Alterations in Anatomical Covariance in the Prematurely Born.

PubMed

Scheinost, Dustin; Kwon, Soo Hyun; Lacadie, Cheryl; Vohr, Betty R; Schneider, Karen C; Papademetris, Xenophon; Constable, R Todd; Ment, Laura R

2017-01-01

Preterm (PT) birth results in long-term alterations in functional and structural connectivity, but the related changes in anatomical covariance are just beginning to be explored. To test the hypothesis that PT birth alters patterns of anatomical covariance, we investigated brain volumes of 25 PTs and 22 terms at young adulthood using magnetic resonance imaging. Using regional volumetrics, seed-based analyses, and whole brain graphs, we show that PT birth is associated with reduced volume in bilateral temporal and inferior frontal lobes, left caudate, left fusiform, and posterior cingulate for prematurely born subjects at young adulthood. Seed-based analyses demonstrate altered patterns of anatomical covariance for PTs compared with terms. PTs exhibit reduced covariance with R Brodmann area (BA) 47, Broca's area, and L BA 21, Wernicke's area, and white matter volume in the left prefrontal lobe, but increased covariance with R BA 47 and left cerebellum. Graph theory analyses demonstrate that measures of network complexity are significantly less robust in PTs compared with term controls. Volumes in regions showing group differences are significantly correlated with phonological awareness, the fundamental basis for reading acquisition, for the PTs. These data suggest both long-lasting and clinically significant alterations in the covariance in the PTs at young adulthood. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Testicular size at weaning in tropically-adapted beef bulls as influenced by breed of sire and dam.

PubMed

Browning, R; Warrington, B G; Holloway, J W; Randel, R D

1997-07-15

This study was conducted to evaluate testicular size at weaning for bulls representing diverse tropically-adapted genotypes. Calves from 2 locations were weighed and castrated at weaning. In one herd, calves were born to Brahman dams and Angus, Tuli, and Brahman sires. Body weights and paired testes weights were heavier (P < 0.01) for Angus x Brahman (AB) genotype than for Tuli x Brahman (TB) and purebred Brahman (BB) genotype calves. The testes:body weight ratio was greater (P < 0.01) for AB than for TB and BB calves. In a second herd, calves were born to Angus cows and Brahman, Tuli, and Senepol sires. Means were similar between Brahman- (BA), Tuli-(TA), and Senepol-sired (SA) calves for body weight and testes:body weight ratio. Paired testes weight was heavier (P < 0.05) for SA than BA calves. Across locations, paired testes weights were heavier (P < 0.01) for TA than TB calves but their body weights were similar. Within-herd deviations were greater (P < 0.01) for AB than BA calves for paired testes weight and testes:body weight ratio. The correlation between the proportion of Bos indicus genetic contribution and testes:body weight ratio was significantly negative. Tropically-adapted calves differed in testicular size at weaning due to breed of sire and dam effects.

Basolateral K channels in an insect epithelium. Channel density, conductance, and block by barium

PubMed Central

Hanrahan, JW; Wills, NK; Phillips, JE; Lewis, SA

1986-01-01

K channels in the basolateral membrane of insect hindgut were studied using current fluctuation analysis and microelectrodes. Locust recta were mounted in Ussing-type chambers containing Cl-free saline and cyclic AMP (cAMP). A transepithelial K current was induced by raising serosal [K] under short-circuit conditions. Adding Ba to the mucosal (luminal) side under these conditions had no effect; however, serosal Ba reversibly inhibited the short-circuit current (Isc), increased transepithelial resistance (Rt), and added a Lorentzian component to power density spectra of the Isc. A nonlinear relationship between corner frequency and serosal [Ba] was observed, which suggests that the rate constant for Ba association with basolateral channels increased as [Ba] was elevated. Microelectrode experiments revealed that the basolateral membrane hyperpolarized when Ba was added: this change in membrane potential could explain the nonlinearity of the 2 pi fc vs. [Ba] relationship if external Ba sensed about three-quarters of the basolateral membrane field. Conventional microelectrodes were used to determine the correspondence between transepithelially measured current noise and basolateral membrane conductance fluctuations, and ion-sensitive microelectrodes were used to measure intracellular K activity (acK). From the relationship between the net electrochemical potential for K across the basolateral membrane and the single channel current calculated from noise analysis, we estimate that the conductance of basolateral K channels is approximately 60 pS, and that there are approximately 180 million channels per square centimeter of tissue area. PMID:2420918

Screening of bat faeces for arthropod-borne apicomplexan protozoa: Babesia canis and Besnoitia besnoiti-like sequences from Chiroptera.

PubMed

Hornok, Sándor; Estók, Péter; Kováts, Dávid; Flaisz, Barbara; Takács, Nóra; Szőke, Krisztina; Krawczyk, Aleksandra; Kontschán, Jenő; Gyuranecz, Miklós; Fedák, András; Farkas, Róbert; Haarsma, Anne-Jifke; Sprong, Hein

2015-08-28

Bats are among the most eco-epidemiologically important mammals, owing to their presence in human settlements and animal keeping facilities. Roosting of bats in buildings may bring pathogens of veterinary-medical importance into the environment of domestic animals and humans. In this context bats have long been studied as carriers of various pathogen groups. However, despite their close association with arthropods (both in their food and as their ectoparasites), only a few molecular surveys have been published on their role as carriers of vector-borne protozoa. The aim of the present study was to compensate for this scarcity of information. Altogether 221 (mostly individual) bat faecal samples were collected in Hungary and the Netherlands. The DNA was extracted, and analysed with PCR and sequencing for the presence of arthropod-borne apicomplexan protozoa. Babesia canis canis (with 99-100% homology) was identified in five samples, all from Hungary. Because it was excluded with an Ixodidae-specific PCR that the relevant bats consumed ticks, these sequences derive either from insect carriers of Ba. canis, or from the infection of bats. In one bat faecal sample from the Netherlands a sequence having the highest (99%) homology to Besnoitia besnoiti was amplified. These findings suggest that some aspects of the epidemiology of canine babesiosis are underestimated or unknown, i.e. the potential role of insect-borne mechanical transmission and/or the susceptibility of bats to Ba. canis. In addition, bats need to be added to future studies in the quest for the final host of Be. besnoiti.

Half-metallic ferromagnetism in Fe, Co and Ni doped BaS: First principles calculations

NASA Astrophysics Data System (ADS)

Maurya, Savita; Sharma, Ramesh; Bhamu, K. C.

2018-04-01

The first principle investigation of structural, electronic, magnetic and optical properties of Ba1-xTMxS (x = 0.25) have been done using FPLAW method within the density functional theory (DFT) using generalized gradient approximation (GGA) for exchange correlation potential using two different functionals which are the PBE-sol and the modified Becke and Johnson local (spin) density approximation (mBJLDA). It was found that mBJLDA functional offer better account for the electronic structure of the Fe, Co and Ni-doped BaS. It was also observed that Fe/Co/Ni d, S p and Ba d states play a major role in determining the electronic properties of this alloy system. Investigation results shows that Ba0.75(Fe/Co/Ni)0.25S is ferromagnetic with magnetic moment of 3.72 µB, 2.73908 µB and 1.74324 µB at Fe, Co and Ni sites respectively. Complex dielectric constant ɛ(ω) and normal incidence reflectivity R(ω) are also been investigate for broad range of photon energies. These results are compared with the some reported existing experimental values.

The Ba 4d-4f giant dipole resonance in complex Ba/Si compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sahle, Ch. J.; Sternemann, C.; Sternemann, H.

2014-08-06

The shape of the Ba 4d–4f giant dipole resonance is studied for Ba atoms embedded inside complex Si networks covering structures consisting of Si nanocages and nanotubes, i.e. the clathrate Ba 8Si 46, the complex compound BaSi 6, and the semiconducting BaSi 2. Here, non-resonant x-ray Raman scattering is used to investigate confinement effects on the shape of the giant resonance in the vicinity of the Ba NIV, V-edge. The distinct momentum transfer dependence of the spectra is analyzed and discussed. The measurements are compared to calculations of the giant resonance within time-dependent local density approximation in the dipole limit.more » No modulation of the giant resonance's shape for Ba atoms confined in different local environments was observed, in contrast to the calculations. The absence of such shape modulation for complex Ba/Si compounds is discussed providing important implications for further studies of giant resonance phenomena utilizing both theory and experiment.« less

The Ba 4d-4f giant dipole resonance in complex Ba/Si compounds

NASA Astrophysics Data System (ADS)

Sahle, Ch J.; Sternemann, C.; Sternemann, H.; Tse, J. S.; Gordon, R. A.; Desgreniers, S.; Maekawa, S.; Yamanaka, S.; Lehmkühler, F.; Wieland, D. C. F.; Mende, K.; Huotari, S.; Tolan, M.

2014-02-01

The shape of the Ba 4d-4f giant dipole resonance is studied for Ba atoms embedded inside complex Si networks covering structures consisting of Si nanocages and nanotubes, i.e. the clathrate Ba8Si46, the complex compound BaSi6, and the semiconducting BaSi2. Here, non-resonant x-ray Raman scattering is used to investigate confinement effects on the shape of the giant resonance in the vicinity of the Ba NIV, V-edge. The distinct momentum transfer dependence of the spectra is analyzed and discussed. The measurements are compared to calculations of the giant resonance within time-dependent local density approximation in the dipole limit. No modulation of the giant resonance’s shape for Ba atoms confined in different local environments was observed, in contrast to the calculations. The absence of such shape modulation for complex Ba/Si compounds is discussed providing important implications for further studies of giant resonance phenomena utilizing both theory and experiment.

Born approximation for scattering by evanescent waves: Comparison with exact scattering by an infinite fluid cylinder

NASA Astrophysics Data System (ADS)

Marston, Philip L.

2004-05-01

In some situations, evanescent waves can be an important component of the acoustic field within the sea bottom. For this reason (as well as to advance the understanding of scattering processes) it can be helpful to examine the modifications to scattering theory resulting from evanescence. Modifications to ray theory were examined in a prior approximation [P. L. Marston, J. Acoust. Soc. Am. 113, 2320 (2003)]. The new research concerns the modifications to the low-frequency Born approximation and confirmation by comparison with the exact two-dimensional scattering by a fluid cylinder. In the case of a circular cylinder having the same density as the surroundings but having a compressibility contrast with the surroundings, the Born approximation with a nonevanescent incident wave gives only monopole scattering. When the cylinder has a density contrast and the same compressibility as the surroundings the regular Born approximation gives only dipole scattering (with the dipole oriented along to the incident wavevector). In both cases when the Born approximation is modified to include the evanescence of the incident wave, an additional dipole scattering term is evident. In each case the new dipole is oriented along to the decay axis of the evanescent wave. [Research supported by ONR.

Effects of temperature and storage time on resting populations of Escherichia coli 0157:H7 and Pseudomonas flurorescens in vitro

USDA-ARS?s Scientific Manuscript database

Assessment of microbial interactions is crucial for documenting bacterial growth in pure and mixed cultures and their potential for biological applications. Pseudomonas fluorescens (non-plant pathogenic and non-pectinolytic) has been used as a biocontrol microbe for plant pathogens and food-borne ba...

Birth asphyxia: a major cause of early neonatal mortality in a Tanzanian rural hospital.

PubMed

Ersdal, Hege Langli; Mduma, Estomih; Svensen, Erling; Perlman, Jeffrey

2012-05-01

Early neonatal mortality within the first 24 hours contributes substantially to overall neonatal mortality rates. The definition of birth asphyxia (BA) is imprecise, and reliable cause-specific mortality data are limited; thus the estimated proportion of BA-related deaths globally remains questionable. The objective was to determine the presumed causes of neonatal death within the first 24 hours in a rural hospital in Northern Tanzania. This is a prospective descriptive observational study conducted in the delivery room and adjacent neonatal area. Research assistants were trained to observe and record events related to labor, neonatal resuscitation, and 24-hour postnatal course. BA was defined as failure to initiate spontaneous respirations and/or 5-minute Apgar score <7, prematurity as gestational age <36 weeks, and low birth weight (LBW) as birth weight <3rd centile for gestational age. Data were analyzed with χ(2) and Student's t tests. Over 1 year, 4720 infants were born and evaluated. Of these, 256 were admitted to the neonatal area. Forty-nine infants died secondary to BA (61%), prematurity (18%), LBW (8%), infection (2%), congenital abnormalities (8%), and unclear reason (2%). The 5-minute Apgar score was ≥7 in 50% of the infants who died secondary to BA. Most cases of early neonatal mortality were related to BA, and prematurity and LBW are additional important considerations. Reducing perinatal mortality requires a multifaceted approach with attention to issues related to BA, potential complications of prematurity, and LBW. The 5-minute Apgar score is a poor surrogate of BA.

First-principles evaluation of electronic and optical properties of (Mo, C) codoped BaHfO3 for applications in photocatalysis

NASA Astrophysics Data System (ADS)

Akhtar, Shaheen; Alay-e-Abbas, Syed Muhammad; Abbas, Syed Muhammad Ghulam; Arshad, Muhammad Imran; Batool, Javaria; Amin, Nasir

2018-04-01

In this paper, we report first-principles spin-polarized density functional theory calculations for exploring the effect of aliovalent Mo and C dopants on the electronic properties and photocatalysis potential of doped modifications of wide-bandgap cubic perovskite oxide BaHfO3 for water splitting. The structural and thermodynamic properties are computed by using the generalized gradient approximation, whereas the modified Becke-Johnson local density approximation is used to calculate the electronic structures of pristine, cation (Mo), and anion (C) monodoped and cation-anion (Mo, C) codoped BaHfO3. The spin-polarized calculations reveal that substitutional dopants CO and MoHf in the BaHfO3 lattice are thermodynamically stable. The incorporation of C in the O site reduces the bandgap of BaHfO3 and acts as a double-acceptor system, whereas a metallic character is obtained when Mo is doped into the Hf site giving rise to a double-donor system. We show that the acceptor and donor states of the C- and Mo-monodoped BaHfO3 can be passivated by (Mo, C) codoping at nearest-neighbor Hf and O sites of the BaHfO3 lattice, respectively. Analysis of the calculated electronic structure and optical absorption of (Mo, C) codoped BaHfO3 with reference to the H2O oxidation and reduction potentials reveals that this system is a suitable candidate for efficient splitting of water through photocatalysis in the visible region of the electromagnetic spectrum.

Collisional excitation of the highly excited hydrogen atoms in the dipole form of the semiclassical impact parameter and Born approximations

NASA Technical Reports Server (NTRS)

Omidvar, K.

1971-01-01

Expressions for the excitation cross section of the highly excited states of the hydrogenlike atoms by fast charged particles have been derived in the dipole approximation of the semiclassical impact parameter and the Born approximations, making use of a formula for the asymptotic expansion of the oscillator strength of the hydrogenlike atoms given by Menzel. When only the leading term in the asymptotic expansion is retained, the expression for the cross section becomes identical to the expression obtained by the method of the classical collision and correspondence principle given by Percival and Richards. Comparisons are made between the Bethe coefficients obtained here and the Bethe coefficients of the Born approximation for transitions where the Born calculation is available. Satisfactory agreement is obtained only for n yields n + 1 transitions, with n the principal quantum number of the excited state.

Topics in electron capture by fast ions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hsin, S.H.

1987-01-01

The post-collision interaction (PCI) model was applied, together with the eikonal approximation, to study the (n = 2,3) capture cross sections in p + H(ls) collisions. The results indeed improve the previous eikonal calculations for l = 0 cases, and agree quite well with present experimental data. Calculations using the strong-potential Born (SPB) approximation, with the Sil and McGuire technique, for capture into the np, nd levels are also presented. While these cross sections are smaller than cross sections for capture into the ns levels at high velocities, nevertheless the Thomas peak is clearly evident in both the absolute valuemore » m = 2, absolute value m = 1 and m = 0 magnetic substates in p + H(ls) collisions. Also calculated were corrections to the SPB using the Distorted-Wave Born formalism of Taulbjerg and Briggs. In the sense of a plane-wave Born expansion, all terms of the third Born approximation and all single switching fourth Born terms are included, but a peaking approximation is needed to reduce the calculation to tractable form. Effects of the higher terms are most visible in the valley between the Thomas peak and the forward peak. The Thomas peak is visible in the correction term, even though it includes no second Born contributions.« less

Beta-gamma spectroscopy of the neutron-rich 150Ba

NASA Astrophysics Data System (ADS)

Yokoyama, R.; Ideguchi, E.; Simpson, G. S.; Tanaka, Mn; Nishimura, S.; Doornenbal, P.; Lorusso, G.; Söderström, P.-A.; Sumikama, T.; Wu, J.; Xu, Z. Y.; Aoi, N.; Baba, H.; Bello Garrote, F. L.; Benzoni, G.; Browne, F.; Daido, R.; Fang, Y.; Fukuda, N.; Gottardo, A.; Gey, G.; Go, S.; Inabe, N.; Isobe, T.; Kameda, D.; Kobayashi, K.; Kobayashi, M.; Kojouharov, I.; Komatsubara, T.; Kubo, T.; Kurz, N.; Kuti, I.; Li, Z.; Matsushita, M.; Michimasa, S.; Moon, C. B.; Nishibata, H.; Nishizuka, I.; Odahara, A.; Patel, Z.; Rice, S.; Sahin, E.; Sakurai, H.; Schaffner, H.; Sinclair, L.; Suzuki, H.; Takeda, H.; Taprogge, J.; Vajta, Zs; Watanabe, H.; Yagi, A.; Inakura, T.

2018-04-01

Excited states in the neutron-rich nucleus ^{150}Ba have been observed via β-γ spectroscopy at the Radioactive Isotope Beam Factory, RIKEN Nishina Center. The ^{150}Ba ions were produced by the in-flight fission of a ^{238}U beam with an energy of 345 MeV/nucleon. The E(2+) energy of ^{150}Ba was identified at 100 keV, which is the lowest known in the neutron-rich Ba isotopes. A γ-ray peak was also observed at 597 keV. A mean-field calculation with a fully 3D real space was performed and a static octupole deformation was obtained for the Ba isotopes. K^{π}=0- and 1- excited states with significant octupole collectivity were newly predicted at around or lower than 1 MeV on the ground state of ^{150}Ba by a random-phase approximation calculation. The 597 keV γ ray can be interpreted as a negative-parity state, showing that ^{150}Ba may possess octupole collectivity.

An integrated model to simulate the scattering of ultrasounds by inclusions in steels.

PubMed

Darmon, Michel; Calmon, Pierre; Bèle, Bertrand

2004-04-01

We present a study performed to model and predict the ultrasonic response of alumina inclusions in steels. The Born and the extended quasistatic approximations have been applied and modified to improve their accuracy in the framework of this application. The modified Born approximation, called "doubly distorted wave (D(2)W) Born approximation" allowing to deal with various inclusion shapes, has been selected to be implemented in the CIVA software. The model reliability has been evaluated by comparison with Ying and Truell's exact analytical solution. In parallel, measurements have been carried out upon both natural and artificial alumina inclusions.

Crystal growth of incommensurate members of 2H-hexagonal perovskite related oxides: Ba{sub 4}M{sub z}Pt{sub 3−z}O{sub 9} (M=Co, Ni, Cu, Zn, Mg, Pt)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ferreira, Timothy; Morrison, Gregory; Yeon, Jeongho

2016-04-15

Millimeter sized crystals of six oxides of approximate composition Ba{sub 4}M{sub z}Pt{sub 3-z}O{sub 9} (M=Co, Ni, Cu, Zn, Mg, Pt) were grown from molten K{sub 2}CO{sub 3} fluxes and found to crystallize in a 2H hexagonal perovskite-related structure type. The compositions of these incommensurate structures, which belong to the A{sub 3n+3m}A′{sub n}B{sub 3m+n}O{sub 9m+6n} family of 2H hexagonal perovskite related oxides, were characterized by X-ray diffraction, energy dispersive spectroscopy, and magnetic susceptibility measurements. The specific synthetic considerations, crystal growth conditions, and magnetic susceptibility measurements are discussed. - Graphical abstract: SEM image and average commensurate unit cell of Ba{sub 4}Pt{sub 3}O{submore » 9.} - Highlights: • Single crystals of the series Ba{sub 4}A′{sub z}Pt{sub 3-z}O{sub 9} were grown via a molten carbonate flux. • Ba{sub 4}Pt{sub 3}O{sub 9} and all substitutional variants are incommensurate, composite structures. • All compounds have an approximate stoichiometry of Ba{sub 4}A′Pt{sub 2}O{sub 9.}.« less

William Wolfgang Brickman, 1913-86.

ERIC Educational Resources Information Center

Parker, Franklin

William Wolfgang Brickman, founding member and President, 1956-59, of the Comparative and International Education Society, died June 22, 1986, in a Philadelphia hospital leukemia unit. Born June 30, 1913, in New York City, he attended city schools and earned B.A. and M.S. degrees at City College, a New York University Ph.D. and an honorary M.A.…

R. Burl Yarberry

ERIC Educational Resources Information Center

Nishimoto, Warren

2007-01-01

R. Burl Yarberry was born in 1920 in Pueblo, Colorado. He attended public schools in Pueblo and graduated from high school in 1938. After a year attending the Colorado School of Mines, he enlisted in the U.S. Marine Corps and served in the Pacific during World War II. Following his discharge, he earned a BA in English from Western State College of…

Validity of the Born approximation for beyond Gaussian weak lensing observables

DOE PAGES

Petri, Andrea; Haiman, Zoltan; May, Morgan

2017-06-06

Accurate forward modeling of weak lensing (WL) observables from cosmological parameters is necessary for upcoming galaxy surveys. Because WL probes structures in the nonlinear regime, analytical forward modeling is very challenging, if not impossible. Numerical simulations of WL features rely on ray tracing through the outputs of N-body simulations, which requires knowledge of the gravitational potential and accurate solvers for light ray trajectories. A less accurate procedure, based on the Born approximation, only requires knowledge of the density field, and can be implemented more efficiently and at a lower computational cost. In this work, we use simulations to show thatmore » deviations of the Born-approximated convergence power spectrum, skewness and kurtosis from their fully ray-traced counterparts are consistent with the smallest nontrivial O(Φ 3) post-Born corrections (so-called geodesic and lens-lens terms). Our results imply a cancellation among the larger O(Φ 4) (and higher order) terms, consistent with previous analytic work. We also find that cosmological parameter bias induced by the Born-approximated power spectrum is negligible even for a LSST-like survey, once galaxy shape noise is considered. When considering higher order statistics such as the κ skewness and kurtosis, however, we find significant bias of up to 2.5σ. Using the LensTools software suite, we show that the Born approximation saves a factor of 4 in computing time with respect to the full ray tracing in reconstructing the convergence.« less

Validity of the Born approximation for beyond Gaussian weak lensing observables

NASA Astrophysics Data System (ADS)

Petri, Andrea; Haiman, Zoltán; May, Morgan

2017-06-01

Accurate forward modeling of weak lensing (WL) observables from cosmological parameters is necessary for upcoming galaxy surveys. Because WL probes structures in the nonlinear regime, analytical forward modeling is very challenging, if not impossible. Numerical simulations of WL features rely on ray tracing through the outputs of N -body simulations, which requires knowledge of the gravitational potential and accurate solvers for light ray trajectories. A less accurate procedure, based on the Born approximation, only requires knowledge of the density field, and can be implemented more efficiently and at a lower computational cost. In this work, we use simulations to show that deviations of the Born-approximated convergence power spectrum, skewness and kurtosis from their fully ray-traced counterparts are consistent with the smallest nontrivial O (Φ3) post-Born corrections (so-called geodesic and lens-lens terms). Our results imply a cancellation among the larger O (Φ4) (and higher order) terms, consistent with previous analytic work. We also find that cosmological parameter bias induced by the Born-approximated power spectrum is negligible even for a LSST-like survey, once galaxy shape noise is considered. When considering higher order statistics such as the κ skewness and kurtosis, however, we find significant bias of up to 2.5 σ . Using the LensTools software suite, we show that the Born approximation saves a factor of 4 in computing time with respect to the full ray tracing in reconstructing the convergence.

Potential variations around grain boundaries in impurity-doped BaSi₂ epitaxial films evaluated by Kelvin probe force microscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsukahara, D.; Baba, M.; Honda, S.

2014-09-28

Potential variations around the grain boundaries (GBs) in antimony (Sb)-doped n-type and boron (B)-doped p-type BaSi₂ epitaxial films on Si(111) were evaluated by Kelvin probe force microscopy. Sb-doped n-BaSi₂ films exhibited positively charged GBs with a downward band bending at the GBs. The average barrier height for holes was approximately 10 meV for an electron concentration n ≈ 10¹⁷ cm⁻³. This downward band bending changed to upward band bending when n was increased to n = 1.8 × 10¹⁸cm⁻³. In the B-doped p-BaSi₂ films, the upward band bending was observed for a hole concentration p ≈ 10¹⁸cm⁻³. The average barriermore » height for electrons decreased from approximately 25 to 15 meV when p was increased from p = 2.7 × 10¹⁸ to p = 4.0 × 10¹⁸ cm⁻³. These results are explained under the assumption that the position of the Fermi level E{sub f} at GBs depends on the degree of occupancy of defect states at the GBs, while E{sub f} approached the bottom of the conduction band or the top of the valence band in the BaSi₂ grain interiors with increasing impurity concentrations. In both cases, such small barrier heights may not deteriorate the carrier transport properties. The electronic structures of impurity-doped BaSi₂ are also discussed using first-principles pseudopotential method to discuss the insertion sites of impurity atoms and clarify the reason for the observed n-type conduction in the Sb-doped BaSi₂ and p-type conduction in the B-doped BaSi₂.« less

Technique for evaluation of the strong potential Born approximation for electron capture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sil, N.C.; McGuire, J.H.

1985-04-01

A technique is presented for evaluating differential cross sections in the strong potential Born (SPB) approximation. Our final expression is expressed as a finite sum of one-dimensional integrals, expressible as a finite sum of derivatives of hypergeometric functions.

Variationally consistent approximation scheme for charge transfer

NASA Technical Reports Server (NTRS)

Halpern, A. M.

1978-01-01

The author has developed a technique for testing various charge-transfer approximation schemes for consistency with the requirements of the Kohn variational principle for the amplitude to guarantee that the amplitude is correct to second order in the scattering wave functions. Applied to Born-type approximations for charge transfer it allows the selection of particular groups of first-, second-, and higher-Born-type terms that obey the consistency requirement, and hence yield more reliable approximation to the amplitude.

Energy transfer between Eu-Mn and photoluminescence properties of Ba0.75Al11O17.25-BaMgAl10O17:Eu2+,Mn2+ solid solution

NASA Astrophysics Data System (ADS)

Zhou, Jun; Wang, Yuhua; Liu, Bitao; Li, Feng

2010-08-01

In order to evaluate the energy transfer between Eu-Mn in Ba0.75Al11O17.25-BaMgAl10O17 solid solution, Ba0.75Al11O17.25-BaMgAl10O17:Eu2+,Mn2+ phosphors were prepared by flux method. The crystal structure and the morphology of the solid solution were demonstrated by x-ray dirrfactometer and scanning electron microscopy. The photoluminescence mechanisms were explained by the energy transfer of Eu2+ to Mn2+ and the Dexter theory. A redshift of green emission peak and a decrease in decay time with the increase in Mn2+ concentration were observed. These phenomena are attributed to the formation of Mn2+ paired centers after analysis by a method of Pade approximations.

Richard L. Hurley, 1934-2008

Treesearch

Justin Runyon

2008-01-01

Richard Lester Hurley, dolichopodid worker and friend to everyone, passed away on September 3rd at the age of 74. He was born on June 22, 1934 in Sault Ste. Marie, Ontario and received a B.A. in biology from Queen's University in Kingston, Ontario in 1957. For his senior thesis, he conducted an insect survey of the Lake Opinicon region. Rich spent the summers of...

Synthesis of new visible light active photocatalysts of Ba(In(1/3)Pb(1/3)M'(1/3))O3 (M' = Nb, Ta): a band gap engineering strategy based on electronegativity of a metal component.

PubMed

Hur, Su Gil; Kim, Tae Woo; Hwang, Seong-Ju; Park, Hyunwoong; Choi, Wonyong; Kim, Sung Jin; Kim, Sun Jin; Choy, Jin-Ho

2005-08-11

We have synthesized new, efficient, visible light active photocatalysts through the incorporation of highly electronegative non-transition metal Pb or Sn ions into the perovskite lattice of Ba(In(1/3)Pb(1/3)M'(1/3))O3 (M = Sn, Pb; M' = Nb, Ta). X-ray diffraction, X-ray absorption spectroscopic, and energy dispersive spectroscopic microprobe analyses reveal that tetravalent Pb or Sn ions exist in the B-site of the perovskite lattice, along with In and Nb/Ta ions. According to diffuse UV-vis spectroscopic analysis, the Pb-containing quaternary metal oxides Ba(In(1/3)Pb(1/3)M'(1/3))O3 possess a much narrower band gap (E(g) approximately 1.48-1.50 eV) when compared to the ternary oxides Ba(In(1/2)M'(1/2))O3 (E(g) approximately 2.97-3.30 eV) and the Sn-containing Ba(In(1/3)Sn(1/3)M'(1/3))O3 derivatives (E(g) approximately 2.85-3.00 eV). Such a variation of band gap energy upon the substitution is attributable to the broadening of the conduction band caused by the dissimilar electronegativities of the B-site cations. In contrast to the ternary or the Sn-substituted quaternary compounds showing photocatalytic activity under UV-vis irradiation, the Ba(In(1/3)Pb(1/3)M'(1/3))O3 compounds induce an efficient photodegradation of 4-chlorophenol under visible light irradiation (lambda > 420 nm). The present results highlight that the substitution of electronegative non-transition metal cations can provide a very powerful way of developing efficient visible light harvesting photocatalysts through tuning of the band structure of a semiconductive metal oxide.

Growth of perturbations in dark energy parametrization scenarios

NASA Astrophysics Data System (ADS)

Mehrabi, Ahmad

2018-04-01

In this paper, we study the evolution of dark matter perturbations in the linear regime by considering the possibility of dark energy perturbations. To do this, two popular parametrizations, Chevallier-Polarski-Linder (CPL) and Barboza-Alcaniz (BA), with the same number of free parameters and different redshift dependency have been considered. We integrate the full relativistic equations to obtain the growth of matter fluctuations for both clustering and smooth versions of CPL and BA dark energy. The growth rate is larger (smaller) than the Λ CDM in the smooth cases when w <-1 (w >-1 ), but the dark energy clustering gives a larger (smaller) growth index when w >-1 (w <-1 ). We measure the relative difference of the growth rate with respect to concordance Λ CDM and study how it changes depending on the free parameters. Furthermore, it is found that the difference of growth rates between smooth CPL and BA is negligible, less than 0.5%, while for the clustering case, the difference is considerable and might be as large as 2%. Eventually, using the latest geometrical and growth rate observational data, we perform an overall likelihood analysis and show that both smooth and clustering cases of CPL and BA parametrizations are consistent with observations. In particular, we find the dark energy figure of merit is approximately 70 for the BA and approximately 30 for the CPL, which indicates the BA model constrains relatively better than the CPL one.

Ultrasonic Investigations on Polonides of Ba, Ca, and Pb

NASA Astrophysics Data System (ADS)

Singh, Devraj; Bhalla, Vyoma; Bala, Jyoti; Wadhwa, Shikha

2017-10-01

The temperature-dependent mechanical and ultrasonic properties of barium, calcium, and lead polonides (BaPo, CaPo, and PbPo) were investigated in the temperature range 100-300 K. The second- and third-order elastic constants (SOECs and TOECs) were computed using Coulomb and Born-Mayer potential and these in turn have been used to estimate other secondary elastic properties such as strength, anisotropy, microhardness, etc. The theoretical approach followed the prediction that BaPo, CaPo, and PbPo are brittle in nature. PbPo is found to be the hardest amongst the chosen compounds. Further the SOECs and TOECs are applied to determine ultrasonic velocities, Debye temperature, and acoustic coupling constants along <100>, <110>, and <111> orientations at room temperature. Additionally thermal conductivity has been computed using Morelli and Slack's approach along different crystallographic directions at room temperature. Finally ultrasonic attenuation due to phonon-phonon interaction and thermoelastic relaxation mechanisms has been computed for BaPo, CaPo, and PbPo. The behaviour of these compounds is similar to that of semi-metals with thermal relaxation time of the order 10-11 s. The present computation study is reasonably in agreement with the available theoretical data for the similar type of materials.

Electronic structure of PrBa2Cu3O7: A local-spin-density approximation with on-site Coulomb interaction

NASA Astrophysics Data System (ADS)

Biagini, M.; Calandra, C.; Ossicini, Stefano

1995-10-01

Electronic structure calculations based on the local-spin-density approximation (LSDA) fail to reproduce the antiferromagnetic ground state of PrBa2Cu3O7 (PBCO). We have performed linear muffin-tin orbital-atomic sphere approximation calculations, based on the local-spin-density approximation with on-site Coulomb correlation applied to Cu(1) and Cu(2) 3d states. We have found that inclusion of the on-site Coulomb interaction modifies qualitatively the electronic structure of PBCO with respect to the LSDA results, and gives Cu spin moments in good agreement with the experimental values. The Cu(2) upper Hubbard band lies about 1 eV above the Fermi energy, indicating a CuII oxidation state. On the other hand, the Cu(1) upper Hubbard band is located across the Fermi level, which implies an intermediate oxidation state for the Cu(1) ion, between CuI and CuII. The metallic character of the CuO chains is preserved, in agreement with optical reflectivity [K. Takenaka et al., Phys. Rev. B 46, 5833 (1992)] and positron annihilation experiments [L. Hoffmann et al., Phys. Rev. Lett. 71, 4047 (1993)]. These results support the view of an extrinsic origin of the insulating character of PrBa2Cu3O7.

L-shell x-ray production cross sections of Ni, Cu, Ge, As, Rb, Sr, Y, Zr, and Pd by (0. 25--2. 5)-MeV protons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duggan, J.L.; Kocur, P.M.; Price, J.L.

1985-10-01

L-shell x-ray production cross sections by /sub 1//sup 1/H/sup +/ ions are reported. The data are compared to the first Born approximation (plane-wave Born approximation for direct ionization and Oppenheimer-Brinkman-Kramers approximation for electron capture) and to the ECPSSR (energy-loss and Coulomb-deflection effects, perturbed stationary-state approximation with relativistic correction) theory. The energy of the protons ranged from 0.25 to 2.5 MeV in steps of 0.25 MeV. The targets used in these measurements were /sub 28/Ni, /sub 29/Cu, /sub 32/Ge, /sub 33/As, /sub 37/Rb, /sub 38/Sr, /sub 39/Y, /sub 40/Zr, and /sub 46/Pd. The first Born theory generally agrees with the datamore » found in the literature at high energies and overpredicts them below 1.5 MeV. The ECPSSR predictions are in better agreement with experimental cross sections. At 0.25 MeV our data, however, are underestimated by this theory and tend to agree with the first Born approximation.« less

Calculation of Protein Heat Capacity from Replica-Exchange Molecular Dynamics Simulations with Different Implicit Solvent Models

DTIC Science & Technology

2008-10-30

rigorous Poisson-based methods generally apply a Lee-Richards mo- lecular surface.9 This surface is considered the de facto description for continuum...definition and calculation of the Born radii. To evaluate the Born radii, two approximations are invoked. The first is the Coulomb field approximation (CFA...energy term, and depending on the particular GB formulation, higher-order non- Coulomb correction terms may be added to the Born radii to account for the

An iPhone application using a novel stool color detection algorithm for biliary atresia screening.

PubMed

Hoshino, Eri; Hayashi, Kuniyoshi; Suzuki, Mitsuyoshi; Obatake, Masayuki; Urayama, Kevin Y; Nakano, Satoshi; Taura, Yasuyuki; Nio, Masaki; Takahashi, Osamu

2017-10-01

The stool color card has been the primary tool for identifying acholic stools in infants with biliary atresia (BA), in several countries. However, BA stools are not always acholic, as obliteration of the bile duct occurs gradually. This study aims to introduce Baby Poop (Baby unchi in Japanese), a free iPhone application, employing a detection algorithm to capture subtle differences in colors, even with non-acholic BA stools. The application is designed for use by caregivers of infants aged approximately 2 weeks-1 month. Baseline analysis to determine optimal color parameters predicting BA stools was performed using logistic regression (n = 50). Pattern recognition and machine learning processes were performed using 30 BA and 34 non-BA images. Additional 5 BA and 35 non-BA pictures were used to test accuracy. Hue, saturation, and value (HSV) were the preferred parameter for BA stool identification. A sensitivity and specificity were 100% (95% confidence interval 0.48-1.00 and 0.90-1.00, respectively) even among a collection of visually non-acholic, i.e., pigmented BA stools and relatively pale-colored non-BA stools. Results suggest that an iPhone mobile application integrated with a detection algorithm is an effective and convenient modality for early detection of BA, and potentially for other related diseases.

A decade of mangrove recovery at affected area by the 2004 tsunami along coast of Banda Aceh city

NASA Astrophysics Data System (ADS)

Onrizal; Mansor, M.

2018-03-01

Banda Aceh (BA) is the capital of Aceh Province, Indonesia. It was the most affected areas by the 2004 tsunami. Before the natural catastrophe, most of the BA mangroves disturbed by human activities and remaining mangroves were fragmented and had a low density of trees. Therefore, the objectives of this study were to calculate the impact of the tsunami on mangrove and subsequently to evaluate the mangrove recovery based on spatial and temporal analysis and ground truthing method within the period 11 years in intertidal areas of BA. Three regions of BA coastal areas were selected, namely Kuala Cangkoy, Gampong Jawa and Lambada coasts. Before the tsunami, the mangrove forests in BA were only 13.6% of BA coastlands and fragmented. Approximately 48.9% of the mangroves have destroyed due to the tsunami. The BA mangroves at 5 and 11 years after tsunami were 66.5% and 81.3% relative to the data before tsunami, respectively. It means that the BA is very vulnerable due to the future tsunami occur. Therefore, the mangrove restoration in BA needs to be improved and maintain based on green belt concept for coastal protection as well as productivity of estuarine ecosystem.

Inactivation of Bacillus anthracis spores to decontaminate subway railcar and related materials via the fogging of peracetic acid and hydrogen peroxide sporicidal liquids.

PubMed

Richter, William R; Wood, Joseph P; Wendling, Morgan Q S; Rogers, James V

2018-01-15

The inactivation of Bacillus anthracis spores on subway and used subway railcar materials was evaluated using fogged peracetic acid/hydrogen peroxide (PAA) and hydrogen peroxide (H 2 O 2 ). A total of 21 separate decontamination tests were conducted using bacterial spores of both B. anthracis Ames (B.a.) and Bacillus atrophaeus (B.g.) inoculated onto several types of materials. Tests were conducted using commercial off-the-shelf fogging equipment filled with either PAA or H 2 O 2 to fumigate a ∼15 cubic meter chamber under uncontrolled ambient relative humidity and controlled temperature (10 or 20 °C) from 8 to 168 h. For the present study, no conditions were found that resulted in complete inactivation of either B.a. Ames or B.g. on all test materials. Approximately 41% and 38% of the decontamination efficacies for B.a. and B.g., respectively, exhibited ≥6 log 10 reduction (LR); efficacy depended greatly on the material. When testing at 10 °C, the mean LR was consistently lower for both B.a. and B.g. as compared to 20 °C. Based on the statistical comparison of the LR results, B.g. exhibited equivalent or greater resistance than B.a. for approximately 92% of the time across all 21 tests. The efficacy data suggest that B.g. may be a suitable surrogate for B.a. Ames when assessing the decontamination efficacy of fogged PAA or H 2 O 2 . Moreover, the results of this testing indicate that in the event of B.a. spore release into a subway system, the fogging of PAA or H 2 O 2 represents a decontamination option for consideration. Copyright © 2017 Elsevier Ltd. All rights reserved.

Electronic structure of BaNi2As2

NASA Astrophysics Data System (ADS)

Zhou, Bo; Xu, Min; Zhang, Yan; Xu, Gang; He, Cheng; Yang, L. X.; Chen, Fei; Xie, B. P.; Cui, Xiao-Yu; Arita, Masashi; Shimada, Kenya; Namatame, Hirofumi; Taniguchi, Masaki; Dai, X.; Feng, D. L.

2011-01-01

BaNi2As2, with a first-order phase transition around 131 K, is studied by the angle-resolved photoemission spectroscopy. The measured electronic structure is compared to the local-density approximation calculations, revealing similar large electronlike bands around M¯ and differences along Γ¯-X¯. We further show that the electronic structure of BaNi2As2 is distinct from that of the sibling iron pnictides. Particularly, there is no signature of band folding, indicating no collinear spin-density-wave-related magnetic ordering. Moreover, across the strong first-order phase transition, the band shift exhibits a hysteresis, which is directly related to the significant lattice distortion in BaNi2As2.

Medium-power diode-pumped Nd:BaY2F8 laser

NASA Astrophysics Data System (ADS)

Agnesi, Antonio; Guandalini, Annalisa; Lucca, Andrea; Sani, Elisa; Toncelli, Alessandra; Tonelli, Mauro; dell'Acqua, Stefano

2003-05-01

We report what is to our knowledge the first Nd:BaY2F8 (Nd:BaYF) laser pumped with a multiwatt fiber-coupled diode array tuned at approximately 804 nm. As much as 2.4 W were obtained with 6.2 W of absorbed pump power, showing efficient operation (51% slope efficiency), excellent beam quality (M2=1.1), and weak thermal lensing. Small intracavity losses (<1%) were measured, indicating both reduced thermally induced aberrations and good optical quality of the laser crystal.

Factors Influencing Time-to-diagnosis of Biliary Atresia.

PubMed

Harpavat, Sanjiv; Lupo, Philip J; Liwanag, Loriel; Hollier, John; Brandt, Mary L; Finegold, Milton J; Shneider, Benjamin L

2018-06-01

Diagnosing biliary atresia (BA) quickly is critical, because earlier treatment correlates with delayed or reduced need for liver transplantation. However, diagnosing BA quickly is also difficult, with infants usually treated after 60 days of life. In this study, we aim to accelerate BA diagnosis and treatment, by better understanding factors influencing the diagnostic timeline. Infants born between 2007 and 2014 and diagnosed with BA at our institution were included (n = 65). Two periods were examined retrospectively: P1, the time from birth to specialist referral, and P2, the time from specialist referral to treatment. How sociodemographic factors associate with P1 and P2 were analyzed with Kaplan-Meier curves and Cox proportional hazard models. In addition, to better characterize P2, laboratory results and early tissue histology were studied. P1 associated with race/ethnicity, with shorter times in non-Hispanic white infants compared to non-Hispanic black and Hispanic infants (P = 0.007 and P = 0.004, respectively). P2 associated with referral age, with shorter times in infants referred after 30, 45, or 60 days of life (P < 0.001, P < 0.001, and P = 0.001, respectively). One potential reason for longer P2 in infants referred ≤30 days is that aminotransferase levels were normal or near-normal. However, despite reassuring laboratory values, tissue histology in early cases showed key features of BA. Our findings suggest 2 opportunities to accelerate BA diagnosis and treatment. First, to achieve prompt referrals for all races/ethnicities, universal screening strategies should be considered. Second, to ensure efficient evaluations independent of age, algorithms designed to detect early features of BA can be developed.

Potential-Energy Surfaces, the Born-Oppenheimer Approximations, and the Franck-Condon Principle: Back to the Roots.

PubMed

Mustroph, Heinz

2016-09-05

The concept of a potential-energy surface (PES) is central to our understanding of spectroscopy, photochemistry, and chemical kinetics. However, the terminology used in connection with the basic approximations is variously, and somewhat confusingly, represented with such phrases as "adiabatic", "Born-Oppenheimer", or "Born-Oppenheimer adiabatic" approximation. Concerning the closely relevant and important Franck-Condon principle (FCP), the IUPAC definition differentiates between a classical and quantum mechanical formulation. Consequently, in many publications we find terms such as "Franck-Condon (excited) state", or a vertical transition to the "Franck-Condon point" with the "Franck-Condon geometry" that relaxes to the excited-state equilibrium geometry. The Born-Oppenheimer approximation and the "classical" model of the Franck-Condon principle are typical examples of misused terms and lax interpretations of the original theories. In this essay, we revisit the original publications of pioneers of the PES concept and the FCP to help stimulate a lively discussion and clearer thinking around these important concepts. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Microwave imaging by three-dimensional Born linearization of electromagnetic scattering

NASA Astrophysics Data System (ADS)

Caorsi, S.; Gragnani, G. L.; Pastorino, M.

1990-11-01

An approach to microwave imaging is proposed that uses a three-dimensional vectorial form of the Born approximation to linearize the equation of electromagnetic scattering. The inverse scattering problem is numerically solved for three-dimensional geometries by means of the moment method. A pseudoinversion algorithm is adopted to overcome ill conditioning. Results show that the method is well suited for qualitative imaging purposes, while its capability for exactly reconstructing the complex dielectric permittivity is affected by the limitations inherent in the Born approximation and in ill conditioning.

On the mathematical treatment of the Born-Oppenheimer approximation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jecko, Thierry, E-mail: thierry.jecko@u-cergy.fr

2014-05-15

Motivated by the paper by Sutcliffe and Woolley [“On the quantum theory of molecules,” J. Chem. Phys. 137, 22A544 (2012)], we present the main ideas used by mathematicians to show the accuracy of the Born-Oppenheimer approximation for molecules. Based on mathematical works on this approximation for molecular bound states, in scattering theory, in resonance theory, and for short time evolution, we give an overview of some rigorous results obtained up to now. We also point out the main difficulties mathematicians are trying to overcome and speculate on further developments. The mathematical approach does not fit exactly to the common usemore » of the approximation in Physics and Chemistry. We criticize the latter and comment on the differences, contributing in this way to the discussion on the Born-Oppenheimer approximation initiated by Sutcliffe and Woolley. The paper neither contains mathematical statements nor proofs. Instead, we try to make accessible mathematically rigourous results on the subject to researchers in Quantum Chemistry or Physics.« less

Terahertz dielectric response of ferroelectric Ba(x)Sr(1-x)TiO3 thin films.

PubMed

Kang, Seung Beom; Kwak, Min Hwan; Choi, Muhan; Kim, Sungil; Kim, Taeyong; Cha, Eun Jong; Kang, Kwang Yong

2011-11-01

Terahertz time-domain spectroscopy has been used to investigate the dielectric and optical properties of ferroelectric Ba(x)Sr(1-x)TiO(3) thin films for nominal x-values of 0.4, 0.6, and 0.8 in the frequency range of 0.3 to 2.5 THz. The ferroelectric thin films were deposited at approximately 700 nm thickness on [001] MgO substrate by pulsed laser deposition. The measured complex dielectric and optical constants were compared with the Cole-Cole relaxation model. The results show that the Cole-Cole relaxation model fits well with the data throughout the frequency range and the dielectric relaxation behavior of ferroelectric Ba(x)Sr(1-x)TiO(3) thin films varies with the films compositions. Among the compositions of Ba(x)Sr(1-x)TiO(3) films with different Ba/Sr ratios, Ba(0.6)Sr(0.4)TiO(3) has the highest dielectric constants and the shortest dielectric relaxation time.

Thermoelectric properties of doped BaHfO{sub 3}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dixit, Chandra Kr., E-mail: ckparadise@gmail.com, E-mail: sharmarameshfgiet@gmail.com; Bhamu, K. C.; Sharma, Ramesh, E-mail: ckparadise@gmail.com, E-mail: sharmarameshfgiet@gmail.com

2016-05-06

We have studied the structural stability, electronic structure, optical properties and thermoelectric properties of doped BaHfO{sub 3} by full potential linearized augmented plane wave (FP-LAPW) method. The electronic structure of BaHfO{sub 3} doped with Sr shows enhances the indirect band gaps of 3.53 eV, 3.58 eV. The charge density plots show strong ionic bonding in Ba-Hf, and ionic and covalent bonding between Hf and O. Calculations of the optical spectra, viz., the dielectric function, refractive index and extinction coefficient are performed for the energy range are calculated and analyzed. Thermoelectric properties of semi conducting are also reported first time. Themore » doped BaHfO{sub 3} is approximately wide band gap semiconductor with the large p-type Seebeck coefficient. The power factor of BaHfO{sub 3} is increased with Sr doping, decreases because of low electrical resistivity and thermal conductivity.« less

Approximate solutions of acoustic 3D integral equation and their application to seismic modeling and full-waveform inversion

NASA Astrophysics Data System (ADS)

Malovichko, M.; Khokhlov, N.; Yavich, N.; Zhdanov, M.

2017-10-01

Over the recent decades, a number of fast approximate solutions of Lippmann-Schwinger equation, which are more accurate than classic Born and Rytov approximations, were proposed in the field of electromagnetic modeling. Those developments could be naturally extended to acoustic and elastic fields; however, until recently, they were almost unknown in seismology. This paper presents several solutions of this kind applied to acoustic modeling for both lossy and lossless media. We evaluated the numerical merits of those methods and provide an estimation of their numerical complexity. In our numerical realization we use the matrix-free implementation of the corresponding integral operator. We study the accuracy of those approximate solutions and demonstrate, that the quasi-analytical approximation is more accurate, than the Born approximation. Further, we apply the quasi-analytical approximation to the solution of the inverse problem. It is demonstrated that, this approach improves the estimation of the data gradient, comparing to the Born approximation. The developed inversion algorithm is based on the conjugate-gradient type optimization. Numerical model study demonstrates that the quasi-analytical solution significantly reduces computation time of the seismic full-waveform inversion. We also show how the quasi-analytical approximation can be extended to the case of elastic wavefield.

Growth of BaSi2 continuous films on Ge(111) by molecular beam epitaxy and fabrication of p-BaSi2/n-Ge heterojunction solar cells

NASA Astrophysics Data System (ADS)

Takabe, Ryota; Yachi, Suguru; Tsukahara, Daichi; Toko, Kaoru; Suemasu, Takashi

2017-05-01

We grew BaSi2 films on Ge(111) substrates by various growth methods based on molecular beam epitaxy (MBE). First, we attempted to form BaSi2 films directly on Ge(111) by MBE without templates. We next formed BaSi2 films using BaGe2 templates as commonly used for MBE growth of BaSi2 on Si substrates. Contrary to our prediction, the lateral growth of BaSi2 was not promoted by these two methods; BaSi2 formed not into a continuous film but into islands. Although streaky patterns of reflection high-energy electron diffraction were observed inside the growth chamber, no X-ray diffraction lines of BaSi2 were observed in samples taken out from the growth chamber. Such BaSi2 islands were easily to get oxidized. We finally attempted to form a continuous BaSi2 template layer on Ge(111) by solid phase epitaxy, that is, the deposition of amorphous Ba-Si layers onto MBE-grown BaSi2 epitaxial islands, followed by post annealing. We achieved the formation of an approximately 5-nm-thick BaSi2 continuous layer by this method. Using this BaSi2 layer as a template, we succeeded in forming a-axis-oriented 520-nm-thick BaSi2 epitaxial films on Ge substrates, although (111)-oriented Si grains were included in the grown layer. We next formed a B-doped p-BaSi2(20 nm)/n-Ge(111) heterojunction solar cell. A wide-spectrum response from 400 to 2000 nm was achieved. At an external bias voltage of 1 V, the external quantum efficiency reached as high as 60%, demonstrating the great potential of BaSi2/Ge combination. However, the efficiency of a solar cell under AM1.5 illumination was quite low (0.1%). The origin of such a low efficiency was examined.

Calculation of strained BaTiO3 with different exchange correlation functionals examined with criterion by Ginzburg-Landau theory, uncovering expressions by crystallographic parameters

NASA Astrophysics Data System (ADS)

Watanabe, Yukio

2018-05-01

In the calculations of tetragonal BaTiO3, some exchange-correlation (XC) energy functionals such as local density approximation (LDA) have shown good agreement with experiments at room temperature (RT), e.g., spontaneous polarization (PS), and superiority compared with other XC functionals. This is due to the error compensation of the RT effect and, hence, will be ineffective in the heavily strained case such as domain boundaries. Here, ferroelectrics under large strain at RT are approximated as those at 0 K because the strain effect surpasses the RT effects. To find effective XC energy functionals for strained BaTiO3, we propose a new comparison, i.e., a criterion. This criterion is the properties at 0 K given by the Ginzburg-Landau (GL) theory because GL theory is a thermodynamic description of experiments working under the same symmetry-constraints as ab initio calculations. With this criterion, we examine LDA, generalized gradient approximations (GGA), meta-GGA, meta-GGA + local correlation potential (U), and hybrid functionals, which reveals the high accuracy of some XC functionals superior to XC functionals that have been regarded as accurate. This result is examined directly by the calculations of homogenously strained tetragonal BaTiO3, confirming the validity of the new criterion. In addition, the data points of theoretical PS vs. certain crystallographic parameters calculated with different XC functionals are found to lie on a single curve, despite their wide variations. Regarding these theoretical data points as corresponding to the experimental results, analytical expressions of the local PS using crystallographic parameters are uncovered. These expressions show the primary origin of BaTiO3 ferroelectricity as oxygen displacements. Elastic compliance and electrostrictive coefficients are estimated. For the comparison of strained results, we show that the effective critical temperature TC under strain <-0.01 is >1000 K from an approximate method combining ab initio results with GL theory. In addition, in a definite manner, the present results show much more enhanced ferroelectricity at large strain than the previous reports.

Edge states in gated bilayer-monolayer graphene ribbons and bilayer domain walls

NASA Astrophysics Data System (ADS)

Mirzakhani, M.; Zarenia, M.; Peeters, F. M.

2018-05-01

Using the effective continuum model, the electron energy spectrum of gated bilayer graphene with a step-like region of decoupled graphene layers at the edge of the sample is studied. Different types of coupled-decoupled interfaces are considered, i.e., zigzag (ZZ) and armchair junctions, which result in significant different propagating states. Two non-valley-polarized conducting edge states are observed for ZZ type, which are mainly located around the ZZ-ended graphene layers. Additionally, we investigated both BA-BA and BA-AB domain walls in the gated bilayer graphene within the continuum approximation. Unlike the BA-BA domain wall, which exhibits gapped insulating behaviour, the domain walls surrounded by different stackings of bilayer regions feature valley-polarized edge states. Our findings are consistent with other theoretical calculations, such as from the tight-binding model and first-principles calculations, and agree with experimental observations.

Low-energy Scattering of Positronium by Atoms

NASA Technical Reports Server (NTRS)

Ray, Hasi

2007-01-01

The survey reports theoretical studies involving positronium (Ps) - atom scattering. Investigations carried out in last few decades have been briefly reviewed in this article. A brief description of close-coupling approximation (CCA), the first-Born approximation (FBA) and the Born-Oppenheimer approximation (BOA) for Ps-Atom systems are made. The CCA codes of Ray et a1 [1-6] are reinvestigated using very fine mesh-points to search for resonances. The article advocates the need for an extended basis set & a systematic study using CCAs.

A harmonic adiabatic approximation to calculate highly excited vibrational levels of ``floppy molecules''

NASA Astrophysics Data System (ADS)

Lauvergnat, David; Nauts, André; Justum, Yves; Chapuisat, Xavier

2001-04-01

The harmonic adiabatic approximation (HADA), an efficient and accurate quantum method to calculate highly excited vibrational levels of molecular systems, is presented. It is well-suited to applications to "floppy molecules" with a rather large number of atoms (N>3). A clever choice of internal coordinates naturally suggests their separation into active, slow, or large amplitude coordinates q', and inactive, fast, or small amplitude coordinates q″, which leads to an adiabatic (or Born-Oppenheimer-type) approximation (ADA), i.e., the total wave function is expressed as a product of active and inactive total wave functions. However, within the framework of the ADA, potential energy data concerning the inactive coordinates q″ are required. To reduce this need, a minimum energy domain (MED) is defined by minimizing the potential energy surface (PES) for each value of the active variables q', and a quadratic or harmonic expansion of the PES, based on the MED, is used (MED harmonic potential). In other words, the overall picture is that of a harmonic valley about the MED. In the case of only one active variable, we have a minimum energy path (MEP) and a MEP harmonic potential. The combination of the MED harmonic potential and the adiabatic approximation (harmonic adiabatic approximation: HADA) greatly reduces the size of the numerical computations, so that rather large molecules can be studied. In the present article however, the HADA is applied to our benchmark molecule HCN/CNH, to test the validity of the method. Thus, the HADA vibrational energy levels are compared and are in excellent agreement with the ADA calculations (adiabatic approximation with the full PES) of Light and Bačić [J. Chem. Phys. 87, 4008 (1987)]. Furthermore, the exact harmonic results (exact calculations without the adiabatic approximation but with the MEP harmonic potential) are compared to the exact calculations (without any sort of approximation). In addition, we compare the densities of the bending motion during the HCN/CNH isomerization, computed with the HADA and the exact wave function.

Paul G. Silver (1948-2009)

NASA Astrophysics Data System (ADS)

Solomon, Sean C.

2009-11-01

A pioneer in the novel application of seismic observations to infer the flow field of Earth's mantle and the mechanics of fault zones, Paul Gordon Silver tragically was killed on 7 August in an automobile accident that also took the life of his 22-year-old daughter, Celine. Born and raised in Los Angeles, Calif., Paul received all of his degrees from the University of California. Following receipt of a B.A. in psychology from the University of California (UC), Los Angeles (1970), he pursued a career as a musician for several years. Drawn to Earth science, Paul obtained a B.A. in geology from UC Berkeley, in 1976, and he was recruited by Tom Jordan (now at the University of Southern California) to the graduate program of the Scripps Institution of Oceanography at UC San Diego.

Aerobic bacterial microflora of Broad-snouted caiman (Caiman latirostris) oral cavity and cloaca, originating from parque Zoológico Arruda Câmara, Paraíba, Brazil

PubMed Central

Silva, J.S.A.; Mota, R.A.; Pinheiro Júnior, J.W.; Almeida, M.C.S.; Silva, D.R.; Ferreira, D.R.A.; Azevedo, J.C.N.

2009-01-01

The objective of this study was to isolate and identify the aerobic bacterial microflora from the oral cavity mucosa and cloaca’s samples, collected from Broad-snouted caiman (Caiman latirostris), born and bred in captivity at Parque Zoológico Arruda Câmara, João Pessoa, Paraíba, Brazil. The most common bacteria were Staphylococcus sp. (14.74%), Corynebacterium sp. (13.68%), Escherichia coli (13.68%) and Shigella sp.(11.58%), and the less common were Citrobacter sp. (1.05%), Klebsiella pneumoniae (1.05%) and Salmonella sp. (1.05%).This emphasizes the importance of these microorganisms’ participation in infectious processes (sepsis) and injuries caused by crocodilians. PMID:24031343

bb̅ud̅ four-quark systems in the Born-Oppenheimer approximation: prospects and challenges

NASA Astrophysics Data System (ADS)

Peters, Antje; Bicudo, Pedro; Wagner, Marc

2018-03-01

We summarize previous work on b̅b̅ud four-quark systems in the Born-Oppenheimer approximation and discuss first steps towards an extension to the theoretically more challenging bb̅ud̅ system. Strategies to identify a possibly existing bb̅ud̅ bound state are discussed and first numerical results are presented.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shen, Wen-jun; Dong, Rui; Chen, Gong, E-mail: chengongzlp@hotmail.com

Highlights: • The RRV infected group showed cholestasis, retardation and extrahepatic biliary atresia. • miR-222 was highly expressed, and PPP2R2A was inhibited in the murine biliary atresia model. • miR-222 profoundly modulated the process of fibrosis in the murine biliary atresia model. • miR-222 might represent a potential target for improving biliary atresia prognosis. - Abstract: microRNA-222 (miR-222) has been shown to initiate the activation of hepatic stellate cells, which plays an important role in the pathogenesis of liver fibrosis. The aim of our study was to evaluate the role of miR-22 in a mouse model of biliary atresia (BA)more » induced by Rhesus Rotavirus (RRV) infection. New-born Balb/c mice were randomized into control and RRV infected groups. The extrahepatic bile ducts were evaluated. The experimental group was divided into BA group and negative group based on histology. The expression of miR-222, protein phosphatase 2 regulatory subunit B alpha (PPP2R2A), proliferating cell nuclear antigen (PCNA) and phospho-Akt were detected. We found that the experimental group showed signs of cholestasis, retardation and extrahepatic biliary atresia. No abnormalities were found in the control group. In the BA group, miR-222, PCNA and Akt were highly expressed, and PPP2R2A expression was significantly inhibited. Our findings suggest that miR-222 profoundly modulated the process of fibrosis in the murine BA model, which might represent a potential target for improving BA prognosis.« less

Infants born very preterm react to variations of the acoustic environment in their incubator from a minimum signal-to-noise ratio threshold of 5 to 10 dBA.

PubMed

Kuhn, Pierre; Zores, Claire; Pebayle, Thierry; Hoeft, Alain; Langlet, Claire; Escande, Benoît; Astruc, Dominique; Dufour, André

2012-04-01

Very early preterm infants (VPIs) are exposed to unpredictable noise in neonatal intensive care units. Their ability to perceive moderate acoustic environmental changes has not been fully investigated. Physiological values of the 598 isolated sound peaks (SPs) that were 5-10 and 10-15 dB slow-response A (dBA) above background noise levels and that occurred during infants' sleep varied significantly, indicating that VPIs detect them. Exposure to 10-15 dBA SPs during active sleep significantly increased mean heart rate and decreased mean respiratory rate and mean systemic and cerebral oxygen saturations relative to baseline. VPIs are sensitive to changes in their nosocomial acoustic environment, with a minimal signal-to-noise ratio (SNR) threshold of 5-10 dBA. These acoustic changes can alter their well-being. In this observational study, we evaluated their differential auditory sensitivity to sound-pressure level (SPL) increments below 70-75 dBA equivalent continuous level in their incubators. Environmental (SPL and audio recording), physiological, cerebral, and behavioral data were prospectively collected over 10 h in 26 VPIs (GA 28 (26-31) wk). SPs emerging from background noise levels were identified and newborns' arousal states at the time of SPs were determined. Changes in parameters were compared over 5-s periods between baseline and the 40 s following the SPs depending on their SNR thresholds above background noise.

Phase equilibria, crystal structures, and dielectric anomaly in the BaZrO 3-CaZrO 3 system

NASA Astrophysics Data System (ADS)

Levin, Igor; Amos, Tammy G.; Bell, Steven M.; Farber, Leon; Vanderah, Terrell A.; Roth, Robert S.; Toby, Brian H.

2003-11-01

Phase equilibria in the (1- x)BaZrO 3- xCaZrO 3 system were analyzed using a combination of X-ray and neutron powder diffraction, and transmission electron microscopy. The proposed phase diagram features two extended two-phase fields containing mixtures of a Ba-rich cubic phase and a tetragonal, or orthorhombic Ca-rich phase, all having perovskite-related structures. The symmetry differences in the Ca-rich phases are caused by different tilting patterns of the [ZrO 6] octahedra. In specimens quenched from 1650°C, CaZrO 3 dissolves only a few percent of Ba, whereas the solubility of Ca in BaZrO 3 is approximately 30 at% . The BaZrO 3-CaZrO 3 system features at least two tilting phase transitions, Pm3 m→ I4/ mcm and I4/ mcm→ Pbnm. Rietveld refinements of the Ba 0.8Ca 0.2ZrO 3 structure using variable-temperature neutron powder diffraction data confirmed that the Pm3 m→ I4/ mcm transition corresponds to a rotation of octahedra about one of the cubic axes; successive octahedra along this axis rotate in opposite directions. In situ variable-temperature electron diffraction studies indicated that the transition temperature increases with increasing Ca-substitution on the A-sites, from approximately -120°C at 5 at% Ca to 225°C at 20 at% Ca. Dielectric measurements revealed that the permittivity increases monotonically from 36 for BaZrO 3 to 53 for Ba 0.9Ca 0.1ZrO 3, and then decreases to 50 for Ba 0.8Ca 0.2ZrO 3. This later specimen was the Ca-richest composition for which pellets could be quenched from the single-phase cubic field with presently available equipment. Strongly non-monotonic behavior was also observed for the temperature coefficient of resonant frequency; however, in this case, the maximum occurred at a lower Ca concentration, 0.05⩽ x⩽0.1. The non-linear behavior of the dielectric properties was attributed to two competing structural effects: a positive effect associated with substitution of relatively small Ca cations on the A-sites, resulting in stretched Ca-O bonds, and a negative effect, related to the distortion of the A-site environment (bond strain relaxation) upon octahedral tilting.

Radial oscillations and stability of compact stars in Eddington-inspired Born-Infeld gravity

NASA Astrophysics Data System (ADS)

Sham, Y.-H.; Lin, L.-M.; Leung, P. T.

2012-09-01

We study the hydrostatic equilibrium structure of compact stars in the Eddington-inspired Born-Infeld gravity recently proposed by Bañados and Ferreira [Phys. Rev. Lett. 105, 011101 (2010)]. We also develop a framework to study the radial perturbations and stability of compact stars in this theory. We find that the standard results of stellar stability still hold in this theory. The frequency square of the fundamental oscillation mode vanishes for the maximum-mass stellar configuration. The dependence of the oscillation mode frequencies on the coupling parameter κ of the theory is also investigated. We find that the fundamental mode is insensitive to the value of κ, while higher-order modes depend more strongly on κ.

Brachial artery vasodilatation during prolonged lower limb exercise: role of shear rate

PubMed Central

Padilla, Jaume; Simmons, Grant H.; Vianna, Lauro C.; Davis, Michael J.; Laughlin, M. Harold; Fadel, Paul J.

2012-01-01

We recently observed a marked increase in brachial artery (BA) diameter during prolonged leg cycling exercise. The purpose of the present study was to test the hypothesis that this increase in BA diameter during lower limb exercise is shear stress mediated. Accordingly, we determined whether recapitulation of cycling-induced BA shear rate with forearm heating, a known stimulus evoking shear-induced conduit artery dilatation, would elicit comparable profiles and magnitudes of BA vasodilatation to those observed during cycling. In 12 healthy men, BA diameter and blood velocity were measured simultaneously using Doppler ultrasonography at baseline and every 5 min during 60 min of either steady-state semi-recumbent leg cycling (120 W) or forearm heating. At the onset of cycling, the BA diameter was reduced (−3.9 ± 1.2% at 5 min; P < 0.05), but it subsequently increased throughout the remainder of the exercise bout (+15.1 ± 1.6% at 60 min; P < 0.05). The increase in BA diameter during exercise was accompanied by an approximately 2.5-fold rise in BA mean shear rate (P < 0.05). Similar increases in BA mean shear with forearm heating elicited an equivalent magnitude of BA vasodilatation to that observed during cycling (P > 0.05). Herein, we found that in the absence of exercise the extent of the BA vasodilator response was reproduced when the BA was exposed to comparable magnitudes of shear rate via forearm heating. These results are consistent with the hypothesis that shear stress plays a key role in signalling brachial artery vasodilatation during dynamic leg exercise. PMID:21784788

Human genetic studies in areas of high natural radiation. VIII. Genetic load not related to radiation.

PubMed Central

Freire-Maia, A; Krieger, H

1975-01-01

The genetic load disclosed by inbreeding has been analyzed in a multiple regression model for a population involving several localities in the state of Espírito Santo, Brazil. The inbreeding load has been estimated for number of pregnancies, abortions, stillbirths, children born alive, anomalies in general, sex ratio, infant mortality, post-infant mortality, and sterility and infertility of the couple. There was no evidence of either maternal or paternal inbreeding effects on the variables analyzed. The effect of inbreeding of the zygote was significant only for anomalies in general (B = 2.29 +/- 0.45) and infant mortality (B = 3.19 +/- 1.39). The latter result must be accepted with caution because of the many environmental causes affecting infant mortality. The B/A ratio suggested a predominantly mutational load for anomalies in general (B/A = 25), but with respect to infant mortality (B/A = 6), the ratio is regarded as an underestimate because of the environmental contribution to A and therefore not supportive of the segregational interpretation. PMID:803018

BaR-SPOrt: the instrument to be accommodated at Dome C

NASA Astrophysics Data System (ADS)

Zannoni, M.; Carretti, E.; Cortiglioni, S.; Macculi, C.; Ramponi, M.; Sbarra, C.; Ventura, G.; Monari, J.; Poloni, M.; Poppi, S.; Natale, V.; Nesti, R.; Baralis, M.; Peverini, O.; Tascone, R.; Virone, G.; Boscaleri, A.; Boella, G.; Sironi, G.; Gervasi, M.; de Bernardis, P.; Masi, S.; de Petris, M.

The BaR-SPOrt (Balloon-Borne Radiometers for Sky Polarization Observations) experiment, a program of the Agenzia Spaziale Italiana (ASI) co-funded by PNRA (Progetto Nazionale di Ricerca in Antartide) was originally designed as a payload for long duration balloons flights. The changing scenario, both scientific and strategic, has led us to propose it for the starting winter campaign of at the Concordia Base. Here the instrument and the features making it suitable to operate at Dome-C are described. After the initial setup, BaR-SPOrt should not require any kind of routine intervention by a dedicated base staff. The experiment will just need electrical power (less than 2 kW) and a suitable accommodation on the field. It can be fully monitored and controlled, including the data acquisition, through its own telemetry/telecommand link using IRIDIUM modems. Both the receiver and the critical electronics are housed inside a temperature-controlled vacuum chamber, providing the properly stabilized environment. The cold part of the radiometer employs a closed loop mechanical cryo-cooler that provides temperatures <70 ±0.1 K with low power consumption (<200 W).

Potency of Bacillus thuringiensis isolates from bareng Tenes-Malang City as a biological control agent for suppressing third instar of Aedes aegypti larvae

NASA Astrophysics Data System (ADS)

Lutfiana, Nihayatul; Gama, Zulfaidah Penata

2017-11-01

Dengue is a mosquito-borne viral disease that is transmitted by the female Aedes species. The number of dengue fever cases has increased in many geographic regions including Indonesia and one of them occurred in Bareng Tenes, Malang City, East Java Province. The objective of this research was to identify the potency of B. thuringeinsis isolates from Bareng Tenes, Malang, as the biological agent to control third instar Ae. aegypti larvae and to identify the potential B. thuringiensis isolates based on 16S rDNA sequence. B. thuringiensis was isolated from water and soil from 12 sites in the Bareng Tenes area. Bacterial isolation was performed using B. thuringiensis selective media. Several isolates had similar phenotypic characters with B. thuringiensis used to toxicity test against third instar Ae. aegypti larvae. The LC50-96h value was determined using probit regression. The most effective isolate was identified based on the 16S rDNA sequence, then aligned to the reference isolate using the BLAST program. A phylogeny tree was constructed using the Maximum Likelihood method. This study showed that among 22 isolates of B. thuringiensis, only BA02b, BS04a, and BA03a isolates have similar phenotypic characters with B. thuringiensis. Based on the toxicity test of B. thuringiensis against the third instar of Ae. aegypti larvae, it was indicated that BA02b and BA03a isolates were the potential agents to control Ae. aegypti larvae. BA02b isolate was the most effective B. thuringiensis (LC50-96h = 2,75 x 107 cell/mL). Based on 16S rDNA sequence, BA02b was identified as Bacillus thuringiensis var. Israelensis BGSC4Q2 (99 % similarities).

Structure and Luminescence Properties of New Green-Emitting Phosphor BaAl12O19:Tb

NASA Astrophysics Data System (ADS)

Xiao, Linjiu; He, Mingrui; Tian, Yanwen; Chen, Yongjie; Karaki, Tomoaki; Zhang, Liqing; Wang, Ning

2007-09-01

New green-emitting BaAl12O19:Tb phosphors were prepared by using the sol-gel method, and their structure and luminescence property were characterized by X-ray diffraction (XRD) analysis and fluorescence spectrometry. The results of XRD analysis revealed that a Ba1-xAl12O19:Tbx crystal structure was obtained at 1300 °C and Tb3+ ions substituted Ba2+ ions into the BaAl12O19 phase in the ion range x=0.005--0.05. The excitation peak of BaAl12O19:Tb was a wide band at approximately 240 nm, originating from the 4 f8-4 f75d1 transition of Tb3+. The emission spectrum consisted of eight emission peaks, originating from the 5D3-7Fi (i=6,5,4,3) and 5D4-7Fj ( j=6,5,4,3) transitions of Tb3+. The emission intensity of BaAl12O19:Tb phosphors at 543 nm was strongest when the phosphors were crystallized at 1300 °C for 2 h, and the content of Tb3+ was 2 mol %.

Golden jackals (Canis aureus) as hosts for ticks and tick-borne pathogens in Serbia.

PubMed

Sukara, Ratko; Chochlakis, Dimosthenis; Ćirović, Duško; Penezić, Aleksandra; Mihaljica, Darko; Ćakić, Sanja; Valčić, Miroslav; Tselentis, Yannis; Psaroulaki, Anna; Tomanović, Snežana

2018-04-10

The golden jackal (Canis aureus) is a medium-sized canid species native to Europe. This species is characterized by rapid large-scale expansion. A similar trend is also observed in Serbia, where the species is now distributed in more than a half of the territory. Although jackals prefer habitats in human-dominated landscapes, these animals have not been studied well enough from an eco-epidemiological point of view, and little is known about their potential for carrying zoonotic pathogens. In a study conducted during a three-year period (01/2010-02/2013), a total of 216 hunted or road-killed golden jackals were collected from 10 localities in Serbia. Ticks, when present, were removed, and after necropsy, spleen samples were collected from each animal. All tick and spleen samples were tested for the DNA of bacterial and protozoan tick-borne pathogens (Borrelia species, Bartonella species, Rickettsia species, Anaplasma species, Coxiella burnetii, Francisella species and Babesia species) by multiplex real-time PCR, conventional PCR and sequencing analyses. The DNA of Babesia canis was detected in nine out of 216 (4.2%) spleen samples, and two samples (0.9%) tested positive for Anaplasma phagocytophilum. In 118 ticks collected from jackals, the DNA of two Babesia species (Ba. canis and Ba. microti), three Borrelia species (Bo. garinii, Bo. valaisiana, and Bo. lusitaniae) and A. marginale was detected. From the aspect of public health surveillance, the potential role of the golden jackal in the maintenance of vector-borne zoonotic pathogens in Serbia must be considered, and further eco-epidemiological studies should be performed to determine the precise role of this animal species in zoonotic disease transmission cycles. Copyright © 2018 Elsevier GmbH. All rights reserved.

Convergence of the strong-potential-Born approximation in Z/sub less-than//Z/sub greater-than/

DOE Office of Scientific and Technical Information (OSTI.GOV)

McGuire, J.H.; Sil, N.C.

1986-01-01

Convergence of the strong-potential Born (SPB) approximation as a function of the charges of the projectile and target is studied numerically. Time-reversal invariance (or detailed balance) is satisfied at sufficiently high velocities even when the charges are asymmetric. This demonstarates that the SPB approximation converges to the correct result even when the charge of the ''weak'' potential, which is kept to first order, is larger than the charge of the ''strong'' potential, which is retained to all orders. Consequently, the SPB approximation is valid for systems of arbitrary charge symmetry (including symmetric systems) at sufficiently high velocities.

High-pressure synthesis of the cubic perovskite BaRuO3 and evolution of ferromagnetism in ARuO3 (A = Ca, Sr, Ba) ruthenates.

PubMed

Jin, C-Q; Zhou, J-S; Goodenough, J B; Liu, Q Q; Zhao, J G; Yang, L X; Yu, Y; Yu, R C; Katsura, T; Shatskiy, A; Ito, E

2008-05-20

The cubic perovskite BaRuO(3) has been synthesized under 18 GPa at 1,000 degrees C. Rietveld refinement indicates that the new compound has a stretched Ru-O bond. The cubic perovskite BaRuO(3) remains metallic to 4 K and exhibits a ferromagnetic transition at T(c) = 60 K, which is significantly lower than the T(c) approximately = 160 K for SrRuO(3). The availability of cubic perovskite BaRuO(3) not only makes it possible to map out the evolution of magnetism in the whole series of ARuO(3) (A = Ca, Sr, Ba) as a function of the ionic size of the A-site r(A,) but also completes the polytypes of BaRuO(3). Extension of the plot of T(c) versus r(A) in perovskites ARuO(3) (A = Ca, Sr, Ba) shows that T(c) does not increase as the cubic structure is approached, but has a maximum for orthorhombic SrRuO(3). Suppressing T(c) by Ca and Ba doping in SrRuO(3) is distinguished by sharply different magnetic susceptibilities chi(T) of the paramagnetic phase. This distinction has been interpreted in the context of a Griffiths' phase on the (Ca Sr)RuO(3) side and bandwidth broadening on the (Sr,Ba)RuO(3) side.

Microbial release of 226Ra2+ from (Ba,Ra)SO4 sludges from uranium mine wastes.

PubMed Central

Fedorak, P M; Westlake, D W; Anders, C; Kratochvil, B; Motkosky, N; Anderson, W B; Huck, P M

1986-01-01

226Ra2+ is removed from uranium mine effluents by coprecipitation with BaSO4. (Ba,Ra)SO4 sludge samples from two Canadian mine sites were found to contain active heterotrophic populations of aerobic, anaerobic, denitrifying, and sulfate-reducing bacteria. Under laboratory conditions, sulfate reduction occurred in batch cultures when carbon sources such as acetate, glucose, glycollate, lactate, or pyruvate were added to samples of (Ba,Ra)SO4 sludge. No external sources of nitrogen or phosphate were required for this activity. Further studies with lactate supplementation showed that once the soluble SO4(2-) in the overlying water was depleted, Ba2+ and 226Ra2+ were dissolved from the (Ba,Ra)SO4 sludge, with the concurrent production of S2-. Levels of dissolved 226Ra2+ reached approximately 400 Bq/liter after 10 weeks of incubation. Results suggest that the ultimate disposal of these sludges must maintain conditions to minimize the activity of the indigenous sulfate-reducing bacteria to ensure that unacceptably high levels of 226Ra2+ are not released to the environment. PMID:3752993

Beam control of high-power broad-area photonic crystal lasers using ladderlike groove structure

NASA Astrophysics Data System (ADS)

Wang, Tao; Wang, Lijie; Shu, Shili; Tian, Sicong; Lu, Zefeng; Hou, Guanyu; Lu, Huanyu; Tong, Cunzhu; Wang, Lijun

2017-06-01

The high-power broad-area (BA) photonic bandgap crystal (PBC) diode laser is promising as a high-brightness laser source, however, it suffers from poor lateral beam quality owing to the intrinsic drawback of BA lasers. In this paper, a ladderlike groove structure (LLGS) was proposed to improve both the lateral beam quality and emission power of BA PBC lasers. An approximately 15.4% improvement in output power and 25.2% decrease in the lateral beam parameter product (BPP) were realized and the underlying mechanism was discussed. On the basis of the one-dimensional PBC epitaxial structure, a stable vertical far field was demonstrated.

Biosolids affect soil barium in a dryland wheat agroecosystem.

PubMed

Ippolito, J A; Barbarick, K A

2006-01-01

In December 2003, the USEPA released an amended list of 15 "candidate pollutants for exposure and hazard screening" with regard to biosolids land application, including Ba. Therefore, we decided to monitor soil Ba concentrations from a dryland wheat (Triticum aestivum L.)-fallow agroecosystem experiment. This experiment received 10 biennial biosolids applications (1982-2003) at rates from 0 to 26.8 dry Mg ha(-1) per application year. The study was conducted on a Platner loam (Aridic Paleustoll), approximately 30 km east of Brighton, CO. Total soil Ba, as measured by 4 M HNO(3), increased with increasing biosolids application rate. In the soil-extraction data from 1988 to 2003, however, we observed significant (P < 0.10) linear or exponential declines in ammonium bicarbonate-diethylenetriaminepentaacetic acid (AB-DTPA) extractable Ba concentrations as a function of increasing biosolids application rates. This was observed in 6 of 7 and 3 of 7 yr for the 0- to 20- and 20- to 60-cm soil depths, respectively. Results suggest that while total soil Ba increased as a result of biosolids application with time, the mineral form of Ba was present in forms not extractable with AB-DTPA. Scanning electron microscopy using energy dispersive spectroscopy verified soil Ba-S compounds in the soil surface, probably BaSO(4). Wet chemistry sequential extraction suggested BaCO(3) precipitation was increasing in the soil subsurface. Our research showed that biosolids application may increase total soil Ba, but soil Ba precipitates are insoluble and should not be an environmental concern in similar soils under similar climatic and management conditions.

Green-Ampt approximations: A comprehensive analysis

NASA Astrophysics Data System (ADS)

Ali, Shakir; Islam, Adlul; Mishra, P. K.; Sikka, Alok K.

2016-04-01

Green-Ampt (GA) model and its modifications are widely used for simulating infiltration process. Several explicit approximate solutions to the implicit GA model have been developed with varying degree of accuracy. In this study, performance of nine explicit approximations to the GA model is compared with the implicit GA model using the published data for broad range of soil classes and infiltration time. The explicit GA models considered are Li et al. (1976) (LI), Stone et al. (1994) (ST), Salvucci and Entekhabi (1994) (SE), Parlange et al. (2002) (PA), Barry et al. (2005) (BA), Swamee et al. (2012) (SW), Ali et al. (2013) (AL), Almedeij and Esen (2014) (AE), and Vatankhah (2015) (VA). Six statistical indicators (e.g., percent relative error, maximum absolute percent relative error, average absolute percent relative errors, percent bias, index of agreement, and Nash-Sutcliffe efficiency) and relative computer computation time are used for assessing the model performance. Models are ranked based on the overall performance index (OPI). The BA model is found to be the most accurate followed by the PA and VA models for variety of soil classes and infiltration periods. The AE, SW, SE, and LI model also performed comparatively better. Based on the overall performance index, the explicit models are ranked as BA > PA > VA > LI > AE > SE > SW > ST > AL. Results of this study will be helpful in selection of accurate and simple explicit approximate GA models for solving variety of hydrological problems.

Microwave beam broadening due to turbulent plasma density fluctuations within the limit of the Born approximation and beyond

NASA Astrophysics Data System (ADS)

Köhn, A.; Guidi, L.; Holzhauer, E.; Maj, O.; Poli, E.; Snicker, A.; Weber, H.

2018-07-01

Plasma turbulence, and edge density fluctuations in particular, can under certain conditions broaden the cross-section of injected microwave beams significantly. This can be a severe problem for applications relying on well-localized deposition of the microwave power, like the control of MHD instabilities. Here we investigate this broadening mechanism as a function of fluctuation level, background density and propagation length in a fusion-relevant scenario using two numerical codes, the full-wave code IPF-FDMC and the novel wave kinetic equation solver WKBeam. The latter treats the effects of fluctuations using a statistical approach, based on an iterative solution of the scattering problem (Born approximation). The full-wave simulations are used to benchmark this approach. The Born approximation is shown to be valid over a large parameter range, including ITER-relevant scenarios.

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID:25611823

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

A new probability distribution model of turbulent irradiance based on Born perturbation theory

NASA Astrophysics Data System (ADS)

Wang, Hongxing; Liu, Min; Hu, Hao; Wang, Qian; Liu, Xiguo

2010-10-01

The subject of the PDF (Probability Density Function) of the irradiance fluctuations in a turbulent atmosphere is still unsettled. Theory reliably describes the behavior in the weak turbulence regime, but theoretical description in the strong and whole turbulence regimes are still controversial. Based on Born perturbation theory, the physical manifestations and correlations of three typical PDF models (Rice-Nakagami, exponential-Bessel and negative-exponential distribution) were theoretically analyzed. It is shown that these models can be derived by separately making circular-Gaussian, strong-turbulence and strong-turbulence-circular-Gaussian approximations in Born perturbation theory, which denies the viewpoint that the Rice-Nakagami model is only applicable in the extremely weak turbulence regime and provides theoretical arguments for choosing rational models in practical applications. In addition, a common shortcoming of the three models is that they are all approximations. A new model, called the Maclaurin-spread distribution, is proposed without any approximation except for assuming the correlation coefficient to be zero. So, it is considered that the new model can exactly reflect the Born perturbation theory. Simulated results prove the accuracy of this new model.

Kasai hepatoportoenterostomy in South Australia: a case for 'centralized decentralization'.

PubMed

Tu, Chen Gang; Khurana, Sanjeev; Couper, Richard; Ford, Andrew W D

2015-11-01

Recent follow-up studies have demonstrated significant improvement in overall survival as well as survival with native liver following geographic centralization of services to three centres in the UK. However, this model has not been replicated in countries with relatively low population density such as Australia and Canada. Retrospective evaluation of all patients born with biliary atresia (BA) in South Australia from 1989 to 2010 was performed. Thirty-one patients with BA were discovered. Two patients were excluded because the initial Kasai procedure (KP) was performed interstate. Outcome parameters measured were (i) clearance of jaundice (bilirubin of less than 20 μmol/L, by 6 months); (ii) survival with native liver; and (iii) overall survival. Kaplan-Meier survival curves were plotted for both survival with native liver and overall survival. The incidence of BA in South Australia between 1989 and 2010 was 7.48 per 100,000 live births. Following KP, clearance of jaundice was achieved in 42.9% of patients. Five-year actuarial survival with native liver was 55.2%, and overall 5-year actuarial survival was 89.3%. The results of KP performed at Women's and Children's Hospital from 1989 to 2010 can be considered comparable with international benchmarks. Based on these results, we propose the creation of a 'centralized' pool of surgeons in Australia to help continue providing 'decentralized' care of BA. © 2014 Royal Australasian College of Surgeons.

A numerical analysis of the Born approximation for image formation modeling of differential interference contrast microscopy for human embryos

NASA Astrophysics Data System (ADS)

Trattner, Sigal; Feigin, Micha; Greenspan, Hayit; Sochen, Nir

2008-03-01

The differential interference contrast (DIC) microscope is commonly used for the visualization of live biological specimens. It enables the view of the transparent specimens while preserving their viability, being a non-invasive modality. Fertility clinics often use the DIC microscope for evaluation of human embryos quality. Towards quantification and reconstruction of the visualized specimens, an image formation model for DIC imaging is sought and the interaction of light waves with biological matter is examined. In many image formation models the light-matter interaction is expressed via the first Born approximation. The validity region of this approximation is defined in a theoretical bound which limits its use to very small specimens with low dielectric contrast. In this work the Born approximation is investigated via the Helmholtz equation, which describes the interaction between the specimen and light. A solution on the lens field is derived using the Gaussian Legendre quadrature formulation. This numerical scheme is considered both accurate and efficient and has shortened significantly the computation time as compared to integration methods that required a great amount of sampling for satisfying the Whittaker - Shannon sampling theorem. By comparing the numerical results with the theoretical values it is shown that the theoretical bound is not directly relevant to microscopic imaging and is far too limiting. The numerical exhaustive experiments show that the Born approximation is inappropriate for modeling the visualization of thick human embryos.

/sub 1//sup 1/H/sup +/- and /sub 2//sup 4/He/sup +/-induced M-shell x-ray-production cross sections for selected elements in the rare-earth region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mehta, R.; Duggan, J.L.; Price, J.L.

1983-12-01

The measurements of M-shell x-ray-production cross sections induced by /sub 1//sup 1/H/sup +/ and /sub 2//sup 4/He/sup +/ ions are compared to the first-Born-approximation and ECPSSR (energy loss, Coulomb-deflection effects; perturbed-stationary-state approximation, with relativistic corrections) theories. Most of the reported experimental data were measured in our laboratory and the other measurements were taken from the literature. The data from our laboratory were for incident H/sup +/ and He/sup +/ ions in the energy range from 0.25 to 2.5 MeV. The M-shell x-ray-production cross sections were measured for the following thin targets: /sub 59/Pr, /sub 60/Nd, /sub 63/Eu, /sub 64/Gd, /submore » 66/Dy, /sub 67/Ho, /sub 68/Er, /sub 70/Yb, and /sub 72/Hf. The data from the literature were for protons and He/sup +/ ions in the energy range from 30 keV to 40 MeV. These data were for the following elements: /sub 54/Xe, /sub 59/Pr, /sub 60/Nd, /sub 62/Sm, /sub 63/Eu, /sub 64/Gd, /sub 65/Tb, /sub 66/Dy, /sub 67/Ho, /sub 68/Er, /sub 70/Yb, /sub 72/Hf, /sub 73/Ta, /sub 74/W, /sub 78/Pt, /sub 79/Au, /sub 80/Hg, /sub 82/Pb, /sub 83/Bi, and /sub 92/U. The first-Born-approximation calculations of the ionization cross section were made using the plane-wave Born approximation for direct ionization and the Oppenheimer-Brinkman-Kramers approximation of Nikolaev for electron capture. The ECPSSR theory of Brandt and Lapicki (Phys. Rev. A 23, 1717 (1981)) goes beyond the first Born approximation and accounts for the energy loss, Coulomb deflection, and relativistic effects in the perturbed-stationary-state theory. The first Born approximation overpredicts all measurements. The ECPSSR theory predicts the M-shell production cross sections correctly for Z/sub 2/>70 and energies per ..mu..>0.25 MeV/..mu...« less

School-Aged Children Born Preterm: Review of Functioning across Multiple Domains and Guidelines for Assessment

ERIC Educational Resources Information Center

Dempsey, Allison G.; Keller-Margulis, Milena; Mire, Sarah; Abrahamson, Catherine; Dutt, Sonia; Llorens, Ashlie; Payan, Anita

2015-01-01

Children born preterm are at risk for developmental deficits across multiple functional domains. As the rate of survival for preterm infants increases due to medical advancements, a greater understanding is needed for how to meet the needs of this growing population in schools. Because approximately 50-70% of children born preterm require…

Fluorine sites in glasses and transparent glass-ceramics of the system Na{sub 2}O/K{sub 2}O/Al{sub 2}O{sub 3}/SiO{sub 2}/BaF{sub 2}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bocker, Christian, E-mail: christian.bocker@uni-jena.d; Munoz, Francisco; Duran, Alicia

2011-02-15

The transparent glass-ceramics obtained in the silicate system Na{sub 2}O/K{sub 2}O/SiO{sub 2}/BaF{sub 2} show homogeneously dispersed BaF{sub 2} nano crystals with a narrow size distribution. The X-ray diffraction and the nuclear magnetic resonance spectroscopy were applied to glasses and the respective glass-ceramics in order to clarify the crystallization mechanism and the role of fluorine during crystallization. With an increasing annealing time, the concentration and also the number of crystals remain approximately constant. With an increasing annealing temperature, the crystalline fraction increases until a saturation limit is reached, while the number of crystals decreases and the size of the crystals increases.more » Fluoride in the glassy network occurs as Al-F-Ba, Al-F-Na and also as Ba-F structures. The latter are transformed into crystalline BaF{sub 2} and fluoride is removed from the Al-F-Ba/Na bonds. However, some fluorine is still present in the glassy phase after the crystallization. -- Graphical abstract: The X-ray diffraction and the nuclear magnetic resonance spectroscopy were applied to glasses in the silicate system Na{sub 2}O/K{sub 2}O/SiO{sub 2}/BaF{sub 2} and the respective glass-ceramics with BaF{sub 2} nano crystals in order to clarify the crystallization mechanism and the role of fluorine during crystallization. Display Omitted Research highlights: {yields} BaF{sub 2} nano crystals are precipitated from a silicate glass system. {yields} Ostwald ripening during the late stage of crystallization does not occur. {yields} Fluorine in the glass is coordinated with Ba as well as Al together with Ba or Na.{yields} In the glass-ceramics, the residual fluorine is coordinated as Al-F-Ba/Na.« less

Robust antiferromagnetic spin waves across the metal-insulator transition in hole-doped BaMn2As2

NASA Astrophysics Data System (ADS)

Ramazanoglu, M.; Sapkota, A.; Pandey, Abhishek; Lamsal, J.; Abernathy, D. L.; Niedziela, J. L.; Stone, M. B.; Kreyssig, A.; Goldman, A. I.; Johnston, D. C.; McQueeney, R. J.

2017-06-01

BaMn2As2 is an antiferromagnetic insulator where a metal-insulator transition occurs with hole doping via the substitution of Ba with K. The metal-insulator transition causes only a small suppression of the Néel temperature (TN) and the ordered moment, suggesting that doped holes interact weakly with the Mn spin system. Powder inelastic neutron scattering measurements were performed on three different samples of Ba1 -xKxMn2As2 with x =0 , 0.125, and 0.25 to study the effect of hole doping and metallization on the spin dynamics. We compare the neutron intensities to a linear spin-wave theory approximation to the J1-J2-Jc Heisenberg model. Hole doping is found to introduce only minor modifications to the exchange energies and spin gap. The changes observed in the exchange constants are consistent with the small drop of TN with doping.

Experimental and first principle studies on electronic structure of BaTiO{sub 3}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sagdeo, Archna, E-mail: archnaj@rrcat.gov.in; Ghosh, Haranath, E-mail: archnaj@rrcat.gov.in; Chakrabarti, Aparna, E-mail: archnaj@rrcat.gov.in

2014-04-24

We have carried out photoemission experiments to obtain valence band spectra of various crystallographic symmetries of BaTiO{sub 3} system which arise as a function of temperature. We also present results of a detailed first principle study of these symmetries of BaTiO{sub 3} using generalized gradient approximation for the exchange-correlation potential. Here we present theoretical results of density of states obtained from DFT based simulations to compare with the experimental valence band spectra. Further, we also perform calculations using post density functional approaches like GGA + U method as well as non-local hybrid exchange-correlation potentials like PBE0, B3LYP, HSE in ordermore » to understand the extent of effect of correlation on band gaps of different available crystallographic symmetries (5 in number) of BaTiO{sub 3}.« less

CMB-lensing beyond the Born approximation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marozzi, Giovanni; Fanizza, Giuseppe; Durrer, Ruth

2016-09-01

We investigate the weak lensing corrections to the cosmic microwave background temperature anisotropies considering effects beyond the Born approximation. To this aim, we use the small deflection angle approximation, to connect the lensed and unlensed power spectra, via expressions for the deflection angles up to third order in the gravitational potential. While the small deflection angle approximation has the drawback to be reliable only for multipoles ℓ ∼< 2500, it allows us to consistently take into account the non-Gaussian nature of cosmological perturbation theory beyond the linear level. The contribution to the lensed temperature power spectrum coming from the non-Gaussianmore » nature of the deflection angle at higher order is a new effect which has not been taken into account in the literature so far. It turns out to be the leading contribution among the post-Born lensing corrections. On the other hand, the effect is smaller than corrections coming from non-linearities in the matter power spectrum, and its imprint on CMB lensing is too small to be seen in present experiments.« less

Star of Lima - Overview and optical diagnostics of a barium Alfven critical velocity experiment

NASA Technical Reports Server (NTRS)

Wescott, E. M.; Stenbaek-Nielsen, H. C.; Hallinan, T.; Foeppl, H.; Valenzuela, A.

1986-01-01

The Alfven critical velocity mechanism for ionization of a neutral gas streaming across the magnetic field has been demonstrated in laboratory experiments. In March 1983, two rocket-borne experiments with Ba and Sr tested the effect in the wall-less laboratory of space from Punto Lobos, Peru, near 430 km altitude. 'Star of Lima' used a conical Ba shaped charge aimed at an instrument payload about 2 km away. Because of rocket overperformance the detonation occurred in partial sunlight, so that less than 21.6 percent of the ionizing UV was present. Particle and field measurements indicate the production of hot electrons and waves in the energy and frequency range that are respectively predicted to produce a cascade of ionization by the Alfven mechanism. However, the ionization fluxes and wave energy density did not reach cascade levels, and optical observations indicate that only 2.5 to 5 x 10 to the 20th Ba ions were produced. A substantial portion and perhaps all of the ionization could have been produced by solar UV. The failure of the Alfven process in this experiment is not well understood.

Recovery of singularities from a backscattering Born approximation for a biharmonic operator in 3D

NASA Astrophysics Data System (ADS)

Tyni, Teemu

2018-04-01

We consider a backscattering Born approximation for a perturbed biharmonic operator in three space dimensions. Previous results on this approach for biharmonic operator use the fact that the coefficients are real-valued to obtain the reconstruction of singularities in the coefficients. In this text we drop the assumption about real-valued coefficients and also establish the recovery of singularities for complex coefficients. The proof uses mapping properties of the Radon transform.

Assessment of the chemical changes induced in human melanoma cells by boric acid treatment using infrared imaging.

PubMed

Acerbo, Alvin S; Miller, Lisa M

2009-08-01

Boron is found in everyday foods and drinking water in trace quantities. Boron exists as boric acid (BA) within plants and animals, where low levels have been linked to cancer incidence. However, this correlation is not well characterized. In this study, we examined the chemical and morphological effects of BA on human skin melanoma cells (SK-MEL28) using Fourier Transform InfraRed Imaging (FTIRI) with a Focal Plane Array (FPA) detector. Cells were grown under concentrations of BA ranging from 0 to 50 mM. Cell viability was determined after 1, 2, 3, 5, 7 and 10 days using trypan blue staining. With FTIRI, images of approximately twenty cells per time point per condition were collected. Principal components analysis (PCA) was used to evaluate changes in cell composition, with particular focus on the lipid, protein, and nucleic acid spectral components. Results from trypan blue staining revealed decreased cell viability as BA concentration increased. FTIRI data indicated that the protein and lipid contents (as indicated by the lipid/protein ratio) did not undergo substantial changes due to BA treatment. In contrast, the nucleic acid/protein ratio significantly decreased with BA treatment. PCA results showed an increase in beta-sheet protein at higher concentrations of BA (12.5, 25, and 50 mM). Together, these results suggest that high concentrations of BA have an anti-proliferative effect and show signs consistent with apoptosis.

Crest - A Balloon-borne Instrument To Measure Cosmic-ray Electrons Above TeV Energies.

NASA Astrophysics Data System (ADS)

Schubnell, Michael; Anderson, T.; Bower, C.; Coutu, S.; Geske, M.; Müller, D.; Musser, J.; Nutter, S.; Park, N.; Tarlé, G.; Wakely, S.; Yagi, A.

2009-01-01

The observation of high energy (E > 1 TeV) electrons in the cosmic radiation provides important information on the distribution and energetics of local cosmic-ray sources. Galactic cosmic-ray electrons are thought to be shock accelerated in supernova remnants as evident from observations of non-thermal X-rays and TeV gamma rays. Their locally observed energy spectrum above 1 TeV is expected to reflect the distribution and abundance of nearby acceleration sites. However, the rates at these energies are low and the direct detection would require unfeasibly large balloons or satellite born detectors. CREST, a balloon-borne detector array of 1024 BaF2 crystals, overcomes this hurdle: it will measure the intensity and spectrum of multi-TeV electrons by detecting synchrotron photons emitted from electrons passing through the earth's magnetic field. Thus CREST's acceptance is several times its geometric area providing sensitivity up to about 50 TeV. Following an engineering flight in spring of 2009, CREST will be flown in a circumpolar orbit on an upcoming Antarctic long-duration balloon flight. This work is supported by NASA and CSBF.

Semiclassical approximation of the Wheeler-DeWitt equation: arbitrary orders and the question of unitarity

NASA Astrophysics Data System (ADS)

Kiefer, Claus; Wichmann, David

2018-06-01

We extend the Born-Oppenheimer type of approximation scheme for the Wheeler-DeWitt equation of canonical quantum gravity to arbitrary orders in the inverse Planck mass squared. We discuss in detail the origin of unitarity violation in this scheme and show that unitarity can be restored by an appropriate modification which requires back reaction from matter onto the gravitational sector. In our analysis, we heavily rely on the gauge aspects of the standard Born-Oppenheimer scheme in molecular physics.

Sediment pollution in margins of the Lake Guaíba, Southern Brazil.

PubMed

de Andrade, Leonardo Capeleto; Tiecher, Tales; de Oliveira, Jessica Souza; Andreazza, Robson; Inda, Alberto Vasconcellos; de Oliveira Camargo, Flávio Anastácio

2017-12-02

Sediments are formed by deposition of organic and inorganic particles on depth of water bodies, being an important role in aquatic ecosystems, including destination and potential source of essential nutrients and heavy metals, which may be toxic for living organisms. The Lake Guaíba supplies water for approximately two million people and it is located in the metropolitan region of Porto Alegre, Rio Grande do Sul State, Brazil. Thus, the aim of this study was to evaluate the sediment pollution in the margins of Lake Guaíba in the vicinity of Porto Alegre city. Surface sediment was sampled in 12 sites to assess the concentration of several elements (C, N, P, Fe, Al, Ca, Mg, Na, K, Mn, Ba, Zn, V, Pb, Cu, Cr, Ni, Cd, Mo, and Se) and the mineralogical composition. Sediment in margins of Lake Guaíba presented predominantly (> 95%) sandy fraction in all samples, but with significant differences between evaluated sites. Sediments in the margins of Lake Guaíba showed indications of punctual water pollution with Pb, Cu, Cr, Ni, TOC, TKN, and P, mainly derived from urban streams that flow into the lake. In order to solve these environmental liabilities, public actions should not focus only on Guaíba, but also in the streams that flow into the lake.

Dynamic Displacement Disorder of Cubic BaTiO3

NASA Astrophysics Data System (ADS)

Paściak, M.; Welberry, T. R.; Kulda, J.; Leoni, S.; Hlinka, J.

2018-04-01

The three-dimensional distribution of the x-ray diffuse scattering intensity of BaTiO3 has been recorded in a synchrotron experiment and simultaneously computed using molecular dynamics simulations of a shell model. Together, these have allowed the details of the disorder in paraelectric BaTiO3 to be clarified. The narrow sheets of diffuse scattering, related to the famous anisotropic longitudinal correlations of Ti ions, are shown to be caused by the overdamped anharmonic soft phonon branch. This finding demonstrates that the occurrence of narrow sheets of diffuse scattering agrees with a displacive picture of the cubic phase of this textbook ferroelectric material. The presented methodology allows one to go beyond the harmonic approximation in the analysis of phonons and phonon-related scattering.

How will millennials impact freight flows in Texas? Final report.

DOT National Transportation Integrated Search

2017-01-01

Millennials (born between 1983 and 2000) represent approximately 25 percent of the population in the United States and already outnumber baby boomers (born between 1946 and 1964) in the current population (15,16,17). As young adults, millennials are ...

Spectroscopic study of carbaryl sorption on smectite from aqueous suspension.

PubMed

de Oliveira, Maurilio Fernandes; Johnston, Cliff T; Premachandra, G S; Teppen, Brian J; Li, Hui; Laird, David A; Zhu, Dongqiang; Boyd, Stephen A

2005-12-01

Sorption of carbaryl (1-naphthyl-N-methyl-carbamate) from aqueous suspension to smectite was studied using Fourier transform infrared (FTIR), high-performance liquid chromatography (HPLC) (for batch sorption), and quantum chemical methods. The amount of carbaryl sorbed was strongly dependent on the surface-charge density of the smectite with more sorption occurring on the two "low" surface-charge density smectites (SHCa-1 and SWy-2) compared to that of the high surface-charge SAz-1 smectite. In addition, the amount of carbaryl sorbed was strongly dependent on the nature of the exchangeable cation and followed the order of Ba approximately Cs approximately Ca > Mg approximately K > Na approximately Li for SWy-2. A similartrend was found for hectorite (SHCa-1) of Cs > Ba > Ca > K approximately Mg > Na approximately Li. Using the shift of the carbonyl stretching band as an indicator of the strength of interaction between carbaryl and the exchangeable cation, the observed order was Mg > Ca > Ba approximately K > Na > Cs. The position of the carbonyl stretching band shifted to lower wavenumbers with increasing ionic potential of the exchangeable cation. Density functional theory predicted a cation-induced lengthening of the C=O bond, resulting from the carbonyl group interacting directly with the exchangeable cation in support of the spectroscopic observations. Further evidence was provided by a concomitant shift in the opposite direction by several vibrational bands in the 1355-1375 cm(-1) region assigned to stretching bands of the carbamate N-Ccarbonyl and Oether-Ccarbonyl bonds. These data indicate that carbaryl sorption is due, in part, to site-specific interactions between the carbamate functional group and exchangeable cations, as evidenced by the FTIR data. However, these data suggest that hydrophobic interactions also contribute to the overall amount of carbaryl sorbed. For example, the FTIR data indicated thatthe weakest interaction occurred when Cs+ was the exchangeable cation. In contrast, the highest amount of carbaryl sorption was observed on Cs-exchanged smectite. Of all the cations studied, Cs has the lowest enthalpy of hydration. It is suggested that this low hydration energy provides the carbaryl with greater access to the hydrophobic regions of the siloxane surface.

Distorted-wave methods for electron capture in ion-atom collisions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burgdoerfer, J.; Taulbjerg, K.

1986-05-01

Distorted-wave methods for electron capture are discussed with emphasis on the surface term in the T matrix and on the properties of the associated integral equations. The surface term is generally nonvanishing if the distorted waves are sufficiently accurate to include parts of the considered physical process. Two examples are considered in detail. If distorted waves of the strong-potential Born-approximation (SPB) type are employed the surface term supplies the first-Born-approximation part of the T matrix. The surface term is shown to vanish in the continuum-distorted-wave (CDW) method. The integral kernel is in either case free of the dangerous disconnected termsmore » discussed by Greider and Dodd but the CDW theory is peculiar in the sense that its first-order approximation (CDW1) excludes a specific on-shell portion of the double-scattering term that is closely connected with the classical Thomas process. The latter is described by the second-order term in the CDW series. The distorted-wave Born approximation with SPB waves is shown to be free of divergences. In the limit of asymmetric collisions the DWB suggests a modification of the SPB approximation to avoid the divergence problem recently identified by Dewangan and Eichler.« less

Reconciling elemental Ba and barite as proxies of export production: Multiple Ba reservoirs in biogenic sediment

NASA Astrophysics Data System (ADS)

Murray, R. W.; Kryc, K. A.; Murray, D. W.

2003-12-01

The use of barite has long been recognized as a promising proxy for export production due to the relationship between its formation and settling biogenic matter. Accordingly, excess Ba (total Ba minus Ba associated with terrigenous material) calculations have been applied as a proxy of barite to assess export production, although this approach may be problematic. For example, because there are additional carrying phases of Ba in sediment other than terrigenous Ba and barite (e.g., oxides, organic matter), excess Ba may not be related in a predictable manner to export production. Indeed, previous workers have also identified the importance of non-barite reservoirs of Ba in sediment traps (e.g., Dymond et al., 1992; Francois et al., 1995) and sediment (e.g., Schroeder et al., 1997; Eagle et al., 2003). Despite these multiple reservoirs, the use of elemental Ba in biogenic sediment as a proxy of export production has a proven and resilient track record. To further understand the partitioning of Ba in biogenic sediment, we sequentially extracted seven, operationally-defined fractions (loosely-bound, exchangeable, carbonate, oxide, organic, opal, and residual) of sediment from surface and downcore samples from a cross-equatorial meridional transect in the equatorial Pacific. We find that Ba is evenly distributed between the sedimentary components with approximately 25-40 percent of the total extracted Ba in each of the exchangeable, carbonate, and oxide fractions for both surface and downcore sediment samples. In the surface sediment transect across the equator, there is no Ba in the residual fraction, and between 10 and 50 percent of the total extracted Ba is in the organic fraction. Also, downcore samples that were extracted from sediments with low relative bulk Ba/Ti tend to have Ba in both the residual and organic fractions as opposed to samples with high relative bulk Ba/Ti where there is a lack of Ba in both the residual and organic fractions. These observations indicate that alternate carriers of Ba, including the exchangeable, carbonate, and oxide fractions of sediment, may exert a larger influence on total Ba than previously suspected. Our new results, when interpreted in the context of recent experimental (Ganeshram et al., 2003) and observational (Eagle et al., 2003) studies of barite formation and the relationship between barite and Ba, further explain why elemental Ba is a valid proxy of export production, as is the distribution of barite (e.g., Paytan et al., 1996). Our results show that while there is a reorganization of elemental Ba between sedimentary phases (which can be considered a continuation of the water column processes described by Ganeshram et al., 2003), the reorganization only affects the distribution of the Ba and does not destroy the primary relationship between export flux and the accumulation of Ba preserved in the sedimentary record.

Sintering and Microstructure of BaTiO3 Nano Particles Synthesized by Molten Salt Method.

PubMed

Lee, Chang-Hyun; Shin, Hyo-Soon; Yeo, Dong-Hun; Ha, Gook-Hyun; Nahm, Sahn

2016-05-01

In order to establish thinner dielectric layers in thick film electronic components such as MLCC (Multilayer ceramic capacitor), BaTiO3 nanoparticles have been utilized. However, studies on the synthesis of nanoparticles smaller than 20 nm, the characteristics of the BaTiO3 powder, and the powder's sintering are lacking. Therefore, this paper aims to synthesize BaTiO3 particles smaller than 20 nm by using the molten salt method and evaluate the microstructure and dielectric properties by varying the sintering temperature from 750 degrees C to 1200 degrees C. Through the molten salt method and by using KOH-KCl mixed salt, 20 nm BaTiO3 powder was synthesized at a low temperature of 150 degrees C. Sintering the pellets formed from the synthesized 20 nm BaTiO3 nano powder led to the observation of an unusual phenomenon where the particles grew to approximate sizes below 850 degrees C where densification progressed. At sintering temperatures above 950 degrees C, particles that expanded into rod shapes were observed and these particles were identified to be unreacted TiO2 based on the results of the EDX (Energy Dispersive X-ray Spectroscopy) analysis and phase analysis results.

Comparison of fate and transport of isoxaflutole to atrazine and metolachlor in 10 Iowa rivers

USGS Publications Warehouse

Meyer, M.T.; Scribner, E.A.; Kalkhoff, S.J.

2007-01-01

Isoxaflutole (IXF), a newer low application rate herbicide, was introduced for weed control in corn (Zea mays) to use as an alternative to widely applied herbicides such as atrazine. The transport of IXF in streamwater has not been well-studied. The fate and transport of IXF and two of its degradation products was studied in 10 Iowa rivers during 2004. IXF rapidly degrades to the herbicidally active diketonitrile (DKN), which degrades to a biologically inactive benzoic acid (BA) analogue. IXF was detected in only four, DKN in 56, and BA in 43 of 75 samples. The concentrations of DKN and BA were approximately 2 orders of magnitude less than those of the commonly detected triazine and acetamide herbicides and their degradation products. Concentrations of IXF, DKN, and BA were highest during the May through June postplanting period. The concentration ratio of BA/DKN was similar to the deethylatrazine/atrazine ratio with smaller ratios occurring during May and June. The relative temporal variation of DKN and BA was similar to that observed for atrazine and deethylatrazine. This study shows that low application rate herbicides can have similar temporal transport patterns in streamwater as compared to more widely applied herbicides but at lower concentrations.

Thermoelectric power of high-pressure synthesized CuBa{sub 2}Ca{sub 3}Cu{sub 4}O{sub 11{minus}{delta}}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, C.; Jin, C.; Yamauchi, H.

We report measurements of thermoelectric power (TEP) for high-pressure synthesized CuBa{sub 2}Ca{sub 3}Cu{sub 4}O{sub 11{minus}{delta}} superconductors. The magnitude of TEP for the sample with {ital T}{sub {ital c},zero}=115.9 K is very small and shows a sign crossover at {approximately}160 K. The TEP shows a peak behavior and displays an approximately linear temperature dependence with a negative slope {minus}0.033 {mu}V/K{sup 2} for 120{le}{ital T}{le}240 K. These features resemble those for other known high-{ital T}{sub {ital c}} cuprate superconductors, in particular {ital S}{sub {ital a}} in the {ital a} direction for an untwinned YBa{sub 2}Cu{sub 3}O{sub 7{minus}{delta}} single crystal and polycrystalline Tl-2201more » samples. A brief discussion is given on the TEP behavior in comparison with CuBa{sub 2}YCu{sub 2}O{sub 7{minus}{delta}} cuprate superconductors by considering their similar structure of building blocks and type of charge reservoir. {copyright} {ital 1996 The American Physical Society.}« less

Impact of Mated Female Nonproductive Days in Breeding Herd after Porcine Epidemic Diarrhea Virus Outbreak.

PubMed

Lin, Jung-Da; Lin, Chuen-Fu; Chung, Wen-Bin; Chiou, Ming-Tang; Lin, Chao-Nan

2016-01-01

Porcine epidemic diarrhea virus (PEDV) is an important pathogen that has a significant economic impact on the swine industry by imposing a high rate of mortality in suckling piglets. However, limited information on the productivity values of gilts and sows infected with PEDV is available. Here, we evaluate the productivity index in gilts and sows during the 1-year period before (19 January 2013 to 18 January 2014) and after (19 January 2014 to 18 January 2015) a PEDV outbreak from a 2000-sow breeding herd in Taiwan. The farrowing rate (FR), return rate (RR), total pigs born per litter (TB), pigs born alive per litter (BA), weaning pigs per litter (WPL), pre-weaning mortality, percentage of sows mated by 7 days after weaning, weaning to first service interval (WFSI), mated female nonproductive days (NPDs), replacement rate of sows and sow culling rate were compared using productive records. The FR (-9.6%), RR (+9.8%), TB (-1.6), BA (-1.1), WPL (-1.1), sows mated by 7 days after weaning (-6.9%), WFSI (+0.8 days), NPDs (+6.9 days) and sow culling rate (+7.2%) were significantly different between the 1-year pre-PEDV outbreak period and the post-PEDV outbreak period. Impacts of the PEDV infection on the reproductive performance were more severe in pregnant gilts than in sows. In conclusion, these findings indicate that the outbreak of PEDV caused an increase in the rate of NPDs in breeding herds.

Annealing temperature and O2 partial pressure dependence of T(sub c) in HgBa2CuO(4+delta)

NASA Technical Reports Server (NTRS)

Xiong, Q.; Cao, Y.; Chen, F.; Xue, Y. Y.; Chu, C. W.

1994-01-01

Samples of HgBa2CuO(4+delta) (Hg-1201) were annealed under various conditions. After carefully controlling annealing time, annealing temperature (T(sub a)) and O2 partial pressure (P(sub 0)), we were able to find the reversible annealing conditions for Hg-1201. Under 1 atm O2 at 260 C less than or equal to T(sub a) less than or equal to 400 C, the obtained T(sub c) is nearly the same (approximately 97 K). However, it decreases quickly with T(sub a) greater than 300 C in high vacuum (P(sub 0) approximately 10(exp -8) atm), and reaches zero at T(sub a) = 400 C. On the other hand, T(sub c) decreases with the decrease of T(sub a) in high-pressure O2 (approximately 500 atm) and reaches approximately 20 K at about 240 C. In the entire annealing region, the oxygen surplus varies significantly from 0.03 to 0.4, and a wide range of T(sub c) variation (0 goes to 97 K goes to 20 K) was obtained with anion doping alone.

One-dimensional carbon nanotube@barium titanate@polyaniline multiheterostructures for microwave absorbing application

NASA Astrophysics Data System (ADS)

Ni, Qing-Qing; Zhu, Yao-Feng; Yu, Lu-Jun; Fu, Ya-Qin

2015-04-01

Multiple-phase nanocomposites filled with carbon nanotubes (CNTs) have been developed for their significant potential in microwave attenuation. The introduction of other phases onto the CNTs to achieve CNT-based heterostructures has been proposed to obtain absorbing materials with enhanced microwave absorption properties and broadband frequency due to their different loss mechanisms. The existence of polyaniline (PANI) as a coating with controllable electrical conductivity can lead to well-matched impedance. In this work, a one-dimensional CNT@BaTiO3@PANI heterostructure composite was fabricated. The fabrication processes involved coating of an acid-modified CNT with BaTiO3 (CNT@BaTiO3) through a sol-gel technique followed by combustion and the formation of CNT@BaTiO3@PANI nanohybrids by in situ polymerization of an aniline monomer in the presence of CNT@BaTiO3, using ammonium persulfate as an oxidant and HCl as a dopant. The as-synthesized CNT@BaTiO3@PANI composites with heterostructures were confirmed by various morphological and structural characterization techniques, as well as conductivity and microwave absorption properties. The measured electromagnetic parameters showed that the CNT@BaTiO3@PANI composites exhibited excellent microwave absorption properties. The minimum reflection loss of the CNT@BaTiO3@PANI composites with 20 wt % loadings in paraffin wax reached -28.9 dB (approximately 99.87% absorption) at 10.7 GHz with a thickness of 3 mm, and a frequency bandwidth less than -20 dB was achieved from 10 to 15 GHz. This work demonstrated that the CNT@BaTiO3@PANI heterostructure composite can be potentially useful in electromagnetic stealth materials, sensors, and electronic devices.

One-dimensional carbon nanotube@barium titanate@polyaniline multiheterostructures for microwave absorbing application.

PubMed

Ni, Qing-Qing; Zhu, Yao-Feng; Yu, Lu-Jun; Fu, Ya-Qin

2015-01-01

Multiple-phase nanocomposites filled with carbon nanotubes (CNTs) have been developed for their significant potential in microwave attenuation. The introduction of other phases onto the CNTs to achieve CNT-based heterostructures has been proposed to obtain absorbing materials with enhanced microwave absorption properties and broadband frequency due to their different loss mechanisms. The existence of polyaniline (PANI) as a coating with controllable electrical conductivity can lead to well-matched impedance. In this work, a one-dimensional CNT@BaTiO3@PANI heterostructure composite was fabricated. The fabrication processes involved coating of an acid-modified CNT with BaTiO3 (CNT@BaTiO3) through a sol-gel technique followed by combustion and the formation of CNT@BaTiO3@PANI nanohybrids by in situ polymerization of an aniline monomer in the presence of CNT@BaTiO3, using ammonium persulfate as an oxidant and HCl as a dopant. The as-synthesized CNT@BaTiO3@PANI composites with heterostructures were confirmed by various morphological and structural characterization techniques, as well as conductivity and microwave absorption properties. The measured electromagnetic parameters showed that the CNT@BaTiO3@PANI composites exhibited excellent microwave absorption properties. The minimum reflection loss of the CNT@BaTiO3@PANI composites with 20 wt % loadings in paraffin wax reached -28.9 dB (approximately 99.87% absorption) at 10.7 GHz with a thickness of 3 mm, and a frequency bandwidth less than -20 dB was achieved from 10 to 15 GHz. This work demonstrated that the CNT@BaTiO3@PANI heterostructure composite can be potentially useful in electromagnetic stealth materials, sensors, and electronic devices.

Infant Stool Color Card Screening Helps Reduce the Hospitalization Rate and Mortality of Biliary Atresia: A 14-Year Nationwide Cohort Study in Taiwan.

PubMed

Lee, Min; Chen, Solomon Chih-Cheng; Yang, Hsin-Yi; Huang, Jui-Hua; Yeung, Chun-Yan; Lee, Hung-Chang

2016-03-01

Biliary atresia (BA) is a significant liver disease in children. Since 2004, Taiwan has implemented a national screening program that uses an infant stool color card (SCC) for the early detection of BA. The purpose of this study was to examine the outcomes of BA cases before and after the launch of this screening program. The objectives of this study were to evaluate the rates of hospitalization, liver transplantation (LT), and mortality of BA cases before and after the program, and to examine the association between the hospitalization rate and survival outcomes.This was a population-based cohort study. BA cases born during 1997 to 2010 were identified from the Taiwan National Health Insurance Research Database. Sex, birth date, hospitalization date, LT, and death data were collected and analyzed. The hospitalization rate by 2 years of age (Hosp/2yr) was calculated to evaluate its association with the outcomes of LT or death.Among 513 total BA cases, 457 (89%) underwent the Kasai procedure. Of these, the Hosp/2yr was significantly reduced from 6.0 to 6.9/case in the earlier cohort (1997-2004) to 4.9 to 5.3/case in the later cohort (2005-2010). This hospitalization rate reduction was followed by a reduction in mortality from 26.2% to 15.9% after 2006. The Cox proportional hazards model showed a significant increase in the risk for both LT (hazard ratio [HR] = 1.14, 95% confidence interval [CI] = 1.10-1.18) and death (HR = 1.05, 95% CI = 1.01-1.08) for each additional hospitalization. A multivariate logistic regression model found that cases with a Hosp/2yr >6 times had a significantly higher risk for both LT (adjusted odds ratio [aOR] = 4.35, 95% CI = 2.82-6.73) and death (aOR = 1.75, 95% CI = 1.17-2.62).The hospitalization and mortality rates of BA cases in Taiwan were significantly and coincidentally reduced after the launch of the SCC screening program. There was a significant association between the hospitalization rate and final outcomes of LT or death. The SCC screening program can help reduce the hospitalization rate and mortality of BA cases and bring great financial benefit.

Many-body Green’s function theory for electron-phonon interactions: The Kadanoff-Baym approach to spectral properties of the Holstein dimer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Säkkinen, Niko; Peng, Yang; Fritz-Haber-Institut der Max-Planck-Gesellschaft, Faradayweg 4-6, 14195 Berlin-Dahlem

2015-12-21

We present a Kadanoff-Baym formalism to study time-dependent phenomena for systems of interacting electrons and phonons in the framework of many-body perturbation theory. The formalism takes correctly into account effects of the initial preparation of an equilibrium state and allows for an explicit time-dependence of both the electronic and phononic degrees of freedom. The method is applied to investigate the charge neutral and non-neutral excitation spectra of a homogeneous, two-site, two-electron Holstein model. This is an extension of a previous study of the ground state properties in the Hartree (H), partially self-consistent Born (Gd) and fully self-consistent Born (GD) approximationsmore » published in Säkkinen et al. [J. Chem. Phys. 143, 234101 (2015)]. Here, the homogeneous ground state solution is shown to become unstable for a sufficiently strong interaction while a symmetry-broken ground state solution is shown to be stable in the Hartree approximation. Signatures of this instability are observed for the partially self-consistent Born approximation but are not found for the fully self-consistent Born approximation. By understanding the stability properties, we are able to study the linear response regime by calculating the density-density response function by time-propagation. This amounts to a solution of the Bethe-Salpeter equation with a sophisticated kernel. The results indicate that none of the approximations is able to describe the response function during or beyond the bipolaronic crossover for the parameters investigated. Overall, we provide an extensive discussion on when the approximations are valid and how they fail to describe the studied exact properties of the chosen model system.« less

Adsorption of benzo(a)pyrene on to asbestos and manmade mineral fibres in an aqueous solution and in a biological model solution.

PubMed Central

Gerde, P; Scholander, P

1988-01-01

The adsorption of benzo(a)pyrene (BaP) on to three types of asbestos (chrysotile antophyllite, and amosite) and three types of manmade mineral fibres (MMMF) (rock wool, slag wool, and glass wool) in a physiological water solution was studied. Adsorption was determined from the decrease in the liquid concentration of BaP on the addition of the solid material. Results show that all the fibres weakly adsorb BaP, approximately within the same order of magnitude. The combined adsorption of BaP and phosphatidylcholine (PC) on to chrysotile and amosite asbestos and on to rock wool in aqueous solution was also studied. PC, one of the major constituents in lung surfactant, forms a separate lipid phase in water consisting of micellar liposomes or lipid bilayers. A decrease in the liquid concentration of PC was found when any of the three materials was added, indicating adsorption of the lipid phase on to the fibres. A coincident decrease in the liquid concentration of BaP was also found indicating that BaP is readily solubilised in PC and will accompany the adsorption of this compound on to the fibres. Owing to the high lipid aqueous partition coefficient of BaP, it is concluded that the direct adsorption of BaP on to the fibres will be negligible when PC is present in the system even at low concentrations. Phospholipid adsorption by the fibres and not their direct adsorption of aromatic hydrocarbons should therefore be the crucial parameter for this indirect interaction between fibres and aromatic hydrocarbons. PMID:3196662

Robust antiferromagnetic spin waves across the metal-insulator transition in hole-doped BaMn 2 As 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramazanoglu, M.; Sapkota, A.; Pandey, Abhishek

BaMn 2 As 2 is an antiferromagnetic insulator where a metal-insulator transition occurs with hole doping via the substitution of Ba with K. The metal-insulator transition causes only a small suppression of the Néel temperature (T N) and the ordered moment, suggesting that doped holes interact weakly with the Mn spin system. Powder inelastic neutron scattering measurements were performed on three different samples of Ba 1 - xK xMn 2 As 2 with x = 0 , 0.125, and 0.25 to study the effect of hole doping and metallization on the spin dynamics. We compare the neutron intensities to amore » linear spin-wave theory approximation to the J 1 $-$ J 2 $-$ J c Heisenberg model. Hole doping is found to introduce only minor modifications to the exchange energies and spin gap. Lastly, the changes observed in the exchange constants are consistent with the small drop of T N with doping.« less

γ -soft Ba 146 and the role of nonaxial shapes at N ≈ 90

DOE PAGES

Mitchell, A. J.; Lister, C. J.; McCutchan, E. A.; ...

2016-01-12

Low-spin states in the neutron-rich, N = 90 nuclide 146Ba were populated following β decay of 146Cs , with the goal of clarifying the development of deformation in barium isotopes through delineation of their nonyrast structures. Fission fragments of 146Cs were extracted from a 1.7-Ci 252Cf source and mass selected using the CAlifornium Rare Ion Breeder Upgrade (CARIBU) facility. Low-energy ions were deposited at the center of a box of thin β detectors, surrounded by a highly efficient high-purity Ge array. The new 146Ba decay scheme now contains 31 excited levels extending up to ~2.5 MeV excitation energy, double whatmore » was previously known. These data are compared to predictions from the interacting boson approximation (IBA) model. It appears that the abrupt shape change found at N = 90 in Sm and Gd is much more gradual in Ba and Ce, due to an enhanced role of the γ degree of freedom.« less

Formation of metal nanoparticles in MgF2, CaF2 and BaF2 crystals under the electron beam irradiation

NASA Astrophysics Data System (ADS)

Bochkareva, Elizaveta S.; Sidorov, Alexander I.; Yurina, Uliana V.; Podsvirov, Oleg A.

2017-07-01

It is shown experimentally that electron beam action with electrons energies of 50 and 70 keV on MgF2, CaF2 and BaF2 crystals results in local formation in the crystal near-surface layer of Mg, Ca or Ba nanoparticles which possess plasmon resonance. In the case of MgF2 spheroidal nanoparticles are formed, in the cases of CaF2 and BaF2 - spherical. The formation of metal nanoparticles is confirmed by computer simulation in dipole quasistatic approximation. The dependence of absorption via electron irradiation dose is non-linear. It is caused by the increase of nanoparticles concentration and by the increase of nanoparticles sizes during irradiation. In the irradiated zones of MgF2 crystals, for irradiation doses less than 80 mC/cm2, the intense luminescence in a visible range appears. The practical application of fabricated composite materials for multilevel optical information recording is discussed.

Robust antiferromagnetic spin waves across the metal-insulator transition in hole-doped BaMn 2 As 2

DOE PAGES

Ramazanoglu, M.; Sapkota, A.; Pandey, Abhishek; ...

2017-06-01

BaMn 2 As 2 is an antiferromagnetic insulator where a metal-insulator transition occurs with hole doping via the substitution of Ba with K. The metal-insulator transition causes only a small suppression of the Néel temperature (T N) and the ordered moment, suggesting that doped holes interact weakly with the Mn spin system. Powder inelastic neutron scattering measurements were performed on three different samples of Ba 1 - xK xMn 2 As 2 with x = 0 , 0.125, and 0.25 to study the effect of hole doping and metallization on the spin dynamics. We compare the neutron intensities to amore » linear spin-wave theory approximation to the J 1 $-$ J 2 $-$ J c Heisenberg model. Hole doping is found to introduce only minor modifications to the exchange energies and spin gap. Lastly, the changes observed in the exchange constants are consistent with the small drop of T N with doping.« less

Emotional and behavioral problems in late preterm and early term births: outcomes at child age 36 months.

PubMed

Stene-Larsen, Kim; Lang, Astri M; Landolt, Markus A; Latal, Beatrice; Vollrath, Margarete E

2016-12-01

Recent findings has shown that late preterm births (gestational weeks 34-36) and early term births (gestational weeks 37-38) is associated with an increased risk of several psychological and developmental morbidities. In this article we investigate whether late preterm and early term births is associated with an increased risk of emotional and behavioral problems at 36 months of age and whether there are gender differences in risk of these outcomes. Forty-three thousand, two hundred ninety-seven children and their mothers participating in the Norwegian Mother and Child Cohort Study (MoBa). One thousand, eight hundred fifty-three (4.3%) of the children in the sample were born late preterm and 7,835 (18.1%) were born early term. Information on gestational age and on prenatal and postnatal risk factors was retrieved from the Medical Birth Registry of Norway. Information on emotional and behavioral problems was assessed by standardized questionnaires (CBCL/ITSEA) filled out by the mothers. Gender-stratified logistic regression analyses were used to explore the association between late preterm / early term and emotional and behavioral problems at 36 months of age. We found a gender-specific increased risk of emotional problems in girls born late preterm (OR 1.47 95%CI 1.11-1.95) and in girls born early term (OR 1.21 95%CI 1.04-1.42). We did not find an increased risk of emotional problems in boys born late preterm (OR 1.09 95%CI 0.82-1.45) or early term (OR 0.93 95%CI 0.79-1.10). Behavioral problems were not increased in children born late preterm or early term. Girls born late preterm and early term show an increased risk of emotional problems at 36 months of age. This finding suggests that gender should be taken into account when evaluating children born at these gestational ages.

Biodistribution and Radiation Dosimetry of the Integrin Marker 64Cu-BaBaSar-RGD2 Determined from Whole-Body PET/CT in a Non-Human Primate

NASA Astrophysics Data System (ADS)

Liu, Shuanglong; Vorobyova, Ivetta; Park, Ryan; Conti, Peter S.

2017-10-01

Introduction: 64Cu-BaBaSar-RGD2 is a positron emission radiotracer taken up by integrin αvβ3, which is overexpressed in many malignancies. The aim of this study was to evaluate the biodistribution of 64Cu-BaBaSar-RGD2 in a non-human primate with positron emission tomography and to estimate the absorbed doses in major organs for human. Materials and methods: Whole-body PET imaging was done in a Siemens Biograph scanner in a male macaque monkey. After an i.v. injection of 13.1–19.7 MBq/kg of 64Cu-BaBaSar-RGD2, whole body scan was collected for a total duration of 180 min. Attenuation and scatter corrections were applied to reconstruction of the whole-body emission scan. After image reconstruction, three-dimensional volumes of interest (VOI) were hand-drawn on the PET transaxial or coronal slices of the frame where the organ was most conspicuous. Time-activity curves for each VOI were obtained, and residence time of each organ was calculated by integration of the time-activity curves. Human absorbed doses were estimated using the standard human model in OLINDA/EXM software. Results: Injection of 64Cu-BaBaSar-RGD2 was well tolerated in the macaque monkey, with no serious tracer-related adverse events observed. 64Cu-BaBaSar-RGD2 was cleared rapidly from the blood pool, with a 12.1-min biological half-time. Increased 64Cu-BaBaSar-RGD2 uptake was observed in the kidneys, and bladder, with mean percentage injected dose (ID%) values at 1 h after injection approximately 35.50 ± 6.47 and 36.89 ± 5.48, respectively. The calculated effective dose was 15.30 ± 2.21 µSv/MBq, and the kidneys had the highest absorbed dose at 108.43 ± 16.41 µGy/MBq using the non-voiding model. For an injected activity of 925 MBq 64Cu for human, the effective dose would be 14.2 ± 2.1 mSv. Discussion: Due to the limitation of the monkey number, we evaluated 64Cu-BaBaSar-RGD2 in the same monkey of three imaging sessions. Measured absorbed doses and effective doses of 64Cu-BaBaSar-RGD2 are comparable to other reported RGD-derived radiopharmaceuticals labeled with 64Cu and 18F. Therefore, 64Cu-BaBaSar-RGD2 can be safely injected into humans for studying integrin αvβ3 expression non-invasively.

Comment on “On the quantum theory of molecules” [J. Chem. Phys. 137, 22A544 (2012)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sutcliffe, Brian T., E-mail: bsutclif@ulb.ac.be; Woolley, R. Guy

2014-01-21

In our previous paper [B. T. Sutcliffe and R. G. Woolley, J. Chem. Phys. 137, 22A544 (2012)] we argued that the Born-Oppenheimer approximation could not be based on an exact transformation of the molecular Schrödinger equation. In this Comment we suggest that the fundamental reason for the approximate nature of the Born-Oppenheimer model is the lack of a complete set of functions for the electronic space, and the need to describe the continuous spectrum using spectral projection.

Divergence of the total cross section for three body rearrangement collisions with coulomb interactions

NASA Technical Reports Server (NTRS)

Omidvar, K.

1972-01-01

Three charged particles 1, 2, 3 collide according to the reaction 1+(2+3) yields (1+3)+2, where (2+3) and (1+3) are hydrogenlike bound states. It is shown when (1+3) is in a highly excited state n, due to the repulsive potential, the cross section in the first Born approximation behaves as 1/n which makes the total cross section to diverge like ln n. The total cross sections in the higher orders of the Born approximation are similarly divergent logarithmically.

Water and sediment dynamics in the Red River mouth and adjacent coastal zone

NASA Astrophysics Data System (ADS)

van Maren, D. S.

2007-02-01

The coastline of the Red River Delta is characterized by alternating patterns of rapid accretion and severe erosion. The main branch of the Red River, the Ba Lat, is presently expanding seaward with a main depositional area several km downstream and offshore the Ba Lat River mouth. Sediment deposition rates are approximately 6 m in the past 50 years. Field measurements were done to determine the processes that regulate marine dispersal and deposition of sediment supplied by the Ba Lat. These measurements reveal that the waters surrounding the Ba Lat delta are strongly stratified with a pronounced southward-flowing surface layer. This southward-flowing surface layer is a coastal current which is generated by river plumes that flow into the coastal zone north of the Ba Lat. However, outflow of turbid river water is not continuous and most sediment enters the coastal zone when the alongshore surface velocities are low. As a consequence, most sediment settles from suspension close to the river mouth. In addition to the southward surface flow, the southward near-bottom currents are also stronger than northward currents. Contrasting with the residual flow near-surface, this southward flow component near-bottom is caused by tidal asymmetry. Because most sediment is supplied by the Ba Lat when wave heights are low, sediment is able to consolidate and therefore the long-term deposition is southward of, but still close to, the Ba Lat mouth.

Born Hartree Bethe approximation in the theory of inelastic electron molecule scattering

NASA Astrophysics Data System (ADS)

Kretinin, I. Yu; Krisilov, A. V.; Zon, B. A.

2008-11-01

We propose a new approximation in the theory of inelastic electron atom and electron molecule scattering. Taking into account the completeness property of atomic and molecular wavefunctions, considered in the Hartree approximation, and using Bethe's parametrization for electronic excitations during inelastic collisions via the mean excitation energy, we show that the calculation of the inelastic total integral cross-sections (TICS), in the framework of the first Born approximation, involves only the ground-state wavefunction. The final analytical formula obtained for the TICS, i.e. for the sum of elastic and inelastic ones, contains no adjusting parameters. Calculated TICS for electron scattering by light atoms and molecules (He, Ne, and H2) are in good agreement within the experimental data; results show asymptotic coincidence for heavier ones (Ar, Kr, Xe and N2).

Materials Data on BaSe (SG:225) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaSe (SG:221) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Thermoelectric properties of AMg 2X 2, AZn 2Sb 2 (A = Ca, Sr, Ba; X = Sb, Bi), and Ba 2ZnX 2 (X = Sb, Bi) Zintl compounds

DOE PAGES

Sun, Jifeng; Singh, David J.

2017-04-03

In this paper, we report a theoretical investigation of the electronic structure and transport properties of eleven Zintl compounds including nine 122 phases (AMg 2X 2, AZn 2Sb 2 (A = Ca, Sr, Ba; X = Sb, Bi)) and two 212 phases (Ba 2ZnX 2 (X = Sb, Bi)). The electronic structures and electrical transport properties are studied using ab initio calculations and semi-classical Boltzmann theory within the constant relaxation time approximation. All the compounds are semiconducting. We find that the n-type 122 phases with the CaAl 2Si 2 structure type show better performance than p-type materials due to themore » multi-valley degeneracy with anisotropic carrier pockets at and near the conduction band minimum. The pocket anisotropy is beneficial in achieving high conductivity and Seebeck coefficient simultaneously. This mechanism yields substantial improvement in the power factor. Finally, the general performance of 212 phases is inferior to that of the 122 phases, with the Ba 2ZnSb 2 compound showing better performance.« less

Materials Data on Ba21Al40 (SG:157) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-02-10

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba(AsPd)2 (SG:123) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaTiO3 (SG:123) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

EPIC'S PRODUCTS AND SERVICES

EPA Science Inventory

EPIC completes approximately 150 site characterizations annually using current and historical aerial photographs. This work is done in support of EPA Regional and Program
offices. Site characterization provides detailed information about a site and its history, often going ba...

Materials Data on BaLiP (SG:187) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaSiC (SG:107) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-09-24

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaCaI4 (SG:52) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-04-22

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaIn2Pd (SG:63) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2017-05-05

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba(POs)2 (SG:139) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2015-03-24

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaF2 (SG:225) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaLiF3 (SG:221) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaBeF4 (SG:62) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaCuF4 (SG:36) by Materials Project

DOE Data Explorer

Kristin Persson

2015-02-09

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaCuTeF (SG:129) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaBOF3 (SG:62) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaPdF4 (SG:140) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaIrF6 (SG:148) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaCuO2 (SG:18) by Materials Project

DOE Data Explorer

Kristin Persson

2016-04-22

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaS3 (SG:18) by Materials Project

DOE Data Explorer

Kristin Persson

2016-03-28

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba(ZnSn)2 (SG:129) by Materials Project

DOE Data Explorer

Kristin Persson

2015-02-09

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba(MnSn)2 (SG:139) by Materials Project

DOE Data Explorer

Kristin Persson

2016-02-05

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba(MgSn)2 (SG:129) by Materials Project

DOE Data Explorer

Kristin Persson

2016-02-05

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Calculated high-pressure structural properties, lattice dynamics and quasi particle band structures of perovskite fluorides KZnF3, CsCaF3 and BaLiF3

NASA Astrophysics Data System (ADS)

Vaitheeswaran, G.; Kanchana, V.; Zhang, Xinxin; Ma, Yanming; Svane, A.; Christensen, N. E.

2016-08-01

A detailed study of the high-pressure structural properties, lattice dynamics and band structures of perovskite structured fluorides KZnF3, CsCaF3 and BaLiF3 has been carried out by means of density functional theory. The calculated structural properties including elastic constants and equation of state agree well with available experimental information. The phonon dispersion curves are in good agreement with available experimental inelastic neutron scattering data. The electronic structures of these fluorides have been calculated using the quasi particle self-consistent GW approximation. The GW calculations reveal that all the fluorides studied are wide band gap insulators, and the band gaps are significantly larger than those obtained by the standard local density approximation, thus emphasizing the importance of quasi particle corrections in perovskite fluorides.

Calculated high-pressure structural properties, lattice dynamics and quasi particle band structures of perovskite fluorides KZnF3, CsCaF3 and BaLiF3.

PubMed

Vaitheeswaran, G; Kanchana, V; Zhang, Xinxin; Ma, Yanming; Svane, A; Christensen, N E

2016-08-10

A detailed study of the high-pressure structural properties, lattice dynamics and band structures of perovskite structured fluorides KZnF3, CsCaF3 and BaLiF3 has been carried out by means of density functional theory. The calculated structural properties including elastic constants and equation of state agree well with available experimental information. The phonon dispersion curves are in good agreement with available experimental inelastic neutron scattering data. The electronic structures of these fluorides have been calculated using the quasi particle self-consistent [Formula: see text] approximation. The [Formula: see text] calculations reveal that all the fluorides studied are wide band gap insulators, and the band gaps are significantly larger than those obtained by the standard local density approximation, thus emphasizing the importance of quasi particle corrections in perovskite fluorides.

Theoretical and experimental studies on wide-band-gap p-type conductive BaCuSeF and related compounds

NASA Astrophysics Data System (ADS)

Sakakima, Hiroshi; Nishitani, Mikihiko; Yamamoto, Koichi; Wada, Takahiro

2015-08-01

BaCuSeF and related compounds, MCuQF (M = Ba, Sr; Q = Se, S), are known to show p-type conduction. The formation energies of the Cu vacancy ΔH[VCu] in a MCuQF system were computed by first-principles calculation with a generalized gradient approximation (GGA) of the Perdew-Burke-Ernzerhof (PBE) functional as an electron exchange and correlation functional. The density of states (DOS) of BaCuSeF was calculated with the hybrid functional of Heyd-Scuseria-Ernzerhof (HSE) 06. ΔH[VCu] was found to be very small under both the Cu- and Q-rich conditions, which probably contributes to p-type conduction. The electronic structure of BaCuSeF was studied by X-ray photoelectron spectroscopy (XPS) with UV photoelectron yield spectroscopy (UVPYS) and photoemission yield spectroscopy (PYS). The determined depth of the top of the valence band relative to the vacuum level was about 4.9 eV. This value is desirable for applications in compound semiconductor thin-film tandem solar cells since the absorbers of polycrystalline thin-film solar cells, such as CdTe and Cu(In,Ga)Se2, are p-type semiconductors. The DOS of BaCuSeF calculated with the HSE06 functional was almost consistent with the XPS spectrum.

Resolution-Adaptive Hybrid MIMO Architectures for Millimeter Wave Communications

NASA Astrophysics Data System (ADS)

Choi, Jinseok; Evans, Brian L.; Gatherer, Alan

2017-12-01

In this paper, we propose a hybrid analog-digital beamforming architecture with resolution-adaptive ADCs for millimeter wave (mmWave) receivers with large antenna arrays. We adopt array response vectors for the analog combiners and derive ADC bit-allocation (BA) solutions in closed form. The BA solutions reveal that the optimal number of ADC bits is logarithmically proportional to the RF chain's signal-to-noise ratio raised to the 1/3 power. Using the solutions, two proposed BA algorithms minimize the mean square quantization error of received analog signals under a total ADC power constraint. Contributions of this paper include 1) ADC bit-allocation algorithms to improve communication performance of a hybrid MIMO receiver, 2) approximation of the capacity with the BA algorithm as a function of channels, and 3) a worst-case analysis of the ergodic rate of the proposed MIMO receiver that quantifies system tradeoffs and serves as the lower bound. Simulation results demonstrate that the BA algorithms outperform a fixed-ADC approach in both spectral and energy efficiency, and validate the capacity and ergodic rate formula. For a power constraint equivalent to that of fixed 4-bit ADCs, the revised BA algorithm makes the quantization error negligible while achieving 22% better energy efficiency. Having negligible quantization error allows existing state-of-the-art digital beamformers to be readily applied to the proposed system.

Description of a Mass Poisoning in a Rural District in Mozambique: The First Documented Bongkrekic Acid Poisoning in Africa.

PubMed

Gudo, Eduardo Samo; Cook, Kyla; Kasper, Amelia M; Vergara, Alfredo; Salomão, Cristolde; Oliveira, Fernanda; Ismael, Hamida; Saeze, Cristovão; Mosse, Carla; Fernandes, Quinhas; Viegas, Sofia Omar; Baltazar, Cynthia S; Doyle, Timothy J; Yard, Ellen; Steck, Alaina; Serret, Mayda; Falconer, Travis M; Kern, Sara E; Brzezinski, Jennifer L; Turner, James A; Boyd, Brian L; Jani, Ilesh V

2018-04-17

On 9 January 2015, in a rural town in Mozambique, >230 persons became sick and 75 died of an illness linked to drinking pombe, a traditional alcoholic beverage. An investigation was conducted to identify case patients and determine the cause of the outbreak. A case patient was defined as any resident of Chitima who developed any new or unexplained neurologic, gastrointestinal, or cardiovascular symptom from 9 January at 6:00 am through 12 January at 11:59 pm. We conducted medical record reviews, healthcare worker and community surveys, anthropologic and toxicologic investigations of local medicinal plants and commercial pesticides, and laboratory testing of the suspect and control pombe. We identified 234 case patients; 75 (32%) died and 159 recovered. Overall, 61% of case patients were female (n = 142), and ages ranged from 1 to 87 years (median, 30 years). Signs and symptoms included abdominal pain, diarrhea, vomiting, and generalized malaise. Death was preceded by psychomotor agitation and abnormal posturing. The median interval from pombe consumption to symptom onset was 16 hours. Toxic levels of bongkrekic acid (BA) were detected in the suspect pombe but not the control pombe. Burkholderia gladioli pathovar cocovenenans, the bacteria that produces BA, was detected in the flour used to make the pombe. We report for the first time an outbreak of a highly lethal illness linked to BA, a deadly food-borne toxin in Africa. Given that no previous outbreaks have been recognized outside Asia, our investigation suggests that BA might be an unrecognized cause of toxic outbreaks globally.

Potential of energy harvesting in barium titanate based laminates from room temperature to cryogenic/high temperatures: measurements and linking phase field and finite element simulations

NASA Astrophysics Data System (ADS)

Narita, Fumio; Fox, Marina; Mori, Kotaro; Takeuchi, Hiroki; Kobayashi, Takuya; Omote, Kenji

2017-11-01

This paper studies the energy harvesting characteristics of piezoelectric laminates consisting of barium titanate (BaTiO3) and copper (Cu) from room temperature to cryogenic/high temperatures both experimentally and numerically. First, the output voltages of the piezoelectric BaTiO3/Cu laminates were measured from room temperature to a cryogenic temperature (77 K). The output power was evaluated for various values of load resistance. The results showed that the maximum output power density is approximately 2240 nW cm-3. The output voltages of the BaTiO3/Cu laminates were also measured from room temperature to a higher temperature (333 K). To discuss the output voltages of the BaTiO3/Cu laminates due to temperature changes, phase field and finite element simulations were combined. A phase field model for grain growth was used to generate grain structures. The phase field model was then employed for BaTiO3 polycrystals, coupled with the time-dependent Ginzburg-Landau theory and the oxygen vacancies diffusion, to calculate the temperature-dependent piezoelectric coefficient and permittivity. Using these properties, the output voltages of the BaTiO3/Cu laminates from room temperature to both 77 K and 333 K were analyzed by three dimensional finite element methods, and the results are presented for several grain sizes and oxygen vacancy densities. It was found that electricity in the BaTiO3 ceramic layer is generated not only through the piezoelectric effect caused by a thermally induced bending stress but also by the temperature dependence of the BaTiO3 piezoelectric coefficient and permittivity.

Effect of BaSi2 template growth duration on the generation of defects and performance of p-BaSi2/n-Si heterojunction solar cells

NASA Astrophysics Data System (ADS)

Yachi, Suguru; Takabe, Ryota; Deng, Tianguo; Toko, Kaoru; Suemasu, Takashi

2018-04-01

We investigated the effect of BaSi2 template growth duration (t RDE = 0-20 min) on the defect generation and performance of p-BaSi2/n-Si heterojunction solar cells. The p-BaSi2 layer grown by molecular beam epitaxy (MBE) was 15 nm thick with a hole concentration of 2 × 1018 cm-3. The conversion efficiency η increased for films grown at long t RDE, owing to improvements of the open-circuit voltage (V OC) and fill factor (FF), reaching a maximum of η = 8.9% at t RDE = 7.5 min. However, η decreased at longer and shorter t RDE owing to lower V OC and FF. Using deep-level transient spectroscopy, we detected a hole trap level 190 meV above the valence band maximum for the sample grown without the template (t RDE = 0 min). An electron trap level 106 meV below the conduction band minimum was detected for a sample grown with t RDE = 20 min. The trap densities for both films were (1-2) × 1013 cm-3. The former originated from the diffusion of Ba into the n-Si region; the latter originated from defects in the template layer. The crystalline qualities of the template and MBE-grown layers were discussed. The root-mean-square surface roughness of the template reached a minimum of 0.51 nm at t RDE = 7.5 min. The a-axis orientation of p-BaSi2 thin films degraded as t RDE exceeded 10 min. In terms of p-BaSi2 crystalline quality and solar cell performance, the optimum t RDE was determined to be 7.5 min, corresponding to approximately 4 nm in thickness.

Chronobiology and chronotherapy of allergic rhinitis and bronchial asthma.

PubMed

Smolensky, Michael H; Lemmer, Bjoern; Reinberg, Alain E

2007-08-31

Study of the chronobiology of allergic rhinitis (AR) and bronchial asthma (BA) and the chronopharmacology and chronotherapy of the medications used in their treatment began five decades ago. AR is an inflammatory disease of the upper airway tissue with hypersensitivity to specific environmental antigens, resulting in further local inflammation, vasomotor changes, and mucus hypersecretion. Symptoms include sneezing, nasal congestion, and runny and itchy nose. Approximately 25% of children and 40% of adults in USA are affected by AR during one or more seasons of the year. The manifestation and severity of AR symptoms exhibit prominent 24-h variation; in most persons they are worse overnight or early in the morning and often comprise nighttime sleep, resulting in poor daytime quality of life, compromised school and work performance, and irritability and moodiness. BA is also an inflammatory medical condition of the lower airways characterized by hypersensitivity to specific environmental antigens, resulting in greater local inflammation as well as bronchoconstriction, vasomotor change, and mucus hypersecretion. In USA an estimated 6.5 million children and 15.7 million adults have BA. The onset and worsening of BA are signaled by chest wheeze and/or croupy cough and difficult and labored breathing. Like AR, BA is primarily a nighttime medical condition. AR is treated with H1-antagonist, decongestant, and anti-inflammatory (glucocorticoid and leukotriene receptor antagonist and modifier) medications. Only H1-antagonist AR medications have been studied for their chronopharmacology and potential chronotherapy. BA is treated with some of the same medications and also theophylline and beta2-agonists. The chronopharmacology and chronotherapy of many classes of BA medications have been explored. This article reviews the rather extensive knowledge of the chronobiology of AR and BA and the chronopharmacology and chronotherapy of the various medications used in their treatment.

Microscopic description of orbital-selective spin ordering in BaMn2As2

NASA Astrophysics Data System (ADS)

Craco, L.; Carara, S. S.

2018-05-01

Using generalized gradient approximation+dynamical mean-field theory, we provide a microscopic description of orbital-selective spin ordering in the tetragonal manganese pnictide BaMn2As2 . We demonstrate the coexistence of local moments and small band-gap electronic states in the parent compound. We also explore the role played by electron/hole doping, showing that the Mott insulating state is rather robust to small removal of electron charge carriers similar to cuprate oxide superconductors. Good qualitative accord between theory and angle-resolved photoemission as well as electrical transport provides support to our view of orbital-selective spin ordering in BaMn2As2 . Our proposal is expected to be an important step to understanding the emergent correlated electronic structure of materials with persisting ordered localized moments coexisting with Coulomb reconstructed nonmagnetic electronic states.

Determination of the charge of relativistic heavy nuclei from emulsion tracks

NASA Technical Reports Server (NTRS)

Morgan, S. H., Jr.; Eby, P. B.

1971-01-01

The number of delta rays with energies between 50 and 150 keV that are produced by heavy nuclei in emulsions is calculated. The Z(2) dependence predicted by the first Born approximation is corrected by a direct calculation of the Mott exact phase-shift scattering cross section. Comparisons are made with corrections predicted by the second Born approximation. When the phase-shift results are applied to the problem of charge identification, corrections of up to 4 units of charge for 1.457-GeV/nucleon nuclei with charge Z = 75 are found.

Measurements of the scattering of sound by a line vortex

NASA Technical Reports Server (NTRS)

Horne, W. C.

1983-01-01

This paper presents measurements of the phase and magnitude of the scattered field arising from the incidence of a monochromatic plane sound field as a steady vortex. The amplitude of the scattered field was found to vary linearly with the vortex strength, and with the incident wave amplitude and frequency as predicted by solutions based on the Born approximation. The scattered field was observed to be nonsingular in the incidence direction, and this was similar to predictions by the Parabolic Equation Method (PEM) rather than the Born approximation, which predicts singular behavior in the incidence direction.

Initial results from the Caltech/DSRI balloon-borne isotope experiment

NASA Technical Reports Server (NTRS)

Schindler, S. M.; Buffington, A.; Christian, E. C.; Grove, J. E.; Lau, K. H.; Stone, E. C.; Rasmussen, I. L.; Laursen, S.

1985-01-01

The Caltech/DSRI balloon-borne High Energy Isotope Spectrometer Telescope (HEIST) was flown successfully from Palestine, Texas on 14 May 1984. The experiment was designed to measure cosmic ray isotopic abundances from neon through iron, with incident particle energies from approximately 1.5 to 2.2 GeV/nucleon, depending on the element. During approximately 38 hours at float altitude, 10 to the 5th events were recorded with Z or = 6 and incident energies 1.5 GeV/nucleon. We present results from the ongoing data analysis associated with both the pre-flight Bevalac calibration and the flight data.

Inhibition of intestinal bile acid absorption improves cholestatic liver and bile duct injury in a mouse model of sclerosing cholangitis.

PubMed

Baghdasaryan, Anna; Fuchs, Claudia D; Österreicher, Christoph H; Lemberger, Ursula J; Halilbasic, Emina; Påhlman, Ingrid; Graffner, Hans; Krones, Elisabeth; Fickert, Peter; Wahlström, Annika; Ståhlman, Marcus; Paumgartner, Gustav; Marschall, Hanns-Ulrich; Trauner, Michael

2016-03-01

Approximately 95% of bile acids (BAs) excreted into bile are reabsorbed in the gut and circulate back to the liver for further biliary secretion. Therefore, pharmacological inhibition of the ileal apical sodium-dependent BA transporter (ASBT/SLC10A2) may protect against BA-mediated cholestatic liver and bile duct injury. Eight week old Mdr2(-/-) (Abcb4(-/-)) mice (model of cholestatic liver injury and sclerosing cholangitis) received either a diet supplemented with A4250 (0.01% w/w) - a highly potent and selective ASBT inhibitor - or a chow diet. Liver injury was assessed biochemically and histologically after 4weeks of A4250 treatment. Expression profiles of genes involved in BA homeostasis, inflammation and fibrosis were assessed via RT-PCR from liver and ileum homogenates. Intestinal inflammation was assessed by RNA expression profiling and immunohistochemistry. Bile flow and composition, as well as biliary and fecal BA profiles were analyzed after 1week of ASBT inhibitor feeding. A4250 improved sclerosing cholangitis in Mdr2(-/-) mice and significantly reduced serum alanine aminotransferase, alkaline phosphatase and BAs levels, hepatic expression of pro-inflammatory (Tnf-α, Vcam1, Mcp-1) and pro-fibrogenic (Col1a1, Col1a2) genes and bile duct proliferation (mRNA and immunohistochemistry for cytokeratin 19 (CK19)). Furthermore, A4250 significantly reduced bile flow and biliary BA output, which correlated with reduced Bsep transcription, while Ntcp and Cyp7a1 were induced. Importantly A4250 significantly reduced biliary BA secretion but preserved HCO3(-) and biliary phospholipid secretion resulting in an increased HCO3(-)/BA and PL/BA ratio. In addition, A4250 profoundly increased fecal BA excretion without causing diarrhea and altered BA pool composition, resulting in diminished concentrations of primary BAs tauro-β-muricholic acid and taurocholic acid. Pharmacological ASBT inhibition attenuates cholestatic liver and bile duct injury by reducing biliary BA concentrations in mice. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Kinetic and pharmacological properties distinguishing three types of calcium currents in chick sensory neurones.

PubMed Central

Fox, A P; Nowycky, M C; Tsien, R W

1987-01-01

1. Calcium currents in cultured dorsal root ganglion (d.r.g.) cells were studied with the whole-cell patch-clamp technique. Using experimental conditions that suppressed Na+ and K+ currents, and 3-10 mM-external Ca2+ or Ba2+, we distinguished three distinct types of calcium currents (L, T and N) on the basis of voltage-dependent kinetics and pharmacology. 2. Component L activates at relatively positive test potentials (t.p. greater than -10 mV) and shows little inactivation during a 200 ms depolarization. It is completely reprimed at a holding potential (h.p.) of -60 mV, and can be isolated by using a more depolarized h.p. (-40 mV) to inactivate the other two types of calcium currents. 3. Component T can be seen in isolation with weak test pulses. It begins activating at potentials more positive than -70 mV and inactivates quickly and completely during a maintained depolarization (time constant, tau approximately 20-50 ms). The current amplitude and the rate of decay increase with stronger depolarizations until both reach a maximum at approximately -40 mV. Inactivation is complete at h.p. greater than -60 mV and is progressively removed between -60 and -95 mV. 4. Component N activates at relatively strong depolarizations (t.p. greater than -20 mV) and decays with time constants ranging from 50 to 110 ms. Inactivation is removed over a very broad range of holding potentials (h.p. between -40 and -110 mV). 5. With 10 mM-EGTA in the pipette solution, substitution of Ba2+ for Ca2+ as the charge carrier does not alter the rates of activation or relaxation of any component. However, T-type channels are approximately equally permeable to Ca2+ and Ba2+, while L-type and N-type channels are both much more permeable to Ba2+. 6. Component N cannot be explained by current-dependent inactivation of L current resulting from recruitment of extra L-type channels at negative holding potentials: raising the external Ba2+ concentration to 110 mM greatly increases the amplitude of L current evoked from h.p. = -30 mV but produces little inactivation. 7. Cadmium ions (20-50 microM) virtually eliminate both N and L currents (greater than 90% block) but leave T relatively unaffected (less than 50% block). 200 microM-Cd2+ blocks all three components. 8. Nickel ions (100 microM) strongly reduce T current but leave N and L current little changed. 9. The dihydropyridine antagonist nifedipine (10 microM) inhibits L current (approximately 60% block) at a holding potential that inactivates half the L-type channels.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:2451016

Materials Data on Ba3(SbO3)2 (SG:2) by Materials Project

DOE Data Explorer

Kristin Persson

2014-07-09

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba5(TiN3)2 (SG:2) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2ReNiO6 (SG:225) by Materials Project

DOE Data Explorer

Kristin Persson

2015-01-27

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2MgReO6 (SG:225) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2ZnReO6 (SG:225) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2MnReO6 (SG:225) by Materials Project

DOE Data Explorer

Kristin Persson

2015-01-27

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2FeReO6 (SG:225) by Materials Project

DOE Data Explorer

Kristin Persson

2015-01-27

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2CoReO6 (SG:225) by Materials Project

DOE Data Explorer

Kristin Persson

2015-01-27

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaAg2SnSe4 (SG:23) by Materials Project

DOE Data Explorer

Kristin Persson

2016-02-10

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaAg2SnS4 (SG:23) by Materials Project

DOE Data Explorer

Kristin Persson

2014-07-09

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaAg2GeSe4 (SG:23) by Materials Project

DOE Data Explorer

Kristin Persson

2016-02-10

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaAg(PO3)3 (SG:19) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaLaMnInO6 (SG:53) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba3MgGeN4 (SG:52) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2017-04-10

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaSi3SnO9 (SG:188) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaSi4O9 (SG:188) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2014-07-09

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaTi(SiO3)3 (SG:188) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2014-07-09

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaSn(GeO3)3 (SG:188) by Materials Project

DOE Data Explorer

Kristin Persson

2014-07-09

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba4GaN3O (SG:61) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2017-04-10

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on K2Ba(SO)12 (SG:13) by Materials Project

DOE Data Explorer

Kristin Persson

2016-05-20

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on K2Ba(NO2)4 (SG:12) by Materials Project

DOE Data Explorer

Kristin Persson

2014-07-09

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaEr2F8 (SG:12) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaGaBO3F2 (SG:176) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaAlBO3F2 (SG:176) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaZnCO3F2 (SG:176) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba4Na(BO3)3 (SG:230) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-04-06

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2BeS(OF)4 (SG:4) by Materials Project

DOE Data Explorer

Kristin Persson

2014-07-09

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba3(GeN)2 (SG:11) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-02-05

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba3(SnP2)2 (SG:14) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba3(SnAs2)2 (SG:14) by Materials Project

DOE Data Explorer

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaSn2S3 (SG:11) by Materials Project

DOE Data Explorer

Kristin Persson

2016-02-04

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on TbBa2IrO6 (SG:225) by Materials Project

DOE Data Explorer

Kristin Persson

2015-02-09

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Auditory Evoked Potentials with Different Speech Stimuli: a Comparison and Standardization of Values

PubMed Central

Didoné, Dayane Domeneghini; Oppitz, Sheila Jacques; Folgearini, Jordana; Biaggio, Eliara Pinto Vieira; Garcia, Michele Vargas

2016-01-01

Introduction Long Latency Auditory Evoked Potentials (LLAEP) with speech sounds has been the subject of research, as these stimuli would be ideal to check individualś detection and discrimination. Objective The objective of this study is to compare and describe the values of latency and amplitude of cortical potentials for speech stimuli in adults with normal hearing. Methods The sample population included 30 normal hearing individuals aged between 18 and 32 years old with ontological disease and auditory processing. All participants underwent LLAEP search using pairs of speech stimuli (/ba/ x /ga/, /ba/ x /da/, and /ba/ x /di/. The authors studied the LLAEP using binaural stimuli at an intensity of 75dBNPS. In total, they used 300 stimuli were used (∼60 rare and 240 frequent) to obtain the LLAEP. Individuals received guidance to count the rare stimuli. The authors analyzed latencies of potential P1, N1, P2, N2, and P300, as well as the ampleness of P300. Results The mean age of the group was approximately 23 years. The averages of cortical potentials vary according to different speech stimuli. The N2 latency was greater for /ba/ x /di/ and P300 latency was greater for /ba/ x /ga/. Considering the overall average amplitude, it ranged from 5.35 and 7.35uV for different speech stimuli. Conclusion It was possible to obtain the values of latency and amplitude for different speech stimuli. Furthermore, the N2 component showed higher latency with the / ba / x / di / stimulus and P300 for /ba/ x / ga /. PMID:27096012

Role of A-site Ca and B-site Zr substitution in BaTiO3 lead-free compounds: Combined experimental and first principles density functional theoretical studies

NASA Astrophysics Data System (ADS)

Keswani, Bhavna C.; Saraf, Deepashri; Patil, S. I.; Kshirsagar, Anjali; James, A. R.; Kolekar, Y. D.; Ramana, C. V.

2018-05-01

We report on the combined experimental and theoretical simulation results of lead-free ferroelectrics, Ba(1-x)CaxTiO3 (x = 0.0-0.3) and BaTi(1-y)ZryO3 (y = 0.0-0.2), synthesized by standard solid state reaction method. First principles density functional calculations are used to investigate the electronic structure, dynamical charges, and spontaneous polarization of these compounds. In addition, the structural, ferroelectric, piezoelectric, and dielectric properties are studied using extensive experiments. The X-ray diffraction and temperature dependent Raman spectroscopy studies indicate that the calcium (Ca) substituted compositions exhibit a single phase crystal structure, while zirconium (Zr) substituted compositions are biphasic. The scanning electron micrographs reveal the uniform and highly dense microstructure. The presence of polarization-electric field and strain-electric field hysteresis loops confirms the ferroelectric and piezoelectric nature of all the compositions. Our results demonstrate higher values for polarization, percentage strain, piezoelectric coefficients, and electrostrictive coefficient compared to those existing in the literature. For smaller substitutions of Ca and Zr in BaTiO3, a direct piezoelectric coefficient (d33) is enhanced, while the highest d33 value (˜300 pC/N) is observed for BaTi0.96Zr0.04O3 due to the biphasic ferroelectric behavior. Calculation of Born effective charges indicates that doping with Ca or Zr increases the dynamical charges on Ti as well as on O and decreases the dynamical charge on Ba. An increase in the dynamical charges on Ti and O is ascribed to the increase in covalency of Ti-O bond that reduces the polarizability of the crystal. A broader range of temperatures is demonstrated to realize the stable phase in the Ca substituted compounds. The results indicate enhancement in the temperature range of applicability of these compounds for device applications. The combined theoretical and experimental study is expected to enhance the current scientific understanding of the lead-free ferroelectric materials.

Biliary atresia: lessons learned from the voluntary German registry.

PubMed

Leonhardt, J; Kuebler, J F; Leute, P J; Turowski, C; Becker, T; Pfister, E-D; Ure, B; Petersen, C

2011-03-01

Aim of the study was to carry out a 5-year survey of German patients with biliary atresia (BA) and to launch a discussion regarding the feasibility of voluntary registries in unregulated healthcare systems. A retrospective analysis of German BA patients born between 2001 and 2005, based on data collected from the voluntary European Biliary Atresia Registry (EBAR), was carried out and supplemented by data from all BA patients who underwent liver transplantation at the only 4 pediatric transplantation centers (pLTx) in Germany which are so far not registered at EBAR. Survival rates were calculated using Kaplan-Meier analysis and compared by Cox regression to determine the predictive value of age at surgery and the influence of the center size (fewer or more than 5 patients/study period) on overall survival and survival with native liver. A critical review of the 148 German EBAR charts revealed that 11 patients (7.4%) had no biliary atresia. The remaining 137 patients from EBAR together with 46 BA patients who underwent LTx without prior registration at EBAR were evaluated with a median follow-up of 39 months (range: 25-85 months). 29 hospitals performed a total of 159 Kasai procedures, but only 7 centers treated 5 or more patients (116 patients, range: 5-68), and 22 hospitals performed less than 5 KP (43 patients, range: 1-4). Primary LTx was performed in 21 patients (11.5%) and 3 patients died without surgical intervention. 16 patients were lost to follow-up (8.7%). Overall survival after 2 years was 83.3% (139 patients), including 105 patients (63%) who had undergone LTx and 34 patients (20.3%) with native liver. 28 patients died (16.7%), 8 after LTx (5.8%). The experience of the center was the only factor with a significant predictive value for jaundice-free survival with native liver (p=0.001). 25% of all German BA patients were not registered at EBAR, and 29 clinics were involved in the surgical management of BA patients. Therefore a new approach consisting of an internet-based decentralized registry for rare neonatal liver diseases is outlined which could improve the future management of patients with BA. The centralization of such patients at experienced centers with higher caseloads is necessary in Germany and would improve the outcome of patients with biliary atresia. © Georg Thieme Verlag KG Stuttgart · New York.

Scaling behaviour of relaxation dependencies in metaloxide superconductors

NASA Technical Reports Server (NTRS)

Sidorenko, A. S.; Panaitov, G. I.; Gabovich, A. M.; Moiseev, D. P.; Postnikov, V. M.

1990-01-01

Superconducting glass state has been investigated in different types of metaloxide ceramics, Y-Ba-Cu-O, Bi-Sr-Ca-Cu-O, Ba-Pb-Bi-O, using the highly sensitive SQUID magnetometer. The analysis of long-time relaxation processes of thermoremanent magnetization m(sup trm) (+) = M(sub o) - Slnt displayed scaling dependence of the decay rate S = -dM/dlnt on quantity of trapped magnetic flux M(sub o): 1gs = 31g M(sub o) - observed universal dependence S is approximately M(sup 3) (sub o) seems to one of the features of superconducting glass state in metaloxide ceramics.

Biotransformation of benzo[a]pyrene by the thermophilic bacterium Bacillus licheniformis M2-7.

PubMed

Guevara-Luna, Joseph; Alvarez-Fitz, Patricia; Ríos-Leal, Elvira; Acevedo-Quiroz, Macdiel; Encarnación-Guevara, Sergio; Moreno-Godinez, Ma Elena; Castellanos-Escamilla, Mildred; Toribio-Jiménez, Jeiry; Romero-Ramírez, Yanet

2018-06-09

Benzo[a]pyrene (BaP) is recognized as a potentially carcinogenic and mutagenic hydrocarbon, and thus, its removal from the environment is a priority. The use of thermophilic bacteria capable of biodegrading or biotransforming this compound to less toxic forms has been explored in recent decades, since it provides advantages compared to mesophilic organisms. This study assessed the biotransformation of BaP by the thermophilic bacterium Bacillus licheniformis M2-7. Our analysis of the biotransformation process mediated by strain M2-7 on BaP shows that it begins during the first 3 h of culture. The gas chromatogram of the compound produced shows a peak with a retention time of 17.38 min, and the mass spectra shows an approximate molecular ion of m/z 167, which coincides with the molecular weight of the chemical formula C 6 H 4 (COOH) 2 , confirming a chemical structure corresponding to phthalic acid. Catechol 2,3-dioxygenase (C23O) enzyme activity was detected in minimal saline medium supplemented with BaP (0.33 U mg -1 of protein). This finding suggests that B. licheniformis M2-7 uses the meta pathway for biodegrading BaP using the enzyme C23O, thereby generating phthalic acid as an intermediate.

Orientation control of barium titanate films using metal oxide nanosheet layer

NASA Astrophysics Data System (ADS)

Uchida, Hiroshi; Oi, Tomotake; Noguchi, Keito; Moki, Shota; Kim, Jin Woon; Shima, Hiromi; Nishida, Ken; Kiguchi, Takanori; Akama, Akihiko; Konno, Toyohiko J.; Funakubo, Hiroshi

2016-10-01

In the present work, we aim to achieve the preferred crystal orientation of chemical solution deposition (CSD)-derived BaTiO3 films on ubiquitous Si wafers with the assistance of Ca2Nb3O10 nanosheet (ns-CN) template layers. The ns-CN on platinized Si (Pt/Si) substrates aligned the BaTiO3(100) plane to the substrate surface, because of the favorable lattice matching of the ns-CN (001) plane. The CSD process in air required a high crystallization temperature of 900 °C for the preferred crystal orientation of BaTiO3(100) because of the BaCO3 byproduct generated during the combustion reaction of the precursor gel. The processing in vacuum to remove CO2 species enhanced the crystal orientation even at the crystallization temperature of 800 °C, although it can generate oxygen vacancies (\\text{V}\\text{O}{} \\bullet \\bullet ) that cause distorted polarization behavior under an applied field higher than approximately 150 kV/cm. The relative dielectric constant (εr) of the (100)-oriented BaTiO3 film on the ns-CN-supported Pt/Si substrate (ns-CN/Pt/Si) was generally larger than that of the randomly oriented film on Pt/Si, depending on the degree of crystal orientation.

Coherent states, quantum gravity, and the Born-Oppenheimer approximation. I. General considerations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stottmeister, Alexander, E-mail: alexander.stottmeister@gravity.fau.de; Thiemann, Thomas, E-mail: thomas.thiemann@gravity.fau.de

2016-06-15

This article, as the first of three, aims at establishing the (time-dependent) Born-Oppenheimer approximation, in the sense of space adiabatic perturbation theory, for quantum systems constructed by techniques of the loop quantum gravity framework, especially the canonical formulation of the latter. The analysis presented here fits into a rather general framework and offers a solution to the problem of applying the usual Born-Oppenheimer ansatz for molecular (or structurally analogous) systems to more general quantum systems (e.g., spin-orbit models) by means of space adiabatic perturbation theory. The proposed solution is applied to a simple, finite dimensional model of interacting spin systems,more » which serves as a non-trivial, minimal model of the aforesaid problem. Furthermore, it is explained how the content of this article and its companion affect the possible extraction of quantum field theory on curved spacetime from loop quantum gravity (including matter fields).« less

Generalized Born Models of Macromolecular Solvation Effects

NASA Astrophysics Data System (ADS)

Bashford, Donald; Case, David A.

2000-10-01

It would often be useful in computer simulations to use a simple description of solvation effects, instead of explicitly representing the individual solvent molecules. Continuum dielectric models often work well in describing the thermodynamic aspects of aqueous solvation, and approximations to such models that avoid the need to solve the Poisson equation are attractive because of their computational efficiency. Here we give an overview of one such approximation, the generalized Born model, which is simple and fast enough to be used for molecular dynamics simulations of proteins and nucleic acids. We discuss its strengths and weaknesses, both for its fidelity to the underlying continuum model and for its ability to replace explicit consideration of solvent molecules in macromolecular simulations. We focus particularly on versions of the generalized Born model that have a pair-wise analytical form, and therefore fit most naturally into conventional molecular mechanics calculations.

Materials Data on BaSb2Xe5F22 (SG:69) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba4TlBiPb2O9 (SG:49) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-02-10

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaNb2Fe2O9 (SG:42) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2017-04-16

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2SnSe3F2 (SG:62) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2SnS3F2 (SG:62) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2014-11-02

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2Fe2S2OF2 (SG:139) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-04-23

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on K4Ba2N7O16 (SG:12) by Materials Project

DOE Data Explorer

Kristin Persson

2016-04-20

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba4Mg(SiN3)2 (SG:70) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2017-04-10

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba4Y2Cu6O13 (SG:47) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-04-23

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2HoCu3O7 (SG:47) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-04-22

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2LaCu3O7 (SG:47) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-04-22

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2Ho2Co4O11 (SG:47) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-04-22

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2LuCu3O7 (SG:47) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-04-23

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2PrCu3O7 (SG:47) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-04-23

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2DyCu3O7 (SG:47) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-04-22

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2ErCu3O7 (SG:47) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-04-22

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba2TmCu3O7 (SG:47) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-04-22

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on BaFe(Si2O5)2 (SG:18) by Materials Project

DOE Data Explorer

Kristin Persson

2014-07-09

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

High calcination of ferroelectric BaTiO₃ doped Fe nanoceramics prepared by a solid-state sintering method.

PubMed

Samuvel, K; Ramachandran, K

2015-07-05

This study examined the effects of the combination of starting materials on the properties of solid-state reacted BaTiO3 using two different types of BaCO3 and TiO2. In addition, the effect of mechanochemical activation by high energy milling and the Ba/Ti molar ratio on the reaction temperature, particle size and tetragonality were investigated. The TiO2 phase and size plays a major role in increasing the reaction temperature and particle size. With the optimum selection of starting materials and processing conditions, BaTiO3 with a particle size <200 nm (Scherrer's formula) and a tetragonality c/a of approximately 1.007 was obtained. Broadband dielectric spectroscopy is applied to investigate the electrical properties of disordered perovskite-like ceramics in a wide temperature range. From the X-ray diffraction analysis it was found that the newly obtained BaTi0.5Fe0.5O3 ceramics consist of two chemically different phases. The electric modulus M∗ formalism used in the analysis enabled us to distinguish and separate the relaxation processes, dominated by marked conductivity in the ε∗(ω) representation. Interfacial effects on the dielectric properties of the samples have been understood by Cole-Cole plots in complex impedance and modulus formalism. Modulus formalism has identified the effects of both grain and grain boundary microstructure on the dielectric properties, particularly in solid state routed samples. Copyright © 2015 Elsevier B.V. All rights reserved.

High calcination of ferroelectric BaTiO3 doped Fe nanoceramics prepared by a solid-state sintering method

NASA Astrophysics Data System (ADS)

Samuvel, K.; Ramachandran, K.

2015-07-01

This study examined the effects of the combination of starting materials on the properties of solid-state reacted BaTiO3 using two different types of BaCO3 and TiO2. In addition, the effect of mechanochemical activation by high energy milling and the Ba/Ti molar ratio on the reaction temperature, particle size and tetragonality were investigated. The TiO2 phase and size plays a major role in increasing the reaction temperature and particle size. With the optimum selection of starting materials and processing conditions, BaTiO3 with a particle size <200 nm (Scherrer's formula) and a tetragonality c/a of approximately 1.007 was obtained. Broadband dielectric spectroscopy is applied to investigate the electrical properties of disordered perovskite-like ceramics in a wide temperature range. From the X-ray diffraction analysis it was found that the newly obtained BaTi0.5Fe0.5O3 ceramics consist of two chemically different phases. The electric modulus M∗ formalism used in the analysis enabled us to distinguish and separate the relaxation processes, dominated by marked conductivity in the ε∗(ω) representation. Interfacial effects on the dielectric properties of the samples have been understood by Cole-Cole plots in complex impedance and modulus formalism. Modulus formalism has identified the effects of both grain and grain boundary microstructure on the dielectric properties, particularly in solid state routed samples.

Results of critical velocity experiments with barium, strontium, and calcium releases from CRRES satellite

NASA Technical Reports Server (NTRS)

Wescott, E. M.; Stenbaek-Nielsen, H. C.; Hampton, D. L.; Delamere, P. A.

1994-01-01

As part of the NASA Combined Release and Radiation Effects Satellite (CRRES) chemical release program in September 1990, two Ba and also one each Sr and Ca canisters of a boron-titanium thermite mixture, which vaporizes the element on ignition, were released near perigee after dusk in the South Pacific to study the critical velocity effect proposed by Alfven. The critical velocities of these three elements are 2.7, 3.5, and 5.4 km/s respectively, all well below the orbital velocity of 9.4 km/s. On September 10, 1990, a Sr and Ba pair (G-13, or critical ionization velocity (CIV) I) was released near Rarotonga at approximately 515 km altitude in a background electron density of 3.4 x 10(exp 6)/cu cm. On September 14, 1990, G-14 or CIV II released a Ca and Ba pair west of New Caledonia near 595 km at an electron density of 1.5 x 10(exp 6)/cu cm. Ions of all three elements were observed with low-light level imagers from two aircraft after they had transited up the magnetic field lines into the sunlight. Emissions from the spherically expanding neutral gas shells below the solar terminator, observed with cameras filtered for the Ba(+) ion line at 4554 A and also in unfiltered imagers for approximately 15 s after release, are probably due to excitation by hot electrons created in the CIV process. The ions created clearly lost much of their energy, which we now show can be explained by elastic collisions: Ba(+) + O. Inventories of the observed ions indicate yields of 0.15% and 1.84% for Ba in the first and second experiments, 0.02% for Sr and 0.27% for Ca. Ionization from all the releases continued along the satellite trajectory much longer (greater than 45 s) than expected for a CIV process. The ion production along the satellite track versus time typically shows a rapid rise to a peak in a few seconds followed by an exponential decrease to a level essentially constant rate. The characteristic distances for CIV I and II are 47 and 62 km, respectively. We interpret the early time rise and exponential fall to be due to CIV ionization, of 0.014% (CIV I) and 0.40% (CIV II) for the Ba releases. The later ions produced at a constant rate probably have origins from other such processes as stripping and associative ionization collisions with atmospheric constituents primarily O, and charge exchange with O(+), He(+), and H(+). We suggest that the much larger Ba ionization rate in CIV II than CIV I is due to the fact that the release occurred in the peak Ca density where hot electrons were already present.

Expressive Language in Preschoolers Born Preterm: Results of Language Sample Analysis and Standardized Assessment

ERIC Educational Resources Information Center

Imgrund, Caitlin

2017-01-01

Children born preterm constitute one of the largest populations of children at risk for the development of language impairments. A little over one in ten pregnancies result in a preterm birth and approximately 25% of these children go on to experience subsequent difficulties with language (CDC, 2015; Foster-Cohen, Friesen, Champion, &…

Immunological control of ticks and tick-borne diseases that impact cattle health and production in Mexico

USDA-ARS?s Scientific Manuscript database

The cattle industry is one of the most important agroeconomic activities in Mexico. The national herd is estimated to include approximately 33.5 million head of cattle. Ticks and tick-borne diseases are principal factors with a negative impact on cattle health and production in Mexico. The most econ...

Microstructure and dielectric properties of silver-barium titanate nanocomplex materials by wet chemical approach

NASA Astrophysics Data System (ADS)

Ueno, Shintaro; Sakamoto, Yasunao; Nakashima, Kouichi; Wada, Satoshi

2014-09-01

To develop ceramic capacitors with a high effective dielectric constant, we attempted to fabricate BaTiO3 (BT) complexes with embedded Ag nanoparticles by wet chemical processes. Ag nanoparticle-adsorbed dendritic BT particles, Ag-BT hybrid particles, were synthesized from the sol-gel-derived precursor gel powders containing Ag, Ba, and Ti by hydrothermal treatment. These particles were pressed with BT fillers and TiO2 precursor nanoparticles into green compacts, and then, the green compacts were chemically converted into the Ag/BT nanocomplex compacts in Ba(OH)2 aqueous solution under the hydrothermal condition at 160 °C. The effective dielectric constant of the resultant Ag/BT nanocomplexes increases with an increase in Ag content. The maximal effective dielectric constant of approximately 900 was recorded for the nanocomplex with the Ag content of 10.7 vol %.

First-principles calculations on thermodynamic properties of BaTiO3 rhombohedral phase.

PubMed

Bandura, Andrei V; Evarestov, Robert A

2012-07-05

The calculations based on the linear combination of atomic orbitals have been performed for the low-temperature phase of BaTiO(3) crystal. Structural and electronic properties, as well as phonon frequencies were obtained using hybrid PBE0 exchange-correlation functional. The calculated frequencies and total energies at different volumes have been used to determine the equation of state and thermal contribution to the Helmholtz free energy within the quasiharmonic approximation. For the first time, the bulk modulus, volume thermal expansion coefficient, heat capacity, and Grüneisen parameters in BaTiO(3) rhombohedral phase have been estimated at zero pressure and temperatures form 0 to 200 K, based on the results of first-principles calculations. Empirical equation has been proposed to reproduce the temperature dependence of the calculated quantities. The agreement between the theoretical and experimental thermodynamic properties was found to be satisfactory. Copyright © 2012 Wiley Periodicals, Inc.

Structure and optical band gaps of (Ba,Sr)SnO{sub 3} films grown by molecular beam epitaxy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schumann, Timo; Raghavan, Santosh; Ahadi, Kaveh

2016-09-15

Epitaxial growth of (Ba{sub x}Sr{sub 1−x})SnO{sub 3} films with 0 ≤ x ≤ 1 using molecular beam epitaxy is reported. It is shown that SrSnO{sub 3} films can be grown coherently strained on closely lattice and symmetry matched PrScO{sub 3} substrates. The evolution of the optical band gap as a function of composition is determined by spectroscopic ellipsometry. The direct band gap monotonously decreases with x from to 4.46 eV (x = 0) to 3.36 eV (x = 1). A large Burnstein-Moss shift is observed with La-doping of BaSnO{sub 3} films. The shift corresponds approximately to the increase in Fermi level and is consistent with the low conduction band mass.

Role of ultrathin metal fluoride layer in organic photovoltaic cells: mechanism of efficiency and lifetime enhancement.

PubMed

Lim, Kyung-Geun; Choi, Mi-Ri; Kim, Ji-Hoon; Kim, Dong Hun; Jung, Gwan Ho; Park, Yongsup; Lee, Jong-Lam; Lee, Tae-Woo

2014-04-01

Although rapid progress has been made recently in bulk heterojunction organic solar cells, systematic studies on an ultrathin interfacial layer at the electron extraction contact have not been conducted in detail, which is important to improve both the device efficiency and the lifetime. We find that an ultrathin BaF2 layer at the electron extraction contact strongly influences the open-circuit voltage (Voc ) as the nanomorphology evolves with increasing BaF2 thickness. A vacuum-deposited ultrathin BaF2 layer grows by island growth, so BaF2 layers with a nominal thickness less than that of single-coverage layer (≈3 nm) partially cover the polymeric photoactive layer. As the nominal thickness of the BaF2 layer increased to that of a single-coverage layer, the Voc and power conversion efficiency (PCE) of the organic photovoltaic cells (OPVs) increased but the short-circuit current remained almost constant. The fill factor and the PCE decreased abruptly as the thickness of the BaF2 layer exceeded that of a single-coverage layer, which was ascribed to the insulating nature of BaF2 . We find the major cause of the increased Voc observed in these devices is the lowered work function of the cathode caused by the reaction and release of Ba from thin BaF2 films upon deposition of Al. The OPV device with the BaF2 layer showed a slightly improved maximum PCE (4.0 %) and a greatly (approximately nine times) increased device half-life under continuous simulated solar irradiation at 100 mW cm(-2) as compared with the OPV without an interfacial layer (PCE=2.1 %). We found that the photodegradation of the photoactive layer was not a major cause of the OPV degradation. The hugely improved lifetime with cathode interface modification suggests a significant role of the cathode interfacial layer that can help to prolong device lifetimes. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Materials Data on BaNaCe2C4O12F (SG:194) by Materials Project

DOE Data Explorer

Kristin Persson

2016-02-10

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba4Fe3(S3F2)2 (SG:62) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2016-04-23

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on K6Ba2CaU6O24 (SG:67) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2014-07-09

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba3NaY3(Si3O10)2 (SG:40) by Materials Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kristin Persson

2017-04-10

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Materials Data on Ba6YTl3(Cu2O7)3 (SG:6) by Materials Project

DOE Data Explorer

Kristin Persson

2014-09-30

Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

Communication: On the calculation of time-dependent electron flux within the Born-Oppenheimer approximation: A flux-flux reflection principle

NASA Astrophysics Data System (ADS)

Albert, Julian; Hader, Kilian; Engel, Volker

2017-12-01

It is commonly assumed that the time-dependent electron flux calculated within the Born-Oppenheimer (BO) approximation vanishes. This is not necessarily true if the flux is directly determined from the continuity equation obeyed by the electron density. This finding is illustrated for a one-dimensional model of coupled electronic-nuclear dynamics. There, the BO flux is in perfect agreement with the one calculated from a solution of the time-dependent Schrödinger equation for the coupled motion. A reflection principle is derived where the nuclear BO flux is mapped onto the electronic flux.

First-principles calculations reveal controlling principles for carrier mobilities in semiconductors

DOE PAGES

Wu, Yu -Ning; Zhang, Xiaoguang; Pantelides, Sokrates T.; ...

2016-10-11

It has long been believed that carrier mobilities in semiconductors can be calculated by Fermi s golden rule (Born approximation). Phenomenological models for scattering amplitudes are typically used for engineering- level device modeling. Here we introduce a parameter-free, first-principles approach based on complex- wavevector energy bands that does not invoke the Born approximation. We show that phonon-limited mobility is controlled by low-resistivity percolation paths and that in ionized-impurity scattering one must account for the effect of the screening charge, which cancels most of the Coulomb tail.Finally, calculated electron mobilities in silicon are in agreement with experimental data.

Comparing the role of the height of men and women in the marriage market.

PubMed

Yamamura, Eiji; Tsutsui, Yoshiro

2017-08-01

This paper explores how the role of men and women's height in the marriage market has changed across generations. Using individual-level data from Japan, we compared the effect of height on marriages between men and women, and investigated how the effect of height on marriage has changed across generations. Our key findings are: (1) for men born before 1965, a 1% increase in height led to an approximately 0.56% increase in the probability of being married. Conversely, for women born before 1965, a 1% increase in height led to an approximately 0.56% decrease in the probability of being married. (2) For men born in or after 1965, a 1% increase in height led to an approximately 1.05% (0.18%) increase (decrease) in the probability of being married (divorced). However, the height effect was not present for women. Japan experienced astounding economic development after World War II, which resulted in changes in its economic and social structure. These changes may have also altered the role of height for Japanese men and women in the marriage market. Copyright © 2017 Elsevier B.V. All rights reserved.

Many-body Green’s function theory for electron-phonon interactions: Ground state properties of the Holstein dimer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Säkkinen, Niko; Leeuwen, Robert van; Peng, Yang

2015-12-21

We study ground-state properties of a two-site, two-electron Holstein model describing two molecules coupled indirectly via electron-phonon interaction by using both exact diagonalization and self-consistent diagrammatic many-body perturbation theory. The Hartree and self-consistent Born approximations used in the present work are studied at different levels of self-consistency. The governing equations are shown to exhibit multiple solutions when the electron-phonon interaction is sufficiently strong, whereas at smaller interactions, only a single solution is found. The additional solutions at larger electron-phonon couplings correspond to symmetry-broken states with inhomogeneous electron densities. A comparison to exact results indicates that this symmetry breaking is stronglymore » correlated with the formation of a bipolaron state in which the two electrons prefer to reside on the same molecule. The results further show that the Hartree and partially self-consistent Born solutions obtained by enforcing symmetry do not compare well with exact energetics, while the fully self-consistent Born approximation improves the qualitative and quantitative agreement with exact results in the same symmetric case. This together with a presented natural occupation number analysis supports the conclusion that the fully self-consistent approximation describes partially the bipolaron crossover. These results contribute to better understanding how these approximations cope with the strong localizing effect of the electron-phonon interaction.« less

Characteristics of polycyclic aromatic hydrocarbons in food oils in Beijing catering services.

PubMed

Hao, Xuewei; Yin, Yong; Feng, Sijie; Du, Xu; Yu, Jingyi; Yao, Zhiliang

2016-12-01

The concentrations and characteristics of 16 polycyclic aromatic hydrocarbons (PAHs) in 48 oil samples randomly collected from 30 catering services that employ six cooking methods were quantified via high-performance liquid chromatography (HPLC). These 16 PAHs were detected in almost all of the samples. The levels of Σ16PAHs, Σ4PAHs, benzo[a]pyrene (BaP), and total BaP equivalents (ΣBaP eq ) for the six cooking methods exceeded the legal limit. The concentrations of Σ4PAHs were approximately 9.5 to 16.4 times the legal limit proposed by the European Commission (Off J Eur Union 215:4-8, 2011), and the level of BaP exceeded the national standard in China by 4.7- to 10.6-fold, particularly in oil from fried foods. Low molecular weight PAHs (LMW PAHs) were predominant in fried food oil from different catering services and accounted for 94.8 % of these oils, and the ΣBaP eq of the high molecular weight PAHs (HMW PAHs) was 11.5-fold higher than that of the LMW PAHs. The concentrations of Σ16PAHs (3751.9-7585.8 μg/kg), Σ4PAHs (144.6-195.7 μg/kg), BaP (79.7-135.8 μg/kg), and ΣBaP eq (231.0-265.4 μg/kg) were highest in the samples from fast food restaurants/buffets (FB), followed by those from fried food stalls (FS) and then cooking restaurants/cafeterias (RC). The results of this study suggest that the government should strengthen control and supervision of PAH contamination in food and edible oils.

Scattering and absorption of massless scalar waves by Born-Infeld black holes

NASA Astrophysics Data System (ADS)

Sanchez, Pablo Alejandro; Bretón, Nora; Bergliaffa, Santiago Esteban Perez

2018-06-01

We present the results of a study of the scattering of massless planar scalar waves by a Born-Infeld black hole. The scattering and absorption cross sections are calculated using partial-wave methods. The numerical results are checked by reproducing those of the Reissner-Nordstrom black hole, and also using several approximations, with which our results are in very good agreement. The dependence of these phenomena on the effective potential, the charge of the black hole, and the value of the Born-Infeld parameter is discussed.

Crest: A Balloon-borne Instrument to Measure Cosmic-ray Electrons above TeV Energies

NASA Astrophysics Data System (ADS)

Nutter, S.; Anderson, T.; Coutu, S.; Geske, M.; Bower, C.; Musser, J.; Muller, D.; Park, N.; Wakely, S.; Schubnell, M.; Tarle, G.; Yagi, A.

2009-05-01

The flux of high-energy (>1 TeV) electrons provides information about the spatial distribution and abundance of nearby cosmic ray sources. CREST, a balloon-borne array of 1024 BaF2 crystals viewed by PMTs, will measure the spectrum of multi-TeV electrons through detection of the x-ray synchrotron photons generated as the electrons traverse the Earth's magnetic field. This method naturally discriminates against the proton and gamma ray backgrounds, and achieves very large detector apertures, since the instrument need only intersect a portion of the kilometers-long line of photons and not the electron itself. Thus CREST's acceptance is several times its geometric area up to energies of 50 TeV, ˜10 times higher in energy than ground based techniques can reach. This measurement will overlap the recent HESS results and extend to higher energies. CREST is scheduled to fly in a long duration circumpolar orbit over Antarctica in 2010. An overview of the detector design and status will be presented.

Migration timing and parenting practices: Contributions to social development in preschoolers with foreign-born and native-born mothers

PubMed Central

Glick, Jennifer E.; Hanish, Laura D.; Yabiku, Scott T.; Bradley, Robert H.

2012-01-01

Little is known about how key aspects of parental migration or child-rearing history affect social development across children from immigrant families. Relying on data on approximately 6,400 children from the Early Childhood Longitudinal Study – Birth Cohort, analyses assessed the role of mothers’ age at migration on children’s social development in the United States (sociability and problem behaviors). Consistent with models of divergent adaptation and assimilation, the relationship between age at arrival and children’s social development is not linear. Parenting practices, observed when children were approximately 24 months of age, partially mediated the relation between mothers’ age at arrival and children’s social development reported at approximate age 48 months, particularly in the case of mothers who arrived as adults. PMID:22966921

Second-order Born calculation of coplanar symmetric (e, 2e) process on Mg

NASA Astrophysics Data System (ADS)

Zhang, Yong-Zhi; Wang, Yang; Zhou, Ya-Jun

2014-06-01

The second-order distorted wave Born approximation (DWBA) method is employed to investigate the triple differential cross sections (TDCS) of coplanar doubly symmetric (e, 2e) collisions for magnesium at excess energies of 6 eV-20 eV. Comparing with the standard first-order DWBA calculations, the inclusion of the second-order Born term in the scattering amplitude improves the degree of agreement with experiments, especially for backward scattering region of TDCS. This indicates that the present second-order Born term is capable to give a reasonable correction to DWBA model in studying coplanar symmetric (e, 2e) problems of two-valence-electron target in low energy range.

Breast-feeding and complementary feeding practices in the first 6 months of life among Norwegian-Somali and Norwegian-Iraqi infants: the InnBaKost survey.

PubMed

Grewal, Navnit Kaur; Andersen, Lene Frost; Sellen, Daniel; Mosdøl, Annhild; Torheim, Liv Elin

2016-03-01

To examine breast-feeding and complementary feeding practices during the first 6 months of life among Norwegian infants of Somali and Iraqi family origin. A cross-sectional survey was performed during March 2013-February 2014. Data were collected using a semi-quantitative FFQ adapted from the second Norwegian national dietary survey among infants in 2006-2007. Somali-born and Iraqi-born mothers living in eastern Norway were invited to participate. One hundred and seven mothers/infants of Somali origin and eighty mothers/infants of Iraqi origin participated. Breast-feeding was almost universally initiated after birth. Only 7 % of Norwegian-Somali and 10 % of Norwegian-Iraqi infants were exclusively breast-fed at 4 months of age. By 1 month of age, water had been introduced to 30 % of Norwegian-Somali and 26 % of Norwegian-Iraqi infants, and infant formula to 44 % and 34 %, respectively. Fifty-four per cent of Norwegian-Somali and 68 % of Norwegian-Iraqi infants had been introduced to solid or semi-solid foods at 4 months of age. Breast-feeding at 6 months of age was more common among Norwegian-Somali infants (79 %) compared with Norwegian-Iraqi infants (58 %; P=0·001). Multivariate analyses indicated no significant factors associated with exclusive breast-feeding at 3·5 months of age. Factors positively associated with breast-feeding at 6 months were country of origin (Somalia) and parity (>2). Breast-feeding initiation was common among Iraqi-born and Somali-born mothers, but the exclusive breast-feeding period was shorter than recommended in both groups. The study suggests that there is a need for new culture-specific approaches to support exclusive breast-feeding and complementary feeding practices among foreign-born mothers living in Norway.

Apparatus for an investigation of proton-pair correlations in the neutrinoless double-beta decay candidate 136Xe via the 134Xe(3He,n)136Ba reaction

NASA Astrophysics Data System (ADS)

Jones, Spencer

2017-09-01

A number of experiments are focused on trying to observe neutrinoless double beta decay to see if neutrinos are Majorana particles, and thus their own antiparticles. If observed, the results could lead to a more direct measurement of neutrino masses, and to an understanding of why each neutrino flavor has the mass that it does. Lepton conservation would be violated, and data could even shed light on the large discrepancy of matter to antimatter found in the universe today, as it is believed that equal amounts of both were present in the first moments after the Big Bang. We plan to study the 134Xe(3He,n)136Ba reaction to inform the proton pairing structure in 136Ba, which is necessary to validate approximations made in calculating the nuclear matrix elements for the neutrinoless double beta decay rate of 136Xe. In particular, the observation of excited 0+ strength would signal a breakdown of the BCS approximation used in QRPA calculations. Design and construction of apparatus to perform this experiment are currently underway. The design of the 3He gas target will be described. This research is supported by the Office of Nuclear Physics in the US Department of Energy Office of Science.

The white dwarf companion of the B a 2 star zeta Cap

NASA Technical Reports Server (NTRS)

Boehm-Vitense, E.

1981-01-01

The Ba II star zeta Cap has a white dwarf companion. Its T (sub eff) is determined to be 22000 K, its mass is approximately one solar mass. The importance of this finding for the explanation of abundance peculiarities is discussed.

Non-linear collisional Penrose process: How much energy can a black hole release?

NASA Astrophysics Data System (ADS)

Nakao, Ken-ichi; Okawa, Hirotada; Maeda, Kei-ichi

2018-01-01

Energy extraction from a rotating or charged black hole is one of the fascinating issues in general relativity. The collisional Penrose process is one such extraction mechanism and has been reconsidered intensively since Bañados, Silk, and West pointed out the physical importance of very high energy collisions around a maximally rotating black hole. In order to get results analytically, the test particle approximation has been adopted so far. Successive works based on this approximation scheme have not yet revealed the upper bound on the efficiency of the energy extraction because of the lack of backreaction. In the Reissner-Nordström spacetime, by fully taking into account the self-gravity of the shells, we find that there is an upper bound on the extracted energy that is consistent with the area law of a black hole. We also show one particular scenario in which almost the maximum energy extraction is achieved even without the Bañados-Silk-West collision.

Competitive cesium-133 NMR spectroscopic study of complexation of different metal ions with dibenzo-21-crown-7 in acetonitrile-dimethylsulfoxide and nitromethane-dimethylsulfoxide mixtures.

PubMed

Sahmsipur, Mojtaba; Dastjerdi, Leila Shafiee; Alizadeh, Nader; Bijanzadeh, Hamid Reza

2008-04-01

(133)Cs NMR spectroscopy was used to determine the stoichiometry and stability of the Cs(+) ion complex with dibenzo-21-crown-7 (DB21C7) in acetonitrile-dimethylsulfoxide (96.5:3.5, w/w) and nitromethane-dimethylsulfoxide (96.5:3.5, w/w) mixtures. A competitive (133)Cs NMR technique was also employed to probe the complexation of Na(+), K(+), Rb(+), Ag(+), Tl(+), NH(4)(+), Mg(2+), Ba(2+), Hg(2+), Pb(2+) and UO(2)(2+) ions with DB21C7 in the same solvent systems. All the resulting 1:1 complexes in nitromethane-dimethylsulfoxide were more stable than those in acetonitrile-dimethylsulfoxide solution. In both solvent systems, the stability of the resulting complexes was found to vary in the order Rb(+)>K(+) approximately Ba(2+)>Tl(+)>Cs(+)>NH(4)(+) approximately Pb(2+)>Ag(+)>UO(2)(2+)>Hg(2+)>Mg(2+)>Na(+).

Migration Timing and Parenting Practices: Contributions to Social Development in Preschoolers with Foreign-Born and Native-Born Mothers

ERIC Educational Resources Information Center

Glick, Jennifer E.; Hanish, Laura D.; Yabiku, Scott T.; Bradley, Robert H.

2012-01-01

Little is known about how key aspects of parental migration or childrearing history affect social development across children from immigrant families. Relying on data on approximately 6,400 children from the Early Childhood Longitudinal Study-Birth Cohort, analyses assessed the role of mother's age at migration on children's social development in…

Critical current densities in superconducting Y-Ba-Cu-O prepared by chelating method

NASA Astrophysics Data System (ADS)

Fujisawa, Tadashi; Okuyama, Katsuro; Ohshima, Shigetoshi; Takagi, Akira

1990-10-01

The IDA, NTA, HEDTA, EDTA, TTHA, and DTPA chelating agents have been used to prepare the Y-Ba-Cu-O compounds whose critical current is presently investigated. It is noted that the precursor YBCO prepared from large stability-constant metal complexes (HEDTA, EDTA, DTPA, and TTHA) exhibited very fine and homogeneous particles. The critical current density of a 1 x 4 x 15 mm block of YBCO sintered at 880-910 C for 24 h and subsequently annealed at 500 C in an O2 flow was approximately 500 A/sq cm at 77 K, in zero magnetic field.

Leaching behaviour, mechanical and durability properties of mortar containing municipal incineration bottom ash

NASA Astrophysics Data System (ADS)

Morales Hernandez, Maria B.

The review of municipal solid waste (MSW) management scheme has indicated that the amount of MSW sent to incineration plants will increase in the UK in coming years. Therefore, the amount of municipal solid waste incineration (MSWI) residues generated will increase significantly. MSWI residues are divided into MSWI fly ash (MSWI-FA) and MSWI bottom ash (MSWI-BA). MSWI-FA is classified as hazardous residue thereby requires special treatment before disposal. MSWI-BA is mostly disposed in landfill sites. MSWI-BA fraction with particle size diameter below approximately 2mm has low engineering properties and may have an adverse effect on the environment due to its high porosity, solubility and leachability of possible toxic compounds. This research programme has investigated new potential uses and leaching behaviour of mortar containing MSWI-BA with particle size diameters below 2.36mm. Fraction of MSWI-BA with particle size diameters (φ) below 2.36 mm (φ <2.36) was divided into different sub-fractions to evaluate their influence on compressive strength of concrete when used as partial replacement of cement or sand. MSWI-BA fraction with φ <212mum (fine fraction) and 212mum < φ2.36mm (coarse fraction) used as partial replacement of cement and sand respectively, showed higher compressive strength compared with the other fractions examined. In addition, replacing sand with the coarse fraction of MSWI-BA exhibited similar or higher strength than the reference mix. Examination of physical and chemical properties of the fine and coarse fractions of MSWI-BA unbound indicated that both fractions had potential to be used as replacement of cement or sand. However, the evaluation of their leaching behaviour suggested that they should be bound in cement-based systems to avoid leaching of potential toxic elements. Evaluation of physical, mechanical and sulfate resistance properties of mortars containing 15% of the fine fraction of MSWI-BA as a partial replacement of cement and 50% of the coarse fraction as partial replacement of sand indicated potential uses in concrete production. In addition, the leachability of mortar specimens containing 15% and 50% of MSWI-BA as partial replacement of cement and sand respectively was significantly reduced when compared to unbound MSWI-BA fractions.

CMB weak-lensing beyond the Born approximation: a numerical approach

NASA Astrophysics Data System (ADS)

Fabbian, Giulio; Calabrese, Matteo; Carbone, Carmelita

2018-02-01

We perform a complete study of the gravitational lensing effect beyond the Born approximation on the Cosmic Microwave Background (CMB) anisotropies using a multiple-lens raytracing technique through cosmological N-body simulations of the DEMNUni suite. The impact of second-order effects accounting for the non-linear evolution of large-scale structures is evaluated propagating for the first time the full CMB lensing jacobian together with the light rays trajectories. We carefully investigate the robustness of our approach against several numerical effects in the raytracing procedure and in the N-body simulation itself, and find no evidence of large contaminations. We discuss the impact of beyond-Born corrections on lensed CMB observables, and compare our results with recent analytical predictions that appeared in the literature, finding a good agreement, and extend these results to smaller angular scales. We measure the gravitationally-induced CMB polarization rotation that appears in the geodesic equation at second order, and compare this result with the latest analytical predictions. We then present the detection prospect of beyond-Born effects with the future CMB-S4 experiment. We show that corrections to the temperature power spectrum can be measured only if a good control of the extragalactic foregrounds is achieved. Conversely, the beyond-Born corrections on E and B-modes power spectra will be much more difficult to detect.

Lung retention and metabolic fate of inhaled benzo(a)pyrene associated with diesel exhaust particles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, J.D.; Wolff, R.K.; Kanapilly, G.M.

The effect of ultrafine, insoluble, carrier particles on the lung retention and metabolic fate of inhaled PAHs was investigated with a radiolabeled model PAH, (/sup 3/H)benzo(a)pyrene (/sup 3/H-BaP). Fischer-344 rats were exposed (30 min) by nose-only inhalation to /sup 3/H-BaP adsorbed (approximately 0.1% by mass) onto diesel engine exhaust particles. The total mass concentration of these aerosols was 4-6 micrograms/liter of air with a mass median diameter of 0.14 micron. Lung clearance of the inhaled particle-associated /sup 3/H radioactivity occurred in two phases. The initially rapid clearance of this inhaled radiolabel had a half-time of less than 1 hr. Themore » second, long-term component of lung clearance had a half-time of 18 +/- 2 days and represented 50 +/- 2% of the /sup 3/H radioactivity that had initially deposited in lungs. In contrast, previous inhalation studies with a pure /sup 3/H-BaP aerosol showed that greater than 99% of the /sup 3/H radioactivity deposited in lungs was cleared within 2 hr after exposure. By HPLC analysis, the majority of diesel soot-associated /sup 3/H radioactivity retained in lungs was BaP (65-76%) with smaller amounts of BaP-phenol (13-17%) and BaP-quinone (5-18%) metabolites also being detected. No other metabolites of BaP were detected in lungs of exposed rats. Tissue distribution and excretion patterns of /sup 3/H radioactivity were qualitatively similar to previous inhalation studies with /sup 3/H-BaP coated Ga2O3 aerosols. These findings suggest that inhaled PAHs may be retained in lungs for a greater period of time when these compounds are associated with diesel engine exhaust particles. These results may have significant implications for the health risks that may be involved with human exposure to particle-associated organic pollutants.« less

Thermostating extended Lagrangian Born-Oppenheimer molecular dynamics.

PubMed

Martínez, Enrique; Cawkwell, Marc J; Voter, Arthur F; Niklasson, Anders M N

2015-04-21

Extended Lagrangian Born-Oppenheimer molecular dynamics is developed and analyzed for applications in canonical (NVT) simulations. Three different approaches are considered: the Nosé and Andersen thermostats and Langevin dynamics. We have tested the temperature distribution under different conditions of self-consistent field (SCF) convergence and time step and compared the results to analytical predictions. We find that the simulations based on the extended Lagrangian Born-Oppenheimer framework provide accurate canonical distributions even under approximate SCF convergence, often requiring only a single diagonalization per time step, whereas regular Born-Oppenheimer formulations exhibit unphysical fluctuations unless a sufficiently high degree of convergence is reached at each time step. The thermostated extended Lagrangian framework thus offers an accurate approach to sample processes in the canonical ensemble at a fraction of the computational cost of regular Born-Oppenheimer molecular dynamics simulations.

Theoretical investigation of structural, electronic and optical properties of MgxBa1-xS, MgxBa1-xSe and MgxBa1-xTe ternary alloys using DFT based FP-LAPW approach

NASA Astrophysics Data System (ADS)

Bhattacharjee, Rahul; Chattopadhyaya, Surya

2017-11-01

Density functional theory (DFT) based full-potential linearized augmented plane wave (FP-LAPW) methodology has been employed to investigate theoretically the structural, electronic and optical properties of MgxBa1-xS, MgxBa1-xSe and MgxBa1-xTe ternary alloys for 0 ≤ x ≤ 1 in their rock-salt (B1) crystallographic phase. The exchange-correlation potentials for the structural properties have been computed using the Wu-Cohen generalized-gradient approximation (WC-GGA) scheme, while those for the electronic and optical properties have been computed using both the WC-GGA and the recently developed Tran-Blaha modified Becke-Johnson (TB-mBJ) schemes. The thermodynamic stability of all the ternary alloys have been investigated by calculating their respective enthalpy of formation. The atomic and orbital origin of different electronic states in the band structure of the compounds have been identified from the respective density of states (DOS). Using the approach of Zunger and co-workers, the microscopic origin of band gap bowing has been discussed in term of volume deformation, charge exchange and structural relaxation. Bonding characteristics among the constituent atoms of each of the specimens have been discussed from their charge density contour plots. Optical properties of the binary compounds and ternary alloys have been investigated theoretically in terms of their respective dielectric function, refractive index, normal incidence reflectivity and optical conductivity. Several calculated results have been compared with available experimental and other theoretical data.

Stress induced magnetic-domain evolution in magnetoelectric composites

NASA Astrophysics Data System (ADS)

Trivedi, Harsh; Shvartsman, Vladimir V.; Lupascu, Doru C.; Medeiros, Marco S. A.; Pullar, Robert C.

2018-06-01

Local observation of the stress mediated magnetoelectric (ME) effect in composites has gained a great deal of interest over the last decades. However, there is an apparent lack of rigorous methods for a quantitative characterization of the ME effect at the local scale, especially in polycrystalline microstructures. In the present work, we address this issue by locally probing the surface magnetic state of barium titante–hexagonal barium ferrite (BaTiO3–BaFe12O19) ceramic composites using magnetic force microscopy (MFM). The effect of the piezoelectrically induced local stress on the magnetostrictive component (BaFe12O19, BaM) was observed in the form of the evolution of the magnetic domains. The local piezoelectric stress was induced by applying a voltage to the neighboring BaTiO3 grains, using a conductive atomic force microscopy tip. The resulting stochastic evolution of magnetic domains was studied in the context of the induced magnetoelastic anisotropy. In order to overcome the ambiguity in the domain changes observed by MFM, certain generalizations about the observed MFM contrast are put forward, followed by application of an algorithm for extracting the average micromagnetic changes. An average change in domain wall thickness of 50 nm was extracted, giving a lower limit on the corresponding induced magnetoelastic anisotropy energy. Furthermore, we demonstrate that this induced magnetomechanical energy is approximately equal to the K1 magnetocrystalline anisotropy constant of BaM, and compare it with a modeled value of applied elastic energy density. The comparison allowed us to judge the quality of the interfaces in the composite system, by roughly gauging the energy conversion ratio.

Seasonal variation of benzo(a)pyrene in the Spanish airborne PM10. Multivariate linear regression model applied to estimate BaP concentrations.

PubMed

Callén, M S; López, J M; Mastral, A M

2010-08-15

The estimation of benzo(a)pyrene (BaP) concentrations in ambient air is very important from an environmental point of view especially with the introduction of the Directive 2004/107/EC and due to the carcinogenic character of this pollutant. A sampling campaign of particulate matter less or equal than 10 microns (PM10) carried out during 2008-2009 in four locations of Spain was collected to determine experimentally BaP concentrations by gas chromatography mass-spectrometry mass-spectrometry (GC-MS-MS). Multivariate linear regression models (MLRM) were used to predict BaP air concentrations in two sampling places, taking PM10 and meteorological variables as possible predictors. The model obtained with data from two sampling sites (all sites model) (R(2)=0.817, PRESS/SSY=0.183) included the significant variables like PM10, temperature, solar radiation and wind speed and was internally and externally validated. The first validation was performed by cross validation and the last one by BaP concentrations from previous campaigns carried out in Zaragoza from 2001-2004. The proposed model constitutes a first approximation to estimate BaP concentrations in urban atmospheres with very good internal prediction (Q(CV)(2)=0.813, PRESS/SSY=0.187) and with the maximal external prediction for the 2001-2002 campaign (Q(ext)(2)=0.679 and PRESS/SSY=0.321) versus the 2001-2004 campaign (Q(ext)(2)=0.551, PRESS/SSY=0.449). Copyright 2010 Elsevier B.V. All rights reserved.

Domain wall motion and electromechanical strain in lead-free piezoelectrics: Insight from the model system (1 - x)Ba(Zr 0.2Ti 0.8)O 3-x(Ba 0.7Ca 0.3)TiO 3 using in situ high-energy X-ray diffraction during application of electric fields

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tutuncu, Goknur; Li, Binzhi; Bowman, Keith

The piezoelectric compositions (1 - x)Ba(Zr 0.2Ti 0.8)O 3–x(Ba 0.7Ca 0.3)TiO 3 (BZT-xBCT) span a model lead-free morphotropic phase boundary (MPB) between room temperature rhombohedral and tetragonal phases at approximately x = 0.5. In the present work, in situ X-ray diffraction measurements during electric field application are used to elucidate the origin of electromechanical strain in several compositions spanning the tetragonal compositional range 0.6 ≤ x ≤ 0.9. As BCT concentration decreases towards the MPB, the tetragonal distortion (given by c/a-1) decreases concomitantly with an increase in 90° domain wall motion. The increase in observed macroscopic strain is predominantly attributedmore » to the increased contribution from 90° domain wall motion. The results demonstrate that domain wall motion is a significant factor in achieving high strain and piezoelectric coefficients in lead-free polycrystalline piezoelectrics.« less

Computational study of Ca, Sr and Ba under pressure

NASA Astrophysics Data System (ADS)

Jona, F.; Marcus, P. M.

2006-05-01

A first-principles procedure for the calculation of equilibrium properties of crystals under hydrostatic pressure is applied to Ca, Sr and Ba. The procedure is based on minimizing the Gibbs free energy G (at zero temperature) with respect to the structure at a given pressure p, and hence does not require the equation of state to fix the pressure. The calculated lattice constants of Ca, Sr and Ba are shown to be generally closer to measured values than previous calculations using other procedures. In particular for Ba, where careful and extensive pressure data are available, the calculated lattice parameters fit measurements to about 1% in three different phases, both cubic and hexagonal. Rigid-lattice transition pressures between phases which come directly from the crossing of G(p) curves are not close to measured transition pressures. One reason is the need to include zero-point energy (ZPE) of vibration in G. The ZPE of cubic phases is calculated with a generalized Debye approximation and applied to Ca and Sr, where it produces significant shifts in transition pressures. An extensive tabulation is given of structural parameters and elastic constants from the literature, including both theoretical and experimental results.

Communication: Vibrational and vibronic coherences in the two dimensional spectroscopy of coupled electron-nuclear motion.

PubMed

Albert, Julian; Falge, Mirjam; Gomez, Sandra; Sola, Ignacio R; Hildenbrand, Heiko; Engel, Volker

2015-07-28

We theoretically investigate the photon-echo spectroscopy of coupled electron-nuclear quantum dynamics. Two situations are treated. In the first case, the Born-Oppenheimer (adiabatic) approximation holds. It is then possible to interpret the two-dimensional (2D) spectra in terms of vibrational motion taking place in different electronic states. In particular, pure vibrational coherences which are related to oscillations in the time-dependent third-order polarization can be identified. This concept fails in the second case, where strong non-adiabatic coupling leads to the breakdown of the Born-Oppenheimer-approximation. Then, the 2D-spectra reveal a complicated vibronic structure and vibrational coherences cannot be disentangled from the electronic motion.

Communication: Vibrational and vibronic coherences in the two dimensional spectroscopy of coupled electron-nuclear motion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Albert, Julian; Falge, Mirjam; Hildenbrand, Heiko

2015-07-28

We theoretically investigate the photon-echo spectroscopy of coupled electron-nuclear quantum dynamics. Two situations are treated. In the first case, the Born-Oppenheimer (adiabatic) approximation holds. It is then possible to interpret the two-dimensional (2D) spectra in terms of vibrational motion taking place in different electronic states. In particular, pure vibrational coherences which are related to oscillations in the time-dependent third-order polarization can be identified. This concept fails in the second case, where strong non-adiabatic coupling leads to the breakdown of the Born-Oppenheimer-approximation. Then, the 2D-spectra reveal a complicated vibronic structure and vibrational coherences cannot be disentangled from the electronic motion.

Spatial Risk Assessments Based on Vector-Borne Disease Epidemiologic Data: Importance of Scale for West Nile Virus Disease in Colorado

PubMed Central

Winters, Anna M.; Eisen, Rebecca J.; Delorey, Mark J.; Fischer, Marc; Nasci, Roger S.; Zielinski-Gutierrez, Emily; Moore, Chester G.; Pape, W. John; Eisen, Lars

2010-01-01

We used epidemiologic data for human West Nile virus (WNV) disease in Colorado from 2003 and 2007 to determine 1) the degree to which estimates of vector-borne disease occurrence is influenced by spatial scale of data aggregation (county versus census tract), and 2) the extent of concordance between spatial risk patterns based on case counts versus incidence. Statistical analyses showed that county, compared with census tract, accounted for approximately 50% of the overall variance in WNV disease incidence, and approximately 33% for the subset of cases classified as West Nile neuroinvasive disease. These findings indicate that sub-county scale presentation provides valuable risk information for stakeholders. There was high concordance between spatial patterns of WNV disease incidence and case counts for census tract (83%) but not for county (50%) or zip code (31%). We discuss how these findings impact on practices to develop spatial epidemiologic data for vector-borne diseases and present data to stakeholders. PMID:20439980

Three-dimensional inversion of multisource array electromagnetic data

NASA Astrophysics Data System (ADS)

Tartaras, Efthimios

Three-dimensional (3-D) inversion is increasingly important for the correct interpretation of geophysical data sets in complex environments. To this effect, several approximate solutions have been developed that allow the construction of relatively fast inversion schemes. One such method that is fast and provides satisfactory accuracy is the quasi-linear (QL) approximation. It has, however, the drawback that it is source-dependent and, therefore, impractical in situations where multiple transmitters in different positions are employed. I have, therefore, developed a localized form of the QL approximation that is source-independent. This so-called localized quasi-linear (LQL) approximation can have a scalar, a diagonal, or a full tensor form. Numerical examples of its comparison with the full integral equation solution, the Born approximation, and the original QL approximation are given. The objective behind developing this approximation is to use it in a fast 3-D inversion scheme appropriate for multisource array data such as those collected in airborne surveys, cross-well logging, and other similar geophysical applications. I have developed such an inversion scheme using the scalar and diagonal LQL approximation. It reduces the original nonlinear inverse electromagnetic (EM) problem to three linear inverse problems. The first of these problems is solved using a weighted regularized linear conjugate gradient method, whereas the last two are solved in the least squares sense. The algorithm I developed provides the option of obtaining either smooth or focused inversion images. I have applied the 3-D LQL inversion to synthetic 3-D EM data that simulate a helicopter-borne survey over different earth models. The results demonstrate the stability and efficiency of the method and show that the LQL approximation can be a practical solution to the problem of 3-D inversion of multisource array frequency-domain EM data. I have also applied the method to helicopter-borne EM data collected by INCO Exploration over the Voisey's Bay area in Labrador, Canada. The results of the 3-D inversion successfully delineate the shallow massive sulfides and show that the method can produce reasonable results even in areas of complex geology and large resistivity contrasts.

Ultrafast charge-transfer-to-solvent dynamics of iodide in tetrahydrofuran. 2. Photoinduced electron transfer to counterions in solution.

PubMed

Bragg, Arthur E; Schwartz, Benjamin J

2008-04-24

The excited states of atomic anions in liquids are bound only by the polarization of the surrounding solvent. Thus, the electron-detachment process following excitation to one of these solvent-bound states, known as charge-transfer-to-solvent (CTTS) states, provides a useful probe of solvent structure and dynamics. These transitions and subsequent relaxation dynamics also are influenced by other factors that alter the solution environment local to the CTTS anion, including the presence of cosolutes, cosolvents, and other ions. In this paper, we examine the ultrafast CTTS dynamics of iodide in liquid tetrahydrofuran (THF) with a particular focus on how the solvent dynamics and the CTTS electron-ejection process are altered in the presence of various counterions. In weakly polar solvents such as THF, iodide salts can be strongly ion-paired in solution; the steady-state UV-visible absorption spectroscopy of various iodide salts in liquid THF indicates that the degree of ion-pairing changes from strong to weak to none as the counterion is switched from Na+ to tetrabutylammonium (t-BA+) to crown-ether-complexed Na+, respectively. In our ultrafast experiments, we have excited the I- CTTS transition of these various iodide salts at 263 nm and probed the dynamics of the CTTS-detached electrons throughout the visible and near-IR. In the previous paper of this series (Bragg, A. E.; Schwartz, B. J. J. Phys. Chem. B 2008, 112, 483-494), we found that for "counterion-free" I- (obtained by complexing Na+ with a crown ether) the CTTS electrons were ejected approximately 6 nm from their partner iodine atoms, the result of significant nonadiabatic coupling between the CTTS excited state and extended electronic states supported by the naturally existing solvent cavities in liquid THF, which also serve as pre-existing electron traps. In contrast, for the highly ion-paired NaI/THF system, we find that approximately 90% of the CTTS electrons are "captured" by a nearby Na+ to form (Na+, e-)THF "tight-contact pairs" (TCPs), which are chemically and spectroscopically distinct from both solvated neutral sodium atoms and free solvated electrons. A simple kinetic model is able to reproduce the details of the electron capture process, with 63% of the electrons captured quickly in approximately 2.3 ps, 26% captured diffusively in approximately 63 ps, and the remaining 11% escaping out into the solution on subnanosecond time scales. We also find that the majority of the CTTS electrons are ejected to within 1 or 2 nm of the Na+. This demonstrates that the presence of the nearby cation biases the relocalization of CTTS-generated electrons from I- in THF, changing the nonadiabatic coupling to the extended, cavity-supported electronic states in THF to produce a much tighter distribution of electron-ejection distances. In the case of the more loosely ion-paired t-BA+-I-/THF system, we find that only 10-15% of the CTTS-ejected electrons associate with t-BA+ to form "loose-contact pairs" (LCPs), which are characterized by a much weaker interaction between the electron and cation than occurs in TCPs. The formation of (t-BA+, e-)THF LCPs is characterized by a Coulombically induced blue shift of the free eTHF- spectrum on a approximately 5-ps time scale. We argue that the weaker interaction between t-BA+ and the parent I- results in little change to the CTTS-ejection process, so that only those electrons that happen to localize in the vicinity of t-BA+ are captured to form LCPs. Finally, we interpret the correlation between electron capture yield and counterion-induced perturbation of the I- CTTS transition as arising from changes in the distribution of ion-pair separations with cation identity, and we discuss our results in the context of relevant solution conductivity measurements.

Total Born approximation cross sections for single electron loss by atoms and ions colliding with atoms

NASA Technical Reports Server (NTRS)

Rule, D. W.

1977-01-01

The first born approximation (FBA) is applied to the calculation of single electron loss cross sections for various ions and atoms containing from one to seven electrons. Screened hydrogenic wave functions were used for the states of the electron ejected from the projectile, and Hartree-Fock elastic and incoherent scattering factors were used to describe the target. The effect of the target atom on the scaling of projectile ionization cross sections with respect to the projectile nuclear charge was explored in the case of hydrogen-like ions. Scaling of the cross section with respect to the target nuclear charge for electron loss by Fe (+25) in collision with neutral atoms ranging from H to Fe is also examined. These results were compared to those of the binary encounter approximation and to the FBA for the case of ionization by completely stripped target ions.

Energy conserving, linear scaling Born-Oppenheimer molecular dynamics.

PubMed

Cawkwell, M J; Niklasson, Anders M N

2012-10-07

Born-Oppenheimer molecular dynamics simulations with long-term conservation of the total energy and a computational cost that scales linearly with system size have been obtained simultaneously. Linear scaling with a low pre-factor is achieved using density matrix purification with sparse matrix algebra and a numerical threshold on matrix elements. The extended Lagrangian Born-Oppenheimer molecular dynamics formalism [A. M. N. Niklasson, Phys. Rev. Lett. 100, 123004 (2008)] yields microcanonical trajectories with the approximate forces obtained from the linear scaling method that exhibit no systematic drift over hundreds of picoseconds and which are indistinguishable from trajectories computed using exact forces.

Non-linear 3-D Born shear waveform tomography in Southeast Asia

NASA Astrophysics Data System (ADS)

Panning, Mark P.; Cao, Aimin; Kim, Ahyi; Romanowicz, Barbara A.

2012-07-01

Southeast (SE) Asia is a tectonically complex region surrounded by many active source regions, thus an ideal test bed for developments in seismic tomography. Much recent development in tomography has been based on 3-D sensitivity kernels based on the first-order Born approximation, but there are potential problems with this approach when applied to waveform data. In this study, we develop a radially anisotropic model of SE Asia using long-period multimode waveforms. We use a theoretical 'cascade' approach, starting with a large-scale Eurasian model developed using 2-D Non-linear Asymptotic Coupling Theory (NACT) sensitivity kernels, and then using a modified Born approximation (nBorn), shown to be more accurate at modelling waveforms, to invert a subset of the data for structure in a subregion (longitude 75°-150° and latitude 0°-45°). In this subregion, the model is parametrized at a spherical spline level 6 (˜200 km). The data set is also inverted using NACT and purely linear 3-D Born kernels. All three final models fit the data well, with just under 80 per cent variance reduction as calculated using the corresponding theory, but the nBorn model shows more detailed structure than the NACT model throughout and has much better resolution at depths greater than 250 km. Based on variance analysis, the purely linear Born kernels do not provide as good a fit to the data due to deviations from linearity for the waveform data set used in this modelling. The nBorn isotropic model shows a stronger fast velocity anomaly beneath the Tibetan Plateau in the depth range of 150-250 km, which disappears at greater depth, consistent with other studies. It also indicates moderate thinning of the high-velocity plate in the middle of Tibet, consistent with a model where Tibet is underplated by Indian lithosphere from the south and Eurasian lithosphere from the north, in contrast to a model with continuous underplating by Indian lithosphere across the entire plateau. The nBorn anisotropic model detects negative ξ anomalies suggestive of vertical deformation associated with subducted slabs and convergent zones at the Himalayan front and Tien Shan at depths near 150 km.

Development of Normal Human Colonocyte Cultures to Identify a Carcinogenic Potential for Priority Disinfection Byproducts

EPA Science Inventory

Epidemiological studies have linked the consumption of disinfected surface waters to an increased risk of colorectal cancer. Of the approximately >600 disinfection byproducts (DBPs) identified, the US EPA regulates 11 DBPS for an increased risk of cancer. An in-depth mechanism-ba...

Permeation and gating properties of the L-type calcium channel in mouse pancreatic beta cells

PubMed Central

1993-01-01

Ba2+ currents through L-type Ca2+ channels were recorded from cell- attached patches on mouse pancreatic beta cells. In 10 mM Ba2+, single- channel currents were recorded at -70 mV, the beta cell resting membrane potential. This suggests that Ca2+ influx at negative membrane potentials may contribute to the resting intracellular Ca2+ concentration and thus to basal insulin release. Increasing external Ba2+ increased the single-channel current amplitude and shifted the current-voltage relation to more positive potentials. This voltage shift could be modeled by assuming that divalent cations both screen and bind to surface charges located at the channel mouth. The single- channel conductance was related to the bulk Ba2+ concentration by a Langmuir isotherm with a dissociation constant (Kd(gamma)) of 5.5 mM and a maximum single-channel conductance (gamma max) of 22 pS. A closer fit to the data was obtained when the barium concentration at the membrane surface was used (Kd(gamma) = 200 mM and gamma max = 47 pS), which suggests that saturation of the concentration-conductance curve may be due to saturation of the surface Ba2+ concentration. Increasing external Ba2+ also shifted the voltage dependence of ensemble currents to positive potentials, consistent with Ba2+ screening and binding to membrane surface charge associated with gating. Ensemble currents recorded with 10 mM Ca2+ activated at more positive potentials than in 10 mM Ba2+, suggesting that external Ca2+ binds more tightly to membrane surface charge associated with gating. The perforated-patch technique was used to record whole-cell currents flowing through L-type Ca2+ channels. Inward currents in 10 mM Ba2+ had a similar voltage dependence to those recorded at a physiological Ca2+ concentration (2.6 mM). BAY-K 8644 (1 microM) increased the amplitude of the ensemble and whole-cell currents but did not alter their voltage dependence. Our results suggest that the high divalent cation solutions usually used to record single L-type Ca2+ channel activity produce a positive shift in the voltage dependence of activation (approximately 32 mV in 100 mM Ba2+). PMID:7687645

A Stochastic Tick-Borne Disease Model: Exploring the Probability of Pathogen Persistence.

PubMed

Maliyoni, Milliward; Chirove, Faraimunashe; Gaff, Holly D; Govinder, Keshlan S

2017-09-01

We formulate and analyse a stochastic epidemic model for the transmission dynamics of a tick-borne disease in a single population using a continuous-time Markov chain approach. The stochastic model is based on an existing deterministic metapopulation tick-borne disease model. We compare the disease dynamics of the deterministic and stochastic models in order to determine the effect of randomness in tick-borne disease dynamics. The probability of disease extinction and that of a major outbreak are computed and approximated using the multitype Galton-Watson branching process and numerical simulations, respectively. Analytical and numerical results show some significant differences in model predictions between the stochastic and deterministic models. In particular, we find that a disease outbreak is more likely if the disease is introduced by infected deer as opposed to infected ticks. These insights demonstrate the importance of host movement in the expansion of tick-borne diseases into new geographic areas.

Thermostating extended Lagrangian Born-Oppenheimer molecular dynamics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martínez, Enrique; Cawkwell, Marc J.; Voter, Arthur F.

Here, Extended Lagrangian Born-Oppenheimer molecular dynamics is developed and analyzed for applications in canonical (NVT) simulations. Three different approaches are considered: the Nosé and Andersen thermostats and Langevin dynamics. We have tested the temperature distribution under different conditions of self-consistent field (SCF) convergence and time step and compared the results to analytical predictions. We find that the simulations based on the extended Lagrangian Born-Oppenheimer framework provide accurate canonical distributions even under approximate SCF convergence, often requiring only a single diagonalization per time step, whereas regular Born-Oppenheimer formulations exhibit unphysical fluctuations unless a sufficiently high degree of convergence is reached atmore » each time step. Lastly, the thermostated extended Lagrangian framework thus offers an accurate approach to sample processes in the canonical ensemble at a fraction of the computational cost of regular Born-Oppenheimer molecular dynamics simulations.« less

Thermostating extended Lagrangian Born-Oppenheimer molecular dynamics

DOE PAGES

Martínez, Enrique; Cawkwell, Marc J.; Voter, Arthur F.; ...

2015-04-21

Here, Extended Lagrangian Born-Oppenheimer molecular dynamics is developed and analyzed for applications in canonical (NVT) simulations. Three different approaches are considered: the Nosé and Andersen thermostats and Langevin dynamics. We have tested the temperature distribution under different conditions of self-consistent field (SCF) convergence and time step and compared the results to analytical predictions. We find that the simulations based on the extended Lagrangian Born-Oppenheimer framework provide accurate canonical distributions even under approximate SCF convergence, often requiring only a single diagonalization per time step, whereas regular Born-Oppenheimer formulations exhibit unphysical fluctuations unless a sufficiently high degree of convergence is reached atmore » each time step. Lastly, the thermostated extended Lagrangian framework thus offers an accurate approach to sample processes in the canonical ensemble at a fraction of the computational cost of regular Born-Oppenheimer molecular dynamics simulations.« less

Phenomenological Study of Interaction between Solar Acoustic Waves and Sunspots from Measured Scattered Wavefunctions

NASA Astrophysics Data System (ADS)

Yang, Ming-Hsu; Chou, Dean-Yi; Zhao, Hui; Liang, Zhi-Chao

2012-08-01

The solar acoustic waves around a sunspot are modified because of the interaction with the sunspot. The interaction can be viewed as that the sunspot, excited by the incident wave, generates the scattered wave, and the scattered wave is added to the incident wave to form the total wave around the sunspot. We define an interaction parameter, which could be complex, describing the interaction between the acoustic waves and the sunspot. The scattered wavefunction on the surface can be expressed as a two-dimensional integral of the product of the Green's function, the wavefunction, and the two-dimensional interaction parameter over the sunspot area for the Born approximation of different orders. We assume a simple model for the two-dimensional interaction parameter distribution: its absolute value is axisymmetric with a Gaussian distribution and its phase is a constant. The measured scattered wavefunctions of various modes for NOAAs 11084 and 11092 are fitted to the theoretical scattered wavefunctions to determine the three model parameters, magnitude, Gaussian radius, and phase, for the Born approximation of different orders. The three model parameters converge to some values at high-order Born approximations. The result of the first-order Born approximation is significantly different from the convergent value in some cases. The rate of convergence depends on the sunspot size and wavelength. It converges more rapidly for the smaller sunspot and longer wavelength. The magnitude increases with mode frequency and degree for each radial order. The Gaussian radius is insensitive to frequency and degree. The spatial range of the interaction parameter is greater than that of the continuum intensity deficit, but smaller than that of the acoustic power deficit of the sunspot. The phase versus phase speed falls into a small range. This suggests that the phase could be a function phase speed. NOAAs 11084 and 11092 have a similar magnitude and phase, although the ratio of their sizes is 0.75.

The Primordial Inflation Polarization Explorer (PIPER)

NASA Technical Reports Server (NTRS)

Chuss, David T.

2010-01-01

The Primordial Inflation Polarization Explorer (PIPER) is a ba1loon-borne instrument designed to search for the faint signature of inflation in the polarized component of the cosmic microwave background (CMB). PIPER will measure the CMB polarization at 4 frequencies (l per flight) using a pair of cryogenic telescopes, one for measuring each of Stokes Q and U in the instrument frame. Each telescope receives both linear orthogonal polarizations in two 32 by 40 element planar arrays that utilize Transition-Edge Sensors (TES). The first element in each telescope is a variable-delay polarization modulator (VPM) that fully modulates the Stokes parameter to which the telescope is sensitive.

Bluues: a program for the analysis of the electrostatic properties of proteins based on generalized Born radii

PubMed Central

2012-01-01

Background The Poisson-Boltzmann (PB) equation and its linear approximation have been widely used to describe biomolecular electrostatics. Generalized Born (GB) models offer a convenient computational approximation for the more fundamental approach based on the Poisson-Boltzmann equation, and allows estimation of pairwise contributions to electrostatic effects in the molecular context. Results We have implemented in a single program most common analyses of the electrostatic properties of proteins. The program first computes generalized Born radii, via a surface integral and then it uses generalized Born radii (using a finite radius test particle) to perform electrostic analyses. In particular the ouput of the program entails, depending on user's requirement: 1) the generalized Born radius of each atom; 2) the electrostatic solvation free energy; 3) the electrostatic forces on each atom (currently in a dvelopmental stage); 4) the pH-dependent properties (total charge and pH-dependent free energy of folding in the pH range -2 to 18; 5) the pKa of all ionizable groups; 6) the electrostatic potential at the surface of the molecule; 7) the electrostatic potential in a volume surrounding the molecule; Conclusions Although at the expense of limited flexibility the program provides most common analyses with requirement of a single input file in PQR format. The results obtained are comparable to those obtained using state-of-the-art Poisson-Boltzmann solvers. A Linux executable with example input and output files is provided as supplementary material. PMID:22536964

Theoretical studies of superconductivity in doped BaCoSO

NASA Astrophysics Data System (ADS)

Qin, Shengshan; Li, Yinxiang; Zhang, Qiang; Le, Congcong; Hu, Jiangping

2018-06-01

We investigate superconductivity that may exist in the doped BaCoSO, a multi-orbital Mott insulator with a strong antiferromagnetic ground state. The superconductivity is studied in both t-J type and Hubbard type multi-orbital models by mean field approach and random phase approximation (RPA) analysis. Even if there is no C 4 rotational symmetry, it is found that the system still carries a d-wave like pairing symmetry state with gapless nodes and sign changed superconducting order parameters on Fermi surfaces. The results are largely doping insensitive. In this superconducting state, the three {t_{{2_g}}} orbitals have very different superconducting form factors in momentum space. In particular, the intra-orbital pairing of the {d_{{x^2} - {y^2}}} orbital has an s-wave like pairing form factor. The two methods also predict very different pairing strength on different parts of Fermi surfaces. These results suggest that BaCoSO and related materials can be a new ground to test and establish fundamental principles for unconventional high temperature superconductivity.

[Microanalytical identification of barium sulphate crystals in statoliths of Chara rhizoids (Ch. fragilis, desv.)].

PubMed

Schröter, K; Läuchli, A; Sievers, A

1975-01-01

In contrast to the statocytes of higher plants, in which amyloplasts function as statoliths, Chara-rhizoids contain statolith vacuoles filled with biocrystallites of BaSO4. This was revealed by qualitative and quantitative electron microprobe analysis, atomic absorption spectrophotometry and selected area electron diffraction. The barium sulphate crystallites are rods which are linearly composed of globular subunits approximately 7 nm in diameter.The electron optical evidence of the crystallites depends on the nature of the fixatives. Best structural preservation was observed after fixation in a buffered solution of glutaraldehyde plus acrolein without addition of heavy metals. OsO4 and particularly KMnO4 partially dissolve the biocrystallites as well as synthetic BaSO4. The crystal solubility must be taken into consideration when micrographs of such small crystallites are interpreted.The fact that BaSO4 is chemically very inert seems to exclude biochemical interactions of the statoliths with other cell components during graviperception. It favours the theory that only the mass of the statoliths is effective.

Luminescence of BaBrI and SrBrI single crystals doped with Eu2+

NASA Astrophysics Data System (ADS)

Shalaev, A. A.; Shendrik, R.; Myasnikova, A. S.; Bogdanov, A.; Rusakov, A.; Vasilkovskyi, A.

2018-05-01

The crystal growth procedure and luminescence properties of pure and Eu2+-doped BaBrI and SrBrI crystals are reported. Emission and excitation spectra were recorded under ultraviolet and vacuum ultraviolet excitations. The energy of the first Eu2+ 4f-5d transition and SrBrI band gap are obtained. The electronic structure calculations were performed within GW approximation as implemented in the Vienna Ab Initio Simulation Package. The energy between lowest Eu2+ 5d state and the bottom of conduction band are found based on luminescence quenching parameters. The vacuum referred binding energy diagram of lanthanide levels was constructed using the chemical shift model.

Magnetic structure of Ba (TiO ) Cu4(PO4)4 probed using spherical neutron polarimetry

NASA Astrophysics Data System (ADS)

Babkevich, P.; Testa, L.; Kimura, K.; Kimura, T.; Tucker, G. S.; Roessli, B.; Rønnow, H. M.

2017-12-01

The antiferromagnetic compound Ba (TiO ) Cu4(PO4)4 contains square cupola of corner-sharing CuO4 plaquettes, which were proposed to form effective quadrupolar order. To identify the magnetic structure, we have performed spherical neutron polarimetry measurements. Based on symmetry analysis and careful measurements, we conclude that the orientation of the Cu2 + spins form a noncollinear in-out structure with spins approximately perpendicular to the CuO4 motif. Strong Dzyaloshinskii-Moriya interaction naturally lends itself to explain this phenomenon. The identification of the ground-state magnetic structure should serve well for future theoretical and experimental studies into this and closely related compounds.

Interpretation of ES, CS, and IOS approximations within a translational--internal coupling scheme. IV. ES and IOS molecule--molecule cross sections

DOE Office of Scientific and Technical Information (OSTI.GOV)

Snider, R.F.; Parvatiyar, M.G.

1981-05-15

Properties of energy sudden and infinite order sudden translational--internal reduced S matrices are given for general molecule--molecule collisions. Formal similarities with the distorted wave Born approximation are discussed. Structural simplifications of energy dependent and kinetic cross sections associated with making the ES approximation are described. Conceptual difficulties associated with applying the ES and IOS approximations to kinetic processes dominated by energetically inelastic collisions are pointed out.

Birth Order and Injury-Related Infant Mortality in the U.S.

PubMed

Ahrens, Katherine A; Rossen, Lauren M; Thoma, Marie E; Warner, Margaret; Simon, Alan E

2017-10-01

The purpose of this study was to evaluate the risk of death during the first year of life due to injury, such as unintentional injury and homicide, by birth order in the U.S. Using national birth cohort-linked birth-infant death data (births, 2000-2010; deaths, 2000-2011), risks of infant mortality due to injury in second-, third-, fourth-, and fifth or later-born singleton infants were compared with first-born singleton infants. Risk ratios were estimated using log-binomial models adjusted for maternal age, marital status, race/ethnicity, and education. The statistical analyses were conducted in 2016. Approximately 40%, 32%, 16%, 7%, and 4% of singleton live births were first, second, third, fourth, and fifth or later born, respectively. From 2000 to 2011, a total of 15,866 infants died as a result of injury (approximately 1,442 deaths per year). Compared with first-born infants (2.9 deaths per 10,000 live births), second or later-born infants were at increased risk of infant mortality due to injury (second, 3.6 deaths; third, 4.2 deaths; fourth, 4.8 deaths; fifth or later, 6.4 deaths). The corresponding adjusted risk ratios were as follows: second, 1.84 (95% CI=1.76, 1.91); third, 2.42 (95% CI=2.30, 2.54); fourth, 2.96 (95% CI=2.77, 3.16); and fifth or later, 4.26 (95% CI=3.96, 4.57). Singleton infants born second or later were at increased risk of mortality due to injury during their first year of life in the U.S. This study's findings highlight the importance of investigating underlying mechanisms behind this increased risk. Published by Elsevier Inc.

Characterization of ZrO2 buffer layers for sequentially evaporated Y-Ba-CuO on Si and Al2O3 substrates

NASA Technical Reports Server (NTRS)

Valco, George J.; Rohrer, Norman J.; Pouch, John J.; Warner, Joseph D.; Bhasin, Kul B.

1988-01-01

Thin film high temperature superconductors have the potential to change the microwave technology for space communications systems. For such applications it is desirable that the films be formed on substrates such as Al2O3 which have good microwave properties. The use of ZrO2 buffer layers between Y-Ba-Cu-O and the substrate has been investigated. These superconducting films have been formed by multilayer sequential electron beam evaporation of Cu, BaF2 and Y with subsequent annealing. The three layer sequence of Y/BaF2/Cu is repeated four times for a total of twelve layers. Such a multilayer film, approximately 1 micron thick, deposited directly on SrTiO3 and annealed at 900 C for 45 min produces a film with a superconducting onset of 93 K and critical temperature of 85 K. Auger electron spectroscopy in conjunction with argon ion sputtering was used to obtain the distribution of each element as a function of depth for an unannealed film, the annealed film on SrTiO3 and annealed films on ZrO2 buffer layers. The individual layers were apparent. After annealing, the bulk of the film on SrTiO3 is observed to be fairly uniform while films on the substrates with buffer layers are less uniform. The Y-Ba-Cu-O/ZrO2 interface is broad with a long Ba tail into the ZrO2, suggesting interaction between the film and the buffer layer. The underlying ZrO2/Si interface is sharper. The detailed Auger results are presented and compared with samples annealed at different temperatures and durations.

Reduction in interface defect density in p-BaSi2/n-Si heterojunction solar cells by a modified pretreatment of the Si substrate

NASA Astrophysics Data System (ADS)

Yamashita, Yudai; Yachi, Suguru; Takabe, Ryota; Sato, Takuma; Emha Bayu, Miftahullatif; Toko, Kaoru; Suemasu, Takashi

2018-02-01

We have investigated defects that occurred at the interface of p-BaSi2/n-Si heterojunction solar cells that were fabricated by molecular beam epitaxy. X-ray diffraction measurements indicated that BaSi2 (a-axis-oriented) was subjected to in-plane compressive strain, which relaxed when the thickness of the p-BaSi2 layer exceeded 50 nm. Additionally, transmission electron microscopy revealed defects in the Si layer near steps that were present on the Si(111) substrate. Deep level transient spectroscopy revealed two different electron traps in the n-Si layer that were located at 0.33 eV (E1) and 0.19 eV (E2) below the conduction band edge. The densities of E1 and E2 levels in the region close to the heterointerface were approximately 1014 cm-3. The density of these electron traps decreased below the limits of detection following Si pretreatment to remove the oxide layers from the n-Si substrate, which involved heating the substrate to 800 °C for 30 min under ultrahigh vacuum while depositing a layer of Si (1 nm). The remaining traps in the n-Si layer were hole traps located at 0.65 eV (H1) and 0.38 eV (H2) above the valence band edge. Their densities were as low as 1010 cm-3. Following pretreatment, the current versus voltage characteristics of the p-BaSi2/n-Si solar cells under AM1.5 illumination were reproducible with conversion efficiencies beyond 5% when using a p-BaSi2 layer thickness of 100 nm. The origin of the H2 level is discussed.

Facile controlled synthesis of micro/nanostructure MCrO 4 (M = Ba, Pb) by using Gemini surfactant C 12-PEG-C 12 as a soft template

NASA Astrophysics Data System (ADS)

Chang, Wengui; Shen, Yuhua; Xie, Anjian; Liu, Xue

2010-04-01

Gemini surfactants, double sodium α-sulfonic polyethylene glycol laurate (abbreviated C 12-PEG-C 12), were prepared and applied as soft templates in the controlled synthesis of BaCrO 4 and PbCrO 4 micro/nanocrystals. The template effects were investigated by adjusting the length of the spacer, using PEG400 and PEG4000, of the Gemini surfactant. The results indicated that the size and morphology of BaCrO 4 and PbCrO 4 micro/nanocrystals varied with the change in spacer length of C 12-PEG-C 12, suggesting that the different lengths of the polyethylene glycol group spacers in the Gemini surfactants played a key role in determining the size and shape of the MCrO 4 micro/nanoparticles. The dynamic process of the formation of the novel morphology BaCrO 4 crystals showed that the morphology grew from a round-bar polyhedron, to regular polyhedron, to approximate octahedron to a uniform pistachio nut shape. The growth mechanism of the BaCrO 4 micro/nanocrystals was explained that C 12-PEG-C 12 had a greater interfacial adsorption and would effectively control the shape evolution during the crystal growth, while PbCrO 4 could be explained that the Gemini surfactants can undergo liquid-crystalline phase transitions with long channels providing a soft template effect and derived the nanorods formation. Room temperature fluorescence spectra were studied and these showed that the pistachio-shaped BaCrO 4 microcrystals and PbCrO 4 nanorods possess photoactive luminescence properties with emission peaks at 470 and 549 nm, respectively.

Synergistic association of elevated serum free fatty acid and glucose levels with large arterial stiffness in a general population: The Nagahama Study.

PubMed

Tabara, Yasuharu; Takahashi, Yoshimitsu; Setoh, Kazuya; Kawaguchi, Takahisa; Gotoh, Norimoto; Terao, Chikashi; Yamada, Ryo; Kosugi, Shinji; Sekine, Akihiro; Nakayama, Takeo; Matsuda, Fumihiko

2016-01-01

Previous studies have reported that artificial increases in circulating free fatty acid (FFA) levels might have adverse effects on the vasculature. However, whether or not this effect can be extrapolated to physiological variations in FFA levels has not been clarified. Given that FFAs exert a lipotoxic effect on pancreatic β-cells and might directly damage the arterial endothelium, we hypothesized that these adverse effects might synergize with hyperglycemia. A total of 9396 Japanese subjects were included in the study. Serum FFA levels were measured at baseline examination. Brachial-to-ankle pulse wave velocity (baPWV) was measured as an index of arterial stiffness. As serum levels of FFA were markedly lower in subjects with higher insulin level, a significant association between FFA levels and baPWV was observed only in subjects with blood samples taken under fasting (≥12 h, P<0.001) or near-fasting (5-11 h, P<0.001) conditions, and not in those taken under non-fasting (<5 h, P=0.307) conditions. Although type 2 diabetes and HbA1c showed a strong association with baPWV, the association between FFA level and baPWV remained significant (β=0.052, P<0.001) after adjustment for glycemic levels. In addition to their direct relationship, FFA and glucose levels were synergistically associated with baPWV (FFA(⁎)glucose; β=0.036, P<0.001). Differences in baPWV between the lowest and highest subgroups divided by a combination of FFA and glucose reached approximately 300 cm/s. Physiological variations in FFA concentrations might be a risk factor for large arterial stiffness. FFA and hyperglycemia exert a synergistic adverse effect on the vasculature. Copyright © 2016 Elsevier Inc. All rights reserved.

Strong-potential Born calculations for electron capture

DOE Office of Scientific and Technical Information (OSTI.GOV)

McGuire, J.H.; Sil, N.C.

1983-12-01

A closed-form expression for 1s-1s electron capture has been developed in the strong-potential Born (SPB) approximation. Terms of the order (Z/sub p//v)/sup 2/ are ignored in our expression, where Z/sub p/ is the charge of the projectile and v is the collision velocity. Our errors of order (Z/sub p//v)/sup 2/ are within the accuracy of the SPB approximation itself, which is valid to first order in the projectile-electron interaction V/sub p/ (and all orders in the stronger target potential V/sub T/). Calculations using our expression are in better agreement with experimental observations of the shape of the Thomas peak thanmore » are other calculations.« less

Electromagnetic backscattering from a random distribution of lossy dielectric scatterers

NASA Technical Reports Server (NTRS)

Lang, R. H.

1980-01-01

Electromagnetic backscattering from a sparse distribution of discrete lossy dielectric scatterers occupying a region 5 was studied. The scatterers are assumed to have random position and orientation. Scattered fields are calculated by first finding the mean field and then by using it to define an equivalent medium within the volume 5. The scatterers are then viewed as being embedded in the equivalent medium; the distorted Born approximation is then used to find the scattered fields. This technique represents an improvement over the standard Born approximation since it takes into account the attenuation of the incident and scattered waves in the equivalent medium. The method is used to model a leaf canopy when the leaves are modeled by lossy dielectric discs.

Time-dependent calculations of transfer ionization by fast proton-helium collision in one-dimensional kinematics

NASA Astrophysics Data System (ADS)

Serov, Vladislav V.; Kheifets, A. S.

2014-12-01

We analyze a transfer ionization (TI) reaction in the fast proton-helium collision H++He →H0+He2 ++ e- by solving a time-dependent Schrödinger equation (TDSE) under the classical projectile motion approximation in one-dimensional kinematics. In addition, we construct various time-independent analogs of our model using lowest-order perturbation theory in the form of the Born series. By comparing various aspects of the TDSE and the Born series calculations, we conclude that the recent discrepancies of experimental and theoretical data may be attributed to deficiency of the Born models used by other authors. We demonstrate that the correct Born series for TI should include the momentum-space overlap between the double-ionization amplitude and the wave function of the transferred electron.

BORN CROSS SECTIONS FOR INELASTIC SCATTERING OF ELECTRONS BY HYDROGEN ATOMS. III. 5s, 5p, 5d, 5f, 5g STATES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Milford, S.N.; Morrissey, J.J.; Scanlon, J.H.

1960-12-01

Born total cross sections were computed for the strong optically allowed transitions from n = 5 to n' = 6, at incident energies between 0.2 and 1361 ev. Thirty energy values were considered for the 5s to 6p and 5g to 6h cases, and nine for the other transitions. The cross sections obtained were larger than those of comparable transitions for lower n. The Bethe (dipole) approximation was also used, and was found to give good agreement with the Born results down to relatively low energies ( approx equal 3 ev). (auth)

Population inversion calculations using near resonant charge exchange as a pumping mechanism

NASA Technical Reports Server (NTRS)

Chubb, D. L.; Rose, J. R.

1972-01-01

Near resonance charge exchange between ions of a large ionization potential gas such as helium or neon and vapors of metals such as zinc, cadmium, selenium, or tellurium has produced laser action in the metal ion gas. The possibility of obtaining population inversions in near resonant charge exchange systems (Xe-Ca, Xe-Mg, Xe-Sr, Xe-Ba, Ar-Mg, N-Ca) was investigated. The analysis is an initial value problem that utilizes rate equations for the densities of relevant levels of the laser gas (Ca, Ba, Mg, or Sr) and an electron energy equation. Electron excitation rates are calculated using the Bohr-Thomson approximation for the cross section. Approximations to experimental values of the electron ionization cross section and the ion-atom charge exchange cross section are used. Preliminary results have been obtained for the Ca-Xe system and show that it is possible to obtain gains greater than 10 to the 14th power/m with inversion times up to 8x10 to the minus 7th power second. A possible charge exchange laser system using a MPD arc plasma accelerator is also described.

Domain wall motion and electromechanical strain in lead-free piezoelectrics: Insight from the model system (1 − x)Ba(Zr{sub 0.2}Ti{sub 0.8})O{sub 3}–x(Ba{sub 0.7}Ca{sub 0.3})TiO{sub 3} using in situ high-energy X-ray diffraction during application of electric fields

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tutuncu, Goknur; Li, Binzhi; Bowman, Keith

The piezoelectric compositions (1 − x)Ba(Zr{sub 0.2}Ti{sub 0.8})O{sub 3}–x(Ba{sub 0.7}Ca{sub 0.3})TiO{sub 3} (BZT-xBCT) span a model lead-free morphotropic phase boundary (MPB) between room temperature rhombohedral and tetragonal phases at approximately x = 0.5. In the present work, in situ X-ray diffraction measurements during electric field application are used to elucidate the origin of electromechanical strain in several compositions spanning the tetragonal compositional range 0.6 ≤ x ≤ 0.9. As BCT concentration decreases towards the MPB, the tetragonal distortion (given by c/a-1) decreases concomitantly with an increase in 90° domain wall motion. The increase in observed macroscopic strain is predominantly attributed to the increased contribution from 90°more » domain wall motion. The results demonstrate that domain wall motion is a significant factor in achieving high strain and piezoelectric coefficients in lead-free polycrystalline piezoelectrics.« less

Preparation of biochar from Enteromorpha prolifera and its use for the removal of polycyclic aromatic hydrocarbons (PAHs) from aqueous solution.

PubMed

Qiao, Kaili; Tian, Weijun; Bai, Jie; Dong, Jie; Zhao, Jing; Gong, Xiaoxi; Liu, Shuhui

2018-03-01

EP-biochar was produced from Enteromorpha prolifera (EP) at temperatures of 200-600°C under limited-oxygen conditions and then activated using HCl and HF. To optimize the sorption of pyrene (PYR) and benzo[a]pyrene (BaP), the effect of the pyrolysis temperature was studied, and the results showed that EP-biochar produced at 500°C gave the highest removal efficiency. The physiochemical properties of EP-biochar pyrolyzed at 500°C were characterized. The examination indicated that the surface area of EP-biochar was 205.32m 2 /g. The effect of the EP-biochar dosage and initial solution pH on the adsorption were studied in batch adsorption experiments. Kinetic studies indicated that the adsorption processes of PYR and BaP agreed well with a pseudo second-order kinetic model. The sorption equilibrium data were well described by the Langmuir model. Desorption experiments were conducted to test the strength of binding interactions of EP-biochar. The results showed that PYR and BaP were difficult to dissolve in water after adsorption. Regeneration experiments demonstrated that the biochars regenerated at 200°C retained approximately 48% and 40% of their initial PYR and BaP uptake. Copyright © 2017 Elsevier Inc. All rights reserved.

Widespread Abundance of Functional Bacterial Amyloid in Mycolata and Other Gram-Positive Bacteria▿

PubMed Central

Jordal, Peter Bruun; Dueholm, Morten Simonsen; Larsen, Poul; Petersen, Steen Vang; Enghild, Jan Johannes; Christiansen, Gunna; Højrup, Peter; Nielsen, Per Halkjær; Otzen, Daniel Erik

2009-01-01

Until recently, extracellular functional bacterial amyloid (FuBA) has been detected and characterized in only a few bacterial species, including Escherichia coli, Salmonella, and the gram-positive organism Streptomyces coelicolor. Here we probed gram-positive bacteria with conformationally specific antibodies and revealed the existence of FuBA in 12 of 14 examined mycolata species, as well as six other distantly related species examined belonging to the phyla Actinobacteria and Firmicutes. Most of the bacteria produced extracellular fimbriae, sometimes copious amounts of them, and in two cases large extracellular fibrils were also produced. In three cases, FuBA was revealed only after extensive removal of extracellular material by saponification, indicating that there is integrated attachment within the cellular envelope. Spores of species in the genera Streptomyces, Bacillus, and Nocardia were all coated with amyloids. FuBA was purified from Gordonia amarae (from the cell envelope) and Geodermatophilus obscurus, and they had the morphology, tinctorial properties, and β-rich structure typical of amyloid. The presence of approximately 9-nm-wide amyloids in the cell envelope of G. amarae was visualized by transmission electron microscopy analysis. We conclude that amyloid is widespread among gram-positive bacteria and may in many species constitute a hitherto overlooked integral part of the spore and the cellular envelope. PMID:19395568

Investigation of structural, ferroelectric, piezoelectric and dielectric properties of Ba0.92Ca0.08TiO3-BaTi0.96Zr0.04O3 lead-free electroceramics

NASA Astrophysics Data System (ADS)

Keswani, Bhavna C.; Patil, S. I.; Kolekar, Y. D.

2018-04-01

Lead free ferroelectric with composition 0.55Ba0.92Ca0.08TiO3-0.45BaTi0.96Zr0.04O3 (BCT8-BZT4) was synthesized by solid state reaction method and investigated their structural, ferroelectric, piezoelectric and dielectric properties. X-ray diffraction analysis shows that BCT8-BZT4 ceramic possess both tetragonal (space group P4mm) and orthorhombic (space group Amm2) crystal structure which was further confirmed from Raman spectra spectroscopy. The micronized grains were observed from scanning electron micrographs while the presence of polarization-electric field hysteresis loop confirms ferroelectric nature of BCT8-BZT4 ceramic. Higher values of maximum polarization (Pmax = 22.27 μC/cm2), remnant polarization (Pr = 11.61 μC/cm2), coercive electric field (Ec = 4.77 kV/cm) and direct piezoelectric coefficient (d33) approximately 185 pC/N were observed. The real part of dielectric constant with frequency shows the usual dielectric dispersion behaviour at RT. The observed properties show that the lead free BCT8-BZT4 ceramic is suitable for ferroelectric memory device, piezoelectric sensor, capacitor, etc. applications.

Crystallization kinetics of BaO-Al2O3-SiO2 glasses

NASA Technical Reports Server (NTRS)

Bansal, Narottam P.; Hyatt, Mark J.

1989-01-01

Barium aluminosilicate glasses are being investigated as matrix materials in high-temperature ceramic composites for structural applications. Kinetics of crystallization of two refractory glass compositions in the barium aluminosilicate system were studied by differential thermal analysis (DTA), X-ray diffraction (XRD), and scanning electron microscopy (SEM). From variable heating rate DTA, the crystallization activation energies for glass compositions (wt percent) 10BaO-38Al2O3-51SiO2-1MoO3 (glass A) and 39BaO-25Al2O3-35SiO2-1MoO3 (glass B) were determined to be 553 and 558 kJ/mol, respectively. On thermal treatment, the crystalline phases in glasses A and B were identified as mullite (3Al2O3-2SiO2) and hexacelsian (BaO-Al2O3-2SiO2), respectively. Hexacelsian is a high-temperature polymorph which is metastable below 1590 C. It undergoes structural transformation into the orthorhombic form at approximately 300 C accompanied by a large volume change which is undesirable for structural applications. A process needs to be developed where stable monoclinic celsian, rather than hexacelsian, precipitates out as the crystal phase in glass B.

Crystallization kinetics of BaO-Al2O3-SiO2 glasses

NASA Technical Reports Server (NTRS)

Bansal, Narottam P.; Hyatt, Mark J.

1988-01-01

Barium aluminosilicate glasses are being investigated as matrix materials in high-temperature ceramic composites for structural applications. Kinetics of crystallization of two refractory glass compositions in the barium aluminosilicate system were studied by differential thermal analysis (DTA), X-ray diffraction (XRD), and scanning electron microscopy (SEM). From variable heating rate DTA, the crystallization activation energies for glass compositions (wt percent) 10BaO-38Al2O3-51SiO2-1MoO3 (glass A) and 39BaO-25Al2O3-35SiO2-1MoO3 (glass B) were determined to be 553 and 558 kJ/mol, respectively. On thermal treatment, the crystalline phases in glasses A and B were identified as mullite (3Al2O3-2SiO2) and hexacelsian (BaO-Al2O3-2SiO2), respectively. Hexacelsian is a high-temperature polymorph which is metastable below 1590 C. It undergoes structural transformation into the orthorhombic form at approximately 300 C accompanied by a large volume change which is undesirable for structural applications. A process needs to be developed where stable monoclinic celsian, rather than hexacelsian, precipitates out as the crystal phase in glass B.

Millimeter-Wave Circuit Analysis and Synthesis.

DTIC Science & Technology

1985-05-01

correct within a few percent and the resulting drain-source t.r7njnal current is usually high by approximately 10 percent. -20- Before Eqs. 5 and 9 can...typically used in arialytic FET models and is correct in the limit of long gates.1-3 With this approximation, the voltage drop across the depletion layer...carried out for two ba. c geometrica ss- ft WI sa of arbitrary thickness place-i c;c:.slc,, wi’ta -v .h each sidewall and (2) a thin Yl, s 1 te w~ith

Alkaline earth filled nickel skutterudite antimonide thermoelectrics

DOEpatents

Singh, David Joseph

2013-07-16

A thermoelectric material including a body centered cubic filled skutterudite having the formula A.sub.xFe.sub.yNi.sub.zSb.sub.12, where A is an alkaline earth element, x is no more than approximately 1.0, and the sum of y and z is approximately equal to 4.0. The alkaline earth element includes guest atoms selected from the group consisting of Be, Mb, Ca, Sr, Ba, Ra and combinations thereof. The filled skutterudite is shown to have properties suitable for a wide variety of thermoelectric applications.

Three-dimensional imaging of buried objects in very lossy earth by inversion of VETEM data

USGS Publications Warehouse

Cui, T.J.; Aydiner, A.A.; Chew, W.C.; Wright, D.L.; Smith, D.V.

2003-01-01

The very early time electromagnetic system (VETEM) is an efficient tool for the detection of buried objects in very lossy earth, which allows a deeper penetration depth compared to the ground-penetrating radar. In this paper, the inversion of VETEM data is investigated using three-dimensional (3-D) inverse scattering techniques, where multiple frequencies are applied in the frequency range from 0-5 MHz. For small and moderately sized problems, the Born approximation and/or the Born iterative method have been used with the aid of the singular value decomposition and/or the conjugate gradient method in solving the linearized integral equations. For large-scale problems, a localized 3-D inversion method based on the Born approximation has been proposed for the inversion of VETEM data over a large measurement domain. Ways to process and to calibrate the experimental VETEM data are discussed to capture the real physics of buried objects. Reconstruction examples using synthesized VETEM data and real-world VETEM data are given to test the validity and efficiency of the proposed approach.

Towards a complete North American Anabaptist Genealogy II: analysis of inbreeding.

PubMed

Agarwala, R; Schäffer, A A; Tomlin, J F

2001-08-01

We describe a large genealogy data base, which can be searched by computer, of 295,095 Amish and Mennonite individuals. The data base was constructed by merging our existing Anabaptist Genealogy Database 2.0 containing approximately 85,000 individuals with a genealogy file containing approximately 242,000 individuals, kindly provided by Mr. James Hostetler. The merging process corrected thousands of inconsistencies and eliminated hundreds of duplicate individuals. Geneticists have long been interested in Anabaptist populations because they are closed and have detailed written genealogies. The creation of an enlarged and unified data base affords the opportunity to examine inbreeding trends and correlates in these populations. We show the following results. The frequency of consanguineous marriages shows steady increase over time and reached approximately 85% for individuals born in 1940-1959. Among consanguineous marriages, the median kinship coefficient stayed stable in the 19th century, but rose from 0.0115 to 0.0151 in the 20th century. There are statistically significant associations (p < 0.0001) between inbreeding and family size and interbirth intervals in the 20th century. There is an association (p < 0.0005) between inbreeding and early death for individuals born in 1920-1959. However, this association reverses dramatically (p < 0.0005 in the opposite direction) for individuals born in 1960-1979. We tested for an association between inbreeding and being the mother of twins, but found none.

Effects of a finite aperture on the Inverse Born Approximation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kogan, V.G.; Rose, J.H.

1983-01-01

One of the most important effects of complex part geometry is that the available entrance and exit angles for ultrasound are limited. We will present a study of the Inverse Born approximation in which we have data for incident (and exit) directions confined to a conical aperture. Modeling the direct problem by the Born Approximation, we obtained analytical results for (1) a weak spherical inclusion, and (2) a penny shaped crack (modeled by an oblate spheroid). General results are: (a) the value of the characteristic function ..gamma.. is constant in the interior of the flaw, but reduced in value; (b)more » the discontinuity at the boundary of the flaw occurs over the lighted portion of the flaw; (c) this discontinuity is contrasted by a region where ..gamma.. is negative; and (d) new non-physical discontinuities and non-analyticities appear in the reconstructed characteristic function. These general features also appear in numerical calculations which use as input strong scattering data from a spherical void and a flat penny shaped crack in Titanium. The numerical results can be straightforwardly interpreted in terms of the analytical calculation mentioned above, indicating that they will be useful in the study of realistic flaws. We conclude by discussing the stabilization of the aperture limited inversion problem and the removal of non-physical features in the reconstruction.« less

Problems related to CMV infection and biliary atresia.

PubMed

Moore, Samuel W; Zabiegaj-Zwick, Caroline; Nel, Etienne

2012-09-11

Human cytomegalovirus (CMV) infection is related to biliary disease, being cholestatic in its own right. It has also been associated with intrahepatic bile duct destruction and duct paucity, indicating a possible role in extrahepatic biliary atresia pathogenesis and progression. When related to biliary atresia CMV IGM positive patients appear to have more liver damage thus affecting outcome. Methods We carried out a retrospective chart review on 74 patients diagnosed with hepatobiliary disease (2000-2011). included clinical and outcome review as well as evaluation of potential risk factors. Patients were divided into 2 groups those with biliary atresia and those without Biliary atresia (BA). The 2 groups were compared in terms of CMV infection. Of the 74 patients with hepatobiliary disease investigated, 39 (52%) were shown to have Biliary atresia and 35 other cases. 12 of the BA group and 4 of the non-BA were excluded due to lack of data Twenty-seven (69%) of the biliary atresia group had sufficient available data for review. Of these, 21 (78% of the 27) had CMV positivity (IgM/IgG) on testing, with 20 of these being IgM positive versus 8 in the non-biliary atresia group. (p<0.01) Two (7.5%) of 27 BA infants were HIV exposed being born to HIV positive mothers whereas HIV positivity was observed in 7 (35%) of the non-biliary atresia group (p<0.01). Both of these biliary atresia infants were CMV IgM positive. Long- term outcome of the 21 with CMV positivity showed 3 deaths (non-HIV exposed) and a higher rate of severe early liver damage suggesting a poorer outcome in CMV affected patients. This study suggests a correlation between CMV exposure, infection and surgical hepatobiliary disease including biliary atresia affecting outcome.HIV positivity does not preclude Biliary atresia and should be further investigated.

Does really Born Oppenheimer approximation break down in charge transfer processes? An exactly solvable model

NASA Astrophysics Data System (ADS)

Kuznetsov, Alexander M.; Medvedev, Igor G.

2006-05-01

Effects of deviation from the Born-Oppenheimer approximation (BOA) on the non-adiabatic transition probability for the transfer of a quantum particle in condensed media are studied within an exactly solvable model. The particle and the medium are modeled by a set of harmonic oscillators. The dynamic interaction of the particle with a single local mode is treated explicitly without the use of BOA. Two particular situations (symmetric and non-symmetric systems) are considered. It is shown that the difference between the exact solution and the true BOA is negligibly small at realistic parameters of the model. However, the exact results differ considerably from those of the crude Condon approximation (CCA) which is usually considered in the literature as a reference point for BOA (Marcus-Hush-Dogonadze formula). It is shown that the exact rate constant can be smaller (symmetric system) or larger (non-symmetric one) than that obtained in CCA. The non-Condon effects are also studied.

Cross sections and rate coefficients for inner-shell excitation of Li-like ions with 6 < Z < 42

NASA Astrophysics Data System (ADS)

Safronova, U. I.; Safronova, M. S.; Kato, T.

1996-07-01

Excitation cross sections and rate coefficients by electron impact were calculated for the 1s22s-1s2s2p, 1s22s-1s2s2 and 1s22s-1s2p2 transitions of the Li-like ions (C IV, N V, O VI, Ne VIII, Mg X, Al XI, Si XII, S XIV, Ar XVI, Ca XVIII, Ti XX, Fe XXIV, Ni XXVI, Zn XXVIII, Ge XXX, Se XXXII, Kr XXXIV and Mo XXXX) in the Coulomb-Born approximation with exchange including relativistic effects and configuration interaction. Level energies, mixing coefficients and transition wavelengths and probabilities were also computed. Calculations performed by the 1/Z perturbation theory and Coulomb-Born approximation are compared with the R-matrix method and the distorted-wave approximation were Z is the nuclear charge. Formulae obtained for the angular factors of n-electron atomic system allow one to generalize this method to an arbitrary system of highly charged ions.

Investigation of the photosensitivity of LiNbO3:BaFeO3 crystal

NASA Astrophysics Data System (ADS)

Darwish, Abdalla M.; Koplitz, Brent D.; Jackson, E.; Jalbout, F.; Jalbout, A.; Aggarwal, Mohan D.

2002-01-01

Ferromagnetic resonance (FMR) absorptions from six fine particle-samples of barium ferrite were studied over a temperature range of -195 degree(s)C to 500 degree(s)C. It was found that the shape of the FMR absorption signal is affected by the particle shape and crystalline anisotropy of each sample. From this analysis, the first magnetic anisotropy constant K1 was estimated approximately as a function of temperature. The estimation suggested that the value of K1 was sensitive to the condition of preparation of fine powders. In addition the photosensitivity of the LiNbO3:BaFe doped crystal was enhanced, suggesting the importance of Barium Ferrite powder as a potential candidate with NOL materials.

Fused X-ray and MR Imaging Guidance of Intrapericardial Delivery of Microencapsulated Human Mesenchymal Stem Cells in Immunocompetent Swine

PubMed Central

Fu, Yingli; Azene, Nicole; Ehtiati, Tina; Flammang, Aaron; Gilson, Wesley D.; Gabrielson, Kathleen; Weiss, Clifford R.; Bulte, Jeff W. M.; Solaiyappan, Meiyappan; Johnston, Peter V.

2014-01-01

Purpose To assess intrapericardial delivery of microencapsulated, xenogeneic human mesenchymal stem cells (hMSCs) by using x-ray fused with magnetic resonance (MR) imaging (x-ray/MR imaging) guidance as a potential treatment for ischemic cardiovascular disease in an immunocompetent swine model. Materials and Methods All animal experiments were approved by the institutional animal care and use committee. Stem cell microencapsulation was performed by using a modified alginate-poly-l-lysine-alginate encapsulation method to include 10% (wt/vol) barium sulfate to create barium-alginate microcapsules (BaCaps) that contained hMSCs. With x-ray/MR imaging guidance, eight female pigs (approximately 25 kg) were randomized to receive either BaCaps with hMSCs, empty BaCaps, naked hMSCs, or saline by using a percutaneous subxiphoid approach and were compared with animals that received empty BaCaps (n = 1) or BaCaps with hMSCs (n = 2) by using standard fluoroscopic delivery only. MR images and C-arm computed tomographic (CT) images were acquired before injection and 1 week after delivery. Animals were sacrificed immediately or at 1 week for histopathologic validation. Cardiac function between baseline and 1 week after delivery was evaluated by using a paired Student t test. Results hMSCs remained highly viable (94.8% ± 6) 2 days after encapsulation in vitro. With x-ray/MR imaging, successful intrapericardial access and delivery were achieved in all animals. BaCaps were visible fluoroscopically and at C-arm CT immediately and 1 week after delivery. Whereas BaCaps were free floating immediately after delivery, they consolidated into a pseudoepicardial tissue patch at 1 week, with hMSCs remaining highly viable within BaCaps; naked hMSCs were poorly retained. Follow-up imaging 1 week after x-ray/MR imaging–guided intrapericardial delivery showed no evidence of pericardial adhesion and/or effusion or adverse effect on cardiac function. In contradistinction, BaCaps delivery with x-ray fluoroscopy without x-ray/MR imaging (n = 3) resulted in pericardial adhesions and poor hMSC viability after 1 week. Conclusion Intrapericardial delivery of BaCaps with hMSCs leads to high cell retention and survival. With x-ray/MR imaging guidance, intrapericardial delivery can be performed safely in the absence of preexisting pericardial effusion to provide a novel route for cardiac cellular regenerative therapy. © RSNA, 2014 Online supplemental material is available for this article. PMID:24749713

The sound of operation and the acoustic attenuation of the Ohmeda Medical Giraffe OmniBed™.

PubMed

Wubben, Stephanie M; Brueggeman, Paul M; Stevens, Dennis C; Helseth, Carol C; Blaschke, Kristen

2011-01-01

The neonatal intensive care unit (NICU) is an environment that provides premature and fragile infants with health provisions needed to make a complete recovery. Premature infants are often born before their auditory systems have had an opportunity to fully mature. Research has shown that the ambient acoustic environment in the NICU exceeds the maximum noise level recommended by the American Academy of Pediatrics, even after measures have been taken to decrease noise levels. The purpose of this study is to evaluate noise levels inside an Ohmeda Medical Giraffe™ OmniBed™, the natural attenuation of the incubator, and the effects of modifications on attenuation and reverberation within the Giraffe TM OmniBed™. The normal operation of the Giraffe™ OmniBed™ is 41.7 dBA which indicates a lower noise of operation than previous studies. The Giraffe™ OmniBed™ naturally attenuates 12 dBA. Leaving an access latch or portal door open causes a statistically significant (P=.001) increase in sound within the bassinet. All modifications in the no-noise and the noise conditions showed a statistically significant (P=.001) drop in L(eq) when compared to baseline.

Corrections to the one-photon approximation in the 0+-->2+ transition of 12C

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paul Gueye; Madeleine Bernheim; J. F. Danel

2001-04-18

Contribution of higher order effects to the one-photon exchange approximation were studied in the first excited state of 12C by comparing inclusive inelastic scattering cross sections of electrons and positrons obtained at the Saclay Linear Accelerator. The data were compared to a distorted wave Born approximation (DWBA)calculation. The results indicate an effect less than 2% within 2sigma, compatible with what was observed in recent elastic scattering measurements.

The graviton luminosity of the sun and other stars

NASA Technical Reports Server (NTRS)

Gould, R. J.

1985-01-01

Graviton production in electron-electron (e-e) and electron-ion (e-z) scattering is evaluated in the Born approximation. The calculation is compared with that for photon production, that is, Coulomb quadrupole bremsstrahlung, and a number of results are taken over from that problem. Application is made to the sun, and it is found that for the solar plasma the main contribution to the graviton luminosity comes from the central core at r/R approximately 0.1. The total luminosity (Lg) in gravitons is about 7.9 x 10 to the 14th ergs/s, close to an earlier estimate by Weinberg (1965, 1972); about 33 percent of the total results from e-e collisions with the rest from e-z collisions (mainly e-p and e-alpha). Approximate corrections to Born formulas are evaluated, and this Lg includes the associated (approximately + or - 10 percent, respectively) modification. The quantum-mechanical aspects of the solar Lg problem are discussed, and it is shown why a previous classical calculation overestimated Lg by about an order of magnitude. Production of gravitons in binary collisions in other types of stars is discussed briefly. It is found that Lg varies very little along the main sequence. White dwarfs have a typical graviton luminosity LWD approximately 10 to the 19th ergs/s, while neutron stars have LNS approximately 10 to the 25th ergs/s; these estimates are very rough.

Postural Complexity Differs Between Infant Born Full Term and Preterm During the Development of Early Behaviors

PubMed Central

Dusing, Stacey C; Izzo, Theresa A.; Thacker, Leroy R.; Galloway, James C

2014-01-01

Background and Aims Postural control differs between infants born preterm and full term at 1–3 weeks of age. It is unclear if differences persist or alter the development of early behaviors. The aim of this longitudinal study was to compare changes in postural control variability during development of head control and reaching in infants born preterm and full term. Methods Eighteen infants born preterm (mean gestational age 28.3±3.1 weeks) were included in this study and compared to existing data from 22 infants born full term. Postural variability was assessed longitudinally using root mean squared displacement and approximate entropy of the center of pressure displacement from birth to 6 months as measures of the magnitude of the variability and complexity of postural control. Behavioral coding was used to quantify development of head control and reaching. Results Group differences were identified in postural complexity during the development of head control and reaching. Infants born preterm used more repetitive and less adaptive postural control strategies than infants born full term. Both groups changed their postural complexity utilized during the development of head control and reaching. Discussion Early postural complexity was decreased in infants born preterm, compared to infants born full term. Commonly used clinical assessments did not identify these early differences in postural control. Altered postural control in infants born preterm influenced ongoing skill development in the first six months of life. PMID:24485170

Prevalence and Diversity of Tick-Borne Pathogens in Nymphal Ixodes scapularis (Acari: Ixodidae) in Eastern National Parks.

PubMed

Johnson, Tammi L; Graham, Christine B; Boegler, Karen A; Cherry, Cara C; Maes, Sarah E; Pilgard, Mark A; Hojgaard, Andrias; Buttke, Danielle E; Eisen, Rebecca J

2017-05-01

Tick-borne pathogens transmitted by Ixodes scapularis Say (Acari: Ixodidae), also known as the deer tick or blacklegged tick, are increasing in incidence and geographic distribution in the United States. We examined the risk of tick-borne disease exposure in 9 national parks across six Northeastern and Mid-Atlantic States and the District of Columbia in 2014 and 2015. To assess the recreational risk to park visitors, we sampled for ticks along frequently used trails and calculated the density of I. scapularis nymphs (DON) and the density of infected nymphs (DIN). We determined the nymphal infection prevalence of I. scapularis with a suite of tick-borne pathogens including Borrelia burgdorferi, Borrelia miyamotoi, Anaplasma phagocytophilum, and Babesia microti. Ixodes scapularis nymphs were found in all national park units; DON ranged from 0.40 to 13.73 nymphs per 100 m2. Borrelia burgdorferi, the causative agent of Lyme disease, was found at all sites where I. scapularis was documented; DIN with B. burgdorferi ranged from 0.06 to 5.71 nymphs per 100 m2. Borrelia miyamotoi and A. phagocytophilum were documented at 60% and 70% of the parks, respectively, while Ba. microti occurred at just 20% of the parks. Ixodes scapularis is well established across much of the Northeastern and Mid-Atlantic States, and our results are generally consistent with previous studies conducted near the areas we sampled. Newly established I. scapularis populations were documented in two locations: Washington, D.C. (Rock Creek Park) and Greene County, Virginia (Shenandoah National Park). This research demonstrates the potential risk of tick-borne pathogen exposure in national parks and can be used to educate park visitors about the importance of preventative actions to minimize tick exposure. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.

Genetic Characterization of the Tick-Borne Orbiviruses

PubMed Central

Belaganahalli, Manjunatha N.; Maan, Sushila; Maan, Narender S.; Brownlie, Joe; Tesh, Robert; Attoui, Houssam; Mertens, Peter P. C.

2015-01-01

The International Committee for Taxonomy of Viruses (ICTV) recognizes four species of tick-borne orbiviruses (TBOs): Chenuda virus, Chobar Gorge virus, Wad Medani virus and Great Island virus (genus Orbivirus, family Reoviridae). Nucleotide (nt) and amino acid (aa) sequence comparisons provide a basis for orbivirus detection and classification, however full genome sequence data were only available for the Great Island virus species. We report representative genome-sequences for the three other TBO species (virus isolates: Chenuda virus (CNUV); Chobar Gorge virus (CGV) and Wad Medani virus (WMV)). Phylogenetic comparisons show that TBOs cluster separately from insect-borne orbiviruses (IBOs). CNUV, CGV, WMV and GIV share low level aa/nt identities with other orbiviruses, in ‘conserved’ Pol, T2 and T13 proteins/genes, identifying them as four distinct virus-species. The TBO genome segment encoding cell attachment, outer capsid protein 1 (OC1), is approximately half the size of the equivalent segment from insect-borne orbiviruses, helping to explain why tick-borne orbiviruses have a ~1 kb smaller genome. PMID:25928203

Genetic characterization of the tick-borne orbiviruses.

PubMed

Belaganahalli, Manjunatha N; Maan, Sushila; Maan, Narender S; Brownlie, Joe; Tesh, Robert; Attoui, Houssam; Mertens, Peter P C

2015-04-28

The International Committee for Taxonomy of Viruses (ICTV) recognizes four species of tick-borne orbiviruses (TBOs): Chenuda virus, Chobar Gorge virus, Wad Medani virus and Great Island virus (genus Orbivirus, family Reoviridae). Nucleotide (nt) and amino acid (aa) sequence comparisons provide a basis for orbivirus detection and classification, however full genome sequence data were only available for the Great Island virus species. We report representative genome-sequences for the three other TBO species (virus isolates: Chenuda virus (CNUV); Chobar Gorge virus (CGV) and Wad Medani virus (WMV)). Phylogenetic comparisons show that TBOs cluster separately from insect-borne orbiviruses (IBOs). CNUV, CGV, WMV and GIV share low level aa/nt identities with other orbiviruses, in 'conserved' Pol, T2 and T13 proteins/genes, identifying them as four distinct virus-species. The TBO genome segment encoding cell attachment, outer capsid protein 1 (OC1), is approximately half the size of the equivalent segment from insect-borne orbiviruses, helping to explain why tick-borne orbiviruses have a ~1 kb smaller genome.

Elastic scattering of spin-polarized electrons and positrons from 23Na nuclei

NASA Astrophysics Data System (ADS)

Jakubassa-Amundsen, D. H.

2018-07-01

Differential cross sections and polarization correlations for the scattering of relativistic spin-polarized leptons from unpolarized ground-state sodium nuclei are calculated within the distorted-wave Born approximation (DWBA). Various nuclear ground-state charge distributions are probed. Besides potential scattering, also electric C2 and magnetic M1 and M3 transitions are taken into account. It is shown that even for a light nucleus such as 23Na there are considerable electron-positron differences at high collision energies and large scattering angles. In particular, the symmetry of the Sherman function with respect to a global sign change, as predicted by the second-order Born approximation when replacing electrons by positrons, is broken whenever the diffraction structures come into play beyond 100 MeV.

Born-Oppenheimer approximation for a singular system

NASA Astrophysics Data System (ADS)

Akbas, Haci; Turgut, O. Teoman

2018-01-01

We discuss a simple singular system in one dimension, two heavy particles interacting with a light particle via an attractive contact interaction and not interacting among themselves. It is natural to apply the Born-Oppenheimer approximation to this problem. We present a detailed discussion of this approach; the advantage of this simple model is that one can estimate the error terms self-consistently. Moreover, a Fock space approach to this problem is presented where an expansion can be proposed to get higher order corrections. A slight modification of the same problem in which the light particle is relativistic is discussed in a later section by neglecting pair creation processes. Here, the second quantized description is more challenging, but with some care, one can recover the first order expression exactly.

Coupled-Sturmian and perturbative treatments of electron transfer and ionization in high-energy p-He+ collisions

NASA Astrophysics Data System (ADS)

Winter, Thomas G.; Alston, Steven G.

1992-02-01

Cross sections have been determined for electron transfer and ionization in collisions between protons and He+ ions at proton energies from several hundred kilo-electron-volts to 2 MeV. A coupled-Sturmian approach is taken, extending the work of Winter [Phys. Rev. A 35, 3799 (1987)] and Stodden et al. [Phys. Rev. A 41, 1281 (1990)] to high energies where perturbative approaches are expected to be valid. An explicit connection is made with the first-order Born approximation for ionization and the impulse version of the distorted, strong-potential Born approximation for electron transfer. The capture cross section is shown to be affected by the presence of target basis functions of positive energy near v2/2, corresponding to the Thomas mechanism.

Calculation of the total electron excitation cross section in the Born approximation using Slater wave functions for the Li (2s yields 2p), Li (2s yields 3p), Na (3s yields 4p), Mg (3p yields 4s), Ca (4s yields 4p) and K (4s yields 4p) excitations. M.S. Thesis

NASA Technical Reports Server (NTRS)

Simsic, P. L.

1974-01-01

Excitation of neutral atoms by inelastic scattering of incident electrons in gaseous nebulae were investigated using Slater Wave functions to describe the initial and final states of the atom. Total cross sections using the Born Approximation are calculated for: Li(2s yields 2p), Na(3s yields 4p), k(4s yields 4p). The intensity of emitted radiation from gaseous nebulae is also calculated, and Maxwell distribution is employed to average the kinetic energy of electrons.

West nile virus and equine encephalitis viruses: new perspectives.

PubMed

Long, Maureen T

2014-12-01

Mosquito-borne diseases affect horses worldwide. Mosquito-borne diseases generally cause encephalomyelitis in the horse and can be difficult to diagnose antemortem. In addition to general disease, and diagnostic and treatment aspects, this review article summarizes the latest information on these diseases, covering approximately the past 5 years, with a focus on new equine disease encroachments, diagnostic and vaccination aspects, and possible therapeutics on the horizon. Copyright © 2014 Elsevier Inc. All rights reserved.

40 CFR 211.204-4 - Supporting information.

Code of Federal Regulations, 2010 CFR

2010-07-01

... level as measured at the ear is 92 dBA. 2. The NRR is (value on label) decibels (dB). 3. The level of... must be affixed to the bulk container or dispenser in the same manner as the label, and in a readily... entering a person's ear, when hearing protector is worn as directed, is closely approximated by the...

Thermoelectric properties of topological insulator BaSn2

NASA Astrophysics Data System (ADS)

Guo, San-Dong; Qiu, Liang

2017-01-01

Recently, \\text{BaS}{{\\text{n}}2} has been predicted to be a strong topological insulator by the first-principle calculations. It is well known that topological insulators have a close connection to thermoelectric materials, such as the \\text{B}{{\\text{i}}2}\\text{T}{{\\text{e}}3} family. In this work, we investigate thermoelectric properties of \\text{BaS}{{\\text{n}}2} by the first-principles calculations combined with the Boltzmann transport theory. The electronic part is carried out by a modified Becke and Johnson (mBJ) exchange potential, including spin-orbit coupling (SOC), while the phonon part is performed using a generalized gradient approximation (GGA). It was found that the electronic transport coefficients between the in-plane and cross-plane directions showed strong anisotropy, while lattice-lattice thermal conductivities demonstrated almost complete isotropy. Calculated results revealed a very low lattice thermal conductivity for \\text{BaS}{{\\text{n}}2} , and the corresponding average lattice thermal conductivity at room temperature is 1.69 \\text{W}~{{\\text{m}}-1}~{{\\text{K}}-1} , which is comparable or lower than those of lead chalcogenides and bismuth-tellurium systems as classic thermoelectric materials. Due to the complicated scattering mechanism, calculating the scattering time τ is challenging. By using an empirical τ ={{10}-14} s, the n-type figure of merit ZT is greater than 0.40 in wide temperature ranges. Experimentally, it is possible to attain better thermoelectric performance by strain or tuning size parameters. This work indicates that \\text{BaS}{{\\text{n}}2} may be a potential thermoelectric material, which can stimulate further theoretical and experimental work.

Hepatoblastoma in Explanted Livers of Patients With Biliary Atresia.

PubMed

Amir, Achiya Z; Sharma, Ajay; Cutz, Ernest; Avitzur, Yaron; Shaikh, Furqan; Kamath, Binita M; Ling, Simon C; Ghanekar, Anand; Ng, Vicky L

2016-08-01

Surveillance of hepatic nodules for malignant transformation to hepatocellular carcinoma is important in the monitoring of patients with biliary atresia (BA). To date, only 2 published case reports describe the finding of hepatoblastoma (HB) in this setting. The present study aimed to investigate this association of HB and BA, and to assess the utility of alpha-fetoprotein (aFP) as a marker in the diagnosis. A retrospective study of all patients who underwent isolated liver transplantation (LTx) for the primary diagnosis of BA at a single center, between January 1999 and June 2014, was conducted. Patient demographics, pre-LTx aFP levels, and histologic examination of native liver explants were reviewed. One hundred two (44% men, median age 11 months) patients underwent LTx for BA. Two (2%) explants examinations were confirmatory for concomitant HB; both patients had abnormally elevated aFP. Overall, 56 (55%) patients had available pre-LTx aFP levels. Recipients with persistently abnormal aFP levels (n = 20, 36%) were older at hepatoportoenterostomy (107 vs 68 days, P = 0.02) and younger at LTx surgery (359 vs 1713 days, P < 0.01), compared to patients with constantly normal levels (n = 24, 43%). In our cohort, HB was found to coexist in approximately 2% of patients with BA undergoing LTx, far exceeding the hypothetical anticipated incidence of 1:10 billion for the concomitant diagnoses. Elevated serum aFP levels may be sensitive but not specific for HB in this context. Further research is required to identify specific mechanisms and risk factors.

Second Order Born Effects in the Perpendicular Plane Ionization of Xe (5p) Atoms

NASA Astrophysics Data System (ADS)

Purohit, G.; Singh, Prithvi; Patidar, Vinod

We report triple differential cross section (TDCS) results for the perpendicular plane ionization of xenon atoms at incident electron energies 5, 10, 20, 30, and 40 eV above ionization potential. The TDCS calculation have been preformed within the modified distorted wave Born approximation formalism including the second order Born (SBA) amplitude. We compare the (e, 2e) TDCS result of our calculation with the very recent measurements of Nixon and Murray [Phys. Rev. A 85, 022716 (2012)] and relativistic DWBA-G results of Illarionov and Stauffer [J. Phys. B: At. Mol. Opt. Phys. 45, 225202 (2012)] and discuss the process contributing to structure seen in the differential cross section.

Few-particle quantum dynamics-comparing nonequilibrium Green functions with the generalized Kadanoff-Baym ansatz to density operator theory

NASA Astrophysics Data System (ADS)

Hermanns, S.; Balzer, K.; Bonitz, M.

2013-03-01

The nonequilibrium description of quantum systems requires, for more than two or three particles, the use of a reduced description to be numerically tractable. Two possible approaches are based on either reduced density matrices or nonequilibrium Green functions (NEGF). Both concepts are formulated in terms of hierarchies of coupled equations—the Bogoliubov-Born-Green-Kirkwood-Yvon (BBGKY) hierarchy for the reduced density operators and the Martin-Schwinger-hierarchy (MS) for the Green functions, respectively. In both cases, similar approximations are introduced to decouple the hierarchy, yet still many questions regarding the correspondence of both approaches remain open. Here we analyze this correspondence by studying the generalized Kadanoff-Baym ansatz (GKBA) that reduces the NEGF to a single-time theory. Starting from the BBGKY-hierarchy we present the approximations that are necessary to recover the GKBA result both, with Hartree-Fock propagators (HF-GKBA) and propagators in second Born approximation. To test the quality of the HF-GKBA, we study the dynamics of a 4-electron Hubbard nanocluster starting from a strong nonequilibrium initial state and compare to exact results and the Wang-Cassing approximation to the BBGKY hierarchy presented recently by Akbari et al. [1].

Ab initio design of laser pulses to control molecular motion

NASA Astrophysics Data System (ADS)

Balint-Kurti, Gabriel; Ren, Qinghua; Manby, Frederick; Artamonov, Maxim; Ho, Tak-San; Rabitz, Herschel; Zou, Shiyang; Singh, Harjinder

2007-03-01

Our recent attempts to design laser pulses entirely theoretically, in a quantitative and accurate manner, so as to fully understand the underlying mechanisms active in the control process will be outlined. We have developed a new Born-Oppenheimer like separation called the electric-nuclear Born-Oppenheimer (ENBO) approximation. In this approximation variations of both the nuclear geometry and of the external electric field are assumed to be slow compared with the speed at which the electronic degrees of freedom respond to these changes. This assumption permits the generation of a potential energy surface that depends not only on the relative geometry of the nuclei, but also on the electric field strength and on the orientation of the molecule with respect to the electric field. The range of validity of the ENBO approximation is discussed. Optimal control theory is used along with the ENBO approximation to design laser pulses for exciting vibrational and rotational motion in H2 and CO molecules. Progress on other applications, including controlling photodissociation processes, isotope separation, stabilization of molecular Bose-Einstein condensates as well as applications to biological molecules also be presented. *Support acknowledged from EPSRC.

Crystal Structure of a Modulated Composite Structure with Two Subsystems: Ba 1.1064CoO 3

NASA Astrophysics Data System (ADS)

El Abed, A.; Elqebbaj, S. E.; Zakhour, M.; Champeaux, M.; Perez-Mato, J. M.; Darriet, J.

2001-11-01

The structure of Ba1.1064CoO3 has been solved in the (3+1)-dimensional formalism. The structure is described as a modulated chain composite with two subsystems, [CoO3] and [Ba], respectively. The superspace group is R-3m(00γ)0s with a=9.8842(20) Å, c=2.4785(12) Å, and q=0.5532(4) c* (Z=3). A saw-tooth function was used to model both the occupational and displacive modulations. Each atomic saw-tooth function is defined by its center ○4 along the fourth dimension, its width (Δ), and the maximum amplitude of the displacive modulation (δ). The paper describes how, as a first approximation, the columns (CoO3) can be mainly described by a single free parameter, based on the height difference of the trigonal prisms and octahedra that constitute the transition metal chains. As a result, this superspace formalism requires only a small number of variables to be refined, compared to the conventional superstructure description.

Theoretical Investigation of Half-Metallic Oxides XFeO3 (X = Sr, Ba) via Modified Becke-Johnson Potential Scheme

NASA Astrophysics Data System (ADS)

Maqsood, Saba; Rashid, Muhammad; Din, Fasih Ud; Saddique, M. Bilal; Laref, A.

2018-03-01

The cubic XFeO3 (X = Sr, Ba) perovskite oxides are studied for their thermodynamic stability in the ferromagnetic phase by using density functional theory calculations. We also explore the elastic properties of these compounds in terms of elastic constants C ij, bulk modulus B, shear modulus G, anisotropy factor A, Poisson's ratio ν and the B/ G ratio. The electronic properties are examined to elucidate the magnetic order, and the thermoelectric properties of XFeO3 (X = Sr, Ba) materials are also presented. The modified Becke-Johnson local density approximation scheme has been used to compute the electronic band structure and density of states, which show that these materials are half-metallic ferromagnetic. We study the magnetic properties by computing the crystal field energy (ΔCF), John-Teller energy (ΔJT) and the exchange splitting energies Δx( d) and Δx( pd). Our results indicate that strong hybridization causes a decrease in the magnetic moment of Fe, which then produces permanent magnetic moments in the nonmagnetic sites.

Recovery of brain abscess-induced stuttering after neurosurgical intervention.

PubMed

Sudo, Daisuke; Doutake, Youichi; Yokota, Hidenori; Watanabe, Eiju

2018-05-12

Stuttering occurs in approximately 5% of all children and 1% of adults. One type, neurogenic stuttering, is usually attributable to strokes or other structural damages to the brain areas that are responsible for language fluency. Here, we present the first case of neurogenic stuttering caused by a brain abscess. The patient was a 60-year-old man admitted for a seizure and administered an anticonvulsant, after which he began stuttering. MRI revealed a brain abscess in the left frontal lobe that extended to the dorsolateral prefrontal cortex (BA (Brodmann's area) 9 and 46), frontal eye field (BA 8) and premotor cortex and supplementary motor area (BA 6). After neurosurgical drainage and antibiotic treatment, the symptoms had resolved. This case is unique in that the therapeutic effects and localisation of the cause of stuttering were rapidly identified, allowing for a more accurate description of the neural circuitry related to stuttering. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Electric-field control of electronic transport properties and enhanced magnetoresistance in La0.7Sr0.3MnO3/0.5BaZr0.2Ti0.8O3-0.5Ba0.7Ca0.3TiO3 lead-free multiferroic structures

NASA Astrophysics Data System (ADS)

Yan, Jian-Min; Gao, Guan-Yin; Liu, Yu-Kuai; Wang, Fei-Fei; Zheng, Ren-Kui

2017-10-01

We report the fabrication of lead-free multiferroic structures by depositing ferromagnetic La0.7Sr0.3MnO3 (LSMO) polycrystalline films on polished 0.5BaZr0.2Ti0.8O3-0.5Ba0.7Ca0.3TiO3 (BZT-BCT) piezoelectric ceramic substrates. By applying electric fields to the BZT-BCT along the thickness direction, the resistivity of LSMO films can be effectively manipulated via the piezoelectric strain of the BZT-BCT. Moreover, the LSMO polycrystalline films exhibit almost temperature independent and significantly enhanced magnetoresistance (MR) below TC. At T = 2 K and H = 8 T, the MR of polycrystalline films is approximately two orders of magnitude higher than that of LSMO epitaxial films grown on (LaAlO3)0.3(SrAl1/2Ta1/2O3)0.7 single-crystal substrates. The enhanced MR mainly results from the spin-polarized tunneling of charge carriers across grain boundaries. The LSMO/BZT-BCT structures with electric-field controllable modulation of resistivity and enhanced MR effect may have potential applications in low-energy consumption and environmentally friendly electronic devices.

The Electronic Structures and Optical Properties of Alkaline-Earth Metals Doped Anatase TiO2: A Comparative Study of Screened Hybrid Functional and Generalized Gradient Approximation

PubMed Central

Ma, Jin-Gang; Zhang, Cai-Rong; Gong, Ji-Jun; Wu, You-Zhi; Kou, Sheng-Zhong; Yang, Hua; Chen, Yu-Hong; Liu, Zi-Jiang; Chen, Hong-Shan

2015-01-01

Alkaline-earth metallic dopant can improve the performance of anatase TiO2 in photocatalysis and solar cells. Aiming to understand doping mechanisms, the dopant formation energies, electronic structures, and optical properties for Be, Mg, Ca, Sr, and Ba doped anatase TiO2 are investigated by using density functional theory calculations with the HSE06 and PBE functionals. By combining our results with those of previous studies, the HSE06 functional provides a better description of electronic structures. The calculated formation energies indicate that the substitution of a lattice Ti with an AEM atom is energetically favorable under O-rich growth conditions. The electronic structures suggest that, AEM dopants shift the valence bands (VBs) to higher energy, and the dopant-state energies for the cases of Ca, Sr, and Ba are quite higher than Fermi levels, while the Be and Mg dopants result into the spin polarized gap states near the top of VBs. The components of VBs and dopant-states support that the AEM dopants are active in inter-band transitions with lower energy excitations. As to optical properties, Ca/Sr/Ba are more effective than Be/Mg to enhance absorbance in visible region, but the Be/Mg are superior to Ca/Sr/Ba for the absorbance improvement in near-IR region. PMID:28793520

The Electronic Structures and Optical Properties of Alkaline-Earth Metals Doped Anatase TiO2: A Comparative Study of Screened Hybrid Functional and Generalized Gradient Approximation.

PubMed

Ma, Jin-Gang; Zhang, Cai-Rong; Gong, Ji-Jun; Wu, You-Zhi; Kou, Sheng-Zhong; Yang, Hua; Chen, Yu-Hong; Liu, Zi-Jiang; Chen, Hong-Shan

2015-08-24

Alkaline-earth metallic dopant can improve the performance of anatase TiO2 in photocatalysis and solar cells. Aiming to understand doping mechanisms, the dopant formation energies, electronic structures, and optical properties for Be, Mg, Ca, Sr, and Ba doped anatase TiO2 are investigated by using density functional theory calculations with the HSE06 and PBE functionals. By combining our results with those of previous studies, the HSE06 functional provides a better description of electronic structures. The calculated formation energies indicate that the substitution of a lattice Ti with an AEM atom is energetically favorable under O-rich growth conditions. The electronic structures suggest that, AEM dopants shift the valence bands (VBs) to higher energy, and the dopant-state energies for the cases of Ca, Sr, and Ba are quite higher than Fermi levels, while the Be and Mg dopants result into the spin polarized gap states near the top of VBs. The components of VBs and dopant-states support that the AEM dopants are active in inter-band transitions with lower energy excitations. As to optical properties, Ca/Sr/Ba are more effective than Be/Mg to enhance absorbance in visible region, but the Be/Mg are superior to Ca/Sr/Ba for the absorbance improvement in near-IR region.

A Smoking Gun for Methane Hydrate Release During the Paleocene-Eocene Thermal Maximum

NASA Astrophysics Data System (ADS)

Frieling, J.; Peterse, F.; Lunt, D. J.; Bohaty, S. M.; S Sinninghe Damsté, J.; Reichart, G. J.; Sluijs, A.

2016-12-01

The Paleocene-Eocene Thermal Maximum (PETM; 56 Ma) was a period of rapid 4-5ºC global warming and a global negative carbon isotope excursion (CIE) of 3-4.5‰, signaling the input of at least 1500 Gt of δ13C-depleted carbon into the ocean-atmosphere system. Methane from submarine hydrates has long been proposed as a carbon source, but direct and indirect evidence is lacking. We generated a new high-resolution TEX86 and δ13C record from Ocean Drilling Program Site 959 in the eastern tropical Atlantic and find that initial warming preceded the PETM CIE by 10 kyr. Moreover, time-shifted cross-correlations on these new and published temperature-δ13C data imply that substantial (2-3 °C) warming lead 13C-depleted carbon injection by an average of 2-3 kyr globally. Finally, a data compilation shows that global burial fluxes of biogenic Ba approximately doubled across all depths of the ocean studied, which on PETM time scales can only be explained by significant Ba addition to the oceans. Submarine hydrates are Ba-rich and require warming to dissociate. The simplest explanation for the temperature lead and Ba addition to the ocean is that methane hydrate dissociated as a response to initial warming and acted as a positive carbon cycle feedback during the PETM.

Association between severe dorsolateral prefrontal dysfunction during random number generation and earlier onset in schizophrenia.

PubMed

Koike, Shinsuke; Takizawa, Ryu; Nishimura, Yukika; Marumo, Kohei; Kinou, Masaru; Kawakubo, Yuki; Rogers, Mark A; Kasai, Kiyoto

2011-08-01

Schizophrenia involves impairment in attention, working memory and executive processes associated with prefrontal cortical function, an essential contributor of social functioning. Age at onset is a major factor for predicting social outcome in schizophrenia. In clinical settings, we need an objective assessment tool for evaluating prefrontal function and social outcome. Participants included 22 right-handed patients with schizophrenia and 40 gender- and age-matched healthy controls. We used a 52-channel near-infrared spectroscopy (NIRS) instrument to measure oxygenated haemoglobin ([oxy-Hb]) changes over the prefrontal cortex during a random number generation (RNG) task. In healthy controls, we found significant [oxy-Hb] increase in the bilateral dorsolateral (DLPFC; BA9 and BA46) and ventrolateral prefrontal cortex (VLPFC; BA44, 45 and 47). The patients with schizophrenia showed significantly smaller activation than the healthy controls in the same approximate regions. In the patient group, a smaller [oxy-Hb] increase in the right DLPFC region (BA9) was significantly correlated with earlier age at onset. NIRS can detect prefrontal cortical dysfunction associated with an executive task, which was coupled with earlier age at onset in schizophrenia. Multichannel NIRS, a non-invasive and user-friendly instrument, may be useful in evaluating cognitive function and social outcome in clinical settings in psychiatry. Copyright © 2011 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

Improved Dielectric Properties via Mechano-Chemical Activation in Ba0.80Pb0.20TiO3 Ceramics

NASA Astrophysics Data System (ADS)

Kumar, Parveen; Rani, Renu; Singh, Sangeeta; Juneja, J. K.; Prakash, Chandra; Raina, K. K.

2011-12-01

The present report is about the preparation and dielectric properties of commonly used Ba0.80Pb0.20TiO3 (BPT) ferroelectric ceramic via Mechano-Chemical Activation (MCA). Results were compared by the BPT sample prepared by conventional solid state method. The BPT sample prepared via MCA technique was found to have decreased tetragonality, dielectric constant value (ɛRT = 450 and ɛmax = 6170) approximately double the value for sample prepared by conventional method (ɛRT = 260 and ɛmax = 3275). Also, the sample prepared by MCA was found to be less frequency dependent. Thus, the BPT sample prepared via MCA is more suitable for capacitor applications requiring lesser frequency dependency than the conventionally prepared BPT sample.

First principles predictions of electronic and elastic properties of BaPb2As2 in the ThCr2Si2-type structure

NASA Astrophysics Data System (ADS)

Bourourou, Y.; Amari, S.; Yahiaoui, I. E.; Bouhafs, B.

2018-01-01

A first-principles approach is used to predicts the electronic and elastic properties of BaPb2As2 superconductor compound, using full-potential linearized augmented plane wave plus local orbitals (FP-L/APW+lo) scheme within the local density approximation LDA. The calculated equilibrium structural parameter a agree well with the experiment while the c/a ratio is far away from the experimental result. The band structure, density of states, together with the charge density and chemical bonding are discussed. The calculated elastic constants for our compound indicate that it is mechanically stable at ambient pressure. Polycrystalline elastic moduli (Young's, Bulk, shear Modulus and the Poisson's ratio) were calculated according to the Voigte-Reusse-Hill (VRH) average.

Pulsating aurora induced by upper atmospheric barium releases

NASA Technical Reports Server (NTRS)

Deehr, C.; Romick, G.

1977-01-01

The paper reports the apparent generation of pulsating aurora by explosive releases of barium vapor near 250 km altitude. This effect occurred only when the explosions were in the path of precipitating electrons associated with the visible aurora. Each explosive charge was a standard 1.5 kg thermite mixture of Ba and CuO with an excess of Ba metal which was vaporized and dispersed by the thermite explosion. Traces of Sr, Na, and Li were added to some of the charges, and monitoring was achieved by ground-based spectrophotometric observations. On March 28, 1976, an increase in emission at 5577 A and at 4278 A was observed in association with the first two bursts, these emissions pulsating with roughly a 10 sec period for approximately 60 to 100 sec after the burst.

Eastern Equine Encephalitis

MedlinePlus

... EEE is one of the most severe mosquito-transmitted diseases in the United States with approximately 33% mortality ... Emerging and Zoonotic Infectious Diseases (NCEZID) Division of Vector-Borne Diseases (DVBD) Email Recommend Tweet YouTube Instagram Listen Watch ...

Electron impact excitation of H2 - Rydberg band systems and the benchmark dissociative cross section for H Lyman-alpha

NASA Technical Reports Server (NTRS)

Shemansky, D. E.; Hall, D. T.; Ajello, J. M.

1985-01-01

The cross sections sigma R 1 (2p) for excitation of H Ly-alpha emission produced by electron impact on H2 is reexamined. A more accurate estimate for sigma R 1 (2p) is obtained based on Born approximation estimates of the H2 Rydberg system cross sections using measured relative excitation functions. The obtained value is (8.18 + or -1.2) x 10 to the -18th sq cm at 100 eV, a factor of 0.69 below the value universally applied to cross section measurements over the past decade. Cross sections for the H2 Rydberg systems fixed in magnitude by the Born approximation have also been obtained using experimentally determined excitation functions. Accurate analytic expressions for these cross sections allow the direct calculation of rate coefficients.

Quantitative assessment of submicron scale anisotropy in tissue multifractality by scattering Mueller matrix in the framework of Born approximation

NASA Astrophysics Data System (ADS)

Das, Nandan Kumar; Dey, Rajib; Chakraborty, Semanti; Panigrahi, Prasanta K.; Meglinski, Igor; Ghosh, Nirmalya

2018-04-01

A number of tissue-like disordered media exhibit local anisotropy of scattering in the scaling behavior. Scaling behavior contains wealth of fractal or multifractal properties. We demonstrate that the spatial dielectric fluctuations in a sample of biological tissue exhibit multifractal anisotropy. Multifractal anisotropy encoded in the wavelength variation of the light scattering Mueller matrix and manifesting as an intriguing spectral diattenuation effect. We developed an inverse method for the quantitative assessment of the multifractal anisotropy. The method is based on the processing of relevant Mueller matrix elements in Fourier domain by using Born approximation, followed by the multifractal analysis. The approach promises for probing subtle micro-structural changes in biological tissues associated with the cancer and precancer, as well as for non-destructive characterization of a wide range of scattering materials.

Single electron impact ionization of the methane molecule

NASA Astrophysics Data System (ADS)

Bouamoud, Mammar; Sahlaoui, Mohammed; Benmansour, Nour El Houda; Atomic and Molecular Collisions Team

2014-10-01

Triply differential cross sections (TDCS) results of electron-impact ionization of the inner 2a1 molecular orbital of CH4 are presented in the framework of the Second Born Approximation and compared with the experimental data performed in coplanar asymmetric geometry. The cross sections are averaged on the random orientations of the molecular target for accurate comparison with experiments and are compared also with the theoretical calculations of the Three Coulomb wave (3CW) model. Our results are in good agreement with experiments and 3CW results in the binary peak. In contrast the Second Born Approximation yields a significant higher values compared to the 3CW results for the recoil peak and seems to describe suitably the recoil region where higher order effects can occur with the participation of the recoiling ion in the collision process.

Precise calculations in simulations of the interaction of low energy neutrons with nano-dispersed media

NASA Astrophysics Data System (ADS)

Artem'ev, V. A.; Nezvanov, A. Yu.; Nesvizhevsky, V. V.

2016-01-01

We discuss properties of the interaction of slow neutrons with nano-dispersed media and their application for neutron reflectors. In order to increase the accuracy of model simulation of the interaction of neutrons with nanopowders, we perform precise quantum mechanical calculation of potential scattering of neutrons on single nanoparticles using the method of phase functions. We compare results of precise calculations with those performed within first Born approximation for nanodiamonds with the radius of 2-5 nm and for neutron energies 3 × 10-7-10-3 eV. Born approximation overestimates the probability of scattering to large angles, while the accuracy of evaluation of integral characteristics (cross sections, albedo) is acceptable. Using Monte-Carlo method, we calculate albedo of neutrons from different layers of piled up diamond nanopowder.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rani, Jyoti; Yadav, K.L., E-mail: klyadav35@yahoo.com; Prakash, Satya

Highlights: • Spinel–perovskite xCoFe{sub 2}O{sub 4}–(1 − x)(0.5Ba(Zr{sub 0.2}Ti{sub 0.8})O{sub 3}–0.5(Ba{sub 0.7}Ca{sub 0.3})TiO{sub 3}) composites have been synthesized by solid state reaction method. • Two anomalies in dielectric constant have been identified, and the composites show relaxor behaviour. • The magnetic properties of the composites improve with increasing concentration of CoFe{sub 2}O{sub 4}. • Enhanced magnetodielectric effect is found, and magnetoelectric coupling has been confirmed by Δϵ ∼ γM{sup 2} relation. • Optical band gap energy of these composites has been reported for the first time. - Abstract: xCoFe{sub 2}O{sub 4}–(1 − x)(0.5Ba(Zr{sub 0.2}Ti{sub 0.8})O{sub 3}–0.5(Ba{sub 0.7}Ca{sub 0.3})TiO{sub 3}) compositesmore » with x = 0.1, 0.2, 0.3 and 0.4 have been synthesized by solid state reaction method. X-ray diffraction analysis and field emission secondary electron microscopy have been used for structural and morphological analysis, respectively. The spinel CoFe{sub 2}O{sub 4} and perovskite 0.5Ba(Zr{sub 0.2}Ti{sub 0.8})O{sub 3}–0.5(Ba{sub 0.7}Ca{sub 0.3})TiO{sub 3} phase could be identified in the composites. Two anomalies in dielectric constant have been identified: first one is close to ferroelectric to paraelectric phase transition of 0.5Ba(Zr{sub 0.2}Ti{sub 0.8})O{sub 3}–0.5(Ba{sub 0.7}Ca{sub 0.3})TiO{sub 3} ceramic and the other lies near the magnetic transition temperature of CoFe{sub 2}O{sub 4}. There is an increase in magnetocapacitance and saturation magnetization of the composites at room temperature with increase in CoFe{sub 2}O{sub 4} content. The magnetoelectric coupling coefficient (γ) was approximated by Δϵ ∼ γM{sup 2} relation. The optical band gap energy of the composites decreases with increase in CoFe{sub 2}O{sub 4} content.« less

Probing the Site for r-Process Nucleosynthesis with Abundances of Barium and Magnesium in Extremely Metal-poor Stars.

PubMed

Tsujimoto; Shigeyama; Yoshii

2000-03-01

We suggest that if the astrophysical site for r-process nucleosynthesis in the early Galaxy is confined to a narrow mass range of Type II supernova (SN II) progenitors, with a lower mass limit of Mms=20 M middle dot in circle, a unique feature in the observed distribution of [Ba/Mg] versus [Mg/H] for extremely metal-poor stars can be adequately reproduced. We associate this feature, a bifurcation of the observed elemental ratios into two branches in the Mg abundance interval -3.7

The Distribution of Dissolved Barium from US GEOTRACES cruises in the North Atlantic and Eastern Tropical South Pacific

NASA Astrophysics Data System (ADS)

Shiller, A. M.; Grissom, K.

2014-12-01

Interest in the oceanic geochemistry of barium (Ba) stems from a variety of reasons including its use as a paleo-productivity indicator, its chemical similarity to Ra, and its utility as a water source tracer. To better constrain these uses of Ba, we have obtained trace element clean samples from both the North Atlantic and Eastern Pacific US GEOTRACES cruises. Analytical work on the Pacific samples is proceeding while work on the Atlantic samples is complete. For the Pacific, 36 stations were occupied from Peru to Tahiti. For the Atlantic, dissolved Ba was determined at 32 stations across the North Atlantic during US cruises GT10 and GT11 along the meridional transect from Lisbon to the Cape Verde Islands and the zonal transect from Cape Cod to the Mauritanian coast. In the Atlantic, the general distribution of dissolved Ba exhibits a vertical bifurcation at approximately 500 m into shallow versus deep water. The greatest variation is found on the eastern side of the basin with concentrations ranging from 35 nmol/kg at the near surface (100 m) to over 83 nmol/kg at depth. A reduction of Ba in excess of 20% compared to the average of mesopelagic depths less than 500 m is observed within the Canary Current upwelling zone east of the Cape Verde Islands and accompanied to some extent by a subsequent regeneration at depth. Below 500 m, dissolved Ba correlates well with dissolved Si, whereas the correlation with alkalinity is poor at depth and shows a decoupling above 500 m. There is evidence of hydrothermal Ba input at the TAG vent system of the Mid-Atlantic Ridge along transect GT11 as indicated by the rapid increase in the dissolved Ba below 2500 m in conjunction with increases in Fe and Mn. In addition to the hydrothermal source, a near surface (~40 m) maximum of 51 nmol/kg is found along the continental slope of North America in correspondence with a minimum surface salinity (34.75) and increased dissolved manganese indicating either fluvial or sediment input; however, a similar input is not evident along the North African continental margin. We will contrast the Atlantic distribution with the Pacific as data become available.

Chemical spray pyrolysis of Tl-Ba-Ca-Cu-O high-T(sub c) superconductors for high-field bitter magnets

NASA Technical Reports Server (NTRS)

Derochemont, L. Pierre; Zhang, John G.; Squillante, Michael R.; Hermann, A. M.; Duan, H. M.; Andrews, Robert J.; Kelliher, Warren C.

1991-01-01

The deposition of Tl-Ba-Ca-Cu-O thick films by spray pyrolyzing a Ba-Ca-Cu-O precursor film and diffusing thallium into the film to form the superconducting phase is examined. This approach was taken to reduce exposure to thallium and its health and safety hazards. The Tl-Ba-Ca-Cu-O system was selected because it has very attractive features which make it appealing to device and manufacturing engineering. Tl-Ba-Ca-Cu-O will accommodate a number of superconducting phases. This attribute makes it very forgiving to stoichiometric fluctuations in the bulk and film. It has excellent thermal and chemical stability, and appears to be relatively insensitive to chemical impurities. Oxygen is tightly bound into the systems, consequently there is no orthorhombic (conductor) to tetragonal (insulator) transition which would affect a component's lifetime. More significantly, the thallium based superconductors appear to have harder magnetic properties than the other high-Tc oxide ceramics. Estimates using magnetoresistance measurements indicate that at 77 K Tl2Ba2CaCu2O10 will have an upper critical field, H(sub c2) fo 26 Tesla for applied fields parallel to the c-axis and approximately 1000 Tesla for fields oriented in the a-b plane. Results to date have shown that superconducting films can be reproducibly deposited on 100 oriented MgO substrates. One film had a zero resistance temperature of 111.5 K. Furthermore, x ray diffraction analysis of the films showed preferential c-axis orientation parallel to the plane of the substrate. These results have now made it possible to consider the manufacture of a superconducting tape wire which can be configured into a topology useful for high-field magnet designs. The research which leads to the preparation of these films and plans for further development are reviewed.

Diet structure, butyric acid, and fermentable carbohydrates influence growth performance, gut morphology, and cecal fermentation characteristics in broilers.

PubMed

Qaisrani, S N; van Krimpen, M M; Kwakkel, R P; Verstegen, M W A; Hendriks, W H

2015-09-01

An experiment with 288 male (Ross 308) 1-d-old broilers was conducted to test the hypothesis that a coarse diet supplemented with butyric acid (BA) and fermentable carbohydrates (FC) improves performance of broilers with a poorly digestible protein source. The interaction effects of diet structure (fine or coarse), FC supplementation (with or without), and BA supplementation (with or without) in a poorly digestible diet based on rapeseed meal (RSM) were tested in a factorial arrangement of 8 (2×2×2) dietary treatments. The coarseness of the diet affected feed intake (FI) (P<0.001), BW gain (P=0.001), and the feed conversion ratio (FCR) (P=0.001) positively. Broilers fed the coarse diets had, on average, 14% heavier gizzards and 11, 7, 5, and 6% lower relative empty weights of the crop, duodenum, jejunum, and ileum, respectively, compared with those fed the fine diets. Dietary coarseness resulted in, on average, 6% greater ileal protein digestibility, 20% lower gizzard pH, 19% greater villus height, 18% lower crypt depth, and 23% reduced cecal branched chain fatty acids (BCFA) compared with chickens fed the fine diets. Broilers fed BA-supplemented diets had an improved FCR (P=0.004) and decreased crypt depth (P<0.001) compared with those fed diets without BA. Fermentable carbohydrate supplementation did not influence growth performance, gut development, or contents of total BCFA and total biogenic amines in the cecal digesta (P>0.05). Supplementation with FC, however, decreased the cecal concentration of spermine by approximately 31% compared with broilers fed diets without FC (P=0.002). In conclusion, feeding a coarse diet supplemented with BA improved performance of broilers fed a diet containing a poorly digestible protein source. The negative effects of a poorly digestible protein source can thus be partly counterbalanced by coarse grinding and BA supplementation in the diet. © The Author 2015. Published by Oxford University Press on behalf of Poultry Science Association.

Diet structure, butyric acid, and fermentable carbohydrates influence growth performance, gut morphology, and cecal fermentation characteristics in broilers

PubMed Central

Qaisrani, S. N.; van Krimpen, M. M.; Kwakkel, R. P.; Verstegen, M. W. A.; Hendriks, W. H.

2015-01-01

An experiment with 288 male (Ross 308) 1-d-old broilers was conducted to test the hypothesis that a coarse diet supplemented with butyric acid (BA) and fermentable carbohydrates (FC) improves performance of broilers with a poorly digestible protein source. The interaction effects of diet structure (fine or coarse), FC supplementation (with or without), and BA supplementation (with or without) in a poorly digestible diet based on rapeseed meal (RSM) were tested in a factorial arrangement of 8 (2 × 2 × 2) dietary treatments. The coarseness of the diet affected feed intake (FI) (P < 0.001), BW gain (P = 0.001), and the feed conversion ratio (FCR) (P = 0.001) positively. Broilers fed the coarse diets had, on average, 14% heavier gizzards and 11, 7, 5, and 6% lower relative empty weights of the crop, duodenum, jejunum, and ileum, respectively, compared with those fed the fine diets. Dietary coarseness resulted in, on average, 6% greater ileal protein digestibility, 20% lower gizzard pH, 19% greater villus height, 18% lower crypt depth, and 23% reduced cecal branched chain fatty acids (BCFA) compared with chickens fed the fine diets. Broilers fed BA-supplemented diets had an improved FCR (P = 0.004) and decreased crypt depth (P < 0.001) compared with those fed diets without BA. Fermentable carbohydrate supplementation did not influence growth performance, gut development, or contents of total BCFA and total biogenic amines in the cecal digesta (P > 0.05). Supplementation with FC, however, decreased the cecal concentration of spermine by approximately 31% compared with broilers fed diets without FC (P = 0.002). In conclusion, feeding a coarse diet supplemented with BA improved performance of broilers fed a diet containing a poorly digestible protein source. The negative effects of a poorly digestible protein source can thus be partly counterbalanced by coarse grinding and BA supplementation in the diet. PMID:26175052

Ion exchange of H+, Na+, Mg2+, Ca2+, Mn2+, and Ba2+, on wood pulp

Treesearch

Alan W. Rudie; Alan Ball; Narendra Patel

2006-01-01

Ion exchange selectivity coefficients were measured for the partition of metals between solution and pulp fibers. The method accurately models the ion exchange isotherms for all cation pairs evaluated and is accurate up to approximately 0.05 molar concentrations. Selectivity coefficients were determined for calcium and magnesium with each other and with hydrogen....

The mechanism of enterohepatic circulation in the formation of gallstone disease.

PubMed

Cai, Jian-Shan; Chen, Jin-Hong

2014-11-01

Bile acids entering into enterohepatic circulating are primary acids synthesized from cholesterol in hepatocyte. They are secreted actively across canalicular membrane and carried in bile to gallbladder, where they are concentrated during digestion. About 95% BAs are actively taken up from the lumen of terminal ileum efficiently, leaving only approximately 5% (or approximately 0.5 g/d) in colon, and a fraction of bile acids are passively reabsorbed after a series of modifications in the human large intestine including deconjugation and oxidation of hydroxy groups. Bile salts hydrolysis and hydroxy group dehydrogenation reactions are performed by a broad spectrum of intestinal anaerobic bacteria. Next, hepatocyte reabsorbs bile acids from sinusoidal blood, which are carried to liver through portal vein via a series of transporters. Bile acids (BAs) transporters are critical for maintenance of the enterohepatic BAs circulation, where BAs exert their multiple physiological functions including stimulation of bile flow, intestinal absorption of lipophilic nutrients, solubilization, and excretion of cholesterol. Tight regulation of BA transporters via nuclear receptors (NRs) is necessary to maintain proper BA homeostasis. In conclusion, disturbances of enterohepatic circulation may account for pathogenesis of gallstones diseases, including BAs transporters and their regulatory NRs and the metabolism of intestinal bacterias, etc.

Impact of compressibility on heat transport characteristics of large terrestrial planets

NASA Astrophysics Data System (ADS)

Čížková, Hana; van den Berg, Arie; Jacobs, Michel

2017-07-01

We present heat transport characteristics for mantle convection in large terrestrial exoplanets (M ⩽ 8M⊕) . Our thermal convection model is based on a truncated anelastic liquid approximation (TALA) for compressible fluids and takes into account a selfconsistent thermodynamic description of material properties derived from mineral physics based on a multi-Einstein vibrational approach. We compare heat transport characteristics in compressible models with those obtained with incompressible models based on the classical- and extended Boussinesq approximation (BA and EBA respectively). Our scaling analysis shows that heat flux scales with effective dissipation number as Nu ∼Dieff-0.71 and with Rayleigh number as Nu ∼Raeff0.27. The surface heat flux of the BA models strongly overestimates the values from the corresponding compressible models, whereas the EBA models systematically underestimate the heat flux by ∼10%-15% with respect to a corresponding compressible case. Compressible models are also systematically warmer than the EBA models. Compressibility effects are therefore important for mantle dynamic processes, especially for large rocky exoplanets and consequently also for formation of planetary atmospheres, through outgassing, and the existence of a magnetic field, through thermal coupling of mantle and core dynamic systems.

Preparation of PVA membrane for immobilization of GOD for glucose biosensor.

PubMed

Kumar, Jitendra; D'Souza, S F

2008-03-15

A membrane was prepared using polyvinyl alcohol (PVA) with low and high degree of polymerization (DOP), acetone, benzoic acid (BA) and was cross-linked by UV treatment. Membrane composition was optimized on the basis of swelling index. Membrane prepared with 12% low DOP and 8% high DOP of PVA, 2% BA, dissolved in buffer containing 20% acetone and cross-linked with UV treatment exhibited lower swelling index. Fourier transform infrared (FTIR) study of the membranes showed appearance of a strong band at approximately 2337 cm(-1) when UV was used for cross-linking in the presence of benzoic acid. Scanning electron microscope (SEM) study revealed that membrane cross-linked with UV treatment was smoother. Glucose oxidase (GOD)-PVA membrane was associated with the dissolved oxygen (DO) probe for biosensor reading. Glucose was detected on the basis of depletion of oxygen, when immobilized GOD oxidizes glucose to gluconolactone. A wide detection range, 0.9-225 mg/dl was estimated from the linear range of calibration plot of biosensor reading. Membranes were reused for 32 reactions without significant loss of activity and stored for 30 days (approximately 90% activity) at 4 degrees C. Membranes were also used with real blood samples.

Immigration, race/ethnicity, and social and economic factors as predictors of breastfeeding initiation.

PubMed

Celi, Ann C; Rich-Edwards, Janet W; Richardson, Marcie K; Kleinman, Ken P; Gillman, Matthew W

2005-03-01

To determine the impact of immigration status as well as race/ethnicity and social and economic factors on breastfeeding initiation. Cohort. Multisite group practice in eastern Massachusetts. One thousand eight hundred twenty-nine pregnant women prospectively followed up in Project Viva. Whether the participant breastfed her infant. The overall breastfeeding initiation rate was 83%. In multivariate models that included race/ethnicity and social, economic, and demographic factors, foreign-born women were more likely to initiate breastfeeding than US-born women (odds ratio [OR], 3.2 [95% confidence interval (CI), 2.0-5.2]). In models stratified by both race/ethnicity and immigration status, and further adjusted for whether the mother herself was breastfed as an infant and the mother's parents' immigration status, US-born and foreign-born black and Hispanic women initiated breastfeeding at rates at least as high as US-born white women (US-born black vs US-born white women, OR, 1.2 [95% CI, 0.8-1.9], US-born Hispanic vs US-born white women, OR, 1.1 [95% CI, 0.6-1.9], foreign-born black vs US-born white women, OR, 2.6 [95% CI, 1.1-6.0], and foreign-born Hispanic vs US-born white women, OR, 1.8 [95% CI, 0.7-4.8]). Calculations of predicted prevalences showed that, for example, the 2.6-fold increase in odds for the foreign-born black vs US-born white women translated to an increase in probability of approximately 1.4. Higher maternal education and household income also predicted higher initiation rates. Immigration status was strongly associated with increased breastfeeding initiation in this cohort, implying that cultural factors are important in the decision to breastfeed. Immigrants of all races/ethnicities initiated breastfeeding more often than their US-born counterparts. In addition, US-born minority groups initiated breastfeeding at rates at least as high as their white counterparts, likely due in part to high levels of education and income as well as to access to a medical care system that explicitly supports breastfeeding.

Fast inverse scattering solutions using the distorted Born iterative method and the multilevel fast multipole algorithm

PubMed Central

Hesford, Andrew J.; Chew, Weng C.

2010-01-01

The distorted Born iterative method (DBIM) computes iterative solutions to nonlinear inverse scattering problems through successive linear approximations. By decomposing the scattered field into a superposition of scattering by an inhomogeneous background and by a material perturbation, large or high-contrast variations in medium properties can be imaged through iterations that are each subject to the distorted Born approximation. However, the need to repeatedly compute forward solutions still imposes a very heavy computational burden. To ameliorate this problem, the multilevel fast multipole algorithm (MLFMA) has been applied as a forward solver within the DBIM. The MLFMA computes forward solutions in linear time for volumetric scatterers. The typically regular distribution and shape of scattering elements in the inverse scattering problem allow the method to take advantage of data redundancy and reduce the computational demands of the normally expensive MLFMA setup. Additional benefits are gained by employing Kaczmarz-like iterations, where partial measurements are used to accelerate convergence. Numerical results demonstrate both the efficiency of the forward solver and the successful application of the inverse method to imaging problems with dimensions in the neighborhood of ten wavelengths. PMID:20707438

A differential equation for the Generalized Born radii.

PubMed

Fogolari, Federico; Corazza, Alessandra; Esposito, Gennaro

2013-06-28

The Generalized Born (GB) model offers a convenient way of representing electrostatics in complex macromolecules like proteins or nucleic acids. The computation of atomic GB radii is currently performed by different non-local approaches involving volume or surface integrals. Here we obtain a non-linear second-order partial differential equation for the Generalized Born radius, which may be solved using local iterative algorithms. The equation is derived under the assumption that the usual GB approximation to the reaction field obeys Laplace's equation. The equation admits as particular solutions the correct GB radii for the sphere and the plane. The tests performed on a set of 55 different proteins show an overall agreement with other reference GB models and "perfect" Poisson-Boltzmann based values.

Bond-length distributions for ions bonded to oxygen: alkali and alkaline-earth metals.

PubMed

Gagné, Olivier Charles; Hawthorne, Frank Christopher

2016-08-01

Bond-length distributions have been examined for 55 configurations of alkali-metal ions and 29 configurations of alkaline-earth-metal ions bonded to oxygen, for 4859 coordination polyhedra and 38 594 bond distances (alkali metals), and for 3038 coordination polyhedra and 24 487 bond distances (alkaline-earth metals). Bond lengths generally show a positively skewed Gaussian distribution that originates from the variation in Born repulsion and Coulomb attraction as a function of interatomic distance. The skewness and kurtosis of these distributions generally decrease with increasing coordination number of the central cation, a result of decreasing Born repulsion with increasing coordination number. We confirm the following minimum coordination numbers: ([3])Li(+), ([3])Na(+), ([4])K(+), ([4])Rb(+), ([6])Cs(+), ([3])Be(2+), ([4])Mg(2+), ([6])Ca(2+), ([6])Sr(2+) and ([6])Ba(2+), but note that some reported examples are the result of extensive dynamic and/or positional short-range disorder and are not ordered arrangements. Some distributions of bond lengths are distinctly multi-modal. This is commonly due to the occurrence of large numbers of structure refinements of a particular structure type in which a particular cation is always present, leading to an over-representation of a specific range of bond lengths. Outliers in the distributions of mean bond lengths are often associated with anomalous values of atomic displacement of the constituent cations and/or anions. For a sample of ([6])Na(+), the ratio Ueq(Na)/Ueq(bonded anions) is partially correlated with 〈([6])Na(+)-O(2-)〉 (R(2) = 0.57), suggesting that the mean bond length is correlated with vibrational/displacement characteristics of the constituent ions for a fixed coordination number. Mean bond lengths also show a weak correlation with bond-length distortion from the mean value in general, although some coordination numbers show the widest variation in mean bond length for zero distortion, e.g. Li(+) in [4]- and [6]-coordination, Na(+) in [4]- and [6]-coordination. For alkali-metal and alkaline-earth-metal ions, there is a positive correlation between cation coordination number and the grand mean incident bond-valence sum at the central cation, the values varying from 0.84 v.u. for ([5])K(+) to 1.06 v.u. for ([8])Li(+), and from 1.76 v.u. for ([7])Ba(2+) to 2.10 v.u. for ([12])Sr(2+). Bond-valence arguments suggest coordination numbers higher than [12] for K(+), Rb(+), Cs(+) and Ba(2+).

The Integral Method, a new approach to quantify bactericidal activity.

PubMed

Gottardi, Waldemar; Pfleiderer, Jörg; Nagl, Markus

2015-08-01

The bactericidal activity (BA) of antimicrobial agents is generally derived from the results of killing assays. A reliable quantitative characterization and particularly a comparison of these substances, however, are impossible with this information. We here propose a new method that takes into account the course of the complete killing curve for assaying BA and that allows a clear-cut quantitative comparison of antimicrobial agents with only one number. The new Integral Method, based on the reciprocal area below the killing curve, reliably calculates an average BA [log10 CFU/min] and, by implementation of the agent's concentration C, the average specific bactericidal activity SBA=BA/C [log10 CFU/min/mM]. Based on experimental killing data, the pertaining BA and SBA values of exemplary active halogen compounds were established, allowing quantitative assertions. N-chlorotaurine (NCT), chloramine T (CAT), monochloramine (NH2Cl), and iodine (I2) showed extremely diverging SBA values of 0.0020±0.0005, 1.11±0.15, 3.49±0.22, and 291±137log10 CFU/min/mM, respectively, against Staphylococcus aureus. This immediately demonstrates an approximately 550-fold stronger activity of CAT, 1730-fold of NH2Cl, and 150,000-fold of I2 compared to NCT. The inferred quantitative assertions and conclusions prove the new method suitable for characterizing bactericidal activity. Its application comprises the effect of defined agents on various bacteria, the consequence of temperature shifts, the influence of varying drug structure, dose-effect relationships, ranking of isosteric agents, comparison of competing commercial antimicrobial formulations, and the effect of additives. Copyright © 2015 Elsevier B.V. All rights reserved.

Simulating the spread of malaria using a generic transmission model for mosquito-borne infectious diseases

NASA Astrophysics Data System (ADS)

Kon, Cynthia Mui Lian; Labadin, Jane

2016-06-01

Malaria is a critical infection caused by parasites which are spread to humans through mosquito bites. Approximately half of the world's population is in peril of getting infected by malaria. Mosquito-borne diseases have a standard behavior where they are transmitted in the same manner, only through vector mosquito. Taking this into account, a generic spatial-temporal model for transmission of multiple mosquito-borne diseases had been formulated. Our interest is to reproduce the actual cases of different mosquito-borne diseases using the generic model and then predict future cases so as to improve control and target measures competently. In this paper, we utilize notified weekly malaria cases in four districts in Sarawak, Malaysia, namely Kapit, Song, Belaga and Marudi. The actual cases for 36 weeks, which is from week 39 in 2012 to week 22 in 2013, are compared with simulations of the generic spatial-temporal transmission mosquito-borne diseases model. We observe that the simulation results display corresponding result to the actual malaria cases in the four districts.

Multigrid based First-Principles Molecular Dynamics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fattebert, Jean-Luc; Osei-Kuffuor, Daniel; Dunn, Ian

2017-06-01

MGmol ls a First-Principles Molecular Dynamics code. It relies on the Born-Oppenheimer approximation and models the electronic structure using Density Functional Theory, either LDA or PBE. Norm-conserving pseudopotentials are used to model atomic cores.

Spin fluctuations and superconductivity in a 3D tight-binding model for BaFe2As2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Graser, Siegfried; Kemper, Alexander F; Maier, Thomas A

2010-01-01

Despite the wealth of experimental data on the Fe-pnictide compounds of the KFe2As2 type, K=Ba, Ca, or Sr, the main theoretical work based on multiorbital tight-binding models has been restricted so far to the study of the related 1111 compounds. This can be ascribed to the more three-dimensional electronic structure found by ab initio calculations for the 122 materials, making this system less amenable to model development. In addition, the more complicated Brillouin zone BZ of the body-centered tetragonal symmetry does not allow a straightforward unfolding of the electronic band structure into an effective 1Fe/unit cell BZ. Here we presentmore » an effective five-orbital tight-binding fit of the full density functional theory band structure for BaFe2As2 including the kz dispersions. We compare the five-orbital spin fluctuation model to one previously studied for LaOFeAs and calculate the random-phase approximation enhanced susceptibility. Using the fluctuation ex- change approximation to determine the leading pairing instability, we then examine the differences between a strictly two-dimensional model calculation over a single kz cut of the BZ and a completely three-dimensional approach. We find pairing states quite similar to the 1111 materials, with generic quasi-isotropic pairing on the hole sheets and nodal states on the electron sheets at kz=0, which however are gapped as the system is hole doped. On the other hand, a substantial kz dependence of the order parameter remains, with most of the pairing strength deriving from processes near kz=?. These states exhibit a tendency for an enhanced anisotropy on the hole sheets and a reduced anisotropy on the electron sheets near the top of the BZ.« less

Feasibility of event-related potential (ERP) biomarker use to study effects of mother's voice exposure on speech sound differentiation of preterm infants.

PubMed

D Chorna, Olena; L Hamm, Ellyn; Shrivastava, Hemang; Maitre, Nathalie L

2018-01-01

Atypical maturation of auditory neural processing contributes to preterm-born infants' language delays. Event-related potential (ERP) measurement of speech-sound differentiation might fill a gap in treatment-response biomarkers to auditory interventions. We evaluated whether these markers could measure treatment effects in a quasi-randomized prospective study. Hospitalized preterm infants in passive or active, suck-contingent mother's voice exposure groups were not different at baseline. Post-intervention, the active group had greater increases in/du/-/gu/differentiation in left frontal and temporal regions. Infants with brain injury had lower baseline/ba/-/ga/and/du/-/gu/differentiation than those without. ERP provides valid discriminative, responsive, and predictive biomarkers of infant speech-sound differentiation.

Attaining genetic height potential: Analysis of height outcomes from the ANSWER Program in children treated with growth hormone over 5 years.

PubMed

Ross, Judith L; Lee, Peter A; Gut, Robert; Germak, John

2015-12-01

This study aimed to assess attainment of genetic height potential after long-term growth hormone (GH) treatment in GH-naïve children diagnosed with isolated growth hormone deficiency (IGHD), multiple pituitary hormone deficiency (MPHD), born small for gestational age (SGA), or idiopathic short stature (ISS) enrolled in the American Norditropin® Web-enabled Research (ANSWER) Program. Children with IGHD (n=2884), MPHD (n=200), SGA (n=481), or ISS (n=733) with baseline height standard deviation score (HSDS)≤-2 were assessed over 5 years of GH treatment for mean HSDS, change in HSDS (ΔHSDS), and corrected HSDS (HSDS-target HSDS). Mean HSDS and corrected HSDS significantly increased to close to target height across all diagnostic groups after 5 years of GH treatment (P<0.0001). ∆HSDS at year 5 increased for all groups (IGHD: 1.8; MPHD: 2.1; SGA: 1.8; ISS: 1.6). Among patients who continued GH for 5 years, mean insulin-like growth factor-I (IGF-I) SDS increased to within normal range across all groups. Body mass index (BMI) SDS remained relatively stable in all diagnostic groups. Bone age (BA) increased, and the mean BA to chronological age (BA/CA) ratio reached or approached 1 across diagnostic groups over 5 years of GH treatment. Long-term GH therapy resulted in a significant increase in mean HSDS and corrected HSDS from baseline values in all diagnostic groups. The observed increase in mean corrected HSDS is consistent with growth that approached the patients' genetic height potential, although complete height gains will be evaluated at the attainment of final height. Copyright © 2015 Elsevier Ltd. All rights reserved.

Boson peak of alkali and alkaline earth silicate glasses: influence of the nature and size of the network-modifying cation.

PubMed

Richet, Nicolas F

2012-01-21

The influence of the size of the alkaline earth cation on the boson peak of binary metasilicate glasses, MSiO(3) (M = Mg, Ca, Sr, Ba), has been investigated from vibrational densities of states determined by inversion of low-temperature heat capacities. As given both by C(p)/T(3) and g(ω)/ω(2), the intensity of the boson peak undergoes a 7-fold increase from Mg to Ba, whereas its temperature and frequency correlatively decrease from 18 to 10 K and from 100 to 20 cm(-1), respectively. The boson peak results from a combination of librations of SiO(4) tetrahedra and localized vibrations of network-modifying cations with non-bridging oxygens whose contribution increases markedly with the ionic radius of the alkaline earth. As a function of ionic radii, the intensity for Sr and Ba varies in the same way as previously found for alkali metasilicate glasses. The localized vibrations involving alkali and heavy alkaline earth cations appear to be insensitive to the overall glass structure. Although the new data are coherent with an almost linear relationship between the temperature of the boson peak and transverse sound velocity, pure SiO(2) and SiO(2)-rich glasses make marked exceptions to this trend because of the weak transverse character of SiO(4) librations. Finally, the universality of the calorimetric boson peak is again borne out because all data for silicate glasses collapse on the same master curve when plotted in a reduced form (C(P)∕/T(3))/(C(P)/T(3))(b) vs. T/T(b). © 2012 American Institute of Physics

120 DEG C Cure, Durable, Corrosion Protection Powder Coatings for Temperature Sensitive Substrates

DTIC Science & Technology

2005-01-28

Extrudate was passed through water-cooled pinch-rolls and collected onto a stainless steel belt; from exit of the extruder, approximately 60 sec... stainless steel belt; from exit of the extruder, approximately 60 sec. was required to reach ambient temperature. Production scale processing at...inherently free from volatile organic compounds, chromates, and hazardous air pollutants. Relative to the incumbent solvent-borne urethane paint

Prevalence of small for gestational age (SGA) and short stature in children born SGA who qualify for growth hormone treatment at 3 years of age: Population-based study.

PubMed

Fujita, Kaori; Nagasaka, Miwako; Iwatani, Sota; Koda, Tsubasa; Kurokawa, Daisuke; Yamana, Keiji; Nishida, Kosuke; Taniguchi-Ikeda, Mariko; Uchino, Eiko; Shirai, Chika; Iijima, Kazumoto; Morioka, Ichiro

2016-05-01

To treat children born small for gestational age (SGA) with severe short stature, treatment with growth hormone (GH) has been approved in the USA, Europe, and Japan, but no population-based studies have reported their prevalence. The aims of this study were to investigate the prevalence of SGA and short stature in children born SGA who qualify for GH treatment at 3 years of age in a Japanese population. A population-based study was conducted in Kobe, Japan with 27 228 infants who were born between 2006 and 2008 and followed until 3 years of age. Prevalence of birthweight (BW) or birth length (BL) ≤ -2.0 standard deviation scores (SDS) for gestational age (GA; definition of SGA) was calculated. Short children born SGA who qualify for GH treatment at 3 years of age were estimated using the following criteria: BW and BL below the 10th percentile for GA, BW or BL ≤ -2.0 SDS for GA, and 2.5 SDS below the mean height for age. The prevalence of SGA was 3.5%. The estimated prevalence of short stature in children born SGA who met the criteria for GH treatment was 0.06%. The prevalence in infants born <34 weeks (0.39%) was significantly higher than that in infants born 34-41 weeks GA (0.05%, P = 0.02). The prevalence of SGA and short stature in children born SGA who qualify for GH treatment is approximately 1 of 30 infants and 1 of 1800 children, respectively. The risk is increased when children are born <34 weeks GA. © 2015 Japan Pediatric Society.

The behavior and concentration of CO2 in the suboceanic mantle: Inferences from undegassed ocean ridge and ocean island basalts

NASA Astrophysics Data System (ADS)

Michael, Peter J.; Graham, David W.

2015-11-01

In order to better determine the behavior of CO2 relative to incompatible elements, and improve the accuracy of mantle CO2 concentration and flux estimates, we determined CO2 glass and vesicle concentrations, plus trace element contents for fifty-one ultradepleted mid-ocean ridge basalt (MORB) glasses from the global mid-ocean ridge system. Fifteen contained no vesicles and were volatile undersaturated for their depth of eruption. Thirty-six contained vesicles and/or were slightly oversaturated, and so may not have retained all of their CO2. If this latter group lost some bubbles during emplacement, then CO2/Ba calculated for the undersaturated group alone is the most reliable and uniform ratio at 98 ± 10, and CO2/Nb is 283 ± 32. If the oversaturated MORBs did not lose bubbles, then CO2/Nb is the most uniform ratio within the entire suite of ultradepleted MORBs at 291 ± 132, while CO2/Ba decreases with increasing incompatible element enrichment. Additional constraints on CO2/Ba and CO2/Nb ratios are provided by published estimates of CO2 contents in highly vesicular enriched basalts that may have retained their vesicles e.g., the Mid-Atlantic Ridge "popping rocks", and from olivine-hosted melt inclusions in normal MORBs. As incompatible element enrichment increases, CO2/Nb increases progressively from 283 ± 32 in ultradepleted MORBs to 603 ± 69 in depleted melt inclusions to 936 ± 132 in enriched, vesicular basalts. In contrast, CO2/Ba is nearly uniform in these sample suites at 98 ± 10, 106 ± 24 and 111 ± 11 respectively. This suggests that Ba is the best proxy for estimating CO2 contents of MORBs, with an overall average CO2/Ba = 105 ± 9. Atlantic, Pacific and Indian basalts have similar values. Gakkel Ridge has lower CO2/Ba because of anomalously high Ba, and is not included in our global averages. Using the CO2/Ba ratio and published compilations of trace elements in average MORBs, the CO2 concentration of a primary, average MORB is 2085+ 473/- 427 ppm, while primary NMORB magmas (> 500 km from ocean island hotspots) have 1840 ppm CO2. The annual flux of CO2 from mid-ocean ridges is 1.25 ± 0.16 × 1014 g/yr, with possible values as low as 0.93 and as high as 1.61 × 1014 g/yr. This amount is equivalent to approximately 0.3% of the anthropogenic addition of CO2 to Earth's atmosphere. NMORB mantle has 183 ppm CO2 (50 ppm C) based on simple melting models and 13% melting. More realistic estimates of incompatible element concentrations in the depleted mantle that are consistent with complex melting models yield much lower estimates for CO2 in the depleted mantle: around 60-130 ppm CO2, with large uncertainties that are more related to melting models than to CO2/Ba. CO2/Ba is not correlated with isotopic or trace element ratios, but there may be systematic regional mantle variations. Iceland melt inclusions and Gakkel Ridge MORBs have lower CO2/Ba ratios, showing that these regional high Ba anomalies are not accompanied by correspondingly high CO2 concentrations.

How large are nonadiabatic effects in atomic and diatomic systems?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Yubo, E-mail: yyang173@illinois.edu, E-mail: normantubman2015@u.northwestern.edu; Tubman, Norm M., E-mail: yyang173@illinois.edu, E-mail: normantubman2015@u.northwestern.edu; Ceperley, David M.

2015-09-28

With recent developments in simulating nonadiabatic systems to high accuracy, it has become possible to determine how much energy is attributed to nuclear quantum effects beyond zero-point energy. In this work, we calculate the non-relativistic ground-state energies of atomic and molecular systems without the Born-Oppenheimer approximation. For this purpose, we utilize the fixed-node diffusion Monte Carlo method, in which the nodes depend on both the electronic and ionic positions. We report ground-state energies for all systems studied, ionization energies for the first-row atoms and atomization energies for the first-row hydrides. We find the ionization energies of the atoms to bemore » nearly independent of the Born-Oppenheimer approximation, within the accuracy of our results. The atomization energies of molecular systems, however, show small effects of the nonadiabatic coupling between electrons and nuclei.« less

Elastic and inelastic scattering of /sup 58/Ni+/sup 208/Pb at bombarding energies from 598 to 1011 MeV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beckerman, M.; Auble, R.L.; Bertrand, F.E.

1987-08-01

High-resolution measurements have been made of elastic and inelastic scattering of /sup 58/Ni+ /sup 208/Pb at four bombarding energies from 10.3 to 17.4 MeV/nucleon. The considerable inelastic strength observed for excitation energies up to at least 7 MeV is dominated by Coulomb-driven quadrupole transitions. Analyses were done using both the distorted-wave Born approximation and coupled-channels models. At the highest bombarding energies the data can be described equally well by distorted-wave Born approximations and coupled channels analyses. We find that B(E2) = 0.062 e/sup 2/b/sup 2/ for the 1.454 MeV 2/sup +/ state in /sup 58/Ni and B(E2) = 0.34 e/supmore » 2/b/sup 2/ for the 4.09 MeV 2/sup +/ state in /sup 208/Pb.« less

u d b \\xAF b \\xAF tetraquark resonances with lattice QCD potentials and the Born-Oppenheimer approximation

NASA Astrophysics Data System (ADS)

Bicudo, Pedro; Cardoso, Marco; Peters, Antje; Pflaumer, Martin; Wagner, Marc

2017-09-01

We study tetraquark resonances with lattice QCD potentials computed for a static b ¯b ¯ pair in the presence of two lighter quarks u d , the Born-Oppenheimer approximation and the emergent wave method. As a proof of concept we focus on the system with isospin I =0 , but consider different relative angular momenta l of the heavy quarks b ¯b ¯. For l =0 a bound state has already been predicted with quantum numbers I (JP)=0 (1+). Exploring various angular momenta we now compute the phase shifts and search for S and T matrix poles in the second Riemann sheet. We predict a tetraquark resonance for l =1 , decaying into two B mesons, with quantum numbers I (JP)=0 (1-) , mass m =10 57 6-4+4 MeV and decay width Γ =11 2-103+90 MeV .

How large are nonadiabatic effects in atomic and diatomic systems?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Yubo; Kylänpää, Ilkka; Tubman, Norm M.

2015-09-29

With recent developments in simulating nonadiabatic systems to high accuracy, it has become possible to determine how much energy is attributed to nuclear quantum effects beyond zero-point energy. Here, we calculate the non-relativistic ground-state energies of atomic and molecular systems without the Born-Oppenheimer approximation. For this purpose, we utilize the fixed-node diffusion Monte Carlo method, in which the nodes depend on both the electronic and ionic positions. Our report shows the ground-state energies for all systems studied, ionization energies for the first-row atoms and atomization energies for the first-row hydrides. We find the ionization energies of the atoms to bemore » nearly independent of the Born-Oppenheimer approximation, within the accuracy of our results. The atomization energies of molecular systems, however, show small effects of the nonadiabatic coupling between electrons and nuclei.« less

On proton excitation of forbidden lines in positive ions

NASA Astrophysics Data System (ADS)

Burgess, Alan; Tully, John A.

2005-08-01

The semi-classical impact parameter approximations used by Bahcall and Wolf and by Bely and Faucher, for proton excitation of electric quadrupole transitions in positive ions, both fail at high energies, giving cross sections which do not fall off correctly as constant/E. This is in contrast with the pioneering example of Seaton for Fe+13 and of Reid and Schwarz for S+3, both of whom achieve the correct functional form, but do not ensure the correct constant of proportionality. By combining the Born and semi-classical approximations one can obtain cross sections which have the full correct behaviour as E → ∞, and hence, rate coefficients which have the correct high temperature behaviour (~C/T1/2 with the correct value of C). We provide a computer program for calculating these. An error in Faucher's derivation of the Born formula is also discussed.

Born distorted-wave approximation applied to the H+ + He collisions at intermediate and high energies

NASA Astrophysics Data System (ADS)

Rahmanian, M.; Fathi, R.; Shojaei, F.

2017-11-01

The single-charge transfer process in collision of protons with helium atoms in their ground states is investigated. The model utilizes the second-order three-body Born distorted-wave approximation (BDW-3B) with correct Coulomb boundary conditions to calculate the differential and total cross sections at intermediate and high energies. The role of the passive electrons and electron-electron correlations are studied by comparing our results and the BDW-4B calculations with the complete perturbation potential. The present results are also compared with other theories, and the Thomas scattering mechanism is investigated. The obtained results are also compared with the recent experimental measurements. For the prior differential cross sections, the comparisons show better agreement with the experiments at smaller scattering angles. The agreement between the total cross sections and the BDW-4B results as well as the experimental data is good at higher impact energies.

The He+H¯→He p¯+e+ rearrangement

NASA Astrophysics Data System (ADS)

Todd, Allan C.; Armour, Edward A. G.

2006-06-01

In this paper, we present a summary of our work in progress on calculating cross sections for the He+H¯→He p¯+e+ rearrangement process in He H¯ scattering. This has involved a study of the system He p¯ within the Born-Oppenheimer (BO) approximation using the Rayleigh-Ritz variational method. This work has been reported in [A.C. Todd, E.A.G. Armour, J. Phys. B 38 (2005) 3367] and is summarised here. Similar calculations are in progress for the He+H¯ entrance channel. We intend to use the entrance channel and rearrangement channel wave functions to obtain the cross sections for the rearrangement using the distorted wave Born approximation T-matrix method described elsewhere in these proceedings [E.A.G. Armour, S. Jonsell, Y. Liu, A.C. Todd, these Proceedings, doi:10.1016/j.nimb.2006.01.049].

High-frequency Born synthetic seismograms based on coupled normal modes

USGS Publications Warehouse

Pollitz, Fred F.

2011-01-01

High-frequency and full waveform synthetic seismograms on a 3-D laterally heterogeneous earth model are simulated using the theory of coupled normal modes. The set of coupled integral equations that describe the 3-D response are simplified into a set of uncoupled integral equations by using the Born approximation to calculate scattered wavefields and the pure-path approximation to modulate the phase of incident and scattered wavefields. This depends upon a decomposition of the aspherical structure into smooth and rough components. The uncoupled integral equations are discretized and solved in the frequency domain, and time domain results are obtained by inverse Fourier transform. Examples show the utility of the normal mode approach to synthesize the seismic wavefields resulting from interaction with a combination of rough and smooth structural heterogeneities. This approach is applied to an ∼4 Hz shallow crustal wave propagation around the site of the San Andreas Fault Observatory at Depth (SAFOD).

Higher-Order Extended Lagrangian Born-Oppenheimer Molecular Dynamics for Classical Polarizable Models.

PubMed

Albaugh, Alex; Head-Gordon, Teresa; Niklasson, Anders M N

2018-02-13

Generalized extended Lagrangian Born-Oppenheimer molecular dynamics (XLBOMD) methods provide a framework for fast iteration-free simulations of models that normally require expensive electronic ground state optimizations prior to the force evaluations at every time step. XLBOMD uses dynamically driven auxiliary degrees of freedom that fluctuate about a variationally optimized ground state of an approximate "shadow" potential which approximates the true reference potential. While the requirements for such shadow potentials are well understood, constructing such potentials in practice has previously been ad hoc, and in this work, we present a systematic development of XLBOMD shadow potentials that match the reference potential to any order. We also introduce a framework for combining friction-like dissipation for the auxiliary degrees of freedom with general-order integration, a combination that was not previously possible. These developments are demonstrated with a simple fluctuating charge model and point induced dipole polarization models.

J-type Carbon Stars: A Dominant Source of 14 N-rich Presolar SiC Grains of Type AB

DOE PAGES

Liu, Nan; Stephan, Thomas; Boehnke, Patrick; ...

2017-07-21

Here, we report Mo isotopic data of 27 new presolar SiC grains, including 12 14N-rich AB ( 14N/ 15N > 440, AB2) and 15 mainstream (MS) grains, and their correlated Sr and Ba isotope ratios when available. Direct comparison of the data for the MS grains, which came from low-mass asymptotic giant branch (AGB) stars with large s-process isotope enhancements, with the AB2 grain data demonstrates that AB2 grains show near-solar isotopic compositions and lack s-process enhancements. The near-normal Sr, Mo, and Ba isotopic compositions of AB2 grains clearly exclude born-again AGB stars, where the intermediate neutron-capture process (i-process) takesmore » place, as their stellar source. On the other hand, low-mass CO novae and early R- and J-type carbon stars show 13C and 14N excesses but no s-process enhancements and are thus potential stellar sources of AB2 grains. And because both early R-type carbon stars and CO novae are rare objects, the abundant J-type carbon stars (10%–15% of all carbon stars) are thus likely to be a dominant source of AB2 grains.« less

J-type Carbon Stars: A Dominant Source of {sup 14}N-rich Presolar SiC Grains of Type AB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Nan; Nittler, Larry R.; Alexander, Conel M. O’D.

We report Mo isotopic data of 27 new presolar SiC grains, including 12 {sup 14}N-rich AB ({sup 14}N/{sup 15}N > 440, AB2) and 15 mainstream (MS) grains, and their correlated Sr and Ba isotope ratios when available. Direct comparison of the data for the MS grains, which came from low-mass asymptotic giant branch (AGB) stars with large s -process isotope enhancements, with the AB2 grain data demonstrates that AB2 grains show near-solar isotopic compositions and lack s -process enhancements. The near-normal Sr, Mo, and Ba isotopic compositions of AB2 grains clearly exclude born-again AGB stars, where the intermediate neutron-capture processmore » ( i -process) takes place, as their stellar source. On the other hand, low-mass CO novae and early R- and J-type carbon stars show {sup 13}C and {sup 14}N excesses but no s -process enhancements and are thus potential stellar sources of AB2 grains. Because both early R-type carbon stars and CO novae are rare objects, the abundant J-type carbon stars (10%–15% of all carbon stars) are thus likely to be a dominant source of AB2 grains.« less

J-type Carbon Stars: A Dominant Source of 14 N-rich Presolar SiC Grains of Type AB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Nan; Stephan, Thomas; Boehnke, Patrick

Here, we report Mo isotopic data of 27 new presolar SiC grains, including 12 14N-rich AB ( 14N/ 15N > 440, AB2) and 15 mainstream (MS) grains, and their correlated Sr and Ba isotope ratios when available. Direct comparison of the data for the MS grains, which came from low-mass asymptotic giant branch (AGB) stars with large s-process isotope enhancements, with the AB2 grain data demonstrates that AB2 grains show near-solar isotopic compositions and lack s-process enhancements. The near-normal Sr, Mo, and Ba isotopic compositions of AB2 grains clearly exclude born-again AGB stars, where the intermediate neutron-capture process (i-process) takesmore » place, as their stellar source. On the other hand, low-mass CO novae and early R- and J-type carbon stars show 13C and 14N excesses but no s-process enhancements and are thus potential stellar sources of AB2 grains. And because both early R-type carbon stars and CO novae are rare objects, the abundant J-type carbon stars (10%–15% of all carbon stars) are thus likely to be a dominant source of AB2 grains.« less

J-type Carbon Stars: A Dominant Source of 14 N-rich Presolar SiC Grains of Type AB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Nan; Stephan, Thomas; Boehnke, Patrick

We report Mo isotopic data of 27 new presolar SiC grains, including 12 N-14-rich AB (N-14/N-15 > 440, AB2) and 15 mainstream (MS) grains, and their correlated Sr and Ba isotope ratios when available. Direct comparison of the data for the MS grains, which came from low-mass asymptotic giant branch (AGB) stars with large s-process isotope enhancements, with the AB2 grain data demonstrates that AB2 grains show near-solar isotopic compositions and lack s-process enhancements. The near-normal Sr, Mo, and Ba isotopic compositions of AB2 grains clearly exclude born-again AGB stars, where the intermediate neutron-capture process (i-process) takes place, as theirmore » stellar source. On the other hand, low-mass CO novae and early R-and J-type carbon stars show C-13 and N-14 excesses but no s-process enhancements and are thus potential stellar sources of AB2 grains. Because both early R-type carbon stars and CO novae are rare objects, the abundant J-type carbon stars (10%-15% of all carbon stars) are thus likely to be a dominant source of AB2 grains.« less

Direct pair production in heavy-ion--atom collisions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anholt, R.; Jakubassa-Amundsen, D.H.; Amundsen, P.A.

1983-02-01

Direct pair production in approx.5-MeV/amu heavy-ion--atom collisions with uranium target atoms is calculated with the plane-wave Born approximation and the semiclassical approximation. Briggs's approximation is used to obtain the electron and positron wave functions. Since pair production involves high momentum transfer q from the moving projectile to the vacuum, use is made of a high-q approximation to greatly simplify the numerical computations. Coulomb deflection of the projectile, the effect of finite nuclear size on the elec- tronic wave functions, and the energy loss by the projectile exciting the pair are all taken into account in these calculations.

Pressure dependence of effective Coulomb interaction parameters in BaFe2As2 by first-principle calculation

NASA Astrophysics Data System (ADS)

Aghajani, M.; Hadipour, H.; Akhavan, M.

2018-05-01

Pressure dependence of the onsite Coulomb interactions of the BaFe2As2 has been studied by employing the constrained random phase approximation within first-principle calculations. Analyzing total and projected density of states, a pseudogap is found for dxy band at the energy roughly 0.25 eV higher than the Fermi level. Also, by applying pressure the spectral weight of the dxy orbital vanishes while other orbitals remain metallic. The different screening channels, as discussed in four different models, affect significantly on the Hubbard U while the Hund J remains almost unchanged. The average onsite bare and partially and fully screened Coulomb interactions increase with different rates upon compression. These different rates can be explained by competition between the electronic screening and reduction of bond lengths.

TlCaBaCuO high Tc superconducting microstrip ring resonators designed for 12 GHz

NASA Technical Reports Server (NTRS)

Subramanyam, G.; Kapoor, V. J.; Chorey, C. M.; Bhasin, K. B.

1993-01-01

Microwave properties of sputtered Tl-Ca-Ba-Cu-O thin films were investigated by designing, fabricating, and testing microstrip ring resonators. Ring resonators designed for 12 GHz fundamental resonance frequency, were fabricated and tested. From the unloaded Q values for the resonators, the surface resistance was calculated by separating the conductor losses from the total losses. The penetration depth was obtained from the temperature dependence of resonance frequency, assuming that the shift in resonance frequency is mainly due to the temperature dependence of penetration depth. The effective surface resistance at 12 GHz and 77 K was determined to be between 1.5 and 2.75 mOmega, almost an order lower than Cu at the same temperature and frequency. The effective penetration depth at 0 K is approximately 7000 A.

Interdependence of spin structure, anion height and electronic structure of BaFe{sub 2}As{sub 2}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sen, Smritijit, E-mail: smritijit.sen@gmail.com; Ghosh, Haranath, E-mail: hng@rrcat.gov.in; Homi Bhabha National Institute, Anushaktinagar, Mumbai, 400094

2016-05-06

Superconducting as well as other electronic properties of Fe-based superconductors are quite sensitive to the structural parameters specially, on anion height which is intimately related to z{sub As}, the fractional z co-ordinate of As atom. Due to presence of strong magnetic fluctuation in these Fe-based superconductors, optimized structural parameters (lattice parameters a, b, c) including z{sub As} using density functional theory (DFT) under generalized gradient approximation (GGA) does not match experimental values accurately. In this work, we show that the optimized value of z{sub As} is strongly influenced by the spin structures in the orthorhombic phase of BaFe{sub 2}As{sub 2}more » system. We take all possible spin structures for the orthorhombic BaFe{sub 2}As{sub 2} system and then optimize z{sub As}. Using these optimized structures we calculate electronic structures like density of states, band structures etc., for each spin configurations. From these studies we show that the electronic structure, orbital order which is responsible for structural as well as related to nematic transition, are significantly influenced by the spin structures.« less

Oxidative cleavage of erucic acid for the synthesis of brassylic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mohammed J. Nasrullah; Pooja Thapliyal; Erica N. Pfarr

2010-10-29

The main focus of this work is to synthesize Brassylic Acid (BA) using oxidative cleavage of Erucic Acid (EA). Crambe (Crambe abyssinica) is an industrial oilseed grown in North Dakota. Crambe has potential as an industrial fatty acid feedstock as a source of Erucic acid (EA). It has approximately 50-60 % of EA, a C{sub 22} monounsaturated fatty acid. Oxidative cleavage of unsaturated fatty acids derived from oilseeds produces long chain (9, 11, and 13 carbon atoms) dibasic and monobasic acids. These acids are known commercial feedstocks for the preparation of nylons, polyesters, waxes, surfactants, and perfumes. Other sources ofmore » EA are Rapeseed seed oil which 50-60 % of EA. Rapeseed is grown outside USA. The oxidative cleavage of EA was done using a high throughput parallel pressure reactor system. Kinetics of the reaction shows that BA yields reach a saturation at 12 hours. H{sub 2}WO{sub 4} was found to be the best catalyst for the oxidative cleavage of EA. High yields of BA were obtained at 80 C with bubbling of O{sub 2} or 10 bar of O{sub 2} for 12 hours.« less

Metal and hydrocarbon behavior in sediments from Brazilian shallow waters drilling activities using nonaqueous drilling fluids (NAFs).

PubMed

do Carmo R Peralba, Maria; Pozebon, Dirce; dos Santos, João H Z; Maia, Sandra M; Pizzolato, Tânia M; Cioccari, Giovani; Barrionuevo, Simone

2010-08-01

The impact of drilling oil activities in the Brazilian Bonito Field/Campos Basin (Rio de Janeiro) shell drilling (300 m) using nonaqueous fluids (NAFs) was investigated with respect to Al, Fe, Mn, Ba, Co, Pb, Cu, As, Hg, Cr, Ni, Zn, Cd, V, and aliphatic and polynuclear aromatic hydrocarbons concentrations in the sediment. Sampling took place in three different times during approximately 33 months. For the metals Al, As, Co, Cr, Cu, Cd, Fe, Ni, Mn, V, and Zn, no significant variation was observed after drilling activities in most of the stations. However, an increase was found in Ba concentration--due to the drilling activity--without return to the levels found 22 months after drilling. High Ba contents was already detected prior to well drilling, probably due to drilling activities in other wells nearby. Hydrocarbon contents also suggest previous anthropogenic activities. Aliphatic hydrocarbon contents were in the range usually reported in other drilling sites. The same behavior was observed in the case of polyaromatic hydrocarbons. Nevertheless, the n-alkane concentration increased sharply after drilling, returning almost to predrilling levels 22 months after drilling activities.

Proton transport polarization and depolarization of hydroxyapatite ceramics

NASA Astrophysics Data System (ADS)

Nakamura, Satoshi; Takeda, Hiroaki; Yamashita, Kimihiro

2001-05-01

Polarization of sintered hydroxyapatite (HAp) ceramics by application of an external dc field at higher temperature was analyzed by thermally stimulated depolarization current (TSDC) measurements. The mechanisms for the polarization and depolarization of HAp were discussed in relation to the instability of the protons in the hydroxide groups. The TSDC spectra consisted of broad peaks, while the ferroelectric substances such as the BaTiO3 ceramics exhibited a sharp peak. Although the maximum current density of 7.87 nA cm-2 for the HAp polarized at 400 °C under 1.0 kV cm-1 was approximately 1/12 lower than that of BaTiO3, the polarization charge of 14.9 μC cm-2 was almost twice as large as that of BaTiO3. Considering the activation energy of 0.72-0.89 eV for the depolarization, it was revealed that the polarization of HAp was ascribed to the migration of protons in the columnar OH- channels with a micrometer-order distance. It was also found that the polarization charge was large and long enough to enhance the biological reactivity of HAp ceramics for biomedical implants.

Effect of heavy-ion irradiation on London penetration depth in overdoped Ba(Fe1-xCox)2As2

NASA Astrophysics Data System (ADS)

Murphy, J.; Tanatar, M. A.; Kim, Hyunsoo; Kwok, W.; Welp, U.; Graf, D.; Brooks, J. S.; Bud'ko, S. L.; Canfield, P. C.; Prozorov, R.

2013-08-01

Irradiation with 1.4 GeV 208Pb ions was used to induce artificial disorder in single crystals of iron-arsenide superconductor Ba(Fe1-xCox)2As2 and to study its effects on the temperature-dependent London penetration depth and transport properties. A study was undertaken on overdoped single crystals with x=0.108 and x=0.127 characterized by notable modulation of the superconducting gap. Irradiation corresponding to the matching fields of Bϕ=6 T and 6.5 T with doses 2.22×1011 d/cm2 and 2.4×1011 d/cm2, respectively, suppresses the superconducting Tc by approximately 0.3 to 1 K. The variation of the low-temperature penetration depth in both pristine and irradiated samples is well described by the power law Δλ(T)=ATn. Irradiation increases the magnitude of the prefactor A and decreases the exponent n, similar to the effect of irradiation in optimally-doped samples. This finding supports universal s± pairing in Ba(Fe1-xCox)2As2 compounds for the entire Co doping range.

Realization of single-phase BaSi2 films by vacuum evaporation with suitable optical properties and carrier lifetime for solar cell applications

NASA Astrophysics Data System (ADS)

Hara, Kosuke O.; Nakagawa, Yoshihiko; Suemasu, Takashi; Usami, Noritaka

2015-07-01

We have realized BaSi2 films by a simple vacuum evaporation technique for solar cell applications. X-ray diffraction analysis shows that single-phase BaSi2 films are formed on alkali-free glass substrates at 500 and 600 °C while impurity phases coexist on quartz or soda-lime glass substrates or at a substrate temperature of 400 °C. The mechanism of film growth is discussed by analyzing the residue on the evaporation boat. An issue on the fabricated films is cracking due to thermal mismatch, as observed by secondary electron microscopy. Optical characterizations by transmittance and reflectance spectroscopy show that the evaporated films have high absorption coefficients, reaching 2 × 104 cm-1 for a photon energy of 1.5 eV, and have indirect absorption edges of 1.14-1.21 eV, which are suitable for solar cells. The microwave-detected photoconductivity decay measurement reveals that the carrier lifetime is approximately 0.027 µs, corresponding to the diffusion length of 0.84 µm, which suggests the potential effective usage of photoexcited carriers.

Evolution of structure and magnetic properties for BaFe11.9Al0.1O19 hexaferrite in a wide temperature range

NASA Astrophysics Data System (ADS)

Trukhanov, A. V.; Trukhanov, S. V.; Panina, L. V.; Kostishyn, V. G.; Kazakevich, I. S.; Trukhanov, An. V.; Trukhanova, E. L.; Natarov, V. O.; Turchenko, V. A.; Salem, M. M.; Balagurov, A. M.

2017-03-01

M-type BaFe11.9Al0.1O19 hexaferrite was successfully synthesized by solid state reactions. Precision investigations of crystal and magnetic structures of BaFe11.9Al0.1O19 powder by neutron diffraction in the temperature range 4.2-730 K have been performed. Magnetic and electrical properties investigations were carried out in the wide temperature range. Neutron powder diffraction data were successfully refined in approximation for both space groups (SG): centrosymmetric #194 (standard non-polar phase) and non-centrosymmetric #186 (polar phase). It has been shown that at low temperatures (below room temperature) better fitting results (value χ2) were for the polar phase (SG: #186) or for the two phases coexistence (SG: #186 and SG: #194). At high temperatures (400-730 K) better fitting results were for SG: #194. It was established coexistence of the dual ferroic properties (specific magnetization and spontaneous polarization) at room temperature. Strong correlation between magnetic and electrical subsystems was demonstrated (magnetoelectrical effect). Temperature dependences of the spontaneous polarization, specific magnetization and magnetoelectrical effect were investigated.

Reduced electronic correlation effects in half substituted Ba(Fe1-xCox)2As2

NASA Astrophysics Data System (ADS)

Liu, Z.-H.; Yaresko, A. N.; Li, Y.; Evtushinsky, D. V.; Dai, P.-C.; Borisenko, S. V.

2018-06-01

We report a comprehensive study of the tridimensional nature and orbital character of the low-energy electronic structure in 50% Cobalt doped Ba(Fe1-xCox)2As2 (d6.5), by using polarization- and photon energy-dependent angle-resolved photoemission spectroscopy. An extra electron-like Fermi surface is observed around the Brillouin zone boundary compared with isoelectronic KyFe2-xSe2 (d6.5). The bands near the Fermi level (EF) are mainly derived from Fe/Co 3d t2g orbitals, revealing visible dispersions along the kz direction. In combination with the local density approximation and the dynamical mean-field theory calculations, we find that the As 4p bands are non-renormalized and the whole 3d band needs to be renormalized by a "single" factor of ˜1.6, indicating moderate electronic correlation effects. The "single" factor description of the correlation strength among the different 3d orbitals is also in sharp contrast to orbital-dependent correlation effects in BaFe2As2. Our findings indicate a remarkable reduction of correlation effects with little difference among 3d orbitals in BaFeCoAs2, due to the increased filling of the electronic 3d shell in the presence of significant Hund's coupling. The results support that the electronic correlation effects and multiple orbital physics play an important role in the superconductivity of the 122 system and in other ferropnictides.

Current and Future Repellent Technologies: The Potential of Spatial Repellents and Their Place in Mosquito-Borne Disease Control.

PubMed

Norris, Edmund J; Coats, Joel R

2017-01-29

Every year, approximately 700,000 people die from complications associated with etiologic disease agents transmitted by mosquitoes. While insecticide-based vector control strategies are important for the management of mosquito-borne diseases, insecticide-resistance and other logistical hurdles may lower the efficacy of this approach, especially in developing countries. Repellent technologies represent another fundamental aspect of preventing mosquito-borne disease transmission. Among these technologies, spatial repellents are promising alternatives to the currently utilized contact repellents and may significantly aid in the prevention of mosquito-borne disease if properly incorporated into integrated pest management approaches. As their deployment would not rely on prohibitively expensive or impractical novel accessory technologies and resources, they have potential utility in developing countries where the burden of mosquito-borne disease is most prevalent. This review aims to describe the history of various repellent technologies, highlight the potential of repellent technologies in preventing the spread of mosquito-borne disease, and discuss currently known mechanisms that confer resistance to current contact and spatial repellents, which may lead to the failures of these repellents. In the subsequent section, current and future research projects aimed at exploring long-lasting non-pyrethroid spatial repellent molecules along with new paradigms and rationale for their development will be discussed.

Current and Future Repellent Technologies: The Potential of Spatial Repellents and Their Place in Mosquito-Borne Disease Control

PubMed Central

Norris, Edmund J.; Coats, Joel R.

2017-01-01

Every year, approximately 700,000 people die from complications associated with etiologic disease agents transmitted by mosquitoes. While insecticide-based vector control strategies are important for the management of mosquito-borne diseases, insecticide-resistance and other logistical hurdles may lower the efficacy of this approach, especially in developing countries. Repellent technologies represent another fundamental aspect of preventing mosquito-borne disease transmission. Among these technologies, spatial repellents are promising alternatives to the currently utilized contact repellents and may significantly aid in the prevention of mosquito-borne disease if properly incorporated into integrated pest management approaches. As their deployment would not rely on prohibitively expensive or impractical novel accessory technologies and resources, they have potential utility in developing countries where the burden of mosquito-borne disease is most prevalent. This review aims to describe the history of various repellent technologies, highlight the potential of repellent technologies in preventing the spread of mosquito-borne disease, and discuss currently known mechanisms that confer resistance to current contact and spatial repellents, which may lead to the failures of these repellents. In the subsequent section, current and future research projects aimed at exploring long-lasting non-pyrethroid spatial repellent molecules along with new paradigms and rationale for their development will be discussed. PMID:28146066

Quantifying Fusion Born Ion Populations in Magnetically Confined Plasmas using Ion Cyclotron Emission

DOE PAGES

Carbajal, L.; Warwick Univ., Coventry; Dendy, R. O.; ...

2017-03-07

Ion cyclotron emission (ICE) offers unique promise as a diagnostic of the fusion born alpha-particle population in magnetically confined plasmas. Pioneering observations from JET and TFTR found that ICE intensity P ICE scales approximately linearly with the measured neutron flux from fusion reactions, and with the inferred concentration, n /n i , of fusion-born alpha-particles confined within the plasma. We present fully nonlinear self-consistent kinetic simulations that reproduce this scaling for the first time. This resolves a longstanding question in the physics of fusion alpha particle confinement and stability in MCF plasmas. It confirms the MCI as the likely emissionmore » mechanism and greatly strengthens the basis for diagnostic exploitation of ICE in future burning plasmas.« less

Quantifying Fusion Born Ion Populations in Magnetically Confined Plasmas using Ion Cyclotron Emission

NASA Astrophysics Data System (ADS)

Carbajal, L.; Dendy, R. O.; Chapman, S. C.; Cook, J. W. S.

2017-03-01

Ion cyclotron emission (ICE) offers a unique promise as a diagnostic of the fusion born alpha-particle population in magnetically confined plasmas. Pioneering observations from JET and TFTR found that ICE intensity PICE scales approximately linearly with the measured neutron flux from fusion reactions, and with the inferred concentration, nα/ni, of fusion born alpha particles confined within the plasma. We present fully nonlinear self-consistent kinetic simulations that reproduce this scaling for the first time. This resolves a long-standing question in the physics of fusion alpha-particle confinement and stability in magnetic confinement fusion plasmas. It confirms the magnetoacoustic cyclotron instability as the likely emission mechanism and greatly strengthens the basis for diagnostic exploitation of ICE in future burning plasmas.

Quantifying Fusion Born Ion Populations in Magnetically Confined Plasmas using Ion Cyclotron Emission.

PubMed

Carbajal, L; Dendy, R O; Chapman, S C; Cook, J W S

2017-03-10

Ion cyclotron emission (ICE) offers a unique promise as a diagnostic of the fusion born alpha-particle population in magnetically confined plasmas. Pioneering observations from JET and TFTR found that ICE intensity P_{ICE} scales approximately linearly with the measured neutron flux from fusion reactions, and with the inferred concentration, n_{α}/n_{i}, of fusion born alpha particles confined within the plasma. We present fully nonlinear self-consistent kinetic simulations that reproduce this scaling for the first time. This resolves a long-standing question in the physics of fusion alpha-particle confinement and stability in magnetic confinement fusion plasmas. It confirms the magnetoacoustic cyclotron instability as the likely emission mechanism and greatly strengthens the basis for diagnostic exploitation of ICE in future burning plasmas.

Intermittent detection of fetal heart rate abnormalities identify infants at greatest risk for fresh stillbirths, birth asphyxia, neonatal resuscitation, and early neonatal deaths in a limited-resource setting: a prospective descriptive observational study at Haydom Lutheran Hospital.

PubMed

Langli Ersdal, Hege; Mduma, Estomih; Svensen, Erling; Sundby, Johanne; Perlman, Jeffrey

2012-01-01

Intermittent fetal heart rate (FHR) monitoring during labor using an acoustic stethoscope is the most frequent method for fetal assessment of well-being in low- and middle-income countries. Evidence concerning reliability and efficacy of this technique is almost nonexistent. To determine the value of routine intermittent FHR monitoring during labor in the detection of FHR abnormalities, and the relationship of abnormalities to the subsequent fresh stillbirths (FSB), birth asphyxia (BA), need for neonatal face mask ventilation (FMV), and neonatal deaths within 24 h. This is a descriptive observational study in a delivery room from November 2009 through December 2011. Research assistants/observers (n = 14) prospectively observed every delivery and recorded labor information including FHR and interventions, neonatal information including responses in the delivery room, and fetal/neonatal outcomes (FSB, death within 24 h, admission neonatal area, or normal). 10,271 infants were born. FHR was abnormal (i.e. <120 or >160 beats/min) in 279 fetuses (2.7%) and absent in 200 (1.9%). Postnatal outcomes included FSB in 159 (1.5%), need for FMV in 695 (6.8%), BA (i.e. 5-min Apgar score <7) in 69 (0.7%), and deaths in 89 (0.9%). Abnormal FHR was associated with labor complications (OR = 31.4; 95% CI: 23.1-42.8), increased need for FMV (OR = 7.8; 95% CI: 5.9-10.1), BA (OR = 21.7; 95% CI: 12.7-37.0), deaths (OR = 9.9; 95% CI: 5.6-17.5), and FSB (OR = 35; 95% CI: 20.3-60.4). An undetected FHR predicted FSB (OR = 1,983; 95% CI: 922-4,264). Intermittent detection of an absent or abnormal FHR using a fetal stethoscope is associated with FSB, increased need for neonatal resuscitation, BA, and neonatal death in a limited-resource setting. The likelihood of an abnormal FHR is magnified with labor complications. Copyright © 2012 S. Karger AG, Basel.

VLF Trimpi modelling on the path NWC-Dunedin using both finite element and 3D Born modelling

NASA Astrophysics Data System (ADS)

Nunn, D.; Hayakawa, K. B. M.

1998-10-01

This paper investigates the numerical modelling of VLF Trimpis, produced by a D region inhomogeneity on the great circle path. Two different codes are used to model Trimpis on the path NWC-Dunedin. The first is a 2D Finite Element Method Code (FEM), whose solutions are rigorous and valid in the strong scattering or non-Born limit. The second code is a 3D model that invokes the Born approximation. The predicted Trimpis from these codes compare very closely, thus confirming the validity of both models. The modal scattering matrices for both codes are analysed in some detail and are found to have a comparable structure. They indicate strong scattering between the dominant TM modes. Analysis of the scattering matrix from the FEM code shows that departure from linear Born behaviour occurs when the inhomogeneity has a horizontal scale size of about 100 km and a maximum electron density enhancement at 75 km altitude of about 6 electrons.

Asymptotic form for the cross section for the Coulomb interacting rearrangement collisions

NASA Technical Reports Server (NTRS)

Omidvar, K.

1973-01-01

It is shown that in a rearrangement collision leading to the formation of the highly excited hydrogenlike states the cross section in all orders of the Born approximation behaves as 1/n sq, with n the principal quantum number, thus invalidating the Brinkman-Kramers approximation for large n. Similarly, in high energy inelastic electron-hydrogenlike atom collisions the exchange cross section for sufficiently large n dominates the direct excitation cross section.

Multi-centennial Record of Labrador Sea Primary Productivity and Sea-Ice Variability Archived in Coralline Algal Ba/Ca

NASA Astrophysics Data System (ADS)

Chan, Phoebe; Halfar, Jochen; Adey, Walter; Hetzinger, Steffen; Zack, Thomas; Moore, Kent; Wortmann, Ulrich; Williams, Branwen; Hou, Alicia

2017-04-01

Arctic sea-ice thickness and concentration have dropped by approximately 9% per decade since 1978. Concurrent with this sea-ice decline is an increase in rates of phytoplankton productivity, driven by shoaling of the mixed layer and enhanced transmittance of solar radiation into the surface ocean. This has recently been confirmed by phytoplankton studies in Arctic and Subarctic basins that have revealed earlier timing, prolonged duration, and increased primary productivity of the spring phytoplankton bloom. However, difficulties of navigating in remote ice-laden waters and harsh polar climates have often resulted in short and incomplete records of in-situ plankton abundance in the northwestern Labrador Sea. Alternatively, information of past ocean productivity may be gained through the study of trace nutrient distributions in the surface water column. Investigations of dissolved barium (Ba) concentrations in the Arctic reveal significant depletions of Ba in surface seawaters due to biological scavenging during the spring phytoplankton bloom. Here we apply a barium-to-calcium (Ba/Ca) and carbon isotope (δ13C) multiproxy approach to long-lived crustose coralline algae in order to reconstruct an annually-resolved multi-centennial record of Labrador Sea productivity related to sea-ice variability in Labrador, Canada that extends well into the Little Ice Age (LIA; 1646 AD). The crustose coralline alga Clathromorphum compactum is a shallow marine calcareous plant that is abundant along the eastern Canadian coastline, and produces annual growth increments which allow for the precise calendar dating and geochemical sampling of hard tissue. Algal Ba/Ca ratios can serve as a promising new proxy for surface water productivity, demonstrating a close correspondence to δ13C that does not suffer from the anthropogenically-induced carbon isotope decline (ex. Suess Effect) beginning in the 1960s. Coralline algal Ba/Ca demonstrates statistically significant correlations to both observational and proxy records of sea-ice extent and transport variability, and shows a persistent pattern of covariability that is broadly consistent with the timing and phasing of the Atlantic Multidecadal Oscillation (AMO). Lower algal Ba/Ca values are interpreted as increased productivity (via biological scavenging) coinciding with warming sea surface temperatures and melting of sea-ice, and vice versa. This relationship is further supported by negative correlations between algal Ba/Ca and spatially averaged chlorophyll α concentrations determined from Sea-Viewing Wide Field-of-View Sensor (SeaWiFS; 1998 - 2009) ocean colour data. Extended comparisons to a multi-centennial tree-ring proxy AMO index demonstrates more frequent positive Ba/Ca excursions (indicating reduced productivity) associated with AMO cool phases during the Little Ice Age, followed by a step-wise decline in Ba/Ca (indicating increasing productivity) from 1910 to present levels - unprecedented in the last 365 years. Our multi-centennial record of coralline algal Ba/Ca in the Subarctic northwest Atlantic demonstrates a long-term increasing trend in primary productivity that is in agreement with recent satellite-based productivity in the Arctic Ocean. This ongoing increase in phytoplankton productivity is expected to fundamentally alter marine biodiversity and trophic dynamics as warming and freshening of the surface layer is projected to intensify over the coming century.

Towards syntactic characterizations of approximation schemes via predicate and graph decompositions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hunt, H.B. III; Stearns, R.E.; Jacob, R.

1998-12-01

The authors present a simple extensible theoretical framework for devising polynomial time approximation schemes for problems represented using natural syntactic (algebraic) specifications endowed with natural graph theoretic restrictions on input instances. Direct application of the technique yields polynomial time approximation schemes for all the problems studied in [LT80, NC88, KM96, Ba83, DTS93, HM+94a, HM+94] as well as the first known approximation schemes for a number of additional combinatorial problems. One notable aspect of the work is that it provides insights into the structure of the syntactic specifications and the corresponding algorithms considered in [KM96, HM+94]. The understanding allows them tomore » extend the class of syntactic specifications for which generic approximation schemes can be developed. The results can be shown to be tight in many cases, i.e. natural extensions of the specifications can be shown to yield non-approximable problems. The results provide a non-trivial characterization of a class of problems having a PTAS and extend the earlier work on this topic by [KM96, HM+94].« less

Design and Development of Novel Hierarchically Ordered Block Copolymer-Magnetoelectric Particle Nanocomposites

DTIC Science & Technology

2012-06-08

microscopy (JEOL 1200EX STEM). The volume fraction of BaTiO3 nanoparticles in the PS-BTO nanocomposites was determined by thermogravimetric analysis ...encapsulated in the 9.8±0.4-nm NP was approximately only 13.8% based on the thermogravimetric analysis (TGA) measurement (Supporting Material Section...the properties of the constituents and their spatial arrangement. Nanocomposites of polymer/ nanoparticle , formed by incorporating nanoparticles into

Functional neural bases of numerosity judgments in healthy adults born preterm.

PubMed

Clark, Caron A C; Liu, Yating; Wright, Nicolas Lee Abbot; Bedrick, Alan; Edgin, Jamie O

2017-11-01

High rates of mathematics learning disabilities among individuals born preterm (<37weeksGA) have spurred calls for a greater understanding of the nature of these weaknesses and their neural underpinnings. Groups of healthy, high functioning young adults born preterm and full term (n=20) completed a symbolic and non-symbolic magnitude comparison task while undergoing functional MRI scanning. Collectively, participants showed activation in superior and inferior frontal and parietal regions previously linked to numeric processing when comparing non-symbolic magnitude arrays separated by small numeric distances. Simultaneous deactivation of the default mode network also was evident during these trials. Individuals born preterm showed increased signal change relative to their full term peers in right inferior frontal and parietal regions when comparing the non-symbolic magnitude arrays. Elevated signal change during non-symbolic task blocks was associated with poorer performance on a calculation task administered outside of the scanner. These findings indicate that healthy, high-functioning adults born preterm may recruit fronto-parietal networks more extensively when processing non-symbolic magnitudes, suggesting that approximate number system training may be an inroad for early intervention to prevent mathematics difficulties in this population. Copyright © 2017 Elsevier Inc. All rights reserved.

Race differences in infant mortality from endogenous causes: a population-based study in North Carolina.

PubMed

Michielutte, R; Moore, M L; Meis, P J; Ernest, J M; Wells, H B

1994-02-01

This study examines the associations between race, birth weight, and mortality from endogenous causes for all singleton births born in 1984-1987 in a 20-county region of North Carolina. A more detailed analysis of preterm low birth weight infants examines these associations according to the proximate medical causes (medical etiology) of the preterm birth. Overall, black infants were found to have approximately twice the mortality risk of white infants. Most of the excess black mortality risk is explained by the larger proportion of black infants born at lower birth weights. The pattern of race differences in infant mortality by birth weight generally replicates the results of earlier studies, but the relative risk ratios within specific birth weight categories are smaller than previously reported. Among preterm low birth weight infants, the association between race and endogenous mortality differs within categories of medical etiology. The mortality risk is the same for black and white infants born preterm due to premature rupture of the membranes (PROM), lower for black infants born preterm due to medical problems, and higher for black infants born preterm due to idiopathic premature labor (IPL).

Variation in Differential and Total Cross Sections Due to Different Radial Wave Functions

ERIC Educational Resources Information Center

Williamson, W., Jr.; Greene, T.

1976-01-01

Three sets of analytical wave functions are used to calculate the Na (3s---3p) transition differential and total electron excitation cross sections by Born approximations. Results show expected large variations in values. (Author/CP)

An approximate inverse scattering technique for reconstructing blockage profiles in water pipelines using acoustic transients.

PubMed

Jing, Liwen; Li, Zhao; Wang, Wenjie; Dubey, Amartansh; Lee, Pedro; Meniconi, Silvia; Brunone, Bruno; Murch, Ross D

2018-05-01

An approximate inverse scattering technique is proposed for reconstructing cross-sectional area variation along water pipelines to deduce the size and position of blockages. The technique allows the reconstructed blockage profile to be written explicitly in terms of the measured acoustic reflectivity. It is based upon the Born approximation and provides good accuracy, low computational complexity, and insight into the reconstruction process. Numerical simulations and experimental results are provided for long pipelines with mild and severe blockages of different lengths. Good agreement is found between the inverse result and the actual pipe condition for mild blockages.

Ionization potential depression and optical spectra in a Debye plasma model

NASA Astrophysics Data System (ADS)

Lin, Chengliang; Röpke, Gerd; Reinholz, Heidi; Kraeft, Wolf-Dietrich

2017-11-01

We show how optical spectra in dense plasmas are determined by the shift of energy levels as well as the broadening owing to collisions with the plasma particles. In lowest approximation, the interaction with the plasma particles is described by the RPA dielectric function, leading to the Debye shift of the continuum edge. The bound states remain nearly un-shifted, their broadening is calculated in Born approximation. The role of ionization potential depression as well as the Inglis-Teller effect are shown. The model calculations have to be improved going beyond the lowest (RPA) approximation when applying to WDM spectra.

Accounting for Location Error in Kalman Filters: Integrating Animal Borne Sensor Data into Assimilation Schemes

PubMed Central

Sengupta, Aritra; Foster, Scott D.; Patterson, Toby A.; Bravington, Mark

2012-01-01

Data assimilation is a crucial aspect of modern oceanography. It allows the future forecasting and backward smoothing of ocean state from the noisy observations. Statistical methods are employed to perform these tasks and are often based on or related to the Kalman filter. Typically Kalman filters assumes that the locations associated with observations are known with certainty. This is reasonable for typical oceanographic measurement methods. Recently, however an alternative and abundant source of data comes from the deployment of ocean sensors on marine animals. This source of data has some attractive properties: unlike traditional oceanographic collection platforms, it is relatively cheap to collect, plentiful, has multiple scientific uses and users, and samples areas of the ocean that are often difficult of costly to sample. However, inherent uncertainty in the location of the observations is a barrier to full utilisation of animal-borne sensor data in data-assimilation schemes. In this article we examine this issue and suggest a simple approximation to explicitly incorporate the location uncertainty, while staying in the scope of Kalman-filter-like methods. The approximation stems from a Taylor-series approximation to elements of the updating equation. PMID:22900005

On the Mass of Atoms in Molecules: Beyond the Born-Oppenheimer Approximation

NASA Astrophysics Data System (ADS)

Scherrer, Arne; Agostini, Federica; Sebastiani, Daniel; Gross, E. K. U.; Vuilleumier, Rodolphe

2017-07-01

Describing the dynamics of nuclei in molecules requires a potential energy surface, which is traditionally provided by the Born-Oppenheimer or adiabatic approximation. However, we also need to assign masses to the nuclei. There, the Born-Oppenheimer picture does not account for the inertia of the electrons, and only bare nuclear masses are considered. Nowadays, experimental accuracy challenges the theoretical predictions of rotational and vibrational spectra and requires the participation of electrons in the internal motion of the molecule. More than 80 years after the original work of Born and Oppenheimer, this issue has still not been solved, in general. Here, we present a theoretical and numerical framework to address this problem in a general and rigorous way. Starting from the exact factorization of the electron-nuclear wave function, we include electronic effects beyond the Born-Oppenheimer regime in a perturbative way via position-dependent corrections to the bare nuclear masses. This maintains an adiabaticlike point of view: The nuclear degrees of freedom feel the presence of the electrons via a single potential energy surface, whereas the inertia of electrons is accounted for and the total mass of the system is recovered. This constitutes a general framework for describing the mass acquired by slow degrees of freedom due to the inertia of light, bounded particles; thus, it is applicable not only in electron-nuclear systems but in light-heavy nuclei or ions as well. We illustrate this idea with a model of proton transfer, where the light particle is the proton and the heavy particles are the oxygen atoms to which the proton is bounded. Inclusion of the light-particle inertia allows us to gain orders of magnitude in accuracy. The electron-nuclear perspective is adopted, instead, to calculate position-dependent mass corrections using density functional theory for a few polyatomic molecules at their equilibrium geometry. These data can serve as input for the computation of high-precision molecular spectra.

Volcanic processes recorded by inclusions in sanidine megacrystals ejected from Quaternary Rockeskyll volcano, Eifel, Germany

NASA Astrophysics Data System (ADS)

Eilhard, Nicole; Schreuer, Jürgen; Stöckhert, Bernhard

2016-04-01

Sanidine megacrystals were ejected by a late stage explosive eruption at the Quaternary Rockeskyll volcanic complex, Eifel volcanic field, Germany. The homogeneous distribution of barium (about 1 % wt BaO equivalent to about 2 mole % celsian component) indicates that the nearly perfect single crystals must have crystallized in the Ostwald-Miers range from a huge reservoir, probably in the roof of a magma chamber. Irregularities during crystal growth caused trapping of hydrous melt inclusions, which are the objective of the present study. The inclusions show a characteristic concentric microstructure, in the following described from the sanidine host towards the inclusion center: (1) Ba is enriched by a factor of 2 to 3 in a ca. 0.01 mm wide rim, compared to the otherwise homogeneous sanidine host; (2) inwards, the continuous rim is overgrown by a thin crust of Ba enriched sanidine with irregular surface; (3) a layer of glass with a composition similar to sanidine; (4) a second, thinner layer of glass slightly reduced in Na2O and K2O, separated from the first glass layer by a sharp interface with approximately spherical shape; (5) a bubble containing a fluid phase, composed of H2O and minor CO2. This record is interpreted as follows: After crystallization of the sanidine megacrystals, a rise in temperature within the magmatic system caused some re-melting of the Ba-rich sanidine around the inclusions. Partitioning of Ba between the small included melt reservoir and the host caused formation of the Ba-rich rim (layer 1) by diffusive exchange. The onset of cooling lead to crystallization of the thin sanidine crust (layer 2). Finally, very rapid decompression and cooling during the subsequent explosive eruption caused sequential phase separation (two stages) in the remaining melt, the denser melt phase (layers 3 and 4) quenched to glass, the complementary low-density volatile-rich phase forming the central bubble. In summary, the microstructure and phase composition of the inclusions in the sanidine megacrystals recorded information on the history of the volcanic system prior to and during explosive eruption.

Processing And Patterning Of Thin Film Superconductors Formed By Metallo-Organic Deposition

NASA Astrophysics Data System (ADS)

Micheli, Adolph L.; Mantese, Joseph V.; Hamdi, Aboud H.

1990-04-01

Thin film superconductors of Y-Ba-Cu and Yb-Ba-Cu were formed by the pyrolysis of neodecanoate solutions of Y, Yb, Ba and Cu which had been deposited onto <100> SrTiO3 substrates [1]. Rapid thermal annealing, in oxygen, of the as-deposited films produced high T films having superconducting onset temperatures above 90 K and zero resistance at 8g K. Scanning Electron Microscopy (SEM) revealed enhancements in grain growth, compared to furnace annealed films, by a factor of 4. X-ray diffraction analysis showed preferred epitaxial grain growth with the c-axis of the films oriented both perpendicular and parallel to the substrate surface. Separate Rutherford Backscattering Spectrometry (RBS) channeling experiments confirmed the formation of preferred epitaxial grain growth. Film composition was determined by RBS and Inductively Coupled Plasma Emission Spectrometry (ICPES). Selective patterning was accomplished by focused beam exposure of the metal neodecanoate films [2-4]. The exposure rendered the neodecanoate film locally insoluble in xylene, thus permitting selective area patterning prior to pyrolysis. Electron, ion and laser beams were used to pattern films on <100> SrTiO3. The finest lines, approximately 5 #m in width and 26 nm thick, were patterned using electron beams whose lines had superconducting onsets above 90 K and zero resistance at 69 K after rapid thermal annealing. Both ion beam and laser patterning had similar superconducting onsets and zero resistance. Neodecanoates of Y, Yb, Ba, and Cu were formed, as previously described [5], by reacting the metal acetates of these materials with either ammonium neodecanoate or tetramethyl ammonium neodecanoate. The carboxylates formed from these reactions were then dissolved in a solution of xylene and pyridine. The individual chemical constituents were combined to produce solutions, Ln:Ba:Cu, in the ratio 1:2:4. Here, Ln is a rare-earth element. Details of the preparation of the metal carboxylates may be found elsewhere [6]. Thin films of Y-Ba-Cu and Yb-Ba-Cu were deposited onto <100> SrTiO by flooding the substrates with the appropriate neodecanoate solutions, then spin drying them at 2000 rpm for 30 s. The substrates were heated rapidly to 500?°C for 5 min in an air oven to pyrolize the metallo organics to their oxides. This process produces thin films about 200 nm thick. The spin coating process was repeated 3-6 times if thicker films were desired. X-ray diffraction analysis of films pyrolized at 500?°C shoed the presence of only microcrystallites. Room temperature resistivities of lx10 0-cm were measured for these films. No superconducting behavior was observed. After the 500?°C pyrolysis the films were further processed by RTA in flowing oxygen. The substrates were placed upon oxidized silicon wafers, rapidly heated to 850?°C for 60 s using infrared radiation produced by a bank of quartz lamps then allowed to cool to room temperature. A second rapid annealing was then performed at 920?°C for 30 s in oxygen. Thin film superconductors formed in the manner described above were very uniform in structure and thickness across the surface of the film. The grains are approximately 1 #m wide and 2 #m long, a factor of 4 larger than the grains found in furnace annealed films formed by MOD [5].

Static and dynamical properties of the spin-1/2 equilateral triangular-lattice antiferromagnet Ba 3CoSb 2O 9

DOE PAGES

Ma, Jie; Kamiya, Yoshitomo; Hong, Tao; ...

2016-02-24

We present single-crystal neutron scattering measurements of the spin-1/2 equilateral triangular-lattice antiferromagnet Ba 3CoSb 2O 9. Besides confirming that the Co 2+ magnetic moments lie in the ab plane for zero magnetic field and then determining all the exchange parameters of the minimal quasi-2D spin Hamiltonian, we provide conclusive experimental evidence of magnon decay through observation of intrinsic line broadening. Through detailed comparisons with the linear and nonlinear spin-wave theories, we also point out that the large-S approximation, which is conventionally employed to predict magnon decay in noncollinear magnets, is inadequate to explain our experimental observation. Hence, our results callmore » for a new theoretical framework for describing excitation spectra in low-dimensional frustrated magnets under strong quantum effects.« less

Assessment of band gaps for alkaline-earth chalcogenides using improved Tran Blaha-modified Becke Johnson potential

NASA Astrophysics Data System (ADS)

Yedukondalu, N.; Kunduru, Lavanya; Roshan, S. C. Rakesh; Sainath, M.

2018-04-01

Assessment of band gaps for nine alkaline-earth chalcogenides namely MX (M = Ca, Sr, Ba and X = S, Se Te) compounds are reported using Tran Blaha-modified Becke Johnson (TB-mBJ) potential and its new parameterization. From the computed electronic band structures at the equilibrium lattice constants, these materials are found to be indirect band gap semiconductors at ambient conditions. The calculated band gaps are improved using TB-mBJ and its new parameterization when compared to local density approximation (LDA) and Becke Johnson potentials. We also observe that TB-mBJ new parameterization for semiconductors below 7 eV reproduces the experimental trends very well for the small band gap semiconducting alkaline-earth chalcogenides. The calculated band profiles look similar for MX compounds (electronic band structures are provided for BaS for representation purpose) using LDA and new parameterization of TB-mBJ potentials.

Diminishing sign anomaly and scaling behavior of the mixed-state Hall resistivity in Tl2Ba2Ca2Cu3O10 films containing columnar defects

NASA Technical Reports Server (NTRS)

Budhani, R. C.; Liou, S. H.; Cai, Z. X.

1993-01-01

The issues of sign reversal of the Hall voltage and scaling between longitudinal (rho(xx)) and Hall (rho(xy)) resistivities are studied in Tl2Ba2Ca2Cu3O10 films in which the vortex dynamics is drastically changed by flux pinning at heavy-ion-irradiation-induced linear defects. While the sign anomaly diminishes with increasing defect concentration, the power law rho(xy) is approximately equal to rho(xx) exp beta, beta = 1.85 +/- 0.1, holds even after irradiation. This result shows that the scaling is a universal feature of the mixed state in this system. The sign anomaly, on the other hand, is not consistent with a model that invokes pinning-induced backflow in the vortex core as the mechanism for this effect.

Rietveld refinement, dielectric and magnetic properties of Nb modified Bi0.80Ba0.20FeO3 ceramic

NASA Astrophysics Data System (ADS)

Jangra, Sandhaya; Sanghi, Sujata; Agarwal, Ashish; Rangi, Manisha

2018-05-01

Bi0.80Ba0.20Fe0.95Nb0.05O3 ceramic has been prepared via conventional solid state reaction method. Structure analysis was carried out by X-ray diffraction (XRD) technique at room temperature. XRD pattern confirmed the crystalline nature of prepared sample. Rietveld analysis used for further structural investigations and confirmed the existence of rhombohedral symmetry (R3c space group). The dielectric response shows dispersion at lower frequency range and becomes frequency independent at high frequency. The approximation of conduction mechanism is determined by the temperature dependent behavior of frequency exponent `s'. Fitting results suggests the applicability of small polaron conduction mechanism at lower temperatures and CBH model at higher temperature. Room temperature magnetic measurements give the evidence of significant enhancement in magnetic properties with remanent magnetization (Mr = 0.1218 emu/g) and coercive field (Hc = 3.5342 kOe).

Physical properties and electronic structure of a new barium titanate suboxide Ba 1+δTi 13-δO₁₂ (δ = 0.11)

DOE PAGES

Rotundu, Costel R.; Jiang, Shan; Deng, Xiaoyu; ...

2015-04-01

The structure, transport, thermodynamic properties, x-ray absorption spectra (XAS), and electronic structure of a new barium titanate suboxide, Ba 1+δTi 13-δO₁₂ (δ = 0.11), are reported. It is a paramagnetic poor metal with hole carriers dominating the transport. Fermi liquid behavior appears at low temperature. The oxidization state of Ti obtained by the XAS is consistent with the metallic Ti²⁺ state. Local density approximation band structure calculations reveal the material is near the Van Hove singularity. The pseudogap behavior in the Ti-d band and the strong hybridization between the Ti-d and O-p orbitals reflect the characteristics of the building blocksmore » of the Ti₁₃ semi-cluster and the TiO₄ quasi-squares, respectively.« less

Ab-initio study of double perovskite Ba2YSbO6

NASA Astrophysics Data System (ADS)

Mondal, Golak; Jha, D.; Himanshu, A. K.; Lahiri, J.; Singh, B. K.; Kumar, Uday; Ray, Rajyavardhan

2018-04-01

The density functional theory with generalized gradient approximation has been used to investigate the electronic structure of double perovskite oxide Ba2YSbO6 (BYS) synthesized in polycrystalline form by solid state reaction. Structural characterization of the compound was done through X-ray diffraction (XRD) followed by Riedvelt analysis of the XRD pattern. The crystal structure is cubic, space group being Fm-3m (No. 225) with the lattice parameter, a = 8.424 Å. Optical band-gap of this system has been calculated using UV-Vis Spectroscopy and Kubelka-Munk (KM) function, having the value 4.56eV. A detailed study of the electronic properties has also been carried out using the Full-Potential Linear Augmented Plane Wave (FPLAPW) as implemented in WIEN2k. BYS is found to be a large band-gap insulator with potential technological applications, such as dielectric resonators and filters in microwave applications.

Optical properties of BaY2F8:Ce3+

NASA Astrophysics Data System (ADS)

Fabeni, P.; di Martino, D.; Nikl, M.; Pazzi, G. P.; Sani, E.; Toncelli, A.; Tonelli, M.; Vedda, A.

2005-01-01

The optical properties of Ce3+-doped BaY2F8 crystals were investigated under selective laser excitation and X-ray irradiation. In both cases, the emission spectrum is dominated by the characteristic doublet transition from the lowest energy level of the 5d configuration to the spin-orbit split 2F ground state of Ce3+. Excitation bands at 4.1, 5.0, 5.9 and 6.2 eV, due to transitions between 4f and split 5d levels were observed. The emission time decay was satisfactorily analyzed by a single exponential component, characterized by a decay time of approximately 28 ns at 10 K and slightly increasing with temperature. A monotonic temperature quenching of the photo-luminescence intensity was observed; on the other hand, the temperature dependence of radio-luminescence intensity is modulated by the presence of shallow traps competing with Ce3+ ions in carrier trapping during irradiation.

Reliability study on high power 638-nm triple emitter broad area laser diode

NASA Astrophysics Data System (ADS)

Yagi, T.; Kuramoto, K.; Kadoiwa, K.; Wakamatsu, R.; Miyashita, M.

2016-03-01

Reliabilities of the 638-nm triple emitter broad area laser diode (BA-LD) with the window-mirror structure were studied. Methodology to estimate mean time to failure (MTTF) due to catastrophic optical mirror degradation (COMD) in reasonable aging duration was newly proposed. Power at which the LD failed due to COMD (PCOMD) was measured for the aged LDs under the several aging conditions. It was revealed that the PCOMD was proportional to logarithm of aging duration, and MTTF due to COMD (MTTF(COMD)) could be estimated by using this relation. MTTF(COMD) estimated by the methodology with the aging duration of approximately 2,000 hours was consistent with that estimated by the long term aging. By using this methodology, the MTTF of the BA-LD was estimated exceeding 100,000 hours under the output of 2.5 W, duty cycles of 30% .

Pilot scale evaluation of the BABIU process--upgrading of landfill gas or biogas with the use of MSWI bottom ash.

PubMed

Mostbauer, P; Lombardi, L; Olivieri, T; Lenz, S

2014-01-01

Biogas or landfill gas can be converted to a high-grade gas rich in methane with the use of municipal solid waste incineration bottom ash as a reactant for fixation of CO2 and H2S. In order to verify results previously obtained at a laboratory scale with 65-90 kg of bottom ash (BA), several test runs were performed at a pilot scale, using 500-1000 kg of bottom ash and up to 9.2 Nm(3)/h real landfill gas from a landfill in the Tuscany region (Italy). The input flow rate was altered. The best process performance was observed at a input flow rate of 3.7 Nm(3)/(htBA). At this flow rate, the removal efficiencies for H2S were approximately 99.5-99%. Copyright © 2013 Elsevier Ltd. All rights reserved.

Buffer Gas Cooled Molecule Source for Cpmmw Spectroscopy

NASA Astrophysics Data System (ADS)

Zhou, Yan; Grimes, David; Barnum, Timothy J.; Klein, Ethan; Field, Robert W.

2014-06-01

We have built a new molecular beam source that implements 20 K Neon buffer gas cooling for the study of the spectra of small molecules. In particular, laser ablation of BaF2 pellets has been optimized to produce a molecular beam of BaF with a number density more than 100 times greater than what we have previously obtained from a typical Smalley-type photoablation supersonic beam source. Moreover, the forward beam velocity of 150 m/s in our apparatus represents an approximate 10-fold reduction, improving spectroscopic resolution from 500 kHz to better than 50 kHz at 100 GHz in a chirped-pulse millimeter-wave experiment in which resolution is limited by Doppler broadening. Novel improvements in our buffer gas source and advantages for CPmmW spectroscopy studies will be discussed. We thank David Patterson, John Barry, John Doyle, and David DeMille for help in the design of our source.

Few-body quark dynamics for doubly heavy baryons and tetraquarks

NASA Astrophysics Data System (ADS)

Richard, Jean-Marc; Valcarce, Alfredo; Vijande, Javier

2018-03-01

We discuss the adequate treatment of the three- and four-body dynamics for the quark model picture of double-charm baryons and tetraquarks. We stress that the variational and Born-Oppenheimer approximations give energies very close to the exact ones, while the diquark approximation might be somewhat misleading. The Hall-Post inequalities also provide very useful lower bounds that exclude the possibility of stable tetraquarks for some mass ratios and some color wave functions.

Density functional theory of electron transfer beyond the Born-Oppenheimer approximation: Case study of LiF.

PubMed

Li, Chen; Requist, Ryan; Gross, E K U

2018-02-28

We perform model calculations for a stretched LiF molecule, demonstrating that nonadiabatic charge transfer effects can be accurately and seamlessly described within a density functional framework. In alkali halides like LiF, there is an abrupt change in the ground state electronic distribution due to an electron transfer at a critical bond length R = R c , where an avoided crossing of the lowest adiabatic potential energy surfaces calls the validity of the Born-Oppenheimer approximation into doubt. Modeling the R-dependent electronic structure of LiF within a two-site Hubbard model, we find that nonadiabatic electron-nuclear coupling produces a sizable elongation of the critical R c by 0.5 bohr. This effect is very accurately captured by a simple and rigorously derived correction, with an M -1 prefactor, to the exchange-correlation potential in density functional theory, M = reduced nuclear mass. Since this nonadiabatic term depends on gradients of the nuclear wave function and conditional electronic density, ∇ R χ(R) and ∇ R n(r, R), it couples the Kohn-Sham equations at neighboring R points. Motivated by an observed localization of nonadiabatic effects in nuclear configuration space, we propose a local conditional density approximation-an approximation that reduces the search for nonadiabatic density functionals to the search for a single function y(n).

Environmental effects on long term behavior of composite laminates

NASA Astrophysics Data System (ADS)

Singhal, S. N.; Chamis, C. C.

Model equations are presented for approximate methods simulating the long-term behavior of composite materials and structures in hot/humid service environments. These equations allow laminate property upgradings with time, and can account for the effects of service environments on creep response. These methodologies are illustrated for various individual and coupled temperature/moisture, longitudinal/transverse, and composite material type cases. Creep deformation is noted to rise dramatically for cases of matrix-borne, but not of fiber-borne, loading in hot, humid environments; the coupled influence of temperature and moisture is greater than a mere combination of their individual influences.

Environmental effects on long term behavior of composite laminates

NASA Technical Reports Server (NTRS)

Singhal, S. N.; Chamis, C. C.

1992-01-01

Model equations are presented for approximate methods simulating the long-term behavior of composite materials and structures in hot/humid service environments. These equations allow laminate property upgradings with time, and can account for the effects of service environments on creep response. These methodologies are illustrated for various individual and coupled temperature/moisture, longitudinal/transverse, and composite material type cases. Creep deformation is noted to rise dramatically for cases of matrix-borne, but not of fiber-borne, loading in hot, humid environments; the coupled influence of temperature and moisture is greater than a mere combination of their individual influences.

Balloon borne Antarctic frost point measurements and their impact on polar stratospheric cloud theories

NASA Technical Reports Server (NTRS)

Rosen, James M.; Hofmann, D. J.; Carpenter, J. R.; Harder, J. W.; Oltsmans, S. J.

1988-01-01

Balloon-borne frost point measurements were performed over Antarctica during September-October 1987 as part of the NOZE II effort at McMurdo. The results show water mixing ratios on the order of 2 ppmv in the 20 km region, suggesting that models of the springtime Antarctic stratosphere should be based on approximately 2 ppmv water vapor. Evidence indicating that some PSCs form at temperatures higher than the frost point in the 15 to 20 km region is discussed. This supports the binary HNO3-H2O theory of PSC composition.

Impacts of silvicultural thinning treatments on beetle trap captures and tree attacks during low bark beetle populations in ponderosa pine forests of northern Arizona.

PubMed

Gaylord, M L; Hofstetter, R W; Wagner, M R

2010-10-01

Our research used a combination of passive traps, funnel traps with lures, baited trees, and surveys of long-term thinning plots to assess the impacts of different levels of stand basal area (BA) on bark beetle tree attack and on trap captures of Ips spp., Dendroctonus spp., and their predators. The study occurred at two sites in ponderosa pine, Pinus ponderosa Dougl. ex Laws., forests, from 2004 to 2007 during low bark beetle populations. Residual stand BA ranged from 9.0 to 37.0 m2/ha. More predators and bark beetles were collected in passive traps in stands of lower BA than in stands of higher BA; however, significance varied by species and site, and total number of beetles collected was low. Height of the clear panel passive traps affected trap catches for some species at some sites and years. When pheromone lures were used with funnel traps [Ips pini (Say) lure: lanierone, +03/-97 ipsdienol], we found no significant difference in trap catches among basal area treatments for bark beetles and their predators. Similarly, when trees were baited (Dendroctonus brevicomis LeConte lure: myrcene, exo-brevicomin and frontalin), we found no significant difference for days to first bark beetle attack. Surveys of long-term thinning treatments found evidence of bark beetle attacks only in unthinned plots (approximately 37 m2/ha basal area). We discuss our results in terms of management implications for bark beetle trapping and control.

First-Principles Study of the Structural, Optical, Dynamical and Thermodynamic Properties of BaZnO2 Under Pressure

NASA Astrophysics Data System (ADS)

Wang, Yi-Xian; Hu, Cui-E.; Chen, Yang-Mei; Cheng, Yan; Ji, Guang-Fu

2016-11-01

The structural, optical, dynamical, and thermodynamic properties of BaZnO2 under pressure are studied based on the density functional theory. The calculated structural parameters are consistent with the available experimental data. In the ground state, the electronic band structure and density of states indicate that BaZnO2 is an insulator with a direct gap of 2.2 eV. The Mulliken charges are also analyzed to characterize the bonding property. After the structural relaxation, the optical properties are studied. It is found that the dielectric function of E Vert x and EVert y are isotropic, whereas the EVert x and EVert z are anisotropic. The effect of pressure on the energy-loss function in the ultraviolet region becomes more obvious as the pressure increases. Furthermore, the dynamical properties under different pressures are investigated using the finite displacement method. We find that the P3121 phase of BaZnO2 is dynamically stable under the pressure ranging from 0 GPa to 30 GPa. The phonon dispersion curves, phonon density of states, vibrational modes and atoms that contribute to these vibrations at {{\\varvec{Γ }}} point under different pressures are also reported in this work. Finally, by employing the quasi-harmonic approximation, the thermodynamic properties such as the temperature dependence of the thermal expansion coefficient, specific heat, entropy and Gibbs free energy under different pressures are investigated. It is found that the influences of the temperature on the heat capacity are much more significant than that of the pressure on it.

Descriptive Norms and Expectancies as Mediators of a Brief Motivational Intervention for Mandated College Students Receiving Stepped Care for Alcohol Use

PubMed Central

Yurasek, Ali M.; Borsari, Brian; Magill, Molly; Mastroleo, Nadine R.; Hustad, John T.P.; Tevyaw, Tracy O'Leary; Barnett, Nancy P.; Kahler, Christopher W.; Monti, Peter M.

2015-01-01

Background and Aims Stepped care approaches for mandated college students provide individual Brief Motivational Interventions (BMI) only for individuals who do not respond to an initial, low-intensity level of treatment such as Brief Advice (BA). However, how BMIs facilitate change in this higher-risk group of mandated students remains unclear. Perceived descriptive norms and alcohol-related expectancies are the most commonly examined mediators of BMI efficacy, but have yet to be examined in the context of stepped care. Methods Participants were mandated college students (N = 598) participating in a stepped care trial in which mandated students first received BA. Those who reported continued risky drinking 6 weeks following a BA session were randomized to either a single-session BMI (N=163) or an Assessment-only comparison condition (AO; N = 165). BMI participants reduced alcohol-related problems at the 9 month follow up significantly more than AO participants. Multiple mediation analyses using bootstrapping techniques examined whether perceived descriptive norms and alcohol-related expectancies mediated the observed outcomes. Results Reductions in perceptions of average student drinking (B = -.24; CI = -.61 to -.04) and negative expectancies (B = -.13; CI = -.38 to -.01) mediated the BMI effects. Furthermore, perceived average student norms were reduced after the BMI to levels approximating those of students who had exhibited lower risk drinking following the BA session. Conclusions Findings highlight the utility of addressing perceived norms and expectancies in BMIs, especially for students who have not responded to less intensive prevention efforts. PMID:26098125

CYT387, a selective JAK1/JAK2 inhibitor: in vitro assessment of kinase selectivity and preclinical studies using cell lines and primary cells from polycythemia vera patients.

PubMed

Pardanani, A; Lasho, T; Smith, G; Burns, C J; Fantino, E; Tefferi, A

2009-08-01

Somatic mutations in Janus kinase 2 (JAK2), including JAK2V617F, result in dysregulated JAK-signal transducer and activator transcription (STAT) signaling, which is implicated in myeloproliferative neoplasm (MPN) pathogenesis. CYT387 is an ATP-competitive small molecule that potently inhibits JAK1/JAK2 kinases (IC(50)=11 and 18 nM, respectively), with significantly less activity against other kinases, including JAK3 (IC(50)=155 nM). CYT387 inhibits growth of Ba/F3-JAK2V617F and human erythroleukemia (HEL) cells (IC(50) approximately 1500 nM) or Ba/F3-MPLW515L cells (IC(50)=200 nM), but has considerably less activity against BCR-ABL harboring K562 cells (IC=58 000 nM). Cell lines harboring mutated JAK2 alleles (CHRF-288-11 or Ba/F3-TEL-JAK2) were inhibited more potently than the corresponding pair harboring mutated JAK3 alleles (CMK or Ba/F3-TEL-JAK3), and STAT-5 phosphorylation was inhibited in HEL cells with an IC(50)=400 nM. Furthermore, CYT387 selectively suppressed the in vitro growth of erythroid colonies harboring JAK2V617F from polycythemia vera (PV) patients, an effect that was attenuated by exogenous erythropoietin. Overall, our data indicate that the JAK1/JAK2 selective inhibitor CYT387 has potential for efficacious treatment of MPN harboring mutated JAK2 and MPL alleles.

Born-Oppenheimer approximation in an effective field theory language

NASA Astrophysics Data System (ADS)

Brambilla, Nora; Krein, Gastão; Tarrús Castellà, Jaume; Vairo, Antonio

2018-01-01

The Born-Oppenheimer approximation is the standard tool for the study of molecular systems. It is founded on the observation that the energy scale of the electron dynamics in a molecule is larger than that of the nuclei. A very similar physical picture can be used to describe QCD states containing heavy quarks as well as light-quarks or gluonic excitations. In this work, we derive the Born-Oppenheimer approximation for QED molecular systems in an effective field theory framework by sequentially integrating out degrees of freedom living at energies above the typical energy scale where the dynamics of the heavy degrees of freedom occurs. In particular, we compute the matching coefficients of the effective field theory for the case of the H2+ diatomic molecule that are relevant to compute its spectrum up to O (m α5). Ultrasoft photon loops contribute at this order, being ultimately responsible for the molecular Lamb shift. In the effective field theory the scaling of all the operators is homogeneous, which facilitates the determination of all the relevant contributions, an observation that may become useful for high-precision calculations. Using the above case as a guidance, we construct under some conditions an effective field theory for QCD states formed by a color-octet heavy quark-antiquark pair bound with a color-octet light-quark pair or excited gluonic state, highlighting the similarities and differences between the QED and QCD systems. Assuming that the multipole expansion is applicable, we construct the heavy-quark potential up to next-to-leading order in the multipole expansion in terms of nonperturbative matching coefficients to be obtained from lattice QCD.

Disparities in vaccinations and cancer screening among U.S.- and foreign-born Arab and European American non-Hispanic White women.

PubMed

Dallo, Florence J; Kindratt, Tiffany B

2015-01-01

Disparities in vaccinations and cancer screening exist when comparing foreign-born and U.S.-born women collectively and disaggregated by race and ethnicity. The purpose of this study was to estimate and compare the age-adjusted prevalence of not receiving a flu or pneumonia vaccine, clinical breast examination, mammogram or Pap smear among U.S.- and foreign-born White women by region of birth and examine associations while controlling for potential confounders. We pooled 12 years of National Health Interview Survey data (n = 117,893). To approximate an "Arab-American" ethnicity, we identified 15 "Arab" countries from the Middle East region that comprise the Arab Nations. Data was requested from the National Center for Health Statistics Research Data Center. We used the χ(2) statistic to compare descriptive statistics and odds ratios (ORs) with 95% CIs were used for inferential statistics. Compared to U.S.-born, foreign-born Whites from the Arab Nations had higher estimates of not receiving recommended vaccinations and cancer screenings. In crude and adjusted analyses, foreign-born Arab-American women were less likely to report receiving a flu vaccine (OR, 0.34; 95% CI, 0.21-0.58), pneumonia vaccine (OR, 0.14; 95% CI, 0.06-0.32), Pap smear (OR, 0.13; 95% CI, 0.05-0.31), or clinical breast examination (OR, 0.16; 95% CI, 0.07-0.37) compared with U.S.-born White women. There were no differences for mammography. This national study examining uptake of flu and pneumonia vaccines and preventive cancer screenings suggests that estimates are lower for foreign-born Arab-American women compared with U.S.-born White women. Future studies should collect qualitative data that assess the cultural context surrounding prevention and screening behaviors among Arab-American women. Copyright © 2015 Jacobs Institute of Women's Health. Published by Elsevier Inc. All rights reserved.

Testicular cancer risk and maternal parity: a population-based cohort study.

PubMed

Westergaard, T; Andersen, P K; Pedersen, J B; Frisch, M; Olsen, J H; Melbye, M

1998-04-01

The aim was to study, in a population-based cohort design, whether first-born sons run a higher risk of testicular cancer than later born sons; to investigate whether this difference in risk was affected by birth cohort, age of the son, maternal age, interval to previous delivery and other reproductive factors; and, finally, to evaluate to what extent changes in women's parity over time might explain the increasing incidence of testicular cancer. By using data from the Civil Registration System, a database was established of all women born in Denmark since 1935 and all their children alive in 1968 or born later. Sons with testicular cancer were identified in the Danish Cancer Registry. Among 1015994 sons followed for 15981 967 person-years, 626 developed testicular cancer (443 non-seminomas, 183 seminomas). Later born sons had a decreased risk of testicular cancer (RR = 0.80, 95% CI = 0.67-0.95) compared with first-born sons. The RR was 0.79 (95% CI = 0.64-0.98) for non-seminomas and 0.81 (95% CI = 0.58-1.13) for seminomas. There was no association between testicular cancer risk and overall parity of the mother, maternal or paternal age at the birth of the son, or maternal age at first birth. The decreased risk of testicular cancer among later born sons was not modified by age, birth cohort, interval to the previous birth, sex of the first-born child, or maternal age at birth of the son or at first birth. The increased proportion of first-borns from birth cohort 1946 to birth cohort 1969 only explained around 3% of an approximated two-fold increase in incidence between the cohorts. Our data document a distinctly higher risk of testicular cancer in first-born compared with later born sons and suggest that the most likely explanation should be sought among exposures in utero. The increase in the proportion of first-borns in the population has only contributed marginally to the increase in testicular cancer incidence.

Structural and electronic properties of Sr{sub x}Ba{sub 1-x}SnO{sub 3} from first principles calculations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moreira, E.; Henriques, J.M.; Azevedo, D.L.

2012-03-15

Neutron diffraction data for Sr{sub x}Ba{sub 1-x}SnO{sub 3} (x=0.0, 0.2, 0.4, 0.6, 0.8 and 1.0) solid solutions were used as inputs to obtain optimized geometries and electronic properties using the density functional theory (DFT) formalism considering both the local density and generalized gradient approximations, LDA and GGA, respectively. The crystal structures and SnO{sub 6} octahedra tilting angles found after total energy minimization agree well with experiment, specially for the GGA data. Elastic constants were also obtained and compared with theoretical and experimental results for cubic BaSnO{sub 3}. While the alloys with cubic unit cell have an indirect band gap, tetragonalmore » and orthorhombic alloys exhibit direct band gaps (exception made to x=1.0). The Kohn-Sham minimum electronic band gap oscillates from 1.52 eV (cubic x=0.0, LDA) to 2.61 eV (orthorhombic x=1.0, LDA), and from 0.74 eV (cubic BaSnO{sub 3}, GGA) to 1.97 eV (orthorhombic SrSnO{sub 3}, GGA). Parabolic interpolation of bands has allowed us to estimate the effective masses for charge carriers, which are shown to be anisotropic and larger for holes. - Graphical Abstract: Highlights: Black-Right-Pointing-Pointer DFT calculations were performed on Sr{sub x}Ba{sub 1-x}SnO{sub 3} solid solutions. Black-Right-Pointing-Pointer Calculated crystal structures agree well with experiment. Black-Right-Pointing-Pointer Alloys have direct or indirect gaps depending on the Sr molar fraction. Black-Right-Pointing-Pointer The Kohn-Sham gap variation from x=0.0 to x=1.0 is close to the experimental value. Black-Right-Pointing-Pointer Carrier effective masses are very anisotropic, specially for holes.« less

Hydration energies and structures of alkaline earth metal ions, M2+(H2O)n, n = 5-7, M = Mg, Ca, Sr, and Ba.

PubMed

Rodriguez-Cruz, S E; Jockusch, R A; Williams, E R

1999-09-29

The evaporation of water from hydrated alkaline earth metal ions, produced by electrospray ionization, was studied in a Fourier transform mass spectrometer. Zero-pressure-limit dissociation rate constants for loss of a single water molecule from the hydrated divalent metal ions, M(2+)(H(2)O)(n) (M = Mg, Ca, and Sr for n = 5-7, and M = Ba for n = 4-7), are measured as a function of temperature using blackbody infrared radiative dissociation. From these values, zero-pressure-limit Arrhenius parameters are obtained. By modeling the dissociation kinetics using a master equation formalism, threshold dissociation energies (E(o)) are determined. These reactions should have a negligible reverse activation barrier; therefore, E(o) values should be approximately equal to the binding energy or hydration enthalpy at 0 K. For the hepta- and hexahydrated ions at low temperature, binding energies follow the trend expected on the basis of ionic radii: Mg > Ca > Sr > Ba. For the hexahydrated ions at high temperature, binding energies follow the order Ca > Mg > Sr > Ba. The same order is observed for the pentahydrated ions. Collisional dissociation experiments on the tetrahydrated species result in relative dissociation rates that directly correlate with the size of the metals. These results indicate the presence of two isomers for hexahydrated magnesium ions: a low-temperature isomer in which the six water molecules are located in the first solvation shell, and a high-temperature isomer with the most likely structure corresponding to four water molecules in the inner shell and two water molecules in the second shell. These results also indicate that the pentahydrated magnesium ions have a structure with four water molecules in the first solvation shell and one in the outer shell. The dissociation kinetics for the hexa- and pentahydrated clusters of Ca(2+), Sr(2+), and Ba(2+) are consistent with structures in which all the water molecules are located in the first solvation shell.

Metabolic profiles and bile acid extraction rate in the liver of cows with fasting-induced hepatic lipidosis.

PubMed

Mohamed, T; Oikawa, S; Iwasaki, Y; Mizunuma, Y; Takehana, K; Endoh, D; Kurosawa, T; Sato, H

2004-04-01

This study was designed to monitor lipid profile in the portal and hepatic blood of cows with fasting-induced hepatic lipidosis, and to compare the results with those in the jugular blood. The work was also carried out to investigate bile acid (BA) in these vessels, and further to investigate BA extraction rate in the liver. Five cows were equipped with catheters in the portal, hepatic and jugular veins (day 0), fasted for 4 days (day 1-day 4) and then refed (day 5-day 11). Before morning feeding, blood was sampled before, during and after fasting from the catheterized vessels. In the portal blood, the concentration of non-esterified fatty acids (NEFA) showed a progressive increase and at day 5 there was an approximate twofold rise. Increased NEFA concentrations were also found similarly in the other two veins. At day 5, beta-hydroxybutyrate (BHBA) in the portal, hepatic and jugular blood rose to 197, 190 and 186% of the pre-fasting value, respectively. However, the concentrations of NEFA and BHBA in the three veins gradually returned to pre-fasting concentration during the refeeding period. Compared with the pre-fasting value at day 0, the content of liver triglyceride (TG) increased significantly at day 5 (P < 0.01). In the liver, the hepatic extraction rate of BA dropped from 3.1 times pre-fasting to 2.2 times during fasting. There were no significant differences in the concentrations of glucose, TG, total cholesterol, cholesterol esters, free cholesterol and phospholipids. The results of the current study show that metabolic alterations occur in the portal, hepatic and jugular veins during induction of hepatic lipidosis in cows, and mostly metabolites, with exception of BA concentration, run parallel. The decreased BA extraction rate in the liver of fasted cows was considered to reflect hepatic cell impairment caused by TG accumulation. Hopefully, the findings, at least in part, contribute to the explanation of the pathophysiology of hepatic lipidosis in dairy cows.

AM-37 and ST-36 Are Small Molecule Bombesin Receptor Antagonists

PubMed Central

Moody, Terry W.; Tashakkori, Nicole; Mantey, Samuel A.; Moreno, Paola; Ramos-Alvarez, Irene; Leopoldo, Marcello; Jensen, Robert T.

2017-01-01

While peptide antagonists for the gastrin-releasing peptide receptor (BB2R), neuromedin B receptor (BB1R), and bombesin (BB) receptor subtype-3 (BRS-3) exist, there is a need to develop non-peptide small molecule inhibitors for all three BBR. The BB agonist (BA)1 binds with high affinity to the BB1R, BB2R, and BRS-3. In this communication, small molecule BBR antagonists were evaluated using human lung cancer cells. AM-37 and ST-36 inhibited binding to human BB1R, BB2R, and BRS-3 with similar affinity (Ki = 1.4–10.8 µM). AM-13 and AM-14 were approximately an order of magnitude less potent than AM-37 and ST-36. The ability of BA1 to elevate cytosolic Ca2+ in human lung cancer cells transfected with BB1R, BB2R, and BRS-3 was antagonized by AM-37 and ST-36. BA1 increased tyrosine phosphorylation of the EGFR and ERK in lung cancer cells, which was blocked by AM-37 and ST-36. AM-37 and ST-36 reduced the growth of lung cancer cells that have BBR. The results indicate that AM-37 and ST-36 function as small molecule BB receptor antagonists. PMID:28785244

AM-37 and ST-36 Are Small Molecule Bombesin Receptor Antagonists.

PubMed

Moody, Terry W; Tashakkori, Nicole; Mantey, Samuel A; Moreno, Paola; Ramos-Alvarez, Irene; Leopoldo, Marcello; Jensen, Robert T

2017-01-01

While peptide antagonists for the gastrin-releasing peptide receptor (BB 2 R), neuromedin B receptor (BB 1 R), and bombesin (BB) receptor subtype-3 (BRS-3) exist, there is a need to develop non-peptide small molecule inhibitors for all three BBR. The BB agonist (BA)1 binds with high affinity to the BB 1 R, BB 2 R, and BRS-3. In this communication, small molecule BBR antagonists were evaluated using human lung cancer cells. AM-37 and ST-36 inhibited binding to human BB 1 R, BB 2 R, and BRS-3 with similar affinity ( K i = 1.4-10.8 µM). AM-13 and AM-14 were approximately an order of magnitude less potent than AM-37 and ST-36. The ability of BA1 to elevate cytosolic Ca 2+ in human lung cancer cells transfected with BB 1 R, BB 2 R, and BRS-3 was antagonized by AM-37 and ST-36. BA1 increased tyrosine phosphorylation of the EGFR and ERK in lung cancer cells, which was blocked by AM-37 and ST-36. AM-37 and ST-36 reduced the growth of lung cancer cells that have BBR. The results indicate that AM-37 and ST-36 function as small molecule BB receptor antagonists.

Effect of heavy-ion irradiation on London penetration depth in overdoped Ba(Fe 1 - x Co x ) 2 As 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murphy, J.; Tanatar, M. A.; Kim, Hyunsoo

2013-08-01

Irradiation with 1.4 GeV 208 Pb ions was used to induce artificial disorder in single crystals of iron-arsenide superconductor Ba(Fe 1 - x Co x ) 2 As 2 and to study its effects on the temperature-dependent London penetration depth and transport properties. A study was undertaken on overdoped single crystals with x = 0.108 and x = 0.127 characterized by notable modulation of the superconducting gap. Irradiation corresponding to the matching fields of B Φ = 6 T and 6.5 T with doses 2.22 × 10 11 d /cm 2 and 2.4 × 10 11 d /cm 2 ,more » respectively, suppresses the superconducting T c by approximately 0.3 to 1 K. The variation of the low-temperature penetration depth in both pristine and irradiated samples is well described by the power law Δ λ ( T ) = A T n . Irradiation increases the magnitude of the prefactor A and decreases the exponent n , similar to the effect of irradiation in optimally-doped samples. This finding supports universal s ± pairing in Ba(Fe 1 - x Co x ) 2 As 2 compounds for the entire Co doping range.« less

Improved dielectric properties of BaTiO3-added CaCu3Ti4O12 polycrystalline ceramics

NASA Astrophysics Data System (ADS)

Kim, Hui Eun; Choi, Soon-Mi; Lee, Sung-Yun; Hong, Youn-Woo; Yoo, Sang-Im

2013-05-01

The effects of the BaTiO3 (BTO) additive on the electrical properties of CaCu3Ti4O12 (CCTO) polycrystalline ceramics were systematically investigated. Various amounts of BTO powder up to 15 mol. % were added to CCTO powder. Each batch was ball-milled, pressed into pellets, and finally sintered at 1060°C for 12 h in air. Compared with pure CCTO sample ( ɛ r ˜ 52,000 and tan δ ˜ 0.38 at 100 kHz), BTO-added CCTO samples commonly showed significantly reduced dielectric losses although their dielectric constants were decreased approximately by one order of magnitude (for instance, ɛ r ˜ 4,075 and tan δ ˜ 0.02 at 100 kHz for 5 mol. % BTO-added CCTO sample). In addition, the breakdown voltages of BTO-added CCTO samples were much higher than that of pure CCTO sample, and thus the leakage currents were greatly reduced at the applied voltage above ˜ 10 V. A large reduction in the dielectric losses and leakage currents is attributed to the secondary phases segregated at the CCTO grain boundary which are composed of CaTiO3, Ba4Ti12O27, and unreacted BTO.

Influences of alkaline earth metal substitution on the crystal structure and physical properties of magnetic RuSr1.9A0.1GdCu2O8 (A = Ca, Sr, and Ba) superconductors.

PubMed

Hur, Su Gil; Park, Dae Hoon; Hwang, Seong-Ju; Kim, Seung Joo; Lee, J H; Lee, Sang Young

2005-11-24

We have investigated the effect of alkaline earth metal substitution on the crystal structure and physical properties of magnetic superconductors RuSr(1.9)A(0.1)GdCu(2)O(8) (A = Ca, Sr, and Ba) in order to probe an interaction between the magnetic coupling of the RuO(2) layer and the superconductivity of the CuO(2) layer. X-ray diffraction and X-ray absorption spectroscopic analyses demonstrate that the isovalent substitution of Sr ions with Ca or Ba ions makes it possible to tune the interlayer distance between the CuO(2) and the RuO(2) layers. From the measurements of electrical resistance and magnetic susceptibility, it was found that, in contrast to negligible change of magnetization, both of the alkaline earth metal substitutions lead to a notable depression of zero-resistance temperature T(c) (DeltaT(c) approximately 17-19 K). On the basis of the absence of a systematic correlation between the T(c) and the interlayer distance/magnetization, we have concluded that the internal magnetic field of the RuO(2) layer has insignificant influence on the superconducting property of the CuO(2) layer in the ruthenocuprate.

Heat-Electric Power Conversion Without Temperature Difference Using Only n-Type Ba8Au x Si46-x Clathrate with Au Compositional Gradient

NASA Astrophysics Data System (ADS)

Osakabe, Yuki; Tatsumi, Shota; Kotsubo, Yuichi; Iwanaga, Junpei; Yamasoto, Keita; Munetoh, Shinji; Furukimi, Osamu; Nakashima, Kunihiko

2018-02-01

Thermoelectric power generation is typically based on the Seebeck effect under a temperature gradient. However, the heat flux generated by the temperature difference results in low conversion efficiency. Recently, we developed a heat-electric power conversion mechanism using a material consisting of a wide-bandgap n-type semiconductor, a narrow-bandgap intrinsic semiconductor, and a wide-bandgap p-type semiconductor. In this paper, we propose a heat-electric power conversion mechanism in the absence of a temperature difference using only n-type Ba8Au x Si46-x clathrate. Single-crystal Ba8Au x Si46-x clathrate with a Au compositional gradient was synthesized by Czochralski method. Based on the results of wavelength-dispersive x-ray spectroscopy and Seebeck coefficient measurements, the presence of a Au compositional gradient in the sample was confirmed. It also observed that the electrical properties changed gradually from wide-bandgap n-type to narrow-bandgap n-type. When the sample was heated in the absence of a temperature difference, the voltage generated was approximately 0.28 mV at 500°C. These results suggest that only an n-type semiconductor with a controlled bandgap can generate electric power in the absence of a temperature difference.

CHEMICAL ABUNDANCES OF MEMBER STARS IN THE OPEN CLUSTER NGC 2632 (PRAESEPE)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, X. L.; Chen, Y. Q.; Zhao, G.

2015-11-15

Based on high-resolution, high signal-to-noise ratio spectra, we present abundances of 17 elements (Fe, O, Na, Mg, Al, Si, Ca, Sc, Ti, V, Cr, Co, Ni, Y, Zr, Ba, La) for six stars (one Am star, one F dwarf star, and four GK giant stars) and radial velocities for 18 proper-motion selected member stars in the open cluster NGC 2632. In the Am star, s-process elements Y and Ba are clearly overabundant, which may be considered as an indicator of a peculiar Am star. The average [Fe/H] is 0.16 ± 0.06 from four GK giant member stars, which is similarmore » to that of solar-type stars in the literature. As compared with dwarf stars, significant overabundances are found for Na, Mg, and Ba elements in our giant stars, which can be explained by the evolutionary effect. We also detect a star-to-star scatter of [Na/Fe] ratios among four giants which locate approximately at the same position in the CMD. Finally, we perform an analysis on the possible connection between the abundance and spatial structure of NGC 2632, but we find no inhomogeneous abundance among different clumps of stars in this cluster based on our limited sample.« less

Suburban migration and the birth outcome of Chicago-born white and African-American women: the merit of the healthy migrant theory?

PubMed

Collins, James W; Rankin, Kristin M; Janowiak, Christine M

2013-11-01

The healthy migrant theory posits that women who migrate before pregnancy are intrinsically healthier and therefore have better birth outcomes than those who don't move. Objective. To determine whether migration to the suburbs is associated with lower rates of preterm (<37 weeks) birth among Chicago-born White and African-American mothers. We performed stratified and multilevel logistic regression analyses on an Illinois transgenerational dataset of non-Latino White and African-American infants (1989-1991) and their mothers (1956-1976) with appended US census income information. Forty percent of Chicago-born White mothers (N = 45,135) migrated to Suburban Cook County and 30 % migrated to the more geographically distant collar counties. In contrast, 10 % of Chicago-born African-American mothers (N = 41,221) migrated to Suburban Cook and only two percent migrated to the collar counties. Chicago-born White and African-American migrant mothers to Suburban Cook County had lower preterm birth rates than their non-migrant counterparts; RR = 0.8 (0.8-0.9) and 0.8 (0.7-0.8), respectively. When neighborhood income was singularly taken into account, the protective association of suburban migration and preterm birth disappeared among Chicago-born Whites. In race-specific multilevel multivariate regression models which included neighborhood income, the adjusted odds ratio of preterm birth, low birth weight, and small for gestational-age for Chicago-born White and African-American migrant (compared to non-migrant) mothers approximated unity. Neighborhood income underlies the protective association of suburban migration and birth outcome among Chicago-born White and African-American mothers. These findings do not support the healthy migrant hypothesis of reproductive outcome.

Students' Moral Reasoning as Related to Cultural Background and Educational Experience.

ERIC Educational Resources Information Center

Bar-Yam, Miriam; And Others

The relationship between moral development and cultural and educational background is examined. Approximately 120 Israeli youth representing different social classes, sex, religious affiliation, and educational experience were interviewed. The youth interviewed included urban middle and lower class students, Kibbutz-born, Youth Aliyah…

Research notes : pavement markings using waterborne paint and Visibeads in Region 2.

DOT National Transportation Integrated Search

1995-01-01

In order to address the problems associated with solvent-borne patins, ODOT Region 2 staff bought sufficient waterborne paint to place approximately 760 linear miles of stripes. This enabled the Region staff to evaluate state-of-the-art materials and...

Aharonov-Casher effect and quantum transport in graphene based nano rings: A self-consistent Born approximation

NASA Astrophysics Data System (ADS)

Ghaderzadeh, A.; Rahbari, S. H. Ebrahimnazhad; Phirouznia, A.

2018-03-01

In this study, Rashba coupling induced Aharonov-Casher effect in a graphene based nano ring is investigated theoretically. The graphene based nano ring is considered as a central device connected to semi-infinite graphene nano ribbons. In the presence of the Rashba spin-orbit interaction, two armchair shaped edge nano ribbons are considered as semi-infinite leads. The non-equilibrium Green's function approach is utilized to obtain the quantum transport characteristics of the system. The relaxation and dephasing mechanisms within the self-consistent Born approximation is scrutinized. The Lopez-Sancho method is also applied to obtain the self-energy of the leads. We unveil that the non-equilibrium current of the system possesses measurable Aharonov-Casher oscillations with respect to the Rashba coupling strength. In addition, we have observed the same oscillations in dilute impurity regimes in which amplitude of the oscillations is shown to be suppressed as a result of the relaxations.

High-frequency Born synthetic seismograms based on coupled normal modes

USGS Publications Warehouse

Pollitz, F.

2011-01-01

High-frequency and full waveform synthetic seismograms on a 3-D laterally heterogeneous earth model are simulated using the theory of coupled normal modes. The set of coupled integral equations that describe the 3-D response are simplified into a set of uncoupled integral equations by using the Born approximation to calculate scattered wavefields and the pure-path approximation to modulate the phase of incident and scattered wavefields. This depends upon a decomposition of the aspherical structure into smooth and rough components. The uncoupled integral equations are discretized and solved in the frequency domain, and time domain results are obtained by inverse Fourier transform. Examples show the utility of the normal mode approach to synthesize the seismic wavefields resulting from interaction with a combination of rough and smooth structural heterogeneities. This approach is applied to an ~4 Hz shallow crustal wave propagation around the site of the San Andreas Fault Observatory at Depth (SAFOD). ?? The Author Geophysical Journal International ?? 2011 RAS.

Electron-impact ionization of Ne (2 p ) and Ar (3 p ) at intermediate energies: Role of the postcollision interaction

NASA Astrophysics Data System (ADS)

Hu, Xiaoqing; Gao, Cong-Zhang; Chen, Zhanbin; Wang, Jianguo; Wu, Yong; Wang, Yang

2017-11-01

We present the absolute triple differential cross section (TDCS) for single ionization of Ne (2 p ) at an impact energy of 599.6 eV and Ar (3 p ) at 195 eV. The role of the postcollision interaction (PCI) is studied using a high-order distorted-wave Born approximation model with a continuum distorted-waves expansion. Both the second- and third-order effects are considered in the present calculations, and the third-order distorted wave Born approximation model is reported in the (e ,2 e ) reaction. The calculated results show satisfactory agreement with experimental data. The magnitude of the absolute TDCS is enhanced by a factor 2-3 when the strength factor γ of the PCI amplitude is summarized just from 0 to 2. This proves that the PCI plays an important role in the absolute TDCS of the (e ,2 e ) reaction in the intermediate-energy region.

Microbial and geochemical investigations of dissolved organic carbon and microbial ecology of native waters from the Biscayne and Upper Floridan Aquifers

USGS Publications Warehouse

Lisle, John T.; Harvey, Ron W.; Aiken, George R.; Metge, David W.

2010-01-01

Groundwater resources in the United States are under ever-increasing demands for potable, irrigation, and recreational uses. Additionally, aquifer systems are being used or targeted for use as storage areas for treated surface waters and (or) groundwaters via injection (for example, aquifer storage and recovery). To date, the influence that the nutrients, including carbon, in the injected water have on native microbial communities and the biogeochemistry in the subsurface zones used for storage of the injectate has not been determined. In this report, we describe a series of experiments that establishes a baseline dataset for the quantity and quality of organic and inorganic carbon and nutrients in the Biscayne Aquifer (BA) and Upper Floridan Aquifer (UFA) in south Florida. The most significant differences between the BA (26 meters below surface) and UFA (366 meters below surface) are the average specific conductance (0.552 and 6.12 microsiemens per centimeter, respectively), dissolved oxygen (1.6 and 0 milligrams per liter, respectively), and oxidation-reduction potential (40.3 and -358 millivolts, respectively). The dissolved organic carbon from the BA is characterized by carbon originating from terrestrial sources and microbial activities, while the UFA has a distinctive microbial signature. Acetate and lactate are the dominant carbon constituents in both aquifers. Additionally, components of the dissolved organic carbon from the UFA have a total trihalomethane-formation potential that is approximately threefold greater than the maximum contaminat level of 80 micrograms per liter established by the U.S. Environmental Protection Agency. The average native bacterial abundances in the aquifers are similar with 4.69x10^4 cells per milliliter in the BA and 1.33x10^4 cells per milliliter in the UFA. The average bacteriophage abundances are also similar with 1.15x10^5 virus-like particles in the BA and 1.92x10^5 virus-like particles in the UFA. Interestingly, ciliated protozoa are present in both aquifers. The average abundance of ciliates in the BA (2.97x10^3 ciliates per milliliter) is approximately twentyfold greater than abundances in the UFA (1.39x10^2 ciliates per milliliter). Collectively, these data indicate that microbial processes are the dominant contributor to the cycling of carbon and inorganic carbon in the BA and may be the only carbon cycling process in the UFA, as this aquifer has not had a terrestrial influx of carbon for more than 15,000 years. The rates of carbon, in the form of acetate, utilization by the native microbial communities are significantly different between the two aquifers. Based on data from 14C-acetate-utilization experiments, the microbial communities in the BA turn over the native acetate in 2.5 years, whereas communities in the UFA turn over native acetate in 6.8 years. These data support the hypothesis derived from the microbial-abundance data, in that the carbon for bacterial maintainence and growth is recycled from bacterial biomass released during cell lysis, especially in the UFA. An in situ diffusion chamber was designed to retain bacterial cells within the chamber while allowing native water constituents to move through the chamber. A series of 1-week deployments of chambers filled with fluorescent beads, inactivated native bacteria and laboratory grown and viable bacteria into the UFA, permitted by the State of Florida Environmental Protection Agency, was successfully completed. This was the first time this type of deployment into an aquifer system that is used for potable water supply has been permitted within the United States. This technology will allow, for the first time, in situ studies on the survival of microbial indicators of fecal pollution and true pathogens in groundwater systems.

General relativistic corrections to the weak lensing convergence power spectrum

NASA Astrophysics Data System (ADS)

Giblin, John T.; Mertens, James B.; Starkman, Glenn D.; Zentner, Andrew R.

2017-11-01

We compute the weak lensing convergence power spectrum, Cℓκκ, in a dust-filled universe using fully nonlinear general relativistic simulations. The spectrum is then compared to more standard, approximate calculations by computing the Bardeen (Newtonian) potentials in linearized gravity and partially utilizing the Born approximation. We find corrections to the angular power spectrum amplitude of order ten percent at very large angular scales, ℓ˜2 - 3 , and percent-level corrections at intermediate angular scales of ℓ˜20 - 30 .

Positronium formation in e+ plus H- collisions

NASA Technical Reports Server (NTRS)

Straton, Jack C.; Drachman, Richard J.

1990-01-01

Cross sections for positronium formation by capture from the negative hydrogen ion are given. Orthogonalization corrections to the Coulomb (First) Born Approximation (CBA) differential and total cross sections are calculated using approximate H- wave functions of both Lowdin and Chandrasekhar. Various methods of orthogonalizing the unbound projectile to the possible bound states are considered. It is found that treating the atomic nuclei as if they were isotopic spin projections of a single type of nucleon gives cross sections that are an improvement over the CBA.

Noise exposure assessment and abatement strategies at an indoor firing range.

PubMed

Kardous, Chucri A; Willson, Robert D; Hayden, Charles S; Szlapa, Piotr; Murphy, William J; Reeves, Efrem R

2003-08-01

Exposure to hazardous impulse noise is common during the firing of weapons at indoor firing ranges. The aims of this study were to characterize the impulse noise environment at a law enforcement firing range; document the insufficiencies found at the range from a health and safety standpoint; and provide noise abatement recommendations to reduce the overall health hazard to the auditory system. Ten shooters conducted a typical live-fire exercise using three different weapons--the Beretta.40 caliber pistol, the Remington.308 caliber shotgun, and the M4.223 caliber assault rifle. Measurements were obtained at 12 different positions throughout the firing range and adjacent areas using dosimeters and sound level meters. Personal and area measurements were recorded to a digital audio tape (DAT) recorder for further spectral analysis. Peak pressure levels inside the firing range reached 163 decibels (dB) in peak pressure. Equivalent sound levels (Leq) ranged from 78 decibels, A-weighted (dBA), in office area adjacent to the range to 122 dBA inside the range. Noise reductions from wall structures ranged from 29-44 dB. Noise abatement strategies ranged from simple noise control measures (such as sealing construction joints and leaks) to elaborate design modifications to eliminate structural-borne sounds using acoustical treatments. Further studies are needed to better characterize the effects of firing weapons in enclosed spaces on hearing and health in general.

Endoparasitic fauna of red foxes (Vulpes vulpes) and golden jackals (Canis aureus) in Serbia.

PubMed

Ilić, Tamara; Becskei, Zsolt; Petrović, Tamaš; Polaček, Vladimir; Ristić, Bojan; Milić, Siniša; Stepanović, Predrag; Radisavljević, Katarina; Dimitrijević, Sanda

2016-03-01

Wild canides have a high epizootiological - epidemiological significance, considering that they are hosts for some parasites which spread vector born diseases. Increased frequency of certain interactions between domestic and wild canides increases the risk of occurrence, spreading and maintaining the infection of parasitic etiology in domestic canides. The research was conducted in 232 wild canides (172 red foxes and 60 golden jackals). The examined material was sampled from foxes and jackals, which were hunted down between 2010 and 2014, from 8 epizootiological areas of Serbia (North-Bačka, West-Bačka, Southern-Banat, Moravički, Zlatiborski, Raški, Rasinski and Zaječarski district). On completing the parasitological dissection and the coprological diagnostics, in wild canides protozoa from the genus Isospora were identified, 3 species of trematoda (Alaria alata, Pseudamphistomum truncatum and Metagonimus yokogawai), cestods from the genus Taenia and 5 species of nematodes (Toxocara canis, Ancylostomatidae, Trichuris vulpis and Capillaria aerophila). The finding of M. yokogawai in golden jackals were, to the best of our knowledge, one of the first diagnosed cases of metagonimosis in golden jackals in Serbia. The continued monitoring of the parasitic fauna of wild canides is needed to establish the widespread of the zoonoses in different regions of Serbia, because they present the reservoirs and/or sources of these infections.

The fading American dream: Trends in absolute income mobility since 1940.

PubMed

Chetty, Raj; Grusky, David; Hell, Maximilian; Hendren, Nathaniel; Manduca, Robert; Narang, Jimmy

2017-04-28

We estimated rates of "absolute income mobility"-the fraction of children who earn more than their parents-by combining data from U.S. Census and Current Population Survey cross sections with panel data from de-identified tax records. We found that rates of absolute mobility have fallen from approximately 90% for children born in 1940 to 50% for children born in the 1980s. Increasing Gross Domestic Product (GDP) growth rates alone cannot restore absolute mobility to the rates experienced by children born in the 1940s. However, distributing current GDP growth more equally across income groups as in the 1940 birth cohort would reverse more than 70% of the decline in mobility. These results imply that reviving the "American dream" of high rates of absolute mobility would require economic growth that is shared more broadly across the income distribution. Copyright © 2017, American Association for the Advancement of Science.

Diagonal Born-Oppenheimer correction for coupled-cluster wave-functions

NASA Astrophysics Data System (ADS)

Shamasundar, K. R.

2018-06-01

We examine how geometry-dependent normalisation freedom of electronic wave-functions affects extraction of a meaningful diagonal Born-Oppenheimer correction (DBOC) to the ground-state Born-Oppenheimer potential energy surface (PES). By viewing this freedom as a kind of gauge-freedom, it is shown that DBOC and the resulting associated mass-dependent adiabatic PES are gauge-invariant quantities. A sum-over-states (SOS) formula for DBOC which explicitly exhibits this invariance is derived. A biorthogonal formulation suitable for DBOC computations using standard unnormalised coupled-cluster (CC) wave-functions is presented. This is shown to lead to a biorthogonal version of SOS formula with similar properties. On this basis, different computational schemes for evaluating DBOC using approximate CC wave-functions are derived. One of this agrees with the formula used in the current literature. The connection to adiabatic-to-diabatic transformations in non-adiabatic dynamics is explored and complications arising from biorthogonal nature of CC theory are identified.

A multiplex serologic platform for diagnosis of tick-borne diseases.

PubMed

Tokarz, Rafal; Mishra, Nischay; Tagliafierro, Teresa; Sameroff, Stephen; Caciula, Adrian; Chauhan, Lokendrasingh; Patel, Jigar; Sullivan, Eric; Gucwa, Azad; Fallon, Brian; Golightly, Marc; Molins, Claudia; Schriefer, Martin; Marques, Adriana; Briese, Thomas; Lipkin, W Ian

2018-02-16

Tick-borne diseases are the most common vector-borne diseases in the United States, with serology being the primary method of diagnosis. We developed the first multiplex, array-based assay for serodiagnosis of tick-borne diseases called the TBD-Serochip. The TBD-Serochip was designed to discriminate antibody responses to 8 major tick-borne pathogens present in the United States, including Anaplasma phagocytophilum, Babesia microti, Borrelia burgdorferi, Borrelia miyamotoi, Ehrlichia chaffeensis, Rickettsia rickettsii, Heartland virus and Powassan virus. Each assay contains approximately 170,000 12-mer linear peptides that tile along the protein sequence of the major antigens from each agent with 11 amino acid overlap. This permits accurate identification of a wide range of specific immunodominant IgG and IgM epitopes that can then be used to enhance diagnostic accuracy and integrate differential diagnosis into a single assay. To test the performance of the TBD-Serochip, we examined sera from patients with confirmed Lyme disease, babesiosis, anaplasmosis, and Powassan virus disease. We identified a wide range of specific discriminatory epitopes that facilitated accurate diagnosis of each disease. We also identified previously undiagnosed infections. Our results indicate that the TBD-Serochip is a promising tool for a differential diagnosis not available with currently employed serologic assays for TBDs.

Electrical excitability: a spectrum of properties in the progeny of a single embryonic neuroblast.

PubMed Central

Goodman, C S; Pearson, K G; Spitzer, N C

1980-01-01

We have examined the range of some properties of the progeny of a single embryonic precursor cell in the grasshopper. The approximately 100 progeny of this single neuroblast share certain features such as their transmitter and some aspects of their morphology; at the same time, however, they demonstrate a broad spectrum of electrical properties, from spiking to non-spiking neurons. The first-born progeny are spiking neurons with peripheral axons. Many of the progeny, including all of the last-born, do not generate action potentials. The nonspiking progeny are local intraganglionic neurons and appear to compose a major proportion of the progeny of this neuroblast. All of the nonspiking neurons have calcium inward current channels and can make action potentials when outward current channels are blocked. We propose a model for grasshopper neurogenesis based on cell lineage such that (i) certain features (e.g., transmitter) are shared by the progeny of all cell divisions from a single neuroblast, and (ii) other features (e.g., electrical properties) are shared by the progeny of a given birth position (e.g., first versus last born) from all of the neuroblasts. According to this model, the first-born progeny from all neuroblasts are spiking neurons, whereas the last-born are nonspiking. Images PMID:6246499

SELF BLOOD GLUCOSE MONITORING UNDERESTIMATES HYPERGLYCEMIA AND HYPOGLYCEMIA AS COMPARED TO CONTINUOUS GLUCOSE MONITORING IN TYPE 1 AND TYPE 2 DIABETES.

PubMed

Mangrola, Devna; Cox, Christine; Furman, Arianne S; Krishnan, Sridevi; Karakas, Sidika E

2018-01-01

When glucose records from self blood glucose monitoring (SBGM) do not reflect estimated average glucose from glycosylated hemoglobin (HgBA1) or when patients' clinical symptoms are not explained by their SBGM records, clinical management of diabetes becomes a challenge. Our objective was to determine the magnitude of differences in glucose values reported by SBGM versus those documented by continuous glucose monitoring (CGM). The CGM was conducted by a clinical diabetes educator (CDE)/registered nurse by the clinic protocol, using the Medtronic iPRO2 ™ system. Patients continued SBGM and managed their diabetes without any change. Data from 4 full days were obtained, and relevant clinical information was recorded. De-identified data sets were provided to the investigators. Data from 61 patients, 27 with type 1 diabetes (T1DM) and 34 with T2DM were analyzed. The lowest, highest, and average glucose recorded by SBGM were compared to the corresponding values from CGM. The lowest glucose values reported by SBGM were approximately 25 mg/dL higher in both T1DM ( P = .0232) and T2DM ( P = .0003). The highest glucose values by SBGM were approximately 30 mg/dL lower in T1DM ( P = .0005) and 55 mg/dL lower in T2DM ( P<.0001). HgBA1c correlated with the highest and average glucose by SBGM and CGM. The lowest glucose values were seen most frequently during sleep and before breakfast; the highest were seen during the evening and postprandially. SBGM accurately estimates the average glucose but underestimates glucose excursions. CGM uncovers glucose patterns that common SBGM patterns cannot. CDE = certified diabetes educator; CGM = continuous glucose monitoring; HgBA1c = glycosylated hemoglobin; MAD = mean absolute difference; SBGM = self blood glucose monitoring; T1DM = type 1 diabetes; T2DM = type 2 diabetes.

Comparative cytotoxic and genotoxic potential of 13 drinking water disinfection by-products using a microplate-based cytotoxicity assay and a developed SOS/umu assay.

PubMed

Zhang, Shao-Hui; Miao, Dong-Yue; Tan, Li; Liu, Ai-Lin; Lu, Wen-Qing

2016-01-01

The implications of disinfection by-products (DBPs) present in drinking water are of public health concern because of their potential mutagenic, carcinogenic and other toxic effects on humans. In this study, we selected 13 main DBPs found in drinking water to quantitatively analyse their cytotoxicity and genotoxicity using a microplate-based cytotoxicity assay and a developed SOS/umu assay in Salmonella typhimurium TA1535/pSK1002. With the developed SOS/umu test, eight DBPs: 3-chloro-4-(dichloromethyl)-5-hydroxy-2[5H]-fura3-chloro-4-(dichloromethyl)-5-hydroxy-2-[5H]-furanone (MX), dibromoacetonitrile (DBN), iodoacetic acid (IA), bromochloroacetonitrile (BCN), bromoacetic acid (BA), trichloroacetonitrile (TCN), dibromoacetic acid (DBA) and dichloroacetic acid (DCA) were significantly genotoxic to S. typhimurium. Three DBPs: chloroacetic acid (CA), trichloroacetic acid (TCA) and dichloroacetonitrile (DCN) were weakly genotoxic, whereas the remaining DBPs: chloroacetonitrile (CN) and chloral hydrate (CH) were negative. The rank order in decreasing genotoxicity was as follows: MX > DBN > IA > BCN > BA > TCN > DBA > DCA > CA, TCA, DCN > CN, CH. MX was approximately 370 000 times more genotoxic than DCA. In the microplate-based cytotoxicity assay, cytotoxic potencies of the 13 DBPs were compared and ranked in decreasing order as follows: MX > IA > DBN > BCN > BA > TCN > DCN > CA > DCA > DBA > CN > TCA > CH. MX was approximately 19 200 times more cytotoxic than CH. A statistically significant correlation was found between cytotoxicity and genotoxicity of the 13 DBPs in S. typhimurium. Results suggest that microplate-based cytotoxicity assay and the developed SOS/umu assay are feasible tools for analysing the cytotoxicity and genotoxicity of DBPs, particularly for comparing their toxic intensities quantitatively. © The Author 2015. Published by Oxford University Press on behalf of the UK Environmental Mutagen Society. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

The nature of the F str lambda 4077 stars. 3: Spectroscopy of the barium dwarfs and other CP stars

NASA Technical Reports Server (NTRS)

North, P.; Berthet, S.; Lanz, T.

1994-01-01

The abundances of C, O, Al, Ca, iron-peak and s-process elements have been derived from high-resolution spectra for a sample of stars classified as F str lambda 4077 by Bidelman. Among the 20 stars mentioned by Bidelman, we have discovered 8 barium dwarfs (or CH subgiants, according to Bond's terminology), while a 9th star, HD 182274, was already known as a CH subgiant. In addition, we have analyzed three barium stars taken from the list of Lu et al. (1983) which are probably dwarfs rather than giants, and three CH subgiants. The other 11 F str lambda 4077 stars resemble either the delta Delphini stars, since their iron abundance is enhanced while Ca is normal, or are probably spectrum composites. A few Am, Ap, lambda Bootis and normal stars have been analyzed for comparison. In particular, we have included three lambda Boo candidates, selected from their photometric properties, and their iron deficiency is confirmed. The spectroscopic, photometric and statistical evidences concerning the Ba dwarfs, support the idea that these stars may be the main sequence counterparts, and possibly the progenitors of the Ba giants. The C/O ratio varies in these stars from normal values to a maximum of 1.5, but mostly within 0.6 and 1.2. Some of these objects may therefore be considered, in this sense, as carbon stars. On the other hand, the abundances of carbon and s-process elements relative to iron are inversely correlated with metallicity, and may even exceed significantly those of typical, solar-metallicity carbon stars. Metal-deficient C stars must therefore have (C/Fe) greater than or approximately equal to 1 and (s/Fe) greater than or approximately equal to 1.5 as soon as (Fe/H) less than or approximately equal to -1. The neutron exposure is shown to increase when the metallicity decreases, which is compatible with the C-13 (alpha, n) O-16 neutron source, but not with the Ne-22 (alpha, n) Mg-25 one. The evolutionary state (within the main sequence) of the Ba dwarfs, is rediscussed in relation with their photometric and spectroscopic surface gravity, but it remains unclear.

First-principles calculations of novel materials

NASA Astrophysics Data System (ADS)

Sun, Jifeng

Computational material simulation is becoming more and more important as a branch of material science. Depending on the scale of the systems, there are many simulation methods, i.e. first-principles calculation (or ab-initio), molecular dynamics, mesoscale methods and continuum methods. Among them, first-principles calculation, which involves density functional theory (DFT) and based on quantum mechanics, has become to be a reliable tool in condensed matter physics. DFT is a single-electron approximation in solving the many-body problems. Intrinsically speaking, both DFT and ab-initio belong to the first-principles calculation since the theoretical background of ab-initio is Hartree-Fock (HF) approximation and both are aimed at solving the Schrodinger equation of the many-body system using the self-consistent field (SCF) method and calculating the ground state properties. The difference is that DFT introduces parameters either from experiments or from other molecular dynamic (MD) calculations to approximate the expressions of the exchange-correlation terms. The exchange term is accurately calculated but the correlation term is neglected in HF. In this dissertation, DFT based first-principles calculations were performed for all the novel materials and interesting materials introduced. Specifically, the DFT theory together with the rationale behind related properties (e.g. electronic, optical, defect, thermoelectric, magnetic) are introduced in Chapter 2. Starting from Chapter 3 to Chapter 5, several representative materials were studied. In particular, a new semiconducting oxytelluride, Ba2TeO is studied in Chapter 3. Our calculations indicate a direct semiconducting character with a band gap value of 2.43 eV, which agrees well with the optical experiment (˜ 2.93 eV). Moreover, the optical and defects properties of Ba2TeO are also systematically investigated with a view to understanding its potential as an optoelectronic or transparent conducting material. We find relatively modest band masses for both electrons and holes suggesting applications. Optical properties show a infrared-red absorption when doped. This could potentially be useful for combining wavelength filtering and transparent conducting functions. Furthermore, our defect calculations show that Ba 2TeO is intrinsically p-type conducting under Ba-poor condition. However, the spontaneous formation of the donor defects may constrain the p-type transport properties and would need to be addressed to enable applications. Chapter 4 mainly devotes to the thermoelectric properties of the famous phase change material, Ge2Sb2Te5 (GST). GST has been used in data storage for more than a decade because of their fast phase switching between metastable crystalline (cubic) and amorphous phases. It also exhibits interesting thermoelectric properties, and we did a systematic study on the two crystalline phases (hexagonal and cubic) and the amorphous phase. We found a high Seebeck coefficient with a broad doping concentrations for both n-type and p-type, at and below room temperatures (300 K) for both the cubic and amorphous phases. This finding will be of crucial interests in further understand the thermoelectric properties experimentally and find device applications in the ultimate goal. Several magnetic materials that involve lanthanide elements are reported in Chapter 5. First of all, the electronic and magnetic properties of the BaLn2O4 (Ln = La-Lu, Y) family compound are studied. The series has been synthesized for the first time in single crystalline form, using a molten metal flux. They crystallize in the CaV 2O4 structure type with primitive orthorhombic symmetry (space group Pnma, #62). Our calculations show an insulating character with band gaps ranging from 3 eV to 4.5 eV for the three representative compounds, BaLa2O4, BaGd2O4 and BaLu 2O4. Moreover, the superexchange magnetism is also studied. Secondly, a strong correlated system with cerium is investigated. As expected, we find a value of 15 states eV-1 that stems from the Ce 4f orbitals at the Fermi energy which indicates intermetallic heavy fermion behavior. The Fermi surface calculation shows nesting feature which might be useful to further understand the antiferromagnetic magnetism. Thirdly, the DFT calculations of another lanthanide oxide involving transition element, LaMo16O44, are also presented. This material crystallizes with a complicated crystal structure consists of MoO6 magnetic clusters. The band structure calculations indicate a spin-polarized half metal feature that comes from different crystallographic sites of Mo since La occurs as trivalent with empty f shell thus no contribution to the magnetic moment. Last but not least, we studied the electronic properties of another newly found oxytellride that having lanthanide, Ba3Yb 2O5Te. We find a insulating behavior with a direct band-gap value of 1.9 eV using the DFT+U methodology.

Microcephaly in north-east Brazil: a retrospective study on neonates born between 2012 and 2015

PubMed Central

Soares de Araújo, Juliana Sousa; Regis, Cláudio Teixeira; Gomes, Renata Grigório Silva; Tavares, Thiago Ribeiro; Rocha dos Santos, Cícera; Assunção, Patrícia Melo; Nóbrega, Renata Valéria; Pinto, Diana de Fátima Alves; Bezerra, Bruno Vinícius Dantas

2016-01-01

Abstract Objective To assess the number of children born with microcephaly in the State of Paraíba, north-east Brazil. Methods We contacted 21 maternity centres belonging to a paediatric cardiology network, with access to information regarding more than 100 000 neonates born between 1 January 2012 and 31 December 2015. For 10% of these neonates, nurses were requested to retrieve head circumference measurements data from delivery-room books. We used three separate criteria to classify whether a neonate had microcephaly: (i) the Brazilian Ministry of Health proposed criterion: term neonates (gestational age ≥ 37 weeks) with a head circumference of less than 32 cm; (ii) Fenton curves: neonates with a head circumference of less than −3 standard deviation for age and gender; or (iii) the proportionality criterion: neonates with a head circumference of less than ((height/2))+10) ± 2. Findings Between 1 and 31 December 2015, nurses obtained data for 16 208 neonates. Depending on which criterion we used, the number of neonates with microcephaly varied from 678 to 1272 (4.2–8.2%). Two per cent (316) of the neonates fulfilled all three criteria. We observed temporal fluctuations of microcephaly prevalence from late 2012. Conclusion The numbers of microcephaly reported here are much higher than the 6.4 per 10 000 live births reported by the Brazilian live birth information system. The results raise questions about the notification system, the appropriateness of the diagnostic criteria and future implications for the affected children and their families. More studies are needed to understand the epidemiology and the implications for the Brazilian health system. PMID:27821886

Microcephaly in north-east Brazil: a retrospective study on neonates born between 2012 and 2015.

PubMed

Soares de Araújo, Juliana Sousa; Regis, Cláudio Teixeira; Gomes, Renata Grigório Silva; Tavares, Thiago Ribeiro; Rocha Dos Santos, Cícera; Assunção, Patrícia Melo; Nóbrega, Renata Valéria; Pinto, Diana de Fátima Alves; Bezerra, Bruno Vinícius Dantas; Mattos, Sandra da Silva

2016-11-01

To assess the number of children born with microcephaly in the State of Paraíba, north-east Brazil. We contacted 21 maternity centres belonging to a paediatric cardiology network, with access to information regarding more than 100 000 neonates born between 1 January 2012 and 31 December 2015. For 10% of these neonates, nurses were requested to retrieve head circumference measurements data from delivery-room books. We used three separate criteria to classify whether a neonate had microcephaly: (i) the Brazilian Ministry of Health proposed criterion: term neonates (gestational age ≥ 37 weeks) with a head circumference of less than 32 cm; (ii) Fenton curves: neonates with a head circumference of less than -3 standard deviation for age and gender; or (iii) the proportionality criterion: neonates with a head circumference of less than ((height/2))+10) ± 2. Between 1 and 31 December 2015, nurses obtained data for 16 208 neonates. Depending on which criterion we used, the number of neonates with microcephaly varied from 678 to 1272 (4.2-8.2%). Two per cent (316) of the neonates fulfilled all three criteria. We observed temporal fluctuations of microcephaly prevalence from late 2012. The numbers of microcephaly reported here are much higher than the 6.4 per 10 000 live births reported by the Brazilian live birth information system. The results raise questions about the notification system, the appropriateness of the diagnostic criteria and future implications for the affected children and their families. More studies are needed to understand the epidemiology and the implications for the Brazilian health system.

Predictability of tick-borne encephalitis fluctuations.

PubMed

Zeman, P

2017-10-01

Tick-borne encephalitis is a serious arboviral infection with unstable dynamics and profound inter-annual fluctuations in case numbers. A dependable predictive model has been sought since the discovery of the disease. The present study demonstrates that four superimposed cycles, approximately 2·4, 3, 5·4, and 10·4 years long, can account for three-fifths of the variation in the disease fluctuations over central Europe. Using harmonic regression, these cycles can be projected into the future, yielding forecasts of sufficient accuracy for up to 4 years ahead. For the years 2016-2018, this model predicts elevated incidence levels in most parts of the region.

The extreme ultraviolet spectrograph: A radial groove grating, sounding rocket-borne, astronomical instrument

NASA Technical Reports Server (NTRS)

Wilkinson, Erik; Green, James C.; Cash, Webster

1993-01-01

The design, calibration, and sounding rocket flight performance of a novel spectrograph suitable for moderate-resolution EUV spectroscopy are presented. The sounding rocket-borne instrument uses a radial groove grating to maintain a high system efficiency while controlling the aberrations induced when doing spectroscopy in a converging beam. The instrument has a resolution of approximately 2 A across the 200-330 A bandpass with an average effective area of 2 sq cm. The instrument, called the Extreme Ultraviolet Spectrograph, acquired the first EUV spectra in this wavelength region of the hot white dwarf G191-B2B and the late-type star Capella.

Flow-Through Leaching of Marine Barite: New Insights on its Composition and Diagenesis

NASA Astrophysics Data System (ADS)

Hsieh, C.; Torres, M. E.; Ungerer, A.; Klinkhammer, G. P.

2007-12-01

The distribution of stable mineral barite (BaSO4) in marine sediments has long been studied as a proxy for paleoproductivity. It is important to investigate the variation in Sr/Ba ratios of crystal barite, as it has a great influence on barite solubility and its early diagenetic processes. In addition, the role of alternative barium carriers to the sediments (e.g. aluminum silicates and oxyhydroxides) and their contributions to overall barium budget and burial efficiency need to be resolved. The techniques currently used to describe and quantify barium phases are all based on batch leaching techniques that define barium phases operationally, not chemically. Because during batch analyses each phase is characterized by a single-point measurement, variations due to phase heterogeneities cannot be resolved; nor can the results of these experiments be related in any systematic way to what happens in nature. To overcome this problem, we are developing a flow-through method that makes use of automated chromatographic techniques, which allows complete monitoring of the dissolution of barite samples with time-resolved analysis (TRA) as each phase is sequentially leached using different reagents. We have analyzed a barite sample recovered from seeps along the San Clemente escarpment, and show that we can attain complete dissolution of the sample (>85%) in 2 hours, using DTPA at 80°C. Approximately 100 μg of barite are first leached with distilled water (pH 5) for 30 minutes. During this step ~2% of the barite is removed. This highly soluble phase has Sr/Ba ratios that range from 30 to 120 mmol/mol. Acid leaching of the samples with 10 mM HNO3 removes an additional 4~8% of the barite, and this phase has Sr/Ba ratios ranging from 13 to 35 mmol/mol. Higher acid concentration (100 mM HNO3) dissolves up to 40% of the barite. These results are consistent with electron microprobe data that show clear oscillatory zoning of the (Ba,Sr)SO4. Unlike the barite sample, sediment samples collected at the base of the escarpment did not show a Ba release in the water leach. We might speculate that the highly susceptible Sr-rich barium phase present in the barite sample, dissolved during transport from a seep site leaving a barite with a lower Sr/Ba ratio, as found in the sediment samples. Our analytical approach has the potential to further address a variety of outstanding questions on the complex geochemical cycle of barium and its applications to climate change, upper ocean fertility and ocean circulation through time.

Reliability Studies of Ceramic Capacitors.

DTIC Science & Technology

1983-07-01

increases. This case has been found to be a good approximation for single crystals with high chemical and structural purity. Shallow traps may arise as a...theory, this sudden increase may be otherwise explained. Single crystals of ZnS have been found to exhibit this vertical increase in the current...Smith and Rose observed SCLC behavior in CdS single crystals . Branwood and Tredgold 2 8 and Branwood et al. 2 9 measured BaTiO 3 single crystals and

First Responder Problem Solving and Decision Making in Today’s Asymmetrical Environment

DTIC Science & Technology

2008-03-01

Scenario: Earthquake 4 It is January 2, 2008, and you are working a day-tour in Ladder Company 999 located in Queens, New York. • Ladder 999’s...able to perform both. 121 Scenario: Earthquake 4 You find out that at approximately 8:58 am, the New York City area...RESPONDER PROBLEM SOLVING AND DECISION MAKING IN TODAY’S ASYMMETRICAL ENVIRONMENT Neil R. Hintze Battalion Chief, New York City Fire Department B.A

Full-Genome Characterisation of Orungo, Lebombo and Changuinola Viruses Provides Evidence for Co-Evolution of Orbiviruses with Their Arthropod Vectors

PubMed Central

Mohd Jaafar, Fauziah; Belhouchet, Mourad; Belaganahalli, Manjunatha; Tesh, Robert B.; Mertens, Peter P. C.; Attoui, Houssam

2014-01-01

The complete genomes of Orungo virus (ORUV), Lebombo virus (LEBV) and Changuinola virus (CGLV) were sequenced, confirming that they each encode 11 distinct proteins (VP1-VP7 and NS1-NS4). Phylogenetic analyses of cell-attachment protein ‘outer-capsid protein 1′ (OC1), show that orbiviruses fall into three large groups, identified as: VP2(OC1), in which OC1 is the 2nd largest protein, including the Culicoides transmitted orbiviruses; VP3(OC1), which includes the mosquito transmitted orbiviruses; and VP4(OC1) which includes the tick transmitted viruses. Differences in the size of OC1 between these groups, places the T2 ‘subcore-shell protein’ as the third largest protein ‘VP3(T2)’ in the first of these groups, but the second largest protein ‘VP3(T2)’ in the other two groups. ORUV, LEBV and CGLV all group with the Culicoides-borne VP2(OC1)/VP3(T2) viruses. The G+C content of the ORUV, LEBV and CGLV genomes is also similar to that of the Culicoides-borne, rather than the mosquito-borne, or tick borne orbiviruses. These data suggest that ORUV and LEBV are Culicoides- rather than mosquito-borne. Multiple isolations of CGLV from sand flies suggest that they are its primary vector. OC1 of the insect-borne orbiviruses is approximately twice the size of the equivalent protein of the tick borne viruses. Together with internal sequence similarities, this suggests its origin by duplication (concatermerisation) of a smaller OC1 from an ancestral tick-borne orbivirus. Phylogenetic comparisons showing linear relationships between the dates of evolutionary-separation of their vector species, and genetic-distances between tick-, mosquito- or Culicoides-borne virus-groups, provide evidence for co-evolution of the orbiviruses with their arthropod vectors. PMID:24475112

High hardness BaCb-(BxOy/BN) composites with 3D mesh-like fine grain-boundary structure by reactive spark plasma sintering.

PubMed

Vasylkiv, Oleg; Borodianska, Hanna; Badica, Petre; Grasso, Salvatore; Sakka, Yoshio; Tok, Alfred; Su, Liap Tat; Bosman, Michael; Ma, Jan

2012-02-01

Boron carbide B4C powders were subject to reactive spark plasma sintering (also known as field assisted sintering, pulsed current sintering or plasma assisted sintering) under nitrogen atmosphere. For an optimum hexagonal BN (h-BN) content estimated from X-ray diffraction measurements at approximately 0.4 wt%, the as-prepared BaCb-(BxOy/BN) ceramic shows values of Berkovich and Vickers hardness of 56.7 +/- 3.1 GPa and 39.3 +/- 7.6 GPa, respectively. These values are higher than for the vacuum SPS processed B4C pristine sample and the h-BN -mechanically-added samples. XRD and electronic microscopy data suggest that in the samples produced by reactive SPS in N2 atmosphere, and containing an estimated amount of 0.3-1.5% h-BN, the crystallite size of the boron carbide grains is decreasing with the increasing amount of N2, while for the newly formed lamellar h-BN the crystallite size is almost constant (approximately 30-50 nm). BN is located at the grain boundaries between the boron carbide grains and it is wrapped and intercalated by a thin layer of boron oxide. BxOy/BN forms a fine and continuous 3D mesh-like structure that is a possible reason for good mechanical properties.

Density functional theory of electron transfer beyond the Born-Oppenheimer approximation: Case study of LiF

NASA Astrophysics Data System (ADS)

Li, Chen; Requist, Ryan; Gross, E. K. U.

2018-02-01

We perform model calculations for a stretched LiF molecule, demonstrating that nonadiabatic charge transfer effects can be accurately and seamlessly described within a density functional framework. In alkali halides like LiF, there is an abrupt change in the ground state electronic distribution due to an electron transfer at a critical bond length R = Rc, where an avoided crossing of the lowest adiabatic potential energy surfaces calls the validity of the Born-Oppenheimer approximation into doubt. Modeling the R-dependent electronic structure of LiF within a two-site Hubbard model, we find that nonadiabatic electron-nuclear coupling produces a sizable elongation of the critical Rc by 0.5 bohr. This effect is very accurately captured by a simple and rigorously derived correction, with an M-1 prefactor, to the exchange-correlation potential in density functional theory, M = reduced nuclear mass. Since this nonadiabatic term depends on gradients of the nuclear wave function and conditional electronic density, ∇Rχ(R) and ∇Rn(r, R), it couples the Kohn-Sham equations at neighboring R points. Motivated by an observed localization of nonadiabatic effects in nuclear configuration space, we propose a local conditional density approximation—an approximation that reduces the search for nonadiabatic density functionals to the search for a single function y(n).

Polycyclic aromatic hydrocarbons in mountain soils of the subtropical Atlantic.

PubMed

Ribes, A; Grimalt, J O; Torres García, C J; Cuevas, E

2003-01-01

Surface soil samples from various altitudes on Tenerife Island, ranging from sea level up to 3400 m above mean sea level, were analyzed to study the distribution of 26 polycyclic aromatic hydrocarbons (PAHs) in a remote subtropical area. The stable atmospheric conditions in this island define three vertically stratified layers: marine boundary, trade-wind inversion, and free troposphere. Total PAH concentrations, 1.9 to 6000 microg/kg dry wt., were high when compared with those in tropical areas and in a similar range to those in temperate areas. In the marine boundary layer, fluoranthene (Fla), pyrene (Pyr), benz [a]anthracene (BaA), and chrysene (C + T) were largely dominant. The predominance of Fla over Pyr may reflect photo-oxidative processes during atmospheric transport, although coal combustion inputs cannot be excluded. The PAHs found in higher concentration in the soils from the inversion layer were benzo[b + j]fluoranthene (BbjF) + benzo[k]fluoranthene (BkF) > benzo[e]pyrene (BeP) approximately indeno[1,2, 3-cd]pyrene (Ind) > benzo[a]pyrene (BaP) approximately benzo[ghi]perylene (Bghi) > coronene (Cor) approximately dibenz[a,h]anthracene (Dib), reflecting that high temperatures and insolation prevent the accumulation of PAHs more volatile than BbjF in significant amounts. These climatic conditions involve a process of standardization that prevents the identification of specific PAH sources such as traffic, forest fires, or industrial inputs. Only soils with high total organic carbon (TOC) (e.g., 10-30%) preserve the more volatile compounds such as phenanthrene (Phe), methylphenanthrenes (MPhe), dimethylphenanthrenes (DMPhe), and retene (Ret). However, no relation between PAHs and soil TOC and black carbon (BC) was found. The specific PAH distributions of the free tropospheric region suggest a direct input from pyrolytic processes related to the volcanic emission of gases in Teide.

TeV electron measurement with CREST experiment

NASA Astrophysics Data System (ADS)

Park, Nahee; Anderson, T.; Bower, C.; Coutu, S.; Gennaro, J.; Geske, M.; Muller, D.; Musser, J.; Nutter, S.

CREST, the Cosmic Ray Electron Synchrotron Telescope is a balloon-borne experiment de-signed to measure the spectrum of multi-TeV electrons by the detection of the x-ray synchrotron photons generated in the magnetic field of the Earth. Electrons in the TeV range are expected to reflect the properties of local sources because fluxes from remote locations are suppressed by radiative losses during propagation. Since CREST needs to intersect only a portion of the kilometers-long trail of photons generated by the high-energy electron, the method yields a larger effective area than the physical size of the detector, boosting detection areas. The in-strument is composed of an array of 1024 BaF2 crystals and a set of scintillating veto counters. A long duration balloon flight in Antarctica is currently planned for the 2010-11 season.

Infant born preterm have delayed development of adaptive postural control in the first 5 months of life.

PubMed

Dusing, Stacey C; Thacker, Leroy R; Galloway, James C

2016-08-01

Infants born preterm are at increased risk of developmental disabilities, that may be attributed to their early experiences and ability to learn. The purpose of this paper was to evaluate the ability of infants born preterm to adapt their postural control to changing task demands. This study included 18 infants born at 32 weeks of gestation or less whose posture was compared in supine under 2 conditions, with and without a visual stimulus presented. The postural variability, measured with root mean squared displacement of the center of pressure, and postural complexity, measured with the approximate entropy of the center of pressure displacement were measured longitudinally from 2.5 to 5 months of age. The infants looked at the toys in midline for several months prior to adapting their postural variability in a manner similar to full term infants. Only after postural variability was reduced in both the caudal cephalic and medial lateral direction in the toy condition did the infants learn to reach for the toy. Postural complexity did not vary between conditions. These findings suggest that infants used a variety of strategies to control their posture. In contrast to research with infants born full term, the infants born preterm in this study did not identify the successful strategy of reducing movement of the center of pressure until months after showing interest in the toy. This delayed adaptation may impact the infants ability to learn over time. Copyright © 2016 Elsevier Inc. All rights reserved.

THE NATIONAL CHILDREN'S STUDY: BEGINNING THE IMPLEMENTATION OF A NATIONAL-PROBABILITY SAMPLE

EPA Science Inventory

Introduction: The National Children's Study (NCS) is a longitudinal cohort study that will follow a sample of approximately 100,000 children born in the United States from before birth until 21 years of age. The NCS will investigate the separate and combined effects of environmen...

Helping Young Hispanic Learners

ERIC Educational Resources Information Center

Garcia, Eugene E.; Jensen, Bryant

2007-01-01

Hispanics are the largest and youngest ethnic group in the United States. Moreover, young Hispanic children make up approximately 80 percent of the U.S. English language learner population. They are a heterogeneous group, born both inside and outside the United States and having origins in Mexico, Cuba, Central America, South America, and the…

Johanna and Tommy: Two Preschoolers in Sweden with Brittle Bones.

ERIC Educational Resources Information Center

Millde, Kristina; Brodin, Jane

Information is presented for caregivers of Swedish children with osteogenesis imperfecta (brittle bones) and their families. Approximately five children with brittle bones are born in Sweden annually. Two main types of brittle bone disease have been identified: congenita and tarda. Typical symptoms include numerous and unexpected fractures, bluish…

Earth Observation

NASA Image and Video Library

2014-05-31

ISS040-E-006165 (31 May 2014 ) --- One of the Expedition 40 crew members aboard the International Space Station photographed this nadir image of the volcanic-born Banks Peninsula, on the east coast of the South Island of New Zealand on May 31, 2014. Banks Peninsula covers an area of approximately 1,150 square kilometers.

Combined active and passive microwave remote sensing of vegetated surfaces at l-band

USDA-ARS?s Scientific Manuscript database

In previous work the distorted Born approximation (DBA) of volume scattering was combined with the numerical solutions of Maxwell equations (NMM3D) for a rough surface to calculate the radar backscattering coefficient for the Soil Moisture Active Passive (SMAP) mission. The model results were valida...

Leucine is a major regulator of muscle protein synthesis in neonates

USDA-ARS?s Scientific Manuscript database

Approximately 10 % of infants born in the United States are of low birth weight. Growth failure during the neonatal period is a common occurrence in low birth weight infants due to their inability to tolerate full feeds, concerns about advancing protein supply, and high nutrient requirements for gro...

Flux pinning landscape up to 25 T in SmBa2Cu3O y films with BaHfO3 nanorods fabricated by low-temperature growth technique

NASA Astrophysics Data System (ADS)

Tsuchiya, Yuji; Miura, Shun; Awaji, Satoshi; Ichino, Yusuke; Matsumoto, Kaname; Izumi, Teruo; Watanabe, Kazuo; Yoshida, Yutaka

2017-10-01

REBa2Cu3O y superconducting tapes are appropriate for high field magnet applications at low temperatures (i.e. below liquid nitrogen temperature). To clarify the morphology and the volume of the effective pinning center at low temperatures, we used a low-temperature growth technique to fabricate SmBa2Cu3O y (SmBCO) films with various amounts of BaHfO3 (BHO) nanorods onto MgO-buffered metal substrates produced by ion-beam-assisted deposition; we investigated their flux pinning properties using a 25 T cryogen-free superconducting magnet that was recently developed at Tohoku University. According to the microstructural analysis using transmission electron microscopy, the BHO nanorods have a content-dependent morphology and are aligned for the higher content. The inclined and discontinuous BHO nanorods were observed in SmBCO films with BHO contents up to 3.8 vol%; they show an excellent flux pinning force density (1.5 TN m-3 at 21 T and 4.2 K) even when the magnetic field is perpendicular to the films. Based on the effective mass model for the flux pinning, the random pinning centers are dominant at low temperatures. The correlated flux pinning is stronger for aligned nanorods; however, the random pinning center becomes weaker in the 4.5 vol% BHO-doped films. Therefore, the optimal BHO doping level is approximately 3.8 vol% in terms of the amplitude of the critical current density and the anisotropy from 4.2 K to 20 K because this provides the best mixture of correlated and random flux pinning centers.

Electronic structure and the van Hove singularity scenario in high-T(sub c)H(g)Ba2CuO(4+delta) superconductors

NASA Technical Reports Server (NTRS)

Agrawal, Bal K.; Agrawal, Savitri

1995-01-01

The electronic structure and the hole concentrations in the high Tc superconductor HgBa2CuO(4+delta) (delta = O, 1) has been investigated by employing a first principles full potential self-consistent LMTO method with the local density functional theory. The scalar relativistic effects have been considered. The hole concentrations of the Cu-d and O-p(x,y) orbitals are seen to be larger for the HgBaCuO5 system than those of the HgBaCuO4 solid. However, the van Hove singularity (vHs) induced Cu-d and O-p peak which is seen to lie comparatively away and above the Fermi level in the delta = 1 system shifts towards the Fermi level in the delta = 0 system. Thus, the superconducting behavior appears to originate from the occurrence of the vHs peak at the Fermi level. The Fermi surface nesting area in the delta = 0 compound is seen to be larger than in the delta = 1 compound. The calculation reveals that the increase in pressure on the crystal enhances the hole concentrations but without showing any optimum value, On the other hand, the vHs peak approaches to-wards the Fermi level with pressure and crosses the Fermi surface near V/Vo approximately equals 0.625 (V and Vo are the crystal volumes at high and normal pressures, respectively). Our calculated value of the bulk modulus equal to 0.626 Mbar predicts the occurrence of this crossover at about 24 GPa which is in complete agreement with the experimental value. At this pressure the compound has maximum nesting area and self-doped behavior.

Influence of glucosamine on the bioactivity of insulin delivered subcutaneously and in an oral nanodelivery system

PubMed Central

Al-Kurdi, Zakieh I; Chowdhry, Babur Z; Leharne, Stephen A; Qinna, Nidal A; Al Omari, Mahmoud MH; Badwan, Adnan A

2015-01-01

The aim of the work reported herein was to study the effect of glucosamine HCl (GlcN·HCl) on the bioactivity (BA) of insulin, administered via subcutaneous (SC) and oral routes, in adult male Sprague Dawley rats. The oral insulin delivery system (insulin–chitosan reverse micelle [IC-RM]) was prepared by solubilizing insulin–chitosan (13 kDa) polyelectrolyte complex in a RM system consisting of oleic acid, PEG-8 caprylic/capric glycerides, and polyglycerol-6-dioleate. The BA of insulin in vivo was evaluated by measuring blood glucose level using a blood glucose meter; the results revealed that the extent of hypoglycemic activity of SC insulin was GlcN·HCl dose dependent when they were administered simultaneously. A significant reduction in blood glucose levels (P<0.05) was found for the insulin:GlcN·HCl at mass ratios of 1:10 and 1:20, whereas lower ratios (eg, 1:1 and 1:4) showed no significant reduction. Furthermore, enhancement of the action of SC insulin was achieved by oral administration of GlcN·HCl for 5 consecutive days prior to insulin injection (P<0.05). For oral insulin administration via the IC-RM system, the presence of GlcN·HCl increased the hypoglycemic activity of insulin (P<0.05). The relative BA were 6.7% and 5.4% in the presence and absence of GlcN·HCl (ie, the increase in the relative BA was approximately 23% due to incorporating GlcN·HCl in the IC-RM system), respectively. The aforementioned findings offer an opportunity to incorporate GlcN·HCl in oral insulin delivery systems in order to enhance a reduction in blood glucose levels. PMID:26640369

Competition between agricultural, urban, and sand-mining areas at the Paraíba do Sul basin in southeastern Brazil

NASA Astrophysics Data System (ADS)

Ronquim, Carlos C.; Cordeiro, Guilherme P. L.; Amorim, Mariana de; de C. Teixeira, Antônio H.; Leivas, Janice F.; Galdino, Sergio

2017-10-01

This work was performed in the Paraíba do Sul basin, within the limits of the São Paulo state, southeastern Brazil, in order to assess the dynamics of the land-use and land-cover changes at the Paraíba do Sul river's floodplains between 1985 and 2016. We focused on investigating the development of agricultural areas used for the production of wetland rice and of areas featuring artificial lakes produced by sand mining. We mapped the land cover in 1985 using images made by the Landsat 5 satellite's Moderate Resolution Imaging Spectroradiometer (MODIS) and Thematic Mapper (TM) sensors, which were segmented to produce vectors featuring homogeneous characteristics, and which were classified by means of visual interpretation. Similarly, we applied the maximum likelihood classification and used spectral curve inserts and adjustments to study and analyze the same area using a Landsat 8's Operational Land Imager (OLI) image made in 2016. Our results show significant reduction of areas used for rice crops, and increase in areas featuring sandmining pits. The rice crop areas decreased approximately 43% from 24,131.4 ha in 1985 to 13,789.8 ha in 2016. Over this 30-year period, the area covered by sand-mining lakes increased from 615 ha to 3,876 ha (+ 630%), and the number of lakes increased from 54 to 316. Sand mining and urbanization are the main factors causing the reduction in wetland rice areas. The absence of environmental management actions at the basin interferes with the rice production, which depends on the Paraíba do Sul river's floodplains.

Analysis of Sr{sub 5{minus}x}Ba{sub x}(PO{sub 4}){sub 3}F:Yb{sup 3+} crystals for improved laser performance with diode-pumping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schaffers, K.I.; Bayramian, A.J.; Marshall, C.D.

Crystals of Yb{sup 3+}:Sr{sub 1-x}Ba{sub x}(PO{sub 4}){sub 3}F (0 < x < 5) have been investigated as a means to obtain broader absorption bands than are currently available with Yb{sup 3+}:S-FAP [Yb{sup 3+}: Sr{sub 5}(PO{sub 4}){sub 3}F], thereby improving diode-pumping efficiency for high peak power applications. Large diode-arrays have a FWHM pump band of >5 nm while the FWHM of the 900 nm absorption band for Yb:S-FAP is 5.5 nm; therefore, a significant amount of pump power can be wasted due to the nonideal overlap. Spectroscopic analysis of Yb:Sr{sub 5-x}Ba{sub x}-FAP crystals indicates that adding barium to the lattice increasesmore » the pump band to 13-16 run which more than compensates for the diode-array pump source without a detrimental reduction in absorption cross section. However, the emission cross section decreases by approximately half with relatively no effect on the emission lifetime. The small signal gain has also been measured and compared to the parent material Yb:S-FAP and emission cross sections have been determined by the method of reciprocity, the Filchtbauer-Ladenburg method, and small signal gain. Overall, Yb{sup 3+}:Sr{sub 5-x}Ba{sub x}(PO{sub 4}){sub 3}F crystals appear to achieve the goal of nearly matching the favorable thermal and laser performance properties of Yb:S-FAP while having a broader absorption band to better accommodate diode pumping.« less

Inelastic cross sections for low-energy electrons in liquid water: exchange and correlation effects.

PubMed

Emfietzoglou, Dimitris; Kyriakou, Ioanna; Garcia-Molina, Rafael; Abril, Isabel; Nikjoo, Hooshang

2013-11-01

Low-energy electrons play a prominent role in radiation therapy and biology as they are the largest contributor to the absorbed dose. However, no tractable theory exists to describe the interaction of low-energy electrons with condensed media. This article presents a new approach to include exchange and correlation (XC) effects in inelastic electron scattering at low energies (below ∼10 keV) in the context of the dielectric theory. Specifically, an optical-data model of the dielectric response function of liquid water is developed that goes beyond the random phase approximation (RPA) by accounting for XC effects using the concept of the many-body local-field correction (LFC). It is shown that the experimental energy-loss-function of liquid water can be reproduced by including into the RPA dispersion relations XC effects (up to second order) calculated in the time-dependent local-density approximation with the addition of phonon-induced broadening in N. D. Mermin's relaxation-time approximation. Additional XC effects related to the incident and/or struck electrons are included by means of the vertex correction calculated by a modified Hubbard formula for the exchange-only LFC. Within the first Born approximation, the present XC corrections cause a significantly larger reduction (∼10-50%) to the inelastic cross section compared to the commonly used Mott and Ochkur approximations, while also yielding much better agreement with the recent experimental data for amorphous ice. The current work offers a manageable, yet rigorous, approach for including non-Born effects in the calculation of inelastic cross sections for low-energy electrons in liquid water, which due to its generality, can be easily extended to other condensed media.

Immunological control of ticks and tick-borne diseases that impact cattle health and production.

PubMed

Almazan, Consuelo; Tipacamu, Gabriela Aguilar; Rodriguez, Sergio; Mosqueda, Juan; Perez de Leon, Adalberto

2018-03-01

The cattle industry is one of the most important agroeconomic activities in Mexico. The national herd is estimated to include approximately 33.5. million head of cattle. Ticks and tick-borne diseases are principal factors with a negative impact on cattle health and production. The most economically important tick species parasitizing cattle in Mexico are Rhipicephalus microplus , R. annulatus , and Amblyomma mixtum . Parasitism by ticks affects cattle health and production directly. Morbidity and mortality caused by tick-borne diseases augment the detrimental effect of tick infestation in cattle. Bovine babesiosis and anaplasmosis are the most important tick-borne diseases of cattle, which are caused by infectious agents transmitted by R. microplus and R. annulatus . However, there are no prophylactic therapies to control bovine babesiosis and anaplasmosis. Chemical control is the most common way to treat animals against ticks, and the use of acaricides can also help manage tick-borne diseases. However, the evolution of resistance to acaricides among cattle tick populations renders chemical control ineffective; which represents a challenge for sustainable ticks and tick-borne diseases control. The only anti-tick vaccine commercially available globally is based on the recombinant antigen Bm86. Because of its mode of immunity against R. microplus and R. annulatus , the Bm86-based vaccine also decreases the exposition of bovines to babesiosis and anaplasmosis. Research with Bm86-based vaccines documented high efficacy against R. annulatus , the efficacy levels against R. microplus varies according to the geographic origin of tick populations, and there is not effect against other ticks species such as Amblyomma spp. The impact of ticks and tick-borne diseases, the problem of chemical control due to acaricide resistance, and progress with anti-tick vaccine research efforts in Mexico are reviewed herein.

Rotational-vibrational coupling in the theory of electron-molecule scattering

NASA Technical Reports Server (NTRS)

Temkin, A.; Sullivan, E. C.

1974-01-01

The adiabatic-nuclei approximation of vibrational-rotational excitation of homonuclear diatomic molecules can be simply augmented to describe the vibrational-rotational coupling by including the dependence of the vibrational wave function on j. Appropriate formulas are given, and the theory, is applied to e-H2 excitation, whereby it is shown that deviations from the simple Born-Oppenheimer approximation measured by Wong and Schultz can be explained. More important, it can be seen that the inclusion of the j-dependent centrifugal term is essential for transitions involving high-rotational quantum numbers.

Systematic study of doping dependence on linear magnetoresistance in p-PbTe

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schneider, J. M.; Chitta, V. A.; Oliveira, N. F.

2014-10-20

We report on a large linear magnetoresistance effect observed in doped p-PbTe films. While undoped p-PbTe reveals a sublinear magnetoresistance, p-PbTe films doped with BaF{sub 2} exhibit a transition to a nearly perfect linear magnetoresistance behaviour that is persistent up to 30 T. The linear magnetoresistance slope ΔR/ΔB is to a good approximation, independent of temperature. This is in agreement with the theory of Quantum Linear Magnetoresistance. We also performed magnetoresistance simulations using a classical model of linear magnetoresistance. We found that this model fails to explain the experimental data. A systematic study of the doping dependence reveals that the linearmore » magnetoresistance response has a maximum for small BaF{sub 2} doping levels and diminishes rapidly for increasing doping levels. Exploiting the huge impact of doping on the linear magnetoresistance signal could lead to new classes of devices with giant magnetoresistance behavior.« less

Relativistic semiempirical-core-potential calculations in Ca+,Sr+ , and Ba+ ions on Lagrange meshes

NASA Astrophysics Data System (ADS)

Filippin, Livio; Schiffmann, Sacha; Dohet-Eraly, Jérémy; Baye, Daniel; Godefroid, Michel

2018-01-01

Relativistic atomic structure calculations are carried out in alkaline-earth-metal ions using a semiempirical-core-potential approach. The systems are partitioned into frozen-core electrons and an active valence electron. The core orbitals are defined by a Dirac-Hartree-Fock calculation using the grasp2k package. The valence electron is described by a Dirac-like Hamiltonian involving a core-polarization potential to simulate the core-valence electron correlation. The associated equation is solved with the Lagrange-mesh method, which is an approximate variational approach having the form of a mesh calculation because of the use of a Gauss quadrature to calculate matrix elements. Properties involving the low-lying metastable D 3 /2 ,5 /2 2 states of Ca+, Sr+, and Ba+ are studied, such as polarizabilities, one- and two-photon decay rates, and lifetimes. Good agreement is found with other theory and observation, which is promising for further applications in alkalilike systems.

Electron-boson spectral density function of correlated multiband systems obtained from optical data: Ba0.6K0.4Fe2As2 and LiFeAs.

PubMed

Hwang, Jungseek

2016-03-31

We introduce an approximate method which can be used to simulate the optical conductivity data of correlated multiband systems for normal and superconducting cases by taking advantage of a reversed process in comparison to a usual optical data analysis, which has been used to extract the electron-boson spectral density function from measured optical spectra of single-band systems, like cuprates. We applied this method to optical conductivity data of two multiband pnictide systems (Ba0.6K0.4Fe2As2 and LiFeAs) and obtained the electron-boson spectral density functions. The obtained electron-boson spectral density consists of a sharp mode and a broad background. The obtained spectral density functions of the multiband systems show similar properties as those of cuprates in several aspects. We expect that our method helps to reveal the nature of strong correlations in the multiband pnictide superconductors.

Neutron scattering studies of the ferroelectric distortion and spin dynamics in the type-1 multiferroic perovskite Sr 0.56 Ba 0.44 MnO 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pratt, Daniel K.; Lynn, Jeffrey W.; Mais, James

2014-10-01

The magnetic order, spin dynamics, and crystal structure of the multiferroic Sr0.56Ba0.44MnO3 have been investigated using neutron and x-ray scattering. Ferroelectricity develops at T-C = 305 K with a polarization of 4.2 mu C/cm(2) associated with the displacements of the Mn ions, while the Mn4+ spins order below T-N approximate to 200 K into a simple G-type commensurate magnetic structure. Below TN the ferroelectric order decreases dramatically, demonstrating that the two order parameters are strongly coupled. The ground state spin dynamics is characterized by a spin gap of 4.6(5) meV and the magnon density of states peaking at 43 meV.more » Detailed spin wave simulations with a gap and isotropic exchange of J = 4.8(2) meV describe the excitation spectrum well. Above TN strong spin correlations coexist with robust ferroelectric order.« less

Photoluminescence and thermoluminescence properties of BaGa2O4

NASA Astrophysics Data System (ADS)

Noto, L. L.; Poelman, D.; Orante-Barrón, V. R.; Swart, H. C.; Mathevula, L. E.; Nyenge, R.; Chithambo, M.; Mothudi, B. M.; Dhlamini, M. S.

2018-04-01

Rare-Earth free luminescent materials are fast becoming important as the cost of rare earth ions gradually increases. In this work, a Rare-Earth free BaGa2O4 luminescent compound was prepared by solid state chemical reaction, which was confirmed to have a single phase by X-ray Diffraction. The Backscattered Electron image and Energy Dispersive X-ray spectroscopy maps confirmed irregular particle and homogeneous compound formation, respectively. The Photoluminescence spectrum displayed broad emission between 350 to 650 nm, which was deconvoluted into two components. The photoluminescence excitation peak was positioned at 254 nm, which corresponds with the band-to-band position observed from the diffuse reflectance spectrum. The band gap was extrapolated to 4.65 ± 0.02 eV using the Kubelka-Munk model. The preliminary thermoluminescence results indicated that the kinetics involved were neither of first nor second order. Additionally, the activation energy of the electrons within the trap centres was approximated to 0.61 ± 0.01 eV using the Initial Rise model.

Chemical stabilization and high pressure synthesis of Ba-free Hg-based superconductors, (Hg,M)Sr2Ca(n-1)Cu(n)O(y)(n=1 to approximately 3)

NASA Technical Reports Server (NTRS)

Kishio, K.; Shimoyama, J.; Hahakura, S.; Kitazawa, K.; Yamaura, K.; Hiroi, Z.; Takano, M.

1995-01-01

A homologous series of new Hg-based HTSC compounds, (Hg,M)Sr2Ca(n - 1)Cu(n)P(y) with n = 1 to 3, have been synthesized. The stabilization of the pure phases have been accomplished by chemical doping of third elements such as M = Cr, Mo and Re. While the Hgl2O1(n = 1) phase was readily obtained in this way, it was necessary to simultaneously dope Y into the Ca site to stabilize the Hg1212(n = 2) phase. On the other hand, single-phase Y-free Hg1212(n = 2) and Hg1223 (n = 3) samples were synthesized only under a high pressure of 6 GPa. In sharp contrast to the Ba containing compounds, all the samples prepared in the present study have been quite stable during the synthesis and no deterioration in air has been observed after the preparation.

Resistance genes in barley (Hordeum vulgare L.) and their identification with molecular markers.

PubMed

Chełkowski, Jerzy; Tyrka, Mirosław; Sobkiewicz, Andrzej

2003-01-01

Current information on barley resistance genes available from scientific papers and on-line databases is summarised. The recent literature contains information on 107 major resistance genes (R genes) against fungal pathogens (excluding powdery mildew), pathogenic viruses and aphids identified in Hordeum vulgare accessions. The highest number of resistance genes was identified against Puccinia hordei, Rhynchosporium secalis, and the viruses BaYMV and BaMMV, with 17, 14 and 13 genes respectively. There is still a lot of confusion regarding symbols for R genes against powdery mildew. Among the 23 loci described to date, two regions Mla and Mlo comprise approximately 31 and 25 alleles. Over 50 R genes have already been localised and over 30 mapped on 7 barley chromosomes. Four barley R genes have been cloned recently: Mlo, Rpg1, Mla1 and Mla6, and their structures (sequences) are available. The paper presents a catalogue of barley resistance gene symbols, their chromosomalocation and the list of available DNA markers useful in characterising cultivars and breeding accessions.