Sample records for bourne crystal diffraction

  1. A space bourne crystal diffraction telescope for the energy range of nuclear transitions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    von Ballmoos, P.; Naya, J.E.; Albernhe, F.

    1995-10-01

    Recent experimental work of the Toulouse-Argonne collaboration has opened for perspective of a focusing gamma-ray telescope operating in the energy range of nuclear transitions, featuring unprecedented sensitivity, angular and energy resolution. The instrument consists of a tunable crystal diffraction lens situated on a stabilized spacecraft, focusing gamma-rays onto a small array of Germanium detectors perched on an extendible boom. While the weight of such an instrument is less than 500 kg, it features an angular resolution of 15 in., an energy resolution of 2 keV and a 3 {sigma} narrow line sensitivity of a few times 10{sup {minus}7} photons s{supmore » {minus}1} cm{sup {minus}2} (10{sup 6} sec observation). This instrumental concept permits observation of any identified source at any selected line-energy in a range of typically 200 keV to 1300 keV. The resulting ``sequential`` operation mode makes sites of explosive nucleosynthesis natural scientific objectives for such a telescope: the nuclear lines of extragalactic supernovae ({sup 56}Ni, {sup 44}Ti, {sup 60}Fe) and galactic novae (p{sup {minus}}p{sup +} line, {sup 7}Be) are accessible to observation, one at a time, due to the erratic appearance and the sequence of half-lifes of these events. Other scientific objectives, include the narrow 511 keV line from galactic broad class annihilators (such as 1E1740-29, nova musca) and possible redshifted annihilation lines from AGN`s.« less

  2. Peter Bourne's drug policy and the perils of a public health ethic, 1976-1978.

    PubMed

    Clark, Claire D; Dufton, Emily

    2015-02-01

    As President Jimmy Carter's advisor for health issues, Peter Bourne promoted a rational and comprehensive drug strategy that combined new supply-side efforts to prevent drug use with previously established demand-side addiction treatment programs. Using a public health ethic that allowed the impact of substances on overall population health to guide drug control, Bourne advocated for marijuana decriminalization as well as increased regulations for barbiturates. A hostile political climate, a series of rumors, and pressure from both drug legalizers and prohibitionists caused Bourne to resign in disgrace in 1978. We argue that Bourne's critics used his own public health framework to challenge him, describe the health critiques that contributed to Bourne's resignation, and present the story of his departure as a cautionary tale for today's drug policy reformers.

  3. 78 FR 9420 - National Register of Historic Places; Notification of Pending Nominations and Related Actions

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-08

    ... Atkinson, 13000036 MASSACHUSETTS Barnstable County Bourne High School, 85 Cotuit Rd., Bourne, 13000035 Bournedale Village School, 29 Herring Pond Rd., Bourne, 13000037 MISSOURI Jackson County Southwest Market... Bacon--Harding Farm, (Cobblestone Architecture of New York State MPS), 3077 Oak Orchard Rd., Gaines...

  4. Combining the Bourne-Shell, sed and awk in the UNIX Environment for Language Analysis.

    ERIC Educational Resources Information Center

    Schmitt, Lothar M.; Christianson, Kiel T.

    This document describes how to construct tools for language analysis in research and teaching using the Bourne-shell, sed, and awk, three search tools, in the UNIX operating system. Applications include: searches for words, phrases, grammatical patterns, and phonemic patterns in text; statistical analysis of text in regard to such searches,…

  5. Peter Bourne’s Drug Policy and the Perils of a Public Health Ethic, 1976–1978

    PubMed Central

    Dufton, Emily

    2015-01-01

    As President Jimmy Carter’s advisor for health issues, Peter Bourne promoted a rational and comprehensive drug strategy that combined new supply-side efforts to prevent drug use with previously established demand-side addiction treatment programs. Using a public health ethic that allowed the impact of substances on overall population health to guide drug control, Bourne advocated for marijuana decriminalization as well as increased regulations for barbiturates. A hostile political climate, a series of rumors, and pressure from both drug legalizers and prohibitionists caused Bourne to resign in disgrace in 1978. We argue that Bourne’s critics used his own public health framework to challenge him, describe the health critiques that contributed to Bourne’s resignation, and present the story of his departure as a cautionary tale for today’s drug policy reformers. PMID:25521893

  6. "The Effort of Reason, and the Adventure of Beauty": The Aesthetic Rhetoric of Randolph Bourne

    ERIC Educational Resources Information Center

    Crick, Nathan; Engels, Jeremy

    2012-01-01

    We are still coming to terms with the legacy of Randolph Bourne. Although he died at the age of 32 just as the United States was cheerfully entering the First World War under the banner of "democracy," the words he penned in an unfinished essay still resonate in the American social conscience: "War is the Health of the State." This maxim, once…

  7. Controlled dehydration improves the diffraction quality of two RNA crystals.

    PubMed

    Park, HaJeung; Tran, Tuan; Lee, Jun Hyuck; Park, Hyun; Disney, Matthew D

    2016-11-03

    Post-crystallization dehydration methods, applying either vapor diffusion or humidity control devices, have been widely used to improve the diffraction quality of protein crystals. Despite the fact that RNA crystals tend to diffract poorly, there is a dearth of reports on the application of dehydration methods to improve the diffraction quality of RNA crystals. We use dehydration techniques with a Free Mounting System (FMS, a humidity control device) to recover the poor diffraction quality of RNA crystals. These approaches were applied to RNA constructs that model various RNA-mediated repeat expansion disorders. The method we describe herein could serve as a general tool to improve diffraction quality of RNA crystals to facilitate structure determinations.

  8. X-ray characterization of curved crystals for hard x-ray astronomy

    NASA Astrophysics Data System (ADS)

    Buffagni, Elisa; Bonnini, Elisa; Ferrari, Claudio; Virgilli, Enrico; Frontera, Filippo

    2015-05-01

    Among the methods to focus photons the diffraction in crystals results as one of the most effective for high energy photons. An assembling of properly oriented crystals can form a lens able to focus x-rays at high energy via Laue diffraction in transmission geometry; this is a Laue lens. The x-ray diffraction theory provides that the maximum diffraction efficiency is achieved in ideal mosaic crystals, but real mosaic crystals show diffraction efficiencies several times lower than the ideal case due to technological problems. An alternative and convenient approach is the use of curved crystals. We have recently optimized an efficient method based on the surface damage of crystals to produce self-standing uniformly curved Si, GaAs and Ge tiles of thickness up to 2-3 mm and curvature radii R down to a few meters. We show that, for curved diffracting planes, such crystals have a diffraction efficiency nearly forty times higher than the diffraction efficiency of perfect similar flat crystals, thus very close to that of ideal mosaic crystals. Moreover, in an alternative configuration where the diffracting planes are perpendicular to the curved ones, a focusing effect occurs and will be shown. These results were obtained for several energies between 17 and 120 keV with lab sources or at high energy facilities such as LARIX at Ferrara (Italy), ESRF at Grenoble (France), and ANKA at Karlsruhe (Germany).

  9. Phononic crystal diffraction gratings

    NASA Astrophysics Data System (ADS)

    Moiseyenko, Rayisa P.; Herbison, Sarah; Declercq, Nico F.; Laude, Vincent

    2012-02-01

    When a phononic crystal is interrogated by an external source of acoustic waves, there is necessarily a phenomenon of diffraction occurring on the external enclosing surfaces. Indeed, these external surfaces are periodic and the resulting acoustic diffraction grating has a periodicity that depends on the orientation of the phononic crystal. This work presents a combined experimental and theoretical study on the diffraction of bulk ultrasonic waves on the external surfaces of a 2D phononic crystal that consists of a triangular lattice of steel rods in a water matrix. The results of transmission experiments are compared with theoretical band structures obtained with the finite-element method. Angular spectrograms (showing frequency as a function of angle) determined from diffraction experiments are then compared with finite-element simulations of diffraction occurring on the surfaces of the crystal. The experimental results show that the diffraction that occurs on its external surfaces is highly frequency-dependent and has a definite relation with the Bloch modes of the phononic crystal. In particular, a strong influence of the presence of bandgaps and deaf bands on the diffraction efficiency is found. This observation opens perspectives for the design of efficient phononic crystal diffraction gratings.

  10. Femtosecond X-ray Diffraction From Two-Dimensional Protein Crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frank, Matthias; Carlson, David B.; Hunter, Mark

    2014-02-28

    Here we present femtosecond x-ray diffraction patterns from two-dimensional (2-D) protein crystals using an x-ray free electron laser (XFEL). To date it has not been possible to acquire x-ray diffraction from individual 2-D protein crystals due to radiation damage. However, the intense and ultrafast pulses generated by an XFEL permits a new method of collecting diffraction data before the sample is destroyed. Utilizing a diffract-before-destroy methodology at the Linac Coherent Light Source, we observed Bragg diffraction to better than 8.5 Å resolution for two different 2-D protein crystal samples that were maintained at room temperature. These proof-of-principle results show promisemore » for structural analysis of both soluble and membrane proteins arranged as 2-D crystals without requiring cryogenic conditions or the formation of three-dimensional crystals.« less

  11. Diffraction Correlation to Reconstruct Highly Strained Particles

    NASA Astrophysics Data System (ADS)

    Brown, Douglas; Harder, Ross; Clark, Jesse; Kim, J. W.; Kiefer, Boris; Fullerton, Eric; Shpyrko, Oleg; Fohtung, Edwin

    2015-03-01

    Through the use of coherent x-ray diffraction a three-dimensional diffraction pattern of a highly strained nano-crystal can be recorded in reciprocal space by a detector. Only the intensities are recorded, resulting in a loss of the complex phase. The recorded diffraction pattern therefore requires computational processing to reconstruct the density and complex distribution of the diffracted nano-crystal. For highly strained crystals, standard methods using HIO and ER algorithms are no longer sufficient to reconstruct the diffraction pattern. Our solution is to correlate the symmetry in reciprocal space to generate an a priori shape constraint to guide the computational reconstruction of the diffraction pattern. This approach has improved the ability to accurately reconstruct highly strained nano-crystals.

  12. Grazing-incidence X-ray diffraction from a crystal with subsurface defects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gaevskii, A. Yu., E-mail: transilv@mail.ru; Golentus, I. E.

    2015-03-15

    The diffraction of X rays incident on a crystal surface under grazing angles under conditions of total external reflection has been investigated. An approach is proposed in which exact solutions to the dynamic problem of grazing-incidence diffraction in an ideal crystal are used as initial functions to calculate the diffuse component of diffraction in a crystal with defects. The diffuse component of diffraction is calculated for a crystal with surface defects of a dilatation-center type. Exact formulas of the continuum theory which take into account the mirror-image forces are used for defect-induced atomic displacements. Scattering intensity maps near Bragg peaksmore » are constructed for different scan modes, and the conditions for detecting primarily the diffuse component are determined. The results of dynamic calculations of grazing-incidence diffraction in defect-containing crystals are compared with calculations in the kinematic approximation.« less

  13. Maximizing Macromolecule Crystal Size for Neutron Diffraction Experiments

    NASA Technical Reports Server (NTRS)

    Judge, R. A.; Kephart, R.; Leardi, R.; Myles, D. A.; Snell, E. H.; vanderWoerd, M.; Curreri, Peter A. (Technical Monitor)

    2002-01-01

    A challenge in neutron diffraction experiments is growing large (greater than 1 cu mm) macromolecule crystals. In taking up this challenge we have used statistical experiment design techniques to quickly identify crystallization conditions under which the largest crystals grow. These techniques provide the maximum information for minimal experimental effort, allowing optimal screening of crystallization variables in a simple experimental matrix, using the minimum amount of sample. Analysis of the results quickly tells the investigator what conditions are the most important for the crystallization. These can then be used to maximize the crystallization results in terms of reducing crystal numbers and providing large crystals of suitable habit. We have used these techniques to grow large crystals of Glucose isomerase. Glucose isomerase is an industrial enzyme used extensively in the food industry for the conversion of glucose to fructose. The aim of this study is the elucidation of the enzymatic mechanism at the molecular level. The accurate determination of hydrogen positions, which is critical for this, is a requirement that neutron diffraction is uniquely suited for. Preliminary neutron diffraction experiments with these crystals conducted at the Institute Laue-Langevin (Grenoble, France) reveal diffraction to beyond 2.5 angstrom. Macromolecular crystal growth is a process involving many parameters, and statistical experimental design is naturally suited to this field. These techniques are sample independent and provide an experimental strategy to maximize crystal volume and habit for neutron diffraction studies.

  14. Optical-diffraction method for determining crystal orientation

    DOEpatents

    Sopori, B.L.

    1982-05-07

    Disclosed is an optical diffraction technique for characterizing the three-dimensional orientation of a crystal sample. An arbitrary surface of the crystal sample is texture etched so as to generate a pseudo-periodic diffraction grating on the surface. A laser light beam is then directed onto the etched surface, and the reflected light forms a farfield diffraction pattern in reflection. Parameters of the diffraction pattern, such as the geometry and angular dispersion of the diffracted beam are then related to grating shape of the etched surface which is in turn related to crystal orientation. This technique may be used for examining polycrystalline silicon for use in solar cells.

  15. Optical devices combining an organic semiconductor crystal with a two-dimensional inorganic diffraction grating

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kitazawa, Takenori; Yamao, Takeshi, E-mail: yamao@kit.ac.jp; Hotta, Shu

    2016-02-01

    We have fabricated optical devices using an organic semiconductor crystal as an emission layer in combination with a two-dimensional (2D) inorganic diffraction grating used as an optical cavity. We formed the inorganic diffraction grating by wet etching of aluminum-doped zinc oxide (AZO) under a 2D cyclic olefin copolymer (COC) diffraction grating used as a mask. The COC diffraction grating was fabricated by nanoimprint lithography. The AZO diffraction grating was composed of convex prominences arranged in a triangular lattice. The organic crystal placed on the AZO diffraction grating indicated narrowed peaks in its emission spectrum under ultraviolet light excitation. These aremore » detected parallel to the crystal plane. The peaks were shifted by rotating the optical devices around the normal to the crystal plane, which reflected the rotational symmetries of the triangular lattice through 60°.« less

  16. Dynamic X-ray diffraction sampling for protein crystal positioning

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Scarborough, Nicole M.; Godaliyadda, G. M. Dilshan P.; Ye, Dong Hye

    A sparse supervised learning approach for dynamic sampling (SLADS) is described for dose reduction in diffraction-based protein crystal positioning. Crystal centering is typically a prerequisite for macromolecular diffraction at synchrotron facilities, with X-ray diffraction mapping growing in popularity as a mechanism for localization. In X-ray raster scanning, diffraction is used to identify the crystal positions based on the detection of Bragg-like peaks in the scattering patterns; however, this additional X-ray exposure may result in detectable damage to the crystal prior to data collection. Dynamic sampling, in which preceding measurements inform the next most information-rich location to probe for image reconstruction,more » significantly reduced the X-ray dose experienced by protein crystals during positioning by diffraction raster scanning. The SLADS algorithm implemented herein is designed for single-pixel measurements and can select a new location to measure. In each step of SLADS, the algorithm selects the pixel, which, when measured, maximizes the expected reduction in distortion given previous measurements. Ground-truth diffraction data were obtained for a 5 µm-diameter beam and SLADS reconstructed the image sampling 31% of the total volume and only 9% of the interior of the crystal greatly reducing the X-ray dosage on the crystal. Furthermore, by usingin situtwo-photon-excited fluorescence microscopy measurements as a surrogate for diffraction imaging with a 1 µm-diameter beam, the SLADS algorithm enabled image reconstruction from a 7% sampling of the total volume and 12% sampling of the interior of the crystal. When implemented into the beamline at Argonne National Laboratory, without ground-truth images, an acceptable reconstruction was obtained with 3% of the image sampled and approximately 5% of the crystal. The incorporation of SLADS into X-ray diffraction acquisitions has the potential to significantly minimize the impact of X-ray exposure on the crystal by limiting the dose and area exposed for image reconstruction and crystal positioning using data collection hardware present in most macromolecular crystallography end-stations.« less

  17. Dynamic X-ray diffraction sampling for protein crystal positioning

    DOE PAGES

    Scarborough, Nicole M.; Godaliyadda, G. M. Dilshan P.; Ye, Dong Hye; ...

    2017-01-01

    A sparse supervised learning approach for dynamic sampling (SLADS) is described for dose reduction in diffraction-based protein crystal positioning. Crystal centering is typically a prerequisite for macromolecular diffraction at synchrotron facilities, with X-ray diffraction mapping growing in popularity as a mechanism for localization. In X-ray raster scanning, diffraction is used to identify the crystal positions based on the detection of Bragg-like peaks in the scattering patterns; however, this additional X-ray exposure may result in detectable damage to the crystal prior to data collection. Dynamic sampling, in which preceding measurements inform the next most information-rich location to probe for image reconstruction,more » significantly reduced the X-ray dose experienced by protein crystals during positioning by diffraction raster scanning. The SLADS algorithm implemented herein is designed for single-pixel measurements and can select a new location to measure. In each step of SLADS, the algorithm selects the pixel, which, when measured, maximizes the expected reduction in distortion given previous measurements. Ground-truth diffraction data were obtained for a 5 µm-diameter beam and SLADS reconstructed the image sampling 31% of the total volume and only 9% of the interior of the crystal greatly reducing the X-ray dosage on the crystal. Furthermore, by usingin situtwo-photon-excited fluorescence microscopy measurements as a surrogate for diffraction imaging with a 1 µm-diameter beam, the SLADS algorithm enabled image reconstruction from a 7% sampling of the total volume and 12% sampling of the interior of the crystal. When implemented into the beamline at Argonne National Laboratory, without ground-truth images, an acceptable reconstruction was obtained with 3% of the image sampled and approximately 5% of the crystal. The incorporation of SLADS into X-ray diffraction acquisitions has the potential to significantly minimize the impact of X-ray exposure on the crystal by limiting the dose and area exposed for image reconstruction and crystal positioning using data collection hardware present in most macromolecular crystallography end-stations.« less

  18. Dynamic X-ray diffraction sampling for protein crystal positioning

    PubMed Central

    Scarborough, Nicole M.; Godaliyadda, G. M. Dilshan P.; Ye, Dong Hye; Kissick, David J.; Zhang, Shijie; Newman, Justin A.; Sheedlo, Michael J.; Chowdhury, Azhad U.; Fischetti, Robert F.; Das, Chittaranjan; Buzzard, Gregery T.; Bouman, Charles A.; Simpson, Garth J.

    2017-01-01

    A sparse supervised learning approach for dynamic sampling (SLADS) is described for dose reduction in diffraction-based protein crystal positioning. Crystal centering is typically a prerequisite for macromolecular diffraction at synchrotron facilities, with X-ray diffraction mapping growing in popularity as a mechanism for localization. In X-ray raster scanning, diffraction is used to identify the crystal positions based on the detection of Bragg-like peaks in the scattering patterns; however, this additional X-ray exposure may result in detectable damage to the crystal prior to data collection. Dynamic sampling, in which preceding measurements inform the next most information-rich location to probe for image reconstruction, significantly reduced the X-ray dose experienced by protein crystals during positioning by diffraction raster scanning. The SLADS algorithm implemented herein is designed for single-pixel measurements and can select a new location to measure. In each step of SLADS, the algorithm selects the pixel, which, when measured, maximizes the expected reduction in distortion given previous measurements. Ground-truth diffraction data were obtained for a 5 µm-diameter beam and SLADS reconstructed the image sampling 31% of the total volume and only 9% of the interior of the crystal greatly reducing the X-ray dosage on the crystal. Using in situ two-photon-excited fluorescence microscopy measurements as a surrogate for diffraction imaging with a 1 µm-diameter beam, the SLADS algorithm enabled image reconstruction from a 7% sampling of the total volume and 12% sampling of the interior of the crystal. When implemented into the beamline at Argonne National Laboratory, without ground-truth images, an acceptable reconstruction was obtained with 3% of the image sampled and approximately 5% of the crystal. The incorporation of SLADS into X-ray diffraction acquisitions has the potential to significantly minimize the impact of X-ray exposure on the crystal by limiting the dose and area exposed for image reconstruction and crystal positioning using data collection hardware present in most macromolecular crystallography end-stations. PMID:28009558

  19. Dynamic X-ray diffraction sampling for protein crystal positioning.

    PubMed

    Scarborough, Nicole M; Godaliyadda, G M Dilshan P; Ye, Dong Hye; Kissick, David J; Zhang, Shijie; Newman, Justin A; Sheedlo, Michael J; Chowdhury, Azhad U; Fischetti, Robert F; Das, Chittaranjan; Buzzard, Gregery T; Bouman, Charles A; Simpson, Garth J

    2017-01-01

    A sparse supervised learning approach for dynamic sampling (SLADS) is described for dose reduction in diffraction-based protein crystal positioning. Crystal centering is typically a prerequisite for macromolecular diffraction at synchrotron facilities, with X-ray diffraction mapping growing in popularity as a mechanism for localization. In X-ray raster scanning, diffraction is used to identify the crystal positions based on the detection of Bragg-like peaks in the scattering patterns; however, this additional X-ray exposure may result in detectable damage to the crystal prior to data collection. Dynamic sampling, in which preceding measurements inform the next most information-rich location to probe for image reconstruction, significantly reduced the X-ray dose experienced by protein crystals during positioning by diffraction raster scanning. The SLADS algorithm implemented herein is designed for single-pixel measurements and can select a new location to measure. In each step of SLADS, the algorithm selects the pixel, which, when measured, maximizes the expected reduction in distortion given previous measurements. Ground-truth diffraction data were obtained for a 5 µm-diameter beam and SLADS reconstructed the image sampling 31% of the total volume and only 9% of the interior of the crystal greatly reducing the X-ray dosage on the crystal. Using in situ two-photon-excited fluorescence microscopy measurements as a surrogate for diffraction imaging with a 1 µm-diameter beam, the SLADS algorithm enabled image reconstruction from a 7% sampling of the total volume and 12% sampling of the interior of the crystal. When implemented into the beamline at Argonne National Laboratory, without ground-truth images, an acceptable reconstruction was obtained with 3% of the image sampled and approximately 5% of the crystal. The incorporation of SLADS into X-ray diffraction acquisitions has the potential to significantly minimize the impact of X-ray exposure on the crystal by limiting the dose and area exposed for image reconstruction and crystal positioning using data collection hardware present in most macromolecular crystallography end-stations.

  20. Spherical quartz crystals investigated with synchrotron radiation

    DOE PAGES

    Pereira, N. R.; Macrander, A. T.; Hill, K. W.; ...

    2015-10-27

    The quality of x-ray spectra and images obtained from plasmas with spherically bent crystals depends in part on the crystal's x-ray diffraction across the entire crystal surface. We employ the energy selectivity and high intensity of synchrotron radiation to examine typical spherical crystals from alpha-quartz for their diffraction quality, in a perpendicular geometry that is particularly convenient to examine sagittal focusing. The crystal's local diffraction is not ideal: the most noticeable problems come from isolated regions that so far have failed to correlate with visible imperfections. In conclusion, excluding diffraction from such problem spots has little effect on the focusmore » beyond a decrease in background.« less

  1. High Resolution X-Ray Diffraction of Macromolecules with Synchrotron Radiation

    NASA Technical Reports Server (NTRS)

    Stojanoff, Vivian; Boggon, Titus; Helliwell, John R.; Judge, Russell; Olczak, Alex; Snell, Edward H.; Siddons, D. Peter; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    We recently combined synchrotron-based monochromatic X-ray diffraction topography methods with triple axis diffractometry and rocking curve measurements: high resolution X-ray diffraction imaging techniques, to better understand the quality of protein crystals. We discuss these methods in the light of results obtained on crystals grown under different conditions. These non destructive techniques are powerful tools in the characterization of the protein crystals and ultimately will allow to improve, develop, and understand protein crystal growth. High resolution X-ray diffraction imaging methods will be discussed in detail in light of recent results obtained on Hen Egg White Lysozyme crystals and other proteins.

  2. Crystallization and preliminary X-ray diffraction study of the protealysin precursor belonging to the peptidase family M4

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gromova, T. Yu., E-mail: duk@img.ras.ru; Demidyuk, I. V.; Kostrov, S. V.

    2008-09-15

    A protealysin precursor (the enzyme of the peptidase family M4) was crystallized for the first time. The crystal-growth conditions were found, and single crystals of the protein with dimensions of 0.3-0.5 mm were grown. The preliminary X-ray diffraction study of the enzyme was performed. The protealysin precursor was shown to crystallize in two crystal modifications suitable for the X-ray diffraction study of the three-dimensional structure of the protein molecule at atomic resolution.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Haishuang; Krysiak, Yaşar; Hoffmann, Kristin

    The crystal structure and disorder phenomena of Al{sub 4}B{sub 2}O{sub 9}, an aluminum borate from the mullite-type family, were studied using automated diffraction tomography (ADT), a recently established method for collection and analysis of electron diffraction data. Al{sub 4}B{sub 2}O{sub 9}, prepared by sol-gel approach, crystallizes in the monoclinic space group C2/m. The ab initio structure determination based on three-dimensional electron diffraction data from single ordered crystals reveals that edge-connected AlO{sub 6} octahedra expanding along the b axis constitute the backbone. The ordered structure (A) was confirmed by TEM and HAADF-STEM images. Furthermore, disordered crystals with diffuse scattering along themore » b axis are observed. Analysis of the modulation pattern implies a mean superstructure (AAB) with a threefold b axis, where B corresponds to an A layer shifted by ½a and ½c. Diffraction patterns simulated for the AAB sequence including additional stacking disorder are in good agreement with experimental electron diffraction patterns. - Graphical abstract: Crystal structure and disorder phenomena of B-rich Al{sub 4}B{sub 2}O{sub 9} studied by automated electron diffraction tomography (ADT) and described by diffraction simulation using DISCUS. - Highlights: • Ab-initio structure solution by electron diffraction from single nanocrystals. • Detected modulation corresponding mainly to three-fold superstructure. • Diffuse diffraction streaks caused by stacking faults in disordered crystals. • Observed streaks explained by simulated electron diffraction patterns.« less

  4. Optical Anisotropy of Photonic Crystals of Cubic Symmetry Induced by Multiple Diffraction of Light

    NASA Astrophysics Data System (ADS)

    Ukleev, T. A.; Shevchenko, N. N.; Iurasova, D. I.; Sel'kin, A. V.

    2018-05-01

    The optical spectra of Bragg reflection from opal-like photonic crystals under conditions of the resonant enhancement of the multiple diffraction of light have been studied experimentally and theoretically using the photonic crystal structures prepared of monodisperse polystyrene globules. It is shown that the reflection signal registered in mutually orthogonal configurations of the polarizer and analyzer is related to the intrinsic optical anisotropy of the crystals and is a specific manifestation of the multiple Bragg diffraction in three-dimensional photonic crystals.

  5. Improving the diffraction of apoA-IV crystals through extreme dehydration.

    PubMed

    Deng, Xiaodi; Davidson, W Sean; Thompson, Thomas B

    2012-01-01

    Apolipoproteins are the protein component of high-density lipoproteins (HDL), which are necessary for mobilizing lipid-like molecules throughout the body. Apolipoproteins undergo self-association, especially at higher concentrations, making them difficult to crystallize. Here, the crystallization and diffraction of the core fragment of apolipoprotein A-IV (apoA-IV), consisting of residues 64-335, is presented. ApoA-IV(64-335) crystallized readily in a variety of hexagonal (P6) morphologies with similar unit-cell parameters, all containing a long axis of nearly 550 Å in length. Preliminary diffraction experiments with the different crystal morphologies all resulted in limited streaky diffraction to 3.5 Å resolution. Crystal dehydration was applied to the different morphologies with variable success and was also used as a quality indicator of crystal-growth conditions. The results show that the morphologies that withstood the most extreme dehydration conditions showed the greatest improvement in diffraction. One morphology in particular was able to withstand dehydration in 60% PEG 3350 for over 12 h, which resulted in well defined intensities to 2.7 Å resolution. These results suggest that the approach of integrating dehydration with variation in crystal-growth conditions might be a general technique to optimize diffraction. © 2012 International Union of Crystallography. All rights reserved.

  6. Micro-beam Laue alignment of multi-reflection Bragg coherent diffraction imaging measurements

    DOE PAGES

    Hofmann, Felix; Phillips, Nicholas W.; Harder, Ross J.; ...

    2017-08-08

    Multi-reflection Bragg coherent diffraction imaging has the potential to allow three-dimensional (3D) resolved measurements of the full lattice strain tensor in specific micro-crystals. Until now such measurements were hampered by the need for laborious, time-intensive alignment procedures. Here, in this paper, a different approach is demonstrated, using micro-beam Laue X-ray diffraction to first determine the lattice orientation of the micro-crystal. This information is then used to rapidly align coherent diffraction measurements of three or more reflections from the crystal. Based on these, 3D strain and stress fields in the crystal are successfully determined. This approach is demonstrated on a focusedmore » ion beam milled micro-crystal from which six reflections could be measured. Since information from more than three independent reflections is available, the reliability of the phases retrieved from the coherent diffraction data can be assessed. Lastly, our results show that rapid, reliable 3D coherent diffraction measurements of the full lattice strain tensor in specific micro-crystals are now feasible and can be successfully carried out even in heavily distorted samples.« less

  7. Micro-beam Laue alignment of multi-reflection Bragg coherent diffraction imaging measurements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hofmann, Felix; Phillips, Nicholas W.; Harder, Ross J.

    Multi-reflection Bragg coherent diffraction imaging has the potential to allow three-dimensional (3D) resolved measurements of the full lattice strain tensor in specific micro-crystals. Until now such measurements were hampered by the need for laborious, time-intensive alignment procedures. Here, in this paper, a different approach is demonstrated, using micro-beam Laue X-ray diffraction to first determine the lattice orientation of the micro-crystal. This information is then used to rapidly align coherent diffraction measurements of three or more reflections from the crystal. Based on these, 3D strain and stress fields in the crystal are successfully determined. This approach is demonstrated on a focusedmore » ion beam milled micro-crystal from which six reflections could be measured. Since information from more than three independent reflections is available, the reliability of the phases retrieved from the coherent diffraction data can be assessed. Lastly, our results show that rapid, reliable 3D coherent diffraction measurements of the full lattice strain tensor in specific micro-crystals are now feasible and can be successfully carried out even in heavily distorted samples.« less

  8. Micro-beam Laue alignment of multi-reflection Bragg coherent diffraction imaging measurements.

    PubMed

    Hofmann, Felix; Phillips, Nicholas W; Harder, Ross J; Liu, Wenjun; Clark, Jesse N; Robinson, Ian K; Abbey, Brian

    2017-09-01

    Multi-reflection Bragg coherent diffraction imaging has the potential to allow three-dimensional (3D) resolved measurements of the full lattice strain tensor in specific micro-crystals. Until now such measurements were hampered by the need for laborious, time-intensive alignment procedures. Here a different approach is demonstrated, using micro-beam Laue X-ray diffraction to first determine the lattice orientation of the micro-crystal. This information is then used to rapidly align coherent diffraction measurements of three or more reflections from the crystal. Based on these, 3D strain and stress fields in the crystal are successfully determined. This approach is demonstrated on a focused ion beam milled micro-crystal from which six reflections could be measured. Since information from more than three independent reflections is available, the reliability of the phases retrieved from the coherent diffraction data can be assessed. Our results show that rapid, reliable 3D coherent diffraction measurements of the full lattice strain tensor in specific micro-crystals are now feasible and can be successfully carried out even in heavily distorted samples.

  9. Micro-beam Laue Alignment of Multi-Reflection Bragg Coherent Diffraction Imaging Measurements

    PubMed Central

    Hofmann, Felix; Phillips, Nicholas W.; Harder, Ross J.; Liu, Wenjun; Clark, Jesse N.; Robinson, Ian K.; Abbey, Brian

    2017-01-01

    Multi-reflection Bragg coherent diffraction imaging has the potential to allow 3D resolved measurements of the full lattice strain tensor in specific micro-crystals. Until now such measurements were hampered by the need for laborious, time-intensive alignment procedures. Here we demonstrate a different approach, using micro-beam Laue X-ray diffraction to first determine the lattice orientation of the micro-crystal. This information is then used to rapidly align coherent diffraction measurements of three or more reflections from the crystal. Based on these, 3D strain and stress fields in the crystal are successfully determined. This approach is demonstrated on a focussed ion beam milled micro-crystal from which six reflections could be measured. Since information from more than three independent reflections is available, the reliability of the phases retrieved from the coherent diffraction data can be assessed. Our results show that rapid, reliable 3D coherent diffraction measurements of the full lattice strain tensor in specific micro-crystals are now feasible and can be successfully carried out even in heavily distorted samples. PMID:28862628

  10. Mesoscopic monodisperse ferromagnetic colloids enable magnetically controlled photonic crystals.

    PubMed

    Xu, Xiangling; Majetich, Sara A; Asher, Sanford A

    2002-11-20

    We report here the first synthesis of mesoscopic, monodisperse particles which contain nanoscopic inclusions of ferromagnetic cobalt ferrites. These monodisperse ferromagnetic composite particles readily self-assemble into magnetically responsive photonic crystals that efficiently Bragg diffract incident light. Magnetic fields can be used to control the photonic crystal orientation and, thus, the diffracted wavelength. We demonstrate the use of these ferromagnetic particles to fabricate magneto-optical diffracting fluids and magnetically switchable diffracting mirrors.

  11. Inclined monochromator for high heat-load synchrotron x-ray radiation

    DOEpatents

    Khounsary, A.M.

    1994-02-15

    A double crystal monochromator is described including two identical, parallel crystals, each of which is cut such that the normal to the diffraction planes of interest makes an angle less than 90 degrees with the surface normal. Diffraction is symmetric, regardless of whether the crystals are symmetrically or asymmetrically cut, enabling operation of the monochromator with a fixed plane of diffraction. As a result of the inclination of the crystal surface, an incident beam has a footprint area which is elongated both vertically and horizontally when compared to that of the conventional monochromator, reducing the heat flux of the incident beam and enabling more efficient surface cooling. Because after inclination of the crystal only a fraction of thermal distortion lies in the diffraction plane, slope errors and the resultant misorientation of the diffracted beam are reduced. 11 figures.

  12. Inclined monochromator for high heat-load synchrotron x-ray radiation

    DOEpatents

    Khounsary, Ali M.

    1994-01-01

    A double crystal monochromator including two identical, parallel crystals, each of which is cut such that the normal to the diffraction planes of interest makes an angle less than 90 degrees with the surface normal. Diffraction is symmetric, regardless of whether the crystals are symmetrically or asymmetrically cut, enabling operation of the monochromator with a fixed plane of diffraction. As a result of the inclination of the crystal surface, an incident beam has a footprint area which is elongated both vertically and horizontally when compared to that of the conventional monochromator, reducing the heat flux of the incident beam and enabling more efficient surface cooling. Because after inclination of the crystal only a fraction of thermal distortion lies in the diffraction plane, slope errors and the resultant misorientation of the diffracted beam are reduced.

  13. Comparative Analysis of Thaumatin Crystals Grown on Earth and in Microgravity. Experiment 23

    NASA Technical Reports Server (NTRS)

    Ng, Joseph D.; Lorber, Bernard; Giege, Richard; Koszelak, Stanley; Day, John; Greenwood, Aaron; McPherson, Alexander

    1998-01-01

    The protein thaumatin was studied as a model macromolecule for crystallization in microgravity environment experiments conducted on two U.S. Space Shuttle missions (second United States Microgravity Laboratory (USML-2) and Life and Microgravity Spacelab (LMS)). In this investigation we evaluated and compared the quality of space- and Earth-grown thaumatin crystals using x-ray diffraction analysis and characterized them according to crystal size, diffraction resolution limit, and mosaicity. Two different approaches for growing thaumatin crystals in the microgravity environment, dialysis and liquid-liquid diffusion, were employed as a joint experiment by our two investigative teams. Thaumatin crystals grown under a microgravity environment were generally larger in volume with fewer total crystals. They diffracted to significantly higher resolution and with improved diffraction properties as judged by relative Wilson plots. The mosaicity for space-grown crystals was significantly less than for those grown on Earth. Increasing concentrations of protein in the crystallization chambers under microgravity lead to larger crystals. The data presented here lend further support to the idea that protein crystals of improved quality can be obtained in a microgravity environment.

  14. Diffractive-refractive optics: X-ray splitter.

    PubMed

    Hrdý, Jaromír

    2010-01-01

    The possibility of splitting a thin (e.g. undulator) X-ray beam based on diffraction-refraction effects is discussed. The beam is diffracted from a crystal whose diffracting surface has the shape of a roof with the ridge lying in the plane of diffraction. The crystal is cut asymmetrically. One half of the beam impinges on the left-hand part of the roof and the other half impinges on the right-hand side of the roof. Owing to refraction the left part of the beam is deviated to the left whereas the right part is deviated to the right. The device proposed consists of two channel-cut crystals with roof-like diffraction surfaces; the crystals are set in a dispersive position. The separation of the beams after splitting is calculated at a distance of 10 m from the crystals for various asymmetry and inclination angles. It is shown that such a splitting may be utilized for long beamlines. Advantages and disadvantages of this method are discussed.

  15. Synchrotron X-ray reciprocal-space mapping, topography and diffraction resolution studies of macromolecular crystal quality.

    PubMed

    Boggon, T J; Helliwell, J R; Judge, R A; Olczak, A; Siddons, D P; Snell, E H; Stojanoff, V

    2000-07-01

    A comprehensive study of microgravity and ground-grown chicken egg-white lysozyme crystals is presented using synchrotron X-ray reciprocal-space mapping, topography techniques and diffraction resolution. Microgravity crystals displayed reduced intrinsic mosaicities on average, but no differences in terms of strain over their ground-grown counterparts. Topographic analysis revealed that in the microgravity case the majority of the crystal was contributing to the peak of the reflection at the appropriate Bragg angle. In the ground-control case only a small volume of the crystal contributed to the intensity at the diffraction peak. The techniques prove to be highly complementary, with the reciprocal-space mapping providing a quantitative measure of the crystal mosaicity and strain (or variation in lattice spacing) and the topography providing a qualitative overall assessment of the crystal in terms of its X-ray diffraction properties. Structural data collection was also carried out at the synchrotron.

  16. Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin

    PubMed Central

    Jaimohan, S. M.; Naresh, M. D.; Arumugam, V.; Mandal, A. B.

    2009-01-01

    Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemo­globins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 Å resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 Å, β = 109.35°. Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit. PMID:19851014

  17. Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin.

    PubMed

    Jaimohan, S M; Naresh, M D; Arumugam, V; Mandal, A B

    2009-10-01

    Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemoglobins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 A resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 A, beta = 109.35 degrees . Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

  18. Synchrotron X-Ray Reciprocal Space Mapping, Topography and Diffraction Resolution Studies of Macromolecular Crystal Quality

    NASA Technical Reports Server (NTRS)

    Boggon, T. J.; Helliwell, J. R.; Judge, Russell A.; Siddons, D. P.; Snell, Edward H.; Stojanoff, V.

    2000-01-01

    A comprehensive study of microgravity and ground grown chicken egg white lysozyme crystals is presented using synchrotron X-ray reciprocal space mapping, topography techniques and diffraction resolution. Microgravity crystals displayed, on average, reduced intrinsic mosaicities but no differences in terms of stress over their earth grown counterparts. Topographic analysis revealed that in the microgravity case the majority of the crystal was contributing to the peak of the reflection at the appropriate Bragg angle. In the earth case at the diffraction peak only a small volume of the crystal contributed to the intensity. The techniques prove to be highly complementary with the reciprocal space mapping providing a quantitative measure of the crystal mosaicity and stress (or variation in lattice spacing) and topography providing a qualitative overall assessment of the crystal in terms of its X-ray diffraction properties. Structural data collection was also carried out both at the synchrotron and in the laboratory.

  19. Observing the overall rocking motion of a protein in a crystal

    NASA Astrophysics Data System (ADS)

    Ma, Peixiang; Xue, Yi; Coquelle, Nicolas; Haller, Jens D.; Yuwen, Tairan; Ayala, Isabel; Mikhailovskii, Oleg; Willbold, Dieter; Colletier, Jacques-Philippe; Skrynnikov, Nikolai R.; Schanda, Paul

    2015-10-01

    The large majority of three-dimensional structures of biological macromolecules have been determined by X-ray diffraction of crystalline samples. High-resolution structure determination crucially depends on the homogeneity of the protein crystal. Overall `rocking' motion of molecules in the crystal is expected to influence diffraction quality, and such motion may therefore affect the process of solving crystal structures. Yet, so far overall molecular motion has not directly been observed in protein crystals, and the timescale of such dynamics remains unclear. Here we use solid-state NMR, X-ray diffraction methods and μs-long molecular dynamics simulations to directly characterize the rigid-body motion of a protein in different crystal forms. For ubiquitin crystals investigated in this study we determine the range of possible correlation times of rocking motion, 0.1-100 μs. The amplitude of rocking varies from one crystal form to another and is correlated with the resolution obtainable in X-ray diffraction experiments.

  20. Hemispherical Laue camera

    DOEpatents

    Li, James C. M.; Chu, Sungnee G.

    1980-01-01

    A hemispherical Laue camera comprises a crystal sample mount for positioning a sample to be analyzed at the center of sphere of a hemispherical, X-radiation sensitive film cassette, a collimator, a stationary or rotating sample mount and a set of standard spherical projection spheres. X-radiation generated from an external source is directed through the collimator to impinge onto the single crystal sample on the stationary mount. The diffracted beam is recorded on the hemispherical X-radiation sensitive film mounted inside the hemispherical film cassette in either transmission or back-reflection geometry. The distances travelled by X-radiation diffracted from the crystal to the hemispherical film are the same for all crystal planes which satisfy Bragg's Law. The recorded diffraction spots or Laue spots on the film thereby preserve both the symmetry information of the crystal structure and the relative intensities which are directly related to the relative structure factors of the crystal orientations. The diffraction pattern on the exposed film is compared with the known diffraction pattern on one of the standard spherical projection spheres for a specific crystal structure to determine the orientation of the crystal sample. By replacing the stationary sample support with a rotating sample mount, the hemispherical Laue camera can be used for crystal structure determination in a manner previously provided in conventional Debye-Scherrer cameras.

  1. Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals

    DOE PAGES

    Dao, E. Han; Sierra, Raymond G.; Laksmono, Hartawan; ...

    2015-04-30

    In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecondmore » X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.« less

  2. Dynamical effects in Bragg coherent x-ray diffraction imaging of finite crystals

    NASA Astrophysics Data System (ADS)

    Shabalin, A. G.; Yefanov, O. M.; Nosik, V. L.; Bushuev, V. A.; Vartanyants, I. A.

    2017-08-01

    We present simulations of Bragg coherent x-ray diffractive imaging (CXDI) data from finite crystals in the frame of the dynamical theory of x-ray diffraction. The developed approach is based on a numerical solution of modified Takagi-Taupin equations and can be applied for modeling of a broad range of x-ray diffraction experiments with finite three-dimensional crystals of arbitrary shape also in the presence of strain. We performed simulations for nanocrystals of a cubic and hemispherical shape of different sizes and provided a detailed analysis of artifacts in the Bragg CXDI reconstructions introduced by the dynamical diffraction. Based on our theoretical analysis we developed an analytical procedure to treat effects of refraction and absorption in the reconstruction. Our results elucidate limitations for the kinematical approach in the Bragg CXDI and suggest a natural criterion to distinguish between kinematical and dynamical cases in coherent x-ray diffraction on a finite crystal.

  3. High frequency monitoring revels new insights into baseflow DOM processing

    NASA Astrophysics Data System (ADS)

    Khamis, K.; Bradley, C.; Blaen, P.; Krause, S.; Hannah, D. M.

    2017-12-01

    Dissolved organic matter (DOM) is important for myriad biogeochemical processes in river ecosystems. Currently, however, we have limited knowledge of DOM dynamics under low flow conditions as most previous studies have focused largely on storm event dynamics. Field deployable fluorescence technology offers new opportunities to explore diurnal DOM dynamics at finer time-steps and for longer periods than previously possible, thus providing new insights into in-stream DOM processing. In this study, we collected hourly fluorescence data (Spring - Fall) and a suite of hydro-climatological variables from two contrasting UK headwater watersheds: the urban Bourn Brook, Birmingham (52° 26' N, 1° 55' W) and agricultural Mill Haft, Shropshire (52° 48' N, 2° 14' W). We hypothesised that diurnal dynamics in humic-like fluorescence (Peak C; Ex. 365 nm / Em. 490 nm) would be driven by photo-oxidation processes; while tryptophan-like fluorescence (Peak T; Ex. 285 nm / Em. 345 nm) would respond to diurnal biomass production cycles. Wavelet analysis identified significant diurnal variations in Peak C for both the Bourn Brook and Mill Haft, with the strongest signal in early summer. While the amplitude was broadly similar between sites, peak timing and consistency differed, the Bourn Brook displayed peaks in the early morning (04:00 ± 2.2 h) and Mill Haft in early evening (19:00 ± 6.6 h). Cross wavelet analysis identified strong coherence with SW radiation for the urban stream but stronger relationships with discharge for the agricultural system. Hence, results from the Bourn Brook support our hypothesis regarding Peak C photo-oxidation processes but for Mill Haft, discharge (DOM dilution) appeared to be the key control. Contrary to our hypothesis, no strong diurnal pattern was identified for Peak T for either system. From this, we infer that the low levels of Peak T produced were rapidly taken up by bacteria and/or that productivity in these systems was low. Future work on in-stream DOM will benefit from improved integration of field deployable sensing and laboratory measurements.

  4. Invited Review Article: Development of crystal lenses for energetic photons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smither, Robert K.

    2014-08-15

    This paper follows the development of crystal diffraction lenses designed to focus energetic photons. It begins with the search for a solution to the astrophysics problem of how to detect weak astrophysics sources of gamma rays and x-rays. This led to the basic designs for a lens and to the understanding of basic limitations of lens design. The discussion of the development of crystal diffraction lenses is divided into two parts: lenses using crystals with mosaic structure, and lenses that use crystals with curved crystal planes. This second group divides into two sub-groups: (1) Curved crystals that are used tomore » increase the acceptance angle of the diffraction of a monochromatic beam and to increase the energy bandwidth of the diffraction. (2) Curved crystals used to focus gamma ray beams. The paper describes how these two types of crystals affect the design of the corresponding crystal lenses in different fields: astrophysics, medical imaging, detection of weak, distant, gamma-ray sources, etc. The designs of crystal lenses for these applications are given in enough detail to allow the reader to design a lens for his own application.« less

  5. Measuring the x-ray resolving power of bent potassium acid phthalate diffraction crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haugh, M. J., E-mail: haughmj@nv.doe.gov; Jacoby, K. D.; Wu, M.

    2014-11-15

    This report presents the results from measuring the X-ray resolving power of a curved potassium acid phthalate (KAP(001)) spectrometer crystal using two independent methods. It is part of a continuing effort to measure the fundamental diffraction properties of bent crystals that are used to study various characteristics of high temperature plasmas. Bent crystals like KAP(001) do not usually have the same diffraction properties as corresponding flat crystals. Models that do exist to calculate the effect of bending the crystal on the diffraction properties have simplifying assumptions and their accuracy limits have not been adequately determined. The type of crystals thatmore » we measured is being used in a spectrometer on the Z machine at Sandia National Laboratories in Albuquerque, New Mexico. The first technique for measuring the crystal resolving power measures the X-ray spectral line width of the characteristic lines from several metal anodes. The second method uses a diode X-ray source and a double crystal diffractometer arrangement to measure the reflectivity curve of the KAP(001) crystal. The width of that curve is inversely proportional to the crystal resolving power. The measurement results are analyzed and discussed.« less

  6. Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

    2016-11-30

    A tetrahydrofolate-dependentO-demethylase, LigM, from Sphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtained P3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding using P3 121/P3 2 21 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space group P2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c = 128.1 Å. The P2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing themore » cryoconditions. Phasing using the single anomalous diffraction method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

  7. Observation of divergent-beam X-ray diffraction from a crystal of diamond using synchrotron radiation.

    PubMed

    Glazer, A M; Collins, S P; Zekria, D; Liu, J; Golshan, M

    2004-03-01

    In 1947 Kathleen Lonsdale conducted a series of experiments on X-ray diffraction using a divergent beam external to a crystal sample. Unlike the Kossel technique, where divergent X-rays are excited by the presence of fluorescing atoms within the crystal, the use of an external divergent source made it possible to study non-fluorescing crystals. The resulting photographs not only illustrated the complexity of X-ray diffraction from crystals in a truly beautiful way, but also demonstrated unprecedented experimental precision. This long-forgotten work is repeated here using a synchrotron radiation source and, once again, considerable merit is found in Lonsdale's technique. The results of this experiment suggest that, through the use of modern 'third-generation' synchrotron sources, divergent-beam diffraction could soon enjoy a renaissance for high-precision lattice-parameter determination and the study of crystal perfection.

  8. Surface-treated self-standing curved crystals as high-efficiency elements for X- and γ-ray optics: theory and experiment.

    PubMed

    Bonnini, Elisa; Buffagni, Elisa; Zappettini, Andrea; Doyle, Stephen; Ferrari, Claudio

    2015-06-01

    The efficiency of a Laue lens for X- and γ-ray focusing in the energy range 60-600 keV is closely linked to the diffraction efficiency of the single crystals composing the lens. A powerful focusing system is crucial for applications like medical imaging and X-ray astronomy where wide beams must be focused. Mosaic crystals with a high density, such as Cu or Au, and bent crystals with curved diffracting planes (CDPs) are considered for the realization of a focusing system for γ-rays, owing to their high diffraction efficiency in a predetermined angular range. In this work, a comparison of the efficiency of CDP crystals and Cu and Au mosaic crystals was performed on the basis of the theory of X-ray diffraction. Si, GaAs and Ge CDP crystals with optimized thicknesses and moderate radii of curvature of several tens of metres demonstrate comparable or superior performance with respect to the higher atomic number mosaic crystals generally used. In order to increase the efficiency of the lens further, a stack of several CDP crystals is proposed as an optical element. CDP crystals were obtained by a surface-damage method, and a stack of two surface-damaged bent Si crystals was prepared and tested. Rocking curves of the stack were performed with synchrotron radiation at 19 keV to check the lattice alignment: they exhibited only one diffraction peak.

  9. Diffraction of real and virtual photons in a pyrolytic graphite crystal as source of intensive quasimonochromatic X-ray beam

    NASA Astrophysics Data System (ADS)

    Bogomazova, E. A.; Kalinin, B. N.; Naumenko, G. A.; Padalko, D. V.; Potylitsyn, A. P.; Sharafutdinov, A. F.; Vnukov, I. E.

    2003-01-01

    A series of experiments on the parametric X-rays radiation (PXR) generation and radiation soft component diffraction of relativistic electrons in pyrolytic graphite (PG) crystals have been carried out at the Tomsk synchrotron. It is shown that the experimental results with PG crystals are explained by the kinematic PXR theory if we take into account a contribution of the real photons diffraction (transition radiation, bremsstrahlung and PXR photons as well). The measurements of the emission spectrum of channeled electrons in the photon energy range much smaller than the characteristic energy of channeling radiation have been performed with a crystal-diffraction spectrometer. For electrons incident along the <1 1 0> axis of a silicon crystal, the radiation intensity in the energy range 30⩽ ω⩽360 keV exceeds the bremsstrahlung one almost by an order of magnitude. Different possibilities to create an effective source of the monochromatic X-ray beam based on the real and virtual photons diffraction in the PG crystals have been considered.

  10. Inorganic pyrophosphatase crystals from Thermococcus thioreducens for X-ray and neutron diffraction.

    PubMed

    Hughes, Ronny C; Coates, Leighton; Blakeley, Matthew P; Tomanicek, Steve J; Langan, Paul; Kovalevsky, Andrey Y; García-Ruiz, Juan M; Ng, Joseph D

    2012-12-01

    Inorganic pyrophosphatase (IPPase) from the archaeon Thermococcus thioreducens was cloned, overexpressed in Escherichia coli, purified and crystallized in restricted geometry, resulting in large crystal volumes exceeding 5 mm3. IPPase is thermally stable and is able to resist denaturation at temperatures above 348 K. Owing to the high temperature tolerance of the enzyme, the protein was amenable to room-temperature manipulation at the level of protein preparation, crystallization and X-ray and neutron diffraction analyses. A complete synchrotron X-ray diffraction data set to 1.85 Å resolution was collected at room temperature from a single crystal of IPPase (monoclinic space group C2, unit-cell parameters a=106.11, b=95.46, c=113.68 Å, α=γ=90.0, β=98.12°). As large-volume crystals of IPPase can be obtained, preliminary neutron diffraction tests were undertaken. Consequently, Laue diffraction images were obtained, with reflections observed to 2.1 Å resolution with I/σ(I) greater than 2.5. The preliminary crystallographic results reported here set in place future structure-function and mechanism studies of IPPase.

  11. Expression, purification, crystallization and preliminary X-ray diffraction analysis of α-11 giardin from Giardia lamblia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pathuri, Puja; Nguyen, Emily Tam; Luecke, Hartmut, E-mail: hudel@uci.edu

    2006-11-01

    α-11 giardin from the intestinal protozoan parasite, G. lamblia has been cloned, expressed, purified and crystallized under two different conditions and in two different space groups. Crystals from the first condition diffracted to 1.1 Å and belong to a primitive orthorhombic space group and crystals obtained in the second condition diffracted to 2.93 Å and belong to a primitive monoclinic space group. α-11 Giardin, a protein from the annexin superfamily, is a 35.0 kDa protein from the intestinal protozoan parasite Giardia lamblia which triggers a form of diarrhea called giardiasis. Here, the cloning, expression, purification and the crystallization of α-11more » giardin under two different conditions and in two different space groups is reported. Crystals from the first condition diffracted to 1.1 Å and belong to a primitive orthorhombic space group, while crystals from the second condition, which included calcium in the crystallization solution, diffracted to 2.93 Å and belong to a primitive monoclinic space group. Determination of the detailed atomic structure of α-11 giardin will provide a better insight into its biological function and might establish whether this class of proteins is a potential drug target against giardiasis.« less

  12. Measuring the X-ray Resolving Power of Bent Potassium Acid Phthalate Diffraction Crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haugh, M. J.; Wu, M.; Jacoby, K. D.

    2014-11-01

    This report presents the results from measuring the X-ray resolving power of a curved potassium acid phthalate (KAP(001)) spectrometer crystal using two independent methods. It is part of a continuing effort to measure the fundamental diffraction properties of bent crystals that are used to study various characteristics of high temperature plasmas. Bent crystals like KAP(001) do not usually have the same diffraction properties as corresponding flat crystals. Models that do exist to calculate the effect of bending the crystal on the diffraction properties have simplifying assumptions and their accuracy limits have not been adequately determined. The type of crystals thatmore » we measured is being used in a spectrometer on the Z machine at Sandia National Laboratories (SNL) in Albuquerque, NM. The first technique for measuring the crystal resolving power measures the X-ray spectral line width of the characteristic lines from several metal anodes. The second method uses a diode X-ray source and a dual goniometer arrangement to measure the reflectivity curve of the KAP(001) crystal. The width of that curve is inversely proportional to the crystal resolving power. The measurement results are analyzed and discussed.« less

  13. Measuring the x-ray resolving power of bent potassium acid phthalate diffraction crystalsa)

    NASA Astrophysics Data System (ADS)

    Haugh, M. J.; Wu, M.; Jacoby, K. D.; Loisel, G. P.

    2014-11-01

    This report presents the results from measuring the X-ray resolving power of a curved potassium acid phthalate (KAP(001)) spectrometer crystal using two independent methods. It is part of a continuing effort to measure the fundamental diffraction properties of bent crystals that are used to study various characteristics of high temperature plasmas. Bent crystals like KAP(001) do not usually have the same diffraction properties as corresponding flat crystals. Models that do exist to calculate the effect of bending the crystal on the diffraction properties have simplifying assumptions and their accuracy limits have not been adequately determined. The type of crystals that we measured is being used in a spectrometer on the Z machine at Sandia National Laboratories in Albuquerque, New Mexico. The first technique for measuring the crystal resolving power measures the X-ray spectral line width of the characteristic lines from several metal anodes. The second method uses a diode X-ray source and a double crystal diffractometer arrangement to measure the reflectivity curve of the KAP(001) crystal. The width of that curve is inversely proportional to the crystal resolving power. The measurement results are analyzed and discussed.

  14. Microfluidic Chips for In Situ Crystal X-ray Diffraction and In Situ Dynamic Light Scattering for Serial Crystallography.

    PubMed

    Gicquel, Yannig; Schubert, Robin; Kapis, Svetlana; Bourenkov, Gleb; Schneider, Thomas; Perbandt, Markus; Betzel, Christian; Chapman, Henry N; Heymann, Michael

    2018-04-24

    This protocol describes fabricating microfluidic devices with low X-ray background optimized for goniometer based fixed target serial crystallography. The devices are patterned from epoxy glue using soft lithography and are suitable for in situ X-ray diffraction experiments at room temperature. The sample wells are lidded on both sides with polymeric polyimide foil windows that allow diffraction data collection with low X-ray background. This fabrication method is undemanding and inexpensive. After the sourcing of a SU-8 master wafer, all fabrication can be completed outside of a cleanroom in a typical research lab environment. The chip design and fabrication protocol utilize capillary valving to microfluidically split an aqueous reaction into defined nanoliter sized droplets. This loading mechanism avoids the sample loss from channel dead-volume and can easily be performed manually without using pumps or other equipment for fluid actuation. We describe how isolated nanoliter sized drops of protein solution can be monitored in situ by dynamic light scattering to control protein crystal nucleation and growth. After suitable crystals are grown, complete X-ray diffraction datasets can be collected using goniometer based in situ fixed target serial X-ray crystallography at room temperature. The protocol provides custom scripts to process diffraction datasets using a suite of software tools to solve and refine the protein crystal structure. This approach avoids the artefacts possibly induced during cryo-preservation or manual crystal handling in conventional crystallography experiments. We present and compare three protein structures that were solved using small crystals with dimensions of approximately 10-20 µm grown in chip. By crystallizing and diffracting in situ, handling and hence mechanical disturbances of fragile crystals is minimized. The protocol details how to fabricate a custom X-ray transparent microfluidic chip suitable for in situ serial crystallography. As almost every crystal can be used for diffraction data collection, these microfluidic chips are a very efficient crystal delivery method.

  15. Simulations of X-ray diffraction of shock-compressed single-crystal tantalum with synchrotron undulator sources.

    PubMed

    Tang, M X; Zhang, Y Y; E, J C; Luo, S N

    2018-05-01

    Polychromatic synchrotron undulator X-ray sources are useful for ultrafast single-crystal diffraction under shock compression. Here, simulations of X-ray diffraction of shock-compressed single-crystal tantalum with realistic undulator sources are reported, based on large-scale molecular dynamics simulations. Purely elastic deformation, elastic-plastic two-wave structure, and severe plastic deformation under different impact velocities are explored, as well as an edge release case. Transmission-mode diffraction simulations consider crystallographic orientation, loading direction, incident beam direction, X-ray spectrum bandwidth and realistic detector size. Diffraction patterns and reciprocal space nodes are obtained from atomic configurations for different loading (elastic and plastic) and detection conditions, and interpretation of the diffraction patterns is discussed.

  16. Three-dimensional Bragg diffraction in growth-disordered opals

    NASA Astrophysics Data System (ADS)

    Baryshev, A. V.; Kaplyanskii, Alexander A.; Kosobukin, Vladimir A.; Limonov, M. F.; Samusev, K. B.; Usvyat, D. E.

    2003-06-01

    After artificial opals as well as opal-based infilled and inverted composites are considered to be promising representatives of photonic crystal materials. Earlier, photonic stop gaps in opals were studied mainly in transmission or specular reflection geometries corresponding to "one-dimensional" Bragg diffraction. On the contrary, this work was aimed at observing the typical patterns of optical Bragg diffraction in which phenomenon opal crystal structure acts as a three-dimensional diffraction grating. Although our experiments were performed for artificial opals possessing unavoidable imperfections a well-pronounced diffraction peaks were observed characteristic of a crystal structure. Each of the diffraction maxima reveals a photonic stop gap in the specified direction, while the spectral width of the peak is a measure of the photonic stop gap width.

  17. Simulations of X-ray diffraction of shock-compressed single-crystal tantalum with synchrotron undulator sources

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tang, M. X.; Zhang, Y. Y.; E, J. C.

    Polychromatic synchrotron undulator X-ray sources are useful for ultrafast single-crystal diffraction under shock compression. Here, simulations of X-ray diffraction of shock-compressed single-crystal tantalum with realistic undulator sources are reported, based on large-scale molecular dynamics simulations. Purely elastic deformation, elastic–plastic two-wave structure, and severe plastic deformation under different impact velocities are explored, as well as an edge release case. Transmission-mode diffraction simulations consider crystallographic orientation, loading direction, incident beam direction, X-ray spectrum bandwidth and realistic detector size. Diffraction patterns and reciprocal space nodes are obtained from atomic configurations for different loading (elastic and plastic) and detection conditions, and interpretation of themore » diffraction patterns is discussed.« less

  18. Diffraction and Imaging Study of Imperfections of Protein Crystals with Coherent X-rays

    NASA Technical Reports Server (NTRS)

    Hu, Z. W.; Thomas, B. R.; Chernov, A. A.; Chu, Y. S.; Lai, B.

    2004-01-01

    High angular-resolution x-ray diffraction and phase contrast x-ray imaging were combined to study defects and perfection of protein crystals. Imperfections including line defects, inclusions and other microdefects were observed in the diffraction images of a uniformly grown lysozyme crystal. The observed line defects carry distinct dislocation features running approximately along the <110> growth front and have been found to originate mostly in a central growth area and occasionally in outer growth regions. Slow dehydration led to the broadening of a fairly symmetric 4 4 0 rocking curve by a factor of approximately 2.6, which was primarily attributed to the dehydration-induced microscopic effects that are clearly shown in diffraction images. X-ray imaging and diffraction characterization of the quality of apoferritin crystals will also be discussed in the presentation.

  19. Crystallization of human nicotinamide phosphoribosyltransferase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takahashi, Ryo; Nakamura, Shota; Yoshida, Takuya

    2007-05-01

    Human nicotinamide phosphoribosyltransferase has been crystallized using microseeding methods and X-ray diffraction data have been collected at 2.0 Å resolution. In the NAD biosynthetic pathway, nicotinamide phosphoribosyltransferase (NMPRTase; EC 2.4.2.12) plays an important role in catalyzing the synthesis of nicotinamide mononucleotide from nicotinamide and 5′-phosphoribosyl-1′-pyrophosphate. Because the diffraction pattern of the initally obtained crystals was not suitable for structure analysis, the crystal quality was improved by successive use of the microseeding technique. The resultant crystals diffracted to 2.0 Å resolution. These crystals belonged to space group P21, with unit-cell parameters a = 60.56, b = 106.40, c = 82.78 Å.more » Here, the crystallization of human NMPRTase is reported in the free form; the crystals should be useful for inhibitor-soaking experiments on the enzyme.« less

  20. Continuous diffraction of molecules and disordered molecular crystals

    PubMed Central

    Yefanov, Oleksandr M.; Ayyer, Kartik; White, Thomas A.; Barty, Anton; Morgan, Andrew; Mariani, Valerio; Oberthuer, Dominik; Pande, Kanupriya

    2017-01-01

    The intensities of far-field diffraction patterns of orientationally aligned molecules obey Wilson statistics, whether those molecules are in isolation (giving rise to a continuous diffraction pattern) or arranged in a crystal (giving rise to Bragg peaks). Ensembles of molecules in several orientations, but uncorrelated in position, give rise to the incoherent sum of the diffraction from those objects, modifying the statistics in a similar way as crystal twinning modifies the distribution of Bragg intensities. This situation arises in the continuous diffraction of laser-aligned molecules or translationally disordered molecular crystals. This paper develops the analysis of the intensity statistics of such continuous diffraction to obtain parameters such as scaling, beam coherence and the number of contributing independent object orientations. When measured, continuous molecular diffraction is generally weak and accompanied by a background that far exceeds the strength of the signal. Instead of just relying upon the smallest measured intensities or their mean value to guide the subtraction of the background, it is shown how all measured values can be utilized to estimate the background, noise and signal, by employing a modified ‘noisy Wilson’ distribution that explicitly includes the background. Parameters relating to the background and signal quantities can be estimated from the moments of the measured intensities. The analysis method is demonstrated on previously published continuous diffraction data measured from crystals of photosystem II [Ayyer et al. (2016 ▸), Nature, 530, 202–206]. PMID:28808434

  1. A Medipix quantum area detector allows rotation electron diffraction data collection from submicrometre three-dimensional protein crystals

    PubMed Central

    Nederlof, Igor; van Genderen, Eric; Li, Yao-Wang; Abrahams, Jan Pieter

    2013-01-01

    When protein crystals are submicrometre-sized, X-ray radiation damage precludes conventional diffraction data collection. For crystals that are of the order of 100 nm in size, at best only single-shot diffraction patterns can be collected and rotation data collection has not been possible, irrespective of the diffraction technique used. Here, it is shown that at a very low electron dose (at most 0.1 e− Å−2), a Medipix2 quantum area detector is sufficiently sensitive to allow the collection of a 30-frame rotation series of 200 keV electron-diffraction data from a single ∼100 nm thick protein crystal. A highly parallel 200 keV electron beam (λ = 0.025 Å) allowed observation of the curvature of the Ewald sphere at low resolution, indicating a combined mosaic spread/beam divergence of at most 0.4°. This result shows that volumes of crystal with low mosaicity can be pinpointed in electron diffraction. It is also shown that strategies and data-analysis software (MOSFLM and SCALA) from X-ray protein crystallography can be used in principle for analysing electron-diffraction data from three-dimensional nanocrystals of proteins. PMID:23793148

  2. Structural, optical, mechanical and dielectric studies of pure and doped L-Prolinium trichloroacetate single crystals.

    PubMed

    Renuka, N; Ramesh Babu, R; Vijayan, N; Vasanthakumar, Geetha; Krishna, Anuj; Ramamurthi, K

    2015-02-25

    In the present work, pure and metal substituted L-Prolinium trichloroacetate (LPTCA) single crystals were grown by slow evaporation method. The grown crystals were subjected to single crystal X-ray diffraction (XRD), powder X-ray diffraction, FTIR, UV-Visible-NIR, hardness, photoluminescence and dielectric studies. The dopant concentration in the crystals was measured by inductively coupled plasma (ICP) analysis. Single crystal X-ray diffraction studies of the pure and metal substituted LPTCA revealed that the grown crystals belong to the trigonal system. Ni(2+) and Co(2+) doping slightly altered the lattice parameters of LPTCA without affecting the basic structure of the crystal. FTIR spectral analysis confirms the presence of various functional groups in the grown crystals. The mechanical behavior of pure and doped crystals was analyzed by Vickers's microhardness test. The optical transmittance, dielectric and photoluminescence properties of the pure and doped crystals were analyzed. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Quantitative analysis of crystalline pharmaceuticals in tablets by pattern-fitting procedure using X-ray diffraction pattern.

    PubMed

    Takehira, Rieko; Momose, Yasunori; Yamamura, Shigeo

    2010-10-15

    A pattern-fitting procedure using an X-ray diffraction pattern was applied to the quantitative analysis of binary system of crystalline pharmaceuticals in tablets. Orthorhombic crystals of isoniazid (INH) and mannitol (MAN) were used for the analysis. Tablets were prepared under various compression pressures using a direct compression method with various compositions of INH and MAN. Assuming that X-ray diffraction pattern of INH-MAN system consists of diffraction intensities from respective crystals, observed diffraction intensities were fitted to analytic expression based on X-ray diffraction theory and separated into two intensities from INH and MAN crystals by a nonlinear least-squares procedure. After separation, the contents of INH were determined by using the optimized normalization constants for INH and MAN. The correction parameter including all the factors that are beyond experimental control was required for quantitative analysis without calibration curve. The pattern-fitting procedure made it possible to determine crystalline phases in the range of 10-90% (w/w) of the INH contents. Further, certain characteristics of the crystals in the tablets, such as the preferred orientation, size of crystallite, and lattice disorder were determined simultaneously. This method can be adopted to analyze compounds whose crystal structures are known. It is a potentially powerful tool for the quantitative phase analysis and characterization of crystals in tablets and powders using X-ray diffraction patterns. Copyright 2010 Elsevier B.V. All rights reserved.

  4. Crystal structure and density of helium to 232 kbar

    NASA Technical Reports Server (NTRS)

    Mao, H. K.; Wu, Y.; Jephcoat, A. P.; Hemley, R. J.; Bell, P. M.; Bassett, W. A.

    1988-01-01

    The properties of helium and hydrogen at high pressure are topics of great interest to the understanding of planetary interiors. These materials constitute 95 percent of the entire solar system. A technique was presented for the measurement of X-ray diffraction from single-crystals of low-Z condenses gases in a diamond-anvil cell at high pressure. The first such single-crystal X-ray diffraction measurements on solid hydrogen to 26.5 GPa were presented. The application of this technique to the problem of the crystal structure, equation of state, and phase diagram of solid helium is reported. Crucial for X-ray diffraction studies of these materials is the use of a synchrotron radiation source which provides high brillance, narrow collimation of the incident and diffracted X-ray beams to reduce the background noise, and energy-dispersive diffraction techniques with polychromatic (white) radiation, which provides high detection efficiency.

  5. A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids.

    PubMed

    Zipper, Lauren E; Aristide, Xavier; Bishop, Dylan P; Joshi, Ishita; Kharzeev, Julia; Patel, Krishna B; Santiago, Brianna M; Joshi, Karan; Dorsinvil, Kahille; Sweet, Robert M; Soares, Alexei S

    2014-12-01

    A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63-82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.

  6. Crystallization of PTP Domains.

    PubMed

    Levy, Colin; Adams, James; Tabernero, Lydia

    2016-01-01

    Protein crystallography is the most powerful method to obtain atomic resolution information on the three-dimensional structure of proteins. An essential step towards determining the crystallographic structure of a protein is to produce good quality crystals from a concentrated sample of purified protein. These crystals are then used to obtain X-ray diffraction data necessary to determine the 3D structure by direct phasing or molecular replacement if the model of a homologous protein is available. Here, we describe the main approaches and techniques to obtain suitable crystals for X-ray diffraction. We include tools and guidance on how to evaluate and design the protein construct, how to prepare Se-methionine derivatized protein, how to assess the stability and quality of the sample, and how to crystallize and prepare crystals for diffraction experiments. While general strategies for protein crystallization are summarized, specific examples of the application of these strategies to the crystallization of PTP domains are discussed.

  7. High resolution synchrotron X-radiation diffraction imaging of crystals grown in microgravity and closely related terrestrial crystals

    NASA Technical Reports Server (NTRS)

    Steiner, Bruce; Dobbyn, Ronald C.; Black, David; Burdette, Harold; Kuriyama, Masao; Fripp, Archibald; Simchik, Richard

    1991-01-01

    Irregularities in three crystals grown in space and in four terrestrial crystals grown under otherwise comparable conditions have been observed in high resolution diffraction imaging. The images provide important new clues to the nature and origins of irregularities in each crystal. For two of the materials, mercuric iodide and lead tin telluride, more than one phase (an array of non-diffracting inclusions) was observed in terrestrial samples; but the formation of these multiple phases appears to have been suppressed in directly comparable crystals grown in microgravity. The terrestrial seed crystal of triglycine sulfate displayed an unexpected layered structure, which propagated during directly comparable space growth. Terrestrial Bridgman regrowth of gallium arsenide revealed a mesoscopic structure substantially different from that of the original Czochralski material. A directly comparable crystal is to be grown shortly in space.

  8. Imperfection and radiation damage in protein crystals studied with coherent radiation

    PubMed Central

    Nave, Colin; Sutton, Geoff; Evans, Gwyndaf; Owen, Robin; Rau, Christoph; Robinson, Ian; Stuart, David Ian

    2016-01-01

    Fringes and speckles occur within diffraction spots when a crystal is illuminated with coherent radiation during X-ray diffraction. The additional information in these features provides insight into the imperfections in the crystal at the sub-micrometre scale. In addition, these features can provide more accurate intensity measurements (e.g. by model-based profile fitting), detwinning (by distinguishing the various components), phasing (by exploiting sampling of the molecular transform) and refinement (by distinguishing regions with different unit-cell parameters). In order to exploit these potential benefits, the features due to coherent diffraction have to be recorded and any change due to radiation damage properly modelled. Initial results from recording coherent diffraction at cryotemperatures from polyhedrin crystals of approximately 2 µm in size are described. These measurements allowed information about the type of crystal imperfections to be obtained at the sub-micrometre level, together with the changes due to radiation damage. PMID:26698068

  9. Crystallization and X-ray diffraction of crystals formed in water-plasticized amorphous lactose.

    PubMed

    Jouppila, K; Kansikas, J; Roos, Y H

    1998-01-01

    Effects of storage time and relative humidity on crystallization and crystal forms produced from amorphous lactose were investigated. Crystallization was observed from time-dependent loss of sorbed water and increasing intensities of peaks in X-ray diffraction patterns. The rate of crystallization increased with increasing storage relative humidity. Lactose crystallized mainly as alpha-lactose monohydrate and anhydrous crystals with alpha- and beta-lactose in a molar ratio of 5:3. The results suggested that the crystal form was defined by the early nucleation process. The crystallization data are important in modeling of crystallization phenomena and prediction of stability of lactose-containing food and pharmaceutical materials.

  10. Energy-dispersive neutron imaging and diffraction of magnetically driven twins in a Ni2MnGa single crystal magnetic shape memory alloy

    NASA Astrophysics Data System (ADS)

    Kabra, Saurabh; Kelleher, Joe; Kockelmann, Winfried; Gutmann, Matthias; Tremsin, Anton

    2016-09-01

    Single crystals of a partially twinned magnetic shape memory alloy, Ni2MnGa, were imaged using neutron diffraction and energy-resolved imaging techniques at the ISIS spallation neutron source. Single crystal neutron diffraction showed that the crystal produces two twin variants with a specific crystallographic relationship. Transmission images were captured using a time of flight MCP/Timepix neutron counting detector. The twinned and untwinned regions were clearly distinguishable in images corresponding to narrow-energy transmission images. Further, the spatially-resolved transmission spectra were used to elucidate the orientations of the crystallites in the different volumes of the crystal.

  11. Crystallization of Mitochondrial Respiratory Complex II from Chicken Heart: a Membrane Protein Complex Diffracting to 2.0 Å.

    PubMed Central

    Huang, Li-shar; Borders, Toni M.; Shen, John T.; Wang, Chung-Jen; Berry, Edward

    2006-01-01

    Synopsis A multi-subunit mitochondrial membrane protein complex involved in the Krebs Cycle and respiratory chain has been crystallized in a form suitable for near-atomic resolution structure determination. A procedure is presented for preparation of diffraction-quality crystals of a vertebrate mitochondrial respiratory Complex II. The crystals have the potential to diffract to at least 2.0 Å with optimization of post-crystal-growth treatment and cryoprotection. This should allow determination of the structure of this important and medically relevant membrane protein complex at near-atomic resolution and provide great detail of the mode of binding of substrates and inhibitors at the two substrate-binding sites. PMID:15805592

  12. Crystallization and X-ray diffraction analysis of a catalytic domain of hyperthermophilic chitinase from Pyrococcus furiosus

    PubMed Central

    Mine, Shouhei; Nakamura, Tsutomu; Hirata, Kunio; Ishikawa, Kazuhiko; Hagihara, Yoshihisa; Uegaki, Koichi

    2006-01-01

    The crystallization and preliminary X-ray diffraction analysis of a catalytic domain of chitinase (PF1233 gene) from the hyperthermophilic archaeon Pyrococcus furiosus is reported. The recombinant protein, prepared using an Escherichia coli expression system, was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected at the undulator beamline BL44XU at SPring-8 to a resolution of 1.50 Å. The crystals belong to space group P212121, with unit-cell parameters a = 90.0, b = 92.8, c = 107.2 Å. PMID:16880559

  13. Purification, crystallization and preliminary X-ray analysis of a thermostable glycoside hydrolase family 43 β-xylosidase from Geobacillus thermoleovorans IT-08

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rohman, Ali; Oosterwijk, Niels van; Kralj, Slavko

    2007-11-01

    The β-xylosidase was crystallized using PEG 6000 as precipitant. 5% PEG 6000 yielded bipyramid-shaped tetragonal crystals diffracting to 1.55 Å resolution, and 13% PEG 6000 gave rectangular monoclinic crystals diffracting to 1.80 Å resolution. The main enzymes involved in xylan-backbone hydrolysis are endo-1,4-β-xylanase and β-xylosidase. β-Xylosidase converts the xylo-oligosaccharides produced by endo-1,4-β-xylanase into xylose monomers. The β-xylosidase from the thermophilic Geobacillus thermoleovorans IT-08, a member of glycoside hydrolase family 43, was crystallized at room temperature using the hanging-drop vapour-diffusion method. Two crystal forms were observed. Bipyramid-shaped crystals belonging to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = bmore » = 62.53, c = 277.4 Å diffracted to 1.55 Å resolution. The rectangular crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 57.94, b = 142.1, c = 153.9 Å, β = 90.5°, and diffracted to 1.80 Å resolution.« less

  14. Growing Larger Crystals for Neutron Diffraction

    NASA Technical Reports Server (NTRS)

    Pusey, Marc

    2003-01-01

    Obtaining crystals of suitable size and high quality has been a major bottleneck in macromolecular crystallography. With the advent of advanced X-ray sources and methods the question of size has rapidly dwindled, almost to the point where if one can see the crystal then it was big enough. Quality is another issue, and major national and commercial efforts were established to take advantage of the microgravity environment in an effort to obtain higher quality crystals. Studies of the macromolecule crystallization process were carried out in many labs in an effort to understand what affected the resultant crystal quality on Earth, and how microgravity improved the process. While technological improvements are resulting in a diminishing of the minimum crystal size required, neutron diffraction structural studies still require considerably larger crystals, by several orders of magnitude, than X-ray studies. From a crystal growth physics perspective there is no reason why these 'large' crystals cannot be obtained: the question is generally more one of supply than limitations mechanism. This talk will discuss our laboratory s current model for macromolecule crystal growth, with highlights pertaining to the growth of crystals suitable for neutron diffraction studies.

  15. Crystallization of multiple forms of bovine seminal ribonuclease in the liganded and unliganded state

    NASA Astrophysics Data System (ADS)

    Sica, F.; Adinolfi, S.; Berisio, R.; De Lorenzo, C.; Mazzarella, L.; Piccoli, R.; Vitagliano, L.; Zagari, A.

    1999-01-01

    Bovine seminal ribonuclease (BS-RNase) is an intriguing homodimeric enzyme which exists as two conformational isomers, characterized by distinct catalytic and biological properties, referred to as M×M and M=M. Reduction of inter-chain disulfide bridges produces a stable monomeric derivative (M) which is still active. This paper reports the screening and optimization of crystallization conditions for growing single diffraction-quality crystals for the various BS-RNase forms. The crystallization trials were performed using both the vapor diffusion and microbatch methods. The M×M dimer was crystallized in the free form from polyethylene glycol (PEG) 4000 at pH 8.5 and as a complex with the substrate analog uridylyl(2'- 5')guanosine (UpG) from an unbuffered ammonium sulfate (AS) solution. These two crystal types diffract X-rays to 2.5 and 1.9 Å resolution, respectively. Two different crystal types were obtained both for the M=M dimer and for the monomeric derivative. (M=M)a crystals, grown from PEG 4000 (8% w/v) at pH 5.6, diffract X-rays to 4.0 Å. At higher PEG concentration (15% w/v) a different crystal type was obtained, (M=M)b, which showed a better diffraction limit (2.5 Å). For the monomer, type (M)a and (M)b crystals, diffracting X-rays to 2.5 Å resolution, were obtained from AS at pH 6.5 and from PEG 4000 at pH 8.5, respectively. A comparison with previously crystallized forms of the dimer M×M and its complexes with uridylyl(2'-5')adenosine and 2'-deoxycytidylyl(3'-5')-2'-deoxyadenosine is also presented. The three-dimensional structure analysis of (M×M)·UpG and (M=M)b is in progress.

  16. Observation of sagittal X-ray diffraction by surface acoustic waves in Bragg geometry.

    PubMed

    Vadilonga, Simone; Zizak, Ivo; Roshchupkin, Dmitry; Evgenii, Emelin; Petsiuk, Andrei; Leitenberger, Wolfram; Erko, Alexei

    2017-04-01

    X-ray Bragg diffraction in sagittal geometry on a Y-cut langasite crystal (La 3 Ga 5 SiO 14 ) modulated by Λ = 3 µm Rayleigh surface acoustic waves was studied at the BESSY II synchrotron radiation facility. Owing to the crystal lattice modulation by the surface acoustic wave diffraction, satellites appear. Their intensity and angular separation depend on the amplitude and wavelength of the ultrasonic superlattice. Experimental results are compared with the corresponding theoretical model that exploits the kinematical diffraction theory. This experiment shows that the propagation of the surface acoustic waves creates a dynamical diffraction grating on the crystal surface, and this can be used for space-time modulation of an X-ray beam.

  17. Observation of sagittal X-ray diffraction by surface acoustic waves in Bragg geometry1

    PubMed Central

    Vadilonga, Simone; Zizak, Ivo; Roshchupkin, Dmitry; Evgenii, Emelin; Petsiuk, Andrei; Leitenberger, Wolfram; Erko, Alexei

    2017-01-01

    X-ray Bragg diffraction in sagittal geometry on a Y-cut langasite crystal (La3Ga5SiO14) modulated by Λ = 3 µm Rayleigh surface acoustic waves was studied at the BESSY II synchrotron radiation facility. Owing to the crystal lattice modulation by the surface acoustic wave diffraction, satellites appear. Their intensity and angular separation depend on the amplitude and wavelength of the ultrasonic superlattice. Experimental results are compared with the corresponding theoretical model that exploits the kinematical diffraction theory. This experiment shows that the propagation of the surface acoustic waves creates a dynamical diffraction grating on the crystal surface, and this can be used for space–time modulation of an X-ray beam. PMID:28381976

  18. Crystallization and preliminary X-ray diffraction analysis of a chitin-binding domain of hyperthermophilic chitinase from Pyrococcus furiosus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakamura, Tsutomu; Ishikawa, Kazuhiko; Hagihara, Yoshihisa

    The expression, purification and preliminary X-ray diffraction studies of a chitin-binding domain of the chitinase from P. furiosus are reported. The crystallization and preliminary X-ray diffraction analysis of the chitin-binding domain of chitinase from a hyperthermophilic archaeon, Pyrococcus furiosus, are reported. The recombinant protein was prepared using an Escherichia coli overexpression system and was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected to 1.70 Å resolution. The crystal belonged to space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2. The unit-cell parameters were determined to be a = b = 48.8, c = 85.0 Å.

  19. Highly efficient acousto-optic diffraction in Sn2P2S6 crystals.

    PubMed

    Martynyuk-Lototska, I Yu; Mys, O G; Grabar, A A; Stoika, I M; Vysochanskii, Yu M; Vlokh, R O

    2008-01-01

    We have studied the acousto-optic (AO) diffraction in Sn2P2S6 crystals and found that they manifest high values of an AO figure of merit. The above crystals may therefore be used as highly efficient materials in different AO applications.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.

    A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under differentmore » conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. Ultimately, the results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less

  1. Studies on the growth, structural, spectral and third-order nonlinear optical properties of ammonium 3-carboxy-4-hydroxy benzenesulfonate monohydrate single crystal.

    PubMed

    Silambarasan, A; Krishna Kumar, M; Thirunavukkarasu, A; Mohan Kumar, R; Umarani, P R

    2015-01-25

    An organic nonlinear optical bulk single crystal, Ammonium 3-carboxy-4-hydroxy benzenesulfonate monohydrate (ACHBS) was successfully grown by solution growth technique. Single crystal X-ray diffraction study confirms that, the grown crystal belongs to P21/c space group. Powder X-ray diffraction and high resolution X-ray diffraction analyses revealed the crystallinity of the grown crystal. Infrared spectral analysis showed the vibrational behavior of chemical bonds and its functional groups. The thermal stability and decomposition stages of the grown crystal were studied by TG-DTA analysis. UV-Visible transmittance studies showed the transparency region and cut-off wavelength of the grown crystal. The third-order nonlinear optical susceptibility of the grown crystal was estimated by Z-scan technique using He-Ne laser source. The mechanical property of the grown crystal was studied by using Vicker's microhardness test. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Preparation and Analysis of RNA Crystals

    NASA Technical Reports Server (NTRS)

    Todd, Paul

    2000-01-01

    The crystallization of RiboNucleic Acids (RNA) was studied from the standpoint of mechanisms of crystal growth in three tasks: (1) preparation of high-quality crystals of oligonuclotides for X-ray diffraction, (2) finding pathways to the growth of high-quality crystals for X-ray diffraction and (3) investigation of mechanisms of action of inertial acceleration on crystal growth. In these tasks: (1) RNA crystals were prepared and studied by X-ray diffraction; (2) a pathway to high-quality crystals was discovered and characterized; a combination of kinetic and equilibrium factors could be optimized as described below; and (3) an interplay between purity and gravity was found in a combination of space and ground experiments with nucleic acids and proteins. Most significantly, the rate of concentration of precipitant and RNA can be controlled by membrane-based methods of water removal or by diffusion of multivalent cations across an interface stabilized by a membrane. Oligonucleotide solutions are electrokinetically stabilized colloids, and crystals can form by the controlled addition of multivalent cations.

  3. Collection of X-ray diffraction data from macromolecular crystals

    PubMed Central

    Dauter, Zbigniew

    2017-01-01

    Diffraction data acquisition is the final experimental stage of the crystal structure analysis. All subsequent steps involve mainly computer calculations. Optimally measured and accurate data make the structure solution and refinement easier and lead to more faithful interpretation of the final models. Here, the important factors in data collection from macromolecular crystals are discussed and strategies appropriate for various applications, such as molecular replacement, anomalous phasing, atomic-resolution refinement etc., are presented. Criteria useful for judging the diffraction data quality are also discussed. PMID:28573573

  4. X-ray plane-wave diffraction effects in a crystal with third-order nonlinearity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balyan, M. K., E-mail: mbalyan@ysu.am

    The two-wave dynamical diffraction in the Laue geometry has been theoretically considered for a plane X-ray wave in a crystal with a third-order nonlinear response to the external field. An analytical solution to the problem stated is found for certain diffraction conditions. A nonlinear pendulum effect is analyzed. The nonlinear extinction length is found to depend on the incident-wave intensity. A pendulum effect of a new type is revealed: the intensities of the transmitted and diffracted waves periodically depend on the incidentwave intensity at a fixed crystal thickness. The rocking curves and Borrmann nonlinear effect are numerically calculated.

  5. Towards protein-crystal centering using second-harmonic generation (SHG) microscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kissick, David J.; Dettmar, Christopher M.; Becker, Michael

    2013-05-01

    The potential of second-harmonic generation (SHG) microscopy for automated crystal centering to guide synchrotron X-ray diffraction of protein crystals has been explored. The potential of second-harmonic generation (SHG) microscopy for automated crystal centering to guide synchrotron X-ray diffraction of protein crystals was explored. These studies included (i) comparison of microcrystal positions in cryoloops as determined by SHG imaging and by X-ray diffraction rastering and (ii) X-ray structure determinations of selected proteins to investigate the potential for laser-induced damage from SHG imaging. In studies using β{sub 2} adrenergic receptor membrane-protein crystals prepared in lipidic mesophase, the crystal locations identified by SHGmore » images obtained in transmission mode were found to correlate well with the crystal locations identified by raster scanning using an X-ray minibeam. SHG imaging was found to provide about 2 µm spatial resolution and shorter image-acquisition times. The general insensitivity of SHG images to optical scatter enabled the reliable identification of microcrystals within opaque cryocooled lipidic mesophases that were not identified by conventional bright-field imaging. The potential impact of extended exposure of protein crystals to five times a typical imaging dose from an ultrafast laser source was also assessed. Measurements of myoglobin and thaumatin crystals resulted in no statistically significant differences between structures obtained from diffraction data acquired from exposed and unexposed regions of single crystals. Practical constraints for integrating SHG imaging into an active beamline for routine automated crystal centering are discussed.« less

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sathyalakshmi, R.; Bhagavannarayana, G.; Ramasamy, P.

    L-(+)-Glutamic acid hydro bromide, an isomorphic salt of L-glutamic acid hydrochloride, was synthesized and the synthesis was confirmed using Fourier transform infrared analysis. Solubility of the material in water was determined. L-Glutamic acid hydro bromide crystals were grown by low temperature solution growth using the solvent evaporation technique. Single crystal X-ray diffraction studies were carried out and the cell parameters, atomic co-ordinates, bond lengths and bond angles were reported. High-resolution X-ray diffraction studies were carried out and good crystallinity for the grown crystal was observed from the diffraction curve. The grown crystals were subjected to dielectric studies. Ultraviolet-visible-near infrared spectralmore » analysis shows good optical transmission in the visible and infrared region of the grown crystals. The second harmonic generation efficiency of L-glutamic acid hydro bromide crystal was determined using the Kurtz powder test and it was found that it had efficiency comparable with that of the potassium di-hydrogen phosphate crystal.« less

  7. Sequential x-ray diffraction topography at 1-BM x-ray optics testing beamline at the advanced photon source

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoupin, Stanislav, E-mail: sstoupin@aps.anl.gov; Shvyd’ko, Yuri; Trakhtenberg, Emil

    2016-07-27

    We report progress on implementation and commissioning of sequential X-ray diffraction topography at 1-BM Optics Testing Beamline of the Advanced Photon Source to accommodate growing needs of strain characterization in diffractive crystal optics and other semiconductor single crystals. The setup enables evaluation of strain in single crystals in the nearly-nondispersive double-crystal geometry. Si asymmetric collimator crystals of different crystallographic orientations were designed, fabricated and characterized using in-house capabilities. Imaging the exit beam using digital area detectors permits rapid sequential acquisition of X-ray topographs at different angular positions on the rocking curve of a crystal under investigation. Results on sensitivity andmore » spatial resolution are reported based on experiments with high-quality Si and diamond crystals. The new setup complements laboratory-based X-ray topography capabilities of the Optics group at the Advanced Photon Source.« less

  8. The collection of MicroED data for macromolecular crystallography.

    PubMed

    Shi, Dan; Nannenga, Brent L; de la Cruz, M Jason; Liu, Jinyang; Sawtelle, Steven; Calero, Guillermo; Reyes, Francis E; Hattne, Johan; Gonen, Tamir

    2016-05-01

    The formation of large, well-ordered crystals for crystallographic experiments remains a crucial bottleneck to the structural understanding of many important biological systems. To help alleviate this problem in crystallography, we have developed the MicroED method for the collection of electron diffraction data from 3D microcrystals and nanocrystals of radiation-sensitive biological material. In this approach, liquid solutions containing protein microcrystals are deposited on carbon-coated electron microscopy grids and are vitrified by plunging them into liquid ethane. MicroED data are collected for each selected crystal using cryo-electron microscopy, in which the crystal is diffracted using very few electrons as the stage is continuously rotated. This protocol gives advice on how to identify microcrystals by light microscopy or by negative-stain electron microscopy in samples obtained from standard protein crystallization experiments. The protocol also includes information about custom-designed equipment for controlling crystal rotation and software for recording experimental parameters in diffraction image metadata. Identifying microcrystals, preparing samples and setting up the microscope for diffraction data collection take approximately half an hour for each step. Screening microcrystals for quality diffraction takes roughly an hour, and the collection of a single data set is ∼10 min in duration. Complete data sets and resulting high-resolution structures can be obtained from a single crystal or by merging data from multiple crystals.

  9. A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids

    PubMed Central

    Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.; Joshi, Ishita; Kharzeev, Julia; Patel, Krishna B.; Santiago, Brianna M.; Joshi, Karan; Dorsinvil, Kahille; Sweet, Robert M.; Soares, Alexei S.

    2014-01-01

    A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations. PMID:25484231

  10. A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids

    DOE PAGES

    Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.; ...

    2014-11-28

    A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under differentmore » conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. Ultimately, the results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less

  11. Purification, isolation, crystallization, and preliminary X-ray diffraction study of the BTB domain of the centrosomal protein 190 from Drosophila melanogaster

    NASA Astrophysics Data System (ADS)

    Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Popov, V. O.

    2017-11-01

    The spatial organization of the genome is controlled by a special class of architectural proteins, including proteins containing BTB domains that are able to dimerize or multimerize. The centrosomal protein 190 is one of such architectural proteins. The purification, crystallization, and preliminary X-ray diffraction study of the BTB domain of the centrosomal protein 190 are reported. The crystallization conditions were found by the vapor-diffusion technique. The crystals diffracted to 1.5 Å resolution and belonged to sp. gr. P3221. The structure was solved by the molecular replacement method. The structure refinement is currently underway.

  12. Crystallization and preliminary X-ray diffraction analysis of the amidase domain of allophanate hydrolase from Pseudomonas sp. strain ADP

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balotra, Sahil; Newman, Janet; French, Nigel G.

    2014-02-19

    The amidase domain of the allophanate hydrolase AtzF from Pseudomonas sp. strain ADP has been crystallized and preliminary X-ray diffraction data have been collected. The allophanate hydrolase from Pseudomonas sp. strain ADP was expressed and purified, and a tryptic digest fragment was subsequently identified, expressed and purified. This 50 kDa construct retained amidase activity and was crystallized. The crystals diffracted to 2.5 Å resolution and adopted space group P2{sub 1}, with unit-cell parameters a = 82.4, b = 179.2, c = 112.6 Å, β = 106.6°.

  13. In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

    DOE PAGES

    Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kevin; ...

    2016-03-01

    The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. Furthermore, the observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined.

  14. In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kevin

    The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. Furthermore, the observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined.

  15. In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

    PubMed Central

    Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kèvin; Stellato, Francesco; Liang, Mengning; White, Thomas A.; Seine, Thomas; Messerschmidt, Marc; Chapman, Henry N.; Wilmanns, Matthias

    2016-01-01

    The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. The observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined. PMID:27006771

  16. Connecting heterogeneous single slip to diffraction peak evolution in high-energy monochromatic X-ray experiments

    PubMed Central

    Pagan, Darren C.; Miller, Matthew P.

    2014-01-01

    A forward modeling diffraction framework is introduced and employed to identify slip system activity in high-energy diffraction microscopy (HEDM) experiments. In the framework, diffraction simulations are conducted on virtual mosaic crystals with orientation gradients consistent with Nye’s model of heterogeneous single slip. Simulated diffraction peaks are then compared against experimental measurements to identify slip system activity. Simulation results compared against diffraction data measured in situ from a silicon single-crystal specimen plastically deformed under single-slip conditions indicate that slip system activity can be identified during HEDM experiments. PMID:24904242

  17. Room-temperature serial crystallography using a kinetically optimized microfluidic device for protein crystallization and on-chip X-ray diffraction

    PubMed Central

    Heymann, Michael; Opthalage, Achini; Wierman, Jennifer L.; Akella, Sathish; Szebenyi, Doletha M. E.; Gruner, Sol M.; Fraden, Seth

    2014-01-01

    An emulsion-based serial crystallographic technology has been developed, in which nanolitre-sized droplets of protein solution are encapsulated in oil and stabilized by surfactant. Once the first crystal in a drop is nucleated, the small volume generates a negative feedback mechanism that lowers the supersaturation. This mechanism is exploited to produce one crystal per drop. Diffraction data are measured, one crystal at a time, from a series of room-temperature crystals stored on an X-ray semi-transparent microfluidic chip, and a 93% complete data set is obtained by merging single diffraction frames taken from different unoriented crystals. As proof of concept, the structure of glucose isomerase was solved to 2.1 Å, demonstrating the feasibility of high-throughput serial X-ray crystallography using synchrotron radiation. PMID:25295176

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aoki, Ken-ichi; Tanaka, Nobutada, E-mail: ntanaka@pharm.showa-u.ac.jp; Ishikura, Shuhei

    Pig heart carbonyl reductase has been crystallized in the presence of NADPH. Diffraction data have been collected using synchrotron radiation. Pig heart carbonyl reductase (PHCR), which belongs to the short-chain dehydrogenase/reductase (SDR) family, has been crystallized by the hanging-drop vapour-diffusion method. Two crystal forms (I and II) have been obtained in the presence of NADPH. Form I crystals belong to the tetragonal space group P4{sub 2}, with unit-cell parameters a = b = 109.61, c = 94.31 Å, and diffract to 1.5 Å resolution. Form II crystals belong to the tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters amore » = b = 120.10, c = 147.00 Å, and diffract to 2.2 Å resolution. Both crystal forms are suitable for X-ray structure analysis at high resolution.« less

  19. Diffractive-refractive optics: (+,-,-,+) X-ray crystal monochromator with harmonics separation.

    PubMed

    Hrdý, Jaromír; Mikulík, Petr; Oberta, Peter

    2011-03-01

    A new kind of two channel-cut crystals X-ray monochromator in dispersive (+,-,-,+) position which spatially separates harmonics is proposed. The diffracting surfaces are oriented so that the diffraction is inclined. Owing to refraction the diffracted beam is sagittally deviated. The deviation depends on wavelength and is much higher for the first harmonics than for higher harmonics. This leads to spatial harmonics separation. The idea is supported by ray-tracing simulation.

  20. Crystallization and preliminary X-ray diffraction studies of the ferredoxin reductase component in the Rieske nonhaem iron oxygenase system carbazole 1,9a-dioxygenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ashikawa, Yuji; Uchimura, Hiromasa; Fujimoto, Zui

    2007-06-01

    The NAD(P)H:ferredoxin oxidoreductase in carbazole 1,9a-dioxygenase from Janthinobacterium sp. J3 was crystallized and diffraction data were collected to 2.60 Å resolution. Carbazole 1,9a-dioxygenase (CARDO), which consists of an oxygenase component (CARDO-O) and the electron-transport components ferredoxin (CARDO-F) and ferredoxin reductase (CARDO-R), catalyzes dihydroxylation at the C1 and C9a positions of carbazole. CARDO-R was crystallized at 277 K using the hanging-drop vapour-diffusion method with the precipitant PEG 8000. Two crystal types (types I and II) were obtained. The type I crystal diffracted to a maximum resolution of 2.80 Å and belonged to space group P4{sub 2}2{sub 1}2, with unit-cell parameters amore » = b = 158.7, c = 81.4 Å. The type II crystal was obtained in drops from which type I crystals had been removed; it diffracted to 2.60 Å resolution and belonged to the same space group, with unit-cell parameters a = b = 161.8, c = 79.5 Å.« less

  1. Neutron and X-ray single-crystal diffraction from protein microcrystals via magnetically oriented microcrystal arrays in gels.

    PubMed

    Tsukui, Shu; Kimura, Fumiko; Kusaka, Katsuhiro; Baba, Seiki; Mizuno, Nobuhiro; Kimura, Tsunehisa

    2016-07-01

    Protein microcrystals magnetically aligned in D2O hydrogels were subjected to neutron diffraction measurements, and reflections were observed for the first time to a resolution of 3.4 Å from lysozyme microcrystals (∼10 × 10 × 50 µm). This result demonstrated the possibility that magnetically oriented microcrystals consolidated in D2O gels may provide a promising means to obtain single-crystal neutron diffraction from proteins that do not crystallize at the sizes required for neutron diffraction structure determination. In addition, lysozyme microcrystals aligned in H2O hydrogels allowed structure determination at a resolution of 1.76 Å at room temperature by X-ray diffraction. The use of gels has advantages since the microcrystals are measured under hydrated conditions.

  2. Preliminary crystallographic analysis of ADP-glucose pyrophosphorylase from Agrobacterium tumefaciens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cupp-Vickery, Jill R., E-mail: jvickery@uci.edu; Igarashi, Robert Y.; Meyer, Christopher R.

    2005-03-01

    Crystallization and X-ray diffraction methods for native A. tumefaciens ADP-glucose pyrophosphorylase and its selenomethionyl derivative are described. Two crystal forms are identified, both of which diffract to 2 Å.

  3. Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum.

    PubMed

    Cranston, Laura J; Roszak, Aleksander W; Cogdell, Richard J

    2014-06-01

    LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment-protein complex that is involved in harvesting light energy and transferring it to the LH1-RC `core' complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a=b=109.36, c=80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer.

  4. Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum

    PubMed Central

    Cranston, Laura J.; Roszak, Aleksander W.; Cogdell, Richard J.

    2014-01-01

    LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment–protein complex that is involved in harvesting light energy and transferring it to the LH1–RC ‘core’ complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a = b = 109.36, c = 80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer. PMID:24915099

  5. Three-dimensional reconstruction of the size and shape of protein microcrystals using Bragg coherent diffractive imaging

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Coughlan, H. D.; Darmanin, C.; Kirkwood, H. J.

    2016-03-14

    Three-dimensional imaging of protein crystals during X-ray diffraction experiments opens up a range of possibilities for optimising crystal quality and gaining new insights into the fundamental processes that drive radiation damage. Obtaining this information at the appropriate lengthscales however is extremely challenging. One approach that has been recently demonstrated as a promising avenue for charactering the size and shape of protein crystals at nanometre lengthscales is Bragg Coherent Diffractive Imaging (BCDI). BCDI is a recently developed technique that is able to recover the phase of the continuous diffraction intensity signal around individual Bragg peaks. When data is collected at multiplemore » points on a rocking curve a Reciprocal Space Map (RSM) can be assembled and then inverted using BCDI to obtain a three-dimensional image of the crystal. The first demonstration of two-dimensional BCDI of protein crystals was reported by Boutet at al., recently this work was extended to the study of radiation damage of micron-sized crystals. Here we present the first three-dimensional reconstructions of a Lysozyme protein crystal using BDI. The results are validated against RSM and TEM data and have implications for both radiation damage studies and for developing new approaches to structure retrieval from micron-sized protein crystals.« less

  6. Crystallization of the C-terminal domain of the addiction antidote CcdA in complex with its toxin CcdB

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buts, Lieven; De Jonge, Natalie; Loris, Remy, E-mail: reloris@vub.ac.be

    2005-10-01

    The CcdA C-terminal domain was crystallized in complex with CcdB in two crystal forms that diffract to beyond 2.0 Å resolution. CcdA and CcdB are the antidote and toxin of the ccd addiction module of Escherichia coli plasmid F. The CcdA C-terminal domain (CcdA{sub C36}; 36 amino acids) was crystallized in complex with CcdB (dimer of 2 × 101 amino acids) in three different crystal forms, two of which diffract to high resolution. Form II belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 37.6, b = 60.5, c = 83.8 Å and diffracts to 1.8more » Å resolution. Form III belongs to space group P2{sub 1}, with unit-cell parameters a = 41.0, b = 37.9, c = 69.6 Å, β = 96.9°, and diffracts to 1.9 Å resolution.« less

  7. Purification, crystallization and preliminary X-ray diffraction analysis of royal palm tree (Roystonea regia) peroxidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, Leandra; Nascimento, Alessandro S.; Zamorano, Laura S.

    2007-09-01

    The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.« less

  8. Growth and characterization of 4-chloro-3-nitrobenzophenone single crystals using vertical Bridgman technique

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aravinth, K., E-mail: anandcgc@gmail.com; Babu, G. Anandha, E-mail: anandcgc@gmail.com; Ramasamy, P., E-mail: anandcgc@gmail.com

    2014-04-24

    4-chloro-3-nitrobenzophenone (4C3N) has been grown by using vertical Bridgman technique. The grown crystal was confirmed by Powder X-ray diffraction analysis. The crystalline perfection of the grown crystal was examined by high-resolution X-ray diffraction study. The fluorescence spectra of grown 4C3N single crystals exhibit emission peak at 575 nm. The micro hardness measurements were used to analyze the mechanical property of the grown crystal.

  9. Macromolecular diffractive imaging using imperfect crystals

    PubMed Central

    Ayyer, Kartik; Yefanov, Oleksandr; Oberthür, Dominik; Roy-Chowdhury, Shatabdi; Galli, Lorenzo; Mariani, Valerio; Basu, Shibom; Coe, Jesse; Conrad, Chelsie E.; Fromme, Raimund; Schaffer, Alexander; Dörner, Katerina; James, Daniel; Kupitz, Christopher; Metz, Markus; Nelson, Garrett; Lourdu Xavier, Paulraj; Beyerlein, Kenneth R.; Schmidt, Marius; Sarrou, Iosifina; Spence, John C. H.; Weierstall, Uwe; White, Thomas A.; Yang, Jay-How; Zhao, Yun; Liang, Mengning; Aquila, Andrew; Hunter, Mark S.; Robinson, Joseph S.; Koglin, Jason E.; Boutet, Sébastien; Fromme, Petra; Barty, Anton; Chapman, Henry N.

    2016-01-01

    The three-dimensional structures of macromolecules and their complexes are predominantly elucidated by X-ray protein crystallography. A major limitation is access to high-quality crystals, to ensure X-ray diffraction extends to sufficiently large scattering angles and hence yields sufficiently high-resolution information that the crystal structure can be solved. The observation that crystals with shrunken unit-cell volumes and tighter macromolecular packing often produce higher-resolution Bragg peaks1,2 hints that crystallographic resolution for some macromolecules may be limited not by their heterogeneity but rather by a deviation of strict positional ordering of the crystalline lattice. Such displacements of molecules from the ideal lattice give rise to a continuous diffraction pattern, equal to the incoherent sum of diffraction from rigid single molecular complexes aligned along several discrete crystallographic orientations and hence with an increased information content3. Although such continuous diffraction patterns have long been observed—and are of interest as a source of information about the dynamics of proteins4 —they have not been used for structure determination. Here we show for crystals of the integral membrane protein complex photosystem II that lattice disorder increases the information content and the resolution of the diffraction pattern well beyond the 4.5 Å limit of measurable Bragg peaks, which allows us to directly phase5 the pattern. With the molecular envelope conventionally determined at 4.5 Å as a constraint, we then obtain a static image of the photosystem II dimer at 3.5 Å resolution. This result shows that continuous diffraction can be used to overcome long-supposed resolution limits of macromolecular crystallography, with a method that puts great value in commonly encountered imperfect crystals and opens up the possibility for model-free phasing6,7. PMID:26863980

  10. Crystal Structure of 17α-Dihydroequilin, C18H22O2, from Synchrotron Powder Diffraction Data and Density Functional Theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaduk, James; Gindhart, Amy; Blanton, Thomas

    The crystal structure of 17α-dihydroequilin has been solved and refined using synchrotron X-ray powder diffraction data, and optimized using density functional techniques. 17α-dihydroequilin crystallizes in space group P212121 (#19) with a = 6.76849(1) Å, b = 8.96849(1) Å, c = 23.39031(5) Å, V = 1419.915(3) Å3, and Z = 4. Both hydroxyl groups form hydrogen bonds to each other, resulting in zig-zag chains along the b-axis. The powder diffraction pattern has been submitted to ICDD for inclusion in the Powder Diffraction File™ as the entry 00-066-1608.

  11. Simulating Picosecond X-ray Diffraction from shocked crystals by Post-processing Molecular Dynamics Calculations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kimminau, G; Nagler, B; Higginbotham, A

    2008-06-19

    Calculations of the x-ray diffraction patterns from shocked crystals derived from the results of Non-Equilibrium-Molecular-Dynamics (NEMD) simulations are presented. The atomic coordinates predicted by the NEMD simulations combined with atomic form factors are used to generate a discrete distribution of electron density. A Fast-Fourier-Transform (FFT) of this distribution provides an image of the crystal in reciprocal space, which can be further processed to produce quantitative simulated data for direct comparison with experiments that employ picosecond x-ray diffraction from laser-irradiated crystalline targets.

  12. X-ray diffraction imaging (topography) of electroopticcrystals by synchrotron radiation

    NASA Technical Reports Server (NTRS)

    Steiner, Bruce; Kuriyama, Masao; Dobbyn, Ronald C.; Laor, Uri

    1988-01-01

    Information of special interest to crystal growers and device physicists now available from monochromatic synchrotron diffraction imaging (topography) is reviewed. Illustrations are taken from a variety of electro-optic crystals. Aspects of the detailed understanding of crystal growth processes obtainable from carefully selected samples are described. Finally, new experimental opportunities now available for exploitation are indicated.

  13. An Excel Spreadsheet for a One-Dimensional Fourier Map in X-ray Crystallography

    ERIC Educational Resources Information Center

    Clegg, William

    2004-01-01

    The teaching of crystal structure determination with single-crystal X-ray diffraction at undergraduate level faces numerous challenges. Single-crystal X-ray diffraction is used in a vast range of chemical research projects and forms the basis for a high proportion of structural results that are presented to high-school, undergraduate, and graduate…

  14. Polymorphism of Alprazolam (Xanax): a review of its crystalline phases and identification, crystallographic characterization, and crystal structure of a new polymorph (form III).

    PubMed

    de Armas, Héctor Novoa; Peeters, Oswald M; Van den Mooter, Guy; Blaton, Norbert

    2007-05-01

    A new polymorphic form of Alprazolam (Xanax), 8-chloro-1-methyl-6-phenyl-4H-[1,2,4]triazolo-[4,3-alpha][1,4]benzodiazepine, C(17)H(13)ClN(4), has been investigated by means of X-ray powder diffraction (XRPD), single crystal X-ray diffraction, and differential scanning calorimetry (DSC). This polymorphic form (form III) was obtained during DSC experiments after the exothermic recrystallization of the melt of form I. The crystal unit cell dimensions for form III were determined from diffractometer methods. The monoclinic unit cell found for this polymorph using XRPD after indexing the powder diffractogram was confirmed by the cell parameters obtained from single crystal X-ray diffractometry on a crystal isolated from the DSC pans. The single crystal unit cell parameters are: a = 28.929(9), b = 13.844(8), c = 7.361(3) angstroms, beta = 92.82(3) degrees , V = 2944(2) angstroms(3), Z = 8, space group P2(1) (No.4), Dx = 1.393 Mg/m(3). The structure obtained from single crystal X-ray diffraction was used as initial model for Rietveld refinement on the powder diffraction data of form III. The temperature phase transformations of alprazolam were also studied using high temperature XRPD. A review of the different phases available in the Powder Diffraction File (PDF) database for this drug is described bringing some clarification and corrections. (c) 2007 Wiley-Liss, Inc. and the American Pharmacists Association.

  15. Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

    2016-11-30

    A tetrahydrofolate-dependentO-demethylase, LigM, fromSphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtainedP3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding usingP3 121/P3 221 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space groupP2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c= 128.1 Å. TheP2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing the cryoconditions. Phasing using the single anomalous diffractionmore » method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

  16. Crystallization and preliminary crystallographic analysis of the Clostridium perfringens enterotoxin

    PubMed Central

    Briggs, David C.; Smedley, James G.; McClane, Bruce A.; Basak, Ajit K.

    2010-01-01

    Clostridium perfringens is a Gram-positive anaerobic species of bacterium that is notable for its ability to produce a plethora of toxins, including membrane-active toxins (α-toxins), pore-forming toxins (∊-toxins) and binary toxins (ι-toxins). Here, the crystallization of the full-length wild-type C. perfringens enterotoxin is reported, which is the causative agent of the second most prevalent food-borne illness in the United States and has been implicated in many other gastrointestinal pathologies. Several crystal forms were obtained. However, only two of these optimized crystal forms (I and II) were useable for X-ray diffraction data collection. The form I crystals diffracted to d min = 2.7 Å and belonged to space group C2, while the form II crystals diffracted to d min = 4 Å and belonged to space group P213. PMID:20606275

  17. LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kusakizako, Tsukasa; Tanaka, Yoshiki; Hipolito, Christopher J.

    A V. cholerae MATE transporter was crystallized using the lipidic cubic phase (LCP) method. X-ray diffraction data sets were collected from single crystals obtained in a sandwich plate and a sitting-drop plate to resolutions of 2.5 and 2.2 Å, respectively. Multidrug and toxic compound extrusion (MATE) transporters, one of the multidrug exporter families, efflux xenobiotics towards the extracellular side of the membrane. Since MATE transporters expressed in bacterial pathogens contribute to multidrug resistance, they are important therapeutic targets. Here, a MATE-transporter homologue from Vibrio cholerae, VcmN, was overexpressed in Escherichia coli, purified and crystallized in lipidic cubic phase (LCP). X-raymore » diffraction data were collected to 2.5 Å resolution from a single crystal obtained in a sandwich plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.3, b = 93.7, c = 100.2 Å. As a result of further LCP crystallization trials, crystals of larger size were obtained using sitting-drop plates. X-ray diffraction data were collected to 2.2 Å resolution from a single crystal obtained in a sitting-drop plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.9, b = 91.8, c = 100.9 Å. The present work provides valuable insights into the atomic resolution structure determination of membrane transporters.« less

  18. Purification, crystallization and preliminary X-ray diffraction studies of N-acetylglucosamine-phosphate mutase from Candida albicans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishitani, Yuichi; Maruyama, Daisuke; Nonaka, Tsuyoshi

    2006-04-01

    Preliminary X-ray diffraction studies on N-acetylglucosamine-phosphate mutase from C. albicans are reported. N-acetylglucosamine-phosphate mutase (AGM1) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine (UDP-GlcNAc) in eukaryotes and belongs to the α-d-phosphohexomutase superfamily. AGM1 from Candida albicans (CaAGM1) was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals obtained belong to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 60.2, b = 130.2, c = 78.0 Å, β = 106.7°. The crystals diffract X-rays to beyond 1.8 Å resolution using synchrotron radiation.

  19. Crystallization and preliminary X-ray diffraction analysis of West Nile virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaufmann, Barbel; Plevka, Pavel; Kuhn, Richard J.

    2010-05-25

    West Nile virus, a human pathogen, is closely related to other medically important flaviviruses of global impact such as dengue virus. The infectious virus was purified from cell culture using polyethylene glycol (PEG) precipitation and density-gradient centrifugation. Thin amorphously shaped crystals of the lipid-enveloped virus were grown in quartz capillaries equilibrated by vapor diffusion. Crystal diffraction extended at best to a resolution of about 25 {angstrom} using synchrotron radiation. A preliminary analysis of the diffraction images indicated that the crystals had unit-cell parameters a {approx_equal} b {approx_equal} 480 {angstrom}, {gamma} = 120{sup o}, suggesting a tight hexagonal packing of onemore » virus particle per unit cell.« less

  20. Use of a miniature diamond-anvil cell in high-pressure single-crystal neutron Laue diffraction

    PubMed Central

    Binns, Jack; Kamenev, Konstantin V.; McIntyre, Garry J.; Moggach, Stephen A.; Parsons, Simon

    2016-01-01

    The first high-pressure neutron diffraction study in a miniature diamond-anvil cell of a single crystal of size typical for X-ray diffraction is reported. This is made possible by modern Laue diffraction using a large solid-angle image-plate detector. An unexpected finding is that even reflections whose diffracted beams pass through the cell body are reliably observed, albeit with some attenuation. The cell body does limit the range of usable incident angles, but the crystallographic completeness for a high-symmetry unit cell is only slightly less than for a data collection without the cell. Data collections for two sizes of hexamine single crystals, with and without the pressure cell, and at 300 and 150 K, show that sample size and temperature are the most important factors that influence data quality. Despite the smaller crystal size and dominant parasitic scattering from the diamond-anvil cell, the data collected allow a full anisotropic refinement of hexamine with bond lengths and angles that agree with literature data within experimental error. This technique is shown to be suitable for low-symmetry crystals, and in these cases the transmission of diffracted beams through the cell body results in much higher completeness values than are possible with X-rays. The way is now open for joint X-ray and neutron studies on the same sample under identical conditions. PMID:27158503

  1. Blazed vector gratings fabricated using photosensitive polymer liquid crystals and control of polarization diffraction

    NASA Astrophysics Data System (ADS)

    Ono, Hiroshi; Kuzuwata, Mitsuru; Sasaki, Tomoyuki; Noda, Kohei; Kawatsuki, Nobuhiro

    2014-03-01

    The blazed vector grating possessing antisymmetric distributions of the birefringence were fabricated by exposing the line-focused linearly polarized ultraviolet light on the photosensitive polymer liquid crystals. The polarization states of the diffraction beams can be highly and widely controlled by designing the blazed structures, and the diffraction properties were well-explained by Jones calculus.

  2. Instrument and method for focusing X-rays, gamma rays and neutrons

    DOEpatents

    Smither, Robert K.

    1984-01-01

    A crystal diffraction instrument or diffraction grating instrument with an improved crystalline structure or grating spacing structure having a face for receiving a beam of photons or neutrons and diffraction planar spacing or grating spacing along that face with the spacing increasing progressively along the face to provide a decreasing Bragg diffraction angle for a monochromatic radiation and thereby increasing the usable area and acceptance angle. The increased planar spacing for the diffraction crystal is provided by the use of a temperature differential across the crystalline structure, by assembling a plurality of crystalline structures with different compositions, by an individual crystalline structure with a varying composition and thereby a changing planar spacing along its face, and by combinations of these techniques. The increased diffraction grating element spacing is generated during the fabrication of the diffraction grating by controlling the cutting tool that is cutting the grooves or controlling the laser beam, electron beam or ion beam that is exposing the resist layer, etc. It is also possible to vary this variation in grating spacing by applying a thermal gradient to the diffraction grating in much the same manner as is done in the crystal diffraction case.

  3. Instrument and method for focusing x rays, gamma rays, and neutrons

    DOEpatents

    Smither, R.K.

    1982-03-25

    A crystal-diffraction instrument or diffraction-grating instrument is described with an improved crystalline structure or grating spacing structure having a face for receiving a beam of photons or neutrons and diffraction planar spacing or grating spacing along that face with the spacing increasing progressively along the face to provide a decreasing Bragg diffraction angle for a monochromatic radiation and thereby increasing the usable area and acceptance angle. The increased planar spacing for the diffraction crystal is provided by the use of a temperature differential across the line structures with different compositions, by an individual crystalline structure with a varying composition and thereby a changing planar spacing along its face, and by combinations of these techniques. The increased diffraction grating element spacing is generated during the fabrication of the diffraction grating by controlling the cutting tool that is cutting the grooves or controlling the laser beam, electron beam, or ion beam that is exposing the resist layer, etc. It is also possible to vary this variation in grating spacing by applying a thermal gradient to the diffraction grating in much the same manner as is done in the crystal-diffraction case.

  4. Crystallization of a fungal lytic polysaccharide monooxygenase expressed from glycoengineered Pichia pastoris for X-ray and neutron diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    O'Dell, William B.; Swartz, Paul D.; Weiss, Kevin L.

    Lytic polysaccharide monooxygenases (LPMOs) are carbohydrate-disrupting enzymes secreted by bacteria and fungi that break glycosidic bondsviaan oxidative mechanism. Fungal LPMOs typically act on cellulose and can enhance the efficiency of cellulose-hydrolyzing enzymes that release soluble sugars for bioethanol production or other industrial uses. The enzyme PMO-2 fromNeurospora crassa(NcPMO-2) was heterologously expressed inPichia pastoristo facilitate crystallographic studies of the fungal LPMO mechanism. Diffraction resolution and crystal morphology were improved by expressingNcPMO-2 from a glycoengineered strain ofP. pastorisand by the use of crystal seeding methods, respectively. These improvements resulted in high-resolution (1.20 Å) X-ray diffraction data collection at 100 K and themore » production of a largeNcPMO-2 crystal suitable for room-temperature neutron diffraction data collection to 2.12 Å resolution.« less

  5. Data Exploration Toolkit for serial diffraction experiments

    DOE PAGES

    Zeldin, Oliver B.; Brewster, Aaron S.; Hattne, Johan; ...

    2015-01-23

    Ultrafast diffraction at X-ray free-electron lasers (XFELs) has the potential to yield new insights into important biological systems that produce radiation-sensitive crystals. An unavoidable feature of the 'diffraction before destruction' nature of these experiments is that images are obtained from many distinct crystals and/or different regions of the same crystal. Combined with other sources of XFEL shot-to-shot variation, this introduces significant heterogeneity into the diffraction data, complicating processing and interpretation. To enable researchers to get the most from their collected data, a toolkit is presented that provides insights into the quality of, and the variation present in, serial crystallography datamore » sets. These tools operate on the unmerged, partial intensity integration results from many individual crystals, and can be used on two levels: firstly to guide the experimental strategy during data collection, and secondly to help users make informed choices during data processing.« less

  6. Purification, crystallization and preliminary X-ray diffraction experiment of nattokinase from Bacillus subtilis natto.

    PubMed

    Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio

    2010-12-01

    Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27,724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a=74.3, b=49.9, c=56.3 Å, β=95.2°. Diffraction images were processed to a resolution of 1.74 Å with an Rmerge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase.

  7. Purification, crystallization and preliminary X-ray diffraction experiment of nattokinase from Bacillus subtilis natto

    PubMed Central

    Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio

    2010-01-01

    Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27 724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a = 74.3, b = 49.9, c = 56.3 Å, β = 95.2°. Diffraction images were processed to a resolution of 1.74 Å with an R merge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase. PMID:21139221

  8. Crystallization, dehydration and experimental phasing of WbdD, a bifunctional kinase and methyltransferase from Escherichia coli O9a

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hagelueken, Gregor; Huang, Hexian; Harlos, Karl

    2012-10-01

    The optimization of WbdD crystals using a novel dehydration protocol and experimental phasing at 3.5 Å resolution by cross-crystal averaging followed by molecular replacement of electron density into a non-isomorphous 3.0 Å resolution native data set are reported. WbdD is a bifunctional kinase/methyltransferase that is responsible for regulation of lipopolysaccharide O antigen polysaccharide chain length in Escherichia coli serotype O9a. Solving the crystal structure of this protein proved to be a challenge because the available crystals belonging to space group I23 only diffracted to low resolution (>95% of the crystals diffracted to resolution lower than 4 Å and most onlymore » to 8 Å) and were non-isomorphous, with changes in unit-cell dimensions of greater than 10%. Data from a serendipitously found single native crystal that diffracted to 3.0 Å resolution were non-isomorphous with a lower (3.5 Å) resolution selenomethionine data set. Here, a strategy for improving poor (3.5 Å resolution) initial phases by density modification and cross-crystal averaging with an additional 4.2 Å resolution data set to build a crude model of WbdD is desribed. Using this crude model as a mask to cut out the 3.5 Å resolution electron density yielded a successful molecular-replacement solution of the 3.0 Å resolution data set. The resulting map was used to build a complete model of WbdD. The hydration status of individual crystals appears to underpin the variable diffraction quality of WbdD crystals. After the initial structure had been solved, methods to control the hydration status of WbdD were developed and it was thus possible to routinely obtain high-resolution diffraction (to better than 2.5 Å resolution). This novel and facile crystal-dehydration protocol may be useful for similar challenging situations.« less

  9. Fast two-dimensional grid and transmission X-ray microscopy scanning methods for visualizing and characterizing protein crystals

    PubMed Central

    Wojdyla, Justyna Aleksandra; Panepucci, Ezequiel; Martiel, Isabelle; Ebner, Simon; Huang, Chia-Ying; Caffrey, Martin; Bunk, Oliver; Wang, Meitian

    2016-01-01

    A fast continuous grid scan protocol has been incorporated into the Swiss Light Source (SLS) data acquisition and analysis software suite on the macromolecular crystallography (MX) beamlines. Its combination with fast readout single-photon counting hybrid pixel array detectors (PILATUS and EIGER) allows for diffraction-based identification of crystal diffraction hotspots and the location and centering of membrane protein microcrystals in the lipid cubic phase (LCP) in in meso in situ serial crystallography plates and silicon nitride supports. Diffraction-based continuous grid scans with both still and oscillation images are supported. Examples that include a grid scan of a large (50 nl) LCP bolus and analysis of the resulting diffraction images are presented. Scanning transmission X-ray microscopy (STXM) complements and benefits from fast grid scanning. STXM has been demonstrated at the SLS beamline X06SA for near-zero-dose detection of protein crystals mounted on different types of sample supports at room and cryogenic temperatures. Flash-cooled crystals in nylon loops were successfully identified in differential and integrated phase images. Crystals of just 10 µm thickness were visible in integrated phase images using data collected with the EIGER detector. STXM offers a truly low-dose method for locating crystals on solid supports prior to diffraction data collection at both synchrotron microfocusing and free-electron laser X-ray facilities. PMID:27275141

  10. Characterization of monoclinic crystals in tablets by pattern-fitting procedure using X-ray powder diffraction data.

    PubMed

    Yamamura, Shigeo; Momose, Yasunori

    2003-06-18

    The purpose of this study is to characterize the monoclinic crystals in tablets by using X-ray powder diffraction data and to evaluate the deformation feature of crystals during compression. The monoclinic crystals of acetaminophen and benzoic acid were used as the samples. The observed X-ray diffraction intensities were fitted to the analytic expression, and the fitting parameters, such as the lattice parameters, the peak-width parameters, the preferred orientation parameter and peak asymmetric parameter were optimized by a non-linear least-squares procedure. The Gauss and March distribution functions were used to correct the preferred orientation of crystallites in the tablet. The March function performed better in correcting the modification of diffraction intensity by preferred orientation of crystallites, suggesting that the crystallites in the tablets had fiber texture with axial orientation. Although a broadening of diffraction peaks was observed in acetaminophen tablets with an increase of compression pressure, little broadening was observed in the benzoic tablets. These results suggest that "acetaminophen is a material consolidating by fragmentation of crystalline particles and benzoic acid is a material consolidating by plastic deformation then occurred rearrangement of molecules during compression". A pattern-fitting procedure is the superior method for characterizing the crystalline drugs of monoclinic crystals in the tablets, as well as orthorhombic isoniazid and mannitol crystals reported in the previous paper.

  11. An X-ray diffractometer using mirage diffraction

    PubMed Central

    Fukamachi, Tomoe; Jongsukswat, Sukswat; Ju, Dongying; Negishi, Riichirou; Hirano, Keiichi; Kawamura, Takaaki

    2014-01-01

    Some characteristics are reported of a triple-crystal diffractometer with a (+, −, +) setting of Si(220) using mirage diffraction. The first crystal is flat, while the second and third crystals are bent. Basically, the first crystal is used as a collimator, the second as a monochromator and the third as the sample. The third crystal also works as an analyzer. The advantages of this diffractometer are that its setup is easy, its structure is simple, the divergence angle from the second crystal is small and the energy resolution of the third crystal is high, of the order of sub-meV. PMID:25242911

  12. High resolution diffraction imaging of crystals grown in microgravity and closely related terrestrial crystals

    NASA Technical Reports Server (NTRS)

    Steiner, B.; Dobbyn, R.; Black, D.; Burdette, H.; Kuriyama, M.; Spal, R.; Vandenberg, L.; Fripp, A.; Simchick, R.; Lal, R.

    1991-01-01

    Irregularities found in three crystals grown in space, in four crystals grown entirely on the ground were examined and compared. Irregularities were observed in mercuric iodide, lead tin telluride, triglycine sulfate, and gallium arsenide by high resolution synchrotron x radiation diffraction imaging. Radiation detectors made from mercuric iodide crystals grown in microgravity were reported to perform far better than conventional detectors grown from the same material under full gravity. Effort is now underway to reproduce these 'space' crystals, optimize their properties, and extend comparable superiority to other types of materials.

  13. Growth and characterization of organic NLO material: Clobetasol propionate

    NASA Astrophysics Data System (ADS)

    Purusothaman, R.; Rajesh, P.; Ramasamy, P.

    2015-06-01

    Single crystals of clobetasol propionate (CP) have been grown by slow evaporation solution technique using mixed solvent of methanol-acetone. The grown crystals were subjected to single crystal X-ray diffraction analysis to confirm their lattice parameter and space group. The powder X-ray diffraction pattern of the grown CP has been indexed. Thermal analysis was performed to study the thermal stability of the grown crystals. Photoluminescence spectrum shows broad emission peak observed at 421 nm. Nonlinear optical studies were carried out for the grown crystal and second harmonic generation (SHG) efficiency was found in the crystal.

  14. Crystallization and preliminary X-ray diffraction analysis of restriction endonuclease EcoRII

    NASA Technical Reports Server (NTRS)

    Karpova, E. A.; Meehan, E.; Pusey, M. L.; Chen, L.

    1999-01-01

    Crystals of the restriction endonuclease EcoRII have been obtained by the vapor-diffusion technique in the presence of ammonium sulfate or polyethylene glycol. The best crystals were grown with ammonium sulfate as a precipitant. Crystals with dimensions of up to 0.6 x 0. 6 x 0.6 mm have been observed. The crystals diffract to about 4.0 A resolution at a cryo-temperature of 100 K using a rotating-anode X-ray source and a Rigaku R-AXIS IV imaging-plate detector. The space group has been determined to be either I23 or I2(1)3, with unit-cell parameters a = b = c = 160.3 A, alpha = beta = gamma = 90 degrees. The crystal asymmetric unit contains two protein molecules, and self-rotation function analysis shows a pseudo-twofold symmetry relating the two monomers. Attempts to improve the resolution of crystal diffraction and to search for heavy-atom derivatives are under way.

  15. Geodetic estimates of fault slip rates in the San Francisco Bay area

    USGS Publications Warehouse

    Savage, J.C.; Svarc, J.L.; Prescott, W.H.

    1999-01-01

    Bourne et al. [1998] have suggested that the interseismic velocity profile at the surface across a transform plate boundary is a replica of the secular velocity profile at depth in the plastosphere. On the other hand, in the viscoelastic coupling model the shape of the interseismic surface velocity profile is a consequence of plastosphere relaxation following the previous rupture of the faults that make up the plate boundary and is not directly related to the secular flow in the plastosphere. The two models appear to be incompatible. If the plate boundary is composed of several subparallel faults and the interseismic surface velocity profile across the boundary known, each model predicts the secular slip rates on the faults which make up the boundary. As suggested by Bourne et al., the models can then be tested by comparing the predicted secular slip rates to those estimated from long-term offsets inferred from geology. Here we apply that test to the secular slip rates predicted for the principal faults (San Andreas, San Gregorio, Hayward, Calaveras, Rodgers Creek, Green Valley and Greenville faults) in the San Andreas fault system in the San Francisco Bay area. The estimates from the two models generally agree with one another and to a lesser extent with the geologic estimate. Because the viscoelastic coupling model has been equally successful in estimating secular slip rates on the various fault strands at a diffuse plate boundary, the success of the model of Bourne et al. [1998] in doing the same thing should not be taken as proof that the interseismic velocity profile across the plate boundary at the surface is a replica of the velocity profile at depth in the plastosphere.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuz'micheva, G. M., E-mail: galkuz@mitht.ru; Zaharko, O.; Tyunina, E. A.

    Langatate crystals of the general composition La{sub 3}(Ga{sub 0.5}Ta{sub 0.5})Ga{sub 5}O{sub 14}, grown by the Czochralski method, have been investigated by neutron diffraction (single crystals) and X-ray diffraction (ground single crystals). The crystals were grown in an atmosphere of 99% Ar + 1% O{sub 2} in the Y54{sup o} direction (rotation by 54{sup o} with respect to the y axis), without subsequent annealing (orange crystal) or with vacuum annealing (colorless crystal). It is established that colorless crystals have a higher gallium content and, therefore, a larger number of oxygen vacancies in comparison with colored crystals; this is a possible reasonmore » for their lower microhardness.« less

  17. Crystallization and preliminary X-ray diffraction analysis of the periplasmic domain of the Escherichia coli aspartate receptor Tar and its complex with aspartate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mise, Takeshi; Matsunami, Hideyuki; Samatey, Fadel A.

    The periplasmic domain of the E. coli aspartate receptor Tar was cloned, expressed, purified and crystallized with and without bound ligand. The crystals obtained diffracted to resolutions of 1.58 and 1.95 Å, respectively. The cell-surface receptor Tar mediates bacterial chemotaxis toward an attractant, aspartate (Asp), and away from a repellent, Ni{sup 2+}. To understand the molecular mechanisms underlying the induction of Tar activity by its ligands, the Escherichia coli Tar periplasmic domain with and without bound aspartate (Asp-Tar and apo-Tar, respectively) were each crystallized in two different forms. Using ammonium sulfate as a precipitant, crystals of apo-Tar1 and Asp-Tar1 weremore » grown and diffracted to resolutions of 2.10 and 2.40 Å, respectively. Alternatively, using sodium chloride as a precipitant, crystals of apo-Tar2 and Asp-Tar2 were grown and diffracted to resolutions of 1.95 and 1.58 Å, respectively. Crystals of apo-Tar1 and Asp-Tar1 adopted space group P4{sub 1}2{sub 1}2, while those of apo-Tar2 and Asp-Tar2 adopted space groups P2{sub 1}2{sub 1}2{sub 1} and C2, respectively.« less

  18. Crystallization and preliminary X-ray diffraction studies of polyketide synthase-1 (PKS-1) from Cannabis sativa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Taguchi, Chiho; Quantum Beam Science Directorate, Japan Atomic Energy Agency; Taura, Futoshi

    Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b =more » 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1.« less

  19. Diffraction crystal for sagittally focusing x-rays

    DOEpatents

    Ice, Gene E.; Sparks, Jr., Cullie J.

    1984-01-01

    The invention is a new type of diffraction crystal designed for sagittally focusing photons of various energies. The invention is based on the discovery that such focusing is not obtainable with conventional crystals because of distortion resulting from anticlastic curvature. The new crystal comprises a monocrystalline base having a front face contoured for sagittally focusing photons and a back face provided with rigid, upstanding, stiffening ribs restricting anticlastic curvature. When mounted in a suitable bending device, the reflecting face of the crystal can be adjusted to focus photons having any one of a range of energies.

  20. Diffraction crystals for sagittally focusing x-rays

    DOEpatents

    Ice, G.E.; Sparks, C.J. Jr.

    1982-06-07

    The invention is a new type of diffraction crystal designed for sagittally focusing photons of various energies. The invention is based on the discovery that such focusing is not obtainable with conventional crystals because of distortion resulting from anticlastic curvature. The new crystal comprises a monocrystalline base having a front face contoured for sagittally focusing photons and a back face provided with rigid, upstanding, stiffening ribs restricting anticlastic curvature. When mounted in a suitable bending device, the reflecting face of the crystal can be adjusted to focus photons having any one of a range of energies.

  1. Purification, crystallization and preliminary X-ray diffraction analysis of aspartate semialdehyde dehydrogenase (Rv3708c) from Mycobacterium tuberculosis

    PubMed Central

    Vyas, Rajan; Kumar, Vijay; Panjikar, Santosh; Karthikeyan, Subramanian; Kishan, K. V. Radha; Tewari, Rupinder; Weiss, Manfred S.

    2008-01-01

    Aspartate semialdehyde dehydrogenase from Mycobacterium tuberculosis (Asd, ASADH, Rv3708c), which is the second enzyme in the lysine/homoserine-biosynthetic pathways, has been expressed heterologously in Escherichia coli. The enzyme was purified using affinity and gel-filtration chromatographic techniques and crystallized in two different crystal forms. Preliminary diffraction data analysis suggested the presence of up to four monomers in the asymmetric unit of the orthorhombic crystal form A and of one or two monomers in the cubic crystal form B. PMID:18323599

  2. 7 Å resolution in protein two-dimensional-crystal X-ray diffraction at Linac Coherent Light Source

    PubMed Central

    Pedrini, Bill; Tsai, Ching-Ju; Capitani, Guido; Padeste, Celestino; Hunter, Mark S.; Zatsepin, Nadia A.; Barty, Anton; Benner, W. Henry; Boutet, Sébastien; Feld, Geoffrey K.; Hau-Riege, Stefan P.; Kirian, Richard A.; Kupitz, Christopher; Messerschmitt, Marc; Ogren, John I.; Pardini, Tommaso; Segelke, Brent; Williams, Garth J.; Spence, John C. H.; Abela, Rafael; Coleman, Matthew; Evans, James E.; Schertler, Gebhard F. X.; Frank, Matthias; Li, Xiao-Dan

    2014-01-01

    Membrane proteins arranged as two-dimensional crystals in the lipid environment provide close-to-physiological structural information, which is essential for understanding the molecular mechanisms of protein function. Previously, X-ray diffraction from individual two-dimensional crystals did not represent a suitable investigational tool because of radiation damage. The recent availability of ultrashort pulses from X-ray free-electron lasers (XFELs) has now provided a means to outrun the damage. Here, we report on measurements performed at the Linac Coherent Light Source XFEL on bacteriorhodopsin two-dimensional crystals mounted on a solid support and kept at room temperature. By merging data from about a dozen single crystal diffraction images, we unambiguously identified the diffraction peaks to a resolution of 7 Å, thus improving the observable resolution with respect to that achievable from a single pattern alone. This indicates that a larger dataset will allow for reliable quantification of peak intensities, and in turn a corresponding increase in the resolution. The presented results pave the way for further XFEL studies on two-dimensional crystals, which may include pump–probe experiments at subpicosecond time resolution. PMID:24914166

  3. A simple X-ray source of two orthogonal beams for small samples imaging

    NASA Astrophysics Data System (ADS)

    Hrdý, J.

    2018-04-01

    A simple method for simultaneous imaging of small samples by two orthogonal beams is proposed. The method is based on one channel-cut crystal which is oriented such that the beam is diffracted on two crystallographic planes simultaneously. These planes are symmetrically inclined to the crystal surface. The beams are three times diffracted. After the first diffraction the beam is split. After the second diffraction the split beams become parallel. Finally, after the third diffraction the beams become convergent and may be used for imaging. The corresponding angular relations to obtain orthogonal beams are derived.

  4. Crystallization and preliminary X-ray analysis of a family 19 glycosyl hydrolase from Carica papaya latex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huet, Joëlle, E-mail: jhuet@ulb.ac.be; Azarkan, Mohamed; Looze, Yvan

    2008-05-01

    A chitinase isolated from the latex of the tropical species Carica papaya has been crystallized. The addition of N-acetyl-d-glucosamine to the crystallization solution has improved the diffraction quality resolution of the crystal to 1.8 Å resolution. A chitinase isolated from the latex of the tropical species Carica papaya has been purified to homogeneity and crystallized. This enzyme belongs to glycosyl hydrolase family 19 and exhibits exceptional resistance to proteolysis. The initially observed crystals, which diffracted to a resolution of 2.0 Å, were improved through modification of the crystallization protocol. Well ordered crystals were subsequently obtained using N-acetyl-d-glucosamine, the monomer resultingmore » from the hydrolysis of chitin, as an additive to the crystallization solution. Here, the characterization of a chitinase crystal that belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 69.08, b = 44.79, c = 76.73 Å, β = 95.33° and two molecules per asymmetric unit, is reported. Diffraction data were collected to a resolution of 1.8 Å. Structure refinement is currently in progress.« less

  5. Signature of dislocations and stacking faults of face-centred cubic nanocrystals in coherent X-ray diffraction patterns: a numerical study.

    PubMed

    Dupraz, Maxime; Beutier, Guillaume; Rodney, David; Mordehai, Dan; Verdier, Marc

    2015-06-01

    Crystal defects induce strong distortions in diffraction patterns. A single defect alone can yield strong and fine features that are observed in high-resolution diffraction experiments such as coherent X-ray diffraction. The case of face-centred cubic nanocrystals is studied numerically and the signatures of typical defects close to Bragg positions are identified. Crystals of a few tens of nanometres are modelled with realistic atomic potentials and 'relaxed' after introduction of well defined defects such as pure screw or edge dislocations, or Frank or prismatic loops. Diffraction patterns calculated in the kinematic approximation reveal various signatures of the defects depending on the Miller indices. They are strongly modified by the dissociation of the dislocations. Selection rules on the Miller indices are provided, to observe the maximum effect of given crystal defects in the initial and relaxed configurations. The effect of several physical and geometrical parameters such as stacking fault energy, crystal shape and defect position are discussed. The method is illustrated on a complex structure resulting from the simulated nanoindentation of a gold nanocrystal.

  6. Signature of dislocations and stacking faults of face-centred cubic nanocrystals in coherent X-ray diffraction patterns: a numerical study1

    PubMed Central

    Dupraz, Maxime; Beutier, Guillaume; Rodney, David; Mordehai, Dan; Verdier, Marc

    2015-01-01

    Crystal defects induce strong distortions in diffraction patterns. A single defect alone can yield strong and fine features that are observed in high-resolution diffraction experiments such as coherent X-ray diffraction. The case of face-centred cubic nanocrystals is studied numerically and the signatures of typical defects close to Bragg positions are identified. Crystals of a few tens of nanometres are modelled with realistic atomic potentials and ‘relaxed’ after introduction of well defined defects such as pure screw or edge dislocations, or Frank or prismatic loops. Diffraction patterns calculated in the kinematic approximation reveal various signatures of the defects depending on the Miller indices. They are strongly modified by the dissociation of the dislocations. Selection rules on the Miller indices are provided, to observe the maximum effect of given crystal defects in the initial and relaxed configurations. The effect of several physical and geometrical parameters such as stacking fault energy, crystal shape and defect position are discussed. The method is illustrated on a complex structure resulting from the simulated nanoindentation of a gold nanocrystal. PMID:26089755

  7. Phase modulation due to crystal diffraction by ptychographic imaging

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Civita, M.; Diaz, A.; Bean, R. J.

    Solving the phase problem in x-ray crystallography has occupied a considerable scientific effort in the 20th century and led to great advances in structural science. Here we use x-ray ptychography to demonstrate an interference method which measures the phase of the beam transmitted through a crystal, relative to the incoming beam, when diffraction takes place. The observed phase change of the direct beam through a small gold crystal is found to agree with both a quasikinematical model and full dynamical theories of diffraction. Our discovery of a diffraction contrast mechanism will enhance the interpretation of data obtained from crystalline samplesmore » using the ptychography method, which provides some of the most accurate x-ray phase-contrast images.« less

  8. Phase modulation due to crystal diffraction by ptychographic imaging

    DOE PAGES

    Civita, M.; Diaz, A.; Bean, R. J.; ...

    2018-03-06

    Solving the phase problem in x-ray crystallography has occupied a considerable scientific effort in the 20th century and led to great advances in structural science. Here we use x-ray ptychography to demonstrate an interference method which measures the phase of the beam transmitted through a crystal, relative to the incoming beam, when diffraction takes place. The observed phase change of the direct beam through a small gold crystal is found to agree with both a quasikinematical model and full dynamical theories of diffraction. Our discovery of a diffraction contrast mechanism will enhance the interpretation of data obtained from crystalline samplesmore » using the ptychography method, which provides some of the most accurate x-ray phase-contrast images.« less

  9. Phase modulation due to crystal diffraction by ptychographic imaging

    NASA Astrophysics Data System (ADS)

    Civita, M.; Diaz, A.; Bean, R. J.; Shabalin, A. G.; Gorobtsov, O. Yu.; Vartanyants, I. A.; Robinson, I. K.

    2018-03-01

    Solving the phase problem in x-ray crystallography has occupied a considerable scientific effort in the 20th century and led to great advances in structural science. Here we use x-ray ptychography to demonstrate an interference method which measures the phase of the beam transmitted through a crystal, relative to the incoming beam, when diffraction takes place. The observed phase change of the direct beam through a small gold crystal is found to agree with both a quasikinematical model and full dynamical theories of diffraction. Our discovery of a diffraction contrast mechanism will enhance the interpretation of data obtained from crystalline samples using the ptychography method, which provides some of the most accurate x-ray phase-contrast images.

  10. Spectrally-Narrowed Emissions from Organic Crystals Having a One-Dimensional Grating on Their Surface.

    PubMed

    Yamamoto, Hiroyuki; Obara, Keiji; Higashihara, Shohei; Obama, Yuki; Yamao, Takeshi; Hotta, Shu

    2016-04-01

    We have succeeded in directly engraving one-dimensional diffraction gratings on the surface of organic semiconducting oligomer crystals by using focused ion beam (FIB) lithography and laser ablation (LA) methods. The FIB method enabled us to shape the gratings with varying periods down to ~150 nm. With the LA method a large-area grating with a ~500-nm period was readily accessible. All the above crystals indicated spectrally-narrowed emission (SNE) lines even in the case of shallow groove depths ~2-4 nm. In particular, we definitively observed the SNE pertinent to the first-order diffraction with the crystal having the diffraction grating of a 148.3-nm average period. The present results indicate utility of the built-in gratings that can directly be fabricated on the surface of the crystals.

  11. Crystallization and preliminary X-ray diffraction studies of θ-toxin (perfringolysin O), a pore-forming cytolysin of Clostridium perfringens

    NASA Astrophysics Data System (ADS)

    Sugahara, Mitsuaki; Sekino-Suzuki, Naoko; Ohno-Iwashita, Yoshiko; Miki, Kunio

    1996-10-01

    θ-Toxin (perfringolysin O), a cholesterol-binding, pore-forming cytolysin of Clostridium perfringens type A was crystallized by the vapor diffusion procedure using polyethyleneglycol 4000 and sodium chloride as precipitants in 2-(cyclohexylamino)ethanesulfonic acid (CHES) buffer at pH 9.5. The diffraction patterns of precession photographs indicated that the crystals belong to the orthorhombic system and the space group C222 1 with unit-cell dimensions of a = 47.7 Å, b = 182.0 Å and c = 175.8 Å. Assuming that the asymmetric unit contains one or two molecules (Mw 52 700), the Vm value is calculated as 3.6 or 1.8 Å 3/dalton, respectively. The crystals diffract X-rays to at least 3 Å resolution and are suitable for high resolution X-ray crystal structure determination.

  12. Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

    NASA Astrophysics Data System (ADS)

    Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2016-11-01

    Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P1211 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, β = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.

  13. Diffractive optical devices produced by light-assisted trapping of nanoparticles.

    PubMed

    Muñoz-Martínez, J F; Jubera, M; Matarrubia, J; García-Cabañes, A; Agulló-López, F; Carrascosa, M

    2016-01-15

    One- and two-dimensional diffractive optical devices have been fabricated by light-assisted trapping and patterning of nanoparticles. The method is based on the dielectrophoretic forces appearing in the vicinity of a photovoltaic crystal, such as Fe:LiNbO3, during or after illumination. By illumination with the appropriate light distribution, the nanoparticles are organized along patterns designed at will. One- and two-dimensional diffractive components have been achieved on X- and Z-cut Fe:LiNbO3 crystals, with their polar axes parallel and perpendicular to the crystal surface, respectively. Diffraction gratings with periods down to around a few micrometers have been produced using metal (Al, Ag) nanoparticles with radii in the range of 70-100 nm. Moreover, several 2D devices, such as Fresnel zone plates, have been also produced showing the potential of the method. The diffractive particle patterns remain stable when light is removed. A method to transfer the diffractive patterns to other nonphotovoltaic substrates, such as silica glass, has been also reported.

  14. Strategies for the crystallization of viruses: using phase diagrams and gels to produce 3D crystals of Grapevine fanleaf virus.

    PubMed

    Schellenberger, Pascale; Demangeat, Gérard; Lemaire, Olivier; Ritzenthaler, Christophe; Bergdoll, Marc; Oliéric, Vincent; Sauter, Claude; Lorber, Bernard

    2011-05-01

    The small icosahedral plant RNA nepovirus Grapevine fanleaf virus (GFLV) is specifically transmitted by a nematode and causes major damage to vineyards worldwide. To elucidate the molecular mechanisms underlying the recognition between the surface of its protein capsid and cellular components of its vector, host and viral proteins synthesized upon infection, the wild type GFLV strain F13 and a natural mutant (GFLV-TD) carrying a Gly₂₉₇Asp mutation were purified, characterized and crystallized. Subsequently, the geometry and volume of their crystals was optimized by establishing phase diagrams. GFLV-TD was twice as soluble as the parent virus in the crystallization solution and its crystals diffracted X-rays to a resolution of 2.7 Å. The diffraction limit of GFLV-F13 crystals was extended from 5.5 to 3 Å by growth in agarose gel. Preliminary crystallographic analyses indicate that both types of crystals are suitable for structure determination. Keys for the successful production of GFLV crystals include the rigorous quality control of virus preparations, crystal quality improvement using phase diagrams, and crystal lattice reinforcement by growth in agarose gel. These strategies are applicable to the production of well-diffracting crystals of other viruses and macromolecular assemblies. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Purification, crystallization and preliminary X-ray structural studies of a 7.2 kDa cytotoxin isolated from the venom of Daboia russelli russelli of the Viperidae family

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Roy Choudhury, Subhasree; Gomes, Aparna; Gomes, Antony

    2006-03-01

    A cytotoxin from Indian Russell’s viper (D. russelli russelli) venom having multifunctional activity has been crystallized in space group P4{sub 1}. Larger crystals diffracted to 1.5 Å but were found to be twinned; preliminary data were therefore collected (2.93 Å) from a smaller crystal. A cytotoxin (MW 7.2 kDa) from Indian Russell’s viper (Daboia russelli russelli) venom possessing antiproliferative activity, cardiotoxicity, neurotoxicity and myotoxicity has been purified, characterized and crystallized. The crystals belong to the tetragonal space group P4{sub 1}, with unit-cell parameters a = b = 47.94, c = 50.2 Å. Larger crystals, which diffracted to 1.5 Å, weremore » found to be twinned; diffraction data were therefore collected to 2.93 Å resolution using a smaller crystal. Molecular-replacement calculations identified two molecules of the protein in the asymmetric unit, which is in accordance with the calculated V{sub M} value.« less

  16. Increasing dissolution of trospium chloride by co-crystallization with urea

    NASA Astrophysics Data System (ADS)

    Skořepová, Eliška; Hušák, Michal; Čejka, Jan; Zámostný, Petr; Kratochvíl, Bohumil

    2014-08-01

    The search for various solid forms of an active pharmaceutical ingredient (API) is an important step in drug development. Our aim was to prepare co-crystals of trospium chloride, an anticholinergic drug used for the treatment of incontinence, and to investigate if they have advantageous properties for drug formulation. Phase identification was done by powder X-ray diffraction and single-crystal X-ray diffraction. The chemical composition was verified by solution NMR and the dissolution rate of the prepared phases was studied by IDR (intrinsic dissolution rate). For further analysis of phase stability and transitions, combined thermal analysis and temperature-resolved X-ray powder diffraction were used. Urea was selected as a co-crystallization partner. Trospium chloride urea (1:1) co-crystal was prepared by a solvent evaporation. From single-crystal data, the co-crystal structure was solved in a space group P21/c and compared to previously published structures of trospium chloride. Intrinsic dissolution rate revealed that the co-crystal dissolves 32% faster than pure API. However, its low thermal and pressure stability makes it a challenging choice for the final drug formulation.

  17. DIFFRACTION FROM MODEL CRYSTALS

    USDA-ARS?s Scientific Manuscript database

    Although calculating X-ray diffraction patterns from atomic coordinates of a crystal structure is a widely available capability, calculation from non-periodic arrays of atoms has not been widely applied to cellulose. Non-periodic arrays result from modeling studies that, even though started with at...

  18. Method of Generating X-Ray Diffraction Data for Integral Detection of Twin Defects in Super-Hetero-Epitaxial Materials

    NASA Technical Reports Server (NTRS)

    Park, Yeonjoon (Inventor); Choi, Sang Hyouk (Inventor); King, Glen C. (Inventor); Elliott, James R. (Inventor)

    2009-01-01

    A method provides X-ray diffraction (XRD) data suitable for integral detection of a twin defect in a strained or lattice-matched epitaxial material made from components having crystal structures having symme try belonging to different space groups. The material is mounted in a n X-ray diffraction (XRD) system. In one embodiment, the XRD system's goniometer angle Omega is set equal to (Theta(sub B)-Beta) where The ta(sub B) is a Bragg angle for a designated crystal plane of the allo y that is disposed at a non-perpendicular orientation with respect to the {111) crystal plane, and Beta is the angle between the designate d crystal plane and a { 111 } crystal plane of one of the epitaxial components. The XRD system's detector angle is set equal to (Theta(su b B)+Beta). The material can be rotated through an angle of azimuthal rotation Phi about the axis aligned with the material. Using the det ector, the intensity of the X-ray diffraction is recorded at least at the angle at which the twin defect occurs.

  19. Bragg coherent diffraction imaging and metrics for radiation damage in protein micro-crystallography.

    PubMed

    Coughlan, H D; Darmanin, C; Kirkwood, H J; Phillips, N W; Hoxley, D; Clark, J N; Vine, D J; Hofmann, F; Harder, R J; Maxey, E; Abbey, B

    2017-01-01

    The proliferation of extremely intense synchrotron sources has enabled ever higher-resolution structures to be obtained using data collected from smaller and often more imperfect biological crystals (Helliwell, 1984). Synchrotron beamlines now exist that are capable of measuring data from single crystals that are just a few micrometres in size. This provides renewed motivation to study and understand the radiation damage behaviour of small protein crystals. Reciprocal-space mapping and Bragg coherent diffractive imaging experiments have been performed on cryo-cooled microcrystals of hen egg-white lysozyme as they undergo radiation damage. Several well established metrics, such as intensity-loss and lattice expansion, are applied to the diffraction data and the results are compared with several new metrics that can be extracted from the coherent imaging experiments. Individually some of these metrics are inconclusive. However, combining metrics, the results suggest that radiation damage behaviour in protein micro-crystals differs from that of larger protein crystals and may allow them to continue to diffract for longer. A possible mechanism to account for these observations is proposed.

  20. Bragg coherent diffraction imaging and metrics for radiation damage in protein micro-crystallography

    DOE PAGES

    Coughlan, H. D.; Darmanin, C.; Kirkwood, H. J.; ...

    2017-01-01

    The proliferation of extremely intense synchrotron sources has enabled ever higher-resolution structures to be obtained using data collected from smaller and often more imperfect biological crystals. Synchrotron beamlines now exist that are capable of measuring data from single crystals that are just a few micrometres in size. This provides renewed motivation to study and understand the radiation damage behaviour of small protein crystals. Reciprocal-space mapping and Bragg coherent diffractive imaging experiments have been performed on cryo-cooled microcrystals of hen egg-white lysozyme as they undergo radiation damage. Several well established metrics, such as intensity-loss and lattice expansion, are applied to themore » diffraction data and the results are compared with several new metrics that can be extracted from the coherent imaging experiments. Individually some of these metrics are inconclusive. However, combining metrics, the results suggest that radiation damage behaviour in protein micro-crystals differs from that of larger protein crystals and may allow them to continue to diffract for longer. As a result, a possible mechanism to account for these observations is proposed.« less

  1. Bragg coherent diffraction imaging and metrics for radiation damage in protein micro-crystallography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Coughlan, H. D.; Darmanin, C.; Kirkwood, H. J.

    The proliferation of extremely intense synchrotron sources has enabled ever higher-resolution structures to be obtained using data collected from smaller and often more imperfect biological crystals. Synchrotron beamlines now exist that are capable of measuring data from single crystals that are just a few micrometres in size. This provides renewed motivation to study and understand the radiation damage behaviour of small protein crystals. Reciprocal-space mapping and Bragg coherent diffractive imaging experiments have been performed on cryo-cooled microcrystals of hen egg-white lysozyme as they undergo radiation damage. Several well established metrics, such as intensity-loss and lattice expansion, are applied to themore » diffraction data and the results are compared with several new metrics that can be extracted from the coherent imaging experiments. Individually some of these metrics are inconclusive. However, combining metrics, the results suggest that radiation damage behaviour in protein micro-crystals differs from that of larger protein crystals and may allow them to continue to diffract for longer. As a result, a possible mechanism to account for these observations is proposed.« less

  2. In situ high-pressure measurement of crystal solubility by using neutron diffraction

    NASA Astrophysics Data System (ADS)

    Chen, Ji; Hu, Qiwei; Fang, Leiming; He, Duanwei; Chen, Xiping; Xie, Lei; Chen, Bo; Li, Xin; Ni, Xiaolin; Fan, Cong; Liang, Akun

    2018-05-01

    Crystal solubility is one of the most important thermo-physical properties and plays a key role in industrial applications, fundamental science, and geoscientific research. However, high-pressure in situ measurements of crystal solubility remain very challenging. Here, we present a method involving high-pressure neutron diffraction for making high-precision in situ measurements of crystal solubility as a function of pressure over a wide range of pressures. For these experiments, we designed a piston-cylinder cell with a large chamber volume for high-pressure neutron diffraction. The solution pressures are continuously monitored in situ based on the equation of state of the sample crystal. The solubility at a high pressure can be obtained by applying a Rietveld quantitative multiphase analysis. To evaluate the proposed method, we measured the high-pressure solubility of NaCl in water up to 610 MPa. At a low pressure, the results are consistent with the previous results measured ex situ. At a higher pressure, more reliable data could be provided by using an in situ high-pressure neutron diffraction method.

  3. Anisotropic light diffraction in crystals with a large acoustic-energy walk-off

    NASA Astrophysics Data System (ADS)

    Balakshy, V. I.; Voloshin, A. S.; Molchanov, V. Ya.

    2014-11-01

    The influence of energy walk-off in an acoustic beam on the characteristic of anisotropic Bragg diffraction of light has been investigated by the example of paratellurite crystal. The angular and frequency characteristics of acousto-optic diffraction have been calculated in wide ranges of ultrasound frequencies and Bragg angles using the modified Raman-Nath equations. It is shown that the walk-off of an acoustic beam may change (either widen or narrow) significantly the frequency and angular ranges. The calculation results have been experimentally checked on an acousto-optic cell made of 10.5°-cut paratellurite crystal.

  4. X-Ray Topography of Tetragonal Lysozyme Grown by the Temperature-Controlled Technique

    NASA Technical Reports Server (NTRS)

    Stojanoff, V.; Siddons, D. P.; Monaco, Lisa A.; Vekilov, Peter; Rosenberger, Franz

    1997-01-01

    Growth-induced defects in lysozyme crystals were observed by white-beam and monochromatic X-ray topography at the National Synchrotron Light Source (NSLS) at the Brookhaven National Laboratory (BNL). The topographic methods were non-destructive to the extent that traditional diffraction data collection could be performed to high resolution after topography. It was found that changes in growth parameters, defect concentration as detected by X-ray topography, and the diffraction quality obtainable from the crystals were all strongly correlated. In addition, crystals with fewer defects showed lower mosaicity and higher diffraction resolution as expected.

  5. Diffraction and imaging study of imperfections of crystallized lysozyme with coherent X-rays

    NASA Technical Reports Server (NTRS)

    Hu, Z. W.; Chu, Y. S.; Lai, B.; Thomas, B. R.; Chernov, A. A.

    2004-01-01

    Phase-contrast X-ray diffraction imaging and high-angular-resolution diffraction combined with phase-contrast radiographic imaging were employed to characterize defects and perfection of a uniformly grown tetragonal lysozyme crystal in the symmetric Laue case. The full-width at half-maximum (FWHM) of a 4 4 0 rocking curve measured from the original crystal was approximately 16.7 arcsec and imperfections including line defects, inclusions and other microdefects were observed in the diffraction images of the crystal. The observed line defects carry distinct dislocation features running approximately along the <1 1 0> growth front and have been found to originate mostly in a central growth area and occasionally in outer growth regions. Inclusions of impurities or formations of foreign particles in the central growth region are resolved in the images with high sensitivity to defects. Slow dehydration led to the broadening of a fairly symmetric 4 4 0 rocking curve by a factor of approximately 2.6, which was primarily attributed to the dehydration-induced microscopic effects that are clearly shown in X-ray diffraction images. The details of the observed defects and the significant change in the revealed microstructures with drying provide insight into the nature of imperfections, nucleation and growth, and the properties of protein crystals.

  6. Three-dimensional electron diffraction of plant light-harvesting complex

    PubMed Central

    Wang, Da Neng; Kühlbrandt, Werner

    1992-01-01

    Electron diffraction patterns of two-dimensional crystals of light-harvesting chlorophyll a/b-protein complex (LHC-II) from photosynthetic membranes of pea chloroplasts, tilted at different angles up to 60°, were collected to 3.2 Å resolution at -125°C. The reflection intensities were merged into a three-dimensional data set. The Friedel R-factor and the merging R-factor were 21.8 and 27.6%, respectively. Specimen flatness and crystal size were critical for recording electron diffraction patterns from crystals at high tilts. The principal sources of experimental error were attributed to limitations of the number of unit cells contributing to an electron diffraction pattern, and to the critical electron dose. The distribution of strong diffraction spots indicated that the three-dimensional structure of LHC-II is less regular than that of other known membrane proteins and is not dominated by a particular feature of secondary structure. ImagesFIGURE 1FIGURE 2 PMID:19431817

  7. Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

    PubMed

    Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

    1977-04-01

    Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained.

  8. Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

    PubMed Central

    Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

    1977-01-01

    Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained. Images PMID:866188

  9. Crystallization and x-ray diffraction analysis of a putative bacterial class I labdane-related diterpene synthase [Crysallization and preliminary x-ray diffraction analysis of a bacterial class I labdane-related diterpene synthase

    DOE PAGES

    Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia; ...

    2015-08-25

    Here, labdane-related diterpenoids are natural products with potential pharmaceutical applications that are rarely found in bacteria. Here, a putative class I labdane-related diterpene synthase (LrdC) identified by genome mining in a streptomycete was successfully crystallized using the microbatch method. Crystals of the LrdC enzyme were obtained in a holo form with its natural cofactor Mg 2+ (LrdC-Mg 2+) and in complex with inorganic pyrophosphate (PP i) (LrdC-Mg 2+–PP i). Crystals of native LrdC-Mg 2+ diffracted to 2.50 Å resolution and belonged to the trigonal space group P3 221, with unit-cell parameters a = b = 107.1, c = 89.2 Å.more » Crystals of the LrdC-Mg 2+–PP i complex grown in the same conditions as the native enzyme with PEG 8000 diffracted to 2.36 Å resolution and also belonged to the trigonal space group P3 221. Crystals of the LrdC-Mg 2+–PP i complex grown in a second crystallization condition with PEG 3350 diffracted to 2.57 Å resolution and belonged to the monoclinic space group P2 1, with unit-cell parameters a = 49.9, b = 104.1, c = 66.5 Å, β = 111.4°. The structure was determined by the single-wavelength anomalous dispersion (SAD) technique using the osmium signal from a potassium hexachloroosmate (IV) derivative.« less

  10. The potential for the indirect crystal structure verification of methyl glycosides based on acetates' parent structures: GIPAW and solid-state NMR approaches

    NASA Astrophysics Data System (ADS)

    Szeleszczuk, Łukasz; Gubica, Tomasz; Zimniak, Andrzej; Pisklak, Dariusz M.; Dąbrowska, Kinga; Cyrański, Michał K.; Kańska, Marianna

    2017-10-01

    A convenient method for the indirect crystal structure verification of methyl glycosides was demonstrated. Single-crystal X-ray diffraction structures for methyl glycoside acetates were deacetylated and subsequently subjected to DFT calculations under periodic boundary conditions. Solid-state NMR spectroscopy served as a guide for calculations. A high level of accuracy of the modelled crystal structures of methyl glycosides was confirmed by comparison with published results of neutron diffraction study using RMSD method.

  11. Improving the dissolution and bioavailability of 6-mercaptopurine via co-crystallization with isonicotinamide.

    PubMed

    Wang, Jian-Rong; Yu, Xueping; Zhou, Chun; Lin, Yunfei; Chen, Chen; Pan, Guoyu; Mei, Xuefeng

    2015-03-01

    6-Mercaptopurine (6-MP) is a clinically important antitumor drug. The commercially available form was provided as monohydrate and belongs to BCS class II category. Co-crystallization screening by reaction crystallization method (RCM) and monitored by powder X-ray diffraction led to the discovery of a new co-crystal formed between 6-MP and isonicotinamide (co-crystal 1). Co-crystal 1 was thoroughly characterized by X-ray diffraction, FT-IR and Raman spectroscopy, and thermal analysis. Noticeably, the in vitro and in vivo studies revealed that co-crystal 1 possesses improved dissolution rate and superior bioavailability on animal model. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. High Pressure Single Crystal Diffraction at PX 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Dongzhou; Dera, Przemyslaw K.; Eng, Peter J.

    2017-01-01

    In this report, we describe detailed procedures for carrying out single crystal X-ray diffraction experiments with a diamond anvil cell at the GSECARS 13-BM-C beamline at the Advanced Photon Source. ATREX and RSV programs are used to analyze the data.

  13. Idealized powder diffraction patterns for cellulose polymorphs

    USDA-ARS?s Scientific Manuscript database

    Cellulose samples are routinely analyzed by X-ray diffraction to determine their crystal type (polymorph) and crystallinity. However, the connection is seldom made between those efforts and the crystal structures of cellulose that have been determined with synchrotron X-radiation and neutron diffrac...

  14. Curved focusing crystals for hard X-ray astronomy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ferrari, C., E-mail: ferrari@imem.cnr.it; Buffagni, E.; Bonnini, E.

    A lens made by a properly arranged array of crystals can be used to focus x-rays of energy ranging from 30 to 500 keV for x-ray astronomy. Mosaic or curved crystals can be employed as x-ray optical elements. In this work self standing curved focusing Si and GaAs crystals in which the lattice bending is induced by a controlled damaging process on one side of planar crystals are characterized. Diffraction profiles in Laue geometry have been measured in crystals at x-ray energies E = 17, 59 and 120 keV. An enhancement of diffraction efficiency is found in asymmetric geometries.

  15. X-ray transparent microfluidic chip for mesophase-based crystallization of membrane proteins and on-chip structure determination

    DOE PAGES

    Khvostichenko, Daria S.; Schieferstein, Jeremy M.; Pawate, Ashtamurthy S.; ...

    2014-08-21

    Crystallization from lipidic mesophase matrices is a promising route to diffraction-quality crystals and structures of membrane proteins. The microfluidic approach reported here eliminates two bottlenecks of the standard mesophase-based crystallization protocols: (i) manual preparation of viscous mesophases and (ii) manual harvesting of often small and fragile protein crystals. In the approach reported here, protein-loaded mesophases are formulated in an X-ray transparent microfluidic chip using only 60 nL of the protein solution per crystallization trial. The X-ray transparency of the chip enables diffraction data collection from multiple crystals residing in microfluidic wells, eliminating the normally required manual harvesting and mounting ofmore » individual crystals. In addition, we validated our approach by on-chip crystallization of photosynthetic reaction center, a membrane protein from Rhodobacter sphaeroides, followed by solving its structure to a resolution of 2.5 Å using X-ray diffraction data collected on-chip under ambient conditions. A moderate conformational change in hydrophilic chains of the protein was observed when comparing the on-chip, room temperature structure with known structures for which data were acquired under cryogenic conditions.« less

  16. X-ray Transparent Microfluidic Chip for Mesophase-Based Crystallization of Membrane Proteins and On-Chip Structure Determination

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khvostichenko, Daria S.; Schieferstein, Jeremy M.; Pawate, Ashtamurthy S.

    2014-10-01

    Crystallization from lipidic mesophase matrices is a promising route to diffraction-quality crystals and structures of membrane proteins. The microfluidic approach reported here eliminates two bottlenecks of the standard mesophase-based crystallization protocols: (i) manual preparation of viscous mesophases and (ii) manual harvesting of often small and fragile protein crystals. In the approach reported here, protein-loaded mesophases are formulated in an X-ray transparent microfluidic chip using only 60 nL of the protein solution per crystallization trial. The X-ray transparency of the chip enables diffraction data collection from multiple crystals residing in microfluidic wells, eliminating the normally required manual harvesting and mounting ofmore » individual crystals. We validated our approach by on-chip crystallization of photosynthetic reaction center, a membrane protein from Rhodobacter sphaeroides, followed by solving its structure to a resolution of 2.5 Å using X-ray diffraction data collected on-chip under ambient conditions. A moderate conformational change in hydrophilic chains of the protein was observed when comparing the on-chip, room temperature structure with known structures for which data were acquired under cryogenic conditions.« less

  17. Exploration of New Principles in Spintronics Based on Topological Insulators (Option 1)

    DTIC Science & Technology

    2012-05-14

    on the surface and found that our crystals are exceedingly homogeneous (Supplementary Information). The persistently narrow X - ray diffraction peaks...modified Bridgman method (see Supplementary Information for details). X - ray diffraction measurements indicated the monotonic shrinkage of a and c axis...and annealing at that temperature for 4 days. X - ray diffraction analyses confirmed that all the samples have the same crystal structure (R 3m

  18. A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zipper, Lauren E.; Binghamton University, 4400 Vestal Parkway East, Vestal, NY 13902; Aristide, Xavier

    This article describes the use of evaporation control lids that are fitted to crystallization plates to improve the reproducibility of trials using as little as 5 nl. The plate lids contain apertures which are large enough for the transfer of protein containing droplets, but small enough to greatly reduce the rate of evaporation during the time needed to prepare the plate. A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fittingmore » the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less

  19. Application of powder X-ray diffraction in studying the compaction behavior of bulk pharmaceutical powders.

    PubMed

    Bandyopadhyay, Rebanta; Selbo, Jon; Amidon, Gregory E; Hawley, Michael

    2005-11-01

    This study investigates the effects of crystal lattice deformation on the powder X-ray diffraction (PXRD) patterns of compressed polycrystalline specimen (compacts/tablets) made from molecular, crystalline powders. The displacement of molecules and the corresponding adjustment of interplanar distances (d-spacings) between diffracting planes of PNU-288034 and PNU-177553, which have crystal habits with a high aspect ratio favoring preferred orientation during tableting, are demonstrated by shifts in the diffracted peak positions. The direction of shift in diffracted peak positions suggests a reduction of interplanar d-spacing in the crystals of PNU-288034 and PNU-177553 following compaction. There is also a general reduction of peak intensities following compression at the different compressive loads. The lattice strain representing the reduction in d-spacing is proportional to the original d-spacing of the uncompressed sample suggesting that, as with systems that obey a simple Hooke's law relationship, the further apart the planes of atoms/molecules within the lattice are, the easier it is for them to approach each other under compressive stresses. For a third model compound comprising more equant-shaped crystals of PNU-141659, the shift in diffracted peak positions are consistent with an expansion of lattice spacing after compression. This apparent anomaly is supported by the PXRD studies of the bulk powder consisting of fractured crystals where also, the shift in peak position suggests expansion of the lattice planes. Thus the crystals of PNU-141659 may be fracturing under the compressive loads used to produce the compacts. Additional studies are underway to relate the PXRD observations with the bulk tableting properties of these model compounds.

  20. Lifetimes and spatio-temporal response of protein crystals in intense X-ray microbeams

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Warkentin, Matthew A.; Atakisi, Hakan; Hopkins, Jesse B.

    Serial synchrotron-based crystallography using intense microfocused X-ray beams, fast-framing detectors and protein microcrystals held at 300 K promises to expand the range of accessible structural targets and to increase overall structure-pipeline throughputs. To explore the nature and consequences of X-ray radiation damage under microbeam illumination, the time-, dose- and temperature-dependent evolution of crystal diffraction have been measured with maximum dose rates of 50 MGy s −1 . At all temperatures and dose rates, the integrated diffraction intensity for a fixed crystal orientation shows non-exponential decays with dose. Non-exponential decays are a consequence of non-uniform illumination and the resulting spatial evolution of diffracted intensitymore » within the illuminated crystal volume. To quantify radiation-damage lifetimes and the damage state of diffracting crystal regions, a revised diffraction-weighted dose (DWD) is defined and it is shown that for Gaussian beams the DWD becomes nearly independent of actual dose at large doses. An apparent delayed onset of radiation damage seen in some intensity–dose curves is in fact a consequence of damage. Intensity fluctuations at high dose rates may arise from the impulsive release of gaseous damage products. Accounting for these effects, data collection at the highest dose rates increases crystal radiation lifetimes near 300 K (but not at 100 K) by a factor of ∼1.5–2 compared with those observed at conventional dose rates. Improved quantification and modeling of the complex spatio-temporal evolution of protein microcrystal diffraction in intense microbeams will enable more efficient data collection, and will be essential in improving the accuracy of structure factors and structural models.« less

  1. Lifetimes and spatio-temporal response of protein crystals in intense X-ray microbeams

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Warkentin, Matthew A.; Atakisi, Hakan; Hopkins, Jesse B.

    Serial synchrotron-based crystallography using intense microfocused X-ray beams, fast-framing detectors and protein microcrystals held at 300 K promises to expand the range of accessible structural targets and to increase overall structure-pipeline throughputs. To explore the nature and consequences of X-ray radiation damage under microbeam illumination, the time-, dose- and temperature-dependent evolution of crystal diffraction have been measured with maximum dose rates of 50 MGy s –1. At all temperatures and dose rates, the integrated diffraction intensity for a fixed crystal orientation shows non-exponential decays with dose. Non-exponential decays are a consequence of non-uniform illumination and the resulting spatial evolution ofmore » diffracted intensity within the illuminated crystal volume. To quantify radiation-damage lifetimes and the damage state of diffracting crystal regions, a revised diffraction-weighted dose (DWD) is defined and it is shown that for Gaussian beams the DWD becomes nearly independent of actual dose at large doses. An apparent delayed onset of radiation damage seen in some intensity–dose curves is in fact a consequence of damage. Intensity fluctuations at high dose rates may arise from the impulsive release of gaseous damage products. Accounting for these effects, data collection at the highest dose rates increases crystal radiation lifetimes near 300 K (but not at 100 K) by a factor of ~1.5–2 compared with those observed at conventional dose rates. As a result, improved quantification and modeling of the complex spatio-temporal evolution of protein microcrystal diffraction in intense microbeams will enable more efficient data collection, and will be essential in improving the accuracy of structure factors and structural models.« less

  2. Lifetimes and spatio-temporal response of protein crystals in intense X-ray microbeams

    DOE PAGES

    Warkentin, Matthew A.; Atakisi, Hakan; Hopkins, Jesse B.; ...

    2017-10-13

    Serial synchrotron-based crystallography using intense microfocused X-ray beams, fast-framing detectors and protein microcrystals held at 300 K promises to expand the range of accessible structural targets and to increase overall structure-pipeline throughputs. To explore the nature and consequences of X-ray radiation damage under microbeam illumination, the time-, dose- and temperature-dependent evolution of crystal diffraction have been measured with maximum dose rates of 50 MGy s –1. At all temperatures and dose rates, the integrated diffraction intensity for a fixed crystal orientation shows non-exponential decays with dose. Non-exponential decays are a consequence of non-uniform illumination and the resulting spatial evolution ofmore » diffracted intensity within the illuminated crystal volume. To quantify radiation-damage lifetimes and the damage state of diffracting crystal regions, a revised diffraction-weighted dose (DWD) is defined and it is shown that for Gaussian beams the DWD becomes nearly independent of actual dose at large doses. An apparent delayed onset of radiation damage seen in some intensity–dose curves is in fact a consequence of damage. Intensity fluctuations at high dose rates may arise from the impulsive release of gaseous damage products. Accounting for these effects, data collection at the highest dose rates increases crystal radiation lifetimes near 300 K (but not at 100 K) by a factor of ~1.5–2 compared with those observed at conventional dose rates. As a result, improved quantification and modeling of the complex spatio-temporal evolution of protein microcrystal diffraction in intense microbeams will enable more efficient data collection, and will be essential in improving the accuracy of structure factors and structural models.« less

  3. Lifetimes and spatio-temporal response of protein crystals in intense X-ray microbeams

    DOE PAGES

    Warkentin, Matthew A.; Atakisi, Hakan; Hopkins, Jesse B.; ...

    2017-10-13

    Serial synchrotron-based crystallography using intense microfocused X-ray beams, fast-framing detectors and protein microcrystals held at 300 K promises to expand the range of accessible structural targets and to increase overall structure-pipeline throughputs. To explore the nature and consequences of X-ray radiation damage under microbeam illumination, the time-, dose- and temperature-dependent evolution of crystal diffraction have been measured with maximum dose rates of 50 MGy s −1 . At all temperatures and dose rates, the integrated diffraction intensity for a fixed crystal orientation shows non-exponential decays with dose. Non-exponential decays are a consequence of non-uniform illumination and the resulting spatial evolution of diffracted intensitymore » within the illuminated crystal volume. To quantify radiation-damage lifetimes and the damage state of diffracting crystal regions, a revised diffraction-weighted dose (DWD) is defined and it is shown that for Gaussian beams the DWD becomes nearly independent of actual dose at large doses. An apparent delayed onset of radiation damage seen in some intensity–dose curves is in fact a consequence of damage. Intensity fluctuations at high dose rates may arise from the impulsive release of gaseous damage products. Accounting for these effects, data collection at the highest dose rates increases crystal radiation lifetimes near 300 K (but not at 100 K) by a factor of ∼1.5–2 compared with those observed at conventional dose rates. Improved quantification and modeling of the complex spatio-temporal evolution of protein microcrystal diffraction in intense microbeams will enable more efficient data collection, and will be essential in improving the accuracy of structure factors and structural models.« less

  4. Dynamical electron diffraction simulation for non-orthogonal crystal system by a revised real space method.

    PubMed

    Lv, C L; Liu, Q B; Cai, C Y; Huang, J; Zhou, G W; Wang, Y G

    2015-01-01

    In the transmission electron microscopy, a revised real space (RRS) method has been confirmed to be a more accurate dynamical electron diffraction simulation method for low-energy electron diffraction than the conventional multislice method (CMS). However, the RRS method can be only used to calculate the dynamical electron diffraction of orthogonal crystal system. In this work, the expression of the RRS method for non-orthogonal crystal system is derived. By taking Na2 Ti3 O7 and Si as examples, the correctness of the derived RRS formula for non-orthogonal crystal system is confirmed by testing the coincidence of numerical results of both sides of Schrödinger equation; moreover, the difference between the RRS method and the CMS for non-orthogonal crystal system is compared at the accelerating voltage range from 40 to 10 kV. Our results show that the CMS method is almost the same as the RRS method for the accelerating voltage above 40 kV. However, when the accelerating voltage is further lowered to 20 kV or below, the CMS method introduces significant errors, not only for the higher-order Laue zone diffractions, but also for zero-order Laue zone. These indicate that the RRS method for non-orthogonal crystal system is necessary to be used for more accurate dynamical simulation when the accelerating voltage is low. Furthermore, the reason for the increase of differences between those diffraction patterns calculated by the RRS method and the CMS method with the decrease of the accelerating voltage is discussed. © 2015 The Authors Journal of Microscopy © 2015 Royal Microscopical Society.

  5. In-situ neutron diffraction and crystal plasticity finite element modeling to study the kinematic stability of retained austenite in bearing steels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Voothaluru, Rohit; Bedekar, Vikram; Xie, Qingge

    This work integrates in-situ neutron diffraction and crystal plasticity finite element modeling to study the kinematic stability of retained austenite in high carbon bearing steels. The presence of a kinematically metastable retained austenite in bearing steels can significantly affect the macro-mechanical and micro-mechanical material response. Mechanical characterization of metastable austenite is a critical component in accurately capturing the micro-mechanical behavior under typical application loads. Traditional mechanical characterization techniques are unable to discretely quantify the micro-mechanical response of the austenite, and as a result, the computational predictions rely heavily on trial and error or qualitative descriptions of the austenite phase. Inmore » order to overcome this, in the present work, we use in-situ neutron diffraction of a uniaxial tension test of an A485 Grade 1 bearing steel specimen. The mechanical response determined from the neutron diffraction analysis was incorporated into a hybrid crystal plasticity finite element model that accounts for the martensite's crystal plasticity and the stress-assisted transformation from austenite to martensite in bearing steels. Here, the modeling response was used to estimate the single crystal elastic constants of the austenite and martensite phases. Finally, the results show that using in-situ neutron diffraction, coupled with a crystal plasticity model, can successfully predict both the micro-mechanical and macro-mechanical responses of bearing steels while accounting for the martensitic transformation of the retained austenite.« less

  6. In-situ neutron diffraction and crystal plasticity finite element modeling to study the kinematic stability of retained austenite in bearing steels

    DOE PAGES

    Voothaluru, Rohit; Bedekar, Vikram; Xie, Qingge; ...

    2018-11-21

    This work integrates in-situ neutron diffraction and crystal plasticity finite element modeling to study the kinematic stability of retained austenite in high carbon bearing steels. The presence of a kinematically metastable retained austenite in bearing steels can significantly affect the macro-mechanical and micro-mechanical material response. Mechanical characterization of metastable austenite is a critical component in accurately capturing the micro-mechanical behavior under typical application loads. Traditional mechanical characterization techniques are unable to discretely quantify the micro-mechanical response of the austenite, and as a result, the computational predictions rely heavily on trial and error or qualitative descriptions of the austenite phase. Inmore » order to overcome this, in the present work, we use in-situ neutron diffraction of a uniaxial tension test of an A485 Grade 1 bearing steel specimen. The mechanical response determined from the neutron diffraction analysis was incorporated into a hybrid crystal plasticity finite element model that accounts for the martensite's crystal plasticity and the stress-assisted transformation from austenite to martensite in bearing steels. Here, the modeling response was used to estimate the single crystal elastic constants of the austenite and martensite phases. Finally, the results show that using in-situ neutron diffraction, coupled with a crystal plasticity model, can successfully predict both the micro-mechanical and macro-mechanical responses of bearing steels while accounting for the martensitic transformation of the retained austenite.« less

  7. Crystallization and characterization of human chorionic gonadotropin in chemically deglycosylated and enzymatically desialylated states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lustbader, J.W.; Birken, S.; Pileggi, N.F.

    1989-11-28

    Crystals suitable for X-ray diffraction studies at moderate resolution have been grown from two forms of human chorionic gonadotropin (hCG): HF-treated hCG and neuraminidase-treated hCG. The enzymatically desialylated form of hCG produced crystals that diffract to 2.8 {angstrom} as compared to the HF-treated hCG crystals that diffract to 3.0 {angstrom}. Although it was assumed that the high and heterogeneous carbohydrate content of the glycoprotein hormones inhibited their crystallization, this report suggests that it is the negatively charged surface sugars and neither the total carbohydrate content nor its heterogeneity which interferes with crystal formation. Chemical deglycosylation resulted in significantly increased proteinmore » degradation during crystal growth. Such peptide bond cleavages were observed to a much lesser extent in the crystals grown from neuraminidase-digested hCG. Sequence analysis of the HF-treated hCG crystals suggested that up to 45% of the molecules within the crystal had an acid-labile peptide bond cleaved. In contrast, the neuraminidase-treated hCG exhibited less than 9% of this type of cleavage. The manner in which hCG was treated prior to crystallization was found to be a very important factor in the extent of peptide bound cleavages occurring during crystal growth. HF treatment of glycoproteins may render glycoproteins more susceptible to peptide bond cleavage during crystal growth.« less

  8. An evaluation of adhesive sample holders for advanced crystallographic experiments

    PubMed Central

    Mazzorana, Marco; Sanchez-Weatherby, Juan; Sandy, James; Lobley, Carina M. C.; Sorensen, Thomas

    2014-01-01

    The hydration state of macromolecular crystals often affects their overall order and, ultimately, the quality of the X-ray diffraction pattern that they produce. Post-crystallization techniques that alter the solvent content of a crystal may induce rearrangement within the three-dimensional array making up the crystal, possibly resulting in more ordered packing. The hydration state of a crystal can be manipulated by exposing it to a stream of air at controlled relative humidity in which the crystal can equilibrate. This approach provides a way of exploring crystal hydration space to assess the diffraction capabilities of existing crystals. A key requirement of these experiments is to expose the crystal directly to the dehydrating environment by having the minimum amount of residual mother liquor around it. This is usually achieved by placing the crystal on a flat porous support (Kapton mesh) and removing excess liquid by wicking. Here, an alternative approach is considered whereby crystals are harvested using adhesives that capture naked crystals directly from their crystallization drop, reducing the process to a one-step procedure. The impact of using adhesives to ease the harvesting of different types of crystals is presented together with their contribution to background scattering and their usefulness in dehydration experiments. It is concluded that adhesive supports represent a valuable tool for mounting macromolecular crystals to be used in humidity-controlled experiments and to improve signal-to-noise ratios in diffraction experiments, and how they can protect crystals from modifications in the sample environment is discussed. PMID:25195752

  9. Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishimura, Mitsuhiro; Protein Research Group, RIKEN Yokohama Institute, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045; Kaminishi, Tatsuya

    2007-11-01

    A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to spacemore » group P3{sub 1}21 or P3{sub 2}21.« less

  10. Purification, crystallization and preliminary X-ray diffraction studies of UDP-N-acetylglucosamine pyrophosphorylase from Candida albicans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maruyama, Daisuke; Nishitani, Yuichi; Nonaka, Tsuyoshi

    2006-12-01

    UDP-N-acetylglucosamine pyrophosphorylase was purified and crystallized and X-ray diffraction data were collected to 2.3 Å resolution. UDP-N-acetylglucosamine pyrophosphorylase (UAP) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine. UAP from Candida albicans was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals of the substrate and product complexes both diffract X-rays to beyond 2.3 Å resolution using synchrotron radiation. The crystals of the substrate complex belong to the triclinic space group P1, with unit-cell parameters a = 47.77, b = 62.89, c = 90.60 Å, α = 90.01, β = 97.72, γ = 92.88°, whereas those of the productmore » complex belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.95, b = 90.87, c = 94.88 Å.« less

  11. Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.

    2016-11-15

    Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P12{sub 1}1 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, βmore » = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.« less

  12. 3D coherent X-ray diffractive imaging of an Individual colloidal crystal grain

    NASA Astrophysics Data System (ADS)

    Shabalin, A.; Meijer, J.-M.; Sprung, M.; Petukhov, A. V.; Vartanyants, I. A.

    Self-assembled colloidal crystals represent an important model system to study nucleation phenomena and solid-solid phase transitions. They are attractive for applications in photonics and sensorics. We present results of a coherent x-ray diffractive imaging experiment performed on a single colloidal crystal grain. The full three-dimensional (3D) reciprocal space map measured by an azimuthal rotational scan contained several orders of Bragg reflections together with the coherent interference signal between them. Applying the iterative phase retrieval approach, the 3D structure of the crystal grain was reconstructed and positions of individual colloidal particles were resolved. We identified an exact stacking sequence of hexagonal close-packed layers including planar and linear defects. Our results open up a breakthrough in applications of coherent x-ray diffraction for visualization of the inner 3D structure of different mesoscopic materials, such as photonic crystals. Present address: University of California - San Diego, USA.

  13. Order and disorder in crystals of hexameric NTPases from dsRNA bacteriophages.

    PubMed

    Mancini, Erika J; Grimes, Jonathan M; Malby, Robyn; Sutton, Geoffrey C; Kainov, Denis E; Juuti, Jarmo T; Makeyev, Eugene V; Tuma, Roman; Bamford, Dennis H; Stuart, David I

    2003-12-01

    The packaging of genomic RNA in members of the Cystoviridae is performed by P4, a hexameric protein with NTPase activity. Across family members such as Phi6, Phi8 and Phi13, the P4 proteins show low levels of sequence identity, but presumably have similar atomic structures. Initial structure-determination efforts for P4 from Phi6 and Phi8 were hampered by difficulties in obtaining crystals that gave ordered diffraction. Diffraction from crystals of full-length P4 showed a variety of disorder and anisotropy. Subsequently, crystals of Phi13 P4 were obtained which yielded well ordered diffraction to 1.7 A. Comparison of the packing arrangements of P4 hexamers in different crystal forms and analysis of the disorder provides insights into the flexibility of this family of proteins, which might be an integral part of their biological function.

  14. Goniometer-based femtosecond crystallography with X-ray free electron lasers

    DOE PAGES

    Cohen, Aina E.; Soltis, S. Michael; González, Ana; ...

    2014-10-31

    The emerging method of femtosecond crystallography (FX) may extend the diffraction resolution accessible from small radiation-sensitive crystals and provides a means to determine catalytically accurate structures of acutely radiation-sensitive metalloenzymes. Automated goniometer-based instrumentation developed for use at the Linac Coherent Light Source enabled efficient and flexible FX experiments to be performed on a variety of sample types. In the case of rod-shaped Cpl hydrogenase crystals, only five crystals and about 30 min of beam time were used to obtain the 125 still diffraction patterns used to produce a 1.6-Å resolution electron density map. With smaller crystals, high-density grids were usedmore » to increase sample throughput; 930 myoglobin crystals mounted at random orientation inside 32 grids were exposed, demonstrating the utility of this approach. Screening results from cryocooled crystals of β 2-adrenoreceptor and an RNA polymerase II complex indicate the potential to extend the diffraction resolution obtainable from very radiation-sensitive samples beyond that possible with undulator-based synchrotron sources.« less

  15. Goniometer-based femtosecond crystallography with X-ray free electron lasers

    PubMed Central

    Cohen, Aina E.; Soltis, S. Michael; González, Ana; Aguila, Laura; Alonso-Mori, Roberto; Barnes, Christopher O.; Baxter, Elizabeth L.; Brehmer, Winnie; Brewster, Aaron S.; Brunger, Axel T.; Calero, Guillermo; Chang, Joseph F.; Chollet, Matthieu; Ehrensberger, Paul; Eriksson, Thomas L.; Feng, Yiping; Hattne, Johan; Hedman, Britt; Hollenbeck, Michael; Holton, James M.; Keable, Stephen; Kobilka, Brian K.; Kovaleva, Elena G.; Kruse, Andrew C.; Lemke, Henrik T.; Lin, Guowu; Lyubimov, Artem Y.; Manglik, Aashish; Mathews, Irimpan I.; McPhillips, Scott E.; Nelson, Silke; Peters, John W.; Sauter, Nicholas K.; Smith, Clyde A.; Song, Jinhu; Stevenson, Hilary P.; Tsai, Yingssu; Uervirojnangkoorn, Monarin; Vinetsky, Vladimir; Wakatsuki, Soichi; Weis, William I.; Zadvornyy, Oleg A.; Zeldin, Oliver B.; Zhu, Diling; Hodgson, Keith O.

    2014-01-01

    The emerging method of femtosecond crystallography (FX) may extend the diffraction resolution accessible from small radiation-sensitive crystals and provides a means to determine catalytically accurate structures of acutely radiation-sensitive metalloenzymes. Automated goniometer-based instrumentation developed for use at the Linac Coherent Light Source enabled efficient and flexible FX experiments to be performed on a variety of sample types. In the case of rod-shaped Cpl hydrogenase crystals, only five crystals and about 30 min of beam time were used to obtain the 125 still diffraction patterns used to produce a 1.6-Å resolution electron density map. For smaller crystals, high-density grids were used to increase sample throughput; 930 myoglobin crystals mounted at random orientation inside 32 grids were exposed, demonstrating the utility of this approach. Screening results from cryocooled crystals of β2-adrenoreceptor and an RNA polymerase II complex indicate the potential to extend the diffraction resolution obtainable from very radiation-sensitive samples beyond that possible with undulator-based synchrotron sources. PMID:25362050

  16. Purification, crystallization and X-ray crystallographic analysis of a putative exopolyphosphatase from Zymomonas mobilis

    PubMed Central

    Zhang, Aili; Guo, Erhong; Qian, Lanfang; Tang, Nga-Yeung; Watt, Rory M.; Bartlam, Mark

    2016-01-01

    Exopolyphosphatase (PPX) enzymes degrade inorganic polyphosphate (poly-P), which is essential for the survival of microbial cells in response to external stresses. In this study, a putative exopolyphosphatase from Zymomonas mobilis (ZmPPX) was crystallized. Crystals of the wild-type enzyme diffracted to 3.3 Å resolution and could not be optimized further. The truncation of 29 amino acids from the N-terminus resulted in crystals that diffracted to 1.8 Å resolution. The crystals belonged to space group C2, with unit-cell parameters a = 122.0, b = 47.1, c = 89.5 Å, α = γ = 90, β = 124.5°. An active-site mutant that crystallized in the same space group and with similar unit-cell parameters diffracted to 1.56 Å resolution. One molecule was identified per asymmetric unit. Analytical ultracentrifugation confirmed that ZmPPX forms a dimer in solution. It was confirmed that ZmPPX possesses exopolyphosphatase activity against a synthetic poly-P substrate. PMID:26919520

  17. Purification, crystallization and X-ray crystallographic analysis of a putative exopolyphosphatase from Zymomonas mobilis.

    PubMed

    Zhang, Aili; Guo, Erhong; Qian, Lanfang; Tang, Nga-Yeung; Watt, Rory M; Bartlam, Mark

    2016-03-01

    Exopolyphosphatase (PPX) enzymes degrade inorganic polyphosphate (poly-P), which is essential for the survival of microbial cells in response to external stresses. In this study, a putative exopolyphosphatase from Zymomonas mobilis (ZmPPX) was crystallized. Crystals of the wild-type enzyme diffracted to 3.3 Å resolution and could not be optimized further. The truncation of 29 amino acids from the N-terminus resulted in crystals that diffracted to 1.8 Å resolution. The crystals belonged to space group C2, with unit-cell parameters a = 122.0, b = 47.1, c = 89.5 Å, α = γ = 90, β = 124.5°. An active-site mutant that crystallized in the same space group and with similar unit-cell parameters diffracted to 1.56 Å resolution. One molecule was identified per asymmetric unit. Analytical ultracentrifugation confirmed that ZmPPX forms a dimer in solution. It was confirmed that ZmPPX possesses exopolyphosphatase activity against a synthetic poly-P substrate.

  18. Evanescent Properties of Optical Diffraction from 2-Dimensional Hexagonal Photonic Crystals and Their Sensor Applications.

    PubMed

    Liao, Yu-Yang; Chen, Yung-Tsan; Chen, Chien-Chun; Huang, Jian-Jang

    2018-04-03

    The sensitivity of traditional diffraction grating sensors is limited by the spatial resolution of the measurement setup. Thus, a large space is required to improve sensor performance. Here, we demonstrate a compact hexagonal photonic crystal (PhC) optical sensor with high sensitivity. PhCs are able to diffract optical beams to various angles in azimuthal space. The critical wavelength that satisfies the phase matching or becomes evanescent was used to benchmark the refractive index of a target analyte applied on a PhC sensor. Using a glucose solution as an example, our sensor demonstrated very high sensitivity and a low limit of detection. This shows that the diffraction mechanism of hexagonal photonic crystals can be used for sensors when compact size is a concern.

  19. Graphene as a protein crystal mounting material to reduce background scatter.

    PubMed

    Wierman, Jennifer L; Alden, Jonathan S; Kim, Chae Un; McEuen, Paul L; Gruner, Sol M

    2013-10-01

    The overall signal-to-noise ratio per unit dose for X-ray diffraction data from protein crystals can be improved by reducing the mass and density of all material surrounding the crystals. This article demonstrates a path towards the practical ultimate in background reduction by use of atomically thin graphene sheets as a crystal mounting platform for protein crystals. The results show the potential for graphene in protein crystallography and other cases where X-ray scatter from the mounting material must be reduced and specimen dehydration prevented, such as in coherent X-ray diffraction imaging of microscopic objects.

  20. Graphene as a protein crystal mounting material to reduce background scatter

    PubMed Central

    Wierman, Jennifer L.; Alden, Jonathan S.; Kim, Chae Un; McEuen, Paul L.; Gruner, Sol M.

    2013-01-01

    The overall signal-to-noise ratio per unit dose for X-ray diffraction data from protein crystals can be improved by reducing the mass and density of all material surrounding the crystals. This article demonstrates a path towards the practical ultimate in background reduction by use of atomically thin graphene sheets as a crystal mounting platform for protein crystals. The results show the potential for graphene in protein crystallography and other cases where X-ray scatter from the mounting material must be reduced and specimen dehydration prevented, such as in coherent X-ray diffraction imaging of microscopic objects. PMID:24068843

  1. A novel Monte Carlo algorithm for simulating crystals with McStas

    NASA Astrophysics Data System (ADS)

    Alianelli, L.; Sánchez del Río, M.; Felici, R.; Andersen, K. H.; Farhi, E.

    2004-07-01

    We developed an original Monte Carlo algorithm for the simulation of Bragg diffraction by mosaic, bent and gradient crystals. It has practical applications, as it can be used for simulating imperfect crystals (monochromators, analyzers and perhaps samples) in neutron ray-tracing packages, like McStas. The code we describe here provides a detailed description of the particle interaction with the microscopic homogeneous regions composing the crystal, therefore it can be used also for the calculation of quantities having a conceptual interest, as multiple scattering, or for the interpretation of experiments aiming at characterizing crystals, like diffraction topographs.

  2. Optical Crystals

    ERIC Educational Resources Information Center

    Bergsten, Ronald

    1974-01-01

    Discusses the production and structure of a sequence of optical crystals which can serve as one-, two-, and three-dimensional diffraction plates to illustrate diffraction patterns by using light rather than x-rays or particles. Applications to qualitative presentations of Laue theory at the secondary and college levels are recommended. (CC)

  3. Protein crystal structure obtained at 2.9 Å resolution from injecting bacterial cells into an X-ray free-electron laser beam

    PubMed Central

    Sawaya, Michael R.; Cascio, Duilio; Gingery, Mari; Rodriguez, Jose; Goldschmidt, Lukasz; Colletier, Jacques-Philippe; Messerschmidt, Marc M.; Boutet, Sébastien; Koglin, Jason E.; Williams, Garth J.; Brewster, Aaron S.; Nass, Karol; Hattne, Johan; Botha, Sabine; Doak, R. Bruce; Shoeman, Robert L.; DePonte, Daniel P.; Park, Hyun-Woo; Federici, Brian A.; Sauter, Nicholas K.; Schlichting, Ilme; Eisenberg, David S.

    2014-01-01

    It has long been known that toxins produced by Bacillus thuringiensis (Bt) are stored in the bacterial cells in crystalline form. Here we describe the structure determination of the Cry3A toxin found naturally crystallized within Bt cells. When whole Bt cells were streamed into an X-ray free-electron laser beam we found that scattering from other cell components did not obscure diffraction from the crystals. The resolution limits of the best diffraction images collected from cells were the same as from isolated crystals. The integrity of the cells at the moment of diffraction is unclear; however, given the short time (∼5 µs) between exiting the injector to intersecting with the X-ray beam, our result is a 2.9-Å-resolution structure of a crystalline protein as it exists in a living cell. The study suggests that authentic in vivo diffraction studies can produce atomic-level structural information. PMID:25136092

  4. The significance of Bragg's law in electron diffraction and microscopy, and Bragg's second law.

    PubMed

    Humphreys, C J

    2013-01-01

    Bragg's second law, which deserves to be more widely known, is recounted. The significance of Bragg's law in electron diffraction and microscopy is then discussed, with particular emphasis on differences between X-ray and electron diffraction. As an example of such differences, the critical voltage effect in electron diffraction is described. It is then shown that the lattice imaging of crystals in high-resolution electron microscopy directly reveals the Bragg planes used for the imaging process, exactly as visualized by Bragg in his real-space law. Finally, it is shown how in 2012, for the first time, on the centennial anniversary of Bragg's law, single atoms have been identified in an electron microscope using X-rays emitted from the specimen. Hence atomic resolution X-ray maps of a crystal in real space can be formed which give the positions and identities of the different atoms in the crystal, or of a single impurity atom in the crystal.

  5. Crystallization and X-ray diffraction analysis of a putative bacterial class I labdane-related diterpene synthase.

    PubMed

    Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia; Stojanoff, Vivian; Rodríguez-Sanoja, Romina; Rudiño-Piñera, Enrique; Sánchez, Sergio

    2015-09-01

    Labdane-related diterpenoids are natural products with potential pharmaceutical applications that are rarely found in bacteria. Here, a putative class I labdane-related diterpene synthase (LrdC) identified by genome mining in a streptomycete was successfully crystallized using the microbatch method. Crystals of the LrdC enzyme were obtained in a holo form with its natural cofactor Mg(2+) (LrdC-Mg(2+)) and in complex with inorganic pyrophosphate (PPi) (LrdC-Mg(2+)-PPi). Crystals of native LrdC-Mg(2+) diffracted to 2.50 Å resolution and belonged to the trigonal space group P3221, with unit-cell parameters a = b = 107.1, c = 89.2 Å. Crystals of the LrdC-Mg(2+)-PPi complex grown in the same conditions as the native enzyme with PEG 8000 diffracted to 2.36 Å resolution and also belonged to the trigonal space group P3221. Crystals of the LrdC-Mg(2+)-PPi complex grown in a second crystallization condition with PEG 3350 diffracted to 2.57 Å resolution and belonged to the monoclinic space group P21, with unit-cell parameters a = 49.9, b = 104.1, c = 66.5 Å, β = 111.4°. The structure was determined by the single-wavelength anomalous dispersion (SAD) technique using the osmium signal from a potassium hexachloroosmate (IV) derivative.

  6. Investigations on synthesis, growth and physicochemical properties of semi-organic NLO crystal bis(thiourea) ammonium nitrate for nonlinear frequency conversion

    NASA Astrophysics Data System (ADS)

    Anbarasi, A.; Ravi Kumar, S. M.; Sundar, G. J. Shanmuga; Mosses, M. Allen; Raj, M. Packiya; Prabhakaran, M.; Ravisankar, R.; Gunaseelan, R.

    2017-10-01

    Bis(thiourea) ammonium nitrate (BTAN), a new nonlinear optical crystal was grown successfully by slow evaporation technique using water as solvent at room temperature. The grown crystals were optically good quality with dimensions upto 10 × 6 × 3 mm3. Single crystal X-Ray diffraction analysis reveals that the crystal lattice is orthorhombic. From Powder X-ray diffraction analysis the diffraction planes have been indexed. The presence of the various functional groups of BTAN was identified through FTIR spectroscopic analysis. UV cut-off wavelength was observed from optical absorbance spectrum and it was found to be 240 nm. Second harmonic efficiency was determined using Kurtz powder method in comparison with KDP to confirm the nonlinearity of the material. Thermal analysis confirmed that grown crystal is thermally stable upto 184 °C. Microhardness studies show that hardness number (Hv) increases with load. Conductivity measurements such as dielectric, ac and photoconductivity were studied. Growth mechanism and surface features of the as grown single crystal was analysed by chemical etching analysis.

  7. Reconstructing three-dimensional protein crystal intensities from sparse unoriented two-axis X-ray diffraction patterns

    PubMed Central

    Lan, Ti-Yen; Wierman, Jennifer L.; Tate, Mark W.; Philipp, Hugh T.; Elser, Veit

    2017-01-01

    Recently, there has been a growing interest in adapting serial microcrystallography (SMX) experiments to existing storage ring (SR) sources. For very small crystals, however, radiation damage occurs before sufficient numbers of photons are diffracted to determine the orientation of the crystal. The challenge is to merge data from a large number of such ‘sparse’ frames in order to measure the full reciprocal space intensity. To simulate sparse frames, a dataset was collected from a large lysozyme crystal illuminated by a dim X-ray source. The crystal was continuously rotated about two orthogonal axes to sample a subset of the rotation space. With the EMC algorithm [expand–maximize–compress; Loh & Elser (2009). Phys. Rev. E, 80, 026705], it is shown that the diffracted intensity of the crystal can still be reconstructed even without knowledge of the orientation of the crystal in any sparse frame. Moreover, parallel computation implementations were designed to considerably improve the time and memory scaling of the algorithm. The results show that EMC-based SMX experiments should be feasible at SR sources. PMID:28808431

  8. Crystallization and preliminary X-ray analysis of a protease inhibitor from the latex of Carica papaya

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Azarkan, Mohamed; Garcia-Pino, Abel; Dibiani, Rachid

    2006-12-01

    The Kunitz-type trypsin/chymotrypsin inhibitor isolated from C. papaya latex has been crystallized using the hanging-drop vapour-diffusion method. Two different crystal forms are observed, diffracting to 2.6 and 1.7 Å. A Kunitz-type protease inhibitor purified from the latex of green papaya (Carica papaya) fruits was crystallized in the presence and absence of divalent metal ions. Crystal form I, which is devoid of divalent cations, diffracts to a resolution of 2.6 Å and belongs to space group P3{sub 1} or P3{sub 2}. This crystal form is a merohedral twin with two molecules in the asymmetric unit and unit-cell parameters a = bmore » = 74.70, c = 78.97 Å. Crystal form II, which was grown in the presence of Co{sup 2+}, diffracts to a resolution of 1.7 Å and belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 44.26, b = 81.99, c = 140.89 Å.« less

  9. Specific features of two diffraction schemes for a widely divergent X-ray beam

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Avetyan, K. T.; Levonyan, L. V.; Semerjian, H. S.

    2015-03-15

    We investigated the specific features of two diffraction schemes for a widely divergent X-ray beam that use a circular diaphragm 30–50 μm in diameter as a point source of characteristic radiation. In one of the schemes, the diaphragm was set in front of the crystal (the diaphragm-crystal (d-c) scheme); in the other, it was installed behind the crystal (the crystal-diaphragm (c-d) scheme). It was established that the diffraction image in the c-d scheme is a topographic map of the investigated crystal area. In the d-c scheme at L = 2l (l and L are the distances between the crystal andmore » the diaphragm and between the photographic plate and the diaphragm, respectively), the branches of hyperbolas formed in this family of planes (hkl) by the characteristic K{sub α} and K{sub β} radiations, including higher order reflections, converge into one straight line. It is experimentally demonstrated that this convergence is very sensitive to structural inhomogeneities in the crystal under study.« less

  10. Structural properties of a family of hydrogen-bonded co-crystals formed between gemfibrozil and hydroxy derivatives of t-butylamine, determined directly from powder X-ray diffraction data

    NASA Astrophysics Data System (ADS)

    Cheung, Eugene Y.; David, Sarah E.; Harris, Kenneth D. M.; Conway, Barbara R.; Timmins, Peter

    2007-03-01

    We report the formation and structural properties of co-crystals containing gemfibrozil and hydroxy derivatives of t-butylamine H 2NC(CH 3) 3-n(CH 2OH) n, with n=0, 1, 2 and 3. In each case, a 1:1 co-crystal is formed, with transfer of a proton from the carboxylic acid group of gemfibrozil to the amino group of the t-butylamine derivative. All of the co-crystal materials prepared are polycrystalline powders, and do not contain single crystals of suitable size and/or quality for single crystal X-ray diffraction studies. Structure determination of these materials has been carried out directly from powder X-ray diffraction data, using the direct-space Genetic Algorithm technique for structure solution followed by Rietveld refinement. The structural chemistry of this series of co-crystal materials reveals well-defined structural trends within the first three members of the family ( n=0, 1, 2), but significantly contrasting structural properties for the member with n=3.

  11. Purification, crystallization and preliminary X-ray diffraction of the N-terminal calmodulin-like domain of the human mitochondrial ATP-Mg/P{sub i} carrier SCaMC1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Qin, E-mail: yang@crystal.harvard.edu; Brüschweiler, Sven; Chou, James J., E-mail: yang@crystal.harvard.edu

    2013-12-24

    The N-terminal calmodulin-like domain of the human mitochondrial ATP-Mg/P{sub i} carrier SCaMC1 was crystallized in the presence of Ca{sup 2+}. X-ray diffraction data were collected to 2.9 Å resolution from crystals which belonged to space group P6{sub 2}22.

  12. The effect of laser radiation on the diffraction of X-rays in crystals

    NASA Astrophysics Data System (ADS)

    Trushin, V. N.; Chuprunov, E. V.; Khokhlov, A. F.

    1988-10-01

    The effect of laser radiation on the intensity of the X-ray diffraction peaks of KDP, ADP, and CuSO4-5H2O crystals was studied experimentally. This intensity was found to increase as a function of the laser beam power. This result suggests that it is possible to use laser beams to control X-ray intensity in the crystals considered.

  13. Crystallization and preliminary X-ray diffraction analysis of the arginine repressor of the hyperthermophile Thermotoga neapolitana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Massant, Jan, E-mail: jan.massant@vub.ac.be; Peeters, Eveline; Charlier, Daniel

    2006-01-01

    The arginine repressor of the hyperthermophile T. neapolitana was crystallized with and without its corepressor arginine. Both crystals diffracted to high resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with similar unit-cell parameters. The arginine repressor of Thermotoga neapolitana (ArgRTnp) is a member of the family of multifunctional bacterial arginine repressors involved in the regulation of arginine metabolism. This hyperthermophilic repressor shows unique DNA-binding features that distinguish it from its homologues. ArgRTnp exists as a homotrimeric protein that assembles into hexamers at higher protein concentrations and/or in the presence of arginine. ArgRTnp was crystallized with andmore » without its corepressor arginine using the hanging-drop vapour-diffusion method. Crystals of the aporepressor diffracted to a resolution of 2.1 Å and belong to the orthorhombic P2{sub 1}2{sub 1}2{sub 1} space group, with unit-cell parameters a = 117.73, b = 134.15, c = 139.31 Å. Crystals of the repressor in the presence of its corepressor arginine diffracted to a resolution of 2.4 Å and belong to the same space group, with similar unit-cell parameters.« less

  14. X-Ray Diffraction and Imaging Study of Imperfections of Crystallized Lysozyme with Coherent X-Rays

    NASA Technical Reports Server (NTRS)

    Hu, Zheng-Wei; Chu, Y. S.; Lai, B.; Cai, Z.; Thomas, B. R.; Chernov, A. A.

    2003-01-01

    Phase-sensitive x-ray diffraction imaging and high angular-resolution diffraction combined with phase contrast radiographic imaging are employed to characterize defects and perfection of a uniformly grown tetragonal lysozyme crystal in symmetric Laue case. The fill width at half-maximum (FWHM) of a 4 4 0 rocking curve measured from the original crystal is approximately 16.7 arcseconds, and defects, which include point defects, line defects, and microscopic domains, have been clearly observed in the diffraction images of the crystal. The observed line defects carry distinct dislocation features running approximately along the <110> growth front, and they have been found to originate mostly at a central growth area and occasionally at outer growth regions. Individual point defects trapped at a crystal nucleus are resolved in the images of high sensitivity to defects. Slow dehydration has led to the broadening of the 4 4 0 rocking curve by a factor of approximately 2.4. A significant change of the defect structure and configuration with drying has been revealed, which suggests the dehydration induced migration and evolution of dislocations and lattice rearrangements to reduce overall strain energy. The sufficient details of the observed defects shed light upon perfection, nucleation and growth, and properties of protein crystals.

  15. Growth, structural, spectral, mechanical, thermal and dielectric characterization of phosphoric acid admixtured L-alanine (PLA) single crystals.

    PubMed

    Rose, A S J Lucia; Selvarajan, P; Perumal, S

    2011-10-15

    Phosphoric acid admixtured L-alanine (PLA) single crystals were grown successfully by solution method with slow evaporation technique at room temperature. Crystals of size 18 mm×12 mm×8 mm have been obtained in 28 days. The grown crystals were colorless and transparent. The solubility of the grown samples has been found out at various temperatures. The lattice parameters of the grown crystals were determined by X-ray diffraction technique. The reflection planes of the sample were confirmed by the powder X-ray diffraction study and diffraction peaks were indexed. Fourier transform infrared (FTIR) studies were used to confirm the presence of various functional groups in the crystals. UV-visible transmittance spectrum was recorded to study the optical transparency of grown crystal. The nonlinear optical (NLO) property of the grown crystal was confirmed by Kurtz-Perry powder technique and a study of its second harmonic generation efficiency in comparison with potassium dihydrogen phosphate (KDP) has been made. The mechanical strength of the crystal was estimated by Vickers hardness test. The grown crystals were subjected to thermo gravimetric and differential thermal analysis (TG/DTA). The dielectric behavior of the sample was also studied. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Thaumatin crystallization aboard the International Space Station using liquid-liquid diffusion in the Enhanced Gaseous Nitrogen Dewar (EGN).

    PubMed

    Barnes, Cindy L; Snell, Edward H; Kundrot, Craig E

    2002-05-01

    This paper reports results from the first biological crystal-growth experiment on the International Space Station (ISS). Crystals of thaumatin were grown using liquid-liquid diffusion in Tygon tubing transported in the Enhanced Gaseous Nitrogen Dewar (EGN). Different volume ratios and concentrations of protein and precipitant were used to test different adaptations of the vapor-diffusion crystallization recipe to the liquid-liquid diffusion method. The EGN warmed up from 77 to 273 K in about 4 d, about the same time it took to warm from 273 to 293 K. The temperature within the EGN was 293-297 K for the majority of the experiment. Air gaps that blocked liquid-liquid diffusion formed in the tubes. Nonetheless, crystals were grown. Synchrotron diffraction data collected from the best space-grown crystal extended to 1.28 A, comparable to previous studies of space-grown thaumatin crystals. The resolution of the best ground-control crystal was only 1.47 A. It is not clear if the difference in diffraction limit arises from factors other than crystal size. Improvements in temperature control and the elimination of air gaps are needed, but the results show that the EGN on the ISS can be used to produce space-grown crystals that diffract to high resolution.

  17. Thaumatin Crystallization Aboard the International Space Station Using Liquid-Liquid Diffusion in the Enhanced Gaseous Nitrogen Dewar (EGN)

    NASA Technical Reports Server (NTRS)

    Kundrot, Craig; Barnes, Cindy L.; Snell, Edward H.; Stinson, Thomas N. (Technical Monitor)

    2002-01-01

    This paper reports results from the first biological crystal growth experiment on the International Space Station (ISS). Crystals of thaumatin were grown using liquid-liquid diffusion in Tygon tubing transported in the Enhanced Gaseous Nitrogen Dewar (EGN). Different Volume ratios and concentrations of protein and precipitant were used to test different adaptations of the vapor diffusion crystallization recipe to the liquid-liquid diffusion method. The EGN warmed up from -196 C to 0 C in about four days, about the same time it took to warm from 0 C to 20 C. The temperature within the EGN was 20 - 24 C for the majority of the experiment. Air gaps that blocked liquid-liquid diffusion formed in the tubes. Nonetheless, crystals were grown. Synchrotron diffraction data collected from the best space grown crystal extended to 1.28 Angstroms, comparable to previous studies of space-grown thaumatin crystals. The resolution of the best ground control crystal was only 1.47 Angstroms. It is not clear if the difference in diffraction limit is due to factors other than crystal size. Improvements in temperature control and the elimination of air gaps are needed, but the results show that EGN on the ISS can be used to produce space grown crystals that diffract to high resolution.

  18. Method for detecting a mass density image of an object

    DOEpatents

    Wernick, Miles N [Chicago, IL; Yang, Yongyi [Westmont, IL

    2008-12-23

    A method for detecting a mass density image of an object. An x-ray beam is transmitted through the object and a transmitted beam is emitted from the object. The transmitted beam is directed at an angle of incidence upon a crystal analyzer. A diffracted beam is emitted from the crystal analyzer onto a detector and digitized. A first image of the object is detected from the diffracted beam emitted from the crystal analyzer when positioned at a first angular position. A second image of the object is detected from the diffracted beam emitted from the crystal analyzer when positioned at a second angular position. A refraction image is obtained and a regularized mathematical inversion algorithm is applied to the refraction image to obtain a mass density image.

  19. Streaking images that appear only in the plane of diffraction in undoped GaAs single crystals: Diffraction imaging (topography) by monochromatic synchrotron radiation

    NASA Technical Reports Server (NTRS)

    Kuriyama, Masao; Steiner, Bruce; Dobbyn, Ronald C.; Laor, Uri; Larson, David; Brown, Margaret

    1988-01-01

    Streaking images restricted to the direction of the diffraction (scattering) vector have been observed on transmission through undoped GaAs. These disruption images (caused by the reduction of diffraction in the direction of observation) appear both in the forward and in Bragg diffracted directions in monochromatic synchrontron radiation diffraction imaging. This previously unobserved phenomenon can be explained in terms of planar defects (interfaces) or platelets which affects the absorption coefficient in anomalous transmission. Such regions of the crystal look perfect despite the presence of imperfections when the scattering vector is not perpendicular to the normal of the platelets. The observed crystallographic orientation of these interfaces strongly indicates that they are antiphase boundaries.

  20. Unified structure theory of icosahedral quasicrystals: Evidence from neutron powder diffraction patterns that AlCrFeMnSi, AlCuLiMg, and TiNiFeSi icosahedral quasicrystals are twins of cubic crystals containing about 820 or 1012 atoms in a primitive unit cube

    PubMed Central

    Pauling, Linus

    1988-01-01

    A unified structure theory of icosahedral quasicrystals, combining the twinned-cubic-crystal theory and the Penrose-tiling-six-dimensional-projection theory, is described. Values of the primitive-cubic lattice constant for several quasicrystals are evaluated from x-ray and neutron diffraction data. The fact that the low-angle diffraction maxima can be indexed with cubic unit cells provides additional support for the twinned-cubic-crystal theory of icosahedral quasicrystals. PMID:16593990

  1. Time-resolved in situ neutron diffraction under supercritical hydrothermal conditions: a study of the synthesis of KTiOPO4.

    PubMed

    Ok, Kang Min; Lee, Dong Woo; Smith, Ronald I; O'Hare, Dermot

    2012-10-31

    In the first in situ neutron powder diffraction study of a supercritical hydrothermal synthesis, the crystallization of KTiOPO(4) (KTP) at 450 °C and 380 bar has been investigated. The time-resolved diffraction data suggest that the crystallization of KTP occurs by the reaction between dissolved K(+)(aq), PO(4)(3-)(aq), and [Ti(OH)(x)]((4-x)+)(aq) species.

  2. IFLA General Conference, 1987. IFLA Core Programmes. Open Forum. Papers.

    ERIC Educational Resources Information Center

    International Federation of Library Associations, The Hague (Netherlands).

    The four papers in this compilation report on some of the recent core programs of the International Federation of Library Associations (IFLA): (1) "The IFLA Universal Bibliographic Control and International Machine Readable Cataloging Programme (UBCIM)" (Ross Bourne, IFLA UBCIM Programme Officer); (2) "The IFLA UAP (Universal…

  3. Humidity control and hydrophilic glue coating applied to mounted protein crystals improves X-ray diffraction experiments

    PubMed Central

    Baba, Seiki; Hoshino, Takeshi; Ito, Len; Kumasaka, Takashi

    2013-01-01

    Protein crystals are fragile, and it is sometimes difficult to find conditions suitable for handling and cryocooling the crystals before conducting X-ray diffraction experiments. To overcome this issue, a protein crystal-mounting method has been developed that involves a water-soluble polymer and controlled humid air that can adjust the moisture content of a mounted crystal. By coating crystals with polymer glue and exposing them to controlled humid air, the crystals were stable at room temperature and were cryocooled under optimized humidity. Moreover, the glue-coated crystals reproducibly showed gradual transformations of their lattice constants in response to a change in humidity; thus, using this method, a series of isomorphous crystals can be prepared. This technique is valuable when working on fragile protein crystals, including membrane proteins, and will also be useful for multi-crystal data collection. PMID:23999307

  4. Structural, mechanical, electrical and optical properties of a new lithium boro phthalate NLO crystal synthesized by a slow evaporation method

    NASA Astrophysics Data System (ADS)

    Mohanraj, K.; Balasubramanian, D.; Jhansi, N.

    2017-11-01

    A new non-linear optical (NLO) single crystal of lithium boro phthalate (LiBP) was grown by slow solvent evaporation technique. The powder sample was subjected to powder X-ray diffraction (PXRD) to find its crystalline nature and the crystal structure of the grown crystal was determined using single crystal X-ray (SXRD) diffraction analysis. The Fourier Transform Infrared (FTIR) spectrum was recorded for grown crystal to identify the various functional groups present in the compound. The mechanical property of the LiBP single crystal was studied using Vickers microhardness tester. The dielectric constant and dielectric loss measurements were carried out for the grown crystal at various temperatures. The grown crystal was subjected to UV-Visible Spectral Studies to analyze the linear optical behavior of the grown crystal. The Kurtz-Perry Powder technique was employed to measure the Second Harmonic Generation efficiency of the grown crystal.

  5. Crystallization and preliminary crystallographic analysis of two Streptococcus agalactiae proteins: the family II inorganic pyrophosphatase and the serine/threonine phosphatase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rantanen, Mika K.; Lehtiö, Lari; Rajagopal, Lakshmi

    Two S. agalactiae proteins, the inorganic pyrophosphatase and the serine/threonine phosphatase, were crystallized and diffraction data were collected and processed from these crystals. The data from the two protein crystals extended to 2.80 and 2.65 Å, respectively. Streptococcus agalactiae, which infects human neonates and causes sepsis and meningitis, has recently been shown to possess a eukaryotic-like serine/threonine protein phosphorylation signalling cascade. Through their target proteins, the S. agalactiae Ser/Thr kinase and Ser/Thr phosphatase together control the growth as well as the morphology and virulence of this organism. One of the targets is the S. agalactiae family II inorganic pyrophosphatase. Themore » inorganic pyrophosphatase and the serine/threonine phosphatase have therefore been purified and crystallized and diffraction data have been collected from their crystals. The data were processed using XDS. The inorganic pyrosphosphatase crystals diffracted to 2.80 Å and the Ser/Thr phosphatase crystals to 2.65 Å. Initial structure-solution experiments indicate that structure solution will be successful in both cases. Solving the structure of the proteins involved in this cascade is the first step towards understanding this phenomenon in atomic detail.« less

  6. Two-dimensional microsphere quasi-crystal: fabrication and properties

    NASA Astrophysics Data System (ADS)

    Noginova, Natalia E.; Venkateswarlu, Putcha; Kukhtarev, Nickolai V.; Sarkisov, Sergey S.; Noginov, Mikhail A.; Caulfield, H. John; Curley, Michael J.

    1996-11-01

    2D quasi-crystals were fabricated from polystyrene microspheres and characterized for their structural, diffraction, and non-linear optics properties. The quasi- crystals were produced with the method based on Langmuir- Blodgett thin film technique. Illuminating the crystal with the laser beam, we observed the diffraction pattern in the direction of the beam propagation and in the direction of the back scattering, similar to the x-ray Laue pattern observed in regular crystals with hexagonal structure. The absorption spectrum of the quasi-crystal demonstrated two series of regular maxima and minima, with the spacing inversely proportional to the microspheres diameter. Illumination of the dye-doped microspheres crystal with Q- switched radiation of Nd:YAG laser showed the enhancement of non-linear properties, in particular, second harmonic generation.

  7. 7 Å Resolution in Protein 2-Dimentional-Crystal X-Ray Diffraction at Linac Coherent Light Source

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pedrini, Bill; Tsai, Ching-Ju; Capitani, Guido

    2014-06-09

    Membrane proteins arranged as two-dimensional (2D) crystals in the lipid en- vironment provide close-to-physiological structural information, which is essential for understanding the molecular mechanisms of protein function. X-ray diffraction from individual 2D crystals did not represent a suitable investigation tool because of radiation damage. The recent availability of ultrashort pulses from X-ray Free Electron Lasers (X-FELs) has now provided a mean to outrun the damage. Here we report on measurements performed at the LCLS X-FEL on bacteriorhodopsin 2D crystals mounted on a solid support and kept at room temperature. By merg- ing data from about a dozen of single crystalmore » diffraction images, we unambiguously identified the diffraction peaks to a resolution of 7 °A, thus improving the observable resolution with respect to that achievable from a single pattern alone. This indicates that a larger dataset will allow for reliable quantification of peak intensities, and in turn a corresponding increase of resolution. The presented results pave the way to further X-FEL studies on 2D crystals, which may include pump-probe experiments at subpicosecond time resolution.« less

  8. Crystal engineering: co-crystals of cinnamic acid derivatives with a pyridyl derivative co-crystallizer.

    PubMed

    Lorenzo, Daniel A; Forrest, Sebastian J K; Sparkes, Hazel A

    2016-02-01

    A number of hydrogen-bonded co-crystals, consisting of a cinnamic acid derivative and a pyridyl co-crystallizer, have been synthesized and their properties investigated by X-ray diffraction. Samples were prepared by recrystallization or solvent drop grinding of trans-cinnamic acid (1), 4-methylcinnamic acid (2), 4-methoxy cinnamic acid (3) or 3,4-methoxy cinnamic acid (4), with 4,4-dipyridyl (A), iso-nicotinamide (B) or nicotinamide (C). The X-ray single-crystal structures of seven novel co-crystals, obtained through recrystallization, are examined and the hydrogen-bonding interactions discussed. Consistent hydrogen-bonding motifs were observed for samples prepared when using 4,4-dipyridyl (A) or iso-nicotinamide (B) as the co-crystallizing agent. Powder X-ray diffraction analysis of the samples prepared by solvent drop grinding suggests the formation of ten co-crystals.

  9. Characterization of calcium crystals in Abelia using x-ray diffraction and electron microscopes

    USDA-ARS?s Scientific Manuscript database

    Localization, chemical composition, and morphology of calcium crystals in leaves and stems of Abelia mosanensis and A. ×grandiflora were analyzed with a variable pressure scanning electron microscope (VP-SEM) equipped with an X-ray diffraction system, low temperature SEM (LT-SEM) and a transmission ...

  10. Using Two-Dimensional Colloidal Crystals to Understand Crystallography

    ERIC Educational Resources Information Center

    Bosse, Stephanie A.; Loening, Nikolaus M.

    2008-01-01

    X-ray crystallography is an essential technique for modern chemistry and biochemistry, but it is infrequently encountered by undergraduate students owing to lack of access to equipment, the time-scale for generating diffraction-quality molecular crystals, and the level of mathematics involved in analyzing the resulting diffraction patterns.…

  11. The Influence of Surface Morphology and Diffraction Resolution of Canavalin Crystals

    NASA Technical Reports Server (NTRS)

    Plomp, M.; Thomas, B. R.; Day, J. S.; McPherson, A.; Chernov, A. A.; Malkin, A.

    2003-01-01

    Canavalin crystals grown from material purified and not purified by High Performance Liquid Chromatography were studied by atomic force microscopy and x-ray diffraction. After purification, resolution was improved from 2.55Angstroms to 2.22Angstroms and jagged isotropic spiral steps transformed into regular, well polygonized steps.

  12. Dislocation, crystallite size distribution and lattice strain of magnesium oxide nanoparticles

    NASA Astrophysics Data System (ADS)

    Sutapa, I. W.; Wahid Wahab, Abdul; Taba, P.; Nafie, N. L.

    2018-03-01

    The oxide of magnesium nanoparticles synthesized using sol-gel method and analysis of the structural properties was conducted. The functional groups of nanoparticles has been analysed by Fourier Transform Infrared Spectroscopy (FT-IR). Dislocations, average size of crystal, strain, stress, the energy density of crystal, crystallite size distribution and morphologies of the crystals were determined based on X-ray diffraction profile analysis. The morphological of the crystal was analysed based on the image resulted from SEM analysis. The crystallite size distribution was calculated with the contention that the particle size has a normal logarithmic form. The most orientations of crystal were determined based on the textural crystal from diffraction data of X-ray diffraction profile analysis. FT-IR results showed the stretching vibration mode of the Mg-O-Mg in the range of 400.11-525 cm-1 as a broad band. The average size crystal of nanoparticles resulted is 9.21 mm with dislocation value of crystal is 0.012 nm-2. The strains, stress, the energy density of crystal are 1.5 x 10-4 37.31 MPa; 0.72 MPa respectively. The highest texture coefficient value of the crystal is 0.98. This result is supported by morphological analysis using SEM which shows most of the regular cubic-shaped crystals. The synthesis method is suitable for simple and cost-effective synthesis model of MgO nanoparticles.

  13. Single-drop optimization of protein crystallization.

    PubMed

    Meyer, Arne; Dierks, Karsten; Hilterhaus, Dierk; Klupsch, Thomas; Mühlig, Peter; Kleesiek, Jens; Schöpflin, Robert; Einspahr, Howard; Hilgenfeld, Rolf; Betzel, Christian

    2012-08-01

    A completely new crystal-growth device has been developed that permits charting a course across the phase diagram to produce crystalline samples optimized for diffraction experiments. The utility of the device is demonstrated for the production of crystals for the traditional X-ray diffraction data-collection experiment, of microcrystals optimal for data-collection experiments at a modern microbeam insertion-device synchrotron beamline and of nanocrystals required for data collection on an X-ray laser beamline.

  14. Discovery of a metastable Al20Sm4 phase

    NASA Astrophysics Data System (ADS)

    Ye, Z.; Zhang, F.; Sun, Y.; Mendelev, M. I.; Ott, R. T.; Park, E.; Besser, M. F.; Kramer, M. J.; Ding, Z.; Wang, C.-Z.; Ho, K.-M.

    2015-03-01

    We present an efficient genetic algorithm, integrated with experimental diffraction data, to solve a nanoscale metastable Al20Sm4 phase that evolves during crystallization of an amorphous magnetron sputtered Al90Sm10 alloy. The excellent match between calculated and experimental X-ray diffraction patterns confirms an accurate description of this metastable phase. Molecular dynamic simulations of crystal growth from the liquid phase predict the formation of disordered defects in the devitrified crystal.

  15. Crystallization screening test for the whole-cell project on Thermus thermophilus HB8

    PubMed Central

    Iino, Hitoshi; Naitow, Hisashi; Nakamura, Yuki; Nakagawa, Noriko; Agari, Yoshihiro; Kanagawa, Mayumi; Ebihara, Akio; Shinkai, Akeo; Sugahara, Mitsuaki; Miyano, Masashi; Kamiya, Nobuo; Yokoyama, Shigeyuki; Hirotsu, Ken; Kuramitsu, Seiki

    2008-01-01

    It was essential for the structural genomics of Thermus thermophilus HB8 to efficiently crystallize a number of proteins. To this end, three conventional robots, an HTS-80 (sitting-drop vapour diffusion), a Crystal Finder (hanging-drop vapour diffusion) and a TERA (modified microbatch) robot, were subjected to a crystallization condition screening test involving 18 proteins from T. thermophilus HB8. In addition, a TOPAZ (microfluidic free-interface diffusion) designed specifically for initial screening was also briefly examined. The number of diffraction-quality crystals and the time of appearance of crystals increased in the order HTS-80, Crystal Finder, TERA. With the HTS-80 and Crystal Finder, the time of appearance was short and the rate of salt crystallization was low. With the TERA, the number of diffraction-quality crystals was high, while the time of appearance was long and the rate of salt crystallization was relatively high. For the protein samples exhibiting low crystallization success rates, there were few crystallization conditions that were common to the robots used. In some cases, the success rate depended greatly on the robot used. The TOPAZ showed the shortest time of appearance and the highest success rate, although the crystals obtained were too small for diffraction studies. These results showed that the combined use of different robots significantly increases the chance of obtaining crystals, especially for proteins exhibiting low crystallization success rates. The structures of 360 of 944 purified proteins have been successfully determined through the combined use of an HTS-80 and a TERA. PMID:18540056

  16. Gelator-doped liquid-crystal phase grating with multistable and dynamic modes

    NASA Astrophysics Data System (ADS)

    Lin, Hui-Chi; Yang, Meng-Ru; Tsai, Sheng-Feng; Yan, Shih-Chiang

    2014-01-01

    We demonstrate a gelator-doped nematic liquid-crystal (LC) phase grating, which can be operated in both the multistable mode and the dynamic mode. Thermoreversible association and dissociation of the gelator molecules can vary and fix the multistable diffraction efficiencies of the gratings. A voltage (V) can also be applied to modulate dynamically the diffraction efficiencies of the grating, which behaves as a conventional LC grating. Experimental results show that the variations of the diffraction efficiencies in the multistable and dynamic modes are similar. The maximum diffraction efficiency is approximately 30% at V = 2 V.

  17. Gelator-doped liquid-crystal phase grating with multistable and dynamic modes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, Hui-Chi, E-mail: huichilin@nfu.edu.tw; Yang, Meng-Ru; Tsai, Sheng-Feng

    2014-01-06

    We demonstrate a gelator-doped nematic liquid-crystal (LC) phase grating, which can be operated in both the multistable mode and the dynamic mode. Thermoreversible association and dissociation of the gelator molecules can vary and fix the multistable diffraction efficiencies of the gratings. A voltage (V) can also be applied to modulate dynamically the diffraction efficiencies of the grating, which behaves as a conventional LC grating. Experimental results show that the variations of the diffraction efficiencies in the multistable and dynamic modes are similar. The maximum diffraction efficiency is approximately 30% at V = 2 V.

  18. Ultra-fast switching blue phase liquid crystals diffraction grating stabilized by chiral monomer

    NASA Astrophysics Data System (ADS)

    Manda, Ramesh; Pagidi, Srinivas; Sarathi Bhattacharya, Surjya; Yoo, Hyesun; T, Arun Kumar; Lim, Young Jin; Lee, Seung Hee

    2018-05-01

    We have demonstrated an ultra-fast switching and efficient polymer stabilized blue phase liquid crystal (PS-BPLC) diffraction grating utilizing a chiral monomer. We have obtained a 0.5 ms response time by a novel polymer stabilization method which is three times faster than conventional PS-BPLC. In addition, the diffraction efficiency was improved 2% with a much wider phase range and the driving voltage to switch the device is reduced. The polarization properties of the diffracted beam are unaffected by this novel polymer stabilization. This device can be useful for future photonic applications.

  19. X-ray Microscopic Characterization of Protein Crystals

    NASA Technical Reports Server (NTRS)

    Hu, Z. W.; Holmes, A.; Thomas, B.R.; Chernov, a. A.; Chu, Y. S.; Lai, B.

    2004-01-01

    The microscopic mapping of the variation in degree of perfection and in type of defects in entire protein crystals by x-rays may well be a prerequisite for better understanding causes of lattice imperfections, the growth history, and properties of protein crystals. However, x-ray microscopic characterization of bulk protein crystals, in the as-grown state, is frequently more challenging than that of small molecular crystals due to the experimental difficulties arising largely from the unique features possessed by protein crystals. In this presentation, we will illustrate ssme recent activities in employing coherence-based phase contrast x-ray imaging and high-angular-resolution diffraction techniques for mapping microdefects and the degree of perfection of protein crystals, and demonstrate a correlation between crystal perfection, diffraction phenomena., and crystallization conditions. The observed features and phenomena will be discussed in context to gain insight into the nature of defects, nucleation and growth, and the properties of protein crystals.

  20. Macromolecule Crystal Quality Improvement in Microgravity: The Role of Impurities

    NASA Technical Reports Server (NTRS)

    Judge, Russell A.; Snell, Edward H.; Pusey, Marc L.; Sportiello, Michael G.; Todd, Paul; Bellamy, Henry; Borgstahl, Gloria E.; Pokros, Matt; Cassanto, John M.

    2000-01-01

    While macromolecule impurities may affect crystal size and morphology the over-riding question is; "How do macromolecule impurities effect crystal X-ray quality and diffraction resolution?" In the case of chicken egg white lysozyme, crystals can be grown in the presence of a number of impurities without affecting diffraction resolution. One impurity however, the lysozyme dimer, does negatively impact the X-ray crystal properties. Crystal quality improvement as a result of better partitioning of this impurity during crystallization in microgravity has been reported'. In our recent experimental work dimer partitioning was found to be not significantly different between the two environments. Mosaicity analysis of pure crystals showed a reduced mosaicity and increased signal to noise for the microgravity grown crystals. Dimer incorporation however, did greatly reduce the resolution limit in both ground and microgravity grown crystals. These results indicate that impurity effects in microgravity are complex and may rely on the conditions or techniques employed.

  1. Crystal structure determination of new antimitotic agent bis(p-fluorobenzyl)trisulfide.

    PubMed

    An, Haoyun; Hu, Xiurong; Gu, Jianming; Chen, Linshen; Xu, Weiming; Mo, Xiaopeng; Xu, Wanhong; Wang, Xiaobo; Xu, Xiao

    2008-01-01

    The purpose of this research was to investigate the physical characteristics and crystalline structure of bis(p-fluorobenzyl)trisulfide, a new anti-tumor agent. Methods used included X-ray single crystal diffraction, X-ray powder diffraction (XRPD), Fourier-transform infrared (FT-IR) spectroscopy, differential scanning calorimetric (DSC) and thermogravimetric (TG) analyses. The findings obtained with X-ray single crystal diffraction showed that a monoclinic unit cell was a = 12.266(1) A, b = 4.7757(4) A, c = 25.510(1) A, beta = 104.25(1) degrees ; cell volume = 1,448.4(2) A(3), Z = 4, and space group C2/c. The XRPD studies of the four crystalline samples, obtained by recrystallization from four different solvents, indicated that they had the same diffraction patterns. The diffraction pattern stimulated from the crystal structure data is in excellent agreement with the experimental results. In addition, the identical FT-IR spectra of the four crystalline samples revealed absorption bands corresponding to S-S and C-S stretching as well as the characteristic aromatic substitution. Five percent weight loss at 163.3 degrees C was observed when TG was used to study the decomposition process in the temperature range of 20-200 degrees C. DSC also allowed for the determination of onset temperatures at 60.4(1)-60.7(3) degrees C and peak temperatures at 62.1(3)-62.4(3) degrees C for the four crystalline samples studied. The results verified that the single crystal structure shared the same crystal form with the four crystalline samples investigated.

  2. Photonic crystal borax competitive binding carbohydrate sensing motif†

    PubMed Central

    Cui, Qingzhou; Muscatello, Michelle M. Ward; Asher, Sanford A.

    2009-01-01

    We developed a photonic crystal sensing method for diol containing species such as carbohydrates based on a poly(vinyl alcohol) (PVA) hydrogel containing an embedded crystalline colloidal array (CCA). The polymerized CCA (PCCA) diffracts visible light. We show that in the presence of borax the diffraction wavelength shifts as the concentration of glucose changes. The diffraction shifts result from the competitive binding of glucose to borate, which reduces the concentration of borate bound to the PVA diols. PMID:19381378

  3. Investigation of Renal Stones by X-ray and Neutron Diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baeva, M.; Boianova, A.; Beskrovnyi, A. I.

    2007-04-23

    Renal stones were investigated by X-ray diffraction. The obtained results showed only one crystal phase in every sample. With the aim to verify eventual availability of second phase (under 3 volume %) the same renal stones were investigated by neutron diffraction. The neutron spectra proved that additional crystal phase was absent in the renal stones. The obtained results are scientific-practical, in aid of the medicine, especially in the case of renal stone disease.

  4. One-Dimensional Photonic Crystal Superprisms

    NASA Technical Reports Server (NTRS)

    Ting, David

    2005-01-01

    Theoretical calculations indicate that it should be possible for one-dimensional (1D) photonic crystals (see figure) to exhibit giant dispersions known as the superprism effect. Previously, three-dimensional (3D) photonic crystal superprisms have demonstrated strong wavelength dispersion - about 500 times that of conventional prisms and diffraction gratings. Unlike diffraction gratings, superprisms do not exhibit zero-order transmission or higher-order diffraction, thereby eliminating cross-talk problems. However, the fabrication of these 3D photonic crystals requires complex electron-beam substrate patterning and multilayer thin-film sputtering processes. The proposed 1D superprism is much simpler in structural complexity and, therefore, easier to design and fabricate. Like their 3D counterparts, the 1D superprisms can exhibit giant dispersions over small spectral bands that can be tailored by judicious structure design and tuned by varying incident beam direction. Potential applications include miniature gas-sensing devices.

  5. Preliminary small-angle X-ray scattering and X-ray diffraction studies of the BTB domain of lola protein from Drosophila melanogaster

    NASA Astrophysics Data System (ADS)

    Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Dorovatovskii, P. V.; Popov, V. O.

    2017-11-01

    The Drosophila genome has several dozens of transcription factors (TTK group) containing BTB domains assembled into octamers. The LOLA protein belongs to this family. The purification, crystallization, and preliminary X-ray diffraction and small-angle X-ray scattering (SAXS) studies of the BTB domain of this protein are reported. The crystallization conditions were found by the vapor-diffusion technique. A very low diffraction resolution (8.7 Å resolution) of the crystals was insufficient for the determination of the threedimensional structure of the BTB domain. The SAXS study demonstrated that the BTB domain of the LOLA protein exists as an octamer in solution.

  6. Liquid crystal devices especially for use in liquid crystal point diffraction interferometer systems

    NASA Technical Reports Server (NTRS)

    Marshall, Kenneth L. (Inventor)

    2009-01-01

    Liquid crystal point diffraction interferometer (LCPDI) systems that can provide real-time, phase-shifting interferograms that are useful in the characterization of static optical properties (wavefront aberrations, lensing, or wedge) in optical elements or dynamic, time-resolved events (temperature fluctuations and gradients, motion) in physical systems use improved LCPDI cells that employ a "structured" substrate or substrates in which the structural features are produced by thin film deposition or photo resist processing to provide a diffractive element that is an integral part of the cell substrate(s). The LC material used in the device may be doped with a "contrast-compensated" mixture of positive and negative dichroic dyes.

  7. Liquid crystal devices especially for use in liquid crystal point diffraction interferometer systems

    DOEpatents

    Marshall, Kenneth L [Rochester, NY

    2009-02-17

    Liquid crystal point diffraction interferometer (LCPDI) systems that can provide real-time, phase-shifting interferograms that are useful in the characterization of static optical properties (wavefront aberrations, lensing, or wedge) in optical elements or dynamic, time-resolved events (temperature fluctuations and gradients, motion) in physical systems use improved LCPDI cells that employ a "structured" substrate or substrates in which the structural features are produced by thin film deposition or photo resist processing to provide a diffractive element that is an integral part of the cell substrate(s). The LC material used in the device may be doped with a "contrast-compensated" mixture of positive and negative dichroic dyes.

  8. Beam-splitter switches based on zenithal bistable liquid-crystal gratings.

    PubMed

    Zografopoulos, Dimitrios C; Beccherelli, Romeo; Kriezis, Emmanouil E

    2014-10-01

    The tunable optical diffractive properties of zenithal bistable nematic liquid-crystal gratings are theoretically investigated. The liquid-crystal orientation is rigorously solved via a tensorial formulation of the Landau-de Gennes theory and the optical transmission properties of the gratings are investigated via full-wave finite-element frequency-domain simulations. It is demonstrated that by proper design the two stable states of the grating can provide nondiffracting and diffracting operation, the latter with equal power splitting among different diffraction orders. An electro-optic switching mechanism, based on dual-frequency nematic materials, and its temporal dynamics are further discussed. Such gratings provide a solution towards tunable beam-steering and beam-splitting components with extremely low power consumption.

  9. Three-dimensional Bragg coherent diffraction imaging of an extended ZnO crystal.

    PubMed

    Huang, Xiaojing; Harder, Ross; Leake, Steven; Clark, Jesse; Robinson, Ian

    2012-08-01

    A complex three-dimensional quantitative image of an extended zinc oxide (ZnO) crystal has been obtained using Bragg coherent diffraction imaging integrated with ptychography. By scanning a 2.5 µm-long arm of a ZnO tetrapod across a 1.3 µm X-ray beam with fine step sizes while measuring a three-dimensional diffraction pattern at each scan spot, the three-dimensional electron density and projected displacement field of the entire crystal were recovered. The simultaneously reconstructed complex wavefront of the illumination combined with its coherence properties determined by a partial coherence analysis implemented in the reconstruction process provide a comprehensive characterization of the incident X-ray beam.

  10. Deterministic Bragg Coherent Diffraction Imaging.

    PubMed

    Pavlov, Konstantin M; Punegov, Vasily I; Morgan, Kaye S; Schmalz, Gerd; Paganin, David M

    2017-04-25

    A deterministic variant of Bragg Coherent Diffraction Imaging is introduced in its kinematical approximation, for X-ray scattering from an imperfect crystal whose imperfections span no more than half of the volume of the crystal. This approach provides a unique analytical reconstruction of the object's structure factor and displacement fields from the 3D diffracted intensity distribution centred around any particular reciprocal lattice vector. The simple closed-form reconstruction algorithm, which requires only one multiplication and one Fourier transformation, is not restricted by assumptions of smallness of the displacement field. The algorithm performs well in simulations incorporating a variety of conditions, including both realistic levels of noise and departures from ideality in the reference (i.e. imperfection-free) part of the crystal.

  11. Crystallization and preliminary X-ray diffraction analysis of a novel sphingomyelinase D from Loxosceles gaucho venom.

    PubMed

    Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy

    2014-10-01

    Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å.

  12. Crystallization and preliminary X-ray diffraction analysis of a novel sphingomyelinase D from Loxosceles gaucho venom

    PubMed Central

    Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy

    2014-01-01

    Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å. PMID:25286953

  13. Studies on the growth, structural, optical, mechanical properties of 8-hydroxyquinoline single crystal by vertical Bridgman technique

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prabhakaran, SP.; Babu, R. Ramesh, E-mail: rampap2k@yahoo.co.in; Velusamy, P.

    2011-11-15

    Highlights: {yields} Growth of bulk single crystal of 8-hydroxyquinoline (8-HQ) by vertical Bridgman technique for the first time. {yields} The crystalline perfection is reasonably good. {yields} The photoluminescence spectrum shows that the material is suitable for blue light emission. -- Abstract: Single crystal of organic nonlinear optical material, 8-hydroxyquinoline (8-HQ) of dimension 52 mm (length) x 12 mm (dia.) was grown from melt using vertical Bridgman technique. The crystal system of the material was confirmed by powder X-ray diffraction analysis. The crystalline perfection of the grown crystal was examined by high-resolution X-ray diffraction study. Low angular spread around 400'' ofmore » the diffraction curve and the low full width half maximum values show that the crystalline perfection is reasonably good. The recorded photoluminescence spectrum shows that the material is suitable for blue light emission. Optical transmittance for the UV and visible region was measured and mechanical strength was estimated from Vicker's microhardness test along the growth face of the grown crystal.« less

  14. A multi-step strategy to obtain crystals of the dengue virus RNA-dependent RNA polymerase that diffract to high resolution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yap, Thai Leong; School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive, Singapore 637551; Chen, Yen Liang

    Crystals of the RNA-dependent RNA polymerase catalytic domain from the dengue virus NS5 protein have been obtained using a strategy that included expression screening of naturally occurring serotype variants of the protein, the addition of divalent metal ions and crystal dehydration. These crystals diffract to 1.85 Å resolution and are thus suitable for a structure-based drug-design program. Dengue virus, a member of the Flaviviridae genus, causes dengue fever, an important emerging disease with several million infections occurring annually for which no effective therapy exists. The viral RNA-dependent RNA polymerase NS5 plays an important role in virus replication and represents anmore » interesting target for the development of specific antiviral compounds. Crystals that diffract to 1.85 Å resolution that are suitable for three-dimensional structure determination and thus for a structure-based drug-design program have been obtained using a strategy that included expression screening of naturally occurring serotype variants of the protein, the addition of divalent metal ions and crystal dehydration.« less

  15. Supercritical carbon dioxide treatment as a method for polymorph preparation of deoxycholic acid.

    PubMed

    Tozuka, Yuichi; Kawada, Dai; Oguchi, Toshio; Yamamoto, Keiji

    2003-09-16

    A new polymorph of deoxycholic acid (DCA) was formed by using a supercritical carbon dioxide treatment. Deoxycholic acid crystals were stored in a pressure vessel purged with carbon dioxide at 12MPa, 60 degrees C for definite intervals. After storage for 1h in supercritical carbon dioxide (SC-CO2), new X-ray diffraction (XRD) peaks, not found in the bulk DCA crystal, were observed at 2theta = 7.4 degrees, 9.7 degrees and 14.0 degrees. The intensities of the new diffraction peaks increased with an increase in storage time, whereas the intensities of the diffraction peaks due to bulk DCA crystal decreased. On the DSC curves, the crystals obtained showed an exothermic peak at around 155 degrees C followed by the melting peak of bulk DCA crystal at 175 degrees C. By the temperature-controlled powder XRD measurement, the crystals obtained were found to be a metastable form of DCA. The polymorphs of DCA have not been reported; therefore, the SC-CO2 treatment would be a peculiar method to obtain a DCA polymorph.

  16. A new method to evaluate the quality of single crystal Cu by an X-ray diffraction butterfly pattern method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu Zhenming; Guo Zhenqi; Li Jianguo

    2004-12-15

    A new method for the evaluation of the quality of an Ohno continuous cast (OCC) Cu single crystal by X-ray diffraction (XRD) butterfly pattern was brought forward. Experimental results show that the growth direction of single crystal Cu is inclined from both sides of the single crystal Cu rod to the axis and is axially symmetric. The degree of deviation from the [100] orientation from the crystal axis is less than 5 deg. with a casting speed 10-40 mm/min. The orientation of single crystal Cu does not have a fixed direction but is in a regular range. Moreover, the orientationmore » of stray grains in the single crystal Cu is random from continuous casting.« less

  17. Microseed matrix screening for optimization in protein crystallization: what have we learned?

    PubMed

    D'Arcy, Allan; Bergfors, Terese; Cowan-Jacob, Sandra W; Marsh, May

    2014-09-01

    Protein crystals obtained in initial screens typically require optimization before they are of X-ray diffraction quality. Seeding is one such optimization method. In classical seeding experiments, the seed crystals are put into new, albeit similar, conditions. The past decade has seen the emergence of an alternative seeding strategy: microseed matrix screening (MMS). In this strategy, the seed crystals are transferred into conditions unrelated to the seed source. Examples of MMS applications from in-house projects and the literature include the generation of multiple crystal forms and different space groups, better diffracting crystals and crystallization of previously uncrystallizable targets. MMS can be implemented robotically, making it a viable option for drug-discovery programs. In conclusion, MMS is a simple, time- and cost-efficient optimization method that is applicable to many recalcitrant crystallization problems.

  18. Microseed matrix screening for optimization in protein crystallization: what have we learned?

    PubMed Central

    D’Arcy, Allan; Bergfors, Terese; Cowan-Jacob, Sandra W.; Marsh, May

    2014-01-01

    Protein crystals obtained in initial screens typically require optimization before they are of X-ray diffraction quality. Seeding is one such optimization method. In classical seeding experiments, the seed crystals are put into new, albeit similar, conditions. The past decade has seen the emergence of an alternative seeding strategy: microseed matrix screening (MMS). In this strategy, the seed crystals are transferred into conditions unrelated to the seed source. Examples of MMS applications from in-house projects and the literature include the generation of multiple crystal forms and different space groups, better diffracting crystals and crystallization of previously uncrystallizable targets. MMS can be implemented robotically, making it a viable option for drug-discovery programs. In conclusion, MMS is a simple, time- and cost-efficient optimization method that is applicable to many recalcitrant crystallization problems. PMID:25195878

  19. X-ray evaluation of crystals for stellar spectrometers

    NASA Technical Reports Server (NTRS)

    Alexandropolos, N. G. (Editor)

    1974-01-01

    The report consists of three parts. The first part is an analysis of the principles involved in X-ray crystal evaluation and how they are applied to a number of crystals. The principles of crystal evaluation analysis as they apply to the special problems of X-ray astronomy are presented. A number of crystals were evaluated, and the energy dependence of the diffraction properties of (002) PET, (111) Ge, (101) ADP, (001) KAP, and (001) RAP are reported. The second part is a compilation of the diffraction properties of a number of crystals as reported by other authors. In the third part some technical details of a triple crystal spectrometer built by the author at Polytechnic Institute of Brooklyn are given. This spectrometer seems to be a most appropriate instrument for evaluation of crystal properties. (Modified author abstract)

  20. Structural and optical properties of WTe2 single crystals synthesized by DVT technique

    NASA Astrophysics Data System (ADS)

    Dixit, Vijay; Vyas, Chirag; Pathak, V. M.; Soalanki, G. K.; Patel, K. D.

    2018-05-01

    Layered transition metal di-chalcogenide (LTMDCs) crystals have attracted much attention due to their potential in optoelectronic device applications recently due to realization of their monolayer based structures. In the present investigation we report growth of WTe2 single crystals by direct vapor transport (DVT) technique. These crystals are then characterized by energy dispersive analysis of x-rays (EDAX) to study stoichiometric composition after growth. The structural properties are studied by x-ray diffraction (XRD) and selected area electron diffraction (SAED) is used to confirm orthorhombic structure of grown WTe2 crystal. Surface morphological properties of the crystals are also studied by scanning electron microscope (SEM). The optical properties of the grown crystals are studied by UV-Visible spectroscopy which gives direct band gap of 1.44 eV for grown WTe2 single crystals.

  1. Additional evidence from x-ray powder diffraction patterns that icosahedral quasi-crystals of intermetallic compounds are twinned cubic crystals

    PubMed Central

    Pauling, Linus

    1988-01-01

    Analysis of the measured values of Q for the weak peaks (small maxima, usually considered to be background fluctuations, “noise”) on the x-ray powder diffraction curves for 17 rapidly quenched alloys leads directly to the conclusion that they are formed by an 820-atom or 1012-atom primitive cubic structure that by icosahedral twinning produces the so-called icosahedral quasi-crystals. PMID:16593948

  2. Crystallization and preliminary X-ray crystallographic analysis of the heterodimeric crotoxin complex and the isolated subunits crotapotin and phospholipase A{sub 2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santos, K. F.; Murakami, M. T.; Cintra, A. C. O.

    2007-04-01

    Crotoxin, a potent neurotoxin from the venom of the South American rattlesnake Crotalus durissus terrificus, exists as a heterodimer formed between a phospholipase A{sub 2} and a catalytically inactive acidic phospholipase A{sub 2} analogue (crotapotin). Large single crystals of the crotoxin complex and of the isolated subunits have been obtained. Crotoxin, a potent neurotoxin from the venom of the South American rattlesnake Crotalus durissus terrificus, exists as a heterodimer formed between a phospholipase A{sub 2} and a catalytically inactive acidic phospholipase A{sub 2} analogue (crotapotin). Large single crystals of the crotoxin complex and of the isolated subunits have been obtained.more » The crotoxin complex crystal belongs to the orthorhombic space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 38.2, b = 68.7, c = 84.2 Å, and diffracted to 1.75 Å resolution. The crystal of the phospholipase A{sub 2} domain belongs to the hexagonal space group P6{sub 1}22 (or its enantiomorph P6{sub 5}22), with unit-cell parameters a = b = 38.7, c = 286.7 Å, and diffracted to 2.6 Å resolution. The crotapotin crystal diffracted to 2.3 Å resolution; however, the highly diffuse diffraction pattern did not permit unambiguous assignment of the unit-cell parameters.« less

  3. Large-scale purification and crystallization of the endoribonuclease XendoU: troubleshooting with His-tagged proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Renzi, Fabiana; Panetta, Gianna; Vallone, Beatrice

    Recombinant His-tagged XendoU, a eukaryotic endoribonuclease, appeared to aggregate in the presence of divalent cations. Monodisperse protein which yielded crystals diffracting to 2.2 Å was obtained by addition of EDTA. XendoU is the first endoribonuclease described in higher eukaryotes as being involved in the endonucleolytic processing of intron-encoded small nucleolar RNAs. It is conserved among eukaryotes and its viral homologue is essential in SARS replication and transcription. The large-scale purification and crystallization of recombinant XendoU are reported. The tendency of the recombinant enzyme to aggregate could be reversed upon the addition of chelating agents (EDTA, imidazole): aggregation is a potentialmore » drawback when purifying and crystallizing His-tagged proteins, which are widely used, especially in high-throughput structural studies. Purified monodisperse XendoU crystallized in two different space groups: trigonal P3{sub 1}21, diffracting to low resolution, and monoclinic C2, diffracting to higher resolution.« less

  4. Laboratory multiple-crystal X-ray topography and reciprocal-space mapping of protein crystals: influence of impurities on crystal perfection

    NASA Technical Reports Server (NTRS)

    Hu, Z. W.; Thomas, B. R.; Chernov, A. A.

    2001-01-01

    Double-axis multiple-crystal X-ray topography, rocking-curve measurements and triple-axis reciprocal-space mapping have been combined to characterize protein crystals using a laboratory source. Crystals of lysozyme and lysozyme crystals doped with acetylated lysozyme impurities were examined. It was shown that the incorporation of acetylated lysozyme into crystals of lysozyme induces mosaic domains that are responsible for the broadening and/or splitting of rocking curves and diffraction-space maps along the direction normal to the reciprocal-lattice vector, while the overall elastic lattice strain of the impurity-doped crystals does not appear to be appreciable in high angular resolution reciprocal-space maps. Multiple-crystal monochromatic X-ray topography, which is highly sensitive to lattice distortions, was used to reveal the spatial distribution of mosaic domains in crystals which correlates with the diffraction features in reciprocal space. Discussions of the influence of acetylated lysozyme on crystal perfection are given in terms of our observations.

  5. Laboratory multiple-crystal X-ray topography and reciprocal-space mapping of protein crystals: influence of impurities on crystal perfection.

    PubMed

    Hu, Z W; Thomas, B R; Chernov, A A

    2001-06-01

    Double-axis multiple-crystal X-ray topography, rocking-curve measurements and triple-axis reciprocal-space mapping have been combined to characterize protein crystals using a laboratory source. Crystals of lysozyme and lysozyme crystals doped with acetylated lysozyme impurities were examined. It was shown that the incorporation of acetylated lysozyme into crystals of lysozyme induces mosaic domains that are responsible for the broadening and/or splitting of rocking curves and diffraction-space maps along the direction normal to the reciprocal-lattice vector, while the overall elastic lattice strain of the impurity-doped crystals does not appear to be appreciable in high angular resolution reciprocal-space maps. Multiple-crystal monochromatic X-ray topography, which is highly sensitive to lattice distortions, was used to reveal the spatial distribution of mosaic domains in crystals which correlates with the diffraction features in reciprocal space. Discussions of the influence of acetylated lysozyme on crystal perfection are given in terms of our observations.

  6. The plug-based nanovolume Microcapillary Protein Crystallization System (MPCS)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gerdts, Cory J.; Elliott, Mark; Lovell, Scott

    2012-02-08

    The Microcapillary Protein Crystallization System (MPCS) embodies a new semi-automated plug-based crystallization technology which enables nanolitre-volume screening of crystallization conditions in a plasticware format that allows crystals to be easily removed for traditional cryoprotection and X-ray diffraction data collection. Protein crystals grown in these plastic devices can be directly subjected to in situ X-ray diffraction studies. The MPCS integrates the formulation of crystallization cocktails with the preparation of the crystallization experiments. Within microfluidic Teflon tubing or the microfluidic circuitry of a plastic CrystalCard, {approx}10-20 nl volume droplets are generated, each representing a microbatch-style crystallization experiment with a different chemical composition.more » The entire protein sample is utilized in crystallization experiments. Sparse-matrix screening and chemical gradient screening can be combined in one comprehensive 'hybrid' crystallization trial. The technology lends itself well to optimization by high-granularity gradient screening using optimization reagents such as precipitation agents, ligands or cryoprotectants.« less

  7. Studies on 2-amino-5-nitropyridinium nitrate (2A5NPN): A semi-organic third order nonlinear optical single crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sivasubramani, V.; Pandian, Muthu Senthil, E-mail: senthilpandianm@ssn.edu.in; Ramasamy, P.

    2016-05-23

    2-amino-5-nitropyridinium nitrate (2A5NPN) is a semi-organic nonlinear optical crystal and optically good quality 2A5NPN single crystals were successfully grown by slow evaporation solution growth technique (SEST) at ambient temperature. The crystallographic structure of the grown crystal was determined by single crystal X-Ray diffraction analysis and it belongs to Monoclinic crystal system with centro symmetric crystalline nature. The crystallinity of the grown crystal was confirmed by powder X-ray diffraction analysis. The other physical properties of grown crystals are also characterized using TG-DTA, UV-Visible NIR, chemical etching, photoconductivity and Z-scan measurements. The Z-scan method reveals that the 2A5NPN crystal possesses multi photonmore » absorption behaviour and the significantly higher third order susceptibility and it is a promising potential NLO material.« less

  8. Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi

    Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 Mmore » sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.« less

  9. An evaluation of adhesive sample holders for advanced crystallographic experiments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mazzorana, Marco; Sanchez-Weatherby, Juan, E-mail: juan.sanchez-weatherby@diamond.ac.uk; Sandy, James

    Commercially available adhesives have been evaluated for crystal mounting when undertaking complex macromolecular crystallography experiments. Here, their use as tools for advanced sample mounting and cryoprotection is assessed and their suitability for room-temperature data-collection and humidity-controlled studies is investigated. The hydration state of macromolecular crystals often affects their overall order and, ultimately, the quality of the X-ray diffraction pattern that they produce. Post-crystallization techniques that alter the solvent content of a crystal may induce rearrangement within the three-dimensional array making up the crystal, possibly resulting in more ordered packing. The hydration state of a crystal can be manipulated by exposingmore » it to a stream of air at controlled relative humidity in which the crystal can equilibrate. This approach provides a way of exploring crystal hydration space to assess the diffraction capabilities of existing crystals. A key requirement of these experiments is to expose the crystal directly to the dehydrating environment by having the minimum amount of residual mother liquor around it. This is usually achieved by placing the crystal on a flat porous support (Kapton mesh) and removing excess liquid by wicking. Here, an alternative approach is considered whereby crystals are harvested using adhesives that capture naked crystals directly from their crystallization drop, reducing the process to a one-step procedure. The impact of using adhesives to ease the harvesting of different types of crystals is presented together with their contribution to background scattering and their usefulness in dehydration experiments. It is concluded that adhesive supports represent a valuable tool for mounting macromolecular crystals to be used in humidity-controlled experiments and to improve signal-to-noise ratios in diffraction experiments, and how they can protect crystals from modifications in the sample environment is discussed.« less

  10. Growth and properties of benzil doped benzimidazole (BMZ) single crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Babu, R. Ramesh, E-mail: rampap2k@yahoo.co.in; Crystal Growth and Crystallography Section, National Physical Laboratory, Krishnan Marg, New Delhi 110 012; Sukumar, M.

    2010-09-15

    In the present work, we have made an attempt to study the effect of benzil doping on the properties of benzimidazole single crystals. For this purpose we have grown pure and benzil doped benzimidazole single crystals by vertical Bridgman technique. The grown crystals were characterized by various characterization techniques. The presence of dopants confirmed by powder X-ray diffraction (XRD). Crystalline perfection of the grown crystals has been analysed by high-resolution X-ray diffraction (HRXRD). The transmittance, electrical property and mechanical strength have been analysed using UV-vis-NIR spectroscopic, dielectric and Vicker's hardness studies. The relative second harmonic generation efficiency of pure andmore » doped benzimidazole crystals measured using Kurtz powder test.« less

  11. Crystallization, optimization and preliminary X-ray characterization of a metal-dependent PI-PLC from Streptomyces antibioticus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jackson, Michael R.; Selby, Thomas L.

    2012-10-30

    A recombinant metal-dependent phosphatidylinositol-specific phospholipase C (PI-PLC) fromStreptomyces antibioticushas been crystallized by the hanging-drop method with and without heavy metals. The native crystals belonged to the orthorhombic space groupP222, with unit-cell parametersa= 41.26,b= 51.86,c = 154.78 Å. The X-ray diffraction results showed significant differences in the crystal quality of samples soaked with heavy atoms. Additionally, drop pinning, which increases the surface area of the drops, was also used to improve crystal growth and quality. The combination of heavy-metal soaks and drop pinning was found to be critical for producing high-quality crystals that diffracted to 1.23 Å resolution.

  12. The use of a mini-κ goniometer head in macromolecular crystallography diffraction experiments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brockhauser, Sandor; UJF–EMBL–CNRS UMI 3265, 6 Rue Jules Horowitz, 38043 Grenoble; Ravelli, Raimond B. G.

    2013-07-01

    Hardware and software solutions for MX data-collection strategies using the EMBL/ESRF miniaturized multi-axis goniometer head are presented. Most macromolecular crystallography (MX) diffraction experiments at synchrotrons use a single-axis goniometer. This markedly contrasts with small-molecule crystallography, in which the majority of the diffraction data are collected using multi-axis goniometers. A novel miniaturized κ-goniometer head, the MK3, has been developed to allow macromolecular crystals to be aligned. It is available on the majority of the structural biology beamlines at the ESRF, as well as elsewhere. In addition, the Strategy for the Alignment of Crystals (STAC) software package has been developed to facilitatemore » the use of the MK3 and other similar devices. Use of the MK3 and STAC is streamlined by their incorporation into online analysis tools such as EDNA. The current use of STAC and MK3 on the MX beamlines at the ESRF is discussed. It is shown that the alignment of macromolecular crystals can result in improved diffraction data quality compared with data obtained from randomly aligned crystals.« less

  13. Structures of Astromaterials Revealed by EBSD

    NASA Technical Reports Server (NTRS)

    Zolensky, M.

    2018-01-01

    Groups at the Johnson Space Center and the University of Tokyo have been using electron back-scattered diffraction (EBSD) to reveal the crystal structures of extraterrestrial minerals for many years. Even though we also routinely use transmission electron microscopy, synchrotron X-ray diffraction (SXRD), and conventional electron diffraction, we find that EBSD is the most powerful technique for crystal structure elucidation in many instances. In this talk I describe a few of the cases where we have found EBSD to provide crucial, unique information. See attachment.

  14. Optical pendulum effect in one-dimensional diffraction-thick porous silicon based photonic crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Novikov, V. B., E-mail: vb.novikov@physics.msu.ru; Svyakhovskiy, S. E.; Maydykovskiy, A. I.

    We present the realization of the multiperiodic optical pendulum effect in 1D porous silicon photonic crystals (PhCs) under dynamical Bragg diffraction in the Laue scheme. The diffraction-thick PhC contained 360 spatial periods with a large variation of the refractive index of adjacent layers of 0.4. The experiments reveal switching of the light leaving the PhC between the two spatial directions, which correspond to Laue diffraction maxima, as the fundamental wavelength or polarization of the incident light is varied. A similar effect can be achieved when the temperature of the sample or the intensity of the additional laser beam illuminating themore » crystal are changed. We show that in our PhC structures, the spectral period of the pendulum effect is down to 5 nm, while the thermal period is about 10 °C.« less

  15. Antibacterial activity of a 7,10-dihydroxy-8(E)-octadecenoic acid against food-bourne pathogenic bacteria

    USDA-ARS?s Scientific Manuscript database

    Microbial conversion of the natural unsaturated fatty acids often generate polyhydroxy fatty acids rendering them to have new properties such as higher viscosity and reactivity. A bacterial strain Pseudomonas aeruginosa (PR3) has been intensively studied to produce a novel 7,10-dihydroxy-8(E)-octad...

  16. 78 FR 2954 - South Atlantic Fishery Management Council (Council)-Public Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-15

    ... Air Force Museum, 175 Bourne Avenue, Pooler, GA 31322; phone: 912/748-8888. 2. January 23, 2013: Hilton Garden Inn, 5265 International Blvd., N. Charleston, SC 29418; phone: 843/308-9330. 3. January 24, 2013: New Bern Riverfront Convention Center, 203 South Front Street, New Bern, NC 28563; phone: 252/637...

  17. 76 FR 71374 - Joseph Giacchino, M.D.; Decision and Order

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-17

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration [Docket No. 10-54] Joseph Giacchino, M.D.; Decision and Order On July 9, 2010, Administrative Law Judge (ALJ) Timothy D. Wing, issued the attached... prevail. See, e.g., Bourne Pharmacy, 72 FR 18,273, 18,274 (2007); Agostino Carlucci, M.D., 49 FR 33,184...

  18. Crystallization and preliminary X-ray diffraction analysis of the wild-type haloalkane dehalogenase DhaA and its variant DhaA13 complexed with different ligands.

    PubMed

    Stsiapanava, Alena; Chaloupkova, Radka; Fortova, Andrea; Brynda, Jiri; Weiss, Manfred S; Damborsky, Jiri; Smatanova, Ivana Kuta

    2011-02-01

    Haloalkane dehalogenases make up an important class of hydrolytic enzymes which catalyse the cleavage of carbon-halogen bonds in halogenated aliphatic compounds. There is growing interest in these enzymes owing to their potential use in environmental and industrial applications. The haloalkane dehalogenase DhaA from Rhodococcus rhodochrous NCIMB 13064 can slowly detoxify the industrial pollutant 1,2,3-trichloropropane (TCP). Structural analysis of this enzyme complexed with target ligands was conducted in order to obtain detailed information about the structural limitations of its catalytic properties. In this study, the crystallization and preliminary X-ray analysis of complexes of wild-type DhaA with 2-propanol and with TCP and of complexes of the catalytically inactive variant DhaA13 with the dye coumarin and with TCP are described. The crystals of wild-type DhaA were plate-shaped and belonged to the triclinic space group P1, while the variant DhaA13 can form prism-shaped crystals belonging to the orthorhombic space group P2(1)2(1)2(1) as well as plate-shaped crystals belonging to the triclinic space group P1. Diffraction data for crystals of wild-type DhaA grown from crystallization solutions with different concentrations of 2-propanol were collected to 1.70 and 1.26 Å resolution, respectively. A prism-shaped crystal of DhaA13 complexed with TCP and a plate-shaped crystal of the same variant complexed with the dye coumarin diffracted X-rays to 1.60 and 1.33 Å resolution, respectively. A crystal of wild-type DhaA and a plate-shaped crystal of DhaA13, both complexed with TCP, diffracted to atomic resolutions of 1.04 and 0.97 Å, respectively.

  19. Indexing amyloid peptide diffraction from serial femtosecond crystallography: new algorithms for sparse patterns

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brewster, Aaron S.; Sawaya, Michael R.; University of California, Los Angeles, CA 90095-1570

    2015-02-01

    Special methods are required to interpret sparse diffraction patterns collected from peptide crystals at X-ray free-electron lasers. Bragg spots can be indexed from composite-image powder rings, with crystal orientations then deduced from a very limited number of spot positions. Still diffraction patterns from peptide nanocrystals with small unit cells are challenging to index using conventional methods owing to the limited number of spots and the lack of crystal orientation information for individual images. New indexing algorithms have been developed as part of the Computational Crystallography Toolbox (cctbx) to overcome these challenges. Accurate unit-cell information derived from an aggregate data setmore » from thousands of diffraction patterns can be used to determine a crystal orientation matrix for individual images with as few as five reflections. These algorithms are potentially applicable not only to amyloid peptides but also to any set of diffraction patterns with sparse properties, such as low-resolution virus structures or high-throughput screening of still images captured by raster-scanning at synchrotron sources. As a proof of concept for this technique, successful integration of X-ray free-electron laser (XFEL) data to 2.5 Å resolution for the amyloid segment GNNQQNY from the Sup35 yeast prion is presented.« less

  20. Ab initio structure determination from prion nanocrystals at atomic resolution by MicroED

    PubMed Central

    Sawaya, Michael R.; Rodriguez, Jose; Cascio, Duilio; Collazo, Michael J.; Shi, Dan; Reyes, Francis E.; Gonen, Tamir; Eisenberg, David S.

    2016-01-01

    Electrons, because of their strong interaction with matter, produce high-resolution diffraction patterns from tiny 3D crystals only a few hundred nanometers thick in a frozen-hydrated state. This discovery offers the prospect of facile structure determination of complex biological macromolecules, which cannot be coaxed to form crystals large enough for conventional crystallography or cannot easily be produced in sufficient quantities. Two potential obstacles stand in the way. The first is a phenomenon known as dynamical scattering, in which multiple scattering events scramble the recorded electron diffraction intensities so that they are no longer informative of the crystallized molecule. The second obstacle is the lack of a proven means of de novo phase determination, as is required if the molecule crystallized is insufficiently similar to one that has been previously determined. We show with four structures of the amyloid core of the Sup35 prion protein that, if the diffraction resolution is high enough, sufficiently accurate phases can be obtained by direct methods with the cryo-EM method microelectron diffraction (MicroED), just as in X-ray diffraction. The success of these four experiments dispels the concern that dynamical scattering is an obstacle to ab initio phasing by MicroED and suggests that structures of novel macromolecules can also be determined by direct methods. PMID:27647903

  1. Crystallization and preliminary X-ray studies of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hou, Jing; Li, Ming; Chen, Jiashu

    Crystals of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of A. acutus have been obtained and characterized by X-ray diffraction. A non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus has been crystallized by the hanging-drop method. The crystals belong to space group P3{sub 1}21, with unit-cell parameters a = b = 80.57, c = 66.77 Å and one molecule in the asymmetric unit. X-ray diffraction data were collected to 1.86 Å resolution.

  2. Crystallization and diffraction analysis of [beta]-N-acetylhexosaminidase from Aspergillus oryzae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vanek, Ondrej; Brynd, Jirí; Hofbauerová, Katerina

    2012-05-08

    Fungal {beta}-N-acetylhexosaminidases are enzymes that are used in the chemoenzymatic synthesis of biologically interesting oligosaccharides. The enzyme from Aspergillus oryzae was produced and purified from its natural source and crystallized using the hanging-drop vapor-diffusion method. Diffraction data from two crystal forms (primitive monoclinic and primitive tetragonal) were collected to resolutions of 3.2 and 2.4 {angstrom}, respectively. Electrophoretic and quantitative N-terminal protein-sequencing analyses confirmed that the crystals are formed by a complete biologically active enzyme consisting of a glycosylated catalytic unit and a noncovalently attached propeptide.

  3. Purification, crystallization and preliminary X-ray crystallographic studies of Rv3705c from Mycobacterium tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Feifei; Gao, Feng; Li, Honglin

    The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of Rv3705c from M. tuberculosis are described. The conserved protein Rv3705c from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The Rv3705c crystals exhibited space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 198.0, c = 364.1 Å, α = β = 90, γ = 120°, and diffracted to a resolution of 3.3 Å.

  4. Preparation of crystals for characterizing the Grb7 SH2 domain before and after complex formation with a bicyclic peptide antagonist.

    PubMed

    Ambaye, Nigus D; Gunzburg, Menachem J; Traore, Daouda A K; Del Borgo, Mark P; Perlmutter, Patrick; Wilce, Matthew C J; Wilce, Jacqueline A

    2014-02-01

    Human growth factor receptor-bound protein 7 (Grb7) is an adapter protein involved in cell growth, migration and proliferation. It is now recognized that Grb7 is an emerging therapeutic target in specific cancer subtypes. Recently, the discovery of a bicyclic peptide inhibitor that targets the Grb7 SH2 domain, named G7-B1, was reported. In an attempt to probe the foundation of its interaction with Grb7, the crystallization and preliminary data collection of both the apo and G7-B1-bound forms of the Grb7 SH2 domain are reported here. Diffraction-quality crystals were obtained using the hanging-drop vapour-diffusion method. After several rounds of microseeding, crystals of the apo Grb7 SH2 domain were obtained that diffracted to 1.8 Å resolution, while those of the G7-B1-Grb7 SH2 domain complex diffracted to 2.2 Å resolution. The apo Grb7 SH2 domain crystallized in the trigonal space group P63, whereas the G7-B1-Grb7 SH2 domain complex crystallized in the monoclinic space group P21. The experimental aspects of crystallization, crystal optimization and data collection and the preliminary data are reported.

  5. Colloidal crystal growth monitored by Bragg diffraction interference fringes.

    PubMed

    Bohn, Justin J; Tikhonov, Alexander; Asher, Sanford A

    2010-10-15

    We monitored the crystal growth kinetics of crystallization of a shear melted crystalline colloidal array (CCA). The fcc CCA heterogeneously nucleates at the flow cell wall surface. We examined the evolution of the (1 1 1) Bragg diffraction peak, and, for the first time, quantitatively monitored growth by measuring the temporal evolution of the Bragg diffraction interference fringes. Modeling of the evolution of the fringe patterns exposes the time dependence of the increasing crystal thickness. The initial diffusion-driven linear growth is followed by ripening-driven growth. Between 80 and 90 microM NaCl concentrations the fcc crystals first linearly grow at rates between 1.9 and 4.2 microm/s until they contact homogeneously nucleated crystals in the bulk. At lower salt concentrations interference fringes are not visible because the strong electrostatic interactions between particles result in high activation barriers, preventing defect annealing and leading to a lower crystal quality. The fcc crystals melt to a liquid phase at >90 microM NaCl concentrations. Increasing NaCl concentrations slow the fcc CCA growth rate consistent with the expectation of the classical Wilson-Frenkel growth theory. The final thickness of wall-nucleated CCA, that is determined by the competition between growth of heterogeneously and homogenously nucleated CCA, increases with higher NaCl concentrations. Copyright 2010 Elsevier Inc. All rights reserved.

  6. Crystallization, X-ray diffraction analysis and SIRAS/molecular-replacenent phasing of three crystal forms of Anabaena sensory rhodopsin transducer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vogeley, Lutz; Luecke, Hartmut, E-mail: hudel@uci.edu

    2006-04-01

    Crystals of Anabaena sensory rhodopsin transducer, the transducer for the cyanobacterial photosensor Anabaena sensory rhodopsin, obtained in the space groups P4, C2 and P2{sub 1}2{sub 1}2{sub 1} diffract to 1.8, 2.1 and 2.0 Å, respectively. Phases for these crystal forms were obtained by SIRAS phasing using an iodide quick-soak derivative (P4) and molecular replacement (C2 and P2{sub 1}2{sub 1}2{sub 1}). Anabaena sensory rhodopsin transducer (ASRT) is a 14.7 kDa soluble signaling protein associated with the membrane-embedded light receptor Anabaena sensory rhodopsin (ASR) from Anabaena sp., a freshwater cyanobacterium. Crystals of ASRT were obtained in three different space groups, P4, C2more » and P2{sub 1}2{sub 1}2{sub 1}, which diffract to 1.8, 2.1 and 2.0 Å, respectively. Phases for one of these crystal forms (P4) were obtained by SIRAS phasing using an iodide quick-soak derivative and a partial model was built. Phases for the remaining crystal forms were obtained by molecular replacement using the partial model from the P4 crystal form.« less

  7. A preliminary neutron diffraction study of rasburicase, a recombinant urate oxidase enzyme, complexed with 8-azaxanthin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Budayova-Spano, Monika, E-mail: spano@embl-grenoble.fr; Institut Laue-Langevin, 6 Rue Jules Horowitz, BP 156, 38042 Grenoble; Bonneté, Françoise

    2006-03-01

    Neutron diffraction data of hydrogenated recombinant urate oxidase enzyme (Rasburicase), complexed with a purine-type inhibitor 8-azaxanthin, was collected to 2.1 Å resolution from a crystal grown in D{sub 2}O by careful control and optimization of crystallization conditions via knowledge of the phase diagram. Deuterium atoms were clearly seen in the neutron-scattering density map. Crystallization and preliminary neutron diffraction measurements of rasburicase, a recombinant urate oxidase enzyme expressed by a genetically modified Saccharomyces cerevisiae strain, complexed with a purine-type inhibitor (8-azaxanthin) are reported. Neutron Laue diffraction data were collected to 2.1 Å resolution using the LADI instrument from a crystal (grownmore » in D{sub 2}O) with volume 1.8 mm{sup 3}. The aim of this neutron diffraction study is to determine the protonation states of the inhibitor and residues within the active site. This will lead to improved comprehension of the enzymatic mechanism of this important enzyme, which is used as a protein drug to reduce toxic uric acid accumulation during chemotherapy. This paper illustrates the high quality of the neutron diffraction data collected, which are suitable for high-resolution structural analysis. In comparison with other neutron protein crystallography studies to date in which a hydrogenated protein has been used, the volume of the crystal was relatively small and yet the data still extend to high resolution. Furthermore, urate oxidase has one of the largest primitive unit-cell volumes (space group I222, unit-cell parameters a = 80, b = 96, c = 106 Å) and molecular weights (135 kDa for the homotetramer) so far successfully studied with neutrons.« less

  8. A Test of Macromolecular Crystallization in Microgravity: Large, Well-Ordered Insulin Crystals

    NASA Technical Reports Server (NTRS)

    Borgstahl, Gloria E. O.; Vahedi-Faridi, Ardeschir; Lovelace, Jeff; Bellamy, Henry D.; Snell, Edward H.; Whitaker, Ann F. (Technical Monitor)

    2001-01-01

    Crystals of insulin grown in microgravity on space shuttle mission STS-95 were extremely well-ordered and unusually large (many > 2 mm). The physical characteristics of six microgravity and six earth-grown crystals were examined by X-ray analysis employing superfine f slicing and unfocused synchrotron radiation. This experimental setup allowed hundreds of reflections to be precisely examined for each crystal in a short period of time. The microgravity crystals were on average 34 times larger, had 7 times lower mosaicity, had 54 times higher reflection peak heights and diffracted to significantly higher resolution than their earth grown counterparts. A single mosaic domain model could account for reflections in microgravity crystals whereas reflections from earth crystals required a model with multiple mosaic domains. This statistically significant and unbiased characterization indicates that the microgravity environment was useful for the improvement of crystal growth and resultant diffraction quality in insulin crystals and may be similarly useful for macromolecular crystals in general.

  9. Study of structural and optical properties of YAG and Nd:YAG single crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kostić, S.; Lazarević, Z.Ž., E-mail: lzorica@yahoo.com; Radojević, V.

    2015-03-15

    Highlights: • Transparent YAG and pale pink Nd:YAG single crystals were produced by the Czochralski technique. • Growth mechanisms and shape of the liquid/solid interface and incorporation of Nd{sup 3+} were studied. • The structure of the crystals was investigated by X-ray diffraction, Raman and IR spectroscopy. • The 15 Raman and 17 IR modes were observed. • The obtained YAG and Nd:YAG single crystals were without core and of good optical quality. - Abstract: Yttrium aluminum garnet (YAG, Y{sub 3}Al{sub 5}O{sub 12}) and yttrium aluminum garnet doped with neodymium (Nd:YAG) single crystals were grown by the Czochralski technique. Themore » critical diameter and the critical rate of rotation were calculated. Suitable polishing and etching solutions were determined. As a result of our experiments, the transparent YAG and pale pink Nd:YAG single crystals were produced. The obtained crystals were studied by X-ray diffraction, Raman and IR spectroscopy. The crystal structure was confirmed by XRD. The 15 Raman and 17 IR modes were observed. The Raman and IR spectroscopy results are in accordance with X-ray diffraction analysis. The obtained YAG and Nd:YAG single crystals were without core and of good optical quality. The absence of a core was confirmed by viewing polished crystal slices. Also, it is important to emphasize that the obtained Nd:YAG single crystal has a concentration of 0.8 wt.% Nd{sup 3+} that is characteristic for laser materials.« less

  10. Racemic & quasi-racemic protein crystallography enabled by chemical protein synthesis.

    PubMed

    Kent, Stephen Bh

    2018-04-04

    A racemic protein mixture can be used to form centrosymmetric crystals for structure determination by X-ray diffraction. Both the unnatural d-protein and the corresponding natural l-protein are made by total chemical synthesis based on native chemical ligation-chemoselective condensation of unprotected synthetic peptide segments. Racemic protein crystallography is important for structure determination of the many natural protein molecules that are refractory to crystallization. Racemic mixtures facilitate the crystallization of recalcitrant proteins, and give diffraction-quality crystals. Quasi-racemic crystallization, using a single d-protein molecule, can facilitate the determination of the structures of a series of l-protein analog molecules. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Isolation, purification, crystallization, and preliminary X-ray diffraction study of the crystals of HU protein from M. gallisepticum

    NASA Astrophysics Data System (ADS)

    Nikolaeva, A. Yu.; Timofeev, V. I.; Boiko, K. M.; Korzhenevskii, D. A.; Rakitina, T. V.; Dorovatovskii, P. V.; Lipkin, A. V.

    2015-11-01

    HU proteins are involved in bacterial DNA and RNA repair. Since these proteins are absent in cells of higher organisms, inhibitors of HU proteins can be used as effective and safe antibiotics. The crystallization conditions for the M. gallisepticum HU protein were found and optimized by the vapor-diffusion method. The X-ray diffraction data set was collected to 2.91 Å resolution from the crystals grown by the vapor-diffusion method on a synchrotron source. The crystals of the HU protein belong to sp. gr. P41212 and have the following unit-cell parameters: a = b = 97.94 Å, c = 77.92 Å, α = β = γ = 90°.

  12. Curved crystals for high-resolution focusing of X and gamma rays through a Laue lens

    NASA Astrophysics Data System (ADS)

    Guidi, Vincenzo; Bellucci, Valerio; Camattari, Riccardo; Neri, Ilaria

    2013-08-01

    Crystals with curved diffracting planes have been investigated as high-efficiency optical components for the realization of a Laue lens for satellite-borne experiments in astrophysics. At Sensor and Semiconductor Laboratory (Ferrara, Italy) a research and development plan to implement Si and Ge curved crystals by surface grooving technique has been undertaken. The method of surface grooving allows obtaining Si and Ge curved crystals with self-standing curvature, i.e., with no need for external bending device, which is a mandatory issue in satellite-borne experiments. Si and Ge grooved crystals have been characterized by X-ray diffraction at ESRF and ILL to prove their functionality for a high-reflectivity Laue lens.

  13. Free-falling Crystals: Biological Macromolecular Crystal Growth Studies in Low Earth Orbit

    NASA Technical Reports Server (NTRS)

    Judge, Russell A.; Snell, E. H.; Pusey, M. L.; Whitaker, Ann F. (Technical Monitor)

    2001-01-01

    Spacecraft orbiting the earth experience a reduced acceleration environment due to being in a state of continuous free-fall. This state colloquially termed microgravity, has produced improved X-ray diffraction quality crystals of biological macromolecules. Improvements in X-ray diffraction resolution (detail) or signal to noise, provide greater detail in the three-dimensional molecular structure providing information about the molecule, how it works, how to improve its function or how to impede it. Greater molecular detail obtained by crystallization in microgravity, has important implications for structural biology. In this article we examine the theories behind macromolecule crystal quality improvement in microgravity using results obtained from studies with the model protein, chicken egg white lysozyme.

  14. Growth of high quality and large-sized Rb 0.3MoO 3 single crystals by molten salt electrolysis method

    NASA Astrophysics Data System (ADS)

    Wang, Junfeng; Xiong, Rui; Yi, Fan; Yin, Di; Ke, Manzhu; Li, Changzhen; Liu, Zhengyou; Shi, Jing

    2005-05-01

    High quality and large-sized Rb 0.3MoO 3 single crystals were synthesized by molten salt electrolysis method. X-ray diffraction (XRD) patterns and rocking curves, as well as the white beam Laue diffraction of X-ray images show the crystals grown by this method have high quality. The lattice constants evaluated from XRD patterns are a0=1.87 nm, b0=0.75 nm, c0=1.00 nm, β=118.83∘. The in situ selected area electron diffraction (SAED) patterns along the [101¯], [11¯1¯] and [103¯] zone axes at room temperature indicate that the Rb 0.3MoO 3 crystal possess perfect C-centered symmetry. Temperature dependence of the resistivity shows this compound undergoes a metal to semiconductor transition at 183 K.

  15. In-situ data collection at the photon factory macromolecular crystallography beamlines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yamada, Yusuke, E-mail: yusuke.yamada@kek.jp; Matsugaki, Naohiro; Kato, Ryuichi

    Crystallization trial is one of the most important but time-consuming steps in macromolecular crystallography, and in-situ diffraction experiment has a capability to make researchers to proceed this step more efficiently. At the Photon Factory, a new tabletop diffractometer for in-situ diffraction experiments has been developed. It consists of XYZ translation stages with a plate handler, an on-axis viewing system and a plate rack with a capacity for ten crystallization plates. These components sit on a common plate and are able to be placed on the existing diffractometer table. The CCD detector with a large active area and a pixel arraymore » detector with a small active area are used for acquiring diffraction images from crystals. Dedicated control software and a user interface have also been developed. The new diffractometer has been operational for users and used for evaluation of crystallization screening since 2014.« less

  16. Applications of the diffraction and interference of light and electronic waves

    NASA Astrophysics Data System (ADS)

    Bahrim, Cristian; Lanning, Robert

    2010-10-01

    As part of a NSF sponsored program, called STAIRSTEP, at Lamar University we work on improving the basic knowledge of our physics majors in topics with broader impact in various areas of science and engineering [1]. The purpose is to facilitate a deeper understanding of some fundamental concepts in the field of optics through hands-on experience [2]. We choose to study the interference/diffraction of light and matter waves, because of its fundamental importance in physics with many applications. We target multiple goals in our field of study such as to understand the formation of electronic waves (wave packets) and their interaction with atoms in crystals (electron diffraction); the Fourier analysis of light with applications in spectroscopy, etc. We can show that a crystal lattice Fourier transforms the sinusoidal waves associated to free electrons fired toward the crystal. Our studies led to a simple and instructive recipe for discovering the arrangement of atoms in crystals from the analysis of the diffraction patterns produced by radiation or by electrons transmitted through crystals. [1] Doerschuk P. et al., 39th ASEE/IEEE Frontiers in Education Conference, San Antonio 2009, M3F-1. [2] Bahrim C, Innovation 2006 -- World Innovations in Engineering Education and Research, Chapter 17, iNEER Innovation Series, ISBN 0-9741252-5-3.

  17. Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of the VP8* carbohydrate-binding protein of the human rotavirus strain Wa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kraschnefski, Mark J.; Scott, Stacy A.; Holloway, Gavan

    2005-11-01

    The carbohydrate-binding component (VP8*{sub 64–223}) of the human Wa rotavirus spike protein has been overexpressed in E. coli, purified and crystallized in two different crystal forms. X-ray diffraction data have been collected that have enabled determination of the Wa VP8*{sub 64–223} structure by molecular replacement. Rotaviruses exhibit host-specificity and the first crystallographic information on a rotavirus strain that infects humans is reported here. Recognition and attachment to host cells, leading to invasion and infection, is critically linked to the function of the outer capsid spike protein of the rotavirus particle. In some strains the VP8* component of the spike proteinmore » is implicated in recognition and binding of sialic-acid-containing cell-surface carbohydrates, thereby enabling infection by the virus. The cloning, expression, purification, crystallization and initial X-ray diffraction analysis of the VP8* core from human Wa rotavirus is reported. Two crystal forms (trigonal P3{sub 2}21 and monoclinic P2{sub 1}) have been obtained and X-ray diffraction data have been collected, enabling determination of the VP8*{sub 64–223} structure by molecular replacement.« less

  18. Femtosecond X-ray protein nanocrystallography.

    PubMed

    Chapman, Henry N; Fromme, Petra; Barty, Anton; White, Thomas A; Kirian, Richard A; Aquila, Andrew; Hunter, Mark S; Schulz, Joachim; DePonte, Daniel P; Weierstall, Uwe; Doak, R Bruce; Maia, Filipe R N C; Martin, Andrew V; Schlichting, Ilme; Lomb, Lukas; Coppola, Nicola; Shoeman, Robert L; Epp, Sascha W; Hartmann, Robert; Rolles, Daniel; Rudenko, Artem; Foucar, Lutz; Kimmel, Nils; Weidenspointner, Georg; Holl, Peter; Liang, Mengning; Barthelmess, Miriam; Caleman, Carl; Boutet, Sébastien; Bogan, Michael J; Krzywinski, Jacek; Bostedt, Christoph; Bajt, Saša; Gumprecht, Lars; Rudek, Benedikt; Erk, Benjamin; Schmidt, Carlo; Hömke, André; Reich, Christian; Pietschner, Daniel; Strüder, Lothar; Hauser, Günter; Gorke, Hubert; Ullrich, Joachim; Herrmann, Sven; Schaller, Gerhard; Schopper, Florian; Soltau, Heike; Kühnel, Kai-Uwe; Messerschmidt, Marc; Bozek, John D; Hau-Riege, Stefan P; Frank, Matthias; Hampton, Christina Y; Sierra, Raymond G; Starodub, Dmitri; Williams, Garth J; Hajdu, Janos; Timneanu, Nicusor; Seibert, M Marvin; Andreasson, Jakob; Rocker, Andrea; Jönsson, Olof; Svenda, Martin; Stern, Stephan; Nass, Karol; Andritschke, Robert; Schröter, Claus-Dieter; Krasniqi, Faton; Bott, Mario; Schmidt, Kevin E; Wang, Xiaoyu; Grotjohann, Ingo; Holton, James M; Barends, Thomas R M; Neutze, Richard; Marchesini, Stefano; Fromme, Raimund; Schorb, Sebastian; Rupp, Daniela; Adolph, Marcus; Gorkhover, Tais; Andersson, Inger; Hirsemann, Helmut; Potdevin, Guillaume; Graafsma, Heinz; Nilsson, Björn; Spence, John C H

    2011-02-03

    X-ray crystallography provides the vast majority of macromolecular structures, but the success of the method relies on growing crystals of sufficient size. In conventional measurements, the necessary increase in X-ray dose to record data from crystals that are too small leads to extensive damage before a diffraction signal can be recorded. It is particularly challenging to obtain large, well-diffracting crystals of membrane proteins, for which fewer than 300 unique structures have been determined despite their importance in all living cells. Here we present a method for structure determination where single-crystal X-ray diffraction 'snapshots' are collected from a fully hydrated stream of nanocrystals using femtosecond pulses from a hard-X-ray free-electron laser, the Linac Coherent Light Source. We prove this concept with nanocrystals of photosystem I, one of the largest membrane protein complexes. More than 3,000,000 diffraction patterns were collected in this study, and a three-dimensional data set was assembled from individual photosystem I nanocrystals (∼200 nm to 2 μm in size). We mitigate the problem of radiation damage in crystallography by using pulses briefer than the timescale of most damage processes. This offers a new approach to structure determination of macromolecules that do not yield crystals of sufficient size for studies using conventional radiation sources or are particularly sensitive to radiation damage.

  19. The molecular and crystal structure of dextrans: a combined electron and X-ray diffraction study. II. A low temperature, hydrated polymorph.

    PubMed

    Guizard, C; Chanzy, H; Sarko, A

    1985-06-05

    The crystal and molecular structure of a dextran hydrate has been determined through combined electron and X-ray diffraction analysis, aided by stereochemical model refinement. A total of 65 hk0 electron diffraction intensities were measured on frozen single crystals held at the temperature of liquid nitrogen, to a resolution limit of 1.6 A. The X-ray intensities were measured from powder patterns recorded from collections of the single crystals. The structure crystallizes in a monoclinic unit cell with parameters a = 25.71 A, b = 10.21 A, c (chain axis) = 7.76 A and beta = 91.3 degrees. The space group is P2(1) with b axis unique. The unit cell contains six chains and eight water molecules, with three chains of the same polarity and four water molecules constituting the asymmetric unit. Along the chain direction the asymmetric unit is a dimer residue; however, the individual glucopyranose residues are very nearly related by a molecular 2-fold screw axis. The conformation of the chain is very similar to that in the anhydrous structure, but the chain packing differs in the two structures in that the rotational positions of the chains about the helix axes (the chain setting angles) are considerably different. The chains still pack in the form of sheets that are separated by water molecules. The difference in the chain setting angles between the anhydrous and hydrate structures corresponds to the angle between like unit cell axes observed in the diffraction diagrams recorded from hybrid crystals containing both polymorphs. Despite some beam damage effects, the structure was determined to a satisfactory degree of agreement, with the residuals R''(electron diffraction) = 0.258 and R(X-ray) = 0.127.

  20. Growth of single crystalline delafossite LaCuO2 by the travelling-solvent floating zone method

    NASA Astrophysics Data System (ADS)

    Mohan, A.; Büchner, B.; Wurmehl, S.; Hess, C.

    2014-09-01

    Single crystals of LaCuO2 have been grown for the first time using the travelling-solvent floating zone method. The crystal was grown in an Ar-atmosphere by reduction of La2Cu2O5, which was used as the feed rod composition for the growth. The grown crystal has been characterized with regard to phase purity and single crystallinity using powder X-ray diffraction, energy dispersive X-ray analysis, Laue diffraction and scanning electron microscopy.

  1. Diffraction imaging (topography) with monochromatic synchrotron radiation

    NASA Technical Reports Server (NTRS)

    Steiner, Bruce; Kuriyama, Masao; Dobbyn, Ronald C.; Laor, Uri

    1988-01-01

    Structural information of special interest to crystal growers and device physicists is now available from high resolution monochromatic synchrotron diffraction imaging (topography). In the review, the importance of superior resolution in momentum transfer and in space is described, and illustrations are taken from a variety of crystals: gallium arsenide, cadmium telluride, mercuric iodide, bismuth silicon oxide, and lithium niobate. The identification and understanding of local variations in crystal growth processes are shown. Finally, new experimental opportunities now available for exploitation are indicated.

  2. Study of silicon strip waveguides with diffraction gratings and photonic crystals tuned to a wavelength of 1.5 µm

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barabanenkov, M. Yu., E-mail: barab@iptm.ru; Vyatkin, A. F.; Volkov, V. T.

    2015-12-15

    Single-mode submicrometer-thick strip waveguides on silicon-on-insulator substrates, fabricated by silicon-planar-technology methods are considered. To solve the problem of 1.5-µm wavelength radiation input-output and its frequency filtering, strip diffraction gratings and two-dimensional photonic crystals are integrated into waveguides. The reflection and transmission spectra of gratings and photonic crystals are calculated. The waveguide-mode-attenuation coefficient for a polycrystalline silicon waveguide is experimentally estimated.

  3. Crystallographic analysis of ground and space thermostable T1 lipase crystal obtained via counter diffusion method approach.

    PubMed

    Mohamad Aris, Sayangku Nor Ariati; Thean Chor, Adam Leow; Mohamad Ali, Mohd Shukuri; Basri, Mahiran; Salleh, Abu Bakar; Raja Abd Rahman, Raja Noor Zaliha

    2014-01-01

    Three-dimensional structure of thermostable lipase is much sought after nowadays as it is important for industrial application mainly found in the food, detergent, and pharmaceutical sectors. Crystallization utilizing the counter diffusion method in space was performed with the aim to obtain high resolution diffracting crystals with better internal order to improve the accuracy of the structure. Thermostable T1 lipase enzyme has been crystallized in laboratory on earth and also under microgravity condition aboard Progress spacecraft to the ISS in collaboration with JAXA (Japanese Aerospace Exploration Agency). This study is conducted with the aims of improving crystal packing and structure resolution. The diffraction data set for ground grown crystal was collected to 1.3 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.40 Å, b = 80.95 Å, and c = 99.81 Å, whereas the diffraction data set for space grown crystal was collected to 1.1 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.31 Å, b = 80.85 Å, and c = 99.81 Å. The major difference between the two crystal growth systems is the lack of convection and sedimentation in microgravity environment resulted in the growth of much higher quality crystals of T1 lipase.

  4. Improved crystallization of the coxsackievirus B3 RNA-dependent RNA polymerase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jabafi, Ilham; Selisko, Barbara; Coutard, Bruno

    2007-06-01

    The first crystal of a coxsackievirus RNA-dependent RNA polymerase is reported. The Picornaviridae virus family contains a large number of human pathogens such as poliovirus, hepatitis A virus and rhinoviruses. Amongst the viruses belonging to the genus Enterovirus, several serotypes of coxsackievirus coexist for which neither vaccine nor therapy is available. Coxsackievirus B3 is involved in the development of acute myocarditis and dilated cardiomyopathy and is thought to be an important cause of sudden death in young adults. Here, the first crystal of a coxsackievirus RNA-dependent RNA polymerase is reported. Standard crystallization methods yielded crystals that were poorly suited tomore » X-ray diffraction studies, with one axis being completely disordered. Crystallization was improved by testing crystallization solutions from commercial screens as additives. This approach yielded crystals that diffracted to 2.1 Å resolution and that were suitable for structure determination.« less

  5. The MORPHEUS II protein crystallization screen

    PubMed Central

    Gorrec, Fabrice

    2015-01-01

    High-quality macromolecular crystals are a prerequisite for the process of protein structure determination by X-ray diffraction. Unfortunately, the relative yield of diffraction-quality crystals from crystallization experiments is often very low. In this context, innovative crystallization screen formulations are continuously being developed. In the past, MORPHEUS, a screen in which each condition integrates a mix of additives selected from the Protein Data Bank, a cryoprotectant and a buffer system, was developed. Here, MORPHEUS II, a follow-up to the original 96-condition initial screen, is described. Reagents were selected to yield crystals when none might be observed in traditional initial screens. Besides, the screen includes heavy atoms for experimental phasing and small polyols to ensure the cryoprotection of crystals. The suitability of the resulting novel conditions is shown by the crystallization of a broad variety of protein samples and their efficiency is compared with commercially available conditions. PMID:26144227

  6. Polarization-resolved second-harmonic generation microscopy as a method to visualize protein-crystal domains

    PubMed Central

    DeWalt, Emma L.; Begue, Victoria J.; Ronau, Judith A.; Sullivan, Shane Z.; Das, Chittaranjan; Simpson, Garth J.

    2013-01-01

    Polarization-resolved second-harmonic generation (PR-SHG) microscopy is described and applied to identify the presence of multiple crystallographic domains within protein-crystal conglomerates, which was confirmed by synchrotron X-ray diffraction. Principal component analysis (PCA) of PR-SHG images resulted in principal component 2 (PC2) images with areas of contrasting negative and positive values for conglomerated crystals and PC2 images exhibiting uniformly positive or uniformly negative values for single crystals. Qualitative assessment of PC2 images allowed the identification of domains of different internal ordering within protein-crystal samples as well as differentiation between multi-domain conglomerated crystals and single crystals. PR-SHG assessments of crystalline domains were in good agreement with spatially resolved synchrotron X-ray diffraction measurements. These results have implications for improving the productive throughput of protein structure determination through early identification of multi-domain crystals. PMID:23275165

  7. SdsA polymorph isolation and improvement of their crystal quality using nonconventional crystallization techniques

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De la Mora, Eugenio; Flores-Hernández, Edith; Jakoncic, Jean

    SdsA, a sodium dodecyl sulfate hydrolase, from Pseudomonas aeruginosa was crystallized in three different crystal polymorphs and their three-dimensional structure was determined. The different polymorphs present different crystal packing habits. One of the polymorphs suggests the existence of a tetramer, an oligomeric state not observed previously, while the crystal packing of the remaining two polymorphs obstructs the active site entrance but stabilizes flexible regions of the protein. Nonconventional crystallization methods that minimize convection, such as counterdiffusion in polyvinyl alcohol gel coupled with the influence of a 500 MHz (10.2 T) magnetic field, were necessary to isolate the poorest diffracting polymorphmore » and increase its internal order to determine its structure by X-ray diffraction. In conclusion, the results obtained show the effectiveness of nonconventional crystallographic methods to isolate different crystal polymorphs.« less

  8. The MORPHEUS II protein crystallization screen.

    PubMed

    Gorrec, Fabrice

    2015-07-01

    High-quality macromolecular crystals are a prerequisite for the process of protein structure determination by X-ray diffraction. Unfortunately, the relative yield of diffraction-quality crystals from crystallization experiments is often very low. In this context, innovative crystallization screen formulations are continuously being developed. In the past, MORPHEUS, a screen in which each condition integrates a mix of additives selected from the Protein Data Bank, a cryoprotectant and a buffer system, was developed. Here, MORPHEUS II, a follow-up to the original 96-condition initial screen, is described. Reagents were selected to yield crystals when none might be observed in traditional initial screens. Besides, the screen includes heavy atoms for experimental phasing and small polyols to ensure the cryoprotection of crystals. The suitability of the resulting novel conditions is shown by the crystallization of a broad variety of protein samples and their efficiency is compared with commercially available conditions.

  9. Cloning, purification, crystallization and preliminary crystallographic analysis of SecA from Enterococcus faecalis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meining, Winfried, E-mail: wim@csb.ki.se; Scheuring, Johannes; Fischer, Markus

    2006-06-01

    SecA ATPase from E. faecalis has been cloned, overexpressed, purified and crystallized. Crystals belong to space group C2 and diffract to 2.4 Å resolution. The gene coding for SecA from Enterococcus faecalis was cloned and overexpressed in Escherichia coli. In this protein, the lysine at position 6 was replaced by an asparagine in order to reduce sensitivity towards proteases. The modified protein was purified and crystallized. Crystals diffracting to 2.4 Å resolution were obtained using the vapour-diffusion technique. The crystals belong to the monoclinic space group C2, with unit-cell parameters a = 203.4, b = 49.8, c = 100.8 Å,more » α = γ = 90.0, β = 119.1°. A selenomethionine derivative was prepared and is currently being tested in crystallization trials.« less

  10. High spatial resolution X-ray and gamma ray imaging system using diffraction crystals

    DOEpatents

    Smither, Robert K [Hinsdale, IL

    2011-05-17

    A method and a device for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation are provided. The device comprises a plurality of arrays, with each array comprising a plurality of elements comprising a first collimator, a diffracting crystal, a second collimator, and a detector.

  11. Band structure and optical properties of opal photonic crystals

    NASA Astrophysics Data System (ADS)

    Pavarini, E.; Andreani, L. C.; Soci, C.; Galli, M.; Marabelli, F.; Comoretto, D.

    2005-07-01

    A theoretical approach for the interpretation of reflectance spectra of opal photonic crystals with fcc structure and (111) surface orientation is presented. It is based on the calculation of photonic bands and density of states corresponding to a specified angle of incidence in air. The results yield a clear distinction between diffraction in the direction of light propagation by (111) family planes (leading to the formation of a stop band) and diffraction in other directions by higher-order planes (corresponding to the excitation of photonic modes in the crystal). Reflectance measurements on artificial opals made of self-assembled polystyrene spheres are analyzed according to the theoretical scheme and give evidence of diffraction by higher-order crystalline planes in the photonic structure.

  12. Excitation of surface waves on one-dimensional solid–fluid phononic crystals and the beam displacement effect

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moiseyenko, Rayisa P.; Georgia Institute of Technology, UMI Georgia Tech – CNRS, George W. Woodruff School of Mechanical Engineering, Georgia Tech Lorraine, 2 rue Marconi, 57070 Metz-Technopole; Liu, Jingfei

    The possibility of surface wave generation by diffraction of pressure waves on deeply corrugated one-dimensional phononic crystal gratings is studied both theoretically and experimentally. Generation of leaky surface waves, indeed, is generally invoked in the explanation of the beam displacement effect that can be observed upon reflection on a shallow grating of an acoustic beam of finite width. True surface waves of the grating, however, have a dispersion that lies below the sound cone in water. They thus cannot satisfy the phase-matching condition for diffraction from plane waves of infinite extent incident from water. Diffraction measurements indicate that deeply corrugatedmore » one-dimensional phononic crystal gratings defined in a silicon wafer are very efficient diffraction gratings. They also confirm that all propagating waves detected in water follow the grating law. Numerical simulations however reveal that in the sub-diffraction regime, acoustic energy of a beam of finite extent can be transferred to elastic waves guided at the surface of the grating. Their leakage to the specular direction along the grating surface explains the apparent beam displacement effect.« less

  13. Single beam write and/or replay of spatial heterodyne holograms

    DOEpatents

    Thomas, Clarence E.; Hanson, Gregory R.

    2007-11-20

    A method of writing a spatially heterodyne hologram having spatially heterodyne fringes includes: passing a single write beam through a spatial light modulator that digitally modulates said single write beam; and focusing the single write beam at a focal plane of a lens to impose a holographic diffraction grating pattern on the photorefractive crystal, the holographic diffraction grating pattern including the spatially heterodyne hologram having spatially heterodyne fringes, wherein only said single write beam is incident on said photorefractive crystal without a reference beam. A method of replaying a spatially heterodyne hologram having spatially heterodyne fringes at a replay angle includes: illuminating a photorefractive crystal having a holographic diffraction grating with a beam from a laser at an illumination angle, the holographic diffraction grating pattern including the spatially heterodyne hologram having spatially heterodyne fringes, wherein a difference between said illumination angle and said replay angle defines a diffraction angle .alpha. that is a function of a plane wave mathematically added to original object wave phase and amplitude data of said spatially heterodyne hologram having spatially heterodyne fringes.

  14. Crystallization and crystal manipulation of a steric chaperone in complex with its lipase substrate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pauwels, Kris, E-mail: krpauwel@vub.ac.be; Loris, Remy; Vandenbussche, Guy

    2005-08-01

    Crystals of the lipase of B. glumae in complex with its specific foldase were obtained in two forms. Crystallization, crystal manipulation and preliminary X-ray diffraction analysis are described. Bacterial lipases that are secreted via the type II secretion pathway require a lipase-specific foldase in order to obtain their native and biologically active conformation in the periplasmic space. The lipase–foldase complex from Burkholderia glumae (319 and 333 residues, respectively) was crystallized in two crystal forms. One crystal form belongs to space group P3{sub 1}21 (P3{sub 2}21), with unit-cell parameters a = b = 122.3, c = 98.2 Å. A procedure ismore » presented which improved the diffraction of these crystals from ∼5 to 2.95 Å. For the second crystal form, which belonged to space group C2 with unit-cell parameters a = 183.0, b = 75.7, c = 116.6 Å, X-ray data were collected to 1.85 Å.« less

  15. Crystallization and preliminary X-ray analysis of gamma-glutamyltranspeptidase from Escherichia coli K-12.

    PubMed

    Kumagai, H; Nohara, S; Suzuki, H; Hashimoto, W; Yamamoto, K; Sakai, H; Sakabe, K; Fukuyama, K; Sakabe, N

    1993-12-20

    gamma-Glutamyltranspeptidase (EC 2.3.2.2) from Escherichia coli K-12 has been purified and crystallized by means of vapor diffusion in hanging drops. Two kinds of crystals on cell dimensions were found for X-ray diffraction analysis, one from ammonium sulfate and the other from polyethylene glycol 6000 as precipitants. The crystals of the orthorhombic form grown in the presence of 15% polyethylene glycol and 20 mM sodium acetate buffer were chosen for further analysis. The crystals belonged to space group P2(1)2(1)2(1), with cell dimensions of a = 128.1, b = 129.9 and c = 79.2 A, and two molecules constitute an asymmetric unit. These crystals diffracted to 2.0 A resolution and were suitable for X-ray crystallographic studies.

  16. Growth and characterization of Cadmium Thiosemicarbazide Bromide crystals for antibacterial and nonlinear optical applications

    NASA Astrophysics Data System (ADS)

    Thomas Joseph Prakash, J.; Martin Sam Gnanaraj, J.

    2015-01-01

    Semiorganic nonlinear optical crystals of Cadmium Thiosemicarbazide Bromide was grown by slow evaporation solution growth technique. The unit cell parameters were estimated by subjecting the crystals to single crystal X-ray diffraction. The grown crystals were subjected to Powder X-ray diffraction for analyzing the crystalline nature of the sample. FTIR studies reveal the functional groups and the optical characters were analyzed by UV-Vis spectral studies. Mechanical stability of the sample was assessed by Vicker's micro hardness test. The presence of surface dislocations was identified by chemical etching technique. Antibacterial study was carried out against ACDP declared harmful pathogens. SHG efficiency of CTSB crystal was tested using Nd: YAG laser and it was found to be ∼1.8 times that of potassium dihydrogen phosphate.

  17. Synthesis, growth, structural, optical, spectral, thermal and mechanical studies of 4-methoxy 4-nitrostilbene (MONS): a new organic nonlinear optical single crystal.

    PubMed

    Dinakaran, Paul M; Bhagavannarayana, G; Kalainathan, S

    2012-11-01

    4-Methoxy 4-nitrostilbene (MONS), a new organic nonlinear optical material has been synthesized. Based on the solubility data good quality single crystal with dimensions up to 38×11×3 mm(3) has been grown by slow evaporation method using ethyl methyl ketone (MEK) as a solvent. Powder XRD confirms the crystalline property and also the diffraction planes have been indexed. The lattice parameters for the grown MONS crystals were determined by using single crystal X-ray diffraction analysis and it reveals that the crystal lattice system is triclinic. The crystalline perfection of the grown crystals has been analysed by high resolution X-ray diffraction (HRXRD) rocking curve measurements. Fourier transform infrared (FTIR) spectrum for powdered MONS sample confirms the functional groups present in the grown crystal. The UV-vis absorption spectrum has been recorded in the range of 190-1100 nm and the cut off wavelength 499 nm has been determined. The optical constants of MONS have been determined through UV-vis-NIR spectroscopy. The MONS crystals were further subjected to other characterizations. i.e., (1)H NMR, TG/DTA, photoluminescence and microhardness test. The Kurtz and Perry powder technique confirms the NLO property of the grown crystal and the SHG efficiency of MONS was found to be 1.55× greater than that of KDP crystal. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Purification, crystallization and preliminary X-ray diffraction analysis of the kinase domain of human tousled-like kinase 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garrote, Ana M.; Redondo, Pilar; Montoya, Guillermo, E-mail: gmontoya@cnio.es

    2014-02-19

    The C-terminal kinase domain of TLK2 (a human tousled-like kinase) has been cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. Tousled-like kinases (TLKs) are an evolutionarily conserved family of serine/threonine protein kinases involved in chromatin dynamics, including DNA replication and repair, transcription and chromosome segregation. The two members of the family reported in humans, namely TLK1 and TLK2, localize to the cell nucleus and are capable of forming homo- ormore » hetero-oligomers by themselves. To characterize the role of TLK2, its C-terminal kinase domain was cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. The latter produced the best diffracting crystal (3.4 Å resolution using synchrotron radiation), with unit-cell parameters a = b = c = 126.05 Å, α = β = γ = 90°. The asymmetric unit contained one protein molecule, with a Matthews coefficient of 4.59 Å{sup 3} Da{sup −1} and a solvent content of 73.23%.« less

  19. Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.

    2017-01-15

    Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus (T. th HB27) has high thermal stability and shows maximum activity at 75°Ð¡, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample,more » which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.« less

  20. Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

    NASA Astrophysics Data System (ADS)

    Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Sinitsyna, E. V.; Esipov, R. S.; Kuranova, I. P.

    2017-01-01

    Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus ( T. th HB27) has high thermal stability and shows maximum activity at 75°C, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample, which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P21 and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.

  1. A possibility of parallel and anti-parallel diffraction measurements on neu- tron diffractometer employing bent perfect crystal monochromator at the monochromatic focusing condition

    NASA Astrophysics Data System (ADS)

    Choi, Yong Nam; Kim, Shin Ae; Kim, Sung Kyu; Kim, Sung Baek; Lee, Chang-Hee; Mikula, Pavel

    2004-07-01

    In a conventional diffractometer having single monochromator, only one position, parallel position, is used for the diffraction experiment (i.e. detection) because the resolution property of the other one, anti-parallel position, is very poor. However, a bent perfect crystal (BPC) monochromator at monochromatic focusing condition can provide a quite flat and equal resolution property at both parallel and anti-parallel positions and thus one can have a chance to use both sides for the diffraction experiment. From the data of the FWHM and the Delta d/d measured on three diffraction geometries (symmetric, asymmetric compression and asymmetric expansion), we can conclude that the simultaneous diffraction measurement in both parallel and anti-parallel positions can be achieved.

  2. Nanomodulated electron beams via electron diffraction and emittance exchange for coherent x-ray generation

    NASA Astrophysics Data System (ADS)

    Nanni, E. A.; Graves, W. S.; Moncton, D. E.

    2018-01-01

    We present a new method for generation of relativistic electron beams with current modulation on the nanometer scale and below. The current modulation is produced by diffracting relativistic electrons in single crystal Si, accelerating the diffracted beam and imaging the crystal structure, then transferring the image into the temporal dimension via emittance exchange. The modulation period can be tuned by adjusting electron optics after diffraction. This tunable longitudinal modulation can have a period as short as a few angstroms, enabling production of coherent hard x-rays from a source based on inverse Compton scattering with total accelerator length of approximately ten meters. Electron beam simulations from cathode emission through diffraction, acceleration, and image formation with variable magnification are presented along with estimates of the coherent x-ray output properties.

  3. In situ neutron diffraction study of twin reorientation and pseudoplastic strain in Ni-Mn-Ga single crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoica, Alexandru Dan

    2011-01-01

    Twin variant reorientation in single-crystal Ni-Mn-Ga during quasi-static mechanical compression was studied using in situ neutron diffraction. The volume fraction of reoriented twin variants for different stress amplitudes were obtained from the changes in integrated intensities of high-order neutron diffraction peaks. It is shown that, during compressive loading, {approx}85% of the twins were reoriented parallel to the loading direction resulting in a maximum pseudoplasticstrain of {approx}5.5%, which is in agreement with measured macroscopic strain.

  4. Spectroscopy and crystal structures of natural stereoisomers of neoclerodane diterpenoids from Teucrium yemense of Saudi medicinal plant

    NASA Astrophysics Data System (ADS)

    Nur-e-Alam, Mohammad; Kanthasamy, Gopikkaa; Yousaf, Muhammad; Alqahtani, Ali S.; Ghabbour, Hazem A.; Al-Rehaily, Adnan J.

    2017-11-01

    3-O-deacetylteugracilin (1) and teugracilin B (2), two natural stereoisomers, are isolated from Teucrium yemense (Defl). These two compounds are almost identical to each other, differing only at the C6 stereocenter. We now crystallise these two compounds and for the first time, determine the crystal structure through single crystal X-ray diffraction, and the stereochemistry for all positions using spectroscopic data. These techniques enable us to establish the difference between the two compounds. Careful interpretation of the results indicates that HRMS and 1 and 2D NMR spectroscopy, are in agreement with single crystal X-ray diffraction data.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David

    The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit.

  6. Radiation damage in a micron-sized protein crystal studied via reciprocal space mapping and Bragg coherent diffractive imaging.

    PubMed

    Coughlan, H D; Darmanin, C; Phillips, N W; Hofmann, F; Clark, J N; Harder, R J; Vine, D J; Abbey, B

    2015-07-01

    For laboratory and synchrotron based X-ray sources, radiation damage has posed a significant barrier to obtaining high-resolution structural data from biological macromolecules. The problem is particularly acute for micron-sized crystals where the weaker signal often necessitates the use of higher intensity beams to obtain the relevant data. Here, we employ a combination of techniques, including Bragg coherent diffractive imaging to characterise the radiation induced damage in a micron-sized protein crystal over time. The approach we adopt here could help screen for potential protein crystal candidates for measurement at X-ray free election laser sources.

  7. Radiation damage in a micron-sized protein crystal studied via reciprocal space mapping and Bragg coherent diffractive imaging

    PubMed Central

    Coughlan, H. D.; Darmanin, C.; Phillips, N. W.; Hofmann, F.; Clark, J. N.; Harder, R. J.; Vine, D. J.; Abbey, B.

    2015-01-01

    For laboratory and synchrotron based X-ray sources, radiation damage has posed a significant barrier to obtaining high-resolution structural data from biological macromolecules. The problem is particularly acute for micron-sized crystals where the weaker signal often necessitates the use of higher intensity beams to obtain the relevant data. Here, we employ a combination of techniques, including Bragg coherent diffractive imaging to characterise the radiation induced damage in a micron-sized protein crystal over time. The approach we adopt here could help screen for potential protein crystal candidates for measurement at X-ray free election laser sources. PMID:26798804

  8. Radiation damage in a micron-sized protein crystal studied via reciprocal space mapping and Bragg coherent diffractive imaging

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Coughlan, H. D.; Darmanin, C.; Phillips, N. W.

    For laboratory and synchrotron based X-ray sources, radiation damage has posed a significant barrier to obtaining high-resolution structural data from biological macromolecules. The problem is particularly acute for micron-sized crystals where the weaker signal often necessitates the use of higher intensity beams to obtain the relevant data. Here, we employ a combination of techniques, including Bragg coherent diffractive imaging to characterise the radiation induced damage in a micron-sized protein crystal over time. The approach we adopt here could help screen for potential protein crystal candidates for measurement at X-ray free election laser sources.

  9. Radiation damage in a micron-sized protein crystal studied via reciprocal space mapping and Bragg coherent diffractive imaging

    DOE PAGES

    Coughlan, H. D.; Darmanin, C.; Phillips, N. W.; ...

    2015-04-29

    For laboratory and synchrotron based X-ray sources, radiation damage has posed a significant barrier to obtaining high-resolution structural data from biological macromolecules. The problem is particularly acute for micron-sized crystals where the weaker signal often necessitates the use of higher intensity beams to obtain the relevant data. Here, we employ a combination of techniques, including Bragg coherent diffractive imaging to characterise the radiation induced damage in a micron-sized protein crystal over time. The approach we adopt here could help screen for potential protein crystal candidates for measurement at X-ray free election laser sources.

  10. Numerical Study of Noise Characteristics in Overexpanded Jet Flows

    DTIC Science & Technology

    2015-08-05

    Bourne, M., and Fisher, M. J., “The Noise from Shock Waves in Supersonic Jets,” AGARD - CP - 131, 1973, pp. 1-13. [2]. Tanna, H. K., “An Experimental Study...Journal, Volume 20, No. 1, 1982, pp. 68- 73 . [7]. Tam, C. K. W., and Tanna, H. K., “Shock Associated Noise of Supersonic Jets from Convergent

  11. The Landscape of Professional Doctorate Provision in English Higher Education Institutions: Inconsistencies, Tensions and Unsustainability

    ERIC Educational Resources Information Center

    Robinson, Carol

    2018-01-01

    This article reports findings from a recent research project, commissioned by the Higher Education Funding Council for England (HEFCE), which explored the current landscape of professional doctorate (PD) provision in English higher education institutions (HEIs) (Mellors-Bourne et al., 2016). Given the absence of a clear definition by the Quality…

  12. Slow: A Tool for Reporting and Diagnosing Performance Problems

    NASA Technical Reports Server (NTRS)

    Root, Darrell; Liviero, Belinda; Lasinski, Tom (Technical Monitor)

    1998-01-01

    Slow is a bourne shell script which is meant to be run by workstation users who are suffering performance problems. It collects a snapshot of performance data using previously published and publicly available diagnostic commands. This paper discusses how to interpret the output of those commands to identify the root-cause of unix workstation performance problems.

  13. The use of workflows in the design and implementation of complex experiments in macromolecular crystallography.

    PubMed

    Brockhauser, Sandor; Svensson, Olof; Bowler, Matthew W; Nanao, Max; Gordon, Elspeth; Leal, Ricardo M F; Popov, Alexander; Gerring, Matthew; McCarthy, Andrew A; Gotz, Andy

    2012-08-01

    The automation of beam delivery, sample handling and data analysis, together with increasing photon flux, diminishing focal spot size and the appearance of fast-readout detectors on synchrotron beamlines, have changed the way that many macromolecular crystallography experiments are planned and executed. Screening for the best diffracting crystal, or even the best diffracting part of a selected crystal, has been enabled by the development of microfocus beams, precise goniometers and fast-readout detectors that all require rapid feedback from the initial processing of images in order to be effective. All of these advances require the coupling of data feedback to the experimental control system and depend on immediate online data-analysis results during the experiment. To facilitate this, a Data Analysis WorkBench (DAWB) for the flexible creation of complex automated protocols has been developed. Here, example workflows designed and implemented using DAWB are presented for enhanced multi-step crystal characterizations, experiments involving crystal reorientation with kappa goniometers, crystal-burning experiments for empirically determining the radiation sensitivity of a crystal system and the application of mesh scans to find the best location of a crystal to obtain the highest diffraction quality. Beamline users interact with the prepared workflows through a specific brick within the beamline-control GUI MXCuBE.

  14. High-energy-resolution monochromator for nuclear resonant scattering of synchrotron radiation by Te-125 at 35.49 keV

    NASA Astrophysics Data System (ADS)

    Imai, Yasuhiko; Yoda, Yoshitaka; Kitao, Shinji; Masuda, Ryo; Higashitaniguchi, Satoshi; Inaba, Chika; Seto, Makoto

    2007-09-01

    We have developed a high-resolution monochromator (HRM) for the measurement of nuclear resonant scattering (NRS) of synchrotron radiation by Te-125 at 35.49 keV using the backscattering of sapphire (9 1 -10 68). HRMs for nuclei with excitation energies less than 30 keV have been successfully developed using high angle diffractions by silicon crystals. Nearly perfect silicon crystal, however, is not suitable for high efficient HRMs at higher energy regions because the symmetry of the crystal structure is high and the Debye-temperature is low. Therefore, we used high quality synthetic sapphire crystal, which has low symmetry of crystal structure and high Debye-temperature. The temperature of the crystal was precisely controlled around 218 K to diffract synchrotron radiation with a Bragg angle of π/2 - 0.52 mrad. Energy was tuned by changing the crystal temperature under the condition of constant diffraction angle. Energy resolution was measured by detecting nuclear forward scattering by Te-125 in enriched TeO II. The relative energy resolution of 2.1×10 -7 is achieved, that is 7.5 meV in energy bandwidth. This HRM opens studies on element-specific dynamics and electronic state of substances containing Te-125.

  15. Applications of thermal-gradients method for the optimization of α-amylase crystallization conditions based on dynamic and static light scattering data

    NASA Astrophysics Data System (ADS)

    Delboni, L. F.; Iulek, J.; Burger, R.; da Silva, A. C. R.; Moreno, A.

    2002-02-01

    The expression, purification, crystallization, and characterization by X-ray diffraction of α-amylase are described here. Dynamic and static light scattering methods with a temperature controller was used to optimize the crystallization conditions of α-amylase from Bacillus stearothermophilus an important enzyme in many fields of industrial activity. After applying thermal gradients for growing crystals, X-ray cryo-crystallographic methods were employed for the data collection. Crystals grown by these thermal-gradients diffracted up to a maximum resolution of 3.8 Å, which allowed the determination of the unit cell constants as follows: a=61.7 Å, b=86.7 Å, c=92.2 Å and space group C222 (or C222 1).

  16. Strain distribution in an Si single crystal measured by interference fringes of X-ray mirage diffraction

    PubMed Central

    Jongsukswat, Sukswat; Fukamachi, Tomoe; Ju, Dongying; Negishi, Riichirou; Hirano, Keiichi; Kawamura, Takaaki

    2013-01-01

    In X-ray interference fringes accompanied by mirage diffraction, variations have been observed in the spacing and position of the fringes from a plane-parallel Si single crystal fixed at one end as a function of distance from the incident plane of the X-rays to the free crystal end. The variations can be explained by distortion of the sample crystal due to gravity. From the variations and positions of the fringes, the strain gradient of the crystal has been determined. The distribution of the observed strain agrees with that expected from rod theory except for residual strain. When the distortion is large, the observed strain distribution does not agree with that expected from rod theory. PMID:24068841

  17. Purification, crystallization and preliminary X-ray structural studies of a 7.2 kDa cytotoxin isolated from the venom of Daboia russelli russelli of the Viperidae family

    PubMed Central

    Roy Choudhury, Subhasree; Gomes, Aparna; Gomes, Antony; Dattagupta, Jiban K.; Sen, Udayaditya

    2006-01-01

    A cytotoxin (MW 7.2 kDa) from Indian Russell’s viper (Daboia russelli russelli) venom possessing antiproliferative activity, cardiotoxicity, neurotoxicity and myotoxicity has been purified, characterized and crystallized. The crystals belong to the tetragonal space group P41, with unit-cell parameters a = b = 47.94, c = 50.2 Å. Larger crystals, which diffracted to 1.5 Å, were found to be twinned; diffraction data were therefore collected to 2.93 Å resolution using a smaller crystal. Molecular-replacement calculations identified two molecules of the protein in the asymmetric unit, which is in accordance with the calculated V M value. PMID:16511326

  18. Incoherent Diffractive Imaging via Intensity Correlations of Hard X Rays

    NASA Astrophysics Data System (ADS)

    Classen, Anton; Ayyer, Kartik; Chapman, Henry N.; Röhlsberger, Ralf; von Zanthier, Joachim

    2017-08-01

    Established x-ray diffraction methods allow for high-resolution structure determination of crystals, crystallized protein structures, or even single molecules. While these techniques rely on coherent scattering, incoherent processes like fluorescence emission—often the predominant scattering mechanism—are generally considered detrimental for imaging applications. Here, we show that intensity correlations of incoherently scattered x-ray radiation can be used to image the full 3D arrangement of the scattering atoms with significantly higher resolution compared to conventional coherent diffraction imaging and crystallography, including additional three-dimensional information in Fourier space for a single sample orientation. We present a number of properties of incoherent diffractive imaging that are conceptually superior to those of coherent methods.

  19. Syntheses, Characterizations, and Applications of Molecular Metal Wires

    DTIC Science & Technology

    2011-08-05

    treated with KPF6 (500 mg, 2.7 mmol). A dark greenish-brown complex was obtained after evaporation. The single crystals suitable for X-ray diffraction...CH2Cl2. Recrystallization from a CH2Cl2 solution layered with hexane gave deep brown single crystals suitable for X-ray diffraction. Yield: 83 mg...5 Synthetic challenges Conductance of single molecules Concluding Remarks

  20. Crystallization and preliminary X-ray diffraction analysis of two extracytoplasmic solute receptors of the DctP family from Bordetella pertussis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rucktooa, Prakash; Huvent, Isabelle; IFR 142, Institut Pasteur de Lille, 1 Rue du Professeur Calmette, BP 245, 59021 Lille CEDEX

    2006-10-01

    Sample preparation, crystallization and preliminary X-ray analysis are reported for two B. pertussis extracytoplasmic solute receptors. DctP6 and DctP7 are two Bordetella pertussis proteins which belong to the extracytoplasmic solute receptors (ESR) superfamily. ESRs are involved in the transport of substrates from the periplasm to the cytosol of Gram-negative bacteria. DctP6 and DctP7 have been crystallized and diffraction data were collected using a synchrotron-radiation source. DctP6 crystallized in space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = 108.39, b = 108.39, c = 63.09 Å, while selenomethionyl-derivatized DctP7 crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parametersmore » a = 64.87, b = 149.83, c = 170.65 Å. The three-dimensional structure of DctP7 will be determined by single-wavelength anomalous diffraction, while the DctP6 structure will be solved by molecular-replacement methods.« less

  1. Purification, crystallization and X-ray diffraction analysis of the C-terminal protease domain of Venezuelan equine encephalitis virus nsP2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Russo, Andrew T.; Watowich, Stanley J., E-mail: watowich@xray.utmb.edu

    2006-06-01

    The C-terminal protease domain of Venezuelan equine encephalitis virus (VEEV) nsP2 has been overexpressed in E. coli, purified and successfully crystallized. Native crystals diffract to beyond 2.5 Å resolution and isomorphous heavy-atom derivatives suitable for phase analysis have been identified. The C-terminal region of Venezuelan equine encephalitis virus (VEEV) nsP2 is responsible for proteolytic processing of the VEEV polyprotein replication complex. This action regulates the activity of the replication complex and is essential for viral replication, thus making nsP2 a very attractive target for development of VEEV therapeutics. The 338-amino-acid C-terminal region of VEEV nsP2 has been overexpressed in Escherichiamore » coli, purified and crystallized. Crystals diffract to beyond 2.5 Å resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}. Isomorphous heavy-atom derivatives suitable for phase analysis have been obtained and work on building a complete structural model is under way.« less

  2. Crystallization of a pentapeptide-repeat protein by reductive cyclic pentylation of free amines with glutaraldehyde

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vetting, Matthew W., E-mail: vetting@aecom.yu.edu; Hegde, Subray S.; Blanchard, John S.

    2009-05-01

    A method to modify proteins with glutaraldehyde under reducing conditions is presented. Treatment with glutaraldehyde and dimethylaminoborane was found to result in cyclic pentylation of free amines and facilitated the structural determination of a protein previously recalcitrant to the formation of diffraction quality crystals. The pentapeptide-repeat protein EfsQnr from Enterococcus faecalis protects DNA gyrase from inhibition by fluoroquinolones. EfsQnr was cloned and purified to homogeneity, but failed to produce diffraction-quality crystals in initial crystallization screens. Treatment of EfsQnr with glutaraldehyde and the strong reducing agent borane–dimethylamine resulted in a derivatized protein which produced crystals that diffracted to 1.6 Å resolution;more » their structure was subsequently determined by single-wavelength anomalous dispersion. Analysis of the derivatized protein using Fourier transform ion cyclotron resonance mass spectrometry indicated a mass increase of 68 Da per free amino group. Electron-density maps about a limited number of structurally ordered lysines indicated that the modification was a cyclic pentylation of free amines, producing piperidine groups.« less

  3. Resolution extension by image summing in serial femtosecond crystallography of two-dimensional membrane-protein crystals

    DOE PAGES

    Casadei, Cecilia M.; Tsai, Ching-Ju; Barty, Anton; ...

    2018-01-01

    Previous proof-of-concept measurements on single-layer two-dimensional membrane-protein crystals performed at X-ray free-electron lasers (FELs) have demonstrated that the collection of meaningful diffraction patterns, which is not possible at synchrotrons because of radiation-damage issues, is feasible. Here, the results obtained from the analysis of a thousand single-shot, room-temperature X-ray FEL diffraction images from two-dimensional crystals of a bacteriorhodopsin mutant are reported in detail. The high redundancy in the measurements boosts the intensity signal-to-noise ratio, so that the values of the diffracted intensities can be reliably determined down to the detector-edge resolution of 4 Å. The results show that two-dimensional serial crystallography atmore » X-ray FELs is a suitable method to study membrane proteins to near-atomic length scales at ambient temperature. The method presented here can be extended to pump–probe studies of optically triggered structural changes on submillisecond timescales in two-dimensional crystals, which allow functionally relevant large-scale motions that may be quenched in three-dimensional crystals.« less

  4. Resolution extension by image summing in serial femtosecond crystallography of two-dimensional membrane-protein crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Casadei, Cecilia M.; Tsai, Ching-Ju; Barty, Anton

    Previous proof-of-concept measurements on single-layer two-dimensional membrane-protein crystals performed at X-ray free-electron lasers (FELs) have demonstrated that the collection of meaningful diffraction patterns, which is not possible at synchrotrons because of radiation-damage issues, is feasible. Here, the results obtained from the analysis of a thousand single-shot, room-temperature X-ray FEL diffraction images from two-dimensional crystals of a bacteriorhodopsin mutant are reported in detail. The high redundancy in the measurements boosts the intensity signal-to-noise ratio, so that the values of the diffracted intensities can be reliably determined down to the detector-edge resolution of 4 Å. The results show that two-dimensional serial crystallography atmore » X-ray FELs is a suitable method to study membrane proteins to near-atomic length scales at ambient temperature. The method presented here can be extended to pump–probe studies of optically triggered structural changes on submillisecond timescales in two-dimensional crystals, which allow functionally relevant large-scale motions that may be quenched in three-dimensional crystals.« less

  5. Crystallization and preliminary X-ray diffraction analyses of the redox-controlled complex of terminal oxygenase and ferredoxin components in the Rieske nonhaem iron oxygenase carbazole 1,9a-dioxygenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matsuzawa, Jun; Aikawa, Hiroki; Umeda, Takashi

    2014-09-25

    A crystal was obtained of the complex between reduced terminal oxygenase and oxidized ferredoxin components of carbazole 1,9a-dioxygenase. The crystal belonged to space group P2{sub 1} and diffracted to 2.25 Å resolution. The initial reaction in bacterial carbazole degradation is catalyzed by carbazole 1,9a-dioxygenase, which consists of terminal oxygenase (Oxy), ferredoxin (Fd) and ferredoxin reductase components. The electron-transfer complex between reduced Oxy and oxidized Fd was crystallized at 293 K using the hanging-drop vapour-diffusion method with PEG 3350 as the precipitant under anaerobic conditions. The crystal diffracted to a maximum resolution of 2.25 Å and belonged to space group P2{submore » 1}, with unit-cell parameters a = 97.3, b = 81.6, c = 116.2 Å, α = γ = 90, β = 100.1°. The V{sub M} value is 2.85 Å{sup 3} Da{sup −1}, indicating a solvent content of 56.8%.« less

  6. Ab initio structure determination from prion nanocrystals at atomic resolution by MicroED

    DOE PAGES

    Sawaya, Michael R.; Rodriguez, Jose; Cascio, Duilio; ...

    2016-09-19

    Electrons, because of their strong interaction with matter, produce high-resolution diffraction patterns from tiny 3D crystals only a few hundred nanometers thick in a frozen-hydrated state. This discovery offers the prospect of facile structure determination of complex biological macromolecules, which cannot be coaxed to form crystals large enough for conventional crystallography or cannot easily be produced in sufficient quantities. Two potential obstacles stand in the way. The first is a phenomenon known as dynamical scattering, in which multiple scattering events scramble the recorded electron diffraction intensities so that they are no longer informative of the crystallized molecule. The second obstaclemore » is the lack of a proven means of de novo phase determination, as is required if the molecule crystallized is insufficiently similar to one that has been previously determined.We showwith four structures of the amyloid core of the Sup35 prion protein that, if the diffraction resolution is high enough, sufficiently accurate phases can be obtained by direct methods with the cryo-EM method microelectron diffraction (MicroED), just as in X-ray diffraction. The success of these four experiments dispels the concern that dynamical scattering is an obstacle to ab initio phasing by MicroED and suggests that structures of novel macromolecules can also be determined by direct methods.« less

  7. Ab initio structure determination from prion nanocrystals at atomic resolution by MicroED

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sawaya, Michael R.; Rodriguez, Jose; Cascio, Duilio

    Electrons, because of their strong interaction with matter, produce high-resolution diffraction patterns from tiny 3D crystals only a few hundred nanometers thick in a frozen-hydrated state. This discovery offers the prospect of facile structure determination of complex biological macromolecules, which cannot be coaxed to form crystals large enough for conventional crystallography or cannot easily be produced in sufficient quantities. Two potential obstacles stand in the way. The first is a phenomenon known as dynamical scattering, in which multiple scattering events scramble the recorded electron diffraction intensities so that they are no longer informative of the crystallized molecule. The second obstaclemore » is the lack of a proven means of de novo phase determination, as is required if the molecule crystallized is insufficiently similar to one that has been previously determined.We showwith four structures of the amyloid core of the Sup35 prion protein that, if the diffraction resolution is high enough, sufficiently accurate phases can be obtained by direct methods with the cryo-EM method microelectron diffraction (MicroED), just as in X-ray diffraction. The success of these four experiments dispels the concern that dynamical scattering is an obstacle to ab initio phasing by MicroED and suggests that structures of novel macromolecules can also be determined by direct methods.« less

  8. Studies on synthesis, growth, structural, thermal, linear and nonlinear optical properties of organic picolinium maleate single crystals.

    PubMed

    Pandi, P; Peramaiyan, G; Sudhahar, S; Chakkaravarthi, G; Mohan Kumar, R; Bhagavannarayana, G; Jayavel, R

    2012-12-01

    Picolinium maleate (PM), an organic material has been synthesised and single crystals were grown by slow evaporation technique. The structure of the grown crystal was elucidated by using single crystal X-ray diffraction analysis. PM crystal belongs to the monoclinic crystallographic system with space group P2(1)/c. The crystalline perfection of the grown crystals was analyzed by high-resolution X-ray diffraction rocking curve measurements. The presence of functional groups in PM was identified by FTIR and FT-NMR spectral analyses. Thermal behaviour and stability of picolinium maleate were studied by TGA/DTA analyses. UV-Vis spectral studies reveal that PM crystals are transparent in the wavelength region 327-1100 nm. The laser damage threshold value of PM crystal was found to be 4.3 GW/cm(2) using Nd:YAG laser. The Kurtz and Perry powder second harmonic generation technique confirms the nonlinear optical property of the grown crystal. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Cloning, purification, crystallization and preliminary X-ray crystallographic analysis of MCAT from Synechocystis sp. PCC 6803.

    PubMed

    Liu, Yinghui; Zhang, Yanming; Cao, Xupeng; Xue, Song

    2013-11-01

    Malonyl-coenzymeA:acyl-carrier protein transacylase (MCAT), which catalyzes the transfer of the malonyl group from malonyl-CoA to acyl-carrier protein (ACP), is an essential enzyme in type II fatty-acid synthesis. The enzyme MCAT from Synechocystis sp. PCC 6803 (spMCAT), the first MCAT counterpart from a cyanobacterium, was cloned, purified and crystallized in order to determine its three-dimensional crystal structure. A higher-quality crystal with better diffraction was obtained by crystallization optimization. The crystal diffracted to 1.8 Å resolution and belonged to the orthorhombic space group P2(1)2(1)2, with unit-cell parameters a = 43.22, b = 149.21, c = 40.59 Å. Matthews coefficient calculations indicated that the crystal contained one spMCAT molecule in the asymmetric unit with a Matthews coefficient of 2.18 Å(3) Da(-1) and a solvent content of 43.65%.

  10. Solid state parameters, structure elucidation, High Resolution X-Ray Diffraction (HRXRD), phase matching, thermal and impedance analysis on L-Proline trichloroacetate (L-PTCA) NLO single crystals.

    PubMed

    Kalaiselvi, P; Raj, S Alfred Cecil; Jagannathan, K; Vijayan, N; Bhagavannarayana, G; Kalainathan, S

    2014-11-11

    Nonlinear optical single crystal of L-Proline trichloroacetate (L-PTCA) was successfully grown by Slow Evaporation Solution Technique (SEST). The grown crystals were subjected to single crystal X-ray diffraction analysis to confirm the structure. From the single crystal XRD data, solid state parameters were determined for the grown crystal. The crystalline perfection has been evaluated using high resolution X-ray diffractometer. The frequencies of various functional groups were identified from FTIR spectral analysis. The percentage of transmittance was obtained from UV Visible spectral analysis. TGA-DSC measurements indicate the thermal stability of the crystal. The dielectric constant, dielectric loss and ac conductivity were measured by the impedance analyzer. The DC conductivity was calculated by the cole-cole plot method. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Hydrothermal Synthesis, Crystal Structure, and Photoluminescent Properties of Li[UO2(CH3COO)3]3[Co(H2O)6

    NASA Astrophysics Data System (ADS)

    AlDamen, Murad A.; Juwhari, Hassan K.; Al-zuheiri, Aya M.; Alnazer, Louy A.

    2017-12-01

    Single crystal of Li[UO2(CH3COO)3]3[Co(H2O)6] was prepared and found to crystallize in the monoclinic crystal system in the sp. gr. C2/ c, with Z = 2, and unit cell parameters a = 22.1857(15) Å, b = 13.6477(8) Å, c = 15.6921(10) Å, β = 117.842(9)°, V = 4201.3(4) Å3. The crystal was characterized by X-ray diffraction, Fourier transform infrared spectroscopy, and differential scanning calorimetry. The single crystal X-ray diffraction analysis revealed that the crystal has a lamellar structure in which a cobalt hydrate is sandwiched within the Li[UO2(CH3COO)3]3 2- chains. Furthermore, the room temperature photoluminescence spectrum of the complex was investigated in the solid state.

  12. Study of Inverse Ni-based Photonic Crystal using the Microradian X-ray Diffraction

    NASA Astrophysics Data System (ADS)

    Vasilieva, A. V.; Grigoryeva, N. A.; Mistonov, A. A.; Sapoletova, N. A.; Napolskii, K. S.; Eliseev, A. A.; Lukashin, A. V.; Tretyakov, Yu D.; Petukhov, A. V.; Byelov, D.; Chernyshov, D.; Okorokov, A. I.; Bouwman, W. G.; Grigoriev, S. V.

    2010-10-01

    Inverse photonic nickel-based crystal films formed by electrocrystallization of metal inside the voids of polymer artificial opal have been studied using the microradian X-ray diffraction. Analysis of the diffraction images agrees with an face-centred cubic (FCC) structure with the lattice constant a0 = 650 ± 10 nm and indicates two types of stacking sequences coexisting in the crystal (twins of ABCABC... and ACBACB... ordering motifs), the ratio between them being 4:5 The transverse structural correlation length Ltran is 2.4 ± 0.1 μm, which corresponds to a sample thickness of 6 layers. The in-plane structural correlation length Llong is 3.4 ± 0.2 μm, and the structure mosaic is of order of 10°.

  13. Structural and electronic evolution of Cr[subscript 2]O[subscript 3] on compression to 55 GPa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dera, Przemyslaw; Lavina, Barbara; Meng, Yue

    2016-08-15

    Synchrotron single-crystal x-ray diffraction experiments have been performed on corundum-type Cr{sub 2}O{sub 3} up to a pressure of 55 GPa in Ne and He pressure transmitting media. Diffraction experiments were complemented by measurements of optical absorption spectra with single crystal samples up to 60 GPa. Results of the diffraction data analysis rule out the earlier reported monoclinic distortion at 15-30 GPa, but indicate evidence of two discontinuous transitions of electronic or magnetic nature, most likely associated with a change in magnetic ordering and charge transfer. The compression mechanism established from single crystal refinements indicates much smaller distortion of the Cr{supmore » 3+} coordination environment than was previously assumed.« less

  14. Crystallization and preliminary X-ray diffraction studies of a novel ferredoxin involved in the dioxygenation of carbazole by Novosphingobium sp. KA1

    PubMed Central

    Umeda, Takashi; Katsuki, Junichi; Usami, Yusuke; Inoue, Kengo; Noguchi, Haruko; Fujimoto, Zui; Ashikawa, Yuji; Yamane, Hisakazu; Nojiri, Hideaki

    2008-01-01

    Novosphingobium sp. KA1 uses carbazole 1,9a-dioxygenase (CARDO) as the first dioxygenase in its carbazole-degradation pathway. The CARDO of KA1 contains a terminal oxygenase component and two electron-transfer components: ferredoxin and ferredoxin reductase. In contrast to the CARDO systems of other species, the ferredoxin component of KA1 is a putidaredoxin-type protein. This novel ferredoxin was crystallized at 293 K by the hanging-drop vapour-diffusion method using PEG MME 550 as the precipitant under anaerobic conditions. The crystals belong to space group C2221 and diffraction data were collected to a resolution of 1.9 Å (the diffraction limit was 1.6 Å). PMID:18607094

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imamura, Kayo; Matsuura, Takanori; Ye, Zhengmao

    Disproportionating enzyme from potato was crystallized and preliminarily analyzed using X-ray diffraction. Disproportionating enzyme (D-enzyme; EC 2.4.1.25) is a 59 kDa protein that belongs to the α-amylase family. D-enzyme catalyses intramolecular and intermolecular transglycosylation reactions of α-1,4 glucan. A crystal of the D-enzyme from potato was obtained by the hanging-drop vapour-diffusion method. Preliminary X-ray data showed that the crystal diffracts to 2.0 Å resolution and belongs to space group C222{sub 1}, with unit-cell parameters a = 69.7, b = 120.3, c = 174.2 Å.

  16. The statistical kinematical theory of X-ray diffraction as applied to reciprocal-space mapping

    PubMed

    Nesterets; Punegov

    2000-11-01

    The statistical kinematical X-ray diffraction theory is developed to describe reciprocal-space maps (RSMs) from deformed crystals with defects of the structure. The general solutions for coherent and diffuse components of the scattered intensity in reciprocal space are derived. As an example, the explicit expressions for intensity distributions in the case of spherical defects and of a mosaic crystal were obtained. The theory takes into account the instrumental function of the triple-crystal diffractometer and can therefore be used for experimental data analysis.

  17. Femtosecond X-ray protein nanocrystallography

    PubMed Central

    Chapman, Henry N.; Fromme, Petra; Barty, Anton; White, Thomas A.; Kirian, Richard A.; Aquila, Andrew; Hunter, Mark S.; Schulz, Joachim; DePonte, Daniel P.; Weierstall, Uwe; Doak, R. Bruce; Maia, Filipe R. N. C.; Martin, Andrew V.; Schlichting, Ilme; Lomb, Lukas; Coppola, Nicola; Shoeman, Robert L.; Epp, Sascha W.; Hartmann, Robert; Rolles, Daniel; Rudenko, Artem; Foucar, Lutz; Kimmel, Nils; Weidenspointner, Georg; Holl, Peter; Liang, Mengning; Barthelmess, Miriam; Caleman, Carl; Boutet, Sébastien; Bogan, Michael J.; Krzywinski, Jacek; Bostedt, Christoph; Bajt, Saša; Gumprecht, Lars; Rudek, Benedikt; Erk, Benjamin; Schmidt, Carlo; Hömke, André; Reich, Christian; Pietschner, Daniel; Strüder, Lothar; Hauser, Günter; Gorke, Hubert; Ullrich, Joachim; Herrmann, Sven; Schaller, Gerhard; Schopper, Florian; Soltau, Heike; Kühnel, Kai-Uwe; Messerschmidt, Marc; Bozek, John D.; Hau-Riege, Stefan P.; Frank, Matthias; Hampton, Christina Y.; Sierra, Raymond G.; Starodub, Dmitri; Williams, Garth J.; Hajdu, Janos; Timneanu, Nicusor; Seibert, M. Marvin; Andreasson, Jakob; Rocker, Andrea; Jönsson, Olof; Svenda, Martin; Stern, Stephan; Nass, Karol; Andritschke, Robert; Schröter, Claus-Dieter; Krasniqi, Faton; Bott, Mario; Schmidt, Kevin E.; Wang, Xiaoyu; Grotjohann, Ingo; Holton, James M.; Barends, Thomas R. M.; Neutze, Richard; Marchesini, Stefano; Fromme, Raimund; Schorb, Sebastian; Rupp, Daniela; Adolph, Marcus; Gorkhover, Tais; Andersson, Inger; Hirsemann, Helmut; Potdevin, Guillaume; Graafsma, Heinz; Nilsson, Björn; Spence, John C. H.

    2012-01-01

    X-ray crystallography provides the vast majority of macromolecular structures, but the success of the method relies on growing crystals of sufficient size. In conventional measurements, the necessary increase in X-ray dose to record data from crystals that are too small leads to extensive damage before a diffraction signal can be recorded1-3. It is particularly challenging to obtain large, well-diffracting crystals of membrane proteins, for which fewer than 300 unique structures have been determined despite their importance in all living cells. Here we present a method for structure determination where single-crystal X-ray diffraction ‘snapshots’ are collected from a fully hydrated stream of nanocrystals using femtosecond pulses from a hard-X-ray free-electron laser, the Linac Coherent Light Source4. We prove this concept with nanocrystals of photosystem I, one of the largest membrane protein complexes5. More than 3,000,000 diffraction patterns were collected in this study, and a three-dimensional data set was assembled from individual photosystem I nanocrystals (~200 nm to 2 μm in size). We mitigate the problem of radiation damage in crystallography by using pulses briefer than the timescale of most damage processes6. This offers a new approach to structure determination of macromolecules that do not yield crystals of sufficient size for studies using conventional radiation sources or are particularly sensitive to radiation damage. PMID:21293373

  18. Improved crystal orientation and physical properties from single-shot XFEL stills

    DOE PAGES

    Sauter, Nicholas K.; Hattne, Johan; Brewster, Aaron S.; ...

    2014-11-28

    X-ray diffraction patterns from still crystals are inherently difficult to process because the crystal orientation is not uniquely determined by measuring the Bragg spot positions. Only one of the three rotational degrees of freedom is directly coupled to spot positions; the other two rotations move Bragg spots in and out of the reflecting condition but do not change the direction of the diffracted rays. This hinders the ability to recover accurate structure factors from experiments that are dependent on single-shot exposures, such as femtosecond diffract-and-destroy protocols at X-ray free-electron lasers (XFELs). Here, additional methods are introduced to optimally model themore » diffraction. The best orientation is obtained by requiring, for the brightest observed spots, that each reciprocal-lattice point be placed into the exact reflecting condition implied by Bragg's law with a minimal rotation. This approach reduces the experimental uncertainties in noisy XFEL data, improving the crystallographic R factors and sharpening anomalous differences that are near the level of the noise.« less

  19. Investigation on bandgap, diffraction, interference, and refraction effects of photonic crystal structure in GaN/InGaN LEDs for light extraction.

    PubMed

    Patra, Saroj Kanta; Adhikari, Sonachand; Pal, Suchandan

    2014-06-20

    In this paper, we have made a clear differentiation among bandgap, diffraction, interference, and refraction effects in photonic crystal structures (PhCs). For observing bandgap, diffraction, and refraction effects, PhCs are considered on the top p-GaN surface of light emitting diodes (LEDs), whereas for interference effect, hole type PhCs are considered to be embedded within n-GaN layer of LED. From analysis, it is observed that at a particular lattice periodicity, for which bandgap lies within the wavelength of interest shows a significant light extraction due to inhibition of guided mode. Beyond a certain periodicity, diffraction effect starts dominating and light extraction improves further. The interference effect is observed in embedded photonic crystal LEDs, where depth of etching supports constructive interference of outward light waves. We have also shed light on refraction effects exhibited by the PhCs and whether negative refraction properties of PhCs may be useful in case of LED light extraction.

  20. Diffraction based method to reconstruct the spectrum of the Thomson scattering x-ray source

    NASA Astrophysics Data System (ADS)

    Chi, Zhijun; Yan, Lixin; Zhang, Zhen; Zhou, Zheng; Zheng, Lianmin; Wang, Dong; Tian, Qili; Wang, Wei; Nie, Zan; Zhang, Jie; Du, Yingchao; Hua, Jianfei; Shi, Jiaru; Pai, Chihao; Lu, Wei; Huang, Wenhui; Chen, Huaibi; Tang, Chuanxiang

    2017-04-01

    As Thomson scattering x-ray sources based on the collision of intense laser and relativistic electrons have drawn much attention in various scientific fields, there is an increasing demand for the effective methods to reconstruct the spectrum information of the ultra-short and high-intensity x-ray pulses. In this paper, a precise spectrum measurement method for the Thomson scattering x-ray sources was proposed with the diffraction of a Highly Oriented Pyrolytic Graphite (HOPG) crystal and was demonstrated at the Tsinghua Thomson scattering X-ray source. The x-ray pulse is diffracted by a 15 mm (L) ×15 mm (H)× 1 mm (D) HOPG crystal with 1° mosaic spread. By analyzing the diffraction pattern, both x-ray peak energies and energy spectral bandwidths at different polar angles can be reconstructed, which agree well with the theoretical value and simulation. The higher integral reflectivity of the HOPG crystal makes this method possible for single-shot measurement.

  1. Diffraction based method to reconstruct the spectrum of the Thomson scattering x-ray source.

    PubMed

    Chi, Zhijun; Yan, Lixin; Zhang, Zhen; Zhou, Zheng; Zheng, Lianmin; Wang, Dong; Tian, Qili; Wang, Wei; Nie, Zan; Zhang, Jie; Du, Yingchao; Hua, Jianfei; Shi, Jiaru; Pai, Chihao; Lu, Wei; Huang, Wenhui; Chen, Huaibi; Tang, Chuanxiang

    2017-04-01

    As Thomson scattering x-ray sources based on the collision of intense laser and relativistic electrons have drawn much attention in various scientific fields, there is an increasing demand for the effective methods to reconstruct the spectrum information of the ultra-short and high-intensity x-ray pulses. In this paper, a precise spectrum measurement method for the Thomson scattering x-ray sources was proposed with the diffraction of a Highly Oriented Pyrolytic Graphite (HOPG) crystal and was demonstrated at the Tsinghua Thomson scattering X-ray source. The x-ray pulse is diffracted by a 15 mm (L) ×15 mm (H)× 1 mm (D) HOPG crystal with 1° mosaic spread. By analyzing the diffraction pattern, both x-ray peak energies and energy spectral bandwidths at different polar angles can be reconstructed, which agree well with the theoretical value and simulation. The higher integral reflectivity of the HOPG crystal makes this method possible for single-shot measurement.

  2. Crystallization and preliminary X-ray diffraction analysis of the sialic acid-binding domain (VP8*) of porcine rotavirus strain CRW-8

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Scott, Stacy A.; Holloway, Gavan; Coulson, Barbara S.

    2005-06-01

    The sialic acid-binding domain (VP8*) component of the porcine CRW-8 rotavirus spike protein has been overexpressed in E. coli, purified and co-crystallized with an N-acetylneuraminic acid derivative. X-ray diffraction data have been collected to 2.3 Å, which has enabled determination of the structure by molecular replacement. Rotavirus recognition and attachment to host cells involves interaction with the spike protein VP4 that projects outwards from the surface of the virus particle. An integral component of these spikes is the VP8* domain, which is implicated in the direct recognition and binding of sialic acid-containing cell-surface carbohydrates and facilitates subsequent invasion by themore » virus. The expression, purification, crystallization and preliminary X-ray diffraction analysis of VP8* from porcine CRW-8 rotavirus is reported. Diffraction data have been collected to 2.3 Å resolution, enabling the determination of the VP8* structure by molecular replacement.« less

  3. Improved crystal orientation and physical properties from single-shot XFEL stills

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sauter, Nicholas K.; Hattne, Johan; Brewster, Aaron S.

    X-ray diffraction patterns from still crystals are inherently difficult to process because the crystal orientation is not uniquely determined by measuring the Bragg spot positions. Only one of the three rotational degrees of freedom is directly coupled to spot positions; the other two rotations move Bragg spots in and out of the reflecting condition but do not change the direction of the diffracted rays. This hinders the ability to recover accurate structure factors from experiments that are dependent on single-shot exposures, such as femtosecond diffract-and-destroy protocols at X-ray free-electron lasers (XFELs). Here, additional methods are introduced to optimally model themore » diffraction. The best orientation is obtained by requiring, for the brightest observed spots, that each reciprocal-lattice point be placed into the exact reflecting condition implied by Bragg's law with a minimal rotation. This approach reduces the experimental uncertainties in noisy XFEL data, improving the crystallographic R factors and sharpening anomalous differences that are near the level of the noise.« less

  4. Protein crystal structure from non-oriented, single-axis sparse X-ray data

    DOE PAGES

    Wierman, Jennifer L.; Lan, Ti-Yen; Tate, Mark W.; ...

    2016-01-01

    X-ray free-electron lasers (XFELs) have inspired the development of serial femtosecond crystallography (SFX) as a method to solve the structure of proteins. SFX datasets are collected from a sequence of protein microcrystals injected across ultrashort X-ray pulses. The idea behind SFX is that diffraction from the intense, ultrashort X-ray pulses leaves the crystal before the crystal is obliterated by the effects of the X-ray pulse. The success of SFX at XFELs has catalyzed interest in analogous experiments at synchrotron-radiation (SR) sources, where data are collected from many small crystals and the ultrashort pulses are replaced by exposure times that aremore » kept short enough to avoid significant crystal damage. The diffraction signal from each short exposure is so `sparse' in recorded photons that the process of recording the crystal intensity is itself a reconstruction problem. Using theEMCalgorithm, a successful reconstruction is demonstrated here in a sparsity regime where there are no Bragg peaks that conventionally would serve to determine the orientation of the crystal in each exposure. In this proof-of-principle experiment, a hen egg-white lysozyme (HEWL) crystal rotating about a single axis was illuminated by an X-ray beam from an X-ray generator to simulate the diffraction patterns of microcrystals from synchrotron radiation. Millions of these sparse frames, typically containing only ~200 photons per frame, were recorded using a fast-framing detector. It is shown that reconstruction of three-dimensional diffraction intensity is possible using theEMCalgorithm, even with these extremely sparse frames and without knowledge of the rotation angle. Further, the reconstructed intensity can be phased and refined to solve the protein structure using traditional crystallographic software. In conclusion, this suggests that synchrotron-based serial crystallography of micrometre-sized crystals can be practical with the aid of theEMCalgorithm even in cases where the data are sparse.« less

  5. Protein crystal structure from non-oriented, single-axis sparse X-ray data

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wierman, Jennifer L.; Lan, Ti-Yen; Tate, Mark W.

    X-ray free-electron lasers (XFELs) have inspired the development of serial femtosecond crystallography (SFX) as a method to solve the structure of proteins. SFX datasets are collected from a sequence of protein microcrystals injected across ultrashort X-ray pulses. The idea behind SFX is that diffraction from the intense, ultrashort X-ray pulses leaves the crystal before the crystal is obliterated by the effects of the X-ray pulse. The success of SFX at XFELs has catalyzed interest in analogous experiments at synchrotron-radiation (SR) sources, where data are collected from many small crystals and the ultrashort pulses are replaced by exposure times that aremore » kept short enough to avoid significant crystal damage. The diffraction signal from each short exposure is so `sparse' in recorded photons that the process of recording the crystal intensity is itself a reconstruction problem. Using theEMCalgorithm, a successful reconstruction is demonstrated here in a sparsity regime where there are no Bragg peaks that conventionally would serve to determine the orientation of the crystal in each exposure. In this proof-of-principle experiment, a hen egg-white lysozyme (HEWL) crystal rotating about a single axis was illuminated by an X-ray beam from an X-ray generator to simulate the diffraction patterns of microcrystals from synchrotron radiation. Millions of these sparse frames, typically containing only ~200 photons per frame, were recorded using a fast-framing detector. It is shown that reconstruction of three-dimensional diffraction intensity is possible using theEMCalgorithm, even with these extremely sparse frames and without knowledge of the rotation angle. Further, the reconstructed intensity can be phased and refined to solve the protein structure using traditional crystallographic software. In conclusion, this suggests that synchrotron-based serial crystallography of micrometre-sized crystals can be practical with the aid of theEMCalgorithm even in cases where the data are sparse.« less

  6. Purification, crystallization and preliminary X-ray diffraction analysis of water-soluble chlorophyll-binding protein from Chenopodium album

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ohtsuki, Takayuki; Ohshima, Shigeru; Uchida, Akira, E-mail: auchida@biomol.sci.toho-u.ac.jp

    2007-09-01

    A water-soluble chlorophyll-binding protein with photoconvertibility from C. album was extracted, purified and crystallized in a darkroom. The crystal diffracted to around 2.0 Å resolution. A water-soluble chlorophyll-binding protein (WSCP) with photoconvertibility from Chenopodium album was extracted, purified and crystallized in a darkroom. Green crystals suitable for data collection appeared in about 10 d. A native data set was collected to 2.0 Å resolution at 100 K. The space group of the crystal was determined to be orthorhombic I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 48.13, b = 60.59, c = 107.21 Å. Preliminary analysis ofmore » the X-ray data indicated that there is one molecule per asymmetric unit.« less

  7. Crystallization Dynamics of Organolead Halide Perovskite by Real-Time X-ray Diffraction.

    PubMed

    Miyadera, Tetsuhiko; Shibata, Yosei; Koganezawa, Tomoyuki; Murakami, Takurou N; Sugita, Takeshi; Tanigaki, Nobutaka; Chikamatsu, Masayuki

    2015-08-12

    We analyzed the crystallization process of the CH3NH3PbI3 perovskite by observing real-time X-ray diffraction immediately after combining a PbI2 thin film with a CH3NH3I solution. A detailed analysis of the transformation kinetics demonstrated the fractal diffusion of the CH3NH3I solution into the PbI2 film. Moreover, the perovskite crystal was found to be initially oriented based on the PbI2 crystal orientation but to gradually transition to a random orientation. The fluctuating characteristics of the crystallization process of perovskites, such as fractal penetration and orientational transformation, should be controlled to allow the fabrication of high-quality perovskite crystals. The characteristic reaction dynamics observed in this study should assist in establishing reproducible fabrication processes for perovskite solar cells.

  8. Crystal growth, structural, thermal and mechanical behavior of l-arginine 4-nitrophenolate 4-nitrophenol dihydrate (LAPP) single crystals.

    PubMed

    Mahadevan, M; Ramachandran, K; Anandan, P; Arivanandhan, M; Bhagavannarayana, G; Hayakawa, Y

    2014-12-10

    Single crystals of l-arginine 4-nitrophenolate 4-nitrophenol dihydrate (LAPP) have been grown successfully from the solution of l-arginine and 4-nitrophenol. Slow evaporation of solvent technique was adopted to grow the bulk single crystals. Single crystal X-ray diffraction analysis confirms the grown crystal has monoclinic crystal system with space group of P21. Powder X-ray diffraction analysis shows the good crystalline nature. The crystalline perfection of the grown single crystals was analyzed by HRXRD by employing a multicrystal X-ray diffractometer. The functional groups were identified from proton NMR spectroscopic analysis. Linear and nonlinear optical properties were determined by UV-Vis spectrophotometer and Kurtz powder technique respectively. It is found that the grown crystal has no absorption in the green wavelength region and the SHG efficiency was found to be 2.66 times that of the standard KDP. The Thermal stability of the crystal was found by obtaining TG/DTA curve. The mechanical behavior of the grown crystal has been studied by Vicker's microhardness method. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Birefringence Bragg Binary (3B) grating, quasi-Bragg grating and immersion gratings

    NASA Astrophysics Data System (ADS)

    Ebizuka, Noboru; Morita, Shin-ya; Yamagata, Yutaka; Sasaki, Minoru; Bianco, Andorea; Tanabe, Ayano; Hashimoto, Nobuyuki; Hirahara, Yasuhiro; Aoki, Wako

    2014-07-01

    A volume phase holographic (VPH) grating achieves high angular dispersion and very high diffraction efficiency for the first diffraction order and for S or P polarization. However the VPH grating could not achieve high diffraction efficiency for non-polarized light at a large diffraction angle because properties of diffraction efficiencies for S and P polarizations are different. Furthermore diffraction efficiency of the VPH grating extinguishes toward a higher diffraction order. A birefringence binary Bragg (3B) grating is a thick transmission grating with optically anisotropic material such as lithium niobate or liquid crystal. The 3B grating achieves diffraction efficiency up to 100% for non-polarized light by tuning of refractive indices for S and P polarizations, even in higher diffraction orders. We fabricated 3B grating with liquid crystal and evaluated the performance of the liquid crystal grating. A quasi-Bragg (QB) grating, which consists long rectangle mirrors aligned in parallel precisely such as a window shade, also achieves high diffraction efficiency toward higher orders. We fabricated QB grating by laminating of silica glass substrates and glued by pressure fusion of gold films. A quasi-Bragg immersion (QBI) grating has smooth mirror hypotenuse and reflector array inside the hypotenuse, instead of step-like grooves of a conventional immersion grating. An incident beam of the QBI grating reflects obliquely at a reflector, then reflects vertically at the mirror surface and reflects again at the same reflector. We are going to fabricate QBI gratings by laminating of mirror plates as similar to fabrication of the QB grating. We will also fabricate silicon and germanium immersion gratings with conventional step-like grooves by means of the latest diamond machining methods. We introduce characteristics and performance of these gratings.

  10. Influence of solvents on the habit modification of alpha lactose monohydrate single crystals

    NASA Astrophysics Data System (ADS)

    Parimaladevi, P.; Srinivasan, K.

    2013-02-01

    Restricted evaporation of solvent method was adopted for the growth of alpha lactose monohydrate single crystals from different solvents. The crystal habits of grown crystals were analysed. The form of crystallization was confirmed by powder x-ray diffraction analysis. Thermal behaviour of the grown crystals was studied by using differential scanning calorimetry.

  11. Nanomodulated electron beams via electron diffraction and emittance exchange for coherent x-ray generation

    DOE PAGES

    Nanni, E. A.; Graves, W. S.; Moncton, D. E.

    2018-01-19

    We present a new method for generation of relativistic electron beams with current modulation on the nanometer scale and below. The current modulation is produced by diffracting relativistic electrons in single crystal Si, accelerating the diffracted beam and imaging the crystal structure, then transferring the image into the temporal dimension via emittance exchange. The modulation period can be tuned by adjusting electron optics after diffraction. This tunable longitudinal modulation can have a period as short as a few angstroms, enabling production of coherent hard x-rays from a source based on inverse Compton scattering with total accelerator length of approximately tenmore » meters. Electron beam simulations from cathode emission through diffraction, acceleration, and image formation with variable magnification are presented along with estimates of the coherent x-ray output properties.« less

  12. Nanomodulated electron beams via electron diffraction and emittance exchange for coherent x-ray generation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nanni, E. A.; Graves, W. S.; Moncton, D. E.

    We present a new method for generation of relativistic electron beams with current modulation on the nanometer scale and below. The current modulation is produced by diffracting relativistic electrons in single crystal Si, accelerating the diffracted beam and imaging the crystal structure, then transferring the image into the temporal dimension via emittance exchange. The modulation period can be tuned by adjusting electron optics after diffraction. This tunable longitudinal modulation can have a period as short as a few angstroms, enabling production of coherent hard x-rays from a source based on inverse Compton scattering with total accelerator length of approximately tenmore » meters. Electron beam simulations from cathode emission through diffraction, acceleration, and image formation with variable magnification are presented along with estimates of the coherent x-ray output properties.« less

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gao, Xiong-Zhuo; National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871; Li, Lan-Fen

    The SMU.961 protein from S. mutans was crystallized and preliminary characterization of the crystals, which diffracted to 2.9 Å resolution, shows them to belong to space group C2. The smu.961 gene encodes a putative protein of 183 residues in Streptococcus mutans, a major pathogen in human dental caries. The gene was cloned into expression vector pET28a and expressed in a substantial quantity in Escherichia coli strain BL21 (DE3) with a His tag at its N-terminus. The recombinant protein SMU.961 was purified to homogeneity in a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals suitable for X-ray diffraction weremore » obtained by the hanging-drop vapour-diffusion method and diffracted to 2.9 Å resolution at beamline I911-3, MAX-II-lab, Sweden. The crystal belonged to space group C2, with unit-cell parameters a = 98.62, b = 73.73, c = 184.73 Å, β = 98.82°.« less

  14. Visualization of membrane protein crystals in lipid cubic phase using X-ray imaging

    PubMed Central

    Warren, Anna J.; Armour, Wes; Axford, Danny; Basham, Mark; Connolley, Thomas; Hall, David R.; Horrell, Sam; McAuley, Katherine E.; Mykhaylyk, Vitaliy; Wagner, Armin; Evans, Gwyndaf

    2013-01-01

    The focus in macromolecular crystallography is moving towards even more challenging target proteins that often crystallize on much smaller scales and are frequently mounted in opaque or highly refractive materials. It is therefore essential that X-ray beamline technology develops in parallel to accommodate such difficult samples. In this paper, the use of X-ray microradiography and microtomography is reported as a tool for crystal visualization, location and characterization on the macromolecular crystallography beamlines at the Diamond Light Source. The technique is particularly useful for microcrystals and for crystals mounted in opaque materials such as lipid cubic phase. X-ray diffraction raster scanning can be used in combination with radiography to allow informed decision-making at the beamline prior to diffraction data collection. It is demonstrated that the X-ray dose required for a full tomography measurement is similar to that for a diffraction grid-scan, but for sample location and shape estimation alone just a few radiographic projections may be required. PMID:23793151

  15. Visualization of membrane protein crystals in lipid cubic phase using X-ray imaging.

    PubMed

    Warren, Anna J; Armour, Wes; Axford, Danny; Basham, Mark; Connolley, Thomas; Hall, David R; Horrell, Sam; McAuley, Katherine E; Mykhaylyk, Vitaliy; Wagner, Armin; Evans, Gwyndaf

    2013-07-01

    The focus in macromolecular crystallography is moving towards even more challenging target proteins that often crystallize on much smaller scales and are frequently mounted in opaque or highly refractive materials. It is therefore essential that X-ray beamline technology develops in parallel to accommodate such difficult samples. In this paper, the use of X-ray microradiography and microtomography is reported as a tool for crystal visualization, location and characterization on the macromolecular crystallography beamlines at the Diamond Light Source. The technique is particularly useful for microcrystals and for crystals mounted in opaque materials such as lipid cubic phase. X-ray diffraction raster scanning can be used in combination with radiography to allow informed decision-making at the beamline prior to diffraction data collection. It is demonstrated that the X-ray dose required for a full tomography measurement is similar to that for a diffraction grid-scan, but for sample location and shape estimation alone just a few radiographic projections may be required.

  16. One-Micron Beams for Macromolecular Crystallography at GM/CA-CAT

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yoder, D. W.; Sanishvili, R.; Xu, S.

    2010-06-23

    GM/CA-CAT has developed a 1-{mu}m beam for challenging micro-diffraction experiments with macromolecular crystals (e.g. small crystals) and for radiation damage studies. Reflective (Kirkpatrick-Baez mirrors) and diffractive (Fresnel zone plates) optics have been used to focus the beam. Both cases are constrained by the need to maintain a small beam convergence. Using two different zone plates, 1.0x1.0 and 0.8x0.9 {mu}m{sup 2} (VxH,FWHM) beams were created at 15.2 keV and 18.5 keV, respectively. Additionally, by introducing a vertical focusing mirror upstream of the zone plate, a line focus at 15.2 keV was created (28x1.4 {mu}m{sup 2} VxH,FWHM) with the line oriented perpendicularmore » to the X-ray polarization and the crystal rotation axis. Crystal-mounting stages with nanometer resolution have been assembled to profile these beams and to perform diffraction experiments.« less

  17. Purification, crystallization and preliminary diffraction studies of an ectromelia virus glutaredoxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bacik, John-Paul; Brigley, Angela M.; Channon, Lisa D.

    2005-06-01

    Ectromelia virus glutaredoxin has been crystallized in the presence of the reducing agent DTT. A diffraction data set has been collected and processed to 1.8 Å resolution. Ectromelia, vaccinia, smallpox and other closely related viruses of the orthopoxvirus genus encode a glutaredoxin gene that is not present in poxviruses outside of this genus. The vaccinia glutaredoxin O2L has been implicated as the reducing agent for ribonucleotide reductase and may thus play an important role in viral deoxyribonucleotide synthesis. As part of an effort to understand nucleotide metabolism by poxviruses, EVM053, the O2L ortholog of the ectromelia virus, has been crystallized.more » EVM053 crystallizes in space group C222{sub 1}, with unit-cell parameters a = 61.98, b = 67.57, c = 108.55 Å. Diffraction data have been processed to 1.8 Å resolution and a self-rotation function indicates that there are two molecules per asymmetric unit.« less

  18. Crystallization and preliminary X-ray diffraction analysis of FabG from Yersinia pestis.

    PubMed

    Nanson, Jeffrey David; Forwood, Jade Kenneth

    2014-01-01

    The type II fatty-acid biosynthesis pathway of bacteria provides enormous potential for antibacterial drug development owing to the structural differences between this and the type I fatty-acid biosynthesis system found in mammals. β-Ketoacyl-ACP reductase (FabG) is responsible for the reduction of the β-ketoacyl group linked to acyl carrier protein (ACP), and is essential for the formation of fatty acids and bacterial survival. Here, the cloning, expression, purification, crystallization and diffraction of FabG from Yersinia pestis (ypFabG), the highly virulent causative agent of plague, are reported. Recombinant FabG was expressed, purified to homogeneity and crystallized via the hanging-drop vapour-diffusion technique. Diffraction data were collected at the Australian Synchrotron to 2.30 Å resolution. The crystal displayed P2(1)2(1)2(1) symmetry, with unit-cell parameters a = 68.22, b = 98.68, c = 169.84 Å, and four ypFabG molecules in the asymmetric unit.

  19. Expression and crystallographic studies of the Arabidopsis thaliana GDP-D-mannose pyrophosphorylase VTC1.

    PubMed

    Zhao, Shun; Liu, Lin

    2016-10-01

    GDP-D-mannose pyrophosphorylase catalyzes the production of GDP-D-mannose, an intermediate product in the plant ascorbic acid (AsA) biosynthetic pathway. This enzyme is a key regulatory target in AsA biosynthesis and is encoded by VITAMIN C DEFECTIVE 1 (VTC1) in the Arabidopsis thaliana genome. Here, recombinant VTC1 was expressed, purified and crystallized. Diffraction data were obtained from VTC1 crystals grown in the absence and presence of substrate using X-rays. The ligand-free VTC1 crystal diffracted X-rays to 3.3 Å resolution and belonged to space group R32, with unit-cell parameters a = b = 183.6, c = 368.5 Å, α = β = 90, γ = 120°; the crystal of VTC1 in the presence of substrate diffracted X-rays to 1.75 Å resolution and belonged to space group P2 1 , with unit-cell parameters a = 70.8, b = 83.9, c = 74.5 Å, α = γ = 90.0, β = 114.9°.

  20. Crystallization and preliminary crystallographic analysis of maganese(II)-dependent 2,3-dihydroxybiphenyl 1,2-dioxygenase from Bacillus sp. JF8

    PubMed Central

    Senda, Miki; Hatta, Takashi; Kimbara, Kazuhide; Senda, Toshiya

    2010-01-01

    A thermostable manganese(II)-dependent 2,3-dihydroxybiphenyl-1,2-dioxygenase derived from Bacillus sp. JF8 was crystallized. The initial screening for crystallization was performed by the sitting-drop vapour-diffusion method using a crystallization robot, resulting in the growth of two crystal forms. The first crystal belonged to space group P1, with unit-cell parameters a = 62.7, b = 71.4, c = 93.6 Å, α = 71.2, β = 81.0, γ = 64.0°, and diffracted to 1.3 Å resolution. The second crystal belonged to space group I222, with unit-cell parameters a = 74.2, b = 90.8, c = 104.3 Å, and diffracted to 1.3 Å resolution. Molecular-replacement trials using homoprotocatechuate 2,3-dioxygenase from Arthrobacter globiformis (28% amino-acid sequence identity) as a search model provided a satisfactory solution for both crystal forms. PMID:20208161

  1. Analysis of submicron-sized niflumic acid crystals prepared by electrospray crystallization.

    PubMed

    Ambrus, Rita; Radacsi, Norbert; Szunyogh, Tímea; van der Heijden, Antoine E D M; Ter Horst, Joop H; Szabó-Révész, Piroska

    2013-03-25

    Interest in submicron-sized drug particles has emerged from both laboratory and industrial perspectives in the last decade. Production of crystals in the nano size scale offers a novel way to particles for drug formulation solving formulation problems of drugs with low solubility in class II of the Biopharmaceutical Classification System. In this work niflumic acid nanoparticles with a size range of 200-800nm were produced by the novel crystallization method, electrospray crystallization. Their properties were compared to those from evaporative and anti-solvent crystallizations, using the same organic solvent, acetone. There is a remarkable difference in the product crystal size depending on the applied methods. The size and morphology were analyzed by scanning electron microscopy and laser diffraction. The structure of the samples was investigated using differential scanning calorimetry, Fourier-transformed infrared spectroscopy and X-ray powder diffraction. The particles produced using electrospray crystallization process were probably changing from amorphous to crystalline state after the procedure. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. High-throughput crystallization screening.

    PubMed

    Skarina, Tatiana; Xu, Xiaohui; Evdokimova, Elena; Savchenko, Alexei

    2014-01-01

    Protein structure determination by X-ray crystallography is dependent on obtaining a single protein crystal suitable for diffraction data collection. Due to this requirement, protein crystallization represents a key step in protein structure determination. The conditions for protein crystallization have to be determined empirically for each protein, making this step also a bottleneck in the structure determination process. Typical protein crystallization practice involves parallel setup and monitoring of a considerable number of individual protein crystallization experiments (also called crystallization trials). In these trials the aliquots of purified protein are mixed with a range of solutions composed of a precipitating agent, buffer, and sometimes an additive that have been previously successful in prompting protein crystallization. The individual chemical conditions in which a particular protein shows signs of crystallization are used as a starting point for further crystallization experiments. The goal is optimizing the formation of individual protein crystals of sufficient size and quality to make them suitable for diffraction data collection. Thus the composition of the primary crystallization screen is critical for successful crystallization.Systematic analysis of crystallization experiments carried out on several hundred proteins as part of large-scale structural genomics efforts allowed the optimization of the protein crystallization protocol and identification of a minimal set of 96 crystallization solutions (the "TRAP" screen) that, in our experience, led to crystallization of the maximum number of proteins.

  3. Expression, purification, crystallization and X-ray diffraction studies of the molecular chaperone prefoldin from Homo sapiens.

    PubMed

    Aikawa, Yoshiki; Kida, Hiroshi; Nishitani, Yuichi; Miki, Kunio

    2015-09-01

    Proper protein folding is an essential process for all organisms. Prefoldin (PFD) is a molecular chaperone that assists protein folding by delivering non-native proteins to group II chaperonin. A heterohexamer of eukaryotic PFD has been shown to specifically recognize and deliver non-native actin and tubulin to chaperonin-containing TCP-1 (CCT), but the mechanism of specific recognition is still unclear. To determine its crystal structure, recombinant human PFD was reconstituted, purified and crystallized. X-ray diffraction data were collected to 4.7 Å resolution. The crystals belonged to space group P21212, with unit-cell parameters a = 123.2, b = 152.4, c = 105.9 Å.

  4. Structural analysis of bacteriophage-encoded peptidoglycan hydrolase domain KMV36C: crystallization and preliminary X-ray diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita

    2008-04-01

    Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)

  5. Expression, purification, crystallization and preliminary X-ray analysis of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from Helicobacter pylori

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Elliott, Paul R.; Mohammad, Shabaz; Melrose, Helen J.

    2008-08-01

    Glyceraldehyde-3-phosphate dehydrogenase B from H. pylori has been cloned, expressed, purified and crystallized in the presence of NAD. Crystals of GAPDHB diffracted to 2.8 Å resolution and belonged to space group P6{sub 5}22, with unit-cell parameters a = b = 166.1, c = 253.1 Å. Helicobacter pylori is a dangerous human pathogen that resides in the upper gastrointestinal tract. Little is known about its metabolism and with the onset of antibiotic resistance new treatments are required. In this study, the expression, purification, crystallization and preliminary X-ray diffraction of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from H. pylori are reported.

  6. Crystallization and X-ray diffraction analysis of 6-­aminohexanoate-dimer hydrolase from Arthrobacter sp. KI72

    PubMed Central

    Ohki, Taku; Mizuno, Nobuhiro; Shibata, Naoki; Takeo, Masahiro; Negoro, Seiji; Higuchi, Yoshiki

    2005-01-01

    To investigate the structure–function relationship between 6-aminohexanoate-dimer hydrolase (EII) from Arthrobacter sp. and a cryptic protein (EII′) which shows 88% sequence identity to EII, a hybrid protein (named Hyb-24) of EII and EII′ was overexpressed, purified and crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant in MES buffer pH 6.5. The crystal belongs to space group P3121 or P3221, with unit-cell parameters a = b = 96.37, c = 113.09 Å. Diffraction data were collected from native and methylmercuric chloride derivative crystals to resolutions of 1.75 and 1.80 Å, respectively. PMID:16511198

  7. Crystal Structure of Hydrazinium Iodide by Neutron Diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Campbell, Eric V.; Wang, Xiaoping; Miller, Joel S.

    The structure of hydrazinium iodide, [H 5N 2] +·I -, at 100 K has monoclinic (P2 1/n) symmetry from single crystal neutron diffraction with a = 7.4599(7) Å, b = 5.3185(6) Å, c = 10.1628(11) Å, β = 103.150(10)°, V = 392.64(7) Å 3, Z = 4. The refinement converged to R = 0.0575, wR 2 = 0.1602, S = 1.022. Data for the crystal structure was collected on the SNS TOPAZ single-crystal time-of-flight Laue diffractometer. The compound has a one-dimensional structure which displays N–H···N hydrogen bonding. Finally, accurate intra- and intermolecular N–H distances have been determined.

  8. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  9. Crystal structure of methylprednisolone acetate form II, C 24H 32O 6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wheatley, Austin M.; Kaduk, James A.; Gindhart, Amy M.

    The crystal structure of methylprednisolone acetate form II, C 24H 32O 6, has been solved and refined using synchrotron X-ray powder diffraction data, and optimized using density functional techniques. Methylprednisolone acetate crystallizes in space groupP2 12 12 1(#19) witha= 8.17608(2),b= 9.67944(3),c= 26.35176(6) Å,V= 2085.474(6) Å 3, andZ= 4. Both hydroxyl groups act as hydrogen bond donors, resulting in a two-dimensional hydrogen bond network in theabplane. C–H…O hydrogen bonds also contribute to the crystal energy. The powder pattern is included in the Powder Diffraction File™ as entry 00-065-1412.

  10. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  11. Crystal Structure of Hydrazinium Iodide by Neutron Diffraction

    DOE PAGES

    Campbell, Eric V.; Wang, Xiaoping; Miller, Joel S.

    2017-10-31

    The structure of hydrazinium iodide, [H 5N 2] +·I -, at 100 K has monoclinic (P2 1/n) symmetry from single crystal neutron diffraction with a = 7.4599(7) Å, b = 5.3185(6) Å, c = 10.1628(11) Å, β = 103.150(10)°, V = 392.64(7) Å 3, Z = 4. The refinement converged to R = 0.0575, wR 2 = 0.1602, S = 1.022. Data for the crystal structure was collected on the SNS TOPAZ single-crystal time-of-flight Laue diffractometer. The compound has a one-dimensional structure which displays N–H···N hydrogen bonding. Finally, accurate intra- and intermolecular N–H distances have been determined.

  12. Single-Crystal Structure of a Covalent Organic Framework

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, YB; Su, J; Furukawa, H

    2013-11-06

    The crystal structure of a new covalent organic framework, termed COF-320, is determined by single-crystal 3D electron diffraction using the rotation electron diffraction (RED) method for data collection. The COF crystals are prepared by an imine condensation of tetra-(4-anilyl)methane and 4,4'-biphenyldialdehyde in 1,4-dioxane at 120 degrees C to produce a highly porous 9-fold interwoven diamond net. COF-320 exhibits permanent porosity with a Langmuir surface area of 2400 m(2)/g and a methane total uptake of 15.0 wt % (176 cm(3)/cm(3)) at 25 degrees C and 80 bar. The successful determination of the structure of COF-320 directly from single-crystal samples is anmore » important advance in the development of COF chemistry.« less

  13. Tunable hard X-ray spectrometer utilizing asymmetric planes of a quartz transmission crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seely, John F., E-mail: seelyjf@gmail.com; Feldman, Uri; Henins, Albert

    2016-05-15

    A Cauchois type hard x-ray spectrometer was developed that utilizes the (301) diffraction planes at an asymmetric angle of 23.51° to the normal to the surface of a cylindrically curved quartz transmission crystal. The energy coverage is tunable by rotating the crystal and the detector arm, and spectra were recorded in the 8 keV to 20 keV range with greater than 2000 resolving power. The high resolution results from low aberrations enabled by the nearly perpendicular angle of the diffracted rays with the back surface of the crystal. By using other asymmetric planes of the same crystal and rotating tomore » selected angles, the spectrometer can operate with high resolution up to 50 keV.« less

  14. Purification, crystallization, and preliminary X-ray diffraction study of purine nucleoside phosphorylase from E. coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abramchik, Yu. A., E-mail: inna@ns.crys.ras.ru; Timofeev, V. I., E-mail: espiov@ibch.ru; Zhukhlistova, N. E., E-mail: tostars@mail.ru

    2015-07-15

    Crystals of E. coli purine nucleoside phosphorylase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 0.99 Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unit-cell parameters: a = 74.1 Å, b = 110.2 Å, c = 88.2 Å, α = γ = 90°, β = 111.08°. The crystal contains six subunits of the enzyme comprising a hexamer per asymmetric unit. The hexamermore » is the biological active form of E. coli. purine nucleoside phosphorylase.« less

  15. Crystal growth of enzymes in low gravity (L-5)

    NASA Technical Reports Server (NTRS)

    Morita, Yuhei

    1993-01-01

    Recent developments in protein engineering have expanded the possibilities of studies of enzymes and other proteins. Now such studies are not limited to the elucidation of the relationship between the structure and function of the protein. They also aim at the production of proteins with new and practical functions, based on results obtained during investigation of structure and function. For continuing research in this field, investigation of the tertiary structure of proteins is important. X-ray diffraction of single crystals of protein is usually used for this purpose. The main difficulty is the preparation of the crystals. The theme of the research is to prepare such crystals at very low gravity, with the main purpose being to obtain large single crystals of proteins suitable for x-ray diffraction studies.

  16. Crystallization and preliminary X-ray diffraction analysis of the small laccase from Streptomyces coelicolor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Skálová, Tereza, E-mail: skalova@imc.cas.cz; Dohnálek, Jan; Institute of Physics, Academy of Sciences of the Czech Republic, Cukrovarnicka 10, 162 53 Praha 6

    2007-12-01

    The expression, purification and crystallization of the small laccase from S. coelicolor are reported. Diffraction data were collected to 3 Å resolution. The small bacterial laccase from the actinobacterium Streptomyces coelicolor which lacks the second of the three domains of the laccases structurally characterized to date was crystallized. This multi-copper phenol oxidase crystallizes in a primitive tetragonal lattice, with unit-cell parameters a = b = 179.8, c = 175.3 Å. The crystals belong to either space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2. The self-rotation function shows the presence of a noncrystallographic threefold axis in the structure. Phases willmore » be determined from the anomalous signal of the natively present copper ions.« less

  17. Crystallization and X-ray diffraction analysis of a novel immune-type receptor from Ictalurus punctatus and phasing by selenium anomalous dispersion methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ostrov, David A., E-mail: ostroda@pathology.ufl.edu; Hernández Prada, José A.; Haire, Robert N.

    2007-12-01

    A highly diversified novel immune-type receptor from catfish, NITR10, was crystallized to reveal novel mechanisms of immune recognition. X-ray diffraction data from crystals of a novel immune-type receptor (NITR10 from the catfish Ictalurus punctatus) were collected to 1.65 Å resolution and reduced to the primitive hexagonal lattice. Native and selenomethionine derivatives of NITR10 crystallized under different conditions yielded P3{sub 1}21 crystals. SeMet NITR10 was phased to a correlation coefficient of 0.77 by SAD methods and experimental electron-density maps were calculated to 1.65 Å. Five NITR10 molecules are predicted to be present in the asymmetric unit based on the Matthews coefficient.

  18. A novel structure of gel grown strontium cyanurate crystal and its structural, optical, electrical characterization

    NASA Astrophysics Data System (ADS)

    Divya, R.; Nair, Lekshmi P.; Bijini, B. R.; Nair, C. M. K.; Gopakumar, N.; Babu, K. Rajendra

    2017-12-01

    Strontium cyanurate crystals with novel structure and unique optical property like mechanoluminescence have been grown by conventional gel method. Transparent crystals were obtained. The single crystal X-ray diffraction analysis reveals the exquisite structure of the grown crystal. The crystal is centrosymmetric and has a three dimensional polymeric structure. The powder X ray diffraction analysis confirms its crystalline nature. The functional groups present in the crystal were identified by Fourier transform infrared spectroscopy. Elemental analysis confirmed the composition of the complex. A study of thermal properties was done by thermo gravimetric analysis and differential thermal analysis. The optical properties like band gap, refractive index and extinction coefficient were evaluated from the UV visible spectral analysis. The etching study was done to reveal the dislocations in the crystal which in turn explains mechanoluminescence emission. The mechanoluminescence property exhibited by the crystal makes it suitable for stress sensing applications. Besides being a centrosymmetric crystal, it also exhibits NLO behavior. Dielectric properties were studied and theoretical calculations of Fermi energy, valence electron plasma energy, penn gap and polarisability have been done.

  19. Improved crystal orientation and physical properties from single-shot XFEL stills

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sauter, Nicholas K., E-mail: nksauter@lbl.gov; Hattne, Johan; Brewster, Aaron S.

    X-ray free-electron laser crystallography relies on the collection of still-shot diffraction patterns. New methods are developed for optimal modeling of the crystals’ orientations and mosaic block properties. X-ray diffraction patterns from still crystals are inherently difficult to process because the crystal orientation is not uniquely determined by measuring the Bragg spot positions. Only one of the three rotational degrees of freedom is directly coupled to spot positions; the other two rotations move Bragg spots in and out of the reflecting condition but do not change the direction of the diffracted rays. This hinders the ability to recover accurate structure factorsmore » from experiments that are dependent on single-shot exposures, such as femtosecond diffract-and-destroy protocols at X-ray free-electron lasers (XFELs). Here, additional methods are introduced to optimally model the diffraction. The best orientation is obtained by requiring, for the brightest observed spots, that each reciprocal-lattice point be placed into the exact reflecting condition implied by Bragg’s law with a minimal rotation. This approach reduces the experimental uncertainties in noisy XFEL data, improving the crystallographic R factors and sharpening anomalous differences that are near the level of the noise.« less

  20. Trapezoidal diffraction grating beam splitters in single crystal diamond

    NASA Astrophysics Data System (ADS)

    Kiss, Marcell; Graziosi, Teodoro; Quack, Niels

    2018-02-01

    Single Crystal Diamond has been recognized as a prime material for optical components in high power applications due to low absorption and high thermal conductivity. However, diamond microstructuring remains challenging. Here, we report on the fabrication and characterization of optical diffraction gratings exhibiting a symmetric trapezoidal profile etched into a single crystal diamond substrate. The optimized grating geometry diffracts the transmitted optical power into precisely defined proportions, performing as an effective beam splitter. We fabricate our gratings in commercially available single crystal CVD diamond plates (2.6mm x 2.6mm x 0.3mm). Using a sputter deposited hard mask and patterning by contact lithography, the diamond is etched in an inductively coupled oxygen plasma with zero platen power. The etch process effectively reveals the characteristic {111} diamond crystal planes, creating a precisely defined angled (54.7°) profile. SEM and AFM measurements of the fabricated gratings evidence the trapezoidal shape with a pitch of 3.82μm, depth of 170 nm and duty cycle of 35.5%. Optical characterization is performed in transmission using a 650nm laser source perpendicular to the sample. The recorded transmitted optical power as function of detector rotation angle shows a distribution of 21.1% in the 0th order and 23.6% in each +/-1st order (16.1% reflected, 16.6% in higher orders). To our knowledge, this is the first demonstration of diffraction gratings with trapezoidal profile in single crystal diamond. The fabrication process will enable beam splitter gratings of custom defined optical power distribution profiles, while antireflection coatings can increase the efficiency.

  1. Liquid-Crystal Point-Diffraction Interferometer for Wave-Front Measurements

    NASA Technical Reports Server (NTRS)

    Mercer, Carolyn R.; Creath, Katherine

    1996-01-01

    A new instrument, the liquid-crystal point-diffraction interferometer (LCPDI), is developed for the measurement of phase objects. This instrument maintains the compact, robust design of Linnik's point-diffraction interferometer and adds to it a phase-stepping capability for quantitative interferogram analysis. The result is a compact, simple to align, environmentally insensitive interferometer capable of accurately measuring optical wave fronts with very high data density and with automated data reduction. We describe the theory and design of the LCPDI. A focus shift was measured with the LCPDI, and the results are compared with theoretical results,

  2. Mapping 180° polar domains using electron backscatter diffraction and dynamical scattering simulations

    DOE PAGES

    Burch, Matthew J.; Fancher, Chris M.; Patala, Srikanth; ...

    2016-11-18

    A novel technique, which directly and nondestructively maps polar domains using electron backscatter diffraction (EBSD) is described and demonstrated. Through dynamical diffraction simulations and quantitative comparison to experimental EBSD patterns, the absolute orientation of a non-centrosymmetric crystal can be determined. With this information, the polar domains of a material can be mapped. The technique is demonstrated by mapping the non-ferroelastic, or 180°, ferroelectric domains in periodically poled LiNbO 3 single crystals. Furthermore, the authors demonstrate the possibility of mapping polarity using this technique in other polar materials system.

  3. XRayView: a teaching aid for X-ray crystallography.

    PubMed

    Phillips, G N

    1995-10-01

    A software package, XRayView, has been developed that uses interactive computer graphics to introduce basic concepts of x-ray diffraction by crystals, including the reciprocal lattice, the Ewald sphere construction, Laue cones, the wavelength dependence of the reciprocal lattice, primitive and centered lattices and systematic extinctions, rotation photography. Laue photography, space group determination and Laue group symmetry, and the alignment of crystals by examination of reciprocal space. XRayView is designed with "user-friendliness" in mind, using pull-down menus to control the program. Many of the experiences of using real x-ray diffraction equipment to examine crystalline diffraction can be simulated. Exercises are available on-line to guide the users through many typical x-ray diffraction experiments.

  4. Cued Recall from Image and Sentence Memory: A Shift from Episodic to Identical Elements Representation

    ERIC Educational Resources Information Center

    Rickard, Timothy C.; Bajic, Daniel

    2006-01-01

    The applicability of the identical elements (IE) model of arithmetic fact retrieval (T. C. Rickard, A. F. Healy, & L. E. Bourne, 1994) to cued recall from episodic (image and sentence) memory was explored in 3 transfer experiments. In agreement with results from arithmetic, speedup following even minimal practice recalling a missing word from an…

  5. Computational Study of Shock-Associated Noise Characteristics Using LES

    DTIC Science & Technology

    2014-10-03

    REFERENCES [1] Harper-Bourne, M., and Fisher, M. J., “The Noise from Shock Waves in Supersonic Jets,” AGARD - CP -131, 1973, pp. 1-13. [2] Tam, C. K...J. M., “Broadband Shock Noise from Supersonic Jets,” AIAA Journal, Volume 20, No. 1, 1982, pp. 68- 73 . [9] Seiner, J. M., “Advances in High Speed

  6. The Effectiveness of Combining Tangible Symbols with the Picture Exchange Communication System to Teach Requesting Skills to Children with Multiple Disabilities Including Visual Impairment

    ERIC Educational Resources Information Center

    Ali, Emad

    2009-01-01

    The Picture Exchange Communication System (PECS) is an augmentative and alternative communication program (Frost & Bondy, 2002). Although PECS has been effectively used to teach functional requesting skills for children with autism, mental retardation, visual impairment, and physical disabilities (e.g., Anderson, Moore, & Bourne, 2007; Chambers &…

  7. ENVIRONMENTAL TECHNOLOGY VERIFICATION: Reduction of Nitrogen in Domestic Wastewater from Individual Residential Homes. BioConcepts, Inc. ReCip® RTS ~ 500 System

    EPA Science Inventory

    Verification testing of the ReCip® RTS-500 System was conducted over a 12-month period at the Massachusetts Alternative Septic System Test Center (MASSTC) located on Otis Air National Guard Base in Bourne, Massachusetts. A nine-week startup period preceded the verification test t...

  8. Occurrence of Cymbasoma longispinosum Bourne, 1890 in the Curuçá River estuary.

    PubMed

    Leite, Natália R; Pereira, Luci C C; Abrunhosa, Fernando; Pires, Marcus A B; Costa, Rauquírio M da

    2010-09-01

    The present work was carried out to verify the occurrence and distribution of Cymbasoma longispinosum Bourne, 1890 in a tropical Amazon estuary from North Brazil. Samplings were performed bimonthly from July/2003 to July/2004 at two different transects (Muriá and Curuçá rivers) situated along the Curuçá estuary (Pará, North Brazil). Samples were collected during neap tides via gentle (1 to 1.5 knots) 200 μm-mesh net tows from a small boat. Additional subsurface water samples were collected for the determination of environmental parameters. Males and females of Cymbasoma longispinosum were only observed during September and November/2003. The highest number of organisms was found in September/2003 at the Muriá River transect. The presence of C. longispinosum in samples obtained during September and November/2003 could probably be related to the reproductive period of this species in the studied estuary, which is directly related to the dry period in the region. The highest salinity values and the highest number of individuals observed in September/2003 corroborate with the previous assumption, since no C. longispinosum was found during the months comprising the rainy period (January to June).

  9. Growth, crystalline perfection, spectral, thermal and theoretical studies on imidazolium L-tartrate crystals.

    PubMed

    Meena, K; Muthu, K; Meenatchi, V; Rajasekar, M; Bhagavannarayana, G; Meenakshisundaram, S P

    2014-04-24

    Transparent optical quality single crystals of imidazolium L-tartrate (IMLT) were grown by conventional slow evaporation solution growth technique. Crystal structure of the as-grown IMLT was determined by single crystal X-ray diffraction analysis. Thermal analysis reveals the purity of the crystal and the sample is stable up to the melting point. Good transmittance in the visible region is observed and the band gap energy is estimated using diffuse reflectance data by the application of Kubelka-Munk algorithm. The powder X-ray diffraction study reveals the crystallinity of the as-grown crystal and it is compared with that of the experimental one. An additional peak in high resolution X-ray diffraction (HRXRD) indicates the presence of an internal structural low angle boundary. Second harmonic generation (SHG) activity of IMLT is significant as estimated by Kurtz and Perry powder technique. HOMO-LUMO energies and first-order molecular hyperpolarizability of IMLT have been evaluated using density functional theory (DFT) employing B3LYP functional and 6-31G(d,p) basis set. The optimized geometry closely resembles the ORTEP. The vibrational patterns present in the molecule are confirmed by FT-IR coinciding with theoretical patterns. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Purification, crystallization and preliminary X-ray analysis of Enterococcus faecium aminoglycoside-2′′-phosphotransferase-Ib [APH(2′′)-Ib

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Walanj, Rupa; Young, Paul; Baker, Heather M.

    2005-04-01

    APH(2′′)-Ib is an enzyme responsible for high-level gentamicin resistance in E. faecium isolates. Native crystals of this enzyme have been prepared and preliminary X-ray diffraction experiments have been undertaken. Bacterial resistance to the aminoglycoside antibiotics is primarily the result of deactivation of the drugs. Three families of enzymes are responsible for this activity, with one such family being the aminoglycoside phosphotransferases (APHs). The gene encoding one of these enzymes, APH(2′′)-Ib, has been cloned and the protein (comprising 299 amino-acid residues) expressed in Escherichia coli, purified and crystallized in the presence of 16%(w/v) PEG 3350 and gentamicin. The crystals belong tomore » the monoclinic space group P2{sub 1}, with approximate unit-cell parameters a = 79.7, b = 58.8, c = 81.4 Å, β = 98.4°, and preliminary X-ray diffraction analysis is consistent with the presence of two molecules in the asymmetric unit. Synchrotron diffraction data to approximately 2.65 Å resolution were collected from a native APH(2′′)-Ib crystal at beamline BL9-2 at SSRL (Stanford, CA, USA). Selenium-substituted crystals have also been produced and structure determination is proceeding.« less

  11. Four crystal forms of a Bence-Jones protein

    PubMed Central

    Makino, Debora L.; Henschen-Edman, Agnes H.; McPherson, Alexander

    2005-01-01

    Four crystal forms have been grown and characterized by X-ray diffraction of a Bence-Jones protein collected from the urine of a multiple myeloma patient more than 40 years ago. Closely related tetragonal and orthorhombic forms belonging to space groups P43212 and P212121, with unit-cell parameters a = b = 68.7, c = 182.1 and a = 67.7, b = 69.4, c = 87.3 Å, diffract to 1.5 and 1.9 Å, respectively. Two closely related trigonal forms, both belonging to space group P3121 with unit-cell parameters a = b = 154.3 Å but differing by a doubling of the c axis, one 46.9 Å and the other 94.0 Å, diffract to 2.9 and 2.6 Å resolution, respectively. The trigonal crystal of short c-axis length shows a positive indication of twinning. The trigonal crystal of longer c axis, which appeared only after eight months of incubation at room temperature, is likely to be composed of proteolytically degraded molecules and unlike the other crystal forms contains two entire Bence-Jones dimers in the asymmetric unit. This latter crystal form may shed some light on the formation of fibrils common to certain storage diseases. PMID:16508097

  12. An Overview of Hardware for Protein Crystallization in a Magnetic Field.

    PubMed

    Yan, Er-Kai; Zhang, Chen-Yan; He, Jin; Yin, Da-Chuan

    2016-11-16

    Protein crystallization under a magnetic field is an interesting research topic because a magnetic field may provide a special environment to acquire improved quality protein crystals. Because high-quality protein crystals are very useful in high-resolution structure determination using diffraction techniques (X-ray, neutron, and electron diffraction), research using magnetic fields in protein crystallization has attracted substantial interest; some studies have been performed in the past two decades. In this research field, the hardware is especially essential for successful studies because the environment is special and the design and utilization of the research apparatus in such an environment requires special considerations related to the magnetic field. This paper reviews the hardware for protein crystallization (including the magnet systems and the apparatus designed for use in a magnetic field) and progress in this area. Future prospects in this field will also be discussed.

  13. Diagnosing the Internal Architecture of Zeolite Ferrierite

    PubMed Central

    Schmidt, Joel E.; Hendriks, Frank C.; Lutz, Martin; Post, L. Christiaan; Fu, Donglong

    2017-01-01

    Abstract Large crystals of zeolite ferrierite (FER) are important model systems for spatially resolved catalysis and diffusion studies, though there is considerable variation in crystal habit depending on the chemical composition and employed synthesis conditions. A synergistic combination of techniques has been applied, including single crystal X‐ray diffraction, high‐temperature in situ confocal fluorescence microscopy, fluorescent probe molecules, wide‐field microscopy and atomic force microscopy to unravel the internal architecture of three distinct FER zeolites. Pyrolyzed template species can be used as markers for the 8‐membered ring direction as they are trapped in the terraced roof of the FER crystals. This happens as the materials grow in a layer‐by‐layer, defect‐free manner normal to the large crystal surface, and leads to a facile method to diagnose the pore system orientation, which avoids tedious single crystal X‐ray diffraction experiments. PMID:28809081

  14. An Overview of Hardware for Protein Crystallization in a Magnetic Field

    PubMed Central

    Yan, Er-Kai; Zhang, Chen-Yan; He, Jin; Yin, Da-Chuan

    2016-01-01

    Protein crystallization under a magnetic field is an interesting research topic because a magnetic field may provide a special environment to acquire improved quality protein crystals. Because high-quality protein crystals are very useful in high-resolution structure determination using diffraction techniques (X-ray, neutron, and electron diffraction), research using magnetic fields in protein crystallization has attracted substantial interest; some studies have been performed in the past two decades. In this research field, the hardware is especially essential for successful studies because the environment is special and the design and utilization of the research apparatus in such an environment requires special considerations related to the magnetic field. This paper reviews the hardware for protein crystallization (including the magnet systems and the apparatus designed for use in a magnetic field) and progress in this area. Future prospects in this field will also be discussed. PMID:27854318

  15. Purification, crystallization and preliminary X-ray diffraction analysis of GatD, a glutamine amidotransferase-like protein from Staphylococcus aureus peptidoglycan

    PubMed Central

    Vieira, Diana; Figueiredo, Teresa A.; Verma, Anil; Sobral, Rita G.; Ludovice, Ana M.; de Lencastre, Hermínia; Trincao, Jose

    2014-01-01

    Amidation of peptidoglycan is an essential feature in Staphylococcus aureus that is necessary for resistance to β-lactams and lysozyme. GatD, a 27 kDa type I glutamine amidotransferase-like protein, together with MurT ligase, catalyses the amidation reaction of the glutamic acid residues of the peptidoglycan of S. aureus. The native and the selenomethionine-derivative proteins were crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol, sodium acetate and calcium acetate. The crystals obtained diffracted beyond 1.85 and 2.25 Å, respectively, and belonged to space group P212121. X-ray diffraction data sets were collected at Diamond Light Source (on beamlines I02 and I04) and were used to obtain initial phases. PMID:24817726

  16. (NZ)CH...O contacts assist crystallization of a ParB-like nuclease.

    PubMed

    Shaw, Neil; Cheng, Chongyun; Tempel, Wolfram; Chang, Jessie; Ng, Joseph; Wang, Xin-Yu; Perrett, Sarah; Rose, John; Rao, Zihe; Wang, Bi-Cheng; Liu, Zhi-Jie

    2007-07-07

    The major bottleneck for determination of 3 D structures of proteins using X-rays is the production of diffraction quality crystals. Often proteins are subjected to chemical modification to improve the chances of crystallization Here, we report the successful crystallization of a nuclease employing a reductive methylation protocol. The key to crystallization was the successful introduction of 44 new cohesive (NZ) CH...O contacts (3.2-3.7 A) by the addition of 2 methyl groups to the side chain amine nitrogen (NZ) of 9 lysine residues of the nuclease. The new contacts dramatically altered the crystallization properties of the protein, resulting in crystals that diffracted to 1.2 A resolution. Analytical ultracentrifugation analysis and thermodynamics results revealed a more compact protein structure with better solvent exclusion of buried Trp residues in the folded state of the methylated protein, assisting crystallization. In this study, introduction of novel cohesive (NZ)CH...O contacts by reductive methylation resulted in the crystallization of a protein that had previously resisted crystallization in spite of extensive purification and crystallization space screening. Introduction of (NZ)CH...O contacts could provide a solution to crystallization problems for a broad range of protein targets.

  17. Synthesis, crystal growth, optical, thermal, and mechanical properties of a nonlinear optical single crystal: ammonium sulfate hydrogen sulphamate (ASHS)

    NASA Astrophysics Data System (ADS)

    Sudhakar, K.; Nandhini, S.; Muniyappan, S.; Arumanayagam, T.; Vivek, P.; Murugakoothan, P.

    2018-04-01

    Ammonium sulfate hydrogen sulphamate (ASHS), an inorganic nonlinear optical crystal, was grown from the aqueous solution by slow evaporation solution growth technique. The single-crystal XRD confirms that the grown single crystal belongs to the orthorhombic system with the space group of Pna21. Powder XRD confirms the crystalline nature and the diffraction planes were indexed. Crystalline perfection of grown crystal was analysed by high-resolution X-ray diffraction rocking curve technique. UV-Vis-NIR studies revealed that ASHS crystal has optical transparency 65% and lower cut-off wavelength at 218 nm. The violet light emission of the crystal was identified by photoluminescence studies. The particle size-dependent second-harmonic generation efficiency for ASHS crystal was evaluated by Kurtz-Perry powder technique using Nd:YAG laser which established the existence of phase matching. Surface laser damage threshold value was evaluated using Nd:YAG laser. Optical homogeneity of the crystal was evaluated using modified channel spectrum method through birefringence study. Thermal analysis reveals that ASHS crystal is stable up to 213 °C. The mechanical behaviour of the ASHS crystal was analysed using Vickers microhardness study.

  18. Crystal pathologies in macromolecular crystallography.

    PubMed

    Dauter, Zbigniew; Jaskólski, Mariusz

    Macromolecules, such as proteins or nucleic acids, form crystals with a large volume fraction of water, ~50% on average. Apart from typical physical defects and rather trivial poor quality problems, macromolecular crystals, as essentially any crystals, can also suffer from several kinds of pathologies, in which everything seems to be perfect, except that from the structural point of view the interpretation may be very difficult, sometimes even impossible. A frequent nuisance is pseudosymmetry, or non-crystallographic symmetry (NCS), which is particularly nasty when it has translational character. Lattice-translocation defects, also called order-disorder twinning (OD-twinning), occur when molecules are packed regularly in layers but the layers are stacked (without rotation) in two (or more) discrete modes, with a unique translocation vector. Crystal twinning arises when twin domains have different orientations, incompatible with the symmetry of the crystal structure. There are also crystals in which the periodic (lattice) order is broken or absent altogether. When the strict short-range translational order from one unit cell to the next is lost but the long-range order is restored by a periodic modulation, we have a modulated crystal structure. In quasicrystals (not observed for macromolecules yet), the periodic order (in 3D space) is lost completely and the diffraction pattern (which is still discrete) cannot be even indexed using three hkl indices. In addition, there are other physical defects and phenomena (such as high mosaicity, diffraction anisotropy, diffuse scattering, etc.) which make diffraction data processing and structure solution difficult or even impossible.

  19. X-ray transparent Microfluidics for Protein Crystallization and Biomineralization

    NASA Astrophysics Data System (ADS)

    Opathalage, Achini

    Protein crystallization demands the fundamental understanding of nucleation and applying techniques to find the optimal conditions to achieve the kinetic pathway for a large and defect free crystal. Classical nucleation theory predicts that the nucleation occurs at high supersaturation conditions. In this dissertation we sought out to develop techniques to attain optimal supersaturation profile to a large defect free crystal and subject it to in-situ X-ray diffraction using microfluidics. We have developed an emulsion-based serial crystallographic technology in nanolitre-sized droplets of protein solution encapsulated in to nucleate one crystal per drop. Diffraction data are measured, one crystal at a time, from a series of room temperature crystals stored on an X-ray semi-transparent microfluidic chip, and a 93% complete data set is obtained by merging single diffraction frames taken from different un-oriented crystals. As proof of concept, the structure of Glucose Isomerase was solved to 2.1 A. We have developed a suite of X-ray semi-transparent micrfluidic devices which enables; controlled evaporation as a method of increasing supersaturation and manipulating the phase space of proteins and small molecules. We exploited the inherently high water permeability of the thin X-ray semi-transparent devices as a mean of increasing the supersaturation by controlling the evaporation. We fabricated the X-ray semi-transparent version of the PhaseChip with a thin PDMS membrane by which the storage and the reservoir layers are separated, and studies the phase transition of amorphous CaCO3.

  20. Measurement and Interpretation of Diffuse Scattering in X-Ray Diffraction for Macromolecular Crystallography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wall, Michael E.

    X-ray diffraction from macromolecular crystals includes both sharply peaked Bragg reflections and diffuse intensity between the peaks. The information in Bragg scattering reflects the mean electron density in the unit cells of the crystal. The diffuse scattering arises from correlations in the variations of electron density that may occur from one unit cell to another, and therefore contains information about collective motions in proteins.

  1. X-Ray Structure determination of the Glycine Cleavage System Protein H of Mycobacterium tuberculosis Using An Inverse Compton Synchrotron X-Ray Source

    PubMed Central

    Abendroth, Jan; McCormick, Michael S.; Edwards, Thomas E.; Staker, Bart; Loewen, Roderick; Gifford, Martin; Rifkin, Jeff; Mayer, Chad; Guo, Wenjin; Zhang, Yang; Myler, Peter; Kelley, Angela; Analau, Erwin; Hewitt, Stephen Nakazawa; Napuli, Alberto J.; Kuhn, Peter; Ruth, Ronald D.; Stewart, Lance J.

    2010-01-01

    Structural genomics discovery projects require ready access to both X-ray and NMR instrumentation which support the collection of experimental data needed to solve large numbers of novel protein structures. The most productive X-ray crystal structure determination laboratories make extensive frequent use of tunable synchrotron X-ray light to solve novel structures by anomalous diffraction methods. This requires that frozen cryo-protected crystals be shipped to large government-run synchrotron facilities for data collection. In an effort to eliminate the need to ship crystals for data collection, we have developed the first laboratory-scale synchrotron light source capable of performing many of the state-of-the-art synchrotron applications in X-ray science. This Compact Light Source is a first-in-class device that uses inverse Compton scattering to generate X-rays of sufficient flux, tunable wavelength and beam size to allow high-resolution X-ray diffraction data collection from protein crystals. We report on benchmarking tests of X-ray diffraction data collection with hen egg white lysozyme, and the successful high-resolution X-ray structure determination of the Glycine cleavage system protein H from Mycobacterium tuberculosis using diffraction data collected with the Compact Light Source X-ray beam. PMID:20364333

  2. Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.

    2010-11-12

    Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.

  3. Strength of shock-loaded single-crystal tantalum [100] determined using in situ broadband x-ray Laue diffraction.

    PubMed

    Comley, A J; Maddox, B R; Rudd, R E; Prisbrey, S T; Hawreliak, J A; Orlikowski, D A; Peterson, S C; Satcher, J H; Elsholz, A J; Park, H-S; Remington, B A; Bazin, N; Foster, J M; Graham, P; Park, N; Rosen, P A; Rothman, S R; Higginbotham, A; Suggit, M; Wark, J S

    2013-03-15

    The strength of shock-loaded single crystal tantalum [100] has been experimentally determined using in situ broadband x-ray Laue diffraction to measure the strain state of the compressed crystal, and elastic constants calculated from first principles. The inferred strength reaches 35 GPa at a shock pressure of 181 GPa and is in excellent agreement with a multiscale strength model [N. R. Barton et al., J. Appl. Phys. 109, 073501 (2011)], which employs a hierarchy of simulation methods over a range of length scales to calculate strength from first principles.

  4. Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus.

    PubMed

    Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J

    2008-06-01

    Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.

  5. Low Temperature and Neutron Physics Studies: Final Progress Report, March 1, 1986--May 31, 1987

    DOE R&D Accomplishments Database

    Shull, C.G.

    1989-07-27

    A search for a novel coupling interaction between the Pendelloesung periodicity which is formed in a diffracting crystal and the Larmor precession of neutrons in a magnetic field has been carried out. This interaction is expected to exhibit a resonant behavior when the two spatial periodicities become matched upon scanning the magnetic field being applied to the crystal. Observations on a diffracting, perfect crystal of silicon with neutrons of wavelength 1 Angstrom show the expected resonant action but some discrepancy between the observed magnitude of the resonance effects remains for interpretation.

  6. How to assign a (3 + 1)-dimensional superspace group to an incommensurately modulated biological macromolecular crystal

    PubMed Central

    2017-01-01

    Periodic crystal diffraction is described using a three-dimensional (3D) unit cell and 3D space-group symmetry. Incommensurately modulated crystals are a subset of aperiodic crystals that need four to six dimensions to describe the observed diffraction pattern, and they have characteristic satellite reflections that are offset from the main reflections. These satellites have a non-integral relationship to the primary lattice and require q vectors for processing. Incommensurately modulated biological macromolecular crystals have been frequently observed but so far have not been solved. The authors of this article have been spearheading an initiative to determine this type of crystal structure. The first step toward structure solution is to collect the diffraction data making sure that the satellite reflections are well separated from the main reflections. Once collected they can be integrated and then scaled with appropriate software. Then the assignment of the superspace group is needed. The most common form of modulation is in only one extra direction and can be described with a (3 + 1)D superspace group. The (3 + 1)D superspace groups for chemical crystallographers are fully described in Volume C of International Tables for Crystallography. This text includes all types of crystallographic symmetry elements found in small-molecule crystals and can be difficult for structural biologists to understand and apply to their crystals. This article provides an explanation for structural biologists that includes only the subset of biological symmetry elements and demonstrates the application to a real-life example of an incommensurately modulated protein crystal. PMID:28808437

  7. Characterization of a bent Laue double-crystal beam-expanding monochromator

    DOE PAGES

    Martinson, Mercedes; Samadi, Nazanin; Shi, Xianbo; ...

    2017-10-19

    A bent Laue double-crystal monochromator system has been designed for vertically expanding the X-ray beam at the Canadian Light Source's BioMedical Imaging and Therapy beamlines. Expansion by a factor of 12 has been achieved without deteriorating the transverse coherence of the beam, allowing phase-based imaging techniques to be performed with high flux and a large field of view. However, preliminary studies revealed a lack of uniformity in the beam, presumed to be caused by imperfect bending of the silicon crystal wafers used in the system. Results from finite-element analysis of the system predicted that the second crystal would be mostmore » severely affected and has been shown experimentally. It has been determined that the majority of the distortion occurs in the second crystal and is likely caused by an imperfection in the surface of the bending frame. Here, measurements were then taken to characterize the bending of the crystal using both mechanical and diffraction techniques. In particular, two techniques commonly used to map dislocations in crystal structures have been adapted to map local curvature of the bent crystals. One of these, a variation of Berg–Berrett topography, has been used to quantify the diffraction effects caused by the distortion of the crystal wafer. This technique produces a global mapping of the deviation of the diffraction angle relative to a perfect cylinder. Finally, this information is critical for improving bending and measuring tolerances of imperfections by correlating this mapping to areas of missing intensity in the beam.« less

  8. Characterization of a bent Laue double-crystal beam-expanding monochromator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martinson, Mercedes; Samadi, Nazanin; Shi, Xianbo

    A bent Laue double-crystal monochromator system has been designed for vertically expanding the X-ray beam at the Canadian Light Source's BioMedical Imaging and Therapy beamlines. Expansion by a factor of 12 has been achieved without deteriorating the transverse coherence of the beam, allowing phase-based imaging techniques to be performed with high flux and a large field of view. However, preliminary studies revealed a lack of uniformity in the beam, presumed to be caused by imperfect bending of the silicon crystal wafers used in the system. Results from finite-element analysis of the system predicted that the second crystal would be mostmore » severely affected and has been shown experimentally. It has been determined that the majority of the distortion occurs in the second crystal and is likely caused by an imperfection in the surface of the bending frame. Here, measurements were then taken to characterize the bending of the crystal using both mechanical and diffraction techniques. In particular, two techniques commonly used to map dislocations in crystal structures have been adapted to map local curvature of the bent crystals. One of these, a variation of Berg–Berrett topography, has been used to quantify the diffraction effects caused by the distortion of the crystal wafer. This technique produces a global mapping of the deviation of the diffraction angle relative to a perfect cylinder. Finally, this information is critical for improving bending and measuring tolerances of imperfections by correlating this mapping to areas of missing intensity in the beam.« less

  9. Protein nanocrystallography: growth mechanism and atomic structure of crystals induced by nanotemplates.

    PubMed

    Pechkova, E; Vasile, F; Spera, R; Fiordoro, S; Nicolini, C

    2005-11-01

    Protein nanocrystallography, a new technology for crystal growth based on protein nanotemplates, has recently been shown to produce diffracting, stable and radiation-resistant lysozyme crystals. This article, by computing these lysozyme crystals' atomic structures, obtained by the diffraction patterns of microfocused synchrotron radiation, provides a possible mechanism for this increased stability, namely a significant decrease in water content accompanied by a minor but significant alpha-helix increase. These data are shown to be compatible with the circular dichroism and two-dimensional Fourier transform spectra of high-resolution H NMR of proteins dissolved from the same nanotemplate-based crystal versus those from a classical crystal. Finally, evidence for protein direct transfer from the nanotemplate to the drop and the participation of the template proteins in crystal nucleation and growth is provided by high-resolution NMR spectrometry and mass spectrometry. Furthermore, the lysozyme nanotemplate appears stable up to 523 K, as confirmed by a thermal denaturation study using spectropolarimetry. The overall data suggest that heat-proof lysozyme presence in the crystal provides a possible explanation of the crystal's resistance to synchrotron radiation.

  10. Crystallization and X-ray diffraction analysis of salicylate synthase, a chorismate-utilizing enyme involved in siderophore biosynthesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parsons, James F., E-mail: parsonsj@umbi.umd.edu; Shi, Katherine; Calabrese, Kelly

    2006-03-01

    Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have beenmore » grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2{sub 1}) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase.« less

  11. Characterization of CuCl quantum dots grown in NaCl single crystals via optical measurements, X-ray diffraction, and transmission electron microscopy

    NASA Astrophysics Data System (ADS)

    Miyajima, Kensuke; Akatsu, Tatsuro; Itoh, Ken

    2018-05-01

    We evaluated the crystal size, shape, and alignment of the lattice planes of CuCl quantum dots (QDs) embedded in NaCl single crystals by optical measurements, X-ray diffraction (XRD) patterns, and transmission electron microscopy (TEM). We obtained, for the first time, an XRD pattern and TEM images for CuCl QDs in NaCl crystals. The XRD pattern showed that the lattice planes of the CuCl QDs were parallel to those of the NaCl crystals. In addition, the size of the QDs was estimated from the diffraction width. It was apparent from the TEM images that almost all CuCl QDs were polygonal, although some cubic QDs were present. The mean size and size distribution of the QDs were also obtained. The dot size obtained from optical measurements, XRD, and TEM image were almost consistent. Our new findings can help to reveal the growth mechanism of semiconductor QDs embedded in a crystallite matrix. In addition, this work will play an important role in progressing the study of optical phenomena originating from assembled semiconductor QDs.

  12. Micropatterned photoalignment for wavefront controlled switchable optical devices

    NASA Astrophysics Data System (ADS)

    Glazar, Nikolaus

    Photoalignment is a well-established technique for surface alignment of the liquid crystal director. Previously, chrome masks were necessary for patterned photoalignment but were difficult to use, costly, and inflexible. To extend the capabilities of photoalignment we built an automated maskless multi-domain photoalignment device based on a DMD (digital multimirror device) projection system. The device is capable of creating arbitrary photoalignment patterns with micron-sized features. Pancharatnam-Berry phase (PB-phase) is a geometric phase that arises from cyclic change of polarization state. By varying the azimuthal anchoring angle in a hybrid-aligned liquid crystal cell we can control the spatial variation of the PB-phase shift. Using our automated photoalignment device to align the liquid crystal arbitrary wave front manipulations are possible. The PB-phase shift effect is maximized when the cell is tuned to have a half-wave retardation and disappears at full-wave retardation, so the cell can be switched on and off by applying a voltage. Two wavefront controlled devices developed using this technique will be discussed: A switchable liquid crystal phase shift mask for creating sub-diffraction sized photolithographic features, and a transparent diffractive display that utilizes a switchable liquid crystal diffraction grating.

  13. CFA-4 - a fluorinated metal-organic framework with exchangeable interchannel cations.

    PubMed

    Fritzsche, J; Grzywa, M; Denysenko, D; Bon, V; Senkovska, I; Kaskel, S; Volkmer, D

    2017-05-23

    The syntheses and crystal structures of the fluorinated linker 1,4-bis(3,5-bis(trifluoromethyl)-1H-pyrazole-4-yl)benzene (H 2 -tfpb; 1) and the novel metal-organic framework family M[CFA-4] (Coordination Framework Augsburg University-4), M[Cu 5 (tfpb) 3 ] (M = Cu(i), K, Cs, Ca(0.5)), are described. The ligand 1 is fully characterized by single crystal X-ray diffraction, photoluminescence-, NMR-, IR spectroscopy, and mass spectrometry. The copper(i)-containing MOF crystallizes in the hexagonal crystal system within the chiral space group P6 3 22 (no. 182) and the unit cell parameters are as follows: a = 23.630(5) Å, c = 41.390(5) Å, V = 20 015(6) Å 3 . M[CFA-4] features a porous 3-D structure constructed from pentanuclear copper(i) secondary building units {Cu(pz) 6 } - (pz = pyrazolate). Cu(I)[CFA-4] is fully characterized by synchrotron single crystal X-ray diffraction, thermogravimetric analysis, variable temperature powder X-ray diffraction, IR spectroscopy, photoluminescence and gas sorption measurements. Moreover, thermal stability and gas sorption properties of K[CFA-4] and Cu(I)[CFA-4] are compared.

  14. Transmission electron microscopy as a tool for nanocrystal characterization pre- and post-injector

    PubMed Central

    Stevenson, H. P.; DePonte, D. P.; Makhov, A. M.; Conway, James F.; Zeldin, O. B.; Boutet, S.; Calero, G.; Cohen, A. E.

    2014-01-01

    Recent advancements at the Linac Coherent Light Source X-ray free-electron laser (XFEL) enabling successful serial femtosecond diffraction experiments using nanometre-sized crystals (NCs) have opened up the possibility of X-ray structure determination of proteins that produce only submicrometre crystals such as many membrane proteins. Careful crystal pre-characterization including compatibility testing of the sample delivery method is essential to ensure efficient use of the limited beamtime available at XFEL sources. This work demonstrates the utility of transmission electron microscopy for detecting and evaluating NCs within the carrier solutions of liquid injectors. The diffraction quality of these crystals may be assessed by examining the crystal lattice and by calculating the fast Fourier transform of the image. Injector reservoir solutions, as well as solutions collected post-injection, were evaluated for three types of protein NCs (i) the membrane protein PTHR1, (ii) the multi-protein complex Pol II-GFP and (iii) the soluble protein lysozyme. Our results indicate that the concentration and diffraction quality of NCs, particularly those with high solvent content and sensitivity to mechanical manipulation may be affected by the delivery process. PMID:24914151

  15. Integrated nonlinear optical imaging microscope for on-axis crystal detection and centering at a synchrotron beamline

    PubMed Central

    Madden, Jeremy T.; Toth, Scott J.; Dettmar, Christopher M.; Newman, Justin A.; Oglesbee, Robert A.; Hedderich, Hartmut G.; Everly, R. Michael; Becker, Michael; Ronau, Judith A.; Buchanan, Susan K.; Cherezov, Vadim; Morrow, Marie E.; Xu, Shenglan; Ferguson, Dale; Makarov, Oleg; Das, Chittaranjan; Fischetti, Robert; Simpson, Garth J.

    2013-01-01

    Nonlinear optical (NLO) instrumentation has been integrated with synchrotron X-ray diffraction (XRD) for combined single-platform analysis, initially targeting applications for automated crystal centering. Second-harmonic-generation microscopy and two-photon-excited ultraviolet fluorescence microscopy were evaluated for crystal detection and assessed by X-ray raster scanning. Two optical designs were constructed and characterized; one positioned downstream of the sample and one integrated into the upstream optical path of the diffractometer. Both instruments enabled protein crystal identification with integration times between 80 and 150 µs per pixel, representing a ∼103–104-fold reduction in the per-pixel exposure time relative to X-ray raster scanning. Quantitative centering and analysis of phenylalanine hydroxylase from Chromobacterium violaceum cPAH, Trichinella spiralis deubiquitinating enzyme TsUCH37, human κ-opioid receptor complex kOR-T4L produced in lipidic cubic phase (LCP), intimin prepared in LCP, and α-cellulose samples were performed by collecting multiple NLO images. The crystalline samples were characterized by single-crystal diffraction patterns, while α-cellulose was characterized by fiber diffraction. Good agreement was observed between the sample positions identified by NLO and XRD raster measurements for all samples studied. PMID:23765294

  16. [Physicochemical properties of suplatast tosilate racemate and enantiomers].

    PubMed

    Ushio, T; Endo, K; Yamamoto, K

    1996-11-01

    The physicochemical properties of the enantiomer and racemates of suplatast tosilate (ST) were investigated by means of infrared spectroscopy, solid-state 13C CP/MAS NMR spectroscopy, thermal analysis, and X-ray diffraction analysis, and by measuring the solubility and hygroscopy. The infrared and NMR spectra and X-ray diffraction pattern of the enantiomer were distinctly different from those of the racemate. The melting point of the enantiomer was lower than that of the racemate by 5 degrees C, while the solubility of the enantiomer was 1.3 times higher than that of the racemate. The hygroscopic rate of the enantiomer was greater than that of the racemate. These results suggested that ST was classified into a racemic compound crystal. Furthermore, by comparing the relative peak intensity ratios on X-ray diffraction patterns of the crystals with various optical purities prepared by recrystallization, it was found that a mixture of racemic compound crystals and either of racemic mixture crystals or racemic solid solutions was obtained by recrystallization of ST in the content of 0 to 64%ee, while the recrystallization of ST in the content of more than 64%ee led to the formation of racemic mixture crystals or racemic solid solutions.

  17. Transition from two-dimensional photonic crystals to dielectric metasurfaces in the optical diffraction with a fine structure

    PubMed Central

    Rybin, Mikhail V.; Samusev, Kirill B.; Lukashenko, Stanislav Yu.; Kivshar, Yuri S.; Limonov, Mikhail F.

    2016-01-01

    We study experimentally a fine structure of the optical Laue diffraction from two-dimensional periodic photonic lattices. The periodic photonic lattices with the C4v square symmetry, orthogonal C2v symmetry, and hexagonal C6v symmetry are composed of submicron dielectric elements fabricated by the direct laser writing technique. We observe surprisingly strong optical diffraction from a finite number of elements that provides an excellent tool to determine not only the symmetry but also exact number of particles in the finite-length structure and the sample shape. Using different samples with orthogonal C2v symmetry and varying the lattice spacing, we observe experimentally a transition between the regime of multi-order diffraction, being typical for photonic crystals to the regime where only the zero-order diffraction can be observed, being is a clear fingerprint of dielectric metasurfaces characterized by effective parameters. PMID:27491952

  18. Synchrotron Bragg diffraction imaging characterization of synthetic diamond crystals for optical and electronic power device applications1 1

    PubMed Central

    Tran Thi, Thu Nhi; Morse, J.; Caliste, D.; Fernandez, B.; Eon, D.; Härtwig, J.; Mer-Calfati, C.; Tranchant, N.; Arnault, J. C.; Lafford, T. A.; Baruchel, J.

    2017-01-01

    Bragg diffraction imaging enables the quality of synthetic single-crystal diamond substrates and their overgrown, mostly doped, diamond layers to be characterized. This is very important for improving diamond-based devices produced for X-ray optics and power electronics applications. The usual first step for this characterization is white-beam X-ray diffraction topography, which is a simple and fast method to identify the extended defects (dislocations, growth sectors, boundaries, stacking faults, overall curvature etc.) within the crystal. This allows easy and quick comparison of the crystal quality of diamond plates available from various commercial suppliers. When needed, rocking curve imaging (RCI) is also employed, which is the quantitative counterpart of monochromatic Bragg diffraction imaging. RCI enables the local determination of both the effective misorientation, which results from lattice parameter variation and the local lattice tilt, and the local Bragg position. Maps derived from these parameters are used to measure the magnitude of the distortions associated with polishing damage and the depth of this damage within the volume of the crystal. For overgrown layers, these maps also reveal the distortion induced by the incorporation of impurities such as boron, or the lattice parameter variations associated with the presence of growth-incorporated nitrogen. These techniques are described, and their capabilities for studying the quality of diamond substrates and overgrown layers, and the surface damage caused by mechanical polishing, are illustrated by examples. PMID:28381981

  19. X-ray diffraction diagnostic design for the National Ignition Facility

    NASA Astrophysics Data System (ADS)

    Ahmed, Maryum F.; House, Allen; Smith, R. F.; Ayers, Jay; Lamb, Zachary S.; Swift, David W.

    2013-09-01

    This paper describes the design considerations for Target Diffraction In-Situ (TARDIS), an x-ray diffraction diagnostic at the National Ignition Facility. A crystal sample is ramp-compressed to peak pressures between 10 and 30 Mbar and, during a pressure hold period, is probed with quasi-monochromatic x-rays emanating from a backlighter source foil. The crystal spectrography diffraction lines are recorded onto image plates. The crystal sample, filter, and image plates are packaged into one assembly, allowing for accurate and repeatable target to image plate registration. Unconverted laser light impinges upon the device, generating debris, the effects of which have been mitigated. Dimpled blast shields, high strength steel alloy, and high-z tungsten are used to shield and protect the image plates. A tapered opening was designed to provide adequate thickness of shielding materials without blocking the drive beams or x-ray source from reaching the crystal target. The high strength steel unit serves as a mount for the crystal target and x-ray source foil. A tungsten body contains the imaging components. Inside this sub-assembly, there are three image plates: a 160 degree field of view curved plate directly opposite the target opening and two flat plates for the top and bottom. A polycarbonate frame, coated with the appropriate filter material and embedded with registration features for image plate location, is inserted into the diagnostic body. The target assembly is metrologized and then the diagnostic assembly is attached.

  20. Multiple film plane diagnostic for shocked lattice measurements (invited)

    NASA Astrophysics Data System (ADS)

    Kalantar, Daniel H.; Bringa, E.; Caturla, M.; Colvin, J.; Lorenz, K. T.; Kumar, M.; Stölken, J.; Allen, A. M.; Rosolankova, K.; Wark, J. S.; Meyers, M. A.; Schneider, M.; Boehly, T. R.

    2003-03-01

    Laser-based shock experiments have been conducted in thin Si and Cu crystals at pressures above the Hugoniot elastic limit. In these experiments, static film and x-ray streak cameras recorded x rays diffracted from lattice planes both parallel and perpendicular to the shock direction. These data showed uniaxial compression of Si(100) along the shock direction and three-dimensional compression of Cu(100). In the case of the Si diffraction, there was a multiple wave structure observed, which may be due to a one-dimensional phase transition or a time variation in the shock pressure. A new film-based detector has been developed for these in situ dynamic diffraction experiments. This large-angle detector consists of three film cassettes that are positioned to record x rays diffracted from a shocked crystal anywhere within a full π steradian. It records x rays that are diffracted from multiple lattice planes both parallel and at oblique angles with respect to the shock direction. It is a time-integrating measurement, but time-resolved data may be recorded using a short duration laser pulse to create the diffraction source x rays. This new instrument has been fielded at the OMEGA and Janus lasers to study single-crystal materials shock compressed by direct laser irradiation. In these experiments, a multiple wave structure was observed on many different lattice planes in Si. These data provide information on the structure under compression.

  1. Analyzing shear band formation with high resolution X-ray diffraction

    DOE PAGES

    Pagan, Darren C.; Obstalecki, Mark; Park, Jun-Sang; ...

    2018-01-10

    Localization of crystallographic slip into shear bands during uniaxial compression of a copper single crystal is studied using very far-field high-energy diffraction microscopy (vff-HEDM). Diffracted intensity was collected in-situ as the crystal deformed using a unique mobile detector stage that provided access to multiple diffraction peaks with high-angular resolution. From the diffraction data, single crystal orientation pole figures (SCPFs) were generated and are used to track the evolution of the distribution of lattice orientation that develops as slip localizes. To aid the identification of ‘signatures’ of shear band formation and analyze the SCPF data, a model of slip-driven lattice reorientationmore » within shear bands is introduced. Confidence is built in conclusions drawn from the SCPF data about the character of internal slip localization through comparisons with strain fields on the sample surface measured simultaneously using digital image correlation. From the diffraction data, we find that the active slip direction and slip plane are not directly aligned with the orientation of the shear bands that formed. In fact, by extracting the underlying slip system activity from the SCPF data, we show that intersecting shear bands measured on the surface of the sample arise from slip primarily on the same underlying single slip system. These new vff-HEDM results raise significant questions on the use of surface measurements for slip system activity estimation.« less

  2. Feasibility of one-shot-per-crystal structure determination using Laue diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cornaby, Sterling; CHESS; Szebenyi, Doletha M. E.

    Structure determination was successfully carried out using single Laue exposures from a group of lysozyme crystals. The Laue method may be a viable option for collection of one-shot-per-crystal data from microcrystals. Crystal size is an important factor in determining the number of diffraction patterns which may be obtained from a protein crystal before severe radiation damage sets in. As crystal dimensions decrease this number is reduced, eventually falling to one, at which point a complete data set must be assembled using data from multiple crystals. When only a single exposure is to be collected from each crystal, the polychromatic Lauemore » technique may be preferable to monochromatic methods owing to its simultaneous recording of a large number of fully recorded reflections per image. To assess the feasibility of solving structures using single Laue images from multiple crystals, data were collected using a ‘pink’ beam at the CHESS D1 station from groups of lysozyme crystals with dimensions of the order of 20–30 µm mounted on MicroMesh grids. Single-shot Laue data were used for structure determination by molecular replacement and correct solutions were obtained even when as few as five crystals were used.« less

  3. The MORPHEUS II protein crystallization screen

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gorrec, Fabrice, E-mail: fgorrec@mrc-lmb.cam.ac.uk

    2015-06-27

    MORPHEUS II is a 96-condition initial crystallization screen formulated de novo. The screen incorporates reagents selected from the Protein Data Bank to yield crystals that are not observed in traditional conditions. In addition, the formulation facilitates the optimization and cryoprotection of crystals. High-quality macromolecular crystals are a prerequisite for the process of protein structure determination by X-ray diffraction. Unfortunately, the relative yield of diffraction-quality crystals from crystallization experiments is often very low. In this context, innovative crystallization screen formulations are continuously being developed. In the past, MORPHEUS, a screen in which each condition integrates a mix of additives selected frommore » the Protein Data Bank, a cryoprotectant and a buffer system, was developed. Here, MORPHEUS II, a follow-up to the original 96-condition initial screen, is described. Reagents were selected to yield crystals when none might be observed in traditional initial screens. Besides, the screen includes heavy atoms for experimental phasing and small polyols to ensure the cryoprotection of crystals. The suitability of the resulting novel conditions is shown by the crystallization of a broad variety of protein samples and their efficiency is compared with commercially available conditions.« less

  4. Large-size TlBr single crystal growth and defect study

    NASA Astrophysics Data System (ADS)

    Zhang, Mingzhi; Zheng, Zhiping; Chen, Zheng; Zhang, Sen; Luo, Wei; Fu, Qiuyun

    2018-04-01

    Thallium bromide (TlBr) is an attractive semiconductor material for fabrication of radiation detectors due to its high photon stopping power originating from its high atomic number, wide band gap and high resistivity. In this paper the vertical Bridgman method was used for crystal growth and TlBr single crystals with diameter of 15 mm were grown. X-ray diffraction (XRD) was used to identify phase and orientation. Electron backscatter diffraction (EBSD) was used to investigate crystal microstructure and crystallographic orientation. The optical and electric performance of the crystal was characterized by infrared (IR) transmittance spectra and I-V measurement. The types of point defects in the crystals were investigated by thermally stimulated current (TSC) spectra and positron annihilation spectroscopy (PAS). Four types of defects, with ionization energy of each defect fitting as follows: 0.1308, 0.1540, 0.3822 and 0.538 eV, were confirmed from the TSC result. The PAS result showed that there were Tl vacancies in the crystal.

  5. Preparation of Gd(OH){sub 3} large single crystals by solid KOH assisted hydrothermal method and their luminescent and magnetic properties

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Hai; Zhang, Youjin, E-mail: zyj@ustc.edu.cn; Zhou, Maozhong

    Highlights: • Gd(OH){sub 3} large single crystals were prepared by solid KOH assisted hydrothermal method. • The possible growth mechanism of Gd(OH){sub 3} large single crystals was proposed. • The Gd(OH){sub 3} samples emitted a strong narrow-band ultraviolet B (NB-UVB) light. • The Gd(OH){sub 3} samples showed good paramagnetic properties. - Abstract: Large single crystals of gadolinium hydroxide [Gd(OH){sub 3}] in the length of several millimeters were successfully prepared by using solid KOH assisted hydrothermal method. Gd(OH){sub 3} samples were characterized by X-ray diffraction (XRD), 4-circle single-crystal diffraction, Fourier transform infrared (FTIR) spectroscopy and X-ray photoelectron spectroscopy (XPS). FESEM imagemore » shows hexagonal prism morphology for the Gd(OH){sub 3} large crystals. The possible growth mechanism of Gd(OH){sub 3} large single crystals was proposed. The photoluminescence and magnetic properties of Gd(OH){sub 3} species were investigated.« less

  6. Analysis of synthetic diamond single crystals by X-ray topography and double-crystal diffractometry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prokhorov, I. A., E-mail: igor.prokhorov@mail.ru; Ralchenko, V. G.; Bolshakov, A. P.

    2013-12-15

    Structural features of diamond single crystals synthesized under high pressure and homoepitaxial films grown by chemical vapor deposition (CVD) have been analyzed by double-crystal X-ray diffractometry and topography. The conditions of a diffraction analysis of diamond crystals using Ge monochromators have been optimized. The main structural defects (dislocations, stacking faults, growth striations, second-phase inclusions, etc.) formed during crystal growth have been revealed. The nitrogen concentration in high-pressure/high-temperature (HPHT) diamond substrates is estimated based on X-ray diffraction data. The formation of dislocation bundles at the film-substrate interface in the epitaxial structures has been revealed by plane-wave topography; these dislocations are likelymore » due to the relaxation of elastic macroscopic stresses caused by the lattice mismatch between the substrate and film. The critical thicknesses of plastic relaxation onset in CVD diamond films are calculated. The experimental techniques for studying the real diamond structure in optimizing crystal-growth technology are proven to be highly efficient.« less

  7. Powder diffraction and crystal structure prediction identify four new coumarin polymorphs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shtukenberg, Alexander G.; Zhu, Qiang; Carter, Damien J.

    Coumarin, a simple, commodity chemical isolated from beans in 1820, has, to date, only yielded one solid state structure. Here, we report a rich polymorphism of coumarin grown from the melt. Four new metastable forms were identified and their crystal structures were solved using a combination of computational crystal structure prediction algorithms and X-ray powder diffraction. With five crystal structures, coumarin has become one of the few rigid molecules showing extensive polymorphism at ambient conditions. We demonstrate the crucial role of advanced electronic structure calculations including many-body dispersion effects for accurate ranking of the stability of coumarin polymorphs and themore » need to account for anharmonic vibrational contributions to their free energy. As such, coumarin is a model system for studying weak intermolecular interactions, crystallization mechanisms, and kinetic effects.« less

  8. Crystallization and preliminary X-ray diffraction study of phosphopantetheine adenylyltransferase from M. tuberculosis crystallizing in space group P3{sub 2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Timofeev, V. I., E-mail: tostars@mail.ru; Chupova, L. A.; Esipov, R. S.

    Crystals of M. tuberculosis phosphopantetheine adenylyltransferase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 2.00-Å resolution. The crystals belong to sp. gr. P3{sub 2} and have the following unit-cell parameters: a = b = 106.47 Å, c = 71.32 Å, α = γ = 90°, β = 120°. The structure was solved by the molecular-replacement method. There are six subunits of the enzyme comprising a hexamer per asymmetricmore » unit. The hexamer is a biologically active form of phosphopantetheine adenylyltransferase from M. tuberculosis.« less

  9. Field induced heliconical structure of cholesteric liquid crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lavrentovich, Oleg D.; Shiyanovsii, Sergij V.; Xiang, Jie

    A diffraction grating comprises a liquid crystal (LC) cell configured to apply an electric field through a cholesteric LC material that induces the cholesteric LC material into a heliconical state with an oblique helicoid director. The applied electric field produces diffracted light from the cholesteric LC material within the visible, infrared or ultraviolet. The axis of the heliconical state is in the plane of the liquid crystal cell or perpendicular to the plane, depending on the application. A color tuning device operates with a similar heliconical state liquid crystal material but with the heliconical director axis oriented perpendicular to themore » plane of the cell. A power generator varies the strength of the applied electric field to adjust the wavelength of light reflected from the cholesteric liquid crystal material within the visible, infrared or ultraviolet.« less

  10. Crystallization and preliminary X-ray diffraction analysis of the lectin from Dioclea rostrata Benth seeds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Delatorre, Plínio; Departamento de Ciências Biológicas, Universidade Regional do Cariri, Crato, CE 63195-000; Nascimento, Kyria Santiago

    2006-02-01

    D. rostrata lectin was crystallized by hanging-drop vapor diffusion. The crystal belongs to the orthorhombic space group I222 and diffracted to 1.87 Å resolution. Lectins from the Diocleinae subtribe (Leguminosae) are highly similar proteins that promote various biological activities with distinctly differing potencies. The structural basis for this experimental data is not yet fully understood. Dioclea rostrata lectin was purified and crystallized by hanging-drop vapour diffusion at 293 K. The crystal belongs to the orthorhombic space group I222, with unit-cell parameters a = 61.51, b = 88.22, c = 87.76 Å. Assuming the presence of one monomer per asymmetric unit,more » the solvent content was estimated to be about 47.9%. A complete data set was collected at 1.87 Å resolution.« less

  11. Crystal Structure of Two V-shaped Ligands with N-Heterocycles

    NASA Astrophysics Data System (ADS)

    Wang, Gao-Feng; Sun, Shu-Wen; Zhang, Xiao; Sun, Shu-Gang

    2017-12-01

    Two V-shaped ligands with N-heterocycles, bis(4-(1 H-imidazol-1-yl) phenyl)methanone ( 1), and bis(4-(1 H-benzo[d]imidazol-1-yl)phenyl)methanone ( 2) have been synthesized and characterized by elemental analyses, IR and 1 H NMR spectroscopy. Crystal structures of 1 and 2 have been determined by X-ray diffraction. The crystal of 1 is monoclinic, sp. gr. P21/ c, Z = 4. The crystal of 2 is orthorhombic, sp. gr. Fdd2, Z = 8. X-ray diffraction analyses show that the V-shaped angles of 1 and 2 are 122.72(15)° and 120.7(4)°, respectively. Intermolecular C-H···O, C-H···N, C-H···π, and π···π interactions link the components into three-dimensional networks in the crystal structures.

  12. Structural and conformational properties of 1-decyl-3-methylimidazolium tetrafluoroborate under high pressure

    NASA Astrophysics Data System (ADS)

    Chen, Liucheng; Li, Haining; Zhu, Xiang; Su, Lei; Yang, Kun; Yuan, Chaosheng; Yang, Guoqiang; Li, Xiaodong

    2017-06-01

    In situ crystalization of 1-decyl-3-methylimidazolium tetrafluoroborate ([C10MIM][BF4]) from melt has been investigated under high pressure up to 3.4 GPa at room temperature by using Raman spectroscopy and synchrotron X-ray diffraction measurement. Raman spectral analysis indicated that [C10MIM][BF4] experienced two successive phase transitions at about 0.3 GPa and 1.6 GPa. And the polymorphism was also discussed in view of the conformational isomerism of [C10MIM]+ cation between gauche and trans conformers. Notably, liquid-crystal and crystal-crystal phase transitions were further confirmed by synchrotron X-ray diffraction measurement. Moreover, it also indicated that high structural flexibility of the cations with long alkyl chain might have effect on the degree of disorder of pressure-induced crystallization for ionic liquids.

  13. On the purification and preliminary crystallographic analysis of isoquinoline 1-oxidoreductase from Brevundimonas diminuta 7

    PubMed Central

    Boer, D. Roeland; Müller, Axel; Fetzner, Susanne; Lowe, David J.; Romão, Maria João

    2005-01-01

    Isoquinoline 1-oxidoreductase (IOR) from Brevundimonas diminuta is a mononuclear molybdoenzyme of the xanthine-dehydrogenase family of proteins and catalyzes the conversion of isoquinoline to isoquinoline-1-one. Its primary sequence and behaviour, specifically in its substrate specificity and lipophilicity, differ from other members of the family. A crystal structure of the enzyme is expected to provide an explanation for these differences. This paper describes the crystallization and preliminary X-ray diffraction experiments as well as an optimized purification protocol for IOR. Crystallization of IOR was achieved using two different crystallization buffers. Streak-seeding and cross-linking were essential to obtain well diffracting crystals. Suitable cryo-conditions were found and a structure solution was obtained by molecular replacement. However, phases need to be improved in order to obtain a more interpretable electron-density map. PMID:16508115

  14. Powder diffraction and crystal structure prediction identify four new coumarin polymorphs

    DOE PAGES

    Shtukenberg, Alexander G.; Zhu, Qiang; Carter, Damien J.; ...

    2017-05-15

    Coumarin, a simple, commodity chemical isolated from beans in 1820, has, to date, only yielded one solid state structure. Here, we report a rich polymorphism of coumarin grown from the melt. Four new metastable forms were identified and their crystal structures were solved using a combination of computational crystal structure prediction algorithms and X-ray powder diffraction. With five crystal structures, coumarin has become one of the few rigid molecules showing extensive polymorphism at ambient conditions. We demonstrate the crucial role of advanced electronic structure calculations including many-body dispersion effects for accurate ranking of the stability of coumarin polymorphs and themore » need to account for anharmonic vibrational contributions to their free energy. As such, coumarin is a model system for studying weak intermolecular interactions, crystallization mechanisms, and kinetic effects.« less

  15. Crystallization and initial X-ray diffraction studies of scaffolding protein (gp7) of bacteriophage ϕ29

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Badasso, Mohammed O., E-mail: badas001@umn.edu; Anderson, Dwight L.; Department of Oral Science, University of Minnesota, Minneapolis, MN 55455

    2005-04-01

    ϕ29 bacteriophage scaffolding protein (gp7) has been overproduced in E. coli, purified, crystallized and characterized by X-ray diffraction. Two distinct crystal forms were obtained and a diffraction data set was collected to 1.8 Å resolution. The Bacillus subtilis bacteriophage ϕ29 scaffolding protein (gp7) has been crystallized by the hanging-drop vapour-diffusion method at 293 K. Two new distinct crystal forms that both differed from a previously crystallized and solved scaffolding protein were grown under the same conditions. Form I belongs to the primitive tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 77.13, c = 37.12 Å.more » Form II crystals exhibit an orthorhombic crystal form, with space group C222 and unit-cell parameters a = 107.50, b = 107. 80, c = 37.34 Å. Complete data sets have been collected to 1.78 and 1.80 Å for forms I and II, respectively, at 100 K using Cu Kα X-rays from a rotating-anode generator. Calculation of a V{sub M} value of 2.46 Å{sup 3} Da{sup −1} for form I suggests the presence of one molecule in the asymmetric unit, corresponding to a solvent content of 50.90%, whereas form II has a V{sub M} of 4.80 Å{sup 3} Da{sup −1} with a solvent content of 48.76% and two molecules in the asymmetric unit. The structures of both crystal forms are being determined by the molecular-replacement method using the coordinates of the published crystal structure of gp7.« less

  16. Liquid-liquid diffusion crystallization improves the X-ray diffraction of EndoS, an endo-β-N-acetylglucosaminidase from Streptococcus pyogenes with activity on human IgG.

    PubMed

    Trastoy, Beatriz; Lomino, Joseph V; Wang, Lai Xi; Sundberg, Eric J

    2013-12-01

    Endoglycosidase S (EndoS) is an enzyme secreted by Streptococcus pyogenes that specifically hydrolyzes the β-1,4-di-N-acetylchitobiose core glycan on immunoglobulin G (IgG) antibodies. One of the most common human pathogens and the cause of group A streptococcal infections, S. pyogenes secretes EndoS in order to evade the host immune system by rendering IgG effector mechanisms dysfunctional. On account of its specificity for IgG, EndoS has also been used extensively for chemoenzymatic synthesis of homogeneous IgG glycoprotein preparations and is being developed as a novel therapeutic for a wide range of autoimmune diseases. The structural basis of its enzymatic activity and substrate specificity, however, remains unknown. Here, the purification and crystallization of EndoS are reported. Using traditional hanging-drop and sitting-drop vapor-diffusion crystallization, crystals of EndoS were grown that diffracted to a maximum of 3.5 Å resolution but suffered from severe anisotropy, the data from which could only be reasonably processed to 7.5 Å resolution. When EndoS was crystallized by liquid-liquid diffusion, it was possible to grow crystals with a different space group to those obtained by vapor diffusion. Crystals of wild-type endoglycosidase and glycosynthase constructs of EndoS grown by liquid-liquid diffusion diffracted to 2.6 and 1.9 Å resolution, respectively, with a greatly diminished anisotropy. Despite extensive efforts, the failure to reproduce these liquid-liquid diffusion-grown crystals by vapor diffusion suggests that these crystallization methods each sample a distinct crystallization space.

  17. Expression, purification, crystallization and X-ray diffraction studies of the molecular chaperone prefoldin from Homo sapiens

    PubMed Central

    Aikawa, Yoshiki; Kida, Hiroshi; Nishitani, Yuichi; Miki, Kunio

    2015-01-01

    Proper protein folding is an essential process for all organisms. Prefoldin (PFD) is a molecular chaperone that assists protein folding by delivering non-native proteins to group II chaperonin. A heterohexamer of eukaryotic PFD has been shown to specifically recognize and deliver non-native actin and tubulin to chaperonin-containing TCP-1 (CCT), but the mechanism of specific recognition is still unclear. To determine its crystal structure, recombinant human PFD was reconstituted, purified and crystallized. X-ray diffraction data were collected to 4.7 Å resolution. The crystals belonged to space group P21212, with unit-cell parameters a = 123.2, b = 152.4, c = 105.9 Å. PMID:26323306

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sippel, K.; Boehlein, S; Sakai, Y

    Mycoplasma genitalium is a human pathogen that is associated with nongonococcal urethritis in men and cervicitis in women. The cloning, expression, purification and crystallization of the protein MG289 from M. genitalium strain G37 are reported here. Crystals of MG289 diffracted X-rays to 2.8 {angstrom} resolution. The crystals belonged to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.7, b = 90.9, c = 176.1 {angstrom}. The diffraction data after processing had an overall R{sub merge} of 8.7%. The crystal structure of Cypl, the ortholog of MG289 from M. hyorhinis, has recently been determined, providing amore » reasonable phasing model; molecular replacement is currently under way.« less

  19. Common path point diffraction interferometer using liquid crystal phase shifting

    NASA Technical Reports Server (NTRS)

    Mercer, Carolyn R. (Inventor)

    1997-01-01

    A common path point diffraction interferometer uses dyed, parallel nematic liquid crystals which surround an optically transparent microsphere. Coherent, collimated and polarized light is focused on the microsphere at a diameter larger than that of the microsphere. A portion of the focused light passes through the microsphere to form a spherical wavefront reference beam and the rest of the light is attenuated by the dyed liquid crystals to form an object beam. The two beams form an interferogram which is imaged by a lens onto an electronic array sensor and into a computer which determines the wavefront of the object beam. The computer phase shifts the interferogram by stepping up an AC voltage applied across the liquid crystals without affecting the reference beam.

  20. In situ Raman and synchrotron X-ray diffraction study on crystallization of Choline chloride/Urea deep eutectic solvent under high pressure

    NASA Astrophysics Data System (ADS)

    Yuan, Chaosheng; Chu, Kunkun; Li, Haining; Su, Lei; Yang, Kun; Wang, Yongqiang; Li, Xiaodong

    2016-09-01

    Pressure-induced crystallization of Choline chloride/Urea (ChCl/Urea) deep eutectic solvent (DES) has been investigated by in-situ Raman spectroscopy and synchrotron X-ray diffraction. The results indicated that high pressure crystals appeared at around 2.6 GPa, and the crystalline structure was different from that formed at ambient pressure. Upon increasing the pressure, the Nsbnd H stretching modes of Urea underwent dramatic change after liquid-solid transition. It appears that high pressures may enhance the hydrogen bonds formed between ChCl and Urea. P versus T phase diagram of ChCl/Urea DES was constructed, and the crystallization mechanism of ChCl/Urea DES was discussed in view of hydrogen bonds.

  1. A von Hamos x-ray spectrometer based on a segmented-type diffraction crystal for single-shot x-ray emission spectroscopy and time-resolved resonant inelastic x-ray scattering studies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Szlachetko, J.; Institute of Physics, Jan Kochanowski University, 25-406 Kielce; Nachtegaal, M.

    2012-10-15

    We report on the design and performance of a wavelength-dispersive type spectrometer based on the von Hamos geometry. The spectrometer is equipped with a segmented-type crystal for x-ray diffraction and provides an energy resolution in the order of 0.25 eV and 1 eV over an energy range of 8000 eV-9600 eV. The use of a segmented crystal results in a simple and straightforward crystal preparation that allows to preserve the spectrometer resolution and spectrometer efficiency. Application of the spectrometer for time-resolved resonant inelastic x-ray scattering and single-shot x-ray emission spectroscopy is demonstrated.

  2. Purification, crystallization and preliminary X-ray diffraction studies of D-tagatose 3-epimerase from Pseudomonas cichorii.

    PubMed

    Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

    2007-02-01

    D-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of D-psicose has not been reported with epimerases other than P. cichorii D-TE and D-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 A, beta = 102.82 degrees . Diffraction data were collected to 2.5 A resolution. The asymmetric unit is expected to contain four molecules.

  3. Preliminary neutron diffraction analysis of challenging human manganese superoxide dismutase crystals

    DOE PAGES

    Azadmanesh, Jahaun; Trickel, Scott R.; Weiss, Kevin L.; ...

    2017-03-29

    Superoxide dismutases (SODs) are enzymes that protect against oxidative stress by dismutation of superoxide into oxygen and hydrogen peroxide through cyclic reduction and oxidation of the active-site metal. The complete enzymatic mechanisms of SODs are unknown since data on the positions of hydrogen are limited. Here, we present, methods for large crystal growth and neutron data collection of human manganese SOD (MnSOD) using perdeuteration and the MaNDi beamline at Oak Ridge National Laboratory. Furthermore, The crystal from which the human MnSOD data set was obtained is the crystal with the largest unit-cell edge (240 Å) from which data have beenmore » collectedvianeutron diffraction to sufficient resolution (2.30 Å) where hydrogen positions can be observed.« less

  4. Preliminary neutron diffraction analysis of challenging human manganese superoxide dismutase crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Azadmanesh, Jahaun; Trickel, Scott R.; Weiss, Kevin L.

    Superoxide dismutases (SODs) are enzymes that protect against oxidative stress by dismutation of superoxide into oxygen and hydrogen peroxide through cyclic reduction and oxidation of the active-site metal. The complete enzymatic mechanisms of SODs are unknown since data on the positions of hydrogen are limited. Here, we present, methods for large crystal growth and neutron data collection of human manganese SOD (MnSOD) using perdeuteration and the MaNDi beamline at Oak Ridge National Laboratory. Furthermore, The crystal from which the human MnSOD data set was obtained is the crystal with the largest unit-cell edge (240 Å) from which data have beenmore » collectedvianeutron diffraction to sufficient resolution (2.30 Å) where hydrogen positions can be observed.« less

  5. Application of Powder Diffraction Methods to the Analysis of the Atomic Structure of Nanocrystals: The Concept of the Apparent Lattice Parameter (ALP)

    NASA Technical Reports Server (NTRS)

    Palosz, B.; Grzanka, E.; Gierlotka, S.; Stelmakh, S.; Pielaszek, R.; Bismayer, U.; Weber, H.-P.; Palosz, W.; Curreri, Peter A. (Technical Monitor)

    2002-01-01

    The applicability of standard methods of elaboration of powder diffraction data for determination of the structure of nano-size crystallites is analysed. Based on our theoretical calculations of powder diffraction data we show, that the assumption of the infinite crystal lattice for nanocrystals smaller than 20 nm in size is not justified. Application of conventional tools developed for elaboration of powder diffraction data, like the Rietveld method, may lead to erroneous interpretation of the experimental results. An alternate evaluation of diffraction data of nanoparticles, based on the so-called 'apparent lattice parameter' (alp) is introduced. We assume a model of nanocrystal having a grain core with well-defined crystal structure, surrounded by a surface shell with the atomic structure similar to that of the core but being under a strain (compressive or tensile). The two structural components, the core and the shell, form essentially a composite crystal with interfering, inseparable diffraction properties. Because the structure of such a nanocrystal is not uniform, it defies the basic definitions of an unambiguous crystallographic phase. Consequently, a set of lattice parameters used for characterization of simple crystal phases is insufficient for a proper description of the complex structure of nanocrystals. We developed a method of evaluation of powder diffraction data of nanocrystals, which refers to a core-shell model and is based on the 'apparent lattice parameter' methodology. For a given diffraction pattem, the alp values are calculated for every individual Bragg reflection. For nanocrystals the alp values depend on the diffraction vector Q. By modeling different a0tomic structures of nanocrystals and calculating theoretically corresponding diffraction patterns using the Debye functions we showed, that alp-Q plots show characteristic shapes which can be used for evaluation of the atomic structure of the core-shell system. We show, that using a simple model of a nanocrystal with spherical shape and centro-symmetric strain at the surface shell we obtain theoretical alp-Q values which match very well the alp-Q plots determined experimentally for Sic, GaN, and diamond nanopowders. The theoretical models are defined by the lattice parameter of the grain core, thickness of the surface shell, and the magnitude and distribution of the strain field in the surface shell. According to our calculations, the part of the diffraction pattern measured at relatively low diffraction vectors Q (below 10/angstrom) provides information on the surface strain, whle determination of the lattice parameters in the grain core requires measurements at large Q-values (above 15 - 20/angstrom).

  6. Diffraction Techniques in Structural Biology

    PubMed Central

    Egli, Martin

    2016-01-01

    A detailed understanding of chemical and biological function and the mechanisms underlying the molecular activities ultimately requires atomic-resolution structural data. Diffraction-based techniques such as single-crystal X-ray crystallography, electron microscopy, and neutron diffraction are well established and they have paved the road to the stunning successes of modern-day structural biology. The major advances achieved in the last 20 years in all aspects of structural research, including sample preparation, crystallization, the construction of synchrotron and spallation sources, phasing approaches, and high-speed computing and visualization, now provide specialists and nonspecialists alike with a steady flow of molecular images of unprecedented detail. The present unit combines a general overview of diffraction methods with a detailed description of the process of a single-crystal X-ray structure determination experiment, from chemical synthesis or expression to phasing and refinement, analysis, and quality control. For novices it may serve as a stepping-stone to more in-depth treatises of the individual topics. Readers relying on structural information for interpreting functional data may find it a useful consumer guide. PMID:27248784

  7. Multi-level diffractive optics for single laser exposure fabrication of telecom-band diamond-like 3-dimensional photonic crystals.

    PubMed

    Chanda, Debashis; Abolghasemi, Ladan E; Haque, Moez; Ng, Mi Li; Herman, Peter R

    2008-09-29

    We present a novel multi-level diffractive optical element for diffractive optic near-field lithography based fabrication of large-area diamond-like photonic crystal structure in a single laser exposure step. A multi-level single-surface phase element was laser fabricated on a thin polymer film by two-photon polymerization. A quarter-period phase shift was designed into the phase elements to generate a 3D periodic intensity distribution of double basis diamond-like structure. Finite difference time domain calculation of near-field diffraction patterns and associated isointensity surfaces are corroborated by definitive demonstration of a diamond-like woodpile structure formed inside thick photoresist. A large number of layers provided a strong stopband in the telecom band that matched predictions of numerical band calculation. SEM and spectral observations indicate good structural uniformity over large exposure area that promises 3D photonic crystal devices with high optical quality for a wide range of motif shapes and symmetries. Optical sensing is demonstrated by spectral shifts of the Gamma-Zeta stopband under liquid emersion.

  8. Diffraction Techniques in Structural Biology

    PubMed Central

    Egli, Martin

    2010-01-01

    A detailed understanding of chemical and biological function and the mechanisms underlying the activities ultimately requires atomic-resolution structural data. Diffraction-based techniques such as single-crystal X-ray crystallography, electron microscopy and neutron diffraction are well established and have paved the road to the stunning successes of modern-day structural biology. The major advances achieved in the last 20 years in all aspects of structural research, including sample preparation, crystallization, the construction of synchrotron and spallation sources, phasing approaches and high-speed computing and visualization, now provide specialists and non-specialists alike with a steady flow of molecular images of unprecedented detail. The present chapter combines a general overview of diffraction methods with a step-by-step description of the process of a single-crystal X-ray structure determination experiment, from chemical synthesis or expression to phasing and refinement, analysis and quality control. For novices it may serve as a stepping-stone to more in-depth treatises of the individual topics. Readers relying on structural information for interpreting functional data may find it a useful consumer guide. PMID:20517991

  9. Diffraction Techniques in Structural Biology.

    PubMed

    Egli, Martin

    2016-06-01

    A detailed understanding of chemical and biological function and the mechanisms underlying the molecular activities ultimately requires atomic-resolution structural data. Diffraction-based techniques such as single-crystal X-ray crystallography, electron microscopy, and neutron diffraction are well established and they have paved the road to the stunning successes of modern-day structural biology. The major advances achieved in the last twenty years in all aspects of structural research, including sample preparation, crystallization, the construction of synchrotron and spallation sources, phasing approaches, and high-speed computing and visualization, now provide specialists and nonspecialists alike with a steady flow of molecular images of unprecedented detail. The present unit combines a general overview of diffraction methods with a detailed description of the process of a single-crystal X-ray structure determination experiment, from chemical synthesis or expression to phasing and refinement, analysis, and quality control. For novices it may serve as a stepping-stone to more in-depth treatises of the individual topics. Readers relying on structural information for interpreting functional data may find it a useful consumer guide. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

  10. A multi-dataset data-collection strategy produces better diffraction data

    PubMed Central

    Liu, Zhi-Jie; Chen, Lirong; Wu, Dong; Ding, Wei; Zhang, Hua; Zhou, Weihong; Fu, Zheng-Qing; Wang, Bi-Cheng

    2011-01-01

    A multi-dataset (MDS) data-collection strategy is proposed and analyzed for macromolecular crystal diffraction data acquisition. The theoretical analysis indicated that the MDS strategy can reduce the standard deviation (background noise) of diffraction data compared with the commonly used single-dataset strategy for a fixed X-ray dose. In order to validate the hypothesis experimentally, a data-quality evaluation process, termed a readiness test of the X-ray data-collection system, was developed. The anomalous signals of sulfur atoms in zinc-free insulin crystals were used as the probe to differentiate the quality of data collected using different data-collection strategies. The data-collection results using home-laboratory-based rotating-anode X-ray and synchrotron X-ray systems indicate that the diffraction data collected with the MDS strategy contain more accurate anomalous signals from sulfur atoms than the data collected with a regular data-collection strategy. In addition, the MDS strategy offered more advantages with respect to radiation-damage-sensitive crystals and better usage of rotating-anode as well as synchrotron X-rays. PMID:22011470

  11. Compressive auto-indexing in femtosecond nanocrystallography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maia, Filipe; Yang, Chao; Marchesini, Stefano

    2010-09-20

    Ultrafast nanocrystallography has the potential to revolutionize biology by enabling structural elucidation of proteins for which it is possible to grow crystals with 10 or fewer unit cells. The success of nanocrystallography depends on robust orientation-determination procedures that allow us to average diffraction data from multiple nanocrystals to produce a 3D diffraction data volume with a high signal-to-noise ratio. Such a 3D diffraction volume can then be phased using standard crystallographic techniques."Indexing" algorithms used in crystallography enable orientation determination of a diffraction data from a single crystal when a relatively large number of reflections are recorded. Here we show thatmore » it is possible to obtain the exact lattice geometry from a smaller number of measurements than standard approaches using a basis pursuit solver.« less

  12. Magnetic and thermal behavior of a family of compositionally related zero-dimensional fluorides

    NASA Astrophysics Data System (ADS)

    Felder, Justin B.; Smith, Mark D.; Sefat, Athena; zur Loye, Hans-Conrad

    2018-07-01

    The mild hydrothermal crystal growth technique has been leveraged to synthesize four new zero-dimensional transition metal fluorides. Their structures were determined by single crystal X-ray diffraction and confirmed by powder X-ray diffraction. The thermal, optical, and magnetic properties were investigated and the presence of thermal polymorphism and antiferromagnetism were observed. In addition, the potential application of these materials as precursors for advanced functional materials was explored.

  13. Production, purification and preliminary X-ray crystallographic studies of adeno-associated virus serotype 7

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Quesada, Odayme; Gurda, Brittney; Govindasamy, Lakshmanan

    2007-12-01

    Crystals of baculovirus-expressed adeno-associated virus serotype 7 capsids have been produced which diffract X-rays to ∼3.0 Å resolution. Crystals of baculovirus-expressed adeno-associated virus serotype 7 capsids diffract X-rays to ∼3.0 Å resolution. The crystals belong to the rhombohedral space group R3, with unit-cell parameters a = 252.4, c = 591.2 Å in the hexagonal setting. The diffraction data were processed and reduced to an overall completeness of 79.0% and an R{sub merge} of 12.0%. There are three viral capsids in the unit cell. The icosahedral threefold axis is coincident with the crystallographic threefold axis, resulting in one third of amore » capsid (20 monomers) per crystallographic asymmetric unit. The orientation of the viral capsid has been determined by rotation-function searches and is positioned at (0, 0, 0) by packing considerations.« less

  14. Phase retrieval for crystalline specimens

    NASA Astrophysics Data System (ADS)

    Arnal, Romain A.; Millane, Rick P.

    2017-09-01

    The recent availability of ultra-bright and ultra-short X-rays pulses from new sources called x-ray free-electron lasers (XFELs) has introduced a new paradigm in X-ray crystallography. Called "diffraction-before-destruction," this paradigm addresses the main problems that plague crystallography using synchrotron sources. However, the phase problem of coherent diffraction imaging remains: one has to retrieve the phase of the measured diffraction amplitude in order to reconstruct the object. Fibrous and membrane proteins that crystallize in 1D and 2D crystals can now potentially be used for data collection with free-electron lasers. The crystallographic phase problem with such crystalline specimens is eased as the Fourier amplitude can be sampled more finely than at the Bragg sampling along one or two directions. Here we characterise uniqueness of the phase problem for different types of crystalline specimen. Simulated ab initio phase retrieval using iterative projection algorithms for 2D crystals is presented.

  15. Recombinant expression, purification, crystallization and preliminary X-ray diffraction analysis of the C-terminal DUF490(963-1138) domain of TamB from Escherichia coli.

    PubMed

    Josts, Inokentijs; Grinter, Rhys; Kelly, Sharon M; Mosbahi, Khedidja; Roszak, Aleksander; Cogdell, Richard; Smith, Brian O; Byron, Olwyn; Walker, Daniel

    2014-09-01

    TamB is a recently described inner membrane protein that, together with its partner protein TamA, is required for the efficient secretion of a subset of autotransporter proteins in Gram-negative bacteria. In this study, the C-terminal DUF490963-1138 domain of TamB was overexpressed in Escherichia coli K-12, purified and crystallized using the sitting-drop vapour-diffusion method. The crystals belonged to the primitive trigonal space group P3121, with unit-cell parameters a = b = 57.34, c = 220.74 Å, and diffracted to 2.1 Å resolution. Preliminary secondary-structure and X-ray diffraction analyses are reported. Two molecules are predicted to be present in the asymmetric unit. Experimental phasing using selenomethionine-labelled protein will be undertaken in the future.

  16. Pink-beam serial crystallography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meents, A.; Wiedorn, M. O.; Srajer, V.

    Serial X-ray crystallography allows macromolecular structure determination at both X-ray free electron lasers (XFELs) and, more recently, synchrotron sources. The time resolution for serial synchrotron crystallography experiments has been limited to millisecond timescales with monochromatic beams. The polychromatic, “pink”, beam provides a more than two orders of magnitude increased photon flux and hence allows accessing much shorter timescales in diffraction experiments at synchrotron sources. Here we report the structure determination of two different protein samples by merging pink-beam diffraction patterns from many crystals, each collected with a single 100 ps X-ray pulse exposure per crystal using a setup optimized formore » very low scattering background. In contrast to experiments with monochromatic radiation, data from only 50 crystals were required to obtain complete datasets. The high quality of the diffraction data highlights the potential of this method for studying irreversible reactions at sub-microsecond timescales using high-brightness X-ray facilities.« less

  17. Pink-beam serial crystallography

    DOE PAGES

    Meents, A.; Wiedorn, M. O.; Srajer, V.; ...

    2017-11-03

    Serial X-ray crystallography allows macromolecular structure determination at both X-ray free electron lasers (XFELs) and, more recently, synchrotron sources. The time resolution for serial synchrotron crystallography experiments has been limited to millisecond timescales with monochromatic beams. The polychromatic, “pink”, beam provides a more than two orders of magnitude increased photon flux and hence allows accessing much shorter timescales in diffraction experiments at synchrotron sources. Here we report the structure determination of two different protein samples by merging pink-beam diffraction patterns from many crystals, each collected with a single 100 ps X-ray pulse exposure per crystal using a setup optimized formore » very low scattering background. In contrast to experiments with monochromatic radiation, data from only 50 crystals were required to obtain complete datasets. The high quality of the diffraction data highlights the potential of this method for studying irreversible reactions at sub-microsecond timescales using high-brightness X-ray facilities.« less

  18. X-ray diffraction analysis and in vitro characterization of the UAM2 protein from Oryza sativa

    DOE PAGES

    Welner, Ditte Hededam; Tsai, Alex Yi-Lin; DeGiovanni, Andy M.; ...

    2017-03-29

    The role of seemingly non-enzymatic proteins in complexes interconverting UDP-arabinopyranose and UDP-arabinofuranose (UDP-arabinosemutases; UAMs) in the plant cytosol remains unknown. To shed light on their function, crystallographic and functional studies of the seemingly non-enzymatic UAM2 protein from Oryza sativa (OsUAM2) were undertaken. Here, X-ray diffraction data are reported, as well as analysis of the oligomeric state in the crystal and in solution. OsUAM2 crystallizes readily but forms highly radiation-sensitive crystals with limited diffraction power, requiring careful low-dose vector data acquisition. Using size-exclusion chromatography, it is shown that the protein is monomeric in solution. Finally, limited proteolysis was employed to demonstratemore » DTT-enhanced proteolytic digestion, indicating the existence of at least one intramolecular disulfide bridge or, alternatively, a requirement for a structural metal ion.« less

  19. Solution to the Phase Problem Using Multibeam X-Ray Diffraction.

    NASA Astrophysics Data System (ADS)

    Shen, Qun

    Multi-beam x-ray diffraction, especially the asymmetry effect in the virtual Bragg scattering case, has been proved to provide useful phase information on the structure factors that are involved in the scattering process. A perturbation theory has been developed to provide an analytical expression for the diffracted wave field in virtual Bragg scattering situations, which explains the physical origin of the asymmetry effect. Two experiments on the (202) reflection of benzil, using 3.5 keV x-rays, have shown that the asymmetry effect is visible in a mosaic non-centrosymmetric organic crystal. The results do not depend on the shape of the crystal, hence proving that the method is universally applicable. A practical method to obtain arbitrary values of the phase triplet, based on the perturbation theory, has been developed and shown to work in the case of non-centrosymmetric crystals like benzil.

  20. ENVIRONMENTAL TECHNOLOGY VERIFICATION: JOINT (NSF-EPA) VERIFICATION STATEMENT AND REPORT FOR THE REDUCTION OF NITROGEN IN DOMESTIC WASTEWATER FROM INDIVIDUAL RESIDENTIAL HOMES, WATERLOO BIOFILTER® MODEL 4-BEDROOM (NSF 02/03/WQPC-SWP)

    EPA Science Inventory

    Verification testing of the Waterloo Biofilter Systems (WBS), Inc. Waterloo Biofilter® Model 4-Bedroom system was conducted over a thirteen month period at the Massachusetts Alternative Septic System Test Center (MASSTC) located at Otis Air National Guard Base in Bourne, Mas...

  1. ENVIRONMENTAL TECHNOLOGY VERIFICATION: JOINT (NSF-EPA) VERIFICATION STATEMENT AND REPORT FOR THE REDUCTION OF NITROGEN IN DOMESTIC WASTEWATER FROM INDIVIDUAL HOMES, AQUAPOINT, INC. BIOCLERE MODEL 16/12 - 02/02/WQPC-SWP

    EPA Science Inventory

    Verification testing of the Aquapoint, Inc. (AQP) BioclereTM Model 16/12 was conducted over a thirteen month period at the Massachusetts Alternative Septic System Test Center (MASSTC), located at Otis Air National Guard Base in Bourne, Massachusetts. Sanitary sewerage from the ba...

  2. Growth, structural, thermal, linear and nonlinear optical and laser damage threshold studies of picolinium tartrate monohydrate single crystals.

    PubMed

    Peramaiyan, G; Pandi, P; Sornamurthy, B M; Bhagavannarayana, G; Mohan Kumar, R

    2012-09-01

    Picolinium tartrate monohydrate (PTM), a novel organic nonlinear optical material was synthesized and bulk crystals were grown from aqueous solution by slow cooling technique. The cell parameters of the grown crystal were found by single and powder X-ray diffraction analyses. The crystalline perfection of the grown crystals has been analyzed by high-resolution X-ray diffraction (HRXRD) rocking curve measurements. The presence of functional groups in the grown crystal was identified by FTIR and FT-Raman spectral analyses. UV-Vis spectral studies reveal PTM crystals are transparent in the wavelength region of 295-1100 nm. The thermal characteristics of PTM were analyzed by TGA/DTA studies. The dielectric and mechanical behaviours of PTM crystals were investigated. Dislocation density was estimated to be 2.89 × 10(3) cm(-2) on the flat-surface of PTM crystals from the etching studies. The laser induced surface damage threshold for the grown crystal was measured using Nd:YAG laser. Its second harmonic generation relative efficiency was measured by Kurtz and Perry powder technique and was observed to be comparable with KDP crystal. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Growth, nonlinear optical, thermal, dielectric and laser damage threshold studies of semiorganic crystal: monohydrate piperazine hydrogen phosphate.

    PubMed

    Krishnan, P; Gayathri, K; Bhagavannarayana, G; Gunasekaran, S; Anbalagan, G

    2013-02-01

    Monohydrate piperazine hydrogen phosphate (MPHP), a semi organic nonlinear optical material has been synthesized and single crystals were grown from aqueous solution by slow evaporation technique. Single crystal X-ray diffraction study on grown crystal reveals that they belong to monoclinic crystal system with space group P2(1)/c; (a=6.39Å; b=12.22Å; c=11.16Å; β=97.14°; V=864Å(3)). The structural perfection of the grown crystal was analyzed by high-resolution X-ray diffraction (HRXRD) rocking curve measurements. FTIR spectrum confirms the presence of the functional groups in synthesized material. UV-Vis spectrum indicates that the crystal is transparent in the entire visible region with a lower cut off wavelength of 387 nm. The variation of dielectric properties of the grown crystal with respect to frequency has been investigated at different temperatures. Thermal analysis carried out on the MPHP crystal shows that the crystal is stable up to 135°C. Relative powder second harmonic generation efficiency tested by Kurtz-Perry powder technique, which was about 0.638 times that of Potassium dihydrogen phosphate. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Recent Advances in the Understanding of the Influence of Electric and Magnetic Fields on Protein Crystal Growth

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pareja-Rivera, Carina; Cuéllar-Cruz, Mayra; Esturau-Escofet, Nuria

    Here, in this contribution we use nonconventional methods that help to increase the success rate of a protein crystal growth, and consequently of structural projects using X-ray diffraction techniques. In order to achieve this purpose, this contribution presents new approaches involving more sophisticated techniques of protein crystallization, not just for growing protein crystals of different sizes by using electric fields, but also for controlling crystal size and orientation. Also, this latter was possible through the use of magnetic fields that allow to obtain protein crystals suitable for both high-resolution X-ray and neutron diffraction crystallography where big crystals are required. Thismore » contribution discusses some pros, cons and realities of the role of electromagnetic fields in protein crystallization research, and their effect on protein crystal contacts. Additionally, we discuss the importance of room and low temperatures during data collection. Finally, we also discuss the effect of applying a rather strong magnetic field of 16.5 T, for shorts and long periods of time, on protein crystal growth, and on the 3D structure of two model proteins.« less

  5. Recent Advances in the Understanding of the Influence of Electric and Magnetic Fields on Protein Crystal Growth

    DOE PAGES

    Pareja-Rivera, Carina; Cuéllar-Cruz, Mayra; Esturau-Escofet, Nuria; ...

    2016-12-05

    Here, in this contribution we use nonconventional methods that help to increase the success rate of a protein crystal growth, and consequently of structural projects using X-ray diffraction techniques. In order to achieve this purpose, this contribution presents new approaches involving more sophisticated techniques of protein crystallization, not just for growing protein crystals of different sizes by using electric fields, but also for controlling crystal size and orientation. Also, this latter was possible through the use of magnetic fields that allow to obtain protein crystals suitable for both high-resolution X-ray and neutron diffraction crystallography where big crystals are required. Thismore » contribution discusses some pros, cons and realities of the role of electromagnetic fields in protein crystallization research, and their effect on protein crystal contacts. Additionally, we discuss the importance of room and low temperatures during data collection. Finally, we also discuss the effect of applying a rather strong magnetic field of 16.5 T, for shorts and long periods of time, on protein crystal growth, and on the 3D structure of two model proteins.« less

  6. A simple 2D composite image analysis technique for the crystal growth study of L-ascorbic acid.

    PubMed

    Kumar, Krishan; Kumar, Virender; Lal, Jatin; Kaur, Harmeet; Singh, Jasbir

    2017-06-01

    This work was destined for 2D crystal growth studies of L-ascorbic acid using the composite image analysis technique. Growth experiments on the L-ascorbic acid crystals were carried out by standard (optical) microscopy, laser diffraction analysis, and composite image analysis. For image analysis, the growth of L-ascorbic acid crystals was captured as digital 2D RGB images, which were then processed to composite images. After processing, the crystal boundaries emerged as white lines against the black (cancelled) background. The crystal boundaries were well differentiated by peaks in the intensity graphs generated for the composite images. The lengths of crystal boundaries measured from the intensity graphs of composite images were in good agreement (correlation coefficient "r" = 0.99) with the lengths measured by standard microscopy. On the contrary, the lengths measured by laser diffraction were poorly correlated with both techniques. Therefore, the composite image analysis can replace the standard microscopy technique for the crystal growth studies of L-ascorbic acid. © 2017 Wiley Periodicals, Inc.

  7. Crystallization and preliminary X-ray diffraction analysis of a novel Arg49 phospholipase A{sub 2} homologue from Zhaoermia mangshanensis venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murakami, Mário T.; Center for Applied Toxinology, CAT-CEPID, São Paulo, SP; Advanced Center for Genomics and Proteomics, UNESP-State University of São Paulo, São José do Rio Preto 15054-000

    2007-07-01

    A single crystal of zhaoermiatoxin with maximum dimensions of 0.2 × 0.2 × 0.5 mm was used for X-ray diffraction data collection to a resolution of 2.05 Å using synchrotron radiation and the diffraction pattern was indexed in the hexagonal space group P6{sub 4}, with unit-cell parameters a = 72.9, b = 72.9, c = 93.9 Å. Zhaoermiatoxin, an Arg49 phospholipase A{sub 2} homologue from Zhaoermia mangshanensis (formerly Trimeresurus mangshanensis, Ermia mangshanensis) venom is a novel member of the PLA{sub 2}-homologue family that possesses an arginine residue at position 49, probably arising from a secondary Lys49→Arg substitution that does notmore » alter the catalytic inactivity towards phospholipids. Like other Lys49 PLA{sub 2} homologues, zhaoermiatoxin induces oedema and strong myonecrosis without detectable PLA{sub 2} catalytic activity. A single crystal with maximum dimensions of 0.2 × 0.2 × 0.5 mm was used for X-ray diffraction data collection to a resolution of 2.05 Å using synchrotron radiation and the diffraction pattern was indexed in the hexagonal space group P6{sub 4}, with unit-cell parameters a = 72.9, b = 72.9, c = 93.9 Å.« less

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Madden, Jeremy T.; Toth, Scott J.; Dettmar, Christopher M.

    Nonlinear optical (NLO) instrumentation has been integrated with synchrotron X-ray diffraction (XRD) for combined single-platform analysis, initially targeting applications for automated crystal centering. Second-harmonic-generation microscopy and two-photon-excited ultraviolet fluorescence microscopy were evaluated for crystal detection and assessed by X-ray raster scanning. Two optical designs were constructed and characterized; one positioned downstream of the sample and one integrated into the upstream optical path of the diffractometer. Both instruments enabled protein crystal identification with integration times between 80 and 150 µs per pixel, representing a ~10 3–10 4-fold reduction in the per-pixel exposure time relative to X-ray raster scanning. Quantitative centering andmore » analysis of phenylalanine hydroxylase fromChromobacterium violaceumcPAH,Trichinella spiralisdeubiquitinating enzyme TsUCH37, human κ-opioid receptor complex kOR-T4L produced in lipidic cubic phase (LCP), intimin prepared in LCP, and α-cellulose samples were performed by collecting multiple NLO images. The crystalline samples were characterized by single-crystal diffraction patterns, while α-cellulose was characterized by fiber diffraction. Good agreement was observed between the sample positions identified by NLO and XRD raster measurements for all samples studied.« less

  9. Single crystal X-ray diffraction study of the HgBa2CuO4+δ superconducting compound

    NASA Astrophysics Data System (ADS)

    Bordet, P.; Duc, F.; Lefloch, S.; Capponi, J. J.; Alexandre, E.; Rosa-Nunes, M.; Antipov, E. V.; Putilin, S.

    1996-02-01

    A high precision X-ray diffraction analysis up to sin θ/λ = 1.15 of a HgBa2CuO4+δ single crystal having a Tc of ~ 90 K is presented. The cell parameters are a = 3.8815(4), c = 9.485 (7) Å. The refinements indicate the existence of a split barium site due to the presence of excess oxygen in the mercury layer. The position of this excess oxygen might be slightly displaced from the (1/2 1/2 0) position. A 6% mercury deficiency is observed. Models, including mercury defects, substitution by copper cations, or carbonate groups, are compared. However, we obtain no definite evidence for either of the three models. A possible disorder of the Hg position, due to the formation of chemical bonds with neighbouring extra oxygen anions, could correlate to the refinements of mixed species at the Hg site. A low temperature single crystal x-ray diffraction study, and comparison of refinements for the same single crystal with different extra oxygen contents, are in progress to help clarify this problem.

  10. Crystallization and preliminary X-ray diffraction analysis of mouse 3(17)α-hydroxysteroid dehydrogenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    El-Kabbani, Ossama, E-mail: ossama.el-kabbani@vcp.monash.edu.au; Ishikura, Syuhei; Wagner, Armin

    2005-07-01

    Orthorhombic crystals of mouse 3(17)α-hydroxysteroid dehydrogenase were obtained from buffered polyethylene glycol solutions. The crystals diffracted to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA. The 3(17)α-hydroxysteroid dehydrogenase from mouse is involved in the metabolism of oestrogens, androgens, neurosteroids and xenobiotic compounds. The enzyme was crystallized by the hanging-drop vapour-diffusion method in space group P222{sub 1}, with unit-cell parameters a = 84.91, b = 84.90, c = 95.83 Å. The Matthews coefficient (V{sub M}) and the solvent content were 2.21 Å{sup 3} Da{sup −1} and 44.6%, respectively, assuming the presence of two molecules in the asymmetricmore » unit. Diffraction data were collected to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA using a MAR CCD area detector and gave a data set with an overall R{sub merge} of 6.8% and a completeness of 91.1%.« less

  11. Evidence for monoclinic distortion in the ground state phase of underdoped La 1.95Sr 0.05CuO 4: A single crystal neutron diffraction study

    DOE PAGES

    Singh, Anar; Schefer, Jurg; Sura, Ravi; ...

    2016-03-24

    The existing controversy about the symmetry of the crystal structure of the ground state of the critical doped La 1.95Sr 0.05CuO 4 has been resolved by analyzing the single crystal neutron diffraction data collected between 5 and 730 K. We observed small but significant intensities for "forbidden" reflections given by extinction rules of the orthorhombic Bmab space group at low temperatures. A careful investigation of neutron diffraction data reveals that the crystal structure of La 1.95Sr 0.05CuO 4 at 5 K is monoclinic with B2/m (2/m 1 1) space group. The monoclinic structure emerges from the orthorhombic structure in amore » continuous way; however, the structure is stable below similar to 120K which agrees with other observed phenomena. Lastly, our results on symmetry changes are crucial for the interpretation of physical properties also in other high temperature superconductors with similar structures.« less

  12. Crystallization and preliminary X-ray diffraction study of phosphoribosyl pyrophosphate synthetase from E. Coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Timofeev, V. I., E-mail: inna@ns.crys.ras.ru; Abramchik, Yu. A., E-mail: tostars@mail.ru; Zhukhlistova, N. E., E-mail: ugama@yandex.ru

    2015-09-15

    Enzymes of the phosphoribosyl pyrophosphate synthetase family (PRPPS, EC 2.7.6.1) catalyze the formation of 5-phosphoribosyl pyrophosphate (5-PRPP) from adenosine triphosphate and ribose 5-phosphate. 5-Phosphoribosyl pyrophosphate is an important intermediate in the synthesis of purine, pyrimidine, and pyridine nucleotides, as well as of the amino acids histidine and tryptophan. The crystallization conditions for E. coli PRPPS were found by the vapor-diffusion technique and were optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals grown by the counter-diffusion technique using a synchrotron radiation source to 3.1-Å resolution. The crystals of PRPPS belong to sp.more » gr. P6{sub 3}22 and have the following unit-cell parameters: a = b = 104.44 Å, c = 124.98 Å, α = β = 90°, γ = 120°. The collected X-ray diffraction data set is suitable for the solution of the three-dimensional structure of PRPPS at 3.1-Å resolution.« less

  13. Evidence for monoclinic distortion in the ground state phase of underdoped La{sub 1.95}Sr{sub 0.05}CuO{sub 4}: A single crystal neutron diffraction study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh, Anar, E-mail: singhanar@gmail.com; Schefer, Jürg; Frontzek, Matthias

    2016-03-28

    The existing controversy about the symmetry of the crystal structure of the ground state of the critical doped La{sub 1.95}Sr{sub 0.05}CuO{sub 4} has been resolved by analyzing the single crystal neutron diffraction data collected between 5 and 730 K. We observed small but significant intensities for “forbidden” reflections given by extinction rules of the orthorhombic Bmab space group at low temperatures. A careful investigation of neutron diffraction data reveals that the crystal structure of La{sub 1.95}Sr{sub 0.05}CuO{sub 4} at 5 K is monoclinic with B2/m (2/m 1 1) space group. The monoclinic structure emerges from the orthorhombic structure in a continuous way;more » however, the structure is stable below ∼120 K which agrees with other observed phenomena. Our results on symmetry changes are crucial for the interpretation of physical properties also in other high temperature superconductors with similar structures.« less

  14. Purification, crystallization and preliminary X-ray analysis of Escherichia coli UDP-N-acetylmuramoyl:L-alanine ligase (MurC).

    PubMed

    Deva, Taru; Pryor, KellyAnn D; Leiting, Barbara; Baker, Edward N; Smith, Clyde A

    2003-08-01

    UDP-N-acetylmuramoyl:L-alanine ligase (MurC) is involved in the pathway leading from UDP-N-glucosamine to the UDP-N-acetylmuramoyl:pentapeptide unit, which is the building block for the peptidoglycan layer found in all bacterial cell walls. The pathways leading to the biosynthesis of the peptidoglycan layer are important targets for the development of novel antibiotics, since animal cells do not contain these pathways. MurC is the first of four similar ATP-dependent amide-bond ligases which share primary and tertiary structural similarities. The crystal structures of three of these have been determined by X-ray crystallography, giving insights into the binding of the carbohydrate substrate and the ATP. Diffraction-quality crystals of the enzyme MurC have been obtained in both native and selenomethionine forms and X-ray diffraction data have been collected at the Se edge at a synchrotron source. The crystals are orthorhombic, with unit-cell parameters a = 73.9, b = 93.6, c = 176.8 A, and diffraction has been observed to 2.6 A resolution.

  15. Periodic order and defects in Ni-based inverse opal-like crystals on the mesoscopic and atomic scale

    NASA Astrophysics Data System (ADS)

    Chumakova, A. V.; Valkovskiy, G. A.; Mistonov, A. A.; Dyadkin, V. A.; Grigoryeva, N. A.; Sapoletova, N. A.; Napolskii, K. S.; Eliseev, A. A.; Petukhov, A. V.; Grigoriev, S. V.

    2014-10-01

    The structure of inverse opal crystals based on nickel was probed on the mesoscopic and atomic levels by a set of complementary techniques such as scanning electron microscopy and synchrotron microradian and wide-angle diffraction. The microradian diffraction revealed the mesoscopic-scale face-centered-cubic (fcc) ordering of spherical voids in the inverse opal-like structure with unit cell dimension of 750±10nm. The diffuse scattering data were used to map defects in the fcc structure as a function of the number of layers in the Ni inverse opal-like structure. The average lateral size of mesoscopic domains is found to be independent of the number of layers. 3D reconstruction of the reciprocal space for the inverse opal crystals with different thickness provided an indirect study of original opal templates in a depth-resolved way. The microstructure and thermal response of the framework of the porous inverse opal crystal was examined using wide-angle powder x-ray diffraction. This artificial porous structure is built from nickel crystallites possessing stacking faults and dislocations peculiar for the nickel thin films.

  16. Purification, partial characterization, crystallization and preliminary X-ray diffraction of a novel cardiotoxin-like basic protein from Naja naja atra (South Anhui) venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rong, Hui; Li, Yan; Lou, Xiao-hua

    2007-02-01

    A novel cardiotoxin-like basic protein from Naja naja atra was crystallized and diffraction data were collected to 2.35 Å resolution. A novel cardiotoxin-like basic protein was isolated from the venom of the Chinese cobra (Naja naja atra) from the south of Anhui in China. The protein inhibits the expression of vascular endothelial growth factor and basic fibroblast growth factor in human lung cancer cell line H1299 and induces the haemolysis of rabbit erythrocytes under low-lecithin conditions. After a two-step chromatographic purification, the resultant 7 kDa protein was crystallized by the hanging-drop vapour-diffusion method at room temperature. A complete data setmore » was collected to 2.35 Å resolution using an in-house X-ray diffraction system. The crystal belongs to space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 43.2, c = 147.9 Å. There are two molecules in the crystallographic asymmetric unit.« less

  17. Expression, purification, crystallization and preliminary X-ray diffraction analysis of the VP8* sialic acid-binding domain of porcine rotavirus strain OSU

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yang-De, E-mail: zhangyd1960@yahoo.com.cn; Li, Hao; Liu, Hui

    2007-02-01

    Porcine rotavirus strain OSU VP8* domain has been expressed, purified and crystallized. X-ray diffraction data from different crystal forms of the VP8* domain have been collected to 2.65 and 2.2 Å resolution, respectively. The rotavirus outer capsid spike protein VP4 is utilized in the process of rotavirus attachment to and membrane penetration of host cells. VP4 is cleaved by trypsin into two domains: VP8* and VP5*. The VP8* domain is implicated in initial interaction with sialic acid-containing cell-surface carbohydrates and triggers subsequent virus invasion. The VP8* domain from porcine OSU rotavirus was cloned and expressed in Escherichia coli. Different crystalmore » forms (orthorhombic P2{sub 1}2{sub 1}2{sub 1} and tetragonal P4{sub 1}2{sub 1}2) were harvested from two distinct crystallization conditions. Diffraction data have been collected to 2.65 and 2.2 Å resolution and the VP8*{sub 65–224} structure was determined by molecular replacement.« less

  18. Expression, purification and preliminary X-ray diffraction studies of the transcriptional factor PyrR from Bacillus halodurans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arreola, Rodrigo; Vega-Miranda, Anita; Gómez-Puyou, Armando

    The gene-regulation factor PyrR from B. halodurans has been crystallized in two crystal forms. Preliminary crystallographic analysis showed that the protein forms tetramers in both space groups. The PyrR transcriptional regulator is widely distributed in bacteria. This RNA-binding protein is involved in the control of genes involved in pyrimidine biosynthesis, in which uridyl and guanyl nucleotides function as effectors. Here, the crystallization and preliminary X-ray diffraction analysis of two crystal forms of Bacillus halodurans PyrR are reported. One of the forms belongs to the monoclinic space group P2{sub 1} with unit-cell parameters a = 59.7, b = 87.4, c =more » 72.1 Å, β = 104.4°, while the other form belongs to the orthorhombic space group P22{sub 1}2{sub 1} with unit-cell parameters a = 72.7, b = 95.9, c = 177.1 Å. Preliminary X-ray diffraction data analysis and molecular-replacement solution revealed the presence of four and six monomers per asymmetric unit; a crystallographic tetramer is formed in both forms.« less

  19. Crystallization and preliminary X-ray analysis of a low density lipoprotein from human plasma.

    PubMed

    Prassl, R; Chapman, J M; Nigon, F; Sara, M; Eschenburg, S; Betzel, C; Saxena, A; Laggner, P

    1996-11-15

    Single crystals of human plasma low density lipoprotein (LDL), the major transport vehicle for cholesterol in blood, have been produced with a view to analysis of the three-dimensional structure by x-ray crystallography. Crystals with dimensions of approximately 200 x 100 x 50 microm have been reproducibly obtained from highly homogeneous LDL particle subspecies, isolated in the density ranges d = 1.0271-1. 0297 g/ml and d = 1.0297-1.0327 g/ml. Electron microscopic imaging of ultrathin-sectioned preparations of the crystals confirmed the existence of a regular, quasihexagonal arrangement of spherical particles of approximately 18 nm in diameter, thereby resembling the dimensions characteristic of LDL after dehydration and fixation. X-ray diffraction with synchrotron radiation under cryogenic conditions revealed the presence of well resolved diffraction spots, to a resolution of about 29 A. The diffraction patterns are indexed in terms of a triclinic lattice with unit cell dimensions of a = 16. 1 nm, b = 39.0 nm, c = 43.9 nm; alpha = 96.2 degrees, beta = 92.1 degrees, gamma = 102 degrees, and with space group P1.

  20. Polyethylene nano crystalsomes formed at a curved liquid/liquid interface.

    PubMed

    Wang, Wenda; Staub, Mark C; Zhou, Tian; Smith, Derrick M; Qi, Hao; Laird, Eric D; Cheng, Shan; Li, Christopher Y

    2017-12-21

    Crystallization is incommensurate with nanoscale curved space due to the lack of three dimensional translational symmetry of the latter. Herein, we report the formation of single-crystal-like, nanosized polyethylene (PE) capsules using a miniemulsion solution crystallization method. The miniemulsion was formed at elevated temperatures using PE organic solution as the oil phase and sodium dodecyl sulfate as the surfactant. Subsequently, cooling the system stepwisely for controlled crystallization led to the formation of hollow, nanosized PE crystalline capsules, which are named as crystalsomes since they mimic the classical self-assembled structures such as liposome, polymersome and colloidosome. We show that the formation of the nanosized PE crystalsomes is driven by controlled crystallization at the curved liquid/liquid interface of the miniemulson droplet. The morphology, structure and mechanical properties of the PE crystalsomes were characterized using scanning electron microscopy, transmission electron microscopy, X-ray diffraction, and atomic force spectroscopy. Electron diffraction showed the single-crystal-like nature of the crystalsomes. The incommensurateness between the nanocurved interface and the crystalline packing led to reduced crystallinity and crystallite size of the PE crystalsome, as observed from the X-ray diffraction measurements. Moreover, directly quenching the emulsion below the spinodal line led to the formation of hierarchical porous PE crystalsomes due to the coupling of the PE crystallization and liquid/liquid phase separation. We anticipate that this unique crystalsome represents a new type of nanostructure that might be used as nanodrug carriers and ultrasound contrast agents.

Top