Minimally invasive esthetic ridge preservation with growth-factor enhanced bone matrix.

PubMed

Nevins, Marc L; Said, Sherif

2017-12-28

Extraction socket preservation procedures are critical to successful esthetic implant therapy. Conventional surgical approaches are technique sensitive and often result in alteration of the soft tissue architecture, which then requires additional corrective surgical procedures. This case series report presents the ability of flapless surgical techniques combined with a growth factor-enhanced bone matrix to provide esthetic ridge preservation at the time of extraction for compromised sockets. When considering esthetic dental implant therapy, preservation, or further enhancement of the available tissue support at the time of tooth extraction may provide an improved esthetic outcome with reduced postoperative sequelae and decreased treatment duration. Advances in minimally invasive surgical techniques combined with recombinant growth factor technology offer an alternative for bone reconstruction while maintaining the gingival architecture for enhanced esthetic outcome. The combination of freeze-dried bone allograft (FDBA) and rhPDGF-BB (platelet-derived growth factor-BB) provides a growth-factor enhanced matrix to induce bone and soft tissue healing. The use of a growth-factor enhanced matrix is an option for minimally invasive ridge preservation procedures for sites with advanced bone loss. Further studies including randomized clinical trials are needed to better understand the extent and limits of these procedures. The use of minimally invasive techniques with growth factors for esthetic ridge preservation reduces patient morbidity associated with more invasive approaches and increases the predictability for enhanced patient outcomes. By reducing the need for autogenous bone grafts the use of this technology is favorable for patient acceptance and ease of treatment process for esthetic dental implant therapy. © 2017 Wiley Periodicals, Inc.

The emerging connections between IGF1, the intestinal microbiome, Lactobacillus strains and bone growth.

PubMed

Poinsot, Pierre; Schwarzer, Martin; Peretti, Noël; Leulier, François

2018-07-01

In most animal species, postnatal growth is controlled by conserved insulin/insulin-like growth factor (IGF) signaling. In mammals, juvenile growth is characterized by a longitudinal bone growth resulting from the ossification of the growth plate. This ossification is under IGF1 influence through endocrine and paracrine mechanisms. Moreover, the nutritional status has been largely described as an important factor influencing the insulin/insulin-like growth factor signaling. It is now well established that the gut microbiota modulates the nutrient availability of its host. Hence, studies of the interaction between nutritional status, gut microbiota and bone growth have recently emerged. Here, we review recent findings using experimental models about the impact of gut bacteria on the somatotropic axis and its consequence on the bone growth. We also discuss the perspectives of these studies in opening an entire field for clinical interventions. © 2018 Society for Endocrinology.

A nanoparticulate injectable hydrogel as a tissue engineering scaffold for multiple growth factor delivery for bone regeneration.

PubMed

Dyondi, Deepti; Webster, Thomas J; Banerjee, Rinti

2013-01-01

Gellan xanthan gels have been shown to be excellent carriers for growth factors and as matrices for several tissue engineering applications. Gellan xanthan gels along with chitosan nanoparticles of 297 ± 61 nm diameter, basic fibroblast growth factor (bFGF), and bone morphogenetic protein 7 (BMP7) were employed in a dual growth factor delivery system to promote the differentiation of human fetal osteoblasts. An injectable system with ionic and temperature gelation was optimized and characterized. The nanoparticle loaded gels showed significantly improved cell proliferation and differentiation due to the sustained release of growth factors. A differentiation marker study was conducted, analyzed, and compared to understand the effect of single vs dual growth factors and free vs encapsulated growth factors. Dual growth factor loaded gels showed a higher alkaline phosphatase and calcium deposition compared to single growth factor loaded gels. The results suggest that encapsulation and stabilization of growth factors within nanoparticles and gels are promising for bone regeneration. Gellan xanthan gels also showed antibacterial effects against Pseudomonas aeruginosa, Staphylococcus aureus, and Staphylococcus epidermidis, the common pathogens in implant failure.

Growth factors and cytokines in patients with long bone fractures and associated spinal cord injury.

PubMed

Khallaf, Fathy G; Kehinde, Elijah O; Mostafa, Ahmed

2016-06-01

The aim of the study was to test the effect of acute traumatic spinal cord injury of quadriplegia or paraplegia on bone healing in patients with associated long bone fractures and to investigate the molecular and cellular events of the underlying mechanism for a possible acceleration. Healing indicators of long bone fractures and growth factors, IGF-II, platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), Activin-A, and cytokine I-L-1, in the patients' blood were calculated and measured for 21 patients with spinal cord injuries and associated long bone fractures in prospective controlled study and compared to 20 patients with only spinal cord injuries, 30 patients with only long bone fractures, and 30 healthy volunteers. The study results showed that long bone fractures in patients with associated acute traumatic spinal cord injury of quadriplegia or paraplegia heal more expectedly, faster, and with exuberant florid union callus (P > 0.001) and show statistically significant higher levels of growth factors like PDGF, VEGF, Activin-A, and cytokine I-L-1, along the 3 weeks of follow-up (P > 0.005). I-IGF-II showed statistically significant subnormal level along the whole follow-up period in the same patients (P > 0.005). We concluded that long bone fractures in spinal cord injury patients heal more expectedly, faster, and with exuberant and florid callus formation; growth factors like IGF-II, PDGF, VEGF, Activin-A, and cytokine I-L-I have roles as mediators, in molecular events and as byproducts of the subtle mechanism of accelerated osteogenesis in these patients and may represent therapeutic potentials to serve as agents to enhance bone repair.

Bone morphogenic protein: an elixir for bone grafting--a review.

PubMed

Shah, Prasun; Keppler, Louis; Rutkowski, James

2012-12-01

Bone morphogenetic proteins (BMPs) are multifunctional growth factors that belong to the transforming growth factor beta superfamily. This literature review focuses on the molecular biology of BMPs, their mechanism of action, and subsequent applications. It also discusses uses of BMPs in the fields of dentistry and orthopedics, research on methods of delivering BMPs, and their role in tissue regeneration. BMP has positive effects on bone grafts, and their calculated and timely use with other growth factors can provide extraordinary results in fractured or nonhealing bones. Use of BMP introduces new applications in the field of implantology and bone grafting. This review touches on a few unknown facts about BMP and this ever-changing field of research to improve human life.

Importance of dual delivery systems for bone tissue engineering.

PubMed

Farokhi, Mehdi; Mottaghitalab, Fatemeh; Shokrgozar, Mohammad Ali; Ou, Keng-Liang; Mao, Chuanbin; Hosseinkhani, Hossein

2016-03-10

Bone formation is a complex process that requires concerted function of multiple growth factors. For this, it is essential to design a delivery system with the ability to load multiple growth factors in order to mimic the natural microenvironment for bone tissue formation. However, the short half-lives of growth factors, their relatively large size, slow tissue penetration, and high toxicity suggest that conventional routes of administration are unlikely to be effective. Therefore, it seems that using multiple bioactive factors in different delivery systems can develop new strategies for improving bone tissue regeneration. Combination of these factors along with biomaterials that permit tunable release profiles would help to achieve truly spatiotemporal regulation during delivery. This review summarizes the various dual-control release systems that are used for bone tissue engineering. Copyright © 2015 Elsevier B.V. All rights reserved.

The role of pleiotrophin in bone repair.

PubMed

Lamprou, Margarita; Kaspiris, Angelos; Panagiotopoulos, Elias; Giannoudis, Peter V; Papadimitriou, Evangelia

2014-12-01

Bone has an enormous capacity for growth, regeneration, and remodelling, largely due to induction of osteoblasts that are recruited to the site of bone formation. Although the pathways involved have not been fully elucidated, it is well accepted that the immediate environment of the cells is likely to play a role via cell–matrix interactions, mediated by several growth factors. Formation of new blood vessels is also significant and interdependent to bone formation, suggesting that enhancement of angiogenesis could be beneficial during the process of bone repair. Pleiotrophin (PTN), also called osteoblast-specific factor 1, is a heparin-binding angiogenic growth factor, with a well-defined and significant role in both physiological and pathological angiogenesis. In this review we summarise the existing evidence on the role of PTN in bone repair.

Mesoporous bioactive glasses: structure characteristics, drug/growth factor delivery and bone regeneration application

PubMed Central

Wu, Chengtie; Chang, Jiang

2012-01-01

The impact of bone diseases and trauma in the whole world has increased significantly in the past decades. Bioactive glasses are regarded as an important bone regeneration material owing to their generally excellent osteoconductivity and osteostimulativity. A new class of bioactive glass, referred to as mesoporous bioglass (MBG), was developed 7 years ago, which possess a highly ordered mesoporous channel structure and a highly specific surface area. The study of MBG for drug/growth factor delivery and bone tissue engineering has grown significantly in the past several years. In this article, we review the recent advances of MBG materials, including the preparation of different forms of MBG, composition–structure relationship, efficient drug/growth factor delivery and bone tissue engineering application. By summarizing our recent research, the interaction of MBG scaffolds with bone-forming cells, the effect of drug/growth factor delivery on proliferation and differentiation of tissue cells and the in vivo osteogenesis of MBG scaffolds are highlighted. The advantages and limitations of MBG for drug delivery and bone tissue engineering have been compared with microsize bioactive glasses and nanosize bioactive glasses. The future perspective of MBG is discussed for bone regeneration application by combining drug delivery with bone tissue engineering and investigating the in vivo osteogenesis mechanism in large animal models. PMID:23741607

Direct and indirect effects of a combination of adipose-derived stem cells and platelet-rich plasma on bone regeneration.

PubMed

Tajima, Satoshi; Tobita, Morikuni; Orbay, Hakan; Hyakusoku, Hiko; Mizuno, Hiroshi

2015-03-01

A key goal for successful bone regeneration is to bridge a bone defect using healing procedures that are stable and durable. Adipose-derived stem cells (ASCs) have the potential to differentiate into bone. Meanwhile, platelet-rich plasma (PRP) is an interesting biological means to repair tissue by inducing chemotactic, proliferative, and anabolic cellular responses. This study evaluated bone regeneration using a combination of ASCs and PRP in a rat calvarial defect model. ASCs were isolated from inguinal fat pads of F344 inbred rats, while PRP was prepared from these rats. ASCs were cultured in control medium supplemented with 10% fetal bovine serum or 5% PRP in vitro. After 1 week, levels of growth factors including insulin-like growth factor-1, transforming growth factor-β1, hepatocyte growth factor, and vascular endothelial growth factor in the culture supernatant were measured by enzyme-linked immunosorbent assays. Moreover, the ASC/PRP admixture was transplanted into the rat calvarial defect. Microcomputed tomography, histological, and immunohistochemical (osteopontin and osteocalcin) analyses were performed at 4 and 8 weeks after transplantation. The in vitro study showed that the levels of growth factors secreted by ASCs were significantly increased by the addition of PRP. Transplantation of the ASC/PRP admixture had dramatic effects on bone regeneration overtime in comparison with rats that received other transplants. Furthermore, some ASCs directly differentiated into osteogenic cells in vivo. These findings suggest that the combination of ASCs and PRP has augmentative effects on bone regeneration. The ASC/PRP admixture may be a promising source for the clinical treatment of cranial defects.

Role of IGF-I Signaling in Muscle Bone Interactions

PubMed Central

Bikle, Daniel D; Tahimic, Candice; Chang, Wenhan; Wang, Yongmei; Philippou, Anastassios; Barton, Elisabeth R.

2015-01-01

Skeletal muscle and bone rely on a number of growth factors to undergo development, modulate growth, and maintain physiological strength. A major player in these actions is insulin-like growth factor I (IGF-I). However, because this growth factor can directly enhance muscle mass and bone density, it alters the state of the musculoskeletal system indirectly through mechanical crosstalk between these two organ systems. Thus, there are clearly synergistic actions of IGF-I that extend beyond the direct activity through its receptor. This review will cover the production and signaling of IGF-I as it pertains to muscle and bone, the chemical and mechanical influences that arise from IGF-I activity, and the potential for therapeutic strategies based on IGF-I. PMID:26453498

Release of growth factors and the effect of age, sex, and severity of injury after long bone fracture. A preliminary report.

PubMed

Pountos, Ippokratis; Georgouli, Theodora; Henshaw, Karen; Bird, Howard; Giannoudis, Peter V

2013-02-01

The systemic response after fracture is regulated by a complex mechanism involving numerous growth factors. In this study, we analyzed the kinetics of key growth factors following lower-limb long bone fracture. Human serum was isolated from 15 patients suffering from lower-limb long bone fracture (tibia/femur) requiring surgical fixation. The levels of platelet-derived growth factor (PDGF-BB), vascular edothelial growth factor (VEGF), insulin growth factor-I (IGF-I), and transforming growth factor β1 (TGF-β1) were assayed by colorimetric ELISA at different time points during the first week after fracture. 10 healthy volunteers made up the control group of the study. Serum levels of the growth factors measured were compared to age, sex, and injury severity score. We found that there was a decline in the levels of PDGF-BB, IGF-I and TGF-β1 during the first 3 days after fracture. However, VEGF levels remained unchanged. The levels of all the growth factors studied then increased, with the highest concentrations noted at day 7 after surgery. No correlation was found between circulating levels of growth factors and age, injury severity score (ISS), blood loss, or fluid administration. There are systemic mitogenic and osteogenic signals after fracture. Important growth factors are released into the peripheral circulation, but early after surgery it appears that serum levels of key growth factors fall. By 7 days postoperatively, the levels had increased considerably. Our findings should be considered in cases where autologous serum is used for ex vivo expansion of mesenchymal stem cells. There should be further evaluation of the use of these molecules as biomarkers of bone union.

Technical Report: Correlation Between the Repair of Cartilage and Subchondral Bone in an Osteochondral Defect Using Bilayered, Biodegradable Hydrogel Composites.

PubMed

Lu, Steven; Lam, Johnny; Trachtenberg, Jordan E; Lee, Esther J; Seyednejad, Hajar; van den Beucken, Jeroen J J P; Tabata, Yasuhiko; Kasper, F Kurtis; Scott, David W; Wong, Mark E; Jansen, John A; Mikos, Antonios G

2015-12-01

The present work investigated correlations between cartilage and subchondral bone repair, facilitated by a growth factor-delivering scaffold, in a rabbit osteochondral defect model. Histological scoring indices and microcomputed tomography morphological parameters were used to evaluate cartilage and bone repair, respectively, at 6 and 12 weeks. Correlation analysis revealed significant associations between specific cartilage indices and subchondral bone parameters that varied with location in the defect (cortical vs. trabecular region), time point (6 vs. 12 weeks), and experimental group (insulin-like growth factor-1 only, bone morphogenetic protein-2 only, or both growth factors). In particular, significant correlations consistently existed between cartilage surface regularity and bone quantity parameters. Overall, correlation analysis between cartilage and bone repair provided a fuller understanding of osteochondral repair and can help drive informed studies for future osteochondral regeneration strategies.

Recent Insights into the Regulation of the Growth Plate

PubMed Central

Lui, Julian C.; Nilsson, Ola; Baron, Jeffrey

2014-01-01

For most bones, elongation is driven primarily by chondrogenesis at the growth plates. This process results from chondrocyte proliferation, hypertrophy, and extracellular matrix secretion and is carefully orchestrated by complex networks of local paracrine factors and modulated by endocrine factors. We review here recent advances in the understanding of growth plate physiology. These advances include new approaches to study expression patterns of large numbers of genes in the growth plate, using microdissection followed by microarray. This approach has been combined with genome-wide association studies to provide insights into the regulation of the human growth plate. We also review recent studies elucidating the roles of bone morphogenetic proteins, fibroblast growth factors, C-type natriuretic peptide, and suppressor of cytokine signaling in the local regulation of growth plate chondrogenesis and longitudinal bone growth. PMID:24740736

Strategies for Controlled Delivery of Growth Factors and Cells for Bone Regeneration

PubMed Central

Vo, Tiffany N.; Kasper, F. Kurtis; Mikos, Antonios G.

2012-01-01

The controlled delivery of growth factors and cells within biomaterial carriers can enhance and accelerate functional bone formation. The carrier system can be designed with preprogrammed release kinetics to deliver bioactive molecules in a localized, spatiotemporal manner most similar to the natural wound healing process. The carrier can also act as an extracellular matrix-mimicking substrate for promoting osteoprogenitor cellular infiltration and proliferation for integrative tissue repair. This review discusses the role of various regenerative factors involved in bone healing and their appropriate combinations with different delivery systems for augmenting bone regeneration. The general requirements of protein, cell and gene therapy are described, with elaboration on how the selection of materials, configurations and processing affects growth factor and cell delivery and regenerative efficacy in both in vitro and in vivo applications for bone tissue engineering. PMID:22342771

Beyond the functional matrix hypothesis: a network null model of human skull growth for the formation of bone articulations

PubMed Central

Esteve-Altava, Borja; Rasskin-Gutman, Diego

2014-01-01

Craniofacial sutures and synchondroses form the boundaries among bones in the human skull, providing functional, developmental and evolutionary information. Bone articulations in the skull arise due to interactions between genetic regulatory mechanisms and epigenetic factors such as functional matrices (soft tissues and cranial cavities), which mediate bone growth. These matrices are largely acknowledged for their influence on shaping the bones of the skull; however, it is not fully understood to what extent functional matrices mediate the formation of bone articulations. Aiming to identify whether or not functional matrices are key developmental factors guiding the formation of bone articulations, we have built a network null model of the skull that simulates unconstrained bone growth. This null model predicts bone articulations that arise due to a process of bone growth that is uniform in rate, direction and timing. By comparing predicted articulations with the actual bone articulations of the human skull, we have identified which boundaries specifically need the presence of functional matrices for their formation. We show that functional matrices are necessary to connect facial bones, whereas an unconstrained bone growth is sufficient to connect non-facial bones. This finding challenges the role of the brain in the formation of boundaries between bones in the braincase without neglecting its effect on skull shape. Ultimately, our null model suggests where to look for modified developmental mechanisms promoting changes in bone growth patterns that could affect the development and evolution of the head skeleton. PMID:24975579

The Multifactorial role of Peripheral Nervous System in Bone Growth

NASA Astrophysics Data System (ADS)

Gkiatas, Ioannis; Papadopoulos, Dimitrios; Pakos, Emilios E.; Kostas-Agnantis, Ioannis; Gelalis, Ioannis; Vekris, Marios; Korompilias, Anastasios

2017-09-01

Bone alters its metabolic and anabolic activities in response to the variety of systemic and local factors such as hormones and growth factors. Classical observations describing abundance of the nerve fibers in bone also predict a paradigm that the nervous system influences bone metabolism and anabolism. Since 1916 several investigators tried to analyze the effect of peripheral nervous system in bone growth and most of them advocated for the positive effect of innervation in the bones of growing organisms. Moreover, neuronal tissue controls bone formation and remodeling. The purpose of this mini-review is to present the most recent data concerning the influence of innervation on bone growth, the current understanding of the skeletal innervation and their proposed physiological effects on bone metabolism as well as the implication of denervation in human skeletal biology in the developing organism since the peripheral neural trauma as well as peripheral neuropathies are common and they have impact on the growing skeleton.

The Skeletal Site-Specific Role of Connective Tissue Growth Factor in Prenatal Osteogenesis

PubMed Central

Lambi, Alex G.; Pankratz, Talia L.; Mundy, Christina; Gannon, Maureen; Barbe, Mary F.; Richtsmeier, Joan T.; Popoff, Steven N.

2013-01-01

Background Connective tissue growth factor (CTGF/CCN2) is a matricellular protein that is highly expressed during bone development. Mice with global CTGF ablation (knockout, KO) have multiple skeletal dysmorphisms and perinatal lethality. A quantitative analysis of the bone phenotype has not been conducted. Results We demonstrated skeletal site-specific changes in growth plate organization, bone microarchitecture, and shape and gene expression levels in CTGF KO compared with wild-type mice. Growth plate malformations included reduced proliferation zone and increased hypertrophic zone lengths. Appendicular skeletal sites demonstrated decreased metaphyseal trabecular bone, while having increased mid-diaphyseal bone and osteogenic expression markers. Axial skeletal analysis showed decreased bone in caudal vertebral bodies, mandibles, and parietal bones in CTGF KO mice, with decreased expression of osteogenic markers. Analysis of skull phenotypes demonstrated global and regional differences in CTGF KO skull shape resulting from allometric (size-based) and nonallometric shape changes. Localized differences in skull morphology included increased skull width and decreased skull length. Dysregulation of the transforming growth factor-β-CTGF axis coupled with unique morphologic traits provides a potential mechanistic explanation for the skull phenotype. Conclusions We present novel data on a skeletal phenotype in CTGF KO mice, in which ablation of CTGF causes site-specific aberrations in bone formation. PMID:23073844

A novel three-dimensional bone chip organ culture.

PubMed

Kuttenberger, Johannes; Polska, Elzbieta; Schaefer, Birgit M

2013-07-01

The objective of this study was to develop a 3D bone chip organ culture model. We aimed to collect in vitro evidence of the ability of vital bone chips to promote new bone formation. We developed a 3D in vitro hypoxic bone chip organ culture model. Histology of the bone chips was performed before and after culture and immunohistochemistry after 3-week culture. The 3D culture supernatants were tested for the presence of pro-angiogenic growth factors, TGFβ1, GADPH, bone alkaline phosphatase, osteocalcin, osteonectin, osteopontin, bone sialoprotein and collagen type I. Histology after culture revealed bone chips in a matrix of fibrin remnants and a fibrous-appearing matter. Collagen type I- and IV-positive structures were also identified. Cells could be seen on the surface of the bone chips, with spindle-shaped cells bridging the bone chip particles. Pro-angiogenic growth factors and TGFβ1were detected in the 3D cell culture supernatants. The transcripts for osteocalcin, bone sialoprotein and collagen type I were revealed only via PCR. Our results indicate that bone chips in our 3D organ culture remain vital and may stimulate the growth of a bone-forming matrix. The use of autogenous bone chips for oral and maxillofacial bone augmentation procedures is widespread in clinical practice. The rationale for this is that if bone chips remain vital in vivo, they could provide an environment promoting new bone formation through growth factors and cells. This 3D culture method is an essential tool for investigating the behaviour of bone chips.

Hydrogel Delivery of Mesenchymal Stem Cell–Expressing Bone Morphogenetic Protein-2 Enhances Bone Defect Repair

PubMed Central

Hsiao, Hui-Yi; Yang, Shu-Rui; Brey, Eric M.; Chu, I-Ming

2016-01-01

Background: The application of bone tissue engineering for repairing bone defects has gradually shown some satisfactory progress. One of the concerns raising scientific attention is the poor supply of growth factors. A number of growth factor delivery approaches have been developed for promoting bone formation. However, there is no systematic comparison of those approaches on efficiency of neobone formation. In this study, the approaches using periosteum, direct supply of growth factors, or gene transfection of growth factors were evaluated to determine the osteogenic capacity on the repair of bone defect. Methods: In total, 42 male 21-week-old Sprague-Dawley rats weighing 250 to 400 g were used as the bone defect model to evaluate the bone repair efficiency. Various tissue engineered constructs of poly(ethylene glycol)-poly(l-lactic acid) (PEG-PLLA) copolymer hydrogel with periosteum, with external supply of bone morphogenetic protein-2 (BMP2), or with BMP2-transfected bone marrow–derived mesenchymal stem cells (BMMSCs) were filled in a 7-mm bone defect region. Animals were euthanized at 3 months, and the hydrogel constructs were harvested. The evaluation with histological staining and radiography analysis were performed for the volume of new bone formation. Results: The PEG-PLLA scaffold with BMMSCs promotes bone regeneration with the addition of periosteum. The group with BMP2-transfected BMMSCs demonstrated the largest volume of new bone among all the testing groups. Conclusions: Altogether, the results of this study provide the evidence that the combination of PEG-PLLA hydrogels with BMMSCs and sustained delivery of BMP2 resulted in the maximal bone regeneration. PMID:27622106

Role of TGF-β in breast cancer bone metastases

PubMed Central

Chiechi, Antonella; Waning, David L.; Stayrook, Keith R.; Buijs, Jeroen T.; Guise, Theresa A.; Mohammad, Khalid S.

2014-01-01

Breast cancer is the most prevalent cancer among females worldwide leading to approximately 350,000 deaths each year. It has long been known that cancers preferentially metastasize to particular organs, and bone metastases occur in ~70% of patients with advanced breast cancer. Breast cancer bone metastases are predominantly osteolytic and accompanied by increased fracture risk, pain, nerve compression and hypercalcemia, causing severe morbidity. In the bone matrix, transforming growth factor-β (TGF-β) is one of the most abundant growth factors, which is released in active form upon tumor-induced osteoclastic bone resorption. TGF-β, in turn, stimulates bone metastatic tumor cells to secrete factors that further drive osteolytic bone destruction adjacent to the tumor. Thus, TGF-β is a crucial factor responsible for driving the feed-forward vicious cycle of cancer growth in bone. Moreover, TGF-β activates epithelial-to-mesenchymal transition, increases tumor cell invasiveness and angiogenesis and induces immunosuppression. Blocking the TGF-β signaling pathway to interrupt this vicious cycle between breast cancer and bone offers a promising target for therapeutic intervention to decrease skeletal metastasis. This review will describe the role of TGF-β in breast cancer and bone metastasis, and pre-clinical and clinical data will be evaluated for the potential use of TGF-β inhibitors in clinical practice to treat breast cancer bone metastases. PMID:24558636

Synergistic Effects of Vascular Endothelial Growth Factor on Bone Morphogenetic Proteins Induced Bone Formation In Vivo: Influencing Factors and Future Research Directions

PubMed Central

Li, Bo; Wang, Hai; Qiu, Guixing; Su, Xinlin

2016-01-01

Vascular endothelial growth factor (VEGF) and bone morphogenetic proteins (BMPs), as key mediators in angiogenesis and osteogenesis, are used in a combined delivery manner as a novel strategy in bone tissue engineering. VEGF has the potential to enhance BMPs induced bone formation. Both gene delivery and material-based delivery systems were incorporated in previous studies to investigate the synergistic effects of VEGF and BMPs. However, their results were controversial due to variation of methods incorporated in different studies. Factors influencing the synergistic effects of VEGF on BMPs induced bone formation were identified and analyzed in this review to reduce confusion on this issue. The potential mechanisms and directions of future studies were also proposed here. Further investigating mechanisms of the synergistic effects and optimizing these influencing factors will help to generate more effective bone regeneration. PMID:28070506

Ricinus communis-based biopolymer and epidermal growth factor regulations on bone defect repair: A rat tibia model

NASA Astrophysics Data System (ADS)

Mendoza-Barrera, C.; Meléndez-Lira, M.; Altuzar, V.; Tomás, S. A.

2003-01-01

We report the effect of the addition of an epidermal growth factor to a Ricinus communis-based biopolymer in the healing of a rat tibia model. Bone repair and osteointegration after a period of three weeks were evaluated employing photoacoustic spectroscopy and x-ray diffraction. A parallel study was performed at 1, 2, 3, 4, 5, 6, 7, and 8 weeks with energy dispersive x-ray spectroscopy. We conclude that the use of an epidermal growth factor (group EGF) in vivo accelerates the process of bony repair in comparison with other groups, and that the employment of the Ricinus communis-based biopolymer as a bone substitute decreases bone production.

Cholesteryl group- and acryloyl group-bearing pullulan nanogel to deliver BMP2 and FGF18 for bone tissue engineering.

PubMed

Fujioka-Kobayashi, Masako; Ota, Masato S; Shimoda, Asako; Nakahama, Ken-ichi; Akiyoshi, Kazunari; Miyamoto, Youji; Iseki, Sachiko

2012-10-01

To create a drug delivery system that allows the controlled release of proteins, such as growth factors, over a long-term period, cholesteryl group- and acryloyl group-bearing pullulan (CHPOA) nanogels were aggregated to form fast-degradable hydrogels (CHPOA/hydrogels) by cross-linking with thiol-bearing polyethylene glycol. The gold standard of clinical bone reconstruction therapy with a physiologically active material is treatment with recombinant human bone morphogenetic protein 2 (BMP2); however, this approach has limitations, such as inflammation, poor cost-efficiency, and varying interindividual susceptibility. In this study, two distinct growth factors, BMP2 and recombinant human fibroblast growth factor 18 (FGF18), were applied to a critical-size skull bone defect for bone repair by the CHPOA/hydrogel system. The CHPOA-FGF18/hydrogel displayed identical results to the control CHPOA-PBS/hydrogel, and the CHPOA-BMP2/hydrogel treatment imperfectly induced bone repair. By contrast, the CHPOA-FGF18 + BMP2/hydrogel treatment strongly enhanced and stabilized the BMP2-dependent bone repair, inducing osteoprogenitor cell infiltration inside and around the hydrogel. This report indicates that the CHPOA/hydrogel system can successfully deliver two different proteins to the bone defect to induce effective bone repair. The combination of the CHPOA/hydrogel system with the growth factors FGF18 and BMP2 might be a step towards efficient bone tissue engineering. Copyright © 2012 Elsevier Ltd. All rights reserved.

Beyond the functional matrix hypothesis: a network null model of human skull growth for the formation of bone articulations.

PubMed

Esteve-Altava, Borja; Rasskin-Gutman, Diego

2014-09-01

Craniofacial sutures and synchondroses form the boundaries among bones in the human skull, providing functional, developmental and evolutionary information. Bone articulations in the skull arise due to interactions between genetic regulatory mechanisms and epigenetic factors such as functional matrices (soft tissues and cranial cavities), which mediate bone growth. These matrices are largely acknowledged for their influence on shaping the bones of the skull; however, it is not fully understood to what extent functional matrices mediate the formation of bone articulations. Aiming to identify whether or not functional matrices are key developmental factors guiding the formation of bone articulations, we have built a network null model of the skull that simulates unconstrained bone growth. This null model predicts bone articulations that arise due to a process of bone growth that is uniform in rate, direction and timing. By comparing predicted articulations with the actual bone articulations of the human skull, we have identified which boundaries specifically need the presence of functional matrices for their formation. We show that functional matrices are necessary to connect facial bones, whereas an unconstrained bone growth is sufficient to connect non-facial bones. This finding challenges the role of the brain in the formation of boundaries between bones in the braincase without neglecting its effect on skull shape. Ultimately, our null model suggests where to look for modified developmental mechanisms promoting changes in bone growth patterns that could affect the development and evolution of the head skeleton. © 2014 Anatomical Society.

Role of Vascular Endothelial Growth Factor and Transforming Growth Factor-β2 in Rat Bone Tissue after Bone Fracture and Placement of Titanium Implants with Bioactive Bioresorbable Coatings.

PubMed

Kalinichenko, S G; Matveeva, N Yu; Kostiv, R E; Puz', A V

2017-03-01

The study established enhanced expression of vascular endothelial growth factor (VEGF) in the subpopulation of osteoblasts located in the regeneration region of femoral bone fracture near the titanium implants with bioactive calcium phosphate and hydroxyapatite coatings and suppressed activity of transforming growth factor-β2 (TGF-β2) in chondroblasts during the two weeks after surgery. In the delayed posttraumatic period, the distribution of TGF-β2 inversely related to its maximal activity. The data revealed the up-regulating effect of bioresorbable coatings on expression of VEGF and TGF-β2 and their implication in the control over various stages of reparative osteogenesis.

Transforming growth factor (TGF. beta. ) decreases the proliferation of human bone marrow fibroblasts by inhibiting the platelet-derived growth factor (PDGF) binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bryckaert, M.C.; Tobelem, G.; Lindroth, M.

1988-12-01

Human bone marrow fibroblasts were cultivated and characterized by immunofluorescent staining and electron microscopy. Their interactions with PDGF and TGF{beta} were studied. While a positive intracellular antifibronectin staining was observed, the cultured cells were not labeled with specific antibodies toward factor VIII von Willebrand factor (F VIII/vWF), desmin, and macrophage antigen. The binding of pure human PDGF to the cultured bone marrow fibroblasts was investigated. Addition of an excess of unlabeled PDGF decreased the binding to 75 and 80%, which means that the nonspecific binding represented 20-25% of total binding, whereas epidermal growth factor (EGF) had no effect. Two classesmore » of sites were detected by Scatchard analysis. The stimulation of DNA synthesis of PDGF was quantified by ({sup 3}H)thymidine incorporation. The results suggested that PDGF and TGF{beta} could modulate the growth of bone marrow fibroblasts.« less

Tissue engineering skeletal muscle for orthopaedic applications

NASA Technical Reports Server (NTRS)

Payumo, Francis C.; Kim, Hyun D.; Sherling, Michael A.; Smith, Lee P.; Powell, Courtney; Wang, Xiao; Keeping, Hugh S.; Valentini, Robert F.; Vandenburgh, Herman H.

2002-01-01

With current technology, tissue-engineered skeletal muscle analogues (bioartificial muscles) generate too little active force to be clinically useful in orthopaedic applications. They have been engineered genetically with numerous transgenes (growth hormone, insulinlike growth factor-1, erythropoietin, vascular endothelial growth factor), and have been shown to deliver these therapeutic proteins either locally or systemically for months in vivo. Bone morphogenetic proteins belonging to the transforming growth factor-beta superfamily are osteoinductive molecules that drive the differentiation pathway of mesenchymal cells toward the chondroblastic or osteoblastic lineage, and stimulate bone formation in vivo. To determine whether skeletal muscle cells endogenously expressing bone morphogenetic proteins might serve as a vehicle for systemic bone morphogenetic protein delivery in vivo, proliferating skeletal myoblasts (C2C12) were transduced with a replication defective retrovirus containing the gene for recombinant human bone morphogenetic protein-6 (C2BMP-6). The C2BMP-6 cells constitutively expressed recombinant human bone morphogenetic protein-6 and synthesized bioactive recombinant human bone morphogenetic protein-6, based on increased alkaline phosphatase activity in coincubated mesenchymal cells. C2BMP-6 cells did not secrete soluble, bioactive recombinant human bone morphogenetic protein-6, but retained the bioactivity in the cell layer. Therefore, genetically-engineered skeletal muscle cells might serve as a platform for long-term delivery of osteoinductive bone morphogenetic proteins locally.

Calcium phosphate ceramic systems in growth factor and drug delivery for bone tissue engineering: A review

PubMed Central

Bose, Susmita; Tarafder, Solaiman

2012-01-01

Calcium phosphates (CaPs) are the most widely used bone substitutes in bone tissue engineering due to their compositional similarities to bone mineral and excellent biocompatibility. In recent years, CaPs, especially hydroxyapatite and tricalcium phosphate, have attracted significant interest in simultaneous use as bone substitute and drug delivery vehicle, adding a new dimension to their application. CaPs are more biocompatible than many other ceramic and inorganic nanoparticles. Their biocompatibility and variable stoichiometry, thus surface charge density, functionality, and dissolution properties, make them suitable for both drug and growth factor delivery. CaP matrices and scaffolds have been reported to act as delivery vehicles for growth factors and drugs in bone tissue engineering. Local drug delivery in musculoskeletal disorder treatments can address some of the critical issues more effectively and efficiently than the systemic delivery. CaPs are used as coatings on metallic implants, CaP cements, and custom designed scaffolds to treat musculoskeletal disorders. This review highlights some of the current drug and growth factor delivery approaches and critical issues using CaP particles, coatings, cements, and scaffolds towards orthopedic and dental applications. PMID:22127225

Optimization of Bone Health in Children before and after Renal Transplantation: Current Perspectives and Future Directions

PubMed Central

Sgambat, Kristen; Moudgil, Asha

2014-01-01

The accrual of healthy bone during the critical period of childhood and adolescence sets the stage for lifelong skeletal health. However, in children with chronic kidney disease (CKD), disturbances in mineral metabolism and endocrine homeostasis begin early on, leading to alterations in bone turnover, mineralization, and volume, and impairing growth. Risk factors for CKD–mineral and bone disorder (CKD–MBD) include nutritional vitamin D deficiency, secondary hyperparathyroidism, increased fibroblast growth factor 23 (FGF-23), altered growth hormone and insulin-like growth factor-1 axis, delayed puberty, malnutrition, and metabolic acidosis. After kidney transplantation, nutritional vitamin D deficiency, persistent hyperparathyroidism, tertiary FGF-23 excess, hypophosphatemia, hypomagnesemia, immunosuppressive therapy, and alteration of sex hormones continue to impair bone health and growth. As function of the renal allograft declines over time, CKD–MBD associated changes are reactivated, further impairing bone health. Strategies to optimize bone health post-transplant include healthy diet, weight-bearing exercise, correction of vitamin D deficiency and acidosis, electrolyte abnormalities, steroid avoidance, and consideration of recombinant human growth hormone therapy. Other drug therapies have been used in adult transplant recipients, but there is insufficient evidence for use in the pediatric population at the present time. Future therapies to be explored include anti-FGF-23 antibodies, FGF-23 receptor blockers, and treatments targeting the colonic microbiota by reduction of generation of bacterial toxins and adsorption of toxic end products that affect bone mineralization. PMID:24605319

Biomaterial strategies for engineering implants for enhanced osseointegration and bone repair

PubMed Central

Agarwal, Rachit; García, Andrés J.

2015-01-01

Bone tissue has a remarkable ability to regenerate and heal itself. However, large bone defects and complex fractures still present a significant challenge to the medical community. Current treatments center on metal implants for structural and mechanical support and auto- or allo-grafts to substitute long bone defects. Metal implants are associated with several complications such as implant loosening and infections. Bone grafts suffer from donor site morbidity, reduced bioactivity, and risk of pathogen transmission. Surgical implants can be modified to provide vital biological cues, growth factors and cells in order to improve osseointegration and repair of bone defects. Here we review strategies and technologies to engineer metal surfaces to promote osseointegration with the host tissue. We also discuss strategies for modifying implants for cell adhesion and bone growth via integrin signaling and growth factor and cytokine delivery for bone defect repair. PMID:25861724

Bone marrow fat: linking adipocyte-induced inflammation with skeletal metastases

PubMed Central

Hardaway, Aimalie L.; Herroon, Mackenzie K.; Rajagurubandara, Erandi

2014-01-01

Adipocytes are important but underappreciated components of bone marrow microenvironment, and their numbers greatly increase with age, obesity, and associated metabolic pathologies. Age and obesity are also significant risk factors for development of metastatic prostate cancer. Adipocytes are metabolically active cells that secrete adipokines, growth factors, and inflammatory mediators; influence behavior and function of neighboring cells; and have a potential to disturb local milleu and dysregulate normal bone homeostasis. Increased marrow adiposity has been linked to bone marrow inflammation and osteoporosis of the bone, but its effects on growth and progression of prostate tumors that have metastasized to the skeleton are currently not known. This review focuses on fat-bone relationship in a context of normal bone homeostasis and metastatic tumor growth in bone. We discuss effects of marrow fat cells on bone metabolism, hematopoiesis, and inflammation. Special attention is given to CCL2- and COX-2-driven pathways and their potential as therapeutic targets for bone metastatic disease. PMID:24398857

Vitamin B12–dependent taurine synthesis regulates growth and bone mass

PubMed Central

Roman-Garcia, Pablo; Quiros-Gonzalez, Isabel; Mottram, Lynda; Lieben, Liesbet; Sharan, Kunal; Wangwiwatsin, Arporn; Tubio, Jose; Lewis, Kirsty; Wilkinson, Debbie; Santhanam, Balaji; Sarper, Nazan; Clare, Simon; Vassiliou, George S.; Velagapudi, Vidya R.; Dougan, Gordon; Yadav, Vijay K.

2014-01-01

Both maternal and offspring-derived factors contribute to lifelong growth and bone mass accrual, although the specific role of maternal deficiencies in the growth and bone mass of offspring is poorly understood. In the present study, we have shown that vitamin B12 (B12) deficiency in a murine genetic model results in severe postweaning growth retardation and osteoporosis, and the severity and time of onset of this phenotype in the offspring depends on the maternal genotype. Using integrated physiological and metabolomic analysis, we determined that B12 deficiency in the offspring decreases liver taurine production and associates with abrogation of a growth hormone/insulin-like growth factor 1 (GH/IGF1) axis. Taurine increased GH-dependent IGF1 synthesis in the liver, which subsequently enhanced osteoblast function, and in B12-deficient offspring, oral administration of taurine rescued their growth retardation and osteoporosis phenotypes. These results identify B12 as an essential vitamin that positively regulates postweaning growth and bone formation through taurine synthesis and suggests potential therapies to increase bone mass. PMID:24911144

Growth factors--BMPs, DBMs, and buffy coat products: are there any proven differences amongst them?

PubMed

Veillette, Christian J H; McKee, Michael D

2007-03-01

Advances in the understanding of bone repair and improved biotechnology have led to the introduction of new strategies for orthopedic surgeons to control and modulate bone healing using growth factors. However, many orthopedic surgeons are uncertain about the current levels of evidence supporting the use of materials that possess these properties and their therapeutic role in the management of skeletal problems such as fracture, long-bone nonunion, and spine fusion. In particular, the differences amongst osteoinductive factors synthesized by recombinant gene technology, or derived from demineralized bone matrix or platelet rich plasma requires clarification.

Advancing osteochondral tissue engineering: bone morphogenetic protein, transforming growth factor, and fibroblast growth factor signaling drive ordered differentiation of periosteal cells resulting in stable cartilage and bone formation in vivo.

PubMed

Mendes, L F; Katagiri, H; Tam, W L; Chai, Y C; Geris, L; Roberts, S J; Luyten, F P

2018-02-21

Chondrogenic mesenchymal stem cells (MSCs) have not yet been used to address the clinical demands of large osteochondral joint surface defects. In this study, self-assembling tissue intermediates (TIs) derived from human periosteum-derived stem/progenitor cells (hPDCs) were generated and validated for stable cartilage formation in vivo using two different animal models. hPDCs were aggregated and cultured in the presence of a novel growth factor (GF) cocktail comprising of transforming growth factor (TGF)-β1, bone morphogenetic protein (BMP)2, growth differentiation factor (GDF)5, BMP6, and fibroblast growth factor (FGF)2. Quantitative polymerase chain reaction (PCR) and immunohistochemistry were used to study in vitro differentiation. Aggregates were then implanted ectopically in nude mice and orthotopically in critical-size osteochondral defects in nude rats and evaluated by microcomputed tomography (µCT) and immunohistochemistry. Gene expression analysis after 28 days of in vitro culture revealed the expression of early and late chondrogenic markers and a significant upregulation of NOGGIN as compared to human articular chondrocytes (hACs). Histological examination revealed a bilayered structure comprising of chondrocytes at different stages of maturity. Ectopically, TIs generated both bone and mineralized cartilage at 8 weeks after implantation. Osteochondral defects treated with TIs displayed glycosaminoglycan (GAG) production, type-II collagen, and lubricin expression. Immunostaining for human nuclei protein suggested that hPDCs contributed to both subchondral bone and articular cartilage repair. Our data indicate that in vitro derived osteochondral-like tissues can be generated from hPDCs, which are capable of producing bone and cartilage ectopically and behave orthotopically as osteochondral units.

Quantification of various growth factors in different demineralized bone matrix preparations.

PubMed

Wildemann, B; Kadow-Romacker, A; Haas, N P; Schmidmaier, G

2007-05-01

Besides autografts, allografts, and synthetic materials, demineralized bone matrix (DBM) is used for bone defect filling and treatment of non-unions. Different DBM formulations are introduced in clinic since years. However, little is known about the presents and quantities of growth factors in DBM. Aim of the present study was the quantification of eight growth factors important for bone healing in three different "off the shelf" DBM formulations, which are already in human use: DBX putty, Grafton DBM putty, and AlloMatrix putty. All three DBM formulations are produced from human donor tissue but they differ in the substitutes added. From each of the three products 10 different lots were analyzed. Protein was extracted from the samples with Guanidine HCL/EDTA method and human ELISA kits were used for growth factor quantification. Differences between the three different products were seen in total protein contend and the absolute growth factor values but also a large variability between the different lots was found. The order of the growth factors, however, is almost comparable between the materials. In the three investigated materials FGF basic and BMP-4 were not detectable in any analyzed sample. BMP-2 revealed the highest concentration extractable from the samples with approximately 3.6 microg/g tissue without a significant difference between the three DBM formulations. In DBX putty significantly more TGF-beta1 and FGFa were measurable compared to the two other DBMs. IGF-I revealed the significantly highest value in the AlloMatrix and PDGF in Grafton. No differences were accessed for VEGF. Due to the differences in the growth factor concentration between the individual samples, independently from the product formulation, further analyzes are required to optimize the clinical outcome of the used demineralized bone matrix. Copyright 2006 Wiley Periodicals, Inc.

[Bone morphogenetic proteins (BMP): clinical application for reconstruction of bone defects].

PubMed

Sierra-García, Gerardo Daniel; Castro-Ríos, Rocío; Gónzalez-Horta, Azucena; Lara-Arias, Jorge; Chávez-Montes, Abelardo

2016-01-01

Since the introduction of bone morphogenetic proteins, their use has become an invaluable ally for the treatment of bone defects. These proteins are potent growth factors, related to angiogenic and osteogenic activity. The osteoinductive capacity of recombinant bone morphogenetic protein (rhBMP) in the formation of bone and cartilage has been confirmed in in vitro studies and evaluated in clinical trials. To obtain a therapeutic effect, administration is systemic, by injection over the physiological dose. Among the disadvantages, ectopic bone formation or high morbidity in cases of spinal fusion is observed. In this review, the roles of bone morphogenetic proteins in bone repair and clinical applications are analyzed. These findings represent advances in the study of bone regeneration and application of growth factors for more predictable results.

A c-fms tyrosine kinase inhibitor, Ki20227, suppresses osteoclast differentiation and osteolytic bone destruction in a bone metastasis model.

PubMed

Ohno, Hiroaki; Kubo, Kazuo; Murooka, Hideko; Kobayashi, Yoshiko; Nishitoba, Tsuyoshi; Shibuya, Masabumi; Yoneda, Toshiyuki; Isoe, Toshiyuki

2006-11-01

In bone metastatic lesions, osteoclasts play a key role in the development of osteolysis. Previous studies have shown that macrophage colony-stimulating factor (M-CSF) is important for the differentiation of osteoclasts. In this study, we investigated whether an inhibitor of M-CSF receptor (c-Fms) suppresses osteoclast-dependent osteolysis in bone metastatic lesions. We developed small molecule inhibitors against ligand-dependent phosphorylation of c-Fms and examined the effects of these compounds on osteolytic bone destruction in a bone metastasis model. We discovered a novel quinoline-urea derivative, Ki20227 (N-{4-[(6,7-dimethoxy-4-quinolyl)oxy]-2-methoxyphenyl}-N'-[1-(1,3-thiazole-2-yl)ethyl]urea), which is a c-Fms tyrosine kinase inhibitor. The IC(50)s of Ki20227 to inhibit c-Fms, vascular endothelial growth factor receptor-2 (KDR), stem cell factor receptor (c-Kit), and platelet-derived growth factor receptor beta were found to be 2, 12, 451, and 217 nmol/L, respectively. Ki20227 did not inhibit other kinases tested, such as fms-like tyrosine kinase-3, epidermal growth factor receptor, or c-Src (c-src proto-oncogene product). Ki20227 was also found to inhibit the M-CSF-dependent growth of M-NFS-60 cells but not the M-CSF-independent growth of A375 human melanoma cells in vitro. Furthermore, in an osteoclast-like cell formation assay using mouse bone marrow cells, Ki20227 inhibited the development of tartrate-resistant acid phosphatase-positive osteoclast-like cells in a dose-dependent manner. In in vivo studies, oral administration of Ki20227 suppressed osteoclast-like cell accumulation and bone resorption induced by metastatic tumor cells in nude rats following intracardiac injection of A375 cells. Moreover, Ki20227 decreased the number of tartrate-resistant acid phosphatase-positive osteoclast-like cells on bone surfaces in ovariectomized (ovx) rats. These findings suggest that Ki20227 inhibits osteolytic bone destruction through the suppression of M-CSF-induced osteoclast accumulation in vivo. Therefore, Ki20227 may be a useful therapeutic agent for osteolytic disease associated with bone metastasis and other bone diseases.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martino, Mikaël M.; Briquez, Priscilla S.; Maruyama, Kenta

Growth factors are very promising molecules to enhance bone regeneration. However, their translation to clinical use has been seriously limited, facing issues related to safety and cost-effectiveness. These problems derive from the vastly supra-physiological doses of growth factor used without optimized delivery systems. Therefore, these issues have motivated the development of new delivery systems allowing better control of the spatio-temporal release and signaling of growth factors. Because the extracellular matrix (ECM) naturally plays a fundamental role in coordinating growth factor activity in vivo, a number of novel delivery systems have been inspired by the growth factor regulatory function of themore » ECM. After introducing the role of growth factors during the bone regeneration process, this review exposes different issues that growth factor-based therapies have encountered in the clinic and highlights recent delivery approaches based on the natural interaction between growth factor and the ECM.« less

Growth factor delivery: How surface interactions modulate release in vitro and in vivo

PubMed Central

King, William J.; Krebsbach, Paul H.

2013-01-01

Biomaterial scaffolds have been extensively used to deliver growth factors to induce new bone formation. The pharmacokinetics of growth factor delivery has been a critical regulator of their clinical success. This review will focus on the surface interactions that control the non-covalent incorporation of growth factors into scaffolds and the mechanisms that control growth factor release from clinically relevant biomaterials. We will focus on the delivery of recombinant human bone morphogenetic protein-2 from materials currently used in the clinical practice, but also suggest how general mechanisms that control growth factor incorporation and release delineated with this growth factor could extend to other systems. A better understanding of the changing mechanisms that control growth factor release during the different stages of preclinical development could instruct the development of future scaffolds for currently untreatable injuries and diseases. PMID:22433783

The prospective opportunities offered by magnetic scaffolds for bone tissue engineering: a review

PubMed Central

ORTOLANI, ALESSANDRO; BIANCHI, MICHELE; MOSCA, MASSIMILIANO; CARAVELLI, SILVIO; FUIANO, MARIO; MARCACCI, MAURILIO; RUSSO, ALESSANDRO

2016-01-01

Magnetic scaffolds are becoming increasingly attractive in tissue engineering, due to their ability to enhance bone tissue formation by attracting soluble factors, such as growth factors, hormones and polypeptides, directly to the implantation site, as well as their potential to improve the fixation and stability of the implant. Moreover, there is increasing evidence that the synergistic effects of magnetic scaffolds and magnetic fields can promote bone repair and regeneration. In this manuscript we review the recent innovations in bone tissue engineering that exploit magnetic biomaterials combined with static magnetic fields to enhance bone cell adhesion and proliferation, and thus bone tissue growth. PMID:28217659

FGF2 High Molecular Weight Isoforms Contribute to Osteoarthropathy in Male Mice

PubMed Central

Meo Burt, Patience; Xiao, Liping; Dealy, Caroline; Fisher, Melanie C.

2016-01-01

Humans with X-linked hypophosphatemia (XLH) and Hyp mice, the murine homolog of the disease, develop severe osteoarthropathy and the precise factors that contribute to this joint degeneration remain largely unknown. Fibroblast growth factor 2 (FGF2) is a key regulatory growth factor in osteoarthritis. Although there are multiple FGF2 isoforms the potential involvement of specific FGF2 isoforms in joint degradation has not been investigated. Mice that overexpress the high molecular weight FGF2 isoforms in bone (HMWTg mice) phenocopy Hyp mice and XLH subjects and Hyp mice overexpress the HMWFGF2 isoforms in osteoblasts and osteocytes. Given that Hyp mice and XLH subjects develop osteoarthropathies we examined whether HMWTg mice also develop knee joint degeneration at 2, 8, and 18 mo compared with VectorTg (control) mice. HMWTg mice developed spontaneous osteoarthropathy as early as age 2 mo with thinning of subchondral bone, osteophyte formation, decreased articular cartilage thickness, abnormal mineralization within the joint, increased cartilage degradative enzymes, hypertrophic markers, and angiogenesis. FGF receptors 1 and 3 and fibroblast growth factor 23 were significantly altered compared with VectorTg mice. In addition, gene expression of growth factors and cytokines including bone morphogenetic proteins, Insulin like growth factor 1, Interleukin 1 beta, as well as transcription factors Sex determining region Y box 9, hypoxia inducible factor 1, and nuclear factor kappa B subunit 1 were differentially modulated in HMWTg compared with VectorTg. This study demonstrates that overexpression of the HMW isoforms of FGF2 in bone results in catabolic activity in joint cartilage and bone that leads to osteoarthropathy. PMID:27732085

Healing of donor site in bone-tendon-bone ACL reconstruction accelerated with plasma rich in growth factors: a randomized clinical trial.

PubMed

Seijas, Roberto; Rius, Marta; Ares, Oscar; García-Balletbó, Montserrat; Serra, Iván; Cugat, Ramón

2015-04-01

To determine whether the use of plasma rich in growth factors accelerates healing of the donor site in bone-tendon-bone anterior cruciate ligament (ACL) reconstruction (patellar graft). The use of the patellar graft presents post-operative problems such as anterior knee pain, which limits its use and leads to preference being taken for alternative grafts. A double-blind, randomized, clinical trial was performed comparing two groups of patients who underwent ACL reconstruction using patellar tendon graft and comparing the use of plasma rich in growth factors at the donor site after graft harvest in terms of local regeneration by ultrasound assessment. The plasma rich in growth factors group shows earlier donor site regeneration in comparison with the control group (2 months earlier), with significant differences in the first 4 months of the follow-up. The application of plasma rich in growth factors shows accelerated tissue regeneration processes with respect to the control group. This fact, together with the previously published with similar conclusions, can create a knowledge basis in order to set out new recovery guidelines following ACL reconstruction. Therapeutic study, Level I.

Effect of plasma-rich in platelet-derived growth factors on peri-implant bone healing: An experimental study in canines

PubMed Central

Birang, Reza; Torabi, Alireza; Shahabooei, Mohammad; Rismanchian, Mansour

2012-01-01

Background: Tissue engineering principles can be exploited to enhance alveolar and peri-implant bone reconstruction by applying such biological factors as platelet-derived growth factors. The objective of the present study is to investigate the effect of autologous plasma-rich in growth factors (on the healing of peri-implant bone in canine mandible). Materials and Methods: In this prospective experimental animal study, two healthy canines of the Iranian mix breed were selected. Three months after removing their premolar teeth on both sides of the mandible, 12 implants of the Osteo Implant Corporationsystem, 5 mm in diameter and 10 mm in length, were selected to be implanted. Plasma rich in growth factors (PRGF) were applied on six implants while the other six were used as plain implants without the plasma. The implants were installed in osteotomy sites on both sides of the mandible to be removed after 4 weeks with the surrounding bones using a trephine bur. Mesio-distal sections and implant blocks, 50 μ in diameter containing the peri-implant bone, were prepared By basic fuchin toluidine-bluefor histological and histomorphometric evaluation by optical microscope. The data were analyzed using Mann-Whitney Test (P<0.05). Results: The bone trabeculae and the type of bone generation in PRGF and control groups had no statistically significant differences (P=0.261, P=0.2) although the parameters showed higher measured values in the PRGF group. However, compared to the control, application of PRGF had significantly increased bone-to-implant contact (P=0.028) Conclusion: Based on the results, it may be concluded that application of PRGF on the surface of implant may enhance bone-to-implant contact. PMID:22363370

Influence of Exercise and Training on Critical Stages of Bone Growth and Development.

PubMed

Klentrou, Panagiota

2016-05-01

Although osteoporosis is considered a geriatric disease, factors affecting bone strength are most influential during child growth and development. This article reviews what is known and still unclear in terms of bone growth, development and adaptation relative to physical activity before and during puberty. Bone is responsive to certain exercise protocols early in puberty and less so in postpubertal years, where bone strength, rather than bone mass, being the outcome of interest. Mechanical loading and high impact exercise promote bone strength. Intense training before and during puberty, however, may negatively affect bone development. Future research should focus on increasing our mechanistic understanding of the manner by which diverse physical stressors alter the integrity of bone. Longitudinal studies that examine the extent to which muscle and bone are comodulated by growth in children are also recommended.

Differential growth factor control of bone formation through osteoprogenitor differentiation.

PubMed

Chaudhary, L R; Hofmeister, A M; Hruska, K A

2004-03-01

The osteogenic factors bone morphogenetic protein (BMP-7), platelet-derived growth factor (PDGF)-BB, and fibroblast growth factor (FGF-2) regulate the recruitment of osteoprogenitor cells and their proliferation and differentiation into mature osteoblasts. However, their mechanisms of action on osteoprogenitor cell growth, differentiation, and bone mineralization remain unclear. Here, we tested the hypothesis that these osteogenic agents were capable of regulating osteoblast differentiation and bone formation in vitro. Normal human bone marrow stromal (HBMS) cells were treated with BMP-7 (40 ng ml(-1)), PDGF-BB (20 ng ml(-1)), FGF-2 (20 ng ml(-1)), or FGF-2 plus BMP-7 for 28 days in a serum-containing medium with 10 mM beta-glycerophosphate and 50 microg ml(-1) ascorbic acid. BMP-7 stimulated a morphological change to cuboidal-shaped cells, increased alkaline phosphatase (ALKP) activity, bone sialoprotein (BSP) gene expression, and alizarin red S positive nodule formation. Hydroxyapatite (HA) crystal deposition in the nodules was demonstrated by Fourier transform infrared (FTIR) spectroscopy only in BMP-7- and dexamethasone (DEX)-treated cells. DEX-treated cells appeared elongated and fibroblast-like compared to BMP-7-treated cells. FGF-2 did not stimulate ALKP, and cell morphology was dystrophic. PDGF-BB had little or no effect on ALKP activity and biomineralization. Alizarin Red S staining of cells and calcium assay indicated that BMP-7, DEX, and FGF-2 enhanced calcium mineral deposition, but FTIR spectroscopic analysis demonstrated no formation of HA similar to human bone in control, PDGF-BB-, and FGF-2-treated samples. Thus, FGF-2 stimulated amorphous octacalcium phosphate mineral deposition that failed to mature into HA. Interestingly, FGF-2 abrogated BMP-7-induced ALKP activity and HA formation. Results demonstrate that BMP-7 was competent as a sole factor in the differentiation of human bone marrow stromal cells to bone-forming osteoblasts confirmed by FTIR examination of mineralized matrix. Other growth factors, PDGF, and FGF-2 were incompetent as sole factors, and FGF-2 inhibited BMP-7-stimulated osteoblast differentiation.

[Issues related to secondary osteoporosis associated with growth hormone deficiency in adulthood].

PubMed

Kužma, Martin; Jackuliak, Peter; Killinger, Zdenko; Vaňuga, Peter; Payer, Juraj

Growth hormone (GH) increases linear bone growth through complex hormonal reactions, mainly mediated by insulin like growth factor 1 (IGF1) that is produced mostly by hepatocytes under influence of GH and stimulates differentiation of epiphyseal prechondrocytes. IGF1 and GH play a key role in the linear bone growth after birth and regulation of bone remodelation during the entire lifespan. It is known that adult GH deficient (GHD) patients have decreased BMD and increased risk of low-impact fractures. Most data gathered thus far on the effect of GH replacement on bone status comprise the measurement of quantitative changes of bone mass. Some animal studies with GHD showed that the bone microarchitecture, measured using computed tomography methods, is significantly compromised and improve after GH replacement. However, human studies did not show significantly decreased bone microarchitecture, but limited methodological quality does not allow firm conclusions on this subject.Key words: bone mass - bone quality - fracture - growth hormone - IGF1.

Bone Metabolism in Adolescent Athletes With Amenorrhea, Athletes With Eumenorrhea, and Control Subjects

PubMed Central

Christo, Karla; Prabhakaran, Rajani; Lamparello, Brooke; Cord, Jennalee; Miller, Karen K.; Goldstein, Mark A.; Gupta, Nupur; Herzog, David B.; Klibanski, Anne; Misra, Madhusmita

2011-01-01

OBJECTIVE We hypothesized that, despite increased activity, bone density would be low in athletes with amenorrhea, compared with athletes with eumenorrhea and control subjects, because of associated hypogonadism and would be associated with a decrease in bone formation and increases in bone-resorption markers. METHODS In a cross-sectional study, we examined bone-density measures (spine, hip, and whole body) and body composition by using dual-energy radiograph absorptiometry and assessed fasting levels of insulin-like growth factor I and bone-turnover markers (N-terminal propeptied of type 1 procollagen and N-telopeptide) in 21 athletes with amenorrhea, 18 athletes with eumenorrhea, and 18 control subjects. Subjects were 12 to 18 years of age and of comparable chronologic and bone age. RESULTS Athletes with amenorrhea had lower bone-density z scores at the spine and whole body, compared with athletes with eumenorrhea and control subjects, and lower hip z scores, compared with athletes with eumenorrhea. Lean mass did not differ between groups. However, athletes with amenorrhea had lower BMI z scores than did athletes with eumenorrhea and lower insulin-like growth factor I levels than did control subjects. Levels of both markers of bone turnover were lower in athletes with amenorrhea than in control subjects. BMI z scores, lean mass, insulin-like growth factor I levels, and diagnostic category were important independent predictors of bone mineral density z scores. CONCLUSIONS Although they showed no significant differences in lean mass, compared with athletes with eumenorrhea and control subjects, athletes with amenorrhea had lower bone density at the spine and whole body. Insulin-like growth factor I levels, body-composition parameters, and menstrual status were important predictors of bone density. Follow-up studies are necessary to determine whether amenorrhea in athletes adversely affects the rate of bone mass accrual and therefore peak bone mass. PMID:18519482

Free bone graft reconstruction of irradiated facial tissue: Experimental effects of basic fibroblast growth factor stimulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eppley, B.L.; Connolly, D.T.; Winkelmann, T.

1991-07-01

A study was undertaken to evaluate the potential utility of basic fibroblast growth factor in the induction of angiogenesis and osseous healing in bone previously exposed to high doses of irradiation. Thirty New Zealand rabbits were evaluated by introducing basic fibroblast growth factor into irradiated mandibular resection sites either prior to or simultaneous with reconstruction by corticocancellous autografts harvested from the ilium. The fate of the free bone grafts was then evaluated at 90 days postoperatively by microangiographic, histologic, and fluorochrome bone-labeling techniques. Sequestration, necrosis, and failure to heal to recipient osseous margins was observed both clinically and histologically inmore » all nontreated irradiated graft sites as well as those receiving simultaneous angiogenic stimulation at the time of graft placement. No fluorescent activity was seen in these graft groups. In the recipient sites pretreated with basic fibroblast growth factor prior to placement of the graft, healing and reestablishment of mandibular contour occurred in nearly 50 percent of the animals. Active bone formation was evident at cortical margins adjacent to the recipient sites but was absent in the more central cancellous regions of the grafts.« less

Tissue Engineering Strategies for Promoting Vascularized Bone Regeneration

PubMed Central

Almubarak, Sarah; Nethercott, Hubert; Freeberg, Marie; Beaudon, Caroline; Jha, Amit; Jackson, Wesley; Marcucio, Ralph; Miclau, Theodore; Healy, Kevin; Bahney, Chelsea

2016-01-01

This review focuses on current tissue engineering strategies for promoting vascularized bone regeneration. We review the role of angiogenic growth factors in promoting vascularized bone regeneration and discuss the different therapeutic strategies for controlled/sustained growth factor delivery. Next, we address the therapeutic uses of stem cells in vascularized bone regeneration. Specifically, this review addresses the concept of co-culture using osteogenic and vasculogenic stem cells, and how adipose derived stem cells compare to bone marrow derived mesenchymal stem cells in the promotion of angiogenesis. We conclude this review with a discussion of a novel approach to bone regeneration through a cartilage intermediate, and discuss why it has the potential to be more effective than traditional bone grafting methods. PMID:26608518

Quantification of Bone Growth Rate Variability in Rats Exposed to Micro- (near zero G) and Macrogravity (2G)

NASA Technical Reports Server (NTRS)

Bromage, Timothy G.; Doty, Stephen B.; Smolyar, Igor; Holton, Emily

1996-01-01

Our stated primary objective is to quantify the growth rate variability of rat lamellar bone exposed to micro and macrogravity (2G). The primary significance of the proposed work is that an elegant method will be established that unequivocally characterizes the morphological consequences of gravitational factors on developing bone. The integrity of this objective depends upon our successful preparation of thin sections suitable for imaging individual bone lamellae, and our imaging and quantitation of growth rate variability in populations of lamellae from individual bone samples.

Differential effects of intermittent and continuous administration of parathyroid hormone on bone histomorphometry and gene expression

NASA Technical Reports Server (NTRS)

Lotinun, Sutada; Sibonga, Jean D.; Turner, Russell T.

2002-01-01

A mechanism explaining the differential skeletal effects of intermittent and continuous elevation of serum parathyroid hormone (PTH) remains elusive. Intermittent PTH increases bone formation and bone mass and is being investigated as a therapy for osteoporosis. By contrast, chronic hyperparathyroidism results in the metabolic bone disease osteitis fibrosa characterized by osteomalacia, focal bone resorption, and peritrabecular bone marrow fibrosis. Intermittent and continuous PTH have similar effects on the number of osteoblasts and bone-forming activity. Many of the beneficial as well as detrimental effects of the hormone appear to be mediated by osteoblast-derived growth factors. This hypothesis was tested using cDNA microgene arrays to compare gene expression in tibia of rats treated with continuous and pulsatile administration of PTH. These treatments result in differential expression of many genes, including growth factors. One of the genes whose steady-state mRNA levels was increased by continuous but not pulsatile administration was platelet-derived growth factor-A (PDGF-A). Administration of a PDGF-A antagonist greatly reduced bone resorption, osteomalacia, and bone marrow fibrosis in a rat model for hyperparathyroidism, suggesting that PDGF-A is a causative agent for this disease. These findings suggest that profiling changes in gene expression can help identify the metabolic pathways responsible for the skeletal responses to the hormone.

Insulin- like Growth Factor-Binding Protein Action in Bone Tissue: A Key Role for Pregnancy- Associated Plasma Protein-A.

PubMed

Beattie, James; Al-Khafaji, Hasanain; Noer, Pernille R; Alkharobi, Hanaa Esa; Alhodhodi, Aishah; Meade, Josephine; El-Gendy, Reem; Oxvig, Claus

2018-01-01

The insulin-like growth factor (IGF) axis is required for the differentiation, development, and maintenance of bone tissue. Accordingly, dysregulation of this axis is associated with various skeletal pathologies including growth abnormalities and compromised bone structure. It is becoming increasingly apparent that the action of the IGF axis must be viewed holistically taking into account not just the actions of the growth factors and receptors, but also the influence of soluble high affinity IGF binding proteins (IGFBPs).There is a recognition that IGFBPs exert IGF-dependent and IGF-independent effects in bone and other tissues and that an understanding of the mechanisms of action of IGFBPs and their regulation in the pericellular environment impact critically on tissue physiology. In this respect, a group of IGFBP proteinases (which may be considered as ancillary members of the IGF axis) play a crucial role in regulating IGFBP function. In this model, cleavage of IGFBPs by specific proteinases into fragments with lower affinity for growth factor(s) regulates the partition of IGFs between IGFBPs and cell surface IGF receptors. In this review, we examine the importance of IGFBP function in bone tissue with special emphasis on the role of pregnancy associated plasma protein-A (PAPP-A). We examine the function of PAPP-A primarily as an IGFBP-4 proteinase and present evidence that PAPP-A induced cleavage of IGFBP-4 is potentially a key regulatory step in bone metabolism. We also highlight some recent findings with regard to IGFBP-2 and IGFBP-5 (also PAPP-A substrates) function in bone tissue and briefly discuss the actions of the other three IGFBPs (-1, -3, and -6) in this tissue. Although our main focus will be in bone we will allude to IGFBP activity in other cells and tissues where appropriate.

The cell biology of bone growth.

PubMed

Price, J S; Oyajobi, B O; Russell, R G

1994-02-01

The field of bone cell biology is clearly of relevance to the problem of stunting in children, as in the final analysis the cells of the growing long bone are the ultimate 'regulators'. It is the alterations in the functions of these cells that manifests as a reduction in height. Normal longitudinal growth is achieved by the coordinated recruitment, proliferation, differentiation, maturation and eventual death of the cells of growth plate and bone. Cellular activity is closely regulated by endocrine factors acting directly or indirectly, with factors produced locally and stored within the bone and cartilage microenvironment having a critical role in intercellular communication. Disruption of any of these processes can lead to growth disturbances, since it only requires a defect in a single gene to have profound effects. Studies in recent years have shed light on the biochemical and molecular effects of cytokines and growth factors and have shown that these regulatory molecules may mediate the effects of certain hormones important in controlling growth. However, the complex interrelationship of these molecules is still not clear. Notwithstanding, understanding of the mechanisms involved in bone remodelling is increasing, as this area attracts much research because of the high incidence of metabolic bone disease in Western society. Although studies of adult bone remodelling are of relevance, there is a requirement for increased research directed specifically at the mechanisms of endochondral ossification and its regulation. Longitudinal bone growth is a challenge to the cell biologist, since it is an accelerated cycle of cellular division and differentiation, within which it is not easy to separate events temporally and spatially. In addition, different regulatory mechanisms are probably important at different stages of growth. Another difficulty impeding progress in this field is the lack of appropriate animal models for research. Much information has come from studies involving rodents, and species differences must always be taken into account. Larger mammals such as the growing piglet or the calf are probably more appropriate for the study of postnatal longitudinal growth in man. If the mechanisms of stunting are to be established at a cellular level, a number of approaches need to be considered. Studies need to be designed using more appropriate animal models, and conditions such as nutritional intake, immunological challenges, chronic intestinal diseases and mechanical loading need to be manipulated. Any effects on longitudinal growth may then be studied temporally and correlated with non-invasive measurements including assays of hormones, cytokines, growth factors and proteins known to regulate their activity.(ABSTRACT TRUNCATED AT 400 WORDS)

Effect of COX-2 (PGE2) and IL-6 on Prostate Cancer Bone Metastases

DTIC Science & Technology

2008-02-02

to stimulate both bone targeting and bone reaction (4). Several factors, such as basic fibroblast growth factor (4), osteocalcin, bone sialoprotein (8...Proc Natl Acad Sci U S A 1990;87:75–9. 8. Huang WC, Xie Z, Konaka H, Sodek J, Zhau HE, Chung LWK. Human osteocalcin and bone sialoprotein medi- ating

Platelet-Rich Plasma in Bone Regeneration: Engineering the Delivery for Improved Clinical Efficacy

PubMed Central

Rodriguez, Isaac A.; Growney Kalaf, Emily A.; Bowlin, Gary L.; Sell, Scott A.

2014-01-01

Human bone is a tissue with a fairly remarkable inherent capacity for regeneration; however, this regenerative capacity has its limitations, and defects larger than a critical size lack the ability to spontaneously heal. As such, the development and clinical translation of effective bone regeneration modalities are paramount. One regenerative medicine approach that is beginning to gain momentum in the clinical setting is the use of platelet-rich plasma (PRP). PRP therapy is essentially a method for concentrating platelets and their intrinsic growth factors to stimulate and accelerate a healing response. While PRP has shown some efficacy in both in vitro and in vivo scenarios, to date its use and delivery have not been optimized for bone regeneration. Issues remain with the effective delivery of the platelet-derived growth factors to a localized site of injury, the activation and temporal release of the growth factors, and the rate of growth factor clearance. This review will briefly describe the physiological principles behind PRP use and then discuss how engineering its method of delivery may ultimately impact its ability to successfully translate to widespread clinical use. PMID:25050347

Dual growth factor-immobilized asymmetrically porous membrane for bone-to-tendon interface regeneration on rat patellar tendon avulsion model.

PubMed

Kim, Joong-Hyun; Oh, Se Heang; Min, Hyun Ki; Lee, Jin Ho

2018-01-01

Insufficient repair of the bone-to-tendon interface (BTI) with structural/compositional gradients has been a significant challenge in orthopedics. In this study, dual growth factor (platelet-derived growth factor-BB [PDGF-BB] and bone morphogenetic protein-2 [BMP-2])-immobilized polycaprolactone (PCL)/Pluronic F127 asymmetrically porous membrane was fabricated to estimate its feasibility as a potential strategy for effective regeneration of BTI injury. The growth factors immobilized (via heparin-intermediated interactions) on the membrane were continuously released for up to ∼80% of the initial loading amount after 5 weeks without a significant initial burst. From the in vivo animal study using a rat patellar tendon avulsion model, it was observed that the PDGF-BB/BMP-2-immobilized membrane accelerates the regeneration of the BTI injury, probably because of the continuous release of both growth factors (biological stimuli) and their complementary effect to create a multiphasic structure (bone, fibrocartilage, and tendon) like a native structure, as well as the role of the asymmetrically porous membrane as a physical barrier (nanopore side; prevention of fibrous tissue invasion into the defect site) and scaffold (micropore side; guidance for tissue regeneration). © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 106A: 115-125, 2018. © 2017 Wiley Periodicals, Inc.

Platelet-Poor and Platelet-Rich Plasma Stimulate Bone Lineage Differentiation in Periodontal Ligament Stem Cells.

PubMed

Martínez, Constanza E; González, Sergio A; Palma, Verónica; Smith, Patricio C

2016-02-01

Plasma-derived fractions have been used as an autologous source of growth factors; however, limited knowledge concerning their biologic effects has hampered their clinical application. In this study, the authors analyze the content and specific effect of both platelet-rich plasma (PRP) and platelet-poor plasma (PPP) on osteoblastic differentiation using primary cultures of human periodontal ligament stem cells (HPLSCs). The authors evaluated the growth factor content of PRP and PPP using a proteome profiler array and enzyme-linked immunosorbent assay. HPLSCs were characterized by flow cytometry and differentiation assays. The effect of PRP and PPP on HPLSC bone differentiation was analyzed by quantifying calcium deposition after 14 and 21 days of treatment. Albeit at different concentrations, the two fractions had similar profiles of growth factors, the most representative being platelet-derived growth factor (PDGF) isoforms (PDGF-AA, -BB, and -AB), insulin-like growth factor binding protein (IGFBP)-2, and IGFBP-6. Both formulations exerted a comparable stimulus on osteoblastic differentiation even at low doses (2.5%), increasing calcium deposits in HPLSCs. PRP and PPP showed a similar protein profile and exerted comparable effects on bone differentiation. Further studies are needed to characterize and compare the effects of PPP and PRP on bone healing in vivo.

In vitro effects of 0 to 120 Grays of irradiation on bone viability and release of growth factors.

PubMed

Sawada, Kosaku; Fujioka-Kobayashi, Masako; Kobayashi, Eizaburo; Brömme, Jens O; Schaller, Benoit; Miron, Richard J

2016-07-04

High dose radiation therapy is commonly used in maxillofacial surgeries to treat a number of head and neck tumors. Despite its widespread use, little information is available regarding the effects of irradiation on bone cell viability and release of growth factors following dose-dependent irradiation. Bone samples were collected from porcine mandibular cortical bone and irradiated at doses of 0, 7.5, 15, 30, 60 and 120 Grays. Thereafter, cell viability was quantified, and the release of growth factors including TGFβ1, BMP2, VEGF, IL1β and RANKL were investigated over time. It was observed that at only 7.5Gy of irradiation, over 85 % of cells were non-vital and by 60 Gy, all cells underwent apoptosis. Furthermore, over a 7-fold decrease in VEGF and a 2-fold decrease in TGFβ1 were observed following irradiation at all tested doses. Little change was observed for BMP2 and IL1β whereas RANKL was significantly increased for all irradiated samples. These results demonstrate the pronounced effects of irradiation on bone-cell vitality and subsequent release of growth factors. Interestingly, the largest observed change in gene expression was the 7-fold decrease in VEGF protein following irradiation. Future research aimed at improving our understanding of bone following irradiation is necessary to further improve future clinical treatments.

Regulation of body growth by microRNAs.

PubMed

Lui, Julian C

2017-11-15

Regulation of body growth remains a fascinating and unresolved biological mystery. One key component of body growth is skeletal and longitudinal bone growth. Children grow taller because their bones grew longer, and the predominant driver of longitudinal bone growth is a cartilaginous structure found near the ends of long bone named the growth plate. Numerous recent studies have started to unveil the importance of microRNAs in regulation of growth plate functions, therefore contributing to regulation of linear growth. In addition to longitudinal growth, other organs in our body need to increase in size and cell number as we grow, and the regulation of organ growth involves both systemic factors like hormones; and other intrinsic mechanisms, which we are just beginning to understand. This review aims to summarize some recent important findings on how microRNAs are involved in both of these processes: the regulation of longitudinal bone growth, and the regulation of organs and overall body growth. Published by Elsevier B.V.

Developmental Regulation of the Growth Plate and Cranial Synchondrosis

PubMed Central

Wei, X.; Hu, M.; Mishina, Y.; Liu, F.

2016-01-01

Long bones and the cranial base are both formed through endochondral ossification. Elongation of long bones is primarily through the growth plate, which is a cartilaginous structure at the end of long bones made up of chondrocytes. Growth plate chondrocytes are organized in columns along the longitudinal axis of bone growth. The cranial base is the growth center of the neurocranium. Synchondroses, consisting of mirror-image growth plates, are critical for cranial base elongation and development. Over the last decade, considerable progress has been made in determining the roles of the parathyroid hormone–related protein, Indian hedgehog, fibroblast growth factor, bone morphogenetic protein, and Wnt signaling pathways in various aspects of skeletal development. Furthermore, recent evidence indicates the important role of the primary cilia signaling pathway in bone elongation. Here, we review the development of the growth plate and cranial synchondrosis and the regulation by the above-mentioned signaling pathways, highlighting the similarities and differences between these 2 structures. PMID:27250655

Coating with a Modular Bone Morphogenetic Peptide Promotes Healing of a Bone-Implant Gap in an Ovine Model

PubMed Central

Lu, Yan; Lee, Jae Sung; Nemke, Brett; Graf, Ben K.; Royalty, Kevin; Illgen, Richard; Vanderby, Ray; Markel, Mark D.; Murphy, William L.

2012-01-01

Despite the potential for growth factor delivery strategies to promote orthopedic implant healing, there is a need for growth factor delivery methods that are controllable and amenable to clinical translation. We have developed a modular bone growth factor, herein termed “modular bone morphogenetic peptide (mBMP)”, which was designed to efficiently bind to the surface of orthopedic implants and also stimulate new bone formation. The purpose of this study was to coat a hydroxyapatite-titanium implant with mBMP and evaluate bone healing across a bone-implant gap in the sheep femoral condyle. The mBMP molecules efficiently bound to a hydroxyapatite-titanium implant and 64% of the initially bound mBMP molecules were released in a sustained manner over 28 days. The results demonstrated that the mBMP-coated implant group had significantly more mineralized bone filling in the implant-bone gap than the control group in C-arm computed tomography (DynaCT) scanning (25% more), histological (35% more) and microradiographic images (50% more). Push-out stiffness of the mBMP group was nearly 40% greater than that of control group whereas peak force did not show a significant difference. The results of this study demonstrated that mBMP coated on a hydroxyapatite-titanium implant stimulates new bone formation and may be useful to improve implant fixation in total joint arthroplasty applications. PMID:23185610

The Use of Recombinant Human Platelet-Derived Growth Factor for Maxillary Sinus Augmentation.

PubMed

Kubota, Atsushi; Sarmiento, Hector; Alqahtani, Mohammed Saad; Llobell, Arturo; Fiorellini, Joseph P

The maxillary sinus augmentation procedure has become a predictable treatment to regenerate bone for implant placement. The purpose of this study was to evaluate the effect of recombinant human platelet-derived growth factor BB (rhPDGF-BB) combined with a deproteinized cancellous bovine bone graft for sinus augmentation. The lateral window approach was used for maxillary sinuses with minimal residual bone. After a healing period of 4 months, dental implants were placed and then restored following a 2-month osseointegration period. The result demonstrated increased bone height and ISQ values and a 100% survival rate. This study indicates that the addition of rhPDGF-BB to deproteinized cancellous bovine bone accelerated the healing period in maxillary sinuses with minimal native bone.

Clinical assessment of bone quality of human extraction sockets after conversion with growth factors.

PubMed

Ntounis, Athanasios; Geurs, Nico; Vassilopoulos, Philip; Reddy, Michael

2015-01-01

The study was conducted to evaluate the effect of mineralized freeze-dried bone allograft (FDBA), alone or in combination with growth factors in extraction sockets, on subjective assessment of bone quality during implant placement. Forty-one patients whose treatment plan involved extraction of anterior or premolar teeth were randomized into four groups: Group 1, collagen plug (control); Group 2, FDBA/β-tricalcium phosphate (β-TCP)/collagen plug; Group 3, FDBA/β-TCP/platelet-rich plasma (PRP)/collagen plug; Group 4, FDBA/β-TCP/recombinant human platelet-derived growth factor BB (rhPDGF-BB)/collagen plug. After 8 weeks of healing, implants were placed. The clinicians assessed bone quality according to the Misch classification. A benchtop calibration exercise test was conducted to evaluate agreement and accuracy of operators in recognizing different bone qualities. Differences were analyzed using one-way analysis of variance (ANOVA) or chi-square tests for continuous and categorical data. Pairwise comparisons were tested using least squares means (LS means). Spearman correlation coefficients were used to evaluate the relationship of bone growth with potential confounders. P < .05 was considered statistically significant. A simple (not weighted) kappa statistic was used to assess the agreement between raters. To assess accuracy in identifying bone quality, a chi-square test was used to compare the percent correct for each rater. The benchtop calibration exercise test demonstrated agreement among clinicians (0.75 and 0.92 between raters 1 and 2 and raters 1 and 3, respectively). Raters were more likely to identify the correct bone quality (P > .05). Inclusion of bone grafting is associated with a shift from D4 quality to D3 quality bone. Inclusion of PRP in bone grafting eliminates the incidence of D4 bone, establishing D3 and D2 quality bone as prevalent (56% vs. 42%, respectively). Inclusion of rhPDGF-BB and β-TCP in combination with the bone grafting has the same effect, although D2 quality is less prevalent. When compared to sockets grafted with FDBA/β-TCP/collagen plug alone, the sockets with growth factors demonstrated fewer residual bone graft particles. (1) Inclusion of bone grafting enhanced bone quality as assessed during implant placement. (2) Overall inclusion of PRP and rhPDGF-BB enhanced subjective bone quality, eliminating incidence of D4 quality in human extraction sockets. (3) The use of PRP or rhPDGF-BB may enhance healing within extraction sockets and decrease the healing time prior to dental implant placement.

Controlled release of drugs in electrosprayed nanoparticles for bone tissue engineering.

PubMed

Jayaraman, Praveena; Gandhimathi, Chinnasamy; Venugopal, Jayarama Reddy; Becker, David Laurence; Ramakrishna, Seeram; Srinivasan, Dinesh Kumar

2015-11-01

Generating porous topographic substrates, by mimicking the native extracellular matrix (ECM) to promote the regeneration of damaged bone tissues, is a challenging process. Generally, scaffolds developed for bone tissue regeneration support bone cell growth and induce bone-forming cells by natural proteins and growth factors. Limitations are often associated with these approaches such as improper scaffold stability, and insufficient cell adhesion, proliferation, differentiation, and mineralization with less growth factor expression. Therefore, the use of engineered nanoparticles has been rapidly increasing in bone tissue engineering (BTE) applications. The electrospray technique is advantageous over other conventional methods as it generates nanomaterials of particle sizes in the micro/nanoscale range. The size and charge of the particles are controlled by regulating the polymer solution flow rate and electric voltage. The unique properties of nanoparticles such as large surface area-to-volume ratio, small size, and higher reactivity make them promising candidates in the field of biomedical engineering. These nanomaterials are extensively used as therapeutic agents and for drug delivery, mimicking ECM, and restoring and improving the functions of damaged organs. The controlled and sustained release of encapsulated drugs, proteins, vaccines, growth factors, cells, and nucleotides from nanoparticles has been well developed in nanomedicine. This review provides an insight into the preparation of nanoparticles by electrospraying technique and illustrates the use of nanoparticles in drug delivery for promoting bone tissue regeneration. Copyright © 2015 Elsevier B.V. All rights reserved.

Bone fracture healing in mechanobiological modeling: A review of principles and methods.

PubMed

Ghiasi, Mohammad S; Chen, Jason; Vaziri, Ashkan; Rodriguez, Edward K; Nazarian, Ara

2017-06-01

Bone fracture is a very common body injury. The healing process is physiologically complex, involving both biological and mechanical aspects. Following a fracture, cell migration, cell/tissue differentiation, tissue synthesis, and cytokine and growth factor release occur, regulated by the mechanical environment. Over the past decade, bone healing simulation and modeling has been employed to understand its details and mechanisms, to investigate specific clinical questions, and to design healing strategies. The goal of this effort is to review the history and the most recent work in bone healing simulations with an emphasis on both biological and mechanical properties. Therefore, we provide a brief review of the biology of bone fracture repair, followed by an outline of the key growth factors and mechanical factors influencing it. We then compare different methodologies of bone healing simulation, including conceptual modeling (qualitative modeling of bone healing to understand the general mechanisms), biological modeling (considering only the biological factors and processes), and mechanobiological modeling (considering both biological aspects and mechanical environment). Finally we evaluate different components and clinical applications of bone healing simulation such as mechanical stimuli, phases of bone healing, and angiogenesis.

The Molecular and Cellular Events That Take Place during Craniofacial Distraction Osteogenesis

PubMed Central

Rachmiel, Adi

2014-01-01

Summary: Gradual bone lengthening using distraction osteogenesis principles is the gold standard for the treatment of hypoplastic facial bones. However, the long treatment time is a major disadvantage of the lengthening procedures. The aim of this study is to review the current literature and summarize the cellular and molecular events occurring during membranous craniofacial distraction osteogenesis. Mechanical stimulation by distraction induces biological responses of skeletal regeneration that is accomplished by a cascade of biological processes that may include differentiation of pluripotential tissue, angiogenesis, osteogenesis, mineralization, and remodeling. There are complex interactions between bone-forming osteoblasts and other cells present within the bone microenvironment, particularly vascular endothelial cells that may be pivotal members of a complex interactive communication network in bone. Studies have implicated number of cytokines that are intimately involved in the regulation of bone synthesis and turnover. The gene regulation of numerous cytokines (transforming growth factor-β, bone morphogenetic proteins, insulin-like growth factor-1, and fibroblast growth factor-2) and extracellular matrix proteins (osteonectin, osteopontin) during distraction osteogenesis has been best characterized and discussed. Understanding the biomolecular mechanisms that mediate membranous distraction osteogenesis may guide the development of targeted strategies designed to improve distraction osteogenesis and accelerate bone regeneration that may lead to shorten the treatment duration. PMID:25289295

Molecular Genetic Studies of Bone Mechanical Strain and of Pedigrees With Very High Bone Density

DTIC Science & Technology

2008-11-01

J Cell Biol 1993, 62(2):352-361. 19. Petersen W, Rafii M: Immunolocalization of the angiogenetic factor pleiotrophin (PTN) in the growth plate of mice...361. 13. Petersen W, Rafii M: Immunolocalization of the angiogenetic factor pleiotrophin (PTN) in the growth plate of mice. Arch Orthop Trauma Surg

Method for protecting bone marrow against chemotherapeutic drugs and radiation therapy using transforming growth factor beta 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keller, J.R.; Ruscetti, F.W.; Wiltrout, R.

1989-06-29

Presented is a method for protecting hematopoietic stem cells from the myelotoxicity of chemotherapeutic drugs or radiation therapy, which comprises administering to a subject a therapeutically effective amount of transforming growth factor beta 1 for protecting bone marrow from the myelotoxicity of chemotherapeutic drugs or radiation therapy.

Bone regeneration with active angiogenesis by basic fibroblast growth factor gene transfected mesenchymal stem cells seeded on porous beta-TCP ceramic scaffolds.

PubMed

Guo, Xiaodong; Zheng, Qixin; Kulbatski, Iris; Yuan, Quan; Yang, Shuhua; Shao, Zengwu; Wang, Hong; Xiao, Baojun; Pan, Zhengqi; Tang, Shuo

2006-09-01

Large segmental bone defect repair remains a clinical and scientific challenge with increasing interest focused on combining gene transfer with tissue engineering techniques. Basic fibroblast growth factor (bFGF) is one of the most prominent osteogenic growth factors that has the potential to accelerate bone healing by promoting the proliferation and differentiation of mesenchymal stem cells (MSCs) and the regeneration of capillary vasculature. However, the short biological half-lives of growth factors may impose severe restraints on their clinical usefulness. Gene-based delivery systems provide a better way of achieving a sustained high concentration of growth factors locally in the defect and delivering a more biologically active product than that achieved by exogenous application of recombinant proteins. The objective of this experimental study was to investigate whether the bFGF gene modified MSCs could enhance the repair of large segmental bone defects. The pcDNA3-bFGF gene transfected MSCs were seeded on biodegradable porous beta tricalcium phosphate (beta-TCP) ceramics and allografted into the 15 mm critical-sized segmental bone defects in the radius of 18 New Zealand White rabbits. The pcDNA3 vector gene transfected MSCs were taken as the control. The follow-up times were 2, 4, 6, 8, 10 and 12 weeks. Scanning electron microscopic, roentgenographic, histologic and immunohistological studies were used to assess angiogenesis and bone regeneration. In vitro, the proliferation and differentiation of bFGF gene transfected MSCs were more active than that of the control groups. In vivo, significantly more new bone formation accompanied by abundant active capillary regeneration was observed in pores of the ceramics loaded with bFGF gene transfected MSCs, compared with control groups. Transfer of gene encoding bFGF to MSCs increases their osteogenic properties by enhancing capillary regeneration, thus providing a rich blood supply for new bone formation. This new bFGF gene enhanced tissue engineering strategy could be of potential benefit to accelerate bone healing, especially in defects caused by atrophic nonunion and avascular necrosis of the femoral head.

Bone morphogenetic protein-4 strongly potentiates growth factor-induced proliferation of mammary epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Montesano, Roberto; Sarkoezi, Rita; Schramek, Herbert

2008-09-12

Bone morphogenetic proteins (BMPs) are multifunctional cytokines that elicit pleiotropic effects on biological processes such as cell proliferation, cell differentiation and tissue morphogenesis. With respect to cell proliferation, BMPs can exert either mitogenic or anti-mitogenic activities, depending on the target cells and their context. Here, we report that in low-density cultures of immortalized mammary epithelial cells, BMP-4 did not stimulate cell proliferation by itself. However, when added in combination with suboptimal concentrations of fibroblast growth factor (FGF)-2, FGF-7, FGF-10, epidermal growth factor (EGF) or hepatocyte growth factor (HGF), BMP-4 potently enhanced growth factor-induced cell proliferation. These results reveal a hithertomore » unsuspected interplay between BMP-4 and growth factors in the regulation of mammary epithelial cell proliferation. We suggest that the ability of BMP-4 to potentiate the mitogenic activity of multiple growth factors may contribute to mammary gland ductal morphogenesis as well as to breast cancer progression.« less

Estrogen prevents bone loss through transforming growth factor β signaling in T cells

PubMed Central

Gao, Yuhao; Qian, Wei-Ping; Dark, Kimberly; Toraldo, Gianluca; Lin, Angela S. P.; Guldberg, Robert E.; Flavell, Richard A.; Weitzmann, M. Neale; Pacifici, Roberto

2004-01-01

Estrogen (E) deficiency leads to an expansion of the pool of tumor necrosis factor (TNF)-producing T cells through an IFN-γ-dependent pathway that results in increased levels of the osteoclastogenic cytokine TNF in the bone marrow. Disregulated IFN-γ production is instrumental for the bone loss induced by ovariectomy (ovx), but the responsible mechanism is unknown. We now show that mice with T cell-specific blockade of type β transforming growth factor (TGFβ) signaling are completely insensitive to the bone-sparing effect of E. This phenotype results from a failure of E to repress IFN-γ production, which, in turn, leads to increased T cell activation and T cell TNF production. Furthermore, ovx blunts TGFβ levels in the bone marrow, and overexpression of TGFβ in vivo prevents ovx-induced bone loss. These findings demonstrate that E prevents bone loss through a TGFβ-dependent mechanism, and that TGFβ signaling in T cells preserves bone homeostasis by blunting T cell activation. Thus, stimulation of TGFβ production in the bone marrow is a critical “upstream” mechanism by which E prevents bone loss, and enhancement of TGFβ levels in vivo may constitute a previously undescribed therapeutic approach for preventing bone loss. PMID:15531637

Blockade of epidermal growth factor receptor signaling in tumor cells and tumor-associated endothelial cells for therapy of androgen-independent human prostate cancer growing in the bone of nude mice.

PubMed

Kim, Sun-Jin; Uehara, Hisanori; Karashima, Takashi; Shepherd, David L; Killion, Jerald J; Fidler, Isaiah J

2003-03-01

We determined whether blockade of the epidermal growth factor receptor (EGF-R) signaling pathway by oral administration of the EGF-R tyrosine kinase inhibitor (PKI 166) alone or in combination with injectable Taxol inhibits the growth of PC-3MM2 human prostate cancer cells in the bone of nude mice. Male nude mice implanted with PC-3MM2 cells in the tibia were treated with oral administrations of PKI 166 or PKI 166 plus injectable Taxol beginning 3 days after implantation. The incidence and size of bone tumors and destruction of bone were determined by digitalized radiography. Expression of epidermal growth factor (EGF), EGF-R, and activated EGF-R in tumor cells and tumor-associated endothelial cells was determined by immunohistochemistry. Oral administration of PKI 166 or PKI 166 plus injectable Taxol reduced the incidence and size of bone tumors and destruction of bone. Immunohistochemical analysis revealed that PC-3MM2 cells growing adjacent to the bone expressed high levels of EGF and activated EGF-R, whereas tumor cells in the adjacent musculature did not. Moreover, endothelial cells within the bone tumor lesions, but not in uninvolved bone or tumors in the muscle, expressed high levels of activated EGF-R. Treatment with PKI 166 and more so with PKI 166 plus Taxol significantly inhibited phosphorylation of EGF-R on tumor and endothelial cells and induced significant apoptosis and endothelial cells within tumor lesions. These data indicate that endothelial cells exposed to EGF produced by tumor cells express activated EGF-R and that targeting EGF-R can produce significant therapeutic effects against prostate cancer bone metastasis.

Effect of transforming growth factor beta (TGF-β) receptor I kinase inhibitor on prostate cancer bone growth.

PubMed

Wan, Xinhai; Li, Zhi-Gang; Yingling, Jonathan M; Yang, Jun; Starbuck, Michael W; Ravoori, Murali K; Kundra, Vikas; Vazquez, Elba; Navone, Nora M

2012-03-01

Transforming growth factor beta 1 (TGF-β1) has been implicated in the pathogenesis of prostate cancer (PCa) bone metastasis. In this study, we tested the antitumor efficacy of a selective TGF-β receptor I kinase inhibitor, LY2109761, in preclinical models. The effect of LY2109761 on the growth of MDA PCa 2b and PC-3 human PCa cells and primary mouse osteoblasts (PMOs) was assessed in vitro by measuring radiolabeled thymidine incorporation into DNA. In vivo, the right femurs of male SCID mice were injected with PCa cells. We monitored the tumor burden in control- and LY2109761-treated mice with MRI analysis and the PCa-induced bone response with X-ray and micro-CT analyses. Histologic changes in bone were studied by performing bone histomorphometric evaluations. PCa cells and PMOs expressed TGF-β receptor I. TGF-β1 induced pathway activation (as assessed by induced expression of p-Smad2) and inhibited cell growth in PC-3 cells and PMOs but not in MDA PCa 2b cells. LY2109761 had no effect on PCa cells but induced PMO proliferation in vitro. As expected, LY2109761 reversed the TGF-β1-induced pathway activation and growth inhibition in PC-3 cells and PMOs. In vivo, LY2109761 treatment for 6weeks resulted in increased volume in normal bone and increased osteoblast and osteoclast parameters. In addition, LY2109761 treatment significantly inhibited the growth of MDA PCa 2b and PC-3 in the bone of SCID mice (p<0.05); moreover, it resulted in significantly less bone loss and change in osteoclast-associated parameters in the PC-3 tumor-bearing bones than in the untreated mice. In summary, we report for the first time that targeting TGF-β receptors with LY2109761 can control PCa bone growth while increasing the mass of normal bone. This increased bone mass in nontumorous bone may be a desirable side effect of LY2109761 treatment for men with osteopenia or osteoporosis secondary to androgen-ablation therapy, reinforcing the benefit of effectively controlling PCa growth in bone. Thus, targeting TGF-β receptor I is a valuable intervention in men with advanced PCa. Copyright © 2011 Elsevier Inc. All rights reserved.

Effect of transforming growth factor beta (TGF-β) receptor I kinase inhibitor on prostate cancer bone growth

PubMed Central

Wan, Xinhai; Li, Zhi-Gang; Yingling, Jonathan M.; Yang, Jun; Starbuck, Michael W.; Ravoori, Murali K.; Kundra, Vikas; Vazquez, Elba; Navone, Nora M.

2012-01-01

Transforming growth factor beta 1 (TGF-β1) has been implicated in the pathogenesis of prostate cancer (PCa) bone metastasis. In this study, we tested the antitumor efficacy of a selective TGF-β receptor I kinase inhibitor, LY2109761, in preclinical models. The effect of LY2109761 on the growth of MDA PCa 2b and PC-3 human PCa cells and primary mouse osteoblasts (PMOs) was assessed in vitro by measuring radiolabeled thymidine incorporation into DNA. In vivo, the right femurs of male SCID mice were injected with PCa cells. We monitored the tumor burden in control- and LY2109761-treated mice with MRI analysis and the PCa-induced bone response with x-ray and micro-CT analyses. Histologic changes in bone were studied by performing bone histomorphometric evaluations. PCa cells and PMOs expressed TGF-β receptor I. TGF-β1 induced pathway activation (as assessed by induced expression of p-Smad2) and inhibited cell growth in PC-3 cells and PMOs but not in MDA PCa 2b cells. LY2109761 had no effect on PCa cells but induced PMO proliferation in vitro. As expected, LY2109761 reversed the TGF-β1–induced pathway activation and growth inhibition in PC-3 cells and PMOs. In vivo, LY2109761 treatment for 6 weeks resulted in increased volume in normal bone and increased osteoblast and osteoclast parameters. In addition, LY2109761 treatment significantly inhibited the growth of MDA PCa 2b and PC-3 in the bone of SCID mice (p < 0.05); moreover, it resulted in significantly less bone loss and change in osteoclast-associated parameters in the PC-3 tumor–bearing bones than in the untreated mice. In summary, we report for the first time that targeting TGF-β receptors with LY2109761 can control PCa bone growth while increasing the mass of normal bone. This increased bone mass in nontumorous bone may be a desirable side effect of LY2109761 treatment for men with osteopenia or osteoporosis secondary to androgen-ablation therapy, reinforcing the benefit of effectively controlling PCa growth in bone. Thus, targeting TGF-β receptor I is a valuable intervention in men with advanced PCa. PMID:22173053

Controlled Dual Growth Factor Delivery From Microparticles Incorporated Within Human Bone Marrow-Derived Mesenchymal Stem Cell Aggregates for Enhanced Bone Tissue Engineering via Endochondral Ossification.

PubMed

Dang, Phuong N; Dwivedi, Neha; Phillips, Lauren M; Yu, Xiaohua; Herberg, Samuel; Bowerman, Caitlin; Solorio, Loran D; Murphy, William L; Alsberg, Eben

2016-02-01

Bone tissue engineering via endochondral ossification has been explored by chondrogenically priming cells using soluble mediators for at least 3 weeks to produce a hypertrophic cartilage template. Although recapitulation of endochondral ossification has been achieved, long-term in vitro culture is required for priming cells through repeated supplementation of inductive factors in the media. To address this challenge, a microparticle-based growth factor delivery system was engineered to drive endochondral ossification within human bone marrow-derived mesenchymal stem cell (hMSC) aggregates. Sequential exogenous presentation of soluble transforming growth factor-β1 (TGF-β1) and bone morphogenetic protein-2 (BMP-2) at various defined time courses resulted in varying degrees of chondrogenesis and osteogenesis as demonstrated by glycosaminoglycan and calcium content. The time course that best induced endochondral ossification was used to guide the development of the microparticle-based controlled delivery system for TGF-β1 and BMP-2. Gelatin microparticles capable of relatively rapid release of TGF-β1 and mineral-coated hydroxyapatite microparticles permitting more sustained release of BMP-2 were then incorporated within hMSC aggregates and cultured for 5 weeks following the predetermined time course for sequential presentation of bioactive signals. Compared with cell-only aggregates treated with exogenous growth factors, aggregates with incorporated TGF-β1- and BMP-2-loaded microparticles exhibited enhanced chondrogenesis and alkaline phosphatase activity at week 2 and a greater degree of mineralization by week 5. Staining for types I and II collagen, osteopontin, and osteocalcin revealed the presence of cartilage and bone. This microparticle-incorporated system has potential as a readily implantable therapy for healing bone defects without the need for long-term in vitro chondrogenic priming. Significance: This study demonstrates the regulation of chondrogenesis and osteogenesis with regard to endochondral bone formation in high-density stem cell systems through the controlled presentation of inductive factors from incorporated microparticles. This work lays the foundation for a rapidly implantable tissue engineering system that promotes bone repair via endochondral ossification, a pathway that can delay the need for a functional vascular network and has an intrinsic ability to promote angiogenesis. The modular nature of this system lends well to using different cell types and/or growth factors to induce endochondral bone formation, as well as the production of other tissue types. ©AlphaMed Press.

Persistent injury-associated anemia: the role of the bone marrow microenvironment.

PubMed

Millar, Jessica K; Kannan, Kolenkode B; Loftus, Tyler J; Alamo, Ines G; Plazas, Jessica; Efron, Philip A; Mohr, Alicia M

2017-06-15

The regulation of erythropoiesis involves hematopoietic progenitor cells, bone marrow stroma, and the microenvironment. Following severe injury, a hypercatecholamine state develops that is associated with increased mobilization of hematopoietic progenitor cells to peripheral blood and decreased growth of bone marrow erythroid progenitor cells that manifests clinically as a persistent injury-associated anemia. Changes within the bone marrow microenvironment influence the development of erythroid progenitor cells. Therefore, we sought to determine the effects of lung contusion, hemorrhagic shock, and chronic stress on the hematopoietic cytokine response. Bone marrow was obtained from male Sprague-Dawley rats (n = 6/group) killed 7 d after lung contusion followed by hemorrhagic shock (LCHS) or LCHS followed by daily chronic restraint stress (LCHS/CS). End point polymerase chain reaction was performed for interleukin-1β, interleukin-10, stem cell factor, transforming growth factor-β, high-mobility group box-1 (HMGB-1), and B-cell lymphoma-extra large. Seven days following LCHS and LCHS/CS, bone marrow expression of prohematopoietic cytokines (interleukin-1β, interleukin-10, stem cell factor, and transforming growth factor-β) was significantly decreased, and bone marrow expression of HMGB-1 was significantly increased. B-cell lymphoma-extra large bone marrow expression was not affected by LCHS or LCHS/CS (naïve: 44 ± 12, LCHS: 44 ± 12, LCHS/CS: 37 ± 1, all P > 0.05). The bone marrow microenvironment was significantly altered following severe trauma in a rodent model. Prohematopoietic cytokines were downregulated, and the proinflammatory cytokine HMGB-1 had increased bone marrow expression. Modulation of the bone marrow microenvironment may represent a therapeutic strategy following severe trauma to alleviate persistent injury-associated anemia. Copyright © 2017 Elsevier Inc. All rights reserved.

Neurotrophin-3 Induces BMP-2 and VEGF Activities and Promotes the Bony Repair of Injured Growth Plate Cartilage and Bone in Rats.

PubMed

Su, Yu-Wen; Chung, Rosa; Ruan, Chun-Sheng; Chim, Shek Man; Kuek, Vincent; Dwivedi, Prem P; Hassanshahi, Mohammadhossein; Chen, Ke-Ming; Xie, Yangli; Chen, Lin; Foster, Bruce K; Rosen, Vicki; Zhou, Xin-Fu; Xu, Jiake; Xian, Cory J

2016-06-01

Injured growth plate is often repaired by bony tissue causing bone growth defects, for which the mechanisms remain unclear. Because neurotrophins have been implicated in bone fracture repair, here we investigated their potential roles in growth plate bony repair in rats. After a drill-hole injury was made in the tibial growth plate and bone, increased injury site mRNA expression was observed for neurotrophins NGF, BDNF, NT-3, and NT-4 and their Trk receptors. NT-3 and its receptor TrkC showed the highest induction. NT-3 was localized to repairing cells, whereas TrkC was observed in stromal cells, osteoblasts, and blood vessel cells at the injury site. Moreover, systemic NT-3 immunoneutralization reduced bone volume at injury sites and also reduced vascularization at the injured growth plate, whereas recombinant NT-3 treatment promoted bony repair with elevated levels of mRNA for osteogenic markers and bone morphogenetic protein (BMP-2) and increased vascularization and mRNA for vascular endothelial growth factor (VEGF) and endothelial cell marker CD31 at the injured growth plate. When examined in vitro, NT-3 promoted osteogenesis in rat bone marrow stromal cells, induced Erk1/2 and Akt phosphorylation, and enhanced expression of BMPs (particularly BMP-2) and VEGF in the mineralizing cells. It also induced CD31 and VEGF mRNA in rat primary endothelial cell culture. BMP activity appears critical for NT-3 osteogenic effect in vitro because it can be almost completely abrogated by co-addition of the BMP inhibitor noggin. Consistent with its angiogenic effect in vivo, NT-3 promoted angiogenesis in metatarsal bone explants, an effect abolished by co-treatment with anti-VEGF. This study suggests that NT-3 may be an osteogenic and angiogenic factor upstream of BMP-2 and VEGF in bony repair, and further studies are required to investigate whether NT-3 may be a potential target for preventing growth plate faulty bony repair or for promoting bone fracture healing. © 2016 American Society for Bone and Mineral Research. © 2016 American Society for Bone and Mineral Research.

Tri-Layered Nanocomposite Hydrogel Scaffold for the Concurrent Regeneration of Cementum, Periodontal Ligament, and Alveolar Bone.

PubMed

Sowmya, S; Mony, Ullas; Jayachandran, P; Reshma, S; Kumar, R Arun; Arzate, H; Nair, Shantikumar V; Jayakumar, R

2017-04-01

A tri-layered scaffolding approach is adopted for the complete and concurrent regeneration of hard tissues-cementum and alveolar bone-and soft tissue-the periodontal ligament (PDL)-at a periodontal defect site. The porous tri-layered nanocomposite hydrogel scaffold is composed of chitin-poly(lactic-co-glycolic acid) (PLGA)/nanobioactive glass ceramic (nBGC)/cementum protein 1 as the cementum layer, chitin-PLGA/fibroblast growth factor 2 as the PDL layer, and chitin-PLGA/nBGC/platelet-rich plasma derived growth factors as the alveolar bone layer. The tri-layered nanocomposite hydrogel scaffold is cytocompatible and favored cementogenic, fibrogenic, and osteogenic differentiation of human dental follicle stem cells. In vivo, tri-layered nanocomposite hydrogel scaffold with/without growth factors is implanted into rabbit maxillary periodontal defects and compared with the controls at 1 and 3 months postoperatively. The tri-layered nanocomposite hydrogel scaffold with growth factors demonstrates complete defect closure and healing with new cancellous-like tissue formation on microcomputed tomography analysis. Histological and immunohistochemical analyses further confirm the formation of new cementum, fibrous PDL, and alveolar bone with well-defined bony trabeculae in comparison to the other three groups. In conclusion, the tri-layered nanocomposite hydrogel scaffold with growth factors can serve as an alternative regenerative approach to achieve simultaneous and complete periodontal regeneration. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Acemannan sponges stimulate alveolar bone, cementum and periodontal ligament regeneration in a canine class II furcation defect model.

PubMed

Chantarawaratit, P; Sangvanich, P; Banlunara, W; Soontornvipart, K; Thunyakitpisal, P

2014-04-01

Periodontal disease is a common infectious disease, found worldwide, causing the destruction of the periodontium. The periodontium is a complex structure composed of both soft and hard tissues, thus an agent applied to regenerate the periodontium must be able to stimulate periodontal ligament, cementum and alveolar bone regeneration. Recent studies demonstrated that acemannan, a polysaccharide extracted from Aloe vera gel, stimulated both soft and hard tissue healing. This study investigated effect of acemannan as a bioactive molecule and scaffold for periodontal tissue regeneration. Primary human periodontal ligament cells were treated with acemannan in vitro. New DNA synthesis, expression of growth/differentiation factor 5 and runt-related transcription factor 2, expression of vascular endothelial growth factor, bone morphogenetic protein-2 and type I collagen, alkaline phosphatase activity, and mineralized nodule formation were determined using [(3)H]-thymidine incorporation, reverse transcription-polymerase chain reaction, enzyme-linked immunoabsorbent assay, biochemical assay and alizarin red staining, respectively. In our in vivo study, premolar class II furcation defects were made in four mongrel dogs. Acemannan sponges were applied into the defects. Untreated defects were used as a negative control group. The amount of new bone, cementum and periodontal ligament formation were evaluated 30 and 60 d after the operation. Acemannan significantly increased periodontal ligament cell proliferation, upregulation of growth/differentiation factor 5, runt-related transcription factor 2, vascular endothelial growth factor, bone morphogenetic protein 2, type I collagen and alkaline phosphatase activity, and mineral deposition as compared with the untreated control group in vitro. Moreover, acemannan significantly accelerated new alveolar bone, cementum and periodontal ligament formation in class II furcation defects. Our data suggest that acemannan could be a candidate biomolecule for periodontal tissue regeneration. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Effect of trehalose coating on basic fibroblast growth factor release from tailor-made bone implants.

PubMed

Choi, Sungjin; Lee, Jongil; Igawa, Kazuyo; Suzuki, Shigeki; Mochizuki, Manabu; Nishimura, Ryohei; Chung, Ung-il; Sasaki, Nobuo

2011-12-01

Artificial bone implants are often incorporated with osteoinductive factors to facilitate early bone regeneration. Calcium phosphate, the main component in artificial bone implants, strongly binds these factors, and in a few cases, the incorporated proteins are not released from the implant under conditions of physiological pH, thereby leading to reduction in their osteoinductivity. In this study, we coated tailor-made bone implants with trehalose to facilitate the release of basic fibroblast growth factor (bFGF). In an in vitro study, mouse osteoblastic cells were separately cultured for 48 hr in a medium with a untreated implant (T-), trehalose-coated implant (T+), bFGF-incorporated implant (FT-), and bFGF-incorporated implant with trehalose coating (FT+). In the FT+ group, cell viability was significantly higher than that in the other groups (P<0.05). Scanning electron microscopy (SEM) and X-ray diffraction (XRD) revealed that trehalose effectively covered the surface of the artificial bone implant without affecting the crystallinity or the mechanical strength of the artificial bone implant. These results suggest that coating artificial bone implants with trehalose could limit the binding of bFGF to calcium phosphate.

Dual targeting c-met and VEGFR2 in osteoblasts suppresses growth and osteolysis of prostate cancer bone metastasis.

PubMed

Lee, Changki; Whang, Young Mi; Campbell, Preston; Mulcrone, Patrick L; Elefteriou, Florent; Cho, Sun Wook; Park, Serk In

2018-02-01

Prostate cancer characteristically induces osteoblastic bone metastasis, for which no therapies are available. A dual kinase inhibitor of c-Met and VEGFR-2 (cabozantinib) was shown to reduce prostate cancer growth in bone, with evidence for suppressing osteoblastic activity. However, c-Met and VEGFR2 signaling in osteoblasts in the context of bone metastasis remain unclear. Here we show using cultured osteoblasts that hepatocyte growth factor (HGF) and VEGF-A increased receptor activator of NFκB ligand (RANKL) and M-CSF, two essential factors for osteoclastogenesis. Insulin-like growth factor-1 (IGF1) also increased RANKL and M-CSF via c-Met transactivation. The conditioned media from IGF1-, HGF-, or VEGFA-treated osteoblasts promoted osteoclastogenesis that was reversed by inhibiting c-Met and/or VEGFR2 in osteoblasts. In vivo experiments used cabozantinib-resistant prostate cancer cells (PC-3 and C4-2B) to test the effects of c-Met/VEGFR2 inhibition specifically in osteoblasts. Cabozantinib (60 mg/kg, 3 weeks) suppressed tumor growth in bone and reduced expression of RANKL and M-CSF and subsequent tumor-induced osteolysis. Collectively, inhibition of c-Met and VEGFR2 in osteoblasts reduced RANKL and M-CSF expression, and associated with reduction of tumor-induced osteolysis, suggesting that c-Met and VEGFR2 are promising therapeutic targets in bone metastasis. Copyright © 2017 Elsevier B.V. All rights reserved.

Stimulation of Mucosal Mast Cell Growth in Normal and Nude Rat Bone Marrow Cultures

NASA Astrophysics Data System (ADS)

Haig, David M.; McMenamin, Christine; Gunneberg, Christian; Woodbury, Richard; Jarrett, Ellen E. E.

1983-07-01

Mast cells with the morphological and biochemical properties of mucosal mast cells (MMC) appear and proliferate to form the predominant cell type in rat bone marrow cultures stimulated with factors from antigen- or mitogen-activated lymphocytes. Conditioned media causing a selective proliferation of MMC were derived from mesenteric lymph node cells of Nippostrongylus brasiliensis-infected rats restimulated in vitro with specific antigen or from normal or infected rat mesenteric lymph node cells stimulated with concanavalin A. MMC growth factor is not produced by T-cell-depleted mesenteric lymph node cells or by the mesenteric lymph node cells of athymic rats. By contrast, MMC precursors are present in the bone marrow of athymic rats and are normally receptive to the growth factor produced by the lymphocytes of thymus-intact rats. The thymus dependence of MMC hyperplasia is thus based on the requirement of a thymus-independent precursor for a T-cell-derived growth promoter.

Guided Bone Regeneration Using Collagen Scaffolds, Growth Factors, and Periodontal Ligament Stem Cells for Treatment of Peri-Implant Bone Defects In Vivo

PubMed Central

Scholz, Malte; Baudisch, Maria; Liese, Jan; Frerich, Bernhard; Lang, Hermann

2017-01-01

Introduction The aim of the study was an evaluation of different approaches for guided bone regeneration (GBR) of peri-implant defects in an in vivo animal model. Materials and Methods In minipigs (n = 15), peri-implant defects around calcium phosphate- (CaP-; n = 46) coated implants were created and randomly filled with (1) blank, (2) collagen/hydroxylapatite/β-tricalcium phosphate scaffold (CHT), (3) CHT + growth factor cocktail (GFC), (4) jellyfish collagen matrix, (5) jellyfish collagen matrix + GFC, (6) collagen powder, and (7) collagen powder + periodontal ligament stem cells (PDLSC). Additional collagen membranes were used for coverage of the defects. After 120 days of healing, bone growth was evaluated histologically (bone to implant contact (BIC;%)), vertical bone apposition (VBA; mm), and new bone height (NBH; %). Results In all groups, new bone formation was seen. Though, when compared to the blank group, no significant differences were detected for all parameters. BIC and NBH in the group with collagen matrix as well as the group with the collagen matrix + GFC were significantly less when compared to the collagen powder group (all: p < 0.003). Conclusion GBR procedures, in combination with CaP-coated implants, will lead to an enhancement of peri-implant bone growth. There was no additional significant enhancement of osseous regeneration when using GFC or PDLSC. PMID:28951742

Guided Bone Regeneration Using Collagen Scaffolds, Growth Factors, and Periodontal Ligament Stem Cells for Treatment of Peri-Implant Bone Defects In Vivo.

PubMed

Kämmerer, Peer W; Scholz, Malte; Baudisch, Maria; Liese, Jan; Wegner, Katharina; Frerich, Bernhard; Lang, Hermann

2017-01-01

The aim of the study was an evaluation of different approaches for guided bone regeneration (GBR) of peri-implant defects in an in vivo animal model. In minipigs ( n = 15), peri-implant defects around calcium phosphate- (CaP-; n = 46) coated implants were created and randomly filled with (1) blank, (2) collagen/hydroxylapatite/ β -tricalcium phosphate scaffold (CHT), (3) CHT + growth factor cocktail (GFC), (4) jellyfish collagen matrix, (5) jellyfish collagen matrix + GFC, (6) collagen powder, and (7) collagen powder + periodontal ligament stem cells (PDLSC). Additional collagen membranes were used for coverage of the defects. After 120 days of healing, bone growth was evaluated histologically (bone to implant contact (BIC;%)), vertical bone apposition (VBA; mm), and new bone height (NBH; %). In all groups, new bone formation was seen. Though, when compared to the blank group, no significant differences were detected for all parameters. BIC and NBH in the group with collagen matrix as well as the group with the collagen matrix + GFC were significantly less when compared to the collagen powder group (all: p < 0.003). GBR procedures, in combination with CaP-coated implants, will lead to an enhancement of peri-implant bone growth. There was no additional significant enhancement of osseous regeneration when using GFC or PDLSC.

Quantitation of Bone Growth Rate Variability in Rats Exposed to Micro-(near zero G) and Macrogravity (2G)

NASA Technical Reports Server (NTRS)

Bromage, Timothy G.; Doty, Stephen B.; Smolyar, Igor; Holton, Emily

1997-01-01

Our stated primary objective is to quantify the growth rate variability of rat lamellar bone exposed to micro- (near zero G: e.g., Cosmos 1887 & 2044; SLS-1 & SLS-2) and macrogravity (2G). The primary significance of the proposed work is that an elegant method will be established that unequivocally characterizes the morphological consequences of gravitational factors on developing bone. The integrity of this objective depends upon our successful preparation of thin sections suitable for imaging individual bone lamellae, and our imaging and quantitation of growth rate variability in populations of lamellae from individual bone samples.

In vitro differentiation of embryonic stem cells into hepatocytes induced by fibroblast growth factors and bone morphological protein-4.

PubMed

Zhou, Qing-Jun; Huang, Yan-Dan; Xiang, Li-Xin; Shao, Jian-Zhong; Zhou, Guo-Shun; Yao, Hang; Dai, Li-Cheng; Lu, Yong-Liang

2007-01-01

The feasibility of transforming embryonic endoderm into different cell types is tightly controlled by mesodermal and septum transversumal signalings during early embryonic development. Here, an induction protocol tracing embryonic liver development was designed, in which, three growth factors, acid fibroblast growth factor, basic fibroblast growth factor and bone morphological protein-4 that secreted from pre-cardiac mesoderm and septum transversum mesenchyme, respectively, were employed to investigate their specific potency of modulating the mature hepatocyte proportion during the differentiation process. Results showed that hepatic differentiation took place spontaneously at a low level, however, supplements of the three growth factors gave rise to a significant up-regulation of mature hepatocytes. Bone morphological protein-4 highlighted the differentiation ratio to 40-55%, showing the most effective promotion, and also exhibited a synergistic effect with the other two fibroblast factors, whereas no similar phenomenon was observed between the other two factors, which was reported for the first time. Our study not only provides a high-performance system of embryonic stem cells differentiating into hepatocytes, which would supply a sufficient hepatic population for related studies, but also make it clear of the inductive effects of three important growth factors, which could support for further investigation on the mechanisms of mesodermal and septumal derived signalings that regulate hepatic differentiation.

Sequential growth factor application in bone marrow stromal cell ligament engineering.

PubMed

Moreau, Jodie E; Chen, Jingsong; Horan, Rebecca L; Kaplan, David L; Altman, Gregory H

2005-01-01

In vitro bone marrow stromal cell (BMSC) growth may be enhanced through culture medium supplementation, mimicking the biochemical environment in which cells optimally proliferate and differentiate. We hypothesize that the sequential administration of growth factors to first proliferate and then differentiate BMSCs cultured on silk fiber matrices will support the enhanced development of ligament tissue in vitro. Confluent second passage (P2) BMSCs obtained from purified bone marrow aspirates were seeded on RGD-modified silk matrices. Seeded matrices were divided into three groups for 5 days of static culture, with medium supplement of basic fibroblast growth factor (B) (1 ng/mL), epidermal growth factor (E; 1 ng/mL), or growth factor-free control (C). After day 5, medium supplementation was changed to transforming growth factor-beta1 (T; 5 ng/mL) or C for an additional 9 days of culture. Real-time RT-PCR, SEM, MTT, histology, and ELISA for collagen type I of all sample groups were performed. Results indicated that BT supported the greatest cell ingrowth after 14 days of culture in addition to the greatest cumulative collagen type I expression measured by ELISA. Sequential growth factor application promoted significant increases in collagen type I transcript expression from day 5 of culture to day 14, for five of six groups tested. All T-supplemented samples surpassed their respective control samples in both cell ingrowth and collagen deposition. All samples supported spindle-shaped, fibroblast cell morphology, aligning with the direction of silk fibers. These findings indicate significant in vitro ligament development after only 14 days of culture when using a sequential growth factor approach.

Invited review of a workshop: anabolic hormones in bone: basic research and therapeutic potential.

PubMed

Margolis, R N; Canalis, E; Partridge, N C

1996-03-01

Age-, postmenopause-, and disease-related conditions that result in low bone mass represent important public health issues. Maintenance of bone mass is a balance between bone resorption and formation and is influenced by diet, body composition, activity level, and the interactions between and among a large number of hormones, growth factors, and cytokines. Recent research has emphasized establishing a more complete understanding of the hormonal regulation of bone and developing anabolic agents with therapeutic potential for the treatment of low bone mass. The NIDDK at the NIH recently sponsored a Workshop, entitled Anabolic Hormones in Bone: Basic Research and Therapeutic Potential, that attempted to define the current state of the art knowledge of hormones, growth factors, and cytokines that affect bone mass, with particular emphasis on those that could potentially have a role as anabolic agents in bone. This review presents a condensed proceedings of that workshop along with a summary of the optimal requisites for the development of anabolic agents with therapeutic potential in bone.

The Nell-1 Growth Factor Stimulates Bone Formation by Purified Human Perivascular Cells

PubMed Central

Zhang, Xinli; Péault, Bruno; Chen, Weiwei; Li, Weiming; Corselli, Mirko; James, Aaron W.; Lee, Min; Siu, Ronald K.; Shen, Pang; Zheng, Zhong; Shen, Jia; Kwak, Jinny; Zara, Janette N.; Chen, Feng; Zhang, Hong; Yin, Zack; Wu, Ben; Ting, Kang

2011-01-01

The search for novel sources of stem cells other than bone marrow mesenchymal stem cells (MSCs) for bone regeneration and repair has been a critical endeavor. We previously established an effective protocol to homogeneously purify human pericytes from multiple fetal and adult tissues, including adipose, bone marrow, skeletal muscle, and pancreas, and identified pericytes as a primitive origin of human MSCs. In the present study, we further characterized the osteogenic potential of purified human pericytes combined with a novel osteoinductive growth factor, Nell-1. Purified pericytes grown on either standard culture ware or human cancellous bone chip (hCBC) scaffolds exhibited robust osteogenic differentiation in vitro. Using a nude mouse muscle pouch model, pericytes formed significant new bone in vivo as compared to scaffold alone (hCBC). Moreover, Nell-1 significantly increased pericyte osteogenic differentiation, both in vitro and in vivo. Interestingly, Nell-1 significantly induced pericyte proliferation and was observed to have pro-angiogenic effects, both in vitro and in vivo. These studies suggest that pericytes are a potential new cell source for future efforts in skeletal regenerative medicine, and that Nell-1 is a candidate growth factor able to induce pericyte osteogenic differentiation. PMID:21615216

Collagen implants equipped with 'fish scale'-like nanoreservoirs of growth factors for bone regeneration.

PubMed

Eap, Sandy; Ferrand, Alice; Schiavi, Jessica; Keller, Laetitia; Kokten, Tunay; Fioretti, Florence; Mainard, Didier; Ladam, Guy; Benkirane-Jessel, Nadia

2014-01-01

Implants triggering rapid, robust and durable tissue regeneration are needed to shorten recovery times and decrease risks of postoperative complications for patients. Here, we describe active living collagen implants with highly promising bone regenerative properties. Bioactivity of the implants is obtained through the protective and stabilizing layer-by-layer immobilization of a protein growth factor in association with a polysaccharide (chitosan), within the form of nanocontainers decorating the collagen nanofibers. All components of the implants are US FDA approved. From both in vitro and in vivo evaluations, the sophisticated strategy described here should enhance, at a reduced cost, the safety and efficacy of the therapeutic implants in terms of large bone defects repair compared with current simplistic approaches based on the soaking of the implants with protein growth factor.

Delivery of small molecules for bone regenerative engineering: preclinical studies and potential clinical applications

PubMed Central

Laurencin, Cato T.; Ashe, Keshia M.; Henry, Nicole; Kan, Ho Man; Lo, Kevin W-H.

2014-01-01

Stimulation of bone regeneration using growth factors is a promising approach for musculoskeletal regenerative engineering. Common limitations with protein growth factors are high manufacturing costs, protein instability, contamination issues, and unwanted immunogenic responses of the host. New strategies for bone regeneration that obviate these problems can have a significant impact on the treatment of skeletal injury and diseases. Over the past decade, a large number of small molecules with the potential of regenerating skeletal tissue have been reported in the literature. Here, we review this literature, paying specific attention to the prospects for small molecule-based bone-regenerative engineering. We also review the preclinical study of small molecules associated with bone regeneration. PMID:24508820

Connective tissue growth factor and bone morphogenetic protein 2 are induced following myocardial ischemia in mice and humans.

PubMed

Rutkovskiy, Arkady; Sagave, Julia; Czibik, Gabor; Baysa, Anton; Zihlavnikova Enayati, Katarina; Hillestad, Vigdis; Dahl, Christen Peder; Fiane, Arnt; Gullestad, Lars; Gravning, Jørgen; Ahmed, Shakil; Attramadal, Håvard; Valen, Guro; Vaage, Jarle

2017-09-01

We aimed to study the cardiac expression of bone morphogenetic protein 2, its receptor 1 b, and connective tissue growth factor, factors implicated in cardiac embryogenesis, following ischemia/hypoxia, heart failure, and in remodeling hearts from humans and mice. Biopsies from the left ventricle of patients with end-stage heart failure due to dilated cardiomyopathy or coronary artery disease were compared with donor hearts and biopsies from patients with normal heart function undergoing coronary artery bypass grafting. Mouse model of post-infarction remodeling was made by permanent ligation of the left coronary artery. Hearts were analyzed by real-time polymerase chain reaction and Western blotting after 24 hours and after 2 and 4 weeks. Patients with dilated cardiomyopathy and mice post-infarction had increased cardiac expression of connective tissue growth factor. Bone morphogenetic protein 2 was increased in human hearts failing due to coronary artery disease and in mice post-infarction. Gene expression of bone morphogenetic protein receptor 1 beta was reduced in hearts of patients with failure, but increased two weeks following permanent ligation of the left coronary artery in mice. In conclusion, connective tissue growth factor is upregulated in hearts of humans with dilated cardiomyopathy, bone morphogenetic protein 2 is upregulated in remodeling due to myocardial infarction while its receptor 1 b in human failing hearts is downregulated. A potential explanation might be an attempt to engage regenerative processes, which should be addressed by further, mechanistic studies.

Derangement of calcium metabolism in diabetes mellitus: negative outcome from the synergy between impaired bone turnover and intestinal calcium absorption.

PubMed

Wongdee, Kannikar; Krishnamra, Nateetip; Charoenphandhu, Narattaphol

2017-01-01

Both types 1 and 2 diabetes mellitus (T1DM and T2DM) are associated with profound deterioration of calcium and bone metabolism, partly from impaired intestinal calcium absorption, leading to a reduction in calcium uptake into the body. T1DM is associated with low bone mineral density (BMD) and osteoporosis, whereas the skeletal changes in T2DM are variable, ranging from normal to increased and to decreased BMD. However, both types of DM eventually compromise bone quality through production of advanced glycation end products and misalignment of collagen fibrils (so-called matrix failure), thereby culminating in a reduction of bone strength. The underlying cellular mechanisms (cellular failure) are related to suppression of osteoblast-induced bone formation and bone calcium accretion, as well as to enhancement of osteoclast-induced bone resorption. Several other T2DM-related pathophysiological changes, e.g., osteoblast insulin resistance, impaired productions of osteogenic growth factors (particularly insulin-like growth factor 1 and bone morphogenetic proteins), overproduction of pro-inflammatory cytokines, hyperglycemia, and dyslipidemia, also aggravate diabetic osteopathy. In the kidney, DM and the resultant hyperglycemia lead to calciuresis and hypercalciuria in both humans and rodents. Furthermore, DM causes deranged functions of endocrine factors related to mineral metabolism, e.g., parathyroid hormone, 1,25-dihydroxyvitamin D 3 , and fibroblast growth factor-23. Despite the wealth of information regarding impaired bone remodeling in DM, the long-lasting effects of DM on calcium metabolism in young growing individuals, pregnant women, and neonates born to women with gestational DM have received scant attention, and their underlying mechanisms are almost unknown and worth exploring.

Bromocriptine modulates the expression of PTHrP receptor, Indian hedgehog, and Runx2 proteins in the growth plate of lactating rats.

PubMed

Wongdee, Kannikar; Thonapan, Natchayaporn; Saengamnart, Wasana; Krishnamra, Nateetip; Charoenphandhu, Narattaphol

2013-09-01

In lactating rats, the endochondral bone growth is markedly enhanced, leading to the lengthening of long bone. This lactation-induced bone elongation could be abolished by a dopaminergic D2 receptor agonist bromocriptine, but how bromocriptine altered the expression of major chondroregulatory proteins in the growth plate cartilage was elusive. Here, we performed a quantitative immunohistochemical analysis to determine the expression of various peptides and transcription factors known to control the growth plate chondrocyte proliferation and differentiation [i.e., parathyroid hormone-related protein (PTHrP), PTHrP receptor, Indian hedgehog (Ihh), and runt-related transcription factor 2 (Runx2)], in bromocriptine-treated lactating rats. The results showed that bromocriptine markedly increased Ihh expression in hypertrophic chondrocytes during early and mid-lactation, while the expression of PTHrP receptor, but not its ligand PTHrP, was upregulated in the proliferative and hypertrophic zones during mid and late lactation. In contrast, the expression of Runx2, an important transcription factor for chondrocyte differentiation, was suppressed in the hypertrophic chondrocytes of bromocriptine-treated rats. In conclusion, bromocriptine increased Ihh and PTHrP receptor expressions and decreased Runx2 expression, which might, in turn, enhance chondrocyte proliferation and delay chondrocyte hypertrophy, thereby slowing down endochondral bone growth. This finding could explain how bromocriptine compromised the lactation-induced bone elongation.

Heparin functionalization increases retention of TGF-β2 and GDF5 on biphasic silk fibroin scaffolds for tendon/ligament-to-bone tissue engineering.

PubMed

Font Tellado, Sònia; Chiera, Silvia; Bonani, Walter; Poh, Patrina S P; Migliaresi, Claudio; Motta, Antonella; Balmayor, Elizabeth R; van Griensven, Martijn

2018-05-01

The tendon/ligament-to-bone transition (enthesis) is a highly specialized interphase tissue with structural gradients of extracellular matrix composition, collagen molecule alignment and mineralization. These structural features are essential for enthesis function, but are often not regenerated after injury. Tissue engineering is a promising strategy for enthesis repair. Engineering of complex tissue interphases such as the enthesis is likely to require a combination of biophysical, biological and chemical cues to achieve functional tissue regeneration. In this study, we cultured human primary adipose-derived mesenchymal stem cells (AdMCs) on biphasic silk fibroin scaffolds with integrated anisotropic (tendon/ligament-like) and isotropic (bone/cartilage like) pore alignment. We functionalized those scaffolds with heparin and explored their ability to deliver transforming growth factor β2 (TGF-β2) and growth/differentiation factor 5 (GDF5). Heparin functionalization increased the amount of TGF-β2 and GDF5 remaining attached to the scaffold matrix and resulted in biological effects at low growth factor doses. We analyzed the combined impact of pore alignment and growth factors on AdMSCs. TGF-β2 and pore anisotropy synergistically increased the expression of tendon/ligament markers and collagen I protein content. In addition, the combined delivery of TGF-β2 and GDF5 enhanced the expression of cartilage markers and collagen II protein content on substrates with isotropic porosity, whereas enthesis markers were enhanced in areas of mixed anisotropic/isotropic porosity. Altogether, the data obtained in this study improves current understanding on the combined effects of biological and structural cues on stem cell fate and presents a promising strategy for tendon/ligament-to-bone regeneration. Regeneration of the tendon/ligament-to-bone interphase (enthesis) is of significance in the repair of ruptured tendons/ligaments to bone to improve implant integration and clinical outcome. This study proposes a novel approach for enthesis regeneration based on a biomimetic and integrated tendon/ligament-to-bone construct, stem cells and heparin-based delivery of growth factors. We show that heparin can keep growth factors local and biologically active at low doses, which is critical to avoid supraphysiological doses and associated side effects. In addition, we identify synergistic effects of biological (growth factors) and structural (pore alignment) cues on stem cells. These results improve current understanding on the combined impact of biological and structural cues on the multi-lineage differentiation capacity of stem cells for regenerating complex tissue interphases. Copyright © 2018 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Decreased heterotopic osteogenesis in vitamin-D-deficient, but normocalcemic guinea pigs

NASA Technical Reports Server (NTRS)

Dziedzic-Goclawska, A.; Toverud, S. U.; Kaminski, A.; Boass, A.; Yamauchi, M.

1992-01-01

The effect of vitamin D deficiency unhampered by hypocalcemia on de novo bone formation was studied in guinea pigs. Heterotopic induction of osteogenesis was evaluated 4 weeks after intramuscular transplantation of allogenic urinary bladder transitional epithelium from vitamin-D-repleted (+D) donors into +D and -D recipients. In -D recipients the frequency of osteogenesis and the amount of induced bone were significantly diminished; induced bone was less mature, scantly cellular woven bone poorly repopulated with bone marrow. No effect of vitamin D deficiency on orthotopic bone growth and on mineralization of orthotopic and heterotopically induced bone was observed. It is proposed that in addition to inducing factors (BMPs, growth factors) which may be responsible for transformation of mesenchymal cells to osteoprogenitor cells, normal concentrations of 1,25-(OH)2D3 may be required for proliferation and further differentiation of these cells into osteoblasts and for expression of genes engaged in extracellular matrix formation and maturation.

Multifunctional mesoporous bioactive glasses for effective delivery of therapeutic ions and drug/growth factors.

PubMed

Wu, Chengtie; Chang, Jiang

2014-11-10

Regeneration of large-size bone defects represents a significant challenge clinically, which requires the use of scaffolds with multifunction, such as anti-bacterial activity, and stimulation of osteogenesis and angiogenesis. It is known that functional ions or drug/growth factors play an important role to stimulate tissue regeneration. Mesoporous bioactive glasses (MBG) possess excellent bioactivity and drug-delivery ability as well as effective ionic release in the body fluids microenvironment due to its specific mesoporous structure and large surface area. For these reasons, functional ions (e.g. lithium (Li), strontium (Sr), Copper (Cu) and Boron (B)) and drug/growth factors (e.g. dexamethasone, vascular endothelial growth factor (VEGF) and bone morphogenetic protein (BMP)) have been incorporated into MBG, which shows high loading efficiency and effective release. The release of therapeutic ions and drug/growth factors from MBG offers it multifunctional properties, such as improved osteogenesis, angiogenesis, anti-bacterial/cancer activity. However, there is no a systematic review about delivery of therapeutic ions and drugs/growth factors from MBG for the functional effect on the tissue regeneration despite that significant progress has been achieved in the past five years. Therefore, in this review, we mainly focused on the new advances for the functional effect of delivering therapeutic ions and drugs/growth factors on the ostegeogenesis, angiogenesis and antibacterial activity. It is expected that the review will offer new concept to develop multifunctional biomaterials for bone regeneration by the synergistic effect of therapeutic ions and drug/growth factors. Copyright © 2014 Elsevier B.V. All rights reserved.

Blockade of epidermal growth factor receptor signaling leads to inhibition of renal cell carcinoma growth in the bone of nude mice.

PubMed

Weber, Kristy L; Doucet, Michele; Price, Janet E; Baker, Cheryl; Kim, Sun Jin; Fidler, Isaiah J

2003-06-01

Renal cell carcinoma (RCC) frequently produces metastases to the musculoskeletal system that are a major source of morbidity in the form of pain, immobilization, fractures, neurological compromise, and a decreased ability to perform activities of daily living. Patients with metastatic RCC therefore have a dismal prognosis because there is no effective adjuvant treatment for this disease. Because the epidermal growth factor receptor (EGF-R) signaling cascade is important in the growth and metastasis of RCC, its blockade has been hypothesized to inhibit tumor growth and hence prevent resultant bone destruction. We determined whether blockade of EGF-R by the tyrosine kinase inhibitor PKI 166 inhibited the growth of RCC in bone. We use a novel cell line, RBM1-IT4, established from a human RCC bone metastasis. Protein and mRNA expression of the ligands and receptors was assessed by Western and Northern blots. The stimulation of RBM1-IT4 cells with epidermal growth factor or transforming growth factor alpha resulted in increased cellular proliferation and tyrosine kinase autophosphorylation. PKI 166 prevented these effects. First, RBM1-IT4 cells were implanted into the tibia of nude mice, where they established lytic, progressively growing lesions, after which the mice were treated with PKI 166 alone or in combination with paclitaxel (Taxol). Immunohistochemical analysis revealed that tumor cells and tumor-associated endothelial cells in control mice expressed activated EGF-R. Treatment of mice with PKI 166 alone or in combination with Taxol produced a significant decrease in the incidence and size of bone lesions as compared with the results in control or Taxol-treated mice (P < 0.001). Treatment with PKI 166 also decreased the expression of phosphorylated EGF-R by tumor cells and tumor-associated endothelial cells, and this was even more pronounced with PKI 166 plus Taxol treatment. The PKI 166 plus Taxol combination produced apoptosis of tumor cells and tumor-associated endothelial cells. Tumor cell proliferation, shown by proliferating cell nuclear antigen positivity, was decreased in all treatment groups. In addition, the integrity of the bone was maintained in mice treated with PKI 166 or PKI 166 plus Taxol, whereas massive bone destruction was seen in control and Taxol-treated mice. These results suggest that blockade of EGF-R signaling inhibits growth of RCC in the bone by its effect on tumor cells and tumor-associated endothelial cells.

Loss of RUNX3 expression inhibits bone invasion of oral squamous cell carcinoma

PubMed Central

Park, Junhee; Kim, Hyun-Jeong; Kim, Ki Rim; Lee, Sun Kyoung; Kim, Hyungkeun; Park, Kwang-Kyun; Chung, Won-Yoon

2017-01-01

High recurrence and lower survival rates in patients with oral squamous cell carcinoma (OSCC) are associated with its bone invasion. We identified the oncogenic role of RUNX3 during bone invasion by OSCC. Tumor growth and the generation of osteolytic lesions were significantly inhibited in mice that were subcutaneously inoculated with RUNX3-knockdown human OSCC cells. RUNX3 knockdown enhanced TGF-β-induced growth arrest and inhibited OSCC cell migration and invasion in the absence or presence of transforming growth factor-β (TGF-β), a major growth factor abundant in the bone microenvironment. RUNX3 knockdown induced cell cycle arrest at the G1 and G2 phases and promoted G2 arrest by TGF-β in Ca9.22 OSCC cells. RUNX3 knockdown also inhibited both the basal and TGF-β-induced epithelial-to-mesenchymal transition by increasing E-cadherin expression and suppressing the nuclear translocation of β-catenin. In addition, the expression and TGF-β-mediated induction of parathyroid hormone-related protein (PTHrP), one of key osteolytic factors, was blocked in RUNX3-knockdown OSCC cells. Furthermore, treating human osteoblastic cells with conditioned medium derived from RUNX3-knockdown OSCC cells reduced the receptor activator of nuclear factor-kappaB ligand (RANKL)/osteoprotegerin ratio compared with treatment with conditioned medium from RUNX3-expressing cells. These findings indicate that RUNX3 expression in OSCC cells contributes to their bone invasion and the resulting osteolysis by inducing their malignant behaviors and production of osteolytic factors. RUNX3 alone or in combination with TGF-β and PTHrP may be a useful predictive biomarker and therapeutic target for bone invasion by oral cancer. PMID:28030842

Loss of RUNX3 expression inhibits bone invasion of oral squamous cell carcinoma.

PubMed

Park, Junhee; Kim, Hyun-Jeong; Kim, Ki Rim; Lee, Sun Kyoung; Kim, Hyungkeun; Park, Kwang-Kyun; Chung, Won-Yoon

2017-02-07

High recurrence and lower survival rates in patients with oral squamous cell carcinoma (OSCC) are associated with its bone invasion. We identified the oncogenic role of RUNX3 during bone invasion by OSCC. Tumor growth and the generation of osteolytic lesions were significantly inhibited in mice that were subcutaneously inoculated with RUNX3-knockdown human OSCC cells. RUNX3 knockdown enhanced TGF-β-induced growth arrest and inhibited OSCC cell migration and invasion in the absence or presence of transforming growth factor-β (TGF-β), a major growth factor abundant in the bone microenvironment. RUNX3 knockdown induced cell cycle arrest at the G1 and G2 phases and promoted G2 arrest by TGF-β in Ca9.22 OSCC cells. RUNX3 knockdown also inhibited both the basal and TGF-β-induced epithelial-to-mesenchymal transition by increasing E-cadherin expression and suppressing the nuclear translocation of β-catenin. In addition, the expression and TGF-β-mediated induction of parathyroid hormone-related protein (PTHrP), one of key osteolytic factors, was blocked in RUNX3-knockdown OSCC cells. Furthermore, treating human osteoblastic cells with conditioned medium derived from RUNX3-knockdown OSCC cells reduced the receptor activator of nuclear factor-kappaB ligand (RANKL)/osteoprotegerin ratio compared with treatment with conditioned medium from RUNX3-expressing cells. These findings indicate that RUNX3 expression in OSCC cells contributes to their bone invasion and the resulting osteolysis by inducing their malignant behaviors and production of osteolytic factors. RUNX3 alone or in combination with TGF-β and PTHrP may be a useful predictive biomarker and therapeutic target for bone invasion by oral cancer.

Genetic evidence that thyroid hormone is indispensable for prepubertal insulin-like growth factor-I expression and bone acquisition in mice.

PubMed

Xing, Weirong; Govoni, Kristen E; Donahue, Leah Rae; Kesavan, Chandrasekhar; Wergedal, Jon; Long, Carlin; Bassett, J H Duncan; Gogakos, Apostolos; Wojcicka, Anna; Williams, Graham R; Mohan, Subburaman

2012-05-01

Understanding how bone growth is regulated by hormonal and mechanical factors during early growth periods is important for optimizing the attainment of peak bone mass to prevent or postpone the occurrence of fragility fractures later in life. Using genetic mouse models that are deficient in thyroid hormone (TH) (Tshr(-/-) and Duox2(-/-)), growth hormone (GH) (Ghrhr(lit/lit)), or both (Tshr(-/-); Ghrhr(lit/lit)), we demonstrate that there is an important period prior to puberty when the effects of GH are surprisingly small and TH plays a critical role in the regulation of skeletal growth. Daily administration of T3/T4 during days 5 to 14, the time when serum levels of T3 increase rapidly in mice, rescued the skeletal deficit in TH-deficient mice but not in mice lacking both TH and GH. However, treatment of double-mutant mice with both GH and T3/T4 rescued the bone density deficit. Increased body fat in the TH-deficient as well as TH/GH double-mutant mice was rescued by T3/T4 treatment during days 5 to 14. In vitro studies in osteoblasts revealed that T3 in the presence of TH receptor (TR) α1 bound to a TH response element in intron 1 of the IGF-I gene to stimulate transcription. In vivo studies using TRα and TRβ knockout mice revealed evidence for differential regulation of insulin-like growth factor (IGF)-I expression by the two receptors. Furthermore, blockade of IGF-I action partially inhibited the biological effects of TH, thus suggesting that both IGF-I-dependent and IGF-I-independent mechanisms contribute to TH effects on prepubertal bone acquisition. Copyright © 2012 American Society for Bone and Mineral Research.

Effects of Single Vitamin D₃ Injection (200,000 Units) on Serum Fibroblast Growth Factor 23 and Sclerostin Levels in Subjects with Vitamin D Deficiency.

PubMed

Zhang, Dongdong; Seo, Da Hea; Choi, Han Seok; Park, Hye Sun; Chung, Yoon Sok; Lim, Sung Kil

2017-12-01

Vitamin D deficiency remains common in all age groups and affects skeletal and non-skeletal health. Fibroblast growth factor 23 is a bone-derived hormone that regulates phosphate and 1,25-dihydroxyvitamin D homeostasis as a counter regulatory factor. 1,25-Dihydroxyvitamin D stimulates fibroblast growth factor 23 synthesis in bone, while fibroblast growth factor 23 suppresses 1,25-dihydroxyvitamin D production in the kidney. The aim of this study was to evaluate the effects of vitamin D₃ intramuscular injection therapy on serum fibroblast growth factor 23 concentrations, and several other parameters associated with bone metabolism such as sclerostin, dickkopf-1, and parathyroid hormone. A total of 34 subjects with vitamin D deficiency (defined by serum 25-hydroxyvitamin D levels below 20 ng/mL) were randomly assigned to either the vitamin D injection group (200,000 units) or placebo treatment group. Serum calcium, phosphate, urine calcium/creatinine, serum 25-hydroxyvitamin D, fibroblast growth factor 23, sclerostin, parathyroid hormone, and dickkopf-1 levels were serially measured after treatment. Comparing the vitamin D injection group with the placebo group, no significant changes were observed in serum fibroblast growth factor 23, parathyroid hormone, or dickkopf-1 levels. Serum sclerostin concentrations transiently increased at week 4 in the vitamin D group. However, these elevated levels declined later and there were no statistically significant differences as compared with baseline levels. Serum fibroblast factor 23, sclerostin, parathyroid hormone, and dickkopf-1 levels were not affected significantly by single intramuscular injection of vitamin D₃. Copyright © 2017 Korean Endocrine Society

Analysing the bioactive makeup of demineralised dentine matrix on bone marrow mesenchymal stem cells for enhanced bone repair.

PubMed

Avery, S J; Sadaghiani, L; Sloan, A J; Waddington, R J

2017-07-10

Dentine matrix has proposed roles for directing mineralised tissue repair in dentine and bone; however, the range of bioactive components in dentine and specific biological effects on bone-derived mesenchymal stem cells (MSCs) in humans are less well understood. The aims of this study were to further elucidate the biological response of MSCs to demineralised dentine matrix (DDM) in enhancing wound repair responses and ascertain key contributing components. Dentine was obtained from human teeth and DDM proteins solubilised with ethylenediaminetetraacetic acid (EDTA). Bone marrow derived MSCs were commercially obtained. Cells with a more immature phenotype were then selected by preferential fibronectin adhesion (FN-BMMSCs) for use in subsequent in vitro assays. DDM at 10 µg/mL reduced cell expansion, attenuated apoptosis and was the minimal concentration capable of inducing osteoblastic differentiation. Enzyme-linked immunosorbent assay (ELISA) quantification of growth factors indicated physiological levels produced the above responses; transforming growth factor β (TGF-β1) was predominant (15.6 ng/mg DDM), with relatively lower concentrations of BMP-2, FGF, VEGF and PDGF (6.2-4.7 ng/mg DDM). Fractionation of growth factors from other DDM components by heparin affinity chromatography diminished osteogenic responses. Depletion of biglycan from DDM also attenuated osteogenic potency, which was partially rescued by the isolated biglycan. Decorin depletion from DDM had no influence on osteogenic potency. Collectively, these results demonstrate the potential of DDM for the delivery of physiological levels of growth factors for bone repair processes, and substantiate a role for biglycan as an additional adjuvant for driving osteogenic pathways.

Recent advances in bone tissue engineering scaffolds

PubMed Central

Bose, Susmita; Roy, Mangal; Bandyopadhyay, Amit

2012-01-01

Bone disorders are of significant concern due to increase in the median age of our population. Traditionally, bone grafts have been used to restore damaged bone. Synthetic biomaterials are now being used as bone graft substitutes. These biomaterials were initially selected for structural restoration based on their biomechanical properties. Later scaffolds were engineered to be bioactive or bioresorbable to enhance tissue growth. Now scaffolds are designed to induce bone formation and vascularization. These scaffolds are often porous, biodegradable materials that harbor different growth factors, drugs, genes or stem cells. In this review, we highlight recent advances in bone scaffolds and discuss aspects that still need to be improved. PMID:22939815

Biology of Bone Tissue: Structure, Function, and Factors That Influence Bone Cells

PubMed Central

Florencio-Silva, Rinaldo; Sasso-Cerri, Estela; Simões, Manuel Jesus; Cerri, Paulo Sérgio

2015-01-01

Bone tissue is continuously remodeled through the concerted actions of bone cells, which include bone resorption by osteoclasts and bone formation by osteoblasts, whereas osteocytes act as mechanosensors and orchestrators of the bone remodeling process. This process is under the control of local (e.g., growth factors and cytokines) and systemic (e.g., calcitonin and estrogens) factors that all together contribute for bone homeostasis. An imbalance between bone resorption and formation can result in bone diseases including osteoporosis. Recently, it has been recognized that, during bone remodeling, there are an intricate communication among bone cells. For instance, the coupling from bone resorption to bone formation is achieved by interaction between osteoclasts and osteoblasts. Moreover, osteocytes produce factors that influence osteoblast and osteoclast activities, whereas osteocyte apoptosis is followed by osteoclastic bone resorption. The increasing knowledge about the structure and functions of bone cells contributed to a better understanding of bone biology. It has been suggested that there is a complex communication between bone cells and other organs, indicating the dynamic nature of bone tissue. In this review, we discuss the current data about the structure and functions of bone cells and the factors that influence bone remodeling. PMID:26247020

Role of IGF1 and EFN-EPH signaling in skeletal metabolism.

PubMed

Lindsey, Richard C; Rundle, Charles H; Mohan, Subburaman

2018-07-01

Insulin-like growth factor 1(IGF1) and ephrin ligand (EFN)-receptor (EPH) signaling are both crucial for bone cell function and skeletal development and maintenance. IGF1 signaling is the major mediator of growth hormone-induced bone growth, but a host of different signals and factors regulate IGF1 signaling at the systemic and local levels. Disruption of the Igf1 gene results in reduced peak bone mass in both experimental animal models and humans. Additionally, EFN-EPH signaling is a complex system which, particularly through cell-cell interactions, contributes to the development and differentiation of many bone cell types. Recent evidence has demonstrated several ways in which the IGF1 and EFN-EPH signaling pathways interact with and depend upon each other to regulate bone cell function. While much remains to be elucidated, the interaction between these two signaling pathways opens a vast array of new opportunities for investigation into the mechanisms of and potential therapies for skeletal conditions such as osteoporosis and fracture repair. © 2018 Society for Endocrinology.

[Local injection of exogenous nerve growth factor improves early bone maturation of implants].

PubMed

Yao, Yang; Du, Yu; Gu, Xia; Guang, Meng-Kai; Huang, Bo; Gong, Ping

2018-04-01

To investigate the effects of nerve growth factor (NGF) in the osteogenic action of implants and the maturation and reconstruction changes in bone tissues in the early stage of osseointegration. The mouse implant model was established by placing titanium in the femoral head of the mouse and locally injecting NGF in the implant zone. On 1, 2 and 4 weeks after operation, stain samples were collected from animals using hematoxylin-eosin (HE) staining and Masson staining. The effect of NGF on the bone maturation was compared at different time points of early stage osseointegration. The results of HE and Masson staining indicated that the local injection of external NGF can up-regulate bone mass, amount of bone trabecula, and bone maturity in the mouse model. The mature bone rate in treatment group of 1 week and 4 weeks after operation were significantly higher than those in the control group (P<0.05). NGF can shorten the period of bone maturation.

FGF signaling in the osteoprogenitor lineage non-autonomously regulates postnatal chondrocyte proliferation and skeletal growth

PubMed Central

Karuppaiah, Kannan; Yu, Kai; Lim, Joohyun; Chen, Jianquan; Smith, Craig; Long, Fanxin

2016-01-01

ABSTRACT Fibroblast growth factor (FGF) signaling is important for skeletal development; however, cell-specific functions, redundancy and feedback mechanisms regulating bone growth are poorly understood. FGF receptors 1 and 2 (Fgfr1 and Fgfr2) are both expressed in the osteoprogenitor lineage. Double conditional knockout mice, in which both receptors were inactivated using an osteoprogenitor-specific Cre driver, appeared normal at birth; however, these mice showed severe postnatal growth defects that include an ∼50% reduction in body weight and bone mass, and impaired longitudinal bone growth. Histological analysis showed reduced cortical and trabecular bone, suggesting cell-autonomous functions of FGF signaling during postnatal bone formation. Surprisingly, the double conditional knockout mice also showed growth plate defects and an arrest in chondrocyte proliferation. We provide genetic evidence of a non-cell-autonomous feedback pathway regulating Fgf9, Fgf18 and Pthlh expression, which led to increased expression and signaling of Fgfr3 in growth plate chondrocytes and suppression of chondrocyte proliferation. These observations show that FGF signaling in the osteoprogenitor lineage is obligately coupled to chondrocyte proliferation and the regulation of longitudinal bone growth. PMID:27052727

Strategies for delivering bone morphogenetic protein for bone healing.

PubMed

Begam, Howa; Nandi, Samit Kumar; Kundu, Biswanath; Chanda, Abhijit

2017-01-01

Bone morphogenetic proteins (BMPs) are the most significant growth factors that belong to the Transforming Growth Factor Beta (TGF-β) super-family. Though more than twenty members of this family have been identified so far in humans, Food and Drug Administration (FDA) approved two growth factors: BMP-2 and BMP-7 for treatments of spinal fusion and long-bone fractures with collagen carriers. Currently BMPs are clinically used in spinal fusion, oral and maxillofacial surgery and also in the repair of long bone defects. The efficiency of BMPs depends a lot on the selection of suitable carriers. At present, different types of carrier materials are used: natural and synthetic polymers, calcium phosphate and ceramic-polymer composite materials. Number of research articles has been published on the minute intricacies of the loading process and release kinetics of BMPs. Despite the significant evidence of its potential for bone healing demonstrated in animal models, future clinical investigations are needed to define dose, scaffold and route of administration. The efficacy and application of BMPs in various levels with a proper carrier and dose is yet to be established. The present article collates various aspects of success and limitation and identifies the prospects and challenges associated with the use of BMPs in orthopaedic surgery. Copyright © 2016 Elsevier B.V. All rights reserved.

Carbon nanotubes functionalized with fibroblast growth factor accelerate proliferation of bone marrow-derived stromal cells and bone formation

NASA Astrophysics Data System (ADS)

Hirata, Eri; Ménard-Moyon, Cécilia; Venturelli, Enrica; Takita, Hiroko; Watari, Fumio; Bianco, Alberto; Yokoyama, Atsuro

2013-11-01

Multi-walled carbon nanotubes (MWCNTs) were functionalized with fibroblast growth factor (FGF) and the advantages of their use as scaffolds for bone augmentation were evaluated in vitro and in vivo. The activity of FGF was assessed by measuring the effect on the proliferation of rat bone marrow stromal cells (RBMSCs). The presence of FGF enhanced the proliferation of RBMSCs and the FGF covalently conjugated to the nanotubes (FGF-CNT) showed the same effect as FGF alone. In addition, FGF-CNT coated sponges were implanted between the parietal bone and the periosteum of rats and the formation of new bone was investigated. At day 14 after implantation, a larger amount of newly formed bone was clearly observed in most pores of FGF-CNT coated sponges. These findings indicated that MWCNTs accelerated new bone formation in response to FGF, as well as the integration of particles into new bone during its formation. Scaffolds coated with FGF-CNT could be considered as promising novel substituting materials for bone regeneration in future tissue engineering applications.

Hydrogels That Allow and Facilitate Bone Repair, Remodeling, and Regeneration

PubMed Central

Short, Aaron R.; Koralla, Deepthi; Deshmukh, Ameya; Wissel, Benjamin; Stocker, Benjamin; Calhoun, Mark; Dean, David; Winter, Jessica O.

2015-01-01

Bone defects can originate from a variety of causes, including trauma, cancer, congenital deformity, and surgical reconstruction. Success of the current “gold standard” treatment (i.e., autologous bone grafts) is greatly influenced by insufficient or inappropriate bone stock. There is thus a critical need for the development of new, engineered materials for bone repair. This review describes the use of natural and synthetic hydrogels as scaffolds for bone tissue engineering. We discuss many of the advantages that hydrogels offer as bone repair materials, including their potential for osteoconductivity, biodegradability, controlled growth factor release, and cell encapsulation. We also discuss the use of hydrogels in composite devices with metals, ceramics, or polymers. These composites are useful because of the low mechanical moduli of hydrogels. Finally, the potential for thermosetting and photo-cross-linked hydrogels as three-dimensionally (3D) printed, patient-specific devices is highlighted. Three-dimensional printing enables controlled spatial distribution of scaffold materials, cells, and growth factors. Hydrogels, especially natural hydrogels present in bone matrix, have great potential to augment existing bone tissue engineering devices for the treatment of critical size bone defects. PMID:26693013

Bone regenerative medicine: classic options, novel strategies, and future directions

PubMed Central

2014-01-01

This review analyzes the literature of bone grafts and introduces tissue engineering as a strategy in this field of orthopedic surgery. We evaluated articles concerning bone grafts; analyzed characteristics, advantages, and limitations of the grafts; and provided explanations about bone-tissue engineering technologies. Many bone grafting materials are available to enhance bone healing and regeneration, from bone autografts to graft substitutes; they can be used alone or in combination. Autografts are the gold standard for this purpose, since they provide osteogenic cells, osteoinductive growth factors, and an osteoconductive scaffold, all essential for new bone growth. Autografts carry the limitations of morbidity at the harvesting site and limited availability. Allografts and xenografts carry the risk of disease transmission and rejection. Tissue engineering is a new and developing option that had been introduced to reduce limitations of bone grafts and improve the healing processes of the bone fractures and defects. The combined use of scaffolds, healing promoting factors, together with gene therapy, and, more recently, three-dimensional printing of tissue-engineered constructs may open new insights in the near future. PMID:24628910

Hydrogels That Allow and Facilitate Bone Repair, Remodeling, and Regeneration.

PubMed

Short, Aaron R; Koralla, Deepthi; Deshmukh, Ameya; Wissel, Benjamin; Stocker, Benjamin; Calhoun, Mark; Dean, David; Winter, Jessica O

2015-10-28

Bone defects can originate from a variety of causes, including trauma, cancer, congenital deformity, and surgical reconstruction. Success of the current "gold standard" treatment (i.e., autologous bone grafts) is greatly influenced by insufficient or inappropriate bone stock. There is thus a critical need for the development of new, engineered materials for bone repair. This review describes the use of natural and synthetic hydrogels as scaffolds for bone tissue engineering. We discuss many of the advantages that hydrogels offer as bone repair materials, including their potential for osteoconductivity, biodegradability, controlled growth factor release, and cell encapsulation. We also discuss the use of hydrogels in composite devices with metals, ceramics, or polymers. These composites are useful because of the low mechanical moduli of hydrogels. Finally, the potential for thermosetting and photo-cross-linked hydrogels as three-dimensionally (3D) printed, patient-specific devices is highlighted. Three-dimensional printing enables controlled spatial distribution of scaffold materials, cells, and growth factors. Hydrogels, especially natural hydrogels present in bone matrix, have great potential to augment existing bone tissue engineering devices for the treatment of critical size bone defects.

Bioactive factors for tissue regeneration: state of the art.

PubMed

Ohba, Shinsuke; Hojo, Hironori; Chung, Ung-Il

2012-07-01

THERE ARE THREE COMPONENTS FOR THE CREATION OF NEW TISSUES: cell sources, scaffolds, and bioactive factors. Unlike conventional medical strategies, regenerative medicine requires not only analytical approaches but also integrative ones. Basic research has identified a number of bioactive factors that are necessary, but not sufficient, for organogenesis. In skeletal development, these factors include bone morphogenetic proteins (BMPs), transforming growth factor β TGF-β, Wnts, hedgehogs (Hh), fibroblast growth factors (FGFs), insulin-like growth factors (IGFs), SRY box-containing gene (Sox) 9, Sp7, and runt-related transcription factors (Runx). Clinical and preclinical studies have been extensively performed to apply the knowledge to bone and cartilage regeneration. Given the large number of findings obtained so far, it would be a good time for a multi-disciplinary, collaborative effort to optimize these known factors and develop appropriate drug delivery systems for delivering them.

ADA-deficient SCID is associated with a specific microenvironment and bone phenotype characterized by RANKL/OPG imbalance and osteoblast insufficiency.

PubMed

Sauer, Aisha V; Mrak, Emanuela; Hernandez, Raisa Jofra; Zacchi, Elena; Cavani, Francesco; Casiraghi, Miriam; Grunebaum, Eyal; Roifman, Chaim M; Cervi, Maria C; Ambrosi, Alessandro; Carlucci, Filippo; Roncarolo, Maria Grazia; Villa, Anna; Rubinacci, Alessandro; Aiuti, Alessandro

2009-10-08

Adenosine deaminase (ADA) deficiency is a disorder of the purine metabolism leading to combined immunodeficiency and systemic alterations, including skeletal abnormalities. We report that ADA deficiency in mice causes a specific bone phenotype characterized by alterations of structural properties and impaired mechanical competence. These alterations are the combined result of an imbalanced receptor activator of nuclear factor-kappaB ligand (RANKL)/osteoprotegerin axis, causing decreased osteoclastogenesis and an intrinsic defect of osteoblast function with subsequent low bone formation. In vitro, osteoblasts lacking ADA displayed an altered transcriptional profile and growth reduction. Furthermore, the bone marrow microenvironment of ADA-deficient mice showed a reduced capacity to support in vitro and in vivo hematopoiesis. Treatment of ADA-deficient neonatal mice with enzyme replacement therapy, bone marrow transplantation, or gene therapy resulted in full recovery of the altered bone parameters. Remarkably, untreated ADA-severe combined immunodeficiency patients showed a similar imbalance in RANKL/osteoprotegerin levels alongside severe growth retardation. Gene therapy with ADA-transduced hematopoietic stem cells increased serum RANKL levels and children's growth. Our results indicate that the ADA metabolism represents a crucial modulatory factor of bone cell activities and remodeling.

Effects of Platelet-Poor Plasma, Platelet-Rich Plasma, and Platelet-Rich Fibrin on Healing of Extraction Sockets with Buccal Dehiscence in Dogs

PubMed Central

Hatakeyama, Ichiro; Takahashi, Yukinobu; Omura, Ken

2014-01-01

Alveolar bone resorption generally occurs during healing after tooth extraction. This study aimed to evaluate the effects of platelet-poor plasma (PPP), platelet-rich plasma (PRP), and platelet-rich fibrin (PRF) on healing in a ridge-augmentation model of the canine socket with dehiscence of the buccal wall. The third mandibular premolars of 12 beagle dogs were extracted and a 3 mm buccal dehiscence from the alveolar crest to the buccal wall of the extraction socket was created. These sockets were then divided into four groups on the basis of the material used to fill the sockets: PPP, PRP, PRF, and control (no graft material) groups. Results were evaluated at 4 and 8 weeks after surgery. The ultrastructural morphology and constructs of each blood product were studied by a scanning electron microscope (SEM) or calculating concentrations of platelets, fibrinogen, platelet-derived growth factor, and transforming growth factor-β. A total of five microcomputed tomography images of specimens were selected for measurement, and the area occupied by the newly formed bone as well as the horizontal bone width were measured. Moreover, decalcified tissue specimens from each defect were analyzed histologically. The median area of new bone at 4 and 8 weeks and median horizontal bone width at 8 weeks were the highest in the PPP group. However, bone maturation in the PRF and the PRP groups was more progressed than that in the PPP and control groups. By SEM findings, the PRF group showed a more highly condensed fibrin fiber network that was regularly arranged when compared with the PPP and PRP groups. The growth factors released from platelets in PRP indicated higher concentrations than that in PRF. Under more severe conditions for bone formation, as in this experiment, the growth factors released from platelets had a negative effect on bone formation. This study showed that PPP is an effective material for the preservation of sockets with buccal dehiscence. PMID:24098948

Effects of platelet-poor plasma, platelet-rich plasma, and platelet-rich fibrin on healing of extraction sockets with buccal dehiscence in dogs.

PubMed

Hatakeyama, Ichiro; Marukawa, Eriko; Takahashi, Yukinobu; Omura, Ken

2014-02-01

Alveolar bone resorption generally occurs during healing after tooth extraction. This study aimed to evaluate the effects of platelet-poor plasma (PPP), platelet-rich plasma (PRP), and platelet-rich fibrin (PRF) on healing in a ridge-augmentation model of the canine socket with dehiscence of the buccal wall. The third mandibular premolars of 12 beagle dogs were extracted and a 3 mm buccal dehiscence from the alveolar crest to the buccal wall of the extraction socket was created. These sockets were then divided into four groups on the basis of the material used to fill the sockets: PPP, PRP, PRF, and control (no graft material) groups. Results were evaluated at 4 and 8 weeks after surgery. The ultrastructural morphology and constructs of each blood product were studied by a scanning electron microscope (SEM) or calculating concentrations of platelets, fibrinogen, platelet-derived growth factor, and transforming growth factor-β. A total of five microcomputed tomography images of specimens were selected for measurement, and the area occupied by the newly formed bone as well as the horizontal bone width were measured. Moreover, decalcified tissue specimens from each defect were analyzed histologically. The median area of new bone at 4 and 8 weeks and median horizontal bone width at 8 weeks were the highest in the PPP group. However, bone maturation in the PRF and the PRP groups was more progressed than that in the PPP and control groups. By SEM findings, the PRF group showed a more highly condensed fibrin fiber network that was regularly arranged when compared with the PPP and PRP groups. The growth factors released from platelets in PRP indicated higher concentrations than that in PRF. Under more severe conditions for bone formation, as in this experiment, the growth factors released from platelets had a negative effect on bone formation. This study showed that PPP is an effective material for the preservation of sockets with buccal dehiscence.

Recombinant human basic fibroblast growth factor (bFGF) stimulates periodontal regeneration in class II furcation defects created in beagle dogs.

PubMed

Murakami, S; Takayama, S; Kitamura, M; Shimabukuro, Y; Yanagi, K; Ikezawa, K; Saho, T; Nozaki, T; Okada, H

2003-02-01

Several growth factors (or cytokines) have been recently investigated for their use as potential therapeutics for periodontal tissue regeneration. The objective of this study was to evaluate periodontal tissue regeneration, including new bone and cementum formation, following topical application of recombinant basic fibroblast growth factor (bFGF, FGF-2) to furcation class II defects. Twelve furcation class II bone defects were surgically created in six beagle dogs, then recombinant bFGF (30 micro g/site) + gelatinous carrier was topically applied to the bony defects. Six weeks after application, periodontal regeneration was analyzed. In all sites where bFGF was applied, periodontal ligament formation with new cementum deposits and new bone formation was observed histomorphometrically, in amounts greater than in the control sites. Basic FGF-applied sites exhibited significant regeneration as represented by the new bone formation rate (NBR) (83.6 +/- 14.3%), new trabecular bone formation rate (NTBR) (44.1 +/- 9.5%), and new cementum formation rate (NCR) (97.0 +/- 7.5%). In contrast, in the carrier-only sites, the NBR, NTBR, and NCR were 35.4 +/- 8.9%, 16.6 +/- 6.2%, and 37.2 +/- 15.1%, respectively. Moreover, no instances of epithelial down growth, ankylosis, or root resorption were observed in the bFGF-applied sites examined. The present results indicate that topical application of bFGF can enhance considerable periodontal regeneration in artificially created furcation class II bone defects of beagle dogs.

Current concepts in periodontal bioengineering

PubMed Central

Taba, M.; Jin, Q.; Sugai, J.V.; Giannobile, W.V.

2008-01-01

Repair of tooth supporting alveolar bone defects caused by periodontal and peri-implant tissue destruction is a major goal of reconstructive therapy. Oral and craniofacial tissue engineering has been achieved with limited success by the utilization of a variety of approaches such as cell-occlusive barrier membranes, bone substitutes and autogenous block grafting techniques. Signaling molecules such as growth factors have been used to restore lost tooth support because of damage by periodontal disease or trauma. This paper will review emerging periodontal therapies in the areas of materials science, growth factor biology and cell/gene therapy. Several different polymer delivery systems that aid in the targeting of proteins, genes and cells to periodontal and peri-implant defects will be highlighted. Results from preclinical and clinical trials will be reviewed using the topical application of bone morphogenetic proteins (BMP-2 and BMP-7) and platelet-derived growth factor-BB (PDGF) for periodontal and peri-implant regeneration. The paper concludes with recent research on the use of ex vivo and in vivo gene delivery strategies via gene therapy vectors encoding growth promoting and inhibiting molecules (PDGF, BMP, noggin and others) to regenerate periodontal structures including bone, periodontal ligament and cementum. PMID:16238610

In vitro characterization of MG-63 osteoblast-like cells cultured on organic-inorganic lyophilized gelatin sponges for early bone healing.

PubMed

Rodriguez, Isaac A; Saxena, Gunjan; Hixon, Katherine R; Sell, Scott A; Bowlin, Gary L

2016-08-01

The development of three-dimensional porous scaffolds with enhanced osteogenic and angiogenic potential would be beneficial for inducing early-stage bone regeneration. Previous studies have demonstrated the advantages of mineralized and nonmineralized acellular 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) cross-linked gelatin sponges enhanced with preparations rich in growth factors, hydroxyapatite, and chitin whiskers. In this study, those same scaffolds were mineralized and dynamically seeded with MG-63 cells. Cell proliferation, protein/cytokine secretion, and compressive mechanical properties of scaffolds were evaluated. It was found that mineralization and the addition of growth factors increased cell proliferation compared to gelatin controls. Cells on all scaffolds responded in an appropriate bone regenerative fashion as shown through osteocalcin secretion and little to no secretion of bone resorbing markers. However, compressive mechanical properties of cellularized scaffolds were not significantly different from acellular scaffolds. The combined results of increased cellular attachment, infiltration, and bone regenerative protein/cytokine secretion on scaffolds support the need for the addition of a bone-like mineral surface. Cellularized scaffolds containing growth factors reported similar advantages and mechanical values in the range of native tissues present in the early stages of bone healing. These results suggest that the developed composite sponges exhibited cellular responses and mechanical properties appropriate for promoting early bone healing in various applications. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 2011-2019, 2016. © 2016 Wiley Periodicals, Inc.

Nell-1-Induced Bone Regeneration in Calvarial Defects

PubMed Central

Aghaloo, Tara; Cowan, Catherine M.; Chou, Yu-Fen; Zhang, Xinli; Lee, Haofu; Miao, Steve; Hong, Nichole; Kuroda, Shun’ichi; Wu, Benjamin; Ting, Kang; Soo, Chia

2006-01-01

Many craniofacial birth defects contain skeletal components requiring bone grafting. We previously identified the novel secreted osteogenic molecule NELL-1, first noted to be overexpressed during premature bone formation in calvarial sutures of craniosynostosis patients. Nell-1 overexpression significantly increases differentiation and mineralization selectively in osteoblasts, while newborn Nell-1 transgenic mice significantly increase premature bone formation in calvarial sutures. In the current study, cultured calvarial explants isolated from Nell-1 transgenic newborn mice (with mild sagittal synostosis) demonstrated continuous bone growth and overlapping sagittal sutures. Further investigation into gene expression cascades revealed that fibroblast growth factor-2 and transforming growth factor-β1 stimulated Nell-1 expression, whereas bone morphogenetic protein (BMP)-2 had no direct effect. Additionally, Nell-1-induced osteogenesis in MC3T3-E1 osteoblasts through reduction in the expression of early up-regulated osteogenic regulators (OSX and ALP) but induction of later markers (OPN and OCN). Grafting Nell-1 protein-coated PLGA scaffolds into rat calvarial defects revealed the osteogenic potential of Nell-1 to induce bone regeneration equivalent to BMP-2, whereas immunohistochemistry indicated that Nell-1 reduced osterix-producing cells and increased bone sialoprotein, osteocalcin, and BMP-7 expression. Insights into Nell-1-regulated osteogenesis coupled with its ability to stimulate bone regeneration revealed a potential therapeutic role and an alternative to the currently accepted techniques for bone regeneration. PMID:16936265

Bone Factors Regulating the Osteotropism of Metastatic Breast Cancer

DTIC Science & Technology

1998-10-01

growth factors and rapid angiogenesis occurs in the immediate vicinity of an active osteoclast. 4,5 Osteoblast-derived bone sialoprotein (BSP...Cells Antigenic Marker Cells Cultured Alone Cells Co-Cultured (2d) MCF-7 MC3T3 MCF-7 MC3T3 human cytokeratin-+ -1 bone sialoprotein (BSP...proteins. Osteonectin, osteopontin and bone sialoprotein have been studied in a series of human breast cancers. 3,15-3 0 Immunohistochemical evaluation

Musculoskeletal Complications and Bone Metastases in Breast Cancer Patients Undergoing Estrogen Deprivation Therapy

DTIC Science & Technology

2016-10-01

are that any treatment or environmental factor that leads to bone loss (e.g., glucocorticoids, GnRH inhibitors, radiation, fracture , osteoporosis...recurrence and mortality. Previous cell culture and clinical studies have demonstrated that peripheral adipose ( fat ) tissue promotes cancer growth, yet the...contribution of increased MAT on metastatic tumor growth in bone is currently unknown. MAT, which is a historically understudied fat depot, accounts

The skeletal structure of insulin-like growth factor I-deficient mice

NASA Technical Reports Server (NTRS)

Bikle, D.; Majumdar, S.; Laib, A.; Powell-Braxton, L.; Rosen, C.; Beamer, W.; Nauman, E.; Leary, C.; Halloran, B.

2001-01-01

The importance of insulin-like growth factor I (IGF-I) for growth is well established. However, the lack of IGF-I on the skeleton has not been examined thoroughly. Therefore, we analyzed the structural properties of bone from mice rendered IGF-I deficient by homologous recombination (knockout [k/o]) using histomorphometry, peripheral quantitative computerized tomography (pQCT), and microcomputerized tomography (muCT). The k/o mice were 24% the size of their wild-type littermates at the time of study (4 months). The k/o tibias were 28% and L1 vertebrae were 26% the size of wild-type bones. Bone formation rates (BFR) of k/o tibias were 27% that of the wild-type littermates. The k/o bones responded normally to growth hormone (GH; 1.7-fold increase) and supranormally to IGF-I (5.2-fold increase) with respect to BFR. Cortical thickness of the proximal tibia was reduced 17% in the k/o mouse. However, trabecular bone volume (bone volume/total volume [BV/TV]) was increased 23% (male mice) and 88% (female mice) in the k/o mice compared with wild-type controls as a result of increased connectivity, increased number, and decreased spacing of the trabeculae. These changes were either less or not found in L1. Thus, lack of IGF-I leads to the development of a bone structure, which, although smaller, appears more compact.

Myostatin is a direct regulator of osteoclast differentiation and its inhibition reduces inflammatory joint destruction in mice.

PubMed

Dankbar, Berno; Fennen, Michelle; Brunert, Daniela; Hayer, Silvia; Frank, Svetlana; Wehmeyer, Corinna; Beckmann, Denise; Paruzel, Peter; Bertrand, Jessica; Redlich, Kurt; Koers-Wunrau, Christina; Stratis, Athanasios; Korb-Pap, Adelheid; Pap, Thomas

2015-09-01

Myostatin (also known as growth and differentiation factor 8) is a secreted member of the transforming growth factor-β (TGF-β) family that is mainly expressed in skeletal muscle, which is also its primary target tissue. Deletion of the myostatin gene (Mstn) in mice leads to muscle hypertrophy, and animal studies support the concept that myostatin is a negative regulator of muscle growth and regeneration. However, myostatin deficiency also increases bone formation, mainly through loading-associated effects on bone. Here we report a previously unknown direct role for myostatin in osteoclastogenesis and in the progressive loss of articular bone in rheumatoid arthritis (RA). We demonstrate that myostatin is highly expressed in the synovial tissues of RA subjects and of human tumor necrosis factor (TNF)-α transgenic (hTNFtg) mice, a model for human RA. Myostatin strongly accelerates receptor activator of nuclear factor κB ligand (RANKL)-mediated osteoclast formation in vitro through transcription factor SMAD2-dependent regulation of nuclear factor of activated T-cells (NFATC1). Myostatin deficiency or antibody-mediated inhibition leads to an amelioration of arthritis severity in hTNFtg mice, chiefly reflected by less bone destruction. Consistent with these effects in hTNFtg mice, the lack of myostatin leads to increased grip strength and less bone erosion in the K/BxN serum-induced arthritis model in mice. The results strongly suggest that myostatin is a potent therapeutic target for interfering with osteoclast formation and joint destruction in RA.

Combined treatment with a transforming growth factor beta inhibitor (1D11) and bortezomib improves bone architecture in a mouse model of myeloma-induced bone disease

PubMed Central

Nyman, Jeffry S.; Merkel, Alyssa R.; Uppuganti, Sasidhar; Nayak, Bijaya; Rowland, Barbara; Makowski, Alexander J.; Oyajobi, Babatunde O.; Sterling, Julie A.

2016-01-01

Multiplemyeloma (MM) patients frequently develop tumor-induced bone destruction, yet no therapy completely eliminates the tumor or fully reverses bone loss. Transforming growth factor-β (TGF-β) activity often contributes to tumor-induced bone disease, and pre-clinical studies have indicated that TGF-β inhibition improves bone volume and reduces tumor growth in bone metastatic breast cancer. We hypothesized that inhibition of TGF-β signaling also reduces tumor growth, increases bone volume, and improves vertebral body strength in MM-bearing mice. We treated myeloma tumor-bearing (immunocompetent KaLwRij and immunocompromised Rag2 −/−) mice with a TGF-β inhibitory (1D11) or control (13C4) antibody, with or without the anti-myeloma drug bortezomib, for 4 weeks after inoculation of murine 5TGM1 MM cells. TGF-β inhibition increased trabecular bone volume, improved trabecular architecture, increased tissue mineral density of the trabeculae as assessed by ex vivo micro-computed tomography, and was associated with significantly greater vertebral body strength in biomechanical compression tests. Serum monoclonal paraprotein titers and spleen weights showed that 1D11 monotherapy did not reduce overall MM tumor burden. Combination therapy with 1D11 and bortezomib increased vertebral body strength, reduced tumor burden, and reduced cortical lesions in the femoral metaphysis, although it did not significantly improve cortical bone strength in three-point bending tests of the mid-shaft femur. Overall, our data provides rationale for evaluating inhibition of TGF-β signaling in combination with existing anti-myeloma agents as a potential therapeutic strategy to improve outcomes in patients with myeloma bone disease. PMID:27423464

Combined treatment with a transforming growth factor beta inhibitor (1D11) and bortezomib improves bone architecture in a mouse model of myeloma-induced bone disease.

PubMed

Nyman, Jeffry S; Merkel, Alyssa R; Uppuganti, Sasidhar; Nayak, Bijaya; Rowland, Barbara; Makowski, Alexander J; Oyajobi, Babatunde O; Sterling, Julie A

2016-10-01

Multiple myeloma (MM) patients frequently develop tumor-induced bone destruction, yet no therapy completely eliminates the tumor or fully reverses bone loss. Transforming growth factor-β (TGF-β) activity often contributes to tumor-induced bone disease, and pre-clinical studies have indicated that TGF-β inhibition improves bone volume and reduces tumor growth in bone metastatic breast cancer. We hypothesized that inhibition of TGF-β signaling also reduces tumor growth, increases bone volume, and improves vertebral body strength in MM-bearing mice. We treated myeloma tumor-bearing (immunocompetent KaLwRij and immunocompromised Rag2-/-) mice with a TGF-β inhibitory (1D11) or control (13C4) antibody, with or without the anti-myeloma drug bortezomib, for 4weeks after inoculation of murine 5TGM1 MM cells. TGF-β inhibition increased trabecular bone volume, improved trabecular architecture, increased tissue mineral density of the trabeculae as assessed by ex vivo micro-computed tomography, and was associated with significantly greater vertebral body strength in biomechanical compression tests. Serum monoclonal paraprotein titers and spleen weights showed that 1D11 monotherapy did not reduce overall MM tumor burden. Combination therapy with 1D11 and bortezomib increased vertebral body strength, reduced tumor burden, and reduced cortical lesions in the femoral metaphysis, although it did not significantly improve cortical bone strength in three-point bending tests of the mid-shaft femur. Overall, our data provides rationale for evaluating inhibition of TGF-β signaling in combination with existing anti-myeloma agents as a potential therapeutic strategy to improve outcomes in patients with myeloma bone disease. Published by Elsevier Inc.

Better Bones Buddies: An Osteoporosis Prevention Program

ERIC Educational Resources Information Center

Schrader, Susan L.; Blue, Rebecca; Horner, Arlene

2005-01-01

Although osteoporosis typically surfaces in later life, peak bone mass attained before age 20 is a key factor in its prevention. However, most American children's diets lack sufficient calcium during the critical growth periods of preadolescence and adolescence to achieve peak bone mass. "Better Bones (BB) Buddies" is an educational…

Hormonal and Local Regulation of Bone Formation.

ERIC Educational Resources Information Center

Canalis, Ernesto

1985-01-01

Reviews effects of hormones, systemic factors, and local regulators on bone formation. Identifies and explains the impact on bone growth of several hormones as well as the components of systemic and local systems. Concentrates on bone collagen and DNA synthesis. (Physicians may earn continuing education credit by completing an appended test). (ML)

Bone Marrow Regeneration Promoted by Biophysically Sorted Osteoprogenitors From Mesenchymal Stromal Cells

PubMed Central

Poon, Zhiyong; Lee, Wong Cheng; Guan, Guofeng; Nyan, Lin Myint; Lim, Chwee Teck; Han, Jongyoon

2015-01-01

Human tissue repair deficiencies can be supplemented through strategies to isolate, expand in vitro, and reimplant regenerative cells that supplant damaged cells or stimulate endogenous repair mechanisms. Bone marrow-derived mesenchymal stromal cells (MSCs), a subset of which is described as mesenchymal stem cells, are leading candidates for cell-mediated bone repair and wound healing, with hundreds of ongoing clinical trials worldwide. An outstanding key challenge for successful clinical translation of MSCs is the capacity to produce large quantities of cells in vitro with uniform and relevant therapeutic properties. By leveraging biophysical traits of MSC subpopulations and label-free microfluidic cell sorting, we hypothesized and experimentally verified that MSCs of large diameter within expanded MSC cultures were osteoprogenitors that exhibited significantly greater efficacy over other MSC subpopulations in bone marrow repair. Systemic administration of osteoprogenitor MSCs significantly improved survival rates (>80%) as compared with other MSC subpopulations (0%) for preclinical murine bone marrow injury models. Osteoprogenitor MSCs also exerted potent therapeutic effects as “cell factories” that secreted high levels of regenerative factors such as interleukin-6 (IL-6), interleukin-8 (IL-8), vascular endothelial growth factor A, bone morphogenetic protein 2, epidermal growth factor, fibroblast growth factor 1, and angiopoietin-1; this resulted in increased cell proliferation, vessel formation, and reduced apoptosis in bone marrow. This MSC subpopulation mediated rescue of damaged marrow tissue via restoration of the hematopoiesis-supporting stroma, as well as subsequent hematopoiesis. Together, the capabilities described herein for label-freeisolation of regenerative osteoprogenitor MSCs can markedly improve the efficacy of MSC-based therapies. PMID:25411477

[Progress of Masquelet technique to repair bone defect].

PubMed

Yin, Qudong; Sun, Zhenzhong; Gu, Sanjun

2013-10-01

To summarize the progress of Masquelet technique to repair bone defect. The recent literature concerning the application of Masquelet technique to repair bone defect was extensively reviewed and summarized. Masquelet technique involves a two-step procedure. First, bone cement is used to fill the bone defect after a thorough debridement, and an induced membrane structure surrounding the spacer formed; then the bone cement is removed after 6-8 weeks, and rich cancellous bone is implanted into the induced membrane. Massive cortical bone defect is repaired by new bone forming and consolidation. Experiments show that the induced membrane has vascular system and is also rich in vascular endothelial growth factor, transforming growth factor beta1, bone morphogenetic protein 2, and bone progenitor cells, so it has osteoinductive property; satisfactory results have been achieved in clinical application of almost all parts of defects, various types of bone defect and massive defect up to 25 cm long. Compared with other repair methods, Masquelet technique has the advantages of reliable effect, easy to operate, few complications, low requirements for recipient site, and wide application. Masquelet technique is an effective method to repair bone defect and is suitable for various types of bone defect, especially for bone defects caused by infection and tumor resection.

Delivery of small molecules for bone regenerative engineering: preclinical studies and potential clinical applications.

PubMed

Laurencin, Cato T; Ashe, Keshia M; Henry, Nicole; Kan, Ho Man; Lo, Kevin W-H

2014-06-01

Stimulation of bone regeneration using growth factors is a promising approach for musculoskeletal regenerative engineering. However, common limitations with protein growth factors, such as high manufacturing costs, protein instability, contamination issues, and unwanted immunogenic responses of the host reduce potential clinical applications. New strategies for bone regeneration that involve inexpensive and stable small molecules can obviate these problems and have a significant impact on the treatment of skeletal injury and diseases. Over the past decade, a large number of small molecules with the potential of regenerating skeletal tissue have been reported in the literature. Here, we review this literature, paying specific attention to the prospects for small molecule-based bone-regenerative engineering. We also review the preclinical study of small molecules associated with bone regeneration. Copyright © 2014 Elsevier Ltd. All rights reserved.

Achondroplasia: Development, Pathogenesis, and Therapy

PubMed Central

Ornitz, David M.; Legeai-Mallet, Laurence

2016-01-01

Autosomal dominant mutations in Fibroblast Growth Factor Receptor 3 (FGFR3) cause Achondroplasia (Ach), the most common form of dwarfism in humans, and related chondrodysplasia syndromes that include Hypochondroplasia (Hch), Severe Achondroplasia with Developmental Delay and Acanthosis Nigricans (SADDAN), and Thanatophoric dysplasia (TD). FGFR3 is expressed in chondrocytes and mature osteoblasts where it functions to regulate bone growth. Analysis of the mutations in FGFR3 revealed increased signaling through a combination of mechanisms that include stabilization of the receptor, enhanced dimerization, and enhanced tyrosine kinase activity. Paradoxically, increased FGFR3 signaling profoundly suppresses proliferation and maturation of growth plate chondrocytes resulting in decreased growth plate size, reduced trabecular bone volume, and resulting decreased bone elongation. In this review we discuss the molecular mechanisms that regulate growth plate chondrocytes, the pathogenesis of Ach, and therapeutic approaches that are being evaluated to improve endochondral bone growth in people with Ach and related conditions. PMID:27987249

Laser Sintered Porous Ti-6Al-4V Implants Stimulate Vertical Bone Growth.

PubMed

Cheng, Alice; Cohen, David J; Kahn, Adrian; Clohessy, Ryan M; Sahingur, Kaan; Newton, Joseph B; Hyzy, Sharon L; Boyan, Barbara D; Schwartz, Zvi

2017-08-01

The objective of this study was to examine the ability of 3D implants with trabecular-bone-inspired porosity and micro-/nano-rough surfaces to enhance vertical bone ingrowth. Porous Ti-6Al-4V constructs were fabricated via laser-sintering and processed to obtain micro-/nano-rough surfaces. Male and female human osteoblasts were seeded on constructs to analyze cell morphology and response. Implants were then placed on rat calvaria for 10 weeks to assess vertical bone ingrowth, mechanical stability and osseointegration. All osteoblasts showed higher levels of osteocalcin, osteoprotegerin, vascular endothelial growth factor and bone morphogenetic protein 2 on porous constructs compared to solid laser-sintered controls. Porous implants placed in vivo resulted in an average of 3.1 ± 0.6 mm 3 vertical bone growth and osseointegration within implant pores and had significantly higher pull-out strength values than solid implants. New bone formation and pull-out strength was not improved with the addition of demineralized bone matrix putty. Scanning electron images and histological results corroborated vertical bone growth. This study indicates that Ti-6Al-4V implants fabricated by additive manufacturing to have porosity based on trabecular bone and post-build processing to have micro-/nano-surface roughness can support vertical bone growth in vivo, and suggests that these implants may be used clinically to increase osseointegration in challenging patient cases.

Autologous blood preparations rich in platelets, fibrin and growth factors.

PubMed

Fioravanti, C; Frustaci, I; Armellin, E; Condò, R; Arcuri, C; Cerroni, L

2015-01-01

Bone regeneration is often needed prior to dental implant treatment due to the lack of adequate quantity and quality after infectious diseases. The greatest regenerative power was obtained with autologous tissue, primarily the bone alive, taken from the same site or adjacent sites, up to the use centrifugation of blood with the selection of the parts with the greatest potential regenerative. In fact, various techniques and technologies were chronologically successive to cope with an ever better preparation of these concentrates of blood. Our aim is to review these advances and discuss the ways in which platelet concentrates may provide such unexpected beneficial therapeutic effects. The research has been carried out in the MEDLINE and Cochrane Central Register of Controlled Trials database by choosing keywords as "platelet rich plasma", "platelet rich fibrin", "platelet growth factors", and "bone regeneration" and "dentistry". Autologous platelet rich plasma is a safe and low cost procedure to deliver growth factors for bone and soft tissue healing. The great heterogeneity of clinical outcomes can be explained by the different PRP products with qualitative and quantitative difference among substance.

Bone-Derived Growth Factors

PubMed Central

Capanna, R.; Campanacci, D.A.; De Biase, P.; Cuomo, P.; Lorenzoni, A.

2010-01-01

Bone regeneration is based on the synergy between osteconduction, osteoinduction and osteogenesis. In recent years, we have witnessed the birth and development of numerous osteoconductive substrates, created with the intention of replacing bone grafts, both autologous and homologous. Recently, attention has shifted to osteogenesis, in other words, to the study of mesenchymal cells and their differentiation into osteoblastic cell lines that can be cultured in vitro (as already seen with chondroblasts). Osteoinduction, too, has been shown to be equally important, ever since Urist’s 1967 study which drew attention to the demineralised bone matrix and its properties. The following twenty years led to the definition of bone morphogenetic protein (BMP) and finally to the marketing of the first ostegenic protein (OP-1) obtained by means of the gene recombination technique. The BMPs produced using this technique that, so far, have been shown to be most active are BMP-2 (Infuse) and BMP-7 (Osigraft). The BMPs are not the only molecules with osteoinductive capacity. Other molecules capable of influencing bone regeneration are: platelet-derived growth factors (PDGFs), the transforming growth factor-beta (TGF-β) family, insulin-like growth factor (IGF-I) and the acidic and basic fibroblast growth factors (FGFs). All these growth factors act in synergy with the BMPs, modulating their action and exerting an inductive and proliferative action on the cell lines responsible for regenerating the bone matrix. The literature has been literally invaded by studies, both experimental and preclinical, on these proteins (Termaat, 2005), and they have provided ample demonstration that the BMPs are effective in improving healing of fractures, pseudoarthrosis and spinal fusions. Important advantages of BMPs are the complete absence of risk of transmissible disease, given that they are produced using recombination technology; their purity, and thus absence of an immune response (although such a response could be linked to the carrier used to administer them); their efficacy, which derives from the use of a pre-established dose and not from the individual variability that is a specific feature of demineralized bone matrix homologous bone grafts. In addition to their use in fractures, pseudoarthrosis and spinal fusions, very recent studies are opening up new possibilities which may represent the future field of application of these proteins: Cook et al. (Cook, 2001, Barrack, 2003) have presented the first results obtained using OP-1 in prosthetic revisions carried out in the presence of bone defects; other authors have published a case report on osteonecrosis of the femoral head treated with grafts in association with OP-1; an Italian group is currently experimenting the use of OP-1 in distraction osteogenesis with the aim of speeding up the results that can be obtained using this already well-established technique. However, the most interesting results on the use of recombinant morphogenetic proteins are those obtained by Warnke et al. (2004), maxillo-facial surgeons who, by mixing synthetic spongious bone grafts, bone marrow concentrate and morphogenetic proteins, prepared a new, replacement mandible for implantation in a patient who had lost his own due to cancer, thereby creating new vacularised bone, tailored to that specific patient. The experimental applications of these new drugs are countless and, with regard to their therapeutic potential, the general feeling is that what we are seeing is only the tip of the iceberg. However, it is necessary to ensure that experiments in this field are always geared towards sustainable clinical applications and, to this end, they should be concentrated in a smaller number of centres and conducted in accordance with approved and recognised guidelines.

Gut microbiota induce IGF-1 and promote bone formation and growth.

PubMed

Yan, Jing; Herzog, Jeremy W; Tsang, Kelly; Brennan, Caitlin A; Bower, Maureen A; Garrett, Wendy S; Sartor, Balfour R; Aliprantis, Antonios O; Charles, Julia F

2016-11-22

Appreciation of the role of the gut microbiome in regulating vertebrate metabolism has exploded recently. However, the effects of gut microbiota on skeletal growth and homeostasis have only recently begun to be explored. Here, we report that colonization of sexually mature germ-free (GF) mice with conventional specific pathogen-free (SPF) gut microbiota increases both bone formation and resorption, with the net effect of colonization varying with the duration of colonization. Although colonization of adult mice acutely reduces bone mass, in long-term colonized mice, an increase in bone formation and growth plate activity predominates, resulting in equalization of bone mass and increased longitudinal and radial bone growth. Serum levels of insulin-like growth factor 1 (IGF-1), a hormone with known actions on skeletal growth, are substantially increased in response to microbial colonization, with significant increases in liver and adipose tissue IGF-1 production. Antibiotic treatment of conventional mice, in contrast, decreases serum IGF-1 and inhibits bone formation. Supplementation of antibiotic-treated mice with short-chain fatty acids (SCFAs), products of microbial metabolism, restores IGF-1 and bone mass to levels seen in nonantibiotic-treated mice. Thus, SCFA production may be one mechanism by which microbiota increase serum IGF-1. Our study demonstrates that gut microbiota provide a net anabolic stimulus to the skeleton, which is likely mediated by IGF-1. Manipulation of the microbiome or its metabolites may afford opportunities to optimize bone health and growth.

Gut microbiota induce IGF-1 and promote bone formation and growth

PubMed Central

Yan, Jing; Herzog, Jeremy W.; Tsang, Kelly; Brennan, Caitlin A.; Bower, Maureen A.; Garrett, Wendy S.; Sartor, Balfour R.; Charles, Julia F.

2016-01-01

Appreciation of the role of the gut microbiome in regulating vertebrate metabolism has exploded recently. However, the effects of gut microbiota on skeletal growth and homeostasis have only recently begun to be explored. Here, we report that colonization of sexually mature germ-free (GF) mice with conventional specific pathogen-free (SPF) gut microbiota increases both bone formation and resorption, with the net effect of colonization varying with the duration of colonization. Although colonization of adult mice acutely reduces bone mass, in long-term colonized mice, an increase in bone formation and growth plate activity predominates, resulting in equalization of bone mass and increased longitudinal and radial bone growth. Serum levels of insulin-like growth factor 1 (IGF-1), a hormone with known actions on skeletal growth, are substantially increased in response to microbial colonization, with significant increases in liver and adipose tissue IGF-1 production. Antibiotic treatment of conventional mice, in contrast, decreases serum IGF-1 and inhibits bone formation. Supplementation of antibiotic-treated mice with short-chain fatty acids (SCFAs), products of microbial metabolism, restores IGF-1 and bone mass to levels seen in nonantibiotic-treated mice. Thus, SCFA production may be one mechanism by which microbiota increase serum IGF-1. Our study demonstrates that gut microbiota provide a net anabolic stimulus to the skeleton, which is likely mediated by IGF-1. Manipulation of the microbiome or its metabolites may afford opportunities to optimize bone health and growth. PMID:27821775

Comparative Analysis of Cellular and Growth Factor Composition in Bone Marrow Aspirate Concentrate and Platelet-Rich Plasma.

PubMed

Sugaya, Hisashi; Yoshioka, Tomokazu; Kato, Toshiki; Taniguchi, Yu; Kumagai, Hiroshi; Hyodo, Kojiro; Ohneda, Osamu; Yamazaki, Masashi; Mishima, Hajime

2018-01-01

The purpose of this study was to quantify the stem cell and growth factor (GF) contents in the bone marrow aspirate concentrate (BMAC) and platelet-rich plasma (PRP) prepared from whole blood using a protocol established in our laboratory. We examined 10 patients with osteonecrosis of the femoral head who were treated by autologous BMAC transplantation at our hospital between January 2015 and June 2015. We quantified CD34+ and CD31-CD45-CD90+CD105+ cells in BMAC and PRP by flow cytometry. Additionally, we measured various GFs, that is, basic fibroblast growth factor (b-FGF), platelet-derived growth factor-BB (PDGF-BB), vascular endothelial growth factor (VEGF), transforming growth factor- β 1 (TGF- β 1), and bone morphogenetic protein-2 (BMP-2) in BMAC and PRP using enzyme-linked immunosorbent assays and statistical analyses. CD34+ and CD31-45-90+105+ cells accounted for approximately 1.9% and 0.03% of cells in BMAC and no cells in PRP. The concentration of b-FGF was higher in BMAC than in PRP ( P < 0.001), whereas no significant differences in the levels of PDGF-BB, VEGF, TGF- β 1, and BMP-2 were observed between the two types of sample. BMAC had an average of 1.9% CD34+ and 0.03% CD31-45-90+105+ cells and higher levels of b-FGF than those of PRP.

Controlled Release Strategies for Bone, Cartilage, and Osteochondral Engineering—Part I: Recapitulation of Native Tissue Healing and Variables for the Design of Delivery Systems

PubMed Central

Santo, Vítor E.; Mano, João F.; Reis, Rui L.

2013-01-01

The potential of growth factors to stimulate tissue healing through the enhancement of cell proliferation, migration, and differentiation is undeniable. However, critical parameters on the design of adequate carriers, such as uncontrolled spatiotemporal presence of bioactive factors, inadequate release profiles, and supraphysiological dosages of growth factors, have impaired the translation of these systems onto clinical practice. This review describes the healing cascades for bone, cartilage, and osteochondral interface, highlighting the role of specific growth factors for triggering the reactions leading to tissue regeneration. Critical criteria on the design of carriers for controlled release of bioactive factors are also reported, focusing on the need to provide a spatiotemporal control over the delivery and presentation of these molecules. PMID:23268651

Combined VEGF and LMP-1 delivery enhances osteoprogenitor cell differentiation and ectopic bone formation.

PubMed

Wang, Xiuli; Cui, Fuai; Madhu, Vedavathi; Dighe, Abhijit S; Balian, Gary; Cui, Quanjun

2011-02-01

A novel strategy to enhance bone repair is to combine angiogenic factors and osteogenic factors. We combined vascular endothelial growth factor (VEGF) and LIM mineralization protein-1 (LMP-1) by using an internal ribosome entry site to link the genes within a single plasmid. We then evaluated the effects on osteoblastic differentiation in vitro and ectopic bone formation in vivo with a subcutaneously placed PLAGA scaffold loaded with a cloned mouse osteoprogenitor cell line, D1, transfected with plasmids containing VEGF and LMP-1 genes. The cells expressing both genes elevated mRNA expression of RunX2 and β-catenin and alkaline phosphatase activity compared to cells from other groups. In vivo, X-ray and micro-CT analysis of the retrieved implants revealed more ectopic bone formation at 2 and 3 weeks but not at 4 weeks compared to other groups. The results indicate that the combination of the therapeutic growth factors potentiates cell differentiation and may promote osteogenesis.

Early development and osteoporosis and bone health.

PubMed

Dennison, E M; Cooper, C; Cole, Z A

2010-06-01

Osteoporosis is a skeletal disorder characterized by low bone mass and micro-architectural deterioration of bone tissue with a consequent increase in bone fragility and susceptibility to fracture. Evidence is now accumulating from human studies that programming of bone growth might be an important contributor to the later risk of osteoporotic fracture. Body weight in infancy is a determinant of adult bone mineral content, as well as of the basal levels of activity of the growth hormone/insulin-like growth factor-1 (GH/IGF-1) and hypothalamo-pituitary-adrenal (HPA) axes, and recent work has suggested a central role for vitamin D. Epidemiological studies have shown that maternal smoking and nutrition during pregnancy influence intrauterine skeletal mineralization. Childhood growth rates have been directly linked to the risk of hip fracture many decades later, and now evidence is emerging from experimental animal studies that support these observational data. Recent studies have also highlighted epigenetic phenomena as potential mechanisms underlying the findings from epidemiological studies.

Bone matrix to growth factors: location, location, location

PubMed Central

Todorovic, Vesna

2010-01-01

The demonstration that fibrillin-1 mutations perturb transforming growth factor (TGF)–β bioavailability/signaling in Marfan syndrome (MFS) changed the view of the extracellular matrix as a passive structural support to a dynamic modulator of cell behavior. In this issue, Nistala et al. (2010. J. Cell Biol. doi: 10.1083/jcb.201003089) advance this concept by demonstrating how fibrillin-1 and -2 regulate TGF-β and bone morphogenetic protein (BMP) action during osteoblast maturation. PMID:20855500

Platelet-rich plasma, plasma rich in growth factors and simvastatin in the regeneration and repair of alveolar bone.

PubMed

Rivera, César; Monsalve, Francisco; Salas, Juan; Morán, Andrea; Suazo, Iván

2013-12-01

Platelet preparations promote bone regeneration by inducing cell migration, proliferation and differentiation in the area of the injury, which are essential processes for regeneration. In addition, several studies have indicated that simvastatin (SIMV), widely used for the treatment of hypercholesterolemia, stimulates osteogenesis. The objective of this study was to evaluate the effects of treatment with either platelet-rich plasma (PRP) or plasma rich in growth factors (PRGF) in combination with SIMV in the regeneration and repair of alveolar bone. The jaws of Sprague Dawley rats (n=18) were subjected to rotary instrument-induced bone damage (BD). Animals were divided into six groups: BD/H 2 O (n=3), distilled water without the drug and alveolar bone damage; BD/H 2 O/PRP (n=3), BD and PRP; BD/H 2 O/PRGF (n=3), BD and PRGF; BD/SIMV (n=3), BD and water with SIMV; BD/SIMV/PRP (n=3), BD, PRP and SIMV; and BD/SIMV/PRGF (n=3), BD, PRGF and SIMV. Conventional histological analysis (hematoxylin and eosin staining) revealed that the BD/SIMV group showed indicators for mature bone tissue, while the BD/SIMV/PRP and BD/SIMV/PRGF groups showed the coexistence of indicators for mature and immature bone tissue, with no statistical differences between the platelet preparations. Simvastatin did not improve the effect of platelet-rich plasma and plasma rich in growth factors. It was not possible to determine which platelet preparation produced superior effects.

Platelet-rich plasma, plasma rich in growth factors and simvastatin in the regeneration and repair of alveolar bone

PubMed Central

RIVERA, CÉSAR; MONSALVE, FRANCISCO; SALAS, JUAN; MORÁN, ANDREA; SUAZO, IVÁN

2013-01-01

Platelet preparations promote bone regeneration by inducing cell migration, proliferation and differentiation in the area of the injury, which are essential processes for regeneration. In addition, several studies have indicated that simvastatin (SIMV), widely used for the treatment of hypercholesterolemia, stimulates osteogenesis. The objective of this study was to evaluate the effects of treatment with either platelet-rich plasma (PRP) or plasma rich in growth factors (PRGF) in combination with SIMV in the regeneration and repair of alveolar bone. The jaws of Sprague Dawley rats (n=18) were subjected to rotary instrument-induced bone damage (BD). Animals were divided into six groups: BD/H2O (n=3), distilled water without the drug and alveolar bone damage; BD/H2O/PRP (n=3), BD and PRP; BD/H2O/PRGF (n=3), BD and PRGF; BD/SIMV (n=3), BD and water with SIMV; BD/SIMV/PRP (n=3), BD, PRP and SIMV; and BD/SIMV/PRGF (n=3), BD, PRGF and SIMV. Conventional histological analysis (hematoxylin and eosin staining) revealed that the BD/SIMV group showed indicators for mature bone tissue, while the BD/SIMV/PRP and BD/SIMV/PRGF groups showed the coexistence of indicators for mature and immature bone tissue, with no statistical differences between the platelet preparations. Simvastatin did not improve the effect of platelet-rich plasma and plasma rich in growth factors. It was not possible to determine which platelet preparation produced superior effects. PMID:24250728

Orthopedic surgery and bone fracture pain are both significantly attenuated by sustained blockade of nerve growth factor

PubMed Central

Majuta, Lisa A.; Longo, Geraldine; Fealk, Michelle N.; McCaffrey, Gwen; Mantyh, Patrick W.

2015-01-01

The number of patients suffering from postoperative pain due to orthopedic surgery and bone fracture is projected to dramatically increase because the human life span, weight, and involvement in high-activity sports continue to rise worldwide. Joint replacement or bone fracture frequently results in skeletal pain that needs to be adequately controlled for the patient to fully participate in needed physical rehabilitation. Currently, the 2 major therapies used to control skeletal pain are nonsteroidal anti-inflammatory drugs and opiates, both of which have significant unwanted side effects. To assess the efficacy of novel therapies, mouse models of orthopedic and fracture pain were developed and evaluated here. These models, orthopedic surgery pain and bone fracture pain, resulted in skeletal pain–related behaviors that lasted 3 weeks and 8 to 10 weeks, respectively. These skeletal pain behaviors included spontaneous and palpation-induced nocifensive behaviors, dynamic weight bearing, limb use, and voluntary mechanical loading of the injured hind limb. Administration of anti–nerve growth factor before orthopedic surgery or after bone fracture attenuated skeletal pain behaviors by 40% to 70% depending on the end point being assessed. These data suggest that nerve growth factor is involved in driving pain due to orthopedic surgery or bone fracture. These animal models may be useful in developing an understanding of the mechanisms that drive postoperative orthopedic and bone fracture pain and the development of novel therapies to treat these skeletal pains. PMID:25599311

The relationship between alkaline phosphatase and bone alkaline phosphatase activity and the growth hormone/insulin-like growth factor-1 axis and vitamin D status in children with growth hormone deficiency.

PubMed

Witkowska-Sędek, Ewelina; Stelmaszczyk-Emmel, Anna; Majcher, Anna; Demkow, Urszula; Pyrżak, Beata

2018-04-13

The relationships between bone turnover, the growth hormone/insulin-like growth factor-1 (GH/IGF-1) axis and vitamin D are complex, but still not fully explained. The GH/IGF-1 axis and vitamin D can mutually modulate each other's metabolism and influence the activation of cell proliferation, maturation, and mineralization as well as bone resorption. The aim of this study was to evaluate the reciprocal associations between bone formation markers [alkaline phosphatase (ALP), bone alkaline phosphatase (BALP)], the GH/IGF-1 axis and 25-hydroxyvitamin D [25(OH)D] in children with growth hormone deficiency at baseline and during recombinant human growth hormone (rhGH) therapy. ALP, BALP, 25(OH)D and IGF-1 levels were evaluated in 53 patients included in this prospective three-year study. ALP, BALP and IGF-1 increased during rhGH therapy. Baseline ALP activity correlated positively with baseline height velocity (HV). ALP and BALP activity at 12 months correlated positively with HV in the first year of therapy. We found positive correlations between ALP and IGF-1 at baseline and during the first year of therapy, between BALP activity at 12 months and rhGH dose in the first year of therapy, and between doses of cholecalciferol in the first year of rhGH therapy and early changes in BALP activity during rhGH therapy. Our results indicate that vitamin D supplementation enhances the effect of rhGH on bone formation process, which could improve the effects of rhGH therapy. ALP and BALP activity are useful in the early prediction of the effects of rhGH therapy, but their utility as long-term predictors seemed insufficient.

Histomorphometric Parameters of the Growth Plate and Trabecular Bone in Wild-Type and Trefoil Factor Family 3 (Tff3)-Deficient Mice Analyzed by Free and Open-Source Image Processing Software.

PubMed

Bijelić, Nikola; Belovari, Tatjana; Stolnik, Dunja; Lovrić, Ivana; Baus Lončar, Mirela

2017-08-01

Trefoil factor family 3 (Tff3) peptide is present during intrauterine endochondral ossification in mice, and its deficiency affects cancellous bone quality in secondary ossification centers of mouse tibiae. The aim of this study was to quantitatively analyze parameters describing the growth plate and primary ossification centers in tibiae of 1-month-old wild-type and Tff3 knock-out mice (n=5 per genotype) by using free and open-source software. Digital photographs of the growth plates and trabecular bone were processed by open-source computer programs GIMP and FIJI. Histomorphometric parameters were calculated using measurements made with FIJI. Tff3 knock-out mice had significantly smaller trabecular number and significantly larger trabecular separation. Trabecular bone volume, trabecular bone surface, and trabecular thickness showed no significant difference between the two groups. Although such histomorphological differences were found in the cancellous bone structure, no significant differences were found in the epiphyseal plate histomorphology. Tff3 peptide probably has an effect on the formation and quality of the cancellous bone in the primary ossification centers, but not through disrupting the epiphyseal plate morphology. This work emphasizes the benefits of using free and open-source programs for morphological studies in life sciences.

An interaction between hepatocyte growth factor and its receptor (c-MET) prolongs the survival of chronic lymphocytic leukemic cells through STAT3 phosphorylation: a potential role of mesenchymal cells in the disease.

PubMed

Giannoni, Paolo; Scaglione, Silvia; Quarto, Rodolfo; Narcisi, Roberto; Parodi, Manuela; Balleari, Enrico; Barbieri, Federica; Pattarozzi, Alessandra; Florio, Tullio; Ferrini, Silvano; Corte, Giorgio; de Totero, Daniela

2011-07-01

Chronic lymphocytic leukemia cells are characterized by an apparent longevity in vivo which is lost when they are cultured in vitro. Cellular interactions and factors provided by the microenvironment appear essential to cell survival and may protect leukemic cells from the cytotoxicity of conventional therapies. Understanding the cross-talk between leukemic cells and stroma is of interest for identifying signals supporting disease progression and for developing novel therapeutic strategies. Different cell types, sharing a common mesenchymal origin and representative of various bone marrow components, were used to challenge the viability of leukemic cells in co-cultures and in contact-free culture systems. Using a bioinformatic approach we searched for genes shared by lineages prolonging leukemic cell survival and further analyzed their biological role in signal transduction experiments. Human bone marrow stromal cells, fibroblasts, trabecular bone-derived cells and an osteoblast-like cell line strongly enhanced survival of leukemic cells, while endothelial cells and chondrocytes did not. Gene expression profile analysis indicated two soluble factors, hepatocyte growth factor and CXCL12, as potentially involved. We demonstrated that hepatocyte growth factor and CXCL12 are produced only by mesenchymal lineages that sustain the survival of leukemic cells. Indeed chronic lymphocytic leukemic cells express a functional hepatocyte growth factor receptor (c-MET) and hepatocyte growth factor enhanced the viability of these cells through STAT3 phosphorylation, which was blocked by a c-MET tyrosine kinase inhibitor. The role of hepatocyte growth factor was confirmed by its short interfering RNA-mediated knock-down in mesenchymal cells. The finding that hepatocyte growth factor prolongs the survival of chronic lymphocytic leukemic cells is novel and we suggest that the interaction between hepatocyte growth factor-producing mesenchymal and neoplastic cells contributes to maintenance of the leukemic clone.

An interaction between hepatocyte growth factor and its receptor (c-MET) prolongs the survival of chronic lymphocytic leukemic cells through STAT3 phosphorylation: a potential role of mesenchymal cells in the disease

PubMed Central

Giannoni, Paolo; Scaglione, Silvia; Quarto, Rodolfo; Narcisi, Roberto; Parodi, Manuela; Balleari, Enrico; Barbieri, Federica; Pattarozzi, Alessandra; Florio, Tullio; Ferrini, Silvano; Corte, Giorgio; de Totero, Daniela

2011-01-01

Background Chronic lymphocytic leukemia cells are characterized by an apparent longevity in vivo which is lost when they are cultured in vitro. Cellular interactions and factors provided by the microenvironment appear essential to cell survival and may protect leukemic cells from the cytotoxicity of conventional therapies. Understanding the cross-talk between leukemic cells and stroma is of interest for identifying signals supporting disease progression and for developing novel therapeutic strategies. Design and Methods Different cell types, sharing a common mesenchymal origin and representative of various bone marrow components, were used to challenge the viability of leukemic cells in co-cultures and in contact-free culture systems. Using a bioinformatic approach we searched for genes shared by lineages prolonging leukemic cell survival and further analyzed their biological role in signal transduction experiments. Results Human bone marrow stromal cells, fibroblasts, trabecular bone-derived cells and an osteoblast-like cell line strongly enhanced survival of leukemic cells, while endothelial cells and chondrocytes did not. Gene expression profile analysis indicated two soluble factors, hepatocyte growth factor and CXCL12, as potentially involved. We demonstrated that hepatocyte growth factor and CXCL12 are produced only by mesenchymal lineages that sustain the survival of leukemic cells. Indeed chronic lymphocytic leukemic cells express a functional hepatocyte growth factor receptor (c-MET) and hepatocyte growth factor enhanced the viability of these cells through STAT3 phosphorylation, which was blocked by a c-MET tyrosine kinase inhibitor. The role of hepatocyte growth factor was confirmed by its short interfering RNA-mediated knock-down in mesenchymal cells. Conclusions The finding that hepatocyte growth factor prolongs the survival of chronic lymphocytic leukemic cells is novel and we suggest that the interaction between hepatocyte growth factor-producing mesenchymal and neoplastic cells contributes to maintenance of the leukemic clone. PMID:21486864

Widespread differential maternal and paternal genome effects on fetal bone phenotype at mid-gestation.

PubMed

Xiang, Ruidong; Lee, Alice M C; Eindorf, Tanja; Javadmanesh, Ali; Ghanipoor-Samami, Mani; Gugger, Madeleine; Fitzsimmons, Carolyn J; Kruk, Zbigniew A; Pitchford, Wayne S; Leviton, Alison J; Thomsen, Dana A; Beckman, Ian; Anderson, Gail I; Burns, Brian M; Rutley, David L; Xian, Cory J; Hiendleder, Stefan

2014-11-01

Parent-of-origin-dependent (epi)genetic factors are important determinants of prenatal development that program adult phenotype. However, data on magnitude and specificity of maternal and paternal genome effects on fetal bone are lacking. We used an outbred bovine model to dissect and quantify effects of parental genomes, fetal sex, and nongenetic maternal effects on the fetal skeleton and analyzed phenotypic and molecular relationships between fetal muscle and bone. Analysis of 51 bone morphometric and weight parameters from 72 fetuses recovered at day 153 gestation (54% term) identified six principal components (PC1-6) that explained 80% of the variation in skeletal parameters. Parental genomes accounted for most of the variation in bone wet weight (PC1, 72.1%), limb ossification (PC2, 99.8%), flat bone size (PC4, 99.7%), and axial skeletal growth (PC5, 96.9%). Limb length showed lesser effects of parental genomes (PC3, 40.8%) and a significant nongenetic maternal effect (gestational weight gain, 29%). Fetal sex affected bone wet weight (PC1, p < 0.0001) and limb length (PC3, p < 0.05). Partitioning of variation explained by parental genomes revealed strong maternal genome effects on bone wet weight (74.1%, p < 0.0001) and axial skeletal growth (93.5%, p < 0.001), whereas paternal genome controlled limb ossification (95.1%, p < 0.0001). Histomorphometric data revealed strong maternal genome effects on growth plate height (98.6%, p < 0.0001) and trabecular thickness (85.5%, p < 0.0001) in distal femur. Parental genome effects on fetal bone were mirrored by maternal genome effects on fetal serum 25-hydroxyvitamin D (96.9%, p < 0.001) and paternal genome effects on alkaline phosphatase (90.0%, p < 0.001) and their correlations with maternally controlled bone wet weight and paternally controlled limb ossification, respectively. Bone wet weight and flat bone size correlated positively with muscle weight (r = 0.84 and 0.77, p < 0.0001) and negatively with muscle H19 expression (r = -0.34 and -0.31, p < 0.01). Because imprinted maternally expressed H19 regulates growth factors by miRNA interference, this suggests muscle-bone interaction via epigenetic factors. © 2014 American Society for Bone and Mineral Research.

Development of controlled drug delivery systems for bone fracture-targeted therapeutic delivery: A review.

PubMed

Wang, Yuchen; Newman, Maureen R; Benoit, Danielle S W

2018-06-01

Impaired fracture healing is a major clinical problem that can lead to patient disability, prolonged hospitalization, and significant financial burden. Although the majority of fractures heal using standard clinical practices, approximately 10% suffer from delayed unions or non-unions. A wide range of factors contribute to the risk for nonunions including internal factors, such as patient age, gender, and comorbidities, and external factors, such as the location and extent of injury. Current clinical approaches to treat nonunions include bone grafts and low-intensity pulsed ultrasound (LIPUS), which realizes clinical success only to select patients due to limitations including donor morbidities (grafts) and necessity of fracture reduction (LIPUS), respectively. To date, therapeutic approaches for bone regeneration rely heavily on protein-based growth factors such as INFUSE, an FDA-approved scaffold for delivery of bone morphogenetic protein 2 (BMP-2). Small molecule modulators and RNAi therapeutics are under development to circumvent challenges associated with traditional growth factors. While preclinical studies has shown promise, drug delivery has become a major hurdle stalling clinical translation. Therefore, this review overviews current therapies employed to stimulate fracture healing pre-clinically and clinically, including a focus on drug delivery systems for growth factors, parathyroid hormone (PTH), small molecules, and RNAi therapeutics, as well as recent advances and future promise of fracture-targeted drug delivery. Copyright © 2018 Elsevier B.V. All rights reserved.

Enhanced Tendon-to-Bone Healing of Chronic Rotator Cuff Tears by Bone Marrow Aspirate Concentrate in a Rabbit Model

PubMed Central

Liu, Xiao Ning; Yang, Cheol-Jung; Kim, Ji Eui; Du, Zhen Wu; Ren, Ming; Zhang, Wei; Zhao, Hong Yu; Kim, Kyung Ok

2018-01-01

Background To evaluate the influence of bone marrow aspirate concentrate (BMAC) on tendon-to-bone healing in a rabbit rotator cuff model and to characterize the composition of growth factors in BMAC. Methods In this in vivo study, 40 rabbits were allocated into five groups: control (C), repair + saline (RS), repair + platelet-rich plasma (PRP; RP), repair + BMAC (RB) and repair + PRP + BMAC (RPB). A tear model was created by supraspinatus tendon transection at the footprint. Six weeks after transection, the torn tendon was repaired along with BMAC or PRP administration. Six weeks after repair, shoulder samples were harvested for biomechanical and histological testing. Ten rabbits were used for processing PRP and BMAC, followed by analysis of blood cell composition and the levels of growth factors in vitro. Results The ultimate load-to-failure was significantly higher in RPB group compared to RS group (p = 0.025). BMAC-treated groups showed higher values of biomechanical properties than RS group. The histology of BMAC-treated samples showed better collagen fiber continuity and orientation than RS group. BMAC contained significantly higher levels of the several growth factors than PRP. Conclusions Locally administered BMAC enhanced tendon-to-bone healing and has potential for clinical applications. PMID:29564054

Improved Protocol for Chondrogenic Differentiation of Bone Marrow Derived Mesenchymal Stem Cells -Effect of PTHrP and FGF-2 on TGFβ1/BMP2-Induced Chondrocytes Hypertrophy.

PubMed

Nasrabadi, Davood; Rezaeiani, Siamak; Eslaminejad, Mohamadreza Baghaban; Shabani, Aliakbar

2018-04-24

Growth factors have a pivotal role in chondrogenic differentiation of stem cells. The differential effects of known growth factors involved in the maintenance and homeostasis of cartilage tissue have been previously studied in vitro. However, there are few reported researches about the interactional effects of growth factors on chondrogenic differentiation of stem cells. The aim of this study is to examine the combined effects of four key growth factors on chondrogenic differentiation of mesenchymal stem cells (MSCs). Isolated and expanded rabbit bone marrow-derived MSCs underwent chondrogenic differentiation in a micromass cell culture system that used a combination of the following growth factors: transforming growth factor beta 1 (TGF-β1), bone morphogenetic protein 2 (BMP2), parathyroid hormone related protein (PTHrP), and fibroblast growth factor 2 (FGF2) according to a defined program. The chondrogenic differentiation program was analyzed by histochemistry methods, quantitative RT-PCR (qRT-PCR), and measurement of matrix deposition of sulfated glycosaminoglycan (sGAG) and collagen content at days 16, 23, and 30. The results showed that the short-term combination of TGF-β1 and BMP-2 increased sGAG and collagen content, Alkaline phosphates (ALP) activity, and type X collagen (COL X) expression. Application of either PTHrP or FGF2 simultaneously decreased TGF-β1/BMP-2 induced hypertrophy and chondrogenic markers (at least for FGF2). However, successive application of PTHrP and FGF2 dramatically maintained the synergistic effects of TGF-β1/BMP-2 on the chondrogenic differentiation potential of MSCs and decreased unwanted hypertrophic markers. This new method can be used effectively in chondrogenic differentiation programs.

The Role of Peripheral Nerve Function in Age-Related Bone Loss and Changes in Bone Adaptation

DTIC Science & Technology

2015-12-01

scratch response in development of spontaneous dermatitis in NC/Nga mice. Br J Dermatol 2004;151:335-45. 32. Nakano T, Andoh T, Sasaki A, Nojima H, Kuraishi... contact a stripe of brain derived neurotrophic factor becomes the axon [16]. During neuron growth, mitochondria, membrane vesicles, proteins involved in...epiphyseal bone marrow [27]. The CGRP containing neurons in rat femurs near the growth plate come in contact with osteoclasts [21]. Neuropeptide

Triazolopyrimidine (trapidil), a platelet-derived growth factor antagonist, inhibits parathyroid bone disease in an animal model for chronic hyperparathyroidism

NASA Technical Reports Server (NTRS)

Lotinun, Sutada; Sibonga, Jean D.; Turner, Russell T.

2003-01-01

Parathyroid bone disease in humans is caused by chronic hyperparathyroidism (HPT). Continuous infusion of PTH into rats results in histological changes similar to parathyroid bone disease, including increased bone formation, focal bone resorption, and severe peritrabecular fibrosis, whereas pulsatile PTH increases bone formation without skeletal abnormalities. Using a cDNA microarray with over 5000 genes, we identified an association between increased platelet-derived growth factor-A (PDGF-A) signaling and PTH-induced bone disease in rats. Verification of PDGF-A overexpression was accomplished with a ribonuclease protection assay. Using immunohistochemistry, PDGF-A peptide was localized to mast cells in PTH-treated rats. We also report a novel strategy for prevention of parathyroid bone disease using triazolopyrimidine (trapidil). Trapidil, an inhibitor of PDGF signaling, did not have any effect on indexes of bone turnover in normal rats. However, dramatic reductions in marrow fibrosis and bone resorption, but not bone formation, were observed in PTH-treated rats given trapidil. Also, trapidil antagonized the PTH-induced increases in mRNA levels for PDGF-A. These results suggest that PDGF signaling is important for the detrimental skeletal effects of HPT, and drugs that target the cytokine or its receptor might be useful in reducing or preventing parathyroid bone disease.

Effect of GH/IGF-1 on Bone Metabolism and Osteoporsosis

PubMed Central

Locatelli, Vittorio; Bianchi, Vittorio E.

2014-01-01

Background. Growth hormone (GH) and insulin-like growth factor (IGF-1) are fundamental in skeletal growth during puberty and bone health throughout life. GH increases tissue formation by acting directly and indirectly on target cells; IGF-1 is a critical mediator of bone growth. Clinical studies reporting the use of GH and IGF-1 in osteoporosis and fracture healing are outlined. Methods. A Pubmed search revealed 39 clinical studies reporting the effects of GH and IGF-1 administration on bone metabolism in osteopenic and osteoporotic human subjects and on bone healing in operated patients with normal GH secretion. Eighteen clinical studies considered the effect with GH treatment, fourteen studies reported the clinical effects with IGF-1 administration, and seven related to the GH/IGF-1 effect on bone healing. Results. Both GH and IGF-1 administration significantly increased bone resorption and bone formation in the most studies. GH/IGF-1 administration in patients with hip or tibial fractures resulted in increased bone healing, rapid clinical improvements. Some conflicting results were evidenced. Conclusions. GH and IGF-1 therapy has a significant anabolic effect. GH administration for the treatment of osteoporosis and bone fractures may greatly improve clinical outcome. GH interacts with sex steroids in the anabolic process. GH resistance process is considered. PMID:25147565

Can physical activity improve peak bone mass?

PubMed

Specker, Bonny; Minett, Maggie

2013-09-01

The pediatric origin of osteoporosis has led many investigators to focus on determining factors that influence bone gain during growth and methods for optimizing this gain. Bone responds to bone loading activities by increasing mass or size. Overall, pediatric studies have found a positive effect of bone loading on bone size and accrual, but the types of loads necessary for a bone response have only recently been investigated in human studies. Findings indicate that responses vary by sex, maturational status, and are site-specific. Estrogen status, body composition, and nutritional status also may influence the bone response to loading. Despite the complex interrelationships among these various factors, it is prudent to conclude that increased physical activity throughout life is likely to optimize bone health.

Role of hepatocyte growth factor in the development of dendritic cells from CD34+ bone marrow cells.

PubMed

Ovali, E; Ratip, S; Kibaroglu, A; Tekelioglu, Y; Cetiner, M; Karti, S; Aydin, F; Bayik, M; Akoglu, T

2000-05-01

Hepatocyte growth factor (HGF) is known to augment the effects of stem cell factor, interleukin-3, granulocyte-macrophage colony-stimulating factor (GM-CSF), erythropoetin, and granulocyte colony-stimulating factor, all of which are involved in hematopoiesis. HGF is also known to have a role in immune responses. The aim of this study was to investigate whether HGF is involved in the development of dendritic cells (DC) from CD34+ bone marrow cells. CD34+ cells obtained from three healthy donors were incubated in various combinations of HGF, GM-CSF, and tumor necrosis factor (TNF) for 12 days. Developing cell populations were analyzed for surface markers, morphology and functional capacities by flow cytometry, light microscopy and mixed lymphocyte reaction, respectively. Incubation with HGF alone generated greater number of dendritic cells from CD34+ bone marrow cells than incubation with GM-CSF, or a combination of GM-CSF with TNF. HGF was also found to potentiate the effect of GM-CSF on DC and monocyte development. The effects of HGF were inhibited by the concurrent use of TNF. HGF appears to be a significant factor in the development of dendritic cells from CD34+ bone marrow cells.

Targeting Transforming Growth Factor Beta to Enhance the Fracture Resistance of Bone

DTIC Science & Technology

2013-01-01

Transforming Growth Factor Beta to Enhance the Fracture Resistance of Bone is to determine whether the suppression of TGF-β activity improves the fracture...effect primarily occurred in the old rats. Effect of TGF-β suppression on fracture resistance in female mice Since the suppression of TGF-β activity by...treated mice. This suggests that 1D11 treatment depleted the osteoprogenitor pool to some extent as inhibition of TGF-β activity in vivo may favor

Degradable Bone Graft Substitute for Effective Delivery of Multiple Growth Factors in the Treatment of Nonunion Fractures

DTIC Science & Technology

2012-08-01

growth factors directly to the bone defect site can enhance repair of non-union fractures. In this study, a new chitosan /xylan composite hydrogel was...delivery aspect of this study did not succeed, treatment with the new xylan/ chitosan hydrogel alone was enough to heal serious fractures that did not...characteristics of the hydrogel in question could be tested as well as performing in vitro cell work. The previous supplier of chitosan , the main polymer

BMP9 inhibits the bone metastasis of breast cancer cells by downregulating CCN2 (connective tissue growth factor, CTGF) expression.

PubMed

Ren, Wei; Sun, Xiaoxiao; Wang, Ke; Feng, Honglei; Liu, Yuehong; Fei, Chang; Wan, Shaoheng; Wang, Wei; Luo, Jinyong; Shi, Qiong; Tang, Min; Zuo, Guowei; Weng, Yaguang; He, Tongchuan; Zhang, Yan

2014-03-01

Bone morphogenetic proteins (BMPs), which belong to the transforming growth factor-β superfamily, regulate a wide range of cellular responses including cell proliferation, differentiation, adhesion, migration, and apoptosis. BMP9, the latest BMP to be discovered, is reportedly expressed in a variety of human carcinoma cell lines, but the role of BMP9 in breast cancer has not been fully clarified. In a previous study, BMP9 was found to inhibit the growth, migration, and invasiveness of MDA-MB-231 breast cancer cells. In the current study, the effect of BMP9 on the bone metastasis of breast cancer cells was investigated. After absent or low expression of BMP9 was detected in the MDA-MB-231 breast cancer cells and breast non-tumor adjacent tissues using Western blot and immunohistochemistry, In our previous study, BMP9 could inhibit the proliferation and invasiveness of breast cancer cells MDA-MB-231 in vitro and in vivo. This paper shows that BMP9 inhibit the bone metastasis of breast cancer cells by activating the BMP/Smad signaling pathway and downregulating connective tissue growth factor (CTGF); however, when CTGF expression was maintained, the inhibitory effect of BMP9 on the MDA-MB-231 cells was abolished. Together, these observations indicate that BMP9 is an important mediator of breast cancer bone metastasis and a potential therapeutic target for treating this deadly disease.

Controlled Release Strategies for Bone, Cartilage, and Osteochondral Engineering—Part II: Challenges on the Evolution from Single to Multiple Bioactive Factor Delivery

PubMed Central

Santo, Vítor E.; Mano, João F.; Reis, Rui L.

2013-01-01

The development of controlled release systems for the regeneration of bone, cartilage, and osteochondral interface is one of the hot topics in the field of tissue engineering and regenerative medicine. However, the majority of the developed systems consider only the release of a single growth factor, which is a limiting step for the success of the therapy. More recent studies have been focused on the design and tailoring of appropriate combinations of bioactive factors to match the desired goals regarding tissue regeneration. In fact, considering the complexity of extracellular matrix and the diversity of growth factors and cytokines involved in each biological response, it is expected that an appropriate combination of bioactive factors could lead to more successful outcomes in tissue regeneration. In this review, the evolution on the development of dual and multiple bioactive factor release systems for bone, cartilage, and osteochondral interface is overviewed, specifically the relevance of parameters such as dosage and spatiotemporal distribution of bioactive factors. A comprehensive collection of studies focused on the delivery of bioactive factors is also presented while highlighting the increasing impact of platelet-rich plasma as an autologous source of multiple growth factors. PMID:23249320

Genetic effects on bone mass and turnover-relevance to black/white differences.

PubMed

Parfitt, A M

1997-08-01

The mass of a bone is given by its volume and its apparent density--mass per unit external volume. Most measurements of so-called density are of mass incompletely normalized by some index of bone size. Genes control about 60% to 75% of the variance of peak bone mass/density and a much smaller proportion of the variance in rate of loss. Genetic influence on bone mass/density are mediated in large part by body size, bone size, and muscle mass. Most of the fifty-fold increase in bone mass from birth to maturity is due to bone growth, which is linked to muscle growth and bodily growth. Three-D apparent bone density in the vertebrae increases about 15% during the pubertal growth spurt. The genetic potential for bone accumulation can be frustrated by insufficient calcium intake, disruption of the calendar of puberty and inadequate physical activity. The growing skeleton is much more responsive than the mature skeleton to the osteotrophic effect of exercise, which is mediated by the detection of deviations from a target value for strain, and orchestration of cellular responses that restore the target value, processes collectively termed the mechanostat. Production of metaphyseal cancellous bone and growth in length are both linked to endochondral ossification, which is driven by growth plate cartilage cell proliferation. Production of diaphyseal cortical bone and growth in width are both linked to periosteal apposition, which is driven by osteoblast precursor proliferation. During adolescence trabeculae and cortices become thicker by net endosteal apposition, which increases apparent density. Two lines of evidence support a genetic basis for black/white differences in bone mass. First, the magnitude (10% to 40%) is incommensurate with known nongenetic factors. Second, the difference is already evident in the fetus and increases progressively during growth, especially in adolescence; the difference in peak bone mass persists throughout life. The genetic determination of bone mass is mediated by two classes of gene. The first regulates growth of the body, including muscles and bones, under the control of a master gene or set of genes whose products function as the sizostat. The second regulates the increase in apparent bone density in response to load bearing, under the control of a master gene or set of genes whose products function as the mechanostat.

Lactoferrin – A Novel Bone Growth Factor

PubMed Central

Naot, Dorit; Grey, Andrew; Reid, Ian R; Cornish, Jillian

2005-01-01

Lactoferrin is an iron-binding glycoprotein that belongs to the transferrin family. It is present in breast milk, in epithelial secretions, and in the secondary granules of neutrophils. In healthy subjects lactoferrin circulates at concentrations of 2–7 x 10−6 g/ml. Lactoferrin is a pleiotropic factor with potent antimicrobial and immunomodulatory activities. Recently, we have shown that lactoferrin can also promote bone growth. At physiological concentrations, lactoferrin potently stimulates the proliferation and differentiation of primary osteoblasts and also acts as a survival factor inhibiting apoptosis induced by serum withdrawal. Lactoferrin also affects osteoclast formation and, in murine bone marrow culture, lactoferrin potently inhibits osteoclastogenesis. In vivo, local injection of lactoferrin above the hemicalvaria of adult mice results in substantial increases in the dynamic histomorphometric indices of bone formation and bone area. The mitogenic effect of lactoferrin in osteoblast-like cells is mediated mainly through LRP1, a member of the family of low-density lipoprotein receptor-related proteins that are primarily known as endocytic receptors. Using confocal laser scanning microscopy, we demonstrated that fluorescently labeled lactoferrin is endocytosed and can be visualized in the cytoplasm of primary osteoblastic cells. Lactoferrin also induces activation of p42/44 MAPK signaling in primary osteoblasts, but the two pathways seem to operate independently as activation of MAPK signaling, but not endocytosis, is necessary for the mitogenic effect of lactoferrin. We conclude that lactoferrin may have a physiological role in bone growth and healing, and a potential therapeutic role as an anabolic factor in osteoporosis. PMID:16012127

Factors that affect postnatal bone growth retardation in the twitcher murine model of Krabbe disease.

PubMed

Contreras, Miguel Agustin; Ries, William Louis; Shanmugarajan, Srinivasan; Arboleda, Gonzalo; Singh, Inderjit; Singh, Avtar Kaur

2010-01-01

Krabbe disease is an inherited lysosomal disorder in which galactosylsphingosine (psychosine) accumulates mainly in the central nervous system. To gain insight into the possible mechanism(s) that may be participating in the inhibition of the postnatal somatic growth described in the animal model of this disease (twitcher mouse, twi), we studied their femora. This study reports that twi femora are smaller than of those of wild type (wt), and present with abnormality of marrow cellularity, bone deposition (osteoblastic function), and osteoclastic activity. Furthermore, lipidomic analysis indicates altered sphingolipid homeostasis, but without significant changes in the levels of sphingolipid-derived intermediates of cell death (ceramide) or the levels of the osteoclast-osteoblast coupling factor (sphingosine-1-phosphate). However, there was significant accumulation of psychosine in the femora of adult twi animals as compared to wt, without induction of tumor necrosis factor-alpha or interleukin-6. Analysis of insulin-like growth factor-1 (IGF-1) plasma levels, a liver secreted hormone known to play a role in bone growth, indicated a drastic reduction in twi animals when compared to wt. To identify the cause of the decrease, we examined the IGF-1 mRNA expression and protein levels in the liver. The results indicated a significant reduction of IGF-1 mRNA as well as protein levels in the liver from twi as compared to wt littermates. Our data suggest that a combination of endogenous (psychosine) and endocrine (IGF-1) factors play a role in the inhibition of postnatal bone growth in twi mice; and further suggest that derangements of liver function may be contributing, at least in part, to this alteration. Copyright 2010 Elsevier B.V. All rights reserved.

Skeletal Effects of Growth Hormone and Insulin-like Growth Factor-I Therapy

PubMed Central

Lindsey, Richard C.; Mohan, Subburaman

2015-01-01

The growth hormone/insulin-like growth factor (GH/IGF) axis is critically important for the regulation of bone formation, and deficiencies in this system have been shown to contribute to the development of osteoporosis and other diseases of low bone mass. The GH/IGF axis is regulated by a complex set of hormonal and local factors which can act to regulate this system at the level of the ligands, receptors, IGF binding proteins (IGFBPs), or IGFBP proteases. A combination of in vitro studies, transgenic animal models, and clinical human investigations has provided ample evidence of the importance of the endocrine and local actions of both GH and IGF-I, the two major components of the GH/IGF axis, in skeletal growth and maintenance. GH- and IGF-based therapies provide a useful avenue of approach for the prevention and treatment of diseases such as osteoporosis. PMID:26408965

Regulation of Bone Metabolism by Serotonin.

PubMed

Lavoie, Brigitte; Lian, Jane B; Mawe, Gary M

2017-01-01

The processes of bone growth and turnover are tightly regulated by the actions of various signaling molecules, including hormones, growth factors, and cytokines. Imbalances in these processes can lead to skeletal disorders such as osteoporosis or high bone mass disease. It is becoming increasingly clear that serotonin can act through a number of mechanisms, and at different locations in the body, to influence the balance between bone formation and resorption. Its actions on bone metabolism can vary, based on its site of synthesis (central or peripheral) as well as the cells and subtypes of receptors that are activated. Within the central nervous system, serotonergic neurons act via the hypothalamus to suppress sympathetic input to the bone. Since sympathetic input inhibits bone formation, brain serotonin has a net positive effect on bone growth. Gut-derived serotonin is thought to inhibit bone growth by attenuating osteoblast proliferation via activation of receptors on pre-osteoblasts. There is also evidence that serotonin can be synthesized within the bone and act to modulate bone metabolism. Osteoblasts, osteoclasts, and osteocytes all have the machinery to synthesize serotonin, and they also express the serotonin-reuptake transporter (SERT). Understanding the roles of serotonin in the tightly balanced system of bone modeling and remodeling is a clinically relevant goal. This knowledge can clarify bone-related side effects of drugs that affect serotonin signaling, including serotonin-specific reuptake inhibitors (SSRIs) and receptor agonists and antagonists, and it can potentially lead to therapeutic approaches for alleviating bone pathologies.

The use of bone marrow stromal cells (bone marrow-derived multipotent mesenchymal stromal cells) for alveolar bone tissue engineering: basic science to clinical translation.

PubMed

Kagami, Hideaki; Agata, Hideki; Inoue, Minoru; Asahina, Izumi; Tojo, Arinobu; Yamashita, Naohide; Imai, Kohzoh

2014-06-01

Bone tissue engineering is a promising field of regenerative medicine in which cultured cells, scaffolds, and osteogenic inductive signals are used to regenerate bone. Human bone marrow stromal cells (BMSCs) are the most commonly used cell source for bone tissue engineering. Although it is known that cell culture and induction protocols significantly affect the in vivo bone forming ability of BMSCs, the responsible factors of clinical outcome are poorly understood. The results from recent studies using human BMSCs have shown that factors such as passage number and length of osteogenic induction significantly affect ectopic bone formation, although such differences hardly affected the alkaline phosphatase activity or gene expression of osteogenic markers. Application of basic fibroblast growth factor helped to maintain the in vivo osteogenic ability of BMSCs. Importantly, responsiveness of those factors should be tested under clinical circumstances to improve the bone tissue engineering further. In this review, clinical application of bone tissue engineering was reviewed with putative underlying mechanisms.

Prefabricated bone flap: an experimental study comparing deep-frozen and lyophilized-demineralized allogenic bones and tissue expression of transforming growth factor β.

PubMed

Rodrigues, Leandro; dos Reis, Luciene Machado; Denadai, Rafael; Raposo-Amaral, Cassio Eduardo; Alonso, Nivaldo; Ferreira, Marcus Castro; Jorgetti, Vanda

2013-11-01

Extensive bone defects are still a challenge for reconstructive surgery. Allogenic bones can be an alternative with no donor area morbidity and unlimited amount of tissue. Better results can be achieved after allogenic bone preparation and adding a vascular supply, which can be done along with flap prefabrication. The purpose of this study was to evaluate demineralized/lyophilized and deep-frozen allogenic bones used for flap prefabrication and the tissue expression of transforming growth factor β (TGF-β) in these bone fragments. Fifty-six Wistar rat bone diaphyses were prepared and distributed in 4 groups: demineralized/lyophilized (experimental group 1 and control group 2) and deep freezing (experimental group 3 and control group 4). Two bone segments (one of each group) were implanted in rats to prefabricate flaps using superficial epigastric vessels (experimental groups) or only transferred as grafts (control groups). These fragments remained in their respective inguinal regions until the death that occurred at 2, 4, and 6 weeks after the operation. Semiquantitative histologic (tetracycline marking, cortical resorption, number of giant cells, and vascularization) and histomorphometrical quantitative (osteoid thickness, cortical thickness, and fibrosis thickness) analyses were performed. Transforming growth factor β immunohistochemistry staining was also performed. Group 1 fragments presented an osteoid matrix on their external surface in all periods. Cartilage formation and mineralization areas were also noticed. These findings were not observed in group 3 fragments. Group 1 had more mineralization and double tetracycline marks, which were almost not seen in group 3. Cortical resorption and the number of giant cells were greater in group 3 in all periods. Vascularization and fibrosis thickness were similar in both experimental groups. Group 1 had more intense TGF-β staining within 2 weeks of study. Nevertheless, from 4 weeks onward, group 3 presented statistically significant stronger staining. Although there are some differences between the preparation methods of allogenic bone, it is possible to prefabricate flaps with demineralized/lyophilized and deep-frozen bones.

Growth factor transgenes interactively regulate articular chondrocytes.

PubMed

Shi, Shuiliang; Mercer, Scott; Eckert, George J; Trippel, Stephen B

2013-04-01

Adult articular chondrocytes lack an effective repair response to correct damage from injury or osteoarthritis. Polypeptide growth factors that stimulate articular chondrocyte proliferation and cartilage matrix synthesis may augment this response. Gene transfer is a promising approach to delivering such factors. Multiple growth factor genes regulate these cell functions, but multiple growth factor gene transfer remains unexplored. We tested the hypothesis that multiple growth factor gene transfer selectively modulates articular chondrocyte proliferation and matrix synthesis. We tested the hypothesis by delivering combinations of the transgenes encoding insulin-like growth factor I (IGF-I), fibroblast growth factor-2 (FGF-2), transforming growth factor beta1 (TGF-β1), bone morphogenetic protein-2 (BMP-2), and bone morphogenetic protien-7 (BMP-7) to articular chondrocytes and measured changes in the production of DNA, glycosaminoglycan, and collagen. The transgenes differentially regulated all these chondrocyte activities. In concert, the transgenes interacted to generate widely divergent responses from the cells. These interactions ranged from inhibitory to synergistic. The transgene pair encoding IGF-I and FGF-2 maximized cell proliferation. The three-transgene group encoding IGF-I, BMP-2, and BMP-7 maximized matrix production and also optimized the balance between cell proliferation and matrix production. These data demonstrate an approach to articular chondrocyte regulation that may be tailored to stimulate specific cell functions, and suggest that certain growth factor gene combinations have potential value for cell-based articular cartilage repair. Copyright © 2012 Wiley Periodicals, Inc.

Stem cell- and growth factor-based regenerative therapies for avascular necrosis of the femoral head

PubMed Central

2012-01-01

Avascular necrosis (AVN) of the femoral head is a debilitating disease of multifactorial genesis, predominately affects young patients, and often leads to the development of secondary osteoarthritis. The evolving field of regenerative medicine offers promising treatment strategies using cells, biomaterial scaffolds, and bioactive factors, which might improve clinical outcome. Early stages of AVN with preserved structural integrity of the subchondral plate are accessible to retrograde surgical procedures, such as core decompression to reduce the intraosseous pressure and to induce bone remodeling. The additive application of concentrated bone marrow aspirates, ex vivo expanded mesenchymal stem cells, and osteogenic or angiogenic growth factors (or both) holds great potential to improve bone regeneration. In contrast, advanced stages of AVN with collapsed subchondral bone require an osteochondral reconstruction to preserve the physiological joint function. Analogously to strategies for osteochondral reconstruction in the knee, anterograde surgical techniques, such as osteochondral transplantation (mosaicplasty), matrix-based autologous chondrocyte implantation, or the use of acellular scaffolds alone, might preserve joint function and reduce the need for hip replacement. This review summarizes recent experimental accomplishments and initial clinical findings in the field of regenerative medicine which apply cells, growth factors, and matrices to address the clinical problem of AVN. PMID:22356811

Effect of transforming growth factor-beta and growth differentiation factor-5 on proliferation and matrix production by human bone marrow stromal cells cultured on braided poly lactic-co-glycolic acid scaffolds for ligament tissue engineering.

PubMed

Jenner, J M G Th; van Eijk, F; Saris, D B F; Willems, W J; Dhert, W J A; Creemers, Laura B

2007-07-01

Tissue engineering of ligaments based on biomechanically suitable biomaterials combined with autologous cells may provide a solution for the drawbacks associated with conventional graft material. The aim of the present study was to investigate the contribution of recombinant human transforming growth factor beta 1 (rhTGF-beta1) and growth differentiation factor (GDF)-5, known for their role in connective tissue regeneration, to proliferation and matrix production by human bone marrow stromal cells (BMSCs) cultured onto woven, bioabsorbable, 3-dimensional (3D) poly(lactic-co-glycolic acid) scaffolds. Cells were cultured for 12 days in the presence or absence of these growth factors at different concentrations. Human BMSCs attached to the suture material, proliferated, and synthesized extracellular matrix rich in collagen type I and collagen III. No differentiation was demonstrated toward cartilage or bone tissue. The addition of rhTGF-beta1 (1-10 ng/mL) and GDF-5 (10-100 ng/mL) increased cell content (p < 0.05), but only TGF-beta1 also increased total collagen production (p < 0.05) and collagen production per cell, which is a parameter indicating differentiation. In conclusion, stimulation with rhTGF-beta1, and to a lesser extent with GDF-5, can modulate human BMSCs toward collagenous soft tissue when applied to a 3D hybrid construct. The use of growth factors could play an important role in the improvement of ligament tissue engineering.

Use of ossein-hydroxyapatite complex in the prevention of bone loss: a review.

PubMed

Castelo-Branco, C; Dávila Guardia, J

2015-02-01

The ossein-hydroxyapatite complex (OHC) is a microcrystalline form of calcium which provides a number of additional minerals (magnesium, phosphorus, potassium, zinc), and proteins (osteocalcin, type I collagen, type I insulin growth factor I and II, transforming growth factor beta) associated with bone metabolism. The objective of this review is to examine the role of OHC in preventing bone loss in different conditions. A review of clinical trials assessing the relationship between OHC and bone loss was made using the following data sources: Medline (from 1966 to December 2013), the Cochrane Controlled Clinical Trials Register, Embase (up to December 2013), contact with companies marketing the supplements studied, and reference lists. Different randomized, clinical trials and meta-analysis suggest that OHC is more effective than calcium supplements in maintaining bone mass in postmenopausal women and in different conditions related to bone loss. In addition, OHC improves pain symptoms and accelerates fracture consolidation in patients with osteopenia or osteoporosis. The ossein-hydroxyapatite complex is significantly more effective in preventing bone loss than calcium carbonate.

The pathophysiological role of PEDF in bone diseases.

PubMed

Broadhead, M L; Akiyama, T; Choong, P F M; Dass, C R

2010-04-01

First discovered in 1991 as a factor secreted by retinal pigment epithelial cells, the potency of pigment epithelium derived factor (PEDF) as an anti-angiogenic has led to examination of its role in active bone growth, repair and remodelling. In the musculoskeletal system, PEDF expression occurs particularly at sites of active bone formation. Expression has been noted in osteoblasts and to a lesser degree osteoclasts, the major classes of bone cells. In fact, PEDF is capable of inducing differentiation of precursor cells into mature osteoblasts. Expression and localisation are closely linked with that of vascular endothelial growth factor (VEGF). Studies at the epiphyseal plate have revealed that PEDF expression plays a key role in endochondral ossification, and beyond this may account for the epiphyseal plate's innate ability to resist neoplastic cell invasion. Collagen-1, the major protein in bone, is avidly bound by PEDF, implicating an important role played by this protein on PEDF function, possibly through MMP-2 and -9 activity. Surprisingly, the role of PEDF has not been evaluated more widely in bone disorders, so the challenge ahead lies in a more diverse evaluation of PEDF in various osteologic pathologies including osteoarthritis and fracture healing.

Fibroblast Growth Factor 23 in Long-Duration Spaceflight

NASA Technical Reports Server (NTRS)

Bokhari, R.; Zwart, S. R.; Fields, E.; Heer, M.; Sibonga, J.; Smith, S. M.

2015-01-01

Many nutritional factors influence bone, from the basics of calcium and vitamin D, to factors which influence bone through acid/base balance, including protein, sodium, and more. Fibroblast growth factor 23 (FGF23) is a recently identified factor, secreted from osteocytes, which is involved in classic (albeit complex) feedback loops controlling phosphorus homeostasis through both vitamin D and parathyroid hormone (PTH) (1, 2). As osteocytes are gravity sensing cells, it is important to determine if there are changes in FGF23 during spaceflight. In extreme cases, such as chronic kidney disease, FGF23 levels are highly elevated. FGF23 imbalances, secondary to dietary influences, may contribute to skeletal demineralization and kidney stone risk during spaceflight.

Achondroplasia: Development, pathogenesis, and therapy.

PubMed

Ornitz, David M; Legeai-Mallet, Laurence

2017-04-01

Autosomal dominant mutations in fibroblast growth factor receptor 3 (FGFR3) cause achondroplasia (Ach), the most common form of dwarfism in humans, and related chondrodysplasia syndromes that include hypochondroplasia (Hch), severe achondroplasia with developmental delay and acanthosis nigricans (SADDAN), and thanatophoric dysplasia (TD). FGFR3 is expressed in chondrocytes and mature osteoblasts where it functions to regulate bone growth. Analysis of the mutations in FGFR3 revealed increased signaling through a combination of mechanisms that include stabilization of the receptor, enhanced dimerization, and enhanced tyrosine kinase activity. Paradoxically, increased FGFR3 signaling profoundly suppresses proliferation and maturation of growth plate chondrocytes resulting in decreased growth plate size, reduced trabecular bone volume, and resulting decreased bone elongation. In this review, we discuss the molecular mechanisms that regulate growth plate chondrocytes, the pathogenesis of Ach, and therapeutic approaches that are being evaluated to improve endochondral bone growth in people with Ach and related conditions. Developmental Dynamics 246:291-309, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

[Histocompatibility of nano-hydroxyapatite/poly-co-glycolic acid tissue engineering bone modified by mesenchymal stem cells with vascular endothelial frowth factor].

PubMed

Zhang, Minglei; Wang, Dapeng; Yin, Ruofeng

2015-10-06

To explorec Histocompatibility of nano-hydroxyapatite/poly-co-glycolic acid tissue engineering bone modified by mesenchymal stem cells with vascular endothelial frowth factor transinfected. Rat bone marrow mesenchymal stem cells (BMSCs) was separated, using BMSCs as target cells, and then vascular endothelial growth factor (VEGF) gene was transfected. Composite bone marrow mesenchymal stem cells and cells transfected with nano-hydroxyapatite (HA)/polylactic-co-glycolic acid (PLGA). The composition of cell and scaffold was observed. The blank plasmid transfection was 39.1%, 40.1% in VEGF group. The cell adhesion and growth was found on the scaffold pore wall after 5 days, and the number of adherent cells in the nano-HA/PLGA composite scaffold material basically had no significant difference in both. Although the nano-HA/PLGA scaffold material is still not fully meet the requirements of the matrix material for bone tissue engineering, but good biocompatibility, structure is its rich microporous satisfaction in material mechanics, toughening, enhanced obviously. Composition scaffold with BMSCs transfected by VEGF plasmid, the ability of angiogenesis is promoted.

Hepatocyte growth factor improves bone regeneration via the bone morphogenetic protein‑2‑mediated NF‑κB signaling pathway.

PubMed

Zhen, Ruixin; Yang, Jianing; Wang, Yu; Li, Yubo; Chen, Bin; Song, Youxin; Ma, Guiyun; Yang, Bo

2018-04-01

Bone regeneration is an important process associated with the treatment of osteonecrosis, which is caused by various factors. Hepatocyte growth factor (HGF) is an active biological factor that has multifunctional roles in cell biology, life sciences and clinical medicine. It has previously been suggested that bone morphogenetic protein (BMP)‑2 exerts beneficial roles in bone formation, repair and angiogenesis in the femoral head. The present study aimed to investigate the benefits and molecular mechanisms of HGF in bone regeneration. The viability of osteoblasts and osteoclasts were studied in vitro. In addition, the expression levels of tumor necrosis factor (TNF)‑α, monocyte chemotactic protein (MCP)‑1, interleukin (IL)‑1 and IL‑6 were detected in a mouse fracture model following treatment with HGF. The expression and activity of nuclear factor (NF)‑κB were also analyzed in osteocytes post‑treatment with HGF. Histological analysis was used to determine the therapeutic effects of HGF on mice with fractures. The migration and differentiation of osteoblasts and osteoclasts were investigated in HGF‑incubated cells. Furthermore, angiogenesis and BMP‑2 expression were analyzed in the mouse fracture model post‑treatment with HGF. The results indicated that HGF regulates the cell viability of osteoblasts and osteoclasts, and also balanced the ratio between osteoblasts and osteoclasts. In addition, HGF decreased the serum expression levels of TNF‑α, MCP‑1, IL‑1 and IL‑6 in experimental mice. The results of a mechanistic analysis demonstrated that HGF upregulated p65, IκB kinase‑β and IκBα expression in osteoblasts from experimental mice. In addition, the expression levels of vascular endothelial growth factor, BMP‑2 receptor, receptor activator of NF‑κB ligand and macrophage colony‑stimulating factor were upregulated by HGF, which may effectively promote blood vessel regeneration, and contribute to the formation and revascularization of tissue‑engineered bone. Furthermore, HGF promoted BMP‑2 expression and enhanced angiogenesis at the fracture location. These results suggested that HGF treatment may significantly promote bone regeneration in a mouse fracture model. In conclusion, these results indicated that HGF is involved in bone regeneration, angiogenesis and the balance between osteoblasts and osteoclasts, thus suggesting that HGF may be considered a potential agent for the treatment of fractures via the promotion of bone regeneration through regulation of the BMP‑2‑mediated NF‑κB signaling pathway.

Phylogenetic, functional, and structural components of variation in bone growth rate of amniotes.

PubMed

Cubo, Jorge; Legendre, Pierre; de Ricqlès, Armand; Montes, Laëtitia; de Margerie, Emmanuel; Castanet, Jacques; Desdevises, Yves

2008-01-01

The biological features observed in every living organism are the outcome of three sets of factors: historical (inherited by homology), functional (biological adaptation), and structural (properties inherent to the materials with which organs are constructed, and the morphogenetic rules by which they grow). Integrating them should bring satisfactory causal explanations of empirical data. However, little progress has been accomplished in practice toward this goal, because a methodologically efficient tool was lacking. Here we use a new statistical method of variation partitioning to analyze bone growth in amniotes. (1) Historical component. The variation of bone growth rates contains a significant phylogenetic signal, suggesting that the observed patterns are partly the outcome of shared ancestry. (2) Functional causation. High growth rates, although energy costly, may be adaptive (i.e., they may increase survival rates) in taxa showing short growth periods (e.g., birds). In ectothermic amniotes, low resting metabolic rates may limit the maximum possible growth rates. (3) Structural constraint. Whereas soft tissues grow through a multiplicative process, growth of mineralized tissues is accretionary (additive, i.e., mineralization fronts occur only at free surfaces). Bone growth of many amniotes partially circumvents this constraint: it is achieved not only at the external surface of the bone shaft, but also within cavities included in the bone cortex as it grows centrifugally. Our approach contributes to the unification of historicism, functionalism, and structuralism toward a more integrated evolutionary biology.

Rapid modification of the bone microenvironment following short-term treatment with Cabozantinib in vivo.

PubMed

Haider, Marie-Therese; Hunter, Keith D; Robinson, Simon P; Graham, Timothy J; Corey, Eva; Dear, T Neil; Hughes, Russell; Brown, Nicola J; Holen, Ingunn

2015-12-01

Bone metastasis remains incurable with treatment restricted to palliative care. Cabozantinib (CBZ) is targeted against multiple receptor tyrosine kinases involved in tumour pathobiology, including hepatocyte growth factor receptor (MET) and vascular endothelial growth factor receptor 2 (VEGFR-2). CBZ has demonstrated clinical activity in advanced prostate cancer with resolution of lesions visible on bone scans, implicating a potential role of the bone microenvironment as a mediator of CBZ effects. We characterised the effects of short-term administration of CBZ on bone in a range of in vivo models to determine how CBZ affects bone in the absence of tumour. Studies were performed in a variety of in vivo models including male and female BALB/c nude mice (age 6-17-weeks). Animals received CBZ (30 mg/kg, 5× weekly) or sterile H2O control for 5 or 10 days. Effects on bone integrity (μCT), bone cell activity (PINP, TRAP ELISA), osteoblast and osteoclast number/mm trabecular bone surface, area of epiphyseal growth plate cartilage, megakaryocyte numbers and bone marrow composition were assessed. Effects of longer-term treatment (15-day & 6-week administration) were assessed in male NOD/SCID and beige SCID mice. CBZ treatment had significant effects on the bone microenvironment, including reduced osteoclast and increased osteoblast numbers compared to control. Trabecular bone structure was altered after 8 administrations. A significant elongation of the epiphyseal growth plate, in particular the hypertrophic chondrocyte zone, was observed in all CBZ treated animals irrespective of administration schedule. Both male and female BALB/c nude mice had increased megakaryocyte numbers/mm(2) tissue after 10-day CBZ treatment, in addition to vascular ectasia, reduced bone marrow cellularity and extravasation of red blood cells into the extra-vascular bone marrow. All CBZ-induced effects were transient and rapidly lost following cessation of treatment. Short-term administration of CBZ induces rapid, reversible effects on the bone microenvironment in vivo highlighting a potential role in mediating treatment responses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

The effect of distant metastases sites on survival in de novo stage-IV breast cancer: A SEER database analysis.

PubMed

Wu, San-Gang; Li, Hui; Tang, Li-Ying; Sun, Jia-Yuan; Zhang, Wen-Wen; Li, Feng-Yan; Chen, Yong-Xiong; He, Zhen-Yu

2017-06-01

To investigate the effect of distant metastases sites on survival in patients with de novo stage-IV breast cancer. From 2010 to 2013, patients with a diagnosis of de novo stage-IV breast cancer were identified using the Surveillance, Epidemiology, and End Results database. Univariate and multivariate Cox regression analyses were performed to analyze the effect of distant metastases sites on breast cancer-specific survival and overall survival. A total of 7575 patients were identified. The most common metastatic sites were bone, followed by lung, liver, and brain. Patients with hormone receptor+/human epidermal growth factor receptor 2- and hormone receptor+/human epidermal growth factor receptor 2+ status were more prone to bone metastases. Lung and brain metastases were common in hormone receptor-/human epidermal growth factor receptor 2+ and hormone receptor-/human epidermal growth factor receptor 2- subtypes, and patients with hormone receptor+/ human epidermal growth factor receptor 2+ and hormone receptor-/human epidermal growth factor receptor 2+ subtypes were more prone to liver metastases. Patients with liver and brain metastases had unfavorable prognosis for breast cancer-specific survival and overall survival, whereas bone and lung metastases had no effect on patient survival in multivariate analyses. The hormone receptor-/human epidermal growth factor receptor 2- subtype conferred a significantly poorer outcome in terms of breast cancer-specific survival and overall survival. hormone receptor+/human epidermal growth factor receptor 2+ disease was associated with the best prognosis in terms of breast cancer-specific survival and overall survival. Patients with liver and brain metastases were more likely to experience poor prognosis for breast cancer-specific survival and overall survival by various breast cancer subtypes. Distant metastases sites have differential impact on clinical outcomes in stage-IV breast cancer. Follow-up screening for brain and liver metastases might be effective in improving breast cancer-specific survival and overall survival.

Hyperspectral Raman imaging of bone growth and regrowth chemistry

NASA Astrophysics Data System (ADS)

Pezzuti, Jerilyn A.; Morris, Michael D.; Bonadio, Jeffrey F.; Goldstein, Steven A.

1998-06-01

Hyperspectral Raman microscopic imaging of carbonated hydroxyapatite (HAP) is used to follow the chemistry of bone growth and regrowth. Deep red excitation is employed to minimize protein fluorescence interference. A passive line generator based on Powell lens optics and a motorized translation stage provide the imaging capabilities. Raman image contrast is generated from several lines of the HAP Raman spectrum, primarily the PO4-3. Factor analysis is used to minimize the integration time needed for acceptable contrast and to explore the chemical species within the bone. Bone age is visualized as variations in image intensity. High definition, high resolution images of newly formed bone and mature bone are compared qualitatively. The technique is currently under evaluation for study of experimental therapies for fracture repair.

Interaction of the endocrine system with inflammation: a function of energy and volume regulation

PubMed Central

2014-01-01

During acute systemic infectious disease, precisely regulated release of energy-rich substrates (glucose, free fatty acids, and amino acids) and auxiliary elements such as calcium/phosphorus from storage sites (fat tissue, muscle, liver, and bone) are highly important because these factors are needed by an energy-consuming immune system in a situation with little or no food/water intake (sickness behavior). This positively selected program for short-lived infectious diseases is similarly applied during chronic inflammatory diseases. This review presents the interaction of hormones and inflammation by focusing on energy storage/expenditure and volume regulation. Energy storage hormones are represented by insulin (glucose/lipid storage and growth-related processes), insulin-like growth factor-1 (IGF-1) (muscle and bone growth), androgens (muscle and bone growth), vitamin D (bone growth), and osteocalcin (bone growth, support of insulin, and testosterone). Energy expenditure hormones are represented by cortisol (breakdown of liver glycogen/adipose tissue triglycerides/muscle protein, and gluconeogenesis; water retention), noradrenaline/adrenaline (breakdown of liver glycogen/adipose tissue triglycerides, and gluconeogenesis; water retention), growth hormone (glucogenic, lipolytic; has also growth-related aspects; water retention), thyroid gland hormones (increase metabolic effects of adrenaline/noradrenaline), and angiotensin II (induce insulin resistance and retain water). In chronic inflammatory diseases, a preponderance of energy expenditure pathways is switched on, leading to typical hormonal changes such as insulin/IGF-1 resistance, hypoandrogenemia, hypovitaminosis D, mild hypercortisolemia, and increased activity of the sympathetic nervous system and the renin-angiotensin-aldosterone system. Though necessary during acute inflammation in the context of systemic infection or trauma, these long-standing changes contribute to increased mortality in chronic inflammatory diseases. PMID:24524669

Interaction of the endocrine system with inflammation: a function of energy and volume regulation.

PubMed

Straub, Rainer H

2014-02-13

During acute systemic infectious disease, precisely regulated release of energy-rich substrates (glucose, free fatty acids, and amino acids) and auxiliary elements such as calcium/phosphorus from storage sites (fat tissue, muscle, liver, and bone) are highly important because these factors are needed by an energy-consuming immune system in a situation with little or no food/water intake (sickness behavior). This positively selected program for short-lived infectious diseases is similarly applied during chronic inflammatory diseases. This review presents the interaction of hormones and inflammation by focusing on energy storage/expenditure and volume regulation. Energy storage hormones are represented by insulin (glucose/lipid storage and growth-related processes), insulin-like growth factor-1 (IGF-1) (muscle and bone growth), androgens (muscle and bone growth), vitamin D (bone growth), and osteocalcin (bone growth, support of insulin, and testosterone). Energy expenditure hormones are represented by cortisol (breakdown of liver glycogen/adipose tissue triglycerides/muscle protein, and gluconeogenesis; water retention), noradrenaline/adrenaline (breakdown of liver glycogen/adipose tissue triglycerides, and gluconeogenesis; water retention), growth hormone (glucogenic, lipolytic; has also growth-related aspects; water retention), thyroid gland hormones (increase metabolic effects of adrenaline/noradrenaline), and angiotensin II (induce insulin resistance and retain water). In chronic inflammatory diseases, a preponderance of energy expenditure pathways is switched on, leading to typical hormonal changes such as insulin/IGF-1 resistance, hypoandrogenemia, hypovitaminosis D, mild hypercortisolemia, and increased activity of the sympathetic nervous system and the renin-angiotensin-aldosterone system. Though necessary during acute inflammation in the context of systemic infection or trauma, these long-standing changes contribute to increased mortality in chronic inflammatory diseases.

Skeletal unloading induces resistance to insulin-like growth factor I

NASA Technical Reports Server (NTRS)

Bikle, D. D.; Harris, J.; Halloran, B. P.; Morey-Holton, E. R.

1994-01-01

In previous studies with a hindlimb elevation model, we demonstrated that skeletal unloading transiently inhibits bone formation. This effect is limited to the unloaded bones (the normally loaded humerus does not cease growing), suggesting that local factors are of prime importance. IGF-I is one such factor; it is produced in bone and stimulates bone formation. To determine the impact of skeletal unloading on IGF-I production and function, we assessed the mRNA levels of IGF-I and its receptor (IGF-IR) in the proximal tibia and distal femur of growing rats during 2 weeks of hindlimb elevation. The mRNA levels for IGF-I and IGF-IR rose during hindlimb elevation, returning toward control values during recovery. This was accompanied by a 77% increase in IGF-I levels in the bone, peaking at day 10 of unloading. Changes in IGF binding protein levels were not observed. Infusion of IGF-I (200 micrograms/day) during 1 week of hindlimb elevation doubled the increase in bone mass of the control animals but failed to reverse the cessation of bone growth in the hindlimb-elevated animals. We conclude that skeletal unloading induces resistance to IGF-I, which may result secondarily in increased local production of IGF-I.

Overexpression of Insulin-Like Growth Factor 1 Enhanced the Osteogenic Capability of Aging Bone Marrow Mesenchymal Stem Cells.

PubMed

Chen, Ching-Yun; Tseng, Kuo-Yun; Lai, Yen-Liang; Chen, Yo-Shen; Lin, Feng-Huei; Lin, Shankung

2017-01-01

Many studies have indicated that loss of the osteoblastogenic potential in bone marrow mesenchymal stem cells (bmMSCs) is the major component in the etiology of the aging-related bone deficit. But how the bmMSCs lose osteogenic capability in aging is unclear. Using 2-dimentional cultures, we examined the dose response of human bmMSCs, isolated from adult and aged donors, to exogenous insulin-like growth factor 1 (IGF-1), a growth factor regulating bone formation. The data showed that the mitogenic activity and the osteoblastogenic potential of bmMSCs in response to IGF-1 were impaired with aging, whereas higher doses of IGF-1 increased the proliferation rate and osteogenic potential of aging bmMSCs. Subsequently, we seeded IGF-1-overexpressing aging bmMSCs into calcium-alginate scaffolds and incubated in a bioreactor with constant perfusion for varying time periods to examine the effect of IGF-1 overexpression to the bone-forming capability of aging bmMSCs. We found that IGF-1 overexpression in aging bmMSCs facilitated the formation of cell clusters in scaffolds, increased the cell survival inside the cell clusters, induced the expression of osteoblast markers, and enhanced the biomineralization of cell clusters. These results indicated that IGF-1 overexpression enhanced cells' osteogenic capability. Thus, our data suggest that the aging-related loss of osteogenic potential in bmMSCs can be attributed in part to the impairment in bmMSCs' IGF-1 signaling, and support possible application of IGF-1-overexpressing autologous bmMSCs in repairing bone defect of the elderly and in producing bone graft materials for repairing large scale bone injury in the elderly.

Effects of Gymnastics Activities on Bone Accrual during Growth: A Systematic Review

PubMed Central

Jürimäe, Jaak; Gruodyte-Raciene, Rita; Baxter-Jones, Adam D. G.

2018-01-01

The amount of bone gained during childhood and adolescence impacts greatly on lifetime skeletal health. The purpose of this review is to summarize current evidence of the effects of gymnastics activities on bone mineral accrual during growth and to describe possible factors that influence bone mineral gains. The PubMed and SportDiscus databases were searched, and a total of 24 articles met the selection criteria and were included in this review. Artistic and rhythmic gymnasts presented higher bone mineral density and content values compared to untrained controls, despite possible negative effects associated with hormonal levels, dietary restrictions and body fat. The results suggest that gymnasts had similar bone turnover values compared to untrained controls. High-intensity mechanical loading of gymnastics activity appears to increase bone development and counterbalance negative effects, such as later pubertal development, lower body fat mass and lower hormone levels. In conclusion, gymnasts present higher bone mineral values in comparison with untrained controls. The osteogenic effect of gymnastics athletic activity has a positive influence on bone mineral accrual and overcomes the possible negative influence of high athletic activity that may cause negative energy balance and low body fat mass which are associated with lower bone accrual. Key points Children and adolescent gymnasts present higher bone mineral density and content values compared to untrained controls, despite a variety of possible negative factors. Gymnastics activity with high-impact mechanical loading appears to be especially osteogenic to achieve maximum possible peak bone accrual during growth and maturation. Skeletal benefits of gymnastics activity in childhood are maintained for several years after retirement from gymnastics trainings in young adulthood. PMID:29769826

Insulin-Like Growth Factor Regulates Peak Bone Mineral Density in Mice by Both Growth Hormone-Dependent and -Independent Mechanisms

PubMed Central

Mohan, Subburaman; Richman, Charmaine; Guo, Rongqing; Amaar, Yousef; Donahue, Leah Rea; Wergedal, Jon; Baylink, David J.

2010-01-01

To evaluate the relative contribution of the GH/IGF axis to the development of peak bone mineral density (BMD), we measured skeletal changes in IGF-I knockout (KO), IGF-II KO, and GH-deficient lit/lit mice and their corresponding control mice at d 23 (prepubertal), 31 (pubertal), and 56 (postpubertal) in the entire femur by dual energy x-ray absorptiometry and in the mid-diaphysis by peripheral quantitative computed tomography. Lack of growth factors resulted in different degrees of failure of skeletal growth depending on the growth period and the growth factor involved. At d 23, femoral length, size, and BMD were reduced by 25–40%, 15–17%, and 8–10%, respectively, in mice deficient in IGF-I, IGF-II, and GH compared with the control mice. During puberty, BMD increased by 40% in control mice and by 15% in IGF-II KO and GH-deficient mice, whereas it did not increase in the IGF-I KO mice. Disruption of IGF-I, but not IGF-II, completely prevented the periosteal expansion that occurs during puberty, whereas it was reduced by 50% in GH-deficient mice. At d 56, femoral length, size, and BMD were reduced by 40–55%, 11–18%, and 25–32%, respectively, in mice deficient in IGF-I, IGF-II, and GH compared with the control mice. Our data demonstrate that: 1) mice deficient in IGF-I exhibit a greater impairment in bone accretion than mice deficient in IGF-II or GH; 2) GH/IGF-I, but not IGF-II, is critical for puberty-induced bone growth; and 3) IGF-I effects on bone accretion during prepuberty are mediated predominantly via mechanisms independent of GH, whereas during puberty they are mediated via both GH-dependent and GH-independent mechanisms. PMID:12586770

Associations of insulin-like growth factor-I and insulin-like growth factor binding protein-3 with bone quality in the general adult population.

PubMed

Böker, J; Völzke, H; Nauck, M; Hannemann, A; Friedrich, N

2018-03-01

Growth hormone (GH) and its main mediator, insulin-like growth factor-I (IGF-I), play a significant role in bone metabolism. The relations between IGF-I and bone mineral density (BMD) or osteoporosis have been assessed in previous studies but whether the associations are sex-specific remains uncertain. Moreover, only a few studies examined bone quality assessed by quantitative ultrasound (QUS). We aimed to investigate these associations in the general population of north-east Germany. Data from 1759 men and 1784 women who participated in the baseline examination of the Study of Health in Pomerania (SHIP)-Trend were used. IGF-I and IGF-binding protein-3 (IGFBP-3) concentrations were measured on the IDS-iSYS multidiscipline automated analyser (Immunodiagnostic Systems Limited). QUS measurements were performed at the heel (Achilles InSight, GE Healthcare). Sex-specific linear and multinomial logistic regression models adjusted for potential confounders were calculated. Linear regression analyses revealed significant positive associations between IGF-I and IGF-I/IGFBP-3 ratio, a marker for free IGF-I, with all QUS parameters in men. Among women, we found an inverse association between IGF-I and the QUS-based fracture risk but no association with any other QUS parameter. There was no association between IGFBP-3 and the QUS-based fracture risk. Our data suggest an important role of IGF-I on bone quality in men. The observed association of IGF-I with the QUS-based stiffness index and QUS-based fracture risk in this study might animate clinicians to refer patients with low IGF-I levels, particularly men, to a further evaluation of risk factors for osteoporosis and a detailed examination of the skeletal system. © 2018 John Wiley & Sons Ltd.

Bone mineralization in childhood and adolescence.

PubMed

Bachrach, L K

1993-08-01

Prevention of osteoporosis depends on establishing adequate peak bone mass in the first two decades of life. Achievement of this goal requires an understanding of factors that promote skeletal health. Genetic factors are important determinants of adult bone mass, but nonheritable variables, including body mass, calcium nutriture, sex steroids, and activity can strongly influence whether maximal bone mineral is achieved. Acquisition of bone mineral continues throughout childhood and adolescence, reaching a lifetime maximum in early adulthood. Adolescence is a particularly critical time for bone mineral accretion as more than half of the bone calcium is normally laid down during the teen years. Chronic illness, malnutrition, or endocrine deficiencies at this age may result in profound deficits in bone mass, which may not be fully reversible. These risk factors contribute to the osteopenia associated with anorexia nervosa, exercise-induced amenorrhea, delayed puberty, Turner's syndrome, and growth hormone deficiency.

A living thick nanofibrous implant bifunctionalized with active growth factor and stem cells for bone regeneration.

PubMed

Eap, Sandy; Keller, Laetitia; Schiavi, Jessica; Huck, Olivier; Jacomine, Leandro; Fioretti, Florence; Gauthier, Christian; Sebastian, Victor; Schwinté, Pascale; Benkirane-Jessel, Nadia

2015-01-01

New-generation implants focus on robust, durable, and rapid tissue regeneration to shorten recovery times and decrease risks of postoperative complications for patients. Herein, we describe a new-generation thick nanofibrous implant functionalized with active containers of growth factors and stem cells for regenerative nanomedicine. A thick electrospun poly(ε-caprolactone) nanofibrous implant (from 700 μm to 1 cm thick) was functionalized with chitosan and bone morphogenetic protein BMP-7 as growth factor using layer-by-layer technology, producing fish scale-like chitosan/BMP-7 nanoreservoirs. This extracellular matrix-mimicking scaffold enabled in vitro colonization and bone regeneration by human primary osteoblasts, as shown by expression of osteocalcin, osteopontin, and bone sialoprotein (BSPII), 21 days after seeding. In vivo implantation in mouse calvaria defects showed significantly more newly mineralized extracellular matrix in the functionalized implant compared to a bare scaffold after 30 days' implantation, as shown by histological scanning electron microscopy/energy dispersive X-ray microscopy study and calcein injection. We have as well bifunctionalized our BMP-7 therapeutic implant by adding human mesenchymal stem cells (hMSCs). The activity of this BMP-7-functionalized implant was again further enhanced by the addition of hMSCs to the implant (living materials), in vivo, as demonstrated by the analysis of new bone formation and calcification after 30 days' implantation in mice with calvaria defects. Therefore, implants functionalized with BMP-7 nanocontainers associated with hMSCs can act as an accelerator of in vivo bone mineralization and regeneration.

Dietary induced serum phenolic acids promote bone growth via p38 MAPK / Beta-Catenin Canonical Wnt signaling

USDA-ARS?s Scientific Manuscript database

Diet and nutritional status are critical factors that influences bone development. In this report, we demonstrate that a mixture of phenolic acids found in the serum of young rats fed blueberries (BB), significantly stimulated osteoblast differentiation, resulting in significantly increased bone mas...

IGFBP-4 regulates adult skeletal growth in a sex-specific manner.

PubMed

Maridas, David E; DeMambro, Victoria E; Le, Phuong T; Nagano, Kenichi; Baron, Roland; Mohan, Subburaman; Rosen, Clifford J

2017-04-01

Insulin-like growth factor-1 (IGF-1) and its binding proteins are critical mediators of skeletal growth. Insulin-like growth factor-binding protein 4 (IGFBP-4) is highly expressed in osteoblasts and inhibits IGF-1 actions in vitro Yet, in vivo studies suggest that it could potentiate IGF-1 and IGF-2 actions. In this study, we hypothesized that IGFBP-4 might potentiate the actions of IGF-1 on the skeleton. To test this, we comprehensively studied 8- and 16-week-old Igfbp4 -/- mice. Both male and female adult Igfbp4 -/- mice had marked growth retardation with reductions in body weight, body and femur lengths, fat proportion and lean mass at 8 and 16 weeks. Marked reductions in aBMD and aBMC were observed in 16-week-old Igfbp4 -/- females, but not in males. Femoral trabecular BV/TV and thickness, cortical fraction and thickness in 16-week-old Igfbp4 -/- females were significantly reduced. However, surprisingly, males had significantly more trabeculae with higher connectivity density than controls. Concordantly, histomorphometry revealed higher bone resorption and lower bone formation in Igfbp4 -/- females. In contrast, Igfbp4 -/- males had lower mineralized surface/bone surface. Femoral expression of Sost and circulating levels of sclerostin were reduced but only in Igfbp4 -/- males. Bone marrow stromal cultures from mutants showed increased osteogenesis, whereas osteoclastogenesis was markedly increased in cells from Igfbp4 -/- females but decreased in males. In sum, our results indicate that loss of Igfbp4 affects mesenchymal stromal cell differentiation, regulates osteoclastogenesis and influences both skeletal development and adult bone maintenance. Thus, IGFBP-4 modulates the skeleton in a gender-specific manner, acting as both a cell autonomous and cell non-autonomous factor. © 2017 The authors.

The Role of GH/IGF-I Axis in Muscle Homeostasis During Weightlessness

NASA Technical Reports Server (NTRS)

Schwartz, Robert J.

1997-01-01

Exposure to reduced gravity during space travel profoundly alters the loads placed on bone and muscle. Astronauts suffer significant losses of muscle and bone strength during weightlessness. Exercise as a countermeasure is only partially effective in remedying severe muscle atrophy and bone demineralization. Similar wasting of muscles and bones affects people on Earth during prolonged bed rest or immobilization due to injury. In the absence of weight bearing activity, atrophy occurs primarily in the muscles that act in low power, routine movements and in maintaining posture. Hormonal disfunction could contribute in part to the loss of muscle and bone during spaceflight. Reduced levels of human Growth Hormone (hGH) were found in astronauts during space flight, as well as reduced GH secretory activity was observed from the anterior pituitary in 7-day space flight rats. Growth hormone has been shown to be required for maintenance of muscle mass and bone mineralization, in part by mediating the biosynthesis IGF-I, a small polypeptide growth factor. IGF biosynthesis and secretion plays an important role in potentiating muscle cell differentiation and has been shown to drive the expression of myogenin, a myogenic specific basic helix-loop-helix factor. IGF-I has also been shown to have an important role in potentiating muscle regeneration, repair and adult muscle hypertrophy.

A modified PMMA cement (Sub-cement) for accelerated fatigue testing of cemented implant constructs using cadaveric bone.

PubMed

Race, Amos; Miller, Mark A; Mann, Kenneth A

2008-10-20

Pre-clinical screening of cemented implant systems could be improved by modeling the longer-term response of the implant/cement/bone construct to cyclic loading. We formulated bone cement with degraded fatigue fracture properties (Sub-cement) such that long-term fatigue could be simulated in short-term cadaver tests. Sub-cement was made by adding a chain-transfer agent to standard polymethylmethacrylate (PMMA) cement. This reduced the molecular weight of the inter-bead matrix without changing reaction-rate or handling characteristics. Static mechanical properties were approximately equivalent to normal cement. Over a physiologically reasonable range of stress-intensity factor, fatigue crack propagation rates for Sub-cement were higher by a factor of 25+/-19. When tested in a simplified 2 1/2-D physical model of a stem-cement-bone system, crack growth from the stem was accelerated by a factor of 100. Sub-cement accelerated both crack initiation and growth rate. Sub-cement is now being evaluated in full stem/cement/femur models.

Bone regeneration in experimental animals using calcium phosphate cement combined with platelet growth factors and human growth hormone.

PubMed

Emilov-Velev, K; Clemente-de-Arriba, C; Alobera-García, M Á; Moreno-Sansalvador, E M; Campo-Loarte, J

2015-01-01

Many substances (growth factors and hormones) have osteoinduction properties and when added to some osteoconduction biomaterial they accelerate bone neoformation properties. The materials included 15 New Zealand rabbits, calcium phosphate cement (Calcibon(®)), human growth hormone (GH), and plasma rich in platelets (PRP). Each animal was operated on in both proximal tibias and a critical size bone defect of 6mm of diameter was made. The animals were separated into the following study groups: Control (regeneration only by Calcibon®), PRP (regeneration by Calcibon® and PRP), GH (regeneration by Calcibon® and GH). All the animals were sacrificed at 28 days. An evaluation was made of the appearance of the proximal extreme of rabbit tibiae in all the animals, and to check the filling of the critical size defect. A histological assessment was made of the tissue response, the presence of new bone formation, and the appearance of the biomaterial. Morphometry was performed using the MIP 45 image analyser. ANOVA statistical analysis was performed using the Statgraphics software application. The macroscopic appearance of the critical defect was better in the PRP and the GH group than in the control group. Histologically greater new bone formation was found in the PRP and GH groups. No statistically significant differences were detected in the morphometric study between bone formation observed in the PRP group and the control group. Significant differences in increased bone formation were found in the GH group (p=0.03) compared to the other two groups. GH facilitates bone regeneration in critical defects filled with calcium phosphate cement in the time period studied in New Zealand rabbits. Copyright © 2014 SECOT. Published by Elsevier Espana. All rights reserved.

Role of nutritional zinc in the prevention of osteoporosis.

PubMed

Yamaguchi, Masayoshi

2010-05-01

Zinc is known as an essential nutritional factor in the growth of the human and animals. Bone growth retardation is a common finding in various conditions associated with dietary zinc deficiency. Bone zinc content has been shown to decrease in aging, skeletal unloading, and postmenopausal conditions, suggesting its role in bone disorder. Zinc has been demonstrated to have a stimulatory effect on osteoblastic bone formation and mineralization; the metal directly activates aminoacyl-tRNA synthetase, a rate-limiting enzyme at translational process of protein synthesis, in the cells, and it stimulates cellular protein synthesis. Zinc has been shown to stimulate gene expression of the transcription factors runt-related transcription factor 2 (Runx2) that is related to differentiation into osteoblastic cells. Moreover, zinc has been shown to inhibit osteoclastic bone resorption due to inhibiting osteoclast-like cell formation from bone marrow cells and stimulating apoptotic cell death of mature osteoclasts. Zinc has a suppressive effect on the receptor activator of nuclear factor (NF)-kappaB ligand (RANKL)-induced osteoclastogenesis. Zinc transporter has been shown to express in osteoblastic and osteoclastic cells. Zinc protein is involved in transcription. The intake of dietary zinc causes an increase in bone mass. beta-Alanyl-L: -histidinato zinc (AHZ) is a zinc compound, in which zinc is chelated to beta-alanyl-L: -histidine. The stimulatory effect of AHZ on bone formation is more intensive than that of zinc sulfate. Zinc acexamate has also been shown to have a potent-anabolic effect on bone. The oral administration of AHZ or zinc acexamate has the restorative effect on bone loss under various pathophysiologic conditions including aging, skeletal unloading, aluminum bone toxicity, calcium- and vitamin D-deficiency, adjuvant arthritis, estrogen deficiency, diabetes, and fracture healing. Zinc compounds may be designed as new supplementation factor in the prevention and therapy of osteoporosis.

Spatial regulation of controlled bioactive factor delivery for bone tissue engineering

PubMed Central

Samorezov, Julia E.; Alsberg, Eben

2015-01-01

Limitations of current treatment options for critical size bone defects create a significant clinical need for tissue engineered bone strategies. This review describes how control over the spatiotemporal delivery of growth factors, nucleic acids, and drugs and small molecules may aid in recapitulating signals present in bone development and healing, regenerating interfaces of bone with other connective tissues, and enhancing vascularization of tissue engineered bone. State-of-the-art technologies used to create spatially controlled patterns of bioactive factors on the surfaces of materials, to build up 3D materials with patterns of signal presentation within their bulk, and to pattern bioactive factor delivery after scaffold fabrication are presented, highlighting their applications in bone tissue engineering. As these techniques improve in areas such as spatial resolution and speed of patterning, they will continue to grow in value as model systems for understanding cell responses to spatially regulated bioactive factor signal presentation in vitro, and as strategies to investigate the capacity of the defined spatial arrangement of these signals to drive bone regeneration in vivo. PMID:25445719

Ontogenetic relationships between in vivo strain environment, bone histomorphometry and growth in the goat radius

PubMed Central

Main, Russell P

2007-01-01

Vertebrate long bone form, at both the gross and the microstructural level, is the result of many interrelated influences. One factor that is considered to have a significant effect on bone form is the mechanical environment experienced by the bone during growth. The work presented here examines the possible relationships between in vivo bone strains, bone geometry and histomorphology in the radii of three age/size groups of domestic goats. In vivo bone strain data were collected from the radii of galloping goats, and the regional cortical distribution of peak axial strain magnitudes, radial and circumferential strain gradients, and longitudinal strain rates related to regional patterns in cortical growth, porosity, remodelling and collagen fibre orientation. Although porosity and remodelling decreased and increased with age, respectively, these features showed no significant regional differences and did not correspond to regional patterns in the mechanical environment. Thicker regions of the radius's cortex were significantly related to high strain levels and higher rates of periosteal, but not endosteal, growth. However, cortical growth and strain environment were not significantly related. Collagen fibre orientation varied regionally, with a higher percentage of transverse fibres in the caudal region of the radius and primarily longitudinal fibres elsewhere, and, although consistent through growth, also did not generally correspond to regional strain patterns. Although strain magnitudes increased during ontogeny and regional strain patterns were variable over the course of a stride, mean regional strain patterns were generally consistent with growth, suggesting that regional growth patterns and histomorphology, in combination with external loads, may play some role in producing a relatively ‘predictable’ strain environment within the radius. It is further hypothesized that the absence of correlation between regional histomorphometric patterns and the measured strain environments is the result of the variable mechanical environment. However, the potential effects of other physiological and mechanical factors, such as skeletal metabolism and adjacent muscle insertions, that can influence the gross and microstructural morphology of the radius during ontogeny, cannot be ignored. PMID:17331177

Autocrine and/or paracrine insulin-like growth factor-I activity in skeletal muscle

NASA Technical Reports Server (NTRS)

Adams, Gregory R.

2002-01-01

Similar to bone, skeletal muscle responds and adapts to changes in loading state via mechanisms that appear to be intrinsic to the muscle. One of the mechanisms modulating skeletal muscle adaptation it thought to involve the autocrine and/or paracrine production of insulinlike growth factor-I. This brief review outlines components of the insulinlike growth factor-I system as it relates to skeletal muscle and provides the rationale for the theory that insulinlike growth factor-I is involved with muscle adaptation.

Nerve growth factor and associated nerve sprouting contribute to local mechanical hyperalgesia in a rat model of bone injury.

PubMed

Yasui, M; Shiraishi, Y; Ozaki, N; Hayashi, K; Hori, K; Ichiyanagi, M; Sugiura, Y

2012-08-01

To clarify the mechanism of tenderness after bone injury, we investigated changes in the withdrawal threshold to mechanical stimuli, nerve distribution and nerve growth factor (NGF)-expression in a rat model of bone injury without immobilization for bone injury healing. Rats were divided into three groups as follows: (1) rats incised in the skin and periosteum, followed by drilling a hole in the tibia [bone lesion group (BLG)]; (2) those incised in the skin and periosteum without bone drilling [periosteum lesion group (PLG)]; and (3) those incised in the skin [skin lesion group (SLG)]. Mechanical hyperalgesia continued for 28 days at a lesion in the BLG, 21 days in PLG and 5 days in SLG after treatments, respectively. Endochondral ossification was observed on days 5-28 in BLG and on days 5-21 in PLG. Nerve growth appeared in deep connective tissue (DCT) at day 28 in BLG. Nerve fibres increased in both cutaneous tissue and DCT at day 7 in PLG, but they were not found at day 28. Mechanical hyperalgesia accompanied with endochondral ossification and nerve fibres increasing at the lesion in both BLG and PLG. NGF was expressed in bone-regenerating cells during the bone injury healing. Anti-NGF and trk inhibitor K252a inhibited hyperalgesia in the different time course. This study shows that localized tenderness coincides with the bone healing and involves NGF expression and nerve sprouting after bone injury. The findings present underlying mechanisms and provide pathophysiological relevance of local tenderness to determination of bone fracture and its healing. © 2011 European Federation of International Association for the Study of Pain Chapters.

Hindlimb unloading of growing rats: a model for predicting skeletal changes during space flight.

PubMed

Morey-Holton, E R; Globus, R K

1998-05-01

A model that uses hindlimb unloading of rats was developed to study the consequences of skeletal unloading and reloading as occurs during and following space flight. Studies using the model were initiated two decades ago and further developed at National Aeronautics and Space Administration (NASA)-Ames Research Center. The model mimics some aspects of exposure to microgravity by removing weightbearing loads from the hindquarters and producing a cephalic fluid shift. Unlike space flight, the forelimbs remain loaded in the model, providing a useful internal control to distinguish between the local and systemic effects of hindlimb unloading. Rats that are hindlimb unloaded by tail traction gain weight at the same rate as pairfed controls, and glucocorticoid levels are not different from controls, suggesting that systemic stress is minimal. Unloaded bones display reductions in cancellous osteoblast number, cancellous mineral apposition rate, trabecular bone volume, cortical periosteal mineralization rate, total bone mass, calcium content, and maturation of bone mineral relative to controls. Subsequent studies reveal that these changes also occur in rats exposed to space flight. In hindlimb unloaded rats, bone formation rates and masses of unloaded bones decline relative to controls, while loaded bones do not change despite a transient reduction in serum 1,25-dihydroxyvitamin D (1,25D) concentrations. Studies using the model to evaluate potential countermeasures show that 1,25D, growth hormone, dietary calcium, alendronate, and muscle stimulation modify, but do not completely correct, the suppression of bone growth caused by unloading, whereas continuous infusion of transforming growth factor-beta2 or insulin-like growth factor-1 appears to protect against some of the bone changes caused by unloading. These results emphasize the importance of local as opposed to systemic factors in the skeletal response to unloading, and reveal the pivotal role that osteoblasts play in the response to gravitational loading. The hindlimb unloading model provides a unique opportunity to evaluate in detail the physiological and cellular mechanisms of the skeletal response to weightbearing loads, and has proven to be an effective model for space flight.

Hindlimb unloading of growing rats: a model for predicting skeletal changes during space flight

NASA Technical Reports Server (NTRS)

Morey-Holton, E. R.; Globus, R. K.

1998-01-01

A model that uses hindlimb unloading of rats was developed to study the consequences of skeletal unloading and reloading as occurs during and following space flight. Studies using the model were initiated two decades ago and further developed at National Aeronautics and Space Administration (NASA)-Ames Research Center. The model mimics some aspects of exposure to microgravity by removing weightbearing loads from the hindquarters and producing a cephalic fluid shift. Unlike space flight, the forelimbs remain loaded in the model, providing a useful internal control to distinguish between the local and systemic effects of hindlimb unloading. Rats that are hindlimb unloaded by tail traction gain weight at the same rate as pairfed controls, and glucocorticoid levels are not different from controls, suggesting that systemic stress is minimal. Unloaded bones display reductions in cancellous osteoblast number, cancellous mineral apposition rate, trabecular bone volume, cortical periosteal mineralization rate, total bone mass, calcium content, and maturation of bone mineral relative to controls. Subsequent studies reveal that these changes also occur in rats exposed to space flight. In hindlimb unloaded rats, bone formation rates and masses of unloaded bones decline relative to controls, while loaded bones do not change despite a transient reduction in serum 1,25-dihydroxyvitamin D (1,25D) concentrations. Studies using the model to evaluate potential countermeasures show that 1,25D, growth hormone, dietary calcium, alendronate, and muscle stimulation modify, but do not completely correct, the suppression of bone growth caused by unloading, whereas continuous infusion of transforming growth factor-beta2 or insulin-like growth factor-1 appears to protect against some of the bone changes caused by unloading. These results emphasize the importance of local as opposed to systemic factors in the skeletal response to unloading, and reveal the pivotal role that osteoblasts play in the response to gravitational loading. The hindlimb unloading model provides a unique opportunity to evaluate in detail the physiological and cellular mechanisms of the skeletal response to weightbearing loads, and has proven to be an effective model for space flight.

Skeletal maturity and growth of adolescent mothers: relationship to pregnancy outcome.

PubMed

Stevens-Simon, C; McAnarney, E R

1993-09-01

The purpose of this study was to evaluate the relationship between postpartum maternal bone age and the incidence of obstetric and neonatal complications in adolescent pregnancies. Bone age determinations were obtained on 93 poor, black 12- through 18-year-old adolescents during the puerperium. Results showed maternal bone ages ranging from 15 to 18 years; bone age was less than 18 years in 64 (68.8%) of the 93 adolescent mothers we studied. Maternal bone age correlated significantly with maternal chronologic age (r = 0.70) and prepregnant body size (r = 0.25) but did not correlate with total maternal weight gain and growth during pregnancy, the incidence of obstetric and neonatal complications, or infant birth weight and gestational age. Our findings suggest that many young, pregnant adolescents have the potential to grow during and after pregnancy, but do not support the hypothesis that ongoing maternal growth is an obstetric risk factor during adolescence.

Potential role of fibroblast growth factor in enhancement of fracture healing.

PubMed

Radomsky, M L; Thompson, A Y; Spiro, R C; Poser, J W

1998-10-01

Fibroblast growth factors are present in significant amounts in bone and several studies have suggested that they may be involved in normal fracture healing. It is well established that fibroblast growth factors have mitogenic and angiogenic activity on mesoderm and neuroectoderm derived cells. Of particular interest as a member of the fibroblast growth factor family, basic fibroblast growth factor stimulates mitogenesis, chemotaxis, differentiation, and angiogenesis. It also plays an important role in the development of vascular, nervous, and skeletal systems, promotes the maintenance and survival of certain tissues, and stimulates wound healing and tissue repair. Animal studies have shown that the direct injection of fibroblast growth factor into fresh fractures stimulates callus formation, which provides mechanical stability to the fracture, accelerates healing, and restores competence. The matrix used to present the fibroblast growth factor at the fracture site plays a critical role in the effectiveness of the treatment. The evaluation of injectable basic fibroblast growth factor in a sodium hyaluronate gel for its effectiveness in stimulating fracture healing is described. When applied directly into a freshly created fracture in the rabbit fibula, a single injection of the basic fibroblast growth factor and hyaluronan results in the stimulation of callus formation, increased bone formation, and earlier restoration of mechanical strength at the fracture site. The hyaluronan gel serves as a reservoir that sequesters the basic fibroblast growth factor at the injection site for the length of time necessary to create an environment conducive to fracture healing. It is concluded that basic fibroblast growth factor and sodium hyaluronate act synergistically to accelerate fracture healing and that the combination is suitable for clinical evaluation as a therapy in fracture treatment.

Growth hormone and bone health.

PubMed

Bex, Marie; Bouillon, Roger

2003-01-01

Growth hormone (GH) and insulin-like growth factor-I have major effects on growth plate chondrocytes and all bone cells. Untreated childhood-onset GH deficiency (GHD) markedly impairs linear growth as well as three-dimensional bone size. Adult peak bone mass is therefore about 50% that of adults with normal height. This is mainly an effect on bone volume, whereas true bone mineral density (BMD; g/cm(3)) is virtually normal, as demonstrated in a large cohort of untreated Russian adults with childhood-onset GHD. The prevalence of fractures in these untreated childhood-onset GHD adults was, however, markedly and significantly increased in comparison with normal Russian adults. This clearly indicates that bone mass and bone size matter more than true bone density. Adequate treatment with GH can largely correct bone size and in several studies also bone mass, but it usually requires more than 5 years of continuous treatment. Adult-onset GHD decreases bone turnover and results in a mild deficit, generally between -0.5 and -1.0 z-score, in bone mineral content and BMD of the lumbar spine, radius and femoral neck. Cross-sectional surveys and the KIMS data suggest an increased incidence of fractures. GH replacement therapy increases bone turnover. The three controlled studies with follow-up periods of 18 and 24 months demonstrated a modest increase in BMD of the lumbar spine and femoral neck in male adults with adult-onset GHD, whereas no significant changes in BMD were observed in women. GHD, whether childhood- or adult-onset, impairs bone mass and strength. Appropriate substitution therapy can largely correct these deficiencies if given over a prolonged period. GH therapy for other bone disorders not associated with primary GHD needs further study but may well be beneficial because of its positive effects on the bone remodelling cycle. Copyright 2003 S. Karger AG, Basel

The Effect of Simvastatin on mRNA Expression of Transforming Growth Factor-β1, Bone Morphogenetic Protein-2 and Vascular Endothelial Growth Factor in Tooth Extraction Socket

PubMed Central

Liu, Chang; Wu, Zhe; Sun, Hong-chen

2009-01-01

Aim To determine the effect of local simvastatin application on the mRNA expression level of transforming growth factor-β1 (TGF-β1), bone morphogenetic protein-2 (BMP-2) and vascular endothelial growth factor (VEGF) in the tooth sockets of rat. Methodology Forty-eight male Wistar rats were randomly divided into experimental and control groups (n=24). Polylactic acid/polyglycolic acid copolymer carriers, with or without simvastatin, were implanted into extraction sockets of right mandibular incisors. The expression of TGF-β1, BMP-2 and VEGF mRNA was determined by in situ hybridization in the tooth extraction socket at five days, one week, two weeks and four weeks after implantation. Results The fusiform stroma cells in the tooth extraction socket began to express TGF-β1, BMP-2 and VEGF mRNA in both experimental and control groups from one week after tooth extraction until the end of experiment. The expression of TGF-β1 and BMP-2 mRNA in the experimental group was significantly up-regulated after one, two and four weeks, and expression of VEGF mRNA was significantly increased after one and two weeks compared with that in the control group. Conclusion The findings indicate that local administration of simvastatin can influence alveolar bone remodeling by regulating the expression of a school of growth factors which are crucial to osteogenesis in the tooth extraction socket. PMID:20687301

Synthetic design of growth factor sequestering extracellular matrix mimetic hydrogel for promoting in vivo bone formation.

PubMed

Yan, Hong Ji; Casalini, Tommaso; Hulsart-Billström, Gry; Wang, Shujiang; Oommen, Oommen P; Salvalaglio, Matteo; Larsson, Sune; Hilborn, Jöns; Varghese, Oommen P

2018-04-01

Synthetic scaffolds that possess an intrinsic capability to protect and sequester sensitive growth factors is a primary requisite for developing successful tissue engineering strategies. Growth factors such as recombinant human bone morphogenetic protein-2 (rhBMP-2) is highly susceptible to premature degradation and to provide a meaningful clinical outcome require high doses that can cause serious side effects. We discovered a unique strategy to stabilize and sequester rhBMP-2 by enhancing its molecular interactions with hyaluronic acid (HA), an extracellular matrix (ECM) component. We found that by tuning the initial protonation state of carboxylic acid residues of HA in a covalently crosslinked hydrogel modulate BMP-2 release at physiological pH by minimizing the electrostatic repulsion and maximizing the Van der Waals interactions. At neutral pH, BMP-2 release is primarily governed by Fickian diffusion, whereas at acidic pH both diffusion and electrostatic interactions between HA and BMP-2 become important as confirmed by molecular dynamics simulations. Our results were also validated in an in vivo rat ectopic model with rhBMP-2 loaded hydrogels, which demonstrated superior bone formation with acidic hydrogel as compared to the neutral counterpart. We believe this study provides new insight on growth factor stabilization and highlights the therapeutic potential of engineered matrices for rhBMP-2 delivery and may help to curtail the adverse side effects associated with the high dose of the growth factor. Copyright © 2018 Elsevier Ltd. All rights reserved.

Association of Angiotensin Converting Enzyme I/D and α-actinin-3 R577X Genotypes with Growth Factors and Physical Fitness in Korean Children

PubMed Central

Ahn, Nayoung; Cheun, Wookwang; Byun, Jayoung; Joo, Youngsik

2015-01-01

This study analyzed the differences in aerobic and anaerobic exercise ability and growth-related indicators, depending on the polymorphism of the ACE and the ACTN3 genes, to understand the genetic influence of exercise ability in the growth process of children. The subjects of the study consisted of elementary school students (n=856, age 10.32±0.07 yr). The anthropometric parameters, physical fitness and growth factors were compared among groups of the ACE I/D or the ACTN3 R577X polymorphisms. There were no significant differences between the anthropometric parameters, physical fitness and growth factors for the ACE gene ID or the ACTN3 gene R577X polymorphism. However, the DD type of ACE gene was highest in the side step test (p<0.05), and the DD type was significantly higher than the II+ID type (p<0.05) in the early bone age. The combined group of the ACE gene II+ID and the ACTN3 gene XX type significantly showed lower early bone age (p< 0.05). This study did not find any individual or compounding effects of the polymorphism in the ACE I/D or the ACTN3 R577X polymorphisms on the anthropometric parameters, physical fitness and growth factors of Korean children. However, the exercise experience and the DD type of the ACE gene may affect the early maturity of the bones. PMID:25729275

Angiogenesis after sintered bone implantation in rat parietal bone.

PubMed

Ohtsubo, S; Matsuda, M; Takekawa, M

2003-01-01

We studied the effect of bone substitutes on revascularization and the restart of blood supply after sintered bone implantation in comparison with synthetic hydroxyapatite implantation and fresh autogenous bone transplantation (control) in rat parietal bones. Methods for the study included the microvascular corrosion cast method and immunohistochemical techniques were also used. The revascularization of the control group was the same as that for usual wound healing in the observations of the microvascular corrosion casts. The sintered bone implantation group was quite similar to that of the control group. In the synthetic hydroxyapatite group, immature newly-formed blood vessels existed even on the 21st day after implantation and the physiological process of angiogenesis was interrupted. Immunohistochemically, vascular endothelial growth factor (VEGF), which activates angiogenesis, appeared at the early stages of both the control group and the sintered bone implantation group. VEGF reduced parallel with the appearance of the transforming growth factor factor-beta-1 (TGF-beta-1), which obstructs angiogenesis, and the angiogenesis passed gradually into the mature stage. In the hydroxyapatite implantation group, TGF-beta-1 appeared at the early stage of the implants. The appearance of VEGF lagged and it existed around the pores of hydroxyapatite even on the 21st day of the implantation. Proliferation and wandering of endothelial cells continued without any maturing of the vessels. These findings suggest that the structure and the components of the implant material affect angiogenesis after implantation as well as new bone formation.

Extracellular vesicles released from mesenchymal stromal cells stimulate bone growth in osteogenesis imperfecta.

PubMed

Otsuru, Satoru; Desbourdes, Laura; Guess, Adam J; Hofmann, Ted J; Relation, Theresa; Kaito, Takashi; Dominici, Massimo; Iwamoto, Masahiro; Horwitz, Edwin M

2018-01-01

Systemic infusion of mesenchymal stromal cells (MSCs) has been shown to induce acute acceleration of growth velocity in children with osteogenesis imperfecta (OI) despite minimal engraftment of infused MSCs in bones. Using an animal model of OI we have previously shown that MSC infusion stimulates chondrocyte proliferation in the growth plate and that this enhanced proliferation is also observed with infusion of MSC conditioned medium in lieu of MSCs, suggesting that bone growth is due to trophic effects of MSCs. Here we sought to identify the trophic factor secreted by MSCs that mediates this therapeutic activity. To examine whether extracellular vesicles (EVs) released from MSCs have therapeutic activity, EVs were isolated from MSC conditioned medium by ultracentrifugation. To further characterize the trophic factor, RNA or microRNA (miRNA) within EVs was depleted by either ribonuclease (RNase) treatment or suppressing miRNA biogenesis in MSCs. The functional activity of these modified EVs was evaluated using an in vitro chondrocyte proliferation assay. Finally, bone growth was evaluated in an animal model of OI treated with EVs. We found that infusion of MSC-derived EVs stimulated chondrocyte proliferation in the growth plate, resulting in improved bone growth in a mouse model of OI. However, infusion of neither RNase-treated EVs nor miRNA-depleted EVs enhanced chondrocyte proliferation. MSCs exert therapeutic effects in OI by secreting EVs containing miRNA, and EV therapy has the potential to become a novel cell-free therapy for OI that will overcome some of the current limitations in MSC therapy. Copyright © 2017 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

Vertical ridge augmentation using an equine bone and collagen block infused with recombinant human platelet-derived growth factor-BB: a randomized single-masked histologic study in non-human primates.

PubMed

Nevins, Myron; Al Hezaimi, Khalid; Schupbach, Peter; Karimbux, Nadeem; Kim, David M

2012-07-01

This study tests the effectiveness of hydroxyapatite and collagen bone blocks of equine origin (eHAC), infused with recombinant human platelet-derived growth factor-BB (rhPDGF-BB), to augment localized posterior mandibular defects in non-human primates (Papio hamadryas). Bilateral critical-sized defects simulating severe atrophy were created at the time of the posterior teeth extraction. Test and control blocks (without growth factor) were randomly grafted into the respective sites in each non-human primate. All sites exhibited vertical ridge augmentation, with physiologic hard- and soft-tissue integration of the blocks when clinical and histologic examinations were done at 4 months after the vertical ridge augmentation procedure. There was a clear, although non-significant, tendency to increased regeneration in the test sites. As in the first two preclinical studies in this series using canines, experimental eHAC blocks infused with rhPDGF-BB proved to be a predictable and technically viable method to predictably regenerate bone and soft tissue in critical-sized defects. This investigation supplies additional evidence that eHAC blocks infused with rhPDGF-BB growth factor is a predictable and technically feasible option for vertical augmentation of severely resorbed ridges.

Positive modulator of bone morphogenic protein-2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zamora, Paul O.; Pena, Louis A.; Lin, Xinhua

Compounds of the present invention of formula I and formula II are disclosed in the specification and wherein the compounds are modulators of Bone Morphogenic Protein activity. Compounds are synthetic peptides having a non-growth factor heparin binding region, a linker, and sequences that bind specifically to a receptor for Bone Morphogenic Protein. Uses of compounds of the present invention in the treatment of bone lesions, degenerative joint disease and to enhance bone formation are disclosed.

Positive modulator of bone morphogenic protein-2

DOEpatents

Zamora, Paul O [Gaithersburg, MD; Pena, Louis A [Poquott, NY; Lin, Xinhua [Plainview, NY; Takahashi, Kazuyuki [Germantown, MD

2009-01-27

Compounds of the present invention of formula I and formula II are disclosed in the specification and wherein the compounds are modulators of Bone Morphogenic Protein activity. Compounds are synthetic peptides having a non-growth factor heparin binding region, a linker, and sequences that bind specifically to a receptor for Bone Morphogenic Protein. Uses of compounds of the present invention in the treatment of bone lesions, degenerative joint disease and to enhance bone formation are disclosed.

P38 MAPK / beta-catenin canonical wnt signaling mediated bone formation effects of blueberries

USDA-ARS?s Scientific Manuscript database

Appropriate nutrition is one of the critical factors that influences bone development. We studied the effects of dietary blueberry supplementation on bone growth in weanling rats. Weanling male and female rats were fed AIN-93G semi-purified diets supplemented with 10% whole blueberry powder for 14 a...

A study of stress-free living bone and its application to space flight

NASA Technical Reports Server (NTRS)

Leblanc, A.; Spira, M.

1983-01-01

Observations of animals and human subjects in weightless space flight (Skylab and COSMOS) document altered bone metabolism. Bone metabolism is affected by a number of local and systemic factors. The calcification and growth of transplanted bone is independent of local muscle, nervous, and mechanical forces; therefore, transplanted bone would provide data on the role of local vs. systematic factors. Bone metabolism in living transplanted bone, devoid of stress, was investigated as a possible tool for the investigation of countermeasures against disuse bone loss. An animal model using Sprague-Dawley rats was developed for transplantation of femur bone tissue on a nutrient vascular pedicel. The long term course of these implants was assessed through the measure of regional and total bone mineral, blood flow, and methylene diphosphonate (MDP) uptake. Clomid, an estrogen agonist/antagonist, was shown to protect bone from disuse loss of minerals by retarding trabecular and cortical resorption.

Platelet-rich plasma derived growth factors contribute to stem cell differentiation in musculoskeletal regeneration

NASA Astrophysics Data System (ADS)

Qian, Yun; Han, Qixin; Chen, Wei; Song, Jialin; Zhao, Xiaotian; Ouyang, Yuanming; Yuan, Weien; Fan, Cunyi

2017-10-01

Stem cell treatment and platelet-rich plasma (PRP) therapy are two significant issues in regenerative medicine. Stem cells such as bone marrow mesenchymal stem cells, adipose-derived stem cells and periodontal ligament stem cells can be successfully applied in the field of tissue regeneration. PRP, a natural product isolated from whole blood, can secrete multiple growth factors (GFs) for regulating physiological activities. These GFs can stimulate proliferation and differentiation of different stem cells in injury models. Therefore, combination of both agents receives wide expectations in regenerative medicine, especially in bone, cartilage and tendon repair. In this review, we thoroughly discussed the interaction and underlying mechanisms of platelet-rich plasma derived growth factors with stem cells, and assessed their functions in cell differentiation for musculoskeletal regeneration.

Bone Growth, Mechanical Stimulus and IGF-1

DTIC Science & Technology

2006-10-01

suffer a bone fracture by the time they reach skeletal maturity. While strenuous physical activity and occupational hazards are key factors in the...females with low bone density. Ultimately, this information could be of great benefit to enhance musculoskeletal development and decrease the risk ...pathogenesis of these fractures , several studies indicate that teenagers who sustain fractures also have decreased bone mass. Therefore, the use of low

Bone healing in 2016

PubMed Central

Buza, John A.; Einhorn, Thomas

2016-01-01

Summary Delayed fracture healing and nonunion occurs in up to 5–10% of all fractures, and can present a challenging clinical scenario for the treating physician. Methods for the enhancement of skeletal repair may benefit patients that are at risk of, or have experienced, delayed healing or nonunion. These methods can be categorized into either physical stimulation therapies or biological therapies. Physical stimulation therapies include electrical stimulation, low-intensity pulsed ultrasonography, or extracorporeal shock wave therapy. Biological therapies can be further classified into local or systemic therapy based on the method of delivery. Local methods include autologous bone marrow, autologous bone graft, fibroblast growth factor-2, platelet-rich plasma, platelet-derived growth factor, and bone morphogenetic proteins. Systemic therapies include parathyroid hormone and bisphosphonates. This article reviews the current applications and supporting evidence for the use of these therapies in the enhancement of fracture healing. PMID:27920804

The potential role of the osteoblast in the development of periprosthetic osteolysis: review of in vitro osteoblast responses to wear debris, corrosion products, and cytokines and growth factors.

PubMed

Vermes, C; Glant, T T; Hallab, N J; Fritz, E A; Roebuck, K A; Jacobs, J J

2001-12-01

Limited information is available on the responses of osteoblasts to wear debris, corrosion products, and cytokines and on the roles of altered osteoblast functions in the development of periprosthetic bone loss. Wear debris-challenged osteoblasts exhibit altered functions resulting in the loss of their capacity to produce bone matrix and to replace the resorbed bone. Also, osteoblasts may secrete cytokines, which act in a paracrine fashion to recruit inflammatory cells into the periprosthetic space and to stimulate osteoclastic bone resorption. These effects may be mediated in part by ionic metal dissolution products. We review the mechanisms by which altered osteoblast functions, in response to particulate wear debris, corrosion products, and cytokines and growth factors, may contribute to the development and the progression of periprosthetic osteolysis.

An osteoblast-derived proteinase controls tumor cell survival via TGF-beta activation in the bone microenvironment.

PubMed

Thiolloy, Sophie; Edwards, James R; Fingleton, Barbara; Rifkin, Daniel B; Matrisian, Lynn M; Lynch, Conor C

2012-01-01

Breast to bone metastases frequently induce a "vicious cycle" in which osteoclast mediated bone resorption and proteolysis results in the release of bone matrix sequestered factors that drive tumor growth. While osteoclasts express numerous proteinases, analysis of human breast to bone metastases unexpectedly revealed that bone forming osteoblasts were consistently positive for the proteinase, MMP-2. Given the role of MMP-2 in extracellular matrix degradation and growth factor/cytokine processing, we tested whether osteoblast derived MMP-2 contributed to the vicious cycle of tumor progression in the bone microenvironment. To test our hypothesis, we utilized murine models of the osteolytic tumor-bone microenvironment in immunocompetent wild type and MMP-2 null mice. In longitudinal studies, we found that host MMP-2 significantly contributed to tumor progression in bone by protecting against apoptosis and promoting cancer cell survival (caspase-3; immunohistochemistry). Our data also indicate that host MMP-2 contributes to tumor induced osteolysis (μCT, histomorphometry). Further ex vivo/in vitro experiments with wild type and MMP-2 null osteoclast and osteoblast cultures identified that 1) the absence of MMP-2 did not have a deleterious effect on osteoclast function (cd11B isolation, osteoclast differentiation, transwell migration and dentin resorption assay); and 2) that osteoblast derived MMP-2 promoted tumor survival by regulating the bioavailability of TGFβ, a factor critical for cell-cell communication in the bone (ELISA, immunoblot assay, clonal and soft agar assays). Collectively, these studies identify a novel "mini-vicious cycle" between the osteoblast and metastatic cancer cells that is key for initial tumor survival in the bone microenvironment. In conclusion, the findings of our study suggest that the targeted inhibition of MMP-2 and/or TGFβ would be beneficial for the treatment of bone metastases.

The Effects of Hematopoietic Growth Factors on Neurite Outgrowth

PubMed Central

Su, Ye; Cui, Lili; Piao, Chunshu; Li, Bin; Zhao, Li-Ru

2013-01-01

Stem cell factor (SCF) and granulocyte colony-stimulating factor (G-CSF) are initially discovered as the essential hematopoietic growth factors regulating bone marrow stem cell proliferation and differentiation, and SCF in combination with G-CSF (SCF+G-CSF) has synergistic effects on bone marrow stem cell mobilization. In this study we have determined the effect of SCF and G-CSF on neurite outgrowth in rat cortical neurons. Using molecular and cellular biology and live cell imaging approaches, we have revealed that receptors for SCF and G-CSF are expressed on the growth core of cortical neurons, and that SCF+G-CSF synergistically enhances neurite extension through PI3K/AKT and NFκB signaling pathways. Moreover, SCF+G-CSF induces much greater NFκB activation, NFκB transcriptional binding and brain-derived neurotrophic factor (BDNF) production than SCF or G-CSF alone. In addition, we have also observed that BDNF, the target gene of NFκB, is required for SCF+G-CSF-induced neurite outgrowth. These data suggest that SCF+G-CSF has synergistic effects to promote neurite growth. This study provides new insights into the contribution of hematopoietic growth factors in neuronal plasticity. PMID:24116056

Mesenchymal Stem Cells From Bone Marrow, Adipose Tissue, and Lung Tissue Differentially Mitigate Lung and Distal Organ Damage in Experimental Acute Respiratory Distress Syndrome.

PubMed

Silva, Johnatas D; Lopes-Pacheco, Miquéias; Paz, Ana H R; Cruz, Fernanda F; Melo, Elga B; de Oliveira, Milena V; Xisto, Débora G; Capelozzi, Vera L; Morales, Marcelo M; Pelosi, Paolo; Cirne-Lima, Elizabeth; Rocco, Patricia R M

2018-02-01

Mesenchymal stem cells-based therapies have shown promising effects in experimental acute respiratory distress syndrome. Different mesenchymal stem cells sources may result in diverse effects in respiratory diseases; however, there is no information regarding the best source of mesenchymal stem cells to treat pulmonary acute respiratory distress syndrome. We tested the hypothesis that mesenchymal stem cells derived from bone marrow, adipose tissue, and lung tissue would lead to different beneficial effects on lung and distal organ damage in experimental pulmonary acute respiratory distress syndrome. Animal study and primary cell culture. Laboratory investigation. Seventy-five Wistar rats. Wistar rats received saline (control) or Escherichia coli lipopolysaccharide (acute respiratory distress syndrome) intratracheally. On day 2, acute respiratory distress syndrome animals were further randomized to receive saline or bone marrow, adipose tissue, or lung tissue mesenchymal stem cells (1 × 10 cells) IV. Lung mechanics, histology, and protein levels of inflammatory mediators and growth factors were analyzed 5 days after mesenchymal stem cells administration. RAW 264.7 cells (a macrophage cell line) were incubated with lipopolysaccharide followed by coculture or not with bone marrow, adipose tissue, and lung tissue mesenchymal stem cells (10 cells/mL medium). Regardless of mesenchymal stem cells source, cells administration improved lung function and reduced alveolar collapse, tissue cellularity, collagen, and elastic fiber content in lung tissue, as well as decreased apoptotic cell counts in liver. Bone marrow and adipose tissue mesenchymal stem cells administration also reduced levels of tumor necrosis factor-α, interleukin-1β, keratinocyte-derived chemokine, transforming growth factor-β, and vascular endothelial growth factor, as well as apoptotic cell counts in lung and kidney, while increasing expression of keratinocyte growth factor in lung tissue. Additionally, mesenchymal stem cells differently modulated the secretion of biomarkers by macrophages depending on their source. Mesenchymal stem cells from different sources led to variable responses in lungs and distal organs. Bone marrow and adipose tissue mesenchymal stem cells yielded greater beneficial effects than lung tissue mesenchymal stem cells. These findings may be regarded as promising in clinical trials.

[Effect of vascular endothelial growth factor and tumor necrosis factor receptor for treatment of avascular necrosis of the femoral head in rabbits].

PubMed

Hu, Zhi-ming; Zhou, Ming-qian; Gao, Ji-min

2008-12-01

To evaluate the therapeutic effect of vascular endothelial growth factor (VEGF) and tumor necrosis factor receptor (TNFR) on avascular necrosis of the femoral head in rabbits. Avascular necrosis of the femoral head was induced in 26 New Zealand white rabbits by injections of horse serum and prednisolone. The rabbits were then divided into VEGF/TNFR treatment group, VEGF treatment group, and untreated model group, with another 4 normal rabbits as the normal control group. In the two treatment groups, the therapeutic agents were injected percutaneously into the femoral head. Enzyme-linked immunosorbent assay was performed to determine the concentration of TNF-alpha in rabbit serum followed by pathological examination of the changes in the bone tissues, bone marrow hematopoietic tissue and the blood vessels in the femoral head. Compared with the model group, the rabbits with both VEGF and TNFR treatment showed decreased serum concentration of TNF-alpha with obvious new vessel formation, decreased empty bone lacunae in the femoral head and hematopoietic tissue proliferation in the bone marrow cavity. Percutaneous injection of VEGF and TNFR into the femoral head can significantly enhance bone tissue angiogenesis and ameliorate osteonecrosis in rabbits with experimental femoral head necrosis.

Horizontal Guided Bone Regeneration in the Esthetic Area with rhPDGF-BB and Anorganic Bovine Bone Graft: A Case Report.

PubMed

Chiantella, Giovanni Carlo

2016-01-01

The present article describes the treatment given to a patient who underwent horizontal ridge augmentation surgery in the maxillary anterior area due to the premature loss of the maxillary central incisors. The complete dehiscence of the buccal plate was detected after elevation of mucoperiosteal flaps. The lesion was overfilled with deproteinized bovine xenograft particles combined with recombinant human platelet-derived growth factor BB (rhPDGF-BB) and covered with a porcine collagen barrier hydrated with the same growth factor. The soft tissues healed with no adverse complications. After 12 months, reentry surgery was carried out to place endosseous implants. Complete bone regeneration with the presence of bone-like tissue was observed. Cross-sectional computed tomography scan images confirmed integration of the bone graft and reconstruction of the lost hard tissue volume. The implants were inserted in an optimal three-dimensional position, thus facilitating esthetic restoration. Two years after insertion of final crowns, cone beam computed tomography scans displayed the stability of regenerated hard tissues around the implants. Controlled clinical studies are necessary to determine the benefit of hydrating bovine bone particles and collagen barriers with rhPDGF-BB for predictable bone regeneration of horizontal lesions.

The influence of stereolithographic scaffold architecture and composition on osteogenic signal expression with rat bone marrow stromal cells

PubMed Central

Kim, Kyobum; Dean, David; Wallace, Jonathan; Breithaupt, Rob; Mikos, Antonios G.; Fisher, John P.

2011-01-01

Scaffold design parameters, especially physical construction factors such as mechanical stiffness of substrate materials, pore size of 3D porous scaffolds, and channel geometry, are known to influence the osteogenic signal expression and subsequent differentiation of a transplanted cell population. In this study of photocrosslinked poly(propylene fumarate) (PPF) and diethyl fumarate (DEF) scaffolds, the effect of DEF incorporation ratio and pore size on the osteogenic signal expression of rat bone marrow stromal cells (BMSCs) was investigated. Results demonstrated that DEF concentrations and pore sizes that led to increased scaffold mechanical stiffness also upregulated osteogenic signal expression, including bone morphogenic protein-2 (BMP-2), fibroblast growth factors-2 (FGF-2), transforming growth factor-β1 (TGF-β1), vascular endothelial growth factor (VEGF), and Runx2 transcriptional factor. Similar scaffold fabrication parameters supported rapid BMSC osteoblastic differentiation, as demonstrated by increased alkaline phosphatase (ALP) and osteocalcin expression. When scaffolds with random architecture, fabricated by porogen leaching, were compared to those with controlled architecture, fabricated by stereolithography (SLA), results showed that SLA scaffolds with the highly permeable and porous channels also have significantly higher expression of FGF-2, TGF-β1, and VEGF. Subsequent ALP expression and osteopontin secretion were also significantly increased in SLA scaffolds. Based upon these results, we conclude that scaffold properties provided by additive manufacturing techniques such as SLA fabrication, particularly increased mechanical stiffness and high permeability, may stimulate dramatic BMSC responses that promote rapid bone tissue regeneration. PMID:21396709

Inflammation and linear bone growth: the inhibitory role of SOCS2 on GH/IGF-1 signaling.

PubMed

Farquharson, Colin; Ahmed, S Faisal

2013-04-01

Linear bone growth is widely recognized to be adversely affected in children with chronic kidney disease (CKD) and other chronic inflammatory disorders. The growth hormone (GH)/insulin-like growth factor-1 (IGF-1) pathway is anabolic to the skeleton and inflammatory cytokines compromise bone growth through a number of different mechanisms, which include interference with the systemic as well as the tissue-level GH/IGF-1 axis. Despite attempts to promote growth and control disease, there are an increasing number of reports of the persistence of poor growth in a substantial proportion of patients receiving rhGH and/or drugs that block cytokine action. Thus, there is an urgent need to consider better and alternative forms of therapy that are directed specifically at the mechanism of the insult which leads to abnormal bone health. Suppressor of cytokine signaling 2 (SOCS2) expression is increased in inflammatory conditions including CKD, and is a recognized inhibitor of GH signaling. Therefore, in this review, we will focus on the premise that SOCS2 signaling represents a critical pathway in growth plate chondrocytes through which pro-inflammatory cytokines alter both GH/IGF-1 signaling and cellular function.

Constitutive production and thrombin-induced release of vascular endothelial growth factor by human megakaryocytes and platelets

PubMed Central

Möhle, Robert; Green, David; Moore, Malcolm A. S.; Nachman, Ralph L.; Rafii, Shahin

1997-01-01

We have shown that coculture of bone marrow microvascular endothelial cells with hematopoietic progenitor cells results in proliferation and differentiation of megakaryocytes. In these long-term cultures, bone marrow microvascular endothelial cell monolayers maintain their cellular integrity in the absence of exogenous endothelial growth factors. Because this interaction may involve paracrine secretion of cytokines, we evaluated megakaryocytic cells for secretion of vascular endothelial growth factor (VEGF). Megakaryocytes (CD41a+) were generated by ex vivo expansion of hematopoietic progenitor cells with kit-ligand and thrombopoietin for 10 days and further purified with immunomagnetic microbeads. Using reverse transcription–PCR, we showed that megakaryocytic cell lines (Dami, HEL) and purified megakaryocytes expressed mRNA of the three VEGF isoforms (121, 165, and 189 amino acids). Large quantities of VEGF (>1 ng/106 cells/3 days) were detected in the supernatant of Dami cells, ex vivo-generated megakaryocytes, and CD41a+ cells isolated from bone marrow. The constitutive secretion of VEGF by CD41a+ cells was stimulated by growth factors of the megakaryocytic lineage (interleukin 3, thrombopoietin). Western blotting of heparin–Sepharose-enriched supernatant mainly detected the isoform VEGF165. In addition, immunohistochemistry showed intracytoplasmic VEGF in polyploid megakaryocytes. Thrombin stimulation of megakaryocytes and platelets resulted in rapid release of VEGF within 30 min. We conclude that human megakaryocytes produce and secrete VEGF in an inducible manner. Within the bone marrow microenvironment, VEGF secreted by megakaryocytes may contribute to the proliferation of endothelial cells. VEGF delivered to sites of vascular injury by activated platelets may initiate angiogenesis. PMID:9012841

Effect of erythropoietin on mesenchymal stem cell differentiation and secretion in vitro in an acute kidney injury microenvironment.

PubMed

Liu, N M; Tian, J; Wang, W W; Han, G F; Cheng, J; Huang, J; Zhang, J Y

2013-02-28

We investigated the effect of erythropoietin (EPO) on differentiation and secretion of bone marrow-derived mesenchymal stem cells in an acute kidney injury microenvironment. Acute kidney injury mouse models were prepared. Both renal cortices were then immediately collected to produce the ischemia/reperfusion kidney homogenate supernatant. The morphological and ultrastructural changes in the cells were observed using an inverted microscope and a transmission electron microscope. Cytokeratin-18 was detected using flow cytometry. Bone morphogenetic protein-7 levels, hepatocyte growth factor, and vascular endothelial growth factor in the culture medium were detected using an enzyme-linked immunosorbent assay. The cells had high CD29 and CD44 expression, as well as low CD34 and CD45 expression. More round and oval cells with cobble-like appearances were observed after EPO treatment. In addition, an increase in the number of rough endoplasmic reticula, lysosomes, and mitochondria was observed in the cytoplasm; the intercellular junction peculiar to epithelial cells was also seen on the cell surface. After treatment with ischemia/reperfusion kidney homogenate supernatant, cytokeratin-18 expression increased significantly and EPO could magnify its expression. Bone morphogenetic protein-7 levels, hepatocyte growth factor, and vascular endothelial growth factor levels after treatment with ischemia/reperfusion kidney homogenate supernatant significantly decreased, whereas EPO increased the cytokine secretion. The acute kidney injury microenvironment can induce the bone marrow-derived mesenchymal stem cells to partially differentiate into renal tubular epithelium-shaped cells, but weaken their secretion function. EPO intervention can boost up their differentiation function and reverse their low secretion effect.

Fabrication of a three-dimensional β-tricalcium-phosphate/gelatin containing chitosan-based nanoparticles for sustained release of bone morphogenetic protein-2: Implication for bone tissue engineering.

PubMed

Bastami, Farshid; Paknejad, Zahrasadat; Jafari, Maissa; Salehi, Majid; Rezai Rad, Maryam; Khojasteh, Arash

2017-03-01

Fabrication of an ideal scaffold having proper composition, physical structure and able to have sustained release of growth factors still is challenging for bone tissue engineering. Current study aimed to design an appropriate three-dimensional (3-D) scaffold with suitable physical characteristics, including proper compressive strength, degradation rate, porosity, and able to sustained release of bone morphogenetic protein-2 (BMP2), for bone tissue engineering. A highly porous 3-D β-tricalcium phosphate (β-TCP) scaffolds, inside of which two perpendicular canals were created, was fabricated using foam-casting technique. Then, scaffolds were coated with gelatin layer. Next, BMP2-loaded chitosan (CS) nanoparticles were dispersed into collagen hydrogel and filled into the scaffold canals. Physical characteristics of fabricated constructs were evaluated. Moreover, the capability of given construct for bone regeneration has been evaluated in vitro in interaction with human buccal fat pad-derived stem cells (hBFPSCs). The results showed that gelatin-coated TCP scaffold with rhBMP2 delivery system not only could act as a mechanically and biologically compatible framework, but also act as an osteoinductive graft by sustained delivering of rhBMP2 in a therapeutic window for differentiation of hBFPSCs towards the osteoblast lineage. The proposed scaffold model can be suggested for delivering of cells and other growth factors such as vascular endothelial growth factor (VEGF), alone or in combination, for future investigations. Copyright © 2016 Elsevier B.V. All rights reserved.

A living thick nanofibrous implant bifunctionalized with active growth factor and stem cells for bone regeneration

PubMed Central

Eap, Sandy; Keller, Laetitia; Schiavi, Jessica; Huck, Olivier; Jacomine, Leandro; Fioretti, Florence; Gauthier, Christian; Sebastian, Victor; Schwinté, Pascale; Benkirane-Jessel, Nadia

2015-01-01

New-generation implants focus on robust, durable, and rapid tissue regeneration to shorten recovery times and decrease risks of postoperative complications for patients. Herein, we describe a new-generation thick nanofibrous implant functionalized with active containers of growth factors and stem cells for regenerative nanomedicine. A thick electrospun poly(ε-caprolactone) nanofibrous implant (from 700 μm to 1 cm thick) was functionalized with chitosan and bone morphogenetic protein BMP-7 as growth factor using layer-by-layer technology, producing fish scale-like chitosan/BMP-7 nanoreservoirs. This extracellular matrix-mimicking scaffold enabled in vitro colonization and bone regeneration by human primary osteoblasts, as shown by expression of osteocalcin, osteopontin, and bone sialoprotein (BSPII), 21 days after seeding. In vivo implantation in mouse calvaria defects showed significantly more newly mineralized extracellular matrix in the functionalized implant compared to a bare scaffold after 30 days’ implantation, as shown by histological scanning electron microscopy/energy dispersive X-ray microscopy study and calcein injection. We have as well bifunctionalized our BMP-7 therapeutic implant by adding human mesenchymal stem cells (hMSCs). The activity of this BMP-7-functionalized implant was again further enhanced by the addition of hMSCs to the implant (living materials), in vivo, as demonstrated by the analysis of new bone formation and calcification after 30 days’ implantation in mice with calvaria defects. Therefore, implants functionalized with BMP-7 nanocontainers associated with hMSCs can act as an accelerator of in vivo bone mineralization and regeneration. PMID:25709432

The Axolotl Fibula as a Model for the Induction of Regeneration across Large Segment Defects in Long Bones of the Extremities

PubMed Central

Chen, Xiaoping; Song, Fengyu; Jhamb, Deepali; Li, Jiliang; Bottino, Marco C.; Palakal, Mathew J.; Stocum, David L.

2015-01-01

We tested the ability of the axolotl (Ambystoma mexicanum) fibula to regenerate across segment defects of different size in the absence of intervention or after implant of a unique 8-braid pig small intestine submucosa (SIS) scaffold, with or without incorporated growth factor combinations or tissue protein extract. Fractures and defects of 10% and 20% of the total limb length regenerated well without any intervention, but 40% and 50% defects failed to regenerate after either simple removal of bone or implanting SIS scaffold alone. By contrast, scaffold soaked in the growth factor combination BMP-4/HGF or in protein extract of intact limb tissue promoted partial or extensive induction of cartilage and bone across 50% segment defects in 30%-33% of cases. These results show that BMP-4/HGF and intact tissue protein extract can promote the events required to induce cartilage and bone formation across a segment defect larger than critical size and that the long bones of axolotl limbs are an inexpensive model to screen soluble factors and natural and synthetic scaffolds for their efficacy in stimulating this process. PMID:26098852

Heparin Microparticle Effects on Presentation and Bioactivity of Bone Morphogenetic Protein-2

PubMed Central

Hettiaratchi, Marian H.; Miller, Tobias; Temenoff, Johnna S.; Guldberg, Robert E.; McDevitt, Todd C.

2014-01-01

Biomaterials capable of providing localized and sustained presentation of bioactive proteins are critical for effective therapeutic growth factor delivery. However, current biomaterial delivery vehicles commonly suffer from limitations that can result in low retention of growth factors at the site of interest or adversely affect growth factor bioactivity. Heparin, a highly sulfated glycosaminoglycan, is an attractive growth factor delivery vehicle due to its ability to reversibly bind positively charged proteins, provide sustained delivery, and maintain protein bioactivity. This study describes the fabrication and characterization of heparin methacrylamide (HMAm) microparticles for recombinant growth factor delivery. HMAm microparticles were shown to efficiently bind several heparin-binding growth factors (e.g. bone morphogenetic protein-2 (BMP-2), vascular endothelial growth factor (VEGF), and basic fibroblast growth factor (FGF-2)), including a wide range of BMP-2 concentrations that exceeds the maximum binding capacity of other common growth factor delivery vehicles, such as gelatin. BMP-2 bioactivity was assessed on the basis of alkaline phosphatase (ALP) activity induced in skeletal myoblasts (C2C12). Microparticles loaded with BMP-2 stimulated comparable C2C12 ALP activity to soluble BMP-2 treatment, indicating that BMP-2-loaded microparticles retain bioactivity and potently elicit a functional cell response. In summary, our results suggest that heparin microparticles stably retain large amounts of bioactive BMP-2 for prolonged periods of time, and that presentation of BMP-2 via heparin microparticles can elicit cell responses comparable to soluble BMP-2 treatment. Consequently, heparin microparticles present an effective method of delivering and spatially retaining growth factors that could be used in a variety of systems to enable directed induction of cell fates and tissue regeneration. PMID:24881028

Concentration of platelets and growth factors in platelet-rich plasma from Goettingen minipigs.

PubMed

Jungbluth, Pascal; Grassmann, Jan-Peter; Thelen, Simon; Wild, Michael; Sager, Martin; Windolf, Joachim; Hakimi, Mohssen

2014-01-01

In minipigs little is known about the concentration of growth factors in plasma, despite their major role in several patho-physiological processes such as healing of fractures. This prompted us to study the concentration of platelets and selected growth factors in plasma and platelet-rich plasma (PRP) preparation of sixteen Goettingen minipigs. Platelet concentrations increased significantly in PRP in comparison to native blood plasma. Generally, significant increase in the concentration of all growth factors tested was observed in the PRP in comparison to the corresponding plasma or serum. Five of the plasma samples examined contained detectable levels of bone morphogenic protein 2 (BMP-2) whereas eleven of the plasma or serum samples contained minimal amounts of vascular endothelial growth factor (VEGF) and platelet-derived growth factor (PDGF-bb) respectively. On the other hand variable concentrations of bone morphogenic protein 7 (BMP-7) and transforming growth factor β1 (TGF-β1) were measured in all plasma samples. In contrast, all PRP samples contained significantly increased amounts of growth factors. The level of BMP-2, BMP-7, TGF-β1, VEGF and PDGF-bb increased by 17.6, 1.5, 7.1, 7.2 and 103.3 fold, in comparison to the corresponding non-enriched preparations. Moreover significant positive correlations were found between platelet count and the concentrations of BMP-2 (r=0.62, p<0.001), TGF-β1 (r=0.85, p<0.001), VEGF (r=0.46, p<0.01) and PDGF-bb (r=0.9, p<0.001). Our results demonstrate that selected growth factors are present in the platelet-rich plasma of minipigs which might thus serve as a source of autologous growth factors.

Genetically engineered flavonol enriched tomato fruit modulates chondrogenesis to increase bone length in growing animals.

PubMed

Choudhary, Dharmendra; Pandey, Ashutosh; Adhikary, Sulekha; Ahmad, Naseer; Bhatia, Chitra; Bhambhani, Sweta; Trivedi, Prabodh Kumar; Trivedi, Ritu

2016-02-26

Externally visible body and longitudinal bone growth is a result of proliferation of chondrocytes. In growth disorder, there is delay in the age associated increase in height. The present study evaluates the effect of extract from transgenic tomato fruit expressing AtMYB12 transcription factor on bone health including longitudinal growth. Constitutive expression of AtMYB12 in tomato led to a significantly enhanced biosynthesis of flavonoids in general and the flavonol biosynthesis in particular. Pre-pubertal ovary intact BALB/c mice received daily oral administration of vehicle and ethanolic extract of wild type (WT-TOM) and transgenic AtMYB12-tomato (MYB12-TOM) fruits for six weeks. Animal fed with MYB12-TOM showed no inflammation in hepatic tissues and normal sinusoidal Kupffer cell morphology. MYB12-TOM extract significantly increased tibial and femoral growth and subsequently improved the bone length as compared to vehicle and WT-TOM. Histomorphometry exhibited significantly wider distal femoral and proximal tibial growth plate, increased number and size of hypertrophic chondrocytes in MYB12-TOM which corroborated with micro-CT and expression of BMP-2 and COL-10, marker genes for hypertrophic cells. We conclude that metabolic reprogramming of tomato by AtMYB12 has the potential to improve longitudinal bone growth thus helping in achievement of greater peak bone mass during adolescence.

Analysis of the Effects of Five Factors Relevant to In Vitro Chondrogenesis of Human Mesenchymal Stem Cells Using Factorial Design and High Throughput mRNA-Profiling

PubMed Central

Jakobsen, Rune B.; Østrup, Esben; Zhang, Xiaolan; Mikkelsen, Tarjei S.; Brinchmann, Jan E.

2014-01-01

The in vitro process of chondrogenic differentiation of mesenchymal stem cells for tissue engineering has been shown to require three-dimensional culture along with the addition of differentiation factors to the culture medium. In general, this leads to a phenotype lacking some of the cardinal features of native articular chondrocytes and their extracellular matrix. The factors used vary, but regularly include members of the transforming growth factor β superfamily and dexamethasone, sometimes in conjunction with fibroblast growth factor 2 and insulin-like growth factor 1, however the use of soluble factors to induce chondrogenesis has largely been studied on a single factor basis. In the present study we combined a factorial quality-by-design experiment with high-throughput mRNA profiling of a customized chondrogenesis related gene set as a tool to study in vitro chondrogenesis of human bone marrow derived mesenchymal stem cells in alginate. 48 different conditions of transforming growth factor β 1, 2 and 3, bone morphogenetic protein 2, 4 and 6, dexamethasone, insulin-like growth factor 1, fibroblast growth factor 2 and cell seeding density were included in the experiment. The analysis revealed that the best of the tested differentiation cocktails included transforming growth factor β 1 and dexamethasone. Dexamethasone acted in synergy with transforming growth factor β 1 by increasing many chondrogenic markers while directly downregulating expression of the pro-osteogenic gene osteocalcin. However, all factors beneficial to the expression of desirable hyaline cartilage markers also induced undesirable molecules, indicating that perfect chondrogenic differentiation is not achievable with the current differentiation protocols. PMID:24816923

Review paper: DNA delivery strategies to promote periodontal regeneration.

PubMed

Elangovan, Satheesh; Karimbux, Nadeem

2010-07-01

Periodontal diseases are caused by bacteria with an inflammatory component that result in the loss of bone and soft tissue around the neck of the teeth. Recent therapies allow clinicians to regenerate some of the lost structures of the periodontium. Regeneration of these lost supporting structures is a highly orchestrated process, involving various cellular and molecular players, leading to the complete restoration of the periodontium (the tooth-supporting apparatus). The introduction of growth factors has positively influenced the clinical outcome of the existing regenerative procedures but the supra-physiological doses and the high cost associated with these growth factors can be drawbacks. Gene therapy may offer some interesting advantages to current therapies. In the field of periodontology, several studies have been conducted to explore the efficacy of delivering the DNA of key growth factors using viral vectors in both periodontal and peri-implant bone regeneration. Relatively few studies have explored the application of nonviral gene therapy in periodontal regeneration. This article is aimed at reviewing the studies conducted so far using viral and nonviral gene delivery approaches to achieve periodontal and peri-implant bone regeneration.

Heterotopic bone formation around sintered porous-surfaced Ti-6Al-4V implants coated with native bone morphogenetic proteins.

PubMed

Simon, Ziv; Deporter, Douglas A; Pilliar, Robert M; Clokie, Cameron M

2006-09-01

Coating endosseous dental implants with growth factors such as bone morphogenetic proteins (BMPs) may be one way to accelerate and/or enhance the quality of osseointegration. The purpose of this study was to investigate in the murine muscle pouch model whether sintered porous-surfaced titanium alloy implants coated with BMPs would lead to heterotopic bone formation around and within the implant surface geometry. Porous-surfaced dental implants were coated with partially purified native human BMPs, with or without a carrier of Poloxamer 407 (BASF Corp., Parsippany, NJ), placed in gelatin capsules and implanted into the hindquarter muscles of mice. Mice were euthanized after 28 days. Sections of retrieved specimens were subsequently prepared for morphometric analysis of bone formation using backscatter electron microscopic images. Human BMPs, either with or without the carrier of Poloxamer 407, led to bone formation within and outside of the sintered porous implant surface. When the sintered implant surface region was subdivided into inner and outer halves, similar levels of bone ingrowth and contact were seen in the 2 halves. Evidence of bone formation to the depth of the solid implant core (i.e., the deepest level possible) also was seen. Sintered porous-surfaced dental implants can be used as substrate for partially purified BMPs in the murine muscle pouch model. With the addition of these osteoinductive factors, the porous implant surface supported bone formation within the surface porosity provided, in some instances, all the way to the solid implant core. The addition of growth factors to a sintered porous surface may be an efficient method for altering locally the healing sequence and quality of bone associated with osseointegration of bone-interfacing implants.

Non-canonical Wnt4 prevents skeletal aging and inflammation by inhibiting NF-κB

PubMed Central

Yu, Bo; Chang, Jia; Liu, Yunsong; Li, Jiong; Kevork, Kareena; Al-Hezaimi, Khalid; Graves, Dana T; Park, No-Hee; Wang, Cun-Yu

2014-01-01

Aging-related bone loss and osteoporosis affect millions of patients worldwide. Chronic inflammation associated with aging and arthritis promotes bone resorption and impairs bone formation. Here we show that Wnt4 attenuated bone loss in osteoporosis and skeletal aging by inhibiting nuclear factor-kappa B (NF-κB) via non-canonical Wnt signaling. Transgenic mice expressing Wnt4 from osteoblasts were significantly protected from bone loss and chronic inflammation induced by ovariectomy, tumor necrosis factor or natural aging. In addition to promoting bone formation, Wnt4 could inhibit osteoclast formation and bone resorption. Mechanistically, Wnt4 inhibited transforming growth factor beta-activated kinase 1-mediated NF-κB activation in macrophages and osteoclast precursors independent of β-catenin. Moreover, recombinant Wnt4 proteins were able to alleviate osteoporotic bone loss and inflammation by inhibiting NF-κB in vivo. Taken together, our results suggest that Wnt4 might be used as a therapeutic agent for treating osteoporosis by attenuating NF-κB. PMID:25108526

Consensus and controversy regarding osteoporosis in the pediatric population.

PubMed

Bachrach, Laura Keyes

2007-09-01

To review current consensus and controversy surrounding the diagnosis and treatment of osteoporosis in childhood and adolescence. The medical literature was reviewed with emphasis on the importance of early skeletal health, risk factors for bone fragility, and the diagnosis and management of children at risk for osteoporosis. Childhood and adolescence are critical periods for optimizing bone growth and mineral accrual. Bone strength is determined by bone size, geometry, quality, and mass-variables that are influenced by genetic factors, activity, nutrition, and hormones. For children with genetic skeletal disorders or chronic disease, bone growth and mineral accrual may be compromised, increasing the lifetime risk of osteoporosis. The goal for the clinician is to identify children at greatest risk for future fragility fracture. Bone densitometry and turnover markers are challenging to interpret in children. Prevention and treatment of bone fragility in children are less well established than in adults. Optimizing nutrition and activity may not restore bone health, but the drug armamentarium is limited. Sex steroid replacement has not proven effective in restoring bone mass in patients with anorexia nervosa or exercise-associated amenorrhea. Bisphosphonates can increase bone mass and may reduce bone pain and fractures, most convincingly in patients with osteogenesis imperfecta. Further studies are needed to establish the safety, efficacy, and optimal drug, duration, and dosage in pediatric patients. Bone health during the first 2 decades contributes to the lifetime risk of osteoporosis. Further research is needed to develop evidence-based recommendations for the diagnosis and treatment of osteoporosis in childhood.

Kidney tubular-cell secretion of osteoblast growth factor is increased by kaempferol: a scientific basis for "the kidney controlling the bone" theory of Chinese medicine.

PubMed

Long, Mian; Li, Shun-xiang; Xiao, Jiang-feng; Wang, Jian; Lozanoff, Scott; Zhang, Zhi-guang; Luft, Benjamin J; Johnson, Francis

2014-09-01

To study, at the cytological level, the basic concept of Chinese medicine that "the Kidney (Shen) controls the bone". Kaempferol was isolated form Rhizoma Drynariae (Gu Sui Bu, GSB) and at several concentrations was incubated with opossum kidney (OK) cells, osteoblasts (MC3T3 E1) and human fibroblasts (HF) at cell concentrations of 2×10(4)/mL. Opossum kidney cell-conditioned culture media with kaempferol at 70 nmol/L (70kaeOKM) and without kaempferol (0OKM) were used to stimulate MC3T3 E1 and HF proliferation. The bone morphological protein receptors I and II (BMPR I and II) in OK cells were identified by immune-fluorescence staining and Western blot analysis. Kaempferol was found to increase OK cell growth (P<0.05), but alone did not promote MC3T3 E1 or HF cell proliferation. However, although OKM by itself increased MC3T3 E1 growth by 198% (P<0.01), the 70kaeOKM further increased the growth of these cells by an additional 127% (P<0.01). It indicates that the kidney cell generates a previously unknown osteoblast growth factor (OGF) and kaempferol increases kidney cell secretion of OGF. Neither of these media had any significant effect on HF growth. Kaempferol also was found to increase the level of the BMPR II in OK cells. This lends strong support to the original idea that the Kidney has a significant influence over bone-formation, as suggested by some long-standing Chinese medical beliefs, kaempferol may also serve to stimulate kidney repair and indirectly stimulate bone formation.

Effects of combined maternal administration with alpha-ketoglutarate (AKG) and β-hydroxy-β-methylbutyrate (HMB) on prenatal programming of skeletal properties in the offspring.

PubMed

Tatara, Marcin R; Krupski, Witold; Tymczyna, Barbara; Studziński, Tadeusz

2012-05-11

Nutritional manipulations during fetal growth may induce long-term metabolic effects in postnatal life. The aim of the study was to test whether combined treatment of pregnant sows with alpha-ketoglutarate and β-hydroxy-β-methylbutyrate induces additive long-term effects on skeletal system properties in the offspring. The study was performed on 290 pigs obtained from 24 sows divided into 4 equal groups and subjected to experimental treatment during two weeks before delivery. The first group consisted of control sows, while the second group received alpha-ketoglutarate. The third group was treated with β-hydroxy-β-methylbutyrate and the fourth group underwent combined administration of alpha-ketoglutarate and β-hydroxy-β-methylbutyrate. Piglets obtained from sows were reared until slaughter age to perform morphometric, densitometric and mechanical analyses of femur. Serum evaluations of growth hormone, insulin-like growth factor-1, bone-specific alkaline phosphatase and osteocalcin were performed in newborns and 90-day old piglets; additionally, plasma amino acid concentration was measured in newborns. Maternal treatment with alpha-ketoglutarate and β-hydroxy-β-methylbutyrate significantly reduced fattening time and increased birth body weight, daily body weight gain, bone weight, volumetric bone mineral density, geometrical parameters and mechanical endurance of femur. These effects were associated with increased serum concentrations of growth hormone, insulin-like growth factor-1, bone-specific alkaline phosphatase and osteocalcin. Furthermore, alpha-ketoglutarate and β-hydroxy-β-methylbutyrate administered solely or in combination significantly increased plasma level of 19 amino acids. Hormonal and amino acid evaluations in pigs indicate additive effects of AKG and HMB on systemic growth and development; however, determination of bone properties has not shown such phenomenon.

Effects of combined maternal administration with alpha-ketoglutarate (AKG) and β-hydroxy-β-methylbutyrate (HMB) on prenatal programming of skeletal properties in the offspring

PubMed Central

2012-01-01

Background Nutritional manipulations during fetal growth may induce long-term metabolic effects in postnatal life. The aim of the study was to test whether combined treatment of pregnant sows with alpha-ketoglutarate and β-hydroxy-β-methylbutyrate induces additive long-term effects on skeletal system properties in the offspring. Methods The study was performed on 290 pigs obtained from 24 sows divided into 4 equal groups and subjected to experimental treatment during two weeks before delivery. The first group consisted of control sows, while the second group received alpha-ketoglutarate. The third group was treated with β-hydroxy-β-methylbutyrate and the fourth group underwent combined administration of alpha-ketoglutarate and β-hydroxy-β-methylbutyrate. Piglets obtained from sows were reared until slaughter age to perform morphometric, densitometric and mechanical analyses of femur. Serum evaluations of growth hormone, insulin-like growth factor-1, bone-specific alkaline phosphatase and osteocalcin were performed in newborns and 90-day old piglets; additionally, plasma amino acid concentration was measured in newborns. Results Maternal treatment with alpha-ketoglutarate and β-hydroxy-β-methylbutyrate significantly reduced fattening time and increased birth body weight, daily body weight gain, bone weight, volumetric bone mineral density, geometrical parameters and mechanical endurance of femur. These effects were associated with increased serum concentrations of growth hormone, insulin-like growth factor-1, bone-specific alkaline phosphatase and osteocalcin. Furthermore, alpha-ketoglutarate and β-hydroxy-β-methylbutyrate administered solely or in combination significantly increased plasma level of 19 amino acids. Conclusions Hormonal and amino acid evaluations in pigs indicate additive effects of AKG and HMB on systemic growth and development; however, determination of bone properties has not shown such phenomenon. PMID:22578071

Controllable mineral coatings on PCL scaffolds as carriers for growth factor release

PubMed Central

Suárez-González, Darilis; Barnhart, Kara; Migneco, Francesco; Flanagan, Colleen; Hollister, Scott J.; Murphy, William L.

2011-01-01

In this study, we have developed mineral coatings on polycaprolactone scaffolds to serve as templates for growth factor binding and release. Mineral coatings were formed using a biomimetic approach that consisted in the incubation of scaffolds in modified simulated body fluids (mSBF). To modulate the properties of the mineral coating, which we hypothesized would dictate growth factor release, we used carbonate (HCO3) concentration in mSBF of 4.2 mM, 25mM, and 100mM. Analysis of the mineral coatings formed using scanning electron microscopy indicated growth of a continuous layer of mineral with different morphologies. X-ray diffraction analysis showed peaks associated with hydroxyapatite, the major inorganic constituent of human bone tissue in coatings formed in all HCO3 concentrations. Mineral coatings with increased HCO3 substitution showed more rapid dissolution kinetics in an environment deficient in calcium and phosphate but showed re-precipitation in an environment with the aforementioned ions. The mineral coating provided an effective mechanism for growth factor binding and release. Peptide versions of vascular endothelial growth factor (VEGF) and bone morphogenetic protein 2 (BMP2) were bound with efficiencies up to 90% to mineral mineral-coated PCL scaffolds. We also demonstrated sustained release of all growth factors with release kinetics that were strongly dependent in the solubility of the mineral coating. PMID:22014948

Impact of IGF-I release kinetics on bone healing: a preliminary study in sheep.

PubMed

Luginbuehl, Vera; Zoidis, Evangelos; Meinel, Lorenz; von Rechenberg, Brigitte; Gander, Bruno; Merkle, Hans P

2013-09-01

Spatiotemporal release of growth factors from a delivery device can profoundly affect the efficacy of bone growth induction. Here, we report on a delivery platform based on the encapsulation of insulin-like growth factor I (IGF-I) in different poly(D,L-lactide) (PLA) and poly(D,L-lactide-co-glycolide) (PLGA) microsphere (MS) formulations to control IGF-I release kinetics. In vitro IGF-I release profiles generally exhibited an initial burst (14-36% of total IGF-I content), which was followed by a more or less pronounced dormant phase with little release (2 to 34 days), and finally, a third phase of re-increased IGF-I release. The osteoinductive potential of these different IGF-I PL(G)A MS formulations was tested in studies using 8-mm metaphyseal drill hole bone defects in sheep. Histomorphometric analysis at 3 and 6 weeks after surgery showed that new bone formation was improved in the defects locally treated with IGF-I PL(G)A MS (n=5) as compared to defects filled with IGF-I-free PL(G)A MS (n=4). The extent of new bone formation was affected by the particular release kinetics, although a definitive relationship was not evident. Local administration of IGF-I resulted in down-regulation of inflammatory marker genes in all IGF-I treated defects. The over-expression of growth factor genes in response to IGF-I delivery was restricted to formulations that produced osteogenic responses. These experiments demonstrate the osteoinductive potential of sustained IGF-I delivery and show the importance of delivery kinetics for successful IGF-I-based therapies. Copyright © 2013 Elsevier B.V. All rights reserved.

The toothless osteopetrotic rat has a normal vitamin D-binding protein-macrophage activating factor (DBP-MAF) cascade and chondrodysplasia resistant to treatments with colony stimulating factor-1 (CSF-1) and/or DBP-MAF.

PubMed

Odgren, P R; Popoff, S N; Safadi, F F; MacKay, C A; Mason-Savas, A; Seifert, M F; Marks, S C

1999-08-01

The osteopetrotic rat mutation toothless (tl) is characterized by little or no bone resorption, few osteoclasts and macrophages, and chondrodysplasia at the growth plates. Short-term treatment of tl rats with colony-stimulating factor-1 (CSF-1) has been shown to increase the number of osteoclasts and macrophages, producing dramatic resolution of skeletal sclerosis at some, but not all, sites. Defects in production of vitamin D-binding protein-macrophage activating factor (DBP-MAF) have been identified in two other independent osteopetrotic mutations of the rat (op and ia), and two in the mouse (op and mi), in which macrophages and osteoclasts can be activated by the administration of exogenous DBP-MAF. The present studies were undertaken to examine the histology and residual growth defects in tl rats following longer CSF-1 treatments, to investigate the possibility that exogenous DBP-MAF might act synergistically with CSF-1 to improve the tl phenotype, and to assess the integrity of the endogenous DBP-MAF pathway in this mutation. CSF-1 treatment-with or without DBP-MAF-induced resorption of metaphyseal bone to the growth plate on the marrow side, improved slightly but did not normalize long bone growth, and caused no improvement in the abnormal histology of the growth plate. Injections of lysophosphatidylcholine (lyso-Pc) to prime macrophage activation via the DBP-MAF pathway raised superoxide production to similar levels in peritoneal macrophages from both normal and mutant animals, indicating no defect in the DBP-MAF pathway in tl rats. Interestingly, pretreatments with CSF-1 alone also increased superoxide production, although the mechanism for this remains unknown. In summary, we find that, unlike other osteopetrotic mutations investigated to date, the DBP-MAF pathway does not appear to be defective in the tl rat; that additional DBP-MAF does not augment the beneficial skeletal effects seen with CSF-1 alone; and that the growth plate chondrodystrophy seen in this mutation is unaffected by either molecule. Thus, the tl mutation intercepts the function of a gene required for both normal endochondral ossification and bone resorption, thereby uncoupling the coordination of skeletal metabolism required for normal long bone growth.

Loss of transcription factor early growth response gene 1 results in impaired endochondral bone repair

PubMed Central

Reumann, Marie K.; Strachna, Olga; Yagerman, Sarah; Torrecilla, Daniel; Kim, Jihye; Doty, Steven B.; Lukashova, Lyudmila; Boskey, Adele L.; Mayer-Kuckuk, Philipp

2011-01-01

Transcription factors that play a role in ossification during development are expected to participate in postnatal fracture repair since the endochondral bone formation that occurs in embryos is recapitulated during fracture repair. However, inherent differences exist between bone development and fracture repair, including a sudden disruption of tissue integrity followed by an inflammatory response. This raises the possibility that repair-specific transcription factors participate in bone healing. Here, we assessed the consequence of loss of early growth response gene 1 (EGR-1) on endochondral bone healing because this transcription factor has been shown to modulate repair in vascularized tissues. Model fractures were created in ribs of wild type (wt) and EGR-1−/− mice. Differences in tissue morphology and composition between these two animal groups were followed over 28 post fracture days (PFDs). In wt mice, bone healing occurred in healing phases characteristic of endochondral bone repair. A similar healing sequence was observed in EGR-1−/− mice but was impaired by alterations. A persistent accumulation of fibrin between the disconnected bones was observed on PFD7 and remained pronounced in the callus on PFD14. Additionally, the PFD14 callus was abnormally enlarged and showed increased deposition of mineralized tissue. Cartilage ossification in the callus was associated with hyper-vascularity and -proliferation. Moreover, cell deposits located in proximity to the callus within skeletal muscle were detected on PFD14. Despite these impairments, repair in EGR-1−/− callus advanced on PFD28, suggesting EGR-1 is not essential for healing. Together, this study provides genetic evidence that EGR-1 is a pleiotropic regulator of endochondral fracture repair. PMID:21726677

Loss of transcription factor early growth response gene 1 results in impaired endochondral bone repair.

PubMed

Reumann, Marie K; Strachna, Olga; Yagerman, Sarah; Torrecilla, Daniel; Kim, Jihye; Doty, Stephen B; Lukashova, Lyudmila; Boskey, Adele L; Mayer-Kuckuk, Philipp

2011-10-01

Transcription factors that play a role in ossification during development are expected to participate in postnatal fracture repair since the endochondral bone formation that occurs in embryos is recapitulated during fracture repair. However, inherent differences exist between bone development and fracture repair, including a sudden disruption of tissue integrity followed by an inflammatory response. This raises the possibility that repair-specific transcription factors participate in bone healing. Here, we assessed the consequence of loss of early growth response gene 1 (EGR-1) on endochondral bone healing because this transcription factor has been shown to modulate repair in vascularized tissues. Model fractures were created in ribs of wild type (wt) and EGR-1(-/-) mice. Differences in tissue morphology and composition between these two animal groups were followed over 28 post fracture days (PFDs). In wt mice, bone healing occurred in healing phases characteristic of endochondral bone repair. A similar healing sequence was observed in EGR-1(-/-) mice but was impaired by alterations. A persistent accumulation of fibrin between the disconnected bones was observed on PFD7 and remained pronounced in the callus on PFD14. Additionally, the PFD14 callus was abnormally enlarged and showed increased deposition of mineralized tissue. Cartilage ossification in the callus was associated with hyper-vascularity and -proliferation. Moreover, cell deposits located in proximity to the callus within skeletal muscle were detected on PFD14. Despite these impairments, repair in EGR-1(-/-) callus advanced on PFD28, suggesting EGR-1 is not essential for healing. Together, this study provides genetic evidence that EGR-1 is a pleiotropic regulator of endochondral fracture repair. Copyright © 2011 Elsevier Inc. All rights reserved.

Impact of prenatal hypoxia on fetal bone growth and osteoporosis in ovariectomized offspring rats.

PubMed

Yang, Yuxian; Fan, Xiaorong; Tao, Jianying; Xu, Ting; Zhang, Yingying; Zhang, Wenna; Li, Lingjun; Li, Xiang; Ding, Hongmei; Sun, Miao; Gao, Qinqin; Xu, Zhice

2018-03-07

Prenatal hypoxia causes intrauterine growth retardation. It is unclear whether/how hypoxia affects the bone in fetal and offspring life. This study showed that prenatal hypoxia retarded fetal skeletal growth in rats, inhibited extracellular matrix (ECM) synthesis and down-regulated of insulin-like growth factor 1 (IGF1) signaling in fetal growth plate chondrocytes in vivo and in vitro. In addition, ovariectomized (OVX) was used for study of postmenopausal osteoporosis. Compared with the control, OVX offspring in prenatal hypoxic group showed an enhanced osteoporosis in the femurs, associated with reduced proteoglycan and IGF1 signaling. The results indicated prenatal hypoxia not only delayed fetal skeletal growth, but also increased OVX-induced osteoporosis in the elder offspring probably through down-regulated IGF1 signaling and inhibition of ECM synthesis, providing important information of prenatal hypoxia on functional and molecular bone growth and metabolism in fetal and offspring. Copyright © 2018 Elsevier Inc. All rights reserved.

The temporal response of bone to unloading

NASA Technical Reports Server (NTRS)

Globus, R. K.; Bikle, D. D.; Morey-Holton, E.

1984-01-01

Rats were suspended by their tails with the forelimbs bearing the weight load to simulate the weightlessness of space flight. Growth in bone mass ceased by 1 week in the hindlimbs and lumbar vertebrae in growing rats, while growth in the forelimbs and cervical vertebrae remained unaffected. The effects of selective skeletal unloading on bone formation during 2 weeks of suspension was investigated using radio iostope incorporation (with Ca-45 and H-3 proline) and histomorphometry (with tetracycline labeling). The results of these studies were confirmed by histomorphometric measurements of bone formation using triple tetracycline labeling. This model of simulated weightlessness results in an initial inhibition of bone formation in the unloaded bones. This temporary cessation of bone formation is followed in the accretion of bone mass, which then resumes at a normal rate by 14 days, despite continued skeletal unloading. This cycle of inhibition and resumption of bone formation has profound implication for understanding bone dynamics durng space flight, immobilization, or bed rest and offers an opportunity to study the hormonal and mechanical factors that regulate bone formation.

The Influence of Primary Microenvironment on Prostate Cancer Osteoblastic Bone Lesion Development

DTIC Science & Technology

2015-09-01

for inhibiting PCa bone lesion development: 3a. Basic fibroblast growth factor (bFGF) in PC3 bone metastasis: bFGF was identified by cytokine...II receptor (TβRII) knockout (Tgfbr2 KO) mouse models. Col1creERT/Tgfbr2 KO (Col/Tgfbr2 KO), which have TGF-β signaling specific KO in fibroblasts ... fibroblasts and osteoblasts in the bone by Colcre/Tgfbr2 KO, or in the myeloid lineage cells, including osteoclasts in the bone by LysMcre/Tgfbr2 KO

Recent biological trends in management of fracture non-union

PubMed Central

Emara, Khaled M; Diab, Ramy Ahmed; Emara, Ahmed Khaled

2015-01-01

Bone regeneration is a complex, well-orchestrated physiological process of bone formation, which can be seen during normal fracture healing, and is involved in continuous remodelling throughout adult life. Currently, there is a plethora of different strategies to augment the impaired or “insufficient” bone-regeneration process, including the “gold standard” autologous bone graft, free fibula vascularised graft, allograft implantation, and use of growth factors, osteoconductive scaffolds, osteoprogenitor cells and distraction osteogenesis. Improved “local” strategies in terms of tissue engineering and gene therapy, or even “systemic” enhancement of bone repair, are under intense investigation, in an effort to overcome the limitations of the current methods, to produce bone-graft substitutes with biomechanical properties that are as identical to normal bone as possible, to accelerate the overall regeneration process, or even to address systemic conditions, such as skeletal disorders and osteoporosis. An improved understanding of the molecular and cellular events that occur during bone repair and remodeling has led to the development of biologic agents that can augment the biological microenvironment and enhance bone repair. Orthobiologics, including stem cells, osteoinductive growth factors, osteoconductive matrices, and anabolic agents, are available clinically for accelerating fracture repair and treatment of compromised bone repair situations like delayed unions and nonunions. A lack of standardized outcome measures for comparison of biologic agents in clinical fracture repair trials, frequent off-label use, and a limited understanding of the biological activity of these agents at the bone repair site have limited their efficacy in clinical applications. PMID:26396938

Bone resorption analysis of platelet-derived growth factor type BB application on collagen for bone grafts secured by titanium mesh over a pig jaw defect model

PubMed Central

Herford, Alan Scott; Cicciù, Marco

2012-01-01

Purpose: The aim of this investigation was to evaluate whether the addition of the platelet derived growth factor type BB (PDGF-BB) to a collagen matrix applied on a titanium mesh would favor healing and resorption onto the grafted bone. A histologic and radiographic study of two different groups (test and control) was performed. Designs: A surgical procedure was performed on 8 pigs to obtain 16 bilateral mandibular alveolar defects. All the defects were then reconstructed with a mixture of autogenous bovine bone using titanium mesh positioning. Two groups, with a total of 16 defects were created: The first to study collagen sponge and PDGF-BB and the second to control collagen only. The collagen matrix was positioned directly over the mesh and soft tissue was closed without tensions onto both groups without attempting to obtain primary closure. Possible exposure of the titanium mesh as well as the height and volume of the new bone was recorded. Results: New bone formation averaged about 6.68 mm in the test group studied; the control group had less regenerated bone at 4.62 mm. Conclusion: PDGF-BB addition to the collagen matrix induced a strong increase in hard and soft tissue healing and favored bone formation, reducing bone resorption even if the mesh was exposed. PMID:23833493

Effects of Monoclonal Antibodies against Nerve Growth Factor on Healthy Bone and Joint Tissues in Mice, Rats, and Monkeys: Histopathologic, Biomarker, and Microcomputed Tomographic Assessments.

PubMed

Gropp, Kathryn E; Carlson, Cathy S; Evans, Mark G; Bagi, Cedo M; Reagan, William J; Hurst, Susan I; Shelton, David L; Zorbas, Mark A

2018-01-01

Tanezumab, an anti-nerve growth factor (NGF) antibody, is in development for management of chronic pain. During clinical trials of anti-NGF antibodies, some patients reported unexpected adverse events requiring total joint replacements, resulting in a partial clinical hold on all NGF inhibitors. Three nonclinical toxicology studies were conducted to evaluate the effects of tanezumab or the murine precursor muMab911 on selected bone and joint endpoints and biomarkers in cynomolgus monkeys, Sprague-Dawley rats, and C57BL/6 mice. Joint and bone endpoints included histology, immunohistochemistry, microcomputed tomography (mCT) imaging, and serum biomarkers of bone physiology. Responses of bone endpoints to tanezumab were evaluated in monkeys at 4 to 30 mg/kg/week for 26 weeks and in rats at 0.2 to 10 mg/kg twice weekly for 28 days. The effects of muMab911 at 10 mg/kg/week for 12 weeks on selected bone endpoints were determined in mice. Tanezumab and muMab911 had no adverse effects on any bone or joint parameter. There were no test article-related effects on bone or joint histology, immunohistochemistry, or structure. Reversible, higher osteocalcin concentrations occurred only in the rat study. No deleterious effects were observed in joints or bones in monkeys, rats, or mice administered high doses of tanezumab or muMab911.

Insulin-like growth factor-1 receptor in mature osteoblasts is required for periosteal bone formation induced by reloading

NASA Astrophysics Data System (ADS)

Kubota, Takuo; Elalieh, Hashem Z.; Saless, Neema; Fong, Chak; Wang, Yongmei; Babey, Muriel; Cheng, Zhiqiang; Bikle, Daniel D.

2013-11-01

Skeletal loading and unloading has a pronounced impact on bone remodeling, a process also regulated by insulin-like growth factor-1 (IGF-1) signaling. Skeletal unloading leads to resistance to the anabolic effect of IGF-1, while reloading after unloading restores responsiveness to IGF-1. However, a direct study of the importance of IGF-1 signaling in the skeletal response to mechanical loading remains to be tested. In this study, we assessed the skeletal response of osteoblast-specific Igf-1 receptor deficient (Igf-1r-/-) mice to unloading and reloading. The mice were hindlimb unloaded for 14 days and then reloaded for 16 days. Igf-1r-/- mice displayed smaller cortical bone and diminished periosteal and endosteal bone formation at baseline. Periosteal and endosteal bone formation decreased with unloading in Igf-1r+/+ mice. However, the recovery of periosteal bone formation with reloading was completely inhibited in Igf-1r-/- mice, although reloading-induced endosteal bone formation was not hampered. These changes in bone formation resulted in the abolishment of the expected increase in total cross-sectional area with reloading in Igf-1r-/- mice compared to the control mice. These results suggest that the Igf-1r in mature osteoblasts has a critical role in periosteal bone formation in the skeletal response to mechanical loading.

Fibroblast growth factor-21 restores insulin sensitivity but induces aberrant bone microstructure in obese insulin-resistant rats.

PubMed

Charoenphandhu, Narattaphol; Suntornsaratoon, Panan; Krishnamra, Nateetip; Sa-Nguanmoo, Piangkwan; Tanajak, Pongpun; Wang, Xiaojie; Liang, Guang; Li, Xiaokun; Jiang, Chao; Chattipakorn, Nipon; Chattipakorn, Siriporn

2017-03-01

Fibroblast growth factor (FGF)-21 is a potent endocrine factor that improves insulin resistance and obesity-associated metabolic disorders. However, concomitant activation of peroxisome proliferator-activated receptor-γ by FGF-21 makes bone susceptible to osteopenia and fragility fracture. Since an increase in body weight often induced adaptive change in bone by making it resistant to fracture, it was unclear whether FGF-21 would still induce bone defects in overweight rats. Therefore, the present study aimed to investigate bone microstructure and its mechanical properties in high fat diet (HF)-fed rats treated with 0.1 mg/kg/day FGF-21. Eighteen male rats were divided into two groups to receive either a normal diet or HF for 12 weeks. HF rats were then divided into two subgroups to receive either vehicle or FGF-21 for 4 weeks. The results showed that HF led to obesity, dyslipidemia and insulin resistance, as indicated by hyperinsulinemia with euglycemia. In HF rats, there was an increase in tibial yield displacement (an indicator of ability to be deformed without losing toughness, as determined by 3-point bending) without changes in tibial trabecular volumetric bone mineral density (vBMD) or cortical bone parameters, e.g., cortical thickness and bone area. FGF-21 treatment strongly improved the metabolic parameters and increased insulin sensitivity in HF rats. However, FGF-21-treated HF rats showed lower yield displacement, trabecular vBMD, trabecular bone volume, trabecular thickness, and osteoblast surface compared with vehicle-treated HF rats. These findings suggest that, despite being a potent antagonist of insulin resistance and visceral fat accumulation, FGF-21 is associated with bone defects in HF rats.

Expression of the genes for insulin-like growth factors and their receptors in bone during skeletal growth

NASA Technical Reports Server (NTRS)

Bikle, D. D.; Harris, J.; Halloran, B. P.; Roberts, C. T.; Leroith, D.; Morey-Holton, E.

1994-01-01

Insulin-like growth factors (IGF) are important regulators of skeletal growth. To determine whether the capacity to produce and respond to these growth factors changes during skeletal development, we measured the protein and mRNA levels for IGF-I, IGF-II, and their receptors (IGF-IR and IGF-IIR, respectively) in the tibia and femur of rats before and up to 28 mo after birth. The mRNA levels remained high during fetal development but fell after birth, reaching a nadir by 3-6 wk. This fall was most pronounced for IGF-II and IGF-IIR mRNA and least pronounced for IGF-I mRNA. However, after 6 wk, both IGF-I and IGF-IR mRNA levels recovered toward the levels observed at birth. In the prenatal bones, the signals for the mRNAs of IGF-II and IGF-IIR were stronger than the signals for the mRNAs of IGF-I and IGF-IR, although the content of IGF-I was three- to fivefold greater than that of IGF-II. IGF-II levels fell postnatally, whereas the IGF-I content rose after birth such that the ratio IGF-I/IGF-II continued to increase with age. We conclude that, during development, rat bone changes its capacity to produce and respond to IGFs with a progressive trend toward the dominance of IGF-I.

Differentiation of Mesenchymal Stem Cells Towards Nephrogenic Lineage and Their Enhanced Resistance to Oxygen Peroxide-induced Oxidative Stress.

PubMed

Tayyeb, Asima; Shahzad, Naveed; Ali, Gibran

2017-07-01

Mesenchymal stem cells (MSCs) have been publicized to ameliorate kidney injury both in vitro and in vivo. However, very less is known if MSCs can be differentiated towards renal lineages and their further application potential in kidney injuries. The present study developed a conditioning system of growth factors fibroblast growth factor 2, transforming growth factor-β2, and leukemia inhibitory factor for in vitro differentiation of MSCs isolated from different sources towards nephrogenic lineage. Less invasively isolated adipose-derived MSCs were also compared to bone marrow-derived MSCs for their differentiation potential to induce renal cell. Differentiated MSCs were further evaluated for their resistance to oxidative stress induced by oxygen peroxide. A combination of growth factors successfully induced differentiation of MSCs. Both types of differentiated cells showed significant expression of pronephrogenic markers (Wnt4, Wt1, and Pax2) and renal epithelial markers (Ecad and ZO1). In contrast, expression of mesenchymal stem cells marker Oct4 and Vim were downregulated. Furthermore, differentiated adipose-derived MSCs and bone marrow-derived MSCs showed enhanced and comparable resistance to oxygen peroxide-induced oxidative stress. Adipose-derived MSC provides a promising alternative to bone marrow-derived MSC as a source of autologous stem cells in human kidney injuries. In addition, differentiated MSCs with further in vivo investigations may serve as a cell source for tissue engineering or cell therapy in different renal ailments.

Time- and dose-related interactions between glucocorticoid and cyclic adenosine 3',5'-monophosphate on CCAAT/enhancer-binding protein-dependent insulin-like growth factor I expression by osteoblasts

NASA Technical Reports Server (NTRS)

McCarthy, T. L.; Ji, C.; Chen, Y.; Kim, K.; Centrella, M.

2000-01-01

Glucocorticoid has complex effects on osteoblasts. Several of these changes appear to be related to steroid concentration, duration of exposure, or specific effects on growth factor expression or activity within bone. One important bone growth factor, insulin-like growth factor I (IGF-I), is induced in osteoblasts by hormones such as PGE2 that increase intracellular cAMP levels. In this way, PGE2 activates transcription factor CCAAT/enhancer-binding protein-delta (C/EBPdelta) and enhances its binding to a specific control element found in exon 1 in the IGF-I gene. Our current studies show that preexposure to glucocorticoid enhanced C/EBPdelta and C/EBPbeta expression by osteoblasts and thereby potentiated IGF-I gene promoter activation in response to PGE2. Importantly, this directly contrasts with inhibitory effects on IGF-I expression that result from sustained or pharmacologically high levels of glucocorticoid exposure. Consistent with the stimulatory effect of IGF-I on bone protein synthesis, pretreatment with glucocorticoid sensitized osteoblasts to PGE2, and in this context significantly enhanced new collagen and noncollagen protein synthesis. Therefore, pharmacological levels of glucocorticoid may reduce IGF-I expression by osteoblasts and cause osteopenic disease, whereas physiological transient increases in glucocorticoid may permit or amplify the effectiveness of hormones that regulate skeletal tissue integrity. These events appear to converge on the important role of C/EBPdelta and C/EBPbeta on IGF-I expression by osteoblasts.

Dual growth factor delivery from biofunctionalized allografts: Sequential VEGF and BMP-2 release to stimulate allograft remodeling.

PubMed

Sharmin, Farzana; McDermott, Casey; Lieberman, Jay; Sanjay, Archana; Khan, Yusuf

2017-05-01

Autografts have been shown to stimulate osteogenesis, osteoclastogenesis, and angiogenesis, and subsequent rapid graft incorporation. Large structural allografts, however, suffer from limited new bone formation and remodeling, both of which are directly associated with clinical failure due to non-unions, late graft fractures, and infections, making it a priority to improve large structural allograft healing. We have previously shown the osteogenic ability of a polymer-coated allograft that delivers bone morphogenetic protein-2 both in vitro and in vivo through both burst release and sustained release kinetics. In this study, we have demonstrated largely sequential delivery of bone morphogenetic protein-2 and vascular endothelial growth factor from the same coated allograft. Release data showed that loading both growth factors onto a polymeric coating with two different techniques resulted in short-term (95% release within 2 weeks) and long-term (95% release within 5 weeks) delivery kinetics. We have also demonstrated how released VEGF, traditionally associated with angiogenesis, can also provide a stimulus for allograft remodeling via resorption. Bone marrow derived mononuclear cells were co-cultured with VEGF released from the coated allograft and showed a statistically significant (p < 0.05) and dose dependent increase in the number of tartrate-resistant acid phosphatase-positive multinucleated osteoclasts. Functionality of these osteoclasts was assessed quantitatively and qualitatively by evaluating resorption pit area from both osteo-assay plates and harvested bone. Data indicated a statistically significant higher resorption area from the cells exposed to VEGF released from the allografts over controls (p < 0.05). These results indicate that by using different loading protocols temporal control can be achieved when delivering multiple growth factors from a polymer-coated allograft. Further, released VEGF can also stimulate osteoclastogenesis that may enhance allograft incorporation, and thus mitigate long-term clinical complications. © 2017 Orthopedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:1086-1095, 2017. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Polymeric scaffolds as stem cell carriers in bone repair.

PubMed

Rossi, Filippo; Santoro, Marco; Perale, Giuseppe

2015-10-01

Although bone has a high potential to regenerate itself after damage and injury, the efficacious repair of large bone defects resulting from resection, trauma or non-union fractures still requires the implantation of bone grafts. Materials science, in conjunction with biotechnology, can satisfy these needs by developing artificial bones, synthetic substitutes and organ implants. In particular, recent advances in polymer science have provided several innovations, underlying the increasing importance of macromolecules in this field. To address the increasing need for improved bone substitutes, tissue engineering seeks to create synthetic, three-dimensional scaffolds made from polymeric materials, incorporating stem cells and growth factors, to induce new bone tissue formation. Polymeric materials have shown a great affinity for cell transplantation and differentiation and, moreover, their structure can be tuned in order to maintain an adequate mechanical resistance and contemporarily be fully bioresorbable. This review emphasizes recent progress in polymer science that allows relaible polymeric scaffolds to be synthesized for stem cell growth in bone regeneration. Copyright © 2013 John Wiley & Sons, Ltd.

Growth patterns and life-history strategies in Placodontia (Diapsida: Sauropterygia)

PubMed Central

Klein, Nicole; Neenan, James M.; Scheyer, Torsten M.; Griebeler, Eva Maria

2015-01-01

Placodontia is a clade of durophagous, near shore marine reptiles from Triassic sediments of modern-day Europe, Middle East and China. Although much is known about their primary anatomy and palaeoecology, relatively little has been published regarding their life history, i.e. ageing, maturation and growth. Here, growth records derived from long bone histological data of placodont individuals are described and modelled to assess placodont growth and life-history strategies. Growth modelling methods are used to confirm traits documented in the growth record (age at onset of sexual maturity, age when asymptotic length was achieved, age at death, maximum longevity) and also to estimate undocumented traits. Based on these growth models, generalized estimates of these traits are established for each taxon. Overall differences in bone tissue types and resulting growth curves indicate different growth patterns and life-history strategies between different taxa of Placodontia. Psephoderma and Paraplacodus grew with lamellar-zonal bone tissue type and show growth patterns as seen in modern reptiles. Placodontia indet. aff. Cyamodus and some Placodontia indet. show a unique combination of fibrolamellar bone tissue regularly stratified by growth marks, a pattern absent in modern sauropsids. The bone tissue type of Placodontia indet. aff. Cyamodus and Placodontia indet. indicates a significantly increased basal metabolic rate when compared with modern reptiles. Double lines of arrested growth, non-annual rest lines in annuli, and subcycles that stratify zones suggest high dependence of placodont growth on endogenous and exogenous factors. Histological and modelled differences within taxa point to high individual developmental plasticity but sexual dimorphism in growth patterns and the presence of different taxa in the sample cannot be ruled out. PMID:26587259

Differential response of bone and kidney to ACEI in db/db mice: A potential effect of captopril on accelerating bone loss.

PubMed

Zhang, Yan; Li, Xiao-Li; Sha, Nan-Nan; Shu, Bing; Zhao, Yong-Jian; Wang, Xin-Luan; Xiao, Hui-Hui; Shi, Qi; Wong, Man-Sau; Wang, Yong-Jun

2017-04-01

The components of renin-angiotensin system (RAS) are expressed in the kidney and bone. Kidney disease and bone injury are common complications associated with diabetes. This study aimed to investigate the effects of an angiotensin-converting enzyme inhibitor, captopril, on the kidney and bone of db/db mice. The db/db mice were orally administered by gavage with captopril for 8weeks with db/+ mice as the non-diabetic control. Serum and urine biochemistries were determined by standard colorimetric methods or ELISA. Histological measurements were performed on the kidney by periodic acid-schiff staining and on the tibial proximal metaphysis by safranin O and masson-trichrome staining. Trabecular bone mass and bone quality were analyzed by microcomputed tomography. Quantitative polymerase chain reaction and immunoblotting were applied for molecular analysis on mRNA and protein expression. Captopril significantly improved albuminuria and glomerulosclerosis in db/db mice, and these effects might be attributed to the down-regulation of angiotensin II expression and the expression of its down-stream profibrotic factors in the kidney, like connective tissue growth factor and vascular endothelial growth factor. Urinary excretion of calcium and phosphorus markedly increased in db/db mice in response to captopril. Treatment with captopril induced a decrease in bone mineral density and deterioration of trabecular bone at proximal metaphysis of tibia in db/db mice, as shown in the histological and reconstructed 3-dimensional images. Even though captopril effectively reversed the diabetes-induced changes in calcium-binding protein 28-k and vitamin D receptor expression in the kidney as well as the expression of RAS components and bradykinin receptor-2 in bone tissue, treatment with captopril increased the osteoclast-covered bone surface, reduced the osteoblast-covered bone surface, down-regulated the expression of type 1 collagen and transcription factor runt-related transcription factor 2 (markers for osteoblastic functions), and up-regulated the expression of carbonic anhydrase II (marker for bone resorption). Captopril exerted therapeutic effects on renal injuries associated with type 2 diabetes but worsened the deteriorations of trabecular bone in db/db mice; the latter of which was at least in part due to the stimulation of osteoclastogenesis and the suppression of osteogenesis by captopril. Copyright © 2017 Elsevier Inc. All rights reserved.

IGFBP-4 regulates adult skeletal growth in a sex-specific manner

PubMed Central

DeMambro, Victoria E; Le, Phuong T; Nagano, Kenichi; Baron, Roland; Mohan, Subburaman; Rosen, Clifford J

2017-01-01

Insulin-like growth factor-1 (IGF-1) and its binding proteins are critical mediators of skeletal growth. Insulin-like growth factor-binding protein 4 (IGFBP-4) is highly expressed in osteoblasts and inhibits IGF-1 actions in vitro. Yet, in vivo studies suggest that it could potentiate IGF-1 and IGF-2 actions. In this study, we hypothesized that IGFBP-4 might potentiate the actions of IGF-1 on the skeleton. To test this, we comprehensively studied 8- and 16-week-old Igfbp4−/− mice. Both male and female adult Igfbp4−/− mice had marked growth retardation with reductions in body weight, body and femur lengths, fat proportion and lean mass at 8 and 16 weeks. Marked reductions in aBMD and aBMC were observed in 16-week-old Igfbp4−/− females, but not in males. Femoral trabecular BV/TV and thickness, cortical fraction and thickness in 16-week-old Igfbp4−/− females were significantly reduced. However, surprisingly, males had significantly more trabeculae with higher connectivity density than controls. Concordantly, histomorphometry revealed higher bone resorption and lower bone formation in Igfbp4−/− females. In contrast, Igfbp4−/− males had lower mineralized surface/bone surface. Femoral expression of Sost and circulating levels of sclerostin were reduced but only in Igfbp4−/− males. Bone marrow stromal cultures from mutants showed increased osteogenesis, whereas osteoclastogenesis was markedly increased in cells from Igfbp4−/− females but decreased in males. In sum, our results indicate that loss of Igfbp4 affects mesenchymal stromal cell differentiation, regulates osteoclastogenesis and influences both skeletal development and adult bone maintenance. Thus, IGFBP-4 modulates the skeleton in a gender-specific manner, acting as both a cell autonomous and cell non-autonomous factor. PMID:28184001

Bone Talk: Activated Osteoblasts Promote Lung Cancer Growth.

PubMed

Bružas, Emilis; Egeblad, Mikala

2018-03-01

Cancer cells can directly stimulate the generation and recruitment of tumor-supportive bone marrow-derived cells (BMDCs), including neutrophils, via secreted factors. A new study demonstrates that lung tumors also remotely activate bone-residing osteoblasts, which in turn promote neutrophil production. This is a multistep mechanism of establishing a supportive tumor microenvironment. Copyright © 2018 Elsevier Ltd. All rights reserved.

Clinical Comparison of Autogenous Bone Graft with and without Plasma Rich in Growth Factors in the Treatment of Grade II Furcation Involvement of Mandibular Molars

PubMed Central

Lafzi, Ardeshir; Shirmohammadi, Adileh; Faramarzi, Masoumeh; Jabali, Sahar; Shayan, Arman

2013-01-01

Background and aims Plasma rich in growth factors (PRGF) is a concentrated suspension of growth factors, which is used to promote periodontal tissue regeneration. The aim of this randomized, controlled, clinical trial was to evaluate of the treatment of grade II mandibular molar furcation involvement using autogenous bone graft with and without PRGF. Materials and methods In this double-blind clinical trial, thirty mandibular molars with grade II furcation involvement in 30 patients were selected. The test group received bone graft combined with PRGF, while the control group was treated with bone graft only. Clinical parameters included clinical probing depth (CPD), vertical clinical attachment level (V-CAL), horizontal clinical attachment level (H-CAL), location of gingival margin (LGM), surgically exposed horizontal probing depth of bony defect (E-HPD), vertical depth of bone crest (V-DBC), vertical depth of the base of bony defect (V-DBD), and length of the intrabony defect (LID). After six months, a re-entry surgery was performed. Data were analyzed by SPSS 14, using Kolmogorov, Mann-Whitney U, and paired t-test. Results After 6 months, both treatment methods led to significant improvement in V-CAL and H-CAL and significant decreases in CPD, E-HPD, V-DBD and LID; there was no significant difference in LGM and V-DBC in any of the treated groups compared to the baseline values. Also, none of the parameters showed significant differences between the study groups. Conclusion Although autogenous bone grafts, with or without PRGF, were successful in treating grade II furcation involvement, no differences between the study groups were observed. PMID:23486928

In vitro and in vivo evaluation of the marine sponge skeleton as a bone mimicking biomaterial.

PubMed

Nandi, Samit K; Kundu, Biswanath; Mahato, Arnab; Thakur, Narsinh L; Joardar, Siddhartha N; Mandal, Biman B

2015-02-01

This investigation was carried out to identify and characterize marine sponges as potential bioscaffolds in bone tissue engineering. The marine sponge (Biemna fortis) samples were collected from the rocky intertidal region of Anjuna, Goa, India, freeze-dried and converted to pure cristobalite at low temperature. After thorough evaluation of sponge samples by DTA-TGA thermography, XRD, FTIR, SEM and cell cytotoxicity by MTT assay, bare sponge scaffolds were fabricated by firing at 1190 °C. These scaffolds were loaded with growth factors (IGF-1 and BMP-2), checked for quasi-dynamic in vitro release kinetics and finally implanted into femoral bone defects in rabbits for up to 90 days, by keeping an empty defect as a control. The in vivo bone healing process was evaluated and compared using chronological radiology, histology, SEM and fluorochrome labeling studies. SEM revealed that the sponge skeleton possesses a collagenous fibrous network consisting of highly internetworked porosity in the size range of 10-220 μm. XRD and FTIR analysis showed a cristobalite phase with acicular crystals of high aspect ratio, and crystallinity was found to increase from 725 to 1190 °C. MTT assay demonstrated the non-cytotoxicity of the samples. A combination of burst and sustained release profile was noticed for both the growth factors and about 74.3% and 83% total release at day 28. In the radiological, histological, scanning electron microscopy and fluorochrome labeling analysis, the IGF-1 impregnated converted sponge scaffold promoted excellent osseous tissue formation followed by the BMP-2 loaded and bare one. These observations suggest that the marine sponge alone and in combination with growth factors is a promising biomaterial for bone repair and bone augmentation.

GDF9 and BMP15 Expressions and Fine Structure Changes During Folliculogenesis in Polycystic Ovary Syndrome.

PubMed

Karagül, Meryem İlkay; Aktaş, Savaş; Coşkun Yılmaz, Banu; Yılmaz, Mustafa; Orekici Temel, Gülhan

2018-01-20

Polycystic ovary syndrome is the most frequently seen endocrine disorder in women of reproductive age with a prevalence of about 10%. To investigate the efficiency of growth differentiation factor 9 and bone morphogenetic protein 15 during folliculogenesis in a dehydroepiandrosterone-induced mouse Polycystic ovary syndrome model. Animal experimentation. Mice were divided into 3 groups: control, vehicle and Polycystic ovary syndrome. Polycystic ovary syndrome model mice were developed by the injection of dehydroepiandrosterone dissolved in 0.1 mL of sesame oil. Ovarian tissues were examined for growth differentiation factor 9 and bone morphogenetic protein 15 using immunofluorescent labelling and electron microscopic examinations. The immunoreactivity of growth differentiation factor 9 and bone morphogenetic protein 15 proteins decreased (p<0.05) in the Polycystic ovary syndrome group (27.73±8.43 and 24.85±7.03, respectively) compared with the control group (33.72±11.22 and 31.12±11.05, respectively) and vehicle group (33.95±10.75 and 29.99±10.72, respectively). Apoptotic changes were observed in granulosa cells, lipid vacuoles increased in Theca cells and thickening and irregularities were noted in the basal lamina of granulosa cells. An increased electron density in the zona pellucida in some of the multilaminar primary and secondary follicles in the Polycystic ovary syndrome model was also observed at the ultrastructural level. These results suggest that the decrease in the growth differentiation factor 9 and bone morphogenetic protein 15 expression initiated at the primary follicle stage effect the follicle development and zona pellucida structure and may cause subfertility or infertility in Polycystic ovary syndrome.

Fibroblast growth factor 2 inhibits up-regulation of bone morphogenic proteins and their receptors during osteoblastic differentiation of human mesenchymal stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Biver, Emmanuel, E-mail: ebiver@yahoo.fr; Department of Rheumatology, Lille University Hospital, Roger Salengro Hospital, 59037 Lille cedex; Service of Bone Diseases, Department of Internal Medicine Specialties, University Hospital of Geneva, CH-1211 Geneva 14

2012-11-02

Highlights: Black-Right-Pointing-Pointer FGF modulates BMPs pathway in HMSCs by down-regulating BMP/BMPR expression. Black-Right-Pointing-Pointer This effect is mediated by ERK and JNK MAPKs pathways. Black-Right-Pointing-Pointer Crosstalk between FGF and BMPs must be taken into account in skeletal bioengineering. Black-Right-Pointing-Pointer It must also be considered in the use of recombinant BMPs in orthopedic and spine surgeries. -- Abstract: Understanding the interactions between growth factors and bone morphogenic proteins (BMPs) signaling remains a crucial issue to optimize the use of human mesenchymal stem cells (HMSCs) and BMPs in therapeutic perspectives and bone tissue engineering. BMPs are potent inducers of osteoblastic differentiation. They exertmore » their actions via BMP receptors (BMPR), including BMPR1A, BMPR1B and BMPR2. Fibroblast growth factor 2 (FGF2) is expressed by cells of the osteoblastic lineage, increases their proliferation and is secreted during the healing process of fractures or in surgery bone sites. We hypothesized that FGF2 might influence HMSC osteoblastic differentiation by modulating expressions of BMPs and their receptors. BMP2, BMP4, BMPR1A and mainly BMPR1B expressions were up-regulated during this differentiation. FGF2 inhibited HMSCs osteoblastic differentiation and the up-regulation of BMPs and BMPR. This effect was prevented by inhibiting the ERK or JNK mitogen-activated protein kinases which are known to be activated by FGF2. These data provide a mechanism explaining the inhibitory effect of FGF2 on osteoblastic differentiation of HMSCs. These crosstalks between growth and osteogenic factors should be considered in the use of recombinant BMPs in therapeutic purpose of fracture repair or skeletal bioengineering.« less

Endocrine Consequences of Anorexia Nervosa

PubMed Central

Misra, Madhusmita; Klibanski, Anne

2014-01-01

Summary Anorexia nervosa (AN) is prevalent in adolescents and young adults, and endocrine changes include hypothalamic amenorrhea, a nutritionally acquired growth hormone resistance with low insulin like growth factor-1 (IGF-1), relative hypercortisolemia, decreases in leptin, insulin, amylin and incretins, and increases in ghrelin, PYY and adiponectin. These changes in turn have deleterious effects on bone, and may affect neurocognition, anxiety, depression and eating disorder psychopathology. Low bone density is particularly concerning; clinical fractures occur and changes in both bone microarchitecture and strength estimates have been reported. Recovery causes improvement of many, but not all, hormonal changes, and deficits in bone accrual may persist despite recovery. Physiologic, primarily transdermal, estrogen replacement increases bone density in adolescents, although catch-up is incomplete. In adults, oral estrogen co-administered with rhIGF-1 in one study, and bisphosphonates in another increased bone density, though not to normal. More studies are necessary to determine the optimal therapeutic approach in AN. PMID:24731664

Bone regeneration with a combination of nanocrystalline hydroxyapatite silica gel, platelet-rich growth factor, and mesenchymal stem cells: a histologic study in rabbit calvaria.

PubMed

Behnia, Hossein; Khojasteh, Arash; Kiani, Mohammad Taghi; Khoshzaban, Ahad; Mashhadi Abbas, Fatemeh; Bashtar, Maryam; Dashti, Seyedeh Ghazaleh

2013-02-01

This study aimed to assess NanoBone as a carrier construct for mesenchymal stem cells (MSCs) and platelet-rich growth factor (PRGF). In the calvarial bone of 8 mature New Zealand White male rabbits, four 8-mm defects were created. Each defect received one of the following treatments: Group 1, 0.2 mg Nano-hydroxyapatite (HA) granule + 2 mL culture medium; Group 2, 0.2 mg Nano-HA + 1 mL autologous PRGF + 2 mL acellular culture medium; Group 3, 0.2 mg Nano-HA + 2 mL culture medium containing 100,000 autogenous MSCs; Group 4, 0.2 mg Nano-HA + 2 mL culture medium containing 100,000 autogenous MSCs + 1 mL autologous PRGF. Histomorphometric analysis at 6 and 12 weeks demonstrated significantly higher bone formation in group 4 (29.45% and 44.55%, respectively) (P < .05). Bone formation in groups 1, 2, and 3 were as follows: 11.35% and 32.53%, 29.10% and 39.74%, and 25.82% and 39.11%, respectively. NanoBone with MSCs and PRGF seems to be an effective combination for bone regeneration in a rabbit calvaria model. Copyright © 2013 Elsevier Inc. All rights reserved.

Tissue-Engineered Nanofibrous Nerve Grafts for Enhancing the Rate of Nerve Regeneration

DTIC Science & Technology

2015-10-01

structured nanofibrous biodegradable nerve graft system that present ECM protein, neurotrophic factor, and pre-seeded with bone marrow stromal cells in...nanofibrous biodegradable nerve graft system that present extracellular matrix (ECM) protein, nerve growth factor, and pre-seeded with bone marrow stromal...proposed novel structured nanofibrous biodegradable grafts will provide the micro environment, bioactivity, transport features and mechanics ideal for

Initial Biochemical Characterization of Cells Derived from Human Periodontium and Their In vitro Response to Platelet-Derived Growth Factor, Epidermal Growth Factor and Transforming Growth Factor-Beta

DTIC Science & Technology

1988-05-01

Periodontal disease is characterized by a loss of connective tissue...obtained for bone cells and fibroblasts. • " S,. O. ipr’ 0 II. LITERATURE REVIEW A . Periodontal Regeneration Periodontal disease is characterized by a ...fracture are felt to involve a similar sequence of cellular events. Since periodontal disease also involves the loss of soft tissue structures, such

Age-related changes in bone turnover in men.

PubMed

Fatayerji, D; Eastell, R

1999-07-01

Biochemical markers of bone turnover can be used to study the pathophysiology of osteoporosis. So far there have been few such studies in men. The aims of this study were to determine the effect of aging on bone turnover and to identify which hormones might regulate bone turnover in men. We studied 178 healthy Caucasian men, ages 20-79 years (30 per decade). The data for the effect of age on bone turnover was best fit by a quadratic function (nadirs at age 56, 57, 53, 39, and 58 years for intact propeptide of type I procollagen, osteocalcin, bone alkaline phosphatase, free deoxypyridinoline, and cross-linked N-telopeptides of type I collagen, respectively). For most markers, bone turnover tended to be highest in the third decade, lowest in the fifth and sixth decade, with a small increase in some markers in the eighth decade. Insulin-like growth factor-I (IGF-I), insulin-like growth factor binding protein-3, dehydroepiandrosterone sulfate, testosterone, estradiol, and free androgen index all decreased significantly with age (54, 17, 76, 26, 33, and 57%, respectively), while sex hormone binding globulin and parathyroid hormone increased significantly with age (62% and 43%). IGF-I and sex hormones were positively correlated with bone turnover, and this association was stronger in young men than older men. In conclusion, increased IGF-I and sex hormones may be associated with increased bone turnover in young men, with less influence on bone turnover in older men.

Postnatal soluble FGFR3 therapy rescues achondroplasia symptoms and restores bone growth in mice.

PubMed

Garcia, Stéphanie; Dirat, Béatrice; Tognacci, Thomas; Rochet, Nathalie; Mouska, Xavier; Bonnafous, Stéphanie; Patouraux, Stéphanie; Tran, Albert; Gual, Philippe; Le Marchand-Brustel, Yannick; Gennero, Isabelle; Gouze, Elvire

2013-09-18

Achondroplasia is a rare genetic disease characterized by abnormal bone development, resulting in short stature. It is caused by a single point mutation in the gene coding for fibroblast growth factor receptor 3 (FGFR3), which leads to prolonged activation upon ligand binding. To prevent excessive intracellular signaling and rescue the symptoms of achondroplasia, we have developed a recombinant protein therapeutic approach using a soluble form of human FGFR3 (sFGFR3), which acts as a decoy receptor and prevents FGF from binding to mutant FGFR3. sFGFR3 was injected subcutaneously to newborn Fgfr3(ach/+) mice-the mouse model of achondroplasia-twice per week throughout the growth period during 3 weeks. Effective maturation of growth plate chondrocytes was restored in bones of treated mice, with a dose-dependent enhancement of skeletal growth in Fgfr3(ach/+) mice. This resulted in normal stature and a significant decrease in mortality and associated complications, without any evidence of toxicity. These results describe a new approach for restoring bone growth and suggest that sFGFR3 could be a potential therapy for children with achondroplasia and related disorders.

Role of FGF/FGFR signaling in skeletal development and homeostasis: learning from mouse models

PubMed Central

Su, Nan; Jin, Min; Chen, Lin

2014-01-01

Fibroblast growth factor (FGF)/fibroblast growth factor receptor (FGFR) signaling plays essential roles in bone development and diseases. Missense mutations in FGFs and FGFRs in humans can cause various congenital bone diseases, including chondrodysplasia syndromes, craniosynostosis syndromes and syndromes with dysregulated phosphate metabolism. FGF/FGFR signaling is also an important pathway involved in the maintenance of adult bone homeostasis. Multiple kinds of mouse models, mimicking human skeleton diseases caused by missense mutations in FGFs and FGFRs, have been established by knock-in/out and transgenic technologies. These genetically modified mice provide good models for studying the role of FGF/FGFR signaling in skeleton development and homeostasis. In this review, we summarize the mouse models of FGF signaling-related skeleton diseases and recent progresses regarding the molecular mechanisms, underlying the role of FGFs/FGFRs in the regulation of bone development and homeostasis. This review also provides a perspective view on future works to explore the roles of FGF signaling in skeletal development and homeostasis. PMID:26273516

Ectopic bone formation and chondrodysplasia in transgenic mice carrying the rat C3(1)/T{sub AG} fusion gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Green, J.E.; Maroulakou, I.G.; Anver, M.

Transgenic mice expressing the SV40 large T-antigen (T{sup AG}) under the regultory control of the hormone-responsive rat C3(1) prostatein promoter develop unusual bone and cartilage lesions, as well as ectopic bone and cartilage formation. Two lines of transgenic animals have been propagated in which the expression of the transgene in chondrocytes results in a mild to moderate generalized disorganization of cartilage growth which appears to affect multiple tissues, including the trachea, ear pinna and articular cartilage. The epiphyseal plates are also affected with normal architecture of the zones of proliferation and maturation, but marked elongation of the zone of hypertrophy.more » Immunocytochemistry demonstrates that expression of T{sup AG} is limited to the zone of hypertropny in the epiphyseal plates, suggesting that the chondrocytes become hormone-responsive at this particular stage of differentiation. Normal mineralization and trabecular formation in long bone appears to occur. Ectopic bone and cartilage formation occurs in the foot pads of the fore- and hind- feet over the course of several months. This is preceded by proliferation of sweat gland epithelial cells followed by the appearance of nodules of cartilage and bone. The nodules are closely associated with proliferating epithelium but are not contiguous with bony structures normally found in the feet. The roles of BMP`s, growth factors, oncogenes and hormones in the development of these lesions will be presented. These transgenic animals may provide new insights into hormone-responsiveness of chondrocytes, as well as factors involved in the processes of bone and cartilage differentiation and growth. These transgenic animals may serve as a useful model for human heterotopic bone formation.« less

The protective effect of platelet released growth factors and bone augmentation (Bio-Oss®) on ethanol impaired osteoblasts.

PubMed

Sönmez, Tolga Taha; Bayer, Andreas; Cremer, Tillman; Hock, Jennifer Vanessa Phi; Lethaus, Bernd; Kweider, Nisreen; Wruck, Christoph Jan; Drescher, Wolf; Jahr, Holger; Lippross, Sebastian; Pufe, Thomas; Tohidnezhad, Mersedeh

2017-11-01

Chronic alcohol consumption is a known limiting factor for bone healing. One promising strategy to improve bone augmentation techniques with Bio-Oss ® in oral and maxillofacial surgery might be the supportive application of platelet-concentrated biomaterials as platelet-released growth factor (PRGF). To address this matter, we performed an in vitro study investigating the protective effects of PRGF and Bio-Oss ® in ethanol (EtOH) treated osteoblasts. The SAOS-2 osteosarcoma cell line, with and without EtOH pretreatment was used. The cell viability, proliferation and alkali phosphatase activity (ALP) after application of 0%, 5% and 10% PRGF and Bio-Oss ® were assessed. The application of PRGF and Bio-Oss ® in EtOH impaired osteoblasts showed a significant beneficial influence increasing the viability of the osteoblasts in cell culture. The synergistic effect of Bio-Oss ® and 5% PRGF on the proliferation of osteoblasts was also demonstrated. Bio-Oss ® only in combination with PRGF increases the alkaline phosphatase (ALP) activity in EtOH pretreated cells. These results indicate that the simultaneous application of PRGF and Bio-Oss ® inhibits EtOH induced bone healing impairment. Furthermore, in the cells, PRGF induced a protective mechanism which might promote bone regeneration. Copyright © 2017 Elsevier GmbH. All rights reserved.

Bone Disease after Kidney Transplantation

PubMed Central

Bouquegneau, Antoine; Salam, Syrazah; Delanaye, Pierre; Eastell, Richard

2016-01-01

Bone and mineral disorders occur frequently in kidney transplant recipients and are associated with a high risk of fracture, morbidity, and mortality. There is a broad spectrum of often overlapping bone diseases seen after transplantation, including osteoporosis as well as persisting high– or low–turnover bone disease. The pathophysiology underlying bone disorders after transplantation results from a complex interplay of factors, including preexisting renal osteodystrophy and bone loss related to a variety of causes, such as immunosuppression and alterations in the parathyroid hormone-vitamin D-fibroblast growth factor 23 axis as well as changes in mineral metabolism. Management is complex, because noninvasive tools, such as imaging and bone biomarkers, do not have sufficient sensitivity and specificity to detect these abnormalities in bone structure and function, whereas bone biopsy is not a widely available diagnostic tool. In this review, we focus on recent data that highlight improvements in our understanding of the prevalence, pathophysiology, and diagnostic and therapeutic strategies of mineral and bone disorders in kidney transplant recipients. PMID:26912549

Hormones and growth factors in the pathogenesis of spinal ligament ossification

PubMed Central

Li, Hai; Jiang, Lei-Sheng

2007-01-01

Ossification of the spinal ligaments (OSL) is a pathologic condition that causes ectopic bone formation and subsequently results in various degrees of neurological deficit, but the etiology of OSL remains almost unknown. Some systemic hormones, such as 1,25-dihydroxyvitamin D, parathyroid hormone (PTH), insulin and leptin, and local growth factors, such as transforming growth factor-β (TGF-β), and bone morphogenetic protein (BMP), have been studied and are thought to be involved in the initiation and development of OSL. This review article summarizes these studies, delineates the possible mechanisms, and puts forward doubts and new questions. The related findings from studies of genes and target cells in the ligament of OSL are also discussed. Although these findings may be helpful in understanding the pathogenesis of OSL, much more research needs to be conducted in order to investigate the nature of OSL. PMID:17426989

Hormones and growth factors in the pathogenesis of spinal ligament ossification.

PubMed

Li, Hai; Jiang, Lei-Sheng; Dai, Li-Yang

2007-08-01

Ossification of the spinal ligaments (OSL) is a pathologic condition that causes ectopic bone formation and subsequently results in various degrees of neurological deficit, but the etiology of OSL remains almost unknown. Some systemic hormones, such as 1,25-dihydroxyvitamin D, parathyroid hormone (PTH), insulin and leptin, and local growth factors, such as transforming growth factor-beta (TGF-beta), and bone morphogenetic protein (BMP), have been studied and are thought to be involved in the initiation and development of OSL. This review article summarizes these studies, delineates the possible mechanisms, and puts forward doubts and new questions. The related findings from studies of genes and target cells in the ligament of OSL are also discussed. Although these findings may be helpful in understanding the pathogenesis of OSL, much more research needs to be conducted in order to investigate the nature of OSL.

Inkjet-based biopatterning of SDF-1β augments BMP-2-induced repair of critical size calvarial bone defects in mice

PubMed Central

Herberg, Samuel; Kondrikova, Galina; Periyasamy-Thandavan, Sudharsan; Howie, R. Nicole; Elsalanty, Mohammed E.; Weiss, Lee; Campbell, Phil; Hill, William D.; Cray, James J.

2014-01-01

Background A major problem in craniofacial surgery is non-healing bone defects. Autologous reconstruction remains the standard of care for these cases. Bone morphogenetic protein-2 (BMP-2) therapy has proven its clinical utility, although non-targeted adverse events occur due to the high milligram-level doses used. Ongoing efforts explore the use of different growth factors, cytokines, or chemokines, as well as co-therapy to augment healing. Methods Here we utilize inkjet-based biopatterning to load acellular DermaMatrix delivery matrices with nanogram-level doses of BMP-2, stromal cell-derived factor-1β (SDF-1β), transforming growth factor-β1 (TGF-β1), or co-therapies thereof. We tested the hypothesis that bioprinted SDF-1β co-delivery enhances BMP-2 and TGF-β1-driven osteogenesis both in-vitro and in-vivo using a mouse calvarial critical size defect (CSD) model. Results Our data showed that BMP-2 bioprinted in low-doses induced significant new bone formation by four weeks post-operation. TGF-β1 was less effective compared to BMP-2, and SDF-1β therapy did not enhance osteogenesis above control levels. However, co-delivery of BMP-2 + SDF-1β was shown to augment BMP-2-induced bone formation compared to BMP-2 alone. In contrast, co-delivery of TGF-β1 + SDF-1β decreased bone healing compared to TGF-β1 alone. This was further confirmed in vitro by osteogenic differentiation studies using MC3T3-E1 pre-osteoblasts. Conclusions Our data indicates that sustained release delivery of a low-dose growth factor therapy using biopatterning technology can aid in healing CSD injuries. SDF-1β augments the ability for BMP-2 to drive healing, a result confirmed in vivo and in vitro; however, because SDF-1β is detrimental to TGF-β1-driven osteogenesis, its’ effect on osteogenesis is not universal. PMID:25016095

A reciprocal regulatory interaction between megakaryocytes, bone cells, and hematopoietic stem cells.

PubMed

Kacena, Melissa A; Gundberg, Caren M; Horowitz, Mark C

2006-11-01

A growing body of evidence suggests that megakaryocytes (MK) or their growth factors play a role in skeletal homeostasis. MK have been shown to express and/or secrete several bone-related proteins including osteocalcin, osteonectin, bone sialoprotein, osteopontin, bone morphogenetic proteins, and osteoprotegerin. In addition, at least 3 mouse models have been described in which MK number was significantly elevated with an accompanying marked increase in bone mineral density. Mice overexpressing thrombopoietin, the major MK growth factor, have an osteosclerotic bone phenotype. Mice deficient in transcription factors GATA-1 and NF-E2, which are required for the differentiation of MK, exhibited a strikingly increased bone mass. Importantly, recent studies have demonstrated that MK can stimulate osteoblast (OB) proliferation and differentiation in vitro and that they can also inhibit osteoclast (OC) formation in vitro. These findings suggest that MK play a dual role in skeletal homeostasis by stimulating formation while simultaneously inhibiting resorption. Conversely, cells of the osteoblast lineage support hematopoiesis, including megakaryopoiesis. Postnatal hematopoiesis occurs almost solely in the bone marrow (BM), close to or on endosteal surfaces. This finding, in conjunction with the observed contact of OB with hematopoietic cells, has lead investigators to explore the molecular and cellular interactions between hematopoietic cells and cells of the OB lineage. Importantly, it has been shown that many of the cytokines that are critical for normal hematopoiesis and megakaryopoiesis are produced by OB. Indeed, culturing osteoblasts with CD34+ BM cells significantly enhances hematopoietic cell number by both enhancing the proliferation of long-term culture initiating cells and the proliferation and differentiation of MK. These data are consistent with cells in the OB lineage playing a critical role in the hematopoietic niche. Overall, these observations demonstrate the importance of MK-bone cell interactions in both skeletal homeostasis and hematopoiesis.

Relationship of Fibroblast Growth Factor 23 (FGF-23) Serum Levels With Low Bone Mass in Postmenopausal Women.

PubMed

Shen, Jun; Fu, Shiping; Song, Yuan

2017-12-01

The aim of this study was to determine the relationship between serum fibroblast growth factor-23 (FGF-23) level and bone mass in postmenopausal women. A total of 60 premenopausal, 60 early postmenopausal, and 60 late postmenopausal women were investigated by the measurement of bone mineral densities (BMDs) at lumbar spine and proximal femur by DXA, together with serum concentrations of Ca, P, 25 (OH) D 3 , OC, iPTH, CTX-I, PINP, and FGF-23. The levels of FGF-23 and PINP in early postmenopausal group were significantly higher than that in the premenopausal or the late postmenopausal groups, their changing patterns were different form 25(OH)D 3, iPTH, IGF, CTX-I, and OC. According to the AUCs in the ROC analysis, we found that serum FGF-23 level was associated with the highest validity as compared to the other bone metabolism factors. Further study indicated the significant negative relationships between serum FGF-23 level and lumbar spine/proximal femur BMDs in postmenopausal women. After detection of the sensitivity and specificity of serum FGF- 23 for the low bone mass at different T-score (SD) lumbar spine/proximal femur BMDs, we found that serum FGF-23 level may be a reliable marker for low bone mass in postmenopausal women. The performance of FGF-23 in the differential diagnosis low bone mass from healthy participants indicated that FGF-23 has the capacity to differentiate the women with low bone mass from the normal ones. Our study indicated that serum FGF-23 level could be served as the utility in the early detection of women with low bone mass. J. Cell. Biochem. 118: 4454-4459, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

A Therapeutic Potential for Marine Skeletal Proteins in Bone Regeneration

PubMed Central

Green, David W.; Padula, Matthew P.; Santos, Jerran; Chou, Joshua; Milthorpe, Bruce; Ben-Nissan, Besim

2013-01-01

A vital ingredient for engineering bone tissue, in the culture dish, is the use of recombinant matrix and growth proteins to help accelerate the growth of cultivated tissues into clinically acceptable quantities. The skeletal organic matrices of calcifying marine invertebrates are an untouched potential source of such growth inducing proteins. They have the advantage of being ready-made and retain the native state of the original protein. Striking evidence shows that skeleton building bone morphogenic protein-2/4 (BMP) and transforming growth factor beta (TGF-β) exist within various marine invertebrates such as, corals. Best practice mariculture and the latest innovations in long-term marine invertebrate cell cultivation can be implemented to ensure that these proteins are produced sustainably and supplied continuously. This also guarantees that coral reef habitats are not damaged during the collection of specimens. Potential proteins for bone repair, either extracted from the skeleton or derived from cultivated tissues, can be identified, evaluated and retrieved using chromatography, cell assays and proteomic methods. Due to the current evidence for bone matrix protein analogues in marine invertebrates, together with the methods established for their production and retrieval there is a genuine prospect that they can be used to regenerate living bone for potential clinical use. PMID:23574983

Angiopoietin-like protein 2 promotes chondrogenic differentiation during bone growth as a cartilage matrix factor.

PubMed

Tanoue, H; Morinaga, J; Yoshizawa, T; Yugami, M; Itoh, H; Nakamura, T; Uehara, Y; Masuda, T; Odagiri, H; Sugizaki, T; Kadomatsu, T; Miyata, K; Endo, M; Terada, K; Ochi, H; Takeda, S; Yamagata, K; Fukuda, T; Mizuta, H; Oike, Y

2018-01-01

Chondrocyte differentiation is crucial for long bone growth. Many cartilage extracellular matrix (ECM) proteins reportedly contribute to chondrocyte differentiation, indicating that mechanisms underlying chondrocyte differentiation are likely more complex than previously appreciated. Angiopoietin-like protein 2 (ANGPTL2) is a secreted factor normally abundantly produced in mesenchymal lineage cells such as adipocytes and fibroblasts, but its loss contributes to the pathogenesis of lifestyle- or aging-related diseases. However, the function of ANGPTL2 in chondrocytes, which are also differentiated from mesenchymal stem cells, remains unclear. Here, we investigate whether ANGPTL2 is expressed in or functions in chondrocytes. First, we evaluated Angptl2 expression during chondrocyte differentiation using chondrogenic ATDC5 cells and wild-type epiphyseal cartilage of newborn mice. We next assessed ANGPTL2 function in chondrogenic differentiation and associated signaling using Angptl2 knockdown ATDC5 cells and Angptl2 knockout mice. ANGPTL2 is expressed in chondrocytes, particularly those located in resting and proliferative zones, and accumulates in ECM surrounding chondrocytes. Interestingly, long bone growth was retarded in Angptl2 knockout mice from neonatal to adult stages via attenuation of chondrocyte differentiation. Both in vivo and in vitro experiments show that changes in ANGPTL2 expression can also alter p38 mitogen-activated protein kinase (MAPK) activity mediated by integrin α5β1. ANGPTL2 contributes to chondrocyte differentiation and subsequent endochondral ossification through α5β1 integrin and p38 MAPK signaling during bone growth. Our findings provide insight into molecular mechanisms governing communication between chondrocytes and surrounding ECM components in bone growth activities. Copyright © 2017. Published by Elsevier Ltd.

Mobilization of bone marrow mesenchymal stem cells in vivo augments bone healing in a mouse model of segmental bone defect.

PubMed

Kumar, Sanjay; Ponnazhagan, Selvarangan

2012-04-01

Although the number of mesenchymal stem cells (MSC) in the bone marrow is sufficient to maintain skeletal homeostasis, in osteopenic pathology, aggravated osteoclast activity or insufficient osteoblast numbers ensue, affecting normal bone remodeling. Most of the currently available therapies are anti-resorptive with limited osteogenic potential. Since mobilization of stem/progenitors from the BM is a prerequisite for their participation in tissue repair, amplification of endogenous stem cells may provide an alternative approach in these conditions. The present study determined the potential of MSC mobilization in vivo, using combinations of different growth factors with the CXCR4 antagonist, AMD3100, in a mouse model of segmental bone defect. Results indicated that among several factors tested IGF1 had maximum proliferative ability of MSC in vitro. Results of the in vivo studies indicated that the combination of IGF1 and AMD3100 provided significant augmentation of bone growth as determined by DXA, micro-CT and histomorphometry in mice bearing segmental fractures. Further, characterization of MSC isolated from mice treated with IGF1 and AMD3100 indicated Akt/PI3K, MEK1/2-Erk1/2 and smad2/3 as key signaling pathways mediating this effect. These data indicate the potential of in vivo stem cell mobilization as a novel alternative for bone healing. Copyright © 2012 Elsevier Inc. All rights reserved.

An Osteoblast-Derived Proteinase Controls Tumor Cell Survival via TGF-beta Activation in the Bone Microenvironment

PubMed Central

Thiolloy, Sophie; Edwards, James R.; Fingleton, Barbara; Rifkin, Daniel B.; Matrisian, Lynn M.; Lynch, Conor C.

2012-01-01

Background Breast to bone metastases frequently induce a “vicious cycle” in which osteoclast mediated bone resorption and proteolysis results in the release of bone matrix sequestered factors that drive tumor growth. While osteoclasts express numerous proteinases, analysis of human breast to bone metastases unexpectedly revealed that bone forming osteoblasts were consistently positive for the proteinase, MMP-2. Given the role of MMP-2 in extracellular matrix degradation and growth factor/cytokine processing, we tested whether osteoblast derived MMP-2 contributed to the vicious cycle of tumor progression in the bone microenvironment. Methodology/Principal Findings To test our hypothesis, we utilized murine models of the osteolytic tumor-bone microenvironment in immunocompetent wild type and MMP-2 null mice. In longitudinal studies, we found that host MMP-2 significantly contributed to tumor progression in bone by protecting against apoptosis and promoting cancer cell survival (caspase-3; immunohistochemistry). Our data also indicate that host MMP-2 contributes to tumor induced osteolysis (μCT, histomorphometry). Further ex vivo/in vitro experiments with wild type and MMP-2 null osteoclast and osteoblast cultures identified that 1) the absence of MMP-2 did not have a deleterious effect on osteoclast function (cd11B isolation, osteoclast differentiation, transwell migration and dentin resorption assay); and 2) that osteoblast derived MMP-2 promoted tumor survival by regulating the bioavailability of TGFβ, a factor critical for cell-cell communication in the bone (ELISA, immunoblot assay, clonal and soft agar assays). Conclusion/Significance Collectively, these studies identify a novel “mini-vicious cycle” between the osteoblast and metastatic cancer cells that is key for initial tumor survival in the bone microenvironment. In conclusion, the findings of our study suggest that the targeted inhibition of MMP-2 and/or TGFβ would be beneficial for the treatment of bone metastases. PMID:22238668

Osteoporosis in Children with Chronic Disease.

PubMed

Högler, Wolfgang; Ward, Leanne

2015-01-01

Serious illness in children and its therapy can cause osteoporosis, manifesting as vertebral and nonvertebral fractures, pain, skeletal deformity and temporary or even permanent loss of ambulation. In contrast to adults, skeletal growth in children offers tremendous potential to recover bone mineral density and to reshape fractured vertebral bodies, even without bone-targeted therapy, provided that bone health threats are transient and residual growth is sufficient. Here, we outline the principles of bone strength development and the risk factors for osteoporosis due to various paediatric systemic illnesses. We also explain why the approach to the diagnosis and monitoring of childhood osteoporosis has moved away from a bone density-centric focus to a more functional assessment. Finally, we discuss the best candidates for and current approaches to the treatment of osteoporosis in children. © 2015 S. Karger AG, Basel.

Rapamycin and the transcription factor C/EBPbeta as a switch in osteoclast differentiation: implications for lytic bone diseases.

PubMed

Smink, Jeske J; Leutz, Achim

2010-03-01

Lytic bone diseases and in particular osteoporosis are common age-related diseases characterized by enhanced bone fragility due to loss of bone density. Increasingly, osteoporosis poses a major global health-care problem due to the growth of the elderly population. Recently, it was found that the gene regulatory transcription factor CCAAT/enhancer binding protein beta (C/EBPbeta) is involved in bone metabolism. C/EBPbeta occurs as different protein isoforms of variable amino terminal length, and regulation of the C/EBPbeta isoform ratio balance was found to represent an important factor in osteoclast differentiation and bone homeostasis. Interestingly, adjustment of the C/EBPbeta isoform ratio by the process of translational control is downstream of the mammalian target of rapamycin kinase (mTOR), a sensor of the nutritional status and a target of immunosuppressive and anticancer drugs. The findings imply that modulating the process of translational control of C/EBPbeta isoform expression could represent a novel therapeutic approach in osteolytic bone diseases, including cancer and infection-induced bone loss.

Bone characteristics of late-term embryonic and hatchling broilers: bone development under extreme growth rate.

PubMed

Yair, R; Uni, Z; Shahar, R

2012-10-01

The development of broilers is an extreme example of rapid growth, increasing in weight from 40 g at hatch to 2,000 g 5 to 6 wk later. Such rapid growth requires a correspondingly fast development of the skeleton. Bone development is a genetically programmed process that is modified by epigenetic factors, mainly muscle-induced stresses and strains. In this study, we describe the temporal changes in bone morphology and material properties during the prehatch period [embryonic day (E) 14, E17, E19, E21] and posthatch d 3 and 7. The bones were examined for their weight, length, ash content, mechanical properties, and cortical structure. We show that the cross-sectional shape of the tibia and femur changes during the examination period from circular to elliptical. Additionally, the changes in bone properties are time-dependent and nonuniform: from E14 to E17 and from d 3 to 7, fast bone growth was noted, with major increases in both mechanical properties (stiffness, ultimate load, and energy to fracture) and geometric properties (cross-sectional area and thickness, medullary area, and moment of inertia). On the other hand, during the last days of incubation, most mechanical and geometric properties remain unchanged or even decrease. The reasons for this finding may relate to the hatching process but also to mineral shortage during the last days of incubation. This study leads to better understanding of bone development in ovo and posthatch in fast-growing broilers.

Osteogenic capacity of transgenic flax scaffolds.

PubMed

Gredes, Tomasz; Wróbel-Kwiatkowska, Magdalena; Dominiak, Marzena; Gedrange, Tomasz; Kunert-Keil, Christiane

2012-01-19

The modification of flax fibers to create biologically active dressings is of undoubted scientific and practical interest. Flax fibers, derived from transgenic flax expressing three bacterial genes for the synthesis of poly-3-hydroxybutyric acid (PHB), have better mechanical properties than unmodified flax fibers; do not show any inflammation response after subcutaneous insertion; and have a good in vitro and in vivo biocompatibility. The aim of this study was to examine the applicability of composites containing flax fibers of genetically modified (M50) or non-modified (wt-Nike) flax within a polylactide (PLA) matrix for bone regeneration. For this, the mRNA expression of genes coding for growth factors (insulin-like growth factor IGF1, IGF2, vascular endothelial growth factor), for osteogenic differentiation (alkaline phosphatase, osteocalcin, Runx2, Phex, type 1 and type 2 collagen), and for bone resorption markers [matrix metalloproteinase 8 (MMP8), acid phosphatase type 5] were analyzed using quantitative real-time polymerase chain reaction. We found a significant elevated mRNA expression of IGF1 with PLA and PLA-wt-Nike composites. The mRNA amount of MMP8 and osteocalcin was significantly decreased in all biocomposite-treated cranial tissue samples compared to controls, whereas the expression of all other tested transcripts did not show any differences. It is assumed that both flax composites are able to stimulate bone regeneration, but composites from transgenic flax plants producing PHB showed faster bone regeneration than composites of non-transgenic flax plants. The application of these linen membranes for bone tissue engineering should be proved in further studies.

Relative binding and biochemical effects of heterodimeric and homodimeric isoforms of platelet-derived growth factor in osteoblast-enriched cultures from fetal rat bone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Centrella, M.; McCarthy, T.L.; Kusmik, W.F.

1991-06-01

Platelet-derived growth factor (PDGF) exists as a homodimer or a heterodimer comprising either PDGF-A or PDGF-B subunits, and each isoform occurs in various tissues, including bone. Although the stimulatory effects of PDGF-BB have been studied in cultures of bone cells and intact bone fragments, the influence of other isoforms that may arise locally or systematically in vivo, has not been reported. Therefore recombinant human PDGF-BB, PDGF-AB, and PDGF-AA were evaluated in osteoblast-enriched cultures from fetal rat bone. Within 24 hours these factors produced a graded response in bone cell DNA and protein synthesis, with half-maximal effects at approximately 0.6, 2.1,more » and 4.8 nM PDGF-BB, PDGF-AB, and PDGF-AA, respectively. Increases in collagen and noncollagen protein synthesis were abrogated when DNA synthesis was blocked with hydroxyurea. Furthermore, each factor reduced alkaline phosphatase activity, PDGF-BB being the most inhibitory. Binding studies with 125I-PDGF-BB or 125I-PDGF-AA and each unlabeled PDGF isoform produced discrete ligand binding and displacement patterns: 125I-PDGF-BB binding was preferentially displaced by PDGF-BB (Ki approximately 0.7 nM), less by PDGF-AB (Ki approximately 2.3 nM) and poorly by PDGF-AA. In contrast, 125I-PDGF-AA binding was measurably reduced by PDGF-AA (Ki approximately 4.0 nM), but was more effectively displaced by PDGF-BB or PDGF-AB (each with Ki approximately 0.7 nM). These studies indicate that each PDGF isoform produces biochemical effects proportional to binding site occupancy and suggest that receptors that favor PDGF-B subunit binding preferentially mediate these results in osteoblast-enriched bone cell cultures.« less

Skeletal unloading causes resistance of osteoprogenitor cells to parathyroid hormone and to insulin-like growth factor-I

NASA Technical Reports Server (NTRS)

Kostenuik, P. J.; Harris, J.; Halloran, B. P.; Turner, R. T.; Morey-Holton, E. R.; Bikle, D. D.

1999-01-01

Skeletal unloading decreases bone formation and osteoblast number in vivo and decreases the number and proliferation of bone marrow osteoprogenitor (BMOp) cells in vitro. We tested the ability of parathyroid hormone (PTH) to stimulate BMOp cells in vivo by treating Sprague Dawley rats (n = 32) with intermittent PTH(1-34) (1 h/day at 8 microg/100 g of body weight), or with vehicle via osmotic minipumps during 7 days of normal weight bearing or hind limb unloading. Marrow cells were flushed from the femur and cultured at the same initial density for up to 21 days. PTH treatment of normally loaded rats caused a 2.5-fold increase in the number of BMOp cells, with similar increases in alkaline phosphatase (ALP) activity and mineralization, compared with cultures from vehicle-treated rats. PTH treatment of hind limb unloaded rats failed to stimulate BMOp cell number, ALP activity, or mineralization. Hind limb unloading had no significant effect on PTH receptor mRNA or protein levels in the tibia. Direct in vitro PTH challenge of BMOp cells isolated from normally loaded bone failed to stimulate their proliferation and inhibited their differentiation, suggesting that the in vivo anabolic effect of intermittent PTH on BMOp cells was mediated indirectly by a PTH-induced factor. We hypothesize that this factor is insulin-like growth factor-I (IGF-I), which stimulated the in vitro proliferation and differentiation of BMOp cells isolated from normally loaded bone, but not from unloaded bone. These results suggest that IGF-I mediates the ability of PTH to stimulate BMOp cell proliferation in normally loaded bone, and that BMOp cells in unloaded bone are resistant to the anabolic effect of intermittent PTH therapy due to their resistance to IGF-I.

FGF23 associated bone diseases.

PubMed

Liao, Eryuan

2013-03-01

Recently, fibroblast growth factor 23 (FGF23) has sparked widespread interest because of its potential role in regulating phosphate and vitamin D metabolism. In this review, we summarized the FGF superfamily, the mechanism of FGF23 on phosphate and vitamin D metabolism, and the FGF23 related bone disease.

Biomaterial delivery of morphogens to mimic the natural healing cascade in bone

PubMed Central

Mehta, Manav; Schmidt-Bleek, Katharina; Duda, Georg N; Mooney, David J

2012-01-01

Complications in treatment of large bone defects using bone grafting still remain. Our understanding of the endogenous bone regeneration cascade has inspired the exploration of a wide variety of growth factors (GFs) in an effort to mimic the natural signaling that controls bone healing. Biomaterial-based delivery of single exogenous GFs has shown therapeutic efficacy, and this likely relates to its ability to recruit and promote replication of cells involved in tissue development and the healing process. However, as the natural bone healing cascade involves the action of multiple factors, each acting in a specific spatiotemporal pattern, strategies aiming to mimic the critical aspects of this process will likely benefit from the usage of multiple therapeutic agents. This article reviews the current status of approaches to deliver single GFs, as well as ongoing efforts to develop sophisticated delivery platforms to deliver multiple lineage-directing morphogens (multiple GFs) during bone healing. PMID:22626978

What People with Anorexia Nervosa Need to Know about Osteoporosis

MedlinePlus

... as a decrease in the production of growth hormone and other growth factors, low body weight (apart from the estrogen loss it causes), calcium deficiency, and malnutrition, may contribute to bone loss in girls and ...

Controllable mineral coatings on scaffolds as carriers for growth factor release for bone tissue engineering

NASA Astrophysics Data System (ADS)

Saurez-Gonzalez, Darilis

The work presented in this document, focused on the development and characterization of mineral coatings on scaffold materials to serve as templates for growth factor binding and release. Mineral coatings were formed using a biomimetic approach that consisted in the incubation of scaffolds in modified simulated body fluids (mSBF). To modulate the properties of the mineral coating, which we hypothesized would dictate growth factor release, we used carbonate (HCO3) concentration in mSBF of 4.2 mM, 25mM, and 100mM. Analysis of the mineral coatings formed using scanning electron microscopy indicated growth of a continuous layer of mineral with different morphologies. X-ray diffraction analysis showed peaks associated with hydroxyapatite. FTIR data confirmed the substitution of HCO3 in the mineral. As the extent of HCO3 substitution increased, the coating exhibited more rapid dissolution kinetics in an environment deficient in calcium and phosphate. The mineral coatings provided an effective mechanism for bioactive growth factor binding and release. Peptide versions of vascular endothelial growth factor (VEGF) and bone morphogenetic protein 2 (BMP2) were bound with efficiencies up to 90% to mineral-coated PCL scaffolds. Recombinant human vascular endothelial growth factor (rhVEGF) also bound to mineral coated scaffolds with lower efficiency (20%) and released with faster release kinetics compared to peptides growth factor. Released rhVEGF induced human umbilical vein endothelial cell (HUVEC) proliferation in vitro and enhanced blood vessel formation in vivo in an intramuscular sheep model. In addition to the use the mineral coatings for single growth factor release, we expanded the concept and bound both an angiogenic (rhVEGF) and osteogenic (mBMP2) growth factor by a simple double dipping process. Sustained release of both growth factors was demonstrated for over 60 days. Released rhVEGF enhanced blood vessel formation in vivo in sheep and its biological activity was not affected by the presence of mBMP2. The approach for growth factor binding and release from mineral coatings can be adapted to different materials and medical devices and provide a simple and adaptable mechanism for sustained release of single or dual growth factors.

Vascular endothelial growth factor/bone morphogenetic protein-2 bone marrow combined modification of the mesenchymal stem cells to repair the avascular necrosis of the femoral head

PubMed Central

Ma, Xiao-Wei; Cui, Da-Ping; Zhao, De-Wei

2015-01-01

Vascular endothelial cell growth factor (VEGF) combined with bone morphogenetic protein (BMP) was used to repair avascular necrosis of the femoral head, which can maintain the osteogenic phenotype of seed cells, and effectively secrete VEGF and BMP-2, and effectively promote blood vessel regeneration and contribute to formation and revascularization of tissue engineered bone tissues. To observe the therapeutic effect on the treatment of avascular necrosis of the femoral head by using bone marrow mesenchymal stem cells (BMSCs) modified by VEGF-165 and BMP-2 in vitro. The models were avascular necrosis of femoral head of rabbits on right leg. There groups were single core decompression group, core decompression + BMSCs group, core decompression + VEGF-165/BMP-2 transfect BMSCs group. Necrotic bone was cleared out under arthroscope. Arthroscopic observation demonstrated that necrotic bone was cleared out in each group, and fresh blood flowed out. Histomorphology determination showed that blood vessel number and new bone area in the repair region were significantly greater at various time points following transplantation in the core decompression + VEGF-165/BMP-2 transfect BMSCs group compared with single core decompression group and core decompression + BMSCs group (P < 0.05). These suggested that VEGF-165/BMP-2 gene transfection strengthened osteogenic effects of BMSCs, elevated number and quality of new bones and accelerated the repair of osteonecrosis of the femoral head. PMID:26629044

Comparison of fibrin clots derived from peripheral blood and bone marrow.

PubMed

Shoji, Takeshi; Nakasa, Tomoyuki; Yoshizuka, Masaaki; Yamasaki, Takuma; Yasunaga, Yuji; Adachi, Nobuo; Ochi, Mitsuo

2017-03-01

Autologous fibrin clots derived from peripheral blood (pb-fibrin clot) and bone marrow (bm-fibrin clot) are thought to be effective for tissue regeneration. However, there is no report detailing the amount of growth factors in pb-/bm-fibrin clot. In this study we evaluated the amount of growth factors in human pb-/bm-fibrin clot, and prove the validity of fibrin clot for clinical use. Human pb-/bm-fibrin clots were obtained during surgery. In the first experiment, enzyme-linked immunosorbent assay (ELISA) was performed for detecting the amount of vascular endothelial growth factor (VEGF), epidermal growth factor (EGF), insulin-like growth factor-1 (IGF-1), fibroblast growth factor basic (bFGF), hepatocyte growth factor (HGF), transforming growth factor-beta (TGF-β), platelet derived-growth factors-AB (PDGF-AB), and stromal cell-derived factor-1 (SDF-1). In the second experiment, the efficacy of fibrin clot on the osteogenic differentiation and fibroblast proliferation was evaluated. Pb-/bm-fibrin clots were incubated in human osteoblast derived from mesenchymal stromal cells (MSCs) or human skin fibroblast. Alizarin red staining and real-time PCR (COL1A1, RUNX2) were performed for the detection of osteogenic potential. Cell-growth assay (WST-8) and real-time PCR (COL1A1) were also performed for the detection of the potential of fibroblast proliferation. ELISA analysis revealed that the amount of VEGF, HGF, bFGF, IGF-1, and SDF-1 of bm-fibrin clot group is higher than that of pb-fibrin clot group with statistical differences. Besides, we confirmed that bm-fibrin clot has much potential for the osteogenic differentiation and fibroblast proliferation. The positive outcomes confirm the efficacy of pb-/bm-fibrin clot, and bm-fibrin clot was proved to have much potential for tissue regeneration compared with pb-fibrin clot. The current study showed the potential of a strategy for regenerative medicine using bm-fibrin clot.

Core binding factor beta (Cbfβ) controls the balance of chondrocyte proliferation and differentiation by upregulating Indian hedgehog (Ihh) expression and inhibiting parathyroid hormone-related protein receptor (PPR) expression in postnatal cartilage and bone formation.

PubMed

Tian, Fei; Wu, Mengrui; Deng, Lianfu; Zhu, Guochun; Ma, Junqing; Gao, Bo; Wang, Lin; Li, Yi-Ping; Chen, Wei

2014-07-01

Core binding factor beta (Cbfβ) is essential for embryonic bone morphogenesis. Yet the mechanisms by which Cbfβ regulates chondrocyte proliferation and differentiation as well as postnatal cartilage and bone formation remain unclear. Hence, using paired-related homeobox transcription factor 1-Cre (Prx1-Cre) mice, mesenchymal stem cell-specific Cbfβ-deficient (Cbfβ(f/f) Prx1-Cre) mice were generated to study the role of Cbfβ in postnatal cartilage and bone development. These mutant mice survived to adulthood but exhibited severe sternum and limb malformations. Sternum ossification was largely delayed in the Cbfβ(f/f) Prx1-Cre mice and the xiphoid process was noncalcified and enlarged. In newborn and 7-day-old Cbfβ(f/f) Prx1-Cre mice, the resting zone was dramatically elongated, the proliferation zone and hypertrophic zone of the growth plates were drastically shortened and disorganized, and trabecular bone formation was reduced. Moreover, in 1-month-old Cbfβ(f/f) Prx1-Cre mice, the growth plates were severely deformed and trabecular bone was almost absent. In addition, Cbfβ deficiency impaired intramembranous bone formation both in vivo and in vitro. Interestingly, although the expression of Indian hedgehog (Ihh) was largely reduced, the expression of parathyroid hormone-related protein (PTHrP) receptor (PPR) was dramatically increased in the Cbfβ(f/f) Prx1-Cre growth plate, indicating that that Cbfβ deficiency disrupted the Ihh-PTHrP negative regulatory loop. Chromatin immunoprecipitation (ChIP) analysis and promoter luciferase assay demonstrated that the Runx/Cbfβ complex binds putative Runx-binding sites of the Ihh promoter regions, and also the Runx/Cbfβ complex directly upregulates Ihh expression at the transcriptional level. Consistently, the expressions of Ihh target genes, including CyclinD1, Ptc, and Pthlh, were downregulated in Cbfβ-deficient chondrocytes. Taken together, our study reveals not only that Cbfβ is essential for chondrocyte proliferation and differentiation for the growth and maintenance of the skeleton in postnatal mice, but also that it functions in upregulating Ihh expression to promoter chondrocyte proliferation and osteoblast differentiation, and inhibiting PPR expression to enhance chondrocyte differentiation. © 2014 American Society for Bone and Mineral Research.

Reversing sex steroid deficiency and optimizing skeletal development in the adolescent with gonadal failure.

PubMed

Vanderschueren, Dirk; Vandenput, Liesbeth; Boonen, Steven

2005-01-01

During puberty, the acquisition of skeletal mass and areal bone mineral density (BMD) mainly reflects an increase in bone size (length and perimeters) and not true volumetric BMD. Sexual dimorphism in bone mass and areal BMD is also explained by differences in bone size (longer and wider bones in males) and not by differences in volumetric BMD. Androgens stimulate skeletal growth by activation of the androgen receptor, whereas estrogens (following aromatization of androgens and stimulation of estrogen receptors) have a biphasic effect on skeletal growth during puberty. Recent evidence from clinical cases has shown that many of the growth-promoting effects of the sex steroids are mediated through estrogens rather than androgens. In addition, skeletal maturation and epiphyseal fusion are also estrogen-dependent in both sexes. Nevertheless, independent actions of androgens in these processes also occur. Both sex steroids maintain volumetric BMD during puberty. Androgens interact with the growth hormone (GH)-insulin-like growth factor-I (IGF-I) axis neonatally, resulting in a sexual dimorphic GH pattern during puberty, whereas estrogens stimulate GH and hereby IGF-I in both sexes. Hypogonadism in adolescents impairs not only bone size but also maintenance of volumetric BMD, hereby severely reducing peak areal BMD. Delayed puberty in boys and Turner's syndrome in women impair both bone length and size, reducing areal BMD. Whether volumetric BMD is also reduced and whether fracture risk is increased in these conditions remains controversial. Replacing sex steroids according to a biphasic pattern (starting at low doses and ending at high-normal doses) seems the safest approach to reach targeted height and to optimize bone development.

Olaratumab Exerts Antitumor Activity in Preclinical Models of Pediatric Bone and Soft Tissue Tumors through Inhibition of Platelet-Derived Growth Factor Receptor α.

PubMed

Lowery, Caitlin D; Blosser, Wayne; Dowless, Michele; Knoche, Shelby; Stephens, Jennifer; Li, Huiling; Surguladze, David; Loizos, Nick; Luffer-Atlas, Debra; Oakley, Gerard J; Guo, Qianxu; Iyer, Seema; Rubin, Brian P; Stancato, Louis

2018-02-15

Purpose: Platelet-derived growth factor receptor α (PDGFRα) is implicated in several adult and pediatric malignancies, where activated signaling in tumor cells and/or cells within the microenvironment drive tumorigenesis and disease progression. Olaratumab (LY3012207/IMC-3G3) is a human mAb that exclusively binds to PDGFRα and recently received accelerated FDA approval and conditional EMA approval for treatment of advanced adult sarcoma patients in combination with doxorubicin. In this study, we investigated olaratumab in preclinical models of pediatric bone and soft tissue tumors. Experimental Design: PDGFRα expression was evaluated by qPCR and Western blot analysis. Olaratumab was investigated in in vitro cell proliferation and invasion assays using pediatric osteosarcoma and rhabdoid tumor cell lines. In vivo activity of olaratumab was assessed in preclinical mouse models of pediatric osteosarcoma and malignant rhabdoid tumor. Results: In vitro olaratumab treatment of osteosarcoma and rhabdoid tumor cell lines reduced proliferation and inhibited invasion driven by individual platelet-derived growth factors (PDGFs) or serum. Furthermore, olaratumab delayed primary tumor growth in mouse models of pediatric osteosarcoma and malignant rhabdoid tumor, and this activity was enhanced by combination with either doxorubicin or cisplatin. Conclusions: Overall, these data indicate that olaratumab, alone and in combination with standard of care, blocks the growth of some preclinical PDGFRα-expressing pediatric bone and soft tissue tumor models. Clin Cancer Res; 24(4); 847-57. ©2017 AACR . ©2017 American Association for Cancer Research.

Enhanced Bone Formation in Segmental Defects with BMP2 in a Biologically Relevant Molecular Context

DTIC Science & Technology

2016-10-16

gun shots . These do not heal on their own once a ‘critical size’ segment of bone is missing. One strategy to induce healing is to use bone-inducing...accelerate BMP2-induced bone formation by presenting the growth factor in a more biologically relevant context. This is based on our observation...that manganese increases the binding of BMP2 to COMP. The next steps are to validate these observations using BMP2:COMP on HA/PLG scaffolds in-vitro

Does fetal smoke exposure affect childhood bone mass? The Generation R Study.

PubMed

Heppe, D H M; Medina-Gomez, C; Hofman, A; Rivadeneira, F; Jaddoe, V W V

2015-04-01

We assessed the intrauterine influence of maternal smoking on childhood bone mass by comparing parental prenatal and postnatal smoking habits. We observed higher bone mass in children exposed to maternal smoking, explained by higher body weight. Maternal smoking or related lifestyle factors may affect childhood weight gain rather than skeletal growth. Maternal smoking during pregnancy may adversely affect bone health in later life. By comparing the associations of maternal and paternal smoking and of prenatal and postnatal exposure with childhood bone measures, we aimed to explore whether the suggested association could be explained by fetal programming or reflects confounding by familial factors. In 5565 mothers, fathers and children participating in a population-based prospective cohort study, parental smoking habits during pregnancy and current household smoking habits were assessed by postal questionnaires. Total body bone mineral content (BMC), bone area (BA) and bone mineral density (BMD) were measured by dual-energy X-ray absorptiometry (DXA) at the median age of 6.0 years (IQR 0.37). In confounder-adjusted models, maternal smoking during pregnancy was associated with a higher BMC of 11.6 g (95 % confidence interval (CI) 5.6, 17.5), a larger BA of 9.7 cm(2) (95 % CI 3.0, 16.4), a higher BMD of 6.7 g/cm(2) (95 % CI 2.4, 11.0) and a higher BMC of 5.4 g (95 % CI 1.3, 9.6) adjusted for BA of the child. Current weight turned out to mediate these associations. Among mothers who did not smoke, paternal smoking did not show evident associations with childhood bone measures. Also, household smoking practices during childhood were not associated with childhood bone measures. Our results do not support the hypothesis of fetal smoke exposure affecting childhood bone mass via intrauterine mechanisms. Maternal smoking or related lifestyle factors may affect childhood weight gain rather than skeletal growth.

The effects of 1α, 25-dihydroxyvitamin D3 and transforming growth factor-β3 on bone development in an ex vivo organotypic culture system of embryonic chick femora.

PubMed

Smith, Emma L; Rashidi, Hassan; Kanczler, Janos M; Shakesheff, Kevin M; Oreffo, Richard O C

2015-01-01

Transforming growth factor-beta3 (TGF-β3) and 1α,25-dihydroxyvitamin D3 (1α,25 (OH) 2D3) are essential factors in chondrogenesis and osteogenesis respectively. These factors also play a fundamental role in the developmental processes and the maintenance of skeletal integrity, but their respective direct effects on these processes are not fully understood. Using an organotypic bone rudiment culture system the current study has examined the direct roles the osteotropic factors 1α,25 (OH)2D3 and TGF-β3 exert on the development and modulation of the three dimensional structure of the embryonic femur. Isolated embryonic chick femurs (E11) were organotypically cultured for 10 days in basal media, or basal media supplemented with either 1α,25 (OH) 2D3 (25 nM) or TGF-β3 (5 ng/mL & 15 ng/mL). Analyses of the femurs were undertaken using micro-computed tomography (μCT), histology and immunohistochemistry. 1α,25 (OH)2D3 supplemented cultures enhanced osteogenesis directly in the developing femurs with elevated levels of osteogenic markers such as type 1 collagen. In marked contrast organotypic femur cultures supplemented with TGF-β3 (5 ng/mL & 15 ng/mL) demonstrated enhanced chondrogenesis with a reduction in osteogenesis. These studies demonstrate the efficacy of the ex vivo organotypic embryonic femur culture employed to elucidate the direct roles of these molecules, 1α,25 (OH) 2D3 and TGF-β3 on the structural development of embryonic bone within a three dimensional framework. We conclude that 1α,25(OH)2D and TGF-β3 modify directly the various cell populations in bone rudiment organotypic cultures effecting tissue metabolism resulting in significant changes in embryonic bone growth and modulation. Understanding the roles of osteotropic agents in the process of skeletal development is integral to developing new strategies for the recapitulation of bone tissue in later life.

Holographic nondestructive testing in bone growth disturbance studies

NASA Astrophysics Data System (ADS)

Silvennoinen, Raimo V. J.; Nygren, Kaarlo

1993-09-01

We used isolated radioulnar bones of subadult European moose collected in various environmental pollution areas of Finland. The bones were radiographed and outer dimensions measured. By using small caudo-cranial bending forces, the bones were tested by using HNDT. For bone mineral studies, samples were taken from the mandibles of the same animals. Results showed, that the bones obtained from the heavily polluted area showed biomechanical response comparable to the bones developed partially without mothers milk. Differences were also seen in morphometrical and radiological studies. The mineral contents studied did not differ significantly from randomly collected samples of the same age category. We therefore conclude that environmental factors may influence the bone matrix development.

Growth in bone and body size among Asian and white girls in the Female Adolescent Maturation (FAM) study.

PubMed

Novotny, Rachel; Davis, James

2015-01-01

This study intends to identify differences in growth of Asian and White girls. Asian girls gained bone at similar rates to White girls. Physical activity was important to bone growth. Ethnic differences remained after adjusting for physical activity, demographics, and diet. Physical activity can improve bone gain. The purpose of this study is to examine differences in body size and bone growth of Asian, White, and Asian-White Mixed girls. Three prospective examinations of 99 Asian, 73 White, and 63 Mixed Asian and White girls, with a mean age of 11.0 years at enrollment were performed. Calcaneal bone mass, skeletal breadths, and body fat were measured. Physical activity, diet, and birth size were reported. The analyses examined the extent that body dimensions and bone size changed over time by demographic, diet, physical activity, body, and bone size parameters. White children were the most physically active yet had lower calcaneal ultrasound values for speed of sound (SOS). Based on regression models, bone mass, and subscapular skinfold thickness were greater in Asian girls compared to White and Asian-White Mixed girls at age 10 years. Asian-White Mixed girls had greater BMI compared to Asian or White girls. Asian girls gained body size more slowly than White girls, but changes in bone parameters did not differ significantly; Asian-White Mixed girls gained abdomen, hip, and weight more slowly than White girls. Among all girls, SOS and broadband ultrasound attenuation (BUA) increased significantly by level of physical activity before 12 years, but not after. Asian girls had more upper body (subscapular) fat at age 10 years and gained height and hip and abdomen circumferences more slowly than Asian-White and White girls. Asian girls had greater bone SOS and BUA at age 10 years but gained bone at similar rates to White girls. Physical activity was especially important to bone growth before age 12 years. However, ethnic differences remained after adjusting for physical activity, demographic, and dietary factors.

Matrix Metalloproteinases in Bone Resorption, Remodeling, and Repair.

PubMed

Paiva, Katiucia B S; Granjeiro, José M

2017-01-01

Matrix metalloproteinases (MMPs) are the major protease family responsible for the cleavage of the matrisome (global composition of the extracellular matrix (ECM) proteome) and proteins unrelated to the ECM, generating bioactive molecules. These proteins drive ECM remodeling, in association with tissue-specific and cell-anchored inhibitors (TIMPs and RECK, respectively). In the bone, the ECM mediates cell adhesion, mechanotransduction, nucleation of mineralization, and the immobilization of growth factors to protect them from damage or degradation. Since the first description of an MMP in bone tissue, many other MMPs have been identified, as well as their inhibitors. Numerous functions have been assigned to these proteins, including osteoblast/osteocyte differentiation, bone formation, solubilization of the osteoid during bone resorption, osteoclast recruitment and migration, and as a coupling factor in bone remodeling under physiological conditions. In turn, a number of pathologies, associated with imbalanced bone remodeling, arise mainly from MMP overexpression and abnormalities of the ECM, leading to bone osteolysis or bone formation. In this review, we will discuss the functions of MMPs and their inhibitors in bone cells, during bone remodeling, pathological bone resorption (osteoporosis and bone metastasis), bone repair/regeneration, and emergent roles in bone bioengineering. © 2017 Elsevier Inc. All rights reserved.

Effect on Clinical Outcome and Growth Factor Synthesis With Adjunctive Use of Pulsed Electromagnetic Fields for Fifth Metatarsal Nonunion Fracture: A Double-Blind Randomized Study.

PubMed

Streit, Adam; Watson, B Collier; Granata, Jaymes D; Philbin, Terrence M; Lin, Hsuan-Ni; O'Connor, J Patrick; Lin, Sheldon

2016-09-01

Electromagnetic bone growth stimulators have been found to biologically enhance the bone healing environment, with upregulation of numerous growth factors. The purpose of the study was to quantify the effect, in vivo, of pulsed electromagnetic fields (PEMFs) on growth factor expression and healing time in fifth metatarsal nonunions. This was a prospective, randomized, double-blind trial of patients, cared for by 2 fellowship-trained orthopedic foot and ankle surgeons. Inclusion criteria consisted of patients between 18 and 75 years old who had been diagnosed with a fifth metatarsal delayed or nonunion, with no progressive signs of healing for a minimum of 3 months. Eight patients met inclusion criteria and were randomized to receive either an active stimulation or placebo PEMF device. Each patient then underwent an open biopsy of the fracture site and was fitted with the appropriate PEMF device. The biopsy was analyzed for messenger-ribonucleic acid (mRNA) levels using quantitative competitive reverse transcription polymerase chain reaction (QT-RT-PCR). Three weeks later, the patient underwent repeat biopsy and open reduction and internal fixation of the nonunion site. The patients were followed at 2- to 4-week intervals with serial radiographs and were graded by the number of cortices of healing. All fractures healed, with an average time to complete radiographic union of 14.7 weeks and 8.9 weeks for the inactive and active PEMF groups, respectively. A significant increase in placental growth factor (PIGF) level was found after active PEMF treatment (P = .043). Other factors trended higher following active PEMF including brain-derived neurotrophic factor (BDNF), bone morphogenetic protein (BMP) -7, and BMP-5. The adjunctive use of PEMF for fifth metatarsal fracture nonunions produced a significant increase in local placental growth factor. PEMF also produced trends toward higher levels of multiple other factors and faster average time to radiographic union compared to unstimulated controls. Level I, prospective randomized trial. © The Author(s) 2016.

Post-Traumatic Caspase-3 Expression in the Adjacent Areas of Growth Plate Injury Site: A Morphological Study

PubMed Central

Musumeci, Giuseppe; Castrogiovanni, Paola; Loreto, Carla; Castorina, Sergio; Pichler, Karin; Weinberg, Annelie Martina

2013-01-01

The epiphyseal plate is a hyaline cartilage plate that sits between the diaphysis and the epiphysis. The objective of this study was to determine the impact of an injury in the growth plate chondrocytes through the study of histological morphology, immunohistochemistry, histomorphometry and Western Blot analyses of the caspase-3 and cleaved PARP-1, and levels of the inflammatory cytokines, Interleukin-6 (IL-6) and Tumor Necrosis Factor alpha (TNF-α), in order to acquire more information about post-injury reactions of physeal cell turnover. In our results, morphological analysis showed that in experimental bones, neo-formed bone trabeculae—resulting from bone formation repair—invaded the growth plate and reached the metaphyseal bone tissue (bone bridge), and this could result in some growth arrest. We demonstrated, by ELISA, increased expression levels of the inflammatory cytokines IL-6 and TNF-α. Immunohistochemistry, histomorphometry and Western Blot analyses of the caspase-3 and cleaved PARP-1 showed that the physeal apoptosis rate of the experimental bones was significantly higher than that of the control ones. In conclusion, we could assume that the inflammation process causes stress to chondrocytes that will die as a biological defense mechanism, and will also increase the survival of new chondrocytes for maintaining cell homeostasis. Nevertheless, the exact stimulus leading to the increased apoptosis rate, observed after injury, needs additional research to understand the possible contribution of chondrocyte apoptosis to growth disturbance. PMID:23899790

Osteoblastic molecular scaffold Gab1 is required for maintaining bone homeostasis.

PubMed

Weng, Tujun; Mao, Fengfeng; Wang, Youliang; Sun, Qiang; Li, Ruixin; Yang, Guan; Zhang, Xizheng; Luo, Jincai; Feng, Gen-Sheng; Yang, Xiao

2010-03-01

The Grb2-associated binder 1 (Gab1), which serves as a scaffolding adaptor protein, plays a crucial role in transmitting key signals that control cell growth, differentiation and function from multiple receptors. However, its biological role in osteoblast activity and postnatal bone metabolism remains unclear. To elucidate the in vivo function of Gab1 in postnatal bone remodeling, we generated osteoblast-specific Gab1 knockout mice. Disruption of Gab1 expression in osteoblasts led to decreased trabecular bone mass with a reduced bone formation rate and a decreased bone resorption. Bones from Gab1 mutants also exhibited inferior mechanical properties. Moreover, primary osteoblasts from Gab1 mutant mice demonstrated markedly suppressed osteoblast mineralization, increased susceptibility to apoptosis and decreased expression of receptor activator of NF-kappaB ligand (RANKL). Activation of serine-threonine Akt kinase and extracellular signal-regulated kinase in response to insulin and insulin-like growth factor 1 was attenuated in Gab1 mutant osteoblasts. Our results show that Gab1-mediated signals in osteoblasts are crucial for normal postnatal bone homeostasis.

The effects of the spatial influence function on orthotropic femur remodelling.

PubMed

Shang, Y; Bai, J; Peng, L

2008-07-01

The morphology and internal structure of bone are modulated by the mechanical stimulus. The osteocytes can sense the stimulus signals from the adjacent regions and respond to them through bone growth or bone absorption. This mechanism can be modelled as the spatial influence function (SIF) in bone adaptation algorithm. In this paper, the remodelling process was simulated in human femurs using an adaptation algorithm with and without SIF, and the trabecular bone was assumed to be orthotropic. A different influence radius and weighting factor were adopted to study the effects of the SIF on the bone density distribution and trabecular alignment. The results have shown that the mean density and L-T ratio (the ratio of longitudinal modulus to transverse modulus) had an excellent linear relationship with the weighting factor when the influence radius was small. The characteristics of density distribution and L-T ratio accorded with the actual observation or measurement when a small weighting factor was used. The large influence radius and weighting factor led to unrealistic results. In contrast, the SIF hardly affected the trabecular alignment, as the mean variation angles of principal axes were less than 1.0 degree for any influence radius and weighting factor.

Hyperelastic "bone": A highly versatile, growth factor-free, osteoregenerative, scalable, and surgically friendly biomaterial.

PubMed

Jakus, Adam E; Rutz, Alexandra L; Jordan, Sumanas W; Kannan, Abhishek; Mitchell, Sean M; Yun, Chawon; Koube, Katie D; Yoo, Sung C; Whiteley, Herbert E; Richter, Claus-Peter; Galiano, Robert D; Hsu, Wellington K; Stock, Stuart R; Hsu, Erin L; Shah, Ramille N

2016-09-28

Despite substantial attention given to the development of osteoregenerative biomaterials, severe deficiencies remain in current products. These limitations include an inability to adequately, rapidly, and reproducibly regenerate new bone; high costs and limited manufacturing capacity; and lack of surgical ease of handling. To address these shortcomings, we generated a new, synthetic osteoregenerative biomaterial, hyperelastic "bone" (HB). HB, which is composed of 90 weight % (wt %) hydroxyapatite and 10 wt % polycaprolactone or poly(lactic-co-glycolic acid), could be rapidly three-dimensionally (3D) printed (up to 275 cm(3)/hour) from room temperature extruded liquid inks. The resulting 3D-printed HB exhibited elastic mechanical properties (~32 to 67% strain to failure, ~4 to 11 MPa elastic modulus), was highly absorbent (50% material porosity), supported cell viability and proliferation, and induced osteogenic differentiation of bone marrow-derived human mesenchymal stem cells cultured in vitro over 4 weeks without any osteo-inducing factors in the medium. We evaluated HB in vivo in a mouse subcutaneous implant model for material biocompatibility (7 and 35 days), in a rat posterolateral spinal fusion model for new bone formation (8 weeks), and in a large, non-human primate calvarial defect case study (4 weeks). HB did not elicit a negative immune response, became vascularized, quickly integrated with surrounding tissues, and rapidly ossified and supported new bone growth without the need for added biological factors. Copyright © 2016, American Association for the Advancement of Science.

Human buccal plate extraction socket regeneration with recombinant human platelet-derived growth factor BB or enamel matrix derivative.

PubMed

Nevins, Marc L; Camelo, Marcelo; Schupbach, Peter; Nevins, Myron; Kim, Soo-Woo; Kim, David M

2011-01-01

The objective of this study was to assess the osseous healing of buccal plate extraction socket defects. There were four cohorts: group A (mineral collagen bone substitute [MCBS] scaffold alone), group B (MCBS with recombinant human platelet-derived growth factor BB [rhPDGF-BB; 0.3 mg/mL]), group C (MCBS with enamel matrix derivative [EMD]), and group D (combination of EMD with bone ceramic). The primary outcome of bone quality was evaluated using light microscopy, backscatter scanning electron microscopy, and histomorphometrics. Reentry surgery provided an opportunity for clinical observation of the healed ridge morphology. Sixteen patients with buccal wall extraction socket defects were randomized into four treatment groups of equal size. Grafting was provided at the time of extraction with advancement of the buccal flap for primary closure. A trephine core biopsy of the implant site preparation was performed after 5 months for implant placement. Histologic examination identified new bone healing around the biomaterial scaffolds. Statistically significant differences in new bone formation were not observed among the treatment groups. There was a histomorphometric trend toward more new bone for the rhPDGF-BB-treated group (group B). This group had the most favorable ridge morphology for optimal implant placement.

Transplantation of Hepatocyte Growth Factor-Modified Dental Pulp Stem Cells Prevents Bone Loss in the Early Phase of Ovariectomy-Induced Osteoporosis.

PubMed

Kong, Fanxuan; Shi, Xuefeng; Xiao, Fengjun; Yang, Yuefeng; Zhang, Xiaoyan; Wang, Li-Sheng; Wu, Chu-Tse; Wang, Hua

2018-02-01

Investigations based on mesenchymal stem cells (MSCs) for osteoporosis have attracted attention recently. MSCs can be derived from various tissues, such as bone marrow, adipose, umbilical cord, placenta, and dental pulp. Among these, dental pulp-derived MSCs (DPSCs) and hepatocyte growth factor (HGF)-modified DPSCs (DPSCs-HGF) highly express osteogenic-related genes and have stronger osteogenic differentiation capacities. DPSCs have more benefits in treating osteoporosis. The purpose of this study was to investigate the roles of HGF gene-modified DPSCs in bone regeneration using a mouse model of ovariectomy (OVX)-induced bone loss. The HGF and luciferase genes were transferred into human DPSCs using recombinant adenovirus. These transduced cells were assayed for distribution or bone regeneration assay by transplantation into an OVX-induced osteoporosis model. By using bioluminogenic imaging, it was determined that some DPSCs could survive for >1 month in vivo. The DPSCs were mainly distributed to the lung in the early stage and to the liver in the late stage of OVX osteoporosis after administration, but they were scarcely distributed to the bone. The homing efficiency of DPSCs is higher when administrated in the early stage of a mouse OVX model. Micro-computed tomography indicated that DPSCs-Null or DPSCs-HGF transplantation significantly reduces OVX-induced bone loss in the trabecular bone of the distal femur metaphysis, and DPSCs-HGF show a stronger capacity to reduce bone loss. The data suggest that systemic infusion of DPSCs-HGF is a potential therapeutic approach for OVX-induced bone loss, which might be mediated by paracrine mechanisms.

Simple Signaling Molecules for Inductive Bone Regenerative Engineering

PubMed Central

Nelson, Stephen J.; Deng, Meng; Sethuraman, Swaminathan; Doty, Stephen B.; Lo, Kevin W. H.; Khan, Yusuf M.; Laurencin, Cato T.

2014-01-01

With greater than 500,000 orthopaedic procedures performed in the United States each year requiring a bone graft, the development of novel graft materials is necessary. We report that some porous polymer/ceramic composite scaffolds possess intrinsic osteoinductivity as shown through their capacity to induce in vivo host osteoid mineralization and in vitro stem cell osteogenesis making them attractive synthetic bone graft substitutes. It was discovered that certain low crystallinity ceramics partially dissociate into simple signaling molecules (i.e., calcium and phosphate ions) that induce stem cells to endogenously produce their own osteoinductive proteins. Review of the literature has uncovered a variety of simple signaling molecules (i.e., gases, ions, and redox reagents) capable of inducing other desirable stem cell differentiation through endogenous growth factor production. Inductive simple signaling molecules, which we have termed inducerons, represent a paradigm shift in the field of regenerative engineering where they can be utilized in place of recombinant protein growth factors. PMID:25019622

Nanofibers implant functionalized by neural growth factor as a strategy to innervate a bioengineered tooth.

PubMed

Eap, Sandy; Bécavin, Thibault; Keller, Laetitia; Kökten, Tunay; Fioretti, Florence; Weickert, Jean-Luc; Deveaux, Etienne; Benkirane-Jessel, Nadia; Kuchler-Bopp, Sabine

2014-03-01

Current strategies for jaw reconstruction require multiple procedures, to repair the bone defect, to offer sufficient support, and to place the tooth implant. The entire procedure can be painful and time-consuming, and the desired functional repair can be achieved only when both steps are successful. The ability to engineer combined tooth and bone constructs, which would grow in a coordinated fashion with the surrounding tissues, could potentially improve the clinical outcomes and also reduce patient suffering. A unique nanofibrous and active implant for bone-tooth unit regeneration and also the innervation of this bioengineered tooth are demonstrated. A nanofibrous polycaprolactone membrane is functionalized with neural growth factor, along with dental germ, and tooth innervation follows. Such innervation allows complete functionality and tissue homeostasis of the tooth, such as dentinal sensitivity, odontoblast function, masticatory forces, and blood flow. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Strategies to engineer tendon/ligament-to-bone interface: Biomaterials, cells and growth factors.

PubMed

Font Tellado, Sonia; Balmayor, Elizabeth R; Van Griensven, Martijn

2015-11-01

Integration between tendon/ligament and bone occurs through a specialized tissue interface called enthesis. The complex and heterogeneous structure of the enthesis is essential to ensure smooth mechanical stress transfer between bone and soft tissues. Following injury, the interface is not regenerated, resulting in high rupture recurrence rates. Tissue engineering is a promising strategy for the regeneration of a functional enthesis. However, the complex structural and cellular composition of the native interface makes enthesis tissue engineering particularly challenging. Thus, it is likely that a combination of biomaterials and cells stimulated with appropriate biochemical and mechanical cues will be needed. The objective of this review is to describe the current state-of-the-art, challenges and future directions in the field of enthesis tissue engineering focusing on four key parameters: (1) scaffold and biomaterials, (2) cells, (3) growth factors and (4) mechanical stimuli. Copyright © 2015 Elsevier B.V. All rights reserved.

Effects of Gymnastics Activities on Bone Accrual during Growth: A Systematic Review.

PubMed

Jürimäe, Jaak; Gruodyte-Raciene, Rita; Baxter-Jones, Adam D G

2018-06-01

The amount of bone gained during childhood and adolescence impacts greatly on lifetime skeletal health. The purpose of this review is to summarize current evidence of the effects of gymnastics activities on bone mineral accrual during growth and to describe possible factors that influence bone mineral gains. The PubMed and SportDiscus databases were searched, and a total of 24 articles met the selection criteria and were included in this review. Artistic and rhythmic gymnasts presented higher bone mineral density and content values compared to untrained controls, despite possible negative effects associated with hormonal levels, dietary restrictions and body fat. The results suggest that gymnasts had similar bone turnover values compared to untrained controls. High-intensity mechanical loading of gymnastics activity appears to increase bone development and counterbalance negative effects, such as later pubertal development, lower body fat mass and lower hormone levels. In conclusion, gymnasts present higher bone mineral values in comparison with untrained controls. The osteogenic effect of gymnastics athletic activity has a positive influence on bone mineral accrual and overcomes the possible negative influence of high athletic activity that may cause negative energy balance and low body fat mass which are associated with lower bone accrual.

Emulating Native Periosteum Cell Population and Subsequent Paracrine Factor Production To Promote Tissue Engineered Periosteum-Mediated Allograft Healing

PubMed Central

Hoffman, Michael D.

2015-01-01

Emulating autograft healing within the context of decellularized bone allografts has immediate clinical applications in the treatment of critical-sized bone defects. The periosteum, a thin, osteogenic tissue that surrounds bone, houses a heterogeneous population of stem cells and osteoprogenitors. There is evidence that periosteum-cell derived paracrine factors, specifically vascular endothelial growth factor (VEGF) and bone morphogenetic protein 2 (BMP2), orchestrate autograft healing through host cell recruitment and subsequent tissue elaboration. In previous work, we demonstrated that the use of poly(ethylene glycol) (PEG) hydrogels as a tissue engineered (T.E.) periosteum to localize mesenchymal stem cells (MSCs) to the surface of decellularized bone enhances allograft healing and integration. Herein, we utilize a mixed population of 50:50 MSCs and osteoprogenitor cells to better mimic native periosteum cell population and paracrine factor production to further promote allograft healing. This mixed cell population was localized to the surface of decellularized allografts within degradable hydrogels and shown to expedite allograft healing. Specifically, bone callus formation and biomechanical graft-host integration are increased as compared to unmodified allografts. These results demonstrate the dual importance of periosteum-mediated paracrine factors orchestrating host cell recruitment as well as new bone formation while developing clinically translatable strategies for allograft healing and integration. PMID:25818449

Effects of Anorexia Nervosa on the Endocrine System.

PubMed

Baskaran, Charumathi; Misra, Madhusmita; Klibanski, Anne

2017-03-01

Anorexia nervosa (AN) is characterized by severe undernutrition associated with alterations in multiple endocrine axes, which are primarily adaptive to the state of caloric deprivation. Hormonal changes include growth hormone (GH) resistance with low insulin like growth factor-1 (IGF-1) levels, hypothalamic hypogonadism, relative hypercortisolemia and changes in appetite regulating hormones, including leptin, ghrelin, and peptide YY. These alterations contribute to abnormalities in bone metabolism leading to low bone mass, impaired bone microarchitecture, and increased risk for fracture, and may also negatively impact cognition, emotions and mood. The best strategy to improve all biologic outcomes is weight and menstrual recovery. Physiological estrogen replacement improves bone accrual rates and measures of trait anxiety in adolescents with AN. Other therapies including testosterone and IGF-1 replacement, and use of DHEA with oral estrogen-progesterone combination pills, bisphosphonates and teriparatide have also been studied to improve bone outcomes. Copyright© of YS Medical Media ltd.

Effect of Concentrated Growth Factor (CGF) on the Promotion of Osteogenesis in Bone Marrow Stromal Cells (BMSC) in vivo.

PubMed

Chen, Xia; Wang, Jian; Yu, Li; Zhou, Jia; Zheng, Danning; Zhang, Bo

2018-04-12

The therapeutic method traditionally used in bone defect reconstruction is autologous bone grafting. The most common problems affecting this type of repair approach are bone absorption and donor trauma. The approach taken in this study overcomes these problems. Bone marrow stromal cells (BMSCs) provided the crucial seed cells. Fibrin biological scaffolds were formed by combining the BMSCs with concentrated growth factor (CGF). BMSCs were isolated from Wistar rat femurs; CGF was prepared from rat heart blood. Five repair groups were created for comparative purposes: (A) CGF + BMSCs; (B) CGF; (C) collagen + BMSCs; (D) collagen; (E) blank. After three months, the rats were sacrificed, and histopathology and three-dimensional CT images produced. Bone regeneration was significantly higher in the (A) CGF + BMSC group; osteogenesis was lower in the (B) CGF and (C) collagen + BMSC groups, at very similar levels; the (D) collagen and (E) blank groups scored the lowest results. Our research suggests that combining CGF with BMSCs leads to the formation of fibrin scaffolds that have a powerful effect on osteogenesis as well as a subsidiary angiogenic effect. SEM images of the CGF scaffolds cultured with BMSCs confirmed good CGF biocompatibility. The superior osteoinductive activity of the CGF + BMSC combination makes it an excellent biomaterial for bone regeneration.

Demineralized bone matrix fibers formable as general and custom 3D printed mold-based implants for promoting bone regeneration.

PubMed

Rodriguez, Rudy U; Kemper, Nathan; Breathwaite, Erick; Dutta, Sucharita M; Hsu, Erin L; Hsu, Wellington K; Francis, Michael P

2016-07-26

Bone repair frequently requires time-consuming implant construction, particularly when using un-formed implants with poor handling properties. We therefore developed osteoinductive, micro-fibrous surface patterned demineralized bone matrix (DBM) fibers for engineering both defect-matched and general three-dimensional implants. Implant molds were filled with demineralized human cortical bone fibers there were compressed and lyophilized, forming mechanically strong shaped DBM scaffolds. Enzyme linked immunosorbent assays and mass spectrometry confirmed that DBM fibers contained abundant osteogenic growth factors (bone morphogenetic proteins, insulin-like growth factor-I) and extracellular matrix proteins. Mercury porosimetry and mechanical testing showed interconnected pores within the mechanically stable, custom DBM fiber scaffolds. Mesenchymal stem cells readily attached to the DBM and showed increasing metabolic activity over time. DBM fibers further increased alkaline phosphatase activity in C2C12 cells. In vivo, DBM implants elicited osteoinductive potential in a mouse muscle pouch, and also promoted spine fusion in a rat arthrodesis model. DBM fibers can be engineered into custom-shaped, osteoinductive and osteoconductive implants with potential for repairing osseous defects with precise fitment, potentially reducing operating time. By providing pre-formed and custom implants, this regenerative allograft may improve patient outcomes following surgical bone repair, while further advancing personalized orthopedic and craniomaxillofacial medicine using three-dimensional-printed tissue molds.

Impact of long-term exposure to the tyrosine kinase inhibitor imatinib on the skeleton of growing rats.

PubMed

Tauer, Josephine T; Hofbauer, Lorenz C; Jung, Roland; Gerdes, Sebastian; Glauche, Ingmar; Erben, Reinhold G; Suttorp, Meinolf

2015-01-01

The tyrosine kinase (TK) inhibitor imatinib provides a highly effective therapy for chronic myeloid leukemia (CML) via inhibition of the oncogenic TK BCR-ABL1. However, off-target TKs like platelet-derived growth factor receptors (PDGF-R) and colony-stimulating factor-1 receptor (c-fms), involved in bone remodeling, are also inhibited. Thus, pediatric patients with CML on imatinib exhibit altered bone metabolism, leading to linear growth failure. As TKI treatment might be necessary for a lifetime, long-term effects exerted on bone in children are of major concern. Therefore, we studied the skeletal long-term effects of continuous and intermittent imatinib exposure in a juvenile rat model. Four-weeks-old male Wistar rats were chronically exposed to imatinib via drinking water over a period of 10 weeks. Animals were exposed to a standard and high imatinib dosage continuously and to the high imatinib dose intermittently. Bone mass and strength were assessed using pQCT, micro-computed tomography (μCT), and biomechanical testing at the prepubertal, pubertal, and postpubertal age. Bone length and vertebral height as well as biochemical markers of bone turnover were analyzed. Femoral and tibial bone length were dose-dependently reduced by up to 24% (p<0.0001), femoral and tibial trabecular bone mass density (BMD) were reduced by up to 25% (p<0.01), and femoral breaking strength was lowered by up to 20% (p<0.05). Intermittent exposure mitigated these skeletal effects. Long-term exposure resulted in reduced vertebral height by 15% and lower trabecular BMD by 5%. Skeletal changes were associated with suppressed serum osteocalcin (p<0.01) and non-significantly elevated serum CTX-I and PINP levels. In conclusion, imatinib mainly impaired longitudinal growth of long bones rather than the vertebrae of growing rats. Interestingly, intermittent imatinib exposure has less skeletal side effects, which may be beneficial in pediatric patients taking imatinib.

The adipose organ and multiple myeloma: Impact of adipokines on tumor growth and potential sites for therapeutic intervention.

PubMed

Allegra, Alessandro; Innao, Vanessa; Gerace, Demetrio; Allegra, Andrea Gaetano; Vaddinelli, Doriana; Bianco, Oriana; Musolino, Caterina

2018-07-01

In addition to its capacity to store lipids the adipose tissue is now identified as a real organ with both endocrine and metabolic roles. Preclinical results indicate that modifying adipose tissue and bone marrow adipose tissue (BMAT) could be a successful multiple myeloma (MM) therapy. BMAT interrelates with bone marrow cells and other immune cells, and may influence MM disease progression. The BM adipocytes may have a role in MM progression, bone homing, chemoresistance, and relapse, due to local endocrine, paracrine, or metabolic factors. BM adipocytes isolated from MM subjects have been shown to increase myeloma growth in vitro and may preserve cells from chemotherapy-induced apoptosis. By producing free fatty acids and emitting signaling molecules such as growth factors and adipokines, BM adipocytes are both an energy font and an endocrine signaling factory. This review should suggest future research approaches toward developing novel treatments to target MM by targeting BMAT and its products. Copyright © 2018 European Federation of Internal Medicine. Published by Elsevier B.V. All rights reserved.

Effects of spaceflight and Insulin-like Growth Factor-1 on rat bone properties

NASA Astrophysics Data System (ADS)

Bateman, Ted A.; Ayers, Reed A.; Spetzler, Michael L.; Simske, Steven J.; Zimmerman, Robert J.

1997-01-01

Spaceflight induces bone degradation which is analogous to an accelerated onset of osteoporosis in humans (Tilton et al., 1980). In rats, decreased bone formation is indicative of reduced osteoblast activity (Morey and Baylink, 1978). Chiron Corporation (Emeryville, CA) is interested in using the microgravity environment of low-Earth-orbit to test its therapeutic drug, Insulin-like Growth Factor-1 (IGF-1). This pharmaceutic is known to promote osteoblast activity (Schmid et al., 1984) and therefore may encourage bone growth in rats. Chiron sponsored the Immune.3 payload on STS-73 (May 19-29, 1996) through its Center for Space Commercialization (CSC) partner BioServe Space Technologies (University of Colorado and Kansas State University) to investigate the effects of IGF-1 on mitigating the skeletal degradation that affects rats and humans during spaceflight. Twelve rats were flown for 10 days using two Animal Enclosure Modules (AEMs) provided by NASA Ames Research Center. Of the twelve, six received 1.4 mg/day of IGF-1; the other six saline. Sixteen vivarium ground controls received the same treatment on a one day delay. Rat femora and tibiae were examined for bone mineral density via DXA scan. Femora and humeri were measured for physical and compositional properties, as well as mechanically tested in three point flexure. Quantitative histomorphometric examination of tibiae, humeri, fibulae, ribs and cranial bone; and microhardness testing on tibiae and humeri are currently in progress. Flight humeri and vivarium femora were significantly larger than their counterparts; however, significant differences in mechanical properties and mineral density were not concurrent to these mass changes.

A composite demineralized bone matrix--self assembling peptide scaffold for enhancing cell and growth factor activity in bone marrow.

PubMed

Hou, Tianyong; Li, Zhiqiang; Luo, Fei; Xie, Zhao; Wu, Xuehui; Xing, Junchao; Dong, Shiwu; Xu, Jianzhong

2014-07-01

The need for suitable bone grafts is high; however, there are limitations to all current graft sources, such as limited availability, the invasive harvest procedure, insufficient osteoinductive properties, poor biocompatibility, ethical problems, and degradation properties. The lack of osteoinductive properties is a common problem. As an allogenic bone graft, demineralized bone matrix (DBM) can overcome issues such as limited sources and comorbidities caused by invasive harvest; however, DBM is not sufficiently osteoinductive. Bone marrow has been known to magnify osteoinductive components for bone reconstruction because it contains osteogenic cells and factors. Mesenchymal stem cells (MSCs) derived from bone marrow are the gold standard for cell seeding in tissue-engineered biomaterials for bone repair, and these cells have demonstrated beneficial effects. However, the associated high cost and the complicated procedures limit the use of tissue-engineered bone constructs. To easily enrich more osteogenic cells and factors to DBM by selective cell retention technology, DBM is modified by a nanoscale self-assembling peptide (SAP) to form a composite DBM/SAP scaffold. By decreasing the pore size and increasing the charge interaction, DBM/SAP scaffolds possess a much higher enriching yield for osteogenic cells and factors compared with DBM alone scaffolds. At the same time, SAP can build a cellular microenvironment for cell adhesion, proliferation, and differentiation that promotes bone reconstruction. As a result, a suitable bone graft fabricated by DBM/SAP scaffolds and bone marrow represents a new strategy and product for bone transplantation in the clinic. Copyright © 2014 Elsevier Ltd. All rights reserved.

Orexin Plays a Role in Growth Impediment Induced by Obstructive Sleep Breathing in Rats.

PubMed

Tarasiuk, Ariel; Levi, Avishag; Assadi, Mohammad H; Troib, Ariel; Segev, Yael

2016-04-01

The mechanisms linking sleep disordered breathing with impairment of sleep and bone metabolism/architecture are poorly understood. Here, we explored the role of the neuropeptide orexin, a respiratory homeostasis modulator, in growth retardation induced in an upper airway obstructed (AO) rat model. The tracheae of 22-day-old rats were narrowed; AO and sham-control animals were monitored for 5 to 7 w. Growth parameters, food intake, sleep/wake activity, and serum hormones were measured. After euthanasia, growth plate (GP) histology, morphometry, orexin receptors (OXR), and related mediators were analyzed. The effect of dual orexin receptor antagonist (almorexant 300 mg/kg) on sleep and GP histology were also investigated. The AO group slept 32% less; the time spent in slow wave and paradoxical sleep during light period and slow wave activity was reduced. The AO group gained 46% less body weight compared to the control group, despite elevated food intake; plasma ghrelin increased by 275% and leptin level decreased by 44%. The impediment of bone elongation and bone mass was followed by a 200% increase in OX1R and 38% reduction of local GP ghrelin proteins and growth hormone secretagogue receptor 1a. Sry-related transcription factor nine (Sox9), a molecule mediating cartilage ossification, was downregulated and the level of transcription factor peroxisome proliferator-activated receptor gamma was upregulated, explaining the bone architecture abnormalities. Administration of almorexant restored sleep and improved GP width in AO animals. In AO animals, enhanced expression of orexin and OX1R plays a role in respiratory induced sleep and growth abnormalities. © 2016 Associated Professional Sleep Societies, LLC.

In vivo demonstration of cell types in bone that harbor epidermal growth factor receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martineau-Doize, B.; Lai, W.H.; Warshawsky, H.

1988-08-01

The binding and internalization of (/sup 125/I)iodoepidermal growth factor (EGF) by bone cells of the rat was demonstrated in situ by quantitative radioautography. Specific binding sites were observed on a cell profile enriched in endocytic components, including lysosome-like structures, a rough endoplasmic reticulum-rich cell profile, and a cell profile that histologically resembles an undifferentiated precursor cell. By the criteria of gel filtration and precipitability by trichloroacetic acid, most of the bound (/sup 125/I)iodo-EGF was considered intact. By morphological criteria none of the cell profiles that bound (/sup 125/I)iodo-EGF corresponded to fully formed osteoclasts or osteoblasts. The endocytic cell was foundmore » in the epiphyseal plate between the invading capillary and the transverse and longitudinal cartilage septa as well as near osteoclasts in the zone of mixed spicules. The rough endoplasmic reticulum-rich cell was present in vacated chondrocyte lacunae of the epiphyseal plate close to the metaphysis, and the poorly differentiated cell was observed between the mixed spicules of the metaphysis. Similar cell types were also found in the alveolar bone surrounding the incisors. These cells may be the origin of established bone cell lines that harbor high concentrations of EGF receptors and may also be responsible for the humoral hypercalcemia in response to the reported actions of injected EGF or transforming growth factor-alpha as well as that of malignancy.« less

Serum levels, and bone marrow immunohistochemical expression of, vascular endothelial growth factor in patients with chronic myeloproliferative diseases.

PubMed

Panteli, Katerina; Bai, Maria; Hatzimichael, Eleftheria; Zagorianakou, Nektaria; Agnantis, Niki John; Bourantas, Konstantinos

2007-12-01

Current data suggest that angiogenesis plays a significant role in the pathogenesis and progression of chronic myeloproliferative diseases (cMPDs). In the present study, we evaluated serum levels of vascular endothelial growth factor (VEGF) in 83 patients with cMPDs [myelofibrosis with myeloid metaplasia (MMM, n = 25), essential thrombocythaemia (ET, n = 40), polycythaemia vera (PV, n = 8) and chronic myeloid leukemia (CML, n = 10)] and in 27 healthy individuals. Serum VEGF levels were significantly increased in patients with cMPDs compared to healthy individuals (all p values were < or = 0.05) and were significantly correlated with bone marrow microvessel density (MVD) (p = 0.0013). In addition, the immunohistochemical expression of VEGF protein in bone marrow biopsy specimens were analyzed in 61 patients with cMPDs, (ET, n = 36 and MMM, n = 25) and in 27 healthy individuals. The cellular distribution of VEGF expression was similar in bone marrow specimens of patients and healthy individuals. VEGF protein was detected mainly in erythroid cells, whereas myeloid cells and megakaryocytes exhibited a variable expression of the protein. The percentage of bone marrow VEGF positive cells was positively correlated with serum levels of VEGF (p = 0.001). The results of the present study suggest that, VEGF is a major angiogenetic factor in patients with cMPDs and contributes to the pathogenesis of these diseases.

An in vitro study of fibrin sealant as a carrier system for recombinant human bone morphogenetic protein (rhBMP)-9 for bone tissue engineering.

PubMed

Fujioka-Kobayashi, Masako; Mottini, Matthias; Kobayashi, Eizaburo; Zhang, Yufeng; Schaller, Benoit; Miron, Richard J

2017-01-01

In the craniofacial bone field, fibrin sealants are used as coagulant and adhesive tools to stabilize grafts during surgery. Despite this, their exact role in osteogenesis is poorly characterized. In the present study, we aimed to characterize the osteogenic potential of TISSEEL fibrin sealant and used its technology to incorporate growth factors within its matrix. We focused on recombinant human bone morphogenetic protein (rhBMP)-9, which has previously been characterized as one of the strongest osteogenetic inducers in the BMP family. TISSEEL displayed an excellent ability to retain rhBMP9, which was gradually released over a 10-day period. Although TISSEEL decreased bone stromal ST2 cell attachment at 8 h, it displayed normal cell proliferation at 1, 3, and 5 days when compared to tissue culture plastic. Interestingly, TISSEEL had little influence on osteoblast differentiation; however its combination with rhBMP9 significantly increased ALP activity at 7 days, Alizarin Red staining at 14 days, and mRNA levels of osteoblast differentiation markers ALP, bone sialoprotein, and osteocalcin. In summary, although fibrin sealants were shown to have little influence on osteogenesis, their combination with bone-inducing growth factors such as rhBMP9 may serve as an attractive carrier/scaffold for future bone regenerative strategies. Future animal studies are now necessary. Copyright © 2016 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

Bone Morphogenetic Protein Usage in Anterior Lumbar Interbody Fusion: What Else Can Go Wrong?

PubMed

Elias, Elias; Nasser, Zeina; Winegan, Lona; Verla, Terence; Omeis, Ibrahim

2018-03-01

Bone morphogenetic protein (BMP) graft showed promising outcome during early phases of its use. However, unreported adverse events and off-label use shattered its safe profile and raised concerns regarding its indication. In 2008 the U.S. Food and Drug Administration prohibited its use in anterior cervical spine procedures due to the possibility of edema, hematoma, and need to intubate. At the molecular level, BMPs act as multifactorial growth factors playing a role in cartilage, heart, and bone formation. However, its unfavorable effect on bone overgrowth or heterotopic ossification post spine surgeries has been described. Reported cases in the literature were limited to epidural bone formation. We present a rare and interesting case of a 59-year-old female, in whom BMP caused intradural bone growth several years after an anterior lumbar interbody fusion surgery. Caution must be exercised while using BMPs because of inadvertent complications. Copyright © 2017 Elsevier Inc. All rights reserved.

Bone Growth, Mechanical Stimulus and IGF-I

DTIC Science & Technology

2005-10-01

children, stress fractures in military recruits, and osteoporotic fractures in elderly women. Insulin-like growth factor-I (IGF-I), a major regulator...subjects completed the intervention arm of the study and returned for the short-term post-intervention appointment, which included anthropometrie

Transforming growth factor-{beta} inhibits CCAAT/enhancer-binding protein expression and PPAR{gamma} activity in unloaded bone marrow stromal cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahdjoudj, S.; Kaabeche, K.; Holy, X.

2005-02-01

The molecular mechanisms regulating the adipogenic differentiation of bone marrow stromal cells in vivo remain largely unknown. In this study, we investigated the regulatory effects of transforming growth factor beta-2 (TGF-{beta}2) on transcription factors involved in adipogenic differentiation induced by hind limb suspension in rat bone marrow stromal cells in vivo. Time course real-time quantitative reverse-transcription polymerase chain reaction (RT-PCR) analysis of gene expression showed that skeletal unloading progressively increases the expression of CCAAT/enhancer-binding protein (C/EBP){alpha} and C/EBP{beta} {alpha} at 5 days in bone marrow stromal cells resulting in increased peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}2) transcripts at 7 days. TGF-{beta}2more » administration in unloaded rats corrected the rise in C/EBP{alpha} and C/EBP{beta} transcripts induced by unloading in bone marrow stromal cells. This resulted in inhibition of PPAR{gamma}2 expression that was associated with increased Runx2 expression. Additionally, the inhibition of C/EBP{alpha} and C/EBP{beta} expression by TGF-{beta}2 was associated with increased PPAR{gamma} serine phosphorylation in bone marrow stromal cells, a mechanism that inhibits PPAR{gamma} transactivating activity. The sequential inhibitory effect of TGF-{beta}2 on C/EBP{alpha}, C/EBP{beta}, and PPAR{gamma}2 resulted in reduced LPL expression and abolition of bone marrow stromal cell adipogenic differentiation, which contributed to prevent bone loss induced by skeletal unloading. We conclude that TGF-{beta}2 inhibits the excessive adipogenic differentiation of bone marrow stromal cells induced by skeletal unloading by inhibiting C/EBP{alpha}, C/EBP{beta}, and PPAR{gamma} expression and activity, which provides a sequential mechanism by which TGF-{beta}2 regulates adipogenic differentiation of bone marrow stromal cells in vivo.« less

Bioactive Nano-Fibrous Scaffolds for Bone and Cartilage Tissue Engineering

NASA Astrophysics Data System (ADS)

Feng, Kai

Scaffolds that can mimic the structural features of natural extracellular matrix and can deliver biomolecules in a controlled fashion may provide cells with a favorable microenvironment to facilitate tissue regeneration. Biodegradable nanofibrous scaffolds with interconnected pore network have previously been developed in our laboratory to mimic collagen matrix and advantageously support both bone and cartilage regeneration. This dissertation project aims to expand both the structural complexity and the biomolecule delivery capacity of such biomimetic scaffolds for tissue engineering. We first developed a nanofibrous scaffold that can release an antibiotic (doxycycline) with a tunable release rate and a tunable dosage, which was demonstrated to be able to inhibit bacterial growth over a prolonged time period. We then developed a nanofibrous tissue-engineciing scaffold that can release basic fibroblast growth factor (bFGF) in a spatially and temporally controlled fashion. In a mouse subcutaneous implantation model, the bFGF-releasing scaffold was shown to enhance cell penetration, tissue ingrowth and angiogenesis. It was also found that both the dose and the release rate of bFGF play roles in the biologic function of the scaffold. After that, we developed a nanofibrous PLLA scaffold that can release both bone morphogenetic protein 7 (BMP-7) and platelet-derived growth factor (PDGF) with distinct dosages and release kinetics. It was demonstrated that BMP-7 and PDGF could synergistically enhance bone regeneration using a mouse ectopic bone formation model and a rat periodontal fenestration defect regeneration model. The regeneration outcome was dependent on the dosage, the ratio and the release kinetics of the two growth factors. Last, we developed an anisotropic composite scaffold with an upper layer mimicking the superficial zone of cartilage and a lower layer mimicking the middle zone of cartilage. The thin superficial layer was fabricated using an electrospinning technique to support a more parallel ECM orientation to the cartilage surface. The lower layer was fabricated using a phase-separation technique to support a more isotropic ECM distribution. Human bone marrow-derived mesenchymal stem cells (hMSCs) were seeded on this complex scaffold and cultured under chondrogenic conditions. The results showed that the composite scaffold was indeed able to support anisotropic cartilage tissue structure formation.

FGF-21 and skeletal remodeling during and after lactation in C57BL/6J mice.

PubMed

Bornstein, Sheila; Brown, Sue A; Le, Phuong T; Wang, Xunde; DeMambro, Victoria; Horowitz, Mark C; MacDougald, Ormond; Baron, Roland; Lotinun, Sutada; Karsenty, Gerard; Wei, Wei; Ferron, Mathieu; Kovacs, Christopher S; Clemmons, David; Wan, Yihong; Rosen, Clifford J

2014-09-01

Lactation is associated with significant alterations in both body composition and bone mass. Systemic and local skeletal factors such as receptor activator of nuclear factor κ-B ligand (RANKL), PTHrP, calcitonin, and estrogen are known to regulate bone remodeling during and after lactation. Fibroblast growth factor 21 (FGF-21) may function as an endocrine factor to regulate body composition changes during lactation by inducing gluconeogenesis and fatty acid oxidation. In this study, we hypothesized that the metabolic changes during lactation were due in part to increased circulating FGF-21, which in turn could accentuate bone loss. We longitudinally characterized body composition in C57BL/6J (B6) mice during (day 7 and day 21 of lactation) and after normal lactation (day 21 postlactation). At day 7 of lactation, areal bone density declined by 10% (P < .001), bone resorption increased (P < .0001), percent fat decreased by 20%, energy expenditure increased (P < .01), and markers of brown-like adipogenesis were suppressed in the inguinal depot and in preformed brown adipose tissue. At day 7 of lactation there was a 2.4-fold increase in serum FGF-21 vs baseline (P < .0001), a 8-fold increase in hepatic FGF-21 mRNA (P < .03), a 2-fold increase in undercarboxylated osteocalcin (Glu13 OCn) (P < .01), and enhanced insulin sensitivity. Recovery of total areal bone density was noted at day 21 of lactation, whereas the femoral trabecular bone volume fraction was still reduced (P < .01). Because FGF-21 levels rose rapidly at day 7 of lactation in B6 lactating mice, we next examined lactating mice with a deletion in the Fgf21 gene. Trabecular and cortical bone masses were maintained throughout lactation in FGF-21(-/-) mice, and pup growth was normal. Compared with lactating control mice, lactating FGF-21(-/-) mice exhibited an increase in bone formation, but no change in bone resorption. In conclusion, in addition to changes in calciotropic hormones, systemic FGF-21 plays a role in skeletal remodeling and changes in body composition during lactation in B6 mice.

FGF-21 and Skeletal Remodeling During and After Lactation in C57BL/6J Mice

PubMed Central

Bornstein, Sheila; Brown, Sue A.; Le, Phuong T.; Wang, Xunde; DeMambro, Victoria; Horowitz, Mark C.; MacDougald, Ormond; Baron, Roland; Lotinun, Sutada; Karsenty, Gerard; Wei, Wei; Ferron, Mathieu; Kovacs, Christopher S.; Clemmons, David

2014-01-01

Lactation is associated with significant alterations in both body composition and bone mass. Systemic and local skeletal factors such as receptor activator of nuclear factor κ-B ligand (RANKL), PTHrP, calcitonin, and estrogen are known to regulate bone remodeling during and after lactation. Fibroblast growth factor 21 (FGF-21) may function as an endocrine factor to regulate body composition changes during lactation by inducing gluconeogenesis and fatty acid oxidation. In this study, we hypothesized that the metabolic changes during lactation were due in part to increased circulating FGF-21, which in turn could accentuate bone loss. We longitudinally characterized body composition in C57BL/6J (B6) mice during (day 7 and day 21 of lactation) and after normal lactation (day 21 postlactation). At day 7 of lactation, areal bone density declined by 10% (P < .001), bone resorption increased (P < .0001), percent fat decreased by 20%, energy expenditure increased (P < .01), and markers of brown-like adipogenesis were suppressed in the inguinal depot and in preformed brown adipose tissue. At day 7 of lactation there was a 2.4-fold increase in serum FGF-21 vs baseline (P < .0001), a 8-fold increase in hepatic FGF-21 mRNA (P < .03), a 2-fold increase in undercarboxylated osteocalcin (Glu13 OCn) (P < .01), and enhanced insulin sensitivity. Recovery of total areal bone density was noted at day 21 of lactation, whereas the femoral trabecular bone volume fraction was still reduced (P < .01). Because FGF-21 levels rose rapidly at day 7 of lactation in B6 lactating mice, we next examined lactating mice with a deletion in the Fgf21 gene. Trabecular and cortical bone masses were maintained throughout lactation in FGF-21−/− mice, and pup growth was normal. Compared with lactating control mice, lactating FGF-21−/− mice exhibited an increase in bone formation, but no change in bone resorption. In conclusion, in addition to changes in calciotropic hormones, systemic FGF-21 plays a role in skeletal remodeling and changes in body composition during lactation in B6 mice. PMID:24914939

Connective Tissue Growth Factor reporter mice label a subpopulation of mesenchymal progenitor cells that reside in the trabecular bone region.

PubMed

Wang, Wen; Strecker, Sara; Liu, Yaling; Wang, Liping; Assanah, Fayekah; Smith, Spenser; Maye, Peter

2015-02-01

Few gene markers selectively identify mesenchymal progenitor cells inside the bone marrow. We have investigated a cell population located in the mouse bone marrow labeled by Connective Tissue Growth Factor reporter expression (CTGF-EGFP). Bone marrow flushed from CTGF reporter mice yielded an EGFP+ stromal cell population. Interestingly, the percentage of stromal cells retaining CTGF reporter expression decreased with age in vivo and was half the frequency in females compared to males. In culture, CTGF reporter expression and endogenous CTGF expression marked the same cell types as those labeled using Twist2-Cre and Osterix-Cre fate mapping approaches, which previously had been shown to identify mesenchymal progenitors in vitro. Consistent with this past work, sorted CTGF+ cells displayed an ability to differentiate into osteoblasts, chondrocytes, and adipocytes in vitro and into osteoblast, adipocyte, and stromal cell lineages after transplantation into a parietal bone defect. In vivo examination of CTGF reporter expression in bone tissue sections revealed that it marked cells highly localized to the trabecular bone region and was not expressed in the perichondrium or periosteum. Mesenchymal cells retaining high CTGF reporter expression were adjacent to, but distinct from mature osteoblasts lining bone surfaces and endothelial cells forming the vascular sinuses. Comparison of CTGF and Osterix reporter expression in bone tissue sections indicated an inverse correlation between the strength of CTGF expression and osteoblast maturation. Down-regulation of CTGF reporter expression also occurred during in vitro osteogenic differentiation. Collectively, our studies indicate that CTGF reporter mice selectively identify a subpopulation of bone marrow mesenchymal progenitor cells that reside in the trabecular bone region. Copyright © 2014 Elsevier Inc. All rights reserved.

Connective Tissue Growth Factor Reporter Mice Label a Subpopulation of Mesenchymal Progenitor Cells that Reside in the Trabecular Bone Region

PubMed Central

Wang, Wen; Strecker, Sara; Liu, Yaling; Wang, Liping; Assanah, Fayekah; Smith, Spenser; Maye, Peter

2014-01-01

Few gene markers selectively identify mesenchymal progenitor cells inside the bone marrow. We have investigated a cell population located in the mouse bone marrow labeled by Connective Tissue Growth Factor reporter expression (CTGF-EGFP). Bone marrow flushed from CTGF reporter mice yielded an EGFP+ stromal cell population. Interestingly, the percentage of stromal cells retaining CTGF reporter expression decreased with age in vivo and was half the frequency in females compared to males. In culture, CTGF reporter expression and endogenous CTGF expression marked the same cell types as those labeled using Twist2-Cre and Osterix-Cre fate mapping approaches, which previously has been shown to identify mesenchymal progenitors in vitro. Consistent with this past work, sorted CTGF+ cells displayed an ability to differentiate into osteoblasts, chondrocytes, and adipocytes in vitro and into osteoblast, adipocyte, and stromal cell lineages after transplantation into a parietal bone defect. In vivo examination of CTGF reporter expression in bone tissue sections revealed it marked cells highly localized to the trabecular bone region and was not expressed in the perichondrium or periosteum. Mesenchymal cells retaining high CTGF reporter expression were adjacent to, but distinct from mature osteoblasts lining bone surfaces and endothelial cells forming the vascular sinuses. Comparison of CTGF and Osterix reporter expression in bone tissue sections indicated an inverse correlation between the strength of CTGF expression and osteoblast maturation. Down-regulation of CTGF reporter expression also occurred during in vitro osteogenic differentiation. Collectively, our studies indicate that CTGF reporter mice selectively identify a subpopulation of bone marrow mesenchymal progenitor cells that reside in the trabecular bone region. PMID:25464947

Autologous Bone Marrow Concentrates and Concentrated Growth Factors Accelerate Bone Regeneration After Enucleation of Mandibular Pathologic Lesions.

PubMed

Talaat, Wael M; Ghoneim, Mohamed M; Salah, Omar; Adly, Osama A

2018-02-23

Stem cell therapy is a revolutionary new way to stimulate mesenchymal tissue regeneration. The platelets concentrate products started with platelet-rich plasma (PRP), followed by platelet-rich fibrin (PRF), whereas concentrated growth factors (CGF) are the latest generation of the platelets concentrate products which were found in 2011. The aim of the present study was to evaluate the potential of combining autologous bone marrow concentrates and CGF for treatment of bone defects resulting from enucleation of mandibular pathologic lesions. Twenty patients (13 males and 7 females) with mandibular benign unilateral lesions were included, and divided into 2 groups. Group I consisted of 10 patients who underwent enucleation of the lesions followed by grafting of the bony defects with autologous bone marrow concentrates and CGF. Group II consisted of 10 patients who underwent enucleation of the lesions without grafting (control). Radiographic examinations were done immediately postoperative, then at 1, 3, 6, and 12 months, to evaluate the reduction in size and changes in bone density at the bony defects. Results indicated a significant increase in bone density with respect to the baseline levels in both groups (P < 0.05). The increase in bone density was significantly higher in group I compared with group II at the 6- and 12-month follow-up examinations (P < 0.05). The percent of reduction in the defects' size was significantly higher in group I compared with group II after 12 months (P = 0.00001). In conclusion, the clinical application of autologous bone marrow concentrates with CGF is a cost effective and safe biotechnology, which accelerates bone regeneration and improves the density of regenerated bone.

Perivascular Stem Cells: A Prospectively Purified Mesenchymal Stem Cell Population for Bone Tissue Engineering

PubMed Central

James, Aaron W.; Zara, Janette N.; Zhang, Xinli; Askarinam, Asal; Goyal, Raghav; Chiang, Michael; Yuan, Wei; Chang, Le; Corselli, Mirko; Shen, Jia; Pang, Shen; Stoker, David; Wu, Ben

2012-01-01

Adipose tissue is an ideal source of mesenchymal stem cells for bone tissue engineering: it is largely dispensable and readily accessible with minimal morbidity. However, the stromal vascular fraction (SVF) of adipose tissue is a heterogeneous cell population, which leads to unreliable bone formation. In the present study, we prospectively purified human perivascular stem cells (PSCs) from adipose tissue and compared their bone-forming capacity with that of traditionally derived SVF. PSCs are a population (sorted by fluorescence-activated cell sorting) of pericytes (CD146+CD34−CD45−) and adventitial cells (CD146−CD34+CD45−), each of which we have previously reported to have properties of mesenchymal stem cells. Here, we found that PSCs underwent osteogenic differentiation in vitro and formed bone after intramuscular implantation without the need for predifferentiation. We next sought to optimize PSCs for in vivo bone formation, adopting a demineralized bone matrix for osteoinduction and tricalcium phosphate particle formulation for protein release. Patient-matched, purified PSCs formed significantly more bone in comparison with traditionally derived SVF by all parameters. Recombinant bone morphogenetic protein 2 increased in vivo bone formation but with a massive adipogenic response. In contrast, recombinant Nel-like molecule 1 (NELL-1; a novel osteoinductive growth factor) selectively enhanced bone formation. These studies suggest that adipose-derived human PSCs are a new cell source for future efforts in skeletal regenerative medicine. Moreover, PSCs are a stem cell-based therapeutic that is readily approvable by the U.S. Food and Drug Administration, with potentially increased safety, purity, identity, potency, and efficacy. Finally, NELL-1 is a candidate growth factor able to induce human PSC osteogenesis. PMID:23197855

Induction of angiogenesis in tissue-engineered scaffolds designed for bone repair: a combined gene therapy-cell transplantation approach.

PubMed

Jabbarzadeh, Ehsan; Starnes, Trevor; Khan, Yusuf M; Jiang, Tao; Wirtel, Anthony J; Deng, Meng; Lv, Qing; Nair, Lakshmi S; Doty, Steven B; Laurencin, Cato T

2008-08-12

One of the fundamental principles underlying tissue engineering approaches is that newly formed tissue must maintain sufficient vascularization to support its growth. Efforts to induce vascular growth into tissue-engineered scaffolds have recently been dedicated to developing novel strategies to deliver specific biological factors that direct the recruitment of endothelial cell (EC) progenitors and their differentiation. The challenge, however, lies in orchestration of the cells, appropriate biological factors, and optimal factor doses. This study reports an approach as a step forward to resolving this dilemma by combining an ex vivo gene transfer strategy and EC transplantation. The utility of this approach was evaluated by using 3D poly(lactide-co-glycolide) (PLAGA) sintered microsphere scaffolds for bone tissue engineering applications. Our goal was achieved by isolation and transfection of adipose-derived stromal cells (ADSCs) with adenovirus encoding the cDNA of VEGF. We demonstrated that the combination of VEGF releasing ADSCs and ECs results in marked vascular growth within PLAGA scaffolds. We thereby delineate the potential of ADSCs to promote vascular growth into biomaterials.

Induction of angiogenesis in tissue-engineered scaffolds designed for bone repair: A combined gene therapy–cell transplantation approach

PubMed Central

Jabbarzadeh, Ehsan; Starnes, Trevor; Khan, Yusuf M.; Jiang, Tao; Wirtel, Anthony J.; Deng, Meng; Lv, Qing; Nair, Lakshmi S.; Doty, Steven B.; Laurencin, Cato T.

2008-01-01

One of the fundamental principles underlying tissue engineering approaches is that newly formed tissue must maintain sufficient vascularization to support its growth. Efforts to induce vascular growth into tissue-engineered scaffolds have recently been dedicated to developing novel strategies to deliver specific biological factors that direct the recruitment of endothelial cell (EC) progenitors and their differentiation. The challenge, however, lies in orchestration of the cells, appropriate biological factors, and optimal factor doses. This study reports an approach as a step forward to resolving this dilemma by combining an ex vivo gene transfer strategy and EC transplantation. The utility of this approach was evaluated by using 3D poly(lactide-co-glycolide) (PLAGA) sintered microsphere scaffolds for bone tissue engineering applications. Our goal was achieved by isolation and transfection of adipose-derived stromal cells (ADSCs) with adenovirus encoding the cDNA of VEGF. We demonstrated that the combination of VEGF releasing ADSCs and ECs results in marked vascular growth within PLAGA scaffolds. We thereby delineate the potential of ADSCs to promote vascular growth into biomaterials. PMID:18678895

“Ins” and “Outs” of mesenchymal stem cell osteogenesis in regenerative medicine

PubMed Central

Yamaguchi, Dean T

2014-01-01

Repair and regeneration of bone requires mesenchymal stem cells that by self-renewal, are able to generate a critical mass of cells with the ability to differentiate into osteoblasts that can produce bone protein matrix (osteoid) and enable its mineralization. The number of human mesenchymal stem cells (hMSCs) diminishes with age and ex vivo replication of hMSCs has limited potential. While propagating hMSCs under hypoxic conditions may maintain their ability to self-renew, the strategy of using human telomerase reverse transcriptase (hTERT) to allow for hMSCs to prolong their replicative lifespan is an attractive means of ensuring a critical mass of cells with the potential to differentiate into various mesodermal structural tissues including bone. However, this strategy must be tempered by the oncogenic potential of TERT-transformed cells, or their ability to enhance already established cancers, the unknown differentiating potential of high population doubling hMSCs and the source of hMSCs (e.g., bone marrow, adipose-derived, muscle-derived, umbilical cord blood, etc.) that may provide peculiarities to self-renewal, differentiation, and physiologic function that may differ from non-transformed native cells. Tissue engineering approaches to use hMSCs to repair bone defects utilize the growth of hMSCs on three-dimensional scaffolds that can either be a base on which hMSCs can attach and grow or as a means of sequestering growth factors to assist in the chemoattraction and differentiation of native hMSCs. The use of whole native extracellular matrix (ECM) produced by hMSCs, rather than individual ECM components, appear to be advantageous in not only being utilized as a three-dimensional attachment base but also in appropriate orientation of cells and their differentiation through the growth factors that native ECM harbor or in simulating growth factor motifs. The origin of native ECM, whether from hMSCs from young or old individuals is a critical factor in “rejuvenating” hMSCs from older individuals grown on ECM from younger individuals. PMID:24772237

ERK1/2 and Akt phosphorylation were essential for MGF E peptide regulating cell morphology and mobility but not proangiogenic capacity of BMSCs under severe hypoxia.

PubMed

Sha, Yongqiang; Yang, Li; Lv, Yonggang

2018-04-01

Severe hypoxia inhibits the adhesion and mobility of bone marrow-derived mesenchymal stem cells (BMSCs) and limits their application in bone tissue engineering. In this study, CoCl 2 was used to simulate severe hypoxia and the effects of mechano-growth factor (MGF) E peptide on the morphology, adhesion, migration, and proangiogenic capacity of BMSCs under hypoxia were measured. It was demonstrated that severe hypoxia (500-μM CoCl 2 ) significantly caused cell contraction and reduced cell area, roundness, adhesion, and migration of BMSCs. RhoA and ROCK1 expression levels were upregulated by severe hypoxia, but p-RhoA and mobility-relevant protein (integrin β1, p-FAK and fibronectin) expression levels in BMSCs were inhibited. Fortunately, MGF E peptide could restore all abovementioned indexes except RhoA expression. MEK-ERK1/2 pathway was involved in MGF E peptide regulating cell morphological changes, mobility, and relevant proteins (except p-FAK). PI3K-Akt pathway was involved in MGF E peptide regulating cell area, mobility, and relevant proteins. Besides, severe hypoxia upregulated vascular endothelial growth factor α expression but was harmful for proangiogenic capacity of BMSCs. Our study suggested that MGF E peptide might be helpful for the clinical application of tissue engineering strategy in bone defect repair. Sever hypoxia impairs bone defect repair with bone marrow-derived mesenchymal stem cells (BMSCs). This study proved that mechano-growth factor E (MGF E) peptide could improve the severe hypoxia-induced cell contraction and decline of cell adhesion and migration of BMSCs. Besides, MGF E peptide weakened the effects of severe hypoxia on the cytoskeleton arrangement- and mobility-relevant protein expression levels in BMSCs. The underlying molecular mechanism was also verified. Finally, it was confirmed that MGF E peptide showed an adverse effect on the expression level of vascular endothelial growth factor α in BMSCs under severe hypoxia but could make up for this deficiency through accelerating cell proliferation. Copyright © 2018 John Wiley & Sons, Ltd.

Enhanced bioactive scaffolds for bone tissue regeneration

NASA Astrophysics Data System (ADS)

Karnik, Sonali

Bone injuries are commonly termed as fractures and they vary in their severity and causes. If the fracture is severe and there is loss of bone, implant surgery is prescribed. The response to the implant depends on the patient's physiology and implant material. Sometimes, the compromised physiology and undesired implant reactions lead to post-surgical complications. [4, 5, 20, 28] Efforts have been directed towards the development of efficient implant materials to tackle the problem of post-surgical implant failure. [ 15, 19, 24, 28, 32]. The field of tissue engineering and regenerative medicine involves the use of cells to form a new tissue on bio-absorbable or inert scaffolds. [2, 32] One of the applications of this field is to regenerate the damaged or lost bone by using stem cells or osteoprogenitor cells on scaffolds that can integrate in the host tissue without causing any harmful side effects. [2, 32] A variety of natural, synthetic materials and their combinations have been used to regenerate the damaged bone tissue. [2, 19, 30, 32, 43]. Growth factors have been supplied to progenitor cells to trigger a sequence of metabolic pathways leading to cellular proliferation, differentiation and to enhance their functionality. [56, 57] The challenge persists to supply these proteins, in the range of nano or even picograms, and in a sustained fashion over a period of time. A delivery system has yet to be developed that would mimic the body's inherent mechanism of delivering the growth factor molecules in the required amount to the target organ or tissue. Titanium is the most preferred metal for orthopedic and orthodontic implants. [28, 46, 48] Even though it has better osteogenic properties as compared to other metals and alloys, it still has drawbacks like poor integration into the surrounding host tissue leading to bone resorption and implant failure. [20, 28, 35] It also faces the problem of postsurgical infections that contributes to the implant failure. [26, 37]. The focus of this dissertation was to design and develop novel implant materials for coating titanium to improve its biological properties. These natural and/or semi-synthetic materials improved cellular adhesion, biological response to the scaffolds and prevented growth of bacteria when they were enhanced with growth factor and anti-infective loaded nanotubes. The implant materials showed promise when tested in vitro for cell proliferation, differentiation and bacterial growth inhibition.

[Development, physiology, and cell activity of bone].

PubMed

de Baat, P; Heijboer, M P; de Baat, C

2005-07-01

Bones are of crucial importance for the human body, providing skeletal support, serving as a home for the formation of haematopoietic cells, and reservoiring calcium and phosphate. Long bones develop by endochondral ossification. Flat bones develop by intramembranous ossification. Bone tissue contains hydroxyapatite and various extracellular proteins, producing bone matrix. Two biological mechanisms, determining the strength of bone, are modelling and remodelling. Modelling can change bone shape and size through bone formation by osteoblasts at some sites and through bone destruction by osteoclasts at other sites. Remodelling is bone turnover, also performed by osteoclasts and osteoblasts. The processes of modelling and remodelling are induced by mechanical loads, predominantly muscle loads. Osteoblasts develop from mesenchymal stem cells. Many stimulating factors are known to activate the differentiation. Mature osteoblasts synthesize bone matrix and may further differentiate into osteocytes. Osteocytes maintain structural bone integrity and allow bone to adapt to any mechanical and chemical stimulus. Osteoclasts derive from haematopoietic stem cells. A number of transcription and growth factors have been identified essential for osteoclast differentiation and function. Finally, there is a complex interaction between osteoblasts and osteoclasts. Bone destruction starts by attachment of osteoclasts to the bone surface. Following this, osteoclasts undergo specific morphological changes. The process of bone destruction starts by acid dissolution of hydroxyapatite. After that osteoclasts start to destruct the organic matrix.

Force-induced bone growth and adaptation: A system theoretical approach to understanding bone mechanotransduction

NASA Astrophysics Data System (ADS)

Maldonado, Solvey; Findeisen, Rolf

2010-06-01

The modeling, analysis, and design of treatment therapies for bone disorders based on the paradigm of force-induced bone growth and adaptation is a challenging task. Mathematical models provide, in comparison to clinical, medical and biological approaches an structured alternative framework to understand the concurrent effects of the multiple factors involved in bone remodeling. By now, there are few mathematical models describing the appearing complex interactions. However, the resulting models are complex and difficult to analyze, due to the strong nonlinearities appearing in the equations, the wide range of variability of the states, and the uncertainties in parameters. In this work, we focus on analyzing the effects of changes in model structure and parameters/inputs variations on the overall steady state behavior using systems theoretical methods. Based on an briefly reviewed existing model that describes force-induced bone adaptation, the main objective of this work is to analyze the stationary behavior and to identify plausible treatment targets for remodeling related bone disorders. Identifying plausible targets can help in the development of optimal treatments combining both physical activity and drug-medication. Such treatments help to improve/maintain/restore bone strength, which deteriorates under bone disorder conditions, such as estrogen deficiency.

Activation of Stat1 by mutant fibroblast growth-factor receptor in thanatophoric dysplasia type II dwarfism.

PubMed

Su, W C; Kitagawa, M; Xue, N; Xie, B; Garofalo, S; Cho, J; Deng, C; Horton, W A; Fu, X Y

1997-03-20

The achondroplasia class of chondrodysplasias comprises the most common genetic forms of dwarfism in humans and includes achondroplasia, hypochondroplasia and thanatophoric dysplasia types I and II (TDI and TDII), which are caused by different mutations in a fibroblast growth-factor receptor FGFR3 (ref. 1). The molecular mechanism and the mediators of these FGFR3-related growth abnormalities are not known. Here we show that mutant TDII FGFR3 has a constitutive tyrosine kinase activity which can specifically activate the transcription factor Stat1 (for signal transducer and activator of transcription). Furthermore, expression of TDII FGFR3 induced nuclear translocation of Stat1, expression of the cell-cycle inhibitor p21(WAF1/CIP1), and growth arrest of the cell. Thus, TDII FGFR3 may use Stat1 as a mediator of growth retardation in bone development. Consistent with this, Stat1 activation and increased p21(WAF1/CIP1) expression was found in the cartilage cells from the TDII fetus, but not in those from the normal fetus. Thus, abnormal STAT activation and p21(WAF1/CIP1) expression by the TDII mutant receptor may be responsible for this FGFR3-related bone disease.

Dual delivery of rhPDGF-BB and bone marrow mesenchymal stromal cells expressing the BMP2 gene enhance bone formation in a critical-sized defect model.

PubMed

Park, Shin-Young; Kim, Kyoung-Hwa; Shin, Seung-Yun; Koo, Ki-Tae; Lee, Yong-Moo; Seol, Yang-Jo

2013-11-01

Bone tissue healing is a dynamic, orchestrated process that relies on multiple growth factors and cell types. Platelet-derived growth factor-BB (PDGF-BB) is released from platelets at wound sites and induces cellular migration and proliferation necessary for bone regeneration in the early healing process. Bone morphogenetic protein-2 (BMP-2), the most potent osteogenic differentiation inducer, directs new bone formation at the sites of bone defects. This study evaluated a combinatorial treatment protocol of PDGF-BB and BMP-2 on bone healing in a critical-sized defect model. To mimic the bone tissue healing process, a dual delivery approach was designed to deliver the rhPDGF-BB protein transiently during the early healing phase, whereas BMP-2 was supplied by rat bone marrow stromal cells (BMSCs) transfected with an adenoviral vector containing the BMP2 gene (AdBMP2) for prolonged release throughout the healing process. In in vitro experiments, the dual delivery of rhPDGF-BB and BMP2 significantly enhanced cell proliferation. However, the osteogenic differentiation of BMSCs was significantly suppressed even though the amount of BMP-2 secreted by the AdBMP2-transfected BMSCs was not significantly affected by the rhPDGF-BB treatment. In addition, dual delivery inhibited the mRNA expression of BMP receptor type II and Noggin in BMSCs. In in vivo experiments, critical-sized calvarial defects in rats showed enhanced bone regeneration by dual delivery of autologous AdBMP2-transfected BMSCs and rhPDGF-BB in both the amount of new bone formed and the bone mineral density. These enhancements in bone regeneration were greater than those observed in the group treated with AdBMP2-transfected BMSCs alone. In conclusion, the dual delivery of rhPDGF-BB and AdBMP2-transfected BMSCs improved the quality of the regenerated bone, possibly due to the modulation of PDGF-BB on BMP-2-induced osteogenesis.

Insulin-like growth factor I is required for the anabolic actions of parathyroid hormone on mouse bone

NASA Technical Reports Server (NTRS)

Bikle, Daniel D.; Sakata, Takeshi; Leary, Colin; Elalieh, Hashem; Ginzinger, David; Rosen, Clifford J.; Beamer, Wesley; Majumdar, Sharmila; Halloran, Bernard P.

2002-01-01

Parathyroid hormone (PTH) is a potent anabolic agent for bone, but the mechanism(s) by which it works remains imperfectly understood. Previous studies have indicated that PTH stimulates insulin-like growth factor (IGF) I production, but it remains uncertain whether IGF-I mediates some or all of the skeletal actions of PTH. To address this question, we examined the skeletal response to PTH in IGF-I-deficient (knockout [k/o]) mice. These mice and their normal littermates (NLMs) were given daily injections of PTH (80 microg/kg) or vehicle for 2 weeks after which their tibias were examined for fat-free weight (FFW), bone mineral content, bone structure, and bone formation rate (BFR), and their femurs were assessed for mRNA levels of osteoblast differentiation markers. In wild-type mice, PTH increased FFW, periosteal BFR, and cortical thickness (C.Th) of the proximal tibia while reducing trabecular bone volume (BV); these responses were not seen in the k/o mice. The k/o mice had normal mRNA levels of the PTH receptor and increased mRNA levels of the IGF-I receptor but markedly reduced basal mRNA levels of the osteoblast markers. Surprisingly, these mRNAs in the k/o bones increased several-fold more in response to PTH than the mRNAs in the bones from their wild-type littermates. These results indicate that IGF-I is required for the anabolic actions of PTH on bone formation, but the defect lies distal to the initial response of the osteoblast to PTH.

Coating of VEGF-releasing scaffolds with bioactive glass for angiogenesis and bone regeneration.

PubMed

Leach, J Kent; Kaigler, Darnell; Wang, Zhuo; Krebsbach, Paul H; Mooney, David J

2006-06-01

Bioactive glasses are potentially useful as bone defect fillers, and vascular endothelial growth factor (VEGF) has demonstrated benefit in bone regeneration as well. We hypothesized that the specific combination of prolonged localized VEGF presentation from a matrix coated with a bioactive glass may enhance bone regeneration. To test this hypothesis, the capacity of VEGF-releasing polymeric scaffolds with a bioactive glass coating was examined in vitro and in vivo using a rat critical-sized defect model. In the presence of a bioactive glass coating, we did not detect pronounced differences in the differentiation of human mesenchymal stem cells in vitro. However, we observed significantly enhanced mitogenic stimulation of endothelial cells in the presence of the bioactive glass coating, with an additive effect with VEGF release. This trend was maintained in vivo, where coated VEGF-releasing scaffolds demonstrated significant improvements in blood vessel density at 2 weeks versus coated control scaffolds. At 12 weeks, bone mineral density was significantly increased in coated VEGF-releasing scaffolds versus coated controls, while only a slight increase in bone volume fraction was observed. The results of this study suggest that a bioactive glass coating on a polymeric substrate participates in bone healing through indirect processes which enhance angiogenesis and bone maturation and not directly on osteoprogenitor differentiation and bone formation. The mass of bioactive glass used in this study provides a comparable and potentially additive, response to localized VEGF delivery over early time points. These studies demonstrate a materials approach to achieve an angiogenic response formerly limited to the delivery of inductive growth factors.

The effects of orbital spaceflight on bone histomorphometry and messenger ribonucleic acid levels for bone matrix proteins and skeletal signaling peptides in ovariectomized growing rats

NASA Technical Reports Server (NTRS)

Cavolina, J. M.; Evans, G. L.; Harris, S. A.; Zhang, M.; Westerlind, K. C.; Turner, R. T.

1997-01-01

A 14-day orbital spaceflight was performed using ovariectomized Fisher 344 rats to determine the combined effects of estrogen deficiency and near weightlessness on tibia radial bone growth and cancellous bone turnover. Twelve ovariectomized rats with established cancellous osteopenia were flown aboard the space shuttle Columbia (STS-62). Thirty ovariectomized rats were housed on earth as ground controls: 12 in animal enclosure modules, 12 in vivarium cages, and 6 killed the day of launch for baseline measurements. An additional 18 ovary-intact rats were housed in vivarium cages as ground controls: 8 rats were killed as baseline controls and the remaining 10 rats were killed 14 days later. Ovariectomy increased periosteal bone formation at the tibia-fibula synostosis; cancellous bone resorption and formation in the secondary spongiosa of the proximal tibial metaphysis; and messenger RNA (mRNA) levels for the prepro-alpha2(1) subunit of type 1 collagen, osteocalcin, transforming growth factor-beta, and insulin-like growth factor I in the contralateral proximal tibial metaphysis and for the collagen subunit in periosteum pooled from tibiae and femora and decreased cancellous bone area. Compared to ovariectomized weight-bearing rats, the flight group experienced decreases in periosteal bone formation, collagen subunit mRNA levels, and cancellous bone area. The flight rats had a small decrease in the cancellous mineral apposition rate, but no change in the calculated bone formation rate. Also, spaceflight had no effect on cancellous osteoblast and osteoclast perimeters or on mRNA levels for bone matrix proteins and signaling peptides. On the other hand, spaceflight resulted in an increase in bone resorption, as ascertained from the diminished retention of a preflight fluorochrome label. This latter finding suggests that osteoclast activity was increased. In a follow-up ground-based experiment, unilateral sciatic neurotomy of ovariectomized rats resulted in cancellous bone loss in the unloaded limb in excess of that induced by gonadal hormone deficiency. This additional bone loss was arrested by estrogen replacement. We conclude from these studies that estrogen alters the expression of signaling peptides believed to mediate skeletal adaptation to changes in mechanical usage and likewise modifies the skeletal response to mechanical unloading.

Enhanced angiogenesis and osteogenesis in critical bone defects by the controlled release of BMP-2 and VEGF: implantation of electron beam melting-fabricated porous Ti6Al4V scaffolds incorporating growth factor-doped fibrin glue.

PubMed

Lv, Jia; Xiu, Peng; Tan, Jie; Jia, Zhaojun; Cai, Hong; Liu, Zhongjun

2015-06-24

Electron beam melting (EBM)-fabricated porous titanium implants possessing low elastic moduli and tailored structures are promising biomaterials for orthopedic applications. However, the bio-inert nature of porous titanium makes reinforcement with growth factors (GFs) a promising method to enhance implant in vivo performance. Bone-morphogenic protein-2 (BMP-2) and vascular endothelial growth factor (VEGF) are key factors of angiogenesis and osteogenesis. Therefore, the present study is aimed at evaluating EBM-fabricated porous titanium implants incorporating GF-doped fibrin glue (FG) as composite scaffolds providing GFs for improvement of angiogenesis and osteogenesis in rabbit femoral condyle defects. BMP-2 and VEGF were added into the constituent compounds of FG, and then this GF-doped FG was subsequently injected into the porous scaffolds. In five groups of implants, angiogenesis and osteogenesis were evaluated at 4 weeks post-implantation using Microfil perfusion and histological analysis: eTi (empty scaffolds), cTi (containing undoped FG), BMP/cTi (containing 50 μg rhBMP-2), VEGF/cTi (containing 0.5 μg VEGF) and Dual/cTi (containing 50 μg rhBMP-2 and 0.5 μg VEGF). The results demonstrate that these composite implants are biocompatible and provide the desired gradual release of the bioactive growth factors. Incorporation of GF delivery, whether a single factor or dual factors, significantly enhanced both angiogenesis and osteogenesis inside the porous scaffolds. However, the synergistic effect of the dual factors combination was observable on angiogenesis but absent on osteogenesis. In conclusion, fibrin glue is a biocompatible material that could be employed as a delivery vehicle in EBM-fabricated porous titanium for controlled release of BMP-2 and VEGF. Application of this method for loading a porous titanium scaffold to incorporate growth factors is a convenient and promising strategy for improving osteogenesis of critical-sized bone defects.

FOXL2 modulates cartilage, skeletal development and IGF1-dependent growth in mice.

PubMed

Marongiu, Mara; Marcia, Loredana; Pelosi, Emanuele; Lovicu, Mario; Deiana, Manila; Zhang, Yonqing; Puddu, Alessandro; Loi, Angela; Uda, Manuela; Forabosco, Antonino; Schlessinger, David; Crisponi, Laura

2015-07-02

Haploinsufficiency of the FOXL2 transcription factor in humans causes Blepharophimosis/Ptosis/Epicanthus Inversus syndrome (BPES), characterized by eyelid anomalies and premature ovarian failure. Mice lacking Foxl2 recapitulate human eyelid/forehead defects and undergo female gonadal dysgenesis. We report here that mice lacking Foxl2 also show defects in postnatal growth and embryonic bone and cartilage formation. Foxl2 (-/-) male mice at different stages of development have been characterized and compared to wild type. Body length and weight were measured and growth curves were created. Skeletons were stained with alcian blue and/or alizarin red. Bone and cartilage formation was analyzed by Von Kossa staining and immunofluorescence using anti-FOXL2 and anti-SOX9 antibodies followed by confocal microscopy. Genes differentially expressed in skull vaults were evaluated by microarray analysis. Analysis of the GH/IGF1 pathway was done evaluating the expression of several hypothalamic-pituitary-bone axis markers by RT-qPCR. Compared to wild-type, Foxl2 null mice are smaller and show skeletal abnormalities and defects in cartilage and bone mineralization, with down-regulation of the GH/IGF1 axis. Consistent with these effects, we find FOXL2 expressed in embryos at 9.5 dpc in neural tube epithelium, in head mesenchyme near the neural tube, and within the first branchial arch; then, starting at 12.5 dpc, expressed in cartilaginous tissue; and at PO and P7, in hypothalamus. Our results support FOXL2 as a master transcription factor in a spectrum of developmental processes, including growth, cartilage and bone formation. Its action overlaps that of SOX9, though they are antagonistic in female vs male gonadal sex determination but conjoint in cartilage and skeletal development.

Augmented macrophage differentiation and polarization of tumor-associated macrophages towards M1 subtype in listeria-administered tumor-bearing host.

PubMed

Rai, Rakesh K; Vishvakarma, Naveen K; Mohapatra, Tribhuban M; Singh, Sukh Mahendra

2012-09-01

This study investigates the effect of Listeria administration on differentiation of macrophages from precursor bone marrow cells and functional status of tumor-associated macrophages (TAM). Listeria administration not only resulted in an augmented infiltration of tumor by F4/80 macrophages but also repolarized the functional status of TAM displaying features of some M1 macrophage subtype with upregulated phagocytosis and tumoricidal activity accompanied by altered expression of monocarboxylate transporter-1, toll-like receptor-2, surface markers: CD11c, interleukin-2 receptor, CD62L, and secreted molecules: nitric oxide, interleukin (IL)-1, IL-6, tumor necrosis factor-α, and vascular endothelial growth factor. Declined tumor cell survival and modulated repertoire of cytokines: interferon-γ, IL-6, IL-10, and transforming growth factor-β in tumor microenvironment indicated their role in polarization of TAM towards proinflammatory state. Bone marrow cell of Listeria-administered tumor-bearing mice showed augmented survival, declined expression of p53 upregulated modulator of apoptosis with an upregulated differentiation into activation responsive bone marrow-derived macrophages along with altered expression of macrophage-colony stimulating factor, macrophage-colony stimulating factor receptor, and granulocyte macrophage-colony stimulating factor receptor. These findings indicate that Listeria infection is associated with an augmented differentiation of macrophages accompanied by tumoricidal activation of TAM.

Effects of the National School Lunch Program on Bone Growth in Japanese Elementary School Children.

PubMed

Kohri, Toshiyuki; Kaba, Naoko; Itoh, Tatsuki; Sasaki, Satoshi

2016-01-01

The Japanese school lunch program with milk was designed to supply 33-50% of the necessary nutrients per day and 50% of the recommended dietary allowance for calcium, which is difficult to obtain from Japanese meals. Although this program contributes to the mental and physical development of children, the effect of these meals on the bone growth in children remains unknown. Therefore, we compared the effect of school lunch with milk on bone growth between elementary school children attending schools that did not enforce the school lunch with milk program (box-lunch group) and those attending schools that did enforce the program (school-lunch group). The study subjects included fourth-grade children during the 2009-2013 school years, of whom 329 children were in the school-lunch group and 484 children in the box-lunch group. The bone area ratio of the right calcaneus was evaluated using quantitative ultrasound (Benus III). Dietary intakes were assessed using brief self-administered diet history questionnaires. The subjects were asked to record their activities for 3 d so that the mean physical activity intensity and the time spent sleeping could be estimated. The bone area ratios (%) were significantly higher in the school-lunch group than in the box-lunch group (males 31.0±0.3 vs. 30.3±0.2; females 30.6±0.2 vs. 29.7±0.2). This tendency did not change even after adjustment for confounding factors associated with bone growth. The results suggest that nutrients supplied by the Japanese school lunch program contributed to increased bone growth in elementary school children.

Seasonal bone growth and physiology in endotherms shed light on dinosaur physiology.

PubMed

Köhler, Meike; Marín-Moratalla, Nekane; Jordana, Xavier; Aanes, Ronny

2012-07-19

Cyclical growth leaves marks in bone tissue that are in the forefront of discussions about physiologies of extinct vertebrates. Ectotherms show pronounced annual cycles of growth arrest that correlate with a decrease in body temperature and metabolic rate; endotherms are assumed to grow continuously until they attain maturity because of their constant high body temperature and sustained metabolic rate. This apparent dichotomy has driven the argument that zonal bone denotes ectotherm-like physiologies, thus fuelling the controversy on dinosaur thermophysiology and the evolution of endothermy in birds and mammal-like reptiles. Here we show, from a comprehensive global study of wild ruminants from tropical to polar environments, that cyclical growth is a universal trait of homoeothermic endotherms. Growth is arrested during the unfavourable season concurrently with decreases in body temperature, metabolic rate and bone-growth-mediating plasma insulin-like growth factor-1 levels, forming part of a plesiomorphic thermometabolic strategy for energy conservation. Conversely, bouts of intense tissue growth coincide with peak metabolic rates and correlated hormonal changes at the beginning of the favourable season, indicating an increased efficiency in acquiring and using seasonal resources. Our study supplies the strongest evidence so far that homeothermic endotherms arrest growth seasonally, which precludes the use of lines of arrested growth as an argument in support of ectothermy. However, high growth rates are a distinctive trait of mammals, suggesting the capacity for endogenous heat generation. The ruminant annual cycle provides an extant model on which to base inferences regarding the thermophysiology of dinosaurs and other extinct taxa.

Pleiotrophin Commits Human Bone Marrow Mesenchymal Stromal Cells towards Hypertrophy during Chondrogenesis

PubMed Central

Bouderlique, Thibault; Henault, Emilie; Lebouvier, Angelique; Frescaline, Guilhem; Bierling, Phillipe; Rouard, Helene; Courty, José

2014-01-01

Pleiotrophin (PTN) is a growth factor present in the extracellular matrix of the growth plate during bone development and in the callus during bone healing. Bone healing is a complicated process that recapitulates endochondral bone development and involves many cell types. Among those cells, mesenchymal stromal cells (MSC) are able to differentiate toward chondrogenic and osteoblastic lineages. We aimed to determine PTN effects on differentiation properties of human bone marrow stromal cells (hBMSC) under chondrogenic induction using histological analysis and quantitative reverse transcription polymerase chain reaction. PTN dramatically potentiated chondrogenic differentiation as indicated by a strong increase of collagen 2 protein, and cartilage-related gene expression. Moreover, PTN increased transcription of hypertrophic chondrocyte markers such as MMP13, collagen 10 and alkaline phosphatase and enhanced calcification and the content of collagen 10 protein. These effects are dependent on PTN receptors signaling and PI3 K pathway activation. These data suggest a new role of PTN in bone regeneration as an inducer of hypertrophy during chondrogenic differentiation of hBMSC. PMID:24516627

Increased bone morphogenetic protein 7 signalling in the kidneys of dogs affected with a congenital portosystemic shunt.

PubMed

van Dongen, Astrid M; Heuving, Susanne M; Tryfonidou, Marianna A; van Steenbeek, Frank G; Rothuizen, Jan; Penning, Louis C

2015-05-01

Dogs with a congenital portosystemic shunt (CPSS) often have enlarged and hyper-filtrating kidneys. Although expression of different growth factors has been well-described in the livers of dogs affected with a CPSS, their expression in the kidneys has yet to be determined. Bone morphogenetic protein 7 (BMP-7), hepatocyte growth factor (HGF) and transforming growth factor (TGF)-β have been implicated in renal development (BMP-7, HGF) or the onset of renal fibrosis (TGF-β). Moreover, BMP-7 and HGF have protective properties in renal fibrosis. In this study, the expression and activity of BMP-7 were investigated in renal biopsies obtained from 13 dogs affected with a CPSS and compared to similar samples from age-matched healthy control dogs. Both quantitative reverse-transcriptase PCR and Western blotting showed up-regulated BMP-7 signalling in kidneys of CPPS-affected dogs. These research findings may help to explain the renal pathology/dysfunction in dogs affected with a CPSS. Copyright © 2015 Elsevier Ltd. All rights reserved.

Insulin-like growth factor-1 (IGF-1) enhances the osteogenic activity of bone morphogenetic protein-6 (BMP-6) in vitro and in vivo, and together have a stronger osteogenic effect than when IGF-1 is combined with BMP-2.

PubMed

Rico-Llanos, Gustavo A; Becerra, Jose; Visser, Rick

2017-07-01

Bone morphogenetic protein-2 (BMP-2) is widely used in orthopedic surgery and bone tissue engineering because of its strong osteogenic activity. However, BMP-2 treatments have several drawbacks and many groups are actively exploring alternatives. Since BMP-6 has been demonstrated to be more osteoinductive, its use, either alone or together with other growth factors, might be an interesting option. In this work, we have compared the effect of BMP-2, BMP-6, or insulin-like growth factor-1 (IGF-1), either alone or in combination. Murine preosteoblasts were treated with 15 nM IGF-1 and/or 6 nM BMP-2 or -6 and the expression of osteogenic marker genes, proliferation, and alkaline phosphatase (ALP) activity in vitro were analyzed. The results showed that IGF-1 greatly enhanced the BMP-induced osteogenic differentiation of these cells in general and that the ALP activity in the cultures was higher when the combination was made with BMP-6 than with BMP-2. Furthermore, we tested the osteogenic potential of these treatments in vivo by loading 25 pmoles of IGF-1 and/or 10 pmoles of BMP-2 or -6 onto absorbable collagen sponges and implanting them into an ectopic bone formation model in rats. This study revealed that only BMP-6 was able to induce bone formation at the used dose and that the addition of IGF-1 contributed to an increase of the mineralization in the implants. Hence, the combination of BMP-6 with IGF-1 might be a better alternative than BMP-2 for orthopedic surgery or bone tissue engineering approaches. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 1867-1875, 2017. © 2017 Wiley Periodicals, Inc.

Asporin and transforming growth factor-beta gene expression in osteoblasts from subchondral bone and osteophytes in osteoarthritis.

PubMed

Sakao, Kei; Takahashi, Kenji A; Arai, Yuji; Saito, Masazumi; Honjyo, Kuniaki; Hiraoka, Nobuyuki; Kishida, Tsunao; Mazda, Osam; Imanishi, Jiro; Kubo, Toshikazu

2009-11-01

To clarify the significance of subchondral bone and osteophytes in the pathology of osteoarthritis (OA), we investigated the expression of asporin (ASPN), transforming growth factor-beta1 (TGF-beta1), TGF-beta2, TGF-beta3, and runt-related transcription factor-2 (Runx2) genes involved in bone metabolism. Osteoblasts were isolated from 19 patients diagnosed with knee OA and from 4 patients diagnosed with femoral neck fracture. Osteoblast expression of mRNA encoding ASPN, TGF-beta1, TGF-beta2, TGF-beta3, and Runx2 was analyzed using real-time RT-PCR. Expression of ASPN, TGF-beta1, and TGF-beta3 mRNA in the subchondral bone and osteophytes of OA patients increased compared with that of non-OA patients. The ratio of ASPN to TGF-beta1 mRNA in patients with severe cartilage damage was higher than that in patients with mild cartilage damage. The increased ratio of ASPN mRNA to TGF-beta1 mRNA in patients with severe relative to mild cartilage damage indicates that increased ASPN mRNA expression was significantly associated with the severity of cartilage degeneration. This finding suggests that ASPN may regulate TGF-beta1-mediated factors in the development of OA, which may provide clues as to the underlying pathology of OA.

Mechanically induced alterations in cultured skeletal muscle growth

NASA Technical Reports Server (NTRS)

Vandenburgh, H. H.; Hatfaludy, S.; Karlisch, P.; Shansky, J.

1991-01-01

Model systems are available for mechanically stimulating cultured skeletal muscle cells by passive tensile forces which simulate those found in vivo. When applied to embryonic muscle cells in vitro these forces induce tissue organogenesis, metabolic adaptations, and muscle cell growth. The mechanical stimulation of muscle cell growth correlates with stretch-induced increases in the efflux of prostaglandins PGE2 and PGF2(alpha) in a time and frequency dependent manner. These prostaglandins act as mechanical 'second messengers' regulating skeletal muscle protein turnover rates. Since they also effect bone remodelling in response to tissue loading and unloading, secreted prostaglandins may serve as paracrine growth factors, coordinating the growth rates of muscle and bone in response to external mechanical forces. Cell culture model systems will supplement other models in understanding mechanical transduction processes at the molecular level.

The association of testosterone, sex hormone-binding globulin, and insulin-like growth factor-1 with bone parameters in Korean men aged 50 years or older.

PubMed

Kim, Hye-Jung; Koo, Hyung Suk; Kim, Young-Sang; Kim, Moon Jong; Kim, Kwang-Min; Joo, Nam-Seok; Haam, Ji-Hee

2017-11-01

Testosterone and insulin-like growth factor-1 (IGF-1) are essential factors for the maintenance of bone health in men. However, the results for the association of testosterone and IGF-1 with bone parameters were not consistent in prior studies. We evaluated the relationship of testosterone, sex hormone-binding globulin (SHBG), and IGF-1 with bone mineral density (BMD) and bone turnover markers (BTMs) in Korean men. We enrolled 1227 men aged ≥50 years in this cross-sectional study. Serum levels of total testosterone (TT), SHBG, IGF-1, osteocalcin, and C-terminal cross-linking telopeptide of type I collagen (CTX) were measured. Free testosterone (FT) was calculated using Vermeulen's method. BMD was measured by dual-energy X-ray absorptiometry. TT level was not related to BMD or BTMs in the unadjusted model; however, after adjusting for SHBG and IGF-1, the association between TT and BTMs was significant (β = -0.139 for osteocalcin and β = -0.204 for CTX). SHBG levels were negatively associated with lumbar BMD, and positively associated with BTMs in all models. As SHBG level increased, the prevalence of osteopenia or osteoporosis defined by BMD significantly increased (OR of 1SD change, 1.24). IGF-1 levels were significantly related with BMD, but not with BTMs. Meanwhile, FT levels were positively associated with BMD and negatively associated with BTMs. In conclusion, SHBG levels were independently related with bone parameters and osteopenia in men aged ≥50 years. IGF-1 levels were positively associated with BMD, but not with BTMs. SHBG may play a role in regulating age-related bone loss in men after middle-age.

Neutral endopeptidase-resistant C-type natriuretic peptide variant represents a new therapeutic approach for treatment of fibroblast growth factor receptor 3-related dwarfism.

PubMed

Wendt, Daniel J; Dvorak-Ewell, Melita; Bullens, Sherry; Lorget, Florence; Bell, Sean M; Peng, Jeff; Castillo, Sianna; Aoyagi-Scharber, Mika; O'Neill, Charles A; Krejci, Pavel; Wilcox, William R; Rimoin, David L; Bunting, Stuart

2015-04-01

Achondroplasia (ACH), the most common form of human dwarfism, is caused by an activating autosomal dominant mutation in the fibroblast growth factor receptor-3 gene. Genetic overexpression of C-type natriuretic peptide (CNP), a positive regulator of endochondral bone growth, prevents dwarfism in mouse models of ACH. However, administration of exogenous CNP is compromised by its rapid clearance in vivo through receptor-mediated and proteolytic pathways. Using in vitro approaches, we developed modified variants of human CNP, resistant to proteolytic degradation by neutral endopeptidase, that retain the ability to stimulate signaling downstream of the CNP receptor, natriuretic peptide receptor B. The variants tested in vivo demonstrated significantly longer serum half-lives than native CNP. Subcutaneous administration of one of these CNP variants (BMN 111) resulted in correction of the dwarfism phenotype in a mouse model of ACH and overgrowth of the axial and appendicular skeletons in wild-type mice without observable changes in trabecular and cortical bone architecture. Moreover, significant growth plate widening that translated into accelerated bone growth, at hemodynamically tolerable doses, was observed in juvenile cynomolgus monkeys that had received daily subcutaneous administrations of BMN 111. BMN 111 was well tolerated and represents a promising new approach for treatment of patients with ACH. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.

Biomaterial delivery of morphogens to mimic the natural healing cascade in bone.

PubMed

Mehta, Manav; Schmidt-Bleek, Katharina; Duda, Georg N; Mooney, David J

2012-09-01

Complications in treatment of large bone defects using bone grafting still remain. Our understanding of the endogenous bone regeneration cascade has inspired the exploration of a wide variety of growth factors (GFs) in an effort to mimic the natural signaling that controls bone healing. Biomaterial-based delivery of single exogenous GFs has shown therapeutic efficacy, and this likely relates to its ability to recruit and promote replication of cells involved in tissue development and the healing process. However, as the natural bone healing cascade involves the action of multiple factors, each acting in a specific spatiotemporal pattern, strategies aiming to mimic the critical aspects of this process will likely benefit from the usage of multiple therapeutic agents. This article reviews the current status of approaches to deliver single GFs, as well as ongoing efforts to develop sophisticated delivery platforms to deliver multiple lineage-directing morphogens (multiple GFs) during bone healing. Copyright © 2012 Elsevier B.V. All rights reserved.

Nanocomposites for bone tissue regeneration.

PubMed

Sahoo, Nanda Gopal; Pan, Yong Zheng; Li, Lin; He, Chao Bin

2013-04-01

Natural bone tissue possesses a nanocomposite structure that provides appropriate physical and biological properties. For bone tissue regeneration, it is crucial for the biomaterial to mimic living bone tissue. Since no single type of material is able to mimic the composition, structure and properties of native bone, nanocomposites are the best choice for bone tissue regeneration as they can provide the appropriate matrix environment, integrate desirable biological properties, and provide controlled, sequential delivery of multiple growth factors for the different stages of bone tissue regeneration. This article reviews the composition, structure and properties of advanced nanocomposites for bone tissue regeneration. It covers aspects of interest such as the biomimetic synthesis of bone-like nanocomposites, guided bone regeneration from inert biomaterials and bioactive nanocomposites, and nanocomposite scaffolds for bone tissue regeneration. The design, fabrication, and in vitro and in vivo characterization of such nanocomposites are reviewed.

Origin of platelet-derived growth factor in megakaryocytes in guinea pigs.

PubMed Central

Chernoff, A; Levine, R F; Goodman, D S

1980-01-01

Growth factor activity, as determined by the stimulation of [3H]thymidine incorporation into the DNA of quiescent 3T3 cells in culture, was found in lysates of guinea pig platelets and megakaryocytes. Quantitative dilution studies demonstrated that, of the cells present in the guinea pig bone marrow, only the megakaryocyte possessed quantitatively significant growth factor activity. The amount of activity present in one megakaryocyte was equivalent to that present in 1,000-5,000 platelets, a value approximately comparable to the number of platelets shed from a single megakaryocyte. It is suggested that guinea pig platelet-derived growth factor has its origin in the megakaryocyte. PMID:7358851

Chronic Inhibition of ERK1/2 Signaling Improves Disordered Bone and Mineral Metabolism in Hypophosphatemic (Hyp) Mice

PubMed Central

Zhang, Martin Y. H.; Ranch, Daniel; Pereira, Renata C.; Armbrecht, Harvey J.; Portale, Anthony A.

2012-01-01

The X-linked hypophosphatemic (Hyp) mouse carries a loss-of-function mutation in the phex gene and is characterized by hypophosphatemia due to renal phosphate (Pi) wasting, inappropriately suppressed 1,25-dihydroxyvitamin D [1,25(OH)2D] production, and rachitic bone disease. Increased serum fibroblast growth factor-23 concentration is responsible for the disordered metabolism of Pi and 1,25(OH)2D. In the present study, we tested the hypothesis that chronic inhibition of fibroblast growth factor-23-induced activation of MAPK signaling in Hyp mice can reverse their metabolic derangements and rachitic bone disease. Hyp mice were administered the MAPK inhibitor, PD0325901 orally for 4 wk. PD0325901 induced a 15-fold and 2-fold increase in renal 1α-hydroxylase mRNA and protein abundance, respectively, and thereby higher serum 1,25(OH)2D concentrations (115 ± 13 vs. 70 ± 16 pg/ml, P < 0.05), compared with values in vehicle-treated Hyp mice. With PD0325901, serum Pi levels were higher (5.1 ± 0.5 vs. 3 ± 0.2 mg/dl, P < 0.05), and the protein abundance of sodium-dependent phosphate cotransporter Npt2a, was greater than in vehicle-treated mice. The rachitic bone disease in Hyp mice is characterized by abundant unmineralized osteoid bone volume, widened epiphyses, and disorganized growth plates. In PD0325901-treated Hyp mice, mineralization of cortical and trabecular bone increased significantly, accompanied by a decrease in unmineralized osteoid volume and thickness, as determined by histomorphometric analysis. The improvement in mineralization in PD0325901-treated Hyp mice was confirmed by microcomputed tomography analysis, which showed an increase in cortical bone volume and thickness. These findings provide evidence that in Hyp mice, chronic MAPK inhibition improves disordered Pi and 1,25(OH)2D metabolism and bone mineralization. PMID:22334725

Chronic inhibition of ERK1/2 signaling improves disordered bone and mineral metabolism in hypophosphatemic (Hyp) mice.

PubMed

Zhang, Martin Y H; Ranch, Daniel; Pereira, Renata C; Armbrecht, Harvey J; Portale, Anthony A; Perwad, Farzana

2012-04-01

The X-linked hypophosphatemic (Hyp) mouse carries a loss-of-function mutation in the phex gene and is characterized by hypophosphatemia due to renal phosphate (Pi) wasting, inappropriately suppressed 1,25-dihydroxyvitamin D [1,25(OH)₂D] production, and rachitic bone disease. Increased serum fibroblast growth factor-23 concentration is responsible for the disordered metabolism of Pi and 1,25(OH)₂D. In the present study, we tested the hypothesis that chronic inhibition of fibroblast growth factor-23-induced activation of MAPK signaling in Hyp mice can reverse their metabolic derangements and rachitic bone disease. Hyp mice were administered the MAPK inhibitor, PD0325901 orally for 4 wk. PD0325901 induced a 15-fold and 2-fold increase in renal 1α-hydroxylase mRNA and protein abundance, respectively, and thereby higher serum 1,25(OH)₂D concentrations (115 ± 13 vs. 70 ± 16 pg/ml, P < 0.05), compared with values in vehicle-treated Hyp mice. With PD0325901, serum Pi levels were higher (5.1 ± 0.5 vs. 3 ± 0.2 mg/dl, P < 0.05), and the protein abundance of sodium-dependent phosphate cotransporter Npt2a, was greater than in vehicle-treated mice. The rachitic bone disease in Hyp mice is characterized by abundant unmineralized osteoid bone volume, widened epiphyses, and disorganized growth plates. In PD0325901-treated Hyp mice, mineralization of cortical and trabecular bone increased significantly, accompanied by a decrease in unmineralized osteoid volume and thickness, as determined by histomorphometric analysis. The improvement in mineralization in PD0325901-treated Hyp mice was confirmed by microcomputed tomography analysis, which showed an increase in cortical bone volume and thickness. These findings provide evidence that in Hyp mice, chronic MAPK inhibition improves disordered Pi and 1,25(OH)₂D metabolism and bone mineralization.

A histomorphometric comparison of Bio-Oss alone versus Bio-Oss and platelet-derived growth factor for sinus augmentation: a postsurgical assessment.

PubMed

Froum, Stuart J; Wallace, Stephen; Cho, Sang-Choon; Rosenburg, Edwin; Froum, Scott; Schoor, Robert; Mascarenhas, Patrick; Tarnow, Dennis P; Corby, Patricia; Elian, Nicolas; Fickl, Stefan; Ricci, John; Hu, Bin; Bromage, Timothy; Khouly, Ismael

2013-01-01

The purpose of this study was to assess vital bone formation at 4 to 5 months and 7 to 9 months following sinus augmentation with anorganic bovine bone matrix (ABBM) with and without recombinant human platelet-derived growth factor (rhPDGF). Twenty-four subjects received bilateral sinus elevation surgery with ABBM on one side and ABBM and rhPDGF on the contralateral side. Twelve patients had core sampling at 4 to 5 months and 12 patients at 7 to 9 months postoperatively. In subjects with cores taken at 4 to 5 months, mean vital bone, connective tissue, and residual graft were 11.8%, 54.1%, and 33.6%, respectively, with ABBM alone. Cores of sinuses filled with ABBM and rhPDGF showed mean 21.1% vital bone, 51.4% connective tissue, and 24.8% residual graft. Paired t test showed a statistically significant difference in vital bone. In cores taken at 7 to 9 months, the values for ABBM alone and ABBM + rhPDGF were 21.4% vs 19.5% vital bone, 28.4% vs 44.2% connective tissue, and 40.3% residual graft vs 35.5%. There was no statistically significant difference in vital bone at 7 to 9 months after surgery. Test and control groups showed clinically acceptable levels of vital bone both at 4 to 5 months and 7 to 9 months postsurgery. However, vital bone formation was significantly greater in the 4- to 5-month sections of ABBM + rhPDGF vs the Bio-Oss alone. In the 7- to 9-month specimens, this difference disappeared. More rapid formation of vital bone with the addition of rhPDGF may allow for earlier implant placement.

Insulin-like growth factor 1, glycation and bone fragility: implications for fracture resistance of bone.

PubMed

Sroga, Grażyna E; Wu, Ping-Cheng; Vashishth, Deepak

2015-01-01

Despite our extensive knowledge of insulin-like growth factor 1 (IGF1) action on the growing skeleton, its role in skeletal homeostasis during aging and age-related development of certain diseases is still unclear. Advanced glycation end products (AGEs) derived from glucose are implicated in osteoporosis and a number of diabetic complications. We hypothesized that because in humans and rodents IGF1 stimulates uptake of glucose (a glycation substrate) from the bloodstream in a dose-dependent manner, the decline of IGF1 could be associated with the accumulation of glycation products and the decreasing resistance of bone to fracture. To test the aforementioned hypotheses, we used human tibial posterior cortex bone samples to perform biochemical (measurement of IGF1, fluorescent AGEs and pentosidine (PEN) contents) and mechanical tests (crack initiation and propagation using compact tension specimens). Our results for the first time show a significant, age-independent association between the levels of IGF1 and AGEs. Furthermore, AGEs (fAGEs, PEN) predict propensity of bone to fracture (initiation and propagation) independently of age in human cortical bone. Based on these results we propose a model of IGF1-based regulation of bone fracture. Because IGF1 level increases postnatally up to the juvenile developmental phase and decreases thereafter with aging, we propose that IGF1 may play a protective role in young skeleton and its age-related decline leads to bone fragility and an increased fracture risk. Our results may also have important implications for current understanding of osteoporosis- and diabetes-related bone fragility as well as in the development of new diagnostic tools to screen for fragile bones.

Insulin-Like Growth Factor 1, Glycation and Bone Fragility: Implications for Fracture Resistance of Bone

PubMed Central

Sroga, Grażyna E.; Wu, Ping-Cheng; Vashishth, Deepak

2015-01-01

Despite our extensive knowledge of insulin-like growth factor 1 (IGF1) action on the growing skeleton, its role in skeletal homeostasis during aging and age-related development of certain diseases is still unclear. Advanced glycation end products (AGEs) derived from glucose are implicated in osteoporosis and a number of diabetic complications. We hypothesized that because in humans and rodents IGF1 stimulates uptake of glucose (a glycation substrate) from the bloodstream in a dose-dependent manner, the decline of IGF1 could be associated with the accumulation of glycation products and the decreasing resistance of bone to fracture. To test the aforementioned hypotheses, we used human tibial posterior cortex bone samples to perform biochemical (measurement of IGF1, fluorescent AGEs and pentosidine (PEN) contents) and mechanical tests (crack initiation and propagation using compact tension specimens). Our results for the first time show a significant, age-independent association between the levels of IGF1 and AGEs. Furthermore, AGEs (fAGEs, PEN) predict propensity of bone to fracture (initiation and propagation) independently of age in human cortical bone. Based on these results we propose a model of IGF1-based regulation of bone fracture. Because IGF1 level increases postnatally up to the juvenile developmental phase and decreases thereafter with aging, we propose that IGF1 may play a protective role in young skeleton and its age-related decline leads to bone fragility and an increased fracture risk. Our results may also have important implications for current understanding of osteoporosis- and diabetes-related bone fragility as well as in the development of new diagnostic tools to screen for fragile bones. PMID:25629402

Subcutaneous administration of insulin-like growth factor (IGF)-II/IGF binding protein-2 complex stimulates bone formation and prevents loss of bone mineral density in a rat model of disuse osteoporosis

NASA Technical Reports Server (NTRS)

Conover, Cheryl A.; Johnstone, Edward W.; Turner, Russell T.; Evans, Glenda L.; John Ballard, F. John; Doran, Patrick M.; Khosla, Sundeep

2002-01-01

Elevated serum levels of insulin-like growth factor binding protein-2 (IGFBP-2) and a precursor form of IGF-II are associated with marked increases in bone formation and skeletal mass in patients with hepatitis C-associated osteosclerosis. In vitro studies indicate that IGF-II in complex with IGFBP-2 has high affinity for bone matrix and is able to stimulate osteoblast proliferation. The purpose of this study was to determine the ability of the IGF-II/IGFBP-2 complex to increase bone mass in vivo. Osteopenia of the femur was induced by unilateral sciatic neurectomy in rats. At the time of surgery, 14-day osmotic minipumps containing vehicle or 2 microg IGF-II+9 microg IGFBP-2/100g body weight/day were implanted subcutaneously in the neck. Bone mineral density (BMD) measurements were taken the day of surgery and 14 days later using a PIXImus small animal densitometer. Neurectomy of the right hindlimb resulted in a 9% decrease in right femur BMD (P<0.05 vs. baseline). This loss in BMD was completely prevented by treatment with IGF-II/IGFBP-2. On the control limb, there was no loss of BMD over the 14 days and IGF-II/IGFBP-2 treatment resulted in a 9% increase in left femur BMD (P<0.05). Bone histomorphometry indicated increases in endocortical and cancellous bone formation rates and in trabecular thickness. These results demonstrate that short-term administration of the IGF-II/IGFBP-2 complex can prevent loss of BMD associated with disuse osteoporosis and stimulate bone formation in adult rats. Furthermore, they provide proof of concept for a novel anabolic approach to increasing bone mass in humans with osteoporosis.

Insulin-like growth factor-II regulates bone sialoprotein gene transcription.

PubMed

Choe, Jin; Sasaki, Yoko; Zhou, Liming; Takai, Hideki; Nakayama, Yohei; Ogata, Yorimasa

2016-09-01

Insulin-like growth factor-I and -II (IGF-I and IGF-II) have been found in bone extracts of several different species, and IGF-II is the most abundant growth factor stored in bone. Bone sialoprotein (BSP) is a noncollagenous extracellular matrix glycoprotein associated with mineralized connective tissues. In this study, we have investigated the regulation of BSP transcription by IGF-II in rat osteoblast-like ROS17/2.8 cells. IGF-II (50 ng/ml) increased BSP mRNA and protein levels after 6-h stimulation, and enhanced luciferase activities of the constructs pLUC3 (-116 to +60), pLUC4 (-425 to +60), pLUC5 (-801 to +60) and pLUC6 (-938 to +60). Effects of IGF-II were inhibited by tyrosine kinase, extracellular signal-regulated kinase1/2 and phosphatidylinositol 3-kinase inhibitors, and abrogated by 2-bp mutations in cAMP response element (CRE), FGF2 response element (FRE) and homeodomain protein-binding site (HOX). The results of gel shift assays showed that nuclear proteins binding to CRE, FRE and HOX sites were increased by IGF-II (50 ng/ml) at 3 and 6 h. CREB1, phospho-CREB1, c-Fos and c-Jun antibodies disrupted the formation of the CRE-protein complexes. Dlx5 and Runx2 antibodies disrupted the FRE- and HOX-protein complex formations. These studies therefore demonstrated that IGF-II increased BSP transcription by targeting CRE, FRE and HOX elements in the proximal promoter of the rat BSP gene. Moreover, phospho-CREB1, c-Fos, c-Jun, Dlx5 and Runx2 transcription factors appear to be key regulators of IGF-II effects on BSP transcription.

Synergistic interaction of platelet derived growth factor (PDGF) with the surface of PLLA/Col/HA and PLLA/HA scaffolds produces rapid osteogenic differentiation.

PubMed

Raghavendran, Hanumantha Rao Balaji; Mohan, Saktiswaren; Genasan, Krishnamurithy; Murali, Malliga Raman; Naveen, Sangeetha Vasudevaraj; Talebian, Sepehr; McKean, Robert; Kamarul, Tunku

2016-03-01

Scaffolds with structural features similar to the extracellular matrix stimulate rapid osteogenic differentiation in favorable microenvironment and with growth factor supplementation. In this study, the osteogenic potential of electrospun poly-l-lactide/hydroxyapatite/collagen (PLLA/Col/HA, PLLA/HA and PLLA/Col) scaffolds were tested in vitro with the supplementation of platelet derived growth factor-BB (PDGF-BB). Cell attachment and topography, mineralization, extracellular matrix protein localization, and gene expression of the human mesenchymal stromal cells were compared between the fibrous scaffolds PLLA/Col/HA, PLLA/Col, and PLLA/HA. The levels of osteocalcin, calcium, and mineralization were significantly greater in the PLLA/Col/HA and PLLA/HA compared with PLLA/Col. High expression of fibronectin, intracellular adhesion molecule, cadherin, and collagen 1 (Col1) suggests that PLLA/Col/HA and PLLA/HA scaffolds had superior osteoinductivity than PLLA/Col. Additionally, osteopontin, osteocalcin, osterix, Runt-related transcription factor 2 (Runx2), and bone morphogenic protein (BMP2) expression were higher in PLLA/Col/HA and PLLA/HA compared with PLLA/Col. In comparison with PLLA/Col, the PLLA/Col/HA and PLLA/HA scaffolds presented a significant upregulation of the genes Runx2, Col 1, Integrin, osteonectin (ON), bone gamma-carboxyglutamic acid-containing protein (BGALP), osteopontin (OPN), and BMP2. The upregulation of these genes was further increased with PDGF-BB supplementation. These results show that PDGF-BB acts synergistically with PLLA/Col/HA and PLLA/HA to enhance the osteogenic differentiation potential. Therefore, this combination can be used for the rapid expansion of bone marrow stromal cells into bone-forming cells for tissue engineering. Copyright © 2015 Elsevier B.V. All rights reserved.

[Effect of Yiguan Decoction on differentiation of bone marrow mesenchymal stem cells into hepatocyte-like cells: an experimental research].

PubMed

Ping, Jian; Chen, Hong-Yun; Yang, Zhou; Yang, Cheng; Xu, Lie-Ming

2014-03-01

To observe the effect of Yiguan Decoction (YGD) on differentiation of bone marrow mesenchymal stem cells (BMSCs) into hepatocyte-like cells in vitro. Rat BMSCs were isolated using whole bone marrow adherent method. The properties of BMSCs were identified by analyzing the expression of surface cytokines by flow cytometry. The third passage cells were differentiated into fat cells to identify their features. BMSCs were incubated with hepatocyte growth factor (HGF) plus fibroblast growth factor 4 (FGF4) or YGD containing serum YGD for 21 days. The mRNA expression of alpha-fetoprotein (alphaAFP), albumin (Alb), and hepatocyte nuclear factor 4alpha (HNF4alpha) were detected by real time PCR. Expression of AFP and cytokeratin 18 (CK18) protein was detected by cell immunofluorescence. Glycogen synthesis was observed using periodic acid-Schiff stain (PAS). CK18, Wnt 3alpha, and alphacatenin protein expressions were detected by Western blot. High expression of CD90, CD29, and CD44, and low expression of CD34 and CD11b were observed in BMSCs isolated by whole bone mar- row adherent method, and numerous lipid droplets were observed in BMSCs using oil red O staining. Both YGD containing serum and growth factor stimulated the expression levels of Alb, AFP, HNF4alpha mRNA and CK18 protein. The down-regulated expression of Wnt 3alpha and beta-catenin could be detected at 21 days after induction. The synthesized glycogen granule could be seen. Down-regulated Wnt 3alpha and beta-catenin expression could also be observed. YGD could induce the differentiation of rat BMSCs into hepatocyte-like cells, which was related to down-regulating Wnt/beta-catenin signal pathway.

SERUM LEVELS OF FIBROBLAST GROWTH FACTOR-23, OSTEOPROTEGERIN, AND RECEPTOR ACTIVATOR OF NUCLEAR FACTOR KAPPA B LIGAND IN PATIENTS WITH PROLACTINOMA.

PubMed

Arslan, Muyesser Sayki; Sahin, Mustafa; Karakose, Melia; Tutal, Esra; Topaloglu, Oya; Ucan, Bekir; Demirci, Taner; Caliskan, Mustafa; Ozdemir, Seyda; Ozbek, Mustafa; Cakal, Erman

2017-03-01

The aim of this study to was to evaluate the effect of fibroblast growth factor-23 (FGF-23), osteoprotegerin (OPG), receptor activator nuclear κB ligand (RANKL), and vitamin D hormones on bone loss in patients with hyperprolactinemia due to pituitary prolactinoma. We recruited 46 premenopausal female patients with prolactinoma and age and sex-matched healthy controls (Group 3, n = 20) for this cross-sectional study. Prolactinoma patients were divided into 2 groups as patients newly diagnosed (Group 1, n = 26) and those under cabergoline treatment (Group 2, n = 20). Anthropometric and metabolic variables; hormonal profiles; and osteocalcin, deoxypyridinoline (DOP), and bone mineral density measurements were performed for all participants. FGF-23, OPG, and RANKL levels were analyzed in all groups. FGF-23, OPG, calcium, phosphorus, and parathormone levels were similar between all groups despite significantly higher levels in the control group in terms of vitamin D and RANKL levels than in patients. Bone loss was found more in Group 2, particularly observed in Z scores of femur and spinal bone (P<.05). Correlation analysis revealed a negative correlation between FGF-23 and femur neck T score (r = -0.0433, P = .05) in patients with active prolactinoma. A positive correlation was also observed between parameters of DOP and OPG (r = 0.673, P = .02). In patients with remission there were a negative correlation between prolactin and luteinizing hormone (r = -600, P = .08). Additionally, a negative correlation was found between osteocalcin and osteoprotegerin in patients in remission (r = -0.73, P = .01). Our data indicated that FGF-23 and OPG levels do not play a critical role on the development of bone decrease in patients with hyperprolactinemia. However, further prospective studies in larger numbers of participants should be designed to clarify this issue. BFP = body fat percentage BMD = bone mineral density BMI = body mass index CV = coefficient of variation DOP = deoxypyridinoline ELISA = enzyme-linked immunosorbent assay FGF-23 = fibroblast growth factor-23 HOMA-IR = homeostatic model assessment of insulin resistance OPG = osteoprotegerin RANKL = receptor activator nuclear κB ligand.

Assessing a relationship between bone microstructure and growth rate: a fluorescent labelling study in the king penguin chick (Aptenodytes patagonicus).

PubMed

de Margerie, E; Robin, J-P; Verrier, D; Cubo, J; Groscolas, R; Castanet, J

2004-02-01

Microstructure-function relationships remain poorly understood in primary bone tissues. The relationship between bone growth rate and bone tissue type, although documented in some species by previous works, remains somewhat unclear and controversial. We assessed this relationship in a species with extreme adaptations, the king penguin (Aptenodytes patagonicus). These birds have a peculiar growth, interrupted 3 months after hatching by the austral winter. Before this interruption, chicks undergo extremely rapid statural and ponderal growth. We recorded experimentally (by means of fluorescent labelling) the growth rate of bone tissue in four long bones (humerus, radius, femur and tibiotarsus) of four king penguin chicks during their fastest phase of growth (3-5 weeks after hatching) and identified the associated bone tissue types ('laminar', 'longitudinal', 'reticular' or 'radial' fibro-lamellar bone tissue). We found the highest bone tissue growth rate known to date, up to 171 microm day(-1) (mean 55 microm day(-1)). There was a highly significant relationship between bone tissue type and growth rate (P<10(-6)). Highest rates were obtained with the radial microarchitecture of fibro-lamellar bone, where cavities in the woven network are aligned radially. This result supports the heuristic value of a relationship between growth rate and bone primary microstructure. However, we also found that growth rates of bone tissue types vary according to the long bone considered (P<10(-5)) (e.g. growth rates were 38% lower in the radius than in the other long bones), a result that puts some restriction on the applicability of absolute growth rate values (e.g. to fossil species). The biomechanical disadvantages of accelerated bone growth are discussed in relation to the locomotor behaviour of the chicks during their first month of life.

Stimulation of fibroblast growth factor 23 by metabolic acidosis requires osteoblastic intracellular calcium signaling and prostaglandin synthesis.

PubMed

Krieger, Nancy S; Bushinsky, David A

2017-10-01

Serum fibroblast growth factor 23 (FGF23) increases progressively in chronic kidney disease (CKD) and is associated with increased mortality. FGF23 is synthesized in osteoblasts and osteocytes; however, the factors regulating its production are not clear. Patients with CKD have decreased renal acid excretion leading to metabolic acidosis (MET). During MET, acid is buffered by bone with release of mineral calcium (Ca) and phosphate (P). MET increases intracellular Ca signaling and cyclooxygenase 2 (COX2)-induced prostaglandin production in the osteoblast, leading to decreased bone formation and increased bone resorption. We found that MET directly stimulates FGF23 in mouse bone organ cultures and primary osteoblasts. We hypothesized that MET increases FGF23 through similar pathways that lead to bone resorption. Neonatal mouse calvariae were incubated in neutral (NTL, pH = 7.44, Pco 2 = 38 mmHg, [HCO 3 - ] = 27 mM) or acid (MET, pH = 7.18, Pco 2 = 37 mmHg, [HCO 3 - ] = 13 mM) medium without or with 2-APB (50 μM), an inhibitor of intracellular Ca signaling or NS-398 (1 μM), an inhibitor of COX2. Each agent significantly inhibited MET stimulation of medium FGF23 protein and calvarial FGF23 RNA as well as bone resorption at 48 h. To exclude the potential contribution of MET-induced bone P release, we utilized primary calvarial osteoblasts. In these cells each agent inhibited MET stimulation of FGF23 RNA expression at 6 h. Thus stimulation of FGF23 by MET in mouse osteoblasts utilizes the same initial signaling pathways as MET-induced bone resorption. Therapeutic interventions directed toward correction of MET, especially in CKD, have the potential to not only prevent bone resorption but also lower FGF23 and perhaps decrease mortality. Copyright © 2017 the American Physiological Society.

A pathway to bone: signaling molecules and transcription factors involved in chondrocyte development and maturation

PubMed Central

Kozhemyakina, Elena; Lassar, Andrew B.; Zelzer, Elazar

2015-01-01

Decades of work have identified the signaling pathways that regulate the differentiation of chondrocytes during bone formation, from their initial induction from mesenchymal progenitor cells to their terminal maturation into hypertrophic chondrocytes. Here, we review how multiple signaling molecules, mechanical signals and morphological cell features are integrated to activate a set of key transcription factors that determine and regulate the genetic program that induces chondrogenesis and chondrocyte differentiation. Moreover, we describe recent findings regarding the roles of several signaling pathways in modulating the proliferation and maturation of chondrocytes in the growth plate, which is the ‘engine’ of bone elongation. PMID:25715393

Effect of insulin-like growth factor-1 (IGF-1) plus alendronate on bone density during puberty in IGF-1-deficient MIDI mice.

PubMed

Stabnov, L; Kasukawa, Y; Guo, R; Amaar, Y; Wergedal, J E; Baylink, D J; Mohan, S

2002-06-01

Insulin-like growth factor-1 (IGF-1) increases both bone formation and bone resorption processes. To test the hypothesis that treatment with an antiresorber along with IGF-1, during the pubertal growth phase, would be more effective than IGF-1 alone to increase peak bone mass, we used an IGF-1 MIDI mouse model, which exhibits a >60% reduction in circulating IGF-1 levels. We first determined an optimal IGF-1 delivery by evaluating IGF-1 administration (2 mg/kg body weight/day) by either a single daily injection, three daily injections, or by continuous delivery via a minipump during puberty. Of the three regimens, the three daily IGF-1 injections and IGF-1 through a minipump produced a significant increase in total body bone mineral density (BMD) (6.0% and 4.4%, respectively) and in femoral BMD (4.3% and 6.2%, respectively) compared with the control group. Single subcutaneous (s.c.) administration did not increase BMD. We chose IGF-1 administration three times daily for testing the combined effects of IGF-1 and alendronate (100 microg/kg per day). The treatment of IGF-1 + alendronate for a period of 2 weeks increased total body BMD at 1 week and 3 weeks after treatment (21.1% and 20.5%, respectively) and femoral BMD by 29% at 3 weeks after treatment. These increases were significantly greater than those produced by IGF-1 alone. IGF-1, but not alendronate, increased bone length. IGF-1 and/or alendronate increased both periosteal and endosteal circumference. Combined treatment caused a greater increase in the total body bone mineral content (BMC) and periosteal circumference compared with individual treatment with IGF-1 or alendronate. Our data demonstrate that: (1) inhibition of bone turnover during puberty increases net bone density; and (2) combined treatment with IGF-1 and alendronate is more effective than IGF-1 or alendronate alone in increasing peak bone mass in an IGF-1-deficient MIDI mouse model.

Preparing the “Soil”: The Premetastatic Niche

PubMed Central

Kaplan, Rosandra N.; Rafii, Shahin; Lyden, David

2010-01-01

Current focus on cancer metastasis has centered on the intrinsic factors regulating the cell autonomous homing of the tumor cells to the metastatic site. Specific up-regulation of fibronectin and clustering of bone marrow–derived cellular infiltrates coexpressing matrix metalloproteinases in distant tissue sites before tumor cell arrival are proving to be indispensable for the initial stages of metastasis. These bone marrow–derived hematopoietic progenitors that express vascular endothelial growth factor receptor 1 mobilize in response to the unique array of growth factors produced by the primary tumor. Their arrival in distant sites represents early changes in the local microenvironment, termed the “premetastatic niche,” which dictate the pattern of metastatic spread. Focus on the early cellular and molecular events in cancer dissemination and selectivity will likely lead to new approaches to detect and prevent metastasis at its earliest inception. PMID:17145848

Socket preservation using freeze-dried bone allograft with and without plasma rich in growth factors in dogs

PubMed Central

Samandari, Mohammad Hasan; Haghighat, Abbas; Torabinia, Nakisa; Taghian, Mehdi; Sadri, Leyli; Naemy, Vahid

2016-01-01

Background: Plasma rich in growth factors (PRGF) and freeze-dried bone allograft (FDBA) are shown to promote bone healing. This study was aimed to histologically and histomorphometrically investigate the effect of combined use of PRGF and FDBA on bone formation, and compare it to FDBA alone and control group. Materials and Methods: The distal roots of the lower premolars were extracted bilaterally in four female dogs. Sockets were randomly divided into FDBA + PRGF, FDBA, and control groups. Two dogs were sacrificed after 2 weeks and two dogs were sacrificed after 4 weeks. Sockets were assessed histologically and histomorphometrically. Data were analyzed by Kruskal–Wallis test followed by Mann–Whitney U-tests utilizing the SPSS software version 20. P < 0.05 was considered statistically significant. Results: While the difference in density of fibrous tissue in three groups was not statistically significant (P = 0.343), the bone density in grafted groups was significantly higher than the control group (P = 0.021). The least decrease in all socket dimensions was observed in the FDBA group. However, these differences were only significant in coronal portion at week 4. Regarding socket dimensions and bone density, the difference between FDBA and FDBA+PRGF groups was not significant in middle and apical portions. Conclusion: The superiority of PRGF+FDBA overFDBA in socket preservation cannot be concluded from this experiment. PMID:27857769

Evaluation of the Effect of Plasma Rich in Growth Factors (PRGF) on Bone Regeneration.

PubMed

Paknejad, M; Shayesteh, Y Soleymani; Yaghobee, S; Shariat, S; Dehghan, M; Motahari, P

2012-01-01

Reconstruction methods are an essential prerequisite for functional rehabilitation of the stomatognathic system. Plasma rich in growth factors (PRGF) offers a new and potentially useful adjunct to bone substitute materials in bone reconstructive surgery. This study was carried out to investigate the influence of PRGF and fibrin membrane on regeneration of bony defects with and without deproteinized bovine bone mineral (DBBM) on rabbit calvaria. Twelve New Zealand white rabbits were included in this randomized, blinded, prospective study. Four equal 3.3×6.6 mm cranial bone defects were created and immediately grafted with DBBM, PRGF+DBBM, PRGF+fibrin membrane and no treatment as control. The defects were evaluated with histologic and histomorphometric analysis performed 4 and 8 weeks later. Adding PRGF to DBBM led to increased bone formation as compared with the control group in 4- and 8-week intervals. In DBBM and PRGF+fibrin membrane samples, no significant increase was seen compared to the control group. There was also a significant increase in the rate of biodegradation of DBBM particles with the addition of PRGF in the 8-week interval. Neither noticeable foreign body reaction nor any severe inflammation was seen in each of the specimens evaluated. Under the limitation of this study, adding PRGF to DBBM enhanced osteogenesis in rabbit calvarias. Applying autologous fibrin membrane in the defects was not helpful.

Evaluation of the Effect of Plasma Rich in Growth Factors (PRGF) on Bone Regeneration

PubMed Central

Paknejad, M.; Shayesteh, Y. Soleymani; Yaghobee, S.; Shariat, S.; Dehghan, M.; Motahari, P.

2012-01-01

Objective: Reconstruction methods are an essential prerequisite for functional rehabilitation of the stomatognathic system. Plasma rich in growth factors (PRGF) offers a new and potentially useful adjunct to bone substitute materials in bone reconstructive surgery. This study was carried out to investigate the influence of PRGF and fibrin membrane on regeneration of bony defects with and without deproteinized bovine bone mineral (DBBM) on rabbit calvaria. Materials and Methods: Twelve New Zealand white rabbits were included in this randomized, blinded, prospective study. Four equal 3.3×6.6 mm cranial bone defects were created and immediately grafted with DBBM, PRGF+DBBM, PRGF+fibrin membrane and no treatment as control. The defects were evaluated with histologic and histomorphometric analysis performed 4 and 8 weeks later. Results: Adding PRGF to DBBM led to increased bone formation as compared with the control group in 4- and 8-week intervals. In DBBM and PRGF+fibrin membrane samples, no significant increase was seen compared to the control group. There was also a significant increase in the rate of biodegradation of DBBM particles with the addition of PRGF in the 8-week interval. Neither noticeable foreign body reaction nor any severe inflammation was seen in each of the specimens evaluated. Conclusion: Under the limitation of this study, adding PRGF to DBBM enhanced osteogenesis in rabbit calvarias. Applying autologous fibrin membrane in the defects was not helpful. PMID:22924103

Elastin-like-polypeptide based fusion proteins for osteogenic factor delivery in bone healing.

PubMed

McCarthy, Bryce; Yuan, Yuan; Koria, Piyush

2016-07-08

Modern treatments of bone injuries and diseases are becoming increasingly dependent on the usage of growth factors to stimulate bone growth. Bone morphogenetic protein-2 (BMP-2), a potent osteogenic inductive protein, exhibits promising results in treatment models, but recently has had its practical efficacy questioned due to the lack of local retention, ectopic bone formation, and potentially lethal inflammation. Where a new delivery technique of the BMP-2 is necessary, here we demonstrate the viability of an elastin-like peptide (ELP) fusion protein containing BMP-2 for delivery of the BMP-2. This fusion protein retains the performance characteristics of both the BMP-2 and ELP. The fusion protein was found to induce osteogenic differentiation of mesenchymal stem cells as evidenced by the production of alkaline phosphatase and extracellular calcium deposits in response to treatment by the fusion protein. Retention of the ELPs inverse phase transition property has allowed for expression of the fusion protein within a bacterial host (such as Escherichia coli) and easy and rapid purification using inverse transition cycling. The fusion protein formed self-aggregating nanoparticles at human-body temperature. The data collected suggests the viability of these fusion protein nanoparticles as a dosage-efficient and location-precise noncytotoxic delivery vehicle for BMP-2 in bone treatment. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1029-1037, 2016. © 2016 American Institute of Chemical Engineers.

Expression of the growth factor pleiotrophin and its receptor protein tyrosine phosphatase beta/zeta in the serum, cartilage and subchondral bone of patients with osteoarthritis.

PubMed

Kaspiris, Angelos; Mikelis, Constantinos; Heroult, Melanie; Khaldi, Lubna; Grivas, Theodoros B; Kouvaras, Ioannis; Dangas, Spyridon; Vasiliadis, Elias; Lioté, Frédéric; Courty, José; Papadimitriou, Evangelia

2013-07-01

Pleiotrophin is a heparin-binding growth factor expressed in embryonic but not mature cartilage, suggesting a role in cartilage development. Elucidation of the molecular changes observed during the remodelling process in osteoarthritis is of paramount importance. This study aimed to investigate serum pleiotrophin levels and expression of pleiotrophin and its receptor protein tyrosine phosphatase beta/zeta in the cartilage and subchondral bone of osteoarthritis patients. Serum samples derived from 16 osteoarthritis patients and 18 healthy donors. Pleiotrophin and receptor protein tyrosine phosphatase beta/zeta in the cartilage and subchondral bone were studied in 29 patients who had undergone total knee or hip replacement for primary osteoarthritis and in 10 control patients without macroscopic osteoarthritis changes. Serum pleiotrophin levels and expression of pleiotrophin in chondrocytes and subchondral bone osteocytes significantly increased in osteoarthritis patients graded Ahlback II to III. Receptor protein tyrosine phosphatase beta/zeta was mainly detected in the subchondral bone osteocytes of patients with moderate osteoarthritis and as disease severity increased, in the osteocytes and bone lining cells of the distant trabeculae. These data render pleiotrophin and receptor protein tyrosine phosphatase beta/zeta promising candidates for further studies towards developing targeted therapeutic schemes for osteoarthritis. Copyright © 2012 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.

Bone, body weight, and weight reduction: what are the concerns?

PubMed

Shapses, Sue A; Riedt, Claudia S

2006-06-01

Of the U.S. population, 65% is either overweight or obese, and weight loss is recommended to reduce co-morbid conditions. However, bone mobilization and loss may also occur with weight loss. The risk for bone loss depends on initial body weight, age, gender, physical activity, and conditions of dieting such as the extent of energy restriction and specific levels of nutrient intake. Older populations are more prone to bone loss with weight loss; in women, this is due at least in part to a reduced dietary Ca intake and/or efficiency of absorption. Potential hormonal mechanisms regulating bone loss during weight loss are discussed, including decreases in estrogen, leptin, glucagon-like peptide-2, growth hormone, and insulin-like growth factor-1, or an increase in cortisol. In contrast, the rise in adiponectin and ghrelin with weight reduction should not be detrimental to bone. Combining energy restriction with exercise does not necessarily prevent bone loss, but may attenuate loss as was shown with additional Ca intake or osteoporosis medications. Future controlled weight loss trials should be designed to further address mechanisms influencing the density and quality of bone sites vulnerable to fracture, in the prevention of osteoporosis.

Clonidine reduces norepinephrine and improves bone marrow function in a rodent model of lung contusion, hemorrhagic shock, and chronic stress.

PubMed

Alamo, Ines G; Kannan, Kolenkode B; Ramos, Harry; Loftus, Tyler J; Efron, Philip A; Mohr, Alicia M

2017-03-01

Propranolol has been shown previously to restore bone marrow function and improve anemia after lung contusion/hemorrhagic shock. We hypothesized that daily clonidine administration would inhibit central sympathetic outflow and restore bone marrow function in our rodent model of lung contusion/hemorrhagic shock with chronic stress. Male Sprague-Dawley rats underwent 6 days of restraint stress after lung contusion/hemorrhagic shock during which the animals received clonidine (75 μg/kg) after the restraint stress. On postinjury day 7, we assessed urine norepinephrine, blood hemoglobin, plasma granulocyte colony stimulating factor, and peripheral blood mobilization of hematopoietic progenitor cells, as well as bone marrow cellularity and erythroid progenitor cell growth. The addition of clonidine to lung contusion/hemorrhagic shock with chronic restraint stress significantly decreased urine norepinephrine levels, improved bone marrow cellularity, restored erythroid progenitor colony growth, and improved hemoglobin (14.1 ± 0.6 vs 10.8 ± 0.6 g/dL). The addition of clonidine to lung contusion/hemorrhagic shock with chronic restraint stress significantly decreased hematopoietic progenitor cells mobilization and restored granulocyte colony stimulating factor levels. After lung contusion/hemorrhagic shock with chronic restraint stress, daily administration of clonidine restored bone marrow function and improved anemia. Alleviating chronic stress and decreasing norepinephrine is a key therapeutic target to improve bone marrow function after severe injury. Copyright © 2016 Elsevier Inc. All rights reserved.

Relationship between plasma fibroblast growth factor-23 concentration and bone mineralization in children with renal failure on peritoneal dialysis.

PubMed

Wesseling-Perry, Katherine; Pereira, Renata C; Wang, Hejing; Elashoff, Robert M; Sahney, Shobha; Gales, Barbara; Jüppner, Harald; Salusky, Isidro B

2009-02-01

Fibroblast growth factor (FGF)-23 is produced in bone, and circulating levels are markedly elevated in patients with end-stage kidney disease, but the relationship between plasma levels of FGF-23 and bone histology in dialysis patients with secondary hyperparathyroidism is unknown. The aim of the study was to evaluate the correlation between plasma levels of FGF-23 and bone histology in pediatric patients with end-stage kidney disease who display biochemical evidence of secondary hyperparathyroidism. We performed a cross-sectional analysis of the relationship between plasma FGF-23 levels and bone histomorphometry. The study was conducted in a referral center. Participants consisted of forty-nine pediatric patients who were treated with maintenance peritoneal dialysis and who had serum PTH levels (1st generation Nichols assay) greater than 400 pg/ml. There were no interventions. Plasma FGF-23 levels and bone histomorphometry were measured. No correlation existed between values of PTH and FGF-23. Bone formation rates correlated with PTH (r = 0.44; P < 0.01), but not with FGF-23. Higher FGF-23 concentrations were associated with decreased osteoid thickness (r = -0.49; P < 0.01) and shorter osteoid maturation time (r = -0.48; P < 0.01). High levels of FGF-23 are associated with improved indices of skeletal mineralization in dialyzed pediatric patients with high turnover renal osteodystrophy. Together with other biomarkers, FGF-23 measurements may indicate skeletal mineralization status in this patient population.

Long-term in vitro correction of alpha-L-iduronidase deficiency (Hurler syndrome) in human bone marrow.

PubMed Central

Fairbairn, L J; Lashford, L S; Spooncer, E; McDermott, R H; Lebens, G; Arrand, J E; Arrand, J R; Bellantuono, I; Holt, R; Hatton, C E; Cooper, A; Besley, G T; Wraith, J E; Anson, D S; Hopwood, J J; Dexter, T M

1996-01-01

Allogeneic bone marrow transplantation is the most effective treatment for Hurler syndrome but, since this therapy is not available to all patients, we have considered an alternative approach based on transfer and expression of the normal gene in autologous bone marrow. A retroviral vector carrying the full-length cDNA for alpha-L-iduronidase has been constructed and used to transduce bone marrow from patients with this disorder. Various gene-transfer protocols have been assessed including the effect of intensive schedules of exposure of bone marrow to viral supernatant and the influence of growth factors. With these protocols, we have demonstrated successful gene transfer into primitive CD34+ cells and subsequent enzyme expression in their maturing progeny. Also, by using long-term bone marrow cultures, we have demonstrated high levels of enzyme expression sustained for several months. The efficiency of gene transfer has been assessed by PCR analysis of hemopoietic colonies as 25-56%. No advantage has been demonstrated for the addition of growth factors or intensive viral exposure schedules. The enzyme is secreted into the medium and functional localization has been demonstrated by reversal of the phenotypic effects of lysosomal storage in macrophages. This work suggests that retroviral gene transfer into human bone marrow may offer the prospect for gene therapy of Hurler syndrome in young patients without a matched sibling donor. Images Fig. 2 Fig. 4 Fig. 7 Fig. 8 PMID:8700879

Effects of spaceflight and Insulin-like Growth Factor-1 on rat bone properties

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bateman, T.A.; Ayers, R.A.; Spetzler, M.L.

Spaceflight induces bone degradation which is analogous to an accelerated onset of osteoporosis in humans (Tilton {ital et al.}, 1980). In rats, decreased bone formation is indicative of reduced osteoblast activity (Morey and Baylink, 1978). Chiron Corporation (Emeryville, CA) is interested in using the microgravity environment of low-Earth-orbit to test its therapeutic drug, Insulin-like Growth Factor-1 (IGF-1). This pharmaceutic is known to promote osteoblast activity (Schmid {ital et al.}, 1984) and therefore may encourage bone growth in rats. Chiron sponsored the Immune.3 payload on STS-73 (May 19{endash}29, 1996) through its Center for Space Commercialization (CSC) partner BioServe Space Technologies (Universitymore » of Colorado and Kansas State University) to investigate the effects of IGF-1 on mitigating the skeletal degradation that affects rats and humans during spaceflight. Twelve rats were flown for 10 days using two Animal Enclosure Modules (AEMs) provided by NASA Ames Research Center. Of the twelve, six received 1.4 mg/day of IGF-1; the other six saline. Sixteen vivarium ground controls received the same treatment on a one day delay. Rat femora and tibiae were examined for bone mineral density via DXA scan. Femora and humeri were measured for physical and compositional properties, as well as mechanically tested in three point flexure. Quantitative histomorphometric examination of tibiae, humeri, fibulae, ribs and cranial bone; and microhardness testing on tibiae and humeri are currently in progress. Flight humeri and vivarium femora were significantly larger than their counterparts; however, significant differences in mechanical properties and mineral density were not concurrent to these mass changes. {copyright} {ital 1997 American Institute of Physics.}« less

Chemical modification of extracellular matrix by cold atmospheric plasma-generated reactive species affects chondrogenesis and bone formation

PubMed Central

Eisenhauer, Peter; Chernets, Natalie; Song, You; Dobrynin, Danil; Pleshko, Nancy; Steinbeck, Marla J.; Freeman, Theresa A.

2017-01-01

The goal of this study was to investigate whether cold plasma generated by dielectric barrier discharge (DBD) modifies extracellular matrices (ECM) to influence chondrogenesis and endochondral ossification. Replacement of cartilage by bone during endochondral ossification is essential in fetal skeletal development, bone growth and fracture healing. Regulation of this process by the ECM occurs through matrix remodelling, involving a variety of cell attachment molecules and growth factors, which influence cell morphology and protein expression. The commercially available ECM, Matrigel, was treated with microsecond or nanosecond pulsed (µsp or nsp, respectively) DBD frequencies conditions at the equivalent frequencies (1 kHz) or power (~1 W). Recombinant human bone morphogenetic protein-2 was added and the mixture subcutaneously injected into mice to simulate ectopic endochondral ossification. Two weeks later, the masses were extracted and analysed by microcomputed tomography. A significant increase in bone formation was observed in Matrigel treated with µsp DBD compared with control, while a significant decrease in bone formation was observed for both nsp treatments. Histological and immunohistochemical analysis showed Matrigel treated with µsp plasma increased the number of invading cells, the amount of vascular endothelial growth factor and chondrogenesis while the opposite was true for Matrigel treated with nsp plasma. In support of the in vivo Matrigel study, 10 T1/2 cells cultured in vitro on µsp DBD-treated type I collagen showed increased expression of adhesion proteins and activation of survival pathways, which decreased with nsp plasma treatments. These results indicate DBD modification of ECM can influence cellular behaviours to accelerate or inhibit chondrogenesis and endochondral ossification. PMID:27510797

Effect of Daily Exposure to an Isolated Soy Protein Supplement on Body Composition, Energy and Macronutrient Intake, Bone Formation Markers, and Lipid Profile in Children in Colombia.

PubMed

Mejía, Wilson; Córdoba, Diana; Durán, Paola; Chacón, Yersson; Rosselli, Diego

2018-01-16

A soy protein-based supplement may optimize bone health, support physical growth, and stimulate bone formation. This study aimed to assess the effect of a daily soy protein supplement (SPS) on nutritional status, bone formation markers, lipid profile, and daily energy and macronutrient intake in children. One hundred seven participants (62 girls), ages 2 to 9, started the study and were randomly assigned to lunch fruit juice with (n = 57, intervention group) or without (n = 50, control group) addition of 45 g (230 Kcal) of a commercial SPS during 12 months; 84 children (51 girls, 33 boys) completed the study (45 and 39 intervention and control, respectively). Nutritional assessment included anthropometry and nutrient intakes; initial and final blood samples were taken; insulin-like growth factor-I (IGF-I), osteocalcin, bone specific alkaline phosphatase (BAP), insulin-like growth factor binding protein-3 (IGFBP-3), cholesterol, triglycerides, low-density lipoprotein (LDL), and high-density lipoprotein (HDL) were analyzed. Statistically significant changes (p < .05) in body mass index and weight for age Z scores were observed between groups while changes in body composition were not. Changes in energy, total protein, and carbohydrate intakes were significantly higher in the intervention group (p < .01). Calorie intake changes were statistically significant between groups (p < .001), and BAP decreased in both groups, with values within normal ranges. Osteocalcin, IGFBP-3, and lipid profile were not different between groups. IGF-I levels and IGF/IGFBP-3 ratio increased significantly in both groups. In conclusion, changes in macronutrient and energy intake and nutritional status in the intervention group compared to control group may ensure harmonious and adequate bone health and development.

Platelet-rich plasma for bone healing and regeneration.

PubMed

Oryan, Ahmad; Alidadi, Soodeh; Moshiri, Ali

2016-01-01

Successful healing of large bone defects (LBDs) is a complicated phenomenon because the body's natural ability often fails to effectively repair the LBDs. New modalities should be utilized to increase the quality and accelerate bone healing. Platelet concentrates in different forms can be considered an attractive option for such purpose. Platelets as a natural source of growth factors, cytokines, and other micro and macromolecules are hypothesized to improve bone healing. This review has covered important concepts regarding platelet-rich plasma (PRP) including mechanisms of action, preparation protocols and their differences, and factors affecting the PRP efficacy during bone healing. In addition, the most recent studies in different levels which evaluated the role of PRP on bone repair has been reviewed and discussed to clarify the controversies and conflicts, and to illustrate a future prospective and directions for orthopedic surgeons to overcome current limitations and difficulties. As the efficacy of PRP is dependent on various factors, the outcome of PRP therapy is variable and unpredictable in orthopedic patients. Therefore, it is still too soon to suggest PRP as the first line treatment option in complicated bone injuries such as LBDs and nonunions. However, combination of PRP with natural and synthetic biomaterials can enhance the effectiveness of PRP.

A histological and micro-CT investigation in to the effect of NGF and EGF on the periodontal, alveolar bone, root and pulpal healing of replanted molars in a rat model - a pilot study

PubMed Central

2014-01-01

Background This study aims to investigate, utilising micro-computed tomography (micro-CT) and histology, whether the topical application of nerve growth factor (NGF) and/or epidermal growth factor (EGF) can enhance periodontal, alveolar bone, root and pulpal tissue regeneration while minimising the risk of pulpal necrosis, root resorption and ankylosis of replanted molars in a rat model. Methods Twelve four-week-old male Sprague-Dawley rats were divided into four groups: sham, collagen, EGF and NGF. The maxillary right first molar was elevated and replanted with or without a collagen membrane impregnated with either the growth factors EGF or NGF, or a saline solution. Four weeks after replantation, the animals were sacrificed and the posterior maxilla was assessed using histological and micro-CT analysis. The maxillary left first molar served as the control for the corresponding right first molar. Results Micro-CT analysis revealed a tendency for all replanted molars to have reduced root length, root volume, alveolar bone height and inter-radicular alveolar bone volume. It appears that the use of the collagen membrane had a negative effect while no positive effect was noted with the incorporation of EGF or NGF. Histologically, the incorporation of the collagen membrane was found to negatively affect pulpal, root, periodontal and alveolar bone healing with pulpal inflammation and hard tissue formation, extensive root resorption and alveolar bone fragmentation. The incorporation of EGF and NGF did not improve root, periodontal or alveolar bone healing. However, EGF was found to improve pulp vascularisation while NGF-improved pulpal architecture and cell organisation, although not to the level of the control group. Conclusions Results indicate a possible benefit on pulpal vascularisation and pulpal cell organisation following the incorporation of EGF and NGF, respectively, into the alveolar socket of replanted molars in the rat model. No potential benefit of EGF and NGF was detected in periodontal or root healing, while the use of a collagen membrane carrier was found to have a negative effect on the healing response. PMID:24393534

Fibroblast growth factor signaling in skeletal development and disease

PubMed Central

Ornitz, David M.; Marie, Pierre J.

2015-01-01

Fibroblast growth factor (FGF) signaling pathways are essential regulators of vertebrate skeletal development. FGF signaling regulates development of the limb bud and formation of the mesenchymal condensation and has key roles in regulating chondrogenesis, osteogenesis, and bone and mineral homeostasis. This review updates our review on FGFs in skeletal development published in Genes & Development in 2002, examines progress made on understanding the functions of the FGF signaling pathway during critical stages of skeletogenesis, and explores the mechanisms by which mutations in FGF signaling molecules cause skeletal malformations in humans. Links between FGF signaling pathways and other interacting pathways that are critical for skeletal development and could be exploited to treat genetic diseases and repair bone are also explored. PMID:26220993

Orexin Plays a Role in Growth Impediment Induced by Obstructive Sleep Breathing in Rats

PubMed Central

Tarasiuk, Ariel; Levi, Avishag; Assadi, Mohammad H.; Troib, Ariel; Segev, Yael

2016-01-01

Study Objectives: The mechanisms linking sleep disordered breathing with impairment of sleep and bone metabolism/architecture are poorly understood. Here, we explored the role of the neuropeptide orexin, a respiratory homeostasis modulator, in growth retardation induced in an upper airway obstructed (AO) rat model. Methods: The tracheae of 22-day-old rats were narrowed; AO and sham-control animals were monitored for 5 to 7 w. Growth parameters, food intake, sleep/wake activity, and serum hormones were measured. After euthanasia, growth plate (GP) histology, morphometry, orexin receptors (OXR), and related mediators were analyzed. The effect of dual orexin receptor antagonist (almorexant 300 mg/kg) on sleep and GP histology were also investigated. Results: The AO group slept 32% less; the time spent in slow wave and paradoxical sleep during light period and slow wave activity was reduced. The AO group gained 46% less body weight compared to the control group, despite elevated food intake; plasma ghrelin increased by 275% and leptin level decreased by 44%. The impediment of bone elongation and bone mass was followed by a 200% increase in OX1R and 38% reduction of local GP ghrelin proteins and growth hormone secretagogue receptor 1a. Sry-related transcription factor nine (Sox9), a molecule mediating cartilage ossification, was downregulated and the level of transcription factor peroxisome proliferator-activated receptor gamma was upregulated, explaining the bone architecture abnormalities. Administration of almorexant restored sleep and improved GP width in AO animals. Conclusions: In AO animals, enhanced expression of orexin and OX1R plays a role in respiratory induced sleep and growth abnormalities. Citation: Tarasiuk A, Levi A, Assadi MH, Troib A, Segev Y. Orexin plays a role in growth impediment induced by obstructive sleep breathing in rats. SLEEP 2016;39(4):887–897. PMID:26943473

Holographic nondestructive testing in bone growth disturbance studies

NASA Astrophysics Data System (ADS)

Silvennoinen, Raimo; Nygren, Kaarlo; Mozerov, Mikhail G.

1994-03-01

We used isolated radioulnar bones (fused radial and ulnar bones) of subadult European moose collected in various environmentally polluted areas of Finland. The bones were radiographed and holographic interference pictures, for holographic nondestructive testing (HNDT), were produced by using small caudocranial bending forces. The cortical index values were measured in the diaphyses and samples were taken for mineral studies from the mandibles of the same animals. Results indicated that the bones obtained from the heavily polluted area showed biomechanical response comparable to the bones developed partially without mothers milk. Differences were also seen in morphometrical and radiological studies. The mineral contents studied did not differ significantly from randomly collected samples of the same age category. We therefore conclude that environmental factors may influence the bone matrix development.

Erythropoietin induces bone marrow and plasma fibroblast growth factor 23 during acute kidney injury.

PubMed

Toro, Luis; Barrientos, Víctor; León, Pablo; Rojas, Macarena; Gonzalez, Magdalena; González-Ibáñez, Alvaro; Illanes, Sebastián; Sugikawa, Keigo; Abarzúa, Néstor; Bascuñán, César; Arcos, Katherine; Fuentealba, Carlos; Tong, Ana María; Elorza, Alvaro A; Pinto, María Eugenia; Alzamora, Rodrigo; Romero, Carlos; Michea, Luis

2018-05-01

It is accepted that osteoblasts/osteocytes are the major source for circulating fibroblast growth factor 23 (FGF23). However, erythropoietic cells of bone marrow also express FGF23. The modulation of FGF23 expression in bone marrow and potential contribution to circulating FGF23 has not been well studied. Moreover, recent studies show that plasma FGF23 may increase early during acute kidney injury (AKI). Erythropoietin, a kidney-derived hormone that targets erythropoietic cells, increases in AKI. Here we tested whether an acute increase of plasma erythropoietin induces FGF23 expression in erythropoietic cells of bone marrow thereby contributing to the increase of circulating FGF23 in AKI. We found that erythroid progenitor cells of bone marrow express FGF23. Erythropoietin increased FGF23 expression in vivo and in bone marrow cell cultures via the homodimeric erythropoietin receptor. In experimental AKI secondary to hemorrhagic shock or sepsis in rodents, there was a rapid increase of plasma erythropoietin, and an induction of bone marrow FGF23 expression together with a rapid increase of circulating FGF23. Blockade of the erythropoietin receptor fully prevented the induction of bone marrow FGF23 and partially suppressed the increase of circulating FGF23. Finally, there was an early increase of both circulating FGF23 and erythropoietin in a cohort of patients with severe sepsis who developed AKI within 48 hours of admission. Thus, increases in plasma erythropoietin and erythropoietin receptor activation are mechanisms implicated in the increase of plasma FGF23 in AKI. Copyright © 2017 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

Effects of epidermal growth factor on bone formation and resorption in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marie, P.J.; Hott, M.; Perheentupa, J.

1990-02-01

The effects of mouse epidermal growth factor (EGF) on bone formation and resorption were examined in male mice. EGF administration (2-200 ng.g-1.day-1 ip for 7 days) induced a dose-dependent rise in plasma EGF levels that remained within physiological range. Histomorphometric analysis of caudal vertebrae showed that EGF (20 and 200 ng.g-1.day-1) reduced the endosteal matrix and mineral appositional rates after 5 days of treatment as measured by double (3H)proline labeling and double tetracycline labeling, respectively. This effect was transitory and was not observed after 7 days of EGF administration. EGF administered for 7 days induced a dose-dependent increase in themore » periosteal osteoblastic and tetracycline double-labeled surfaces. At high dosage (200 ng.g-1.day-1) EGF administration increased the osteoclastic surface and the number of acid phosphatase-stained osteoclasts, although plasma calcium remained normal. The results show that EGF administration at physiological doses induces distinct effects on endosteal and periosteal bone formation and that the effects are dependent on EGF dosage and duration of treatment. This study indicates that EGF at physiological dosage stimulates periosteal bone formation and increases endosteal bone resorption in the growing mouse.« less

Multiple faces of fibroblast growth factor-23.

PubMed

Han, Xiaobin; Quarles, L Darryl

2016-07-01

This review examines the role of fibroblast growth factor-23 (FGF-23) in mineral metabolism, innate immunity and adverse cardiovascular outcomes. FGF-23, produced by osteocytes in bone, activates FGFR/α-Klotho (α-Kl) complexes in the kidney. The resulting bone-kidney axis coordinates renal phosphate reabsorption with bone mineralization, and creates a counter-regulatory feedback loop to prevent vitamin D toxicity. FGF-23 acts to counter-regulate the effects of vitamin D on innate immunity and cardiovascular responses. FGF-23 is ectopically expressed along with α-Kl in activated macrophages, creating a proinflammatory paracrine signaling pathway that counters the antiinflammatory actions of vitamin D. FGF-23 also inhibits angiotensin-converting enzyme 2 expression and increases sodium reabsorption in the kidney, leading to hypertension and left ventricular hypertrophy. Finally, FGF-23 is purported to cause adverse cardiac and impair neutrophil responses through activation of FGFRs in the absence of α-Kl. Although secreted forms of α-Kl have FGF-23 independent effects, the possibility of α-Kl independent effects of FGF-23 is controversial and requires additional experimental validation. FGF-23 participates in a bone-kidney axis regulating mineral homeostasis, proinflammatory paracrine macrophage signaling pathways, and in a bone-cardio-renal axis regulating hemodynamics that counteract the effects of vitamin D.

3D-printed porous titanium changed femoral head repair growth patterns: osteogenesis and vascularisation in porous titanium.

PubMed

Zhu, Wei; Zhao, Yan; Ma, Qi; Wang, Yingjie; Wu, Zhihong; Weng, Xisheng

2017-04-01

Osteonecrosis of the femoral head (ONFH) is a major cause of morbidity, and total hip arthroplasty is both traumatic and expensive. Here, we created a gelatine scaffold embedded in uniquely shaped, 3D-printed porous titanium parts, which could attract and promote the proliferation of osteoblasts as well as bone regeneration, as the extracellular matrix (ECM) does in vivo. Interestingly, after hybridisation with platelets, the scaffold exhibited a low yet considerable rate of stable, safe and long-term growth factor release. Additionally, a novel ONFH model was constructed and verified. Scaffolds implanted in this model were found to accelerate bone repair. In conclusion, our scaffold successfully simulates the ECM and considerably accelerates bone regeneration, in which platelets play an indispensable role. We believe that platelets should be emphasised as carriers that may be employed to transport drugs, cytokines and other small molecules to target locations in vivo. In addition, this novel scaffold is a useful material for treating ONFH. An overview of the novel scaffold mimicking the extracellular environment in bone repair. a and b: A gelatine scaffold was cross-linked and freeze-dried within 3D-printed porous titanium. c: Platelets were coated onto the gelatine microscaffold after freeze-drying platelet-rich plasma. d: The microscaffold supported the migration of cells into the titanium pores and their subsequent growth, while the platelets slowly released cell factors, exerting bioactivity.

Orthobiologics in Pediatric Sports Medicine.

PubMed

Bray, Christopher C; Walker, Clark M; Spence, David D

2017-07-01

Orthobiologics are biological substances that allow injured muscles, tendons, ligaments, and bone to heal more quickly. They are found naturally in the body; at higher concentrations they can aid in the healing process. These substances include autograft bone, allograft bone, demineralized bone matrix, bone morphogenic proteins, growth factors, stem cells, plasma-rich protein, and ceramic grafts. Their use in sports medicine has exploded in efforts to increase graft incorporation, stimulate healing, and get athletes back to sport with problems including anterior cruciate ligament ruptures, tendon ruptures, cartilage injuries, and fractures. This article reviews orthobiologics and their applications in pediatric sports medicine. Copyright © 2017 Elsevier Inc. All rights reserved.

The consequences of pediatric renal transplantation on bone metabolism and growth.

PubMed

Bacchetta, Justine; Ranchin, Bruno; Demède, Delphine; Allard, Lise

2013-10-01

During childhood, growth retardation, decreased final height and renal osteodystrophy are common complications of chronic kidney disease (CKD). These problems remain present in patients undergoing renal transplantation, even though steroid-sparing strategies are more widely used. In this context, achieving normal height and growth in children after transplantation is a crucial issue for both quality of life and self-esteem. The aim of this review is to provide an overview of pathophysiology of CKD-mineral bone disorder (MBD) in children undergoing renal transplantation and to propose keypoints for its daily management. In adults, calcimimetics are effective for posttransplant hyperparathyroidism, but data are missing in the pediatric population. Fibroblast growth factor 23 levels are associated with increased risk of rejection, but the underlying mechanisms remain unclear. A recent meta-analysis also demonstrated the effectiveness of rhGH therapy in short transplanted children. In 2013, the daily clinical management of CKD-MBD in transplanted children should still focus on simple objectives: to optimize renal function, to develop and promote steroid-sparing strategies, to provide optimal nutritional support to maximize final height and avoid bone deformations, to equilibrate calcium/phosphate metabolism so as to provide acceptable bone quality and cardiovascular status, to correct all metabolic and clinical abnormalities that can worsen both bone and growth (mainly metabolic acidosis, anemia and malnutrition), promote good lifestyle habits (adequate calcium intake, regular physical activity, no sodas consumption, no tobacco exposure) and eventually to correct native vitamin D deficiency (target of 25-vitamin D >75 nmol/l).

Epigenetic regulation of fetal bone development and placental transfer of nutrients: progress for osteoporosis.

PubMed

Bocheva, Georgeta; Boyadjieva, Nadka

2011-12-01

Osteoporosis is a common age-related disorder and causes acute and long-term disability and economic cost. Many factors influence the accumulation of bone minerals, including heredity, diet, physical activity, gender, endocrine functions, and risk factors such as alcohol, drug abuse, some pharmacological drugs or cigarette smoking. The pathology of bone development during intrauterine life is a factor for osteoporosis. Moreover, the placental transfer of nutrients plays an important role in the building of bones of fetuses. The importance of maternal calcium intake and vitamin D status are highlighted in this review. Various environmental factors including nutrition state or maternal stress may affect the epigenetic state of a number of genes during fetal development of bones. Histone modifications as histone hypomethylation, histone hypermethylation, hypoacetylation, etc. are involved in chromatin remodeling, known to contribute to the epigenetic landscape of chromosomes, and play roles in both fetal bone development and osteoporosis. This review will give an overview of epigenetic modulation of bone development and placental transfer of nutrients. In addition, the data from animal and human studies support the role of epigenetic modulation of calcium and vitamin D in the pathogenesis of osteoporosis. We review the evidence suggesting that various genes are involved in regulation of osteoclast formation and differentiation by osteoblasts and stem cells. Epigenetic changes in growth factors as well as cytokines play a rol in fetal bone development. On balance, the data suggest that there is a link between epigenetic changes in placental transfer of nutrients, including calcium and vitamin D, abnormal intrauterine bone development and pathogenesis of osteoporosis.

Regional variations in growth plate chondrocyte deformation as predicted by three-dimensional multi-scale simulations.

PubMed

Gao, Jie; Roan, Esra; Williams, John L

2015-01-01

The physis, or growth plate, is a complex disc-shaped cartilage structure that is responsible for longitudinal bone growth. In this study, a multi-scale computational approach was undertaken to better understand how physiological loads are experienced by chondrocytes embedded inside chondrons when subjected to moderate strain under instantaneous compressive loading of the growth plate. Models of representative samples of compressed bone/growth-plate/bone from a 0.67 mm thick 4-month old bovine proximal tibial physis were subjected to a prescribed displacement equal to 20% of the growth plate thickness. At the macroscale level, the applied compressive deformation resulted in an overall compressive strain across the proliferative-hypertrophic zone of 17%. The microscale model predicted that chondrocytes sustained compressive height strains of 12% and 6% in the proliferative and hypertrophic zones, respectively, in the interior regions of the plate. This pattern was reversed within the outer 300 μm region at the free surface where cells were compressed by 10% in the proliferative and 26% in the hypertrophic zones, in agreement with experimental observations. This work provides a new approach to study growth plate behavior under compression and illustrates the need for combining computational and experimental methods to better understand the chondrocyte mechanics in the growth plate cartilage. While the current model is relevant to fast dynamic events, such as heel strike in walking, we believe this approach provides new insight into the mechanical factors that regulate bone growth at the cell level and provides a basis for developing models to help interpret experimental results at varying time scales.

Regional Variations in Growth Plate Chondrocyte Deformation as Predicted By Three-Dimensional Multi-Scale Simulations

PubMed Central

Gao, Jie; Roan, Esra; Williams, John L.

2015-01-01

The physis, or growth plate, is a complex disc-shaped cartilage structure that is responsible for longitudinal bone growth. In this study, a multi-scale computational approach was undertaken to better understand how physiological loads are experienced by chondrocytes embedded inside chondrons when subjected to moderate strain under instantaneous compressive loading of the growth plate. Models of representative samples of compressed bone/growth-plate/bone from a 0.67 mm thick 4-month old bovine proximal tibial physis were subjected to a prescribed displacement equal to 20% of the growth plate thickness. At the macroscale level, the applied compressive deformation resulted in an overall compressive strain across the proliferative-hypertrophic zone of 17%. The microscale model predicted that chondrocytes sustained compressive height strains of 12% and 6% in the proliferative and hypertrophic zones, respectively, in the interior regions of the plate. This pattern was reversed within the outer 300 μm region at the free surface where cells were compressed by 10% in the proliferative and 26% in the hypertrophic zones, in agreement with experimental observations. This work provides a new approach to study growth plate behavior under compression and illustrates the need for combining computational and experimental methods to better understand the chondrocyte mechanics in the growth plate cartilage. While the current model is relevant to fast dynamic events, such as heel strike in walking, we believe this approach provides new insight into the mechanical factors that regulate bone growth at the cell level and provides a basis for developing models to help interpret experimental results at varying time scales. PMID:25885547

Clec11a/osteolectin is an osteogenic growth factor that promotes the maintenance of the adult skeleton

PubMed Central

Yue, Rui; Shen, Bo; Morrison, Sean J

2016-01-01

Bone marrow stromal cells maintain the adult skeleton by forming osteoblasts throughout life that regenerate bone and repair fractures. We discovered that subsets of these stromal cells, osteoblasts, osteocytes, and hypertrophic chondrocytes secrete a C-type lectin domain protein, Clec11a, which promotes osteogenesis. Clec11a-deficient mice appeared developmentally normal and had normal hematopoiesis but reduced limb and vertebral bone. Clec11a-deficient mice exhibited accelerated bone loss during aging, reduced bone strength, and delayed fracture healing. Bone marrow stromal cells from Clec11a-deficient mice showed impaired osteogenic differentiation, but normal adipogenic and chondrogenic differentiation. Recombinant Clec11a promoted osteogenesis by stromal cells in culture and increased bone mass in osteoporotic mice in vivo. Recombinant human Clec11a promoted osteogenesis by human bone marrow stromal cells in culture and in vivo. Clec11a thus maintains the adult skeleton by promoting the differentiation of mesenchymal progenitors into mature osteoblasts. In light of this, we propose to call this factor Osteolectin. DOI: http://dx.doi.org/10.7554/eLife.18782.001 PMID:27976999

[Recent research advance on bone marrow microenvironment-mediated leukemia drug resistant mechanism].

PubMed

Fu, Bing; Ling, Yan-Juan

2011-06-01

The bone marrow microenvironment consists of bone marrow stromal cells, osteoblasts and osteoclasts which facilities the survival, differentiation and proliferation of hematopoietic cells through secreting soluble factors and extracellular matrix proteins that mediate these functions. This environment not only supports the growth of normal and malignant hematopoietic cells, but also protects them against the damage from chemotherapeutic agents through the secretion of soluble cytokines, cell adhesion, up-regulation of resistant genes and changes of cell cycle. In this review, the research advances on drug-resistance mechanisms mediated by bone marrow microenvironment are summarized briefly, including soluble factors mediating drug resistance, intercellular adhesion inducing drug resistance, up-regulation of some drug resistance genes, regulation in metabolism of leukemic cells, changes in cell cycles of tumor cells and so on.

Platelet-rich plasma therapy - future or trend?

PubMed Central

2012-01-01

Chronic complex musculoskeletal injuries that are slow to heal pose challenges to physicians and researchers alike. Orthobiologics is a relatively newer science that involves application of naturally found materials from biological sources (for example, cell-based therapies), and offers exciting new possibilities to promote and accelerate bone and soft tissue healing. Platelet-rich plasma (PRP) is an orthobiologic that has recently gained popularity as an adjuvant treatment for musculoskeletal injuries. It is a volume of fractionated plasma from the patient's own blood that contains platelet concentrate. The platelets contain alpha granules that are rich in several growth factors, such as platelet-derived growth factor, transforming growth factor-β, insulin-like growth factor, vascular endothelial growth factor and epidermal growth factor, which play key roles in tissue repair mechanisms. PRP has found application in diverse surgical fields to enhance bone and soft-tissue healing by placing supra-physiological concentrations of autologous platelets at the site of tissue damage. The relative ease of preparation, applicability in the clinical setting, favorable safety profile and possible beneficial outcome make PRP a promising therapeutic approach for future regenerative treatments. However, there is a large knowledge gap in our understanding of PRPs mechanism of action, which has raised skepticism regarding its potential efficacy and use. Thus, the aim of this review is to describe the various factors proposed to contribute to the biological activity of PRP, and the published pre-clinical and clinical evidence to support it. Additionally, we describe the current techniques and technology for PRP preparation, and review the present shortcomings of this therapy that will need to be overcome if it is to gain broad acceptance. PMID:22894643

Hepatocyte Growth Factor and Interleukin-6 in Prostate Cancer Bone Metastasis

DTIC Science & Technology

2006-06-01

Wif1 Wnt inhibitory factor 1 ## ## ## ## Cxcl4 Chemokine (C-X-C motif) ligand 4 ## ## ## ## Cxcl12 Chemokine (C-X-C motif) ligand 12...CGGCTGAAGAACAACAACAG GGCGTCTGACTCACACCTCT Clu CAGCTGGCTAACCTCACACA AACAGCTTCACCACCACCTC Cxcl4 AGTCCTGAGCTGCTGCTTCT CCCAGAGGAGATGGTCTTCA Col1A1 GAGAGCATGACCGATGGATT

DYSAPOPTOSIS OF OSTEOBLASTS AND OSTEOCYTES INCREASES CANCELLOUS BONE FORMATION BUT EXAGGERATES BONE POROSITY WITH AGE

PubMed Central

Jilka, Robert L.; O’Brien, Charles A.; Roberson, Paula K.; Bonewald, Lynda F.; Weinstein, Robert S.; Manolagas, Stavros C.

2013-01-01

Skeletal aging is accompanied by decreased cancellous bone mass and increased formation of pores within cortical bone. The latter accounts for a large portion of the increase in non-vertebral fractures after age 65 in humans. We selectively deleted Bak and Bax, two genes essential for apoptosis, in two types of terminally differentiated bone cells: the short-lived osteoblasts that elaborate the bone matrix, and the long-lived osteocytes that are immured within the mineralized matrix and choreograph the regeneration of bone. Attenuation of apoptosis in osteoblasts increased their working lifespan and thereby cancellous bone mass in the femur. In long-lived osteocytes, however, it caused dysfunction with advancing age and greatly magnified intracortical femoral porosity associated with increased production of receptor activator of nuclear factor-κB ligand and vascular endothelial growth factor. Increasing bone mass by artificial prolongation of the inherent lifespan of short-lived osteoblasts, while exaggerating the adverse effects of aging on long-lived osteocytes, highlights the seminal role of cell age in bone homeostasis. In addition, our findings suggest that distress signals produced by old and/or dysfunctional osteocytes are the culprits of the increased intracortical porosity in old age. PMID:23761243

Use of platelet lysate for bone regeneration - are we ready for clinical translation?

PubMed Central

Altaie, Ala; Owston, Heather; Jones, Elena

2016-01-01

Current techniques to improve bone regeneration following trauma or tumour resection involve the use of autograft bone or its substitutes supplemented with osteoinductive growth factors and/or osteogenic cells such as mesenchymal stem cells (MSCs). Although MSCs are most commonly grown in media containing fetal calf serum, human platelet lysate (PL) offers an effective alternative. Bone marrow - derived MSCs grown in PL-containing media display faster proliferation whilst maintaining good osteogenic differentiation capacity. Limited pre-clinical investigations using PL-expanded MSCs seeded onto osteoconductive scaffolds indicate good potential of such constructs to repair bone in vivo. In an alternative approach, nude PL-coated scaffolds without seeded MSCs have been proposed as novel regenerative medicine devices. Even though methods to coat scaffolds with PL vary, in vitro studies suggest that PL allows for MSC adhesion, migration and differentiation inside these scaffolds. Increased new bone formation and vascularisation in comparison to uncoated scaffolds have also been observed in vivo. This review outlines the state-of-the-art research in the field of PL for ex vivo MSC expansion and in vivo bone regeneration. To minimise inconsistency between the studies, further work is required towards standardisation of PL preparation in terms of the starting material, platelet concentration, leukocyte depletion, and the method of platelet lysis. PL quality control procedures and its “potency” assessment are urgently needed, which could include measurements of key growth and attachment factors important for MSC maintenance and differentiation. Furthermore, different PL formulations could be tailor-made for specific bone repair indications. Such measures would undoubtedly speed up clinical translation of PL-based treatments for bone regeneration. PMID:26981170

Use of platelet lysate for bone regeneration - are we ready for clinical translation?

PubMed

Altaie, Ala; Owston, Heather; Jones, Elena

2016-02-26

Current techniques to improve bone regeneration following trauma or tumour resection involve the use of autograft bone or its substitutes supplemented with osteoinductive growth factors and/or osteogenic cells such as mesenchymal stem cells (MSCs). Although MSCs are most commonly grown in media containing fetal calf serum, human platelet lysate (PL) offers an effective alternative. Bone marrow - derived MSCs grown in PL-containing media display faster proliferation whilst maintaining good osteogenic differentiation capacity. Limited pre-clinical investigations using PL-expanded MSCs seeded onto osteoconductive scaffolds indicate good potential of such constructs to repair bone in vivo. In an alternative approach, nude PL-coated scaffolds without seeded MSCs have been proposed as novel regenerative medicine devices. Even though methods to coat scaffolds with PL vary, in vitro studies suggest that PL allows for MSC adhesion, migration and differentiation inside these scaffolds. Increased new bone formation and vascularisation in comparison to uncoated scaffolds have also been observed in vivo. This review outlines the state-of-the-art research in the field of PL for ex vivo MSC expansion and in vivo bone regeneration. To minimise inconsistency between the studies, further work is required towards standardisation of PL preparation in terms of the starting material, platelet concentration, leukocyte depletion, and the method of platelet lysis. PL quality control procedures and its "potency" assessment are urgently needed, which could include measurements of key growth and attachment factors important for MSC maintenance and differentiation. Furthermore, different PL formulations could be tailor-made for specific bone repair indications. Such measures would undoubtedly speed up clinical translation of PL-based treatments for bone regeneration.

Insulin-like growth factor I has independent effects on bone matrix formation and cell replication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hock, J.M.; Centrella, M.; Canalis, E.

1988-01-01

The effects of insulin-like growth factor-I (IGF-I) and insulin on bone matrix synthesis and bone cell replication were studied in cultured 21-day-old fetal rat calvariae. Histomorphometry techniques were developed to measure the incorporation of (2,3-/sup 3/H)proline and (methyl-/sup 3/H)thymidine into bone matrix and bone cell nuclei, respectively, using autoradiographs of sagittal sections of calvariae cultured with IGF-I, insulin, or vehicle for up to 96 h. To confirm an effect on bone formation, IGF-I was also studied for its effects on (/sup 3/H)proline incorporation into collagenase-digestible protein (CDP) and noncollagen protein and on (/sup 3/H)thymidine incorporation into acid-precipitable material (DNA). IGF-Imore » at 10(-9)-10(-7) M significantly increased the rate of bone matrix apposition and CDP after 24 h by 45-50% and increased cell labeling by 8-fold in the osteoprogenitor cell zone, by 4-fold in the osteoblast cell zone, and by 2-fold in the periosteal fibroblast zone. Insulin at 10(-9)-10(-6) M also increased matrix apposition rate and CDP by 40-50%, but increased cell labeling by 2-fold only at a concentration of 10(-7) M or higher and then only in the osteoprogenitor cell zone. When hydroxyurea was added to IGF-I-treated bones, the effects of IGF-I on DNA synthesis were abolished, but the increase in bone matrix apposition induced by IGF-I was only partly diminished. In conclusion, IGF-I stimulates matrix synthesis in calvariae, an effect that is partly, although not completely, dependent on its stimulatory effect on DNA synthesis.« less

Tissue engineering in periodontal tissue.

PubMed

Iwata, Takanori; Yamato, Masayuki; Ishikawa, Isao; Ando, Tomohiro; Okano, Teruo

2014-01-01

Periodontitis, a recognized disease worldwide, is bacterial infection-induced inflammation of the periodontal tissues that results in loss of alveolar bone. Once it occurs, damaged tissue cannot be restored to its original form, even if decontaminating treatments are performed. For more than half a century, studies have been conducted to investigate true periodontal regeneration. Periodontal regeneration is the complete reconstruction of the damaged attachment apparatus, which contains both hard tissue (alveolar bone and cementum) and soft tissue (periodontal ligament). Several treatments, including bone grafts, guided tissue regeneration with physical barriers for epithelial cells, and growth factors have been approved for clinical use; however, their indications and outcomes are limited. To overcome these limitations, the concept of "tissue engineering" was introduced. Combination treatment using cells, growth factors, and scaffolds, has been studied in experimental animal models, and some studies have been translated into clinical trials. In this review, we focus on recent progressive tissue engineering studies and discuss future perspectives on periodontal regeneration. Copyright © 2013 Wiley Periodicals, Inc.

Calvarial cleidocraniodysplasia-like defects with ENU-induced Nell-1 deficiency.

PubMed

Zhang, Xinli; Ting, Kang; Pathmanathan, Dharmini; Ko, Theodore; Chen, Weiwei; Chen, Feng; Lee, Haofu; James, Aaron W; Siu, Ronald K; Shen, Jia; Culiat, Cymbeline T; Soo, Chia

2012-01-01

Nell-1, first identified by its overexpression in synostotic cranial sutures, is a novel osteoinductive growth and differentiation factor. To further define Nell-1's role in craniofacial patterning, we characterized defects of the ENU-induced Nell-1-deficient (END) mice, focusing on both intramembranous and endochondral cranial bones. Results showed that calvarial bones of neonatal END mice were reduced in thickness and density, with a phenotype resembling calvarial cleidocraniodysplasia. In addition, a global reduction in osteoblast markers was observed, including reductions in Runx2, alkaline phosphatase, and osteocalcin. Remarkably, detailed analysis of endochondral bones showed dysplasia as well. The chondrocranium in the END mouse showed enrichment for early, proliferating Sox9⁺ chondrocytes, whereas in contrast markers of chondrocytes maturation were reduced. These data suggest that Nell-1 is an important growth factor for regulation of osteochondral differentiation, by regulating both Runx2 and Sox9 expression within the calvarium. In summary, Nell-1 is required for normal craniofacial membranous and endochondral skeletal development.

Toughening and functionalization of bioactive ceramic and glass bone scaffolds by biopolymer coatings and infiltration: a review of the last 5 years.

PubMed

Philippart, Anahí; Boccaccini, Aldo R; Fleck, Claudia; Schubert, Dirk W; Roether, Judith A

2015-01-01

Inorganic scaffolds with high interconnected porosity based on bioactive glasses and ceramics are prime candidates for applications in bone tissue engineering. These materials however exhibit relatively low fracture strength and high brittleness. A simple and effective approach to improve the toughness is to combine the basic scaffold structure with polymer coatings or through the formation of interpenetrating polymer-bioactive ceramic microstructures. The polymeric phase can additionally serve as a carrier for growth factors and therapeutic drugs, thus adding biological functionalities. The present paper reviews the state-of-the art in the field of polymer coated and infiltrated bioactive inorganic scaffolds. Based on the notable combination of bioactivity, improved mechanical properties and drug or growth factor delivery capability, this scaffold type is a candidate for bone and osteochondral regeneration strategies. Remaining challenges for the improvement of the materials are discussed and opportunities to broaden the application potential of this scaffold type are also highlighted.

Molecular and cellular mechanisms of aortic stenosis.

PubMed

Yetkin, Ertan; Waltenberger, Johannes

2009-06-12

Calcific aortic stenosis is the most common cause of aortic valve replacement in developed countries, and this condition increases in prevalence with advancing age. The fibrotic thickening and calcification are common eventual endpoint in both non-rheumatic calcific and rheumatic aortic stenoses. New observations in human aortic valves support the hypothesis that degenerative valvular aortic stenosis is the result of active bone formation in the aortic valve, which may be mediated through a process of osteoblast-like differentiation in these tissues. Additionally histopathologic evidence suggests that early lesions in aortic valves are not just a disease process secondary to aging, but an active cellular process that follows the classical "response to injury hypothesis" similar to the situation in atherosclerosis. Although there are similarities with the risk factor and as well as with the process of atherogenesis, not all the patients with coronary artery disease or atherosclerosis have calcific aortic stenosis. This review mainly focuses on the potential vascular and molecular mechanisms involved in the pathogenesis of aortic valve stenosis. Namely extracellular matrix remodeling, angiogenesis, inflammation, and eventually osteoblast-like differentiation resulting in bone formation have been shown to play a role in the pathogenesis of calcific aortic stenosis. Several mediators related to underlying mechanisms, including growth factors especially transforming growth factor-beta1 and vascular endothelial growth factors, angiogenesis, cathepsin enzymes, adhesion molecules, bone regulatory proteins and matrix metalloproteinases have been demonstrated, however the target to be attacked is not defined yet.

Development of an efficient, non-viral transfection method for studying gene function and bone growth in human primary cranial suture mesenchymal cells reveals that the cells respond to BMP2 and BMP3.

PubMed

Dwivedi, Prem P; Anderson, Peter J; Powell, Barry C

2012-08-03

Achieving efficient introduction of plasmid DNA into primary cultures of mammalian cells is a common problem in biomedical research. Human primary cranial suture cells are derived from the connective mesenchymal tissue between the bone forming regions at the edges of the calvarial plates of the skull. Typically they are referred to as suture mesenchymal cells and are a heterogeneous population responsible for driving the rapid skull growth that occurs in utero and postnatally. To better understand the molecular mechanisms involved in skull growth, and in abnormal growth conditions, such as craniosynostosis, caused by premature bony fusion, it is essential to be able to easily introduce genes into primary bone forming cells to study their function. A comparison of several lipid-based techniques with two electroporation-based techniques demonstrated that the electroporation method known as nucleofection produced the best transfection efficiency. The parameters of nucleofection, including cell number, amount of DNA and nucleofection program, were optimized for transfection efficiency and cell survival. Two different genes and two promoter reporter vectors were used to validate the nucleofection method and the responses of human primary suture mesenchymal cells by fluorescence microscopy, RT-PCR and the dual luciferase assay. Quantification of bone morphogenetic protein (BMP) signalling using luciferase reporters demonstrated robust responses of the cells to both osteogenic BMP2 and to the anti-osteogenic BMP3. A nucleofection protocol has been developed that provides a simple and efficient, non-viral alternative method for in vitro studies of gene and protein function in human skull growth. Human primary suture mesenchymal cells exhibit robust responses to BMP2 and BMP3, and thus nucleofection can be a valuable method for studying the potential competing action of these two bone growth factors in a model system of cranial bone growth.

Signaling pathways effecting crosstalk between cartilage and adjacent tissues: Seminars in cell and developmental biology: The biology and pathology of cartilage.

PubMed

Maes, Christa

2017-02-01

Endochondral ossification, the mechanism responsible for the development of the long bones, is dependent on an extremely stringent coordination between the processes of chondrocyte maturation in the growth plate, vascular expansion in the surrounding tissues, and osteoblast differentiation and osteogenesis in the perichondrium and the developing bone center. The synchronization of these processes occurring in adjacent tissues is regulated through vigorous crosstalk between chondrocytes, endothelial cells and osteoblast lineage cells. Our knowledge about the molecular constituents of these bidirectional communications is undoubtedly incomplete, but certainly some signaling pathways effective in cartilage have been recognized to play key roles in steering vascularization and osteogenesis in the perichondrial tissues. These include hypoxia-driven signaling pathways, governed by the hypoxia-inducible factors (HIFs) and vascular endothelial growth factor (VEGF), which are absolutely essential for the survival and functioning of chondrocytes in the avascular growth plate, at least in part by regulating the oxygenation of developing cartilage through the stimulation of angiogenesis in the surrounding tissues. A second coordinating signal emanating from cartilage and regulating developmental processes in the adjacent perichondrium is Indian Hedgehog (IHH). IHH, produced by pre-hypertrophic and early hypertrophic chondrocytes in the growth plate, induces the differentiation of adjacent perichondrial progenitor cells into osteoblasts, thereby harmonizing the site and time of bone formation with the developmental progression of chondrogenesis. Both signaling pathways represent vital mediators of the tightly organized conversion of avascular cartilage into vascularized and mineralized bone during endochondral ossification. Copyright © 2016. Published by Elsevier Ltd.

VEGF-incorporated biomimetic poly(lactide-co-glycolide) sintered microsphere scaffolds for bone tissue engineering.

PubMed

Jabbarzadeh, Ehsan; Deng, Meng; Lv, Qing; Jiang, Tao; Khan, Yusuf M; Nair, Lakshmi S; Laurencin, Cato T

2012-11-01

Regenerative engineering approaches utilizing biomimetic synthetic scaffolds provide alternative strategies to repair and restore damaged bone. The efficacy of the scaffolds for functional bone regeneration critically depends on their ability to induce and support vascular infiltration. In the present study, three-dimensional (3D) biomimetic poly(lactide-co-glycolide) (PLAGA) sintered microsphere scaffolds were developed by sintering together PLAGA microspheres followed by nucleation of minerals in a simulated body fluid. Further, the angiogenic potential of vascular endothelial growth factor (VEGF)-incorporated mineralized PLAGA scaffolds were examined by monitoring the growth and phenotypic expression of endothelial cells on scaffolds. Scanning electron microscopy micrographs confirmed the growth of bone-like mineral layers on the surface of microspheres. The mineralized PLAGA scaffolds possessed interconnectivity and a compressive modulus of 402 ± 61 MPa and compressive strength of 14.6 ± 2.9 MPa. Mineralized scaffolds supported the attachment and growth and normal phenotypic expression of endothelial cells. Further, precipitation of apatite layer on PLAGA scaffolds resulted in an enhanced VEGF adsorption and prolonged release compared to nonmineralized PLAGA and, thus, a significant increase in endothelial cell proliferation. Together, these results demonstrated the potential of VEGF-incorporated biomimetic PLAGA sintered microsphere scaffolds for bone tissue engineering as they possess the combined effects of osteointegrativity and angiogenesis. Copyright © 2012 Wiley Periodicals, Inc.

Noni leaf and black tea enhance bone regeneration in estrogen-deficient rats.

PubMed

Shalan, Nor Aijratul Asikin Mohd; Mustapha, Noordin M; Mohamed, Suhaila

2017-01-01

Black tea and Nonileaf are among the dietary compounds that can benefit patients with bone resorption disorders. Their bone regeneration effects and their mechanisms were studied in estrogen-deficient rats. Noni leaves (three doses) and black tea water extracts were fed to ovariectomized rats for 4 mo, and their effects (analyzed via mechanical measurements, micro-computed tomography scan, and reverse transcriptase polymerase chain reaction mRNA) were compared with Remifemin (a commercial phytoestrogen product from black cohosh). The water extracts (dose-dependently for noni leaves) increased bone regeneration biomarker (runt-related transcription factor 2, bone morphogenetic protein 2, osteoprotegerin, estrogen receptor 1 [ESR1], collagen type I alpha 1A) expressions and reduced the inflammatory biomarkers (interleukin-6, tumor necrosis factor-α, nuclear factor [NF]-κB, and receptor activator of NF-κB ligand) mRNA expressions/levels in the rats. The extracts also improved bone physical and mechanical properties. The extracts demonstrated bone regeneration through improving bone size and structure, bone mechanical properties (strength and flexibility), and bone mineralization and density. The catechin-rich extract favored bone regeneration and suppressed bone resorption. The mechanisms involved enhancing osteoblast generation and survival, inhibiting osteoclast growth and activities, suppressing inflammation, improving bone collagen synthesis and upregulating ESR1 expression to augment phytoestrogenic effects. Estrogen deficiency bone loss and all extracts studied (best effect from Morinda leaf at 300 mg/kg body weight) mitigated the loss, indicating benefits for the aged and menopausal women. Copyright © 2016 Elsevier Inc. All rights reserved.

In Vitro Osteoblast Model for Bone Wound Infections and Antimicrobial Therapy

DTIC Science & Technology

2012-10-01

such as  osteocalcin, osteopontin, and bone  sialoprotein . In addition, osteoblast‐produced  of circulating cytokines and growth factors also influence...genes such osteocalcin, bone  sialoprotein , osteopontin, and collagen type I .  When infected with the AB, KP or PA, RUNX2 expression was not significant

Phosphate homeostasis and its role in bone health.

PubMed

Penido, Maria Goretti M G; Alon, Uri S

2012-11-01

Phosphate is one of the most abundant minerals in the body, and its serum levels are regulated by a complex set of processes occurring in the intestine, skeleton, and kidneys. The currently known main regulators of phosphate homeostasis include parathyroid hormone (PTH), calcitriol, and a number of peptides collectively known as the "phosphatonins" of which fibroblast growth factor-23 (FGF-23) has been best defined. Maintenance of extracellular and intracellular phosphate levels within a narrow range is important for many biological processes, including energy metabolism, cell signaling, regulation of protein synthesis, skeletal development, and bone integrity. The presence of adequate amounts of phosphate is critical for the process of apoptosis of mature chondrocytes in the growth plate. Without the presence of this mineral in high enough quantities, chondrocytes will not go into apoptosis, and the normal physiological chain of events that includes invasion of blood vessels and the generation of new bone will be blocked, resulting in rickets and delayed growth. In the rest of the skeleton, hypophosphatemia will result in osteomalacia due to an insufficient formation of hydroxyapatite. This review will address phosphate metabolism and its role in bone health.

Pleiotrophin regulates the expansion and regeneration of hematopoietic stem cells

PubMed Central

Himburg, Heather A; Muramoto, Garrett G; Daher, Pamela; Meadows, Sarah K; Russell, J Lauren; Doan, Phuong; Chi, Jen-Tsan; Salter, Alice B; Lento, William E; Reya, Tannishtha; Chao, Nelson; Chute, John P

2013-01-01

Hematopoietic stem cell (HSC) self-renewal is regulated by both intrinsic and extrinsic signals. Although some of the pathways that regulate HSC self-renewal have been uncovered, it remains largely unknown whether these pathways can be triggered by deliverable growth factors to induce HSC growth or regeneration. Here we show that pleiotrophin, a neurite outgrowth factor with no known function in hematopoiesis, efficiently promotes HSC expansion in vitro and HSC regeneration in vivo. Treatment of mouse bone marrow HSCs with pleiotrophin caused a marked increase in long-term repopulating HSC counts in culture, as measured in competitive repopulating assays. Treatment of human cord blood CD34+CDCD38−Lin− cells with pleiotrophin also substantially increased severe combined immunodeficient (SCID)-repopulating cell counts in culture, compared to input and cytokine-treated cultures. Systemic administration of pleiotrophin to irradiated mice caused a pronounced expansion of bone marrow stem and progenitor cells in vivo, indicating that pleiotrophin is a regenerative growth factor for HSCs. Mechanistically, pleiotrophin activated phosphoinositide 3-kinase (PI3K) signaling in HSCs; antagonism of PI3K or Notch signaling inhibited pleiotrophin-mediated expansion of HSCs in culture. We identify the secreted growth factor pleiotrophin as a new regulator of both HSC expansion and regeneration PMID:20305662

Pleiotrophin regulates the expansion and regeneration of hematopoietic stem cells.

PubMed

Himburg, Heather A; Muramoto, Garrett G; Daher, Pamela; Meadows, Sarah K; Russell, J Lauren; Doan, Phuong; Chi, Jen-Tsan; Salter, Alice B; Lento, William E; Reya, Tannishtha; Chao, Nelson J; Chute, John P

2010-04-01

Hematopoietic stem cell (HSC) self-renewal is regulated by both intrinsic and extrinsic signals. Although some of the pathways that regulate HSC self-renewal have been uncovered, it remains largely unknown whether these pathways can be triggered by deliverable growth factors to induce HSC growth or regeneration. Here we show that pleiotrophin, a neurite outgrowth factor with no known function in hematopoiesis, efficiently promotes HSC expansion in vitro and HSC regeneration in vivo. Treatment of mouse bone marrow HSCs with pleiotrophin caused a marked increase in long-term repopulating HSC numbers in culture, as measured in competitive repopulating assays. Treatment of human cord blood CD34(+)CDCD38(-)Lin(-) cells with pleiotrophin also substantially increased severe combined immunodeficient (SCID)-repopulating cell counts in culture, compared to input and cytokine-treated cultures. Systemic administration of pleiotrophin to irradiated mice caused a pronounced expansion of bone marrow stem and progenitor cells in vivo, indicating that pleiotrophin is a regenerative growth factor for HSCs. Mechanistically, pleiotrophin activated phosphoinositide 3-kinase (PI3K) signaling in HSCs; antagonism of PI3K or Notch signaling inhibited pleiotrophin-mediated expansion of HSCs in culture. We identify the secreted growth factor pleiotrophin as a new regulator of both HSC expansion and regeneration.

Optimally designed collagen/polycaprolactone biocomposites supplemented with controlled release of HA/TCP/rhBMP-2 and HA/TCP/PRP for hard tissue regeneration.

PubMed

Kim, WonJin; Jang, Chul Ho; Kim, GeunHyung

2017-09-01

Collagen has been widely used as a very promising material to regenerate various tissues. It is a chief component of the extracellular matrix, and encourages various biological effects conducive to tissue regeneration. However, poor mechanical stability, low processability, and high level of water absorption can lead to impaired control of growth factor release and have impeded the use of collagen as a functional biomedical scaffold. Here, to overcome the shortcomings of collagen scaffolds, we have additively manufactured collagen/polycaprolactone (PCL) biocomposites supplemented with a bioceramic (hydroxyapatite (HA)/β-tricalcium-phosphate (TCP)) and two growth factors (recombinant human bone morphogenetic protein-2 [rhBMP-2] and platelet-rich plasma [PRP]). Various weight fractions of PCL in the collagen/PCL composites were manipulated to select optimal growth factor release and highly active cellular responses. After the optimal concentration of PCL in the collagen/PCL scaffold was determined, biocomposites supplemented with bioceramic/growth-factors were fabricated. Continuously released growth factors were assumed to increase the in vitro cellular activities of the osteoblast-like cells (MG63) cultured on the biocomposites. In vitro cellular responses, including osteogenic activities, were examined, and results showed that compared to the HA/TCP/rhBMP-2 supplemented scaffold the HA/TCP/PRP biocomposites provide significantly high cellular activities (cell proliferation: >1.3-fold) and mineralization (calcium deposition: >1.4-fold, osteocalcin: >2.6-fold) sufficient for regenerating bone tissue. Copyright © 2017. Published by Elsevier B.V.

Nutrition in Cardioskeletal Health123

PubMed Central

Hill Gallant, Kathleen M; Weaver, Connie M; Towler, Dwight A; Thuppal, Sowmyanarayanan V; Bailey, Regan L

2016-01-01

Bone and heart health are linked through a variety of cellular, endocrine, and metabolic mechanisms, including the bidirectional effects of mineral-regulating hormones parathyroid hormone and fibroblast growth factor 23. Nutrition plays an important role in the development of both cardiovascular and bone disease. This review describes current knowledge on the relations between the cardiovascular system and bone and the influence of key nutrients involved in mineral metabolism—calcium, vitamin D, and phosphorus—on heart and bone health, as well as the racial/ethnic differences in cardiovascular disease and osteoporosis and the influence that nutrition has on these disparities. PMID:27184281

Comparison of potentials between stem cells isolated from human anterior cruciate ligament and bone marrow for ligament tissue engineering.

PubMed

Cheng, Ming-Te; Liu, Chien-Lin; Chen, Tain-Hsiung; Lee, Oscar K

2010-07-01

We have previously isolated and identified stem cells from human anterior cruciate ligament (ACL). The purpose of this study was to evaluate the differences in proliferation, differentiation, and extracellular matrix (ECM) formation abilities between bone marrow stem cells (BMSCs) and ACL-derived stem cells (LSCs) from the same donors when cultured with different growth factors, including basic fibroblast growth factor (bFGF), epidermal growth factor, and transforming growth factor-beta 1 (TGF-beta1). Ligament tissues and bone marrow aspirate were obtained from patients undergoing total knee arthroplasty and ACL reconstruction surgeries. Proliferation, colony formation, and population doubling capacity as well as multilineage differentiation potentials of LSCs and BMSCs were compared. Gene expression and ECM production for ligament engineering were also evaluated. It was found that BMSCs possessed better osteogenic differentiation potential than LSCs, while similar adipogenic and chondrogenic differentiation abilities were observed. Proliferation rates of both LSCs and BMSCs were enhanced by bFGF and TGF-beta1. TGF-beta1 treatment significantly increased the expression of type I collagen, type III collagen, fibronectin, and alpha-smooth muscle actin in LSCs, but TGF-beta1 only upregulated type I collagen and tenascin-c in BMSCs. Protein quantification further confirmed the results of differential gene expression and suggested that LSCs and BMSCs increase ECM production upon TGF-beta1 treatment. In summary, in comparison with BMSCs, LSCs proliferate faster and maintain an undifferentiated state with bFGF treatment, whereas under TGF-beta1 treatment, LSCs upregulate major tendinous gene expression and produce a robust amount of ligament ECM protein, making LSCs a potential cell source in future applications of ACL tissue engineering.

Symposium on ‘Nutrition and health in children and adolescents’ Session 1: Nutrition in growth and development

PubMed Central

Prentice, Ann; Schoenmakers, Inez; Laskey, M. Ann; de Bono, Stephanie; Ginty, Fiona; Goldberg, Gail R.

2007-01-01

The growth and development of the human skeleton requires an adequate supply of many different nutritional factors. Classical nutrient deficiencies are associated with stunting (e.g. energy, protein, Zn), rickets (e.g. vitamin D) and other bone abnormalities (e.g. Cu, Zn, vitamin C). In recent years there has been interest in the role nutrition may play in bone growth at intakes above those required to prevent classical deficiencies, particularly in relation to optimising peak bone mass and minimising osteoporosis risk. There is evidence to suggest that peak bone mass and later fracture risk are influenced by the pattern of growth in childhood and by nutritional exposures in utero, in infancy and during childhood and adolescence. Of the individual nutrients, particular attention has been paid to Ca, vitamin D, protein and P. There has also been interest in several food groups, particularly dairy products, fruit and vegetables and foods contributing to acid–base balance. However, it is not possible at the present time to define dietary reference values using bone health as a criterion, and the question of what type of diet constitutes the best support for optimal bone growth and development remains open. Prudent recommendations (Department of Health, 1998; World Health Organization/Food and Agriculture Organization, 2003) are the same as those for adults, i.e. to consume a Ca intake close to the reference nutrient intake, optimise vitamin D status through adequate summer sunshine exposure (and diet supplementation where appropriate), be physically active, have a body weight in the healthy range, restrict salt intake and consume plenty of fruit and vegetables. PMID:17181901

Oestrogen-deficiency inducing haematopoiesis dysfunction via reduction in haematopoietic stem cells and haematopoietic growth factors in rats

PubMed Central

Qiu, Xi; Yuan, Xiang-Gui; Jin, Xiao-li; He, Xin; Zhu, Lei; Zhao, Xiao-Ying

2012-01-01

Summary Haematopoiesis is a self-renewing and multi-directional differentiation process of haematopoietic stem cells (HSCs), which is modulated very precisely by the haematopoietic microenvironment in bone marrow. Our previous study has demonstrated that oestrogen-deficiency leads to haematopoiesis dysfunction which manifests as a decrease in haematopoietic tissues and an increase in adipose tissues in bone marrow. However, the mechanism involved in the oestrogen-deficiency effects on haematopoiesis dysfunction is not completely understood. In this study, we established an oestrogen-deficiency rat model by ovariectomy (OVX group). Haematopoiesis was evaluated at the 12th, 16th, 20th, 24th and 28th weeks after operation in the OVX group and its control (Sham group) by pathological examination; the number and function of HSCs were evaluated by flow cytometry analysis and colony-forming assay respectively. Haematopoietic growth factors levels including granulocyte/macrophage-colony-stimulating factor (GM-CSF), stem cell factor (SCF) and interleukin-3 (IL-3) were examined by ELISA kits at different time points. We found that in the OVX group, haematopoiesis dysfunction in bone marrow was observed (P < 0.05) from the 12th week when compared with the Sham group, and extramedullary haematopoiesis began to appear in the liver and spleen from the 16th week. The number of HSCs and colony-forming units-granulocyte/macrophage (CFUs-GM) in bone marrow was reduced significantly (P < 0.05) from the 20th and 16th week respectively. Furthermore, GM-CSF, SCF and IL-3 in the OVX group decreased significantly (P < 0.05) since the 12th, 16th and 24th week respectively. Taken together, these results suggested that oestrogen is required for normal haematopoiesis. Oestrogen-deficiency inducing haematopoiesis dysfunction may be via reduction in HSCs and haematopoietic growth factors at a late stage. PMID:22583131

Oestrogen-deficiency inducing haematopoiesis dysfunction via reduction in haematopoietic stem cells and haematopoietic growth factors in rats.

PubMed

Qiu, Xi; Yuan, Xiang-Gui; Jin, Xiao-Li; He, Xin; Zhu, Lei; Zhao, Xiao-Ying

2012-06-01

Haematopoiesis is a self-renewing and multi-directional differentiation process of haematopoietic stem cells (HSCs), which is modulated very precisely by the haematopoietic microenvironment in bone marrow. Our previous study has demonstrated that oestrogen-deficiency leads to haematopoiesis dysfunction which manifests as a decrease in haematopoietic tissues and an increase in adipose tissues in bone marrow. However, the mechanism involved in the oestrogen-deficiency effects on haematopoiesis dysfunction is not completely understood. In this study, we established an oestrogen-deficiency rat model by ovariectomy (OVX group). Haematopoiesis was evaluated at the 12th, 16th, 20th, 24th and 28th weeks after operation in the OVX group and its control (Sham group) by pathological examination; the number and function of HSCs were evaluated by flow cytometry analysis and colony-forming assay respectively. Haematopoietic growth factors levels including granulocyte/macrophage-colony-stimulating factor (GM-CSF), stem cell factor (SCF) and interleukin-3 (IL-3) were examined by ELISA kits at different time points. We found that in the OVX group, haematopoiesis dysfunction in bone marrow was observed (P < 0.05) from the 12th week when compared with the Sham group, and extramedullary haematopoiesis began to appear in the liver and spleen from the 16th week. The number of HSCs and colony-forming units-granulocyte/macrophage (CFUs-GM) in bone marrow was reduced significantly (P < 0.05) from the 20th and 16th week respectively. Furthermore, GM-CSF, SCF and IL-3 in the OVX group decreased significantly (P < 0.05) since the 12th, 16th and 24th week respectively. Taken together, these results suggested that oestrogen is required for normal haematopoiesis. Oestrogen-deficiency inducing haematopoiesis dysfunction may be via reduction in HSCs and haematopoietic growth factors at a late stage. © 2012 The Authors. International Journal of Experimental Pathology © 2012 International Journal of Experimental Pathology.

The inward rectifier potassium channel Kir2.1 is expressed in mouse neutrophils from bone marrow and liver.

PubMed

Masia, Ricard; Krause, Daniela S; Yellen, Gary

2015-02-01

Neutrophils are phagocytic cells that play a critical role in innate immunity by destroying bacterial pathogens. Channels belonging to the inward rectifier potassium channel subfamily 2 (Kir2 channels) have been described in other phagocytes (monocytes/macrophages and eosinophils) and in hematopoietic precursors of phagocytes. Their physiological function in these cells remains unclear, but some evidence suggests a role in growth factor-dependent proliferation and development. Expression of functional Kir2 channels has not been definitively demonstrated in mammalian neutrophils. Here, we show by RT-PCR that neutrophils from mouse bone marrow and liver express mRNA for the Kir2 subunit Kir2.1 but not for other subunits (Kir2.2, Kir2.3, and Kir2.4). In electrophysiological experiments, resting (unstimulated) neutrophils from mouse bone marrow and liver exhibit a constitutively active, external K(+)-dependent, strong inwardly rectifying current that constitutes the dominant current. The reversal potential is dependent on the external K(+) concentration in a Nernstian fashion, as expected for a K(+)-selective current. The current is not altered by changes in external or internal pH, and it is blocked by Ba(2+), Cs(+), and the Kir2-selective inhibitor ML133. The single-channel conductance is in agreement with previously reported values for Kir2.1 channels. These properties are characteristic of homomeric Kir2.1 channels. Current density in short-term cultures of bone marrow neutrophils is decreased in the absence of growth factors that are important for neutrophil proliferation [granulocyte colony-stimulating factor (G-CSF) and stem cell factor (SCF)]. These results demonstrate that mouse neutrophils express functional Kir2.1 channels and suggest that these channels may be important for neutrophil function, possibly in a growth factor-dependent manner. Copyright © 2015 the American Physiological Society.

Low-carbohydrate, high-fat diets have sex-specific effects on bone health in rats.

PubMed

Zengin, Ayse; Kropp, Benedikt; Chevalier, Yan; Junnila, Riia; Sustarsic, Elahu; Herbach, Nadja; Fanelli, Flaminia; Mezzullo, Marco; Milz, Stefan; Bidlingmaier, Martin; Bielohuby, Maximilian

2016-10-01

Studies in humans suggest that consumption of low-carbohydrate, high-fat diets (LC-HF) could be detrimental for growth and bone health. In young male rats, LC-HF diets negatively affect bone health by impairing the growth hormone/insulin-like growth factor axis (GH/IGF axis), while the effects in female rats remain unknown. Therefore, we investigated whether sex-specific effects of LC-HF diets on bone health exist. Twelve-week-old male and female Wistar rats were isoenergetically pair-fed either a control diet (CD), "Atkins-style" protein-matched diet (LC-HF-1), or ketogenic low-protein diet (LC-HF-2) for 4 weeks. In females, microcomputed tomography and histomorphometry analyses were performed on the distal femur. Sex hormones were analysed with liquid chromatography-tandem mass spectrometry, and endocrine parameters including GH and IGF-I were measured by immunoassay. Trabecular bone volume, serum IGF-I and the bone formation marker P1NP were lower in male rats fed both LC-HF diets versus CD. LC-HF diets did not impair bone health in female rats, with no change in trabecular or cortical bone volume nor in serum markers of bone turnover between CD versus both LC-HF diet groups. Pituitary GH secretion was lower in female rats fed LC-HF diet, with no difference in circulating IGF-I. Circulating sex hormone concentrations remained unchanged in male and female rats fed LC-HF diets. A 4-week consumption of LC-HF diets has sex-specific effects on bone health-with no effects in adult female rats yet negative effects in adult male rats. This response seems to be driven by a sex-specific effect of LC-HF diets on the GH/IGF system.

Saxagliptin affects long-bone microarchitecture and decreases the osteogenic potential of bone marrow stromal cells.

PubMed

Sbaraglini, María Laura; Molinuevo, María Silvina; Sedlinsky, Claudia; Schurman, León; McCarthy, Antonio Desmond

2014-03-15

Diabetes mellitus is associated with a decrease in bone quality and an increase in fracture incidence. Additionally, treatment with anti-diabetic drugs can either adversely or positively affect bone metabolism. In this study we evaluated: the effect of a 3-week oral treatment with saxagliptin on femoral microarchitecture in young male non-type-2-diabetic Sprague Dawley rats; and the in vitro effect of saxagliptin and/or fetal bovine serum (FBS), insulin or insulin-like growth factor-1 (IGF1), on the proliferation, differentiation (Runx2 and PPAR-gamma expression, type-1 collagen production, osteocalcin expression, mineralization) and extracellular-regulated kinase (ERK) activation, in bone marrow stromal cells (MSC) obtained from control (untreated) rats and in MC3T3E1 osteoblast-like cells. In vivo, oral saxagliptin treatment induced a significant decrease in the femoral osteocytic and osteoblastic density of metaphyseal trabecular bone and in the average height of the proximal cartilage growth plate; and an increase in osteoclastic tartrate-resistant acid phosphatase (TRAP) activity of the primary spongiosa. In vitro, saxagliptin inhibited FBS-, insulin- and IGF1-induced ERK phosphorylation and cell proliferation, in both MSC and MC3T3E1 preosteoblasts. In the absence of growth factors, saxagliptin had no effect on ERK activation or cell proliferation. In both MSC and MC3T3E1 cells, saxagliptin in the presence of FBS inhibited Runx2 and osteocalcin expression, type-1 collagen production and mineralization, while increasing PPAR-gamma expression. In conclusion, orally administered saxagliptin induced alterations in long-bone microarchitecture that could be related to its in vitro down-regulation of the ERK signaling pathway for insulin and IGF1 in MSC, thus decreasing the osteogenic potential of these cells. Copyright © 2014 Elsevier B.V. All rights reserved.

The use of injectable sonication-induced silk hydrogel for VEGF165 and BMP-2 delivery for elevation of the maxillary sinus floor

PubMed Central

Zhang, Wenjie; Wang, Xiuli; Wang, Shaoyi; Zhao, Jun; Xu, Lianyi; Zhu, Chao; Zeng, Deliang; Chen, Jake; Zhang, Zhiyuan; Kaplan, David L.; Jiang, Xinquan

2011-01-01

Sonication-induced silk hydrogels were previously prepared as an injectable bone replacement biomaterial, with a need to improve osteogenic features. Vascular endothelial growth factor (VEGF165) and bone morphogenic protein-2 (BMP-2) are key regulators of angiogenesis and osteogenesis, respectively, during bone regeneration. Therefore, the present study aimed at evaluating in situ forming silk hydrogels as a vehicle to encapsulate dual factors for rabbit maxillary sinus floor augmentation. Sonication-induced silk hydrogels were prepared in vitro and the slow release of VEGF165 and BMP-2 from these silk gels was evaluated by ELISA. For in vivo studies for each time point (4 and 12 weeks), 24 sinus floors elevation surgeries were made bilaterally in 12 rabbits for the following four treatment groups: silk gel (group Silk gel), silk gel/VEGF165 (group VEGF), silk gel/BMP-2 (group BMP-2), silk gel/VEGF165/BMP-2 (group V+B) (n=6 per group). Sequential florescent labeling and radiographic observations were used to record new bone formation and mineralization, along with histological and histomorphometric analysis. At week 4, VEGF165 promoted more tissue infiltration into the gel and accelerated the degradation of the gel material. At this time point, the bone area in group V+B was significantly larger than those in the other three groups. At week 12, elevated sinus floor heights of groups BMP-2 and V+B were larger than those of the Silk gel and VEGF groups, and the V+B group had the largest new bone area among all groups. In addition, a larger blood vessel area formed in the remaining gel areas in groups VEGF and V+B. In conclusion, VEGF165 and BMP-2 released from injectable and biodegradable silk gels promoted angiogenesis and new bone formation, with the two factors demonstrating an additive effect on bone regeneration. These results indicate that silk hydrogels can be used as an injectable vehicle to deliver multiple growth factors in a minimally invasive approach to regenerate irregular bony cavities. PMID:21889205

Vitamin D and the immunomodulation of rotator cuff injury

PubMed Central

Dougherty, Kaitlin A; Dilisio, Matthew F; Agrawal, Devendra K

2016-01-01

Tendon-to-bone healing after rotator cuff repair surgery has a failure rate of 20%–94%. There has been a recent interest to determine the factors that act as determinants between successful and unsuccessful rotator cuff repair. Vitamin D level in patients is one of the factors that have been linked to bone and muscle proliferation and healing, and it may have an effect on tendon-to-bone healing. The purpose of this article is to critically review relevant published research that relates to the effect of vitamin D on rotator cuff tears and subsequent healing. A review of the literature was conducted to identify all studies that investigate the relationship between vitamin D and tendon healing, in addition to its mechanism of action. The data were then analyzed in order to summarize what is currently known about vitamin D, rotator cuff pathology, and tendon-to-bone healing. The activated metabolite of vitamin D, 1α,25-dihydroxyvitamin D3, affects osteoblast proliferation and differentiation. Likewise, vitamin D plays a significant role in the tendon-to-bone healing process by increasing the bone mineral density and strengthening the skeletal muscles. The 1α,25-dihydroxyvitamin D3 binds to vitamin D receptors on myocytes to stimulate growth and proliferation. The form of vitamin D produced by the liver, calcifediol, is a key initiator of the myocyte healing process by moving phosphate into myocytes, which improves function and metabolism. Investigation into the effect of vitamin D on tendons has been sparse, but limited studies have been promising. Matrix metalloproteinases play an active role in remodeling the extracellular matrix (ECM) of tendons, particularly deleterious remodeling of the collagen fibers. Also, the levels of transforming growth factor-β3 positively influence the success of the surgery for rotator cuff repair. In the tendon-to-bone healing process, vitamin D has been shown to successfully influence bone and muscle healing, but more research is needed to delve into the mechanisms of vitamin D as a factor in skeletal tendon health and healing. PMID:27366101

Adipose, bone and muscle tissues as new endocrine organs: role of reciprocal regulation for osteoporosis and obesity development.

PubMed

Migliaccio, Silvia; Greco, Emanuela A; Wannenes, Francesca; Donini, Lorenzo M; Lenzi, Andrea

2014-01-01

The belief that obesity is protective against osteoporosis has recently been revised. In fact, the latest epidemiologic and clinical studies show that a high level of fat mass, but also reduced muscle mass, might be a risk factor for osteoporosis and fragility fractures. Furthermore, increasing evidence seems to indicate that different components such as myokines, adipokines and growth factors, released by both fat and muscle tissues, could play a key role in the regulation of skeletal health and in low bone mineral density and, thus, in osteoporosis development. This review considers old and recent data in the literature to further evaluate the relationship between fat, bone and muscle tissue.

Transforming growth factor-β synthesized by stromal cells and cancer cells participates in bone resorption induced by oral squamous cell carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakamura, Ryosuke; Department of Maxillofacial Surgery, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo; Kayamori, Kou

Transforming growth factor beta (TGF-β) plays a significant role in the regulation of the tumor microenvironment. To explore the role of TGF-β in oral cancer-induced bone destruction, we investigated the immunohistochemical localization of TGF-β and phosphorylated Smad2 (p-Smad2) in 12 surgical specimens of oral squamous cell carcinoma (OSCC). These studies revealed TGF-β and p-Smad2 expression in cancer cells in all tested cases. Several fibroblasts located between cancer nests and resorbing bone expressed TGF-β in 10 out of 12 cases and p-Smad2 in 11 out of 12 cases. Some osteoclasts also exhibited p ∼ Smad2 expression. The OSCC cell line, HSC3, and themore » bone marrow-derived fibroblastic cell line, ST2, synthesized substantial levels of TGF-β. Culture media derived from HSC3 cells could stimulate Tgf-β1 mRNA expression in ST2 cells. Recombinant TGF-β1 could stimulate osteoclast formation induced by receptor activator of nuclear factor kappa-B ligand (RANKL) in RAW264 cells. TGF-β1 could upregulate the expression of p-Smad2 in RAW264 cells, and this action was suppressed by the addition of a neutralizing antibody against TGF-β or by SB431542. Transplantation of HSC3 cells onto the calvarial region of athymic mice caused bone destruction, associated with the expression of TGF-β and p-Smad2 in both cancer cells and stromal cells. The bone destruction was substantially inhibited by the administration of SB431542. The present study demonstrated that TGF-β synthesized by both cancer cells and stromal cells participates in the OSCC-induced bone destruction. - Highlights: • Cancer cell, fibroblastic cells, and osteoclasts at bone resorbing area by oral cancer exhibited TGF-β and p-Smad2. • TGF-β1 stimulated osteoclastogenesis induced by RAKL in RAW264 cell. • Xenograft model of oral cancer-induced bone resorption was substantially inhibited by SB431542. • TGF-β synthesized by both cancer cells and stromal cells participates in the OSCC-induced bone destruction.« less

Rethinking the nature of fibrolamellar bone: an integrative biological revision of sauropod plexiform bone formation.

PubMed

Stein, Koen; Prondvai, Edina

2014-02-01

We present novel findings on sauropod bone histology that cast doubt on general palaeohistological concepts concerning the true nature of woven bone in primary cortical bone and its role in the rapid growth and giant body sizes of sauropod dinosaurs. By preparing and investigating longitudinal thin sections of sauropod long bones, of which transverse thin sections were published previously, we found that the amount of woven bone in the primary complex has been largely overestimated. Using comparative cellular and light-extinction characteristics in the two section planes, we revealed that the majority of the bony lamina consists of longitudinally organized primary bone, whereas woven bone is usually represented only by a layer a few cells thin in the laminae. Previous arguments on sauropod biology, which have been based on the overestimated amount, misinterpreted formation process and misjudged role of woven bone in the plexiform bone formation of sauropod dinosaurs, are thereby rejected. To explain the observed pattern in fossil bones, we review the most recent advances in bone biology concerning bone formation processes at the cellular and tissue levels. Differentiation between static and dynamic osteogenesis (SO and DO) and the revealed characteristics of SO- versus DO-derived bone tissues shed light on several questions raised by our palaeohistological results and permit identification of these bone tissues in fossils with high confidence. By presenting the methods generally used for investigating fossil bones, we show that the major cause of overestimation of the amount of woven bone in previous palaeohistological studies is the almost exclusive usage of transverse sections. In these sections, cells and crystallites of the longitudinally organized primary bone are cut transversely, thus cells appear rounded and crystallites remain dark under crossed plane polarizers, thereby giving the false impression of woven bone. In order to avoid further confusion in palaeohistological studies, we introduce new osteohistological terms as well as revise widely used but incorrect terminology. To infer the role of woven bone in the bone formation of fast-growing tetrapods, we review some aspects of the interrelationships between the vascularity of bone tissues, basal metabolic rate, body size and growth rate. By putting our findings into the context of osteogenesis, we provide a new model for the diametrical limb bone growth of sauropods and present new implications for the evolution of fast growth in vertebrates. Since biomechanical studies of bone tissues suggest that predominant collagen fibre orientation (CFO) is controlled by endogenous, functional and perhaps phylogenetic factors, the relationship between CFO and bone growth rate as defined by Amprino's rule, which has been the basis for the biological interpretation of several osteohistological features, must be revised. Our findings draw attention to the urgent need for revising widely accepted basic concepts of palaeohistological studies, and for a more integrative approach to bone formation, biomechanics and bone microstructural features of extant and extinct vertebrates to infer life history traits of long extinct, iconic animals like dinosaurs. © 2013 The Authors. Biological Reviews © 2013 Cambridge Philosophical Society.

Novel application of stem cell-derived factors for periodontal regeneration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inukai, Takeharu, E-mail: t-inukai@med.nagoya-u.ac.jp; Katagiri, Wataru, E-mail: w-kat@med.nagoya-u.ac.jp; Yoshimi, Ryoko, E-mail: lianzi@med.nagoya-u.ac.jp

Highlights: Black-Right-Pointing-Pointer Mesenchymal stem cells (MSCs) secrete a variety of cytokines. Black-Right-Pointing-Pointer Cytokines were detected in conditioned medium from cultured MSCs (MSC-CM). Black-Right-Pointing-Pointer MSC-CM enhanced activation of dog MSCs and periodontal ligament cells. Black-Right-Pointing-Pointer MSC-CM significantly promoted alveolar bone and cementum regeneration. Black-Right-Pointing-Pointer Multiple cytokines contained in MSC-CM promote periodontal regeneration. -- Abstract: The effect of conditioned medium from cultured mesenchymal stem cells (MSC-CM) on periodontal regeneration was evaluated. In vitro, MSC-CM stimulated migration and proliferation of dog MSCs (dMSCs) and dog periodontal ligament cells (dPDLCs). Cytokines such as insulin-like growth factor, vascular endothelial growth factor, transforming growth factor-{beta}1, andmore » hepatocyte growth factor were detected in MSC-CM. In vivo, one-wall critical-size, intrabony periodontal defects were surgically created in the mandible of dogs. Dogs with these defects were divided into three groups that received MSC-CM, PBS, or no implants. Absorbable atelo-collagen sponges (TERUPLUG Registered-Sign ) were used as a scaffold material. Based on radiographic and histological observation 4 weeks after transplantation, the defect sites in the MSC-CM group displayed significantly greater alveolar bone and cementum regeneration than the other groups. These findings suggest that MSC-CM enhanced periodontal regeneration due to multiple cytokines contained in MSC-CM.« less

Delayed Expression of Circulating TGF-β1 and BMP-2 Levels in Human Nonunion Long Bone Fracture Healing.

PubMed

Hara, Yoshiaki; Ghazizadeh, Mohammad; Shimizu, Hajime; Matsumoto, Hisashi; Saito, Nobuyuki; Yagi, Takanori; Mashiko, Kazuki; Mashiko, Kunihiro; Kawai, Makoto; Yokota, Hiroyuki

2017-01-01

The healing process of bone fracture requires a well-controlled multistage and sequential order beginning immediately after the injury. However, complications leading to nonunion exist, creating serious problems and costs for patients. Transforming growth factor-beta 1 (TGF-β1) and bone morphogenic protein 2 (BMP-2) are two major growth factors involved in human bone fracture healing by promoting various stages of bone ossification. In this study, we aimed to determine the role of these factors during the fracture healing of human long bones and assess their impacts on nonunion condition. We performed a comprehensive analysis of plasma TGF-β1 and BMP-2 levels in blood samples from 10 patients with proved nonunion and 10 matched patients with normal union following a predetermined time schedule. The concentrations of TGF-β1 and BMP-2 were measured at each time point using a solid-phase ELISA. TGF-β1 and BMP-2 levels were detectable in all patients. For all patients, a maximal peak for TGF-β1 was found at 3-week. In normal union group, TGF-β1 showed a maximal peak at 2-week while nonunion group had a delayed maximal peak at 3-week. Plasma levels of BMP-2 for all patients and for normal union group reached a maximal peak at 1-week, but nonunion group showed a delayed maximal peak at 2-week. In general, plasma TGF-β1 or BMP-2 level was not significantly different between normal union and nonunion groups. The expression levels of TGF-β1 and BMP-2 appeared to be delayed in nonunion patients which could play an important role in developing an early marker of fracture union condition and facilitate improved patient's management.

Role of ghrelin and insulin-like growth factor binding protein-3 in the development of osteoporosis in inflammatory bowel disease.

PubMed

Koutroubakis, Ioannis E; Zavos, Christos; Damilakis, John; Papadakis, Georgios; Neratzoulakis, John; Karkavitsas, Nikolaos; Kouroumalis, Elias A

2011-07-01

A high prevalence of bone loss is observed in patients with inflammatory bowel disease (IBD). Leptin, ghrelin, insulin-like growth factor (IGF)-1, and IGF binding protein (IGFBP)-3 have been suggested to interfere in the bone metabolism. The aim of this study was to investigate the role of these peptides in the development of osteoporosis in IBD. One hundred and eighteen consecutive IBD patients were included. All patients underwent bone densitometry by dual energy x-ray absorptiometry at the femoral neck and lumbar spine levels. Serum samples were collected from all patients and analyzed for concentrations of the aforementioned peptides by radioimmunoassay. Forty (33.9%) patients were normal, 55 (46.6%) were osteopenic, and 23 (19.5%) were osteoporotic. Positive statistically significant correlations were found between body mass index (BMI), leptin, IGFBP-3 levels, and the bone mineral density (BMD) of the femoral neck and lumbar spine. Moreover, an inverse statistically significant correlation was found between BMD of the femoral neck and the lumbar spine, and age, duration of the disease, and ghrelin levels. Multivariate analysis revealed that the most significant factors associated with the BMD were age and BMI. A weak but statistically significant correlation was found between IGFBP-3 and femoral neck BMD (P=0.045) and between ghrelin and spine BMD (P=0.039). No correlation was observed between leptin and BMD. Low BMI is the most important independent risk factor for osteoporosis in IBD patients. There is no independent influence of leptin but ghrelin and IGFBP-3 may play a role in the bone metabolism in the IBD.

Bone regeneration: Biomaterials as local delivery systems with improved osteoinductive properties.

PubMed

Martin, Victor; Bettencourt, Ana

2018-01-01

Bone is a mineralized conjunctive tissue, with a unique trauma healing capability. However, the replacement or regeneration of lost bone is not always successful and becomes more difficult the wider the bone defect. A significant growth in the demand for orthopedic and maxillofacial surgical procedures as a result of population aging and increase in chronic diseases as diabetes is a fact and successful approaches for bone regeneration are still needed. Until today, autogenous bone graft continues to be the best solution even with important limitations, as quantity and the requirement of a donator area. Alternatively, local delivery systems combining an osteoconductive biomaterial with osteoinductive compounds as hormones, growth factors or drugs is a popular approach aiming to replace the need for autogenous bone grafts. Nevertheless, in spite of the intense research in the area, presently there is no system that can mimic all the biological functions of the autogenous bone grafts. In this context, the present work provides an overview of the most recent advances in the field of synthetic bone grafts. The opportunities and limitations are detailed along with the remaining gaps in the research that are still preventing the successful translation of more products into the market able to be a valuable option in comparison to the autogenous bone grafts. Copyright © 2017 Elsevier B.V. All rights reserved.

Combination of platelet-rich plasma with degradable bioactive borate glass for segmental bone defect repair.

PubMed

Zhang, Ya-Dong; Wang, Gang; Sun, Yan; Zhang, Chang-Qing

2011-02-01

Porous scaffold biomaterials may offer a clinical alternative to bone grafts; however, scaffolds alone are typically insufficient to heal large bone defects. Numerous studies have demonstrated that osteoinductive growth factor significantly improves bone repair. In this study, a strategy combining degradable bioactive borate glass (BG) scaffolds with platelet-rich plasma (PRP) was tested. The bone defect was filled with BG alone, BG combined with autologous PRP or left empty. Bone formation was analyzed at 4, 8 and 12 weeks using both histology and radiology. The PRP treated group yielded better bone formation than the pure BG scaffold as determined by both histology and microcomputer tomography after 12 weeks. In conclusion, PRP improved bone healing in a diaphyseal rabbit model on BG. The combination of PRP and BG may be an effective approach to repair critical defects.

Chronology and regulation of gene expression of RANKL in the rat dental follicle.

PubMed

Liu, D; Yao, S; Pan, F; Wise, G E

2005-10-01

Tooth eruption in the rat requires bone resorption resulting from a major burst of osteoclastogenesis on postnatal day 3 and a minor burst of osteoclastogenesis on postnatal day 10 in the alveolar bone of the first mandibular molar. The dental follicle regulates the major burst on postnatal day 3 by down-regulating its osteoprotegerin (OPG) gene expression to enable osteoclastogenesis to occur. To determine the role of receptor activator of nuclear factor-kappa B ligand (RANKL) in tooth eruption, its gene expression was measured on postnatal days 1-11 in the dental follicle. The results show that RANKL expression was significantly elevated on postnatal days 9-11 in comparison to low expression levels at earlier time-points. As OPG expression is high at this latter time-point, this increase in RANKL expression would be needed for stimulating the minor burst of osteoclastogenesis. Tumor necrosis factor-alpha enhances RANKL gene expression in vitro and it may be responsible for up-regulating RANKL in vivo. Transforming growth factor-beta1 and interleukin-1alpha also enhance RANKL gene expression in vitro but probably have no effect in vivo because they are maximally expressed early. Bone morphogenetic protein-2 acts to down-regulate RANKL expression in vitro and, in vivo, may promote alveolar bone growth in the basal region of the tooth.

Fibroblast growth factor signaling in skeletal development and disease.

PubMed

Ornitz, David M; Marie, Pierre J

2015-07-15

Fibroblast growth factor (FGF) signaling pathways are essential regulators of vertebrate skeletal development. FGF signaling regulates development of the limb bud and formation of the mesenchymal condensation and has key roles in regulating chondrogenesis, osteogenesis, and bone and mineral homeostasis. This review updates our review on FGFs in skeletal development published in Genes & Development in 2002, examines progress made on understanding the functions of the FGF signaling pathway during critical stages of skeletogenesis, and explores the mechanisms by which mutations in FGF signaling molecules cause skeletal malformations in humans. Links between FGF signaling pathways and other interacting pathways that are critical for skeletal development and could be exploited to treat genetic diseases and repair bone are also explored. © 2015 Ornitz and Marie; Published by Cold Spring Harbor Laboratory Press.

Platelet-Rich Plasma Derived Growth Factors Contribute to Stem Cell Differentiation in Musculoskeletal Regeneration.

PubMed

Qian, Yun; Han, Qixin; Chen, Wei; Song, Jialin; Zhao, Xiaotian; Ouyang, Yuanming; Yuan, Weien; Fan, Cunyi

2017-01-01

Stem cell treatment and platelet-rich plasma (PRP) therapy are two significant issues in regenerative medicine. Stem cells such as bone marrow mesenchymal stem cells, adipose-derived stem cells and periodontal ligament stem cells can be successfully applied in the field of tissue regeneration. PRP, a natural product isolated from whole blood, can secrete multiple growth factors (GFs) for regulating physiological activities. These GFs can stimulate proliferation and differentiation of different stem cells in injury models. Therefore, combination of both agents receives wide expectations in regenerative medicine, especially in bone, cartilage and tendon repair. In this review, we thoroughly discussed the interaction and underlying mechanisms of PRP derived GFs with stem cells, and assessed their functions in cell differentiation for musculoskeletal regeneration.

Growth of C57BL/6 mice and the material and mechanical properties of cortical bone from the tibia.

PubMed

Somerville, J M; Aspden, R M; Armour, K E; Armour, K J; Reid, D M

2004-05-01

Murine models are becoming increasingly important for studying skeletal growth and regulation because of the relative ease with which their genomes can be manipulated. This study measured the changes in cortical bone of tibiae from one of the more common models, the C57Bl/6, as a function of aging. A total of 97 mice, male and female, were studied at the ages of 1, 2, 3, 6, 9, and 12 months. The body weight of the animals, the length of the tibiae, the composition (in terms of mineral and organic mass fractions), and the density and modulus of the bone were measured. Peripheral quantitative computed tomography was also used to measure bone mineral density (BMD), total and cortical areas, and the cross-sectional moment of inertia. Most parameters measured followed a growth-like curve, which leveled off some time before 6 months of age. Bone composition and modulus were the same at maturity in both sexes, but there were sex-related differences in the modulus with aging. Dimensional measurements and the density of the bone showed significant differences between male and female animals at all ages, with the male mice having larger values. Skeletal maturity for most factors in C57Bl/6 mice has been reached before the age of 6 months.

[In vitro generation of insulin-producing cells from the neonatal rat bone marrow mesenchymal stem cells].

PubMed

Li, Xiaohu; Huang, Haiyan; Liu, Xirong; Xia, Hongxia; Li, Mincai

2015-03-01

To observe the differentiation of the neonatal rat bone marrow mesenchymal stem cells (MSCs) into insulin-producing cells and detect the expressions of insulin, pancreatic duodenal homebox-1 (PDX-1) and nestin. MSCs were isolated from the neonatal rats and cultured in the modified medium composed of 10 μg/L human epidermal growth factor (EGF), 10 μg/L basic fibroblast growth factor (bFGF), 10 μg/L hepatocyte growth factor (HGF), 10 μg/L human B cell regulin, 20 mmol/L nicotinamide and 20 g/L B27. After the induction, the mRNA expressions of insulin, PDX-1 and nestin were examined by reverse transcription-PCR, and the insulin, PDX-1 and nestin protein levels were detected by immunocytochemistry. The insulin and PDX-1 mRNA expressions increased and the nestin mRNA expression decreased in the differentiation of the neonatal rat MSCs into insulin-producing cells. The nestin, PDX-1 and insulin proteins were co-expressed in insulin-producing cells. MSCs can be induced to differentiate into insulin-producing cells.

Controlled release of TGF-beta 1 from RADA self-assembling peptide hydrogel scaffolds

PubMed Central

Zhou, Ao; Chen, Shuo; He, Bin; Zhao, Weikang; Chen, Xiaojun; Jiang, Dianming

2016-01-01

Bioactive mediators, cytokines, and chemokines have an important role in regulating and optimizing the synergistic action of materials, cells, and cellular microenvironments for tissue engineering. RADA self-assembling peptide hydrogels have been proved to have an excellent ability to promote cell proliferation, wound healing, tissue repair, and drug delivery. Here, we report that D-RADA16 and L-RADA16-RGD self-assembling peptides can form stable second structure and hydrogel scaffolds, affording the slow release of growth factor (transforming growth factor cytokine-beta 1 [TGF-beta 1]). In vitro tests demonstrated that the plateau release amount can be obtained till 72 hours. Moreover, L-RADA16, D-RADA16, and L-RADA16-RGD self-assembling peptide hydrogels containing TGF-beta 1 were used for 3D cell culture of bone mesenchymal stem cells of rats for 2 weeks. The results revealed that these three RADA16 peptide hydrogels had a significantly favorable influence on proliferation of bone mesenchymal stem cells and hold some promise in slow and sustained release of growth factor. PMID:27703332

Identifying the culprit lesion in tumor induced hypophosphatemia, the solution of a clinical enigma.

PubMed

Slot-Steenks, Mathilde M Bruins; Hamdy, Neveen A T; van de Sande, Michiel A J; Vriens, Dennis; Cleven, Arjen H G; Appelman-Dijkstra, Natasha M

2016-12-01

Tumor-induced osteomalacia is a rare acquired metabolic bone disorder characterized by isolated renal phosphate wasting due to abnormal tumor production of fibroblast growth factor 23. We report the case of a 59 year old woman referred to our department with a long history of progressive diffuse muscle weakness and pain, generalized bone pains and multiple insufficiency fractures of heels, ankles and hips due to a hypophosphatemic osteomalacia. A fibroblast growth factor 23-producing phosphaturic mesenchymal tumor localized in the left quadriceps femoris muscle was identified 7 years after onset of symptoms. Excision of the tumor resulted in normalization of serum phosphate and fibroblast growth factor 23 levels and in complete resolution of the clinical picture with disappearance of all musculoskeletal symptoms. This case illustrates the diagnostic difficulties in establishing a diagnosis tumor-induced osteomalacia and in identifying the responsible tumor. Our case underscores the clinical need to investigate all patients with persistent musculoskeletal symptoms for hypophosphatemia. A systematic approach is of pivotal importance because early recognition and treatment of the metabolic abnormality can prevent deleterious effects of osteomalacia on the skeleton.

Role of Bruton's tyrosine kinase (BTK) in growth and metastasis of INA6 myeloma cells

PubMed Central

Bam, R; Venkateshaiah, S U; Khan, S; Ling, W; Randal, S S; Li, X; Zhang, Q; van Rhee, F; Barlogie, B; Epstein, J; Yaccoby, S

2014-01-01

Bruton's tyrosine kinase (BTK) and the chemokine receptor CXCR4 are linked in various hematologic malignancies. The aim of the study was to understand the role of BTK in myeloma cell growth and metastasis using the stably BTK knockdown luciferase-expressing INA6 myeloma line. BTK knockdown had reduced adhesion to stroma and migration of myeloma cells toward stromal cell-derived factor-1. BTK knockdown had no effect on short-term in vitro growth of myeloma cells, although clonogenicity was inhibited and myeloma cell growth was promoted in coculture with osteoclasts. In severe combined immunodeficient-rab mice with contralaterally implanted pieces of bones, BTK knockdown in myeloma cells promoted their proliferation and growth in the primary bone but suppressed metastasis to the contralateral bone. BTK knockdown myeloma cells had altered the expression of genes associated with adhesion and proliferation and increased mammalian target of rapamycin signaling. In 176 paired clinical samples, BTK and CXCR4 expression was lower in myeloma cells purified from a focal lesion than from a random site. BTK expression in random-site samples was correlated with proportions of myeloma cells expressing cell surface CXCR4. Our findings highlight intratumoral heterogeneity of myeloma cells in the bone marrow microenvironment and suggest that BTK is involved in determining proliferative, quiescent or metastatic phenotypes of myeloma cells. PMID:25083818

A Retrospective Tomographic and Histologic Analysis of Horizontal Bone Augmentation in Maxillary Atrophic Ridges Using Resorbable Membrane with Anorganic Bovine Bone-Derived Mineral and Plasma Rich in Growth Factors.

PubMed

Lorenzetti, Massimo; Vono, Maurizio; Lorenzetti, Virginia

2018-02-16

A total of six patients treated from 2010 to 2014, having a knife-edge ridge (Cawood-Howell Class IV resorbed ridges) and requiring an implant-prosthetic rehabilitation, were selected. Tomographic measurement of the edentulous ridges was performed before grafting and after implant placement. At 6 months postgraft, a total of 41 implants had been inserted, 17 in the posterior region, 12 in the central region, and 12 in the anterior region. No surgical or healing complications were recorded, and the prostheses were loaded 6 to 9 months after implant placement. The tomographic measurements demonstrated an increased area in all the sites where bone augmentation had been performed, corresponding to 11.1% in the anterior region, 94.7% in the central region, and 760.2% in the posterior region. Histology was performed in 2 patients, one at 1 year and the other at 5 years postgrafting, and demonstrated the presence of mature lamellar bone tissue and newly formed bone without morphologic signs of necrosis or inflammation and a reduction of 50% to 30% of the grafted material. Although this study included a small number of clinical cases, it demonstrated how management of the atrophic maxillary ridge, with the goal of implant placement, may be handled using a technique that requires a single anorganic bovine bone-derived mineral treatment combined with a plasma rich in growth factors and resorbable collagen membrane.

Periosteum tissue engineering-a review.

PubMed

Li, Nanying; Song, Juqing; Zhu, Guanglin; Li, Xiaoyu; Liu, Lei; Shi, Xuetao; Wang, Yingjun

2016-10-18

As always, the clinical therapy of critical size bone defects caused by trauma, tumor removal surgery or congenital malformation is facing great challenges. Currently, various approaches including autograft, allograft and cell-biomaterial composite based tissue-engineering strategies have been implemented to reconstruct injured bone. However, due to damage during the transplantation processes or design negligence of the bionic scaffolds, these methods expose vulnerabilities without the assistance of periosteum, a bilayer membrane on the outer surface of the bone. Periosteum plays a significant role in bone formation and regeneration as a store for progenitor cells, a source of local growth factors and a scaffold to recruit cells and growth factors, and more and more researchers have recognized its great value in tissue engineering application. Besides direct transplantation, periosteum-derived cells can be cultured on various scaffolds for osteogenesis or chondrogenesis application due to their availability. Research studies also provide a biomimetic methodology to synthesize artificial periosteum which mimic native periosteum in structure or function. According to the studies, these tissue-engineered periostea did obviously enhance the therapeutic effects of bone graft and scaffold engineering while they could be directly used as substitutes of native periosteum. Periosteum tissue engineering, whose related research studies have provided new opportunities for the development of bone tissue engineering and therapy, has gradually become a hot spot and there are still lots to consummate. In this review, tissue-engineered periostea were classified into four kinds and discussed, which might help subsequent researchers get a more systematic view of pseudo-periosteum.

Comparison between autogenous iliac bone and freeze-dried bone allograft for repair of alveolar clefts in the presence of plasma rich in growth factors: A randomized clinical trial.

PubMed

Shirani, Gholamreza; Abbasi, Amir J; Mohebbi, Simin Z; Moharrami, Mohammad

2017-10-01

This study aimed to compare the effectiveness of alveolar cleft repair using iliac bone and freeze-dried bone allograft (FDBA) in the presence of plasma rich in growth factors (PRGF). Patients with unilateral alveolar cleft (n = 32) were randomly allocated to either the iliac plus PRGF group or the FDBA plus PRGF group. CBCT images were obtained before and 6 months after the surgery to assess the regenerated bone volume. Paired t-tests and two-way analysis of variance (ANOVA) were applied to analyze the data using SPSS 16.0 software. The patients' mean age was 15 ± 5.7 years (range = 8-27). In the iliac plus PRGF group, the mean volume of cleft before the surgery and the mean regenerated bone volume 6 months after were 1.67 ± 0.66 and 1.14 ± 0.47 cm 3 , respectively. The corresponding values were 1.5 ± 0.54 and 0.72 ± 0.23 cm 3 in the FDBA plus PRGF group. The remaining bone to cleft volume ratio was not associated with grafting time (secondary or tertiary) and the original cleft volume. Iliac bone reinforced with PRGF was more successful than FDBA plus PRGF in repairing alveolar cleft (p = 0.007). Due to the poor performance of the allograft, autografts should still be preferred in spite of possible donor site morbidity. Copyright © 2017 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

Bone augmentation using a highly porous PLGA/β-TCP scaffold containing fibroblast growth factor-2.

PubMed

Yoshida, T; Miyaji, H; Otani, K; Inoue, K; Nakane, K; Nishimura, H; Ibara, A; Shimada, A; Ogawa, K; Nishida, E; Sugaya, T; Sun, L; Fugetsu, B; Kawanami, M

2015-04-01

Beta-tricalcium phosphate (β-TCP), a bio-absorbable ceramic, facilitates bone conductivity. We constructed a highly porous three-dimensional scaffold, using β-TCP, for bone tissue engineering and coated it with co-poly lactic acid/glycolic acid (PLGA) to improve the mechanical strength and biological performance. The aim of this study was to examine the effect of implantation of the PLGA/β-TCP scaffold loaded with fibroblast growth factor-2 (FGF-2) on bone augmentation. The β-TCP scaffold was fabricated by the replica method using polyurethane foam, then coated with PLGA. The PLGA/β-TCP scaffold was characterized by scanning electron miscroscopy (SEM), transmission electron microscopy (TEM), X-ray diffraction, compressive testing, cell culture and a subcutaneous implant test. Subsequently, a bone-forming test was performed using 52 rats. The β-TCP scaffold, PLGA-coated scaffold, and β-TCP and PLGA-coated scaffolds loaded with FGF-2, were implanted into rat cranial bone. Histological observations were made at 10 and 35 d postsurgery. SEM and TEM observations showed a thin PLGA layer on the β-TCP particles after coating. High porosity (> 90%) of the scaffold was exhibited after PLGA coating, and the compressive strength of the PLGA/β-TCP scaffold was six-fold greater than that of the noncoated scaffold. Good biocompatibility of the PLGA/β-TCP scaffold was found in the culture and implant tests. Histological samples obtained following implantation of PLGA/β-TCP scaffold loaded with FGF-2 showed significant bone augmentation. The PLGA coating improved the mechanical strength of β-TCP scaffolds while maintaining high porosity and tissue compatibility. PLGA/β-TCP scaffolds, in combination with FGF-2, are bioeffective for bone augmentation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

STK-1, the human homolog of Flk-2/Flt-3, is selectively expressed in CD34+ human bone marrow cells and is involved in the proliferation of early progenitor/stem cells.

PubMed Central

Small, D; Levenstein, M; Kim, E; Carow, C; Amin, S; Rockwell, P; Witte, L; Burrow, C; Ratajczak, M Z; Gewirtz, A M

1994-01-01

We cloned the cDNA for stem cell tyrosine kinase 1 (STK-1), the human homolog of murine Flk-2/Flt-3, from a CD34+ hematopoietic stem cell-enriched library and investigated its expression in subsets of normal human bone marrow. The cDNA encodes a protein of 993 aa with 85% identity and 92% similarity to Flk-2/Flt-3. STK-1 is a member of the type III receptor tyrosine kinase family that includes KIT (steel factor receptor), FMS (colony-stimulating factor 1R), and platelet-derived growth factor receptor. STK-1 expression in human blood and marrow is restricted to CD34+ cells, a population greatly enriched for stem/progenitor cells. Anti-STK-1 antiserum recognizes polypeptides of 160 and 130 kDa in several STK-1-expressing cell lines and in 3T3 cells transfected with a STK-1 expression vector. Antisense oligonucleotides directed against STK-1 sequences inhibited hematopoietic colony formation, most strongly in long-term bone marrow cultures. These data suggest that STK-1 may function as a growth factor receptor on hematopoietic stem and/or progenitor cells. Images Fig. 2 Fig. 3 Fig. 4 PMID:7507245

Enhancing proliferation and optimizing the culture condition for human bone marrow stromal cells using hypoxia and fibroblast growth factor-2.

PubMed

Lee, Jung-Seok; Kim, Seul Ki; Jung, Byung-Joo; Choi, Seong-Bok; Choi, Eun-Young; Kim, Chang-Sung

2018-04-01

This study aimed to determine the cellular characteristics and behaviors of human bone marrow stromal cells (hBMSCs) expanded in media in a hypoxic or normoxic condition and with or without fibroblast growth factor-2 (FGF-2) treatment. hBMSCs isolated from the vertebral body and expanded in these four groups were evaluated for cellular proliferation/migration, colony-forming units, cell-surface characterization, in vitro differentiation, in vivo transplantation, and gene expression. Culturing hBMSCs using a particular environmental factor (hypoxia) and with the addition of FGF-2 increased the cellular proliferation rate while enhancing the regenerative potential, modulated the multipotency-related processes (enhanced chondrogenesis-related processes/osteogenesis, but reduced adipogenesis), and increased cellular migration and collagen formation. The gene expression levels in the experimental samples showed activation of the hypoxia-inducible factor-1 pathway and glycolysis in the hypoxic condition, with this not being affected by the addition of FGF-2. The concurrent application of hypoxia and FGF-2 could provide a favorable condition for culturing hBMSCs to be used in clinical applications associated with bone tissue engineering, due to the enhancement of cellular proliferation and regenerative potential. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Bone lengthening for congenital differences of the hands and digits in children.

PubMed

Matsuno, Takahiro; Ishida, Osamu; Sunagawa, Toru; Ichikawa, Makoto; Ikuta, Yoshikazu; Ochi, Mitsuo

2004-07-01

We investigated the growth of bones after lengthening to evaluate the effectiveness and usefulness of bone lengthening in congenital hand deficiencies. Bone lengthening was performed to treat congenital hand deficiencies including hypoplastic thumb, hypoplasia of the small finger, cleft hand, metacarpal synostosis, brachymetacarpia, symbrachydactyly, and amniotic band syndrome. A total of 15 patients (1-13 years old) underwent lengthening of 23 bones. The average of distraction was 10 mm. The mean follow-up period was 59 months. The length of the bones at follow-up evaluation was measured and then compared with the length of the bones immediately after lengthening. The bone growth after lengthening, the percentage of growth after lengthening, and the growth rate were compared among diagnostic groups. In the cases involving older patients the bone length changed little and the growth plates of these patients closed naturally soon after lengthening. In contrast, in the cases in which the patients were younger than 7 years old the lengthened bones grew continuously. The amount of bone growth was different for each disease in the younger patients. In patients with amniotic band syndrome the lengthened bones grew at the same rate as the bones in the hand. Other diagnoses such as symbrachydactyly had a different growth pattern in the hand. We conclude that bone lengthening is a reliable method for the correction of congenital differences of the hand. The indications for this procedure must be determined while considering the relationship between the specific disease and subsequent bone growth.

Pleiotropy of tissue-specific growth factors: from neurons to vessels via the bone marrow

PubMed Central

Duda, Dan G.; Jain, Rakesh K.

2005-01-01

Recent evidence has demonstrated that endothelial-specific growth factors affect the development of apparently unrelated organs and cells. Expanding this evidence further, new findings in this issue of the JCI show that neurotrophic factors can affect neovascularization. Neurotrophic factors achieve proangiogenic effects not only by directly affecting endothelial cells, but also by recruiting hematopoietic precursors. Further understanding of the biology of angiogenic factors, as well as of the function of hematopoietic cells in tissue neovascularization, will lead to improved therapeutic strategies for the treatment of diseases ranging from ischemia to cancer. PMID:15765145

Programmed administration of parathyroid hormone increases bone formation and reduces bone loss in hindlimb-unloaded ovariectomized rats

NASA Technical Reports Server (NTRS)

Turner, R. T.; Evans, G. L.; Cavolina, J. M.; Halloran, B.; Morey-Holton, E.

1998-01-01

Gonadal insufficiency and reduced mechanical usage are two important risk factors for osteoporosis. The beneficial effects of PTH therapy to reverse the estrogen deficiency-induced bone loss in the laboratory rat are well known, but the influence of mechanical usage in this response has not been established. In this study, the effects of programed administration of PTH on cancellous bone volume and turnover at the proximal tibial metaphysis were determined in hindlimb-unloaded, ovariectomized (OVX), 3-month-old Sprague-Dawley rats. PTH was administered to weight-bearing and hindlimb-unloaded OVX rats with osmotic pumps programed to deliver 20 microg human PTH (approximately 80 microg/kg x day) during a daily 1-h infusion for 7 days. Compared with sham-operated rats, OVX increased longitudinal and radial bone growth, increased indexes of cancellous bone turnover, and resulted in net resorption of cancellous bone. Hindlimb unloading of OVX rats decreased longitudinal and radial bone growth, decreased osteoblast number, increased osteoclast number, and resulted in a further decrease in cancellous bone volume compared with those in weight-bearing OVX rats. Programed administration of PTH had no effect on either radial or longitudinal bone growth in weight-bearing and hindlimb-unloaded OVX rats. PTH treatment had dramatic effects on selected cancellous bone measurements; PTH maintained cancellous bone volume in OVX weight-bearing rats and greatly reduced cancellous bone loss in OVX hindlimb-unloaded rats. In the latter animals, PTH treatment prevented the hindlimb unloading-induced reduction in trabecular thickness, but the hormone was ineffective in preventing either the increase in osteoclast number or the loss of trabecular plates. Importantly, PTH treatment increased the retention of a baseline flurochrome label, osteoblast number, and bone formation in the proximal tibial metaphysis regardless of the level of mechanical usage. These findings demonstrate that programed administration of PTH is effective in increasing osteoblast number and bone formation and has beneficial effects on bone volume in the absence of weight-bearing and gonadal hormones. We conclude that the actions of PTH on cancellous bone are independent of the level of mechanical usage.

Effect of Magnolol on the Function of Osteoblastic MC3T3-E1 Cells

PubMed Central

Kwak, Eun Jung; Lee, Young Soon; Choi, Eun Mi

2012-01-01

Objectives. In the present study, the ability of magnolol, a hydroxylated biphenyl compound isolated from Magnolia officinalis, to stimulate osteoblast function and inhibit the release of bone-resorbing mediators was investigated in osteoblastic MC3T3-E1 cells. Methods. Osteoblast function was measured by cell growth, alkaline phosphatase activity, collagen synthesis, and mineralization. Glutathione content was also measured in the cells. Bone-resorbing cytokines, receptor activator of nuclear factor-κB ligand (RANKL), TNF-α, and IL-6 were measured with an enzyme immunoassay system. Results. Magnolol caused a significant elevation of cell growth, alkaline phosphatase activity, collagen synthesis, mineralization, and glutathione content in the cells (P < 0.05). Skeletal turnover is orchestrated by a complex network of regulatory factors. Among cytokines, RANKL, TNF-α, and IL-6 were found to be key osteoclastogenetic molecules produced by osteoblasts. Magnolol significantly (P < 0.05) decreased the production of osteoclast differentiation inducing factors such as RANKL, TNF-α, and IL-6 in the presence of antimycin A, which inhibits mitochondrial electron transport and has been used as an ROS generator. Conclusion. Magnolol might be a candidate as an agent for the prevention of bone disorders such as osteoporosis. PMID:22474400

Insulin-like growth factor-I increases bone sialoprotein (BSP) expression through fibroblast growth factor-2 response element and homeodomain protein-binding site in the proximal promoter of the BSP gene.

PubMed

Nakayama, Youhei; Nakajima, Yu; Kato, Naoko; Takai, Hideki; Kim, Dong-Soon; Arai, Masato; Mezawa, Masaru; Araki, Shouta; Sodek, Jaro; Ogata, Yorimasa

2006-08-01

Insulin-like growth factor-I (IGF-I) promotes bone formation by stimulating proliferation and differentiation of osteoblasts. Bone sialoprotein (BSP), is thought to function in the initial mineralization of bone, is selectively expressed by differentiated osteoblast. To determine the molecular mechanism of IGF-I regulation of osteogenesis, we analyzed the effects of IGF-I on the expression of BSP in osteoblast-like Saos2 and in rat stromal bone marrow (RBMC-D8) cells. IGF-I (50 ng/ml) increased BSP mRNA levels at 12 h in Saos2 cells. In RBMC-D8 cells, IGF-I increased BSP mRNA levels at 3 h. From transient transfection assays, a twofold increase in transcription by IGF-I was observed at 12 h in pLUC3 construct that included the promoter sequence from -116 to +60. Effect of IGF-I was abrogated by 2-bp mutations in either the FGF2 response element (FRE) or homeodomain protein-binding site (HOX). Gel shift analyses showed that IGF-I increased binding of nuclear proteins to the FRE and HOX elements. Notably, the HOX-protein complex was supershifted by Smad1 antibody, while the FRE-protein complex was shifted by Smad1 and Cbfa1 antibodies. Dlx2 and Dlx5 antibodies disrupted the formation of the FRE- and HOX-protein complexes. The IGF-I effects on the formation of FRE-protein complexes were abolished by tyrosine kinase inhibitor herbimycin A (HA), PI3-kinase/Akt inhibitor LY249002, and MAP kinase kinase inhibitor U0126, while IGF-I effects on HOX-protein complexes were abolished by HA and LY249002. These studies demonstrate that IGF-I stimulates BSP transcription by targeting the FRE and HOX elements in the proximal promoter of BSP gene.

Direct Melanoma Cell Contact Induces Stromal Cell Autocrine Prostaglandin E2-EP4 Receptor Signaling That Drives Tumor Growth, Angiogenesis, and Metastasis.

PubMed

Inada, Masaki; Takita, Morichika; Yokoyama, Satoshi; Watanabe, Kenta; Tominari, Tsukasa; Matsumoto, Chiho; Hirata, Michiko; Maru, Yoshiro; Maruyama, Takayuki; Sugimoto, Yukihiko; Narumiya, Shuh; Uematsu, Satoshi; Akira, Shizuo; Murphy, Gillian; Nagase, Hideaki; Miyaura, Chisato

2015-12-11

The stromal cells associated with tumors such as melanoma are significant determinants of tumor growth and metastasis. Using membrane-bound prostaglandin E synthase 1 (mPges1(-/-)) mice, we show that prostaglandin E2 (PGE2) production by host tissues is critical for B16 melanoma growth, angiogenesis, and metastasis to both bone and soft tissues. Concomitant studies in vitro showed that PGE2 production by fibroblasts is regulated by direct interaction with B16 cells. Autocrine activity of PGE2 further regulates the production of angiogenic factors by fibroblasts, which are key to the vascularization of both primary and metastatic tumor growth. Similarly, cell-cell interactions between B16 cells and host osteoblasts modulate mPGES-1 activity and PGE2 production by the osteoblasts. PGE2, in turn, acts to stimulate receptor activator of NF-κB ligand expression, leading to osteoclast differentiation and bone erosion. Using eicosanoid receptor antagonists, we show that PGE2 acts on osteoblasts and fibroblasts in the tumor microenvironment through the EP4 receptor. Metastatic tumor growth and vascularization in soft tissues was abrogated by an EP4 receptor antagonist. EP4-null Ptger4(-/-) mice do not support B16 melanoma growth. In vitro, an EP4 receptor antagonist modulated PGE2 effects on fibroblast production of angiogenic factors. Our data show that B16 melanoma cells directly influence host stromal cells to generate PGE2 signals governing neoangiogenesis and metastatic growth in bone via osteoclast erosive activity as well as angiogenesis in soft tissue tumors. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Direct Melanoma Cell Contact Induces Stromal Cell Autocrine Prostaglandin E2-EP4 Receptor Signaling That Drives Tumor Growth, Angiogenesis, and Metastasis*

PubMed Central

Inada, Masaki; Takita, Morichika; Yokoyama, Satoshi; Watanabe, Kenta; Tominari, Tsukasa; Matsumoto, Chiho; Hirata, Michiko; Maru, Yoshiro; Maruyama, Takayuki; Sugimoto, Yukihiko; Narumiya, Shuh; Uematsu, Satoshi; Akira, Shizuo; Murphy, Gillian; Nagase, Hideaki; Miyaura, Chisato

2015-01-01

The stromal cells associated with tumors such as melanoma are significant determinants of tumor growth and metastasis. Using membrane-bound prostaglandin E synthase 1 (mPges1−/−) mice, we show that prostaglandin E2 (PGE2) production by host tissues is critical for B16 melanoma growth, angiogenesis, and metastasis to both bone and soft tissues. Concomitant studies in vitro showed that PGE2 production by fibroblasts is regulated by direct interaction with B16 cells. Autocrine activity of PGE2 further regulates the production of angiogenic factors by fibroblasts, which are key to the vascularization of both primary and metastatic tumor growth. Similarly, cell-cell interactions between B16 cells and host osteoblasts modulate mPGES-1 activity and PGE2 production by the osteoblasts. PGE2, in turn, acts to stimulate receptor activator of NF-κB ligand expression, leading to osteoclast differentiation and bone erosion. Using eicosanoid receptor antagonists, we show that PGE2 acts on osteoblasts and fibroblasts in the tumor microenvironment through the EP4 receptor. Metastatic tumor growth and vascularization in soft tissues was abrogated by an EP4 receptor antagonist. EP4-null Ptger4−/− mice do not support B16 melanoma growth. In vitro, an EP4 receptor antagonist modulated PGE2 effects on fibroblast production of angiogenic factors. Our data show that B16 melanoma cells directly influence host stromal cells to generate PGE2 signals governing neoangiogenesis and metastatic growth in bone via osteoclast erosive activity as well as angiogenesis in soft tissue tumors. PMID:26475855

Bringing new life to damaged bone: the importance of angiogenesis in bone repair and regeneration.

PubMed

Stegen, Steve; van Gastel, Nick; Carmeliet, Geert

2015-01-01

Bone has the unique capacity to heal without the formation of a fibrous scar, likely because several of the cellular and molecular processes governing bone healing recapitulate the events during skeletal development. A critical component in bone healing is the timely appearance of blood vessels in the fracture callus. Angiogenesis, the formation of new blood vessels from pre-existing ones, is stimulated after fracture by the local production of numerous angiogenic growth factors. The fracture vasculature not only supplies oxygen and nutrients, but also stem cells able to differentiate into osteoblasts and in a later phase also the ions necessary for mineralization. This review provides a concise report of the regulation of angiogenesis by bone cells, its importance during bone healing and its possible therapeutic applications in bone tissue engineering. This article is part of a Special Issue entitled "Stem Cells and Bone". Copyright © 2014 Elsevier Inc. All rights reserved.

Muscle-Bone Interactions in Pediatric Bone Diseases.

PubMed

Veilleux, Louis-Nicolas; Rauch, Frank

2017-10-01

Here, we review the skeletal effects of pediatric muscle disorders as well as muscle impairment in pediatric bone disorders. When starting in utero, muscle disorders can lead to congenital multiple contractures. Pediatric-onset muscle weakness such as cerebral palsy, Duchenne muscular dystrophy, spinal muscular atrophy, or spina bifida typically are associated with small diameter of long-bone shafts, low density of metaphyseal bone, and increased fracture incidence in the lower extremities, in particular, the distal femur. Primary bone diseases can affect muscles through generic mechanisms, such as decreased physical activity or in disease-specific ways. For example, the collagen defect underlying the bone fragility of osteogenesis imperfecta may also affect muscle force generation or transmission. Transforming growth factor beta released from bone in Camurati Engelman disease may decrease muscle function. Considering muscle-bone interactions does not only contribute to the understanding of musculoskeletal disorders but also can identify new targets for therapeutic interventions.

Growth hormone mediates pubertal skeletal development independent of hepatic IGF-1 production.

PubMed

Courtland, Hayden-William; Sun, Hui; Beth-On, Mordechay; Wu, Yingjie; Elis, Sebastien; Rosen, Clifford J; Yakar, Shoshana

2011-04-01

Deficiencies in either growth hormone (GH) or insulin-like growth factor 1 (IGF-1) are associated with reductions in bone size during growth in humans and animal models. Liver-specific IGF-1-deficient (LID) mice, which have 75% reductions in serum IGF-1, were created previously to separate the effects of endocrine (serum) IGF-1 from autocrine/paracrine IGF-1. However, LID mice also have two- to threefold increases in GH, and this may contribute to the observed pubertal skeletal phenotype. To clarify the role of GH in skeletal development under conditions of significantly reduced serum IGF-1 levels (but normal tissue IGF-1 levels), we studied the skeletal response of male LID and control mice to GH inhibition by pegvisomant from 4 to 8 weeks of age. Treatment of LID mice with pegvisomant resulted in significant reductions in body weight, femur length (Le), and femur total area (Tt.Ar), as well as further reductions in serum IGF-1 levels by 8 weeks of age, compared with the mean values of vehicle-treated LID mice. Reductions in both Tt.Ar and Le were proportional after treatment with pegvisomant. On the other hand, the relative amount of cortical tissue formed (RCA) in LID mice treated with pegvisomant was significantly less than that in both vehicle-treated LID and control mice, indicating that antagonizing GH action, either directly (through GH receptor signaling inhibition) or indirectly (through further reductions in serum/tissue IGF-1 levels), results in disproportionate reductions in the amount of cortical bone formed. This resulted in bones with significantly reduced mechanical properties (femoral whole-bone stiffness and work to failure were markedly decreased), suggesting that compensatory increases of GH in states of IGF-1 deficiency (LID mice) act to protect against a severe inhibition of bone modeling during growth, which otherwise would result in bones that are too weak for normal and/or extreme loading conditions. Copyright © 2011 American Society for Bone and Mineral Research.

Cartilage Engineering from Mesenchymal Stem Cells

NASA Astrophysics Data System (ADS)

Goepfert, C.; Slobodianski, A.; Schilling, A. F.; Adamietz, P.; Pörtner, R.

Mesenchymal progenitor cells known as multipotent mesenchymal stromal cells or mesenchymal stem cells (MSC) have been isolated from various tissues. Since they are able to differentiate along the mesenchymal lineages of cartilage and bone, they are regarded as promising sources for the treatment of skeletal defects. Tissue regeneration in the adult organism and in vitro engineering of tissues is hypothesized to follow the principles of embryogenesis. The embryonic development of the skeleton has been studied extensively with respect to the regulatory mechanisms governing morphogenesis, differentiation, and tissue formation. Various concepts have been designed for engineering tissues in vitro based on these developmental principles, most of them involving regulatory molecules such as growth factors or cytokines known to be the key regulators in developmental processes. Growth factors most commonly used for in vitro cultivation of cartilage tissue belong to the fibroblast growth factor (FGF) family, the transforming growth factor-beta (TGF-β) super-family, and the insulin-like growth factor (IGF) family. In this chapter, in vivo actions of members of these growth factors described in the literature are compared with in vitro concepts of cartilage engineering making use of these growth factors.

Osteoblast role in osteoarthritis pathogenesis.

PubMed

Maruotti, Nicola; Corrado, Addolorata; Cantatore, Francesco P

2017-11-01

Even if osteoarthritis pathogenesis is still poorly understood, numerous evidences suggest that osteoblasts dysregulation plays a key role in osteoarthritis pathogenesis. An abnormal expression of OPG and RANKL has been described in osteoarthritis osteoblasts, which is responsible for abnormal bone remodeling and decreased mineralization. Alterations in genes expression are involved in dysregulation of osteoblast function, bone remodeling, and mineralization, leading to osteoarthritis development. Moreover, osteoblasts produce numerous transcription factors, growth factors, and other proteic molecules which are involved in osteoarthritis pathogenesis. © 2017 The Authors. Journal of Cellular Physiology Published by Wiley Periodicals, Inc.

PHYSIOLOGY AND ENDOCRINOLOGY SYMPOSIUM:The effects of poor maternal nutrition during gestation on offspring postnatal growth and metabolism.

PubMed

Hoffman, M L; Reed, S A; Pillai, S M; Jones, A K; McFadden, K K; Zinn, S A; Govoni, K E

2017-05-01

Poor maternal nutrition during gestation has been linked to poor growth and development, metabolic dysfunction, impaired health, and reduced productivity of offspring in many species. Poor maternal nutrition can be defined as an excess or restriction of overall nutrients or specific macro- or micronutrients in the diet of the mother during gestation. Interestingly, there are several reports that both restricted- and over-feeding during gestation negatively affect offspring postnatal growth with reduced muscle and bone deposition, increased adipose accumulation, and metabolic dysregulation through reduced leptin and insulin sensitivity. Our laboratory and others have used experimental models of restricted- and over-feeding during gestation to evaluate effects on early postnatal growth of offspring. Restricted- and over-feeding during gestation alters body size, circulating growth factors, and metabolic hormones in offspring postnatally. Both restricted- and over-feeding alter muscle growth, increase lipid content in the muscle, and cause changes in expression of myogenic factors. Although the negative effects of poor maternal nutrition on offspring growth have been well characterized in recent years, the mechanisms contributing to these changes are not well established. Our laboratory has focused on elucidating these mechanisms by evaluating changes in gene and protein expression, and stem cell function. Through RNA-Seq analysis, we observed changes in expression of genes involved in protein synthesis, metabolism, cell function, and signal transduction in muscle tissue. We recently reported that satellite cells, muscle stem cells, have altered expression of myogenic factors in offspring from restricted-fed mothers. Bone marrow derived mesenchymal stem cells, multipotent cells that contribute to development and maintenance of several tissues including bone, muscle, and adipose, have a 50% reduction in cell proliferation and altered metabolism in offspring from both restricted- and over-fed mothers. These findings indicate that poor maternal nutrition may alter offspring postnatal growth by programming stem cell populations. In conclusion, poor maternal nutrition during gestation negatively affects offspring postnatal growth, potentially through impaired stem and satellite cell function. Therefore, determining the mechanisms that contribute to fetal programming is critical to identifying effective management interventions for these offspring and improving efficiency of production.

[Experimental study on the transforming growth factor β3 combined with dental pulp stem cells in early bone integration of implant].

PubMed

Guzalinuer, Ababaikeli; Muhetaer, Huojia; Wu, H; Paerhati, Abudureheman

2018-04-09

Objective: To establish the experimental model of rabbit mandibular anterior implant repair and evaluate the effects of transforming growth factor (TGF)-β3 and dental pulp stem cells (DPSC) in promoting the bone integration of implant. Methods: The New Zealand rabbits were randomly divided into experimental group, control group and blank group (6 rabbits for each group) . In the experimental group, the implant area was filled with the mixture of TGF-β3, DPSC and Bio-oss powder. In the control group, the implant area was filled with the mixture of DPSC and Bio-oss powder. In the blank group, the implant area was filled with the mixture of phosphate buffer solution and Bio-oss powder. Eighteen New Zealand rabbits were sacrificed in 2 weeks after procedure. The treated alveolar bone tissue was observed. The bone tissue around the implant were estimated by HE staining, immunocytochemical staining and real-time quantitative PCR. Results: The implants were no shedding nor loose. HE staining shows the blank group had a sparse trabecular bone and a small amount of blood vessel around the implant and no obvious new bone formation. The control group showed that the bone trabecula around the implant was sparse and slender, the osteoblasts were arranged linearly around the trabecular bone, a small amount of new bone formation was found around the implant. In the experimental group, there were more thick and dense trabecular bone around the implant, the surrounding osteoblasts were arranged in clusters. The osteoblasts were active and many new bone formed. Typical bone lacunae, bone cells and a large number of new blood vessels can be observed. Immunohistochemistry showed that the proportion of average positive area in the experimental group, control group, blank group were (24.6±5.3) %, (11.3±2.8) % and (7.6±3.8) % respectively. The expression of bone sialoprotein in experimental group were significantly higher than the other 2 groups( P= 0.000). Real-time quantitative PCR results showed that the expression level of Runt-related transcription factor 2 (RUNX2), type Ⅰcollagen (COL-Ⅰ), alkaline phosphatase in the experimental group was higher than in the blank group. The expression level of RUNX2 and COL-Ⅰ in the experimental group was higher than that of the control group ( P= 0.023). Conclusions: TGF-β3 has potential to promote the transformation of DPSC into osteoblasts, which can promote the integration of bone around the implant.

Optimization of culture conditions for stem cells derived from human anterior cruciate ligament and bone marrow.

PubMed

Cheng, Ming-Te; Liu, Chien-Lin; Chen, Tain-Hsiung; Lee, Oscar K

2014-01-01

Tissue engineering with stem cells is a fascinating approach for treating anterior cruciate ligament (ACL) injuries. In our previous study, stem cells isolated from the human anterior cruciate ligament were shown to possess extensive proliferation and differentiation capabilities when treated with specific growth factors. However, optimal culture conditions and the usefulness of fetal bovine serum (FBS) as a growth factor in in vitro culture systems are yet to be determined. In this study, we compared the effects of different culture media containing combinations of various concentrations of FBS and the growth factors basic fibroblastic growth factor (bFGF) and transforming growth factor-β1 (TGF-β1) on the proliferation and differentiation of ligament-derived stem cells (LSCs) and bone marrow mesenchymal stem cells (BMSCs). We found that α-MEM plus 10% FBS and bFGF was able to maintain both LSCs and BMSCs in a relatively undifferentiated state but with lower major extracellular matrix (ECM) component gene expression and protein production, which is beneficial for stem cell expansion. However, the differentiation and proliferation potentials of LSCs and BMSCs were increased when cultured in MesenPRO, a commercially available stem cell medium containing 2% FBS. MesenPRO in conjunction with TGF-β1 had the greatest ability to induce the differentiation of BMSCs and LSCs to ligament fibroblasts, which was evidenced by the highest ligamentous ECM gene expression and protein production. These results indicate that culture media and growth factors play a very important role in the success of tissue engineering. With α-MEM plus 10% FBS and bFGF, rapid proliferation of stem cells can be achieved. In this study, MesenPRO was able to promote differentiation of both LSCs and BMSCs to ligament fibroblasts. Differentiation was further increased by TGF-β1. With increasing understanding of the effects of different culture media and growth factors, manipulation of stem cells in the desired direction for ligament tissue engineering can be achieved.

PDGF-B Gene Therapy Accelerates Bone Engineering and Oral Implant Osseointegration

PubMed Central

Chang, Po-Chun; Seol, Yang-Jo; Cirelli, Joni A; Pellegrini, Gaia R.; Jin, Qiming; Franco, Lea M.; Goldstein, Steven A.; Chandler, Lois A.; Sosnowski, Barbara; Giannobile, William V.

2009-01-01

Platelet-derived growth factor-BB (PDGF-BB) stimulates repair of healing-impaired chronic wounds such as diabetic ulcers and periodontal lesions. However, limitations in predictability of tissue regeneration occur due in part to transient growth factor bioavailability in vivo. Here, we report that gene delivery of PDGF-B stimulates repair of oral implant extraction socket defects. Alveolar ridge defects were created in rats and were treated at the time of titanium implant installation with a collagen matrix containing an adenoviral (Ad) vector encoding PDGF-B (5.5×108 or 5.5×109 pfu/ml), Ad encoding luciferase (Ad-Luc; 5.5×109 pfu/ml; control) or recombinant human PDGF-BB protein (rhPDGF-BB, 0.3 mg/ml). Bone repair and osseointegration were measured via backscattered SEM, histomorphometry, microcomputed tomography, and biomechanical assessments. Further, a panel of local and systemic safety assessments was performed. Results demonstrated bone repair was accelerated by Ad-PDGF-B and rhPDGF-BB delivery compared to Ad-Luc, with the high dose of Ad-PDGF-B more effective than the low dose. No significant dissemination of the vector construct or alteration of systemic parameters was noted. In summary, gene delivery of Ad-PDGF-B demonstrates regenerative and safety capabilities for bone tissue engineering and osseointegration in alveolar bone defects comparable to rhPDGF-BB protein delivery in vivo. PMID:19741730