Sample records for bp consensus sequence

  1. Structure of genes and an insertion element in the methane producing archaebacterium Methanobrevibacter smithii.

    PubMed

    Hamilton, P T; Reeve, J N

    1985-01-01

    DNA fragments cloned from the methanogenic archaebacterium Methanobrevibacter smithii which complement mutations in the purE and proC genes of E. coli have been sequenced. Sequence analyses, transposon mutagenesis and expression in E. coli minicells indicate that purE and proC complementations result from the synthesis of M. smithii polypeptides with molecular weights of 36,697 and 27,836 respectively. The encoding genes appear to be located in operons. The M. smithii genome contains 69% A/T basepairs (bp) which is reflected in unusual codon usages and intergenic regions containing approximately 85% A/T bp. An insertion element, designated ISM1, was found within the cloned M. smithii DNA located adjacent to the proC complementing region. ISM1 is 1381 bp in length, has 29 bp terminal inverted repeat sequences and contains one major ORF encoded in 87% of the ISM1 sequence. ISM1 is mobile, present in approximately 10 copies per genome and integration duplicates 8 bp at the site of insertion. The duplicated sequences show homology with sequences within the 29 bp terminal repeat sequence of ISM1. Comparison of our data with sequences from halophilic archaebacteria suggests that 5'GAANTTTCA and 5'TTTTAATATAAA may be consensus promoter sequences for archaebacteria. These sequences closely resemble the consensus sequences which precede Drosophila heat-shock genes (Pelham 1982; Davidson et al. 1983). Methanogens appear to employ the eubacterial system of mRNA: 16SrRNA hybridization to ensure initiation of translation; the consensus ribosome binding sequence is 5'AGGTGA.

  2. DNA sequence analysis of ARS elements from chromosome III of Saccharomyces cerevisiae: identification of a new conserved sequence.

    PubMed Central

    Palzkill, T G; Oliver, S G; Newlon, C S

    1986-01-01

    Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036

  3. Molecular identification and characterization of clustered regularly interspaced short palindromic repeats (CRISPRs) in a urease-positive thermophilic Campylobacter sp. (UPTC).

    PubMed

    Tasaki, E; Hirayama, J; Tazumi, A; Hayashi, K; Hara, Y; Ueno, H; Moore, J E; Millar, B C; Matsuda, M

    2012-02-01

    Novel clustered regularly-interspaced short palindromic repeats (CRISPRs) locus [7,500 base pairs (bp) in length] occurred in the urease-positive thermophilic Campylobacter (UPTC) Japanese isolate, CF89-12. The 7,500 bp gene loci consisted of the 5'-methylaminomethyl-2-thiouridylate methyltransferase gene, putative (P) CRISPR associated (p-Cas), putative open reading frames, Cas1 and Cas2, leader sequence region (146 bp), 12 CRISPRs consensus sequence repeats (each 36 bp) separated by a non-repetitive unique spacer region of similar length (26-31 bp) and the phosphatidyl glycerophosphatase A gene. When the CRISPRs loci in the UPTC CF89-12 and five C. jejuni isolates were compared with one another, these six isolates contained p-Cas, Cas1 and Cas2 within the loci. Four to 12 CRISPRs consensus sequence repeats separated by a non-repetitive unique spacer region occurred in six isolates and the nucleotide sequences of those repeats gave approximately 92-100% similarity with each other. However, no sequence similarity occurred in the unique spacer regions among these isolates. The putative σ(70) transcriptional promoter and the hypothetical ρ-independent terminator structures for the CRISPRs and Cas were detected. No in vivo transcription of p-Cas, Cas1 and Cas2 was confirmed in the UPTC cells.

  4. Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

    PubMed

    Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

    2000-05-31

    cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

  5. Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

    PubMed

    O'Sullivan, D J; O'Gara, F

    1991-08-01

    An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

  6. Consensus generation and variant detection by Celera Assembler.

    PubMed

    Denisov, Gennady; Walenz, Brian; Halpern, Aaron L; Miller, Jason; Axelrod, Nelson; Levy, Samuel; Sutton, Granger

    2008-04-15

    We present an algorithm to identify allelic variation given a Whole Genome Shotgun (WGS) assembly of haploid sequences, and to produce a set of haploid consensus sequences rather than a single consensus sequence. Existing WGS assemblers take a column-by-column approach to consensus generation, and produce a single consensus sequence which can be inconsistent with the underlying haploid alleles, and inconsistent with any of the aligned sequence reads. Our new algorithm uses a dynamic windowing approach. It detects alleles by simultaneously processing the portions of aligned reads spanning a region of sequence variation, assigns reads to their respective alleles, phases adjacent variant alleles and generates a consensus sequence corresponding to each confirmed allele. This algorithm was used to produce the first diploid genome sequence of an individual human. It can also be applied to assemblies of multiple diploid individuals and hybrid assemblies of multiple haploid organisms. Being applied to the individual human genome assembly, the new algorithm detects exactly two confirmed alleles and reports two consensus sequences in 98.98% of the total number 2,033311 detected regions of sequence variation. In 33,269 out of 460,373 detected regions of size >1 bp, it fixes the constructed errors of a mosaic haploid representation of a diploid locus as produced by the original Celera Assembler consensus algorithm. Using an optimized procedure calibrated against 1 506 344 known SNPs, it detects 438 814 new heterozygous SNPs with false positive rate 12%. The open source code is available at: http://wgs-assembler.cvs.sourceforge.net/wgs-assembler/

  7. Molecular identification and characterization of clustered regularly interspaced short palindromic repeat (CRISPR) gene cluster in Taylorella equigenitalis.

    PubMed

    Hara, Yasushi; Hayashi, Kyohei; Nakajima, Takuya; Kagawa, Shizuko; Tazumi, Akihiro; Moore, John E; Matsuda, Motoo

    2013-09-01

    Clustered regularly interspaced short palindromic repeats (CRISPRs), of approximately 10,000 base pairs (bp) in length, were shown to occur in the Japanese Taylorella equigenitalis strain, EQ59. The locus was composed of the putative CRISPRs-associated with 5 (cas5), RAMP csd1, csd2, recB, cas1, a leader region, 13 CRISPR consensus sequence repeats (each 32 bp; 5'-TCAGCCACGTTCGCGTGGCTGTGTGTTTAAAG-3'). These were in turn separated by 12 non repetitive unique spacer regions of similar length. In addition, a leader region, a transposase/IS protein, a leader region, and cas3 were also seen. All seven putative open reading frames carry their ribosome binding sites. Promoter consensus sequences at the -35 and -10 regions and putative intrinsic ρ-independent transcription terminator regions also occurred. A possible long overlap of 170 bp in length occurred between the recB and cas1 loci. Positive reverse transcription PCR signals of cas5, RAMP csd1, csd2-recB/cas1, and cas3 were generated. A putative secondary structure of the CRISPR consensus repeats was constructed. Following this, CRISPR results of the T. equigenitalis EQ59 isolate were subsequently compared with those from the Taylorella asinigenitalis MCE3 isolate.

  8. The short interspersed repetitive element of Trypanosoma cruzi, SIRE, is part of VIPER, an unusual retroelement related to long terminal repeat retrotransposons

    PubMed Central

    Vázquez, Martín; Ben-Dov, Claudia; Lorenzi, Hernan; Moore, Troy; Schijman, Alejandro; Levin, Mariano J.

    2000-01-01

    The short interspersed repetitive element (SIRE) of Trypanosoma cruzi was first detected when comparing the sequences of loci that encode the TcP2β genes. It is present in about 1,500–3,000 copies per genome, depending on the strain, and it is distributed in all chromosomes. An initial analysis of SIRE sequences from 21 genomic fragments allowed us to derive a consensus nucleotide sequence and structure for the element, consisting of three regions (I, II, and III) each harboring distinctive features. Analysis of 158 transcribed SIREs demonstrates that the consensus is highly conserved. The sequences of 51 cDNAs show that SIRE is included in the 3′ end of several mRNAs, always transcribed from the sense strand, contributing the polyadenylation site in 63% of the cases. This study led to the characterization of VIPER (vestigial interposed retroelement), a 2,326-bp-long unusual retroelement. VIPER's 5′ end is formed by the first 182 bp of SIRE, whereas its 3′ end is formed by the last 220 bp of the element. Both SIRE moieties are connected by a 1,924-bp-long fragment that carries a unique ORF encoding a complete reverse transcriptase-RNase H gene whose 15 C-terminal amino acids derive from codons specified by SIRE's region II. The amino acid sequence of VIPER's reverse transcriptase-RNase H shares significant homology to that of long terminal repeat retrotransposons. The fact that SIRE and VIPER sequences are found only in the T. cruzi genome may be of relevance for studies concerning the evolution and the genome flexibility of this protozoan parasite. PMID:10688909

  9. Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.

    PubMed

    Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R

    1987-01-01

    The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.

  10. [An intriguing model for 5S rDNA sequences dispersion in the genome of freshwater stingray Potamotrygon motoro (Chondrichthyes: Potamotrygonidae)].

    PubMed

    Cruz, V P; Oliveira, C; Foresti, F

    2015-01-01

    5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.

  11. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  12. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

    DOE PAGES

    Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

    2015-03-22

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

  13. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

  14. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

    PubMed

    Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

    2015-06-01

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

  15. Cloning and Expression of the Erwinia carotovora subsp. carotovora Gene Encoding the Low-Molecular-Weight Bacteriocin Carocin S1▿

    PubMed Central

    Chuang, Duen-yau; Chien, Yung-chei; Wu, Huang-Pin

    2007-01-01

    The purpose of this study was to clone the carocin S1 gene and express it in a non-carocin-producing strain of Erwinia carotovora. A mutant, TH22-10, which produced a high-molecular-weight bacteriocin but not a low-molecular-weight bacteriocin, was obtained by Tn5 insertional mutagenesis using H-rif-8-2 (a spontaneous rifampin-resistant mutant of Erwinia carotovora subsp. carotovora 89-H-4). Using thermal asymmetric interlaced PCR, the DNA sequence from the Tn5 insertion site and the DNA sequence of the contiguous 2,280-bp region were determined. Two complete open reading frames (ORF), designated ORF2 and ORF3, were identified within the sequence fragment. ORF2 and ORF3 were identified with the carocin S1 genes, caroS1K (ORF2) and caroS1I (ORF3), which, respectively, encode a killing protein (CaroS1K) and an immunity protein (CaroS1I). These genes were homologous to the pyocin S3 gene and the pyocin AP41 gene. Carocin S1 was expressed in E. carotovora subsp. carotovora Ea1068 and replicated in TH22-10 but could not be expressed in Escherichia coli (JM101) because a consensus sequence resembling an SOS box was absent. A putative sequence similar to the consensus sequence for the E. coli cyclic AMP receptor protein binding site (−312 bp) was found upstream of the start codon. Production of this bacteriocin was also induced by glucose and lactose. The homology search results indicated that the carocin S1 gene (between bp 1078 and bp 1704) was homologous to the pyocin S3 and pyocin AP41 genes in Pseudomonas aeruginosa. These genes encode proteins with nuclease activity (domain 4). This study found that carocin S1 also has nuclease activity. PMID:17071754

  16. Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.

    PubMed

    Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J

    2016-01-04

    The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Full trans–activation mediated by the immediate–early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence

    PubMed Central

    Kim, Seong K.; Shakya, Akhalesh K.; O'Callaghan, Dennis J.

    2015-01-01

    The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt −89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). PMID:26541315

  18. A variant Tc4 transposable element in the nematode C. elegans could encode a novel protein.

    PubMed Central

    Li, W; Shaw, J E

    1993-01-01

    A variant C. elegans Tc4 transposable element, Tc4-rh1030, has been sequenced and is 3483 bp long. The Tc4 element that had been analyzed previously is 1605 bp long, consists of two 774-bp nearly perfect inverted terminal repeats connected by a 57-bp loop, and lacks significant open reading frames. In Tc4-rh1030, by comparison, a 2343-bp novel sequence is present in place of a 477-bp segment in one of the inverted repeats. The novel sequence of Tc4-rh1030 is present about five times per haploid genome and is invariably associated with Tc4 elements; we have used the designation Tc4v to denote this variant subfamily of Tc4 elements. Sequence analysis of three cDNA clones suggests that a Tc4v element contains at least five exons that could encode a novel basic protein of 537 amino acid residues. On northern blots, a 1.6-kb Tc4v-specific transcript was detected in the mutator strain TR679 but not in the wild-type strain N2; Tc4 elements are known to transpose in TR679 but appear to be quiescent in N2. We have analyzed transcripts produced by an unc-33 gene that has the Tc4-rh1030 insertional mutation in its transcribed region; all or almost all of the Tc4v sequence is frequently spliced out of the mutant unc-33 transcripts, sometimes by means of non-consensus splice acceptor sites. Images PMID:8382791

  19. (S)-3-hydroxy-3-methylglutaryl coenzyme A reductase, a product of the mva operon of Pseudomonas mevalonii, is regulated at the transcriptional level.

    PubMed Central

    Wang, Y L; Beach, M J; Rodwell, V W

    1989-01-01

    We have cloned and sequenced a 505-base-pair (bp) segment of DNA situated upstream of mvaA, the structural gene for (S)-3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.88) of Pseudomonas mevalonii. The DNA segment that we characterized includes the promoter region for the mva operon. Nuclease S1 mapping and primer extension analysis showed that mvaA is the promoter-proximal gene of the mva operon. Transcription initiates at -56 bp relative to the first A (+1) of the translation start site. Transcription in vivo was induced by mevalonate. Structural features of the mva promoter region include an 80-bp A + T-rich region, and -12, -24 consensus sequences that resemble sequences of sigma 54 promoters in enteric organisms. The relative amplitudes of catalytic activity, enzyme protein, and mvaA mRNA are consistent with a model of regulation of this operon at the transcriptional level. Images PMID:2477360

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lapidus, Alla L.

    From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly ofmore » whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.« less

  1. A novel species-specific tandem repeat DNA family from Sinapis arvensis: detection of telomere-like sequences.

    PubMed

    Kapila, R; Das, S; Srivastava, P S; Lakshmikumaran, M

    1996-08-01

    DNA sequences representing a tandemly repeated DNA family of the Sinapis arvensis genome were cloned and characterized. The 700-bp tandem repeat family is represented by two clones, pSA35 and pSA52, which are 697 and 709 bp in length, respectively. Dot matrix analysis of the sequences indicates the presence of repeated elements within each monomeric unit. Sequence analysis of the repetitive region of clones pSA35 and pSA52 shows that there are several copies of a 7-bp repeat element organized in tandem. The consensus sequence of this repeat element is 5'-TTTAGGG-3'. These elements are highly mutated and the difference in length between the two clones is due to different copy numbers of these elements. The repetitive region of clone pSA35 has 26 copies of the element TTTAGGG, whereas clone pSA52 has 28 copies. The repetitive region in both clones is flanked on either side by inverted repeats that may be footprints of a transposition event. Sequence comparison indicates that the element TTTAGGG is identical to telomeric repeats present in Arabidopsis, maize, tomato, and other plants. However, Bal31 digestion kinetics indicates non-telomeric localization of the 700-bp tandem repeats. The clones represent a novel repeat family as (i) they contain telomere-like motifs as subrepeats within each unit; and (ii) they do not hybridize to related crucifers and are species-specific in nature.

  2. The consensus sequence of FAMLF alternative splice variants is overexpressed in undifferentiated hematopoietic cells.

    PubMed

    Chen, W L; Luo, D F; Gao, C; Ding, Y; Wang, S Y

    2015-07-01

    The familial acute myeloid leukemia related factor gene (FAMLF) was previously identified from a familial AML subtractive cDNA library and shown to undergo alternative splicing. This study used real-time quantitative PCR to investigate the expression of the FAMLF alternative-splicing transcript consensus sequence (FAMLF-CS) in peripheral blood mononuclear cells (PBMCs) from 119 patients with de novo acute leukemia (AL) and 104 healthy controls, as well as in CD34+ cells from 12 AL patients and 10 healthy donors. A 429-bp fragment from a novel splicing variant of FAMLF was obtained, and a 363-bp consensus sequence was targeted to quantify total FAMLF expression. Kruskal-Wallis, Nemenyi, Spearman's correlation, and Mann-Whitney U-tests were used to analyze the data. FAMLF-CS expression in PBMCs from AL patients and CD34+ cells from AL patients and controls was significantly higher than in control PBMCs (P < 0.0001). Moreover, FAMLF-CS expression in PBMCs from the AML group was positively correlated with red blood cell count (rs =0.317, P=0.006), hemoglobin levels (rs = 0.210, P = 0.049), and percentage of peripheral blood blasts (rs = 0.256, P = 0.027), but inversely correlated with hemoglobin levels in the control group (rs = -0.391, P < 0.0001). AML patients with high CD34+ expression showed significantly higher FAMLF-CS expression than those with low CD34+ expression (P = 0.041). Our results showed that FAMLF is highly expressed in both normal and malignant immature hematopoietic cells, but that expression is lower in normal mature PBMCs.

  3. Isolation and characterization of the gene coding for Escherichia coli arginyl-tRNA synthetase.

    PubMed Central

    Eriani, G; Dirheimer, G; Gangloff, J

    1989-01-01

    The gene coding for Escherichia coli arginyl-tRNA synthetase (argS) was isolated as a fragment of 2.4 kb after analysis and subcloning of recombinant plasmids from the Clarke and Carbon library. The clone bearing the gene overproduces arginyl-tRNA synthetase by a factor 100. This means that the enzyme represents more than 20% of the cellular total protein content. Sequencing revealed that the fragment contains a unique open reading frame of 1734 bp flanked at its 5' and 3' ends respectively by 247 bp and 397 bp. The length of the corresponding protein (577 aa) is well consistent with earlier Mr determination (about 70 kd). Primer extension analysis of the ArgRS mRNA by reverse transcriptase, located its 5' end respectively at 8 and 30 nucleotides downstream of a TATA and a TTGAC like element (CTGAC) and 60 nucleotides upstream of the unusual translation initiation codon GUG; nuclease S1 analysis located the 3'-end at 48 bp downstream of the translation termination codon. argS has a codon usage pattern typical for highly expressed E. coli genes. With the exception of the presence of a HVGH sequence similar to the HIGH consensus element, ArgRS has no relevant sequence homologies with other aminoacyl-tRNA synthetases. Images PMID:2668891

  4. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    PubMed

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  5. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D`Souza, T.M.; Boominathan, K.; Reddy, C.A.

    1996-10-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum,more » Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.« less

  6. Multistress Regulation in Escherichia coli: Expression of osmB Involves Two Independent Promoters Responding either to σS or to the RcsCDB His-Asp Phosphorelay

    PubMed Central

    Boulanger, Alice; Francez-Charlot, Anne; Conter, Annie; Castanié-Cornet, Marie-Pierre; Cam, Kaymeuang; Gutierrez, Claude

    2005-01-01

    Transcription of the Escherichia coli osmB gene is induced by several stress conditions. osmB is expressed from two promoters, osmBp1 and osmBp2. The downstream promoter, osmBp2, is induced after osmotic shock or upon entry into stationary phase in a σS-dependent manner. The upstream promoter, osmBp1, is independent of σS and is activated by RcsB, the response regulator of the His-Asp phosphorelay signal transduction system RcsCDB. RcsB is responsible for the induction of osmBp1 following treatment with chlorpromazine. Activation of osmBp1 by RcsB requires a sequence upstream of its −35 element similar to the RcsB binding site consensus, suggesting a direct regulatory role. osmB appears as another example of a multistress-responsive gene whose transcription involves both a σS-dependent promoter and a second one independent of σS but controlled by stress-specific transcription factors. PMID:15838058

  7. Mini-midi-mito: adapting the amplification and sequencing strategy of mtDNA to the degradation state of crime scene samples.

    PubMed

    Berger, Cordula; Parson, Walther

    2009-06-01

    The degradation state of some biological traces recovered from the crime scene requires the amplification of very short fragments to attain a useful mitochondrial (mt)DNA sequence. We have previously introduced two mini-multiplex assays that amplify 10 overlapping control region (CR) fragments in two separate multiplex PCRs, which brought successful CR consensus sequences from even highly degraded DNA extracts. This procedure requires a total of 20 sequencing reactions per sample, which is laborious and cost intensive. For only moderately degraded samples that we encounter more frequently with typical mtDNA casework material, we developed two new multiplex assays that use a subset of the mini-amplicon primers but embrace larger fragments (midis) and require only 10 sequencing reactions to build a double-stranded CR consensus sequence. We used a preceding mtDNA quantitation step by real-time PCR with two different target fragments (143 and 283 bp) that roughly correspond to the average fragment sizes of the different multiplex approaches to estimate size-dependent mtDNA quantities and to aid the choice of the appropriate PCR multiplexes with respect to quality of the results and required costs.

  8. Nucleotide sequence and expression of a novel pectate lyase gene (pel-3) and a closely linked endopolygalacturonase gene (peh-1) of Erwinia carotovora subsp. carotovora 71.

    PubMed Central

    Liu, Y; Chatterjee, A; Chatterjee, A K

    1994-01-01

    Our previous genetic analysis (J. W. Willis, J. K. Engwall, and A. K. Chatterjee, Phytopathology 77:1199-1205, 1987) had revealed a tight linkage between pel-3 (pel, pectate lyase gene) and peh-1 (peh, polygalacturonase gene) within the chromosome of Erwinia carotovora subsp. carotovora 71. Nucleotide sequencing, transcript assays, and expression of enzymatic activities in Escherichia coli have now confirmed that a 3,500-bp segment contains the open reading frames (ORFs) for Pel-3 and Peh-1. The 1,041-bp pel-3 ORF and the 1,206-bp peh-1 ORF are separated by a 579-bp sequence. The genes are transcribed divergently from their own promoters. In E. coli and E. carotovora subsp. carotovora 71, peh-1 is better expressed than pel-3. However, plant signals activate the expression of both the genes in E. carotovora subsp. carotovora. A consensus integration host factor (IHF)-binding sequence upstream of pel-3 appears physiologically significant, since pel-3 promoter activity is higher in an E. coli IHF+ strain than in an IHF- strain. While peh-1 has extensive homology with plant and bacterial peh genes, pel-3 appears not to have significant homology with the pel genes belonging to the pelBC, pelADE, or periplasmic pel families. Pel-3 also is unusual in that it is predicted to contain an ATP- and GTP-binding site motif A (P-loop) not found in the other Pels. Images PMID:8074530

  9. Characterization and chromosomal mapping of the human TFG gene involved in thyroid carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mencinger, M.; Panagopoulos, I.; Andreasson, P.

    1997-05-01

    Homology searches in the Expressed Sequence Tag Database were performed using SPYGQ-rich regions as query sequences to find genes encoding protein regions similar to the N-terminal parts of the sarcoma-associated EWS and FUS proteins. Clone 22911 (T74973), encoding a SPYGQ-rich region in its 5{prime} end, and several other clones that overlapped 22911 were selected. The combined data made it possible to assemble a full-length cDNA sequence. This cDNA sequence is 1677 bp, containing an initiation codon ATG, an open reading frame of 400 amino acids, a poly(A) signal, and a poly(A) tail. We found 100% identity between the 5{prime} partmore » of the consensus sequence and the 598-bp-long sequence named TFG. The TFG sequence is fused to the 3{prime} end of NTRK1, generating the TRK-T3 fusion transcript found in papillary thyroid carcinoma. The cDNA therefore represents the full-length transcript of the TFG gene. TFG was localized to 3q11-q12 by fluorescence in situ hybridization. The 3{prime} and the 5{prime} ends of the TFG cDNA probe hybridized to a 2.2-kb band on Northern blot filters in all tissues examined. 28 refs., 5 figs., 1 tab.« less

  10. Comprehensive Survey of Genetic Diversity in Chloroplast Genomes and 45S nrDNAs within Panax ginseng Species

    PubMed Central

    Kim, Kyunghee; Lee, Sang-Choon; Lee, Junki; Lee, Hyun Oh; Joh, Ho Jun; Kim, Nam-Hoon; Park, Hyun-Seung; Yang, Tae-Jin

    2015-01-01

    We report complete sequences of chloroplast (cp) genome and 45S nuclear ribosomal DNA (45S nrDNA) for 11 Panax ginseng cultivars. We have obtained complete sequences of cp and 45S nrDNA, the representative barcoding target sequences for cytoplasm and nuclear genome, respectively, based on low coverage NGS sequence of each cultivar. The cp genomes sizes ranged from 156,241 to 156,425 bp and the major size variation was derived from differences in copy number of tandem repeats in the ycf1 gene and in the intergenic regions of rps16-trnUUG and rpl32-trnUAG. The complete 45S nrDNA unit sequences were 11,091 bp, representing a consensus single transcriptional unit with an intergenic spacer region. Comparative analysis of these sequences as well as those previously reported for three Chinese accessions identified very rare but unique polymorphism in the cp genome within P. ginseng cultivars. There were 12 intra-species polymorphisms (six SNPs and six InDels) among 14 cultivars. We also identified five SNPs from 45S nrDNA of 11 Korean ginseng cultivars. From the 17 unique informative polymorphic sites, we developed six reliable markers for analysis of ginseng diversity and cultivar authentication. PMID:26061692

  11. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

    PubMed Central

    D'Souza, T M; Boominathan, K; Reddy, C A

    1996-01-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

  12. Identification of cDNAs encoding viper venom hyaluronidases: cross-generic sequence conservation of full-length and unusually short variant transcripts.

    PubMed

    Harrison, Robert A; Ibison, Frances; Wilbraham, Davina; Wagstaff, Simon C

    2007-05-01

    The immobilisation of prey by snakes is most efficiently achieved by the rapid dissemination of venom from its site of injection into the blood stream. Hyaluronidase is a common component of snake venoms and has been termed the "venom spreading factor". In the absence of nucleotide or protein sequence data to confirm the functional identity of this venom component, we interrogated a venom gland EST database for the saw-scaled viper, Echis ocellatus (Nigeria), using the gene ontology (GO) term "carbohydrate metabolism". A single hyalurononglucosaminadase-activity matching sequence (EOC00242) was found and used to design PCR primers to acquire the full-length cDNA sequence. Although very different from the bee venom and mammalian hyaluronidase sequences, the E. ocellatus sequence retained all the catalytic, positional and structural residues that characterise this class of carbohydrate metabolising hydrolases. An extraordinarily high level of sequence identity (>95%) was observed in analogous venom gland cDNA sequences isolated (by PCR) from another saw-scaled viper species, E. pyramidum leakeyi (Kenya), and from the sahara horned viper, Cerastes cerastes cerastes (Egypt) and the puff adder, Bitis arietans (Nigeria). Smaller amplicons, lacking hyaluronidase catalytic residues because of 768 bp or 855 bp central deletions, appear to encode either truncated peptides without hyaluronidase activity, or are non-translated transcripts because they lack consensus translation initiating motifs.

  13. Comparative analysis on the structural features of the 5' flanking region of κ-casein genes from six different species

    PubMed Central

    Gerencsér, Ákos; Barta, Endre; Boa, Simon; Kastanis, Petros; Bösze, Zsuzsanna; Whitelaw, C Bruce A

    2002-01-01

    κ-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. We determined the 5'-flanking sequences for the murine, rabbit and human κ-casein genes and compared them to the published ruminant sequences. The most conserved region was not the proximal promoter region but an approximately 400 bp long region centred 800 bp upstream of the TATA box. This region contained two highly conserved MGF/STAT5 sites with common spacing relative to each other. In this region, six conserved short stretches of similarity were also found which did not correspond to known transcription factor consensus sites. On the contrary to ruminant and human 5' regulatory sequences, the rabbit and murine 5'-flanking regions did not harbour any kind of repetitive elements. We generated a phylogenetic tree of the six species based on multiple alignment of the κ-casein sequences. This study identified conserved candidate transcriptional regulatory elements within the κ-casein gene promoter. PMID:11929628

  14. Genomic Structure of the Luciferase Gene from the Bioluminescent Beetle, Nyctophila cf. Caucasica

    PubMed Central

    Day, John C.; Chaichi, Mohammad J.; Najafil, Iraj; Whiteley, Andrew S.

    2006-01-01

    The gene coding for beetle luciferase, the enzyme responsible for bioluminescence in over two thousand coleopteran species has, to date, only been characterized from one Palearctic species of Lampyridae. Here we report the characterization of the luciferase gene from a female beetle of an Iranian lampyrid species, Nyctophila cf. caucasica (Coleoptera:Lampyridae). The luciferase gene was composed of seven exons, coding for 547 amino acids, separated by six introns spanning 1976 bp of genomic DNA. The deduced amino acid sequences of the luciferase gene of N. caucasica showed 98.9% homology to that of the Palearctic species Lampyris noctiluca. Analysis of the 810 bp upstream region of the luciferase gene revealed three TATA boxes and several other consensus transcriptional factor recognition sequences presenting evidence for a putative core promoter region conserved in Lampyrinae from -190 through to -155 upstream of the luciferase start codon. Along with the core promoter region the luciferase gene was compared with orthologous sequences from other lampyrid species and found to have greatest identity to Lampyris turkistanicus and Lampyris noctiluca. The significant sequence identity to the former is discussed in relation to taxonomic issues of Iranian lampyrids. PMID:20298115

  15. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    PubMed

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  16. Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

    PubMed

    Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

    1994-05-01

    Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

  17. Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

    PubMed

    Bricheux, G; Brugerolle, G

    1997-08-01

    The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

  18. Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

    PubMed Central

    Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

    1995-01-01

    The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

  19. Characterization of cis-acting elements required for autorepression of the equine herpesvirus 1 IE gene

    PubMed Central

    Kim, Seongman; Dai, Gan; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The immediate-early protein (IEP), the major regulatory protein encoded by the IE gene of equine herpesvirus 1 (EHV-1), plays a crucial role as both transcription activator and repressor during a productive lytic infection. To investigate the mechanism by which the EHV-1 IEP inhibits its own promoter, IE promoter-luciferase reporter plasmids containing wild-type and mutant IEP-binding site (IEBS) were constructed and used for luciferase reporter assays. The IEP inhibited transcription from its own promoter in the presence of a consensus IEBS (5’-ATCGT-3’) located near the transcription initiation site but did not inhibit when the consensus sequence was deleted. To determine whether the distance between the TATA box and the IEBS affects transcriptional repression, the IEBS was displaced from the original site by the insertion of synthetic DNA sequences. Luciferase reporter assays revealed that the IEP is able to repress its own promoter when the IEBS is located within 26-bp from the TATA box. We also found that the proper orientation and position of the IEBS were required for the repression by the IEP. Interestingly, the level of repression was significantly reduced when a consensus TATA sequence was deleted from the promoter region, indicating that the IEP efficiently inhibits its own promoter in a TATA box-dependent manner. Taken together, these results suggest that the EHV-1 IEP delicately modulates autoregulation of its gene through the consensus IEBS that is near the transcription initiation site and the TATA box. PMID:22265772

  20. Characterization of cis-acting elements required for autorepression of the equine herpesvirus 1 IE gene.

    PubMed

    Kim, Seongman; Dai, Gan; O'Callaghan, Dennis J; Kim, Seong Kee

    2012-04-01

    The immediate-early protein (IEP), the major regulatory protein encoded by the IE gene of equine herpesvirus 1 (EHV-1), plays a crucial role as both transcription activator and repressor during a productive lytic infection. To investigate the mechanism by which the EHV-1 IEP inhibits its own promoter, IE promoter-luciferase reporter plasmids containing wild-type and mutant IEP-binding site (IEBS) were constructed and used for luciferase reporter assays. The IEP inhibited transcription from its own promoter in the presence of a consensus IEBS (5'-ATCGT-3') located near the transcription initiation site but did not inhibit when the consensus sequence was deleted. To determine whether the distance between the TATA box and the IEBS affects transcriptional repression, the IEBS was displaced from the original site by the insertion of synthetic DNA sequences. Luciferase reporter assays revealed that the IEP is able to repress its own promoter when the IEBS is located within 26-bp from the TATA box. We also found that the proper orientation and position of the IEBS were required for the repression by the IEP. Interestingly, the level of repression was significantly reduced when a consensus TATA sequence was deleted from the promoter region, indicating that the IEP efficiently inhibits its own promoter in a TATA box-dependent manner. Taken together, these results suggest that the EHV-1 IEP delicately modulates autoregulation of its gene through the consensus IEBS that is near the transcription initiation site and the TATA box. Copyright © 2012. Published by Elsevier B.V.

  1. Multiple bidirectional initiations and terminations of transcription in the Marek's disease virus long repeat regions.

    PubMed Central

    Chen, X B; Velicer, L F

    1991-01-01

    Marek's disease is an oncogenic disease of chickens caused by a herpesvirus, Marek's disease virus (MDV). Serial in vitro passage of pathogenic MDV results in amplification of a 132-bp direct repeat in the MDV genome's TRL and IRL repeat regions and loss of tumorigenicity. This led to the hypothesis that upon such expansion, one or more tumor-inducing genes fail to be expressed. In this report a group of cDNAs mapping in the expanded regions were isolated from a pathogenic MDV strain in which the 132-bp direct repeat number was found to range between one and seven. Partial cDNA sequencing and S1 nuclease protection analysis revealed that the corresponding transcripts are either initiated or terminated within or near the expanded regions at multiple sites in both rightward and leftward directions. Furthermore, each 132-bp repeat contains one TATA box and two polyadenylation consensus sequences in each direction. These RNAs contain a partial copy or one or more full copies of the 132-bp direct repeat at either their 5' or 3' end. Northern (RNA) blot analysis showed that the majority of transcripts are 1.8 kb in size, while the minor species range in size from 0.67 to 3.1 kb. Together, these data raise the possibility that the 132-bp direct repeat, and indirectly its copy number, may be involved in the regulation of transcriptional initiation and termination and therefore in the generation of four groups of transcripts from the TRL and IRL, although this remains to be demonstrated. Images PMID:1850022

  2. A Phylogenomic Approach Based on PCR Target Enrichment and High Throughput Sequencing: Resolving the Diversity within the South American Species of Bartsia L. (Orobanchaceae)

    PubMed Central

    Tank, David C.

    2016-01-01

    Advances in high-throughput sequencing (HTS) have allowed researchers to obtain large amounts of biological sequence information at speeds and costs unimaginable only a decade ago. Phylogenetics, and the study of evolution in general, is quickly migrating towards using HTS to generate larger and more complex molecular datasets. In this paper, we present a method that utilizes microfluidic PCR and HTS to generate large amounts of sequence data suitable for phylogenetic analyses. The approach uses the Fluidigm Access Array System (Fluidigm, San Francisco, CA, USA) and two sets of PCR primers to simultaneously amplify 48 target regions across 48 samples, incorporating sample-specific barcodes and HTS adapters (2,304 unique amplicons per Access Array). The final product is a pooled set of amplicons ready to be sequenced, and thus, there is no need to construct separate, costly genomic libraries for each sample. Further, we present a bioinformatics pipeline to process the raw HTS reads to either generate consensus sequences (with or without ambiguities) for every locus in every sample or—more importantly—recover the separate alleles from heterozygous target regions in each sample. This is important because it adds allelic information that is well suited for coalescent-based phylogenetic analyses that are becoming very common in conservation and evolutionary biology. To test our approach and bioinformatics pipeline, we sequenced 576 samples across 96 target regions belonging to the South American clade of the genus Bartsia L. in the plant family Orobanchaceae. After sequencing cleanup and alignment, the experiment resulted in ~25,300bp across 486 samples for a set of 48 primer pairs targeting the plastome, and ~13,500bp for 363 samples for a set of primers targeting regions in the nuclear genome. Finally, we constructed a combined concatenated matrix from all 96 primer combinations, resulting in a combined aligned length of ~40,500bp for 349 samples. PMID:26828929

  3. Pestoides F, an atypical Yersinia pestis strain from the former Soviet Union.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garcia, Emilio; Worsham, Patricia; Bearden, S.

    2007-01-01

    Unlike the classical Yersinia pestis strains, members of an atypical group of Y. pestis from Central Asia, denominated Y. pestis subspecies caucasica (also known as one of several pestoides types), are distinguished by a number of characteristics including their ability to ferment rhamnose and melibiose, their lack of the small plasmid encoding the plasminogen activator (pla) and pesticin, and their exceptionally large variants of the virulence plasmid pMT (encoding murine toxin and capsular antigen). We have obtained the entire genome sequence of Y. pestis Pestoides F, an isolate from the former Soviet Union that has enabled us to carryout amore » comprehensive genome-wide comparison of this organism's genomic content against the six published sequences of Y. pestis and their Y. pseudotuberculosis ancestor. Based on classical glycerol fermentation (+ve) and nitrate reduction (+ve) Y. pestis Pestoides F is an isolate that belongs to the biovar antiqua. This strain is unusual in other characteristics such as the fact that it carries a non-consensus V antigen (lcrV) sequence, and that unlike other Pla(-) strains, Pestoides F retains virulence by the parenteral and aerosol routes. The chromosome of Pestoides F is 4,517,345 bp in size comprising some 3,936 predicted coding sequences, while its pCD and pMT plasmids are 71,507 bp and 137,010 bp in size respectively. Comparison of chromosome-associated genes in Pestoides F with those in the other sequenced Y. pestis strains reveals differences ranging from strain-specific rearrangements, insertions, deletions, single nucleotide polymorphisms, and a unique distribution of insertion sequences. There is a single approximately 7 kb unique region in the chromosome not found in any of the completed Y. pestis strains sequenced to date, but which is present in the Y. pseudotuberculosis ancestor. Taken together, these findings are consistent with Pestoides F being derived from the most ancient lineage of Y. pestis yet sequenced.« less

  4. Pestoides F, and Atypical Yersinia pestis Strain from the Former Soviet Union

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garcia, E; Worsham, P; Bearden, S

    2007-01-05

    Unlike the classical Yersinia pestis strains, members of an atypical group of Y. pestis from Central Asia, denominated Y. pestis subspecies caucasica (also known as one of several pestoides types), are distinguished by a number of characteristics including their ability to ferment rhamnose and melibiose, their lacking the small plasmid encoding the plasminogen activator (pla) and pesticin, and their exceptionally large variants of the virulence plasmid pMT (encoding murine toxin and capsular antigen). We have obtained the entire genome sequence of Y. pestis Pestoides F, an isolate from the former Soviet Union that has enabled us to carryout a comprehensivemore » genome-wide comparison of this organism's genomic content against the six published sequences of Y. pestis and their Y. pseudotuberculosis ancestor. Based on classical glycerol fermentation (+ve) and nitrate reduction (+ve) Y. pestis Pestoides F is an isolate that belongs to the biovar antiqua. This strain is unusual in other characteristics such as the fact that it carries a non-consensus V antigen (lcrV) sequence, and that unlike other Pla{sup -} strains, Pestoides F retains virulence by the parenteral and aerosol routes. The chromosome of Pestoides F is 4,517,345 bp in size comprising some 3,936 predicted coding sequences, while its pCD and pMT plasmids are 71,507 bp and 137,010 bp in size respectively. Comparison of chromosome-associated genes in Pestoides F with those in the other sequenced Y. pestis strains, reveals a series of differences ranging from strain-specific rearrangements, insertions, deletions, single nucleotide polymorphisms, and a unique distribution of insertion sequences. There is a single {approx}7 kb unique region in the chromosome not found in any of the completed Y. pestis strains sequenced to date, but which is present in the Y. pseudotuberculosis ancestor. Taken together, these findings are consistent with Pestoides F being derived from the most ancient lineage of Y. pestis yet sequenced.« less

  5. Effective de novo assembly of fish genome using haploid larvae.

    PubMed

    Iwasaki, Yuki; Nishiki, Issei; Nakamura, Yoji; Yasuike, Motoshige; Kai, Wataru; Nomura, Kazuharu; Yoshida, Kazunori; Nomura, Yousuke; Fujiwara, Atushi; Kobayashi, Takanori; Ototake, Mitsuru

    2016-02-01

    Recent improvements in next-generation sequencing technology have made it possible to do whole genome sequencing, on even non-model eukaryote species with no available reference genomes. However, de novo assembly of diploid genomes is still a big challenge because of allelic variation. The aim of this study was to determine the feasibility of utilizing the genome of haploid fish larvae for de novo assembly of whole-genome sequences. We compared the efficiency of assembly using the haploid genome of yellowtail (Seriola quinqueradiata) with that using the diploid genome obtained from the dam. De novo assembly from the haploid and the diploid sequence reads (100 million reads per each datasets) generated by the Ion Proton sequencer (200 bp) was done under two different assembly algorithms, namely overlap-layout-consensus (OLC) and de Bruijn graph (DBG). This revealed that the assembly of the haploid genome significantly reduced (approximately 22% for OLC, 9% for DBG) the total number of contigs (with longer average and N50 contig lengths) when compared to the diploid genome assembly. The haploid assembly also improved the quality of the scaffolds by reducing the number of regions with unassigned nucleotides (Ns) (total length of Ns; 45,331,916 bp for haploids and 67,724,360 bp for diploids) in OLC-based assemblies. It appears clear that the haploid genome assembly is better because the allelic variation in the diploid genome disrupts the extension of contigs during the assembly process. Our results indicate that utilizing the genome of haploid larvae leads to a significant improvement in the de novo assembly process, thus providing a novel strategy for the construction of reference genomes from non-model diploid organisms such as fish. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Concurrent speciation in the eastern woodland salamanders (Genus Plethodon):DNA sequences of the complete albumin nuclear and partialmitochondrial 12s genes

    USGS Publications Warehouse

    Highton, Richard; Hastings, Amy Picard; Palmer, Catherine; Watts, Richard; Hass, Carla A.; Culver, Melanie; Arnold, Stevan

    2012-01-01

    Salamanders of the North American plethodontid genus Plethodon are important model organisms in a variety of studies that depend on a phylogenetic framework (e.g., chemical communication, ecological competition, life histories, hybridization, and speciation), and consequently their systematics has been intensively investigated over several decades. Nevertheless, we lack a synthesis of relationships among the species. In the analyses reported here we use new DNA sequence data from the complete nuclear albumin gene (1818 bp) and the 12s mitochondrial gene (355 bp), as well as published data for four other genes (Wiens et al., 2006), up to a total of 6989 bp, to infer relationships. We relate these results to past systematic work based on morphology, allozymes, and DNA sequences. Although basal relationships show a strong consensus across studies, many terminal relationships remain in flux despite substantial sequencing and other molecular and morphological studies. This systematic instability appears to be a consequence of contemporaneous bursts of speciation in the late Miocene and Pliocene, yielding many closely related extant species in each of the four eastern species groups. Therefore we conclude that many relationships are likely to remain poorly resolved in the face of additional sequencing efforts. On the other hand, the current classification of the 45 eastern species into four species groups is supported. The Plethodon cinereus group (10 species) is the sister group to the clade comprising the other three groups, but these latter groups (Plethodon glutinosus [28 species], Plethodon welleri [5 species], and Plethodon wehrlei [2 species]) probably diverged from each other at approximately the same time.

  7. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    PubMed

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  8. Survey of bat populations from Mexico and Paraguay for rabies.

    PubMed

    Sheeler-Gordon, L L; Smith, J S

    2001-07-01

    A mammalian survey was conducted in Mexico (October 1994-January 1996) and in Paraguay (August 1996-March 1997); a complete specimen was collected for each bat in the survey, including primary voucher specimen, ectoparasites, karyotype, and various frozen tissues. The surveys combined provided 937 brain samples (65 bat species) for rabies diagnosis. One male Lasiurus ega, collected in Paraguay, tested positive for the rabies virus (overall prevalence rate of 0.1%). Nucleotide sequence from a 300 bp region of the rabies nucleoprotein gene was compared with sequence obtained from representative rabies virus samples in the repository at the Centers for Disease Control and Prevention (Atlanta, Georgia, USA). Rabies virus extracted from the brain material of L. ega differed by only one nucleotide from a 300 bp consensus sequence (>99% homology) derived from samples for the variant of rabies virus transmitted by Lasiurus cinereus. Lasiurus ego differed by approximately 15% for the variant transmitted by Desmodus rotundus. Phylogenetic analysis found no evidence to suggest L. ego is a reservoir for rabies antigenic variant 6. The most likely explanation for rabies in L. ega was infection following contact with a rabid L. cinereus.

  9. Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout

    USGS Publications Warehouse

    Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.

    2010-01-01

    The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

  10. DNA barcoding of Clarias gariepinus, Coptodon zillii and Sarotherodon melanotheron from Southwestern Nigeria

    PubMed Central

    Falade, Mofolusho O.; Opene, Anthony J.; Benson, Otarigho

    2016-01-01

    DNA barcoding has been adopted as a gold standard rapid, precise and unifying identification system for animal species and provides a database of genetic sequences that can be used as a tool for universal species identification. In this study, we employed mitochondrial genes 16S rRNA (16S) and cytochrome oxidase subunit I (COI) for the identification of some Nigerian freshwater catfish and Tilapia species. Approximately 655 bp were amplified from the 5′ region of the mitochondrial cytochrome C oxidase subunit I (COI) gene whereas 570 bp were amplified for the 16S rRNA gene. Nucleotide divergences among sequences were estimated based on Kimura 2-parameter distances and the genetic relationships were assessed by constructing phylogenetic trees using the neighbour-joining (NJ) and maximum likelihood (ML) methods. Analyses of consensus barcode sequences for each species, and alignment of individual sequences from within a given species revealed highly consistent barcodes (99% similarity on average), which could be compared with deposited sequences in public databases. The nucleotide distance between species belonging to different genera based on COI ranged from 0.17% between Sarotherodon melanotheron and Coptodon zillii to 0.49% between Clarias gariepinus and C. zillii, indicating that S. melanotheron and C. zillii are closely related. Based on the data obtained, the utility of COI gene was confirmed in accurate identification of three fish species from Southwest Nigeria. PMID:27990256

  11. Detection of a new bat gammaherpesvirus in the Philippines.

    PubMed

    Watanabe, Shumpei; Ueda, Naoya; Iha, Koichiro; Masangkay, Joseph S; Fujii, Hikaru; Alviola, Phillip; Mizutani, Tetsuya; Maeda, Ken; Yamane, Daisuke; Walid, Azab; Kato, Kentaro; Kyuwa, Shigeru; Tohya, Yukinobu; Yoshikawa, Yasuhiro; Akashi, Hiroomi

    2009-08-01

    A new bat herpesvirus was detected in the spleen of an insectivorous bat (Hipposideros diadema, family Hipposideridae) collected on Panay Island, the Philippines. PCR analyses were performed using COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOPs) targeting the herpesvirus DNA polymerase (DPOL) gene. Although we obtained PCR products with CODEHOPs, direct sequencing using the primers was not possible because of high degree of degeneracy. Direct sequencing technology developed in our rapid determination system of viral RNA sequences (RDV) was applied in this study, and a partial DPOL nucleotide sequence was determined. In addition, a partial gB gene nucleotide sequence was also determined using the same strategy. We connected the partial gB and DPOL sequences with long-distance PCR, and a 3741-bp nucleotide fragment, including the 3' part of the gB gene and the 5' part of the DPOL gene, was finally determined. Phylogenetic analysis showed that the sequence was novel and most similar to those of the subfamily Gammaherpesvirinae.

  12. Genetic characterization of the oxytocin-neurophysin I gene (OXT) and its regulatory regions analysis in domestic Old and New World camelids

    PubMed Central

    Ogah, Danlami Moses; Iannaccone, Marco; Erhardt, Georg; Di Stasio, Liliana; Cosenza, Gianfranco

    2018-01-01

    Oxytocin is a neurohypophysial peptide linked to a wide range of biological functions, including milk ejection, temperament and reproduction. Aims of the present study were a) the characterization of the OXT (Oxytocin-neurophysin I) gene and its regulatory regions in Old and New world camelids; b) the investigation of the genetic diversity and the discovery of markers potentially affecting the gene regulation. On average, the gene extends over 814 bp, ranging between 825 bp in dromedary, 811 bp in Bactrian and 810 bp in llama and alpaca. Such difference in size is due to a duplication event of 21 bp in dromedary. The main regulatory elements, including the composite hormone response elements (CHREs), were identified in the promoter, whereas the presence of mature microRNAs binding sequences in the 3’UTR improves the knowledge on the factors putatively involved in the OXT gene regulation, although their specific biological effect needs to be still elucidated. The sequencing of genomic DNA allowed the identification of 17 intraspecific polymorphisms and 69 nucleotide differences among the four species. One of these (MF464535:g.622C>G) is responsible, in alpaca, for the loss of a consensus sequence for the transcription factor SP1. Furthermore, the same SNP falls within a CpG island and it creates a new methylation site, thus opening future possibilities of investigation to verify the influence of the novel allelic variant in the OXT gene regulation. A PCR-RFLP method was setup for the genotyping and the frequency of the allele C was 0.93 in a population of 71 alpacas. The obtained data clarify the structure of OXT gene in domestic camelids and add knowledge to the genetic variability of a genomic region, which has received little investigation so far. These findings open the opportunity for new investigations, including association studies with productive and reproductive traits. PMID:29608621

  13. Genetic characterization of the oxytocin-neurophysin I gene (OXT) and its regulatory regions analysis in domestic Old and New World camelids.

    PubMed

    Pauciullo, Alfredo; Ogah, Danlami Moses; Iannaccone, Marco; Erhardt, Georg; Di Stasio, Liliana; Cosenza, Gianfranco

    2018-01-01

    Oxytocin is a neurohypophysial peptide linked to a wide range of biological functions, including milk ejection, temperament and reproduction. Aims of the present study were a) the characterization of the OXT (Oxytocin-neurophysin I) gene and its regulatory regions in Old and New world camelids; b) the investigation of the genetic diversity and the discovery of markers potentially affecting the gene regulation. On average, the gene extends over 814 bp, ranging between 825 bp in dromedary, 811 bp in Bactrian and 810 bp in llama and alpaca. Such difference in size is due to a duplication event of 21 bp in dromedary. The main regulatory elements, including the composite hormone response elements (CHREs), were identified in the promoter, whereas the presence of mature microRNAs binding sequences in the 3'UTR improves the knowledge on the factors putatively involved in the OXT gene regulation, although their specific biological effect needs to be still elucidated. The sequencing of genomic DNA allowed the identification of 17 intraspecific polymorphisms and 69 nucleotide differences among the four species. One of these (MF464535:g.622C>G) is responsible, in alpaca, for the loss of a consensus sequence for the transcription factor SP1. Furthermore, the same SNP falls within a CpG island and it creates a new methylation site, thus opening future possibilities of investigation to verify the influence of the novel allelic variant in the OXT gene regulation. A PCR-RFLP method was setup for the genotyping and the frequency of the allele C was 0.93 in a population of 71 alpacas. The obtained data clarify the structure of OXT gene in domestic camelids and add knowledge to the genetic variability of a genomic region, which has received little investigation so far. These findings open the opportunity for new investigations, including association studies with productive and reproductive traits.

  14. Phylogenetic Analysis of Prevalent Tuberculosis and Non-Tuberculosis Mycobacteria in Isfahan, Iran, Based on a 360 bp Sequence of the rpoB Gene

    PubMed Central

    Nasr Esfahani, Bahram; Moghim, Sharareh; Ghasemian Safaei, Hajieh; Moghoofei, Mohsen; Sedighi, Mansour; Hadifar, Shima

    2016-01-01

    Background Taxonomic and phylogenetic studies of Mycobacterium species have been based around the 16sRNA gene for many years. However, due to the high strain similarity between species in the Mycobacterium genus (94.3% - 100%), defining a valid phylogenetic tree is difficult; consequently, its use in estimating the boundaries between species is limited. The sequence of the rpoB gene makes it an appropriate gene for phylogenetic analysis, especially in bacteria with limited variation. Objectives In the present study, a 360bp sequence of rpoB was used for precise classification of Mycobacterium strains isolated in Isfahan, Iran. Materials and Methods From February to October 2013, 57 clinical and environmental isolates were collected, subcultured, and identified by phenotypic methods. After DNA extraction, a 360bp fragment was PCR-amplified and sequenced. The phylogenetic tree was constructed based on consensus sequence data, using MEGA5 software. Results Slow and fast-growing groups of the Mycobacterium strains were clearly differentiated based on the constructed tree of 56 common Mycobacterium isolates. Each species with a unique title in the tree was identified; in total, 13 nods with a bootstrap value of over 50% were supported. Among the slow-growing group was Mycobacterium kansasii, with M. tuberculosis in a cluster with a bootstrap value of 98% and M. gordonae in another cluster with a bootstrap value of 90%. In the fast-growing group, one cluster with a bootstrap value of 89% was defined, including all fast-growing members present in this study. Conclusions The results suggest that only the application of the rpoB gene sequence is sufficient for taxonomic categorization and definition of a new Mycobacterium species, due to its high resolution power and proper variation in its sequence (85% - 100%); the resulting tree has high validity. PMID:27284397

  15. Identification of Sinorhizobium (Ensifer) medicae based on a specific genomic sequence unveiled by M13-PCR fingerprinting.

    PubMed

    Dourado, Ana Catarina; Alves, Paula I L; Tenreiro, Tania; Ferreira, Eugénio M; Tenreiro, Rogério; Fareleira, Paula; Crespo, M Teresa Barreto

    2009-12-01

    A collection of nodule isolates from Medicago polymorpha obtained from southern and central Portugal was evaluated by M13-PCR fingerprinting and hierarchical cluster analysis. Several genomic clusters were obtained which, by 16S rRNA gene sequencing of selected representatives, were shown to be associated with particular taxonomic groups of rhizobia and other soil bacteria. The method provided a clear separation between rhizobia and co-isolated non-symbiotic soil contaminants. Ten M13-PCR groups were assigned to Sinorhizobium (Ensifer) medicae and included all isolates responsible for the formation of nitrogen-fixing nodules upon re-inoculation of M. polymorpha test-plants. In addition, enterobacterial repetitive intergenic consensus (ERIC)-PCR fingerprinting indicated a high genomic heterogeneity within the major M13- PCR clusters of S. medicae isolates. Based on nucleotide sequence data of an M13-PCR amplicon of ca. 1500 bp, observed only in S. medicae isolates and spanning locus Smed_3707 to Smed_3709 from the pSMED01 plasmid sequence of S. medicae WSM419 genome's sequence, a pair of PCR primers was designed and used for direct PCR amplification of a 1399-bp sequence within this fragment. Additional in silico and in vitro experiments, as well as phylogenetic analysis, confirmed the specificity of this primer combination and therefore the reliability of this approach in the prompt identification of S. medicae isolates and their distinction from other soil bacteria.

  16. Pearl millet [Pennisetum glaucum (L.) R. Br.] consensus linkage map constructed using four RIL mapping populations and newly developed EST-SSRs.

    PubMed

    Rajaram, Vengaldas; Nepolean, Thirunavukkarasu; Senthilvel, Senapathy; Varshney, Rajeev K; Vadez, Vincent; Srivastava, Rakesh K; Shah, Trushar M; Supriya, Ambawat; Kumar, Sushil; Ramana Kumari, Basava; Bhanuprakash, Amindala; Narasu, Mangamoori Lakshmi; Riera-Lizarazu, Oscar; Hash, Charles Thomas

    2013-03-09

    Pearl millet [Pennisetum glaucum (L.) R. Br.] is a widely cultivated drought- and high-temperature tolerant C4 cereal grown under dryland, rainfed and irrigated conditions in drought-prone regions of the tropics and sub-tropics of Africa, South Asia and the Americas. It is considered an orphan crop with relatively few genomic and genetic resources. This study was undertaken to increase the EST-based microsatellite marker and genetic resources for this crop to facilitate marker-assisted breeding. Newly developed EST-SSR markers (99), along with previously mapped EST-SSR (17), genomic SSR (53) and STS (2) markers, were used to construct linkage maps of four F7 recombinant inbred populations (RIP) based on crosses ICMB 841-P3 × 863B-P2 (RIP A), H 77/833-2 × PRLT 2/89-33 (RIP B), 81B-P6 × ICMP 451-P8 (RIP C) and PT 732B-P2 × P1449-2-P1 (RIP D). Mapped loci numbers were greatest for RIP A (104), followed by RIP B (78), RIP C (64) and RIP D (59). Total map lengths (Haldane) were 615 cM, 690 cM, 428 cM and 276 cM, respectively. A total of 176 loci detected by 171 primer pairs were mapped among the four crosses. A consensus map of 174 loci (899 cM) detected by 169 primer pairs was constructed using MergeMap to integrate the individual linkage maps. Locus order in the consensus map was well conserved for nearly all linkage groups. Eighty-nine EST-SSR marker loci from this consensus map had significant BLAST hits (top hits with e-value ≤ 1E-10) on the genome sequences of rice, foxtail millet, sorghum, maize and Brachypodium with 35, 88, 58, 48 and 38 loci, respectively. The consensus map developed in the present study contains the largest set of mapped SSRs reported to date for pearl millet, and represents a major consolidation of existing pearl millet genetic mapping information. This study increased numbers of mapped pearl millet SSR markers by >50%, filling important gaps in previously published SSR-based linkage maps for this species and will greatly facilitate SSR-based QTL mapping and applied marker-assisted selection programs.

  17. Abr1, a Transposon-Like Element in the Genome of the Cultivated Mushroom Agaricus bisporus (Lange) Imbach

    PubMed Central

    Sonnenberg, Anton S. M.; Baars, Johan J. P.; Mikosch, Thomas S. P.; Schaap, Peter J.; Van Griensven, Leo J. L. D.

    1999-01-01

    A 300-bp repetitive element was found in the genome of the white button mushroom, Agaricus bisporus, and designated Abr1. It is present in ∼15 copies per haploid genome in the commercial strain Horst U1. Analysis of seven copies showed 89 to 97% sequence identity. The repeat has features typical of class II transposons (i.e., terminal inverted repeats, subterminal repeats, and a target site duplication of 7 bp). The latter shows a consensus sequence. When used as probe on Southern blots, Abr1 identifies relatively little variation within traditional and present-day commercial strains, indicating that most strains are identical or have a common origin. In contrast to these cultivars, high variation is found among field-collected strains. Furthermore, a remarkable difference in copy numbers of Abr1 was found between A. bisporus isolates with a secondarily homothallic life cycle and those with a heterothallic life cycle. Abr1 is a type II transposon not previously reported in basidiomycetes and appears to be useful for the identification of strains within the species A. bisporus. PMID:10427018

  18. Regulatory interactions between the human HOXB1, HOXB2, and HOXB3 proteins and the upstream sequence of the Otx2 gene in embryonal carcinoma cells.

    PubMed

    Guazzi, S; Pintonello, M L; Viganò, A; Boncinelli, E

    1998-05-01

    Vertebrate Hox and Otx genes encode homeodomain-containing transcription factors thought to transduce positional information along the body axis in the segmental portion of the trunk and in the rostral brain, respectively. Moreover, Hox and Otx2 genes show a complementary spatial regulation during embryogenesis. In this report, we show that a 1821-base pair (bp) upstream DNA fragment of the Otx2 gene is positively regulated by co-transfection with expression vectors for the human HOXB1, HOXB2, and HOXB3 proteins in an embryonal carcinoma cell line (NT2/D1) and that a shorter fragment of only 534 bp is able to drive this regulation. We also identified the HOXB1, HOXB2, and HOXB3 DNA-binding region on the 534-bp Otx2 genomic fragment using nuclear extracts from Hox-transfected COS cells and 12.5 days postcoitum mouse embryos or HOXB3 homeodomain-containing bacterial extracts. HOXB1, HOXB3, and nuclear extracts from 12.5 days postcoitum mouse embryos bind to a sequence containing two palindromic TAATTA sites, which bear four copies of the ATTA core sequence, a common feature of most HOM-C/HOX binding sites. HOXB2 protected an adjacent site containing a direct repeat of an ACTT sequence, quite divergent from the ATTA consensus. The region bound by the three homeoproteins is strikingly conserved through evolution and necessary (at least for HOXB1 and HOXB3) to mediate the up-regulation of the Otx2 transcription. Taken together, our data support the hypothesis that anteriorly expressed Hox genes might play a role in the refinement of the Otx2 early expression boundaries in vivo.

  19. Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi

    2015-11-15

    Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less

  20. Detection of a novel herpesvirus from bats in the Philippines.

    PubMed

    Sano, Kaori; Okazaki, Sachiko; Taniguchi, Satoshi; Masangkay, Joseph S; Puentespina, Roberto; Eres, Eduardo; Cosico, Edison; Quibod, Niña; Kondo, Taisuke; Shimoda, Hiroshi; Hatta, Yuuki; Mitomo, Shumpei; Oba, Mami; Katayama, Yukie; Sassa, Yukiko; Furuya, Tetsuya; Nagai, Makoto; Une, Yumi; Maeda, Ken; Kyuwa, Shigeru; Yoshikawa, Yasuhiro; Akashi, Hiroomi; Omatsu, Tsutomu; Mizutani, Tetsuya

    2015-08-01

    Bats are natural hosts of many zoonotic viruses. Monitoring bat viruses is important to detect novel bat-borne infectious diseases. In this study, next generation sequencing techniques and conventional PCR were used to analyze intestine, lung, and blood clot samples collected from wild bats captured at three locations in Davao region, in the Philippines in 2012. Different viral genes belonging to the Retroviridae and Herpesviridae families were identified using next generation sequencing. The existence of herpesvirus in the samples was confirmed by PCR using herpesvirus consensus primers. The nucleotide sequences of the resulting PCR amplicons were 166-bp. Further phylogenetic analysis identified that the virus from which this nucleotide sequence was obtained belonged to the Gammaherpesvirinae subfamily. PCR using primers specific to the nucleotide sequence obtained revealed that the infection rate among the captured bats was 30 %. In this study, we present the partial genome of a novel gammaherpesvirus detected from wild bats. Our observations also indicate that this herpesvirus may be widely distributed in bat populations in Davao region.

  1. Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

    PubMed Central

    Mavrothalassitis, G J; Watson, D K; Papas, T S

    1990-01-01

    The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

  2. Molecular detection of Sarcocystis lutrae in the European badger (Meles meles) in Scotland.

    PubMed

    Lepore, T; Bartley, P M; Chianini, F; Macrae, A I; Innes, E A; Katzer, F

    2017-09-01

    Neck samples from 54 badgers and 32 tongue samples of the same badgers (Meles meles), collected in the Lothians and Borders regions of Scotland, were tested using polymerase chain reactions (PCRs) directed against the 18S ribosomal DNA and the internal transcribed spacer (ITS1) region of protozoan parasites of the family Sarcocystidae. Positive results were obtained from 36/54 (67%) neck and 24/32 (75%) tongue samples using an 18S rDNA PCR. A 468 base pair consensus sequence that was generated from the 18S rDNA PCR amplicons (KX229728) showed 100% identity to Sarcocystis lutrae. The ITS1 PCR results revealed that 12/20 (60%) neck and 10/20 (50%) tongue samples were positive for Sarcocystidae DNA. A 1074 bp consensus sequence was generated from the ITS1 PCR amplicons (KX431307) and showed 100% identity to S. lutrae. Multiple sequence alignments and phylogenetic analysis support the finding that the rDNA found in badgers is identical to that of S. lutrae. This parasite has not been previously reported in badgers or in the UK. Sarcocystis lutrae has previously only been detected in tongue, skeletal muscle and diaphragm samples of the Eurasian otter (Lutra lutra) in Norway and potentially in the Arctic fox (Vulpes lagopus).

  3. Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

    PubMed Central

    Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

    1994-01-01

    We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

  4. Consensus and controversies in best practices for molecular genetic testing of spinocerebellar ataxias

    PubMed Central

    Sequeiros, Jorge; Seneca, Sara; Martindale, Joanne

    2010-01-01

    Many laboratories worldwide are offering molecular genetic testing for spinocerebellar ataxias (SCAs). This is essential for differential diagnosis and adequate genetic counselling. The European Molecular Genetics Quality Network (EMQN) started an SCA external quality assessment scheme in 2004. There was a clear need for updated laboratory guidelines. EMQN and EuroGentest organized a Best Practice (BP) meeting to discuss current practices and achieve consensus. A pre-meeting survey showed that 36 laboratories (20 countries) conducted nearly 18 000 SCA tests the year before, and identified issues to discuss. Draft guidelines were produced immediately after the meeting and discussed online for several months. The final version was endorsed by EMQN, and harmonized with guidelines from other oligonucleotide repeat disorders. We present the procedures taken to organize the survey, BP meeting, as well as drafting and approval of BP guidelines. We emphasize the most important recommendations on (1) pre-test requirements, (2) appropriate methodologies and (3) interpretation and reporting, and focus on the discussion of controversial issues not included in the final document. In addition, after an extensive review of scientific literature, and responding to recommendations made, we now produce information that we hope will facilitate the activities of diagnostic laboratories and foster quality SCA testing. For the main loci, this includes (1) a list of repeat sequences, as originally published; (2) primers in use; and (3) an evidence-based description of the normal and pathogenic repeat-size ranges, including those of reduced penetrance and those in which there is still some uncertainty. This information will be maintained and updated in http://www.scabase.eu. PMID:20179748

  5. Two novel types of contiguous gene deletion of the AVPR2 and ARHGAP4 genes in unrelated Japanese kindreds with nephrogenic diabetes insipidus.

    PubMed

    Demura, Masashi; Takeda, Yoshiyu; Yoneda, Takashi; Furukawa, Kenji; Usukura, Mikiya; Itoh, Yuji; Mabuchi, Hiroshi

    2002-01-01

    Study of two families containing individuals with nephrogenic diabetes insipidus (NDI) indicated different types of 21.3 kb and 26.3 kb deletions involving the AVPR2 and ARHGAP4 (RhoGAP C1) genes. In the case of the 21.3 kb deletion, the deletion consensus motif (5'-TGAAGG-3') and polypurine runs, known as the arrest site of polymerase alpha, were detected in the vicinity of the deletion junction. Inverted repeats (7/8 matches), believed to potentiate DNA loop formation, flank the deletion breakpoint. We propose this deletion to be the result of slipped mispairing during DNA replication. In the case of the 26.3 kb deletion, the 12,945 bp inverted region with the 10,003 bp internal deletion was accompanied with the 2,509 bp deletion in the 5'-side and the 13,785 bp deletion in the 3'-side. We defined three deletion junctions in this rearrangement (DJ1, DJ2, and DJ3) from the 5'-side. The surrounding sequence of DJ1 (5'-CCC-3') closely resembled that of DJ3 (5'-AGGG-3') (DJ1; 5'-cCCCgaggg-3', DJ3; 5'-ccccAGGG-3'), and DJ1 was located in the 5'-side of DJ3 without any overlapping in sequence. The immunoglobulin class switch (ICS) motif (5'-TGGGG-3') was found around the complementary sequence of DJ3. There was a 10-base palindrome (5'-aGACAtgtct-3') in the alignment of the DJ2 (5'-GACA-3') region. From these findings, we propose a novel mutation process with the rearrangement probably resulting from stem-loop induced non-homologous recombination in an ICS-like fashion. Both patients, despite lacking ARHGAP4, had no morphological, clinical, or laboratory abnormalities except for those usually found in patients with NDI. Copyright 2001 Wiley-Liss, Inc.

  6. [Identification of Tibetan medicine "Dida" of Gentianaceae using DNA barcoding].

    PubMed

    Liu, Chuan; Zhang, Yu-Xin; Liu, Yue; Chen, Yi-Long; Fan, Gang; Xiang, Li; Xu, Jiang; Zhang, Yi

    2016-02-01

    The ITS2 barcode was used toidentify Tibetan medicine "Dida", and tosecure its quality and safety in medication. A total of 13 species, 151 experimental samples for the study from the Tibetan Plateau, including Gentianaceae Swertia, Halenia, Gentianopsis, Comastoma, Lomatogonium ITS2 sequences were amplified, and purified PCR products were sequenced. Sequence assembly and consensus sequence generation were performed using the CodonCode Aligner V3.7.1. The Kimura 2-Parameter (K2P) distances were calculated using MEGA 6.0. The neighbor-joining (NJ) phylogenetic trees were constructed. There are 31 haplotypes among 231 bp after alignment of all ITS2 sequence haplotypes, and the average G±C content of 61.40%. The NJ tree strongly supported that every species clustered into their own clade and high identification success rate, except that Swertia bifolia and Swertia wolfangiana could not be distinguished from each other based on the sequence divergences. DNA barcoding could be used as a fast and accurate identification method to distinguish Tibetan medicine "Dida" to ensure its safe use. Copyright© by the Chinese Pharmaceutical Association.

  7. [Screening specific recognition motif of RNA-binding proteins by SELEX in combination with next-generation sequencing technique].

    PubMed

    Zhang, Lu; Xu, Jinhao; Ma, Jinbiao

    2016-07-25

    RNA-binding protein exerts important biological function by specifically recognizing RNA motif. SELEX (Systematic evolution of ligands by exponential enrichment), an in vitro selection method, can obtain consensus motif with high-affinity and specificity for many target molecules from DNA or RNA libraries. Here, we combined SELEX with next-generation sequencing to study the protein-RNA interaction in vitro. A pool of RNAs with 20 bp random sequences were transcribed by T7 promoter, and target protein was inserted into plasmid containing SBP-tag, which can be captured by streptavidin beads. Through only one cycle, the specific RNA motif can be obtained, which dramatically improved the selection efficiency. Using this method, we found that human hnRNP A1 RRMs domain (UP1 domain) bound RNA motifs containing AGG and AG sequences. The EMSA experiment indicated that hnRNP A1 RRMs could bind the obtained RNA motif. Taken together, this method provides a rapid and effective method to study the RNA binding specificity of proteins.

  8. Structural Basis of Transcriptional Regulation of the Proline Utilization Regulon by Multifunctional PutA

    PubMed Central

    Zhou, Yuzhen; Larson, John D.; Bottoms, Christopher A.; Arturo, Emilia C.; Henzl, Michael T.; Jenkins, Jermaine L.; Nix, Jay C.; Becker, Donald F.; Tanner, John J.

    2009-01-01

    Summary The multifunctional Escherichia coli PutA flavoprotein functions as both a membrane-associated proline catabolic enzyme and transcriptional repressor of the proline utilization genes putA and putP. To better understand the mechanism of transcriptional regulation by PutA, we have mapped the put regulatory region, determined a crystal structure of the PutA ribbon-helix-helix domain (PutA52) complexed with DNA and examined the thermodynamics of DNA binding to PutA52. Five operator sites, each containing the sequence motif 5′-GTTGCA-3′, were identified using gel-shift analysis. Three of the sites are shown to be critical for repression of putA, whereas the two other sites are important for repression of putP. The 2.25 Å resolution crystal structure of PutA52 bound to one of the operators (operator 2, 21-bp) shows that the protein contacts a 9-bp fragment, corresponding to the GTTGCA consensus motif plus three flanking base pairs. Since the operator sequences differ in flanking bases, the structure implies that PutA may have different affinities for the five operators. This hypothesis was explored using isothermal titration calorimetry. The binding of PutA52 to operator 2 is exothermic with an enthalpy of −1.8 kcal/mol and a dissociation constant of 210 nM. Substitution of the flanking bases of operator 4 into operator 2 results in an unfavorable enthalpy of 0.2 kcal/mol and 15-fold lower affinity, which shows that base pairs outside of the consensus motif impact binding. The structural and thermodynamic data suggest that hydrogen bonds between Lys9 and bases adjacent to the GTTGCA motif contribute to transcriptional regulation by fine-tuning the affinity of PutA for put control operators. PMID:18586269

  9. Combination therapy in hypertension: an Asia-Pacific consensus viewpoint.

    PubMed

    Abdul Rahman, Abdul Rashid; Reyes, Eugenio B; Sritara, Piyamitr; Pancholia, Arvind; Van Phuoc, Dang; Tomlinson, Brian

    2015-05-01

    Hypertension incurs a significant healthcare burden in Asia-Pacific countries, which have suboptimal rates of blood pressure (BP) treatment and control. A consensus meeting of hypertension experts from the Asia-Pacific region convened in Hanoi, Vietnam, in April 2013. The principal objectives were to discuss the growing problem of hypertension in the Asia-Pacific region, and to develop consensus recommendations to promote standards of care across the region. A particular focus was recommendations for combination therapy, since it is known that most patients with hypertension will require two or more antihypertensive drugs to achieve BP control, and also that combinations of drugs with complementary mechanisms of action achieve BP targets more effectively than monotherapy. The expert panel reviewed guidelines for hypertension management from the USA and Europe, as well as individual Asia-Pacific countries, and devised a treatment matrix/guide, in which they propose the preferred combination therapy regimens for patients with hypertension, both with and without compelling indications. This report summarizes key recommendations from the group, including recommended antihypertensive combinations for specific patient populations. These strategies generally entail initiating therapy with free drug combinations, starting with the lowest available dosage, followed by treatment with single-pill combinations once the BP target has been achieved. A single reference for the whole Asia-Pacific region may contribute to increased consistency of treatment and greater proportions of patients achieving BP control, and hence reducing hypertension-related morbidity and mortality.

  10. Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats☆

    PubMed Central

    Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

    2013-01-01

    Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. PMID:23648487

  11. Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats.

    PubMed

    Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

    2013-08-01

    Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

  12. Structural and Thermodynamic Signatures of DNA Recognition by Mycobacterium tuberculosis DnaA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsodikov, Oleg V.; Biswas, Tapan

    An essential protein, DnaA, binds to 9-bp DNA sites within the origin of replication oriC. These binding events are prerequisite to forming an enigmatic nucleoprotein scaffold that initiates replication. The number, sequences, positions, and orientations of these short DNA sites, or DnaA boxes, within the oriCs of different bacteria vary considerably. To investigate features of DnaA boxes that are important for binding Mycobacterium tuberculosis DnaA (MtDnaA), we have determined the crystal structures of the DNA binding domain (DBD) of MtDnaA bound to a cognate MtDnaA-box (at 2.0 {angstrom} resolution) and to a consensus Escherichia coli DnaA-box (at 2.3 {angstrom}). Thesemore » structures, complemented by calorimetric equilibrium binding studies of MtDnaA DBD in a series of DnaA-box variants, reveal the main determinants of DNA recognition and establish the [T/C][T/A][G/A]TCCACA sequence as a high-affinity MtDnaA-box. Bioinformatic and calorimetric analyses indicate that DnaA-box sequences in mycobacterial oriCs generally differ from the optimal binding sequence. This sequence variation occurs commonly at the first 2 bp, making an in vivo mycobacterial DnaA-box effectively a 7-mer and not a 9-mer. We demonstrate that the decrease in the affinity of these MtDnaA-box variants for MtDnaA DBD relative to that of the highest-affinity box TTGTCCACA is less than 10-fold. The understanding of DnaA-box recognition by MtDnaA and E. coli DnaA enables one to map DnaA-box sequences in the genomes of M. tuberculosis and other eubacteria.« less

  13. Regulation of muscle GLUT-4 transcription by AMP-activated protein kinase.

    PubMed

    Zheng, D; MacLean, P S; Pohnert, S C; Knight, J B; Olson, A L; Winder, W W; Dohm, G L

    2001-09-01

    Skeletal muscle GLUT-4 transcription in response to treatment with 5-aminoimidazole-4-carboxamide-1-beta-D-ribofuranoside (AICAR), a known activator of AMP-activated protein kinase (AMPK), was studied in rats and mice. The increase in GLUT-4 mRNA levels in response to a single subcutaneous injection of AICAR, peaked at 13 h in white and red quadriceps muscles but not in the soleus muscle. The mRNA level of chloramphenicol acyltransferase reporter gene which is driven by 1,154 or 895 bp of the human GLUT-4 proximal promoter was increased in AICAR-treated transgenic mice, demonstrating the transcriptional upregulation of the GLUT-4 gene by AICAR. However, this induction of transcription was not apparent with 730 bp of the promoter. In addition, nuclear extracts from AICAR-treated mice bound to the consensus sequence of myocyte enhancer factor-2 (from -473 to -464) to a greater extent than from saline-injected mice. Thus AMP-activated protein kinase activation by AICAR increases GLUT-4 transcription by a mechanism that requires response elements within 895 bp of human GLUT-4 proximal promoter and that may be cooperatively mediated by myocyte enhancer factor-2.

  14. Structural and sequence diversity of the transposon Galileo in the Drosophila willistoni genome.

    PubMed

    Gonçalves, Juliana W; Valiati, Victor Hugo; Delprat, Alejandra; Valente, Vera L S; Ruiz, Alfredo

    2014-09-13

    Galileo is one of three members of the P superfamily of DNA transposons. It was originally discovered in Drosophila buzzatii, in which three segregating chromosomal inversions were shown to have been generated by ectopic recombination between Galileo copies. Subsequently, Galileo was identified in six of 12 sequenced Drosophila genomes, indicating its widespread distribution within this genus. Galileo is strikingly abundant in Drosophila willistoni, a neotropical species that is highly polymorphic for chromosomal inversions, suggesting a role for this transposon in the evolution of its genome. We carried out a detailed characterization of all Galileo copies present in the D. willistoni genome. A total of 191 copies, including 133 with two terminal inverted repeats (TIRs), were classified according to structure in six groups. The TIRs exhibited remarkable variation in their length and structure compared to the most complete copy. Three copies showed extended TIRs due to internal tandem repeats, the insertion of other transposable elements (TEs), or the incorporation of non-TIR sequences into the TIRs. Phylogenetic analyses of the transposase (TPase)-encoding and TIR segments yielded two divergent clades, which we termed Galileo subfamilies V and W. Target-site duplications (TSDs) in D. willistoni Galileo copies were 7- or 8-bp in length, with the consensus sequence GTATTAC. Analysis of the region around the TSDs revealed a target site motif (TSM) with a 15-bp palindrome that may give rise to a stem-loop secondary structure. There is a remarkable abundance and diversity of Galileo copies in the D. willistoni genome, although no functional copies were found. The TIRs in particular have a dynamic structure and extend in different ways, but their ends (required for transposition) are more conserved than the rest of the element. The D. willistoni genome harbors two Galileo subfamilies (V and W) that diverged ~9 million years ago and may have descended from an ancestral element in the genome. Galileo shows a significant insertion preference for a 15-bp palindromic TSM.

  15. Characterization of NIST human mitochondrial DNA SRM-2392 and SRM-2392-I standard reference materials by next generation sequencing.

    PubMed

    Riman, Sarah; Kiesler, Kevin M; Borsuk, Lisa A; Vallone, Peter M

    2017-07-01

    Standard Reference Materials SRM 2392 and 2392-I are intended to provide quality control when amplifying and sequencing human mitochondrial genome sequences. The National Institute of Standards and Technology (NIST) offers these SRMs to laboratories performing DNA-based forensic human identification, molecular diagnosis of mitochondrial diseases, mutation detection, evolutionary anthropology, and genetic genealogy. The entire mtGenome (∼16569bp) of SRM 2392 and 2392-I have previously been characterized at NIST by Sanger sequencing. Herein, we used the sensitivity, specificity, and accuracy offered by next generation sequencing (NGS) to: (1) re-sequence the certified values of the SRM 2392 and 2392-I; (2) confirm Sanger data with a high coverage new sequencing technology; (3) detect lower level heteroplasmies (<20%); and thus (4) support mitochondrial sequencing communities in the adoption of NGS methods. To obtain a consensus sequence for the SRMs as well as identify and control any bias, sequencing was performed using two NGS platforms and data was analyzed using different bioinformatics pipelines. Our results confirm five low level heteroplasmy sites that were not previously observed with Sanger sequencing: three sites in the GM09947A template in SRM 2392 and two sites in the HL-60 template in SRM 2392-I. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. A composite molecular phylogeny of living lemuroid primates.

    PubMed

    DelPero, Massimiliano; Pozzi, Luca; Masters, Judith C

    2006-01-01

    Lemuroid phylogeny is a source of lively debate among primatologists. Reconstructions based on morphological, physiological, behavioural and molecular data have yielded a diverse array of tree topologies with few nodes in common. In the last decade, molecular phylogenetic studies have grown in popularity, and a wide range of sequences has been brought to bear on the problem, but consensus has remained elusive. We present an analysis based on a composite molecular data set of approx. 6,400 bp assembled from the National Center for Biotechnology Information (NCBI) database, including both mitochondrial and nuclear genes, and diverse analytical methods. Our analysis consolidates some of the nodes that were insecure in previous reconstructions, but is still equivocal on the placement of some taxa. We conducted a similar analysis of a composite data set of approx. 3,600 bp to investigate the controversial relationships within the family Lemuridae. Here our analysis was more successful; only the position of Eulemur coronatus remained uncertain. Copyright 2006 S. Karger AG, Basel.

  17. Characterization of the human peroxisome proliferator activated receptor delta gene and its expression.

    PubMed

    Skogsberg, J; Kannisto, K; Roshani, L; Gagne, E; Hamsten, A; Larsson, C; Ehrenborg, E

    2000-07-01

    Peroxisome proliferator activated receptors (PPARs) are nuclear receptors regulating the expression of genes involved in lipid and glucose metabolism. Three different PPARs; alpha (PPARA), gamma (PPARG) and delta (PPARD) have been characterized and they are distinguished from each other by tissue distribution and cell activation. In this study, the structure and detailed chromosomal localization of the human PPARD gene was determined. Three genomic clones containing the PPARD gene was isolated from a human P1 library. The gene spans approximately 85 kb of DNA and consists of 9 exons and 8 introns with exons ranging in size from 84 bp to 2.3 kb and introns ranging from 180 bp to 50 kb. All splice acceptor and donor sites conform to the consensus sequences including the AG-GT motif. Although PPARD lacks a TATA box, the gene is transcribed from a unique start site located 380 bp upstream of the ATG initiation codon. The 5' and 3' ends were mapped by rapid amplification of cDNA ends and the mRNA size of PPARD based upon the structure of the gene is 3803 bp. In addition, the chromosomal sublocalization of PPARD was determined by radiation hybrid mapping. The PPARD gene is located at 14 cR from the colipase gene and 15 cR from the serine kinase gene at chromosomal region 6p21.2.

  18. Direct repeat sequences are essential for function of the cis-acting locus of transfer (clt) of Streptomyces phaeochromogenes plasmid pJV1.

    PubMed

    Franco, Bernardo; González-Cerón, Gabriela; Servín-González, Luis

    2003-11-01

    The functionality of direct and inverted repeat sequences inside the cis acting locus of transfer (clt) of the Streptomyces plasmid pJV1 was determined by testing the effect of different deletions on plasmid transfer. The results show that the single most important element for pJV1 clt function is a series of evenly spaced 9 bp long direct repeats which match the consensus CCGCACA(C/G)(C/G), since their deletion caused a dramatic reduction in plasmid transfer. The presence of these repeats in the absence of any other clt sequences allowed plasmid transfer to occur at a frequency that was at least two orders of magnitude higher than that obtained in the complete absence of clt. A database search revealed regions with a similar organization, and in the same position, in Streptomyces plasmids pSN22 and pSLS, which have transfer proteins homologous to those of pJV1.

  19. Regulated expression of the Ras effector Rin1 in forebrain neurons

    PubMed Central

    Dzudzor, Bartholomew; Huynh, Lucia; Thai, Minh; Bliss, Joanne M.; Nagaoka, Yoshiko; Wang, Ying; Ch'ng, Toh Hean; Jiang, Meisheng; Martin, Kelsey C.; Colicelli, John

    2009-01-01

    The Ras effector Rin1 is induced concomitant with synaptogenesis in forebrain neurons, where it inhibits fear conditioning and amygdala LTP. In epithelial cells, lower levels of Rin1 orchestrate receptor endocytosis. A 945bp Rin1 promoter fragment was active in hippocampal neurons and directed accurate tissue-specific and temporal expression in transgenic mice. Regulated expression in neurons and epithelial cells was mediated in part by Snail transcriptional repressors: mutation of a conserved Snail site increased expression and endogenous Snai1 was detected at the Rin1 promoter. We also describe an element closely related to, but distinct from, the consensus site for REST, a master repressor of neuronal genes. Conversion to a consensus REST sequence reduced expression in both cell types. These results provide insight into regulated expression of a neuronal Ras effector, define a promoter useful in telencephalic neuron studies, and describe a novel REST site variant directing expression to mature neurons. PMID:19837165

  20. Divergence and evolution of homologous regions of Bombyx mori nuclear polyhedrosis virus.

    PubMed Central

    Majima, K; Kobara, R; Maeda, S

    1993-01-01

    Homologous regions (hrs) (hr1,hr2-left,hr2-right,hr3,hr4-left,hr 4-right, and hr5) similar to those found in the Autographa californica nuclear polyhedrosis virus (AcNPV) genome were found in the Bombyx mori NPV (BmNPV) genome. The BmNPV hrs contained two to eight repeats of a homologous nucleotide sequence which were on average about 75 bp long. All of these homologous sequence repeats contained a 26-bp-long palindrome motif with an EcoRI or EcoRI-like site at its core. The consensus sequence of the BmNPV hrs showed 95% conservation with respect to those found in AcNPV. Nucleotide sequence analysis indicated that hr2-left and hr2-right of BmNPV evolved from an ancestor similar to hr2 of AcNPV by inversion, cleavage, and ligation. The polarities of the BmNPV and AcNPV hrs were conserved except for that of hr4-left. Within hr4-right of BmNPV, four repeats of a previously underscribed palindrome motif were found. Bmhr5D, a BmNPV mutant which lacked hr5, replicated at a rate similar to that of wild-type BmNPV in BmN cells and silkworm larvae, indicating that hr5 was not essential for viral replication. After ten passages of Bmhr5D in BmN cells, no detectable changes in its genome were observed by restriction endonuclease analysis. The evolution and divergence of the BmNPV genome are also discussed. Images PMID:8230471

  1. Origin Replication Complex Binding, Nucleosome Depletion Patterns, and a Primary Sequence Motif Can Predict Origins of Replication in a Genome with Epigenetic Centromeres

    PubMed Central

    Tsai, Hung-Ji; Baller, Joshua A.; Liachko, Ivan; Koren, Amnon; Burrack, Laura S.; Hickman, Meleah A.; Thevandavakkam, Mathuravani A.; Rusche, Laura N.

    2014-01-01

    ABSTRACT Origins of DNA replication are key genetic elements, yet their identification remains elusive in most organisms. In previous work, we found that centromeres contain origins of replication (ORIs) that are determined epigenetically in the pathogenic yeast Candida albicans. In this study, we used origin recognition complex (ORC) binding and nucleosome occupancy patterns in Saccharomyces cerevisiae and Kluyveromyces lactis to train a machine learning algorithm to predict the position of active arm (noncentromeric) origins in the C. albicans genome. The model identified bona fide active origins as determined by the presence of replication intermediates on nondenaturing two-dimensional (2D) gels. Importantly, these origins function at their native chromosomal loci and also as autonomously replicating sequences (ARSs) on a linear plasmid. A “mini-ARS screen” identified at least one and often two ARS regions of ≥100 bp within each bona fide origin. Furthermore, a 15-bp AC-rich consensus motif was associated with the predicted origins and conferred autonomous replicating activity to the mini-ARSs. Thus, while centromeres and the origins associated with them are epigenetic, arm origins are dependent upon critical DNA features, such as a binding site for ORC and a propensity for nucleosome exclusion. PMID:25182328

  2. The mitochondrial genome of the gymnosperm Cycas taitungensis contains a novel family of short interspersed elements, Bpu sequences, and abundant RNA editing sites.

    PubMed

    Chaw, Shu-Miaw; Shih, Arthur Chun-Chieh; Wang, Daryi; Wu, Yu-Wei; Liu, Shu-Mei; Chou, The-Yuan

    2008-03-01

    The mtDNA of Cycas taitungensis is a circular molecule of 414,903 bp, making it 2- to 6-fold larger than the known mtDNAs of charophytes and bryophytes, but similar to the average of 7 elucidated angiosperm mtDNAs. It is characterized by abundant RNA editing sites (1,084), more than twice the number found in the angiosperm mtDNAs. The A + T content of Cycas mtDNA is 53.1%, the lowest among known land plants. About 5% of the Cycas mtDNA is composed of a novel family of mobile elements, which we designated as "Bpu sequences." They share a consensus sequence of 36 bp with 2 terminal direct repeats (AAGG) and a recognition site for the Bpu 10I restriction endonuclease (CCTGAAGC). Comparison of the Cycas mtDNA with other plant mtDNAs revealed many new insights into the biology and evolution of land plant mtDNAs. For example, the noncoding sequences in mtDNAs have drastically expanded as land plants have evolved, with abrupt increases appearing in the bryophytes, and then in the seed plants. As a result, the genomic organizations of seed plant mtDNAs are much less compact than in other plants. Also, the Cycas mtDNA appears to have been exempted from the frequent gene loss observed in angiosperm mtDNAs. Similar to the angiosperms, the 3 Cycas genes nad1, nad2, and nad5 are disrupted by 5 group II intron squences, which have brought the genes into trans-splicing arrangements. The evolutionary origin and invasion/duplication mechanism of the Bpu sequences in Cycas mtDNA are hypothesized and discussed.

  3. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    PubMed

    Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  4. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    PubMed Central

    Rehm, Charlotte; Wurmthaler, Lena A.; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S.

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1–5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6–9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria. PMID:26695179

  5. Characterization of the Porphyromonas gingivalis conjugative transposon CTnPg1: determination of the integration site and the genes essential for conjugal transfer.

    PubMed

    Naito, Mariko; Sato, Keiko; Shoji, Mikio; Yukitake, Hideharu; Ogura, Yoshitoshi; Hayashi, Tetsuya; Nakayama, Koji

    2011-07-01

    In our previous study, extensive genomic rearrangements were found in two strains of the Gram-negative anaerobic bacterium Porphyromonas (Por.) gingivalis, and most of these rearrangements were associated with mobile genetic elements such as insertion sequences and conjugative transposons (CTns). CTnPg1, identified in Por. gingivalis strain ATCC 33277, was the first complete CTn reported for the genus Porphyromonas. In the present study, we found that CTnPg1 can be transferred from strain ATCC 33277 to another Por. gingivalis strain, W83, at a frequency of 10(-7) to 10(-6). The excision of CTnPg1 from the chromosome in a donor cell depends on an integrase (Int; PGN_0094) encoded in CTnPg1, whereas CTnPg1 excision is independent of PGN_0084 (a DNA topoisomerase I homologue; Exc) encoded within CTnPg1 and recA (PGN_1057) on the donor chromosome. Intriguingly, however, the transfer of CTnPg1 between Por. gingivalis strains requires RecA function in the recipient. Sequencing analysis of CTnPg1-integrated sites on the chromosomes of transconjugants revealed that the consensus attachment (att) sequence is a 13 bp sequence, TTTTCNNNNAAAA. We further report that CTnPg1 is able to transfer to two other bacterial species, Bacteroides thetaiotaomicron and Prevotella oralis. In addition, CTnPg1-like CTns are located in the genomes of other oral anaerobic bacteria, Porphyromonas endodontalis, Prevotella buccae and Prevotella intermedia, with the same consensus att sequence. These results suggest that CTns in the CTnPg1 family are widely distributed among oral anaerobic Gram-negative bacteria found in humans and play important roles in horizontal gene transfer among these bacteria.

  6. Transcriptional Regulation of Aggregatibacter actinomycetemcomitans lsrACDBFG and lsrRK Operons and Their Role in Biofilm Formation

    PubMed Central

    Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Lamont, Richard J.

    2013-01-01

    Autoinducer-2 (AI-2) is required for biofilm formation and virulence of the oral pathogen Aggregatibacter actinomycetemcomitans, and we previously showed that lsrB codes for a receptor for AI-2. The lsrB gene is expressed as part of the lsrACDBFG operon, which is divergently transcribed from an adjacent lsrRK operon. In Escherichia coli, lsrRK encodes a repressor and AI-2 kinase that function to regulate lsrACDBFG. To determine if lsrRK controls lsrACDBFG expression and influences biofilm growth of A. actinomycetemcomitans, we first defined the promoters for each operon. Transcriptional reporter plasmids containing the 255-bp lsrACDBFG-lsrRK intergenic region (IGR) fused to lacZ showed that essential elements of lsrR promoter reside 89 to 255 bp upstream from the lsrR start codon. Two inverted repeat sequences that represent potential binding sites for LsrR and two sequences resembling the consensus cyclic AMP receptor protein (CRP) binding site were identified in this region. Using electrophoretic mobility shift assay (EMSA), purified LsrR and CRP proteins were shown to bind probes containing these sequences. Surprisingly, the 255-bp IGR did not contain the lsrA promoter. Instead, a fragment encompassing nucleotides +1 to +159 of lsrA together with the 255-bp IGR was required to promote lsrA transcription. This suggests that a region within the lsrA coding sequence influences transcription, or alternatively that the start codon of A. actinomycetemcomitans lsrA has been incorrectly annotated. Transformation of ΔlsrR, ΔlsrK, ΔlsrRK, and Δcrp deletion mutants with lacZ reporters containing the lsrA or lsrR promoter showed that LsrR negatively regulates and CRP positively regulates both lsrACDBFG and lsrRK. However, in contrast to what occurs in E. coli, deletion of lsrK had no effect on the transcriptional activity of the lsrA or lsrR promoters, suggesting that another kinase may be capable of phosphorylating AI-2 in A. actinomycetemcomitans. Finally, biofilm formation of the ΔlsrR, ΔlsrRK, and Δcrp mutants was significantly reduced relative to that of the wild type, indicating that proper regulation of the lsr locus is required for optimal biofilm growth by A. actinomycetemcomitans. PMID:23104800

  7. Structural organization of the porcine and human genes coding for a leydig cell-specific insulin-like peptide (LEY I-L) and chromosomal localization of the human gene (INSL3)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Burkhardt E.; Adham, I.M.; Brosig, B.

    1994-03-01

    Leydig insulin-like protein (LEY I-L) is a member of the insulin-like hormone superfamily. The LEY I-L gene (designated INSL3) is expressed exclusively in prenatal and postnatal Leydig cells. The authors report here the cloning and nucleotide sequence of porcine and human LEY I-L genes including the 5[prime] regions. Both genes consist of two exons and one intron. The organization of the LEY I-L gene is similar to that of insulin and relaxin. The transcription start site in the porcine and human LEY I-L gene is localized 13 and 14 bp upstream of the translation start site, respectively. Alignment of themore » 5[prime] flanking regions of both genes reveals that the first 107 nucleotides upstream of the transcription start site exhibit an overall sequence similarity of 80%. This conserved region contains a consensus TATAA box, a CAAT-like element (GAAT), and a consensus SP1 sequence (GGGCGG) at equivalent positions in both genes and therefore may play a role in regulation of expression of the LEY I-L gene. The porcine and human genome contains a single copy of the LEY I-L gene. By in situ hybridization, the human gene was assigned to bands p13.2-p12 of the short arm of chromosome 19. 25 refs., 6 figs.« less

  8. Mechanisms of radiation-induced gene responses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woloschak, G.E.; Paunesku, T.

    1996-10-01

    In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5` region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3` region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts;more » however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process.« less

  9. Molecular cloning and sequence analysis of full-length growth hormone cDNAs from six important economic fishes.

    PubMed

    Zhang, Jing-Nan; Song, Ping; Hu, Jia-Rui; Mo, Sai-Jun; Peng, Mao-Yu; Zhou, Wei; Zou, Ji-Xing; Hu, Yin-Chang

    2005-01-01

    In this study,the full-length cDNAs of GH (Growth Hormone) gene was isolated from six important economic fishes, Siniperca kneri, Epinephelus coioides, Monopterus albus, Silurus asotus, Misgurnus anguillicaudatus and Carassius auratus gibelio Bloch. It is the first time to clone these GH sequences except E. coioides GH. The lengths of the above cDNAs are as follows: 953 bp, 1 023 bp, 825 bp, 1 082 bp, 1 154 bp and 1 180 bp. Each sequence includes an ORF of about 600 bp which encodes a protein of about 200 amino acid: S. kneri, E. coioides and M. albus GHs of 204 amino acid, S. asotus GH of 200 amino acid, M. anguillicaudatus and C. auratus gibelio GHs of 210 amino acid. Then detailed sequence analysis of the six GHs with many other fish sequences was performed. The six sequences all showed high homology to other sequences, especially to sequences within the same order, and many conserved residues were identified, most localized in five domains. The phylogenetic trees (MP and NJ) of many fish GH ORF sequences (including the new six) with Amia calva as outgroup were generally resolved and largely congruent with the morphology-based tree though some incongruities were observed, suggesting GH ORF should be paid more attention to in teleostean phylogeny.

  10. Highly conserved D-loop-like nuclear mitochondrial sequences (Numts) in tiger (Panthera tigris).

    PubMed

    Zhang, Wenping; Zhang, Zhihe; Shen, Fujun; Hou, Rong; Lv, Xiaoping; Yue, Bisong

    2006-08-01

    Using oligonucleotide primers designed to match hypervariable segments I (HVS-1) of Panthera tigris mitochondrial DNA (mtDNA), we amplified two different PCR products (500 bp and 287 bp) in the tiger (Panthera tigris), but got only one PCR product (287 bp) in the leopard (Panthera pardus). Sequence analyses indicated that the sequence of 287 bp was a D-loop-like nuclear mitochondrial sequence (Numts), indicating a nuclear transfer that occurred approximately 4.8-17 million years ago in the tiger and 4.6-16 million years ago in the leopard. Although the mtDNA D-loop sequence has a rapid rate of evolution, the 287-bp Numts are highly conserved; they are nearly identical in tiger subspecies and only 1.742% different between tiger and leopard. Thus, such sequences represent molecular 'fossils' that can shed light on evolution of the mitochondrial genome and may be the most appropriate outgroup for phylogenetic analysis. This is also proved by comparing the phylogenetic trees reconstructed using the D-loop sequence of snow leopard and the 287-bp Numts as outgroup.

  11. Complete Genome Sequence of Methylobacterium populi P-1M, Isolated from Pink-Pigmented Household Biofilm

    PubMed Central

    Morohoshi, Tomohiro

    2016-01-01

    Methylobacterium populi P-1M is isolated from the pink-pigmented household biofilm. Here, we present the complete genome sequence of P-1M, consisting of one chromosome of 5,705,640 bp and five plasmids of 64,864 bp, 59,879 bp, 42,569 bp, 41,417 bp, and 29,506 bp. PMID:27313289

  12. Identification of B Cells as a Major Site for Cyprinid Herpesvirus 3 Latency

    PubMed Central

    Reed, Aimee N.; Izume, Satoko; Dolan, Brian P.; LaPatra, Scott; Kent, Michael; Dong, Jing

    2014-01-01

    ABSTRACT Cyprinid herpesvirus 3 (CyHV-3), commonly known as koi herpesvirus (KHV), is a member of the Alloherpesviridae, and is a recently discovered emerging herpesvirus that is highly pathogenic for koi and common carp. Our previous study demonstrated that CyHV-3 becomes latent in peripheral white blood cells (WBC). In this study, CyHV-3 latency was further investigated in IgM+ WBC. The presence of the CyHV-3 genome in IgM+ WBC was about 20-fold greater than in IgM− WBC. To determine whether CyHV-3 expressed genes during latency, transcription from all eight open reading frames (ORFs) in the terminal repeat was investigated in IgM+ WBC from koi with latent CyHV-3 infection. Only a spliced ORF6 transcript was found to be abundantly expressed in IgM+ WBC from CyHV-3 latently infected koi. The spliced ORF6 transcript was also detected in vitro during productive infection as early as 1 day postinfection. The ORF6 transcript from in vitro infection begins at −127 bp upstream of the ATG codon and ends +188 bp downstream of the stop codon, +20 bp downstream of the polyadenylation signal. The hypothetical protein of ORF6 contains a consensus sequence with homology to a conserved domain of EBNA-3B and ICP4 from Epstein-Barr virus and herpes simplex virus 1, respectively, both members of the Herpesviridae. This is the first report of latent CyHV-3 in B cells and identification of gene transcription during latency for a member of the Alloherpesviridae. IMPORTANCE This is the first demonstration that a member of the Alloherpesviridae, cyprinid herpesvirus 3 (CyHV-3), establishes a latent infection in the B cells of its host, Cyprinus carpio. In addition, this is the first report of identification of gene transcription during latency for a member of Herpesvirales outside Herpesviridae. This is also the first report that the hypothetical protein of latent transcript of CyHV-3 contains a consensus sequence with homology to a conserved domain of EBNA-3B from Epstein-Barr virus and ICP4 from herpes simplex virus 1, which are genes important for latency. These strongly suggest that latency is evolutionally conserved across vertebrates. PMID:24899202

  13. Identification of B cells as a major site for cyprinid herpesvirus 3 latency.

    PubMed

    Reed, Aimee N; Izume, Satoko; Dolan, Brian P; LaPatra, Scott; Kent, Michael; Dong, Jing; Jin, Ling

    2014-08-01

    Cyprinid herpesvirus 3 (CyHV-3), commonly known as koi herpesvirus (KHV), is a member of the Alloherpesviridae, and is a recently discovered emerging herpesvirus that is highly pathogenic for koi and common carp. Our previous study demonstrated that CyHV-3 becomes latent in peripheral white blood cells (WBC). In this study, CyHV-3 latency was further investigated in IgM(+) WBC. The presence of the CyHV-3 genome in IgM(+) WBC was about 20-fold greater than in IgM(-) WBC. To determine whether CyHV-3 expressed genes during latency, transcription from all eight open reading frames (ORFs) in the terminal repeat was investigated in IgM(+) WBC from koi with latent CyHV-3 infection. Only a spliced ORF6 transcript was found to be abundantly expressed in IgM(+) WBC from CyHV-3 latently infected koi. The spliced ORF6 transcript was also detected in vitro during productive infection as early as 1 day postinfection. The ORF6 transcript from in vitro infection begins at -127 bp upstream of the ATG codon and ends +188 bp downstream of the stop codon, +20 bp downstream of the polyadenylation signal. The hypothetical protein of ORF6 contains a consensus sequence with homology to a conserved domain of EBNA-3B and ICP4 from Epstein-Barr virus and herpes simplex virus 1, respectively, both members of the Herpesviridae. This is the first report of latent CyHV-3 in B cells and identification of gene transcription during latency for a member of the Alloherpesviridae. This is the first demonstration that a member of the Alloherpesviridae, cyprinid herpesvirus 3 (CyHV-3), establishes a latent infection in the B cells of its host, Cyprinus carpio. In addition, this is the first report of identification of gene transcription during latency for a member of Herpesvirales outside Herpesviridae. This is also the first report that the hypothetical protein of latent transcript of CyHV-3 contains a consensus sequence with homology to a conserved domain of EBNA-3B from Epstein-Barr virus and ICP4 from herpes simplex virus 1, which are genes important for latency. These strongly suggest that latency is evolutionally conserved across vertebrates. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  14. Complete Genome Sequence of Methylobacterium populi P-1M, Isolated from Pink-Pigmented Household Biofilm.

    PubMed

    Morohoshi, Tomohiro; Ikeda, Tsukasa

    2016-06-16

    Methylobacterium populi P-1M is isolated from the pink-pigmented household biofilm. Here, we present the complete genome sequence of P-1M, consisting of one chromosome of 5,705,640 bp and five plasmids of 64,864 bp, 59,879 bp, 42,569 bp, 41,417 bp, and 29,506 bp. Copyright © 2016 Morohoshi and Ikeda.

  15. Echinococcus granulosus Sensu Stricto in Dogs and Jackals from Caspian Sea Region, Northern Iran

    PubMed Central

    GHOLAMI, Shirzad; JAHANDAR, Hefzallah; ABASTABAR, Mahdi; PAGHEH, Abdolsatar; MOBEDI, Iraj; SHARBATKHORI, Mitra

    2016-01-01

    Background: The aim of the present study was genotyping of Echinococcus granulosus isolates from dogs and jackals in Mazandaran Province, northern Iran, and using partial sequence of the mitochondrial cytochrome c oxidase subunit 1 gene (cox1). Methods: E. granulosus isolates (n = 15) were collected from 42 stray dogs and 16 jackals found in south of the Caspian Sea in northern Iran. After morphological study, the isolates were genetically characterized using consensus sequences (366bp) of the cox1 gene. Phylogenetic analysis of cox1 nucleotide sequence data was performed using a Bayesian Inference approach. Results: Four different sequences were observed among the isolates. Two genotypes [G1 (66.7%) and G3 (33.3%)] were identified among the isolates. The G1 sequences indicated three sequence profiles. One profile (Maz1) had 100% homology with reference sequence (AN: KP339045). Two other profiles, designated Maz2 and Maz3, had 99% homology with the G1 genotype (ANs: KP339046 and KP339047). A G3 sequence designated Maz4 showed 100% homology with a G3 reference sequence (AN: KP339048). Conclusion: The occurrence of the G1 genotype of E. granulosus sensu stricto as a frequent genotype in dogs is emphasized. This study established the first molecular characterization of E. granulosus in the province. PMID:28096852

  16. Structural basis for genome wide recognition of 5-bp GC motifs by SMAD transcription factors.

    PubMed

    Martin-Malpartida, Pau; Batet, Marta; Kaczmarska, Zuzanna; Freier, Regina; Gomes, Tiago; Aragón, Eric; Zou, Yilong; Wang, Qiong; Xi, Qiaoran; Ruiz, Lidia; Vea, Angela; Márquez, José A; Massagué, Joan; Macias, Maria J

    2017-12-12

    Smad transcription factors activated by TGF-β or by BMP receptors form trimeric complexes with Smad4 to target specific genes for cell fate regulation. The CAGAC motif has been considered as the main binding element for Smad2/3/4, whereas Smad1/5/8 have been thought to preferentially bind GC-rich elements. However, chromatin immunoprecipitation analysis in embryonic stem cells showed extensive binding of Smad2/3/4 to GC-rich cis-regulatory elements. Here, we present the structural basis for specific binding of Smad3 and Smad4 to GC-rich motifs in the goosecoid promoter, a nodal-regulated differentiation gene. The structures revealed a 5-bp consensus sequence GGC(GC)|(CG) as the binding site for both TGF-β and BMP-activated Smads and for Smad4. These 5GC motifs are highly represented as clusters in Smad-bound regions genome-wide. Our results provide a basis for understanding the functional adaptability of Smads in different cellular contexts, and their dependence on lineage-determining transcription factors to target specific genes in TGF-β and BMP pathways.

  17. Transcription activation mediated by a cyclic AMP receptor protein from Thermus thermophilus HB8.

    PubMed

    Shinkai, Akeo; Kira, Satoshi; Nakagawa, Noriko; Kashihara, Aiko; Kuramitsu, Seiki; Yokoyama, Shigeyuki

    2007-05-01

    The extremely thermophilic bacterium Thermus thermophilus HB8, which belongs to the phylum Deinococcus-Thermus, has an open reading frame encoding a protein belonging to the cyclic AMP (cAMP) receptor protein (CRP) family present in many bacteria. The protein named T. thermophilus CRP is highly homologous to the CRP family proteins from the phyla Firmicutes, Actinobacteria, and Cyanobacteria, and it forms a homodimer and interacts with cAMP. CRP mRNA and intracellular cAMP were detected in this strain, which did not drastically fluctuate during cultivation in a rich medium. The expression of several genes was altered upon disruption of the T. thermophilus CRP gene. We found six CRP-cAMP-dependent promoters in in vitro transcription assays involving DNA fragments containing the upstream regions of the genes exhibiting decreased expression in the CRP disruptant, indicating that the CRP is a transcriptional activator. The consensus T. thermophilus CRP-binding site predicted upon nucleotide sequence alignment is 5'-(C/T)NNG(G/T)(G/T)C(A/C)N(A/T)NNTCACAN(G/C)(G/C)-3'. This sequence is unique compared with the known consensus binding sequences of CRP family proteins. A putative -10 hexamer sequence resides at 18 to 19 bp downstream of the predicted T. thermophilus CRP-binding site. The CRP-regulated genes found in this study comprise clustered regularly interspaced short palindromic repeat (CRISPR)-associated (cas) ones, and the genes of a putative transcriptional regulator, a protein containing the exonuclease III-like domain of DNA polymerase, a GCN5-related acetyltransferase homolog, and T. thermophilus-specific proteins of unknown function. These results suggest a role for cAMP signal transduction in T. thermophilus and imply the T. thermophilus CRP is a cAMP-responsive regulator.

  18. Determining ERβ Binding Affinity to Singly Mutant ERE Using Dual Polarization Interferometry

    NASA Astrophysics Data System (ADS)

    Song, Hong Yan; Su, Xiaodi

    In a classic mode of estrogen action, estrogen receptors (ERs) bind to estrogen responsive element (ERE) to activate gene transcription. A perfect ERE contains a 13-base pair sequence of a palindromic repeat separated by a three-base spacer, 5‧-GGTCAnnnTGACC-3‧. In addition to the consensus or wild-type ERE (wtERE), naturally occurring EREs often have one or two base pairs’ alternation. Based on the newly constructed Thermodynamic Modeling of ChIP-seq (TherMos) model, binding energy between ERβ and a series of 34-bp mutant EREs (mutERE) was simulated to predict the binding affinity between ERs and EREs with single base pair deviation at different sites of the 13-bp inverted sequence. Experimentally, dual polarization interferometry (DPI) method was developed to measure ERβ-mutEREs binding affinity. On a biotin-NeutrAvidin (NA)-biotin treated DPI chip, wtERE is immobilized. In a direct binding assay, ERβ-wtERE binding affinity is determined. In a competition assay, ERβ was preincubated with mutant EREs before being added for competitive binding to the immobilized wtERE. This competition strategy provided a successful platform to evaluate the binding affinity variation among large number of ERE with different base mutations. The experimental result correlates well with the mathematically predicted binding energy with a Spearman correlation coefficient of 0.97.

  19. 3'-terminal sequence of a small round structured virus (SRSV) in Japan.

    PubMed

    Utagawa, E T; Takeda, N; Inouye, S; Kasuga, K; Yamazaki, S

    1994-01-01

    We determined the nucleotide sequence of about 1,000 bases from the 3'-terminus of a small round structured virus (SRSV), which caused a gastroenteritis outbreak in Chiba Prefecture, Japan, in 1987. The sequence was compared with the corresponding sequence region of Norwalk virus; it consisted of a part of the open reading frame 2 (ORF2), whole ORF3, and 3'-noncoding region (NCR). The 624-base-long ORF3 had sequence homology of 68% with the corresponding region of Norwalk virus. (The amino acid sequence homology was 74%.) The 94-base-long NCR had 65% homology with Norwalk virus. We then selected two consensus-sequence portions in the above sequence between Chiba and Norwalk viruses for primers in the reverse transcriptase-polymerase chain reaction (RT-PCR). Using this primer set, we detected 669-bp bands in agarose gel electrophoresis of RT-PCR products from feces containing Chiba or Norwalk viruses. Furthermore, in Southern hybridization with Chiba probes which were labeled with digoxigenin-dUTP in PCR, the bands of the two viruses were clearly stained under a low stringency condition. Since both Chiba and Norwalk viruses were detected by the above primer set although they are geographically and chronologically different viruses, our primer-pair may be useful for detection of a broad range of SRSVs which cause gastroenteritis in different areas.

  20. Molecular phylogeny and SNP variation of polar bears (Ursus maritimus), brown bears (U. arctos), and black bears (U. americanus) derived from genome sequences.

    PubMed

    Cronin, Matthew A; Rincon, Gonzalo; Meredith, Robert W; MacNeil, Michael D; Islas-Trejo, Alma; Cánovas, Angela; Medrano, Juan F

    2014-01-01

    We assessed the relationships of polar bears (Ursus maritimus), brown bears (U. arctos), and black bears (U. americanus) with high throughput genomic sequencing data with an average coverage of 25× for each species. A total of 1.4 billion 100-bp paired-end reads were assembled using the polar bear and annotated giant panda (Ailuropoda melanoleuca) genome sequences as references. We identified 13.8 million single nucleotide polymorphisms (SNP) in the 3 species aligned to the polar bear genome. These data indicate that polar bears and brown bears share more SNP with each other than either does with black bears. Concatenation and coalescence-based analysis of consensus sequences of approximately 1 million base pairs of ultraconserved elements in the nuclear genome resulted in a phylogeny with black bears as the sister group to brown and polar bears, and all brown bears are in a separate clade from polar bears. Genotypes for 162 SNP loci of 336 bears from Alaska and Montana showed that the species are genetically differentiated and there is geographic population structure of brown and black bears but not polar bears.

  1. Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis.

    PubMed

    Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T

    2000-05-01

    A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.

  2. [A family of short retroposons (Squaml) from squamate reptiles (Reptilia: Squamata): structure, evolution and correlation with phylogeny].

    PubMed

    Kosushkin, S A; Borodulina, O R; Solov'eva, E N; Grechko, V V

    2008-01-01

    We have isolated and characterised sequences of a SINE family specific for squamate reptiles from a genome of lacertid lizard that we called Squam1. Copies are 360-390 bp in length and share a significant similarity with tRNA gene sequence on its 5'-end. This family was also detected by us in DNA of representatives of varanids, iguanids (anolis), gekkonids, and snakes. No signs of it were found in DNA of mammals, birds, amphibians, and crocodiles. Detailed analysis of primary structure of the retroposons obtained by us from genomic libraries or GenBank sequences was carried out. Most taxa possess 2-3 subfamilies of the SINE in their genomes with specific diagnostic features in their primary structure. Individual variability of copies in different families is about 85% and is just slightly lower on the genera level. Comparison of consensus sequences on family level reveals a high degree of structural similarity with a number of specific apomorphic features which makes it a useful marker of phylogeny for this group of reptiles. Snakes do not show specific affinity to varanids when compared to other lizards, as it was suggested earlier.

  3. Home blood pressure monitoring. Current knowledge and directions for future research.

    PubMed

    Reims, H; Fossum, E; Kjeldsen, S E; Julius, S

    2001-01-01

    Home blood pressure (BP) monitoring has become popular in clinical practice and several automated devices for home BP measurement are now recommendable. Home BP is generally lower than clinic BP, and similar to daytime ambulatory BP. Home BP measurement eliminates the white coat effect and provides a high number of readings, and it is considered more accurate and reproducible than clinic BP. It can improve the sensitivity and statistical power of clinical drug trials and may have a higher prognostic value than clinic BP. Home monitoring may improve compliance and BP control, and reduce costs of hypertension management. Diagnostic thresholds and treatment target values for home BP remain to be established by longitudinal studies. Until then, home BP monitoring is to be considered a supplement. However, high home BP may support or confirm the diagnosis made in the doctor's office, and low home BP may warrant ambulatory BP monitoring. During long-term follow-up, home BP monitoring provides an opportunity for close attention to BP levels and variations. The first international guidelines have established a consensus document with recommendations, including a proposal of preliminary diagnostic thresholds, but further research is needed to define the precise role of home BP monitoring in clinical practice.

  4. Complete mitochondrial genome of the whiter-spotted flower chafer, Protaetia brevitarsis (Coleoptera: Scarabaeidae).

    PubMed

    Kim, Min Jee; Im, Hyun Hwak; Lee, Kwang Youll; Han, Yeon Soo; Kim, Iksoo

    2014-06-01

    Abstract The complete nucleotide sequences of the mitochondrial genome from the whiter-spotted flower chafer, Protaetia brevitarsis (Coleoptera: Scarabaeidae), was determined. The 20,319-bp long circular genome is the longest among completely sequenced Coleoptera. As is typical in animals, the P. brevitarsis genome consisted of two ribosomal RNAs, 22 transfer RNAs, 13 protein-coding genes and one A + T-rich region. Although the size of the coding genes was typical, the non-coding A + T-rich region was 5654 bp, which is the longest in insects. The extraordinary length of this region was composed of 28,117-bp tandem repeats and 782-bp tandem repeats. These repeat sequences were encompassed by three non-repeat sequences constituting 1804 bp.

  5. Comparison of MY09/11 consensus PCR and type-specific PCRs in the detection of oncogenic HPV types.

    PubMed

    Depuydt, C E; Boulet, G A V; Horvath, C A J; Benoy, I H; Vereecken, A J; Bogers, J J

    2007-01-01

    The causal relationship between persistent infection with high-risk HPV and cervical cancer has resulted in the development of HPV DNA detection systems. The widely used MY09/11 consensus PCR targets a 450bp conserved sequence in the HPV L1 gene, and can therefore amplify a broad spectrum of HPV types. However, limitations of these consensus primers are evident, particularly in regard to the variability in detection sensitivity among different HPV types. This study compared MY09/11 PCR with type-specific PCRs in the detection of oncogenic HPV types. The study population comprised 15, 774 patients. Consensus PCR failed to detect 522 (10.9%) HPV infections indicated by type-specific PCRs. A significant correlation between failure of consensus PCR and HPV type was found. HPV types 51, 68 and 45 were missed most frequently. The clinical relevance of the HPV infections missed by MY09/11 PCR was reflected in the fraction of cases with cytological abnormalities and in follow-up, showing 104 (25.4%) CIN2+ cases. The MY09/11 false negativity could be the result of poor sensitivity, mismatch of MY09/11 primers or disruption of L1 target by HPV integration or DNA degradation. Furthermore, MY09/11 PCR lacked specificity for oncogenic HPVs. Diagnostic accuracy of the PCR systems, in terms of sensitivity (MY09/11 PCR: 87.9%; type-specific PCRs: 98.3%) and specificity (MY09/11 PCR: 38.7%; type-specific PCRs: 76.14%), and predictive values for histologically confirmed CIN2+, suggest that type-specific PCRs could be used in a clinical setting as a reliable screening tool.

  6. Genetic diversity and population history of the red panda (Ailurus fulgens) as inferred from mitochondrial DNA sequence variations.

    PubMed

    Su, B; Fu, Y; Wang, Y; Jin, L; Chakraborty, R

    2001-06-01

    The red panda (Ailurus fulgens) is one of the flagship species in worldwide conservation and is of special interest in evolutionary studies due to its taxonomic uniqueness. We sequenced a 236-bp fragment of the mitochondrial D-loop region in a sample of 53 red pandas from two populations in southwestern China. Seventeen polymorphic sites were found, together with a total of 25 haplotypes, indicating a high level of genetic diversity in the red panda. However, no obvious genetic divergence was detected between the Sichuan and Yunnan populations. The consensus phylogenetic tree of the 25 haplotypes was starlike. The pairwise mismatch distribution fitted into a pattern of populations undergoing expansion. Furthermore, Fu's F(S) test of neutrality was significant for the total population (F(S) = -7.573), which also suggests a recent population expansion. Interestingly, the effective population size in the Sichuan population was both larger and more stable than that in the Yunnan population, implying a southward expansion from Sichuan to Yunnan.

  7. BCL2 oncogene translocation is mediated by a chi-like consensus

    PubMed Central

    1992-01-01

    Examination of 64 translocations involving the major breakpoint region (mbr) of the BCL2 oncogene and the immunoglobulin heavy chain locus identified three short (14, 16, and 18 bp) segments within the mbr at which translocations occurred with very high frequency. Each of these clusters was associated with a 15-bp region of sequence homology, the principal one containing an octamer related to chi, the procaryotic activator of recombination. The presence of short deletions and N nucleotide additions at the breakpoints, as well as involvement of JH and DH coding regions, suggested that these sequences served as signals capable of interacting with the VDJ recombinase complex, even though no homology with the traditional heptamer/spacer/nonamer (IgRSS) existed. Furthermore, the BCL2 signal sequences were employed in a bidirectional fashion and could mediate recombination of one mbr region with another. Segments homologous to the BCL2 signal sequences flanked individual members of the XP family of diversity gene segments, which were themselves highly overrepresented in the reciprocal products (18q-) of BCL2 translocation. We propose that the chi-like signal sequences of BCL2 represent a distinct class of recognition sites for the recombinase complex, responsible for initiating interactions between regions of DNA separated by great distances, and that BCL2 translocation begins by a recombination event between mbr and DXP chi signals. Since recombinant joints containing chi, not IgRSS, occur in brain cells expressing RAG-1 (Matsuoka, M., F. Nagawa, K. Okazaki, L. Kingsbury, K. Yoshida, U. Muller, D. T. Larue, J. A. Winer, and H. Sakano. 1991. Science [Wash. DC]. 254:81; reference 1), we further suggest that the product of this gene could mediate both BCL2 translocation and the first step of normal DJ assembly through the creation of chi joints, rather than signal or coding joints. PMID:1588282

  8. Population-genomic variation within RNA viruses of the Western honey bee, Apis mellifera, inferred from deep sequencing

    PubMed Central

    2013-01-01

    Background Deep sequencing of viruses isolated from infected hosts is an efficient way to measure population-genetic variation and can reveal patterns of dispersal and natural selection. In this study, we mined existing Illumina sequence reads to investigate single-nucleotide polymorphisms (SNPs) within two RNA viruses of the Western honey bee (Apis mellifera), deformed wing virus (DWV) and Israel acute paralysis virus (IAPV). All viral RNA was extracted from North American samples of honey bees or, in one case, the ectoparasitic mite Varroa destructor. Results Coverage depth was generally lower for IAPV than DWV, and marked gaps in coverage occurred in several narrow regions (< 50 bp) of IAPV. These coverage gaps occurred across sequencing runs and were virtually unchanged when reads were re-mapped with greater permissiveness (up to 8% divergence), suggesting a recurrent sequencing artifact rather than strain divergence. Consensus sequences of DWV for each sample showed little phylogenetic divergence, low nucleotide diversity, and strongly negative values of Fu and Li’s D statistic, suggesting a recent population bottleneck and/or purifying selection. The Kakugo strain of DWV fell outside of all other DWV sequences at 100% bootstrap support. IAPV consensus sequences supported the existence of multiple clades as had been previously reported, and Fu and Li’s D was closer to neutral expectation overall, although a sliding-window analysis identified a significantly positive D within the protease region, suggesting selection maintains diversity in that region. Within-sample mean diversity was comparable between the two viruses on average, although for both viruses there was substantial variation among samples in mean diversity at third codon positions and in the number of high-diversity sites. FST values were bimodal for DWV, likely reflecting neutral divergence in two low-diversity populations, whereas IAPV had several sites that were strong outliers with very low FST. Conclusions This initial survey of genetic variation within honey bee RNA viruses suggests future directions for studies examining the underlying causes of population-genetic structure in these economically important pathogens. PMID:23497218

  9. Population-genomic variation within RNA viruses of the Western honey bee, Apis mellifera, inferred from deep sequencing.

    PubMed

    Cornman, Robert Scott; Boncristiani, Humberto; Dainat, Benjamin; Chen, Yanping; vanEngelsdorp, Dennis; Weaver, Daniel; Evans, Jay D

    2013-03-07

    Deep sequencing of viruses isolated from infected hosts is an efficient way to measure population-genetic variation and can reveal patterns of dispersal and natural selection. In this study, we mined existing Illumina sequence reads to investigate single-nucleotide polymorphisms (SNPs) within two RNA viruses of the Western honey bee (Apis mellifera), deformed wing virus (DWV) and Israel acute paralysis virus (IAPV). All viral RNA was extracted from North American samples of honey bees or, in one case, the ectoparasitic mite Varroa destructor. Coverage depth was generally lower for IAPV than DWV, and marked gaps in coverage occurred in several narrow regions (< 50 bp) of IAPV. These coverage gaps occurred across sequencing runs and were virtually unchanged when reads were re-mapped with greater permissiveness (up to 8% divergence), suggesting a recurrent sequencing artifact rather than strain divergence. Consensus sequences of DWV for each sample showed little phylogenetic divergence, low nucleotide diversity, and strongly negative values of Fu and Li's D statistic, suggesting a recent population bottleneck and/or purifying selection. The Kakugo strain of DWV fell outside of all other DWV sequences at 100% bootstrap support. IAPV consensus sequences supported the existence of multiple clades as had been previously reported, and Fu and Li's D was closer to neutral expectation overall, although a sliding-window analysis identified a significantly positive D within the protease region, suggesting selection maintains diversity in that region. Within-sample mean diversity was comparable between the two viruses on average, although for both viruses there was substantial variation among samples in mean diversity at third codon positions and in the number of high-diversity sites. FST values were bimodal for DWV, likely reflecting neutral divergence in two low-diversity populations, whereas IAPV had several sites that were strong outliers with very low FST. This initial survey of genetic variation within honey bee RNA viruses suggests future directions for studies examining the underlying causes of population-genetic structure in these economically important pathogens.

  10. Research on wind field algorithm of wind lidar based on BP neural network and grey prediction

    NASA Astrophysics Data System (ADS)

    Chen, Yong; Chen, Chun-Li; Luo, Xiong; Zhang, Yan; Yang, Ze-hou; Zhou, Jie; Shi, Xiao-ding; Wang, Lei

    2018-01-01

    This paper uses the BP neural network and grey algorithm to forecast and study radar wind field. In order to reduce the residual error in the wind field prediction which uses BP neural network and grey algorithm, calculating the minimum value of residual error function, adopting the residuals of the gray algorithm trained by BP neural network, using the trained network model to forecast the residual sequence, using the predicted residual error sequence to modify the forecast sequence of the grey algorithm. The test data show that using the grey algorithm modified by BP neural network can effectively reduce the residual value and improve the prediction precision.

  11. Blood Pressure Response to Exercise and Cardiovascular Disease.

    PubMed

    Schultz, Martin G; La Gerche, Andre; Sharman, James E

    2017-10-18

    This review aimed to provide a clinical update on exercise blood pressure (BP) and its relationship to cardiovascular disease (CVD), outlining key determinants of abnormal exercise BP responses. We also highlight current evidence gaps that need addressing in order to optimise the relevance of exercise BP as clinical CVD risk factor. Abnormal exercise BP manifests as either exercise hypotension (low BP response) or as exaggerated exercise BP (high BP response). Exercise hypotension is an established sign of existing and likely severe CVD, but exaggerated exercise BP also carries elevated CVD risk due to its association with sub-clinical hypertension. Although exaggerated exercise BP is related to heightened CVD risk at any exercise intensity, recent data suggest that the BP response to submaximal intensity exercise holds greater prognostic and clinical significance than BP achieved at peak/maximal intensity exercise. Cardiorespiratory fitness is a strong modifier of the exercise BP response, and should be taken into consideration when assessing the association with CVD. Both exercise hypotension and exaggerated exercise BP serve as markers that should prompt evaluation for potential underlying CVD. However, the clinical utility of these markers is currently inhibited by the lack of consensus informing the definitions and thresholds for abnormalities in exercise BP.

  12. Complete mitochondrial genome of the larch hawk moth, Sphinx morio (Lepidoptera: Sphingidae).

    PubMed

    Kim, Min Jee; Choi, Sei-Woong; Kim, Iksoo

    2013-12-01

    The larch hawk moth, Sphinx morio, belongs to the lepidopteran family Sphingidae that has long been studied as a family of model insects in a diverse field. In this study, we describe the complete mitochondrial genome (mitogenome) sequences of the species in terms of general genomic features and characteristic short repetitive sequences found in the A + T-rich region. The 15,299-bp-long genome consisted of a typical set of genes (13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes) and one major non-coding A + T-rich region, with the typical arrangement found in Lepidoptera. The 316-bp-long A + T-rich region located between srRNA and tRNA(Met) harbored the conserved sequence blocks that are typically found in lepidopteran insects. Additionally, the A + T-rich region of S. morio contained three characteristic repeat sequences that are rarely found in Lepidoptera: two identical 12-bp repeat, three identical 5-bp-long tandem repeat, and six nearly identical 5-6 bp long repeat sequences.

  13. Consensus statement on the definition of neurogenic supine hypertension in cardiovascular autonomic failure by the American Autonomic Society (AAS) and the European Federation of Autonomic Societies (EFAS) : Endorsed by the European Academy of Neurology (EAN) and the European Society of Hypertension (ESH).

    PubMed

    Fanciulli, Alessandra; Jordan, Jens; Biaggioni, Italo; Calandra-Buonaura, Giovanna; Cheshire, William P; Cortelli, Pietro; Eschlboeck, Sabine; Grassi, Guido; Hilz, Max J; Kaufmann, Horacio; Lahrmann, Heinz; Mancia, Giuseppe; Mayer, Gert; Norcliffe-Kaufmann, Lucy; Pavy-Le Traon, Anne; Raj, Satish R; Robertson, David; Rocha, Isabel; Struhal, Walter; Thijs, Roland; Tsioufis, Konstantinos P; van Dijk, J Gert; Wenning, Gregor K

    2018-05-15

    Patients suffering from cardiovascular autonomic failure often develop neurogenic supine hypertension (nSH), i.e., high blood pressure (BP) in the supine position, which falls in the upright position owing to impaired autonomic regulation. A committee was formed to reach consensus among experts on the definition and diagnosis of nSH in the context of cardiovascular autonomic failure. As a first and preparatory step, a systematic search of PubMed-indexed literature on nSH up to January 2017 was performed. Available evidence derived from this search was discussed in a consensus expert round table meeting in Innsbruck on February 16, 2017. Statements originating from this meeting were further discussed by representatives of the American Autonomic Society and the European Federation of Autonomic Societies and are summarized in the document presented here. The final version received the endorsement of the European Academy of Neurology and the European Society of Hypertension. In patients with neurogenic orthostatic hypotension, nSH is defined as systolic BP ≥ 140 mmHg and/or diastolic BP ≥ 90 mmHg, measured after at least 5 min of rest in the supine position. Three severity degrees are recommended: mild, moderate and severe. nSH may also be present during nocturnal sleep, with reduced-dipping, non-dipping or rising nocturnal BP profiles with respect to mean daytime BP values. Home BP monitoring and 24-h-ambulatory BP monitoring provide relevant information for a customized clinical management. The establishment of expert-based criteria to define nSH should standardize diagnosis and allow a better understanding of its epidemiology, prognosis and, ultimately, treatment.

  14. [Discussion on the botanical origin of Isatidis radix and Isatidis folium based on DNA barcoding].

    PubMed

    Sun, Zhi-Ying; Pang, Xiao-Hui

    2013-12-01

    This paper aimed to investigate the botanical origins of Isatidis Radix and Isatidis Folium, and clarify the confusion of its classification. The second internal transcribed spacer (ITS2) of ribosomal DNA, the chloroplast matK gene of 22 samples from some major production areas were amplified and sequenced. Sequence assembly and consensus sequence generation were performed using the CodonCode Aligner. Phylogenetic study was performed using MEGA 4.0 software in accordance with the Kimura 2-Parameter (K2P) model, and the phylogenetic tree was constructed using the neighbor-joining methods. The results showed that the length of ITS2 sequence of the botanical origins of Isatidis Radix and Isatidis Folium was 191 bp. The sequence showed that some samples had several SNP sites, and some samples had heterozygosis sites. In the NJ tree, based on ITS2 sequence, the studied samples were separated into two groups, and one of them was gathered with Isatis tinctoria L. The studied samples also were divided into two groups obviously based on the chloroplast matK gene. In conclusion, our results support that the botanical origins of Isatidis Radix and Isatidis Folium are Isatis indigotica Fortune, and Isatis indigotica and Isatis tinctoria are two distinct species. This study doesn't support the opinion about the combination of these two species in Flora of China.

  15. The partial sequence of RNA 1 of the ophiovirus Ranunculus white mottle virus indicates its relationship to rhabdoviruses and provides candidate primers for an ophiovirus-specific RT-PCR test.

    PubMed

    Vaira, A M; Accotto, G P; Costantini, A; Milne, R G

    2003-06-01

    A 4018 nucleotide sequence was obtained for RNA 1 of Ranunculus white mottle virus (RWMV), genus Ophiovirus, representing an incomplete ORF of 1339 aa. Amino acid sequence analysis revealed significant similarities with RNA polymerases of viruses in the family Rhabdoviridae and a conserved domain of 685 aa, corresponding to the RdRp domain of those in the order Mononegavirales. Phylogenetic analysis indicated that the genus Ophiovirus is not related to the genus Tenuivirus or the family Bunyaviridae, with which it has been linked, and probably deserves a special taxonomic position, within a new family. A pair of degenerate primers was designed from a consensus sequence obtained from a relatively conserved region in the RNA 1 of two members of the genus, Citrus psorosis virus (CPsV) and RWMV. The primers, used in RT-PCR experiments, amplified a 136 bp DNA fragment from all the three recognized members of the genus, i.e. CPsV, RWMV and Tulip mild mottle mosaic virus (TMMMV) and from two tentative ophioviruses from lettuce and freesia. The amplified DNAs were sequenced and compared with the corresponding sequences of CPsV and RWMV and phylogenetic relationships were evaluated. Assays using extracts from plants infected by viruses belonging to the genera Tospovirus, Tenuivirus, Rhabdovirus and Varicosavirus indicated that the primers are genus-specific.

  16. [Molecular identification of astragali radix and its adulterants by ITS sequences].

    PubMed

    Cui, Zhan-Hu; Li, Yue; Yuan, Qing-Jun; Zhou, Li-She; Li, Min-Hui

    2012-12-01

    To explore a new method for identification Astragali Radix from its adulterants by using ITS sequence. Thirteen samples of the different Astragali Radix materials and 6 samples of the adulterants of the roots of Hedysarum polybotrys, Medicago sativa and Althaea rosea were collected. ITS sequence was amplified by PCR and sequenced unidirectionally. The interspecific K-2-P distances of Astragali Radix and its adulterants were calculated, and NJ tree and UPGMA tree were constructed by MEGA 4. ITS sequences were obtained from 19 samples respectively, there were Astragali Radix 646-650 bp, H. polybotrys 664 bp, Medicago sativa 659 bp, Althaea rosea 728 bp, which were registered in the GenBank. Phylogeny trees reconstruction using NJ and UPGMA analysis based on ITS nucleotide sequences can effectively distinguish Astragali Radix from adulterants. ITS sequence can be used to identify Astragali Radix from its adulterants successfully and is an efficient molecular marker for authentication of Astragali Radix and its adulterants.

  17. The complete mitochondrial genome sequence of Malus hupehensis var. pinyiensis.

    PubMed

    Duan, Naibin; Sun, Honghe; Wang, Nan; Fei, Zhangjun; Chen, Xuesen

    2016-07-01

    The complete mitochondrial genome sequence of Malus hupehensis var. pinyiensis, a widely used apple rootstock, was determined using the Illumina high-throughput sequencing approach. The genome is 422,555 bp in length and has a GC content of 45.21%. It is separated by a pair of inverted repeats of 32,504 bp, to form a large single copy region of 213,055 bp and a small single copy region of 144,492 bp. The genome contains 38 protein-coding genes, four pseudogenes, 25 tRNA genes, and three rRNA genes. The genome is 25,608 bp longer than that of M. domestica, and several structural variations between these two mitogenomes were detected.

  18. Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

    PubMed

    Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

    2007-04-10

    To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

  19. Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

    PubMed Central

    Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

    2010-01-01

    Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

  20. Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

    PubMed

    Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

    2010-04-01

    Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

  1. A Ribeiroia spp. (Class: Trematoda) - Specific PCR-based diagnostic

    USGS Publications Warehouse

    Reinitz, David M.; Yoshino, T.P.; Cole, Rebecca A.

    2007-01-01

    Increased reporting of amphibian malformations in North America has been noted with concern in light of reports that amphibian numbers and species are declining worldwide. Ribeiroia ondatrae has been shown to cause a variety of types of malformations in amphibians. However, little is known about the prevalence of R. ondatrae in North America. To aid in conducting field studies of Ribeiroia spp., we have developed a polymerase chain reaction (PCR)-based diagnostic. Herein, we describe the development of an accurate, rapid, simple, and cost-effective diagnostic for detection of Ribeiroia spp. infection in snails (Planorbella trivolvis). Candidate oligonucleotide primers for PCR were designed via DNA sequence analyses of multiple ribosomal internal transcribed spacer-2 regions from Ribeiroia spp. and Echinostoma spp. Comparison of consensus sequences determined from both genera identified areas of sequence potentially unique to Ribeiroia spp. The PCR reliably produced a diagnostic 290-base pair (bp) product in the presence of a wide concentration range of snail or frog DNA. Sensitivity was examined with DNA extracted from single R. ondatrae cercaria. The single-tube PCR could routinely detect less than 1 cercariae equivalent, because DNA isolated from a single cercaria could be diluted at least 1:50 and still yield a positive result via gel electrophoresis. An even more sensitive nested PCR also was developed that routinely detected 100 fg of the 290-bp fragment. The assay did not detect furcocercous cercariae of certain Schistosomatidae, Echinostoma sp., or Sphaeridiotrema globulus nor adults of Clinostomum sp. or Cyathocotyle bushiensis. Field testing of 137 P. trivolvis identified 3 positives with no overt environmental cross-reactivity, and results concurred with microscopic examinations in all cases. ?? American Society of Parasitologists 2007.

  2. Comparison of Two Capillary Gel Electrophoresis Systems for Clostridium difficile Ribotyping, Using a Panel of Ribotype 027 Isolates and Whole-Genome Sequences as a Reference Standard

    PubMed Central

    Xiao, Meng; Kong, Fanrong; Jin, Ping; Wang, Qinning; Xiao, Kelin; Jeoffreys, Neisha; James, Gregory

    2012-01-01

    PCR ribotyping is the most commonly used Clostridium difficile genotyping method, but its utility is limited by lack of standardization. In this study, we analyzed four published whole genomes and tested an international collection of 21 well-characterized C. difficile ribotype 027 isolates as the basis for comparison of two capillary gel electrophoresis (CGE)-based ribotyping methods. There were unexpected differences between the 16S-23S rRNA intergenic spacer region (ISR) allelic profiles of the four ribotype 027 genomes, but six bands were identified in all four and a seventh in three genomes. All seven bands and another, not identified in any of the whole genomes, were found in all 21 isolates. We compared sequencer-based CGE (SCGE) with three different primer pairs to the Qiagen QIAxcel CGE (QCGE) platform. Deviations from individual reference/consensus band sizes were smaller for SCGE (0 to 0.2 bp) than for QCGE (4.2 to 9.5 bp). Compared with QCGE, SCGE more readily distinguished bands of similar length (more discriminatory), detected bands of larger size and lower intensity (more sensitive), and assigned band sizes more accurately and reproducibly, making it more suitable for standardization. Specifically, QCGE failed to identify the largest ISR amplicon. Based on several criteria, we recommend the primer set 16S-USA/23S-USA for use in a proposed standard SCGE method. Similar differences between SCGE and QCGE were found on testing of 14 isolates of four other C. difficile ribotypes. Based on our results, ISR profiles based on accurate sequencer-based band lengths would be preferable to agarose gel-based banding patterns for the assignment of ribotypes. PMID:22692737

  3. Identification of a cis-regulatory region of a gene in Arabidopsis thaliana whose induction by dehydration is mediated by abscisic acid and requires protein synthesis.

    PubMed

    Iwasaki, T; Yamaguchi-Shinozaki, K; Shinozaki, K

    1995-05-20

    In Arabidopsis thaliana, the induction of a dehydration-responsive gene, rd22, is mediated by abscisic acid (ABA) but the gene does not include any sequence corresponding to the consensus ABA-responsive element (ABRE), RYACGTGGYR, in its promoter region. The cis-regulatory region of the rd22 promoter was identified by monitoring the expression of beta-glucuronidase (GUS) activity in leaves of transgenic tobacco plants transformed with chimeric gene fusions constructed between 5'-deleted promoters of rd22 and the coding region of the GUS reporter gene. A 67-bp nucleotide fragment corresponding to positions -207 to -141 of the rd22 promoter conferred responsiveness to dehydration and ABA on a non-responsive promoter. The 67-bp fragment contains the sequences of the recognition sites for some transcription factors, such as MYC, MYB, and GT-1. The fact that accumulation of rd22 mRNA requires protein synthesis raises the possibility that the expression of rd22 might be regulated by one of these trans-acting protein factors whose de novo synthesis is induced by dehydration or ABA. Although the structure of the RD22 protein is very similar to that of a non-storage seed protein, USP, of Vicia faba, the expression of the GUS gene driven by the rd22 promoter in non-stressed transgenic Arabidopsis plants was found mainly in flowers and bolted stems rather than in seeds.

  4. Identification and characterization of tandem repeats in exon III of dopamine receptor D4 (DRD4) genes from different mammalian species.

    PubMed

    Larsen, Svend Arild; Mogensen, Line; Dietz, Rune; Baagøe, Hans Jørgen; Andersen, Mogens; Werge, Thomas; Rasmussen, Henrik Berg

    2005-12-01

    In this study we have identified and characterized dopamine receptor D4 (DRD4) exon III tandem repeats in 33 public available nucleotide sequences from different mammalian species. We found that the tandem repeat in canids could be described in a novel and simple way, namely, as a structure composed of 15- and 12- bp modules. Tandem repeats composed of 18-bp modules were found in sequences from the horse, zebra, onager, and donkey, Asiatic bear, polar bear, common raccoon, dolphin, harbor porpoise, and domestic cat. Several of these sequences have been analyzed previously without a tandem repeat being found. In the domestic cow and gray seal we identified tandem repeats composed of 36-bp modules, each consisting of two closely related 18-bp basic units. A tandem repeat consisting of 9-bp modules was identified in sequences from mink and ferret. In the European otter we detected an 18-bp tandem repeat, while a tandem repeat consisting of 27-bp modules was identified in a sequence from European badger. Both these tandem repeats were composed of 9-bp basic units, which were closely related with the 9-bp repeat modules identified in the mink and ferret. Tandem repeats could not be identified in sequences from rodents. All tandem repeats possessed a high GC content with a strong bias for C. On phylogenetic analysis of the tandem repeats evolutionary related species were clustered into the same groups. The degree of conservation of the tandem repeats varied significantly between species. The deduced amino acid sequences of most of the tandem repeats exhibited a high propensity for disorder. This was also the case with an amino acid sequence of the human DRD4 exon III tandem repeat, which was included in the study for comparative purposes. We identified proline-containing motifs for SH3 and WW domain binding proteins, potential phosphorylation sites, PDZ domain binding motifs, and FHA domain binding motifs in the amino acid sequences of the tandem repeats. The numbers of potential functional sites varied pronouncedly between species. Our observations provide a platform for future studies of the architecture and evolution of the DRD4 exon III tandem repeat, and they suggest that differences in the structure of this tandem repeat contribute to specialization and generation of diversity in receptor function.

  5. Identification of Simple Sequence Repeats in Chloroplast Genomes of Magnoliids Through Bioinformatics Approach.

    PubMed

    Srivastava, Deepika; Shanker, Asheesh

    2016-12-01

    Basal angiosperms or Magnoliids is an important clade of commercially important plants which mainly include spices and edible fruits. In this study, 17 chloroplast genome sequences belonging to clade Magnoliids were screened for the identification of chloroplast simple sequence repeats (cpSSRs). Simple sequence repeats or microsatellites are short stretches of DNA up to 1-6 base pair in length. These repeats are ubiquitous and play important role in the development of molecular markers and to study the mapping of traits of economic, medical or ecological interest. A total of 479 SSRs were detected, showing average density of 1 SSR/6.91 kb. Depending on the repeat units, the length of SSRs ranged from 12 to 24 bp for mono-, 12 to 18 bp for di-, 12 to 26 bp for tri-, 12 to 24 bp for tetra-, 15 bp for penta- and 18 bp for hexanucleotide repeats. Mononucleotide repeats were the most frequent (207, 43.21 %) followed by tetranucleotide repeats (130, 27.13 %). Penta- and hexanucleotide repeats were least frequent or absent in these chloroplast genomes.

  6. Site directed recombination

    DOEpatents

    Jurka, Jerzy W.

    1997-01-01

    Enhanced homologous recombination is obtained by employing a consensus sequence which has been found to be associated with integration of repeat sequences, such as Alu and ID. The consensus sequence or sequence having a single transition mutation determines one site of a double break which allows for high efficiency of integration at the site. By introducing single or double stranded DNA having the consensus sequence flanking region joined to a sequence of interest, one can reproducibly direct integration of the sequence of interest at one or a limited number of sites. In this way, specific sites can be identified and homologous recombination achieved at the site by employing a second flanking sequence associated with a sequence proximal to the 3'-nick.

  7. Transcriptome sequencing for high throughput SNP development and genetic mapping in Pea

    PubMed Central

    2014-01-01

    Background Pea has a complex genome of 4.3 Gb for which only limited genomic resources are available to date. Although SNP markers are now highly valuable for research and modern breeding, only a few are described and used in pea for genetic diversity and linkage analysis. Results We developed a large resource by cDNA sequencing of 8 genotypes representative of modern breeding material using the Roche 454 technology, combining both long reads (400 bp) and high coverage (3.8 million reads, reaching a total of 1,369 megabases). Sequencing data were assembled and generated a 68 K unigene set, from which 41 K were annotated from their best blast hit against the model species Medicago truncatula. Annotated contigs showed an even distribution along M. truncatula pseudochromosomes, suggesting a good representation of the pea genome. 10 K pea contigs were found to be polymorphic among the genetic material surveyed, corresponding to 35 K SNPs. We validated a subset of 1538 SNPs through the GoldenGate assay, proving their ability to structure a diversity panel of breeding germplasm. Among them, 1340 were genetically mapped and used to build a new consensus map comprising a total of 2070 markers. Based on blast analysis, we could establish 1252 bridges between our pea consensus map and the pseudochromosomes of M. truncatula, which provides new insight on synteny between the two species. Conclusions Our approach created significant new resources in pea, i.e. the most comprehensive genetic map to date tightly linked to the model species M. truncatula and a large SNP resource for both academic research and breeding. PMID:24521263

  8. A novel thermophilic and halophilic esterase from Janibacter sp. R02, the first member of a new lipase family (Family XVII).

    PubMed

    Castilla, Agustín; Panizza, Paola; Rodríguez, Diego; Bonino, Luis; Díaz, Pilar; Irazoqui, Gabriela; Rodríguez Giordano, Sonia

    2017-03-01

    Janibacter sp. strain R02 (BNM 560) was isolated in our laboratory from an Antarctic soil sample. A remarkable trait of the strain was its high lipolytic activity, detected in Rhodamine-olive oil supplemented plates. Supernatants of Janibacter sp. R02 displayed superb activity on transesterification of acyl glycerols, thus being a good candidate for lipase prospection. Considering the lack of information concerning lipases of the genus Janibacter, we focused on the identification, cloning, expression and characterization of the extracellular lipases of this strain. By means of sequence alignment and clustering of consensus nucleotide sequences, a DNA fragment of 1272bp was amplified, cloned and expressed in E. coli. The resulting recombinant enzyme, named LipJ2, showed preference for short to medium chain-length substrates, and displayed maximum activity at 80°C and pH 8-9, being strongly activated by a mixture of Na + and K + . The enzyme presented an outstanding stability regarding both pH and temperature. Bioinformatics analysis of the amino acid sequence of LipJ2 revealed the presence of a consensus catalytic triad and a canonical pentapeptide. However, two additional rare motifs were found in LipJ2: an SXXL β-lactamase motif and two putative Y-type oxyanion holes (YAP). Although some of the previous features could allow assigning LipJ2 to the bacterial lipase families VIII or X, the phylogenetic analysis showed that LipJ2 clusters apart from other members of known lipase families, indicating that the newly isolated Janibacter esterase LipJ2 would be the first characterized member of a new family of bacterial lipases. Published by Elsevier Inc.

  9. Characterization of Cer-1 cis-regulatory region during early Xenopus development.

    PubMed

    Silva, Ana Cristina; Filipe, Mário; Steinbeisser, Herbert; Belo, José António

    2011-05-01

    Cerberus-related molecules are well-known Wnt, Nodal, and BMP inhibitors that have been implicated in different processes including anterior–posterior patterning and left–right asymmetry. In both mouse and frog, two Cerberus-related genes have been isolated, mCer-1 and mCer-2, and Xcer and Xcoco, respectively. Until now, little is known about the mechanisms involved in their transcriptional regulation. Here, we report a heterologous analysis of the mouse Cerberus-1 gene upstream regulatory regions, responsible for its expression in the visceral endodermal cells. Our analysis showed that the consensus sequences for a TATA, CAAT, or GC boxes were absent but a TGTGG sequence was present at position -172 to -168 bp, relative to the ATG. Using a series of deletion constructs and transient expression in Xenopus embryos, we found that a fragment of 1.4 kb of Cer-1 promoter sequence could reproduce the endogenous expression pattern of Xenopus cerberus. A 0.7-kb mcer-1 upstream region was able to drive reporter expression to the involuting mesendodermal cells, while further deletions abolished reporter gene expression. Our results suggest that although no sequence similarity was found between mouse and Xenopus cerberus cis-regulatory regions, the signaling cascades regulating cerberus expression, during gastrulation, is conserved.

  10. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    PubMed

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  11. In silico analysis of β-1,3-glucanase from a psychrophilic yeast, Glaciozyma antarctica PI12

    NASA Astrophysics Data System (ADS)

    Mohammadi, Salimeh; Bakar, Farah Diba Abu; Rabu, Amir; Murad, Abdul Munir Abdul

    2014-09-01

    1,3-beta-glucanase is an industrially important enzyme having wide range of applications especially in food industry. It is crucial to gain an understanding about the structure and functional aspects of various beta-1,3-glucanase produced from diverse sources. In this, study a cDNA encoding β-1,3-glucanase (GaExg55) was isolated from a psychrophilic yeast, Glaciozyma antarctica PI12. The cDNA sequence has been submitted to Genbank with an accession number (KJ436377). Subsequently, the perdition protein was analyzed using various bioinformatics tools to explore the properties of the protein. GaEXG55 is consisting of 1,440-bp nucleotides encoding 480 amino acid residues. Alignment of the deduced amino acid for GaExg55 with other exo-β-1,3-glucanase available at the NCBI database indicate that deduced amino acids shared a consensus motif NEP, which is signature pattern of GH5 hydrolases. Predicted molecular weight of GaExg55 is 53.66 kDa. GaExg55 sequences possesses signal peptide sequence and it is highly conserved with other fungal exo-beta-1,3 glucanase.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sekiyama, Naotaka; Arthanari, Haribabu; Papadopoulos, Evangelos

    The eIF4E-binding protein (4E-BP) is a phosphorylation-dependent regulator of protein synthesis. The nonphosphorylated or minimally phosphorylated form binds translation initiation factor 4E (eIF4E), preventing binding of eIF4G and the recruitment of the small ribosomal subunit. Signaling events stimulate serial phosphorylation of 4E-BP, primarily by mammalian target of rapamycin complex 1 (mTORC1) at residues T 37/T 46, followed by T 70 and S 65. Hyperphosphorylated 4E-BP dissociates from eIF4E, allowing eIF4E to interact with eIF4G and translation initiation to resume. Because overexpression of eIF4E is linked to cellular transformation, 4E-BP is a tumor suppressor, and up-regulation of its activity is amore » goal of interest for cancer therapy. A recently discovered small molecule, eIF4E/eIF4G interaction inhibitor 1 (4EGI-1), disrupts the eIF4E/eIF4G interaction and promotes binding of 4E-BP1 to eIF4E. Structures of 14- to 16-residue 4E-BP fragments bound to eIF4E contain the eIF4E consensus binding motif, 54YXXXXLΦ 60 (motif 1) but lack known phosphorylation sites. We report in this paper a 2.1-Å crystal structure of mouse eIF4E in complex with m 7GTP and with a fragment of human 4E-BP1, extended C-terminally from the consensus-binding motif (4E-BP1 50–84). The extension, which includes a proline-turn-helix segment (motif 2) followed by a loop of irregular structure, reveals the location of two phosphorylation sites (S 65 and T 70). Our major finding is that the C-terminal extension (motif 3) is critical to 4E-BP1–mediated cell cycle arrest and that it partially overlaps with the binding site of 4EGI-1. Finally, the binding of 4E-BP1 and 4EGI-1 to eIF4E is therefore not mutually exclusive, and both ligands contribute to shift the equilibrium toward the inhibition of translation initiation.« less

  13. Definition of Cis-Acting Elements Regulating Expression of the Drosophila Melanogaster Ninae Opsin Gene by Oligonucleotide-Directed Mutagenesis

    PubMed Central

    Mismer, D.; Rubin, G. M.

    1989-01-01

    We have analyzed the cis-acting regulatory sequences of the Rh1 (ninaE) gene in Drosophila melanogaster by P-element-mediated germline transformation of indicator genes transcribed from mutant ninaE promoter sequences. We have previously shown that a 200-bp region extending from -120 to +67 relative to the transcription start site is sufficient to obtain eye-specific expression from the ninaE promoter. In the present study, 22 different 4-13-bp sequences in the -120/+67 promoter region were altered by oligonucleotide-directed mutagenesis. Several of these sequences were found to be required for proper promoter function; two of these are conserved in the promoter of the homologous gene isolated from the related species Drosophila virilis. Alteration of a conserved 9-bp sequence results in aberrant, low level expression in the body. Alteration of a separate 11-bp sequence, found in the promoter regions of several photoreceptor-specific genes of Drosophila, results in an approximately 15-fold reduction in promoter efficiency but without apparent alteration of tissue-specificity. A protein factor capable of interacting with this 11-bp sequence has been detected by DNaseI footprinting in embryonic nuclear extracts. Finally, we have further characterized two separable enhancer sequences previously shown to be required for normal levels of expression from this promoter. PMID:2521839

  14. Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

    NASA Technical Reports Server (NTRS)

    Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

    1995-01-01

    In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

  15. Second-generation sequencing of entire mitochondrial coding-regions (∼15.4 kb) holds promise for study of the phylogeny and taxonomy of human body lice and head lice.

    PubMed

    Xiong, H; Campelo, D; Pollack, R J; Raoult, D; Shao, R; Alem, M; Ali, J; Bilcha, K; Barker, S C

    2014-08-01

    The Illumina Hiseq platform was used to sequence the entire mitochondrial coding-regions of 20 body lice, Pediculus humanus Linnaeus, and head lice, P. capitis De Geer (Phthiraptera: Pediculidae), from eight towns and cities in five countries: Ethiopia, France, China, Australia and the U.S.A. These data (∼310 kb) were used to see how much more informative entire mitochondrial coding-region sequences were than partial mitochondrial coding-region sequences, and thus to guide the design of future studies of the phylogeny, origin, evolution and taxonomy of body lice and head lice. Phylogenies were compared from entire coding-region sequences (∼15.4 kb), entire cox1 (∼1.5 kb), partial cox1 (∼700 bp) and partial cytb (∼600 bp) sequences. On the one hand, phylogenies from entire mitochondrial coding-region sequences (∼15.4 kb) were much more informative than phylogenies from entire cox1 sequences (∼1.5 kb) and partial gene sequences (∼600 to ∼700 bp). For example, 19 branches had > 95% bootstrap support in our maximum likelihood tree from the entire mitochondrial coding-regions (∼15.4 kb) whereas the tree from 700 bp cox1 had only two branches with bootstrap support > 95%. Yet, by contrast, partial cytb (∼600 bp) and partial cox1 (∼486 bp) sequences were sufficient to genotype lice to Clade A, B or C. The sequences of the mitochondrial genomes of the P. humanus, P. capitis and P. schaeffi Fahrenholz studied are in NCBI GenBank under the accession numbers KC660761-800, KC685631-6330, KC241882-97, EU219988-95, HM241895-8 and JX080388-407. © 2014 The Royal Entomological Society.

  16. Sequence diversity within the HA-1 gene as detected by melting temperature assay without oligonucleotide probes

    PubMed Central

    Graziano, Claudio; Giorgi, Massimo; Malentacchi, Cecilia; Mattiuz, Pier Luigi; Porfirio, Berardino

    2005-01-01

    Background The minor histocompatibility antigens (mHags) are self-peptides derived from common cellular proteins and presented by MHC class I and II molecules. Disparities in mHags are a potential risk for the development of graft-versus-host disease (GvHD) in the recipients of bone marrow from HLA-identical donors. Two alleles have been identified in the mHag HA-1. The correlation between mismatches of the mHag HA-1 and GvHD has been suggested and methods to facilitate large-scale testing were afterwards developed. Methods We used sequence specific primer (SSP) PCR and direct sequencing to detect HA-1 gene polymorphisms in a sample of 131 unrelated Italian subjects. We then set up a novel melting temperature (Tm) assay that may help identification of HA-1 alleles without oligonucleotide probes. Results We report the frequencies of HA-1 alleles in the Italian population and the presence of an intronic 5 base-pair deletion associated with the immunogeneic allele HA-1H. We also detected novel variable sites with respect to the consensus sequence of HA-1 locus. Even though recombination/gene conversion events are documented, there is considerable linkage disequilibrium in the data. The gametic associations between HA-1R/H alleles and the intronic 5-bp ins/del polymorphism prompted us to try the Tm analysis with SYBR® Green I. We show that the addition of dimethylsulfoxide (DMSO) during the assay yields distinct patterns when amplicons from HA-1H homozygotes, HA-1R homozygotes, and heterozygotes are analysed. Conclusion The possibility to use SYBR® Green I to detect Tm differences between allelic variants is attractive but requires great caution. We succeeded in allele discrimination of the HA-1 locus using a relatively short (101 bp) amplicon, only in the presence of DMSO. We believe that, at least in certain assets, Tm assays may benefit by the addition of DMSO or other agents affecting DNA strand conformation and stability. PMID:16202172

  17. The human myelin oligodendrocyte glycoprotein (MOG) gene: Complete nucleotide sequence and structural characterization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paule Roth, M.; Malfroy, L.; Offer, C.

    1995-07-20

    Human myelin oligodendrocyte glycoprotein (MOG), a myelin component of the central nervous system, is a candidate target antigen for autoimmune-mediated demyelination. We have isolated and sequenced part of a cosmid clone that contains the entire human MOG gene. The primary nuclear transcript, extending from the putative start of transcription to the site of poly(A) addition, is 15,561 nucleotides in length. The human MOG gene contains 8 exons, separated by 7 introns; canonical intron/exon boundary sites are observed at each junction. The introns vary in size from 242 to 6484 bp and contain numerous repetitive DNA elements, including 14 Alu sequencesmore » within 3 introns. Another Alu element is located in the 3{prime}-untranslated region of the gene. Alu sequences were classified with respect to subfamily assignment. Seven hundred sixty-three nucleotides 5{prime} of the transcription start and 1214 nucleotides 3{prime} of the poly(A) addition sites were also sequenced. The 5{prime}-flanking region revealed the presence of several consensus sequences that could be relevant in the transcription of the MOG gene, in particular binding sites in common with other myelin gene promoters. Two polymorphic intragenic dinucleotide (CA){sub n} and tetranucleotide (TAAA){sub n} repeats were identified and may provide genetic marker tools for association and linkage studies. 50 refs., 3 figs., 3 tabs.« less

  18. Characterization of Trichuris trichiura from humans and T. suis from pigs in China using internal transcribed spacers of nuclear ribosomal DNA.

    PubMed

    Liu, G H; Zhou, W; Nisbet, A J; Xu, M J; Zhou, D H; Zhao, G H; Wang, S K; Song, H Q; Lin, R Q; Zhu, X Q

    2014-03-01

    Trichuris trichiura and Trichuris suis parasitize (at the adult stage) the caeca of humans and pigs, respectively, causing trichuriasis. Despite these parasites being of human and animal health significance, causing considerable socio-economic losses globally, little is known of the molecular characteristics of T. trichiura and T. suis from China. In the present study, the entire first and second internal transcribed spacer (ITS-1 and ITS-2) regions of nuclear ribosomal DNA (rDNA) of T. trichiura and T. suis from China were amplified by polymerase chain reaction (PCR), the representative amplicons were cloned and sequenced, and sequence variation in the ITS rDNA was examined. The ITS rDNA sequences for the T. trichiura and T. suis samples were 1222-1267 bp and 1339-1353 bp in length, respectively. Sequence analysis revealed that the ITS-1, 5.8S and ITS-2 rDNAs of both whipworms were 600-627 bp and 655-661 bp, 154 bp, and 468-486 bp and 530-538 bp in size, respectively. Sequence variation in ITS rDNA within and among T. trichiura and T. suis was examined. Excluding nucleotide variations in the simple sequence repeats, the intra-species sequence variation in the ITS-1 was 0.2-1.7% within T. trichiura, and 0-1.5% within T. suis. For ITS-2 rDNA, the intra-species sequence variation was 0-1.3% within T. trichiura and 0.2-1.7% within T. suis. The inter-species sequence differences between the two whipworms were 60.7-65.3% for ITS-1 and 59.3-61.5% for ITS-2. These results demonstrated that the ITS rDNA sequences provide additional genetic markers for the characterization and differentiation of the two whipworms. These data should be useful for studying the epidemiology and population genetics of T. trichiura and T. suis, as well as for the diagnosis of trichuriasis in humans and pigs.

  19. To Clone or Not To Clone: Method Analysis for Retrieving Consensus Sequences In Ancient DNA Samples

    PubMed Central

    Winters, Misa; Barta, Jodi Lynn; Monroe, Cara; Kemp, Brian M.

    2011-01-01

    The challenges associated with the retrieval and authentication of ancient DNA (aDNA) evidence are principally due to post-mortem damage which makes ancient samples particularly prone to contamination from “modern” DNA sources. The necessity for authentication of results has led many aDNA researchers to adopt methods considered to be “gold standards” in the field, including cloning aDNA amplicons as opposed to directly sequencing them. However, no standardized protocol has emerged regarding the necessary number of clones to sequence, how a consensus sequence is most appropriately derived, or how results should be reported in the literature. In addition, there has been no systematic demonstration of the degree to which direct sequences are affected by damage or whether direct sequencing would provide disparate results from a consensus of clones. To address this issue, a comparative study was designed to examine both cloned and direct sequences amplified from ∼3,500 year-old ancient northern fur seal DNA extracts. Majority rules and the Consensus Confidence Program were used to generate consensus sequences for each individual from the cloned sequences, which exhibited damage at 31 of 139 base pairs across all clones. In no instance did the consensus of clones differ from the direct sequence. This study demonstrates that, when appropriate, cloning need not be the default method, but instead, should be used as a measure of authentication on a case-by-case basis, especially when this practice adds time and cost to studies where it may be superfluous. PMID:21738625

  20. Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

    PubMed

    D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

    1995-09-01

    Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

  1. Complete genome sequence of the phenanthrene-degrading soil bacterium Delftia acidovorans Cs1-4

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shetty, Ameesha R.; de Gannes, Vidya; Obi, Chioma C.

    Polycyclic aromatic hydrocarbons (PAH) are ubiquitous environmental pollutants and microbial biodegradation is an important means of remediation of PAH-contaminated soil. Delftia acidovorans Cs1-4 (formerly Delftia sp. Cs1-4) was isolated by using phenanthrene as the sole carbon source from PAH contaminated soil in Wisconsin. Its full genome sequence was determined to gain insights into a mechanisms underlying biodegradation of PAH. Three genomic libraries were constructed and sequenced: an Illumina GAii shotgun library (916,416,493 reads), a 454 Titanium standard library (770,171 reads) and one paired-end 454 library (average insert size of 8 kb, 508,092 reads). The initial assembly contained 40 contigs inmore » two scaffolds. The 454 Titanium standard data and the 454 paired end data were assembled together and the consensus sequences were computationally shredded into 2 kb overlapping shreds. Illumina sequencing data was assembled, and the consensus sequence was computationally shredded into 1.5 kb overlapping shreds. Gaps between contigs were closed by editing in Consed, by PCR and by Bubble PCR primer walks. A total of 182 additional reactions were needed to close gaps and to raise the quality of the finished sequence. The final assembly is based on 253.3 Mb of 454 draft data (averaging 38.4 X coverage) and 590.2 Mb of Illumina draft data (averaging 89.4 X coverage). The genome of strain Cs1-4 consists of a single circular chromosome of 6,685,842 bp (66.7 %G+C) containing 6,028 predicted genes; 5,931 of these genes were protein-encoding and 4,425 gene products were assigned to a putative function. Genes encoding phenanthrene degradation were localized to a 232 kb genomic island (termed the phn island), which contained near its 3’ end a bacteriophage P4-like integrase, an enzyme often associated with chromosomal integration of mobile genetic elements. Other biodegradation pathways reconstructed from the genome sequence included: benzoate (by the acetyl-CoA pathway), styrene, nicotinic acid (by the maleamate pathway) and the pesticides Dicamba and Fenitrothion. Lastly, determination of the complete genome sequence of D. acidovorans Cs1-4 has provided new insights the microbial mechanisms of PAH biodegradation that may shape the process in the environment.« less

  2. Complete genome sequence of the phenanthrene-degrading soil bacterium Delftia acidovorans Cs1-4

    DOE PAGES

    Shetty, Ameesha R.; de Gannes, Vidya; Obi, Chioma C.; ...

    2015-08-15

    Polycyclic aromatic hydrocarbons (PAH) are ubiquitous environmental pollutants and microbial biodegradation is an important means of remediation of PAH-contaminated soil. Delftia acidovorans Cs1-4 (formerly Delftia sp. Cs1-4) was isolated by using phenanthrene as the sole carbon source from PAH contaminated soil in Wisconsin. Its full genome sequence was determined to gain insights into a mechanisms underlying biodegradation of PAH. Three genomic libraries were constructed and sequenced: an Illumina GAii shotgun library (916,416,493 reads), a 454 Titanium standard library (770,171 reads) and one paired-end 454 library (average insert size of 8 kb, 508,092 reads). The initial assembly contained 40 contigs inmore » two scaffolds. The 454 Titanium standard data and the 454 paired end data were assembled together and the consensus sequences were computationally shredded into 2 kb overlapping shreds. Illumina sequencing data was assembled, and the consensus sequence was computationally shredded into 1.5 kb overlapping shreds. Gaps between contigs were closed by editing in Consed, by PCR and by Bubble PCR primer walks. A total of 182 additional reactions were needed to close gaps and to raise the quality of the finished sequence. The final assembly is based on 253.3 Mb of 454 draft data (averaging 38.4 X coverage) and 590.2 Mb of Illumina draft data (averaging 89.4 X coverage). The genome of strain Cs1-4 consists of a single circular chromosome of 6,685,842 bp (66.7 %G+C) containing 6,028 predicted genes; 5,931 of these genes were protein-encoding and 4,425 gene products were assigned to a putative function. Genes encoding phenanthrene degradation were localized to a 232 kb genomic island (termed the phn island), which contained near its 3’ end a bacteriophage P4-like integrase, an enzyme often associated with chromosomal integration of mobile genetic elements. Other biodegradation pathways reconstructed from the genome sequence included: benzoate (by the acetyl-CoA pathway), styrene, nicotinic acid (by the maleamate pathway) and the pesticides Dicamba and Fenitrothion. Lastly, determination of the complete genome sequence of D. acidovorans Cs1-4 has provided new insights the microbial mechanisms of PAH biodegradation that may shape the process in the environment.« less

  3. Draft Genome Sequences of Acinetobacter and Bacillus Strains Isolated from Spacecraft-Associated Surfaces

    PubMed Central

    Seuylemezian, Arman; Vaishampayan, Parag; Cooper, Kerry

    2018-01-01

    ABSTRACT We report here the draft genome sequences of four strains isolated from spacecraft-associated surfaces exhibiting increased resistance to stressors such as UV radiation and exposure to H2O2. The draft genomes of strains 1P01SCT, FO-92T, 50v1, and 2P01AA had sizes of 5,500,894 bp, 4,699,376 bp, 3,174,402 bp, and 4,328,804 bp, respectively. PMID:29439046

  4. Complete genome sequence of Rhizobium leguminosarum bv. trifolii strain WSM1325, an effective microsymbiont of annual Mediterranean clovers.

    PubMed Central

    Reeve, Wayne; O’Hara, Graham; Chain, Patrick; Ardley, Julie; Bräu, Lambert; Nandesena, Kemanthi; Tiwari, Ravi; Copeland, Alex; Nolan, Matt; Han, Cliff; Brettin, Thomas; Land, Miriam; Ovchinikova, Galina; Ivanova, Natalia; Mavromatis, Konstantinos; Markowitz, Victor; Kyrpides, Nikos; Melino, Vanessa; Denton, Matthew; Yates, Ron; Howieson, John

    2010-01-01

    Rhizobium leguminosarum bv trifolii is a soil-inhabiting bacterium that has the capacity to be an effective nitrogen fixing microsymbiont of a diverse range of annual Trifolium (clover) species. Strain WSM1325 is an aerobic, motile, non-spore forming, Gram-negative rod isolated from root nodules collected in 1993 from the Greek Island of Serifos. WSM1325 is produced commercially in Australia as an inoculant for a broad range of annual clovers of Mediterranean origin due to its superior attributes of saprophytic competence, nitrogen fixation and acid-tolerance. Here we describe the basic features of this organism, together with the complete genome sequence, and annotation. This is the first completed genome sequence for a microsymbiont of annual clovers. We reveal that its genome size is 7,418,122 bp encoding 7,232 protein-coding genes and 61 RNA-only encoding genes. This multipartite genome contains 6 distinct replicons; a chromosome of size 4,767,043 bp and 5 plasmids of size 828,924 bp, 660,973 bp, 516,088 bp, 350,312 bp and 294,782 bp. PMID:21304718

  5. Gene-for-genes interactions between cotton R genes and Xanthomonas campestris pv. malvacearum avr genes.

    PubMed

    De Feyter, R; Yang, Y; Gabriel, D W

    1993-01-01

    Six plasmid-borne avirulence (avr) genes were previously cloned from strain XcmH of the cotton pathogen, Xanthomonas campestris pv. malvacearum. We have now localized all six avr genes on the cloned fragments by subcloning and Tn5-gusA insertional mutagenesis. None of these avr genes appeared to exhibit exclusively gene-for-gene patterns of interactions with cotton R genes, and avrB4 was demonstrated to confer avr gene-for-R genes (plural) avirulence to X. c. pv. malvacearum on congenic cotton lines carrying either of two different resistance loci, B1 or B4. Furthermore, the B1 locus appeared to confer R gene-for-avr genes resistance to cotton against isogenic X. c. pv. malvacearum strains carrying any one of three avr genes: avrB4, avrb6, or avrB102. Restriction enzyme, Southern blot hybridization, and DNA sequence analyses showed that the XcmH avr genes are all highly similar to each other, to avrBs3 and avrBsP from the pepper pathogen X. c. pv. vesicatoria, and to the host-specific virulence gene pthA from the citrus pathogen X. citri. The XcmH avr genes differed primarily in the multiplicity of a tandemly repeated 102-base pair motif within the central portions of the genes, repeated from 14 to 23 times in members of this gene family. The complete nucleotide sequence of avrb6 revealed that it is 97% identical in DNA sequence to avrB4, avrBs3, avrBsP, and pthA and that 62-bp inverted terminal repeats mark the boundaries of homology between avrb6 and all members of this Xanthomonas virulence/avirulence gene family sequenced to date. The terminal 38 bp of both inverted repeats are highly similar to the 38-bp consensus terminal sequence of the Tn3 family of transposons. Up to 11 members of the avr gene family appear to be present in North American strains of X. c. pv. malvacearum, including XcmH. The high level of homology observed among these avr genes and their presence in multiple copies may explain the gene-for-genes interactions and also the observed high frequencies (10(-3) to 10(-4) per locus) of X. c. pv. malvacearum race change mutations. Five spontaneous race change mutants of XcmH suffered avr locus deletions, strongly indicating intergenic recombination as the primary mechanism for generating new races in X. c. pv. malvacearum.

  6. Characterization of the complete chloroplast genome of Platycarya strobilacea (Juglandaceae)

    Treesearch

    Jing Yan; Kai Han; Shuyun Zeng; Peng Zhao; Keith Woeste; Jianfang Li; Zhan-Lin Liu

    2017-01-01

    The whole chloroplast genome (cp genome) sequence of Platycarya strobilacea was characterized from Illumina pair-end sequencing data. The complete cp genome was 160,994 bp in length and contained a large single copy region (LSC) of 90,225 bp and a small single copy region (SSC) of 18,371 bp, which were separated by a pair of inverted repeat regions...

  7. A short region of the promoter of the breast cancer associated PLU-1 gene can regulate transcription in vitro and in vivo.

    PubMed

    Catteau, Aurélie; Rosewell, Ian; Solomon, Ellen; Taylor-Papadimitriou, Joyce

    2004-07-01

    The recently cloned gene PLU-1 shows restricted expression in adult tissues, with high expression being found in testis, and transiently in the pregnant mammary gland. However, both the gene and the protein product are specifically up-regulated in breast cancer. To investigate the control of expression of the PLU-1 gene, we have cloned and functionally characterised the 5' flanking region of the gene, which was found to contain another putative gene. Two transcription start sites of the PLU-1 gene were mapped by 5' RACE. A short proximal 249 bp region was defined using reporter gene assays, which encompasses the major transcription start site and exhibits a strong constitutive promoter activity in all cell lines tested. However, regions upstream of this sequence repress transcription more effectively in a non-malignant breast cell line as compared to breast cancer cell lines. The 249 bp region is GC-rich and includes consensus Sp1 sites, GC boxes, cAMP-responsive element (CRE) and other putative cis-elements. Mutational analysis showed that two intact conserved Sp1 binding sites (shown here to bind Sp1 and/or Sp3) are critical for constitutive promoter activity, while a negative role for a neighbouring GC box is indicated. The sequence of the core promoter is highly conserved in the mouse and Plu-1 expression in the mouse embryo has been documented. Using transgenesis, we therefore examined the ability of the 249 bp fragment to control expression of a reporter gene during embryogenesis. We found that not only is the core promoter sufficient to activate transcription in vivo, but that the expression of the reporter gene coincides both temporally and spatially with regions where endogenous Plu-1 is highly expressed. This suggests that tissue specific controlling elements are found within the short fragment and are functional in the embryonic environment.

  8. The Complete Chloroplast and Mitochondrial Genome Sequences of Boea hygrometrica: Insights into the Evolution of Plant Organellar Genomes

    PubMed Central

    Wang, Xumin; Deng, Xin; Zhang, Xiaowei; Hu, Songnian; Yu, Jun

    2012-01-01

    The complete nucleotide sequences of the chloroplast (cp) and mitochondrial (mt) genomes of resurrection plant Boea hygrometrica (Bh, Gesneriaceae) have been determined with the lengths of 153,493 bp and 510,519 bp, respectively. The smaller chloroplast genome contains more genes (147) with a 72% coding sequence, and the larger mitochondrial genome have less genes (65) with a coding faction of 12%. Similar to other seed plants, the Bh cp genome has a typical quadripartite organization with a conserved gene in each region. The Bh mt genome has three recombinant sequence repeats of 222 bp, 843 bp, and 1474 bp in length, which divide the genome into a single master circle (MC) and four isomeric molecules. Compared to other angiosperms, one remarkable feature of the Bh mt genome is the frequent transfer of genetic material from the cp genome during recent Bh evolution. We also analyzed organellar genome evolution in general regarding genome features as well as compositional dynamics of sequence and gene structure/organization, providing clues for the understanding of the evolution of organellar genomes in plants. The cp-derived sequences including tRNAs found in angiosperm mt genomes support the conclusion that frequent gene transfer events may have begun early in the land plant lineage. PMID:22291979

  9. Molecular typing of Staphylococcus aureus based on coagulase gene.

    PubMed

    Javid, Faizan; Taku, Anil; Bhat, Mohd Altaf; Badroo, Gulzar Ahmad; Mudasir, Mir; Sofi, Tanveer Ahmad

    2018-04-01

    This study was conducted to study the coagulase gene-based genetic diversity of Staphylococcus aureus , isolated from different samples of cattle using restriction fragment length polymorphism (RFLP) and their sequence-based phylogenetic analysis. A total of 192 different samples from mastitic milk, nasal cavity, and pus from skin wounds of cattle from Military Dairy Farm, Jammu, India, were screened for the presence of S. aureus . The presumptive isolates were confirmed by nuc gene-based polymerase chain reaction (PCR). The confirmed S. aureus isolates were subjected to coagulase ( coa ) gene PCR. Different coa genotypes observed were subjected to RFLP using restriction enzymes Hae111 and Alu1 , to obtain the different restriction patterns. One isolate from each restriction pattern was sequenced. These sequences were aligned for maximum homology using the Bioedit softwareandsimilarity in the sequences was inferred with the help of sequence identity matrix. Of 192 different samples,39 (20.31%) isolates of S. aureus were confirmed by targeting nuc gene using PCR. Of 39 S. aureus isolates, 25 (64.10%) isolates carried coa gene. Four different genotypes of coa gene, i.e., 514 bp, 595 bp, 757 bp, and 802 bp were obtained. Two coa genotypes, 595 bp (15 isolates) and 802 bp (4 isolates), were observed in mastitic milk. 514 bp (2 isolates) and 757 bp (4 isolates) coa genotypes were observed from nasal cavity and pus from skin wounds, respectively. On RFLP using both restriction enzymes, four different restriction patterns P1, P2, P3, and P4 were observed. On sequencing, four different sequences having unique restriction patterns were obtained. The most identical sequences with the value of 0.810 were found between isolate S. aureus 514 (nasal cavity) and S. aureus 595 (mastitic milk), and thus, they are most closely related. While as the most distant sequences with the value of 0.483 were found between S. aureus 514 and S. aureus 802 isolates. The study, being localized to only one farm, yielded different RFLP patterns as observed from different sampling sites, which indicates that different S . aureus coagulase typeshave a site-specific predilection. Two coa patterns were observed in mastitic milk indicating multiple origins of infection, with 595 bp coa genotype being predominant in mastitic milk. The coa genotypes and their restriction patterns observed in the present study are novel, not published earlier. 514 and 595 coa variants of S. aureus are genetically most related.

  10. The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

    PubMed Central

    Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

    1987-01-01

    Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

  11. “A draft Musa balbisiana genome sequence for molecular genetics in polyploid, inter- and intra-specific Musa hybrids”

    PubMed Central

    2013-01-01

    Background Modern banana cultivars are primarily interspecific triploid hybrids of two species, Musa acuminata and Musa balbisiana, which respectively contribute the A- and B-genomes. The M. balbisiana genome has been associated with improved vigour and tolerance to biotic and abiotic stresses and is thus a target for Musa breeding programs. However, while a reference M. acuminata genome has recently been released (Nature 488:213–217, 2012), little sequence data is available for the corresponding B-genome. To address these problems we carried out Next Generation gDNA sequencing of the wild diploid M. balbisiana variety ‘Pisang Klutuk Wulung’ (PKW). Our strategy was to align PKW gDNA reads against the published A-genome and to extract the mapped consensus sequences for subsequent rounds of evaluation and gene annotation. Results The resulting B-genome is 79% the size of the A-genome, and contains 36,638 predicted functional gene sequences which is nearly identical to the 36,542 of the A-genome. There is substantial sequence divergence from the A-genome at a frequency of 1 homozygous SNP per 23.1 bp, and a high degree of heterozygosity corresponding to one heterozygous SNP per 55.9 bp. Using expressed small RNA data, a similar number of microRNA sequences were predicted in both A- and B-genomes, but additional novel miRNAs were detected, including some that are unique to each genome. The usefulness of this B-genome sequence was evaluated by mapping RNA-seq data from a set of triploid AAA and AAB hybrids simultaneously to both genomes. Results for the plantains demonstrated the expected 2:1 distribution of reads across the A- and B-genomes, but for the AAA genomes, results show they contain regions of significant homology to the B-genome supporting proposals that there has been a history of interspecific recombination between homeologous A and B chromosomes in Musa hybrids. Conclusions We have generated and annotated a draft reference Musa B-genome and demonstrate that this can be used for molecular genetic mapping of gene transcripts and small RNA expression data from several allopolyploid banana cultivars. This draft therefore represents a valuable resource to support the study of metabolism in inter- and intraspecific triploid Musa hybrids and to help direct breeding programs. PMID:24094114

  12. Molecular mechanism of the dual activity of 4EGI-1: Dissociating eIF4G from eIF4E but stabilizing the binding of unphosphorylated 4E-BP1

    DOE PAGES

    Sekiyama, Naotaka; Arthanari, Haribabu; Papadopoulos, Evangelos; ...

    2015-07-13

    The eIF4E-binding protein (4E-BP) is a phosphorylation-dependent regulator of protein synthesis. The nonphosphorylated or minimally phosphorylated form binds translation initiation factor 4E (eIF4E), preventing binding of eIF4G and the recruitment of the small ribosomal subunit. Signaling events stimulate serial phosphorylation of 4E-BP, primarily by mammalian target of rapamycin complex 1 (mTORC1) at residues T 37/T 46, followed by T 70 and S 65. Hyperphosphorylated 4E-BP dissociates from eIF4E, allowing eIF4E to interact with eIF4G and translation initiation to resume. Because overexpression of eIF4E is linked to cellular transformation, 4E-BP is a tumor suppressor, and up-regulation of its activity is amore » goal of interest for cancer therapy. A recently discovered small molecule, eIF4E/eIF4G interaction inhibitor 1 (4EGI-1), disrupts the eIF4E/eIF4G interaction and promotes binding of 4E-BP1 to eIF4E. Structures of 14- to 16-residue 4E-BP fragments bound to eIF4E contain the eIF4E consensus binding motif, 54YXXXXLΦ 60 (motif 1) but lack known phosphorylation sites. We report in this paper a 2.1-Å crystal structure of mouse eIF4E in complex with m 7GTP and with a fragment of human 4E-BP1, extended C-terminally from the consensus-binding motif (4E-BP1 50–84). The extension, which includes a proline-turn-helix segment (motif 2) followed by a loop of irregular structure, reveals the location of two phosphorylation sites (S 65 and T 70). Our major finding is that the C-terminal extension (motif 3) is critical to 4E-BP1–mediated cell cycle arrest and that it partially overlaps with the binding site of 4EGI-1. Finally, the binding of 4E-BP1 and 4EGI-1 to eIF4E is therefore not mutually exclusive, and both ligands contribute to shift the equilibrium toward the inhibition of translation initiation.« less

  13. Development of chemiluminescent probe hybridization, RT-PCR and nucleic acid cycle sequencing assays of Sabin type 3 isolates to identify base pair 472 Sabin type 3 mutants associated with vaccine associated paralytic poliomyelitis.

    PubMed

    Old, M O; Logan, L H; Maldonado, Y A

    1997-11-01

    Sabin type 3 polio vaccine virus is the most common cause of poliovaccine associated paralytic poliomyelitis. Vaccine associated paralytic poliomyelitis cases have been associated with Sabin type 3 revertants containing a single U to C substitution at bp 472 of Sabin type 3. A rapid method of identification of Sabin type 3 bp 472 mutants is described. An enterovirus group-specific probe for use in a chemiluminescent dot blot hybridization assay was developed to identify enterovirus positive viral lysates. A reverse transcription-polymerase chain reaction (RT-PCR) assay producing a 319 bp PCR product containing the Sabin type 3 bp 472 mutation site was then employed to identify Sabin type 3 isolates. Chemiluminescent nucleic acid cycle sequencing of the purified 319 bp PCR product was then employed to identify nucleic acid sequences at bp 472. The enterovirus group probe hybridization procedure and isolation of the Sabin type 3 PCR product were highly sensitive and specific; nucleic acid cycle sequencing corresponded to the known sequence of stock Sabin type 3 isolates. These methods will be used to identify the Sabin type 3 reversion rate from sequential stool samples of infants obtained after the first and second doses of oral poliovirus vaccine.

  14. In situ detection of a PCR-synthesized human pancentromeric DNA hybridization probe by color pigment immunostaining: application for dicentric assay automation.

    PubMed

    Kolanko, C J; Pyle, M D; Nath, J; Prasanna, P G; Loats, H; Blakely, W F

    2000-03-01

    We report a low cost and efficient method for synthesizing a human pancentromeric DNA probe by the polymerase chain reaction (PRC) and an optimized protocol for in situ detection using color pigment immunostaining. The DNA template used in the PCR was a 2.4 kb insert containing human alphoid repeated sequences of pancentromeric DNA subcloned into pUC9 (Miller et al. 1988) and the primers hybridized to internal sequences of the 172 bp consensus tandem repeat associated with human centromeres. PCR was performed in the presence of biotin-11-dUTP, and the product was used for in situ hybridization to detect the pancentromeric region of human chromosomes in metaphase spreads. Detection of pancentromeric probe was achieved by immunoenzymatic color pigment painting to yield a permanent image detected at high resolution by bright field microscopy. The ability to synthesize the centromeric probe rapidly and to detect it with color pigment immunostaining will lead to enhanced identification and eventually to automation of various chromosome aberration assays.

  15. A safe an easy method for building consensus HIV sequences from 454 massively parallel sequencing data.

    PubMed

    Fernández-Caballero Rico, Jose Ángel; Chueca Porcuna, Natalia; Álvarez Estévez, Marta; Mosquera Gutiérrez, María Del Mar; Marcos Maeso, María Ángeles; García, Federico

    2018-02-01

    To show how to generate a consensus sequence from the information of massive parallel sequences data obtained from routine HIV anti-retroviral resistance studies, and that may be suitable for molecular epidemiology studies. Paired Sanger (Trugene-Siemens) and next-generation sequencing (NGS) (454 GSJunior-Roche) HIV RT and protease sequences from 62 patients were studied. NGS consensus sequences were generated using Mesquite, using 10%, 15%, and 20% thresholds. Molecular evolutionary genetics analysis (MEGA) was used for phylogenetic studies. At a 10% threshold, NGS-Sanger sequences from 17/62 patients were phylogenetically related, with a median bootstrap-value of 88% (IQR83.5-95.5). Association increased to 36/62 sequences, median bootstrap 94% (IQR85.5-98)], using a 15% threshold. Maximum association was at the 20% threshold, with 61/62 sequences associated, and a median bootstrap value of 99% (IQR98-100). A safe method is presented to generate consensus sequences from HIV-NGS data at 20% threshold, which will prove useful for molecular epidemiological studies. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  16. Species identification of mutans streptococci by groESL gene sequence.

    PubMed

    Hung, Wei-Chung; Tsai, Jui-Chang; Hsueh, Po-Ren; Chia, Jean-San; Teng, Lee-Jene

    2005-09-01

    The near full-length sequences of the groESL genes were determined and analysed among eight reference strains (serotypes a to h) representing five species of mutans group streptococci. The groES sequences from these reference strains revealed that there are two lengths (285 and 288 bp) in the five species. The intergenic spacer between groES and groEL appears to be a unique marker for species, with a variable size (ranging from 111 to 310 bp) and sequence. Phylogenetic analysis of groES and groEL separated the eight serotypes into two major clusters. Strains of serotypes b, c, e and f were highly related and had groES gene sequences of the same length, 288 bp, while strains of serotypes a, d, g and h were also closely related and their groES gene sequence lengths were 285 bp. The groESL sequences in clinical isolates of three serotypes of S. mutans were analysed for intraspecies polymorphism. The results showed that the groESL sequences could provide information for differentiation among species, but were unable to distinguish serotypes of the same species. Based on the determined sequences, a PCR assay was developed that could differentiate members of the mutans streptococci by amplicon size and provide an alternative way for distinguishing mutans streptococci from other viridans streptococci.

  17. Accurate, Rapid Taxonomic Classification of Fungal Large-Subunit rRNA Genes

    PubMed Central

    Liu, Kuan-Liang; Porras-Alfaro, Andrea; Eichorst, Stephanie A.

    2012-01-01

    Taxonomic and phylogenetic fingerprinting based on sequence analysis of gene fragments from the large-subunit rRNA (LSU) gene or the internal transcribed spacer (ITS) region is becoming an integral part of fungal classification. The lack of an accurate and robust classification tool trained by a validated sequence database for taxonomic placement of fungal LSU genes is a severe limitation in taxonomic analysis of fungal isolates or large data sets obtained from environmental surveys. Using a hand-curated set of 8,506 fungal LSU gene fragments, we determined the performance characteristics of a naïve Bayesian classifier across multiple taxonomic levels and compared the classifier performance to that of a sequence similarity-based (BLASTN) approach. The naïve Bayesian classifier was computationally more rapid (>460-fold with our system) than the BLASTN approach, and it provided equal or superior classification accuracy. Classifier accuracies were compared using sequence fragments of 100 bp and 400 bp and two different PCR primer anchor points to mimic sequence read lengths commonly obtained using current high-throughput sequencing technologies. Accuracy was higher with 400-bp sequence reads than with 100-bp reads. It was also significantly affected by sequence location across the 1,400-bp test region. The highest accuracy was obtained across either the D1 or D2 variable region. The naïve Bayesian classifier provides an effective and rapid means to classify fungal LSU sequences from large environmental surveys. The training set and tool are publicly available through the Ribosomal Database Project (http://rdp.cme.msu.edu/classifier/classifier.jsp). PMID:22194300

  18. Mitochondrial genome sequences of landsnails Aegista diversifamilia and Dolicheulota formosensis (Gastropoda: Pulmonata: Stylommatophora).

    PubMed

    Huang, Chih-Wei; Lin, Si-Min; Wu, Wen-Lung

    2016-07-01

    The first mitochondrial genome sequences of Aegista and Dolicheulota belonging to Bradybaenidae are described in this report. Mitogenomic sequences were generated from Illumina paired-end sequencing. The complete mitogenome of Aegista diversifamilia was 14,039 bp in length and nearly complete mitogenome of Dolicheulota formosensis was 14,237 bp. Both mitogenomes consisted of 13 protein-coding genes (PCGs), 2 ribosomal RNA genes, and 22 transfer RNA genes. Most genes were overlapped with neighboring genes that the overlapping regions ranged from 2 to 64 bp in A. diversifamilia and from 1 to 45 bp in D. formosensis. Novel gene arrangement, tRNA-Tyr-ND3-tRNA-Trp, was identified in A. diversifamilia, whereas D. formosensis showed identical gene order to other Bradybaenidae mitogenomes. Maximum likelihood phylogenetic tree suggested Aegista as a sister clade to Euhadra and Dolicheulota. Bradybaenidae is monophyly sister clade to Camaenidae.

  19. The complete chloroplast genome sequence of Dendrobium officinale.

    PubMed

    Yang, Pei; Zhou, Hong; Qian, Jun; Xu, Haibin; Shao, Qingsong; Li, Yonghua; Yao, Hui

    2016-01-01

    The complete chloroplast sequence of Dendrobium officinale, an endangered and economically important traditional Chinese medicine, was reported and characterized. The genome size is 152,018 bp, with 37.5% GC content. A pair of inverted repeats (IRs) of 26,284 bp are separated by a large single-copy region (LSC, 84,944 bp) and a small single-copy region (SSC, 14,506 bp). The complete cp DNA contains 83 protein-coding genes, 39 tRNA genes and 8 rRNA genes. Fourteen genes contained one or two introns.

  20. First complete genome sequence of infectious laryngotracheitis virus

    PubMed Central

    2011-01-01

    Background Infectious laryngotracheitis virus (ILTV) is an alphaherpesvirus that causes acute respiratory disease in chickens worldwide. To date, only one complete genomic sequence of ILTV has been reported. This sequence was generated by concatenating partial sequences from six different ILTV strains. Thus, the full genomic sequence of a single (individual) strain of ILTV has not been determined previously. This study aimed to use high throughput sequencing technology to determine the complete genomic sequence of a live attenuated vaccine strain of ILTV. Results The complete genomic sequence of the Serva vaccine strain of ILTV was determined, annotated and compared to the concatenated ILTV reference sequence. The genome size of the Serva strain was 152,628 bp, with a G + C content of 48%. A total of 80 predicted open reading frames were identified. The Serva strain had 96.5% DNA sequence identity with the concatenated ILTV sequence. Notably, the concatenated ILTV sequence was found to lack four large regions of sequence, including 528 bp and 594 bp of sequence in the UL29 and UL36 genes, respectively, and two copies of a 1,563 bp sequence in the repeat regions. Considerable differences in the size of the predicted translation products of 4 other genes (UL54, UL30, UL37 and UL38) were also identified. More than 530 single-nucleotide polymorphisms (SNPs) were identified. Most SNPs were located within three genomic regions, corresponding to sequence from the SA-2 ILTV vaccine strain in the concatenated ILTV sequence. Conclusions This is the first complete genomic sequence of an individual ILTV strain. This sequence will facilitate future comparative genomic studies of ILTV by providing an appropriate reference sequence for the sequence analysis of other ILTV strains. PMID:21501528

  1. Frequencies of polymorphisms associated with BSE resistance differ significantly between Bos taurus, Bos indicus, and composite cattle

    PubMed Central

    Brunelle, Brian W; Greenlee, Justin J; Seabury, Christopher M; Brown, Charles E; Nicholson, Eric M

    2008-01-01

    Background Transmissible spongiform encephalopathies (TSEs) are neurodegenerative diseases that affect several mammalian species. At least three factors related to the host prion protein are known to modulate susceptibility or resistance to a TSE: amino acid sequence, atypical number of octapeptide repeats, and expression level. These factors have been extensively studied in breeds of Bos taurus cattle in relation to classical bovine spongiform encephalopathy (BSE). However, little is currently known about these factors in Bos indicus purebred or B. indicus × B. taurus composite cattle. The goal of our study was to establish the frequency of markers associated with enhanced susceptibility or resistance to classical BSE in B. indicus purebred and composite cattle. Results No novel or TSE-associated PRNP-encoded amino acid polymorphisms were observed for B. indicus purebred and composite cattle, and all had the typical number of octapeptide repeats. However, differences were observed in the frequencies of the 23-bp and 12-bp insertion/deletion (indel) polymorphisms associated with two bovine PRNP transcription regulatory sites. Compared to B. taurus, B. indicus purebred and composite cattle had a significantly lower frequency of 23-bp insertion alleles and homozygous genotypes. Conversely, B. indicus purebred cattle had a significantly higher frequency of 12-bp insertion alleles and homozygous genotypes in relation to both B. taurus and composite cattle. The origin of these disparities can be attributed to a significantly different haplotype structure within each species. Conclusion The frequencies of the 23-bp and 12-bp indels were significantly different between B. indicus and B. taurus cattle. No other known or potential risk factors were detected for the B. indicus purebred and composite cattle. To date, no consensus exists regarding which bovine PRNP indel region is more influential with respect to classical BSE. Should one particular indel region and associated genotypes prove more influential with respect to the incidence of classical BSE, differences regarding overall susceptibility and resistance for B. indicus and B. taurus cattle may be elucidated. PMID:18808703

  2. The mariner transposons belonging to the irritans subfamily were maintained in chordate genomes by vertical transmission.

    PubMed

    Sinzelle, Ludivine; Chesneau, Albert; Bigot, Yves; Mazabraud, André; Pollet, Nicolas

    2006-01-01

    Mariner-like elements (MLEs) belong to the Tc1-mariner superfamily of DNA transposons, which is very widespread in animal genomes. We report here the first complete description of a MLE, Xtmar1, within the genome of a poikilotherm vertebrate, the amphibian Xenopus tropicalis. A close relative, XlMLE, is also characterized within the genome of a sibling species, Xenopus laevis. The phylogenetic analysis of the relationships between MLE transposases reveals that Xtmar1 is closely related to Hsmar2 and Bytmar1 and that together they form a second distinct lineage of the irritans subfamily. All members of this lineage are also characterized by the 36- to 43-bp size of their imperfectly conserved inverted terminal repeats and by the -8-bp motif located at their outer extremity. Since XlMLE, Xlmar1, and Hsmar2 are present in species located at both extremities of the vertebrate evolutionary tree, we looked for MLE relatives belonging to the same subfamily in the available sequencing projects using the amino acid consensus sequence of the Hsmar2 transposase as an in silico probe. We found that irritans MLEs are present in chordate genomes including most craniates. This therefore suggests that these elements have been present within chordate genomes for 750 Myr and that the main way they have been maintained in these species has been via vertical transmission. The very small number of stochastic losses observed in the data available suggests that their inactivation during evolution has been very slow.

  3. Extension of the Southern Hemisphere Atmospheric Radiocarbon Curve, 2120-850 years BP: Results from Tasmanian Huon Pine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zimmerman, S R; P.Guilderson, T; Buckley, B M

    2010-02-12

    Decadal samples of dendrochronologically-dated pine (Lagorostrobos franklinii) from the Stanley River basin, Tasmania have been radiocarbon dated between 2120-850 yr BP. This data set overlaps and extends the current Southern Hemisphere record, which currently covers the period 110-995 yr BP. There is good agreement between the two records between 995-850 yr BP, between sample replicates and with consensus values for standards. As in the younger dataset, we find evidence for a distinct but variable offset between the southern hemisphere data and IntCal04; although this is likely due to real temporal variability in the interhemispheric offset, further work is planned tomore » rule out possible laboratory or sample preparation differences.« less

  4. Molecular cloning and promoter analysis of squalene synthase and squalene epoxidase genes from Betula platyphylla.

    PubMed

    Zhang, Mengyan; Wang, Siyao; Yin, Jing; Li, Chunxiao; Zhan, Yaguang; Xiao, Jialei; Liang, Tian; Li, Xin

    2016-09-01

    Betula platyphylla is a rich repository of pharmacologically active secondary metabolites known as birch triterpenoids (TBP). Here, we cloned the squalene synthase (SS) and squalene epoxidase genetic (SE) sequences from B. platyphylla that encode the key enzymes that are involved in triterpenoid biosynthesis and analyzed the conserved domains and phylogenetics of their corresponding proteins. The full-length sequence of BpSS is 1588 bp with a poly-A tail, which contained an open reading frame (ORF) of 1241 bp that encoded a protein of 413 amino acids. Additionally, the BpSE full-length sequence of 2040 bp with a poly-A tail was also obtained, which contained an ORF of 1581 bp encoding a protein of 526 amino acids. Their organ-specific expression patterns in 4-week-old tissue culture seedlings of B. platyphylla were detected by real-time PCR and showed that they were all highly expressed in leaves, as compared to stem and root tissues. Additionaly, both BpSS and BpSE were enhanced following stimulation with ethephon and MeJA. The expression of BpSS was enhanced by ABA, whereas BpSE was not. The SA treatment did not affect the BpSS and BpSE transcripts notably. Using a genome walking approach, promoter sequences of 965 and 1193 bp, respectively, for BpSS and BpSE were isolated, and they revealed several key cis-regulatory elements known to be involved in the response to phytohormone and abiotic plant stress. We also found that the BpSS protein is localized in the cytoplasm. Opening reading frames of BpSS and BpSE were ligated into yeast expression plasmid pYES2 under control of GAL1 promoter and introduced into the yeast INVScl1 strain. The transformants were cultured for 12 h, the squalene content of galactose-induced BpSS expression yeast cells was 13.2 times of control (empty vector control yeast cells) by high-performance liquid chromatography (HPLC) test method. And, the squalene epoxidase activity of induced BpSE expression yeast cell was about 11.8 times of control. These indicated that we cloned birch BpSS and BpSE that were indeed involved in the synthesis of triteropenoids. This is the first report wherein SS and SE from B. platyphylla were cloned and may be of significant interest to understand the regulatory role of SS and SE in the triterpenoids biosynthesis of B. platyphylla. This is the first report wherein SS and SE from B. platyphylla were cloned and may be of significant interest to understand the regulatory role of SS and SE in the biosynthesis of birch triterpenoids.

  5. Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs.

    PubMed

    Yuan, Xiao-Long; Zhang, Zhe; Pan, Rong-Yang; Gao, Ning; Deng, Xi; Li, Bin; Zhang, Hao; Sangild, Per Torp; Li, Jia-Qi

    2017-01-01

    Reduced representation bisulfite sequencing (RRBS) has been widely used to profile genome-scale DNA methylation in mammalian genomes. However, the applications and technical performances of RRBS with different fragment sizes have not been systematically reported in pigs, which serve as one of the important biomedical models for humans. The aims of this study were to evaluate capacities of RRBS libraries with different fragment sizes to characterize the porcine genome. We found that the Msp I-digested segments between 40 and 220 bp harbored a high distribution peak at 74 bp, which were highly overlapped with the repetitive elements and might reduce the unique mapping alignment. The RRBS library of 110-220 bp fragment size had the highest unique mapping alignment and the lowest multiple alignment. The cost-effectiveness of the 40-110 bp, 110-220 bp and 40-220 bp fragment sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40-220 bp fragment sizes, and these detected CpG sties differently located in gene- and CpG island-related regions. In this study, our results demonstrated that selections of fragment sizes could affect the numbers and sequencing depth of detected CpG sites as well as the cost-efficiency. No single solution of RRBS is optimal in all circumstances for investigating genome-scale DNA methylation. This work provides the useful knowledge on designing and executing RRBS for investigating the genome-wide DNA methylation in tissues from pigs.

  6. Tenebrio molitor antifreeze protein gene identification and regulation.

    PubMed

    Qin, Wensheng; Walker, Virginia K

    2006-02-15

    The yellow mealworm, Tenebrio molitor, is a freeze susceptible, stored product pest. Its winter survival is facilitated by the accumulation of antifreeze proteins (AFPs), encoded by a small gene family. We have now isolated 11 different AFP genomic clones from 3 genomic libraries. All the clones had a single coding sequence, with no evidence of intervening sequences. Three genomic clones were further characterized. All have putative TATA box sequences upstream of the coding regions and multiple potential poly(A) signal sequences downstream of the coding regions. A TmAFP regulatory region, B1037, conferred transcriptional activity when ligated to a luciferase reporter sequence and after transfection into an insect cell line. A 143 bp core promoter including a TATA box sequence was identified. Its promoter activity was increased 4.4 times by inserting an exotic 245 bp intron into the construct, similar to the enhancement of transgenic expression seen in several other systems. The addition of a duplication of the first 120 bp sequence from the 143 bp core promoter decreased promoter activity by half. Although putative hormonal response sequences were identified, none of the five hormones tested enhanced reporter activity. These studies on the mechanisms of AFP transcriptional control are important for the consideration of any transfer of freeze-resistance phenotypes to beneficial hosts.

  7. Complete Chloroplast Genome Sequence of Tartary Buckwheat (Fagopyrum tataricum) and Comparative Analysis with Common Buckwheat (F. esculentum)

    PubMed Central

    Cho, Kwang-Soo; Yun, Bong-Kyoung; Yoon, Young-Ho; Hong, Su-Young; Mekapogu, Manjulatha; Kim, Kyung-Hee; Yang, Tae-Jin

    2015-01-01

    We report the chloroplast (cp) genome sequence of tartary buckwheat (Fagopyrum tataricum) obtained by next-generation sequencing technology and compared this with the previously reported common buckwheat (F. esculentum ssp. ancestrale) cp genome. The cp genome of F. tataricum has a total sequence length of 159,272 bp, which is 327 bp shorter than the common buckwheat cp genome. The cp gene content, order, and orientation are similar to those of common buckwheat, but with some structural variation at tandem and palindromic repeat frequencies and junction areas. A total of seven InDels (around 100 bp) were found within the intergenic sequences and the ycf1 gene. Copy number variation of the 21-bp tandem repeat varied in F. tataricum (four repeats) and F. esculentum (one repeat), and the InDel of the ycf1 gene was 63 bp long. Nucleotide and amino acid have highly conserved coding sequence with about 98% homology and four genes—rpoC2, ycf3, accD, and clpP—have high synonymous (Ks) value. PCR based InDel markers were applied to diverse genetic resources of F. tataricum and F. esculentum, and the amplicon size was identical to that expected in silico. Therefore, these InDel markers are informative biomarkers to practically distinguish raw or processed buckwheat products derived from F. tataricum and F. esculentum. PMID:25966355

  8. bpRNA: large-scale automated annotation and analysis of RNA secondary structure.

    PubMed

    Danaee, Padideh; Rouches, Mason; Wiley, Michelle; Deng, Dezhong; Huang, Liang; Hendrix, David

    2018-05-09

    While RNA secondary structure prediction from sequence data has made remarkable progress, there is a need for improved strategies for annotating the features of RNA secondary structures. Here, we present bpRNA, a novel annotation tool capable of parsing RNA structures, including complex pseudoknot-containing RNAs, to yield an objective, precise, compact, unambiguous, easily-interpretable description of all loops, stems, and pseudoknots, along with the positions, sequence, and flanking base pairs of each such structural feature. We also introduce several new informative representations of RNA structure types to improve structure visualization and interpretation. We have further used bpRNA to generate a web-accessible meta-database, 'bpRNA-1m', of over 100 000 single-molecule, known secondary structures; this is both more fully and accurately annotated and over 20-times larger than existing databases. We use a subset of the database with highly similar (≥90% identical) sequences filtered out to report on statistical trends in sequence, flanking base pairs, and length. Both the bpRNA method and the bpRNA-1m database will be valuable resources both for specific analysis of individual RNA molecules and large-scale analyses such as are useful for updating RNA energy parameters for computational thermodynamic predictions, improving machine learning models for structure prediction, and for benchmarking structure-prediction algorithms.

  9. Bioinformatic analysis of phage AB3, a phiKMV-like virus infecting Acinetobacter baumannii.

    PubMed

    Zhang, J; Liu, X; Li, X-J

    2015-01-16

    The phages of Acinetobacter baumannii has drawn increasing attention because of the multi-drug resistance of A. baumanni. The aim of this study was to sequence Acinetobacter baumannii phage AB3 and conduct bioinformatic analysis to lay a foundation for genome remodeling and phage therapy. We isolated and sequenced A. baumannii phage AB3 and attempted to annotate and analyze its genome. The results showed that the genome is a double-stranded DNA with a total length of 31,185 base pairs (bp) and 97 open reading frames greater than 100 bp. The genome includes 28 predicted genes, of which 24 are homologous to phage AB1. The entire coding sequence is located on the negative strand, representing 90.8% of the total length. The G+C mol% was 39.18%, without areas of high G+C content over 200 bp in length. No GC island, tRNA gene, or repeated sequence was identified. Gene lengths were 120-3099 bp, with an average of 1011 bp. Six genes were found to be greater than 2000 bp in length. Genomic alignment and phylogenetic analysis of the RNA polymerase gene showed that similar to phage AB1, phage AB3 is a phiKMV-like virus in the T7 phage family.

  10. Complete mitochondrial genome sequences from five Eimeria species (Apicomplexa; Coccidia; Eimeriidae) infecting domestic turkeys

    PubMed Central

    2014-01-01

    Background Clinical and subclinical coccidiosis is cosmopolitan and inflicts significant losses to the poultry industry globally. Seven named Eimeria species are responsible for coccidiosis in turkeys: Eimeria dispersa; Eimeria meleagrimitis; Eimeria gallopavonis; Eimeria meleagridis; Eimeria adenoeides; Eimeria innocua; and, Eimeria subrotunda. Although attempts have been made to characterize these parasites molecularly at the nuclear 18S rDNA and ITS loci, the maternally-derived and mitotically replicating mitochondrial genome may be more suited for species level molecular work; however, only limited sequence data are available for Eimeria spp. infecting turkeys. The purpose of this study was to sequence and annotate the complete mitochondrial genomes from 5 Eimeria species that commonly infect the domestic turkey (Meleagris gallopavo). Methods Six single-oocyst derived cultures of five Eimeria species infecting turkeys were PCR-amplified and sequenced completely prior to detailed annotation. Resulting sequences were aligned and used in phylogenetic analyses (BI, ML, and MP) that included complete mitochondrial genomes from 16 Eimeria species or concatenated CDS sequences from each genome. Results Complete mitochondrial genome sequences were obtained for Eimeria adenoeides Guelph, 6211 bp; Eimeria dispersa Briston, 6238 bp; Eimeria meleagridis USAR97-01, 6212 bp; Eimeria meleagrimitis USMN08-01, 6165 bp; Eimeria gallopavonis Weybridge, 6215 bp; and Eimeria gallopavonis USKS06-01, 6215 bp). The order, orientation and CDS lengths of the three protein coding genes (COI, COIII and CytB) as well as rDNA fragments encoding ribosomal large and small subunit rRNA were conserved among all sequences. Pairwise sequence identities between species ranged from 88.1% to 98.2%; sequence variability was concentrated within CDS or between rDNA fragments (where indels were common). No phylogenetic reconstruction supported monophyly of Eimeria species infecting turkeys; Eimeria dispersa may have arisen via host switching from another avian host. Phylogenetic analyses suggest E. necatrix and E. tenella are related distantly to other Eimeria of chickens. Conclusions Mitochondrial genomes of Eimeria species sequenced to date are highly conserved with regard to gene content and structure. Nonetheless, complete mitochondrial genome sequences and, particularly the three CDS, possess sufficient sequence variability for differentiating Eimeria species of poultry. The mitochondrial genome sequences are highly suited for molecular diagnostics and phylogenetics of coccidia and, potentially, genetic markers for molecular epidemiology. PMID:25034633

  11. Complete mitochondrial genome sequences from five Eimeria species (Apicomplexa; Coccidia; Eimeriidae) infecting domestic turkeys.

    PubMed

    Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Barta, John R

    2014-07-17

    Clinical and subclinical coccidiosis is cosmopolitan and inflicts significant losses to the poultry industry globally. Seven named Eimeria species are responsible for coccidiosis in turkeys: Eimeria dispersa; Eimeria meleagrimitis; Eimeria gallopavonis; Eimeria meleagridis; Eimeria adenoeides; Eimeria innocua; and, Eimeria subrotunda. Although attempts have been made to characterize these parasites molecularly at the nuclear 18S rDNA and ITS loci, the maternally-derived and mitotically replicating mitochondrial genome may be more suited for species level molecular work; however, only limited sequence data are available for Eimeria spp. infecting turkeys. The purpose of this study was to sequence and annotate the complete mitochondrial genomes from 5 Eimeria species that commonly infect the domestic turkey (Meleagris gallopavo). Six single-oocyst derived cultures of five Eimeria species infecting turkeys were PCR-amplified and sequenced completely prior to detailed annotation. Resulting sequences were aligned and used in phylogenetic analyses (BI, ML, and MP) that included complete mitochondrial genomes from 16 Eimeria species or concatenated CDS sequences from each genome. Complete mitochondrial genome sequences were obtained for Eimeria adenoeides Guelph, 6211 bp; Eimeria dispersa Briston, 6238 bp; Eimeria meleagridis USAR97-01, 6212 bp; Eimeria meleagrimitis USMN08-01, 6165 bp; Eimeria gallopavonis Weybridge, 6215 bp; and Eimeria gallopavonis USKS06-01, 6215 bp). The order, orientation and CDS lengths of the three protein coding genes (COI, COIII and CytB) as well as rDNA fragments encoding ribosomal large and small subunit rRNA were conserved among all sequences. Pairwise sequence identities between species ranged from 88.1% to 98.2%; sequence variability was concentrated within CDS or between rDNA fragments (where indels were common). No phylogenetic reconstruction supported monophyly of Eimeria species infecting turkeys; Eimeria dispersa may have arisen via host switching from another avian host. Phylogenetic analyses suggest E. necatrix and E. tenella are related distantly to other Eimeria of chickens. Mitochondrial genomes of Eimeria species sequenced to date are highly conserved with regard to gene content and structure. Nonetheless, complete mitochondrial genome sequences and, particularly the three CDS, possess sufficient sequence variability for differentiating Eimeria species of poultry. The mitochondrial genome sequences are highly suited for molecular diagnostics and phylogenetics of coccidia and, potentially, genetic markers for molecular epidemiology.

  12. Length and sequence variability in mitochondrial control region of the milkfish, Chanos chanos.

    PubMed

    Ravago, Rachel G; Monje, Virginia D; Juinio-Meñez, Marie Antonette

    2002-01-01

    Extensive length variability was observed in the mitochondrial control region of the milkfish, Chanos chanos. The nucleotide sequence of the control region and flanking regions was determined. Length variability and heteroplasmy was due to the presence of varying numbers of a 41-bp tandemly repeated sequence and a 48-bp insertion/deletion (indel). The structure and organization of the milkfish control region is similar to that of other teleost fish and vertebrates. However, extensive variation in the copy number of tandem repeats (4-20 copies) and the presence of a relatively large (48-bp) indel, are apparently uncommon in teleost fish control region sequences reported to date. High sequence variability of control region peripheral domains indicates the potential utility of selected regions as markers for population-level studies.

  13. Embedding strategies for effective use of information from multiple sequence alignments.

    PubMed Central

    Henikoff, S.; Henikoff, J. G.

    1997-01-01

    We describe a new strategy for utilizing multiple sequence alignment information to detect distant relationships in searches of sequence databases. A single sequence representing a protein family is enriched by replacing conserved regions with position-specific scoring matrices (PSSMs) or consensus residues derived from multiple alignments of family members. In comprehensive tests of these and other family representations, PSSM-embedded queries produced the best results overall when used with a special version of the Smith-Waterman searching algorithm. Moreover, embedding consensus residues instead of PSSMs improved performance with readily available single sequence query searching programs, such as BLAST and FASTA. Embedding PSSMs or consensus residues into a representative sequence improves searching performance by extracting multiple alignment information from motif regions while retaining single sequence information where alignment is uncertain. PMID:9070452

  14. PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

    PubMed Central

    Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

    2008-01-01

    Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

  15. Isolation of an insertion sequence (IS1051) from Xanthomonas campestris pv. dieffenbachiae with potential use for strain identification and characterization.

    PubMed Central

    Berthier, Y; Thierry, D; Lemattre, M; Guesdon, J L

    1994-01-01

    A new insertion sequence was isolated from Xanthomonas campestris pv. dieffenbachiae. Sequence analysis showed that this element is 1,158 bp long and has 15-bp inverted repeat ends containing two mismatches. Comparison of this sequence with sequences in data bases revealed significant homology with Escherichia coli IS5. IS1051, which detected multiple restriction fragment length polymorphisms, was used as a probe to characterize strains from the pathovar dieffenbachiae. Images PMID:7906933

  16. The complete chloroplast genome sequence of Euonymus japonicus (Celastraceae).

    PubMed

    Choi, Kyoung Su; Park, SeonJoo

    2016-09-01

    The complete chloroplast (cp) genome sequence of the Euonymus japonicus, the first sequenced of the genus Euonymus, was reported in this study. The total length was 157 637 bp, containing a pair of 26 678 bp inverted repeat region (IR), which were separated by small single copy (SSC) region and large single copy (LSC) region of 18 340 bp and 85 941 bp, respectively. This genome contains 107 unique genes, including 74 coding genes, four rRNA genes, and 29 tRNA genes. Seventeen genes contain intron of E. japonicus, of which three genes (clpP, ycf3, and rps12) include two introns. The maximum likelihood (ML) phylogenetic analysis revealed that E. japonicus was closely related to Manihot and Populus.

  17. Adjacent DNA sequences modulate Sox9 transcriptional activation at paired Sox sites in three chondrocyte-specific enhancer elements

    PubMed Central

    Bridgewater, Laura C.; Walker, Marlan D.; Miller, Gwen C.; Ellison, Trevor A.; Holsinger, L. Daniel; Potter, Jennifer L.; Jackson, Todd L.; Chen, Reuben K.; Winkel, Vicki L.; Zhang, Zhaoping; McKinney, Sandra; de Crombrugghe, Benoit

    2003-01-01

    Expression of the type XI collagen gene Col11a2 is directed to cartilage by at least three chondrocyte-specific enhancer elements, two in the 5′ region and one in the first intron of the gene. The three enhancers each contain two heptameric sites with homology to the Sox protein-binding consensus sequence. The two sites are separated by 3 or 4 bp and arranged in opposite orientation to each other. Targeted mutational analyses of these three enhancers showed that in the intronic enhancer, as in the other two enhancers, both Sox sites in a pair are essential for enhancer activity. The transcription factor Sox9 binds as a dimer at the paired sites, and the introduction of insertion mutations between the sites demonstrated that physical interactions between the adjacently bound proteins are essential for enhancer activity. Additional mutational analyses demonstrated that although Sox9 binding at the paired Sox sites is necessary for enhancer activity, it alone is not sufficient. Adjacent DNA sequences in each enhancer are also required, and mutation of those sequences can eliminate enhancer activity without preventing Sox9 binding. The data suggest a new model in which adjacently bound proteins affect the DNA bend angle produced by Sox9, which in turn determines whether an active transcriptional enhancer complex is assembled. PMID:12595563

  18. Gene structure and functional characterization of growth hormone in dogfish, Squalus acanthias.

    PubMed

    Moriyama, Shunsuke; Oda, Mayumi; Yamazaki, Tomohide; Yamaguchi, Kiyoko; Amiya, Noriko; Takahashi, Akiyoshi; Amano, Masafumi; Goto, Tomoaki; Nozaki, Masumi; Meguro, Hiroshi; Kawauchi, Hiroshi

    2008-06-01

    Dogfish (Squalus acanthias) growth hormone (GH) was identified by cDNA cloning and protein purification from the pituitary gland. Dogfish GH cDNA encoded a prehormone of 210 amino acids (aa). Sequence analysis of purified GH revealed that the prehormone is composed of a signal peptide of 27 aa and a mature protein of 183 aa. Dogfish GH showed 94% sequence identity with blue shark GH, and also showed 37-66%, 26%, and 48-67% sequence identity with GH from osteichtyes, an agnathan, and tetrapods. The site of production was identified through immunocytochemistry to be cells of the proximal pars distalis of the pituitary gland. Dogfish GH stimulates both insulin-like growth factor-I and II mRNA levels in dogfish liver in vitro. The dogfish GH gene consisted of five exons and four introns, the same as in lamprey, teleosts such as cypriniforms and siluriforms, and tetrapods. The 5'-flanking region within 1082 bp of the transcription start site contained consensus sequences for the TATA box, Pit-1/GHF-1, CRE, TRE, and ERE. These results show that the endocrine mechanism for growth stimulation by the GH-IGF axis was established at an early stage of vertebrate evolution, and that the 5-exon-type gene organization might reflect the structure of the ancestral gene for the GH gene family.

  19. Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter.

    PubMed

    Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian

    2018-03-12

    ZmbZIP25 ( Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5' RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from -2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from -2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5'-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5'-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5'-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5'-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from -1117 to -957 that were responsible for the specificity of the ZmbZIP25 5'-flanking sequence.

  20. Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter

    PubMed Central

    Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian

    2018-01-01

    ZmbZIP25 (Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5′ RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from −2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from −2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5′-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5′-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5′-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5′-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from −1117 to −957 that were responsible for the specificity of the ZmbZIP25 5′-flanking sequence. PMID:29534529

  1. Molecular characterization and distribution of a 145-bp tandem repeat family in the genus Populus.

    PubMed

    Rajagopal, J; Das, S; Khurana, D K; Srivastava, P S; Lakshmikumaran, M

    1999-10-01

    This report aims to describe the identification and molecular characterization of a 145-bp tandem repeat family that accounts for nearly 1.5% of the Populus genome. Three members of this repeat family were cloned and sequenced from Populus deltoides and P. ciliata. The dimers of the repeat were sequenced in order to confirm the head-to-tail organization of the repeat. Hybridization-based analysis using the 145-bp tandem repeat as a probe on genomic DNA gave rise to ladder patterns which were identified to be a result of methylation and (or) sequence heterogeneity. Analysis of the methylation pattern of the repeat family using methylation-sensitive isoschizomers revealed variable methylation of the C residues and lack of methylation of the A residues. Sequence comparisons between the monomers revealed a high degree of sequence divergence that ranged between 6% and 11% in P. deltoides and between 4.2% and 8.3% in P. ciliata. This indicated the presence of sub-families within the 145-bp tandem family of repeats. Divergence was mainly due to the accumulation of point mutations and was concentrated in the central region of the repeat. The 145-bp tandem repeat family did not show significant homology to known tandem repeats from plants. A short stretch of 36 bp was found to show homology of 66.7% to a centromeric repeat from Chironomus plumosus. Dot-blot analysis and Southern hybridization data revealed the presence of the repeat family in 13 of the 14 Populus species examined. The absence of the 145-bp repeat from P. euphratica suggested that this species is relatively distant from other members of the genus, which correlates with taxonomic classifications. The widespread occurrence of the tandem family in the genus indicated that this family may be of ancient origin.

  2. A novel non prophage(-like) gene-intervening element within gerE that is reconstituted during sporulation in Bacillus cereus ATCC10987.

    PubMed

    Abe, Kimihiro; Shimizu, Shin-Ya; Tsuda, Shuhei; Sato, Tsutomu

    2017-09-12

    Gene rearrangement is a widely-shared phenomenon in spore forming bacteria, in which prophage(-like) elements interrupting sporulation-specific genes are excised from the host genome to reconstitute the intact gene. Here, we report a novel class of gene-intervening elements, named gin, inserted in the 225 bp gerE-coding region of the B. cereus ATCC10987 genome, which generates a sporulation-specific rearrangement. gin has no phage-related genes and possesses three site-specific recombinase genes; girA, girB, and girC. We demonstrated that the gerE rearrangement occurs at the middle stage of sporulation, in which site-specific DNA recombination took place within the 9 bp consensus sequence flanking the disrupted gerE segments. Deletion analysis of gin uncovered that GirC and an additional factor, GirX, are responsible for gerE reconstitution. Involvement of GirC and GirX in DNA recombination was confirmed by an in vitro recombination assay. These results broaden the definition of the sporulation-specific gene rearrangement phenomenon: gene-intervening elements are not limited to phage DNA but may include non-viral genetic elements that carry a developmentally-regulated site-specific recombination system.

  3. Characterization of BreR Interaction with the Bile Response Promoters breAB and breR in Vibrio cholerae

    PubMed Central

    Cerda-Maira, Francisca A.; Kovacikova, Gabriela; Jude, Brooke A.; Skorupski, Karen

    2013-01-01

    The Vibrio cholerae BreR protein is a transcriptional repressor of the breAB efflux system operon, which encodes proteins involved in bile resistance. In a previous study (F. A. Cerda-Maira, C. S. Ringelberg, and R. K. Taylor, J. Bacteriol. 190:7441–7452, 2008), we used gel mobility shift assays to determine that BreR binds at two independent binding sites at the breAB promoter and a single site at its own promoter. Here it is shown, by DNase I footprinting and site-directed mutagenesis, that BreR is able to bind at a distal and a proximal site in the breAB promoter. However, only one of these sites, the proximal 29-bp site, is necessary for BreR-mediated transcriptional repression of breAB expression. In addition, it was determined that BreR represses its own expression by recognizing a 28-bp site at the breR promoter. These sites comprise regions of dyad symmetry within which residues critical for BreR function could be identified. The BreR consensus sequence AANGTANAC-N6-GTNTACNTT overlaps the −35 region at both promoters, implying that the repression of gene expression is achieved by interfering with RNA polymerase binding at these promoters. PMID:23144245

  4. Identification and characterization of yak (Bos grunniens) b-Boule gene and its alternative splice variants.

    PubMed

    Li, Bojiang; Ngo, Sherry; Wu, Wangjun; Xu, Hongtao; Xie, Zhuang; Li, Qifa; Pan, Zengxiang

    2014-10-25

    Boule is responsible for meiotic arrest of sperms and male sterility during mammalian spermatogenesis. In the present study, we first identified yak b-Boule gene and its two alternative splice variants. The full length coding region of yak b-Boule is 888bp and encodes a 295-amino acid protein with a typical RNA-recognition motif (RRM) and a Deleted in Azoospermia (DAZ) repetitive sequence motif. Two alternative splice variants of yak b-Boule were generated following the consensus "GT-AG" rule and named b-Boule1 (36bp deletion in exon 3) and b-Boule2 (deletion of integral exon 7), respectively. In male yak, b-Boule, b-Boule1 and b-Boule2 were found to be exclusively expressed in the testes at a ratio of 81:0.1:1. Intriguingly, the mRNA expression levels of b-Boule and b-Boule1 in yak testis were significantly higher than those in cattle-yak, although no significant difference was observed for b-Boule2 expression between the yak and cattle-yak. These results suggest that b-Boule gene, which is partially regulated by alternative splicing, may be involved in the process of yak spermatogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. [Identification and phylogenetic application of unique nucleotide sequence of nad7 intron2 in Rhodiola (Crassulaceae) species].

    PubMed

    Deng, Ke-Jun; Yang, Zu-Jun; Liu, Cheng; Zhao, Wei; Liu, Chang; Feng, Juan; Ren, Zheng-Long

    2007-03-01

    Genetic characterization of 9 populations of Rhodiola crenulata, R. fastigiata and R. sachalinensis (Crassulaceae) species from Sichuan and Jilin Provinces of China, was investigated using the conserved primer of nad7 intron 2. All PCR products about 800 bp long were shorter than other Crassulaceae plants, which were used as molecular markers to identify the Rhodiola species. The sequence of the products indicated that total exon of 53 bp and intron of 738 bp exhibit only 9 nucleotide variations. Blasting the nad7 sequences to GenBank and the phylogenetic analysis showed that the sequence of Rhodiola species was clusted independently, and the length was smaller than all the registered sequences of higher plants. The result suggests that the Rhiodola species had a unique sequence in this gene region, which might be related to the special growth condition.

  6. The complete chloroplast genome sequence of Hibiscus syriacus.

    PubMed

    Kwon, Hae-Yun; Kim, Joon-Hyeok; Kim, Sea-Hyun; Park, Ji-Min; Lee, Hyoshin

    2016-09-01

    The complete chloroplast genome sequence of Hibiscus syriacus L. is presented in this study. The genome is composed of 161 019 bp in length, with a typical circular structure containing a pair of inverted repeats of 25 745 bp of length separated by a large single-copy region and a small single-copy region of 89 698 bp and 19 831 bp of length, respectively. The overall GC content is 36.8%. One hundred and fourteen genes were annotated, including 81 protein-coding genes, 4 ribosomal RNA genes and 29 transfer RNA genes.

  7. Complete Genome Sequences of 38 Gordonia sp. Bacteriophages

    PubMed Central

    Montgomery, Matthew T.; Bonilla, J. Alfred; Dejong, Randall; Garlena, Rebecca A.; Guerrero Bustamante, Carlos; Klyczek, Karen K.; Russell, Daniel A.; Wertz, John T.; Jacobs-Sera, Deborah; Hatfull, Graham F.

    2017-01-01

    ABSTRACT We report here the genome sequences of 38 newly isolated bacteriophages using Gordonia terrae 3612 (ATCC 25594) and Gordonia neofelifaecis NRRL59395 as bacterial hosts. All of the phages are double-stranded DNA (dsDNA) tail phages with siphoviral morphologies, with genome sizes ranging from 17,118 bp to 93,843 bp and spanning considerable nucleotide sequence diversity. PMID:28057748

  8. The complete chloroplast genome of Capsicum annuum var. glabriusculum using Illumina sequencing.

    PubMed

    Raveendar, Sebastin; Na, Young-Wang; Lee, Jung-Ro; Shim, Donghwan; Ma, Kyung-Ho; Lee, Sok-Young; Chung, Jong-Wook

    2015-07-20

    Chloroplast (cp) genome sequences provide a valuable source for DNA barcoding. Molecular phylogenetic studies have concentrated on DNA sequencing of conserved gene loci. However, this approach is time consuming and more difficult to implement when gene organization differs among species. Here we report the complete re-sequencing of the cp genome of Capsicum pepper (Capsicum annuum var. glabriusculum) using the Illumina platform. The total length of the cp genome is 156,817 bp with a 37.7% overall GC content. A pair of inverted repeats (IRs) of 50,284 bp were separated by a small single copy (SSC; 18,948 bp) and a large single copy (LSC; 87,446 bp). The number of cp genes in C. annuum var. glabriusculum is the same as that in other Capsicum species. Variations in the lengths of LSC; SSC and IR regions were the main contributors to the size variation in the cp genome of this species. A total of 125 simple sequence repeat (SSR) and 48 insertions or deletions variants were found by sequence alignment of Capsicum cp genome. These findings provide a foundation for further investigation of cp genome evolution in Capsicum and other higher plants.

  9. Identification and characterization of cell-specific enhancer elements for the mouse ETF/Tead2 gene.

    PubMed

    Tanoue, Y; Yasunami, M; Suzuki, K; Ohkubo, H

    2001-12-21

    We have identified and characterized by transient transfection assays the cell-specific 117-bp enhancer sequence in the first intron of the mouse ETF (Embryonic TEA domain-containing factor)/Tead2 gene required for transcriptional activation in ETF/Tead2 gene-expressing cells, such as P19 cells. The 117-bp enhancer contains one GC-rich sequence (5'-GGGGCGGGG-3'), termed the GC box, and two tandemly repeated GA-rich sequences (5'-GGGGGAGGGG-3'), termed the proximal and distal GA elements. Further analyses, including transfection studies and electrophoretic mobility shift assays using a series of deletion and mutation constructs, indicated that Sp1, a putative activator, may be required to predominate over its competition with another unknown putative repressor, termed the GA element-binding factor, for binding to both the GC box, which overlapped with the proximal GA element, and the distal GA element in the 117-bp sequence in order to achieve a full enhancer activity. We also discuss a possible mechanism underlying the cell-specific enhancer activity of the 117-bp sequence.

  10. Molecular cloning and characterization of novel phytocystatin gene from turmeric, Curcuma longa.

    PubMed

    Chan, Seow-Neng; Abu Bakar, Norliza; Mahmood, Maziah; Ho, Chai-Ling; Shaharuddin, Noor Azmi

    2014-01-01

    Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5'/3' rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis.

  11. Molecular Cloning and Characterization of Novel Phytocystatin Gene from Turmeric, Curcuma longa

    PubMed Central

    Chan, Seow-Neng; Abu Bakar, Norliza; Mahmood, Maziah; Ho, Chai-Ling

    2014-01-01

    Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5′/3′ rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis. PMID:25853138

  12. Exon–intron organization of genes in the slime mold Physarum polycephalum

    PubMed Central

    Trzcinska-Danielewicz, Joanna; Fronk, Jan

    2000-01-01

    The slime mold Physarum polycephalum is a morphologically simple organism with a large and complex genome. The exon–intron organization of its genes exhibits features typical for protists and fungi as well as those characteristic for the evolutionarily more advanced species. This indicates that both the taxonomic position as well as the size of the genome shape the exon–intron organization of an organism. The average gene has 3.7 introns which are on average 138 bp, with a rather narrow size distribution. Introns are enriched in AT base pairs by 13% relative to exons. The consensus sequences at exon–intron boundaries resemble those found for other species, with minor differences between short and long introns. A unique feature of P.polycephalum introns is the strong preference for pyrimidines in the coding strand throughout their length, without a particular enrichment at the 3′-ends. PMID:10982858

  13. SURVEY AND SUMMARY: exon-intron organization of genes in the slime mold Physarum polycephalum.

    PubMed

    Trzcinska-Danielewicz, J; Fronk, J

    2000-09-15

    The slime mold Physarum polycephalum is a morphologically simple organism with a large and complex genome. The exon-intron organization of its genes exhibits features typical for protists and fungi as well as those characteristic for the evolutionarily more advanced species. This indicates that both the taxonomic position as well as the size of the genome shape the exon-intron organization of an organism. The average gene has 3.7 introns which are on average 138 bp, with a rather narrow size distribution. Introns are enriched in AT base pairs by 13% relative to exons. The consensus sequences at exon-intron boundaries resemble those found for other species, with minor differences between short and long introns. A unique feature of P.polycephalum introns is the strong preference for pyrimidines in the coding strand throughout their length, without a particular enrichment at the 3'-ends.

  14. Multiple splicing defects in an intronic false exon.

    PubMed

    Sun, H; Chasin, L A

    2000-09-01

    Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

  15. BAC end sequencing of Pacific white shrimp Litopenaeus vannamei: a glimpse into the genome of Penaeid shrimp

    NASA Astrophysics Data System (ADS)

    Zhao, Cui; Zhang, Xiaojun; Liu, Chengzhang; Huan, Pin; Li, Fuhua; Xiang, Jianhai; Huang, Chao

    2012-05-01

    Little is known about the genome of Pacific white shrimp ( Litopenaeus vannamei). To address this, we conducted BAC (bacterial artificial chromosome) end sequencing of L. vannamei. We selected and sequenced 7 812 BAC clones from the BAC library LvHE from the two ends of the inserts by Sanger sequencing. After trimming and quality filtering, 11 279 BAC end sequences (BESs) including 4 609 pairedends BESs were obtained. The total length of the BESs was 4 340 753 bp, representing 0.18% of the L. vannamei haploid genome. The lengths of the BESs ranged from 100 bp to 660 bp with an average length of 385 bp. Analysis of the BESs indicated that the L. vannamei genome is AT-rich and that the primary repeats patterns were simple sequence repeats (SSRs) and low complexity sequences. Dinucleotide and hexanucleotide repeats were the most common SSR types in the BESs. The most abundant transposable element was gypsy, which may contribute to the generation of the large genome size of L. vannamei. We successfully annotated 4 519 BESs by BLAST searching, including genes involved in immunity and sex determination. Our results provide an important resource for functional gene studies, map construction and integration, and complete genome assembly for this species.

  16. Sequence Analysis of the Genome of Carnation (Dianthus caryophyllus L.)

    PubMed Central

    Yagi, Masafumi; Kosugi, Shunichi; Hirakawa, Hideki; Ohmiya, Akemi; Tanase, Koji; Harada, Taro; Kishimoto, Kyutaro; Nakayama, Masayoshi; Ichimura, Kazuo; Onozaki, Takashi; Yamaguchi, Hiroyasu; Sasaki, Nobuhiro; Miyahara, Taira; Nishizaki, Yuzo; Ozeki, Yoshihiro; Nakamura, Noriko; Suzuki, Takamasa; Tanaka, Yoshikazu; Sato, Shusei; Shirasawa, Kenta; Isobe, Sachiko; Miyamura, Yoshinori; Watanabe, Akiko; Nakayama, Shinobu; Kishida, Yoshie; Kohara, Mitsuyo; Tabata, Satoshi

    2014-01-01

    The whole-genome sequence of carnation (Dianthus caryophyllus L.) cv. ‘Francesco’ was determined using a combination of different new-generation multiplex sequencing platforms. The total length of the non-redundant sequences was 568 887 315 bp, consisting of 45 088 scaffolds, which covered 91% of the 622 Mb carnation genome estimated by k-mer analysis. The N50 values of contigs and scaffolds were 16 644 bp and 60 737 bp, respectively, and the longest scaffold was 1 287 144 bp. The average GC content of the contig sequences was 36%. A total of 1050, 13, 92 and 143 genes for tRNAs, rRNAs, snoRNA and miRNA, respectively, were identified in the assembled genomic sequences. For protein-encoding genes, 43 266 complete and partial gene structures excluding those in transposable elements were deduced. Gene coverage was ∼98%, as deduced from the coverage of the core eukaryotic genes. Intensive characterization of the assigned carnation genes and comparison with those of other plant species revealed characteristic features of the carnation genome. The results of this study will serve as a valuable resource for fundamental and applied research of carnation, especially for breeding new carnation varieties. Further information on the genomic sequences is available at http://carnation.kazusa.or.jp. PMID:24344172

  17. Mechanism of estrogen activation of c-myc oncogene expression.

    PubMed

    Dubik, D; Shiu, R P

    1992-08-01

    The estrogen receptor complex is a known trans-acting factor that regulates transcription of specific genes through an interaction with a specific estrogen-responsive cis-acting element (ERE). In previous studies we have shown that in estrogen-responsive human breast cancer cells estrogen rapidly activates c-myc expression. This activated expression occurs through enhanced transcription and does not require the synthesis of new protein intermediates; therefore, an ERE is present in the human c-myc gene regulatory region. To localize the ERE, constructs containing varying lengths of the c-myc 5'-flanking region ranging from -2327 to +25 (relative to the P1 promoter) placed adjacent to the chloramphenicol acetyl transferase reporter gene (CAT) were prepared. They were used in transient transfection studies in MCF-7 and HeLa cells co-transfected with an estrogen receptor expression vector. These studies reveal that all constructs containing the P2 promoter region exhibited estrogen-regulated CAT expression and that a 116-bp region upstream and encompassing the P2 TATA box is necessary for this activity. Analysis of this 116-bp region failed to identify a cis-acting element with sequences resembling the consensus ERE; however, co-transfection studies with mutant estrogen receptor expression vectors showed that the DNA-binding domain of the receptor is essential for estrogen-regulated CAT gene expression. We have also observed that anti-estrogen receptor complexes can weakly trans-activate from this 116-bp region but fail to do so from the ERE-containing ApoVLDLII-CAT construct. To explain these results we propose a new mechanism of estrogen trans-activation in the c-myc gene promoter.

  18. Repeatability of clades as a criterion of reliability: a case study for molecular phylogeny of Acanthomorpha (Teleostei) with larger number of taxa.

    PubMed

    Chen, Wei-Jen; Bonillo, Céline; Lecointre, Guillaume

    2003-02-01

    Although much progress has been made recently in teleostean phylogeny, relationships among the main lineages of the higher teleosts (Acanthomorpha), containing more than 60% of all fish species, remain poorly defined. This study represents the most extensive taxonomic sampling effort to date to collect new molecular characters for phylogenetic analysis of acanthomorph fishes. We compiled and analyzed three independent data sets, including: (i) mitochondrial ribosomal fragments from 12S and 16s (814bp for 97 taxa); (ii) nuclear ribosomal 28S sequences (847bp for 74 taxa); and (iii) a nuclear protein-coding gene, rhodopsin (759bp for 86 taxa). Detailed analyses were conducted on each data set separately and the principle of taxonomic congruence without consensus trees was used to assess confidence in the results as follows. Repeatability of clades from separate analyses was considered the primary criterion to establish reliability, rather than bootstrap proportions from a single combined (total evidence) data matrix. The new and reliable clades emerging from this study of the acanthomorph radiation were: Gadiformes (cods) with Zeioids (dories); Beloniformes (needlefishes) with Atheriniformes (silversides); blenioids (blennies) with Gobiesocoidei (clingfishes); Channoidei (snakeheads) with Anabantoidei (climbing gouramies); Mastacembeloidei (spiny eels) with Synbranchioidei (swamp-eels); the last two pairs of taxa grouping together, Syngnathoidei (aulostomids, macroramphosids) with Dactylopteridae (flying gurnards); Scombroidei (mackerels) plus Stromatoidei plus Chiasmodontidae; Ammodytidae (sand lances) with Cheimarrhichthyidae (torrentfish); Zoarcoidei (eelpouts) with Cottoidei; Percidae (perches) with Notothenioidei (Antarctic fishes); and a clade grouping Carangidae (jacks), Echeneidae (remoras), Sphyraenidae (barracudas), Menidae (moonfish), Polynemidae (threadfins), Centropomidae (snooks), and Pleuronectiformes (flatfishes).

  19. Plasmid origin of replication of herpesvirus papio: DNA sequence and enhancer function.

    PubMed Central

    Loeb, D D; Sung, N S; Pesano, R L; Sexton, C J; Hutchison, C; Pagano, J S

    1990-01-01

    Herpesvirus papio (HVP) is a lymphotropic virus of baboons which is related to Epstein-Barr virus (EBV) and produces latent infection. The nucleotide sequence of the 5,775-base-pair (bp) EcoRI K fragment of HVP, which has previously been shown to confer the ability to replicate autonomously, has been determined. Within this DNA fragment is a region which bears structural and sequence similarity to the ori-P region of EBV. The HVP ori-P region has a 10- by 26-bp tandem array which is related to the 20- by 30-bp tandem array from the EBV ori-P region. In HVP there is an intervening region of 764 bp followed by five partial copies of the 26-bp monomer. Both the EBV and HVP 3' regions have the potential to form dyad structures which, however, differ in arrangement. We also demonstrate that a transcriptional enhancer which requires transactivation by a virus-encoded factor is present in the HVP ori-P. Images PMID:2159548

  20. Comparison of pulsed-field gel electrophoresis and enterobacterial repetitive intergenic consensus PCR and biochemical tests to characterize Lactococcus garvieae.

    PubMed

    Ture, M; Altinok, I; Capkin, E

    2015-01-01

    Biochemical test, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR) were used to compare 42 strains of Lactococcus garvieae isolated from different regions of Turkey, Italy, France and Spain. Twenty biotypes of L. garvieae were formed based on 54 biochemical tests. ERIC-PCR of genomic DNA from different L. garvieae strains resulted in amplification of multiple fragments of DNA in sizes ranging between 200 and 5000 bp with various band intensities. After cutting DNA with ApaI restriction enzyme and running on the PFGE, 11–22 resolvable bands ranging from 2 to 194 kb were observed. Turkish isolates were grouped into two clusters, and only A58 (Italy) strain was connected with Turkish isolates. Similarities between Turkish, Spanish, Italian and French isolates were <50% except 216-6 Rize strain. In Turkey, first lactococcosis occurred in Mugla, and then, it has been spread all over the country. Based on ERIC-PCR, Spanish and Italian strains of L. garvieae were related to Mugla strains. Therefore, after comparing PFGE profiles, ERIC-PCR profiles and phenotypic characteristics of 42 strains of L. garvieae, there were no relationships found between these three typing methods. PFGE method was more discriminative than the other methods. © 2014 John Wiley & Sons Ltd.

  1. Divergent homologs of the predicted small RNA BpCand697 in Burkholderia spp.

    NASA Astrophysics Data System (ADS)

    Damiri, Nadzirah; Mohd-Padil, Hirzahida; Firdaus-Raih, Mohd

    2015-09-01

    The small RNA (sRNA) gene candidate, BpCand697 was previously reported to be unique to Burkholderia spp. and is encoded at 3' non-coding region of a putative AraC family transcription regulator gene. This study demonstrates the conservation of BpCand697 sequence across 32 Burkholderia spp. including B. pseudomallei, B. mallei, B. thailandensis and Burkholderia sp. by integrating both sequence homology and secondary structural analyses of BpCand697 within the dataset. The divergent sequence of BpCand697 was also used as a discriminatory power in clustering the dataset according to the potential virulence of Burkholderia spp., showing that B. thailandensis was clearly secluded from the virulent cluster of B. pseudomallei and B. mallei. Finally, the differential co-transcript expression of BpCand697 and its flanking gene, bpsl2391 was detected in Burkholderia pseudomallei D286 after grown under two different culture conditions using nutrient-rich and minimal media. It is hypothesized that the differential expression of BpCand697-bpsl2391 co-transcript between the two standard prepared media might correlate with nutrient availability in the culture media, suggesting that the physical co-localization of BpCand697 in B. pseudomallei D286 might be directly or indirectly involved with the transcript regulation of bpsl2391 under the selected in vitro culture conditions.

  2. The complete plastid genome sequence of Eustrephus latifolius (Asparagaceae: Lomandroideae).

    PubMed

    Kim, Hyoung Tae; Kim, Jung Sung; Kim, Joo-Hwan

    2016-01-01

    The complete chloroplast (cp) genome sequence of Eustrephus latifolius was firstly determined in subfamily Lomandriodeae of family Asparagaceae. It was 159,736 bp and contained a large single copy region (82,403 bp) and a small single copy region (13,607 bp) which were separated by two inverted repeat regions (31,863 bp). In total, 132 genes were identified and they were consisted of 83 coding genes, 8 rRNA genes, 38 tRNA genes, 3 pseudogenes. rpl23 and clpP were pseudogenes due to sequence deletions. Among 23 genes containing introns, rps12 and ycf3 contained two introns and the rest had just one intron. The intact ycf68 was identified within an intron of trnI-GAU. The amino acid sequence was almost identical with Phoenix dactylifera in Aracales. Ycf1 of E. latifolius was completely located in IR. It was similar to cp genome structure of Lemna minor, Spirodela polyrhiza, Wolffiella lingulata, Wolffia australiana in Alismatales.

  3. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    NASA Astrophysics Data System (ADS)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  4. Carboxy-terminal sequence variation of LMP1 gene in Epstein-Barr-virus-associated mononucleosis and tumors from Serbian patients.

    PubMed

    Banko, Ana; Lazarevic, Ivana; Cupic, Maja; Stevanovic, Goran; Boricic, Ivan; Jovanovic, Tanja

    2012-04-01

    Seven strains of Epstein-Barr virus (EBV) are defined based on C-terminal sequence variations of the latent membrane protein 1 (LMP1). Some strains, especially those with a 30-bp deletion, are thought to be related to tumorigenic activity and geographical localization. The aims of the study were to determine the prevalence of different LMP1 strains and to investigate sequence variation in the C-terminal region of LMP1 in Serbian isolates. This study included 53 EBV-DNA-positive plasma and tissue block samples from patients with mononucleosis syndrome, renal transplantation, and tumors, mostly nasopharyngeal carcinoma. The sequence of the 506-bp fragment of LMP1 C terminus was used for phylogenetic analyses and identification of LMP1 strains, deletions, and mutations. The majority of isolates were non-deleted (66%), and the rest had 30-bp, rare 69-bp, or yet unknown 27-bp deletions, which were not related to malignant or non-malignant isolate origin. However, the majority of 69-bp deletion isolates were derived from patients with nasopharyngeal carcinoma. Less than five 33-bp repeats were found in the majority of non-deleted isolates (68.6%), whereas most 69-bp deletion isolates (75%) had five or six repeats. Serbian isolates were assigned to four LMP1 strains: B95-8 (32.1%), China 1 (24.5%), North Carolina (NC; 18.9%), and Mediterranean (Med; 24.5%). In NC isolates, three new mutations unique for this strain were identified. EBV EBNA2 genotypes 1 and 2 were both found, with dominance of genotype 1 (90.7%). This study demonstrated noticeable geographical-associated characteristics in the LMP1 C terminus of investigated isolates. Copyright © 2012 Wiley Periodicals, Inc.

  5. Late Holocene stratigraphy of the Tetimpa archaeological sites, northeast flank of Popocatepetl volcano, central Mexico

    USGS Publications Warehouse

    Panfil, M.S.; Gardner, T.W.; Hirth, K.G.

    1999-01-01

    Late Holocene (240 km2 on the east side of the volcano with >25 cm of tephra. Lavas from eruptive sequence I dammed drainage in the lowland area near the town of San Nicolas and caused local upstream deposition of as much as 30 m of lacustrine silts, clays, and sands. These lacustrine deposits record an eruptive hiatus for the Tetimpa area of about 750 14C yr: between ca. 2100 and ca. 1350 yr B.P., no major tephras were deposited in the Tetimpa area. In upland areas, this time period is represented by an unconformity and by Entisols formed in the top of pumice deposits and lavas from eruptive sequence I. Artifacts, agricultural furrows, and dwellings record human reoccupation of this surface. At the end of this hiatus, several lahars were deposited above the lacustrine sequence and locally above the Entisol in upland positions adjacent to streams. Between ca. 1350 and ca. 1200 yr B.P., tephras from eruptive sequence II buried these paleosols, occupation sites, lacustrine sediments, and lahars. Andesitic (~62% SiO2) pumice lapilli deposits in the Tetimpa area record three pumice-fall eruptions directed northeast and east of the crater. The first and smallest of these (maximum Tetimpa area thickness = 12 cm; >52 km2 covered by >25 cm) took place at ca. 1350 yr B.P. and was accompanied by pyroclastic surge events preserved in the Tetimpa area by charcoal, sand waves, and cross-stratified sand-sized tephra. At ca. 1200 yr B.P., the products of two Plinian-style events and additional pyroclastic surges reached the Tetimpa area. The largest of these tephra-fall events covered the Tetimpa area with 0.5-1 m of tephra and blanketed an area of >230 km2 with a thickness of >25 cm. The Tetimpa record confirms two of the four periods of explosive volcanism recognized by studies conducted around Popocatepetl in the past 30 yr. Eruptive sequence I corresponds to the explosive period between 2100 and 2500 yr B.P., and eruptive sequence II corresponds to the period between 900 and 1400 yr B.P. The archaeology and lacustrine stratigraphy of the Tetimpa area help constrain the timing of the Plinian phase of eruptive sequence I to ca. 2100 yr B.P. and suggest that the pumice-fall eruptions of eruptive sequence II took place in at least two intervals between ca. 1350 and ca. 1200 yr B.P.

  6. Evaluation of the genetic diversity of Plum pox virus in a single plum tree.

    PubMed

    Predajňa, Lukáš; Šubr, Zdeno; Candresse, Thierry; Glasa, Miroslav

    2012-07-01

    Genetic diversity of Plum pox virus (PPV) and its distribution within a single perennial woody host (plum, Prunus domestica) has been evaluated. A plum tree was triply infected by chip-budding with PPV-M, PPV-D and PPV-Rec isolates in 2003 and left to develop untreated under open field conditions. In September 2010 leaf and fruit samples were collected from different parts of the tree canopy. A 745-bp NIb-CP fragment of PPV genome, containing the hypervariable region encoding the CP N-terminal end was amplified by RT-PCR from each sample and directly sequenced to determine the dominant sequence. In parallel, the PCR products were cloned and a total of 105 individual clones were sequenced. Sequence analysis revealed that after 7 years of infection, only PPV-M was still detectable in the tree and that the two other isolates (PPV-Rec and PPV-D) had been displaced. Despite the fact that the analysis targeted a relatively short portion of the genome, a substantial amount of intra-isolate variability was observed for PPV-M. A total of 51 different haplotypes could be identified from the 105 individual sequences, two of which were largely dominant. However, no clear-cut structuration of the viral population by the tree architecture could be highlighted although the results obtained suggest the possibility of intra-leaf/fruit differentiation of the viral population. Comparison of the consensus sequence with the original source isolate showed no difference, suggesting within-plant stability of this original isolate under open field conditions. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Effects of weather conditions on emergency ambulance calls for acute coronary syndromes

    NASA Astrophysics Data System (ADS)

    Vencloviene, Jone; Babarskiene, Ruta; Dobozinskas, Paulius; Siurkaite, Viktorija

    2015-08-01

    The aim of this study was to evaluate the relationship between weather conditions and daily emergency ambulance calls for acute coronary syndromes (ACS). The study included data on 3631 patients who called the ambulance for chest pain and were admitted to the department of cardiology as patients with ACS. We investigated the effect of daily air temperature ( T), barometric pressure (BP), relative humidity, and wind speed (WS) to detect the risk areas for low and high daily volume (DV) of emergency calls. We used the classification and regression tree method as well as cluster analysis. The clusters were created by applying the k-means cluster algorithm using the standardized daily weather variables. The analysis was performed separately during cold (October-April) and warm (May-September) seasons. During the cold period, the greatest DV was observed on days of low T during the 3-day sequence, on cold and windy days, and on days of low BP and high WS during the 3-day sequence; low DV was associated with high BP and decreased WS on the previous day. During June-September, a lower DV was associated with low BP, windless days, and high BP and low WS during the 3-day sequence. During the warm period, the greatest DV was associated with increased BP and changing WS during the 3-day sequence. These results suggest that daily T, BP, and WS on the day of the ambulance call and on the two previous days may be prognostic variables for the risk of ACS.

  8. The complete chloroplast genome sequence of Dianthus superbus var. longicalycinus.

    PubMed

    Gurusamy, Raman; Lee, Do-Hyung; Park, SeonJoo

    2016-05-01

    The complete chloroplast genome (cpDNA) sequence of Dianthus superbus var. longicalycinus is an economically important traditional Chinese medicine was reported and characterized. The cpDNA of Dianthus superbus var. longicalycinus is 149,539 bp, with 36.3% GC content. A pair of inverted repeats (IRs) of 24,803 bp is separated by a large single-copy region (LSC, 82,805 bp) and a small single-copy region (SSC, 17,128 bp). It encodes 85 protein-coding genes, 36 tRNA genes and 8 rRNA genes. Of 129 individual genes, 13 genes encoded one intron and three genes have two introns.

  9. The complete chloroplast genome sequence of Dendrobium nobile.

    PubMed

    Yan, Wenjin; Niu, Zhitao; Zhu, Shuying; Ye, Meirong; Ding, Xiaoyu

    2016-11-01

    The complete chloroplast (cp) genome sequence of Dendrobium nobile, an endangered and traditional Chinese medicine with important economic value, is presented in this article. The total genome size is 150,793 bp, containing a large single copy (LSC) region (84,939 bp) and a small single copy region (SSC) (13,310 bp) which were separated by two inverted repeat (IRs) regions (26,272 bp). The overall GC contents of the plastid genome were 38.8%. In total, 130 unique genes were annotated and they were consisted of 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. Fourteen genes contained one or two introns.

  10. The complete chloroplast genome sequence of Curcuma flaviflora (Curcuma).

    PubMed

    Zhang, Yan; Deng, Jiabin; Li, Yangyi; Gao, Gang; Ding, Chunbang; Zhang, Li; Zhou, Yonghong; Yang, Ruiwu

    2016-09-01

    The complete chloroplast (cp) genome of Curcuma flaviflora, a medicinal plant in Southeast Asia, was sequenced. The genome size was 160 478 bp in length, with 36.3% GC content. A pair of inverted repeats (IRs) of 26 946 bp were separated by a large single copy (LSC) of 88 008 bp and a small single copy (SSC) of 18 578 bp, respectively. The cp genome contained 132 annotated genes, including 79 protein coding genes, 30 tRNA genes, and four rRNA genes. And 19 of these genes were duplicated in inverted repeat regions.

  11. Guidance on home blood pressure monitoring: A statement of the HOPE Asia Network.

    PubMed

    Kario, Kazuomi; Park, Sungha; Buranakitjaroen, Peera; Chia, Yook-Chin; Chen, Chen-Huan; Divinagracia, Romeo; Hoshide, Satoshi; Shin, Jinho; Siddique, Saulat; Sison, Jorge; Soenarta, Arieska Ann; Sogunuru, Guru Prasad; Tay, Jam Chin; Turana, Yuda; Wong, Lawrence; Zhang, Yuqing; Wang, Ji-Guang

    2018-03-01

    Hypertension is an important modifiable cardiovascular risk factor and a leading cause of death throughout Asia. Effective prevention and control of hypertension in the region remain a significant challenge despite the availability of several regional and international guidelines. Out-of-office measurement of blood pressure (BP), including home BP monitoring (HBPM), is an important hypertension management tool. Home BP is better than office BP for predicting cardiovascular risk and HBPM should be considered for all patients with office BP ≥ 130/85 mm Hg. It is important that HBPM is undertaken using a validated device and patients are educated about how to perform HBPM correctly. During antihypertensive therapy, monitoring of home BP control and variability is essential, especially in the morning. This is because HBPM can facilitate the choice of individualized optimal therapy. The evidence and practice points in this document are based on the Hypertension Cardiovascular Outcome Prevention and Evidence (HOPE) Asia Network expert panel consensus recommendations for HBPM in Asia. ©2018 Wiley Periodicals, Inc.

  12. Generation and Characterization of HIV-1 Transmitted and Founder Virus Consensus Sequence from Intravenous Drug Users in Xinjiang, China.

    PubMed

    Li, Fan; Ma, Liying; Feng, Yi; Hu, Jing; Ni, Na; Ruan, Yuhua; Shao, Yiming

    2017-06-01

    HIV-1 transmission in intravenous drug users (IDUs) has been characterized by high genetic multiplicity and suggests a greater challenge for HIV-1 infection blocking. We investigated a total of 749 sequences of full-length gp160 gene obtained by single genome sequencing (SGS) from 22 HIV-1 early infected IDUs in Xinjiang province, northwest China, and generated a transmitted and founder virus (T/F virus) consensus sequence (IDU.CON). The T/F virus was classified as subtype CRF07_BC and predicted to be CCR5-tropic virus. The variable region (V1, V2, and V4 loop) of IDU.CON showed length variation compared with the heterosexual T/F virus consensus sequence (HSX.CON) and homosexual T/F virus consensus sequence (MSM.CON). A total of 26 N-linked glycosylation sites were discovered in the IDU.CON sequence, which is less than that of MSM.CON and HSX.CON. Characterization of T/F virus from IDUs highlights the genetic make-up and complexity of virus near the moment of transmission or in early infection preceding systemic dissemination and is important toward the development of an effective HIV-1 preventive methods, including vaccines.

  13. Design of the hairpin ribozyme for targeting specific RNA sequences.

    PubMed

    Hampel, A; DeYoung, M B; Galasinski, S; Siwkowski, A

    1997-01-01

    The following steps should be taken when designing the hairpin ribozyme to cleave a specific target sequence: 1. Select a target sequence containing BN*GUC where B is C, G, or U. 2. Select the target sequence in areas least likely to have extensive interfering structure. 3. Design the conventional hairpin ribozyme as shown in Fig. 1, such that it can form a 4 bp helix 2 and helix 1 lengths up to 10 bp. 4. Synthesize this ribozyme from single-stranded DNA templates with a double-stranded T7 promoter. 5. Prepare a series of short substrates capable of forming a range of helix 1 lengths of 5-10 bp. 6. Identify these by direct RNA sequencing. 7. Assay the extent of cleavage of each substrate to identify the optimal length of helix 1. 8. Prepare the hairpin tetraloop ribozyme to determine if catalytic efficiency can be improved.

  14. [Cloning and sequence analysis of full-length cDNA of secoisolariciresinol dehydrogenase of Dysosma versipellis].

    PubMed

    Xu, Li; Ding, Zhi-Shan; Zhou, Yun-Kai; Tao, Xue-Fen

    2009-06-01

    To obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis by RACE PCR,then investigate the character of Secoisolariciresinol Dehydrogenase gene. The full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene was obtained by 3'-RACE and 5'-RACE from Dysosma versipellis. We first reported the full cDNA sequences of Secoisolariciresinol Dehydrogenase in Dysosma versipellis. The acquired gene was 991bp in full length, including 5' untranslated region of 42bp, 3' untranslated region of 112bp with Poly (A). The open reading frame (ORF) encoding 278 amino acid with molecular weight 29253.3 Daltons and isolectric point 6.328. The gene accession nucleotide sequence number in GeneBank was EU573789. Semi-quantitative RT-PCR analysis revealed that the Secoisolariciresinol Dehydrogenase gene was highly expressed in stem. Alignment of the amino acid sequence of Secoisolariciresinol Dehydrogenase indicated there may be some significant amino acid sequence difference among different species. Obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis.

  15. Complete chloroplast genome and 45S nrDNA sequences of the medicinal plant species Glycyrrhiza glabra and Glycyrrhiza uralensis.

    PubMed

    Kang, Sang-Ho; Lee, Jeong-Hoon; Lee, Hyun Oh; Ahn, Byoung Ohg; Won, So Youn; Sohn, Seong-Han; Kim, Jung Sun

    2017-10-06

    Glycyrrhiza uralensis and G. glabra, members of the Fabaceae, are medicinally important species that are native to Asia and Europe. Extracts from these plants are widely used as natural sweeteners because of their much greater sweetness than sucrose. In this study, the three complete chloroplast genomes and five 45S nuclear ribosomal (nr)DNA sequences of these two licorice species and an interspecific hybrid are presented. The chloroplast genomes of G. glabra, G. uralensis and G. glabra × G. uralensis were 127,895 bp, 127,716 bp and 127,939 bp, respectively. The three chloroplast genomes harbored 110 annotated genes, including 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The 45S nrDNA sequences were either 5,947 or 5,948 bp in length. Glycyrrhiza glabra and G. glabra × G. uralensis showed two types of nrDNA, while G. uralensis contained a single type. The complete 45S nrDNA sequence unit contains 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 26S rRNA. We identified simple sequence repeat and tandem repeat sequences. We also developed four reliable markers for analysis of Glycyrrhiza diversity authentication.

  16. Phylogenetic Relationship in Different Commercial Strains of Pleurotus nebrodensis Based on ITS Sequence and RAPD.

    PubMed

    Alam, Nuhu; Shim, Mi Ja; Lee, Min Woong; Shin, Pyeong Gyun; Yoo, Young Bok; Lee, Tae Soo

    2009-09-01

    The molecular phylogeny in nine different commercial cultivated strains of Pleurotus nebrodensis was studied based on their internal transcribed spacer (ITS) region and RAPD. In the sequence of ITS region of selected strains, it was revealed that the total length ranged from 592 to 614 bp. The size of ITS1 and ITS2 regions varied among the strains from 219 to 228 bp and 211 to 229 bp, respectively. The sequence of ITS2 was more variable than ITS1 and the region of 5.8S sequences were identical. Phylogenetic tree of the ITS region sequences indicated that selected strains were classified into five clusters. The reciprocal homologies of the ITS region sequences ranged from 99 to 100%. The strains were also analyzed by RAPD with 20 arbitrary primers. Twelve primers were efficient to applying amplification of the genomic DNA. The sizes of the polymorphic fragments obtained were in the range of 200 to 2000 bp. RAPD and ITS analysis techniques were able to detect genetic variation among the tested strains. Experimental results suggested that IUM-1381, IUM-3914, IUM-1495 and AY-581431 strains were genetically very similar. Therefore, all IUM and NCBI gene bank strains of P. nebrodensis were genetically same with some variations.

  17. The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

    PubMed Central

    Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

    1982-01-01

    The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

  18. Porcine calbindin-D9k gene: expression in endometrium, myometrium, and placenta in the absence of a functional estrogen response element in intron A.

    PubMed

    Krisinger, J; Jeung, E B; Simmen, R C; Leung, P C

    1995-01-01

    The expression of Calbindin-D9k (CaBP-9k) in the pig uterus and placenta was measured by Northern blot analysis and reverse transcription polymerase chain reaction (PCR), respectively. Progesterone (P4) administration to ovariectomized pigs decreased CaBP-9k mRNA levels. Expression of endometrial CaBP-9k mRNA was high on pregnancy Days 10-12 and below the detection limit on Days 15 and 18. On Day 60, expression could be detected at low levels. In myometrium and placenta, CaBP-9k mRNA expression was not detectable by Northern analysis using total RNA. Reverse-transcribed RNA from both tissues demonstrated the presence of CaBP-9k transcripts by means of PCR. The partial CaBP-9k gene was amplified by PCR and cloned to determine the sequence of intron A. In contrast to the rat CaBP-9k gene, the pig gene does not contain a functional estrogen response element (ERE) within this region. A similar ERE-like sequence located at the identical location was examined by gel retardation analysis and failed to bind the estradiol receptor. A similar disruption of this ERE-like sequence has been described in the human CaBP-9k gene, which is not expressed at any level in placenta, myometrium, or endometrium. It is concluded that the pig CaBP-9k gene is regulated in these reproductive tissues in a manner distinct from that in rat and human tissues. The regulation is probably due to a regulatory region outside of intron A, which in the rat gene contains the key cis element for uterine expression of the CaBP-9k gene.

  19. Sequence analysis of the genome of carnation (Dianthus caryophyllus L.).

    PubMed

    Yagi, Masafumi; Kosugi, Shunichi; Hirakawa, Hideki; Ohmiya, Akemi; Tanase, Koji; Harada, Taro; Kishimoto, Kyutaro; Nakayama, Masayoshi; Ichimura, Kazuo; Onozaki, Takashi; Yamaguchi, Hiroyasu; Sasaki, Nobuhiro; Miyahara, Taira; Nishizaki, Yuzo; Ozeki, Yoshihiro; Nakamura, Noriko; Suzuki, Takamasa; Tanaka, Yoshikazu; Sato, Shusei; Shirasawa, Kenta; Isobe, Sachiko; Miyamura, Yoshinori; Watanabe, Akiko; Nakayama, Shinobu; Kishida, Yoshie; Kohara, Mitsuyo; Tabata, Satoshi

    2014-06-01

    The whole-genome sequence of carnation (Dianthus caryophyllus L.) cv. 'Francesco' was determined using a combination of different new-generation multiplex sequencing platforms. The total length of the non-redundant sequences was 568,887,315 bp, consisting of 45,088 scaffolds, which covered 91% of the 622 Mb carnation genome estimated by k-mer analysis. The N50 values of contigs and scaffolds were 16,644 bp and 60,737 bp, respectively, and the longest scaffold was 1,287,144 bp. The average GC content of the contig sequences was 36%. A total of 1050, 13, 92 and 143 genes for tRNAs, rRNAs, snoRNA and miRNA, respectively, were identified in the assembled genomic sequences. For protein-encoding genes, 43 266 complete and partial gene structures excluding those in transposable elements were deduced. Gene coverage was ∼ 98%, as deduced from the coverage of the core eukaryotic genes. Intensive characterization of the assigned carnation genes and comparison with those of other plant species revealed characteristic features of the carnation genome. The results of this study will serve as a valuable resource for fundamental and applied research of carnation, especially for breeding new carnation varieties. Further information on the genomic sequences is available at http://carnation.kazusa.or.jp. © The Author 2013. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  20. Evolutionary diversity and potential recombinogenic role of integration targets of non-LTR retrotransposons

    PubMed Central

    Gentles, Andrew J.; Kohany, Oleksiy; Jurka, Jerzy

    2005-01-01

    Short interspersed elements (SINEs) make up a significant fraction of total DNA in mammalian genomes, providing a rich substrate for chromosomal rearrangements by SINE-SINE recombinations. Proliferation of mammalian SINEs is mediated primarily by LINE1 (L1) non-LTR retrotransposons that preferentially integrate at DNA sequence targets with average length ~15 bp and containing conserved endonucleolytic nicking signals at both ends. We report that sequence variations in the first of the two nicking signals, represented by a 5′TT-AAAA consensus sequence, affect the position of the second signal thus leading to target site duplications (TSDs) of different lengths. The length distribution of TSDs appears to be affected also by L1-encoded enzyme variants, since targets with the same 5′ nicking site can be of different average length in different mammalian species. Taking this into account, we re-analyzed the second nicking site and found that it is larger and includes more conserved sites than previously appreciated, with a consensus of 5′ANTNTN-AA. We also studied potential involvement of the nicking sites in stimulating recombinations between SINE elements. We determined that SINE elements retaining TSDs with perfect 5′TT-AAAA nicking sites appear to be lost relatively rapidly from the human and rat genomes, and less rapidly from dog. We speculate that the introduction of single-strand DNA breaks induced by recurring endonucleolytic attacks at these sites, combined with the ubiquitousness of SINEs, may significantly promote recombination between repetitive elements, leading to the observed losses. At the same time new L1 subfamilies may be selected for “incompatibility” with pre-existing targets. This provides a possible driving force for the continual emergence of new L1 subfamilies which, in turn, may affect selection of L1-dependent SINE subfamilies. PMID:15944437

  1. A complete mitochondrial genome sequence of Asian black bear Sichuan subspecies (Ursus thibetanus mupinensis)

    PubMed Central

    Hou, Wan-ru; Chen, Yu; Wu, Xia; Hu, Jin-chu; Peng, Zheng-song; Yang, Jung; Tang, Zong-xiang; Zhou, Cai-Quan; Li, Yu-ming; Yang, Shi-kui; Du, Yu-jie; Kong, Ling-lu; Ren, Zheng-long; Zhang, Huai-yu; Shuai, Su-rong

    2007-01-01

    We obtained the complete mitochondrial genome of U.thibetanus mupinensis by DNA sequencing based on the PCR fragments of 18 primers we designed. The results indicate that the mtDNA is 16 868 bp in size, encodes 13 protein genes, 22 tRNA genes, and 2 rRNA genes, with an overall H-strand base composition of 31.2% A, 25.4% C, 15.5% G and 27.9% T. The sequence of the control region (CR) located between tRNA-Pro and tRNA-Phe is 1422 bp in size, consists of 8.43% of the whole genome, GC content is 51.9% and has a 6bp tandem repeat and two 10bp tandem repeats identified by using the Tandem Repeats Finder. U. thibetanus mupinensis mitochondrial genome shares high similarity with those of three other Ursidae: U. americanus (91.46%), U. arctos (89.25%) and U. maritimus (87.66%). PMID:17205108

  2. Complete chloroplast genome of Prunus yedoensis Matsum.(Rosaceae), wild and endemic flowering cherry on Jeju Island, Korea.

    PubMed

    Cho, Myong-Suk; Hyun Cho, Chung; Yeon Kim, Su; Su Yoon, Hwan; Kim, Seung-Chul

    2016-09-01

    The complete chloroplast genome sequences of the wild flowering cherry, Prunus yedoensis Matsum., which is native and endemic to Jeju Island, Korea, is reported in this study. The genome size is 157 786 bp in length with 36.7% GC content, which is composed of LSC region of 85 908 bp, SSC region of 19 120 bp and two IR copies of 26 379 bp each. The cp genome contains 131 genes, including 86 coding genes, 8 rRNA genes and 37 tRNA genes. The maximum likelihood analysis was conducted to verify a phylogenetic position of the newly sequenced cp genome of P. yedoensis using 11 representatives of complete cp genome sequences within the family Rosaceae. The genus Prunus exhibited monophyly and the result of the phylogenetic relationship agreed with the previous phylogenetic analyses within Rosaceae.

  3. Genetic Characterization of Fasciola Isolates from West Azerbaijan Province Iran Based on ITS1 and ITS2 Sequence of Ribosomal DNA

    PubMed Central

    GALAVANI, Hossein; GHOLIZADEH, Saber; HAZRATI TAPPEH, Khosrow

    2016-01-01

    Background: Fascioliasis, caused by Fasciola hepatica and F. gigantica, has medical and economic importance in the world. Molecular approaches comparing traditional methods using for identification and characterization of Fasciola spp. are precise and reliable. The aims of current study were molecular characterization of Fasciola spp. in West Azerbaijan Province, Iran and then comparative analysis of them using GenBank sequences. Methods: A total number of 580 isolates were collected from different hosts in five cities of West Azerbaijan Province, in 2014 from 90 slaughtered cattle (n=50) and sheep (n=40). After morphological identification and DNA extraction, designing specific primer were used to amplification of ITS1, 5.8s and ITS2 regions, 50 samples were conducted to sequence, randomly. Result: Using morphometric characters 99.14% and 0.86% of isolates identified as F. hepatica and F. gigantica, respectively. PCR amplification of 1081 bp fragment and sequencing result showed 100% similarity with F. hepatica in ITS1 (428 bp), 5.8s (158 bp), and ITS2 (366 bp) regions. Sequence comparison among current study sequences and GenBank data showed 98% identity with 11 nucleotide mismatches. However, in phylogenetic tree F. hepatica sequences of West Azerbaijan Province, Iran, were in a close relationship with Iranian, Asian, and African isolates. Conclusions: Only F. hepatica species is distributed among sheep and cattle in West Azerbaijan Province Iran. However, 5 and 6 bp variation in ITS1 and ITS2 regions, respectively, is not enough to separate of Fasciola spp. Therefore, more studies are essential for designing new molecular markers to correct species identification. PMID:27095969

  4. ATP hydrolysis provides functions that promote rejection of pairings between different copies of long repeated sequences

    PubMed Central

    Danilowicz, Claudia; Hermans, Laura; Coljee, Vincent; Prévost, Chantal

    2017-01-01

    Abstract During DNA recombination and repair, RecA family proteins must promote rapid joining of homologous DNA. Repeated sequences with >100 base pair lengths occupy more than 1% of bacterial genomes; however, commitment to strand exchange was believed to occur after testing ∼20–30 bp. If that were true, pairings between different copies of long repeated sequences would usually become irreversible. Our experiments reveal that in the presence of ATP hydrolysis even 75 bp sequence-matched strand exchange products remain quite reversible. Experiments also indicate that when ATP hydrolysis is present, flanking heterologous dsDNA regions increase the reversibility of sequence matched strand exchange products with lengths up to ∼75 bp. Results of molecular dynamics simulations provide insight into how ATP hydrolysis destabilizes strand exchange products. These results inspired a model that shows how pairings between long repeated sequences could be efficiently rejected even though most homologous pairings form irreversible products. PMID:28854739

  5. Isolation of an inhibitory insulin-like growth factor (IGF) binding protein from bone cell-conditioned medium: A potential local regulator of IGF action

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mohan, S.; Bautista, C.M.; Wergedal, J.

    1989-11-01

    Inhibitory insulin-like growth factor binding protein (In-IGF-BP) has been purified to homogeneity from medium conditioned by TE89 human osteosarcoma cells by two different methods using Sephadex G-100 gel filtration, FPLC Mono Q ion-exchange, HPLC C{sub 4} reverse-phase, HPLC CN reverse-phase and affinity chromatographies. In-IGF-BP thus purified appeared to be homogeneous and unique by the following criteria. (i) N-terminal sequence analysis yielded a unique sequence (Asp-Glu-Ala-Ile-His-Cys-Pro-Pro-Glu-Ser-Glu-Ala-Lys-Leu-Ala). (ii) Amino acid composition of In-IGF-BP revealed marked differences with the amino acid compositions of other known PBs. (iii) In-IGF-BP exhibited a single band with molecular mass of 25 kDa under reducing conditions on sodiummore » dodecyl sulfate/polyacrylamide gels. IGF-I and IGF-II but not insulin displaced the binding of {sup 125}I-labeled IGF-I or {sup 125}I-labeled IGF-II binding to In-IGF-BP. In-IGF-BP inhibited basal, IGF-stimulated bone cell proliferation and serum-stimulated bone cell proliferation. Forskolin increases synthesis of In-IGF-BP in TE85 human osteosarcoma cells in a dose-dependent manner. Based on these findings, the authors conclude that In-IGF-BP is a protein that has a unique sequence and significant biological actions on bone cells.« less

  6. The complete mitochondrial genome structure of snow leopard Panthera uncia.

    PubMed

    Wei, Lei; Wu, Xiaobing; Jiang, Zhigang

    2009-05-01

    The complete mitochondrial genome (mtDNA) of snow leopard Panthera uncia was obtained by using the polymerase chain reaction (PCR) technique based on the PCR fragments of 30 primers we designed. The entire mtDNA sequence was 16 773 base pairs (bp) in length, and the base composition was: A-5,357 bp (31.9%); C-4,444 bp (26.5%); G-2,428 bp (14.5%); T-4,544 bp (27.1%). The structural characteristics [0] of the P. uncia mitochondrial genome were highly similar to these of Felis catus, Acinonyx jubatus, Neofelis nebulosa and other mammals. However, we found several distinctive features of the mitochondrial genome of Panthera unica. First, the termination codon of COIII was TAA, which differed from those of F. catus, A. jubatus and N. nebulosa. Second, tRNA(Ser) ((AGY)), which lacked the ''DHU'' arm, could not be folded into the typical cloverleaf-shaped structure. Third, in the control region, a long repetitive sequence in RS-2 (32 bp) region was found with 2 repeats while one short repetitive segment (9 bp) was found with 15 repeats in the RS-3 region. We performed phylogenetic analysis based on a 3 816 bp concatenated sequence of 12S rRNA, 16S rRNA, ND2, ND4, ND5, Cyt b and ATP8 for P. uncia and other related species, the result indicated that P. uncia and P. leo were the sister species, which was different from the previous findings.

  7. Construction of an ultra-high density consensus genetic map, and enhancement of the physical map from genome sequencing in Lupinus angustifolius.

    PubMed

    Zhou, Gaofeng; Jian, Jianbo; Wang, Penghao; Li, Chengdao; Tao, Ye; Li, Xuan; Renshaw, Daniel; Clements, Jonathan; Sweetingham, Mark; Yang, Huaan

    2018-01-01

    An ultra-high density genetic map containing 34,574 sequence-defined markers was developed in Lupinus angustifolius. Markers closely linked to nine genes of agronomic traits were identified. A physical map was improved to cover 560.5 Mb genome sequence. Lupin (Lupinus angustifolius L.) is a recently domesticated legume grain crop. In this study, we applied the restriction-site associated DNA sequencing (RADseq) method to genotype an F 9 recombinant inbred line population derived from a wild type × domesticated cultivar (W × D) cross. A high density linkage map was developed based on the W × D population. By integrating sequence-defined DNA markers reported in previous mapping studies, we established an ultra-high density consensus genetic map, which contains 34,574 markers consisting of 3508 loci covering 2399 cM on 20 linkage groups. The largest gap in the entire consensus map was 4.73 cM. The high density W × D map and the consensus map were used to develop an improved physical map, which covered 560.5 Mb of genome sequence data. The ultra-high density consensus linkage map, the improved physical map and the markers linked to genes of breeding interest reported in this study provide a common tool for genome sequence assembly, structural genomics, comparative genomics, functional genomics, QTL mapping, and molecular plant breeding in lupin.

  8. The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

    PubMed Central

    Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

    1995-01-01

    A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result. PMID:7853501

  9. The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

    PubMed

    Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

    1995-03-01

    A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result.

  10. The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

    PubMed Central

    2010-01-01

    Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545

  11. Chloroplast genome of Aconitum barbatum var. puberulum (Ranunculaceae) derived from CCS reads using the PacBio RS platform.

    PubMed

    Chen, Xiaochen; Li, Qiushi; Li, Ying; Qian, Jun; Han, Jianping

    2015-01-01

    The chloroplast genome (cp genome) of Aconitum barbatum var. puberulum was sequenced using the third-generation sequencing platform based on the single-molecule real-time (SMRT) sequencing approach. To our knowledge, this is the first reported complete cp genome of Aconitum, and we anticipate that it will have great value for phylogenetic studies of the Ranunculaceae family. In total, 23,498 CCS reads and 20,685,462 base pairs were generated, the mean read length was 880 bp, and the longest read was 2,261 bp. Genome coverage of 100% was achieved with a mean coverage of 132× and no gaps. The accuracy of the assembled genome is 99.973%; the assembly was validated using Sanger sequencing of six selected genes from the cp genome. The complete cp genome of A. barbatum var. puberulum is 156,749 bp in length, including a large single-copy region of 87,630 bp and a small single-copy region of 16,941 bp separated by two inverted repeats of 26,089 bp. The cp genome contains 130 genes, including 84 protein-coding genes, 34 tRNA genes and eight rRNA genes. Four forward, five inverted and eight tandem repeats were identified. According to the SSR analysis, the longest poly structure is a 20-T repeat. Our results presented in this paper will facilitate the phylogenetic studies and molecular authentication on Aconitum.

  12. Burkholderia pseudomallei sequencing identifies genomic clades with distinct recombination, accessory, and epigenetic profiles

    PubMed Central

    Nandi, Tannistha; Holden, Matthew T.G.; Didelot, Xavier; Mehershahi, Kurosh; Boddey, Justin A.; Beacham, Ifor; Peak, Ian; Harting, John; Baybayan, Primo; Guo, Yan; Wang, Susana; How, Lee Chee; Sim, Bernice; Essex-Lopresti, Angela; Sarkar-Tyson, Mitali; Nelson, Michelle; Smither, Sophie; Ong, Catherine; Aw, Lay Tin; Hoon, Chua Hui; Michell, Stephen; Studholme, David J.; Titball, Richard; Chen, Swaine L.; Parkhill, Julian

    2015-01-01

    Burkholderia pseudomallei (Bp) is the causative agent of the infectious disease melioidosis. To investigate population diversity, recombination, and horizontal gene transfer in closely related Bp isolates, we performed whole-genome sequencing (WGS) on 106 clinical, animal, and environmental strains from a restricted Asian locale. Whole-genome phylogenies resolved multiple genomic clades of Bp, largely congruent with multilocus sequence typing (MLST). We discovered widespread recombination in the Bp core genome, involving hundreds of regions associated with multiple haplotypes. Highly recombinant regions exhibited functional enrichments that may contribute to virulence. We observed clade-specific patterns of recombination and accessory gene exchange, and provide evidence that this is likely due to ongoing recombination between clade members. Reciprocally, interclade exchanges were rarely observed, suggesting mechanisms restricting gene flow between clades. Interrogation of accessory elements revealed that each clade harbored a distinct complement of restriction-modification (RM) systems, predicted to cause clade-specific patterns of DNA methylation. Using methylome sequencing, we confirmed that representative strains from separate clades indeed exhibit distinct methylation profiles. Finally, using an E. coli system, we demonstrate that Bp RM systems can inhibit uptake of non-self DNA. Our data suggest that RM systems borne on mobile elements, besides preventing foreign DNA invasion, may also contribute to limiting exchanges of genetic material between individuals of the same species. Genomic clades may thus represent functional units of genetic isolation in Bp, modulating intraspecies genetic diversity. PMID:25236617

  13. Chloroplast genome of Aconitum barbatum var. puberulum (Ranunculaceae) derived from CCS reads using the PacBio RS platform

    PubMed Central

    Chen, Xiaochen; Li, Qiushi; Li, Ying; Qian, Jun; Han, Jianping

    2015-01-01

    The chloroplast genome (cp genome) of Aconitum barbatum var. puberulum was sequenced using the third-generation sequencing platform based on the single-molecule real-time (SMRT) sequencing approach. To our knowledge, this is the first reported complete cp genome of Aconitum, and we anticipate that it will have great value for phylogenetic studies of the Ranunculaceae family. In total, 23,498 CCS reads and 20,685,462 base pairs were generated, the mean read length was 880 bp, and the longest read was 2,261 bp. Genome coverage of 100% was achieved with a mean coverage of 132× and no gaps. The accuracy of the assembled genome is 99.973%; the assembly was validated using Sanger sequencing of six selected genes from the cp genome. The complete cp genome of A. barbatum var. puberulum is 156,749 bp in length, including a large single-copy region of 87,630 bp and a small single-copy region of 16,941 bp separated by two inverted repeats of 26,089 bp. The cp genome contains 130 genes, including 84 protein-coding genes, 34 tRNA genes and eight rRNA genes. Four forward, five inverted and eight tandem repeats were identified. According to the SSR analysis, the longest poly structure is a 20-T repeat. Our results presented in this paper will facilitate the phylogenetic studies and molecular authentication on Aconitum. PMID:25705213

  14. Homoeologous cloning of omega-secalin gene family in a wheat 1BL/1RS translocation.

    PubMed

    Chai, Jian Fang; Liu, Xu; Jia, Ji Zeng

    2005-08-01

    Wheat 1BL/1RS translocations are widely planted in China as well as in most of the wheat producing area in the world for their good qualities of disease resistance and high yield. 1BL/1RS translocations are however poor in bread making, partially caused by a family of small monomeric proteins, omega-secalins, which are encoded by genes on 1RS. Based on published sequence of a rye omega-secalin gene we designed a pair of primers to cover the whole mature protein coding sequence. A major band could be amplified from 1BL/1RS translocations but not from euploid wheat. Using this primer set we conducted PCR amplification by using high fidelity Pfu polymerase on the genomic DNAs and cDNAs purified from a 1BL/1RS translocation Lankao 906. Sequencing analysis indicated that this gene family contains several members of 1150 bp, 1076 bp, 1075 bp, 1052 bp and 1004 bp genes, including two pseudogenes and three active genes. The gene transcripts were differentially expressed in developing seeds.

  15. The kinetoplast DNA of the Australian trypanosome, Trypanosoma copemani, shares features with Trypanosoma cruzi and Trypanosoma lewisi.

    PubMed

    Botero, Adriana; Kapeller, Irit; Cooper, Crystal; Clode, Peta L; Shlomai, Joseph; Thompson, R C Andrew

    2018-05-17

    Kinetoplast DNA (kDNA) is the mitochondrial genome of trypanosomatids. It consists of a few dozen maxicircles and several thousand minicircles, all catenated topologically to form a two-dimensional DNA network. Minicircles are heterogeneous in size and sequence among species. They present one or several conserved regions that contain three highly conserved sequence blocks. CSB-1 (10 bp sequence) and CSB-2 (8 bp sequence) present lower interspecies homology, while CSB-3 (12 bp sequence) or the Universal Minicircle Sequence is conserved within most trypanosomatids. The Universal Minicircle Sequence is located at the replication origin of the minicircles, and is the binding site for the UMS binding protein, a protein involved in trypanosomatid survival and virulence. Here, we describe the structure and organisation of the kDNA of Trypanosoma copemani, a parasite that has been shown to infect mammalian cells and has been associated with the drastic decline of the endangered Australian marsupial, the woylie (Bettongia penicillata). Deep genomic sequencing showed that T. copemani presents two classes of minicircles that share sequence identity and organisation in the conserved sequence blocks with those of Trypanosoma cruzi and Trypanosoma lewisi. A 19,257 bp partial region of the maxicircle of T. copemani that contained the entire coding region was obtained. Comparative analysis of the T. copemani entire maxicircle coding region with the coding regions of T. cruzi and T. lewisi showed they share 71.05% and 71.28% identity, respectively. The shared features in the maxicircle/minicircle organisation and sequence between T. copemani and T. cruzi/T. lewisi suggest similarities in their process of kDNA replication, and are of significance in understanding the evolution of Australian trypanosomes. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. Identification of natural and artificial DNA substrates for the light-activated LOV-HTH transcription factor EL222

    PubMed Central

    Rivera-Cancel, Giomar; Motta-Mena, Laura B.; Gardner, Kevin H.

    2012-01-01

    Light-oxygen-voltage (LOV) domains serve as the photosensory modules for a wide range of plant and bacterial proteins, conferring blue light dependent regulation to effector activities as diverse as enzymes and DNA binding. LOV domains can also be engineered into a variety of exogenous targets, enabling similar regulation for new protein-based reagents. Common to these proteins is the ability for LOV domains to reversibly form a photochemical adduct between an internal flavin chromophore and the surrounding protein, using this to trigger conformational changes that affect output activity. Using the Erythrobacter litoralis protein EL222 model system which links LOV regulation to a helix-turn-helix (HTH) DNA binding domain, we demonstrated that the LOV domain binds and inhibits the HTH domain in the dark, releasing these interactions upon illumination [Nash et al. (2011) Proc. Natl. Acad. Sci. USA 108, 9449–9454]. Here we combine genomic and in vitro selection approaches to identify optimal DNA binding sites for EL222. Within the bacterial host, we observe binding several genomic sites using a 12 bp sequence consensus that is also found by in vitro selection methods. Sequence-specific alterations in the DNA consensus reduce EL222-binding affinity in a manner consistent with the expected binding mode: a protein dimer binding to two repeats. Finally, we demonstrate the light-dependent activation of transcription of two genes adjacent to an EL222 binding site. Taken together, these results shed light on the native function of EL222 and provide useful reagents for further basic and applications research of this versatile protein. PMID:23205774

  17. The complete chloroplast genome sequence of American bird pepper (Capsicum annuum var. glabriusculum).

    PubMed

    Zeng, Fan-chun; Gao, Cheng-wen; Gao, Li-zhi

    2016-01-01

    The complete chloroplast genome sequence of American bird pepper (Capsicum annuum var. glabriusculum) is reported and characterized in this study. The genome size is 156,612 bp, containing a pair of inverted repeats (IRs) of 25,776 bp separated by a large single-copy region of 87,213 bp and a small single-copy region of 17,851 bp. The chloroplast genome harbors 130 known genes, including 89 protein-coding genes, 8 ribosomal RNA genes, and 37 tRNA genes. A total of 18 of these genes are duplicated in the inverted repeat regions, 16 genes contain 1 intron, and 2 genes and one ycf have 2 introns.

  18. Increased Sensitivity of Diagnostic Mutation Detection by Re-analysis Incorporating Local Reassembly of Sequence Reads.

    PubMed

    Watson, Christopher M; Camm, Nick; Crinnion, Laura A; Clokie, Samuel; Robinson, Rachel L; Adlard, Julian; Charlton, Ruth; Markham, Alexander F; Carr, Ian M; Bonthron, David T

    2017-12-01

    Diagnostic genetic testing programmes based on next-generation DNA sequencing have resulted in the accrual of large datasets of targeted raw sequence data. Most diagnostic laboratories process these data through an automated variant-calling pipeline. Validation of the chosen analytical methods typically depends on confirming the detection of known sequence variants. Despite improvements in short-read alignment methods, current pipelines are known to be comparatively poor at detecting large insertion/deletion mutations. We performed clinical validation of a local reassembly tool, ABRA (assembly-based realigner), through retrospective reanalysis of a cohort of more than 2000 hereditary cancer cases. ABRA enabled detection of a 96-bp deletion, 4-bp insertion mutation in PMS2 that had been initially identified using a comparative read-depth approach. We applied an updated pipeline incorporating ABRA to the entire cohort of 2000 cases and identified one previously undetected pathogenic variant, a 23-bp duplication in PTEN. We demonstrate the effect of read length on the ability to detect insertion/deletion variants by comparing HiSeq2500 (2 × 101-bp) and NextSeq500 (2 × 151-bp) sequence data for a range of variants and thereby show that the limitations of shorter read lengths can be mitigated using appropriate informatics tools. This work highlights the need for ongoing development of diagnostic pipelines to maximize test sensitivity. We also draw attention to the large differences in computational infrastructure required to perform day-to-day versus large-scale reprocessing tasks.

  19. Submesoscale characteristics and transcription of a fatty acid elongase gene from a freshwater green microalgae, Myrmecia incisa Reisigl

    NASA Astrophysics Data System (ADS)

    Yu, Shuiyan; Liu, Shicheng; Li, Chunyang; Zhou, Zhigang

    2011-01-01

    Myrmecia incisa is a green coccoid freshwater microalgae, which is rich in arachidonic acid (ArA, C20: 4ω-6, δ5, 8, 11, 14), a long chain polyunsaturated fatty acid (PUFA), especially under nitrogen starvation stress. A cDNA library of M. incisa was constructed with λ phage vectors and a 545 nt expressed sequence tag (EST) was screened from this library as a putative elongase gene due to its 56% and 49% identity to Marchantia polymorpha L. and Ostreococcus tauri Courties et Chrétiennot-Dinet, respectively. Based upon this EST sequence, an elongase gene designated MiFAE was isolated from M. incisa via 5'/3' rapid amplification of cDNA ends (RACE). The cDNA sequence was 1 331 bp long and included a 33 bp 5'-untranslated region (UTR) and a 431 bp 3'-UTR with a typical poly-A tail. The 867 bp ORF encoded a predicted protein of 288 amino acids. This protein was characterized by a conserved histidine-rich box and a MYxYY motif that was present in other members of the elongase family. The genomic DNA sequence of MiFAE was found to be interrupted by three introns with splicing sites of Introns I (81 bp), II (81 bp), and III (67 bp) that conformed to the GT-AG rule. Quantitative real-time PCR showed that the transcription level of MiFAE in this microalga under nitrogen starvation was higher than that under normal condition. Prior to the ArA content accumulation, the transcription of MiFAE was enhanced, suggesting that it was possibly responsible for the ArA accumulation in this microalga cultured under nitrogen starvation conditions.

  20. Novel x-type high-molecular-weight glutenin genes from Aegilops tauschii and their implications on the wheat origin and evolution mechanism of Glu-D1-1 proteins.

    PubMed

    Zhang, Yanzhen; Li, Xiaohui; Wang, Aili; An, Xueli; Zhang, Qian; Pei, Yuhe; Gao, Liyan; Ma, Wujun; Appels, Rudi; Yan, Yueming

    2008-01-01

    Two new x-type high-molecular-weight glutenin subunits with similar size to 1Dx5, designated 1Dx5*t and 1Dx5.1*t in Aegilops tauschii, were identified by SDS-PAGE, RP-HPLC, and MALDI-TOF-MS. The coding sequences were isolated by AS-PCR and the complete ORFs were obtained. Allele 1Dx5*t consists of 2481 bp encoding a mature protein of 827 residues with deduced Mr of 85,782 Da whereas 1Dx5.1*t comprises 2526 bp encoding 842 residues with Mr of 87,663 Da. The deduced Mr's of both genes were consistent with those determined by MALDI-TOF-MS. Molecular structure analysis showed that the repeat motifs of 1Dx5*t were correspondingly closer to the consensus compared to 1Dx5.1*t and 1Dx5 subunits. A total of 11 SNPs (3 in 1Dx5*t and 8 in 1Dx5.1*t) and two indels in 1Dx5*t were identified, among which 8 SNPs were due to C-T or A-G transitions (an average of 73%). Expression of the cloned ORFs and N-terminal sequencing confirmed the authenticities of the two genes. Interestingly, several hybrid clones of 1Dx5*t expressed a slightly smaller protein relative to the authentic subunit present in seed proteins; this was confirmed to result from a deletion of 180 bp through illegitimate recombination as well as an in-frame stop codon. Network analysis demonstrated that 1Dx5*t, 1Dx2t, 1Dx1.6t, and 1Dx2.2* represent a root within a network and correspond to the common ancestors of the other Glu-D-1-1 alleles in an associated star-like phylogeny, suggesting that there were at least four independent origins of hexaploid wheat. In addition to unequal homologous recombination, duplication and deletion of large fragments occurring in Glu-D-1-1 alleles were attributed to illegitimate recombination.

  1. Cloning and characterization of an autonomous replication sequence from Coxiella burnetii.

    PubMed Central

    Suhan, M; Chen, S Y; Thompson, H A; Hoover, T A; Hill, A; Williams, J C

    1994-01-01

    A Coxiella burnetii chromosomal fragment capable of functioning as an origin for the replication of a kanamycin resistance (Kanr) plasmid was isolated by use of origin search methods utilizing an Escherichia coli host. The 5.8-kb fragment was subcloned into phagemid vectors and was deleted progressively by an exonuclease III-S1 technique. Plasmids containing progressively shorter DNA fragments were then tested for their capability to support replication by transformation of an E. coli polA strain. A minimal autonomous replication sequence (ARS) was delimited to 403 bp. Sequencing of the entire 5.8-kb region revealed that the minimal ARS contained two consensus DnaA boxes, three A + T-rich 21-mers, a transcriptional promoter leading rightwards, and potential integration host factor and factor of inversion stimulation binding sites. Database comparisons of deduced amino acid sequences revealed that open reading frames located around the ARS were homologous to genes often, but not always, found near bacterial chromosomal origins; these included identities with rpmH and rnpA in E. coli and identities with the 9K protein and 60K membrane protein in E. coli and Pseudomonas species. These and direct hybridization data suggested that the ARS was chromosomal and not associated with the resident plasmid QpH1. Two-dimensional agarose gel electrophoresis did not reveal the presence of initiating intermediates, indicating that the ARS did not initiate chromosome replication during laboratory growth of C. burnetii. Images PMID:8071197

  2. First Report of a New Isolate of Metarhizium rileyi from Maize Fields of Quivicán, Cuba.

    PubMed

    Álvarez, Sandra Pérez; Guerrero, Amaury Méndez; Duarte, Bernardo Nayar Débora; Tapia, Marco Antonio Magallanes; Medina, Jesús Alicia Chávez; Domínguez Rodríguez, Yoannis

    2018-06-01

    Metarhizium rileyi (Farlow) Samson is an important entomopathogenic fungus of more than 30 species of Lepidoptera larvae. The aim of this research was to characterize isolate of M. rileyi from Quivicán, Cuba on the basis of morphological and molecular approaches. The fungus was isolated from samples of S . frugiperda larvae collected from maize fields of Quivicán municipality, Mayabeque province, Cuba, and it was cultured on PDA + Ampicillin solid media for morphological characterization. The DNA was isolated using CTAB method and internal transcribed spacer (ITS1, ITS4) were used as the primers for the amplification. The amplified products of 1335 bp were purified and sequenced at CINVESTAV-IPN in both the directions using the above primers. A consensus sequence was obtained by alignment of the forward and reverse sequences for this region and deposited in GenBank (MG637450). The fungus produced slightly cottony colony of pale green color and dispersed conidia and septal mycelium were observed under the optical microscope. A BLAST search of the sequence in GenBank revealed a 99% of identity with several strains of N. rileyi (e.g., AF368501.1, AB268359.1 and EU553337.1) and M. rileyi (e.g., KY436756.1). This is the first report of M. rileyi isolate from maize fields of Quivicán in Cuba and this is important for biodiversity studies and is another possibility for Integrated Pest Management.

  3. Divergence in centromere structure distinguishes related genomes in Coix lacryma-jobi and its wild relative.

    PubMed

    Han, Yonghua; Wang, Guixiang; Liu, Zhao; Liu, Jinhua; Yue, Wei; Song, Rentao; Zhang, Xueyong; Jin, Weiwei

    2010-02-01

    Knowledge about the composition and structure of centromeres is critical for understanding how centromeres perform their functional roles. Here, we report the sequences of one centromere-associated bacterial artificial chromosome clone from a Coix lacryma-jobi library. Two Ty3/gypsy-class retrotransposons, centromeric retrotransposon of C. lacryma-jobi (CRC) and peri-centromeric retrotransposon of C. lacryma-jobi, and a (peri)centromere-specific tandem repeat with a unit length of 153 bp were identified. The CRC is highly homologous to centromere-specific retrotransposons reported in grass species. An 80-bp DNA region in the 153-bp satellite repeat was found to be conserved to centromeric satellite repeats from maize, rice, and pearl millet. Fluorescence in situ hybridization showed that the three repetitive sequences were located in (peri-)centromeric regions of both C. lacryma-jobi and Coix aquatica. However, the 153-bp satellite repeat was only detected on 20 out of the 30 chromosomes in C. aquatica. Immunostaining with an antibody against rice CENH3 indicates that the 153-bp satellite repeat and CRC might be both the major components for functional centromeres, but not all the 153-bp satellite repeats or CRC sequences are associated with CENH3. The evolution of centromeric repeats of C. lacryma-jobi during the polyploidization was discussed.

  4. CENP-B binds a novel centromeric sequence in the Asian mouse Mus caroli.

    PubMed Central

    Kipling, D; Mitchell, A R; Masumoto, H; Wilson, H E; Nicol, L; Cooke, H J

    1995-01-01

    Minor satellite DNA, found at Mus musculus centromeres, is not present in the genome of the Asian mouse Mus caroli. This repetitive sequence family is speculated to have a role in centromere function by providing an array of binding sites for the centromere-associated protein CENP-B. The apparent absence of CENP-B binding sites in the M. caroli genome poses a major challenge to this hypothesis. Here we describe two abundant satellite DNA sequences present at M. caroli centromeres. These satellites are organized as tandem repeat arrays, over 1 Mb in size, of either 60- or 79-bp monomers. All autosomes carry both satellites and small amounts of a sequence related to the M. musculus major satellite. The Y chromosome contains small amounts of both major satellite and the 60-bp satellite, whereas the X chromosome carries only major satellite sequences. M. caroli chromosomes segregate in M. caroli x M. musculus interspecific hybrid cell lines, indicating that the two sets of chromosomes can interact with the same mitotic spindle. Using a polyclonal CENP-B antiserum, we demonstrate that M. caroli centromeres can bind murine CENP-B in such an interspecific cell line, despite the absence of canonical 17-bp CENP-B binding sites in the M. caroli genome. Sequence analysis of the 79-bp M. caroli satellite reveals a 17-bp motif that contains all nine bases previously shown to be necessary for in vitro binding of CENP-B. This M. caroli motif binds CENP-B from HeLa cell nuclear extract in vitro, as indicated by gel mobility shift analysis. We therefore suggest that this motif also causes CENP-B to associate with M. caroli centromeres in vivo. Despite the sequence differences, M. caroli presents a third, novel mammalian centromeric sequence producing an array of binding sites for CENP-B. PMID:7623797

  5. Complete chloroplast DNA sequence from a Korean endemic genus, Megaleranthis saniculifolia, and its evolutionary implications.

    PubMed

    Kim, Young-Kyu; Park, Chong-wook; Kim, Ki-Joong

    2009-03-31

    The chloroplast DNA sequences of Megaleranthis saniculifolia, an endemic and monotypic endangered plant species, were completed in this study (GenBank FJ597983). The genome is 159,924 bp in length. It harbors a pair of IR regions consisting of 26,608 bp each. The lengths of the LSC and SSC regions are 88,326 bp and 18,382 bp, respectively. The structural organizations, gene and intron contents, gene orders, AT contents, codon usages, and transcription units of the Megaleranthis chloroplast genome are similar to those of typical land plant cp DNAs. However, the detailed features of Megaleranthis chloroplast genomes are substantially different from that of Ranunculus, which belongs to the same family, the Ranunculaceae. First, the Megaleranthis cp DNA was 4,797 bp longer than that of Ranunculus due to an expanded IR region into the SSC region and duplicated sequence elements in several spacer regions of the Megaleranthis cp genome. Second, the chloroplast genomes of Megaleranthis and Ranunculus evidence 5.6% sequence divergence in the coding regions, 8.9% sequence divergence in the intron regions, and 18.7% sequence divergence in the intergenic spacer regions, respectively. In both the coding and noncoding regions, average nucleotide substitution rates differed markedly, depending on the genome position. Our data strongly implicate the positional effects of the evolutionary modes of chloroplast genes. The genes evidencing higher levels of base substitutions also have higher incidences of indel mutations and low Ka/Ks ratios. A total of 54 simple sequence repeat loci were identified from the Megaleranthis cp genome. The existence of rich cp SSR loci in the Megaleranthis cp genome provides a rare opportunity to study the population genetic structures of this endangered species. Our phylogenetic trees based on the two independent markers, the nuclear ITS and chloroplast matK sequences, strongly support the inclusion of the Megaleranthis to the Trollius. Therefore, our molecular trees support Ohwi's original treatment of Megaleranthis saniculiforia to Trollius chosenensis Ohwi.

  6. Sequencing, bioinformatic characterization and expression pattern of a putative amino acid transporter from the parasitic cestode Echinococcus granulosus.

    PubMed

    Camicia, Federico; Paredes, Rodolfo; Chalar, Cora; Galanti, Norbel; Kamenetzky, Laura; Gutierrez, Ariana; Rosenzvit, Mara C

    2008-03-31

    We have sequenced and partially characterized an Echinococcus granulosus cDNA, termed egat1, from a protoscolex signal sequence trap (SST) cDNA library. The isolated 1627 bp long cDNA contains an ORF of 489 amino acids and shows an amino acid identity of 30% with neutral and excitatory amino acid transporters members of the Dicarboxylate/Amino Acid Na+ and/or H+ Cation Symporter family (DAACS) (TC 2.A.23). Additional bioinformatics analysis of EgAT1, confirmed the results obtained by similarity searches and showed the presence of 9 to 10 transmembrane domains, consensus sequences for N-glycosylation between the third and fourth transmembrane domain, a highly similar hydropathy profile with ASCT1 (a known member of DAACS family), high score with SDF (Sodium Dicarboxilate Family) and similar motifs with EDTRANSPORT, a fingerprint of excitatory amino acid transporters. The localization of the putative amino acid transporter was analyzed by in situ hybridization and immunofluorescence in protoscoleces and associated germinal layer. The in situ hybridization labelling indicates the distribution of egat1 mRNA throughout the tegument. EgAT1 protein, which showed in Western blots a molecular mass of approximately 60 kD, is localized in the subtegumental region of the metacestode, particularly around suckers and rostellum of protoscoleces and layers from brood capsules. The sequence and expression analyses of EgAT1 pave the way for functional analysis of amino acids transporters of E. granulosus and its evaluation as new drug targets against cystic echinococcosis.

  7. Isolation of a gene (pbsC) required for siderophore biosynthesis in fluorescent Pseudomonas sp. strain M114.

    PubMed

    Adams, C; Dowling, D N; O'Sullivan, D J; O'Gara, F

    1994-06-03

    An iron-regulated gene, pbsC, required for siderophore production in fluorescent Pseudomonas sp. strain M114 has been identified. A kanamycin-resistance cassette was inserted at specific restriction sites within a 7 kb genomic fragment of M114 DNA and by marker exchange two siderophore-negative mutants, designated M1 and M2, were isolated. The nucleotide sequence of approximately 4 kb of the region flanking the insertion sites was determined and a large open reading frame (ORF) extending for 2409 bp was identified. This gene was designated pbsC (pseudobactin synthesis C) and its putative protein product termed PbsC. PbsC was found to be homologous to a family of enzymes involved in the biosynthesis of secondary metabolites, including EntF of Escherichia coli. These enzymes are believed to act via ATP-dependent binding of AMP to their substrate. Several areas of high sequence homology between these proteins and PbsC were observed, including a conserved AMP-binding domain. The expression of pbsC is iron-regulated as revealed when a DNA fragment containing the upstream region was cloned in a promoter probe vector and conjugated into the wild-type strain, M114. The nucleotide sequence upstream of the putative translational start site contains a region homologous to previously defined -16 to -25 sequences of iron-regulated genes but did not contain an iron-box consensus sequence. It was noted that inactivation of the pbsC gene also affected other iron-regulated phenotypes of Pseudomonas M114.

  8. Repetitive Elements May Comprise Over Two-Thirds of the Human Genome

    PubMed Central

    de Koning, A. P. Jason; Gu, Wanjun; Castoe, Todd A.; Batzer, Mark A.; Pollock, David D.

    2011-01-01

    Transposable elements (TEs) are conventionally identified in eukaryotic genomes by alignment to consensus element sequences. Using this approach, about half of the human genome has been previously identified as TEs and low-complexity repeats. We recently developed a highly sensitive alternative de novo strategy, P-clouds, that instead searches for clusters of high-abundance oligonucleotides that are related in sequence space (oligo “clouds”). We show here that P-clouds predicts >840 Mbp of additional repetitive sequences in the human genome, thus suggesting that 66%–69% of the human genome is repetitive or repeat-derived. To investigate this remarkable difference, we conducted detailed analyses of the ability of both P-clouds and a commonly used conventional approach, RepeatMasker (RM), to detect different sized fragments of the highly abundant human Alu and MIR SINEs. RM can have surprisingly low sensitivity for even moderately long fragments, in contrast to P-clouds, which has good sensitivity down to small fragment sizes (∼25 bp). Although short fragments have a high intrinsic probability of being false positives, we performed a probabilistic annotation that reflects this fact. We further developed “element-specific” P-clouds (ESPs) to identify novel Alu and MIR SINE elements, and using it we identified ∼100 Mb of previously unannotated human elements. ESP estimates of new MIR sequences are in good agreement with RM-based predictions of the amount that RM missed. These results highlight the need for combined, probabilistic genome annotation approaches and suggest that the human genome consists of substantially more repetitive sequence than previously believed. PMID:22144907

  9. Cloning and characterization of pyruvate carboxylase gene responsible for calcium malate overproduction in Penicillium viticola 152 and its expression analysis.

    PubMed

    Khan, Ibrar; Qayyum, Sadia; Ahmed, Shehzad; Maqbool, Farhana; Tauseef, Isfahan; Haleem, Kashif Syed; Chi, Zhen-Ming

    2017-03-20

    In this study, a pyruvate carboxylase gene (PYC) from a marine fungus Penicillium viticola 152 isolated from marine algae was cloned and characterized by using Genome Walking method. An open reading frame (ORF) of The PYC gene (accession number: KM593097) had 3582bp encoding 1193 amino acid protein (isoelectric point: 5.01) with a calculated molecular weight of 131.2757kDa. A putative promoter (intronless) of the gene was located at -666bp and contained a TATA box, several CAAT boxes, the 5'-SYGGRG-3' and a 5'-HGATAR-3' sequences. A consensus polyadenylation site (AATAAA) was also observed at +10bp downstream of the ORF. The protein deduced from the PYC gene had no signal peptide, was a homotetramer (4), and had the four functional domains. Furthermore, PYC protein also had three potential N-linked glycosylation sites, among them, -N-S-T-I- at 36 amino acid, -N-G-T-V- at 237 amino acid, and -N-G-S-S- at 517 amino acid were the most possible N-glycosylation sites. After expression of the PYC gene of P. viticola 152 in medium supplemented with CSL and biotin, it was found that the specific pyruvate carboxylase activity in MA production medium supplemented with CSL was much higher (0.5U/mg) than in MA medium supplemented with biotin (0.3U/mg), suggesting that optimal concentration of CSL is required for increased expression of the PYC gene, which is responsible for high level production of malic acid in P. viticola 152 strain. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Mitochondrial genome sequencing helps show the evolutionary mechanism of mitochondrial genome formation in Brassica

    PubMed Central

    2011-01-01

    Background Angiosperm mitochondrial genomes are more complex than those of other organisms. Analyses of the mitochondrial genome sequences of at least 11 angiosperm species have showed several common properties; these cannot easily explain, however, how the diverse mitotypes evolved within each genus or species. We analyzed the evolutionary relationships of Brassica mitotypes by sequencing. Results We sequenced the mitotypes of cam (Brassica rapa), ole (B. oleracea), jun (B. juncea), and car (B. carinata) and analyzed them together with two previously sequenced mitotypes of B. napus (pol and nap). The sizes of whole single circular genomes of cam, jun, ole, and car are 219,747 bp, 219,766 bp, 360,271 bp, and 232,241 bp, respectively. The mitochondrial genome of ole is largest as a resulting of the duplication of a 141.8 kb segment. The jun mitotype is the result of an inherited cam mitotype, and pol is also derived from the cam mitotype with evolutionary modifications. Genes with known functions are conserved in all mitotypes, but clear variation in open reading frames (ORFs) with unknown functions among the six mitotypes was observed. Sequence relationship analysis showed that there has been genome compaction and inheritance in the course of Brassica mitotype evolution. Conclusions We have sequenced four Brassica mitotypes, compared six Brassica mitotypes and suggested a mechanism for mitochondrial genome formation in Brassica, including evolutionary events such as inheritance, duplication, rearrangement, genome compaction, and mutation. PMID:21988783

  11. Complete genome sequence of the larval shellfish pathogen Vibrio Tubiashii type strain ATCC 19109

    USDA-ARS?s Scientific Manuscript database

    Vibrio tubiashii is a larval shellfish pathogen. Here we report the first closed genome sequence for this species (American Type Culture Collection type strain 19109), which has two chromosomes (3,294,490 and 1,766,582 bp), two megaplasmids (251,408 and 122,808 bp) and two plasmids (57,076 and 47,9...

  12. Comparison of complete mitochondrial DNA sequences between old and new world strains of the cowpea aphid, Aphis craccivora (Hemiptera: Aphididae)

    USDA-ARS?s Scientific Manuscript database

    Mitochondrial DNA provides useful tools for inferring population genetic structure within a species and phylogenetic relationships between species. The complete mitogenome sequences were assembled from strains of the cowpea aphids, Aphis craccivora, from the old (15,308 bp) and new world (15,305 bp...

  13. Whole genome sequence of “Candidatus Profftella armatura” from Diaphorina citri in Guangdong, China

    USDA-ARS?s Scientific Manuscript database

    The genome of “Candidatus Profftella armatura” strain YCPA, a symbiont of Asian citrus psyllid, from Guangdong, China, was sequenced. The strain chromosome was 457,565 bp with 24.3% G+C content, 364 predicted open reading frames (ORFs), and 38 RNA genes. The strain also contains a 5,458 bp plasmid, ...

  14. PROSPECT improves cis-acting regulatory element prediction by integrating expression profile data with consensus pattern searches

    PubMed Central

    Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David

    2001-01-01

    Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681

  15. Characteristics of MHC class I genes in house sparrows Passer domesticus as revealed by long cDNA transcripts and amplicon sequencing.

    PubMed

    Karlsson, Maria; Westerdahl, Helena

    2013-08-01

    In birds the major histocompatibility complex (MHC) organization differs both among and within orders; chickens Gallus gallus of the order Galliformes have a simple arrangement, while many songbirds of the order Passeriformes have a more complex arrangement with larger numbers of MHC class I and II genes. Chicken MHC genes are found at two independent loci, classical MHC-B and non-classical MHC-Y, whereas non-classical MHC genes are yet to be verified in passerines. Here we characterize MHC class I transcripts (α1 to α3 domain) and perform amplicon sequencing using a next-generation sequencing technique on exon 3 from house sparrow Passer domesticus (a passerine) families. Then we use phylogenetic, selection, and segregation analyses to gain a better understanding of the MHC class I organization. Trees based on the α1 and α2 domain revealed a distinct cluster with short terminal branches for transcripts with a 6-bp deletion. Interestingly, this cluster was not seen in the tree based on the α3 domain. 21 exon 3 sequences were verified in a single individual and the average numbers within an individual were nine and five for sequences with and without a 6-bp deletion, respectively. All individuals had exon 3 sequences with and without a 6-bp deletion. The sequences with a 6-bp deletion have many characteristics in common with non-classical MHC, e.g., highly conserved amino acid positions were substituted compared with the other alleles, low nucleotide diversity and just a single site was subject to positive selection. However, these alleles also have characteristics that suggest they could be classical, e.g., complete linkage and absence of a distinct cluster in a tree based on the α3 domain. Thus, we cannot determine for certain whether or not the alleles with a 6-bp deletion are non-classical based on our present data. Further analyses on segregation patterns of these alleles in combination with dating the 6-bp deletion through MHC characterization across the genus Passer may solve this matter in the future.

  16. In silico analysis of 16S ribosomal RNA gene sequencing‐based methods for identification of medically important anaerobic bacteria

    PubMed Central

    Woo, Patrick C Y; Chung, Liliane M W; Teng, Jade L L; Tse, Herman; Pang, Sherby S Y; Lau, Veronica Y T; Wong, Vanessa W K; Kam, Kwok‐ling; Lau, Susanna K P; Yuen, Kwok‐Yung

    2007-01-01

    This study is the first study that provides useful guidelines to clinical microbiologists and technicians on the usefulness of full 16S rRNA sequencing, 5′‐end 527‐bp 16S rRNA sequencing and the existing MicroSeq full and 500 16S rDNA bacterial identification system (MicroSeq, Perkin‐Elmer Applied Biosystems Division, Foster City, California, USA) databases for the identification of all existing medically important anaerobic bacteria. Full and 527‐bp 16S rRNA sequencing are able to identify 52–63% of 130 Gram‐positive anaerobic rods, 72–73% of 86 Gram‐negative anaerobic rods and 78% of 23 anaerobic cocci. The existing MicroSeq databases are able to identify only 19–25% of 130 Gram‐positive anaerobic rods, 38% of 86 Gram‐negative anaerobic rods and 39% of 23 anaerobic cocci. These represent only 45–46% of those that should be confidently identified by full and 527‐bp 16S rRNA sequencing. To improve the usefulness of MicroSeq, bacterial species that should be confidently identified by full and/or 527‐bp 16S rRNA sequencing but not included in the existing MicroSeq databases should be included. PMID:17046845

  17. Sequences spanning the leader-repeat junction mediate CRISPR adaptation to phage in Streptococcus thermophilus

    PubMed Central

    Wei, Yunzhou; Chesne, Megan T.; Terns, Rebecca M.; Terns, Michael P.

    2015-01-01

    CRISPR-Cas systems are RNA-based immune systems that protect prokaryotes from invaders such as phages and plasmids. In adaptation, the initial phase of the immune response, short foreign DNA fragments are captured and integrated into host CRISPR loci to provide heritable defense against encountered foreign nucleic acids. Each CRISPR contains a ∼100–500 bp leader element that typically includes a transcription promoter, followed by an array of captured ∼35 bp sequences (spacers) sandwiched between copies of an identical ∼35 bp direct repeat sequence. New spacers are added immediately downstream of the leader. Here, we have analyzed adaptation to phage infection in Streptococcus thermophilus at the CRISPR1 locus to identify cis-acting elements essential for the process. We show that the leader and a single repeat of the CRISPR locus are sufficient for adaptation in this system. Moreover, we identified a leader sequence element capable of stimulating adaptation at a dormant repeat. We found that sequences within 10 bp of the site of integration, in both the leader and repeat of the CRISPR, are required for the process. Our results indicate that information at the CRISPR leader-repeat junction is critical for adaptation in this Type II-A system and likely other CRISPR-Cas systems. PMID:25589547

  18. Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

    PubMed

    Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

    1998-06-01

    Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

  19. Diversity of Cronobacter spp. isolates from the vegetables in the middle-east coastline of China.

    PubMed

    Chen, Wanyi; Yang, Jielin; You, Chunping; Liu, Zhenmin

    2016-06-01

    Cronobacter spp. has caused life-threatening neonatal infections mainly resulted from consumption of contaminated powdered infant formula. A total of 102 vegetable samples from retail markets were evaluated for the presence of Cronobacter spp. Thirty-five presumptive Cronobacter isolates were isolated and identified using API 20E and 16S rDNA sequencing analyses. All isolates and type strains were characterized using enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR), and genetic profiles of cluster analysis from this molecular typing test clearly showed that there were differences among isolates from different vegetables. A polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) based on the amplification of the gyrB gene (1258 bp) was developed to differentiate among Cronobacter species. A new PCR-RFLP assay based on the amplification of the gyrB gene using Alu I and Hinf I endonuclease combination is established and it has been confirmed an accurate and rapid subtyping method to differentiate Cronobacter species. Sequence analysis of the gyrB gene was proven to be suitable for the phylogenetic analysis of the Cronobacter strains, which has much better resolution based on SNPs in the identification of Cronobacter species specificity than PCR-RFLP and ERIC-PCR. Our study further confirmed that vegetables are one of the most common habitats or sources of Cronobacter spp. contamination in the middle-east coastline of China.

  20. Transposase-Mediated Excision, Conjugative Transfer, and Diversity of ICE6013 Elements in Staphylococcus aureus.

    PubMed

    Sansevere, Emily A; Luo, Xiao; Park, Joo Youn; Yoon, Sunghyun; Seo, Keun Seok; Robinson, D Ashley

    2017-04-15

    ICE 6013 represents one of two families of integrative conjugative elements (ICEs) identified in the pan-genome of the human and animal pathogen Staphylococcus aureus Here we investigated the excision and conjugation functions of ICE 6013 and further characterized the diversity of this element. ICE 6013 excision was not significantly affected by growth, temperature, pH, or UV exposure and did not depend on recA The IS 30 -like DDE transposase (Tpase; encoded by orf1 and orf2 ) of ICE 6013 must be uninterrupted for excision to occur, whereas disrupting three of the other open reading frames (ORFs) on the element significantly affects the level of excision. We demonstrate that ICE 6013 conjugatively transfers to different S. aureus backgrounds at frequencies approaching that of the conjugative plasmid pGO1. We found that excision is required for conjugation, that not all S. aureus backgrounds are successful recipients, and that transconjugants acquire the ability to transfer ICE 6013 Sequencing of chromosomal integration sites in serially passaged transconjugants revealed a significant integration site preference for a 15-bp AT-rich palindromic consensus sequence, which surrounds the 3-bp target site that is duplicated upon integration. A sequence analysis of ICE 6013 from different host strains of S. aureus and from eight other species of staphylococci identified seven divergent subfamilies of ICE 6013 that include sequences previously classified as a transposon, a plasmid, and various ICEs. In summary, these results indicate that the IS 30 -like Tpase functions as the ICE 6013 recombinase and that ICE 6013 represents a diverse family of mobile genetic elements that mediate conjugation in staphylococci. IMPORTANCE Integrative conjugative elements (ICEs) encode the abilities to integrate into and excise from bacterial chromosomes and plasmids and mediate conjugation between bacteria. As agents of horizontal gene transfer, ICEs may affect bacterial evolution. ICE 6013 represents one of two known families of ICEs in the pathogen Staphylococcus aureus , but its core functions of excision and conjugation are not well studied. Here, we show that ICE 6013 depends on its IS 30 -like DDE transposase for excision, which is unique among ICEs, and we demonstrate the conjugative transfer and integration site preference of ICE 6013 A sequence analysis revealed that ICE 6013 has diverged into seven subfamilies that are dispersed among staphylococci. Copyright © 2017 American Society for Microbiology.

  1. Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

    PubMed Central

    Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

  2. Preliminary analysis of length and GC content variation in the ribosomal first internal transcribed spacer (ITS1) of marine animals.

    PubMed

    Chow, S; Ueno, Y; Toyokawa, M; Oohara, I; Takeyama, H

    2009-01-01

    Length and guanine-cytosine (GC) content of the ribosomal first internal transcribed spacer (ITS1) were compared across a wide variety of marine animal species, and its phylogenetic utility was investigated. From a total of 773 individuals representing 599 species, we only failed to amplify the ITS1 sequence from 87 individuals by polymerase chain reaction with universal ITS1 primers. No species was found to have an ITS1 region shorter than 100 bp. In general, the ITS1 sequences of vertebrates were longer (318 to 2,318 bp) and richer in GC content (56.8% to 78%) than those of invertebrates (117 to 1,613 bp and 35.8% to 71.3%, respectively). Specifically, gelatinous animals (Cnidaria and Ctenophora) were observed to have short ITS1 sequences (118 to 422 bp) with lower GC content (35.8% to 61.7%) than the other animal taxa. Mollusca and Crustacea were diverse groups with respect to ITS1 length, ranging from 108 to 1,118 and 182 to 1,613 bp, respectively. No universal relationship between length and GC content was observed. Our data indicated that ITS1 has a limited utility for phylogenetic analysis as obtaining confident sequence alignment was often impossible between different genera of the same family and even between congeneric species.

  3. 5-bp Classical Satellite DNA Loci from Chromosome-1 Instability in Cervical Neoplasia Detected by DNA Breakage Detection/Fluorescence in Situ Hybridization (DBD-FISH).

    PubMed

    Cortés-Gutiérrez, Elva I; Ortíz-Hernández, Brenda L; Dávila-Rodríguez, Martha I; Cerda-Flores, Ricardo M; Fernández, José Luis; López-Fernández, Carmen; Gosálvez, Jaime

    2013-02-19

    We aimed to evaluate the association between the progressive stages of cervical neoplasia and DNA damage in 5-bp classical satellite DNA sequences from chromosome-1 in cervical epithelium and in peripheral blood lymphocytes using DNA breakage detection/fluorescence in situ hybridization (DBD-FISH). A hospital-based unmatched case-control study was conducted in 2011 with a sample of 30 women grouped according to disease stage and selected according to histological diagnosis; 10 with low-grade squamous intraepithelial lesions (LG-SIL), 10 with high-grade SIL (HG-SIL), and 10 with no cervical lesions, from the Unidad Medica de Alta Especialidad of The Mexican Social Security Institute, IMSS, Mexico. Specific chromosome damage levels in 5-bp classical satellite DNA sequences from chromosome-1 were evaluated in cervical epithelium and peripheral blood lymphocytes using the DBD-FISH technique. Whole-genome DNA hybridization was used as a reference for the level of damage. Results of Kruskal-Wallis test showed a significant increase according to neoplastic development in both tissues. The instability of 5-bp classical satellite DNA sequences from chromosome-1 was evidenced using chromosome-orientation FISH. In conclusion, we suggest that the progression to malignant transformation involves an increase in the instability of 5-bp classical satellite DNA sequences from chromosome-1.

  4. New Insights on the Use of Dietary Polyphenols or Probiotics for the Management of Arterial Hypertension

    PubMed Central

    de Brito Alves, José L.; de Sousa, Vanessa P.; Cavalcanti Neto, Marinaldo P.; Magnani, Marciane; Braga, Valdir de Andrade; da Costa-Silva, João H.; Leandro, Carol G.; Vidal, Hubert; Pirola, Luciano

    2016-01-01

    Arterial hypertension (AH) is one of the most prevalent risk factors for cardiovascular diseases (CD) and is the main cause of deaths worldwide. Current research establish that dietary polyphenols may help to lower blood pressure (BP), thus contributing to the reduction of cardiovascular complications. In addition, the health benefits of probiotics on BP have also attracted increased attention, as probiotics administration modulates the microbiota, which, by interacting with ingested polyphenols, controls their bioavalability. The aim of the present mini-review is to summarize and clarify the effects of dietary polyphenols and probiotics administration on BP using combined evidence from clinical and experimental studies, as well as to discuss the current debate in the literature about the usefulness of this nutritional approach to manage BP. Clinical trials and experimental studies have demonstrated that consuming dietary polyphenols or probiotics in adequate amounts may improve BP, ranging from modest to greater effects. However, the mechanisms linking probiotic intake and reduced BP levels need to be further elucidated as a definitive consensus on the link between intake of polyphenols or probiotics and improvement of AH has not been reached yet. PMID:27766081

  5. The complete chloroplast genome of a medicinal plant Epimedium koreanum Nakai (Berberidaceae).

    PubMed

    Lee, Jung-Hoon; Kim, Kyunghee; Kim, Na-Rae; Lee, Sang-Choon; Yang, Tae-Jin; Kim, Young-Dong

    2016-11-01

    Epimedium koreanum is a perennial medicinal plant distributed in Eastern Asia. The complete chloroplast genome sequences of E. koreanum was obtained by de novo assembly using whole genome next-generation sequences. The chloroplast genome of E. koreanum was 157 218 bp in length and separated into four distinct regions such as large single copy region (89 600 bp), small single copy region (17 222 bp) and a pair of inverted repeat regions (25 198 bp). The genome contained a total of 112 genes including 78 protein-coding genes, 30 tRNA genes, and 4 rRNA genes. Phylogenetic analysis with the reported chloroplast genomes revealed that E. koreanum is most closely related to Berberis bealei, a traditional medicinal plant in the Berberidaceae family.

  6. The complete chloroplast genome sequence of the medicinal plant Salvia miltiorrhiza.

    PubMed

    Qian, Jun; Song, Jingyuan; Gao, Huanhuan; Zhu, Yingjie; Xu, Jiang; Pang, Xiaohui; Yao, Hui; Sun, Chao; Li, Xian'en; Li, Chuyuan; Liu, Juyan; Xu, Haibin; Chen, Shilin

    2013-01-01

    Salvia miltiorrhiza is an important medicinal plant with great economic and medicinal value. The complete chloroplast (cp) genome sequence of Salvia miltiorrhiza, the first sequenced member of the Lamiaceae family, is reported here. The genome is 151,328 bp in length and exhibits a typical quadripartite structure of the large (LSC, 82,695 bp) and small (SSC, 17,555 bp) single-copy regions, separated by a pair of inverted repeats (IRs, 25,539 bp). It contains 114 unique genes, including 80 protein-coding genes, 30 tRNAs and four rRNAs. The genome structure, gene order, GC content and codon usage are similar to the typical angiosperm cp genomes. Four forward, three inverted and seven tandem repeats were detected in the Salvia miltiorrhiza cp genome. Simple sequence repeat (SSR) analysis among the 30 asterid cp genomes revealed that most SSRs are AT-rich, which contribute to the overall AT richness of these cp genomes. Additionally, fewer SSRs are distributed in the protein-coding sequences compared to the non-coding regions, indicating an uneven distribution of SSRs within the cp genomes. Entire cp genome comparison of Salvia miltiorrhiza and three other Lamiales cp genomes showed a high degree of sequence similarity and a relatively high divergence of intergenic spacers. Sequence divergence analysis discovered the ten most divergent and ten most conserved genes as well as their length variation, which will be helpful for phylogenetic studies in asterids. Our analysis also supports that both regional and functional constraints affect gene sequence evolution. Further, phylogenetic analysis demonstrated a sister relationship between Salvia miltiorrhiza and Sesamum indicum. The complete cp genome sequence of Salvia miltiorrhiza reported in this paper will facilitate population, phylogenetic and cp genetic engineering studies of this medicinal plant.

  7. Imported dengue virus serotype 1 from Madeira to Finland 2012.

    PubMed

    Huhtamo, E; Korhonen, Em; Vapalahti, O

    2013-02-21

    Imported dengue cases originating from the Madeiran outbreak are increasingly reported. In 2012 five Finnish travellers returning from Madeira were diagnosed with dengue fever. Viral sequence data was obtained from two patients. The partial C-preM sequences (399 and 396 bp respectively) were found similar to that of an autochthonous case from Madeira. The partial E-gene sequence (933 bp) which was identical among the two patients grouped phylogenetically with South American strains of dengue virus serotype 1.

  8. Phylogenetic position of the giant anuran trypanosomes Trypanosoma chattoni, Trypanosoma fallisi, Trypanosoma mega, Trypanosoma neveulemairei, and Trypanosoma ranarum inferred from 18S rRNA gene sequences.

    PubMed

    Martin, Donald S; Wright, André-Denis G; Barta, John R; Desser, Sherwin S

    2002-06-01

    Phylogenetic relationships within the kinetoplastid flagellates were inferred from comparisons of small-subunit ribosomal RNA gene sequences. These included 5 new gene sequences, Trypanosoma fallisi (2,239 bp), Trypanosoma chattoni (2,180 bp), Trypanosoma mega (2,211 bp), Trypanosoma neveulemairei (2,197 bp), and Trypanosoma ranarum (2,203 bp). Trees produced using maximum-parsimony and distance-matrix methods (least-squares, neighbor-joining, and maximum-likelihood), supported by strong bootstrap and quartet-puzzle analyses, indicated that the trypanosomes are a monophyletic group that divides into 2 major lineages, the salivarian trypanosomes and the nonsalivarian trypanosomes. The nonsalivarian trypanosomes further divide into 2 lineages, 1 containing trypanosomes of birds, mammals, and reptiles and the other containing trypanosomes of fish, reptiles, and anurans. Among the giant trypanosomes, T. chattoni is clearly shown to be distantly related to all the other anuran trypanosome species. Trypanosoma mega is closely associated with T. fallisi and T. ranarum, whereas T. neveulemairei and Trypanosoma rotatorium are sister taxa. The branching order of the anuran trypanosomes suggests that some toad trypanosomes may have evolved by host switching from frogs to toads.

  9. Final progress report, Construction of a genome-wide highly characterized clone resource for genome sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nierman, William C.

    At TIGR, the human Bacterial Artificial Chromosome (BAC) end sequencing and trimming were with an overall sequencing success rate of 65%. CalTech human BAC libraries A, B, C and D as well as Roswell Park Cancer Institute's library RPCI-11 were used. To date, we have generated >300,000 end sequences from >186,000 human BAC clones with an average read length {approx}460 bp for a total of 141 Mb covering {approx}4.7% of the genome. Over sixty percent of the clones have BAC end sequences (BESs) from both ends representing over five-fold coverage of the genome by the paired-end clones. The average phredmore » Q20 length is {approx}400 bp. This high accuracy makes our BESs match the human finished sequences with an average identity of 99% and a match length of 450 bp, and a frequency of one match per 12.8 kb contig sequence. Our sample tracking has ensured a clone tracking accuracy of >90%, which gives researchers a high confidence in (1) retrieving the right clone from the BA C libraries based on the sequence matches; and (2) building a minimum tiling path of sequence-ready clones across the genome and genome assembly scaffolds.« less

  10. Detailed analysis of stem I and its 5' and 3' neighbor regions in the trans-acting HDV ribozyme.

    PubMed Central

    Nishikawa, F; Roy, M; Fauzi, H; Nishikawa, S

    1999-01-01

    To determine the stem I structure of the human hepatitis delta virus (HDV) ribozyme, which is related to the substrate sequence in the trans -acting system, we kinetically studied stem I length and sequences. Stem I extension from 7 to 8 or 9 bp caused a loss of activity and a low amount of active complex with 9 bp in the trans -acting system. In a previous report, we presented cleavage in a 6 bp stem I. The observed reaction rates indicate that the original 7 bp stem I is in the most favorable location for catalytic reaction among the possible 6-8 bp stems. To test base specificity, we replaced the original GC-rich sequence in stem I with AU-rich sequences containing six AU or UA base pairs with the natural +1G.U wobble base pair at the cleavage site. The cis -acting AU-rich molecules demonstrated similar catalytic activity to that of the wild-type. In trans -acting molecules, due to stem I instability, reaction efficiency strongly depended on the concentration of the ribozyme-substrate complex and reaction temperature. Multiple turnover was observed at 37 degreesC, strongly suggesting that stem I has no base specificity and more efficient activity can be expected under multiple turnover conditions by substituting several UA or AU base pairs into stem I. We also studied the substrate damaging sequences linked to both ends of stem I for its development in therapeutic applications and confirmed the functions of the unique structure. PMID:9862958

  11. Complete mitochondrial genome of Camponotus atrox (Hymenoptera: Formicidae): a new tRNA arrangement in Hymenoptera.

    PubMed

    Kim, Min Jee; Hong, Eui Jeong; Kim, Iksoo

    2016-01-01

    We sequenced the complete mitochondrial (mt) genome of Camponotus atrox (Hymenoptera: Formicidae), which is only distributed in Korea. The genome was 16 540 bp in size and contained typical sets of genes (13 protein-coding genes, 22 tRNAs, and 2 rRNAs). The C. atrox A+T-rich region, at 1402 bp, was the longest of all sequenced ant genomes and was composed of an identical tandem repeat consisting of six 100-bp copies and one 96-bp copy. A total of 315 bp of intergenic spacer sequence was spread over 23 regions. An alignment of the spacer sequences in ants was largely feasible among congeneric species, and there was substantial sequence divergence, indicating their potential use as molecular markers for congeneric species. The A/T contents at the first and second codon positions of protein-coding genes (PCGs) were similar for ant species, including C. atrox (73.9% vs. 72.3%, on average). With increased taxon sampling among hymenopteran superfamilies, differences in the divergence rates (i.e., the non-synonymous substitution rates) between the suborders Symphyta and Apocrita were detected, consistent with previous results. The C. atrox mt genome had a unique gene arrangement, trnI-trnM-trnQ, at the A+T-rich region and ND2 junction (underline indicates inverted gene). This may have originated from a tandem duplication of trnM-trnI, resulting in trnM-trnI-trnM-trnI-trnQ, and the subsequent loss of the first trnM and second trnI, resulting in trnI-trnM-trnQ.

  12. Complete Chloroplast Genome of the Multifunctional Crop Globe Artichoke and Comparison with Other Asteraceae

    PubMed Central

    Curci, Pasquale L.; De Paola, Domenico; Danzi, Donatella; Vendramin, Giovanni G.; Sonnante, Gabriella

    2015-01-01

    With over 20,000 species, Asteraceae is the second largest plant family. High-throughput sequencing of nuclear and chloroplast genomes has allowed for a better understanding of the evolutionary relationships within large plant families. Here, the globe artichoke chloroplast (cp) genome was obtained by a combination of whole-genome and BAC clone high-throughput sequencing. The artichoke cp genome is 152,529 bp in length, consisting of two single-copy regions separated by a pair of inverted repeats (IRs) of 25,155 bp, representing the longest IRs found in the Asteraceae family so far. The large (LSC) and the small (SSC) single-copy regions span 83,578 bp and 18,641 bp, respectively. The artichoke cp sequence was compared to the other eight Asteraceae complete cp genomes available, revealing an IR expansion at the SSC/IR boundary. This expansion consists of 17 bp of the ndhF gene generating an overlap between the ndhF and ycf1 genes. A total of 127 cp simple sequence repeats (cpSSRs) were identified in the artichoke cp genome, potentially suitable for future population studies in the Cynara genus. Parsimony-informative regions were evaluated and allowed to place a Cynara species within the Asteraceae family tree. The eight most informative coding regions were also considered and tested for “specific barcode” purpose in the Asteraceae family. Our results highlight the usefulness of cp genome sequencing in exploring plant genome diversity and retrieving reliable molecular resources for phylogenetic and evolutionary studies, as well as for specific barcodes in plants. PMID:25774672

  13. Complete chloroplast genome of the multifunctional crop globe artichoke and comparison with other Asteraceae.

    PubMed

    Curci, Pasquale L; De Paola, Domenico; Danzi, Donatella; Vendramin, Giovanni G; Sonnante, Gabriella

    2015-01-01

    With over 20,000 species, Asteraceae is the second largest plant family. High-throughput sequencing of nuclear and chloroplast genomes has allowed for a better understanding of the evolutionary relationships within large plant families. Here, the globe artichoke chloroplast (cp) genome was obtained by a combination of whole-genome and BAC clone high-throughput sequencing. The artichoke cp genome is 152,529 bp in length, consisting of two single-copy regions separated by a pair of inverted repeats (IRs) of 25,155 bp, representing the longest IRs found in the Asteraceae family so far. The large (LSC) and the small (SSC) single-copy regions span 83,578 bp and 18,641 bp, respectively. The artichoke cp sequence was compared to the other eight Asteraceae complete cp genomes available, revealing an IR expansion at the SSC/IR boundary. This expansion consists of 17 bp of the ndhF gene generating an overlap between the ndhF and ycf1 genes. A total of 127 cp simple sequence repeats (cpSSRs) were identified in the artichoke cp genome, potentially suitable for future population studies in the Cynara genus. Parsimony-informative regions were evaluated and allowed to place a Cynara species within the Asteraceae family tree. The eight most informative coding regions were also considered and tested for "specific barcode" purpose in the Asteraceae family. Our results highlight the usefulness of cp genome sequencing in exploring plant genome diversity and retrieving reliable molecular resources for phylogenetic and evolutionary studies, as well as for specific barcodes in plants.

  14. Comparative analysis of seven viral nuclear export signals (NESs) reveals the crucial role of nuclear export mediated by the third NES consensus sequence of nucleoprotein (NP) in influenza A virus replication.

    PubMed

    Chutiwitoonchai, Nopporn; Kakisaka, Michinori; Yamada, Kazunori; Aida, Yoko

    2014-01-01

    The assembly of influenza virus progeny virions requires machinery that exports viral genomic ribonucleoproteins from the cell nucleus. Currently, seven nuclear export signal (NES) consensus sequences have been identified in different viral proteins, including NS1, NS2, M1, and NP. The present study examined the roles of viral NES consensus sequences and their significance in terms of viral replication and nuclear export. Mutation of the NP-NES3 consensus sequence resulted in a failure to rescue viruses using a reverse genetics approach, whereas mutation of the NS2-NES1 and NS2-NES2 sequences led to a strong reduction in viral replication kinetics compared with the wild-type sequence. While the viral replication kinetics for other NES mutant viruses were also lower than those of the wild-type, the difference was not so marked. Immunofluorescence analysis after transient expression of NP-NES3, NS2-NES1, or NS2-NES2 proteins in host cells showed that they accumulated in the cell nucleus. These results suggest that the NP-NES3 consensus sequence is mostly required for viral replication. Therefore, each of the hydrophobic (Φ) residues within this NES consensus sequence (Φ1, Φ2, Φ3, or Φ4) was mutated, and its viral replication and nuclear export function were analyzed. No viruses harboring NP-NES3 Φ2 or Φ3 mutants could be rescued. Consistent with this, the NP-NES3 Φ2 and Φ3 mutants showed reduced binding affinity with CRM1 in a pull-down assay, and both accumulated in the cell nucleus. Indeed, a nuclear export assay revealed that these mutant proteins showed lower nuclear export activity than the wild-type protein. Moreover, the Φ2 and Φ3 residues (along with other Φ residues) within the NP-NES3 consensus were highly conserved among different influenza A viruses, including human, avian, and swine. Taken together, these results suggest that the Φ2 and Φ3 residues within the NP-NES3 protein are important for its nuclear export function during viral replication.

  15. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    PubMed Central

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  16. Enzyme-triggered delivery of chlorambucil from conjugates based on the cell-penetrating peptide BP16.

    PubMed

    Soler, Marta; González-Bártulos, Marta; Figueras, Eduard; Ribas, Xavi; Costas, Miquel; Massaguer, Anna; Planas, Marta; Feliu, Lidia

    2015-02-07

    The undecapeptide KKLFKKILKKL-NH2 (BP16) is a non-toxic cell-penetrating peptide (CPP) that is mainly internalized into cancer cells through a clathrin dependent endocytic mechanism and localizes in late endosomes. Moreover, this CPP is able to enhance the cellular uptake of chlorambucil (CLB) improving its cytotoxicity. In this work, we further explored the cell-penetrating properties of BP16 and those of its arginine analogue BP308. We investigated the influence on the cytotoxicity and on the cellular uptake of conjugating CLB at the N- or the C-terminal end of these undecapeptides. The effect of incorporating the cathepsin B-cleavable sequence Gly-Phe-Leu-Gly in CLB-BP16 and CLB-BP308 conjugates was also evaluated. The activity of CLB was significantly improved when conjugated at the N- or the C-terminus of BP16, or at the N-terminus of BP308. While CLB alone was not active (IC50 of 73.7 to >100 μM), the resulting conjugates displayed cytotoxic activity against CAPAN-1, MCF-7, PC-3, 1BR3G and SKMEL-28 cell lines with IC50 values ranging from 8.7 to 25.5 μM. These results were consistent with the internalization properties observed for the corresponding 5(6)-carboxyfluorescein-labeled conjugates. The presence of the tetrapeptide Gly-Phe-Leu-Gly at either the N- or the C-terminus of CLB-BP16 conjugates further increased the efficacy of CLB (IC50 of 3.6 to 16.2 μM), which could be attributed to its selective release in the lysosomal compartment. Enzymatic assays with cathepsin B showed the release of CLB-Gly-OH from these sequences within a short time. Therefore, the combination of BP16 with an enzymatic cleavable sequence can be used as a drug delivery system for the effective uptake and release of drugs in cancer cells.

  17. Complete genome sequence for the shellfish pathogen Vibrio coralliilyticus RE98 isolated from a shellfish hatchery

    USDA-ARS?s Scientific Manuscript database

    Vibrio coralliilyticus is a pathogen of corals and larval shellfish. Publications on strain RE98 list it as a Vibrio tubiashii; however, whole genome sequencing confirms RE98 as V. coralliilyticus containing a total of 6,037,824 bp consisting of two chromosomes (3,420,228 and 1,917,482 bp), and two...

  18. Complete Closed Genome Sequence of Nontoxigenic Invasive Corynebacterium diphtheriae bv. mitis Strain ISS 3319.

    PubMed

    Azevedo Antunes, Camila; Richardson, Emily J; Quick, Joshua; Fuentes-Utrilla, Pablo; Isom, Georgia L; Goodall, Emily C; Möller, Jens; Hoskisson, Paul A; Mattos-Guaraldi, Ana Luiza; Cunningham, Adam F; Loman, Nicholas J; Sangal, Vartul; Burkovski, Andreas; Henderson, Ian R

    2018-02-01

    The genome sequence of the human pathogen Corynebacterium diphtheriae bv. mitis strain ISS 3319 was determined and closed in this study. The genome is estimated to have 2,404,936 bp encoding 2,257 proteins. This strain also possesses a plasmid of 1,960 bp. Copyright © 2018 Azevedo Antunes et al.

  19. Identification and transcription profiling of NDUFS8 in Aedes taeniorhynchus (Diptera:Culididae): developmental regulation and environmental response

    USDA-ARS?s Scientific Manuscript database

    The cDNA of a NADH dehydrogenase -ubiquinone Fe-S protein 8 subunit (NDUFS8) gene from Aedes (Ochlerotatus) taeniorhynchus Wiedemann has been cloned and sequenced. The full-length mRNA sequence (824 bp) of AetNDUFS8 encodes an open reading region of 651 bp (i.e., 217 amino acids). To detect whether ...

  20. The complete chloroplast genome sequence of Actinidia arguta using the PacBio RS II platform

    PubMed Central

    Lin, Miaomiao; Qi, Xiujuan; Chen, Jinyong; Sun, Leiming; Zhong, Yunpeng; Fang, Jinbao; Hu, Chungen

    2018-01-01

    Actinidia arguta is the most basal species in a phylogenetically and economically important genus in the family Actinidiaceae. To better understand the molecular basis of the Actinidia arguta chloroplast (cp), we sequenced the complete cp genome from A. arguta using Illumina and PacBio RS II sequencing technologies. The cp genome from A. arguta was 157,611 bp in length and composed of a pair of 24,232 bp inverted repeats (IRs) separated by a 20,463 bp small single copy region (SSC) and an 88,684 bp large single copy region (LSC). Overall, the cp genome contained 113 unique genes. The cp genomes from A. arguta and three other Actinidia species from GenBank were subjected to a comparative analysis. Indel mutation events and high frequencies of base substitution were identified, and the accD and ycf2 genes showed a high degree of variation within Actinidia. Forty-seven simple sequence repeats (SSRs) and 155 repetitive structures were identified, further demonstrating the rapid evolution in Actinidia. The cp genome analysis and the identification of variable loci provide vital information for understanding the evolution and function of the chloroplast and for characterizing Actinidia population genetics. PMID:29795601

  1. Complete sequence and comparative analysis of the chloroplast genome of Plinia trunciflora

    PubMed Central

    Eguiluz, Maria; Yuyama, Priscila Mary; Guzman, Frank; Rodrigues, Nureyev Ferreira; Margis, Rogerio

    2017-01-01

    Abstract Plinia trunciflora is a Brazilian native fruit tree from the Myrtaceae family, also known as jaboticaba. This species has great potential by its fruit production. Due to the high content of essential oils in their leaves and of anthocyanins in the fruits, there is also an increasing interest by the pharmaceutical industry. Nevertheless, there are few studies focusing on its molecular biology and genetic characterization. We herein report the complete chloroplast (cp) genome of P. trunciflora using high-throughput sequencing and compare it to other previously sequenced Myrtaceae genomes. The cp genome of P. trunciflora is 159,512 bp in size, comprising inverted repeats of 26,414 bp and single-copy regions of 88,097 bp (LSC) and 18,587 bp (SSC). The genome contains 111 single-copy genes (77 protein-coding, 30 tRNA and four rRNA genes). Phylogenetic analysis using 57 cp protein-coding genes demonstrated that P. trunciflora, Eugenia uniflora and Acca sellowiana form a cluster with closer relationship to Syzygium cumini than with Eucalyptus. The complete cp sequence reported here can be used in evolutionary and population genetics studies, contributing to resolve the complex taxonomy of this species and fill the gap in genetic characterization. PMID:29111566

  2. Importance of Viral Sequence Length and Number of Variable and Informative Sites in Analysis of HIV Clustering.

    PubMed

    Novitsky, Vlad; Moyo, Sikhulile; Lei, Quanhong; DeGruttola, Victor; Essex, M

    2015-05-01

    To improve the methodology of HIV cluster analysis, we addressed how analysis of HIV clustering is associated with parameters that can affect the outcome of viral clustering. The extent of HIV clustering and tree certainty was compared between 401 HIV-1C near full-length genome sequences and subgenomic regions retrieved from the LANL HIV Database. Sliding window analysis was based on 99 windows of 1,000 bp and 45 windows of 2,000 bp. Potential associations between the extent of HIV clustering and sequence length and the number of variable and informative sites were evaluated. The near full-length genome HIV sequences showed the highest extent of HIV clustering and the highest tree certainty. At the bootstrap threshold of 0.80 in maximum likelihood (ML) analysis, 58.9% of near full-length HIV-1C sequences but only 15.5% of partial pol sequences (ViroSeq) were found in clusters. Among HIV-1 structural genes, pol showed the highest extent of clustering (38.9% at a bootstrap threshold of 0.80), although it was significantly lower than in the near full-length genome sequences. The extent of HIV clustering was significantly higher for sliding windows of 2,000 bp than 1,000 bp. We found a strong association between the sequence length and proportion of HIV sequences in clusters, and a moderate association between the number of variable and informative sites and the proportion of HIV sequences in clusters. In HIV cluster analysis, the extent of detectable HIV clustering is directly associated with the length of viral sequences used, as well as the number of variable and informative sites. Near full-length genome sequences could provide the most informative HIV cluster analysis. Selected subgenomic regions with a high extent of HIV clustering and high tree certainty could also be considered as a second choice.

  3. Importance of Viral Sequence Length and Number of Variable and Informative Sites in Analysis of HIV Clustering

    PubMed Central

    Novitsky, Vlad; Moyo, Sikhulile; Lei, Quanhong; DeGruttola, Victor

    2015-01-01

    Abstract To improve the methodology of HIV cluster analysis, we addressed how analysis of HIV clustering is associated with parameters that can affect the outcome of viral clustering. The extent of HIV clustering and tree certainty was compared between 401 HIV-1C near full-length genome sequences and subgenomic regions retrieved from the LANL HIV Database. Sliding window analysis was based on 99 windows of 1,000 bp and 45 windows of 2,000 bp. Potential associations between the extent of HIV clustering and sequence length and the number of variable and informative sites were evaluated. The near full-length genome HIV sequences showed the highest extent of HIV clustering and the highest tree certainty. At the bootstrap threshold of 0.80 in maximum likelihood (ML) analysis, 58.9% of near full-length HIV-1C sequences but only 15.5% of partial pol sequences (ViroSeq) were found in clusters. Among HIV-1 structural genes, pol showed the highest extent of clustering (38.9% at a bootstrap threshold of 0.80), although it was significantly lower than in the near full-length genome sequences. The extent of HIV clustering was significantly higher for sliding windows of 2,000 bp than 1,000 bp. We found a strong association between the sequence length and proportion of HIV sequences in clusters, and a moderate association between the number of variable and informative sites and the proportion of HIV sequences in clusters. In HIV cluster analysis, the extent of detectable HIV clustering is directly associated with the length of viral sequences used, as well as the number of variable and informative sites. Near full-length genome sequences could provide the most informative HIV cluster analysis. Selected subgenomic regions with a high extent of HIV clustering and high tree certainty could also be considered as a second choice. PMID:25560745

  4. The Functional Human C-Terminome

    PubMed Central

    Hedden, Michael; Lyon, Kenneth F.; Brooks, Steven B.; David, Roxanne P.; Limtong, Justin; Newsome, Jacklyn M.; Novakovic, Nemanja; Rajasekaran, Sanguthevar; Thapar, Vishal; Williams, Sean R.; Schiller, Martin R.

    2016-01-01

    All translated proteins end with a carboxylic acid commonly called the C-terminus. Many short functional sequences (minimotifs) are located on or immediately proximal to the C-terminus. However, information about the function of protein C-termini has not been consolidated into a single source. Here, we built a new “C-terminome” database and web system focused on human proteins. Approximately 3,600 C-termini in the human proteome have a minimotif with an established molecular function. To help evaluate the function of the remaining C-termini in the human proteome, we inferred minimotifs identified by experimentation in rodent cells, predicted minimotifs based upon consensus sequence matches, and predicted novel highly repetitive sequences in C-termini. Predictions can be ranked by enrichment scores or Gene Evolutionary Rate Profiling (GERP) scores, a measurement of evolutionary constraint. By searching for new anchored sequences on the last 10 amino acids of proteins in the human proteome with lengths between 3–10 residues and up to 5 degenerate positions in the consensus sequences, we have identified new consensus sequences that predict instances in the majority of human genes. All of this information is consolidated into a database that can be accessed through a C-terminome web system with search and browse functions for minimotifs and human proteins. A known consensus sequence-based predicted function is assigned to nearly half the proteins in the human proteome. Weblink: http://cterminome.bio-toolkit.com. PMID:27050421

  5. Drosophila C-terminal binding protein, dCtBP is required for sensory organ prepattern and sharpens proneural transcriptional activity of the GATA factor Pnr.

    PubMed

    Biryukova, Inna; Heitzler, Pascal

    2008-11-01

    The peripheral nervous system is required for animals to detect and to relay environmental stimuli to central nervous system for the information processing. In Drosophila, the precise spatial and temporal expression of two proneural genes achaete (ac) and scute (sc), is necessary for development of the sensory organs. Here we present an evidence that the transcription co-repressor, dCtBP acts as a negative regulator of sensory organ prepattern. Loss of dCtBP function mutant exhibits ectopic sensory organs, while overexpression of dCtBP results in a dramatic loss of sensory organs. These phenotypes are correlated with mis-emerging of sensory organ precursors and perturbated expression of proneural transcription activator Ac. Mammalian CtBP-1 was identified via interaction with the consensus motif PXDLSX(K/R) of adenovirus E1A oncoprotein. We demonstrated that dCtBP binds directly to PLDLS motif of Drosophila Friend of GATA-1 protein, U-shaped and sharpens the adult sensory organ development. Moreover, we found that dCtBP mediates multivalent interaction with the GATA transcriptional activator Pannier and acts as a direct co-repressor of the Pannier-mediated activation of proneural genes. We demonstrated that Pannier genetically interacts with dCtBP-interacting protein HDAC1, suggesting that the dCtBP-dependent regulation of Pannier activity could utilize a repressive mechanism involving alteration of local chromatine structure.

  6. Genetic Relatedness of Clostridium difficile Isolates from Various Origins Determined by Triple-Locus Sequence Analysis Based on Toxin Regulatory Genes tcdC, tcdR, and cdtR▿

    PubMed Central

    Bouvet, Philippe J. M.; Popoff, Michel R.

    2008-01-01

    A triple-locus nucleotide sequence analysis based on toxin regulatory genes tcdC, tcdR and cdtR was initiated to assess the sequence variability of these genes among Clostridium difficile isolates and to study the genetic relatedness between isolates. A preliminary investigation of the variability of the tcdC gene was done with 57 clinical and veterinary isolates. Twenty-three isolates representing nine main clusters were selected for tcdC, tcdR, and cdtR analysis. The numbers of alleles found for tcdC, tcdR and cdtR were nine, six, and five, respectively. All strains possessed the cdtR gene except toxin A-negative toxin B-positive variants. All but one binary toxin CDT-positive isolate harbored a deletion (>1 bp) in the tcdC gene. The combined analyses of the three genes allowed us to distinguish five lineages correlated with the different types of deletion in tcdC, i.e., 18 bp (associated or not with a deletion at position 117), 36 bp, 39 bp, and 54 bp, and with the wild-type tcdC (no deletion). The tcdR and tcdC genes, though located within the same pathogenicity locus, were found to have evolved separately. Coevolution of the three genes was noted only with strains harboring a 39-bp or a 54-bp deletion in tcdC that formed two homogeneous, separate divergent clusters. Our study supported the existence of the known clones (PCR ribotype 027 isolates and toxin A-negative toxin B-positive C. difficile variants) and evidence for clonality of isolates with a 39-bp deletion (toxinotype V, PCR ribotype 078) that are frequently isolated worldwide from human infections and from food animals. PMID:18832125

  7. Sequence space coverage, entropy of genomes and the potential to detect non-human DNA in human samples

    PubMed Central

    Liu, Zhandong; Venkatesh, Santosh S; Maley, Carlo C

    2008-01-01

    Background Genomes store information for building and maintaining organisms. Complete sequencing of many genomes provides the opportunity to study and compare global information properties of those genomes. Results We have analyzed aspects of the information content of Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae, and Escherichia coli (K-12) genomes. Virtually all possible (> 98%) 12 bp oligomers appear in vertebrate genomes while < 2% of 19 bp oligomers are present. Other species showed different ranges of > 98% to < 2% of possible oligomers in D. melanogaster (12–17 bp), C. elegans (11–17 bp), A. thaliana (11–17 bp), S. cerevisiae (10–16 bp) and E. coli (9–15 bp). Frequencies of unique oligomers in the genomes follow similar patterns. We identified a set of 2.6 M 15-mers that are more than 1 nucleotide different from all 15-mers in the human genome and so could be used as probes to detect microbes in human samples. In a human sample, these probes would detect 100% of the 433 currently fully sequenced prokaryotes and 75% of the 3065 fully sequenced viruses. The human genome is significantly more compact in sequence space than a random genome. We identified the most frequent 5- to 20-mers in the human genome, which may prove useful as PCR primers. We also identified a bacterium, Anaeromyxobacter dehalogenans, which has an exceptionally low diversity of oligomers given the size of its genome and its GC content. The entropy of coding regions in the human genome is significantly higher than non-coding regions and chromosomes. However chromosomes 1, 2, 9, 12 and 14 have a relatively high proportion of coding DNA without high entropy, and chromosome 20 is the opposite with a low frequency of coding regions but relatively high entropy. Conclusion Measures of the frequency of oligomers are useful for designing PCR assays and for identifying chromosomes and organisms with hidden structure that had not been previously recognized. This information may be used to detect novel microbes in human tissues. PMID:18973670

  8. BpWrapper: BioPerl-based sequence and tree utilities for rapid prototyping of bioinformatics pipelines.

    PubMed

    Hernández, Yözen; Bernstein, Rocky; Pagan, Pedro; Vargas, Levy; McCaig, William; Ramrattan, Girish; Akther, Saymon; Larracuente, Amanda; Di, Lia; Vieira, Filipe G; Qiu, Wei-Gang

    2018-03-02

    Automated bioinformatics workflows are more robust, easier to maintain, and results more reproducible when built with command-line utilities than with custom-coded scripts. Command-line utilities further benefit by relieving bioinformatics developers to learn the use of, or to interact directly with, biological software libraries. There is however a lack of command-line utilities that leverage popular Open Source biological software toolkits such as BioPerl ( http://bioperl.org ) to make many of the well-designed, robust, and routinely used biological classes available for a wider base of end users. Designed as standard utilities for UNIX-family operating systems, BpWrapper makes functionality of some of the most popular BioPerl modules readily accessible on the command line to novice as well as to experienced bioinformatics practitioners. The initial release of BpWrapper includes four utilities with concise command-line user interfaces, bioseq, bioaln, biotree, and biopop, specialized for manipulation of molecular sequences, sequence alignments, phylogenetic trees, and DNA polymorphisms, respectively. Over a hundred methods are currently available as command-line options and new methods are easily incorporated. Performance of BpWrapper utilities lags that of precompiled utilities while equivalent to that of other utilities based on BioPerl. BpWrapper has been tested on BioPerl Release 1.6, Perl versions 5.10.1 to 5.25.10, and operating systems including Apple macOS, Microsoft Windows, and GNU/Linux. Release code is available from the Comprehensive Perl Archive Network (CPAN) at https://metacpan.org/pod/Bio::BPWrapper . Source code is available on GitHub at https://github.com/bioperl/p5-bpwrapper . BpWrapper improves on existing sequence utilities by following the design principles of Unix text utilities such including a concise user interface, extensive command-line options, and standard input/output for serialized operations. Further, dozens of novel methods for manipulation of sequences, alignments, and phylogenetic trees, unavailable in existing utilities (e.g., EMBOSS, Newick Utilities, and FAST), are provided. Bioinformaticians should find BpWrapper useful for rapid prototyping of workflows on the command-line without creating custom scripts for comparative genomics and other bioinformatics applications.

  9. Sequence space coverage, entropy of genomes and the potential to detect non-human DNA in human samples.

    PubMed

    Liu, Zhandong; Venkatesh, Santosh S; Maley, Carlo C

    2008-10-30

    Genomes store information for building and maintaining organisms. Complete sequencing of many genomes provides the opportunity to study and compare global information properties of those genomes. We have analyzed aspects of the information content of Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae, and Escherichia coli (K-12) genomes. Virtually all possible (> 98%) 12 bp oligomers appear in vertebrate genomes while < 2% of 19 bp oligomers are present. Other species showed different ranges of > 98% to < 2% of possible oligomers in D. melanogaster (12-17 bp), C. elegans (11-17 bp), A. thaliana (11-17 bp), S. cerevisiae (10-16 bp) and E. coli (9-15 bp). Frequencies of unique oligomers in the genomes follow similar patterns. We identified a set of 2.6 M 15-mers that are more than 1 nucleotide different from all 15-mers in the human genome and so could be used as probes to detect microbes in human samples. In a human sample, these probes would detect 100% of the 433 currently fully sequenced prokaryotes and 75% of the 3065 fully sequenced viruses. The human genome is significantly more compact in sequence space than a random genome. We identified the most frequent 5- to 20-mers in the human genome, which may prove useful as PCR primers. We also identified a bacterium, Anaeromyxobacter dehalogenans, which has an exceptionally low diversity of oligomers given the size of its genome and its GC content. The entropy of coding regions in the human genome is significantly higher than non-coding regions and chromosomes. However chromosomes 1, 2, 9, 12 and 14 have a relatively high proportion of coding DNA without high entropy, and chromosome 20 is the opposite with a low frequency of coding regions but relatively high entropy. Measures of the frequency of oligomers are useful for designing PCR assays and for identifying chromosomes and organisms with hidden structure that had not been previously recognized. This information may be used to detect novel microbes in human tissues.

  10. Detection and identification of bacteria in clinical samples by 16S rRNA gene sequencing: comparison of two different approaches in clinical practice.

    PubMed

    Jenkins, Claire; Ling, Clare L; Ciesielczuk, Holly L; Lockwood, Julianne; Hopkins, Susan; McHugh, Timothy D; Gillespie, Stephen H; Kibbler, Christopher C

    2012-04-01

    Amplification and sequence analysis of the 16S rRNA gene can be applied to detect and identify bacteria in clinical samples. We examined 75 clinical samples (17 culture-positive, 58 culture-negative) prospectively by two different PCR protocols, amplifying either a single fragment (1343 bp) or two fragments (762/598 bp) of the 16S rRNA gene. The 1343 bp PCR and 762/598 bp PCRs detected and identified the bacterial 16S rRNA gene in 23 (31 %) and 38 (51 %) of the 75 samples, respectively. The 1343 bp PCR identified 19 of 23 (83 %) PCR-positive samples to species level while the 762/598 bp PCR identified 14 of 38 (37 %) bacterial 16S rRNA gene fragments to species level and 24 to the genus level only. Amplification of shorter fragments of the bacterial 16S rRNA gene (762 and 598 bp) resulted in a more sensitive assay; however, analysis of a large fragment (1343 bp) improved species discrimination. Although not statistically significant, the 762/598 bp PCR detected the bacterial 16S rRNA gene in more samples than the 1343 bp PCR, making it more likely to be a more suitable method for the primary detection of the bacterial 16S rRNA gene in the clinical setting. The 1343 bp PCR may be used in combination with the 762/598 bp PCR when identification of the bacterial rRNA gene to species level is required.

  11. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    PubMed

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  12. Characterization of Halophilic Bacterial Communities in Turda Salt Mine (Romania)

    NASA Astrophysics Data System (ADS)

    Carpa, Rahela; Keul, Anca; Muntean, Vasile; Dobrotă, Cristina

    2014-09-01

    Halophilic organisms are having adaptations to extreme salinity, the majority of them being Archaean, which have the ability to grow at extremely high salt concentrations, (from 3 % to 35 %). Level of salinity causes natural fluctuations in the halophilic populations that inhabit this particular habitat, raising problems in maintaining homeostasis of the osmotic pressure. Samples such as salt and water taken from Turda Salt Mine were analyzed in order to identify the eco-physiological bacterial groups. Considering the number of bacteria of each eco-physiological group, the bacterial indicators of salt quality (BISQ) were calculated and studied for each sample. The phosphatase, catalase and dehydrogenases enzymatic activities were quantitatively determined and the enzymatic indicators of salt quality (EISQ) were calculated. Bacterial isolates were analyzed using 16S rRNA gene sequence analysis. Universal bacterial primers, targeting the consensus region of the bacterial 16S rRNA gene were used. Analysis of a large fragment, of 1499 bp was performed to improve discrimination at the species level.

  13. Diffusion-weighted imaging of the liver with multiple b values: effect of diffusion gradient polarity and breathing acquisition on image quality and intravoxel incoherent motion parameters--a pilot study.

    PubMed

    Dyvorne, Hadrien A; Galea, Nicola; Nevers, Thomas; Fiel, M Isabel; Carpenter, David; Wong, Edmund; Orton, Matthew; de Oliveira, Andre; Feiweier, Thorsten; Vachon, Marie-Louise; Babb, James S; Taouli, Bachir

    2013-03-01

    To optimize intravoxel incoherent motion (IVIM) diffusion-weighted (DW) imaging by estimating the effects of diffusion gradient polarity and breathing acquisition scheme on image quality, signal-to-noise ratio (SNR), IVIM parameters, and parameter reproducibility, as well as to investigate the potential of IVIM in the detection of hepatic fibrosis. In this institutional review board-approved prospective study, 20 subjects (seven healthy volunteers, 13 patients with hepatitis C virus infection; 14 men, six women; mean age, 46 years) underwent IVIM DW imaging with four sequences: (a) respiratory-triggered (RT) bipolar (BP) sequence, (b) RT monopolar (MP) sequence, (c) free-breathing (FB) BP sequence, and (d) FB MP sequence. Image quality scores were assessed for all sequences. A biexponential analysis with the Bayesian method yielded true diffusion coefficient (D), pseudodiffusion coefficient (D*), and perfusion fraction (PF) in liver parenchyma. Mixed-model analysis of variance was used to compare image quality, SNR, IVIM parameters, and interexamination variability between the four sequences, as well as the ability to differentiate areas of liver fibrosis from normal liver tissue. Image quality with RT sequences was superior to that with FB acquisitions (P = .02) and was not affected by gradient polarity. SNR did not vary significantly between sequences. IVIM parameter reproducibility was moderate to excellent for PF and D, while it was less reproducible for D*. PF and D were both significantly lower in patients with hepatitis C virus than in healthy volunteers with the RT BP sequence (PF = 13.5% ± 5.3 [standard deviation] vs 9.2% ± 2.5, P = .038; D = [1.16 ± 0.07] × 10(-3) mm(2)/sec vs [1.03 ± 0.1] × 10(-3) mm(2)/sec, P = .006). The RT BP DW imaging sequence had the best results in terms of image quality, reproducibility, and ability to discriminate between healthy and fibrotic liver with biexponential fitting.

  14. Pilot survey of expressed sequence tags (ESTs) from the asexual blood stages of Plasmodium vivax in human patients.

    PubMed

    Merino, Emilio F; Fernandez-Becerra, Carmen; Madeira, Alda M B N; Machado, Ariane L; Durham, Alan; Gruber, Arthur; Hall, Neil; del Portillo, Hernando A

    2003-07-21

    Plasmodium vivax is the most widely distributed human malaria, responsible for 70-80 million clinical cases each year and large socio-economical burdens for countries such as Brazil where it is the most prevalent species. Unfortunately, due to the impossibility of growing this parasite in continuous in vitro culture, research on P. vivax remains largely neglected. A pilot survey of expressed sequence tags (ESTs) from the asexual blood stages of P. vivax was performed. To do so, 1,184 clones from a cDNA library constructed with parasites obtained from 10 different human patients in the Brazilian Amazon were sequenced. Sequences were automatedly processed to remove contaminants and low quality reads. A total of 806 sequences with an average length of 586 bp met such criteria and their clustering revealed 666 distinct events. The consensus sequence of each cluster and the unique sequences of the singlets were used in similarity searches against different databases that included P. vivax, Plasmodium falciparum, Plasmodium yoelii, Plasmodium knowlesi, Apicomplexa and the GenBank non-redundant database. An E-value of <10(-30) was used to define a significant database match. ESTs were manually assigned a gene ontology (GO) terminology A total of 769 ESTs could be assigned a putative identity based upon sequence similarity to known proteins in GenBank. Moreover, 292 ESTs were annotated and a GO terminology was assigned to 164 of them. These are the first ESTs reported for P. vivax and, as such, they represent a valuable resource to assist in the annotation of the P. vivax genome currently being sequenced. Moreover, since the GC-content of the P. vivax genome is strikingly different from that of P. falciparum, these ESTs will help in the validation of gene predictions for P. vivax and to create a gene index of this malaria parasite.

  15. The complete chloroplast genome of Sinopodophyllum hexandrum Ying (Berberidaceae).

    PubMed

    Meng, Lihua; Liu, Ruijuan; Chen, Jianbing; Ding, Chenxu

    2017-05-01

    The complete nucleotide sequence of the Sinopodophyllum hexandrum Ying chloroplast genome (cpDNA) was determined based on next-generation sequencing technologies in this study. The genome was 157 203 bp in length, containing a pair of inverted repeat (IRa and IRb) regions of 25 960 bp, which were separated by a large single-copy (LSC) region of 87 065 bp and a small single-copy (SSC) region of 18 218 bp, respectively. The cpDNA contained 148 genes, including 96 protein-coding genes, 8 ribosomal RNA genes, and 44 tRNA genes. In these genes, eight harbored a single intron, and two (ycf3 and clpP) contained a couple of introns. The cpDNA AT content of S. hexandrum cpDNA is 61.5%.

  16. Characterization of a Novel Composite Staphylococcal Cassette Chromosome mec in Methicillin-Resistant Staphylococcus pseudintermedius from Thailand

    PubMed Central

    Chanchaithong, Pattrarat; Prapasarakul, Nuvee; Schwendener, Sybille

    2015-01-01

    A novel staphylococcal cassette chromosome mec (SCCmec) composite island (SCCmecAI16-SCCczrAI16-CI) was identified in Staphylococcus pseudintermedius. Four integration site sequences for SCC subdivided the 60,734-bp island into 41,232-bp SCCmecAI16, 19,400-bp SCCczrAI16, and 102-bp SCC-likeAI16 elements. SCCmecAI16 represents a new combination of ccrA1B3 genes with a class A mec complex. SCCczrAI16 contains ccrA1B6 and genes related to restriction modification and heavy metal resistance. SCCmecAI16-SCCczrAI16-CI was found in methicillin-resistant S. pseudintermedius sequence type 112 (ST112) and ST111 isolated from dogs and veterinarians in Thailand. PMID:26643350

  17. The complete chloroplast genome of the Dendrobium strongylanthum (Orchidaceae: Epidendroideae).

    PubMed

    Li, Jing; Chen, Chen; Wang, Zhe-Zhi

    2016-07-01

    Complete chloroplast genome sequence is very useful for studying the phylogenetic and evolution of species. In this study, the complete chloroplast genome of Dendrobium strongylanthum was constructed from whole-genome Illumina sequencing data. The chloroplast genome is 153 058 bp in length with 37.6% GC content and consists of two inverted repeats (IRs) of 26 316 bp. The IR regions are separated by large single-copy region (LSC, 85 836 bp) and small single-copy (SSC, 14 590 bp) region. A total of 130 chloroplast genes were successfully annotated, including 84 protein coding genes, 38 tRNA genes, and eight rRNA genes. Phylogenetic analyses showed that the chloroplast genome of Dendrobium strongylanthum is related to that of the Dendrobium officinal.

  18. Pyrosequencing as a tool for the identification of common isolates of Mycobacterium sp.

    PubMed

    Tuohy, Marion J; Hall, Gerri S; Sholtis, Mary; Procop, Gary W

    2005-04-01

    Pyrosequencing technology, sequencing by addition, was evaluated for categorization of mycobacterial isolates. One hundred and eighty-nine isolates, including 18 ATCC and Trudeau Mycobacterial Culture Collection (TMC) strains, were studied. There were 38 Mycobacterium tuberculosis complex, 27 M. kansasii, 27 MAI complex, 21 M. marinum, 14 M. gordonae, 20 M. chelonae-abscessus group, 10 M. fortuitum, 5 M. xenopi, 3 M. celatum, 2 M. terrae complex, 20 M. mucogenicum, and 2 M. scrofulaceum. Nucleic acid extracts were prepared from solid media or MGIT broth. Traditional PCR was performed with one of the primers biotinylated; the assay targeted a portion of the 16S rRNA gene that contains a hypervariable region, which has been previously shown to be useful for the identification of mycobacteria. The PSQ Sample Preparation Kit was used, and the biotinylated PCR product was processed to a single-stranded DNA template. The sequencing primer was hybridized to the DNA template in a PSQ96 plate. Incorporation of the complementary nucleotides resulted in light generation peaks, forming a pyrogram, which was evaluated by the instrument software. Thirty basepairs were used for isolate categorization. Manual interpretation of the sequences was performed if the quality of the 30-bp sequence was in doubt or if more than 4 bp homopolymers were recognized. Sequences with more than 5 bp of bad quality were deemed unacceptable. When blasted against GenBank, 179 of 189 sequences (94.7%) assigned isolates to the correct molecular genus or group. Ten M. gordonae isolates had more than 5 bp of bad quality sequence and were not accepted. Pyrosequencing of this hypervariable region afforded rapid and acceptable characterization of common, routinely isolated clinical Mycobacterium sp. Algorithms are recommended for further differentiation with an additional sequencing primer or additional biochemicals.

  19. Antibiotic Resistance Markers in Burkholderia pseudomallei Strain Bp1651 Identified by Genome Sequence Analysis

    PubMed Central

    Sue, David; Gee, Jay E.; Elrod, Mindy G.; Hoffmaster, Alex R.; Randall, Linnell B.; Chirakul, Sunisa; Tuanyok, Apichai; Schweizer, Herbert P.; Weigel, Linda M.

    2017-01-01

    ABSTRACT Burkholderia pseudomallei Bp1651 is resistant to several classes of antibiotics that are usually effective for treatment of melioidosis, including tetracyclines, sulfonamides, and β-lactams such as penicillins (amoxicillin-clavulanic acid), cephalosporins (ceftazidime), and carbapenems (imipenem and meropenem). We sequenced, assembled, and annotated the Bp1651 genome and analyzed the sequence using comparative genomic analyses with susceptible strains, keyword searches of the annotation, publicly available antimicrobial resistance prediction tools, and published reports. More than 100 genes in the Bp1651 sequence were identified as potentially contributing to antimicrobial resistance. Most notably, we identified three previously uncharacterized point mutations in penA, which codes for a class A β-lactamase and was previously implicated in resistance to β-lactam antibiotics. The mutations result in amino acid changes T147A, D240G, and V261I. When individually introduced into select agent-excluded B. pseudomallei strain Bp82, D240G was found to contribute to ceftazidime resistance and T147A contributed to amoxicillin-clavulanic acid and imipenem resistance. This study provides the first evidence that mutations in penA may alter susceptibility to carbapenems in B. pseudomallei. Another mutation of interest was a point mutation affecting the dihydrofolate reductase gene folA, which likely explains the trimethoprim resistance of this strain. Bp1651 was susceptible to aminoglycosides likely because of a frameshift in the amrB gene, the transporter subunit of the AmrAB-OprA efflux pump. These findings expand the role of penA to include resistance to carbapenems and may assist in the development of molecular diagnostics that predict antimicrobial resistance and provide guidance for treatment of melioidosis. PMID:28396541

  20. Characterization and phylogenetic analysis of the swine leukocyte antigen 3 gene from Korean native pigs.

    PubMed

    Chung, H Y; Choi, Y C; Park, H N

    2015-05-18

    We investigated the phylogenetic relationships between pig breeds, compared the genetic similarity between humans and pigs, and provided basic genetic information on Korean native pigs (KNPs), using genetic variants of the swine leukocyte antigen 3 (SLA-3) gene. Primers were based on sequences from GenBank (accession Nos. AF464010 and AF464009). Polymerase chain reaction analysis amplified approximately 1727 bp of segments, which contained 1086 bp of coding regions and 641 bp of the 3'- and 5'-untranslated regions. Bacterial artificial chromosome clones of miniature pigs were used for sequencing the SLA-3 genomic region, which was 3114 bp in total length, including the coding (1086 bp) and non-coding (2028 bp) regions. Sequence analysis detected 53 single nucleotide polymorphisms (SNPs), based on a minor allele frequency greater than 0.01, which is low compared with other pig breeds, and the results suggest that there is low genetic variability in KNPs. Comparative analysis revealed that humans possess approximately three times more genetic variation than do pigs. Approximately 71% of SNPs in exons 2 and 3 were detected in KNPs, and exon 5 in humans is a highly polymorphic region. Newly identified sequences of SLA-3 using KNPs were submitted to GenBank (accession No. DQ992512-18). Cluster analysis revealed that KNPs were grouped according to three major alleles: SLA-3*0502 (DQ992518), SLA-3*0302 (DQ992513 and DQ992516), and SLA-3*0303 (DQ992512, DQ992514, DQ992515, and DQ992517). Alignments revealed that humans have a relatively close genetic relationship with pigs and chimpanzees. The information provided by this study may be useful in KNP management.

  1. Investigating Holocene human population history in North Asia using ancient mitogenomes.

    PubMed

    Kılınç, Gülşah Merve; Kashuba, Natalija; Yaka, Reyhan; Sümer, Arev Pelin; Yüncü, Eren; Shergin, Dmitrij; Ivanov, Grigorij Leonidovich; Kichigin, Dmitrii; Pestereva, Kjunnej; Volkov, Denis; Mandryka, Pavel; Kharinskii, Artur; Tishkin, Alexey; Ineshin, Evgenij; Kovychev, Evgeniy; Stepanov, Aleksandr; Alekseev, Aanatolij; Fedoseeva, Svetlana Aleksandrovna; Somel, Mehmet; Jakobsson, Mattias; Krzewińska, Maja; Storå, Jan; Götherström, Anders

    2018-06-12

    Archaeogenomic studies have largely elucidated human population history in West Eurasia during the Stone Age. However, despite being a broad geographical region of significant cultural and linguistic diversity, little is known about the population history in North Asia. We present complete mitochondrial genome sequences together with stable isotope data for 41 serially sampled ancient individuals from North Asia, dated between c.13,790 BP and c.1,380 BP extending from the Palaeolithic to the Iron Age. Analyses of mitochondrial DNA sequences and haplogroup data of these individuals revealed the highest genetic affinity to present-day North Asian populations of the same geographical region suggesting a possible long-term maternal genetic continuity in the region. We observed a decrease in genetic diversity over time and a reduction of maternal effective population size (N e ) approximately seven thousand years before present. Coalescent simulations were consistent with genetic continuity between present day individuals and individuals dating to 7,000 BP, 4,800 BP or 3,000 BP. Meanwhile, genetic differences observed between 7,000 BP and 3,000 BP as well as between 4,800 BP and 3,000 BP were inconsistent with genetic drift alone, suggesting gene flow into the region from distant gene pools or structure within the population. These results indicate that despite some level of continuity between ancient groups and present-day populations, the region exhibits a complex demographic history during the Holocene.

  2. Complete Genome Sequence of Thermus thermophilus TMY, Isolated from a Geothermal Power Plant

    PubMed Central

    Fujino, Yasuhiro; Nagayoshi, Yuko; Ohshima, Toshihisa; Ogata, Seiya

    2017-01-01

    ABSTRACT Thermus thermophilus TMY (JCM 10668) was isolated from silica scale formed at a geothermal power plant in Japan. Here, we report the complete genome sequence for this strain, which contains a chromosomal DNA of 2,121,526 bp with 2,500 predicted genes and a pTMY plasmid of 19,139 bp, with 28 predicted genes. PMID:28153912

  3. Assembly of the draft genome of buckwheat and its applications in identifying agronomically useful genes

    PubMed Central

    Yasui, Yasuo; Hirakawa, Hideki; Ueno, Mariko; Matsui, Katsuhiro; Katsube-Tanaka, Tomoyuki; Yang, Soo Jung; Aii, Jotaro; Sato, Shingo; Mori, Masashi

    2016-01-01

    Buckwheat (Fagopyrum esculentum Moench; 2n = 2x = 16) is a nutritionally dense annual crop widely grown in temperate zones. To accelerate molecular breeding programmes of this important crop, we generated a draft assembly of the buckwheat genome using short reads obtained by next-generation sequencing (NGS), and constructed the Buckwheat Genome DataBase. After assembling short reads, we determined 387,594 scaffolds as the draft genome sequence (FES_r1.0). The total length of FES_r1.0 was 1,177,687,305 bp, and the N50 of the scaffolds was 25,109 bp. Gene prediction analysis revealed 286,768 coding sequences (CDSs; FES_r1.0_cds) including those related to transposable elements. The total length of FES_r1.0_cds was 212,917,911 bp, and the N50 was 1,101 bp. Of these, the functions of 35,816 CDSs excluding those for transposable elements were annotated by BLAST analysis. To demonstrate the utility of the database, we conducted several test analyses using BLAST and keyword searches. Furthermore, we used the draft genome as a reference sequence for NGS-based markers, and successfully identified novel candidate genes controlling heteromorphic self-incompatibility of buckwheat. The database and draft genome sequence provide a valuable resource that can be used in efforts to develop buckwheat cultivars with superior agronomic traits. PMID:27037832

  4. [Blue-light induced expression of S-adenosy-L-homocysteine hydrolase-like gene in Mucor amphibiorum RCS1].

    PubMed

    Gao, Ya; Wang, Shu; Fu, Mingjia; Zhong, Guolin

    2013-09-04

    To determine blue-light induced expression of S-adenosyl-L-homocysteine hydrolase-like (sahhl) gene in fungus Mucor amphibiorum RCS1. In the random process of PCR, a sequence of 555 bp was obtained from M. amphibiorum RCS1. The 555 bp sequence was labeled with digoxin to prepare the probe for northern hybridization. By northern hybridization, the transcription of sahhl gene was analyzed in M. amphibiorum RCS1 mycelia culture process from darkness to blue light to darkness. Simultaneously real-time PCR method was used to the sahhl gene expression analysis. Compared with the sequence of sahh gene from Homo sapiens, Mus musculus and some fungi species, a high homology of the 555 bp sequence was confirmed. Therefore, the preliminary confirmation has supported that the 555 bp sequence should be sahhl gene from M. amphibiorum RCS1. Under the dark pre-culture in 24 h, a large amounts of transcript of sahhl gene in the mycelia can be detected by northern hybridization and real-time PCR in the condition of 24 h blue light. But a large amounts of transcript of sahhl gene were not found in other detection for the dark pre-culture of 48 h, even though M. amphibiorum RCS1 mycelia were induced by blue light. Blue light can induce the expression of sahhl gene in the vigorous growth of M. amphibiorum RCS1 mycelia.

  5. Structure of the highly repeated, long interspersed DNA family (LINE or L1Rn) of the rat.

    PubMed Central

    D'Ambrosio, E; Waitzkin, S D; Witney, F R; Salemme, A; Furano, A V

    1986-01-01

    We present the DNA sequence of a 6.7-kilobase member of the rat long interspersed repeated DNA family (LINE or L1Rn). This member (LINE 3) is flanked by a perfect 14-base-pair (bp) direct repeat and is a full-length, or close-to-full-length, member of this family. LINE 3 contains an approximately 100-bp A-rich right end, a number of long (greater than 400-bp) open reading frames, and a ca. 200-bp G + C-rich (ca. 60%) cluster near each terminus. Comparison of the LINE 3 sequence with the sequence of about one-half of another member, which we also present, as well as restriction enzyme analysis of the genomic copies of this family, indicates that in length and overall structure LINE 3 is quite typical of the 40,000 or so other genomic members of this family which would account for as much as 10% of the rat genome. Therefore, the rat LINE family is relatively homogeneous, which contrasts with the heterogeneous LINE families in primates and mice. Transcripts corresponding to the entire LINE sequence are abundant in the nuclear RNA of rat liver. The characteristics of the rat LINE family are discussed with respect to the possible function and evolution of this family of DNA sequences. Images PMID:3023845

  6. Inter-individual and intragenomic variations in the ITS region of Clonorchis sinensis (Trematoda: Opisthorchiidae) from Russia and Vietnam.

    PubMed

    Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh

    2017-11-01

    Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. The complete chloroplast genome of Cinnamomum camphora and its comparison with related Lauraceae species.

    PubMed

    Chen, Caihui; Zheng, Yongjie; Liu, Sian; Zhong, Yongda; Wu, Yanfang; Li, Jiang; Xu, Li-An; Xu, Meng

    2017-01-01

    Cinnamomum camphora , a member of the Lauraceae family, is a valuable aromatic and timber tree that is indigenous to the south of China and Japan. All parts of Cinnamomum camphora have secretory cells containing different volatile chemical compounds that are utilized as herbal medicines and essential oils. Here, we reported the complete sequencing of the chloroplast genome of Cinnamomum camphora using illumina technology. The chloroplast genome of Cinnamomum camphora is 152,570 bp in length and characterized by a relatively conserved quadripartite structure containing a large single copy region of 93,705 bp, a small single copy region of 19,093 bp and two inverted repeat (IR) regions of 19,886 bp. Overall, the genome contained 123 coding regions, of which 15 were repeated in the IR regions. An analysis of chloroplast sequence divergence revealed that the small single copy region was highly variable among the different genera in the Lauraceae family. A total of 40 repeat structures and 83 simple sequence repeats were detected in both the coding and non-coding regions. A phylogenetic analysis indicated that Calycanthus is most closely related to Lauraceae , both being members of Laurales , which forms a sister group to Magnoliids . The complete sequence of the chloroplast of Cinnamomum camphora will aid in in-depth taxonomical studies of the Lauraceae family in the future. The genetic sequence information will also have valuable applications for chloroplast genetic engineering.

  8. Sequence stratigraphy of the subaqueous Changjiang (Yangtze River) delta since the Last Glacial Maximum

    NASA Astrophysics Data System (ADS)

    Xu, Taoyu; Wang, Guoqing; Shi, Xuefa; Wang, Xin; Yao, Zhengquan; Yang, Gang; Fang, Xisheng; Qiao, Shuqing; Liu, Shengfa; Wang, Xuchen; Zhao, Quanhong

    2016-01-01

    This study focuses on sedimentary research at the subaqueous Changjiang (Yangtze River) delta, based on five high-resolution seismic profiles and seven borehole cores with accurate AMS 14C datings. Three distinct seismic units were identified from the seismic profiles according to seismic reflection characteristics, and five sedimentary facies were recognized from borehole cores. These facies constituted a fining upward sedimentary sequence in relation to postglacial sea-level transgression. Three sequence surfaces (sequence boundary (SB), transgressive surface (TS), and maximum flooding surface (MFS)) demarcate the boundaries between early transgressive system tract (E-TST), late transgressive system tract (L-TST), early highstand system tract (E-HST) and late highstand system tract (L-HST), which constitute the sixth order sequence. These system tracts were developed coevally with postglacial sea-level rise. E-TST (~ 19-12 ka BP) corresponds to an incised-valley infilling in the early stages of postglacial transgression whereas L-TST (~ 12-7.5 ka BP) was formed during the last stage of postglacial transgression. The progradational structure of L-TST reflected in seismic profiles is possibly related to the intensification of the East Asian summer monsoon. E-HST (~ 7.5-2 ka BP) was deposited in response to the highstand after maximum postglacial transgression was reached, while L-HST (~ 2 ka BP-present) was initiated by accelerated progradation of the Changjiang delta.

  9. Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

    PubMed Central

    Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

    1993-01-01

    The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

  10. Molecular characterization of eimeria species naturally infecting egyptian baldi chickens.

    PubMed

    Gadelhaq, Sahar M; Arafa, Waleed M; Aboelhadid, Shawky M

    2015-01-01

    Coccidiosis is a serious protozoal disease of poultry. The identification of Eimeria species has important implications for diagnosis and control as well as for epidemiology. The molecular characterization of Eimeria species infecting Egyptian baladi chickens was investigated. Eimeria species oocysts were harvested from intestines of naturally infected Egyptian baldi chickens. The morphometry characterization of oocysts along with COCCIMORPH software was done. The DNA was extracted initially by freezing and thawing then the prepared samples was subjected to commercial DNA kits. The DNA products were analyzed through conventional polymerase chain reaction by using amplified region (SCAR) marker. The PCR results confirmed the presence of 7 Eimeria species in the examined fecal samples of Egyptian baldi breed with their specific ampilicon sizes being E. acervulina (811bp), E. brunette (626bp), E. tenella (539bp), E. maxima (272bp), E. necatrix (200bp), E. mitis (327bp) and E. praecopx (354bp). A sequencing of the two most predominant species of Eimeria was done, on E. tenella and E. máxima. Analysis of the obtained sequences revealed high identities 99% between Egyptian isolates and the reference one. Similarly, E. maxima isolated from Egyptian baldi chickens showed 98% nucleotide identities with the reference strain. Only single nucleotide substitution was observed among the Egyptian E. tenella isolates (A181G) when compared to the reference one. The Egyptian isolates acquired 4 unique mutations (A68T, C164T, G190A and C227G) in compared with the reference sequence. This is the first time to identify the 7 species of Eimeria from Egyptian baladi chickens.

  11. Holocene thermal optimal and climate variability of East Asian monsoon inferred from forest reconstruction of a subalpine pollen sequence, Taiwan

    NASA Astrophysics Data System (ADS)

    Liew, P. M.; Lee, C. Y.; Kuo, C. M.

    2006-10-01

    The East Asian monsoon Holocene optimal period has been debated both about duration and whether conditions were a maximum in thermal conditions or in precipitation. In this study we show Holocene climate variability inferred by a forest reconstruction of a subalpine pollen sequence from peat bog deposits in central Taiwan, based on modern analogues of various altitudinal biomes in the region. A warmer interval occurred between 8 and 4 ka BP (calibrated 14C years) when the subtropical forests were more extensive. The Holocene thermal optimum is represented by an altitudinal tropical forest at 6.1-5.9 ka BP and 6.9 ka BP and only the latter was accompanied by wet conditions, indicating decoupling of thermal and precipitation mechanism in the middle Holocene. Abrupt and relative severe cold phases, shown by biome changes, occurred at about 11.2-11.0 ka BP; 7.5 ka BP; 7.2 ka BP; 7.1 ka BP; 5.2 ka BP, 5.0 ka BP and 4.9 ka BP. A spectral analysis of pollen of a relatively cold taxon — Salix, reveals that the time series is dominated by a 1500 yr periodicity and similar to the cold cycle reported in the marine records of Indian and western Pacific Oceans. The cold-warm conditions inferred by the change of forests show close relationship to solar energy in comparison with the production rate of Be-10.

  12. Characterization of the novel antifungal protein PgAFP and the encoding gene of Penicillium chrysogenum.

    PubMed

    Rodríguez-Martín, Andrea; Acosta, Raquel; Liddell, Susan; Núñez, Félix; Benito, M José; Asensio, Miguel A

    2010-04-01

    The strain RP42C from Penicillium chrysogenum produces a small protein PgAFP that inhibits the growth of some toxigenic molds. The molecular mass of the protein determined by electrospray ionization mass spectrometry (ESI-MS) was 6 494Da. PgAFP showed a cationic character with an estimated pI value of 9.22. Upon chemical and enzymatic treatments of PgAFP, no evidence for N- or O-glycosylations was obtained. Five partial sequences of PgAFP were obtained by Edman degradation and by ESI-MS/MS after trypsin and chymotrypsin digestions. Using degenerate primers from these peptide sequences, a segment of 70bp was amplified by PCR from pgafp gene. 5'- and 3'-ends of pgafp were obtained by RACE-PCR with gene-specific primers designed from the 70bp segment. The complete pgafp sequence of 404bp was obtained using primers designed from 5'- and 3'-ends. Comparison of genomic and cDNA sequences revealed a 279bp coding region interrupted by two introns of 63 and 62bp. The precursor of the antifungal protein consists of 92 amino acids and appears to be processed to the mature 58 amino acids PgAFP. The deduced amino acid sequence of the mature protein shares 79% identity to the antifungal protein Anafp from Aspergillus niger. PgAFP is a new protein that belongs to the group of small, cysteine-rich, and basic proteins with antifungal activity produced by ascomycetes. Given that P. chrysogenum is regarded as safe mold commonly found in foods, PgAFP may be useful to prevent growth of toxigenic molds in food and agricultural products. Copyright (c) 2009 Elsevier Inc. All rights reserved.

  13. The complete chloroplast DNA sequence of Eleutherococcus senticosus (Araliaceae); comparative evolutionary analyses with other three asterids.

    PubMed

    Yi, Dong-Keun; Lee, Hae-Lim; Sun, Byung-Yun; Chung, Mi Yoon; Kim, Ki-Joong

    2012-05-01

    This study reports the complete chloroplast (cp) DNA sequence of Eleutherococcus senticosus (GenBank: JN 637765), an endangered endemic species. The genome is 156,768 bp in length, and contains a pair of inverted repeat (IR) regions of 25,930 bp each, a large single copy (LSC) region of 86,755 bp and a small single copy (SSC) region of 18,153 bp. The structural organization, gene and intron contents, gene order, AT content, codon usage, and transcription units of the E. senticosus chloroplast genome are similar to that of typical land plant cp DNA. We aligned and analyzed the sequences of 86 coding genes, 19 introns and 113 intergenic spacers (IGS) in three different taxonomic hierarchies; Eleutherococcus vs. Panax, Eleutherococcus vs. Daucus, and Eleutherococcus vs. Nicotiana. The distribution of indels, the number of polymorphic sites and nucleotide diversity indicate that positional constraint is more important than functional constraint for the evolution of cp genome sequences in Asterids. For example, the intron sequences in the LSC region exhibited base substitution rates 5-11-times higher than that of the IR regions, while the intron sequences in the SSC region evolved 7-14-times faster than those in the IR region. Furthermore, the Ka/Ks ratio of the gene coding sequences supports a stronger evolutionary constraint in the IR region than in the LSC or SSC regions. Therefore, our data suggest that selective sweeps by base collection mechanisms more frequently eliminate polymorphisms in the IR region than in other regions. Chloroplast genome regions that have high levels of base substitutions also show higher incidences of indels. Thirty-five simple sequence repeat (SSR) loci were identified in the Eleutherococcus chloroplast genome. Of these, 27 are homopolymers, while six are di-polymers and two are tri-polymers. In addition to the SSR loci, we also identified 18 medium size repeat units ranging from 22 to 79 bp, 11 of which are distributed in the IGS or intron regions. These medium size repeats may contribute to developing a cp genome-specific gene introduction vector because the region may use for specific recombination sites.

  14. Complete genome sequence of Hirschia baltica type strain (IFAM 1418T)

    PubMed Central

    Chertkov, Olga; Brown, Pamela J.B.; Kysela, David T.; de Pedro, Miguel A.; Lucas, Susan; Copeland, Alex; Lapidus, Alla; Del Rio, Tijana Glavina; Tice, Hope; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Detter, John C.; Han, Cliff; Larimer, Frank; Chang, Yun-juan; Jeffries, Cynthia D.; Land, Miriam; Hauser, Loren; Kyrpides, Nikos C.; Ivanova, Natalia; Ovchinnikova, Galina; Tindall, Brian J.; Göker, Markus; Klenk, Hans-Peter; Brun, Yves V.

    2011-01-01

    The family Hyphomonadaceae within the Alphaproteobacteria is largely comprised of bacteria isolated from marine environments with striking morphologies and an unusual mode of cell growth. Here, we report the complete genome sequence Hirschia baltica, which is only the second a member of the Hyphomonadaceae with a published genome sequence. H. baltica is of special interest because it has a dimorphic life cycle and is a stalked, budding bacterium. The 3,455,622 bp long chromosome and 84,492 bp plasmid with a total of 3,222 protein-coding and 44 RNA genes were sequenced as part of the DOE Joint Genome Institute Program CSP 2008. PMID:22675580

  15. Automated Sanger Analysis Pipeline (ASAP): A Tool for Rapidly Analyzing Sanger Sequencing Data with Minimum User Interference.

    PubMed

    Singh, Aditya; Bhatia, Prateek

    2016-12-01

    Sanger sequencing platforms, such as applied biosystems instruments, generate chromatogram files. Generally, for 1 region of a sequence, we use both forward and reverse primers to sequence that area, in that way, we have 2 sequences that need to be aligned and a consensus generated before mutation detection studies. This work is cumbersome and takes time, especially if the gene is large with many exons. Hence, we devised a rapid automated command system to filter, build, and align consensus sequences and also optionally extract exonic regions, translate them in all frames, and perform an amino acid alignment starting from raw sequence data within a very short time. In full capabilities of Automated Mutation Analysis Pipeline (ASAP), it is able to read "*.ab1" chromatogram files through command line interface, convert it to the FASTQ format, trim the low-quality regions, reverse-complement the reverse sequence, create a consensus sequence, extract the exonic regions using a reference exonic sequence, translate the sequence in all frames, and align the nucleic acid and amino acid sequences to reference nucleic acid and amino acid sequences, respectively. All files are created and can be used for further analysis. ASAP is available as Python 3.x executable at https://github.com/aditya-88/ASAP. The version described in this paper is 0.28.

  16. Cis-acting elements in the promoter region of the human aldolase C gene.

    PubMed

    Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F

    1993-08-16

    We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.

  17. Sequence of pNL194, a 79.3-Kilobase IncN Plasmid Carrying the blaVIM-1 Metallo-β-Lactamase Gene in Klebsiella pneumoniae▿

    PubMed Central

    Miriagou, V.; Papagiannitsis, C. C.; Kotsakis, S. D.; Loli, A.; Tzelepi, E.; Legakis, N. J.; Tzouvelekis, L. S.

    2010-01-01

    The nucleotide sequence of pNL194, a VIM-1-encoding plasmid, is described in this study. pNL194 (79,307 bp) comprised an IncN-characteristic segment (38,940 bp) and a mosaic structure (40,367 bp) including blaVIM-1, aacA7, aadA1, aadA2, dfrA1, dfrA12, aphA1, strA, strB, and sul1. Tn1000 or Tn5501 insertion within fipA probably facilitated recruitment of additional mobile elements carrying resistance genes. PMID:20660690

  18. Swine and Poultry Pathogens: the Complete Genome Sequences of Two Strains of Mycoplasma hyopneumoniae and a Strain of Mycoplasma synoviae†

    PubMed Central

    Vasconcelos, Ana Tereza R.; Ferreira, Henrique B.; Bizarro, Cristiano V.; Bonatto, Sandro L.; Carvalho, Marcos O.; Pinto, Paulo M.; Almeida, Darcy F.; Almeida, Luiz G. P.; Almeida, Rosana; Alves-Filho, Leonardo; Assunção, Enedina N.; Azevedo, Vasco A. C.; Bogo, Maurício R.; Brigido, Marcelo M.; Brocchi, Marcelo; Burity, Helio A.; Camargo, Anamaria A.; Camargo, Sandro S.; Carepo, Marta S.; Carraro, Dirce M.; de Mattos Cascardo, Júlio C.; Castro, Luiza A.; Cavalcanti, Gisele; Chemale, Gustavo; Collevatti, Rosane G.; Cunha, Cristina W.; Dallagiovanna, Bruno; Dambrós, Bibiana P.; Dellagostin, Odir A.; Falcão, Clarissa; Fantinatti-Garboggini, Fabiana; Felipe, Maria S. S.; Fiorentin, Laurimar; Franco, Gloria R.; Freitas, Nara S. A.; Frías, Diego; Grangeiro, Thalles B.; Grisard, Edmundo C.; Guimarães, Claudia T.; Hungria, Mariangela; Jardim, Sílvia N.; Krieger, Marco A.; Laurino, Jomar P.; Lima, Lucymara F. A.; Lopes, Maryellen I.; Loreto, Élgion L. S.; Madeira, Humberto M. F.; Manfio, Gilson P.; Maranhão, Andrea Q.; Martinkovics, Christyanne T.; Medeiros, Sílvia R. B.; Moreira, Miguel A. M.; Neiva, Márcia; Ramalho-Neto, Cicero E.; Nicolás, Marisa F.; Oliveira, Sergio C.; Paixão, Roger F. C.; Pedrosa, Fábio O.; Pena, Sérgio D. J.; Pereira, Maristela; Pereira-Ferrari, Lilian; Piffer, Itamar; Pinto, Luciano S.; Potrich, Deise P.; Salim, Anna C. M.; Santos, Fabrício R.; Schmitt, Renata; Schneider, Maria P. C.; Schrank, Augusto; Schrank, Irene S.; Schuck, Adriana F.; Seuanez, Hector N.; Silva, Denise W.; Silva, Rosane; Silva, Sérgio C.; Soares, Célia M. A.; Souza, Kelly R. L.; Souza, Rangel C.; Staats, Charley C.; Steffens, Maria B. R.; Teixeira, Santuza M. R.; Urmenyi, Turan P.; Vainstein, Marilene H.; Zuccherato, Luciana W.; Simpson, Andrew J. G.; Zaha, Arnaldo

    2005-01-01

    This work reports the results of analyses of three complete mycoplasma genomes, a pathogenic (7448) and a nonpathogenic (J) strain of the swine pathogen Mycoplasma hyopneumoniae and a strain of the avian pathogen Mycoplasma synoviae; the genome sizes of the three strains were 920,079 bp, 897,405 bp, and 799,476 bp, respectively. These genomes were compared with other sequenced mycoplasma genomes reported in the literature to examine several aspects of mycoplasma evolution. Strain-specific regions, including integrative and conjugal elements, and genome rearrangements and alterations in adhesin sequences were observed in the M. hyopneumoniae strains, and all of these were potentially related to pathogenicity. Genomic comparisons revealed that reduction in genome size implied loss of redundant metabolic pathways, with maintenance of alternative routes in different species. Horizontal gene transfer was consistently observed between M. synoviae and Mycoplasma gallisepticum. Our analyses indicated a likely transfer event of hemagglutinin-coding DNA sequences from M. gallisepticum to M. synoviae. PMID:16077101

  19. Identification of a cis-Regulatory Element Involved in Phytochrome Down-Regulated Expression of the Pea Small GTPase Gene pra21

    PubMed Central

    Inaba, Takehito; Nagano, Yukio; Sakakibara, Toshihiro; Sasaki, Yukiko

    1999-01-01

    The pra2 gene encodes a pea (Pisum sativum) small GTPase belonging to the YPT/rab family, and its expression is down-regulated by light, mediated by phytochrome. We have isolated and characterized a genomic clone of this gene and constructed a fusion DNA of its 5′-upstream region in front of the gene for firefly luciferase. Using this construct in a transient assay, we determined a pra2 cis-regulatory region sufficient to direct the light down-regulation of the luciferase reporter gene. Both 5′- and internal deletion analyses revealed that the 93-bp sequence between −734 and −642 from the transcriptional start site was important for phytochrome down-regulation. Gain-of-function analysis showed that this 93-bp region could confer light down-regulation when fused to the cauliflower mosaic virus 35S promoter. Furthermore, linker-scanning analysis showed that a 12-bp sequence within the 93-bp region mediated phytochrome down-regulation. Gel-retardation analysis showed the presence of a nuclear factor that was specifically bound to the 12-bp sequence in vitro. These results indicate that this element is a cis-regulatory element involved in phytochrome down-regulated expression. PMID:10364400

  20. mtDNA control-region sequence variation suggests multiple independent origins of an "Asian-specific" 9-bp deletion in sub-Saharan Africans.

    PubMed Central

    Soodyall, H.; Vigilant, L.; Hill, A. V.; Stoneking, M.; Jenkins, T.

    1996-01-01

    The intergenic COII/tRNA(Lys) 9-bp deletion in human mtDNA, which is found at varying frequencies in Asia, Southeast Asia, Polynesia, and the New World, was also found in 81 of 919 sub-Saharan Africans. Using mtDNA control-region sequence data from a subset of 41 individuals with the deletion, we identified 22 unique mtDNA types associated with the deletion in Africa. A comparison of the unique mtDNA types from sub-Saharan Africans and Asians with the 9-bp deletion revealed that sub-Saharan Africans and Asians have sequence profiles that differ in the locations and frequencies of variant sites. Both phylogenetic and mismatch-distribution analysis suggest that 9-bp deletion arose independently in sub-Saharan Africa and Asia and that the deletion has arisen more than once in Africa. Within Africa, the deletion was not found among Khoisan peoples and was rare to absent in western and southwestern African populations, but it did occur in Pygmy and Negroid populations from central Africa and in Malawi and southern African Bantu-speakers. The distribution of the 9-bp deletion in Africa suggests that the deletion could have arisen in central Africa and was then introduced to southern Africa via the recent "Bantu expansion." PMID:8644719

  1. The neurologist's dilemma: a comprehensive clinical review of Bell's palsy, with emphasis on current management trends.

    PubMed

    Zandian, Anthony; Osiro, Stephen; Hudson, Ryan; Ali, Irfan M; Matusz, Petru; Tubbs, Shane R; Loukas, Marios

    2014-01-20

    Recent advances in Bell's palsy (BP) were reviewed to assess the current trends in its management and prognosis. We retrieved the literature on BP using the Cochrane Database of Systematic Reviews, PubMed, and Google Scholar. Key words and phrases used during the search included 'Bell's palsy', 'Bell's phenomenon', 'facial palsy', and 'idiopathic facial paralysis'. Emphasis was placed on articles and randomized controlled trails (RCTs) published within the last 5 years. BP is currently considered the leading disorder affecting the facial nerve. The literature is replete with theories of its etiology, but the reactivation of herpes simplex virus isoform 1 (HSV-1) and/or herpes zoster virus (HZV) from the geniculate ganglia is now the most strongly suspected cause. Despite the advancements in neuroimaging techniques, the diagnosis of BP remains one of exclusion. In addition, most patients with BP recover spontaneously within 3 weeks. Corticosteroids are currently the drug of choice when medical therapy is needed. Antivirals, in contrast, are not superior to placebo according to most reliable studies. At the time of publication, there is no consensus as to the benefit of acupuncture or surgical decompression of the facial nerve. Long-term therapeutic agents and adjuvant medications for BP are necessary due to recurrence and intractable cases. In the future, large RCTs will be required to determine whether BP is associated with an increased risk of stroke.

  2. The CentO satellite confers translational and rotational phasing on cenH3 nucleosomes in rice centromeres.

    PubMed

    Zhang, Tao; Talbert, Paul B; Zhang, Wenli; Wu, Yufeng; Yang, Zujun; Henikoff, Jorja G; Henikoff, Steven; Jiang, Jiming

    2013-12-10

    Plant and animal centromeres comprise megabases of highly repeated satellite sequences, yet centromere function can be specified epigenetically on single-copy DNA by the presence of nucleosomes containing a centromere-specific variant of histone H3 (cenH3). We determined the positions of cenH3 nucleosomes in rice (Oryza sativa), which has centromeres composed of both the 155-bp CentO satellite repeat and single-copy non-CentO sequences. We find that cenH3 nucleosomes protect 90-100 bp of DNA from micrococcal nuclease digestion, sufficient for only a single wrap of DNA around the cenH3 nucleosome core. cenH3 nucleosomes are translationally phased with 155-bp periodicity on CentO repeats, but not on non-CentO sequences. CentO repeats have an ∼10-bp periodicity in WW dinucleotides and in micrococcal nuclease cleavage, providing evidence for rotational phasing of cenH3 nucleosomes on CentO and suggesting that satellites evolve for translational and rotational stabilization of centromeric nucleosomes.

  3. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  4. A complete high-quality MinION nanopore assembly of an extensively drug-resistant Mycobacterium tuberculosis Beijing lineage strain identifies novel variation in repetitive PE/PPE gene regions.

    PubMed

    Bainomugisa, Arnold; Duarte, Tania; Lavu, Evelyn; Pandey, Sushil; Coulter, Chris; Marais, Ben J; Coin, Lachlan M

    2018-06-15

    A better understanding of the genomic changes that facilitate the emergence and spread of drug-resistant Mycobacterium tuberculosis strains is currently required. Here, we report the use of the MinION nanopore sequencer (Oxford Nanopore Technologies) to sequence and assemble an extensively drug-resistant (XDR) isolate, which is part of a modern Beijing sub-lineage strain, prevalent in Western Province, Papua New Guinea. Using 238-fold coverage obtained from a single flow-cell, de novo assembly of nanopore reads resulted into one contiguous assembly with 99.92 % assembly accuracy. Incorporation of complementary short read sequences (Illumina) as part of consensus error correction resulted in a 4 404 064 bp genome with 99.98 % assembly accuracy. This assembly had an average nucleotide identity of 99.7 % relative to the reference genome, H37Rv. We assembled nearly all GC-rich repetitive PE/PPE family genes (166/168) and identified variants within these genes. With an estimated genotypic error rate of 5.3 % from MinION data, we demonstrated identification of variants to include the conventional drug resistance mutations, and those that contribute to the resistance phenotype (efflux pumps/transporter) and virulence. Reference-based alignment of the assembly allowed detection of deletions and insertions. MinION sequencing provided a fully annotated assembly of a transmissible XDR strain from an endemic setting and showed its utility to provide further understanding of genomic processes within Mycobacterium tuberculosis.

  5. Mapping and Sequencing of the Canine NRAMP1 Gene and Identification of Mutations in Leishmaniasis-Susceptible Dogs

    PubMed Central

    Altet, Laura; Francino, Olga; Solano-Gallego, Laia; Renier, Corinne; Sánchez, Armand

    2002-01-01

    The NRAMP1 gene (Slc11a1) encodes an ion transporter protein involved in the control of intraphagosomal replication of parasites and in macrophage activation. It has been described in mice as the determinant of natural resistance or susceptibility to infection with antigenically unrelated pathogens, including Leishmania. Our aims were to sequence and map the canine Slc11a1 gene and to identify mutations that may be associated with resistance or susceptibility to Leishmania infection. The canine Slc11a1 gene has been mapped to dog chromosome CFA37 and covers 9 kb, including a 700-bp promoter region, 15 exons, and a polymorphic microsatellite in intron 1. It encodes a 547-amino-acid protein that has over 87% identity with the Slc11a1 proteins of different mammalian species. A case-control study with 33 resistant and 84 susceptible dogs showed an association between allele 145 of the microsatellite and susceptible dogs. Sequence variant analysis was performed by direct sequencing of the cDNA and the promoter region of four unrelated beagles experimentally infected with Leishmania infantum to search for possible functional mutations. Two of the dogs were classified as susceptible and the other two were classified as resistant based on their immune responses. Two important mutations were found in susceptible dogs: a G-rich region in the promoter that was common to both animals and a complete deletion of exon 11, which encodes the consensus transport motif of the protein, in the unique susceptible dog that needed an additional and prolonged treatment to avoid continuous relapses. A study with a larger dog population would be required to prove the association of these sequence variants with disease susceptibility. PMID:12010961

  6. Distribution of a Nocardia brasiliensis catalase gene fragment in members of the genera Nocardia, Gordona, and Rhodococcus.

    PubMed

    Vera-Cabrera, L; Johnson, W M; Welsh, O; Resendiz-Uresti, F L; Salinas-Carmona, M C

    1999-06-01

    An immunodominant protein from Nocardia brasiliensis, P61, was subjected to amino-terminal and internal sequence analysis. Three sequences of 22, 17, and 38 residues, respectively, were obtained and compared with the protein database from GenBank by using the BLAST system. The sequences showed homology to some eukaryotic catalases and to a bromoperoxidase-catalase from Streptomyces violaceus. Its identity as a catalase was confirmed by analysis of its enzymatic activity on H2O2 and by a double-staining method on a nondenaturing polyacrylamide gel with 3,3'-diaminobenzidine and ferricyanide; the result showed only catalase activity, but no peroxidase. By using one of the internal amino acid sequences and a consensus catalase motif (VGNNTP), we were able to design a PCR assay that generated a 500-bp PCR product. The amplicon was analyzed, and the nucleotide sequence was compared to the GenBank database with the observation of high homology to other bacterial and eukaryotic catalases. A PCR assay based on this target sequence was performed with primers NB10 and NB11 to confirm the presence of the NB10-NB11 gene fragment in several N. brasiliensis strains isolated from mycetoma. The same assay was used to determine whether there were homologous sequences in several type strains from the genera Nocardia, Rhodococcus, Gordona, and Streptomyces. All of the N. brasiliensis strains presented a positive result but only some of the actinomycetes species tested were positive in the PCR assay. In order to confirm these findings, genomic DNA was subjected to Southern blot analysis. A 1.7-kbp band was observed in the N. brasiliensis strains, and bands of different molecular weight were observed in cross-reacting actinomycetes. Sequence analysis of the amplicons of selected actinomycetes showed high homology in this catalase fragment, thus demonstrating that this protein is highly conserved in this group of bacteria.

  7. Whole-Genome Sequence of "Candidatus Profftella armatura" from Diaphorina citri in Guangdong, China.

    PubMed

    Wu, F; Deng, X; Liang, G; Huang, J; Cen, Y; Chen, J

    2015-11-05

    The genome of "Candidatus Profftella armatura" strain YCPA from Diaphorina citri in Guangdong, China, was sequenced. The strain has a chromosome of 457,565 bp, 24.3% G+C content, 364 predicted open reading frames (ORFs), and 38 RNAs, and a plasmid, pYCPA54, of 5,458 bp with 23.9% G+C content and 5 ORFs. Copyright © 2015 Wu et al.

  8. Identification of gyrB and rpoB gene mutations and differentially expressed proteins between a novobiocin-resistant Aeromonas hydrophila catfish vaccine strain and its virulent parent strain

    USDA-ARS?s Scientific Manuscript database

    Sequence comparison between the full-length 2412 bp DNA gyrase subunit B (gyrB) gene of a novobiocin resistant Aeromonas hydrophila AH11NOVO vaccine strain and that of its virulent parent strain AH11P revealed 10 missense mutations. Similarly, sequence comparison between the full-length 4092 bp RNA ...

  9. Complete Genome Sequence of Thermus thermophilus TMY, Isolated from a Geothermal Power Plant.

    PubMed

    Fujino, Yasuhiro; Nagayoshi, Yuko; Ohshima, Toshihisa; Ogata, Seiya; Doi, Katsumi

    2017-02-02

    Thermus thermophilus TMY (JCM 10668) was isolated from silica scale formed at a geothermal power plant in Japan. Here, we report the complete genome sequence for this strain, which contains a chromosomal DNA of 2,121,526 bp with 2,500 predicted genes and a pTMY plasmid of 19,139 bp, with 28 predicted genes. Copyright © 2017 Fujino et al.

  10. Novel C8orf37 mutations cause retinitis pigmentosa in consanguineous families of Pakistani origin

    PubMed Central

    Ravesh, Zeinab; El Asrag, Mohammed E.; Weisschuh, Nicole; McKibbin, Martin; Reuter, Peggy; Watson, Christopher M.; Baumann, Britta; Poulter, James A.; Sajid, Sundus; Panagiotou, Evangelia S.; O’Sullivan, James; Abdelhamed, Zakia; Bonin, Michael; Soltanifar, Mehdi; Black, Graeme C.M.; Din, Muhammad Amin-ud; Toomes, Carmel; Ansar, Muhammad; Inglehearn, Chris F.; Wissinger, Bernd

    2015-01-01

    Purpose To investigate the molecular basis of retinitis pigmentosa in two consanguineous families of Pakistani origin with multiple affected members. Methods Homozygosity mapping and Sanger sequencing of candidate genes were performed in one family while the other was analyzed with whole exome next-generation sequencing. A minigene splicing assay was used to confirm the splicing defects. Results In family MA48, a novel homozygous nucleotide substitution in C8orf37, c.244–2A>C, that disrupted the consensus splice acceptor site of exon 3 was found. The minigene splicing assay revealed that this mutation activated a cryptic splice site within exon 3, causing a 22 bp deletion in the transcript that is predicted to lead to a frameshift followed by premature protein truncation. In family MA13, a novel homozygous null mutation in C8orf37, c.555G>A, p.W185*, was identified. Both mutations segregated with the disease phenotype as expected in a recessive manner and were absent in 8,244 unrelated individuals of South Asian origin. Conclusions In this report, we describe C8orf37 mutations that cause retinal dystrophy in two families of Pakistani origin, contributing further data on the phenotype and the spectrum of mutations in this form of retinitis pigmentosa. PMID:25802487

  11. Impact of sequencing depth and read length on single cell RNA sequencing data of T cells.

    PubMed

    Rizzetto, Simone; Eltahla, Auda A; Lin, Peijie; Bull, Rowena; Lloyd, Andrew R; Ho, Joshua W K; Venturi, Vanessa; Luciani, Fabio

    2017-10-06

    Single cell RNA sequencing (scRNA-seq) provides great potential in measuring the gene expression profiles of heterogeneous cell populations. In immunology, scRNA-seq allowed the characterisation of transcript sequence diversity of functionally relevant T cell subsets, and the identification of the full length T cell receptor (TCRαβ), which defines the specificity against cognate antigens. Several factors, e.g. RNA library capture, cell quality, and sequencing output affect the quality of scRNA-seq data. We studied the effects of read length and sequencing depth on the quality of gene expression profiles, cell type identification, and TCRαβ reconstruction, utilising 1,305 single cells from 8 publically available scRNA-seq datasets, and simulation-based analyses. Gene expression was characterised by an increased number of unique genes identified with short read lengths (<50 bp), but these featured higher technical variability compared to profiles from longer reads. Successful TCRαβ reconstruction was achieved for 6 datasets (81% - 100%) with at least 0.25 millions (PE) reads of length >50 bp, while it failed for datasets with <30 bp reads. Sufficient read length and sequencing depth can control technical noise to enable accurate identification of TCRαβ and gene expression profiles from scRNA-seq data of T cells.

  12. The complete chloroplast genome of North American ginseng, Panax quinquefolius.

    PubMed

    Han, Zeng-Jie; Li, Wei; Liu, Yuan; Gao, Li-Zhi

    2016-09-01

    We report complete nucleotide sequence of the Panax quinquefolius chloroplast genome using next-generation sequencing technology. The genome size is 156 359 bp, including two inverted repeats (IRs) of 52 153 bp, separated by the large single-copy (LSC 86 184 bp) and small single-copy (SSC 18 081 bp) regions. This cp genome encodes 114 unigenes (80 protein-coding genes, four rRNA genes, and 30 tRNA genes), in which 18 are duplicated in the IR regions. Overall GC content of the genome is 38.08%. A phylogenomic analysis of the 10 complete chloroplast genomes from Araliaceae using Daucus carota from Apiaceae as outgroup showed that P. quinquefolius is closely related to the other two members of the genus Panax, P. ginseng and P. notoginseng.

  13. The complete chloroplast genome sequence of Chikusichloa aquatica (Poaceae: Oryzeae).

    PubMed

    Zhang, Jie; Zhang, Dan; Shi, Chao; Gao, Ju; Gao, Li-Zhi

    2016-07-01

    The complete chloroplast sequence of the Chikusichloa aquatica was determined in this study. The genome consists of 136 563 bp containing a pair of inverted repeats (IRs) of 20 837 bp, which was separated by a large single-copy region and a small single-copy region of 82 315 bp and 33 411 bp, respectively. The C. aquatica cp genome encodes 111 functional genes (71 protein-coding genes, four rRNA genes, and 36 tRNA genes): 92 are unique, while 19 are duplicated in the IR regions. The genic regions account for 58.9% of whole cp genome, and the GC content of the plastome is 39.0%. A phylogenomic analysis showed that C. aquatica is closely related to Rhynchoryza subulata that belongs to the tribe Oryzeae.

  14. Characterization of replication and conjugation of plasmid pWTY27 from a widely distributed Streptomyces species

    PubMed Central

    2012-01-01

    Background Streptomyces species are widely distributed in natural habitats, such as soils, lakes, plants and some extreme environments. Replication loci of several Streptomyces theta-type plasmids have been reported, but are not characterized in details. Conjugation loci of some Streptomyces rolling-circle-type plasmids are identified and mechanism of conjugal transferring are described. Results We report the detection of a widely distributed Streptomyces strain Y27 and its indigenous plasmid pWTY27 from fourteen plants and four soil samples cross China by both culturing and nonculturing methods. The complete nucleotide sequence of pWTY27 consisted of 14,288 bp. A basic locus for plasmid replication comprised repAB genes and an adjacent iteron sequence, to a long inverted-repeat (ca. 105 bp) of which the RepA protein bound specifically in vitro, suggesting that RepA may recognize a second structure (e.g. a long stem-loop) of the iteron DNA. A plasmid containing the locus propagated in linear mode when the telomeres of a linear plasmid were attached, indicating a bi-directional replication mode for pWTY27. As for rolling-circle plasmids, a single traA gene and a clt sequence (covering 16 bp within traA and its adjacent 159 bp) on pWTY27 were required for plasmid transfer. TraA recognized and bound specifically to the two regions of the clt sequence, one containing all the four DC1 of 7 bp (TGACACC) and one DC2 (CCCGCCC) and most of IC1, and another covering two DC2 and part of IC1, suggesting formation of a high-ordered DNA-protein complex. Conclusions This work (i) isolates a widespread Streptomyces strain Y27 and sequences its indigenous theta-type plasmid pWTY27; (ii) identifies the replication and conjugation loci of pWTY27 and; (iii) characterizes the binding sequences of the RepA and TraA proteins. PMID:23134842

  15. First full-length genome sequence of the polerovirus luffa aphid-borne yellows virus (LABYV) reveals the presence of at least two consensus sequences in an isolate from Thailand.

    PubMed

    Knierim, Dennis; Maiss, Edgar; Kenyon, Lawrence; Winter, Stephan; Menzel, Wulf

    2015-10-01

    Luffa aphid-borne yellows virus (LABYV) was proposed as the name for a previously undescribed polerovirus based on partial genome sequences obtained from samples of cucurbit plants collected in Thailand between 2008 and 2013. In this study, we determined the first full-length genome sequence of LABYV. Based on phylogenetic analysis and genome properties, it is clear that this virus represents a distinct species in the genus Polerovirus. Analysis of sequences from sample TH24, which was collected in 2010 from a luffa plant in Thailand, reveals the presence of two different full-length genome consensus sequences.

  16. Superior ab initio identification, annotation and characterisation of TEs and segmental duplications from genome assemblies.

    PubMed

    Zeng, Lu; Kortschak, R Daniel; Raison, Joy M; Bertozzi, Terry; Adelson, David L

    2018-01-01

    Transposable Elements (TEs) are mobile DNA sequences that make up significant fractions of amniote genomes. However, they are difficult to detect and annotate ab initio because of their variable features, lengths and clade-specific variants. We have addressed this problem by refining and developing a Comprehensive ab initio Repeat Pipeline (CARP) to identify and cluster TEs and other repetitive sequences in genome assemblies. The pipeline begins with a pairwise alignment using krishna, a custom aligner. Single linkage clustering is then carried out to produce families of repetitive elements. Consensus sequences are then filtered for protein coding genes and then annotated using Repbase and a custom library of retrovirus and reverse transcriptase sequences. This process yields three types of family: fully annotated, partially annotated and unannotated. Fully annotated families reflect recently diverged/young known TEs present in Repbase. The remaining two types of families contain a mixture of novel TEs and segmental duplications. These can be resolved by aligning these consensus sequences back to the genome to assess copy number vs. length distribution. Our pipeline has three significant advantages compared to other methods for ab initio repeat identification: 1) we generate not only consensus sequences, but keep the genomic intervals for the original aligned sequences, allowing straightforward analysis of evolutionary dynamics, 2) consensus sequences represent low-divergence, recently/currently active TE families, 3) segmental duplications are annotated as a useful by-product. We have compared our ab initio repeat annotations for 7 genome assemblies to other methods and demonstrate that CARP compares favourably with RepeatModeler, the most widely used repeat annotation package.

  17. Superior ab initio identification, annotation and characterisation of TEs and segmental duplications from genome assemblies

    PubMed Central

    Zeng, Lu; Kortschak, R. Daniel; Raison, Joy M.

    2018-01-01

    Transposable Elements (TEs) are mobile DNA sequences that make up significant fractions of amniote genomes. However, they are difficult to detect and annotate ab initio because of their variable features, lengths and clade-specific variants. We have addressed this problem by refining and developing a Comprehensive ab initio Repeat Pipeline (CARP) to identify and cluster TEs and other repetitive sequences in genome assemblies. The pipeline begins with a pairwise alignment using krishna, a custom aligner. Single linkage clustering is then carried out to produce families of repetitive elements. Consensus sequences are then filtered for protein coding genes and then annotated using Repbase and a custom library of retrovirus and reverse transcriptase sequences. This process yields three types of family: fully annotated, partially annotated and unannotated. Fully annotated families reflect recently diverged/young known TEs present in Repbase. The remaining two types of families contain a mixture of novel TEs and segmental duplications. These can be resolved by aligning these consensus sequences back to the genome to assess copy number vs. length distribution. Our pipeline has three significant advantages compared to other methods for ab initio repeat identification: 1) we generate not only consensus sequences, but keep the genomic intervals for the original aligned sequences, allowing straightforward analysis of evolutionary dynamics, 2) consensus sequences represent low-divergence, recently/currently active TE families, 3) segmental duplications are annotated as a useful by-product. We have compared our ab initio repeat annotations for 7 genome assemblies to other methods and demonstrate that CARP compares favourably with RepeatModeler, the most widely used repeat annotation package. PMID:29538441

  18. Complete genome sequence of a novel aquareovirus that infects the endangered fountain darter, Etheostoma fonticola

    USGS Publications Warehouse

    Iwanowicz, Luke R.; Iwanowicz, Deborah; Adams, Cynthia; Lewis, Teresa D.; Brandt, Thomas M.; Cornman, Robert S.; Sanders, Lakyn R.

    2016-01-01

    Here, we report the complete genome of a novel aquareovirus isolated from clinically normal fountain darters, Etheostoma fonticola, inhabiting the San Marcos River, Texas, USA. The complete genome consists of 23,958 bp consisting of 11 segments that range from 783 bp (S11) to 3,866 bp (S1).

  19. Complete Genome Sequence of a Novel Aquareovirus That Infects the Endangered Fountain Darter, Etheostoma fonticola

    PubMed Central

    Adams, Cynthia R.; Lewis, Teresa D.; Brandt, Thomas M.; Sanders, Lakyn

    2016-01-01

    Here, we report the complete genome of a novel aquareovirus isolated from clinically normal fountain darters, Etheostoma fonticola, inhabiting the San Marcos River, Texas, USA. The complete genome consists of 23,958 bp consisting of 11 segments that range from 783 bp (S11) to 3,866 bp (S1). PMID:28007856

  20. Complete Chloroplast Genome Sequences of Important Oilseed Crop Sesamum indicum L

    PubMed Central

    Yi, Dong-Keun; Kim, Ki-Joong

    2012-01-01

    Sesamum indicum is an important crop plant species for yielding oil. The complete chloroplast (cp) genome of S. indicum (GenBank acc no. JN637766) is 153,324 bp in length, and has a pair of inverted repeat (IR) regions consisting of 25,141 bp each. The lengths of the large single copy (LSC) and the small single copy (SSC) regions are 85,170 bp and 17,872 bp, respectively. Comparative cp DNA sequence analyses of S. indicum with other cp genomes reveal that the genome structure, gene order, gene and intron contents, AT contents, codon usage, and transcription units are similar to the typical angiosperm cp genomes. Nucleotide diversity of the IR region between Sesamum and three other cp genomes is much lower than that of the LSC and SSC regions in both the coding region and noncoding region. As a summary, the regional constraints strongly affect the sequence evolution of the cp genomes, while the functional constraints weakly affect the sequence evolution of cp genomes. Five short inversions associated with short palindromic sequences that form step-loop structures were observed in the chloroplast genome of S. indicum. Twenty-eight different simple sequence repeat loci have been detected in the chloroplast genome of S. indicum. Almost all of the SSR loci were composed of A or T, so this may also contribute to the A-T richness of the cp genome of S. indicum. Seven large repeated loci in the chloroplast genome of S. indicum were also identified and these loci are useful to developing S. indicum-specific cp genome vectors. The complete cp DNA sequences of S. indicum reported in this paper are prerequisite to modifying this important oilseed crop by cp genetic engineering techniques. PMID:22606240

  1. The complete chloroplast genome sequence of date palm (Phoenix dactylifera L.).

    PubMed

    Yang, Meng; Zhang, Xiaowei; Liu, Guiming; Yin, Yuxin; Chen, Kaifu; Yun, Quanzheng; Zhao, Duojun; Al-Mssallem, Ibrahim S; Yu, Jun

    2010-09-15

    Date palm (Phoenix dactylifera L.), a member of Arecaceae family, is one of the three major economically important woody palms--the two other palms being oil palm and coconut tree--and its fruit is a staple food among Middle East and North African nations, as well as many other tropical and subtropical regions. Here we report a complete sequence of the data palm chloroplast (cp) genome based on pyrosequencing. After extracting 369,022 cp sequencing reads from our whole-genome-shotgun data, we put together an assembly and validated it with intensive PCR-based verification, coupled with PCR product sequencing. The date palm cp genome is 158,462 bp in length and has a typical quadripartite structure of the large (LSC, 86,198 bp) and small single-copy (SSC, 17,712 bp) regions separated by a pair of inverted repeats (IRs, 27,276 bp). Similar to what has been found among most angiosperms, the date palm cp genome harbors 112 unique genes and 19 duplicated fragments in the IR regions. The junctions between LSC/IRs and SSC/IRs show different features of sequence expansion in evolution. We identified 78 SNPs as major intravarietal polymorphisms within the population of a specific cp genome, most of which were located in genes with vital functions. Based on RNA-sequencing data, we also found 18 polycistronic transcription units and three highly expression-biased genes--atpF, trnA-UGC, and rrn23. Unlike most monocots, date palm has a typical cp genome similar to that of tobacco--with little rearrangement and gene loss or gain. High-throughput sequencing technology facilitates the identification of intravarietal variations in cp genomes among different cultivars. Moreover, transcriptomic analysis of cp genes provides clues for uncovering regulatory mechanisms of transcription and translation in chloroplasts.

  2. The complete chloroplast genome sequence of Epipremnum aureum and its comparative analysis among eight Araceae species

    PubMed Central

    Han, Limin; Chen, Chen; Wang, Zhezhi

    2018-01-01

    Epipremnum aureum is an important foliage plant in the Araceae family. In this study, we have sequenced the complete chloroplast genome of E. aureum by using Illumina Hiseq sequencing platforms. This genome is a double-stranded circular DNA sequence of 164,831 bp that contains 35.8% GC. The two inverted repeats (IRa and IRb; 26,606 bp) are spaced by a small single-copy region (22,868 bp) and a large single-copy region (88,751 bp). The chloroplast genome has 131 (113 unique) functional genes, including 86 (79 unique) protein-coding genes, 37 (30 unique) tRNA genes, and eight (four unique) rRNA genes. Tandem repeats comprise the majority of the 43 long repetitive sequences. In addition, 111 simple sequence repeats are present, with mononucleotides being the most common type and di- and tetranucleotides being infrequent events. Positive selection pressure on rps12 in the E. aureum chloroplast has been demonstrated via synonymous and nonsynonymous substitution rates and selection pressure sites analyses. Ycf15 and infA are pseudogenes in this species. We constructed a Maximum Likelihood phylogenetic tree based on the complete chloroplast genomes of 38 species from 13 families. Those results strongly indicated that E. aureum is positioned as the sister of Colocasia esculenta within the Araceae family. This work may provide information for further study of the molecular phylogenetic relationships within Araceae, as well as molecular markers and breeding novel varieties by chloroplast genetic-transformation of E. aureum in particular. PMID:29529038

  3. Multiplex picoliter-droplet digital PCR for quantitative assessment of DNA integrity in clinical samples.

    PubMed

    Didelot, Audrey; Kotsopoulos, Steve K; Lupo, Audrey; Pekin, Deniz; Li, Xinyu; Atochin, Ivan; Srinivasan, Preethi; Zhong, Qun; Olson, Jeff; Link, Darren R; Laurent-Puig, Pierre; Blons, Hélène; Hutchison, J Brian; Taly, Valerie

    2013-05-01

    Assessment of DNA integrity and quantity remains a bottleneck for high-throughput molecular genotyping technologies, including next-generation sequencing. In particular, DNA extracted from paraffin-embedded tissues, a major potential source of tumor DNA, varies widely in quality, leading to unpredictable sequencing data. We describe a picoliter droplet-based digital PCR method that enables simultaneous detection of DNA integrity and the quantity of amplifiable DNA. Using a multiplex assay, we detected 4 different target lengths (78, 159, 197, and 550 bp). Assays were validated with human genomic DNA fragmented to sizes of 170 bp to 3000 bp. The technique was validated with DNA quantities as low as 1 ng. We evaluated 12 DNA samples extracted from paraffin-embedded lung adenocarcinoma tissues. One sample contained no amplifiable DNA. The fractions of amplifiable DNA for the 11 other samples were between 0.05% and 10.1% for 78-bp fragments and ≤1% for longer fragments. Four samples were chosen for enrichment and next-generation sequencing. The quality of the sequencing data was in agreement with the results of the DNA-integrity test. Specifically, DNA with low integrity yielded sequencing results with lower levels of coverage and uniformity and had higher levels of false-positive variants. The development of DNA-quality assays will enable researchers to downselect samples or process more DNA to achieve reliable genome sequencing with the highest possible efficiency of cost and effort, as well as minimize the waste of precious samples. © 2013 American Association for Clinical Chemistry.

  4. Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis.

    PubMed

    Buldyrev, S V; Goldberger, A L; Havlin, S; Mantegna, R N; Matsa, M E; Peng, C K; Simons, M; Stanley, H E

    1995-05-01

    An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

  5. Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis

    NASA Technical Reports Server (NTRS)

    Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Matsa, M. E.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

  6. Complete chloroplast genome sequence and comparative analysis of loblolly pine (Pinus taeda L.) with related species

    PubMed Central

    Khan, Abdul Latif; Khan, Muhammad Aaqil; Shahzad, Raheem; Lubna; Kang, Sang Mo; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung

    2018-01-01

    Pinaceae, the largest family of conifers, has a diversified organization of chloroplast (cp) genomes with two typical highly reduced inverted repeats (IRs). In the current study, we determined the complete sequence of the cp genome of an economically and ecologically important conifer tree, the loblolly pine (Pinus taeda L.), using Illumina paired-end sequencing and compared the sequence with those of other pine species. The results revealed a genome size of 121,531 base pairs (bp) containing a pair of 830-bp IR regions, distinguished by a small single copy (42,258 bp) and large single copy (77,614 bp) region. The chloroplast genome of P. taeda encodes 120 genes, comprising 81 protein-coding genes, four ribosomal RNA genes, and 35 tRNA genes, with 151 randomly distributed microsatellites. Approximately 6 palindromic, 34 forward, and 22 tandem repeats were found in the P. taeda cp genome. Whole cp genome comparison with those of other Pinus species exhibited an overall high degree of sequence similarity, with some divergence in intergenic spacers. Higher and lower numbers of indels and single-nucleotide polymorphism substitutions were observed relative to P. contorta and P. monophylla, respectively. Phylogenomic analyses based on the complete genome sequence revealed that 60 shared genes generated trees with the same topologies, and P. taeda was closely related to P. contorta in the subgenus Pinus. Thus, the complete P. taeda genome provided valuable resources for population and evolutionary studies of gymnosperms and can be used to identify related species. PMID:29596414

  7. Simplifying complex sequence information: a PCP-consensus protein binds antibodies against all four Dengue serotypes.

    PubMed

    Bowen, David M; Lewis, Jessica A; Lu, Wenzhe; Schein, Catherine H

    2012-09-14

    Designing proteins that reflect the natural variability of a pathogen is essential for developing novel vaccines and drugs. Flaviviruses, including Dengue (DENV) and West Nile (WNV), evolve rapidly and can "escape" neutralizing monoclonal antibodies by mutation. Designing antigens that represent many distinct strains is important for DENV, where infection with a strain from one of the four serotypes may lead to severe hemorrhagic disease on subsequent infection with a strain from another serotype. Here, a DENV physicochemical property (PCP)-consensus sequence was derived from 671 unique sequences from the Flavitrack database. PCP-consensus proteins for domain 3 of the envelope protein (EdomIII) were expressed from synthetic genes in Escherichia coli. The ability of the purified consensus proteins to bind polyclonal antibodies generated in response to infection with strains from each of the four DENV serotypes was determined. The initial consensus protein bound antibodies from DENV-1-3 in ELISA and Western blot assays. This sequence was altered in 3 steps to incorporate regions of maximum variability, identified as significant changes in the PCPs, characteristic of DENV-4 strains. The final protein was recognized by antibodies against all four serotypes. Two amino acids essential for efficient binding to all DENV antibodies are part of a discontinuous epitope previously defined for a neutralizing monoclonal antibody. The PCP-consensus method can significantly reduce the number of experiments required to define a multivalent antigen, which is particularly important when dealing with pathogens that must be tested at higher biosafety levels. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Fine-tuning structural RNA alignments in the twilight zone.

    PubMed

    Bremges, Andreas; Schirmer, Stefanie; Giegerich, Robert

    2010-04-30

    A widely used method to find conserved secondary structure in RNA is to first construct a multiple sequence alignment, and then fold the alignment, optimizing a score based on thermodynamics and covariance. This method works best around 75% sequence similarity. However, in a "twilight zone" below 55% similarity, the sequence alignment tends to obscure the covariance signal used in the second phase. Therefore, while the overall shape of the consensus structure may still be found, the degree of conservation cannot be estimated reliably. Based on a combination of available methods, we present a method named planACstar for improving structure conservation in structural alignments in the twilight zone. After constructing a consensus structure by alignment folding, planACstar abandons the original sequence alignment, refolds the sequences individually, but consistent with the consensus, aligns the structures, irrespective of sequence, by a pure structure alignment method, and derives an improved sequence alignment from the alignment of structures, to be re-submitted to alignment folding, etc.. This circle may be iterated as long as structural conservation improves, but normally, one step suffices. Employing the tools ClustalW, RNAalifold, and RNAforester, we find that for sequences with 30-55% sequence identity, structural conservation can be improved by 10% on average, with a large variation, measured in terms of RNAalifold's own criterion, the structure conservation index.

  9. Complete Chloroplast Genome Sequences of Mongolia Medicine Artemisia frigida and Phylogenetic Relationships with Other Plants

    PubMed Central

    Liu, Yue; Huo, Naxin; Dong, Lingli; Wang, Yi; Zhang, Shuixian; Young, Hugh A.; Feng, Xiaoxiao; Gu, Yong Qiang

    2013-01-01

    Background Artemisia frigida Willd. is an important Mongolian traditional medicinal plant with pharmacological functions of stanch and detumescence. However, there is little sequence and genomic information available for Artemisia frigida, which makes phylogenetic identification, evolutionary studies, and genetic improvement of its value very difficult. We report the complete chloroplast genome sequence of Artemisia frigida based on 454 pyrosequencing. Methodology/Principal Findings The complete chloroplast genome of Artemisia frigida is 151,076 bp including a large single copy (LSC) region of 82,740 bp, a small single copy (SSC) region of 18,394 bp and a pair of inverted repeats (IRs) of 24,971 bp. The genome contains 114 unique genes and 18 duplicated genes. The chloroplast genome of Artemisia frigida contains a small 3.4 kb inversion within a large 23 kb inversion in the LSC region, a unique feature in Asteraceae. The gene order in the SSC region of Artemisia frigida is inverted compared with the other 6 Asteraceae species with the chloroplast genomes sequenced. This inversion is likely caused by an intramolecular recombination event only occurred in Artemisia frigida. The existence of rich SSR loci in the Artemisia frigida chloroplast genome provides a rare opportunity to study population genetics of this Mongolian medicinal plant. Phylogenetic analysis demonstrates a sister relationship between Artemisia frigida and four other species in Asteraceae, including Ageratina adenophora, Helianthus annuus, Guizotia abyssinica and Lactuca sativa, based on 61 protein-coding sequences. Furthermore, Artemisia frigida was placed in the tribe Anthemideae in the subfamily Asteroideae (Asteraceae) based on ndhF and trnL-F sequence comparisons. Conclusion The chloroplast genome sequence of Artemisia frigida was assembled and analyzed in this study, representing the first plastid genome sequenced in the Anthemideae tribe. This complete chloroplast genome sequence will be useful for molecular ecology and molecular phylogeny studies within Artemisia species and also within the Asteraceae family. PMID:23460871

  10. 53BP1 promotes microhomology-mediated end-joining in G1-phase cells

    PubMed Central

    Xiong, Xiahui; Du, Zhanwen; Wang, Ying; Feng, Zhihui; Fan, Pan; Yan, Chunhong; Willers, Henning; Zhang, Junran

    2015-01-01

    Alternative non-homologous end joining (alt-NHEJ) was originally identified as a backup repair mechanism in the absence of classical NHEJ (c-NHEJ) factors but recent studies have demonstrated that alt-NHEJ is active even when c-NHEJ as well as homologous recombination is available. The functions of 53BP1 in NHEJ processes are not well understood. Here, we report that 53BP1 promotes DNA double-strand break (DSB) repair and genomic stability not only in c-NHEJ-proficient but also -deficient human G1-phase cells. Using an array of repair substrates we show that these effects of 53BP1 are correlated with a promotion of microhomology-mediated end-joining (MMEJ), a subtype of alt-NHEJ, in G1-phase. Consistent with a specific role in MMEJ we confirm that 53BP1 status does not affect c-NHEJ. 53BP1 supports sequence deletion during MMEJ consistent with a putative role in facilitating end-resection. Interestingly, promotion of MMEJ by 53BP1 in G1-phase cells is only observed in the presence of functional BRCA1. Depletion of both 53BP1 and BRCA1 increases repair needing microhomology usage and augments loss of DNA sequence, suggesting that MMEJ is a highly regulated DSB repair process. Together, these findings significantly expand our understanding of the cell-cycle-dependent roles of 53BP1 in DSB repair. PMID:25586219

  11. Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

    PubMed

    Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

    1993-12-22

    The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

  12. Molecular Characterization of Eimeria Species Naturally Infecting Egyptian Baldi Chickens

    PubMed Central

    GADELHAQ, Sahar M; ARAFA, Waleed M; ABOELHADID, Shawky M

    2015-01-01

    Background: Coccidiosis is a serious protozoal disease of poultry. The identification of Eimeria species has important implications for diagnosis and control as well as for epidemiology. The molecular characterization of Eimeria species infecting Egyptian baladi chickens was investigated. Methods: Eimeria species oocysts were harvested from intestines of naturally infected Egyptian baldi chickens. The morphometry characterization of oocysts along with COCCIMORPH software was done. The DNA was extracted initially by freezing and thawing then the prepared samples was subjected to commercial DNA kits. The DNA products were analyzed through conventional polymerase chain reaction by using amplified region (SCAR) marker. Results: The PCR results confirmed the presence of 7 Eimeria species in the examined fecal samples of Egyptian baldi breed with their specific ampilicon sizes being E. acervulina (811bp), E. brunette (626bp), E. tenella (539bp), E. maxima (272bp), E. necatrix (200bp), E. mitis (327bp) and E. praecopx (354bp). A sequencing of the two most predominant species of Eimeria was done, on E. tenella and E. máxima. Analysis of the obtained sequences revealed high identities 99% between Egyptian isolates and the reference one. Similarly, E. maxima isolated from Egyptian baldi chickens showed 98% nucleotide identities with the reference strain. Only single nucleotide substitution was observed among the Egyptian E. tenella isolates (A181G) when compared to the reference one. The Egyptian isolates acquired 4 unique mutations (A68T, C164T, G190A and C227G) in compared with the reference sequence. Conclusion: This is the first time to identify the 7 species of Eimeria from Egyptian baladi chickens. PMID:25904950

  13. Characterization of the heart transcriptome of the white shark (Carcharodon carcharias)

    PubMed Central

    2013-01-01

    Background The white shark (Carcharodon carcharias) is a globally distributed, apex predator possessing physical, physiological, and behavioral traits that have garnered it significant public attention. In addition to interest in the genetic basis of its form and function, as a representative of the oldest extant jawed vertebrate lineage, white sharks are also of conservation concern due to their small population size and threat from overfishing. Despite this, surprisingly little is known about the biology of white sharks, and genomic resources are unavailable. To address this deficit, we combined Roche-454 and Illumina sequencing technologies to characterize the first transciptome of any tissue for this species. Results From white shark heart cDNA we generated 665,399 Roche 454 reads (median length 387-bp) that were assembled into 141,626 contigs (mean length 503-bp). We also generated 78,566,588 Illumina reads, which we aligned to the 454 contigs producing 105,014 454/Illumina consensus sequences. To these, we added 3,432 non-singleton 454 contigs. By comparing these sequences to the UniProtKB/Swiss-Prot database we were able to annotate 21,019 translated open reading frames (ORFs) of ≥ 20 amino acids. Of these, 19,277 were additionally assigned Gene Ontology (GO) functional annotations. While acknowledging the limitations of our single tissue transcriptome, Fisher tests showed the white shark transcriptome to be significantly enriched for numerous metabolic GO terms compared to the zebra fish and human transcriptomes, with white shark showing more similarity to human than to zebra fish (i.e. fewer terms were significantly different). We also compared the transcriptome to other available elasmobranch sequences, for signatures of positive selection and identified several genes of putative adaptive significance on the white shark lineage. The white shark transcriptome also contained 8,404 microsatellites (dinucleotide, trinucleotide, or tetranucleotide motifs ≥ five perfect repeats). Detailed characterization of these microsatellites showed that ORFs with trinucleotide repeats, were significantly enriched for transcription regulatory roles and that trinucleotide frequency within ORFs was lower than for a wide range of taxonomic groups including other vertebrates. Conclusion The white shark heart transcriptome represents a valuable resource for future elasmobranch functional and comparative genomic studies, as well as for population and other biological studies vital for effective conservation of this globally vulnerable species. PMID:24112713

  14. Characterization of the heart transcriptome of the white shark (Carcharodon carcharias).

    PubMed

    Richards, Vincent P; Suzuki, Haruo; Stanhope, Michael J; Shivji, Mahmood S

    2013-10-11

    The white shark (Carcharodon carcharias) is a globally distributed, apex predator possessing physical, physiological, and behavioral traits that have garnered it significant public attention. In addition to interest in the genetic basis of its form and function, as a representative of the oldest extant jawed vertebrate lineage, white sharks are also of conservation concern due to their small population size and threat from overfishing. Despite this, surprisingly little is known about the biology of white sharks, and genomic resources are unavailable. To address this deficit, we combined Roche-454 and Illumina sequencing technologies to characterize the first transciptome of any tissue for this species. From white shark heart cDNA we generated 665,399 Roche 454 reads (median length 387-bp) that were assembled into 141,626 contigs (mean length 503-bp). We also generated 78,566,588 Illumina reads, which we aligned to the 454 contigs producing 105,014 454/Illumina consensus sequences. To these, we added 3,432 non-singleton 454 contigs. By comparing these sequences to the UniProtKB/Swiss-Prot database we were able to annotate 21,019 translated open reading frames (ORFs) of ≥ 20 amino acids. Of these, 19,277 were additionally assigned Gene Ontology (GO) functional annotations. While acknowledging the limitations of our single tissue transcriptome, Fisher tests showed the white shark transcriptome to be significantly enriched for numerous metabolic GO terms compared to the zebra fish and human transcriptomes, with white shark showing more similarity to human than to zebra fish (i.e. fewer terms were significantly different). We also compared the transcriptome to other available elasmobranch sequences, for signatures of positive selection and identified several genes of putative adaptive significance on the white shark lineage. The white shark transcriptome also contained 8,404 microsatellites (dinucleotide, trinucleotide, or tetranucleotide motifs ≥ five perfect repeats). Detailed characterization of these microsatellites showed that ORFs with trinucleotide repeats, were significantly enriched for transcription regulatory roles and that trinucleotide frequency within ORFs was lower than for a wide range of taxonomic groups including other vertebrates. The white shark heart transcriptome represents a valuable resource for future elasmobranch functional and comparative genomic studies, as well as for population and other biological studies vital for effective conservation of this globally vulnerable species.

  15. The Molecular Cytogenetic Characterization of Pistachio (Pistacia vera L.) Suggests the Arrest of Recombination in the Largest Heteropycnotic Pair HC1.

    PubMed

    Sola-Campoy, Pedro J; Robles, Francisca; Schwarzacher, Trude; Ruiz Rejón, Carmelo; de la Herrán, Roberto; Navajas-Pérez, Rafael

    2015-01-01

    This paper represents the first molecular cytogenetic characterization of the strictly dioecious pistachio tree (Pistacia vera L.). The karyotype was characterized by fluorescent in situ hybridization (FISH) with probes for 5S and 45S rDNAs, and the pistachio specific satellite DNAs PIVE-40, and PIVE-180, together with DAPI-staining. PIVE-180 has a monomeric unit of 176-178 bp and high sequence homology between family members; PIVE-40 has a 43 bp consensus monomeric unit, and is most likely arranged in higher order repeats (HORs) of two units. The P. vera genome is highly heterochromatic, and prominent DAPI positive blocks are detected in most chromosomes. Despite the difficulty in classifying chromosomes according to morphology, 10 out of 15 pairs (2n = 30) could be distinguished by their unique banding patterns using a combination of FISH probes. Significantly, the largest pair, designated HC1, is strongly heteropycnotic, shows differential condensation, and has massive enrichment in PIVE-40 repeats. There are two types of HC1 chromosomes (type-I and type-II) with differing PIVE-40 hybridization signal. Only type-I/II heterozygotes and type-I homozygotes individuals were found. We speculate that the differentiation between the two HC1 chromosomes is due to suppression of homologous recombination at meiosis, reinforced by the presence of PIVE-40 HORs and differences in PIVE-40 abundance. This would be compatible with a ZW sex-determination system in the pistachio tree.

  16. The Molecular Cytogenetic Characterization of Pistachio (Pistacia vera L.) Suggests the Arrest of Recombination in the Largest Heteropycnotic Pair HC1

    PubMed Central

    Sola-Campoy, Pedro J.; Robles, Francisca; Schwarzacher, Trude; Ruiz Rejón, Carmelo; de la Herrán, Roberto; Navajas-Pérez, Rafael

    2015-01-01

    This paper represents the first molecular cytogenetic characterization of the strictly dioecious pistachio tree (Pistacia vera L.). The karyotype was characterized by fluorescent in situ hybridization (FISH) with probes for 5S and 45S rDNAs, and the pistachio specific satellite DNAs PIVE-40, and PIVE-180, together with DAPI-staining. PIVE-180 has a monomeric unit of 176–178 bp and high sequence homology between family members; PIVE-40 has a 43 bp consensus monomeric unit, and is most likely arranged in higher order repeats (HORs) of two units. The P. vera genome is highly heterochromatic, and prominent DAPI positive blocks are detected in most chromosomes. Despite the difficulty in classifying chromosomes according to morphology, 10 out of 15 pairs (2n = 30) could be distinguished by their unique banding patterns using a combination of FISH probes. Significantly, the largest pair, designated HC1, is strongly heteropycnotic, shows differential condensation, and has massive enrichment in PIVE-40 repeats. There are two types of HC1 chromosomes (type-I and type-II) with differing PIVE-40 hybridization signal. Only type-I/II heterozygotes and type-I homozygotes individuals were found. We speculate that the differentiation between the two HC1 chromosomes is due to suppression of homologous recombination at meiosis, reinforced by the presence of PIVE-40 HORs and differences in PIVE-40 abundance. This would be compatible with a ZW sex-determination system in the pistachio tree. PMID:26633808

  17. Erwinia carotovora subsp. carotovora extracellular protease: characterization and nucleotide sequence of the gene.

    PubMed Central

    Kyöstiö, S R; Cramer, C L; Lacy, G H

    1991-01-01

    The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878

  18. Assembly of the draft genome of buckwheat and its applications in identifying agronomically useful genes.

    PubMed

    Yasui, Yasuo; Hirakawa, Hideki; Ueno, Mariko; Matsui, Katsuhiro; Katsube-Tanaka, Tomoyuki; Yang, Soo Jung; Aii, Jotaro; Sato, Shingo; Mori, Masashi

    2016-06-01

    Buckwheat (Fagopyrum esculentum Moench; 2n = 2x = 16) is a nutritionally dense annual crop widely grown in temperate zones. To accelerate molecular breeding programmes of this important crop, we generated a draft assembly of the buckwheat genome using short reads obtained by next-generation sequencing (NGS), and constructed the Buckwheat Genome DataBase. After assembling short reads, we determined 387,594 scaffolds as the draft genome sequence (FES_r1.0). The total length of FES_r1.0 was 1,177,687,305 bp, and the N50 of the scaffolds was 25,109 bp. Gene prediction analysis revealed 286,768 coding sequences (CDSs; FES_r1.0_cds) including those related to transposable elements. The total length of FES_r1.0_cds was 212,917,911 bp, and the N50 was 1,101 bp. Of these, the functions of 35,816 CDSs excluding those for transposable elements were annotated by BLAST analysis. To demonstrate the utility of the database, we conducted several test analyses using BLAST and keyword searches. Furthermore, we used the draft genome as a reference sequence for NGS-based markers, and successfully identified novel candidate genes controlling heteromorphic self-incompatibility of buckwheat. The database and draft genome sequence provide a valuable resource that can be used in efforts to develop buckwheat cultivars with superior agronomic traits. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  19. Species-specific markers for the differential diagnosis of Trypanosoma cruzi and Trypanosoma rangeli and polymorphisms detection in Trypanosoma rangeli.

    PubMed

    Ferreira, Keila Adriana Magalhães; Fajardo, Emanuella Francisco; Baptista, Rodrigo P; Macedo, Andrea Mara; Lages-Silva, Eliane; Ramírez, Luis Eduardo; Pedrosa, André Luiz

    2014-06-01

    Trypanosoma cruzi and Trypanosoma rangeli are kinetoplastid parasites which are able to infect humans in Central and South America. Misdiagnosis between these trypanosomes can be avoided by targeting barcoding sequences or genes of each organism. This work aims to analyze the feasibility of using species-specific markers for identification of intraspecific polymorphisms and as target for diagnostic methods by PCR. Accordingly, primers which are able to specifically detect T. cruzi or T. rangeli genomic DNA were characterized. The use of intergenic regions, generally divergent in the trypanosomatids, and the serine carboxypeptidase gene were successful. Using T. rangeli genomic sequences for the identification of group-specific polymorphisms and a polymorphic AT(n) dinucleotide repeat permitted the classification of the strains into two groups, which are entirely coincident with T. rangeli main lineages, KP1 (+) and KP1 (-), previously determined by kinetoplast DNA (kDNA) characterization. The sequences analyzed totalize 622 bp (382 bp represent a hypothetical protein sequence, and 240 bp represent an anonymous sequence), and of these, 581 (93.3%) are conserved sites and 41 bp (6.7%) are polymorphic, with 9 transitions (21.9%), 2 transversions (4.9%), and 30 (73.2%) insertion/deletion events. Taken together, the species-specific markers analyzed may be useful for the development of new strategies for the accurate diagnosis of infections. Furthermore, the identification of T. rangeli polymorphisms has a direct impact in the understanding of the population structure of this parasite.

  20. The complete chloroplast genome of Gentiana straminea (Gentianaceae), an endemic species to the Sino-Himalayan subregion.

    PubMed

    Ni, Lianghong; Zhao, Zhili; Xu, Hongxi; Chen, Shilin; Dorje, Gaawe

    2016-02-15

    Endemic to the Sino-Himalayan subregion, the medicinal alpine plant Gentiana straminea is a threatened species. The genetic and molecular data about it is deficient. Here we report the complete chloroplast (cp) genome sequence of G. straminea, as the first sequenced member of the family Gentianaceae. The cp genome is 148,991bp in length, including a large single copy (LSC) region of 81,240bp, a small single copy (SSC) region of 17,085bp and a pair of inverted repeats (IRs) of 25,333bp. It contains 112 unique genes, including 78 protein-coding genes, 30 tRNAs and 4 rRNAs. The rps16 gene lacks exon2 between trnK-UUU and trnQ-UUG, which is the first rps16 pseudogene found in the nonparasitic plants of Asterids clade. Sequence analysis revealed the presence of 13 forward repeats, 13 palindrome repeats and 39 simple sequence repeats (SSRs). An entire cp genome comparison study of G. straminea and four other species in Gentianales was carried out. Phylogenetic analyses using maximum likelihood (ML) and maximum parsimony (MP) were performed based on 69 protein-coding genes from 36 species of Asterids. The results strongly supported the position of Gentianaceae as one member of the order Gentianales. The complete chloroplast genome sequence will provide intragenic information for its conservation and contribute to research on the genetic and phylogenetic analyses of Gentianales and Asterids. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. The complete chloroplast genome sequence of Dodonaea viscosa: comparative and phylogenetic analyses.

    PubMed

    Saina, Josphat K; Gichira, Andrew W; Li, Zhi-Zhong; Hu, Guang-Wan; Wang, Qing-Feng; Liao, Kuo

    2018-02-01

    The plant chloroplast (cp) genome is a highly conserved structure which is beneficial for evolution and systematic research. Currently, numerous complete cp genome sequences have been reported due to high throughput sequencing technology. However, there is no complete chloroplast genome of genus Dodonaea that has been reported before. To better understand the molecular basis of Dodonaea viscosa chloroplast, we used Illumina sequencing technology to sequence its complete genome. The whole length of the cp genome is 159,375 base pairs (bp), with a pair of inverted repeats (IRs) of 27,099 bp separated by a large single copy (LSC) 87,204 bp, and small single copy (SSC) 17,972 bp. The annotation analysis revealed a total of 115 unique genes of which 81 were protein coding, 30 tRNA, and four ribosomal RNA genes. Comparative genome analysis with other closely related Sapindaceae members showed conserved gene order in the inverted and single copy regions. Phylogenetic analysis clustered D. viscosa with other species of Sapindaceae with strong bootstrap support. Finally, a total of 249 SSRs were detected. Moreover, a comparison of the synonymous (Ks) and nonsynonymous (Ka) substitution rates in D. viscosa showed very low values. The availability of cp genome reported here provides a valuable genetic resource for comprehensive further studies in genetic variation, taxonomy and phylogenetic evolution of Sapindaceae family. In addition, SSR markers detected will be used in further phylogeographic and population structure studies of the species in this genus.

  2. Development and validation of the JAX Cancer Treatment Profile™ for detection of clinically actionable mutations in solid tumors

    PubMed Central

    Ananda, Guruprasad; Mockus, Susan; Lundquist, Micaela; Spotlow, Vanessa; Simons, Al; Mitchell, Talia; Stafford, Grace; Philip, Vivek; Stearns, Timothy; Srivastava, Anuj; Barter, Mary; Rowe, Lucy; Malcolm, Joan; Bult, Carol; Karuturi, Radha Krishna Murthy; Rasmussen, Karen; Hinerfeld, Douglas

    2015-01-01

    Background The continued development of targeted therapeutics for cancer treatment has required the concomitant development of more expansive methods for the molecular profiling of the patient’s tumor. We describe the validation of the JAX Cancer Treatment Profile™ (JAX-CTP™), a next generation sequencing (NGS)-based molecular diagnostic assay that detects actionable mutations in solid tumors to inform the selection of targeted therapeutics for cancer treatment. Methods NGS libraries are generated from DNA extracted from formalin fixed paraffin embedded tumors. Using hybrid capture, the genes of interest are enriched and sequenced on the Illumina HiSeq 2500 or MiSeq sequencers followed by variant detection and functional and clinical annotation for the generation of a clinical report. Results The JAX-CTP™ detects actionable variants, in the form of single nucleotide variations and small insertions and deletions (≤50bp) in 190 genes in specimens with a neoplastic cell content of ≥10%. The JAX-CTP™ is also validated for the detection of clinically actionable gene amplifications. Conclusions There is a lack of consensus in the molecular diagnostics field on the best method for the validation of NGS-based assays in oncology, thus the importance of communicating methods, as contained in this report. The growing number of targeted therapeutics and the complexity of the tumor genome necessitates continued development and refinement of advanced assays for tumor profiling to enable precision cancer treatment. PMID:25562415

  3. Mutant type glutathione S-transferase theta 1 gene homologue to mTOR in myelodysplastic syndrome: possible clinical application of rapamycin.

    PubMed

    Maeda, Yasuhiro; Yamaguchi, Terufumi; Ueda, Satomi; Matsuo, Koki; Morita, Yasuyoshi; Naiki, Yoshito; Miyazato, Hajime; Shimada, Takahiro; Miyatake, Jun-Ichi; Matsuda, Mitsuhiro; Kanamaru, Akihisa

    2003-07-01

    In this study, we observed the expression of the GSTT-1 gene in patients with myelodysplastic syndrome (MDS) at the messenger RNA level. Reverse transcription-polymerase chain reaction (RT-PCR) for GSTT-1 was performed with a pair of primers complementary to the 5' coding section and the 3' coding section of the GSTT-1 cDNA for amplifying the 623-bp band. Among 20 patients with MDS, 8 patients showed the expected 623-bp band on RT-PCR, and 12 patients showed a 500-bp band on RT-PCR, indicating that a 123-bp sequence was deleted as a mutant of the GSTT-1 gene. Furthermore, a BLAST DNA search showed that the deletion of a 123 bp sequence creates a sequence that is 63% homologous to human FKBP-rapamycin associated protein (FRAP); this protein has been termed a mammalian target of rapamycin (mTOR). We respectively transfected the wild type and the mutant type GSTT-1 gene in an expression vector to two cell lines (K562 and HL-60). The stable transformants for the wild type and the mutant type GSTT-1 genes were made by G418 selection. Interestingly, rapamycin could induce significant growth inhibition of the stable transformants for mutant type GSTT-1, which was indicative of apoptosis, but not that of those for wild type GSTT-1. These results suggest that rapamycin could be included in the therapeutic modality for the patients with MDS who have the mTOR sequences in GSTT-1 gene.

  4. A computational framework to empower probabilistic protein design

    PubMed Central

    Fromer, Menachem; Yanover, Chen

    2008-01-01

    Motivation: The task of engineering a protein to perform a target biological function is known as protein design. A commonly used paradigm casts this functional design problem as a structural one, assuming a fixed backbone. In probabilistic protein design, positional amino acid probabilities are used to create a random library of sequences to be simultaneously screened for biological activity. Clearly, certain choices of probability distributions will be more successful in yielding functional sequences. However, since the number of sequences is exponential in protein length, computational optimization of the distribution is difficult. Results: In this paper, we develop a computational framework for probabilistic protein design following the structural paradigm. We formulate the distribution of sequences for a structure using the Boltzmann distribution over their free energies. The corresponding probabilistic graphical model is constructed, and we apply belief propagation (BP) to calculate marginal amino acid probabilities. We test this method on a large structural dataset and demonstrate the superiority of BP over previous methods. Nevertheless, since the results obtained by BP are far from optimal, we thoroughly assess the paradigm using high-quality experimental data. We demonstrate that, for small scale sub-problems, BP attains identical results to those produced by exact inference on the paradigmatic model. However, quantitative analysis shows that the distributions predicted significantly differ from the experimental data. These findings, along with the excellent performance we observed using BP on the smaller problems, suggest potential shortcomings of the paradigm. We conclude with a discussion of how it may be improved in the future. Contact: fromer@cs.huji.ac.il PMID:18586717

  5. Complete Genome Sequence of the Opitutaceae Bacterium Strain TAV5, a Potential Facultative Methylotroph of the Wood-Feeding Termite Reticulitermes flavipes

    DOE PAGES

    Kotak, Malini; Isanapong, Jantiya; Goodwin, Lynne A.; ...

    2015-03-05

    The Opitutaceae bacterium strain TAV5, a member of the phylum Verrucomicrobia, was isolated from the wood-feeding termite hindgut. Here, we report here its complete genome sequence, which contains a chromosome and a plasmid of 7,317,842 bp and 99,831 bp, respectively. In conclusion, genomic analysis reveals genes for methylotrophy, lignocellulose degradation, and ammonia and sulfate assimilation.

  6. Complete Genome Sequence of Sulfuriferula sp. Strain AH1, a Sulfur-Oxidizing Autotroph Isolated from Weathered Mine Tailings from the Duluth Complex in Minnesota

    PubMed Central

    Roepke, Elizabeth W.; Hua, An An; Flood, Beverly E.; Bailey, Jake V.

    2017-01-01

    ABSTRACT We report the closed and annotated genome sequence of Sulfuriferula sp. strain AH1. Strain AH1 has a 2,877,007-bp chromosome that includes a partial Sox system for inorganic sulfur oxidation and a complete nitrogen fixation pathway. It also has a single 39,138-bp plasmid with genes for arsenic and mercury resistance. PMID:28798167

  7. Identification of a second flagellin gene and functional characterization of a sigma70-like promoter upstream of a Leptospira borgpetersenii flaB gene.

    PubMed

    Lin, Min; Dan, Hanhong; Li, Yijing

    2004-02-01

    Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.

  8. Complete Genome Sequence of a Novel Aquareovirus That Infects the Endangered Fountain Darter, Etheostoma fonticola.

    PubMed

    Iwanowicz, Luke R; Iwanowicz, Deborah D; Adams, Cynthia R; Lewis, Teresa D; Brandt, Thomas M; Cornman, Robert S; Sanders, Lakyn

    2016-12-22

    Here, we report the complete genome of a novel aquareovirus isolated from clinically normal fountain darters, Etheostoma fonticola, inhabiting the San Marcos River, Texas, USA. The complete genome consists of 23,958 bp consisting of 11 segments that range from 783 bp (S11) to 3,866 bp (S1). Copyright © 2016 Iwanowicz et al.

  9. Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

    PubMed Central

    Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

    2011-01-01

    DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jackrel, Sara L.; Owens, Sarah M.; Gilbert, Jack A.

    Plants in terrestrial and aquatic environments contain a diverse microbiome. Yet, the chloroplast and mitochondria organelles of the plant eukaryotic cell originate from free-living cyanobacteria and Rickettsiales. This represents a challenge for sequencing the plant microbiome with universal primers, as ~99% of 16S rRNA sequences may consist of chloroplast and mitochondrial sequences. Peptide nucleic acid clamps offer a potential solution by blocking amplification of host-associated sequences. We assessed the efficacy of chloroplast and mitochondria-blocking clamps against a range of microbial taxa from soil, freshwater and marine environments. While we found that the mitochondrial blocking clamps appear to be a robustmore » method for assessing animal-associated microbiota, Proteobacterial 16S rRNA binds to the chloroplast-blocking clamp, resulting in a strong sequencing bias against this group. We attribute this bias to a conserved 14-bp sequence in the Proteobacteria that matches the 17-bp chloroplast-blocking clamp sequence. By scanning the Greengenes database, we provide a reference list of nearly 1500 taxa that contain this 14-bp sequence, including 48 families such as the Rhodobacteraceae, Phyllobacteriaceae, Rhizobiaceae, Kiloniellaceae and Caulobacteraceae. To determine where these taxa are found in nature, we mapped this taxa reference list against the Earth Microbiome Project database. These taxa are abundant in a variety of environments, particularly aquatic and semiaquatic freshwater and marine habitats. To facilitate informed decisions on effective use of organelle-blocking clamps, we provide a searchable database of microbial taxa in the Greengenes and Silva databases matching various n-mer oligonucleotides of each PNA sequence.« less

  11. EXONSAMPLER: a computer program for genome-wide and candidate gene exon sampling for targeted next-generation sequencing.

    PubMed

    Cosart, Ted; Beja-Pereira, Albano; Luikart, Gordon

    2014-11-01

    The computer program EXONSAMPLER automates the sampling of thousands of exon sequences from publicly available reference genome sequences and gene annotation databases. It was designed to provide exon sequences for the efficient, next-generation gene sequencing method called exon capture. The exon sequences can be sampled by a list of gene name abbreviations (e.g. IFNG, TLR1), or by sampling exons from genes spaced evenly across chromosomes. It provides a list of genomic coordinates (a bed file), as well as a set of sequences in fasta format. User-adjustable parameters for collecting exon sequences include a minimum and maximum acceptable exon length, maximum number of exonic base pairs (bp) to sample per gene, and maximum total bp for the entire collection. It allows for partial sampling of very large exons. It can preferentially sample upstream (5 prime) exons, downstream (3 prime) exons, both external exons, or all internal exons. It is written in the Python programming language using its free libraries. We describe the use of EXONSAMPLER to collect exon sequences from the domestic cow (Bos taurus) genome for the design of an exon-capture microarray to sequence exons from related species, including the zebu cow and wild bison. We collected ~10% of the exome (~3 million bp), including 155 candidate genes, and ~16,000 exons evenly spaced genomewide. We prioritized the collection of 5 prime exons to facilitate discovery and genotyping of SNPs near upstream gene regulatory DNA sequences, which control gene expression and are often under natural selection. © 2014 John Wiley & Sons Ltd.

  12. The complete chloroplast genome of an irreplaceable dietary and model crop, foxtail millet (Setaria italica).

    PubMed

    Wang, Shuo; Gao, Li-Zhi

    2016-11-01

    The complete chloroplast genome sequence of foxtail millet (Setaria italica), an important food and fodder crop in the family Poaceae, is first reported in this study. The genome consists of 1 35 516 bp containing a pair of inverted repeats (IRs) of 21 804 bp separated by a large single-copy (LSC) region and a small single-copy (SSC) region of 79 896 bp and 12 012 bp, respectively. Coding sequences constitute 58.8% of the genome harboring 111 unique genes, 71 of which are protein-coding genes, 4 are rRNA genes, and 36 are tRNA genes. Phylogenetic analysis indicated foxtail millet clustered with Panicum virgatum and Echinochloa crus-galli belonging to the tribe Paniceae of the subfamily Panicoideae. This newly determined chloroplast genome will provide valuable information for the future breeding programs of valuable cereal crops in the family Poaceae.

  13. Engineering an efficient and tight D-amino acid-inducible gene expression system in Rhodosporidium/Rhodotorula species.

    PubMed

    Liu, Yanbin; Koh, Chong Mei John; Ngoh, Si Te; Ji, Lianghui

    2015-10-26

    Rhodosporidium and Rhodotorula are two genera of oleaginous red yeast with great potential for industrial biotechnology. To date, there is no effective method for inducible expression of proteins and RNAs in these hosts. We have developed a luciferase gene reporter assay based on a new codon-optimized LUC2 reporter gene (RtLUC2), which is flanked with CAR2 homology arms and can be integrated into the CAR2 locus in the nuclear genome at >90 % efficiency. We characterized the upstream DNA sequence of a D-amino acid oxidase gene (DAO1) from R. toruloides ATCC 10657 by nested deletions. By comparing the upstream DNA sequences of several putative DAO1 homologs of Basidiomycetous fungi, we identified a conserved DNA motif with a consensus sequence of AGGXXGXAGX11GAXGAXGG within a 0.2 kb region from the mRNA translation initiation site. Deletion of this motif led to strong mRNA transcription under non-inducing conditions. Interestingly, DAO1 promoter activity was enhanced about fivefold when the 108 bp intron 1 was included in the reporter construct. We identified a conserved CT-rich motif in the intron with a consensus sequence of TYTCCCYCTCCYCCCCACWYCCGA, deletion or point mutations of which drastically reduced promoter strength under both inducing and non-inducing conditions. Additionally, we created a selection marker-free DAO1-null mutant (∆dao1e) which displayed greatly improved inducible gene expression, particularly when both glucose and nitrogen were present in high levels. To avoid adding unwanted peptide to proteins to be expressed, we converted the original translation initiation codon to ATC and re-created a translation initiation codon at the start of exon 2. This promoter, named P DAO1-in1m1 , showed very similar luciferase activity to the wild-type promoter upon induction with D-alanine. The inducible system was tunable by adjusting the levels of inducers, carbon source and nitrogen source. The intron 1-containing DAO1 promoters coupled with a DAO1 null mutant makes an efficient and tight D-amino acid-inducible gene expression system in Rhodosporidium and Rhodotorula genera. The system will be a valuable tool for metabolic engineering and enzyme expression in these yeast hosts.

  14. Chloroplast Genome Sequence of Pigeonpea (Cajanus cajan (L.) Millspaugh) and Cajanus scarabaeoides (L.) Thouars: Genome Organization and Comparison with Other Legumes

    PubMed Central

    Kaila, Tanvi; Chaduvla, Pavan K.; Saxena, Swati; Bahadur, Kaushlendra; Gahukar, Santosh J.; Chaudhury, Ashok; Sharma, T. R.; Singh, N. K.; Gaikwad, Kishor

    2016-01-01

    Pigeonpea (Cajanus cajan (L.) Millspaugh), a diploid (2n = 22) legume crop with a genome size of 852 Mbp, serves as an important source of human dietary protein especially in South East Asian and African regions. In this study, the draft chloroplast genomes of Cajanus cajan and Cajanus scarabaeoides (L.) Thouars were generated. Cajanus scarabaeoides is an important species of the Cajanus gene pool and has also been used for developing promising CMS system by different groups. A male sterile genotype harboring the C. scarabaeoides cytoplasm was used for sequencing the plastid genome. The cp genome of C. cajan is 152,242bp long, having a quadripartite structure with LSC of 83,455 bp and SSC of 17,871 bp separated by IRs of 25,398 bp. Similarly, the cp genome of C. scarabaeoides is 152,201bp long, having a quadripartite structure in which IRs of 25,402 bp length separates 83,423 bp of LSC and 17,854 bp of SSC. The pigeonpea cp genome contains 116 unique genes, including 30 tRNA, 4 rRNA, 78 predicted protein coding genes and 5 pseudogenes. A 50 kb inversion was observed in the LSC region of pigeonpea cp genome, consistent with other legumes. Comparison of cp genome with other legumes revealed the contraction of IR boundaries due to the absence of rps19 gene in the IR region. Chloroplast SSRs were mined and a total of 280 and 292 cpSSRs were identified in C. scarabaeoides and C. cajan respectively. RNA editing was observed at 37 sites in both C. scarabaeoides and C. cajan, with maximum occurrence in the ndh genes. The pigeonpea cp genome sequence would be beneficial in providing informative molecular markers which can be utilized for genetic diversity analysis and aid in understanding the plant systematics studies among major grain legumes. PMID:28018385

  15. Chloroplast Genome Sequence of Pigeonpea (Cajanus cajan (L.) Millspaugh) and Cajanus scarabaeoides (L.) Thouars: Genome Organization and Comparison with Other Legumes.

    PubMed

    Kaila, Tanvi; Chaduvla, Pavan K; Saxena, Swati; Bahadur, Kaushlendra; Gahukar, Santosh J; Chaudhury, Ashok; Sharma, T R; Singh, N K; Gaikwad, Kishor

    2016-01-01

    Pigeonpea ( Cajanus cajan (L.) Millspaugh), a diploid (2n = 22) legume crop with a genome size of 852 Mbp, serves as an important source of human dietary protein especially in South East Asian and African regions. In this study, the draft chloroplast genomes of Cajanus cajan and Cajanus scarabaeoides (L.) Thouars were generated. Cajanus scarabaeoides is an important species of the Cajanus gene pool and has also been used for developing promising CMS system by different groups. A male sterile genotype harboring the C. scarabaeoides cytoplasm was used for sequencing the plastid genome. The cp genome of C. cajan is 152,242bp long, having a quadripartite structure with LSC of 83,455 bp and SSC of 17,871 bp separated by IRs of 25,398 bp. Similarly, the cp genome of C. scarabaeoides is 152,201bp long, having a quadripartite structure in which IRs of 25,402 bp length separates 83,423 bp of LSC and 17,854 bp of SSC. The pigeonpea cp genome contains 116 unique genes, including 30 tRNA, 4 rRNA, 78 predicted protein coding genes and 5 pseudogenes. A 50 kb inversion was observed in the LSC region of pigeonpea cp genome, consistent with other legumes. Comparison of cp genome with other legumes revealed the contraction of IR boundaries due to the absence of rps19 gene in the IR region. Chloroplast SSRs were mined and a total of 280 and 292 cpSSRs were identified in C. scarabaeoides and C. cajan respectively. RNA editing was observed at 37 sites in both C. scarabaeoides and C. cajan , with maximum occurrence in the ndh genes. The pigeonpea cp genome sequence would be beneficial in providing informative molecular markers which can be utilized for genetic diversity analysis and aid in understanding the plant systematics studies among major grain legumes.

  16. NFATc1 regulation of the human β3 integrin promoter in osteoclast differentiation

    PubMed Central

    Crotti, Tania N.; Flannery, Merrilee; Walsh, Nicole C.; Fleming, Joseph D.; Goldring, Steven R.; McHugh, Kevin P.

    2006-01-01

    The transcription factor NFATc1 plays an essential role in transducing signals from RANKL in osteoclast differentiation. To date, however, the specific transcriptional targets of NFATc1 are unknown. Expression of the β3 integrin is required for normal osteoclast function. We therefore examined the role of NFATc1 in human β3 integrin expression in osteoclast differentiation. Analysis of the mouse and human β3 gene promoters revealed considerable sequence homology across a 1.3 kb region upstream of the transcription start site (TSS), with conserved NFAT binding elements present. The region −1242 to +29 (relative to the TSS) was cloned as a luciferase reporter construct (pB3-1.3) and a deletion construct removing to −997 (pB3-1) made. The deletion of 245 bp 5′ removed three conserved NFAT sites including a consensus NFAT:AP-1 site. The pB3-1.3 reporter construct was induced by treatment with RANKL in the range 2.5–40 ng/ml and dose-dependently induced by co-transfection with human NFATc1 in RAW264.7 cells. The pB3-1 deletion construct was minimally induced with RANKL treatment and unresponsive to co-transfected NFATc1. Direct NFAT binding to two of the consensus NFAT sites within this 245 bp 5′ region was demonstrated by EMSA and supershift with anti-NFAT antibodies. Mutation of two of the conserved NFAT sites in the −1242 to −997 fragment was required to prevent binding. The double NFAT mutant, in the context of the full-length promoter was unresponsive to RANKL treatment or co-transfected NFATc1. We generated cell-permeable TAT-dominant-negative (dn)NFATc1 fusion proteins to assess the effect of blockade of NFAT signaling. Transduction with dnNFAT inhibited RANKL induction of the human β3 integrin promoter. Involvement of the NFATc1-calcineurin pathway in regulating the human β3 integrin promoter was further confirmed using the calcineurin pathway inhibitory peptide 11R-VIVIT. Together these results establish the β3 gene as a direct target of NFATc1 in RANKL-dependent osteoclast formation. PMID:16513293

  17. Diffusion-weighted Imaging of the Liver with Multiple b Values: Effect of Diffusion Gradient Polarity and Breathing Acquisition on Image Quality and Intravoxel Incoherent Motion Parameters—A Pilot Study

    PubMed Central

    Dyvorne, Hadrien A.; Galea, Nicola; Nevers, Thomas; Fiel, M. Isabel; Carpenter, David; Wong, Edmund; Orton, Matthew; de Oliveira, Andre; Feiweier, Thorsten; Vachon, Marie-Louise; Babb, James S.

    2013-01-01

    Purpose: To optimize intravoxel incoherent motion (IVIM) diffusion-weighted (DW) imaging by estimating the effects of diffusion gradient polarity and breathing acquisition scheme on image quality, signal-to-noise ratio (SNR), IVIM parameters, and parameter reproducibility, as well as to investigate the potential of IVIM in the detection of hepatic fibrosis. Materials and Methods: In this institutional review board–approved prospective study, 20 subjects (seven healthy volunteers, 13 patients with hepatitis C virus infection; 14 men, six women; mean age, 46 years) underwent IVIM DW imaging with four sequences: (a) respiratory-triggered (RT) bipolar (BP) sequence, (b) RT monopolar (MP) sequence, (c) free-breathing (FB) BP sequence, and (d) FB MP sequence. Image quality scores were assessed for all sequences. A biexponential analysis with the Bayesian method yielded true diffusion coefficient (D), pseudodiffusion coefficient (D*), and perfusion fraction (PF) in liver parenchyma. Mixed-model analysis of variance was used to compare image quality, SNR, IVIM parameters, and interexamination variability between the four sequences, as well as the ability to differentiate areas of liver fibrosis from normal liver tissue. Results: Image quality with RT sequences was superior to that with FB acquisitions (P = .02) and was not affected by gradient polarity. SNR did not vary significantly between sequences. IVIM parameter reproducibility was moderate to excellent for PF and D, while it was less reproducible for D*. PF and D were both significantly lower in patients with hepatitis C virus than in healthy volunteers with the RT BP sequence (PF = 13.5% ± 5.3 [standard deviation] vs 9.2% ± 2.5, P = .038; D = [1.16 ± 0.07] × 10−3 mm2/sec vs [1.03 ± 0.1] × 10−3 mm2/sec, P = .006). Conclusion: The RT BP DW imaging sequence had the best results in terms of image quality, reproducibility, and ability to discriminate between healthy and fibrotic liver with biexponential fitting. © RSNA, 2012 PMID:23220895

  18. The last Viking King: a royal maternity case solved by ancient DNA analysis.

    PubMed

    Dissing, Jørgen; Binladen, Jonas; Hansen, Anders; Sejrsen, Birgitte; Willerslev, Eske; Lynnerup, Niels

    2007-02-14

    The last of the Danish Viking Kings, Sven Estridsen, died in a.d. 1074 and is entombed in Roskilde Cathedral with other Danish kings and queens. Sven's mother, Estrid, is entombed in a pillar across the chancel. However, while there is no reasonable doubt about the identity of Sven, there have been doubts among historians whether the woman entombed was indeed Estrid. To shed light on this problem, we have extracted and analysed mitochondrial DNA (mtDNA) from pulp of teeth from each of the two royals. Four overlapping DNA-fragments covering about 400bp of hypervariable region 1 (HVR-1) of the D-loop were PCR amplified, cloned and a number of clones with each segment were sequenced. Also a segment containing the H/non-H specific nucleotide 7028 was sequenced. Consensus sequences were determined and D-loop results were replicated in an independent laboratory. This allowed the assignment of King Sven Estridsen to haplogroup H; Estrid's sequence differed from that of Sven at two positions in HVR-1, 16093T-->C and 16304T-->C, indicating that she belongs to subgroup H5a. Given the maternal inheritance of mtDNA, offspring will have the same mtDNA sequence as their mother with the exception of rare cases where the sequence has been altered by a germ line mutation. Therefore, the observation of two sequence differences makes it highly unlikely that the entombed woman was the mother of Sven. In addition, physical examination of the skeleton and the teeth strongly indicated that this woman was much younger (approximately 35 years) at the time of death than the 70 years history records tell. Although the entombed woman cannot be the Estrid, she may well be one of Sven's two daughters-in-law who were also called Estrid and who both became queens.

  19. Molecular phylogeny of 21 tropical bamboo species reconstructed by integrating non-coding internal transcribed spacer (ITS1 and 2) sequences and their consensus secondary structure.

    PubMed

    Ghosh, Jayadri Sekhar; Bhattacharya, Samik; Pal, Amita

    2017-06-01

    The unavailability of the reproductive structure and unpredictability of vegetative characters for the identification and phylogenetic study of bamboo prompted the application of molecular techniques for greater resolution and consensus. We first employed internal transcribed spacer (ITS1, 5.8S rRNA and ITS2) sequences to construct the phylogenetic tree of 21 tropical bamboo species. While the sequence alone could grossly reconstruct the traditional phylogeny amongst the 21-tropical species studied, some anomalies were encountered that prompted a further refinement of the phylogenetic analyses. Therefore, we integrated the secondary structure of the ITS sequences to derive individual sequence-structure matrix to gain more resolution on the phylogenetic reconstruction. The results showed that ITS sequence-structure is the reliable alternative to the conventional phenotypic method for the identification of bamboo species. The best-fit topology obtained by the sequence-structure based phylogeny over the sole sequence based one underscores closer clustering of all the studied Bambusa species (Sub-tribe Bambusinae), while Melocanna baccifera, which belongs to Sub-Tribe Melocanneae, disjointedly clustered as an out-group within the consensus phylogenetic tree. In this study, we demonstrated the dependability of the combined (ITS sequence+structure-based) approach over the only sequence-based analysis for phylogenetic relationship assessment of bamboo.

  20. Selection of homeotic proteins for binding to a human DNA replication origin.

    PubMed

    de Stanchina, E; Gabellini, D; Norio, P; Giacca, M; Peverali, F A; Riva, S; Falaschi, A; Biamonti, G

    2000-06-09

    We have previously shown that a cell cycle-dependent nucleoprotein complex assembles in vivo on a 74 bp sequence within the human DNA replication origin associated to the Lamin B2 gene. Here, we report the identification, using a one-hybrid screen in yeast, of three proteins interacting with the 74 bp sequence. All of them, namely HOXA13, HOXC10 and HOXC13, are orthologues of the Abdominal-B gene of Drosophila melanogaster and are members of the homeogene family of developmental regulators. We describe the complete open reading frame sequence of HOXC10 and HOXC13 along with the structure of the HoxC13 gene. The specificity of binding of these two proteins to the Lamin B2 origin is confirmed by both band-shift and in vitro footprinting assays. In addition, the ability of HOXC10 and HOXC13 to increase the activity of a promoter containing the 74 bp sequence, as assayed by CAT-assay experiments, demonstrates a direct interaction of these homeoproteins with the origin sequence in mammalian cells. We also show that HOXC10 expression is cell-type-dependent and positively correlates with cell proliferation. Copyright 2000 Academic Press.

  1. Sequence polymorphism in an insect RNA virus field population: A snapshot from a single point in space and time reveals stochastic differences among and within individual hosts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stenger, Drake C., E-mail: drake.stenger@ars.usda.

    Population structure of Homalodisca coagulata Virus-1 (HoCV-1) among and within field-collected insects sampled from a single point in space and time was examined. Polymorphism in complete consensus sequences among single-insect isolates was dominated by synonymous substitutions. The mutant spectrum of the C2 helicase region within each single-insect isolate was unique and dominated by nonsynonymous singletons. Bootstrapping was used to correct the within-isolate nonsynonymous:synonymous arithmetic ratio (N:S) for RT-PCR error, yielding an N:S value ~one log-unit greater than that of consensus sequences. Probability of all possible single-base substitutions for the C2 region predicted N:S values within 95% confidence limits of themore » corrected within-isolate N:S when the only constraint imposed was viral polymerase error bias for transitions over transversions. These results indicate that bottlenecks coupled with strong negative/purifying selection drive consensus sequences toward neutral sequence space, and that most polymorphism within single-insect isolates is composed of newly-minted mutations sampled prior to selection. -- Highlights: •Sampling protocol minimized differential selection/history among isolates. •Polymorphism among consensus sequences dominated by negative/purifying selection. •Within-isolate N:S ratio corrected for RT-PCR error by bootstrapping. •Within-isolate mutant spectrum dominated by new mutations yet to undergo selection.« less

  2. Complete genome sequence of Thauera aminoaromatica strain MZ1T

    PubMed Central

    Jiang, Ke; Sanseverino, John; Chauhan, Archana; Lucas, Susan; Copeland, Alex; Lapidus, Alla; Del Rio, Tijana Glavina; Dalin, Eileen; Tice, Hope; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Sims, David; Brettin, Thomas; Detter, John C.; Han, Cliff; Chang, Y.J.; Larimer, Frank; Land, Miriam; Hauser, Loren; Kyrpides, Nikos C.; Mikhailova, Natalia; Moser, Scott; Jegier, Patricia; Close, Dan; DeBruyn, Jennifer M.; Wang, Ying; Layton, Alice C.; Allen, Michael S.; Sayler, Gary S.

    2012-01-01

    Thauera aminoaromatica strain MZ1T, an isolate belonging to genus Thauera, of the family Rhodocyclaceae and the class the Betaproteobacteria, has been characterized for its ability to produce abundant exopolysaccharide and degrade various aromatic compounds with nitrate as an electron acceptor. These properties, if fully understood at the genome-sequence level, can aid in environmental processing of organic matter in anaerobic cycles by short-circuiting a central anaerobic metabolite, acetate, from microbiological conversion to methane, a critical greenhouse gas. Strain MZ1T is the first strain from the genus Thauera with a completely sequenced genome. The 4,496,212 bp chromosome and 78,374 bp plasmid contain 4,071 protein-coding and 71 RNA genes, and were sequenced as part of the DOE Community Sequencing Program CSP_776774. PMID:23407619

  3. The hypervariable region 1 protein of hepatitis C virus broadly reactive with sera of patients with chronic hepatitis C has a similar amino acid sequence with the consensus sequence.

    PubMed

    Watanabe, K; Yoshioka, K; Ito, H; Ishigami, M; Takagi, K; Utsunomiya, S; Kobayashi, M; Kishimoto, H; Yano, M; Kakumu, S

    1999-11-10

    Hypervariable region 1 (HVR1) proteins of hepatitis C virus (HCV) have been reported to react broadly with sera of patients with HCV infection. However, the variability of the broad reactivity of individual HVR1 proteins has not been elucidated. We assessed the reactivity of 25 different HVR1 proteins (genotype 1b) with sera of 81 patients with HCV infection (genotype 1b) by Western blot. HVR1 proteins reacted with 2-60 sera. The number of sera reactive with each HVR1 protein significantly correlated with the number of amino acid residues identical to the consensus sequence defined by Puntoriero et al. (G. Puntoriero, A. Lahm, S. Zucchelli, B. B. Ercole, R. Tafi, M. Penzzanera, M. U. Mondelli, R. Cortese, A. Tramontano, G. Galfre', and A. Nicosia. 1998. EMBO J. 17, 3521-3533. ) (r = 0.561, P < 0.005). The most widely reactive HVR1 protein, 12-22, had a sequence similar to the consensus sequence. The peptide with C-terminal 13-amino-acids sequence of HVR1 protein 12-22 (NH2-CSFTSLFTPGPSQK) was injected into rabbits as an immunogen. The rabbit immune sera reacted with 9 of 25 HVR1 proteins of genotype 1b including HVR1 protein 12-22 and with 3 of 12 proteins of genotype 2a. These results indicate that the HVR1 protein broadly reactive with patients' sera has a sequence similar to the consensus sequence, can induce broadly reactive sera, and could be one of the candidate immunogens in a prophylactic vaccine against HCV. Copyright 1999 Academic Press.

  4. Constitutive expression of transgenes encoding derivatives of the synthetic antimicrobial peptide BP100: impact on rice host plant fitness

    PubMed Central

    2012-01-01

    Background The Biopeptide BP100 is a synthetic and strongly cationic α-helical undecapeptide with high, specific antibacterial activity against economically important plant-pathogenic bacteria, and very low toxicity. It was selected from a library of synthetic peptides, along with other peptides with activities against relevant bacterial and fungal species. Expression of the BP100 series of peptides in plants is of major interest to establish disease-resistant plants and facilitate molecular farming. Specific challenges were the small length, peptide degradation by plant proteases and toxicity to the host plant. Here we approached the expression of the BP100 peptide series in plants using BP100 as a proof-of-concept. Results Our design considered up to three tandemly arranged BP100 units and peptide accumulation in the endoplasmic reticulum (ER), analyzing five BP100 derivatives. The ER retention sequence did not reduce the antimicrobial activity of chemically synthesized BP100 derivatives, making this strategy possible. Transformation with sequences encoding BP100 derivatives (bp100der) was over ten-fold less efficient than that of the hygromycin phosphotransferase (hptII) transgene. The BP100 direct tandems did not show higher antimicrobial activity than BP100, and genetically modified (GM) plants constitutively expressing them were not viable. In contrast, inverted repeats of BP100, whether or not elongated with a portion of a natural antimicrobial peptide (AMP), had higher antimicrobial activity, and fertile GM rice lines constitutively expressing bp100der were produced. These GM lines had increased resistance to the pathogens Dickeya chrysanthemi and Fusarium verticillioides, and tolerance to oxidative stress, with agronomic performance comparable to untransformed lines. Conclusions Constitutive expression of transgenes encoding short cationic α-helical synthetic peptides can have a strong negative impact on rice fitness. However, GM plants expressing, for example, BP100 based on inverted repeats, have adequate agronomic performance and resistant phenotypes as a result of a complex equilibrium between bp100der toxicity to plant cells, antimicrobial activity and transgene-derived plant stress response. It is likely that these results can be extended to other peptides with similar characteristics. PMID:22947243

  5. Constitutive expression of transgenes encoding derivatives of the synthetic antimicrobial peptide BP100: impact on rice host plant fitness.

    PubMed

    Nadal, Anna; Montero, Maria; Company, Nuri; Badosa, Esther; Messeguer, Joaquima; Montesinos, Laura; Montesinos, Emilio; Pla, Maria

    2012-09-04

    The Biopeptide BP100 is a synthetic and strongly cationic α-helical undecapeptide with high, specific antibacterial activity against economically important plant-pathogenic bacteria, and very low toxicity. It was selected from a library of synthetic peptides, along with other peptides with activities against relevant bacterial and fungal species. Expression of the BP100 series of peptides in plants is of major interest to establish disease-resistant plants and facilitate molecular farming. Specific challenges were the small length, peptide degradation by plant proteases and toxicity to the host plant. Here we approached the expression of the BP100 peptide series in plants using BP100 as a proof-of-concept. Our design considered up to three tandemly arranged BP100 units and peptide accumulation in the endoplasmic reticulum (ER), analyzing five BP100 derivatives. The ER retention sequence did not reduce the antimicrobial activity of chemically synthesized BP100 derivatives, making this strategy possible. Transformation with sequences encoding BP100 derivatives (bp100der) was over ten-fold less efficient than that of the hygromycin phosphotransferase (hptII) transgene. The BP100 direct tandems did not show higher antimicrobial activity than BP100, and genetically modified (GM) plants constitutively expressing them were not viable. In contrast, inverted repeats of BP100, whether or not elongated with a portion of a natural antimicrobial peptide (AMP), had higher antimicrobial activity, and fertile GM rice lines constitutively expressing bp100der were produced. These GM lines had increased resistance to the pathogens Dickeya chrysanthemi and Fusarium verticillioides, and tolerance to oxidative stress, with agronomic performance comparable to untransformed lines. Constitutive expression of transgenes encoding short cationic α-helical synthetic peptides can have a strong negative impact on rice fitness. However, GM plants expressing, for example, BP100 based on inverted repeats, have adequate agronomic performance and resistant phenotypes as a result of a complex equilibrium between bp100der toxicity to plant cells, antimicrobial activity and transgene-derived plant stress response. It is likely that these results can be extended to other peptides with similar characteristics.

  6. Control of silicification by genetically engineered fusion proteins: silk-silica binding peptides.

    PubMed

    Zhou, Shun; Huang, Wenwen; Belton, David J; Simmons, Leo O; Perry, Carole C; Wang, Xiaoqin; Kaplan, David L

    2015-03-01

    In the present study, an artificial spider silk gene, 6mer, derived from the consensus sequence of Nephila clavipes dragline silk gene, was fused with different silica-binding peptides (SiBPs), A1, A3 and R5, to study the impact of the fusion protein sequence chemistry on silica formation and the ability to generate a silk-silica composite in two different bioinspired silicification systems: solution-solution and solution-solid. Condensed silica nanoscale particles (600-800 nm) were formed in the presence of the recombinant silk and chimeras, which were smaller than those formed by 15mer-SiBP chimeras, revealing that the molecular weight of the silk domain correlated to the sizes of the condensed silica particles in the solution system. In addition, the chimeras (6mer-A1/A3/R5) produced smaller condensed silica particles than the control (6mer), revealing that the silica particle size formed in the solution system is controlled by the size of protein assemblies in solution. In the solution-solid interface system, silicification reactions were performed on the surface of films fabricated from the recombinant silk proteins and chimeras and then treated to induce β-sheet formation. A higher density of condensed silica formed on the films containing the lowest β-sheet content while the films with the highest β-sheet content precipitated the lowest density of silica, revealing an inverse correlation between the β-sheet secondary structure and the silica content formed on the films. Intriguingly, the 6mer-A3 showed the highest rate of silica condensation but the lowest density of silica deposition on the films, compared with 6mer-A1 and -R5, revealing antagonistic crosstalk between the silk and the SiBP domains in terms of protein assembly. These findings offer a path forward in the tailoring of biopolymer-silica composites for biomaterial related needs. Copyright © 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  7. Control of silicification by genetically engineered fusion proteins: Silk–silica binding peptides

    PubMed Central

    Zhou, Shun; Huang, Wenwen; Belton, David J.; Simmons, Leo O.; Perry, Carole C.; Wang, Xiaoqin; Kaplan, David L.

    2014-01-01

    In the present study, an artificial spider silk gene, 6mer, derived from the consensus sequence of Nephila clavipes dragline silk gene, was fused with different silica-binding peptides (SiBPs), A1, A3 and R5, to study the impact of the fusion protein sequence chemistry on silica formation and the ability to generate a silk–silica composite in two different bioinspired silicification systems: solution–solution and solution– solid. Condensed silica nanoscale particles (600–800 nm) were formed in the presence of the recombinant silk and chimeras, which were smaller than those formed by 15mer-SiBP chimeras [1], revealing that the molecular weight of the silk domain correlated to the sizes of the condensed silica particles in the solution system. In addition, the chimeras (6mer-A1/A3/R5) produced smaller condensed silica particles than the control (6mer), revealing that the silica particle size formed in the solution system is controlled by the size of protein assemblies in solution. In the solution–solid interface system, silicification reactions were performed on the surface of films fabricated from the recombinant silk proteins and chimeras and then treated to induce β-sheet formation. A higher density of condensed silica formed on the films containing the lowest β-sheet content while the films with the highest β-sheet content precipitated the lowest density of silica, revealing an inverse correlation between the β-sheet secondary structure and the silica content formed on the films. Intriguingly, the 6mer-A3 showed the highest rate of silica condensation but the lowest density of silica deposition on the films, compared with 6mer-A1 and -R5, revealing antagonistic crosstalk between the silk and the SiBP domains in terms of protein assembly. These findings offer a path forward in the tailoring of biopolymer–silica composites for biomaterial related needs. PMID:25462851

  8. An Alternative Model for the Early Peopling of Southern South America Revealed by Analyses of Three Mitochondrial DNA Haplogroups

    PubMed Central

    de Saint Pierre, Michelle; Bravi, Claudio M.; Motti, Josefina M. B.; Fuku, Noriyuki; Tanaka, Masashi; Llop, Elena; Bonatto, Sandro L.; Moraga, Mauricio

    2012-01-01

    After several years of research, there is now a consensus that America was populated from Asia through Beringia, probably at the end of the Pleistocene. But many details such as the timing, route(s), and origin of the first settlers remain uncertain. In the last decade genetic evidence has taken on a major role in elucidating the peopling of the Americas. To study the early peopling of South America, we sequenced the control region of mitochondrial DNA from 300 individuals belonging to indigenous populations of Chile and Argentina, and also obtained seven complete mitochondrial DNA sequences. We identified two novel mtDNA monophyletic clades, preliminarily designated B2l and C1b13, which together with the recently described D1g sub-haplogroup have locally high frequencies and are basically restricted to populations from the extreme south of South America. The estimated ages of D1g and B2l, about ∼15,000 years BP, together with their similar population dynamics and the high haplotype diversity shown by the networks, suggests that they probably appeared soon after the arrival of the first settlers and agrees with the dating of the earliest archaeological sites in South America (Monte Verde, Chile, 14,500 BP). One further sub-haplogroup, D4h3a5, appears to be restricted to Fuegian-Patagonian populations and reinforces our hypothesis of the continuity of the current Patagonian populations with the initial founders. Our results indicate that the extant native populations inhabiting South Chile and Argentina are a group which had a common origin, and suggest a population break between the extreme south of South America and the more northern part of the continent. Thus the early colonization process was not just an expansion from north to south, but also included movements across the Andes. PMID:22970129

  9. An alternative model for the early peopling of southern South America revealed by analyses of three mitochondrial DNA haplogroups.

    PubMed

    de Saint Pierre, Michelle; Bravi, Claudio M; Motti, Josefina M B; Fuku, Noriyuki; Tanaka, Masashi; Llop, Elena; Bonatto, Sandro L; Moraga, Mauricio

    2012-01-01

    After several years of research, there is now a consensus that America was populated from Asia through Beringia, probably at the end of the Pleistocene. But many details such as the timing, route(s), and origin of the first settlers remain uncertain. In the last decade genetic evidence has taken on a major role in elucidating the peopling of the Americas. To study the early peopling of South America, we sequenced the control region of mitochondrial DNA from 300 individuals belonging to indigenous populations of Chile and Argentina, and also obtained seven complete mitochondrial DNA sequences. We identified two novel mtDNA monophyletic clades, preliminarily designated B2l and C1b13, which together with the recently described D1g sub-haplogroup have locally high frequencies and are basically restricted to populations from the extreme south of South America. The estimated ages of D1g and B2l, about ~15,000 years BP, together with their similar population dynamics and the high haplotype diversity shown by the networks, suggests that they probably appeared soon after the arrival of the first settlers and agrees with the dating of the earliest archaeological sites in South America (Monte Verde, Chile, 14,500 BP). One further sub-haplogroup, D4h3a5, appears to be restricted to Fuegian-Patagonian populations and reinforces our hypothesis of the continuity of the current Patagonian populations with the initial founders. Our results indicate that the extant native populations inhabiting South Chile and Argentina are a group which had a common origin, and suggest a population break between the extreme south of South America and the more northern part of the continent. Thus the early colonization process was not just an expansion from north to south, but also included movements across the Andes.

  10. Characterization of two genes encoding leucine-rich repeat-containing proteins in grass carp Ctenopharyngodon idellus.

    PubMed

    Chang, M X; Nie, P; Xie, H X; Sun, B J; Gao, Q

    2005-01-01

    The cDNAs and genes of two different types of leucine-rich repeat-containing proteins from grass carp (Ctenopharyngodon idellus) were cloned. Homology search revealed that the two genes, designated as GC-GARP and GC-LRG, have 37% and 32% deduced amino-acid sequence similarities with human glycoprotein A repetitions predominant precursor (GARP) and leucine-rich alpha2-glycoprotein (LRG), respectively. The cDNAs of GC-GARP and GC-LRG encoded 664 and 339 amino acid residues, respectively. GC-GARP and GC-LRG contain many distinct structural and/or functional motifs of the leucine-rich repeat (LRR) subfamily, such as multiple conserved 11-residue segments with the consensus sequence LxxLxLxxN/CxL (x can be any amino acid). The genes GC-GARP and GC-LRG consist of two exons, with 4,782 bp and 2,119 bp in total length, respectively. The first exon of each gene contains a small 5'-untranslated region and partial open reading frame. The putative promoter region of GC-GARP was found to contain transcription factor binding sites for GATA-1, IRF4, Oct-1, IRF-7, IRF-1, AP1, GATA-box and NFAT, and the promoter region of GC-LRG for MYC-MAX, MEIS1, ISRE, IK3, HOXA9 and C/EBP alpha. Phylogenetic analysis showed that GC-GARP and mammalian GARPs were clustered into one branch, while GC-LRG and mammalian LRGs were in another branch. The GC-GARP gene was only detected in head kidney, and GC-LRG in the liver, spleen and heart in the copepod (Sinergasilus major)-infected grass carp, indicating the induction of gene expression by the parasite infection. The results obtained in the present study provide insight into the structure of fish LRR genes, and further study should be carried out to understand the importance of LRR proteins in host-pathogen interactions.

  11. Complex structure of knob DNA on maize chromosome 9. Retrotransposon invasion into heterochromatin.

    PubMed Central

    Ananiev, E V; Phillips, R L; Rines, H W

    1998-01-01

    The recovery of maize (Zea mays L.) chromosome addition lines of oat (Avena sativa L.) from oat x maize crosses enables us to analyze the structure and composition of specific regions, such as knobs, of individual maize chromosomes. A DNA hybridization blot panel of eight individual maize chromosome addition lines revealed that 180-bp repeats found in knobs are present in each of these maize chromosomes, but the copy number varies from approximately 100 to 25, 000. Cosmid clones with knob DNA segments were isolated from a genomic library of an oat-maize chromosome 9 addition line with the help of the 180-bp knob-associated repeated DNA sequence used as a probe. Cloned knob DNA segments revealed a complex organization in which blocks of tandemly arranged 180-bp repeating units are interrupted by insertions of other repeated DNA sequences, mostly represented by individual full size copies of retrotransposable elements. There is an obvious preference for the integration of retrotransposable elements into certain sites (hot spots) of the 180-bp repeat. Sequence microheterogeneity including point mutations and duplications was found in copies of 180-bp repeats. The 180-bp repeats within an array all had the same polarity. Restriction maps constructed for 23 cloned knob DNA fragments revealed the positions of polymorphic sites and sites of integration of insertion elements. Discovery of the interspersion of retrotransposable elements among blocks of tandem repeats in maize and some other organisms suggests that this pattern may be basic to heterochromatin organization for eukaryotes. PMID:9691055

  12. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    NASA Astrophysics Data System (ADS)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  13. Negatively supercoiled simian virus 40 DNA contains Z-DNA segments within transcriptional enhancer sequences

    NASA Technical Reports Server (NTRS)

    Nordheim, A.; Rich, A.

    1983-01-01

    Three 8-base pair (bp) segments of alternating purine-pyrimidine from the simian virus 40 enhancer region form Z-DNA on negative supercoiling; minichromosome DNase I-hypersensitive sites determined by others bracket these three segments. A survey of transcriptional enhancer sequences reveals a pattern of potential Z-DNA-forming regions which occur in pairs 50-80 bp apart. This may influence local chromatin structure and may be related to transcriptional activation.

  14. Draft genome sequence of Lactobacillus mali KCTC 3596.

    PubMed

    Kim, Dong-Wook; Choi, Sang-Haeng; Kang, Aram; Nam, Seong-Hyeuk; Kim, Dae-Soo; Kim, Ryong Nam; Kim, Aeri; Park, Hong-Seog

    2011-09-01

    We announce the draft genome sequence of the type strain Lactobacillus mali KCTC 3596 (2,652,969 bp, with a G+C content of 36.0%), which is one of the most prevalent lactic acid bacteria present during the manufacturing process of apple juice. The genome consists of 122 large contigs (>100 bp). All of the contigs were assembled by Newbler Assembler 2.3 (454 Life Science). Copyright © 2011, American Society for Microbiology. All Rights Reserved.

  15. Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion.

    PubMed

    Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An

    2017-09-11

    The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.

  16. Sequencing Bands of Ribosomal Intergenic Spacer Analysis Fingerprints for Characterization and Microscale Distribution of Soil Bacterium Populations Responding to Mercury Spiking

    PubMed Central

    Ranjard, Lionel; Brothier, Elisabeth; Nazaret, Sylvie

    2000-01-01

    Two major emerging bands (a 350-bp band and a 650-bp band) within the RISA (ribosomal intergenic spacer analysis) profile of a soil bacterial community spiked with Hg(II) were selected for further identification of the populations involved in the response of the community to the added metal. The bands were cut out from polyacrylamide gels, cloned, characterized by restriction analysis, and sequenced for phylogenetic affiliation of dominant clones. The sequences were the intergenic spacer between the rrs and rrl genes and the first 130 nucleotides of the rrl gene. Comparison of sequences derived from the 350-bp band to The GenBank database permitted us to identify the bacteria as being mostly close relatives to low G+C firmicutes (Clostridium-like genera), while the 650-bp band permitted us to identify the bacteria as being mostly close relatives to β-proteobacteria (Ralstonia-like genera). Oligonucleotide probes specific for the identified dominant bacteria were designed and hybridized with the RISA profiles derived from the control and spiked communities. These studies confirmed the contribution of these populations to the community response to the metal. Hybridization of the RISA profiles from subcommunities (bacterial pools associated with different soil microenvironments) also permitted to characterize the distribution and the dynamics of these populations at a microscale level following mercury spiking. PMID:11097911

  17. The first complete chloroplast genome sequence of a lycophyte,Huperzia lucidula (Lycopodiaceae)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wolf, Paul G.; Karol, Kenneth G.; Mandoli, Dina F.

    2005-02-01

    We used a unique combination of techniques to sequence the first complete chloroplast genome of a lycophyte, Huperzia lucidula. This plant belongs to a significant clade hypothesized to represent the sister group to all other vascular plants. We used fluorescence-activated cell sorting (FACS) to isolate the organelles, rolling circle amplification (RCA) to amplify the genome, and shotgun sequencing to 8x depth coverage to obtain the complete chloroplast genome sequence. The genome is 154,373bp, containing inverted repeats of 15,314 bp each, a large single-copy region of 104,088 bp, and a small single-copy region of 19,671 bp. Gene order is more similarmore » to those of mosses, liverworts, and hornworts than to gene order for other vascular plants. For example, the Huperziachloroplast genome possesses the bryophyte gene order for a previously characterized 30 kb inversion, thus supporting the hypothesis that lycophytes are sister to all other extant vascular plants. The lycophytechloroplast genome data also enable a better reconstruction of the basaltracheophyte genome, which is useful for inferring relationships among bryophyte lineages. Several unique characters are observed in Huperzia, such as movement of the gene ndhF from the small single copy region into the inverted repeat. We present several analyses of evolutionary relationships among land plants by using nucleotide data, amino acid sequences, and by comparing gene arrangements from chloroplast genomes. The results, while still tentative pending the large number of chloroplast genomes from other key lineages that are soon to be sequenced, are intriguing in themselves, and contribute to a growing comparative database of genomic and morphological data across the green plants.« less

  18. Cloning of human prourokinase cDNA without the signal peptide and expression in Escherichia coli.

    PubMed

    Hu, B; Li, J; Yu, W; Fang, J

    1993-01-01

    Human prourokinase (pro-UK) cDNA without the signal peptide was obtained using synthetic oligonucleotide and DNA recombination techniques and was successfully expressed in E. coli. The plasmid pMMUK which contained pro-UK cDNA (including both the entire coding sequence and the sequence for signal peptide) was digested with Hind III and PstI, so that the N-terminal 371-bp fragment could be recovered. A 304-bp fragment was collected from the 371-bp fragment after partial digestion with Fnu4HI in order to remove the signal peptide sequence. An intermediate plasmid was formed after this 304-bp fragment and the synthetic oligonucleotide was ligated with pUC18. Correctness of the ligation was confirmed by enzyme digestion and sequencing. By joining the PstI-PstI fragment of pro-UK to the plasmid we obtained the final plasmid which contained the entire coding sequence of pro-UK without the signal peptide. The coding sequence with correct orientation was inserted into pBV220 under the control of the temperature-induced promoter PRPL, and mature pro-UK was expressed in E. coli at 42 degrees C. Both sonicated supernatant and inclusion bodies of the bacterial host JM101 showed positive results by ELISA and FAPA assays. After renaturation, the biological activity of the expressed product was increased from 500-1000IU/L to about 60,000IU/L. The bacterial pro-UK showed a molecular weight of about 47,000 daltons by Western blot analysis. It can be completely inhibited by UK antiserum but not by t-PA antiserum nor by normal rabbit serum.

  19. Genetic diversity among Babesia rossi detected in naturally infected dogs in Abeokuta, Nigeria, based on 18S rRNA gene sequences.

    PubMed

    Takeet, Michael I; Oyewusi, Adeoye J; Abakpa, Simon A V; Daramola, Olukayode O; Peters, Sunday O

    2017-03-01

    Adequate knowledge of the genetic diversity among Babesia species infecting dogs is necessary for a better understanding of the epidemiology and control of canine babesiosis. Hence, this study determined the genetic diversity among the Babesia rossi detected in dogs presented for routine examination in Veterinary Hospitals in Abeokuta, Nigeria. Blood were randomly collected from 209 dogs. Field-stained thin smears were made and DNA extracted from the blood. Partial region of the 18S small subunit ribosomal RNA (rRNA) gene was amplified, sequenced and analysed. Babesia species was detected in 16 (7.7%) of the dogs by microscopy. Electrophoresed PCR products from 39 (18.66%) dogs revealed band size of 450 bp and 2 (0.95%) dogs had band size of 430 bp. The sequences obtained from 450 bp amplicon displayed homology of 99.74% (387/388) with partial sequences of 18S rRNA gene of Babesia rossi in the GeneBank. Of the two sequences that had 430 bp amplicon, one was identified as T. annulata and second as T. ovis. A significantly (p<0.05) higher prevalence of B. rossi was detected by PCR compared to microscopy. The mean PCV of Babesia infected dogs was significantly (p<0.05) lower than non-infected dogs. Phylogenetic analysis revealed minimal diversity among B. rossi with the exception of one sequence that was greatly divergent from the others. This study suggests that more than one genotype of B. rossi may be in circulation among the dog population in the study area and this may have potential implication on clinical outcome of canine babesiosis.

  20. Structural features of diverse Pin-II proteinase inhibitor genes from Capsicum annuum.

    PubMed

    Mahajan, Neha S; Dewangan, Veena; Lomate, Purushottam R; Joshi, Rakesh S; Mishra, Manasi; Gupta, Vidya S; Giri, Ashok P

    2015-02-01

    The proteinase inhibitor (PI) genes from Capsicum annuum were characterized with respect to their UTR, introns and promoter elements. The occurrence of PIs with circularly permuted domain organization was evident. Several potato inhibitor II (Pin-II) type proteinase inhibitor (PI) genes have been analyzed from Capsicum annuum (L.) with respect to their differential expression during plant defense response. However, complete gene characterization of any of these C. annuum PIs (CanPIs) has not been carried out so far. Complete gene architectures of a previously identified CanPI-7 (Beads-on-string, Type A) and a member of newly isolated Bracelet type B, CanPI-69 are reported in this study. The 5' UTR (untranslated region), 3'UTR, and intronic sequences of both the CanPI genes were obtained. The genomic sequence of CanPI-7 exhibited, exon 1 (49 base pair, bp) and exon 2 (740 bp) interrupted by a 294-bp long type I intron. We noted the occurrence of three multi-domain PIs (CanPI-69, 70, 71) with circularly permuted domain organization. CanPI-69 was found to possess exon 1 (49 bp), exon 2 (551 bp) and a 584-bp long type I intron. The upstream sequence analysis of CanPI-7 and CanPI-69 predicted various transcription factor-binding sites including TATA and CAAT boxes, hormone-responsive elements (ABRELATERD1, DOFCOREZM, ERELEE4), and a defense-responsive element (WRKY71OS). Binding of transcription factors such as zinc finger motif MADS-box and MYB to the promoter regions was confirmed using electrophoretic mobility shift assay followed by mass spectrometric identification. The 3' UTR analysis for 25 CanPI genes revealed unique/distinct 3' UTR sequence for each gene. Structures of three domain CanPIs of type A and B were predicted and further analyzed for their attributes. This investigation of CanPI gene architecture will enable the better understanding of the genetic elements present in CanPIs.

  1. Analysis of Complete Nucleotide Sequences of 12 Gossypium Chloroplast Genomes: Origin and Evolution of Allotetraploids

    PubMed Central

    Xu, Qin; Xiong, Guanjun; Li, Pengbo; He, Fei; Huang, Yi; Wang, Kunbo; Li, Zhaohu; Hua, Jinping

    2012-01-01

    Background Cotton (Gossypium spp.) is a model system for the analysis of polyploidization. Although ascertaining the donor species of allotetraploid cotton has been intensively studied, sequence comparison of Gossypium chloroplast genomes is still of interest to understand the mechanisms underlining the evolution of Gossypium allotetraploids, while it is generally accepted that the parents were A- and D-genome containing species. Here we performed a comparative analysis of 13 Gossypium chloroplast genomes, twelve of which are presented here for the first time. Methodology/Principal Findings The size of 12 chloroplast genomes under study varied from 159,959 bp to 160,433 bp. The chromosomes were highly similar having >98% sequence identity. They encoded the same set of 112 unique genes which occurred in a uniform order with only slightly different boundary junctions. Divergence due to indels as well as substitutions was examined separately for genome, coding and noncoding sequences. The genome divergence was estimated as 0.374% to 0.583% between allotetraploid species and A-genome, and 0.159% to 0.454% within allotetraploids. Forty protein-coding genes were completely identical at the protein level, and 20 intergenic sequences were completely conserved. The 9 allotetraploids shared 5 insertions and 9 deletions in whole genome, and 7-bp substitutions in protein-coding genes. The phylogenetic tree confirmed a close relationship between allotetraploids and the ancestor of A-genome, and the allotetraploids were divided into four separate groups. Progenitor allotetraploid cotton originated 0.43–0.68 million years ago (MYA). Conclusion Despite high degree of conservation between the Gossypium chloroplast genomes, sequence variations among species could still be detected. Gossypium chloroplast genomes preferred for 5-bp indels and 1–3-bp indels are mainly attributed to the SSR polymorphisms. This study supports that the common ancestor of diploid A-genome species in Gossypium is the maternal source of extant allotetraploid species and allotetraploids have a monophyletic origin. G. hirsutum AD1 lineages have experienced more sequence variations than other allotetraploids in intergenic regions. The available complete nucleotide sequences of 12 Gossypium chloroplast genomes should facilitate studies to uncover the molecular mechanisms of compartmental co-evolution and speciation of Gossypium allotetraploids. PMID:22876273

  2. Genome Sequence of the Bacterium Streptomyces davawensis JCM 4913 and Heterologous Production of the Unique Antibiotic Roseoflavin

    PubMed Central

    Jankowitsch, Frank; Schwarz, Julia; Rückert, Christian; Gust, Bertolt; Szczepanowski, Rafael; Blom, Jochen; Pelzer, Stefan; Kalinowski, Jörn

    2012-01-01

    Streptomyces davawensis JCM 4913 synthesizes the antibiotic roseoflavin, a structural riboflavin (vitamin B2) analog. Here, we report the 9,466,619-bp linear chromosome of S. davawensis JCM 4913 and a 89,331-bp linear plasmid. The sequence has an average G+C content of 70.58% and contains six rRNA operons (16S-23S-5S) and 69 tRNA genes. The 8,616 predicted protein-coding sequences include 32 clusters coding for secondary metabolites, several of which are unique to S. davawensis. The chromosome contains long terminal inverted repeats of 33,255 bp each and atypical telomeres. Sequence analysis with regard to riboflavin biosynthesis revealed three different patterns of gene organization in Streptomyces species. Heterologous expression of a set of genes present on a subgenomic fragment of S. davawensis resulted in the production of roseoflavin by the host Streptomyces coelicolor M1152. Phylogenetic analysis revealed that S. davawensis is a close relative of Streptomyces cinnabarinus, and much to our surprise, we found that the latter bacterium is a roseoflavin producer as well. PMID:23043000

  3. The neurologist’s dilemma: A comprehensive clinical review of Bell’s palsy, with emphasis on current management trends

    PubMed Central

    Zandian, Anthony; Osiro, Stephen; Hudson, Ryan; Ali, Irfan M.; Matusz, Petru; Tubbs, Shane R.; Loukas, Marios

    2014-01-01

    Background Recent advances in Bell’s palsy (BP) were reviewed to assess the current trends in its management and prognosis. Material/Methods We retrieved the literature on BP using the Cochrane Database of Systematic Reviews, PubMed, and Google Scholar. Key words and phrases used during the search included ‘Bell’s palsy’, ‘Bell’s phenomenon’, ‘facial palsy’, and ‘idiopathic facial paralysis’. Emphasis was placed on articles and randomized controlled trails (RCTs) published within the last 5 years. Results BP is currently considered the leading disorder affecting the facial nerve. The literature is replete with theories of its etiology, but the reactivation of herpes simplex virus isoform 1 (HSV-1) and/or herpes zoster virus (HZV) from the geniculate ganglia is now the most strongly suspected cause. Despite the advancements in neuroimaging techniques, the diagnosis of BP remains one of exclusion. In addition, most patients with BP recover spontaneously within 3 weeks. Conclusions Corticosteroids are currently the drug of choice when medical therapy is needed. Antivirals, in contrast, are not superior to placebo according to most reliable studies. At the time of publication, there is no consensus as to the benefit of acupuncture or surgical decompression of the facial nerve. Long-term therapeutic agents and adjuvant medications for BP are necessary due to recurrence and intractable cases. In the future, large RCTs will be required to determine whether BP is associated with an increased risk of stroke. PMID:24441932

  4. The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

    PubMed

    Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

    1999-09-24

    To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

  5. Fine-tuning structural RNA alignments in the twilight zone

    PubMed Central

    2010-01-01

    Background A widely used method to find conserved secondary structure in RNA is to first construct a multiple sequence alignment, and then fold the alignment, optimizing a score based on thermodynamics and covariance. This method works best around 75% sequence similarity. However, in a "twilight zone" below 55% similarity, the sequence alignment tends to obscure the covariance signal used in the second phase. Therefore, while the overall shape of the consensus structure may still be found, the degree of conservation cannot be estimated reliably. Results Based on a combination of available methods, we present a method named planACstar for improving structure conservation in structural alignments in the twilight zone. After constructing a consensus structure by alignment folding, planACstar abandons the original sequence alignment, refolds the sequences individually, but consistent with the consensus, aligns the structures, irrespective of sequence, by a pure structure alignment method, and derives an improved sequence alignment from the alignment of structures, to be re-submitted to alignment folding, etc.. This circle may be iterated as long as structural conservation improves, but normally, one step suffices. Conclusions Employing the tools ClustalW, RNAalifold, and RNAforester, we find that for sequences with 30-55% sequence identity, structural conservation can be improved by 10% on average, with a large variation, measured in terms of RNAalifold's own criterion, the structure conservation index. PMID:20433706

  6. [Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

    PubMed

    Chen, Suiqing; Lu, Xiaolei; Wang, Lili

    2011-05-01

    To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

  7. DYZ1 arrays show sequence variation between the monozygotic males

    PubMed Central

    2014-01-01

    Background Monozygotic twins (MZT) are an important resource for genetical studies in the context of normal and diseased genomes. In the present study we used DYZ1, a satellite fraction present in the form of tandem arrays on the long arm of the human Y chromosome, as a tool to uncover sequence variations between the monozygotic males. Results We detected copy number variation, frequent insertions and deletions within the sequences of DYZ1 arrays amongst all the three sets of twins used in the present study. MZT1b showed loss of 35 bp compared to that in 1a, whereas 2a showed loss of 31 bp compared to that in 2b. Similarly, 3b showed 10 bp insertion compared to that in 3a. MZT1a germline DNA showed loss of 5 bp and 1b blood DNA showed loss of 26 bp compared to that of 1a blood and 1b germline DNA, respectively. Of the 69 restriction sites detected in DYZ1 arrays, MboII, BsrI, TspEI and TaqI enzymes showed frequent loss and or gain amongst all the 3 pairs studied. MZT1 pair showed loss/gain of VspI, BsrDI, AgsI, PleI, TspDTI, TspEI, TfiI and TaqI restriction sites in both blood and germline DNA. All the three sets of MZT showed differences in the number of DYZ1 copies. FISH signals reflected somatic mosaicism of the DYZ1 copies across the cells. Conclusions DYZ1 showed both sequence and copy number variation between the MZT males. Sequence variation was also noticed between germline and blood DNA samples of the same individual as we observed at least in one set of sample. The result suggests that DYZ1 faithfully records all the genetical changes occurring after the twining which may be ascribed to the environmental factors. PMID:24495361

  8. A DNA sequence element that advances replication origin activation time in Saccharomyces cerevisiae.

    PubMed

    Pohl, Thomas J; Kolor, Katherine; Fangman, Walton L; Brewer, Bonita J; Raghuraman, M K

    2013-11-06

    Eukaryotic origins of DNA replication undergo activation at various times in S-phase, allowing the genome to be duplicated in a temporally staggered fashion. In the budding yeast Saccharomyces cerevisiae, the activation times of individual origins are not intrinsic to those origins but are instead governed by surrounding sequences. Currently, there are two examples of DNA sequences that are known to advance origin activation time, centromeres and forkhead transcription factor binding sites. By combining deletion and linker scanning mutational analysis with two-dimensional gel electrophoresis to measure fork direction in the context of a two-origin plasmid, we have identified and characterized a 19- to 23-bp and a larger 584-bp DNA sequence that are capable of advancing origin activation time.

  9. Identification by Subtractive Hybridization of a Novel Insertion Sequence Specific for Virulent Strains of Porphyromonas gingivalis

    PubMed Central

    Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji

    1999-01-01

    Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208

  10. Unique properties of multiple tandem copies of the M26 recombination hotspot in mitosis and meiosis in Schizosaccharomyces pombe.

    PubMed

    Steiner, Walter W; Recor, Chelsea L; Zakrzewski, Bethany M

    2016-11-15

    The M26 hotspot of the fission yeast Schizosaccharomyces pombe is one of the best-characterized eukaryotic hotspots of recombination. The hotspot requires a seven bp sequence, ATGACGT, that serves as a binding site for the Atf1-Pcr1 transcription factor, which is also required for activity. The M26 hotspot is active in meiosis but not mitosis and is active in some but not all chromosomal contexts and not on a plasmid. A longer palindromic version of M26, ATGACGTCAT, shows significantly greater activity than the seven bp sequence. Here, we tested whether the properties of the seven bp sequence were also true of the longer sequence by placing one, two, or three copies of the sequence into the ade6 gene, where M26 was originally discovered. These constructs were tested for activity when located on a plasmid or on a chromosome in mitosis and meiosis. We found that two copies of the 10bp M26 motif on a chromosome were significantly more active for meiotic recombination than one, but no further increase was observed with three copies. However, three copies of M26 on a chromosome created an Atf1-dependent mitotic recombination hotspot. When located on a plasmid, M26 also appears to behave as a mitotic recombination hotspot; however, this behavior most likely results from Atf1-dependent inter-allelic complementation between the plasmid and chromosomal ade6 alleles. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Complete chloroplast genome sequence of a major invasive species, crofton weed (Ageratina adenophora).

    PubMed

    Nie, Xiaojun; Lv, Shuzuo; Zhang, Yingxin; Du, Xianghong; Wang, Le; Biradar, Siddanagouda S; Tan, Xiufang; Wan, Fanghao; Weining, Song

    2012-01-01

    Crofton weed (Ageratina adenophora) is one of the most hazardous invasive plant species, which causes serious economic losses and environmental damages worldwide. However, the sequence resource and genome information of A. adenophora are rather limited, making phylogenetic identification and evolutionary studies very difficult. Here, we report the complete sequence of the A. adenophora chloroplast (cp) genome based on Illumina sequencing. The A. adenophora cp genome is 150, 689 bp in length including a small single-copy (SSC) region of 18, 358 bp and a large single-copy (LSC) region of 84, 815 bp separated by a pair of inverted repeats (IRs) of 23, 755 bp. The genome contains 130 unique genes and 18 duplicated in the IR regions, with the gene content and organization similar to other Asteraceae cp genomes. Comparative analysis identified five DNA regions (ndhD-ccsA, psbI-trnS, ndhF-ycf1, ndhI-ndhG and atpA-trnR) containing parsimony-informative characters higher than 2%, which may be potential informative markers for barcoding and phylogenetic analysis. Repeat structure, codon usage and contraction of the IR were also investigated to reveal the pattern of evolution. Phylogenetic analysis demonstrated a sister relationship between A. adenophora and Guizotia abyssinica and supported a monophyly of the Asterales. We have assembled and analyzed the chloroplast genome of A. adenophora in this study, which was the first sequenced plastome in the Eupatorieae tribe. The complete chloroplast genome information is useful for plant phylogenetic and evolutionary studies within this invasive species and also within the Asteraceae family.

  12. The First Complete Chloroplast Genome Sequences in Actinidiaceae: Genome Structure and Comparative Analysis.

    PubMed

    Yao, Xiaohong; Tang, Ping; Li, Zuozhou; Li, Dawei; Liu, Yifei; Huang, Hongwen

    2015-01-01

    Actinidia chinensis is an important economic plant belonging to the basal lineage of the asterids. Availability of a complete Actinidia chloroplast genome sequence is crucial to understanding phylogenetic relationships among major lineages of angiosperms and facilitates kiwifruit genetic improvement. We report here the complete nucleotide sequences of the chloroplast genomes for Actinidia chinensis and A. chinensis var deliciosa obtained through de novo assembly of Illumina paired-end reads produced by total DNA sequencing. The total genome size ranges from 155,446 to 157,557 bp, with an inverted repeat (IR) of 24,013 to 24,391 bp, a large single copy region (LSC) of 87,984 to 88,337 bp and a small single copy region (SSC) of 20,332 to 20,336 bp. The genome encodes 113 different genes, including 79 unique protein-coding genes, 30 tRNA genes and 4 ribosomal RNA genes, with 16 duplicated in the inverted repeats, and a tRNA gene (trnfM-CAU) duplicated once in the LSC region. Comparisons of IR boundaries among four asterid species showed that IR/LSC borders were extended into the 5' portion of the psbA gene and IR contraction occurred in Actinidia. The clap gene has been lost from the chloroplast genome in Actinidia, and may have been transferred to the nucleus during chloroplast evolution. Twenty-seven polymorphic simple sequence repeat (SSR) loci were identified in the Actinidia chloroplast genome. Maximum parsimony analyses of a 72-gene, 16 taxa angiosperm dataset strongly support the placement of Actinidiaceae in Ericales within the basal asterids.

  13. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    PubMed

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  14. Complete genome sequence of Lactobacillus salivarius Ren, a probiotic strain with anti-tumor activity.

    PubMed

    Sun, Erna; Ren, Fazheng; Liu, Songling; Ge, Shaoyang; Zhang, Ming; Guo, Huiyuan; Jiang, Lu; Zhang, Hao; Zhao, Liang

    2015-09-20

    Lactobacillus salivarius Ren (LsR) (CGMCC No. 3606) is a probiotic strain that was isolated from the feces of a healthy centenarian living in Bama, Guangxi, China. Previous studies have shown that this strain decreases 4-nitroquinoline 1-oxide (4-NQO)-induced genotoxicity in vitro. It also suppresses 4-NQO-induced oral carcinogenesis and 1,2-dimethylhydrazine (DMH)-induced colorectal carcinogenesis, and therefore may be used as an adjuvant therapeutic agent for cancer. Here, we report the complete genome sequence of LsR that consists of a circular chromosome of 1751,565 bp and two plasmids (pR1, 176,951 bp; pR2, 49,848 bp). Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Coexistence of Two blaNDM-5 Genes on an IncF Plasmid as Revealed by Nanopore Sequencing.

    PubMed

    Feng, Yu; Liu, Lu; McNally, Alan; Zong, Zhiyong

    2018-05-01

    In a carbapenem-resistant Escherichia coli clinical isolate of sequence type 167, two copies of bla NDM-5 were found on a 144,225-bp IncF self-transmissible plasmid of the F36:A4:B - type. Both bla NDM-5 genes were located in 11,065-bp regions flanked by two copies of IS 26 The two regions were identical in sequence but were present at different locations on the plasmid, suggesting a duplication of the same region. This study highlights the complex genetic contexts of bla NDM-5 . Copyright © 2018 American Society for Microbiology.

  16. Adenovirus sequences required for replication in vivo.

    PubMed Central

    Wang, K; Pearson, G D

    1985-01-01

    We have studied the in vivo replication properties of plasmids carrying deletion mutations within cloned adenovirus terminal sequences. Deletion mapping located the adenovirus DNA replication origin entirely within the first 67 bp of the adenovirus inverted terminal repeat. This region could be further subdivided into two functional domains: a minimal replication origin and an adjacent auxillary region which boosted the efficiency of replication by more than 100-fold. The minimal origin occupies the first 18 to 21 bp and includes sequences conserved between all adenovirus serotypes. The adjacent auxillary region extends past nucleotide 36 but not past nucleotide 67 and contains the binding site for nuclear factor I. Images PMID:2991857

  17. Draft Genome Sequence of Enterococcus casseliflavus PAVET15 Obtained from the Oviduct Infection of the Cattle Tick (Rhipicephalus microplus) in Jiutepec, Morelos, Mexico

    PubMed Central

    Cossío-Bayúgar, R.; Miranda-Miranda, E.; Arreguín-Pérez, C. A.; Lozano, L.; Peréz de la Rosa, D.; Rocha-Martínez, M. K.; Bravo-Díaz, M. A.

    2017-01-01

    ABSTRACT Enterococcus spp. are Gram-positive lactic acid-producing bacteria found in the intestinal tracts of animals, like mammals, birds, and arthropods. Enterococcus spp. may cause oportunistic infections in vertebrate and invertebrate hosts. We report here the draft genome sequence of Enterococcus casseliflavus PAVET15 containing 3,722,480 bp, with 80 contigs, an N50 of 179,476 bp, and 41.93% G+C content. PMID:28428300

  18. Introgression of the SbASR-1 Gene Cloned from a Halophyte Salicornia brachiata Enhances Salinity and Drought Endurance in Transgenic Groundnut (Arachis hypogaea) and Acts as a Transcription Factor

    PubMed Central

    Tiwari, Vivekanand; Chaturvedi, Amit Kumar; Mishra, Avinash; Jha, Bhavanath

    2015-01-01

    The SbASR-1 gene, cloned from a halophyte Salicornia brachiata, encodes a plant-specific hydrophilic and stress responsive protein. The genome of S. brachiata has two paralogs of the SbASR-1 gene (2549 bp), which is comprised of a single intron of 1611 bp, the largest intron of the  abscisic acid stress ripening [ASR] gene family yet reported. In silico analysis of the 843-bp putative promoter revealed the presence of ABA, biotic stress, dehydration, phytohormone, salinity, and sugar responsive cis-regulatory motifs. The SbASR-1 protein belongs to Group 7 LEA protein family with different amino acid composition compared to their glycophytic homologs. Bipartite Nuclear Localization Signal (NLS) was found on the C-terminal end of protein and localization study confirmed that SbASR-1 is a nuclear protein. Furthermore, transgenic groundnut (Arachis hypogaea) plants over-expressing the SbASR-1 gene constitutively showed enhanced salinity and drought stress tolerance in the T1 generation. Leaves of transgenic lines exhibited higher chlorophyll and relative water contents and lower electrolyte leakage, malondialdehyde content, proline, sugars, and starch accumulation under stress treatments than wild-type (Wt) plants. Also, lower accumulation of H2O2 and O2 .- radicals was detected in transgenic lines compared to Wt plants under stress conditions. Transcript expression of APX (ascorbate peroxidase) and CAT (catalase) genes were higher in Wt plants, whereas the SOD (superoxide dismutase) transcripts were higher in transgenic lines under stress. Electrophoretic mobility shift assay (EMSA) confirmed that the SbASR-1 protein binds at the consensus sequence (C/G/A)(G/T)CC(C/G)(C/G/A)(A/T). Based on results of the present study, it may be concluded that SbASR-1 enhances the salinity and drought stress tolerance in transgenic groundnut by functioning as a LEA (late embryogenesis abundant) protein and a transcription factor. PMID:26158616

  19. Molecular cloning and characterization of satellite DNA sequences from constitutive heterochromatin of the habu snake (Protobothrops flavoviridis, Viperidae) and the Burmese python (Python bivittatus, Pythonidae).

    PubMed

    Matsubara, Kazumi; Uno, Yoshinobu; Srikulnath, Kornsorn; Seki, Risako; Nishida, Chizuko; Matsuda, Yoichi

    2015-12-01

    Highly repetitive DNA sequences of the centromeric heterochromatin provide valuable molecular cytogenetic markers for the investigation of genomic compartmentalization in the macrochromosomes and microchromosomes of sauropsids. Here, the relationship between centromeric heterochromatin and karyotype evolution was examined using cloned repetitive DNA sequences from two snake species, the habu snake (Protobothrops flavoviridis, Crotalinae, Viperidae) and Burmese python (Python bivittatus, Pythonidae). Three satellite DNA (stDNA) families were isolated from the heterochromatin of these snakes: 168-bp PFL-MspI from P. flavoviridis and 196-bp PBI-DdeI and 174-bp PBI-MspI from P. bivittatus. The PFL-MspI and PBI-DdeI sequences were localized to the centromeric regions of most chromosomes in the respective species, suggesting that the two sequences were the major components of the centromeric heterochromatin in these organisms. The PBI-MspI sequence was localized to the pericentromeric region of four chromosome pairs. The PFL-MspI and the PBI-DdeI sequences were conserved only in the genome of closely related species, Gloydius blomhoffii (Crotalinae) and Python molurus, respectively, although their locations on the chromosomes were slightly different. In contrast, the PBI-MspI sequence was also in the genomes of P. molurus and Boa constrictor (Boidae), and additionally localized to the centromeric regions of eight chromosome pairs in B. constrictor, suggesting that this sequence originated in the genome of a common ancestor of Pythonidae and Boidae, approximately 86 million years ago. The three stDNA sequences showed no genomic compartmentalization between the macrochromosomes and microchromosomes, suggesting that homogenization of the centromeric and/or pericentromeric stDNA sequences occurred in the macrochromosomes and microchromosomes of these snakes.

  20. Using information content and base frequencies to distinguish mutations from genetic polymorphisms in splice junction recognition sites.

    PubMed

    Rogan, P K; Schneider, T D

    1995-01-01

    Predicting the effects of nucleotide substitutions in human splice sites has been based on analysis of consensus sequences. We used a graphic representation of sequence conservation and base frequency, the sequence logo, to demonstrate that a change in a splice acceptor of hMSH2 (a gene associated with familial nonpolyposis colon cancer) probably does not reduce splicing efficiency. This confirms a population genetic study that suggested that this substitution is a genetic polymorphism. The information theory-based sequence logo is quantitative and more sensitive than the corresponding splice acceptor consensus sequence for detection of true mutations. Information analysis may potentially be used to distinguish polymorphisms from mutations in other types of transcriptional, translational, or protein-coding motifs.

  1. Atan1p-an extracellular tannase from the dimorphic yeast Arxula adeninivorans: molecular cloning of the ATAN1 gene and characterization of the recombinant enzyme.

    PubMed

    Böer, Erik; Bode, Rüdiger; Mock, Hans-Peter; Piontek, Michael; Kunze, Gotthard

    2009-06-01

    The tannase-encoding Arxula adeninivorans gene ATAN1 was isolated from genomic DNA by PCR, using as primers oligonucleotide sequences derived from peptides obtained after tryptic digestion of the purified tannase protein. The gene harbours an ORF of 1764 bp, encoding a 587-amino acid protein, preceded by an N-terminal secretion sequence comprising 28 residues. The deduced amino acid sequence was similar to those of tannases from Aspergillus oryzae (50% identity), A. niger (48%) and putative tannases from A. fumigatus (52%) and A. nidulans (50%). The sequence contains the consensus pentapeptide motif (-Gly-X-Ser-X-Gly-) which forms part of the catalytic centre of serine hydrolases. Expression of ATAN1 is regulated by the carbon source. Supplementation with tannic acid or gallic acid leads to induction of ATAN1, and accumulation of the native tannase enzyme in the medium. The enzymes recovered from both wild-type and recombinant strains were essentially indistinguishable. A molecular mass of approximately 320 kDa was determined, indicating that the native, glycosylated tannase consists of four identical subunits. The enzyme has a temperature optimum at 35-40 degrees C and a pH optimum at approximately 6.0. The enzyme is able to remove gallic acid from both condensed and hydrolysable tannins. The wild-type strain LS3 secreted amounts of tannase equivalent to 100 U/l under inducing conditions, while the transformant strain, which overexpresses the ATAN1 gene from the strong, constitutively active A. adeninivorans TEF1 promoter, produced levels of up to 400 U/l when grown in glucose medium in shake flasks. Copyright (c) 2009 John Wiley & Sons, Ltd.

  2. Chromosome-encoded narrow-spectrum Ambler class A beta-lactamase GIL-1 from Citrobacter gillenii.

    PubMed

    Naas, Thierry; Aubert, Daniel; Ozcan, Ayla; Nordmann, Patrice

    2007-04-01

    A novel beta-lactamase gene was cloned from the whole-cell DNA of an enterobacterial Citrobacter gillenii reference strain that displayed a weak narrow-spectrum beta-lactam-resistant phenotype and was expressed in Escherichia coli. It encoded a clavulanic acid-inhibited Ambler class A beta-lactamase, GIL-1, with a pI value of 7.5 and a molecular mass of ca. 29 kDa. GIL-1 had the highest percent amino acid sequence identity with TEM-1 and SHV-1, 77%, and 67%, respectively, and only 46%, 31%, and 32% amino acid sequence identity with CKO-1 (C. koseri), CdiA1 (C. diversus), and SED-1 (C. sedlaki), respectively. The substrate profile of the purified GIL-1 was similar to that of beta-lactamases TEM-1 and SHV-1. The blaGIL-1 gene was chromosomally located, as revealed by I-CeuI experiments, and was constitutively expressed at a low level in C. gillenii. No gene homologous to the regulatory ampR genes of chromosomal class C beta-lactamases was found upstream of the blaGIL-1 gene, which fits the noninducibility of beta-lactamase expression in C. gillenii. Rapid amplification of DNA 5' ends analysis of the promoter region revealed putative promoter sequences that diverge from what has been identified as the consensus sequence in E. coli. The blaGIL-1 gene was part of a 5.5-kb DNA fragment bracketed by a 9-bp duplication and inserted between the d-lactate dehydrogenase gene and the ydbH genes; this DNA fragment was absent in other Citrobacter species. This work further illustrates the heterogeneity of beta-lactamases in Citrobacter spp., which may indicate that the variability of Citrobacter species is greater than expected.

  3. Regulation of Lactobacillus casei Sorbitol Utilization Genes Requires DNA-Binding Transcriptional Activator GutR and the Conserved Protein GutM▿

    PubMed Central

    Alcántara, Cristina; Sarmiento-Rubiano, Luz Adriana; Monedero, Vicente; Deutscher, Josef; Pérez-Martínez, Gaspar; Yebra, María J.

    2008-01-01

    Sequence analysis of the five genes (gutRMCBA) downstream from the previously described sorbitol-6-phosphate dehydrogenase-encoding Lactobacillus casei gutF gene revealed that they constitute a sorbitol (glucitol) utilization operon. The gutRM genes encode putative regulators, while the gutCBA genes encode the EIIC, EIIBC, and EIIA proteins of a phosphoenolpyruvate-dependent sorbitol phosphotransferase system (PTSGut). The gut operon is transcribed as a polycistronic gutFRMCBA messenger, the expression of which is induced by sorbitol and repressed by glucose. gutR encodes a transcriptional regulator with two PTS-regulated domains, a galactitol-specific EIIB-like domain (EIIBGat domain) and a mannitol/fructose-specific EIIA-like domain (EIIAMtl domain). Its inactivation abolished gut operon transcription and sorbitol uptake, indicating that it acts as a transcriptional activator. In contrast, cells carrying a gutB mutation expressed the gut operon constitutively, but they failed to transport sorbitol, indicating that EIIBCGut negatively regulates GutR. A footprint analysis showed that GutR binds to a 35-bp sequence upstream from the gut promoter. A sequence comparison with the presumed promoter region of gut operons from various firmicutes revealed a GutR consensus motif that includes an inverted repeat. The regulation mechanism of the L. casei gut operon is therefore likely to be operative in other firmicutes. Finally, gutM codes for a conserved protein of unknown function present in all sequenced gut operons. A gutM mutant, the first constructed in a firmicute, showed drastically reduced gut operon expression and sorbitol uptake, indicating a regulatory role also for GutM. PMID:18676710

  4. The chaperonin-60 universal target is a barcode for bacteria that enables de novo assembly of metagenomic sequence data.

    PubMed

    Links, Matthew G; Dumonceaux, Tim J; Hemmingsen, Sean M; Hill, Janet E

    2012-01-01

    Barcoding with molecular sequences is widely used to catalogue eukaryotic biodiversity. Studies investigating the community dynamics of microbes have relied heavily on gene-centric metagenomic profiling using two genes (16S rRNA and cpn60) to identify and track Bacteria. While there have been criteria formalized for barcoding of eukaryotes, these criteria have not been used to evaluate gene targets for other domains of life. Using the framework of the International Barcode of Life we evaluated DNA barcodes for Bacteria. Candidates from the 16S rRNA gene and the protein coding cpn60 gene were evaluated. Within complete bacterial genomes in the public domain representing 983 species from 21 phyla, the largest difference between median pairwise inter- and intra-specific distances ("barcode gap") was found from cpn60. Distribution of sequence diversity along the ∼555 bp cpn60 target region was remarkably uniform. The barcode gap of the cpn60 universal target facilitated the faithful de novo assembly of full-length operational taxonomic units from pyrosequencing data from a synthetic microbial community. Analysis supported the recognition of both 16S rRNA and cpn60 as DNA barcodes for Bacteria. The cpn60 universal target was found to have a much larger barcode gap than 16S rRNA suggesting cpn60 as a preferred barcode for Bacteria. A large barcode gap for cpn60 provided a robust target for species-level characterization of data. The assembly of consensus sequences for barcodes was shown to be a reliable method for the identification and tracking of novel microbes in metagenomic studies.

  5. First ancient DNA sequences from the Late Pleistocene red deer (Cervus elaphus) in the Crimea, Ukraine

    NASA Astrophysics Data System (ADS)

    Stanković, Ana; Nadachowski, Adam; Doan, Karolina; Stefaniak, Krzysztof; Baca, Mateusz; Socha, Paweł; Wegleński, Piotr; Ridush, Bogdan

    2010-05-01

    The Late Pleistocene has been a period of significant population and species turnover and extinctions among the large mammal fauna. Massive climatic and environmental changes during Pleistocene significantly influenced the distribution and also genetic diversity of plants and animals. The model of glacial refugia and habitat contraction to southern peninsulas in Europe as areas for the survival of temperate animal species during unfavourable Pleistocene glaciations is at present widely accepted. However, both molecular data and the fossil record indicate the presence of northern and perhaps north-eastern refugia in Europe. In recent years, much new palaeontological data have been obtained in the Crimean Peninsula, Ukraine, following extensive investigations. The red deer (Cervus elaphus) samples for aDNA studies were collected in Emine-Bair-Khosar Cave, situated on the north edge of Lower Plateau of the Chatyrdag Massif (Crimean Mountains). The cave is a vertical shaft, which functioned as a huge mega-trap over a long period of time (probably most of the Pleistocene). The bone assemblages provided about 5000 bones belonging to more than 40 species. The C. elaphus bones were collected from three different stratigraphical levels, radiocarbon dated by accelerator mass spectrometry (AMS) method. The bone fragments of four specimens of red deer were used for the DNA isolation and analysis. The mtDNA (Cytochome b) was successfully isolated from three bone fragments and the cytochrome b sequences were amplified by multiplex PCR. The sequences obtained so far allowed for the reconstruction of only preliminary phylogenetic trees. A fragment of metatarsus from level dated to ca. 48,500±2,000 years BP, yielded a sequence of 513 bp, allowing to locate the specimen on the phylogenetic tree within modern C. elaphus specimens from southern and middle Europe. The second bone fragment, a fragment of mandible, collected from level dated approximately to ca. 33,500±400 years BP, yielded a sequence (696 bp) locating this specimen much closer to the modern C. elaphus specimens from China and Far East. From the third bone fragment (metatarsus), dated between ca. 12,000 years BP and 30,000 years BP, the sequence of only 346 bp has been obtained. It locates this specimen between European and Asiatic haplogroups. The preliminary results of analysis of the DNA from Crimean C. elaphus fossils reveal the great genetic heterogeneity and a complex phylogeographical pattern of the material studied. The obtained results support the opinion that Crimean Peninsula was the most north-eastern refugium in Europe during Late Pleistocene playing a major role in recolonization and dispersal processes of temperate species during and after the Late Pleistocene in this part of the Euro-Asian continent.

  6. Sequence variations of the bovine prion protein gene (PRNP) in native Korean Hanwoo cattle

    PubMed Central

    Choi, Sangho

    2012-01-01

    Bovine spongiform encephalopathy (BSE) is one of the fatal neurodegenerative diseases known as transmissible spongiform encephalopathies (TSEs) caused by infectious prion proteins. Genetic variations correlated with susceptibility or resistance to TSE in humans and sheep have not been reported for bovine strains including those from Holstein, Jersey, and Japanese Black cattle. Here, we investigated bovine prion protein gene (PRNP) variations in Hanwoo cattle [Bos (B.) taurus coreanae], a native breed in Korea. We identified mutations and polymorphisms in the coding region of PRNP, determined their frequency, and evaluated their significance. We identified four synonymous polymorphisms and two non-synonymous mutations in PRNP, but found no novel polymorphisms. The sequence and number of octapeptide repeats were completely conserved, and the haplotype frequency of the coding region was similar to that of other B. taurus strains. When we examined the 23-bp and 12-bp insertion/deletion (indel) polymorphisms in the non-coding region of PRNP, Hanwoo cattle had a lower deletion allele and 23-bp del/12-bp del haplotype frequency than healthy and BSE-affected animals of other strains. Thus, Hanwoo are seemingly less susceptible to BSE than other strains due to the 23-bp and 12-bp indel polymorphisms. PMID:22705734

  7. Structure, organization and expression of common carp (Cyprinus carpio L.) SLP-76 gene.

    PubMed

    Huang, Rong; Sun, Xiao-Feng; Hu, Wei; Wang, Ya-Ping; Guo, Qiong-Lin

    2008-05-01

    SLP-76 is an important member of the SLP-76 family of adapters, and it plays a key role in TCR signaling and T cell function. Partial cDNA sequence of SLP-76 of common carp (Cyprinus carpio L.) was isolated from thymus cDNA library by the method of suppression subtractive hybridization (SSH). Subsequently, the full length cDNA of carp SLP-76 was obtained by means of 3' RACE and 5' RACE, respectively. The full length cDNA of carp SLP-76 was 2007 bp, consisting of a 5'-terminal untranslated region (UTR) of 285 bp, a 3'-terminal UTR of 240 bp, and an open reading frame of 1482 bp. Sequence comparison showed that the deduced amino acid sequence of carp SLP-76 had an overall similarity of 34-73% to that of other species homologues, and it was composed of an NH2-terminal domain, a central proline-rich domain, and a C-terminal SH2 domain. Amino acid sequence analysis indicated the existence of a Gads binding site R-X-X-K, a 10-aa-long sequence which binds to the SH3 domain of LCK in vitro, and three conserved tyrosine-containing sequence in the NH2-terminal domain. Then we used PCR to obtain a genomic DNA which covers the entire coding region of carp SLP-76. In the 9.2k-long genomic sequence, twenty one exons and twenty introns were identified. RT-PCR results showed that carp SLP-76 was expressed predominantly in hematopoietic tissues, and was upregulated in thymus tissue of four-month carp compared to one-year old carp. RT-PCR and virtual northern hybridization results showed that carp SLP-76 was also upregulated in thymus tissue of GH transgenic carp at the age of four-months. These results suggest that the expression level of SLP-76 gene may be related to thymocyte development in teleosts.

  8. The Complete Chloroplast Genome Sequence of Date Palm (Phoenix dactylifera L.)

    PubMed Central

    Yang, Meng; Zhang, Xiaowei; Liu, Guiming; Yin, Yuxin; Chen, Kaifu; Yun, Quanzheng; Zhao, Duojun; Al-Mssallem, Ibrahim S.; Yu, Jun

    2010-01-01

    Background Date palm (Phoenix dactylifera L.), a member of Arecaceae family, is one of the three major economically important woody palms—the two other palms being oil palm and coconut tree—and its fruit is a staple food among Middle East and North African nations, as well as many other tropical and subtropical regions. Here we report a complete sequence of the data palm chloroplast (cp) genome based on pyrosequencing. Methodology/Principal Findings After extracting 369,022 cp sequencing reads from our whole-genome-shotgun data, we put together an assembly and validated it with intensive PCR-based verification, coupled with PCR product sequencing. The date palm cp genome is 158,462 bp in length and has a typical quadripartite structure of the large (LSC, 86,198 bp) and small single-copy (SSC, 17,712 bp) regions separated by a pair of inverted repeats (IRs, 27,276 bp). Similar to what has been found among most angiosperms, the date palm cp genome harbors 112 unique genes and 19 duplicated fragments in the IR regions. The junctions between LSC/IRs and SSC/IRs show different features of sequence expansion in evolution. We identified 78 SNPs as major intravarietal polymorphisms within the population of a specific cp genome, most of which were located in genes with vital functions. Based on RNA-sequencing data, we also found 18 polycistronic transcription units and three highly expression-biased genes—atpF, trnA-UGC, and rrn23. Conclusions Unlike most monocots, date palm has a typical cp genome similar to that of tobacco—with little rearrangement and gene loss or gain. High-throughput sequencing technology facilitates the identification of intravarietal variations in cp genomes among different cultivars. Moreover, transcriptomic analysis of cp genes provides clues for uncovering regulatory mechanisms of transcription and translation in chloroplasts. PMID:20856810

  9. Efficient and Accurate Algorithm for Cleaved Fragments Prediction (CFPA) in Protein Sequences Dataset Based on Consensus and Its Variants: A Novel Degradomics Prediction Application.

    PubMed

    El-Assaad, Atlal; Dawy, Zaher; Nemer, Georges; Hajj, Hazem; Kobeissy, Firas H

    2017-01-01

    Degradomics is a novel discipline that involves determination of the proteases/substrate fragmentation profile, called the substrate degradome, and has been recently applied in different disciplines. A major application of degradomics is its utility in the field of biomarkers where the breakdown products (BDPs) of different protease have been investigated. Among the major proteases assessed, calpain and caspase proteases have been associated with the execution phases of the pro-apoptotic and pro-necrotic cell death, generating caspase/calpain-specific cleaved fragments. The distinction between calpain and caspase protein fragments has been applied to distinguish injury mechanisms. Advanced proteomics technology has been used to identify these BDPs experimentally. However, it has been a challenge to identify these BDPs with high precision and efficiency, especially if we are targeting a number of proteins at one time. In this chapter, we present a novel bioinfromatic detection method that identifies BDPs accurately and efficiently with validation against experimental data. This method aims at predicting the consensus sequence occurrences and their variants in a large set of experimentally detected protein sequences based on state-of-the-art sequence matching and alignment algorithms. After detection, the method generates all the potential cleaved fragments by a specific protease. This space and time-efficient algorithm is flexible to handle the different orientations that the consensus sequence and the protein sequence can take before cleaving. It is O(mn) in space complexity and O(Nmn) in time complexity, with N number of protein sequences, m length of the consensus sequence, and n length of each protein sequence. Ultimately, this knowledge will subsequently feed into the development of a novel tool for researchers to detect diverse types of selected BDPs as putative disease markers, contributing to the diagnosis and treatment of related disorders.

  10. Molecular identification of Nocardia species using the sodA gene: Identificación molecular de especies de Nocardia utilizando el gen sodA.

    PubMed

    Sánchez-Herrera, K; Sandoval, H; Mouniee, D; Ramírez-Durán, N; Bergeron, E; Boiron, P; Sánchez-Saucedo, N; Rodríguez-Nava, V

    2017-09-01

    Currently for bacterial identification and classification the rrs gene encoding 16S rRNA is used as a reference method for the analysis of strains of the genus Nocardia. However, it does not have enough polymorphism to differentiate them at the species level. This fact makes it necessary to search for molecular targets that can provide better identification. The sod A gene (encoding the enzyme superoxide dismutase) has had good results in identifying species of other Actinomycetes. In this study the sod A gene is proposed for the identification and differentiation at the species level of the genus Nocardia. We used 41 type species of various collections; a 386 bp fragment of the sod A gene was amplified and sequenced, and a phylogenetic analysis was performed comparing the genes rrs (1171 bp), hsp 65 (401 bp), sec A1 (494 bp), gyr B (1195 bp) and rpo B (401 bp). The sequences were aligned using the Clustal X program. Evolutionary trees according to the neighbour-joining method were created with the programs Phylo_win and MEGA 6. The specific variability of the sod A genus of the genus Nocardia was analysed. A high phylogenetic resolution, significant genetic variability, and specificity and reliability were observed for the differentiation of the isolates at the species level. The polymorphism observed in the sod A gene sequence contains variable regions that allow the discrimination of closely related Nocardia species. The clear specificity, despite its small size, proves to be of great advantage for use in taxonomic studies and clinical diagnosis of the genus Nocardia.

  11. Sanger sequencing as a first-line approach for molecular diagnosis of Andersen-Tawil syndrome.

    PubMed

    Totomoch-Serra, Armando; Marquez, Manlio F; Cervantes-Barragán, David E

    2017-01-01

    In 1977, Frederick Sanger developed a new method for DNA sequencing based on the chain termination method, now known as the Sanger sequencing method (SSM).  Recently, massive parallel sequencing, better known as next-generation sequencing (NGS),  is replacing the SSM for detecting mutations in cardiovascular diseases with a genetic background. The present opinion article wants to remark that "targeted" SSM is still effective as a first-line approach for the molecular diagnosis of some specific conditions, as is the case for Andersen-Tawil syndrome (ATS). ATS is described as a rare multisystemic autosomal dominant channelopathy syndrome caused mainly by a heterozygous mutation in the KCNJ2 gene . KCJN2 has particular characteristics that make it attractive for "directed" SSM. KCNJ2 has a sequence of 17,510 base pairs (bp), and a short coding region with two exons (exon 1=166 bp and exon 2=5220 bp), half of the mutations are located in the C-terminal cytosolic domain, a mutational hotspot has been described in residue Arg218, and this gene explains the phenotype in 60% of ATS cases that fulfill all the clinical criteria of the disease. In order to increase the diagnosis of ATS we urge cardiologists to search for facial and muscular abnormalities in subjects with frequent ventricular arrhythmias (especially bigeminy) and prominent U waves on the electrocardiogram.

  12. Sanger sequencing as a first-line approach for molecular diagnosis of Andersen-Tawil syndrome

    PubMed Central

    Totomoch-Serra, Armando; Marquez, Manlio F.; Cervantes-Barragán, David E.

    2017-01-01

    In 1977, Frederick Sanger developed a new method for DNA sequencing based on the chain termination method, now known as the Sanger sequencing method (SSM).  Recently, massive parallel sequencing, better known as next-generation sequencing (NGS),  is replacing the SSM for detecting mutations in cardiovascular diseases with a genetic background. The present opinion article wants to remark that “targeted” SSM is still effective as a first-line approach for the molecular diagnosis of some specific conditions, as is the case for Andersen-Tawil syndrome (ATS). ATS is described as a rare multisystemic autosomal dominant channelopathy syndrome caused mainly by a heterozygous mutation in the KCNJ2 gene . KCJN2 has particular characteristics that make it attractive for “directed” SSM. KCNJ2 has a sequence of 17,510 base pairs (bp), and a short coding region with two exons (exon 1=166 bp and exon 2=5220 bp), half of the mutations are located in the C-terminal cytosolic domain, a mutational hotspot has been described in residue Arg218, and this gene explains the phenotype in 60% of ATS cases that fulfill all the clinical criteria of the disease. In order to increase the diagnosis of ATS we urge cardiologists to search for facial and muscular abnormalities in subjects with frequent ventricular arrhythmias (especially bigeminy) and prominent U waves on the electrocardiogram. PMID:29093808

  13. A novel 5-bp deletion in Clarin 1 in a family with Usher syndrome.

    PubMed

    Akoury, Elie; El Zir, Elie; Mansour, Ahmad; Mégarbané, André; Majewski, Jacek; Slim, Rima

    2011-11-01

    To identify the genetic defect in a Lebanese family with two sibs diagnosed with Usher Syndrome. Exome capture and sequencing were performed on DNA from one affected member using Agilent in solution bead capture, followed by Illumina sequencing. This analysis revealed the presence of a novel homozygous 5-bp deletion, in Clarin 1 (CLRN1), a known gene responsible for Usher syndrome type III. The deletion is inherited from both parents and segregates with the disease phenotype in the family. The 5-bp deletion, c.301_305delGTCAT, p.Val101SerfsX27, is predicted to result in a frameshift and protein truncation after 27 amino acids. Sequencing all the coding regions of the CLRN1 gene in the proband did not reveal any other mutation or variant. Here we describe a novel deletion in CLRN1. Our data support previously reported intra familial variability in the clinical features of Usher syndrome type I and III.

  14. Complete mitochondrial genome of the frillneck lizard (Chlamydosaurus kingii, Reptilia; Agamidae), another squamate with two control regions.

    PubMed

    Ujvari, Beata; Madsen, Thomas

    2008-10-01

    Using PCR, the complete mitochondrial genome was sequenced in three frillneck lizards (Chlamydosaurus kingii). The mitochondria spanned over 16,761bp. As in other vertebrates, two rRNA genes, 22 tRNA genes and 13 protein coding genes were identified. However, similar to some other squamate reptiles, two control regions (CRI and CRII) were identified, spanning 801 and 812 bp, respectively. Our results were compared with another Australian member of the family Agamidae, the bearded dragon (Pogana vitticeps). The overall base composition of the light-strand sequence largely mirrored that observed in P vitticeps. Furthermore, similar to P. vitticeps, we observed an insertion 801 bp long between the ND5 and ND6 genes. However, in contrast to P vitticeps we did not observe a conserved sequence block III region. Based on a comparison among the three frillneck lizards, we also present data on the proportion of variable sites within the major mitochondrial regions.

  15. Complete genome sequence of the filamentous gliding predatory bacterium Herpetosiphon aurantiacus type strain (114-95T)

    PubMed Central

    Kiss, Hajnalka; Nett, Markus; Domin, Nicole; Martin, Karin; Maresca, Julia A.; Copeland, Alex; Lapidus, Alla; Lucas, Susan; Berry, Kerrie W.; Glavina Del Rio, Tijana; Dalin, Eileen; Tice, Hope; Pitluck, Sam; Richardson, Paul; Bruce, David; Goodwin, Lynne; Han, Cliff; Detter, John C.; Schmutz, Jeremy; Brettin, Thomas; Land, Miriam; Hauser, Loren; Kyrpides, Nikos C.; Ivanova, Natalia; Göker, Markus; Woyke, Tanja; Klenk, Hans-Peter; Bryant, Donald A.

    2011-01-01

    Herpetosiphon aurantiacus Holt and Lewin 1968 is the type species of the genus Herpetosiphon, which in turn is the type genus of the family Herpetosiphonaceae, type family of the order Herpetosiphonales in the phylum Chloroflexi. H. aurantiacus cells are organized in filaments which can rapidly glide. The species is of interest not only because of its rather isolated position in the tree of life, but also because Herpetosiphon ssp. were identified as predators capable of facultative predation by a wolf pack strategy and of degrading the prey organisms by excreted hydrolytic enzymes. The genome of H. aurantiacus strain 114-95T is the first completely sequenced genome of a member of the family Herpetosiphonaceae. The 6,346,587 bp long chromosome and the two 339,639 bp and 99,204 bp long plasmids with a total of 5,577 protein-coding and 77 RNA genes was sequenced as part of the DOE Joint Genome Institute Program DOEM 2005. PMID:22675585

  16. Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

    PubMed

    Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

    1997-04-01

    A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.

  17. Gut Microbial Diversity in Rat Model Induced by Rhubarb

    PubMed Central

    Peng, Ying; Wu, Chunfu; Yang, Jingyu; Li, Xiaobo

    2014-01-01

    Rhubarb is often used to establish chronic diarrhea and spleen (Pi)-deficiency syndrome animal models in China. In this study, we utilized the enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) method to detect changes in bacterial diversity in feces and the bowel mucosa associated with this model. Total microbial genomic DNA from the small bowel (duodenum, jejunum, and ileum), large bowel (proximal colon, distal colon, and rectum), cecum, and feces of normal and rhubarb-exposed rats were used as templates for the ERIC-PCR analysis. We found that the fecal microbial composition did not correspond to the bowel bacteria mix. More bacterial diversity was observed in the ileum of rhubarb-exposed rats (P<0.05). Furthermore, a 380 bp product was found to be increased in rhubarb-exposed rats both in faces and the bowel mucosa. The product was cloned and sequenced and showed high similarity with regions of the Bacteroides genome. AS a result of discriminant analysis with the SPSS software, the Canonical Discriminant Function Formulae for model rats was established. PMID:25048267

  18. Organization of 5S rDNA in species of the fish Leporinus: two different genomic locations are characterized by distinct nontranscribed spacers.

    PubMed

    Martins, C; Galetti, P M

    2001-10-01

    To address understanding the organization of the 5S rRNA multigene family in the fish genome, the nucleotide sequence and organization array of 5S rDNA were investigated in the genus Leporinus, a representative freshwater fish group of South American fauna. PCR, subgenomic library screening, genomic blotting, fluorescence in situ hybridization, and DNA sequencing were employed in this study. Two arrays of 5S rDNA were identified for all species investigated, one consisting of monomeric repeat units of around 200 bp and another one with monomers of 900 bp. These 5S rDNA arrays were characterized by distinct NTS sequences (designated NTS-I and NTS-II for the 200- and 900-bp monomers, respectively); however, their coding sequences were nearly identical. The 5S rRNA genes were clustered in two chromosome loci, a major one corresponding to the NTS-I sites and a minor one corresponding to the NTS-II sites. The NTS-I sequence was variable among Leporinus spp., whereas the NTS-II was conserved among them and even in the related genus Schizodon. The distinct 5S rDNA arrays might characterize two 5S rRNA gene subfamilies that have been evolving independently in the genome.

  19. Sequence variability in three mitochondrial genes among four roundworm species from wild animals in China.

    PubMed

    Chang, Qiao-Cheng; Gao, Jun-Feng; Sheng, Zhong-Hua; Lou, Yan; Zheng, Xu; Wang, Chun-Ren

    2015-02-01

    Sequence variability in three mitochondrial DNA (mtDNA) regions, namely portions of cytochrome c oxidase subunit 1 (pcox1), NADH dehydrogenase subunit 1 (pnad1) and NADH dehydrogenase subunit 4 (pnad4), for Toxocara canis. Baylisacaris transfuga. Ascaris suum and Parascaris equorum from Canis lupus. Ursus thibetanus. Sus scrofa and Equus burchelli in China were examined. The lengths of the sequences of pcox1, pnad1 and pnad4 were 711 bp, 648 bp and 666 bp, respectively. No intra-species differences were detected in pcox1 for the four examined ascarid species, in pnad1 for T. canis. A. suum and P. equorum, and in pnad4 for B. transfuga and P. equorum. Sequence differences in pnad4 for six roundworm samples of T. canis and P. equorum were 0-0.1% and 0-0.3%, respectively, and were 0-0.3% in pnad1 for six roundworm samples isolate of B. transfuga. The inter-specific sequence differences among four species were 8.7-12.4% for pcox1, 13.9-17.7% for pnad1, and 14.0-25.7% for pnad4. Phylogenetic analyses suggested that the three mtDNA fragments could be used to identify ascarid species in families Ascaridiae and Toxocaridae.

  20. Biological assay using T cell response for Cry-consensus peptide designed for the peptide-based immunotherapy of Japanese cedar pollinosis.

    PubMed

    Kozutsumi, Daisuke; Tsunematsu, Masako; Yamaji, Taketo; Kino, Kohsuke

    2007-01-01

    Cry-consensus peptide is a linearly linked peptide of T-cell epitopes for the management of Japanese cedar (JC) pollinosis and is expected to become a new drug for immunotherapy. However, the mechanism of T-cell epitopes in allergic diseases is not well understood, and thus, a simple in vitro procedure for evaluation of its biological activity is desired. Peripheral blood mononuclear cells (PBMC) were isolated from 27 JC pollinosis patients and 10 healthy subjects, and cultured in vitro for 4 days in the presence of Cry-consensus peptide and (3)H-thymidine. The relationship between growth stimulation (stimulation index; SI) and antigen-specific IgE levels in serum was also investigated in JC pollinosis patients. Moreover, to confirm the importance of the primary sequence in Cry-consensus peptide, heat-treated Cry-consensus peptide and a mixture of the amino acids of which Cry-consensus peptide is composed, and their (3)H-thymidine uptake was compared with Cry-consensus peptide. Finally, whether Cry-consensus peptide stimulates PBMCs from healthy subjects was investigated. The mean SI of JC patients showed a good correlation with Cry-consensus peptide concentration in the culture medium; however, the SI was independent of the anti-Cry j 1 IgE level. Heat-denatured Cry-consensus peptide retained a PBMC proliferation stimulatory effect comparable to the original Cry-consensus peptide, while the mixture of amino acids constituting Cry-consensus peptide did not stimulate PBMC proliferation. PBMCs from healthy subjects did not respond to Cry-consensus peptide at all. These data indicate that the PBMC response of patients suffering from JC pollinosis to Cry-consensus peptide is specific for the sequence of T cell epitopes thereof and may be useful for the evaluation of the efficacy of Cry-consensus peptide in vivo.

  1. Detecting cooperative sequences in the binding of RNA Polymerase-II

    NASA Astrophysics Data System (ADS)

    Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

    2008-03-01

    Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

  2. Characterization of a species-specific repetitive DNA from a highly endangered wild animal, Rhinoceros unicornis, and assessment of genetic polymorphism by microsatellite associated sequence amplification (MASA).

    PubMed

    Ali, S; Azfer, M A; Bashamboo, A; Mathur, P K; Malik, P K; Mathur, V B; Raha, A K; Ansari, S

    1999-03-04

    We have cloned and sequenced a 906bp EcoRI repeat DNA fraction from Rhinoceros unicornis genome. The contig pSS(R)2 is AT rich with 340 A (37.53%), 187 C (20.64%), 173 G (19.09%) and 206 T (22.74%). The sequence contains MALT box, NF-E1, Poly-A signal, lariat consensus sequences, TATA box, translational initiation sequences and several stop codons. Translation of the contig showed seven different types of protein motifs, among which, EGF-like domain cysteine pattern signatures and Bowman-Birk serine protease inhibitor family signatures were prominent. The presence of eukaryotic transcriptional elements, protein signatures and analysis of subset sequences in the 5' region from 1 to 165nt indicating coding potential (test code value=0.97) suggest possible regulatory and/or functional role(s) of these sequences in the rhino genome. Translation of the complementary strand from 906 to 706nt and 190 to 2nt showed proteins of more than 7kDa rich in non-polar residues. This suggests that pSS(R)2 is either a part of, or adjacent to, a functional gene. The contig contains mostly non-consecutive simple repeat units from 2 to 17nt with varying frequencies, of which four base motifs were found to be predominant. Zoo-blot hybridization revealed that pSS(R)2 sequences are unique to R. unicornis genome because they do not cross-hybridize, even with the genomic DNA of South African black rhino Diceros bicornis. Southern blot analysis of R. unicornis genomic DNA with pSS(R)2 and other synthetic oligo probes revealed a high level of genetic homogeneity, which was also substantiated by microsatellite associated sequence amplification (MASA). Owing to its uniqueness, the pSS(R)2 probe has a potential application in the area of conservation biology for unequivocal identification of horn or other body tissues of R. unicornis. The evolutionary aspect of this repeat fraction in the context of comparative genome analysis is discussed.

  3. Genetic diversity of Clostridium perfringens type A isolates from animals, food poisoning outbreaks and sludge

    PubMed Central

    Johansson, Anders; Aspan, Anna; Bagge, Elisabeth; Båverud, Viveca; Engström, Björn E; Johansson, Karl-Erik

    2006-01-01

    Background Clostridium perfringens, a serious pathogen, causes enteric diseases in domestic animals and food poisoning in humans. The epidemiological relationship between C. perfringens isolates from the same source has previously been investigated chiefly by pulsed-field gel electrophoresis (PFGE). In this study the genetic diversity of C. perfringens isolated from various animals, from food poisoning outbreaks and from sludge was investigated. Results We used PFGE to examine the genetic diversity of 95 C. perfringens type A isolates from eight different sources. The isolates were also examined for the presence of the beta2 toxin gene (cpb2) and the enterotoxin gene (cpe). The cpb2 gene from the 28 cpb2-positive isolates was also partially sequenced (519 bp, corresponding to positions 188 to 706 in the consensus cpb2 sequence). The results of PFGE revealed a wide genetic diversity among the C. perfringens type A isolates. The genetic relatedness of the isolates ranged from 58 to 100% and 56 distinct PFGE types were identified. Almost all clusters with similar patterns comprised isolates with a known epidemiological correlation. Most of the isolates from pig, horse and sheep carried the cpb2 gene. All isolates originating from food poisoning outbreaks carried the cpe gene and three of these also carried cpb2. Two evolutionary different populations were identified by sequence analysis of the partially sequenced cpb2 genes from our study and cpb2 sequences previously deposited in GenBank. Conclusion As revealed by PFGE, there was a wide genetic diversity among C. perfringens isolates from different sources. Epidemiologically related isolates showed a high genetic similarity, as expected, while isolates with no obvious epidemiological relationship expressed a lesser degree of genetic similarity. The wide diversity revealed by PFGE was not reflected in the 16S rRNA sequences, which had a considerable degree of sequence similarity. Sequence comparison of the partially sequenced cpb2 gene revealed two genetically different populations. This is to our knowledge the first study in which the genetic diversity of C. perfringens isolates both from different animals species, from food poisoning outbreaks and from sludge has been investigated. PMID:16737528

  4. Regulation of COL1A1 expression in type I collagen producing tissues: identification of a 49 base pair region which is required for transgene expression in bone of transgenic mice

    NASA Technical Reports Server (NTRS)

    Bedalov, A.; Salvatori, R.; Dodig, M.; Kronenberg, M. S.; Kapural, B.; Bogdanovic, Z.; Kream, B. E.; Woody, C. O.; Clark, S. H.; Mack, K.; hide

    1995-01-01

    Previous deletion studies using a series of COL1A1-CAT fusion genes have indicated that the 625 bp region of the COL1A1 upstream promoter between -2295 and -1670 bp is required for high levels of expression in bone, tendon, and skin of transgenic mice. To further define the important sequences within this region, a new series of deletion constructs extending to -1997, -1794, -1763, and -1719 bp has been analyzed in transgenic mice. Transgene activity, determined by measuring CAT activity in tissue extracts of 6- to 8-day-old transgenic mouse calvariae, remains high for all the new deletion constructs and drops to undetectable levels in calvariae containing the -1670 bp construct. These results indicate that the 49 bp region of the COL1A1 promoter between -1719 and -1670 bp is required for high COL1A1 expression in bone. Although deletion of the same region caused a substantial reduction of promoter activity in tail tendon, the construct extending to -1670 bp is still expressed in this tissue. However, further deletion of the promoter to -944 bp abolished activity in tendon. Gel mobility shift studies identified a protein in calvarial nuclear extracts that is not found in tendon nuclear extracts, which binds within this 49 bp region. Our study has delineated sequences in the COL1A1 promoter required for expression of the COL1A1 gene in high type I collagen-producing tissues, and suggests that different cis elements control expression of the COL1A1 gene in bone and tendon.

  5. Identification and Functional Characterization of a Novel Acetylcholine-binding Protein from the Marine Annelid Capitella teleta

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCormack, T.; Petrovich,; Mercier, K

    2010-01-01

    We identified a homologue of the molluscan acetylcholine-binding protein (AChBP) in the marine polychaete Capitella teleta, from the annelid phylum. The amino acid sequence of C. teleta AChBP (ct-AChBP) is 21-30% identical with those of known molluscan AChBPs. Sequence alignments indicate that ct-AChBP has a shortened Cys loop compared to other Cys loop receptors, and a variation on a conserved Cys loop triad, which is associated with ligand binding in other AChBPs and nicotinic ACh receptor (nAChR) {alpha} subunits. Within the D loop of ct-AChBP, a conserved aromatic residue (Tyr or Trp) in nAChRs and molluscan AChBPs, which has beenmore » implicated directly in ligand binding, is substituted with an isoleucine. Mass spectrometry results indicate that Asn122 and Asn216 of ct-AChBP are glycosylated when expressed using HEK293 cells. Small-angle X-ray scattering data suggest that the overall shape of ct-AChBP in the apo or unliganded state is similar to that of homologues with known pentameric crystal structures. NMR experiments show that acetylcholine, nicotine, and {alpha}-bungarotoxin bind to ct-AChBP with high affinity, with KD values of 28.7 {micro}M, 209 nM, and 110 nM, respectively. Choline bound with a lower affinity (K{sub D} = 163 {micro}M). Our finding of a functional AChBP in a marine annelid demonstrates that AChBPs may exhibit variations in hallmark motifs such as ligand-binding residues and Cys loop length and shows conclusively that this neurotransmitter binding protein is not limited to the phylum Mollusca.« less

  6. Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

    PubMed

    Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

    1993-12-01

    Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

  7. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

    PubMed Central

    Pietan, Lucas L.; Spradling, Theresa A.

    2016-01-01

    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  8. Development of Multilocus Sequence Typing (MLST) for Mycoplasma synoviae.

    PubMed

    El-Gazzar, Mohamed; Ghanem, Mostafa; McDonald, Kristina; Ferguson-Noel, Naola; Raviv, Ziv; Slemons, Richard D

    2017-03-01

    Mycoplasma synoviae (MS) is a poultry pathogen that has had an increasing incidence and economic impact over the past few years. Strain identification is necessary for outbreak investigation, infection source identification, and facilitating prevention and control as well as eradication efforts. Currently, a segment of the variable lipoprotein hemagglutinin A (vlhA) gene (420 bp) is the only target that is used for MS strain identification. A major limitation of this assay is that colonality of typed samples can only be inferred if their vlhA sequences are identical; however, if their sequences are different, the degree of relatedness is uncertain. In this study we propose a multilocus sequence typing (MLST) assay to further refine MS strain identification. After initial screening of 24 housekeeping genes as potential targets, seven genes were selected for the MLST assay. An internal segment (450-711 bp) from each of the seven genes was successfully amplified and sequenced from 58 different MS strains and field isolates (n = 30) or positive clinical samples (n = 28). The collective sequence of all seven gene segments (3960 bp total) was used for MS sequence typing. The 58 tested MS samples were typed into 30 different sequence types using the MLST assay and, coincidentally, all the samples were typed into 30 sequence types using the vlhA assay. However, the phylogenetic tree generated using the MLST data was more congruent to the epidemiologic information than was the tree generated by the vlhA assay. We suggest that the newly developed MLST assay and the vlhA assay could be used in tandem for MS typing. The MLST assay will be a valuable and more reliable tool for MS sequence typing, providing better understanding of the epidemiology of MS infection. This in turn will aid disease prevention, control, and eradication efforts.

  9. Mitochondrial Genome Sequence of the Legume Vicia faba

    PubMed Central

    Negruk, Valentine

    2013-01-01

    The number of plant mitochondrial genomes sequenced exceeds two dozen. However, for a detailed comparative study of different phylogenetic branches more plant mitochondrial genomes should be sequenced. This article presents sequencing data and comparative analysis of mitochondrial DNA (mtDNA) of the legume Vicia faba. The size of the V. faba circular mitochondrial master chromosome of cultivar Broad Windsor was estimated as 588,000 bp with a genome complexity of 387,745 bp and 52 conservative mitochondrial genes; 32 of them encoding proteins, 3 rRNA, and 17 tRNA genes. Six tRNA genes were highly homologous to chloroplast genome sequences. In addition to the 52 conservative genes, 114 unique open reading frames (ORFs) were found, 36 without significant homology to any known proteins and 29 with homology to the Medicago truncatula nuclear genome and to other plant mitochondrial ORFs, 49 ORFs were not homologous to M. truncatula but possessed sequences with significant homology to other plant mitochondrial or nuclear ORFs. In general, the unique ORFs revealed very low homology to known closely related legumes, but several sequence homologies were found between V. faba, Beta vulgaris, Nicotiana tabacum, Vitis vinifera, and even the monocots Oryza sativa and Zea mays. Most likely these ORFs arose independently during angiosperm evolution (Kubo and Mikami, 2007; Kubo and Newton, 2008). Computational analysis revealed in total about 45% of V. faba mtDNA sequence being homologous to the Medicago truncatula nuclear genome (more than to any sequenced plant mitochondrial genome), and 35% of this homology ranging from a few dozen to 12,806 bp are located on chromosome 1. Apparently, mitochondrial rrn5, rrn18, rps10, ATP synthase subunit alpha, cox2, and tRNA sequences are part of transcribed nuclear mosaic ORFs. PMID:23675376

  10. Identification of single nucleotide polymorphism in ginger using expressed sequence tags

    PubMed Central

    Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J

    2009-01-01

    Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184

  11. LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

    PubMed

    Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

    2018-05-17

    Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

  12. Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

    PubMed

    Zhang, Chun; Feng, Li; Tian, Xing-Shan

    2018-04-26

    The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

  13. Genetic speciation of environmental Legionella isolates in Thailand.

    PubMed

    Paveenkittiporn, Wantana; Dejsirilert, Surang; Kalambaheti, Thareerat

    2012-10-01

    Legionella-like organisms were isolated during 2003-2007 from various water resources by culturing on selective media of Wadowsky-Yee-Okuda agar. The 256 isolates were identified as belonging to the Legionella genus based on detection of 108 bp PCR product of the 5S rRNA gene, while the inclusion as Legionella pneumophila were confirmed by PCR detection of a specific mip gene region of 168 bp. The 50 isolates, identified as non-pneumophila, were then subjected to DNA tree analysis, based on mip gene of ~650 bp and rnpB genes product ranged from 304 to 354 bp. Phylogenetic tree was constructed to predict their species in relative to the available database. The isolates of which their speciation, based on those two genes were inconclusive, were then investigated for the almost full-length of 16S rRNA sequences. The isolates were assigned as 16 known Legionella species, and proposed seven novel species based on their unique 16S rRNA sequence. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Conserved patterns hidden within group A Streptococcus M protein hypervariability recognize human C4b-binding protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buffalo, Cosmo Z.; Bahn-Suh, Adrian J.; Hirakis, Sophia P.

    No vaccine exists against group A Streptococcus (GAS), a leading cause of worldwide morbidity and mortality. A severe hurdle is the hypervariability of its major antigen, the M protein, with >200 different M types known. Neutralizing antibodies typically recognize M protein hypervariable regions (HVRs) and confer narrow protection. In stark contrast, human C4b-binding protein (C4BP), which is recruited to the GAS surface to block phagocytic killing, interacts with a remarkably large number of M protein HVRs (apparently ~90%). Such broad recognition is rare, and we discovered a unique mechanism for this through the structure determination of four sequence-diverse M proteinsmore » in complexes with C4BP. The structures revealed a uniform and tolerant ‘reading head’ in C4BP, which detected conserved sequence patterns hidden within hypervariability. Our results open up possibilities for rational therapies that target the M–C4BP interaction, and also inform a path towards vaccine design.« less

  15. Nucleotide sequence of a cluster of early and late genes in a conserved segment of the vaccinia virus genome.

    PubMed Central

    Plucienniczak, A; Schroeder, E; Zettlmeissl, G; Streeck, R E

    1985-01-01

    The nucleotide sequence of a 7.6 kb vaccinia DNA segment from a genomic region conserved among different orthopox virus has been determined. This segment contains a tight cluster of 12 partly overlapping open reading frames most of which can be correlated with previously identified early and late proteins and mRNAs. Regulatory signals used by vaccinia virus have been studied. Presumptive promoter regions are rich in A, T and carry the consensus sequences TATA and AATAA spaced at 20-24 base pairs. Tandem repeats of a CTATTC consensus sequence are proposed to be involved in the termination of early transcription. PMID:2987815

  16. Resting blood pressure differentially predicts time course in a tonic pain experiment.

    PubMed

    Horing, Bjoern; McCubbin, James A; Moore, Dewayne; Muth, Eric R

    2016-10-01

    Resting blood pressure (BP) shows a negative relationship with pain sensitivity (BP-related hypoalgesia). In chronic pain conditions, this relationship is inverted. The precise mechanisms responsible for the inversion are unknown. Using a tonic pain protocol, we report findings closely resembling this inversion in healthy participants. Resting BP and state measures of anxiety and mood were assessed from 33 participants (21 female). Participants then immersed their dominant hand in painfully hot water (47 °C) for five trials of 1-min duration, with 30-s intertrial intervals. Throughout the trials, participants continually registered their pain. After a 35-min intermission, the trial sequence was repeated. A disassociation of the negative relationship of resting systolic BP (as per Trial 1) was found using hierarchical linear modeling (p < .001, R(2)  = .07). The disassociation unfolds over each consecutive trial, with an increasingly positive relationship. In Sequence 2, the initially negative relationship is almost completely absent. Furthermore, the association of BP and pain was found to be moderated by anxiety, such that only persons with low anxiety exhibited BP hypoalgesia. Our findings expand the existing literature by incorporating anxiety as a moderator of BP hypoalgesia. Furthermore, the protocol emulates the changing relationship between BP and pain observed in chronic pain patients. The protocol has potential as a model for chronic pain; however, future research should determine if similar physiological systems are involved. The finding holds potential diagnostic or prognostic relevance for certain clinical pain conditions, especially those involving dysfunction of the descending modulation of pain. © 2016 Society for Psychophysiological Research.

  17. Cloning and characterization of a type 3 iodothyronine deiodinase (D3) in the liver of the chondrichtyan Chiloscyllium punctatum.

    PubMed

    Martínez, Lidia Mayorga; Orozco, Aurea; Villalobos, Patricia; Valverde-R, Carlos

    2008-05-01

    Thyroid hormone bioactivity is finely regulated at the cellular level by the peripheral iodothyronine deiodinases (D). The study of thyroid function in fish has been restricted mainly to teleosts, whereas the study and characterization of Ds have been overlooked in chondrichthyes. Here we report the cloning and operational characterization of both the native and the recombinant hepatic type 3 iodothyronine deiodinase in the tropical shark Chiloscyllium punctatum. Native and recombinant sD3 show identical catalytic activities: a strong preference for T3-inner-ring deiodination, a requirement for a high concentration of DTT, a sequential reaction mechanism, and resistance to PTU inhibition. The cloned cDNA contains 1298 nucleotides [excluding the poly(A) tail] and encodes a predicted protein of 259 amino acids. The triplet TGA coding for selenocysteine (Sec) is at position 123. The consensus selenocysteine insertion sequence (SECIS) was identified 228 bp upstream of the poly(A) tail and corresponds to form 2. The deduced amino acid sequence was 77% and 72% identical to other D3 cDNAs in fishes and other vertebrates, respectively. As in the case of other piscivore teleost species, shark expresses hepatic D3 through adulthood. This characteristic may be associated with the alimentary strategy in which the protection from an exogenous overload of thyroid hormones could be of physiological importance for thyroidal homeostasis.

  18. Characterization of the genome of the dairy Lactobacillus helveticus bacteriophage {Phi}AQ113.

    PubMed

    Zago, Miriam; Scaltriti, Erika; Rossetti, Lia; Guffanti, Alessandro; Armiento, Angelarita; Fornasari, Maria Emanuela; Grolli, Stefano; Carminati, Domenico; Brini, Elena; Pavan, Paolo; Felsani, Armando; D'Urzo, Annalisa; Moles, Anna; Claude, Jean-Baptiste; Grandori, Rita; Ramoni, Roberto; Giraffa, Giorgio

    2013-08-01

    The complete genomic sequence of the dairy Lactobacillus helveticus bacteriophage ΦAQ113 was determined. Phage ΦAQ113 is a Myoviridae bacteriophage with an isometric capsid and a contractile tail. The final assembled consensus sequence revealed a linear, circularly permuted, double-stranded DNA genome with a size of 36,566 bp and a G+C content of 37%. Fifty-six open reading frames (ORFs) were predicted, and a putative function was assigned to approximately 90% of them. The ΦAQ113 genome shows functionally related genes clustered together in a genome structure composed of modules for DNA replication/regulation, DNA packaging, head and tail morphogenesis, cell lysis, and lysogeny. The identification of genes involved in the establishment of lysogeny indicates that it may have originated as a temperate phage, even if it was isolated from natural cheese whey starters as a virulent phage, because it is able to propagate in a sensitive host strain. Additionally, we discovered that the ΦAQ113 phage genome is closely related to Lactobacillus gasseri phage KC5a and Lactobacillus johnsonii phage Lj771 genomes. The phylogenetic similarities between L. helveticus phage ΦAQ113 and two phages that belong to gut species confirm a possible common ancestral origin and support the increasing consideration of L. helveticus as a health-promoting organism.

  19. Characterization of the Genome of the Dairy Lactobacillus helveticus Bacteriophage ΦAQ113

    PubMed Central

    Scaltriti, Erika; Rossetti, Lia; Guffanti, Alessandro; Armiento, Angelarita; Fornasari, Maria Emanuela; Grolli, Stefano; Carminati, Domenico; Brini, Elena; Pavan, Paolo; Felsani, Armando; D'Urzo, Annalisa; Moles, Anna; Claude, Jean-Baptiste; Grandori, Rita; Ramoni, Roberto; Giraffa, Giorgio

    2013-01-01

    The complete genomic sequence of the dairy Lactobacillus helveticus bacteriophage ΦAQ113 was determined. Phage ΦAQ113 is a Myoviridae bacteriophage with an isometric capsid and a contractile tail. The final assembled consensus sequence revealed a linear, circularly permuted, double-stranded DNA genome with a size of 36,566 bp and a G+C content of 37%. Fifty-six open reading frames (ORFs) were predicted, and a putative function was assigned to approximately 90% of them. The ΦAQ113 genome shows functionally related genes clustered together in a genome structure composed of modules for DNA replication/regulation, DNA packaging, head and tail morphogenesis, cell lysis, and lysogeny. The identification of genes involved in the establishment of lysogeny indicates that it may have originated as a temperate phage, even if it was isolated from natural cheese whey starters as a virulent phage, because it is able to propagate in a sensitive host strain. Additionally, we discovered that the ΦAQ113 phage genome is closely related to Lactobacillus gasseri phage KC5a and Lactobacillus johnsonii phage Lj771 genomes. The phylogenetic similarities between L. helveticus phage ΦAQ113 and two phages that belong to gut species confirm a possible common ancestral origin and support the increasing consideration of L. helveticus as a health-promoting organism. PMID:23728811

  20. Distinct regulators of Shh transcription in the floor plate and notochord indicate separate origins for these tissues in the mouse node.

    PubMed

    Jeong, Yongsu; Epstein, Douglas J

    2003-08-01

    The establishment of the floor plate at the ventral midline of the CNS is dependent on an inductive signaling process mediated by the secreted protein Sonic hedgehog (Shh). To understand molecularly how floor plate induction proceeds we identified a Shh-responsive regulatory element that directs transgene reporter expression to the ventral midline of the CNS and notochord in a Shh-like manner and characterized critical cis-acting sequences regulating this element. Cross-species comparisons narrowed the activity of the Shh floor plate enhancer to an 88-bp sequence within intron 2 of Shh that included highly conserved binding sites matching the consensus for homeodomain, Tbx and Foxa transcription factors. Mutational analysis revealed that the homeodomain and Foxa binding sites are each required for activation of the Shh floor plate enhancer, whereas the Tbx site was required for repression in regions of the CNS where Shh is not normally expressed. We further show that Shh enhancer activity was detected in the mouse node from where the floor plate and notochord precursors derive. Shh reporter expression was restricted to the ventral (mesodermal) layer of the node in a pattern similar to endogenous Shh. X-gal-positive cells emerging from the node were only detected in the notochord lineage, suggesting that the floor plate and notochord arise from distinct precursors in the mouse node.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schriner, J.E.; Yi, W.; Hofmann, S.L.

    Palmitoyl-protein thioesterase (PPT) is a small glycoprotein that removes palmitate groups from cysteine residues in lipid-modified proteins. We recently reported mutations in PPT in patients with infantile neuronal ceroid lipofuscinosis (INCL), a severe neurodegenerative disorder. INCL is characterized by the accumulation of proteolipid storage material in brain and other tissues, suggesting that the disease is a consequence of abnormal catabolism of acylated proteins. In the current paper, we report the sequence of the human PPT cDNA and the structure of the human PPT gene. The cDNA predicts a protein of 306 amino acids that contains a 25-amino-acid signal peptide, threemore » N-linked glycosylation sites, and consensus motifs characteristic of thioesterases. Northern analysis of a human tissue blot revealed ubiquitous expression of a single 2.5-kb mRNA, with highest expression in lung, brain, and heart. The human PPT gene spans 25 kb and is composed of seven coding exons and a large eighth exon, containing the entire 3{prime}-untranslated region of 1388 bp. An Alu repeat and promoter elements corresponding to putative binding sites for several general transcription factors were identified in the 1060 nucleotides upstream of the transcription start site. The human PPT cDNA sequence and gene structure will provide the means for the identification of further causative mutations in INCL and facilitate genetic screening in selected high-risk populations. 31 refs., 5 figs., 1 tab.« less

  2. Identification of a cytochrome P450 gene in the earthworm Eisenia fetida and its mRNA expression under enrofloxacin stress.

    PubMed

    Li, Yinsheng; Zhao, Chun; Lu, Xiaoxu; Ai, Xiaojie; Qiu, Jiangping

    2018-04-15

    Cytochrome P450 (CYP450) enzymes are a family of hemoproteins primarily responsible for detoxification functions. Earthworms have been used as a bioindicator of soil pollution in numerous studies, but no CYP450 gene has so far been cloned. RT-PCR and RACE-PCR were employed to construct and sequence the CYP450 gene DNA from the extracted mRNA in the earthworm Eisenia fetida. The cloned gene (EW1) has an open reading frame of 477bp. The 3'-terminal region contained both the consensus and the signature sequences characteristic of CYP450. It was closely related to the CYP450 gene from the flatworm genus Opisthorchis felineus with 87% homology. The predicted structure of the putative protein was 97% homologous to human CYP450 family 27. This gene has been deposited in GenBank (accession no. KM881474). Earthworms (E. fetida) were then exposed to 1, 10, 100, and 500mgkg -1 enrofloxacin in soils to explore the mRNA expression by real time qPCR. The effect of enrofloxacin on mRNA expression levels of EW1 exhibited a marked hormesis pattern across the enrofloxacin dose range tested. This is believed to be the first reported CYP450 gene in earthworms, with reference value for molecular studies on detoxification processes in earthworms. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. R2R--software to speed the depiction of aesthetic consensus RNA secondary structures.

    PubMed

    Weinberg, Zasha; Breaker, Ronald R

    2011-01-04

    With continuing identification of novel structured noncoding RNAs, there is an increasing need to create schematic diagrams showing the consensus features of these molecules. RNA structural diagrams are typically made either with general-purpose drawing programs like Adobe Illustrator, or with automated or interactive programs specific to RNA. Unfortunately, the use of applications like Illustrator is extremely time consuming, while existing RNA-specific programs produce figures that are useful, but usually not of the same aesthetic quality as those produced at great cost in Illustrator. Additionally, most existing RNA-specific applications are designed for drawing single RNA molecules, not consensus diagrams. We created R2R, a computer program that facilitates the generation of aesthetic and readable drawings of RNA consensus diagrams in a fraction of the time required with general-purpose drawing programs. Since the inference of a consensus RNA structure typically requires a multiple-sequence alignment, the R2R user annotates the alignment with commands directing the layout and annotation of the RNA. R2R creates SVG or PDF output that can be imported into Adobe Illustrator, Inkscape or CorelDRAW. R2R can be used to create consensus sequence and secondary structure models for novel RNA structures or to revise models when new representatives for known RNA classes become available. Although R2R does not currently have a graphical user interface, it has proven useful in our efforts to create 100 schematic models of distinct noncoding RNA classes. R2R makes it possible to obtain high-quality drawings of the consensus sequence and structural models of many diverse RNA structures with a more practical amount of effort. R2R software is available at http://breaker.research.yale.edu/R2R and as an Additional file.

  4. Next generation sequencing yields the complete mitochondrial genome of the Hornlip mullet Plicomugil labiosus (Teleostei: Mugilidae).

    PubMed

    Shen, Kang-Ning; Chen, Ching-Hung; Hsiao, Chung-Der

    2016-05-01

    In this study, the complete mitogenome sequence of hornlip mullet Plicomugil labiosus (Teleostei: Mugilidae) has been sequenced by next-generation sequencing method. The assembled mitogenome, consisting of 16,829 bp, had the typical vertebrate mitochondrial gene arrangement, including 13 protein coding genes, 22 transfer RNAs, 2 ribosomal RNAs genes and a non-coding control region of D-loop. D-loop contains 1057 bp length is located between tRNA-Pro and tRNA-Phe. The overall base composition of P. labiosus is 28.0% for A, 29.3% for C, 15.5% for G and 27.2% for T. The complete mitogenome may provide essential and important DNA molecular data for further population, phylogenetic and evolutionary analysis for Mugilidae.

  5. Next generation sequencing yields the complete mitochondrial genome of the largescale mullet, Liza macrolepis (Teleostei: Mugilidae).

    PubMed

    Shen, Kang-Ning; Tsai, Shiou-Yi; Chen, Ching-Hung; Hsiao, Chung-Der; Durand, Jean-Dominique

    2016-11-01

    In this study, the complete mitogenome sequence of largescale mullet (Teleostei: Mugilidae) has been sequenced by the next-generation sequencing method. The assembled mitogenome, consisting of 16,832 bp, had the typical vertebrate mitochondrial gene arrangement, including 13 protein-coding genes, 22 transfer RNAs, two ribosomal RNAs genes, and a non-coding control region of D-loop. D-loop which has a length of 1094 bp is located between tRNA-Pro and tRNA-Phe. The overall base composition of largescale mullet is 27.8% for A, 30.1% for C, 16.2% for G, and 25.9% for T. The complete mitogenome may provide essential and important DNA molecular data for further phylogenetic and evolutionary analysis for Mugilidae.

  6. A DNA Sequence Element That Advances Replication Origin Activation Time in Saccharomyces cerevisiae

    PubMed Central

    Pohl, Thomas J.; Kolor, Katherine; Fangman, Walton L.; Brewer, Bonita J.; Raghuraman, M. K.

    2013-01-01

    Eukaryotic origins of DNA replication undergo activation at various times in S-phase, allowing the genome to be duplicated in a temporally staggered fashion. In the budding yeast Saccharomyces cerevisiae, the activation times of individual origins are not intrinsic to those origins but are instead governed by surrounding sequences. Currently, there are two examples of DNA sequences that are known to advance origin activation time, centromeres and forkhead transcription factor binding sites. By combining deletion and linker scanning mutational analysis with two-dimensional gel electrophoresis to measure fork direction in the context of a two-origin plasmid, we have identified and characterized a 19- to 23-bp and a larger 584-bp DNA sequence that are capable of advancing origin activation time. PMID:24022751

  7. Portuguese Lexical Clusters and CVC Sequences in Speech Perception and Production.

    PubMed

    Cunha, Conceição

    2015-01-01

    This paper investigates similarities between lexical consonant clusters and CVC sequences differing in the presence or absence of a lexical vowel in speech perception and production in two Portuguese varieties. The frequent high vowel deletion in the European variety (EP) and the realization of intervening vocalic elements between lexical clusters in Brazilian Portuguese (BP) may minimize the contrast between lexical clusters and CVC sequences in the two Portuguese varieties. In order to test this hypothesis we present a perception experiment with 72 participants and a physiological analysis of 3-dimensional movement data from 5 EP and 4 BP speakers. The perceptual results confirmed a gradual confusion of lexical clusters and CVC sequences in EP, which corresponded roughly to the gradient consonantal overlap found in production. © 2015 S. Karger AG, Basel.

  8. Structure and evolution of the mitochondrial genome of Exorista sorbillans: the Tachinidae (Diptera: Calyptratae) perspective.

    PubMed

    Shao, Yuan-jun; Hu, Xian-qiong; Peng, Guang-da; Wang, Rui-xian; Gao, Rui-na; Lin, Chao; Shen, Wei-de; Li, Rui; Li, Bing

    2012-12-01

    The first complete mitochondrial genome (mitogenome) of Tachinidae Exorista sorbillans (Diptera) is sequenced by PCR-based approach. The circular mitogenome is 14,960 bp long and has the representative mitochondrial gene (mt gene) organization and order of Diptera. All protein-coding sequences are initiated with ATN codon; however, the only exception is Cox I gene, which has a 4-bp ATCG putative start codon. Ten of the thirteen protein-coding genes have a complete termination codon (TAA), but the rest are seated on the H strand with incomplete codons. The mitogenome of E. sorbillans is biased toward A+T content at 78.4 %, and the strand-specific bias is in reflection of the third codon positions of mt genes, and their T/C ratios as strand indictor are higher on the H strand more than those on the L strand pointing at any strain of seven Diptera flies. The length of the A+T-rich region of E. sorbillans is 106 bp, including a tandem triple copies of a13-bp fragment. Compared to Haematobia irritans, E. sorbillans holds distant relationship with Drosophila. Phylogenetic topologies based on the amino acid sequences, supporting that E. sorbillans (Tachinidae) is clustered with strains of Calliphoridae and Oestridae, and superfamily Oestroidea are polyphyletic groups with Muscidae in a clade.

  9. Molecular cloning of the heat shock protein 20 gene from Paphia textile and its expression in response to heat shock

    NASA Astrophysics Data System (ADS)

    Li, Jiakai; Wu, Xiangwei; Tan, Jing; Zhao, Ruixiang; Deng, Lingwei; Liu, Xiande

    2015-07-01

    P. textile is an important aquaculture species in China and is mainly distributed in Fujian, Guangdong, and Guangxi Provinces. In this study, an HSP20 cDNA designated PtHSP20 was cloned from P. textile. The full-length cDNA of PtHSP20 is 1 090 bp long and contains a 5' untranslated region (UTR) of 93 bp, a 3' UTR of 475 bp, and an open reading frame (ORF) of 522 bp. The PtHSP20 cDNA encodes 173 amino acid residues and has a molecular mass of 20.22 kDa and an isoelectric point of 6.2. Its predicted amino acid sequence shows that PtHSP20 contains a typical α-crystallin domain (residues 77-171) and three polyadenylation signal-sequences at the C-terminus. According to an amino acid sequence alignment, PtHSP20 shows moderate homology to other mollusk sHSPs. PtHSP20 mRNA was present in all of the test tissues including the heart, digestive gland, adductor muscle, gonad, gill, and mantle, with the highest concentration found in the gonad. Under the stress of high temperature, the expression of PtHSP20 mRNA was down-regulated in all of the tissues except the adductor muscle and gonad.

  10. DNA Methylation of Gene Expression in Acanthamoeba castellanii Encystation.

    PubMed

    Moon, Eun-Kyung; Hong, Yeonchul; Lee, Hae-Ahm; Quan, Fu-Shi; Kong, Hyun-Hee

    2017-04-01

    Encystation mediating cyst specific cysteine proteinase (CSCP) of Acanthamoeba castellanii is expressed remarkably during encystation. However, the molecular mechanism involved in the regulation of CSCP gene expression remains unclear. In this study, we focused on epigenetic regulation of gene expression during encystation of Acanthamoeba . To evaluate methylation as a potential mechanism involved in the regulation of CSCP expression, we first investigated the correlation between promoter methylation status of CSCP gene and its expression. A 2,878 bp of promoter sequence of CSCP gene was amplified by PCR. Three CpG islands (island 1-3) were detected in this sequence using bioinformatics tools. Methylation of CpG island in trophozoites and cysts was measured by bisulfite sequence PCR. CSCP promoter methylation of CpG island 1 (1,633 bp) was found in 8.2% of trophozoites and 7.3% of cysts. Methylation of CpG island 2 (625 bp) was observed in 4.2% of trophozoites and 5.8% of cysts. Methylation of CpG island 3 (367 bp) in trophozoites and cysts was both 3.6%. These results suggest that DNA methylation system is present in CSCP gene expression of Acanthamoeba . In addition, the expression of encystation mediating CSCP is correlated with promoter CpG island 1 hypomethylation.

  11. Phylogenomic relationship of feijoa (Acca sellowiana (O.Berg) Burret) with other Myrtaceae based on complete chloroplast genome sequences.

    PubMed

    Machado, Lilian de Oliveira; Vieira, Leila do Nascimento; Stefenon, Valdir Marcos; Oliveira Pedrosa, Fábio de; Souza, Emanuel Maltempi de; Guerra, Miguel Pedro; Nodari, Rubens Onofre

    2017-04-01

    Given their distribution, importance, and richness, Myrtaceae species comprise a model system for studying the evolution of tropical plant diversity. In addition, chloroplast (cp) genome sequencing is an efficient tool for phylogenetic relationship studies. Feijoa [Acca sellowiana (O. Berg) Burret; CN: pineapple-guava] is a Myrtaceae species that occurs naturally in southern Brazil and northern Uruguay. Feijoa is known for its exquisite perfume and flavorful fruits, pharmacological properties, ornamental value and increasing economic relevance. In the present work, we reported the complete cp genome of feijoa. The feijoa cp genome is a circular molecule of 159,370 bp with a quadripartite structure containing two single copy regions, a Large Single Copy region (LSC 88,028 bp) and a Small Single Copy region (SSC 18,598 bp) separated by Inverted Repeat regions (IRs 26,372 bp). The genome structure, gene order, GC content and codon usage are similar to those of typical angiosperm cp genomes. When compared to other cp genome sequences of Myrtaceae, feijoa showed closest relationship with pitanga (Eugenia uniflora L.). Furthermore, a comparison of pitanga synonymous (Ks) and nonsynonymous (Ka) substitution rates revealed extremely low values. Maximum Likelihood and Bayesian Inference analyses produced phylogenomic trees identical in topology. These trees supported monophyly of three Myrtoideae clades.

  12. Glucocorticoids suppress tumor necrosis factor-alpha expression by human monocytic THP-1 cells by suppressing transactivation through adjacent NF-kappa B and c-Jun-activating transcription factor-2 binding sites in the promoter.

    PubMed

    Steer, J H; Kroeger, K M; Abraham, L J; Joyce, D A

    2000-06-16

    Glucocorticoid drugs suppress tumor necrosis factor-alpha (TNF-alpha) synthesis by activated monocyte/macrophages, contributing to an anti-inflammatory action in vivo. In lipopolysaccharide (LPS)-activated human monocytic THP-1 cells, glucocorticoids acted primarily on the TNF-alpha promoter to suppress a burst of transcriptional activity that occurred between 90 min and 3 h after LPS exposure. LPS increased nuclear c-Jun/ATF-2, NF-kappaB(1)/Rel-A, and Rel-A/C-Rel transcription factor complexes, which bound specifically to oligonucleotide sequences from the -106 to -88 base pair (bp) region of the promoter. The glucocorticoid, dexamethasone, suppressed nuclear binding activity of these complexes prior to and during the critical phase of TNF-alpha transcription. Site-directed mutagenesis in TNF-alpha promoter-luciferase reporter constructs showed that the adjacent c-Jun/ATF-2 (-106 to -99 bp) and NF-kappaB (-97 to -88 bp) binding sites each contributed to the LPS-stimulated expression. Mutating both sites largely prevented dexamethasone from suppressing TNF-alpha promoter-luciferase reporters. LPS exposure also increased nuclear Egr-1 and PU.1 abundance. The Egr-1/Sp1 (-172 to -161 bp) binding sites and the PU.1-binding Ets site (-116 to -110 bp) each contributed to the LPS-stimulated expression but not to glucocorticoid response. Dexamethasone suppressed the abundance of the c-Fos/c-Jun complex in THP-1 cell nuclei, but there was no direct evidence for c-Fos/c-Jun transactivation through sites in the -172 to -52 bp region. Small contributions to glucocorticoid response were attributable to promoter sequences outside the -172 to -88 bp region and to sequences in the TNF-alpha 3'-untranslated region. We conclude that glucocorticoids suppress LPS-stimulated secretion of TNF-alpha from human monocytic cells largely through antagonizing transactivation by c-Jun/ATF-2 and NF-kappaB complexes at binding sites in the -106 to -88 bp region of the TNF-alpha promoter.

  13. Molecular cloning and sequence analysis of heat shock proteins 70 (HSP70) and 90 (HSP90) and their expression analysis when exposed to benzo(a)pyrene in the clam Ruditapes philippinarum.

    PubMed

    Liu, Tong; Pan, Luqing; Cai, Yuefeng; Miao, Jingjing

    2015-01-25

    HSP70 and HSP90 are the most important heat shock proteins (HSPs), which play the key roles in the cell as molecular chaperones and may involve in metabolic detoxification. The present research has obtained full-length cDNAs of genes HSP70 and HSP90 from the clam Ruditapes philippinarum and studied the transcriptional responses of the two genes when exposed to benzo(a)pyrene (BaP). The full-length RpHSP70 cDNA was 2336bp containing a 5' untranslated region (UTR) of 51bp, a 3' UTR of 335bp and an open reading frame (ORF) of 1950bp encoding 650 amino acid residues. The full-length RpHSP90 cDNA was 2839bp containing a 107-bp 5' UTR, a 554-bp 3' UTR and a 2178-bp ORF encoding 726 amino acid residues. The deduced amino acid sequences of RpHSP70 and RpHSP90 shared the highest identity with the sequences of Paphia undulata, and the phylogenetic trees showed that the evolutions of RpHSP70 and RpHSP90 were almost in accord with the evolution of species. The RpHSP70 and RpHSP90 mRNA expressions were detected in all tested tissues in the adult clams (digestive gland, gill, adductor muscle and mantle) and the highest mRNA expression level was observed in the digestive gland compared to other tissues. Quantitative real-time RT-PCR analysis revealed that mRNA expression levels of the clam RpHSP70, RpHSP90 and other xenobiotic metabolizing enzymes (XMEs) (AhR, DD, GST, GPx) in the digestive gland of R. philippinarum were induced by benzo(a)pyrene (BaP) and the absolute expression levels of these genes showed a temporal and dose-dependent response. The results suggested that RpHSP70 and RpHSP90 were involved in the metabolic detoxification of BaP in the clam R. philippinarum. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. The Late-Glacial and Holocene Marboré Lake sequence (2612 m a.s.l., Central Pyrenees, Spain): Testing high altitude sites sensitivity to millennial scale vegetation and climate variability

    NASA Astrophysics Data System (ADS)

    Leunda, Maria; González-Sampériz, Penélope; Gil-Romera, Graciela; Aranbarri, Josu; Moreno, Ana; Oliva-Urcia, Belén; Sevilla-Callejo, Miguel; Valero-Garcés, Blas

    2017-10-01

    This paper presents the environmental, climate and vegetation changes reconstructed for the last 14.6 kyr cal BP from the Marboré Lake sedimentary sequence, the highest altitude record (2612 m a.s.l.) in the Pyrenees studied up to date. We investigate the sensitivity of this high altitude site to vegetational and climate dynamics and altitudinal shifts during the Holocene by comparing palynological spectra of the fossil sequence and pollen rain content from current moss pollsters. We hypothesize that the input of sediments in lakes at such altitude is strongly controlled by ice phenology (ice-free summer months) and that during cold periods Pollen Accumulation Rate (PAR) and Pollen Concentration (PC) reflect changes in ice-cover and thus is linked to temperature changes. Low sedimentation rates and low PC and PAR occurred during colder periods as the Younger Dryas (GS-1) and the Holocene onset (12.6-10.2 kyr cal BP), suggesting that the lake-surface remained ice-covered for most of the year during these periods. Warmer conditions are not evident until 10.2 kyr cal BP, when an abrupt increase in sedimentation rate, PC and PAR occur, pointing to a delayed onset of the Holocene temperature increase at high altitude. Well-developed pinewoods and deciduous forest dominated the mid montane belt since 9.3 kyr cal BP until mid-Holocene (5.2 kyr cal BP). A downwards shift in the deciduous forest occurred after 5.2 kyr cal BP, in agreement with the aridity trend observed at a regional and Mediterranean context. The increase of herbaceous taxa during the late-Holocene (3.5 kyr cal BP-present) reflects a general trend to reduced montane forest, as anthropogenic disturbances were not evident until 1.3 kyr cal BP when Olea proportions from lowland areas and other anthropogenic indicators clearly expand. Our study demonstrates the need to perform local experimental approaches to check the effect of ice phenology on high altitude lakes sensitivity to vegetation changes to obtain more realistic reconstructions of mountain vegetation belts dynamics.

  15. A case of canine borreliosis in Iran caused by Borrelia persica.

    PubMed

    Shirani, Darush; Rakhshanpoor, Alaleh; Cutler, Sally Jane; Ghazinezhad, Behnaz; Naddaf, Saied Reza

    2016-04-01

    Tick-borne relapsing fever is an endemic disease in Iran, with most cases attributed to infection by Borrelia persica, which is transmitted by Ornithodoros tholozani soft ticks. Here, we report spirochetemia in blood of a puppy residing in Tehran, Iran. The causative species was identified by use of highly discriminative IGS sequencing; the 489 bp IGS sequence obtained in our study showed 99% identity (100% coverage) when compared with B. persica sequences derived from clinical cases or from O. tholozani ticks. Our IGS sequence also showed 99% similarity over 414 bp (85% coverage) with a strain from a domestic dog, and 96% over 328 bp (69% coverage) with a strain from a domestic cat. Pet-keeping in cosmopolitan cities like Tehran has become increasingly popular in recent years. Animals are often transported into the city in cages or cardboard boxes that might also harbor minute tick larvae and/or early stages of the nymphs bringing them into the urban environment. This may pose a threat to household members who buy and keep these puppies and as a result may come into close contact with infected ticks. Copyright © 2016 Elsevier GmbH. All rights reserved.

  16. The genomes and comparative genomics of Lactobacillus delbrueckii phages.

    PubMed

    Riipinen, Katja-Anneli; Forsman, Päivi; Alatossava, Tapani

    2011-07-01

    Lactobacillus delbrueckii phages are a great source of genetic diversity. Here, the genome sequences of Lb. delbrueckii phages LL-Ku, c5 and JCL1032 were analyzed in detail, and the genetic diversity of Lb. delbrueckii phages belonging to different taxonomic groups was explored. The lytic isometric group b phages LL-Ku (31,080 bp) and c5 (31,841 bp) showed a minimum nucleotide sequence identity of 90% over about three-fourths of their genomes. The genomic locations of their lysis modules were unique, and the genomes featured several putative overlapping transcription units of genes. LL-Ku and c5 virions displayed peptidoglycan hydrolytic activity associated with a ~36-kDa protein similar in size to the endolysin. Unexpectedly, the 49,433-bp genome of the prolate phage JCL1032 (temperate, group c) revealed a conserved gene order within its structural genes. Lb. delbrueckii phages representing groups a (a phage LL-H), b and c possessed only limited protein sequence homology. Genomic comparison of LL-Ku and c5 suggested that diversification of Lb. delbrueckii phages is mainly due to insertions, deletions and recombination. For the first time, the complete genome sequences of group b and c Lb. delbrueckii phages are reported.

  17. Description of polymerase chain reaction and sequencing DNA Mycobacterium tuberculosis from specimen sputum of tuberculosis patients in Medan

    NASA Astrophysics Data System (ADS)

    Lily; Siregar, Y.; Ilyas, S.

    2018-03-01

    This study purposed to describe the product Polymerase Chain Reaction (PCR) and sequencing of DNA Mycobacterium (M.) tuberculosis from sputum of tuberculosis (TB) patients in Medan. Sputum was collected from patients that diagnosed with pulmonary TB by a physician. Specimen processed by PCR method of Li et al. and sequencing at Macrogen Laboratory. All of 12 product PCR were showed brightness bands at 126 base pair (bp). These results indicated similarity to the study of Li et al. Sequencing analysis showed the presence of a mutation and non-mutation groups of M. tuberculosis. The reference and outcome berange of the mutation and non-mutation of M. tuberculosis were 56-107, 59-85, 60-120 and 63-94, respectively. The percentage bp difference between the outcome and references for mutation and non-mutation were 3.448-6.569and 3.278-7.428%, respectively. In conclusion, the successful amplification of PCR products in a 1.5% agarose gel electrophoresis where all 12 sputa contained rpoB-positive M. tuberculosis and 0.644% difference was found between the outcome with reference bp of the mutation and non-mutation M. tuberculosis groups.

  18. Verification of STS markers for leaf rust resistance genes of wheat by seven European laboratories.

    PubMed

    Błaszczyk, Lidia; Chełkowski, Jerzy; Korzun, Victor; Kraic, Jan; Ordon, Frank; Ovesná, Jaroslava; Purnhauser, Laszlo; Tar, Melinda; Vida, Gyula

    2004-01-01

    A set of Thatcher near-isogenic lines and two breeding lines were used to examine sequence tagged site (STS) markers linked to leaf rust resistance genes Lr9, Lr10, Lr19, Lr24, Lr28, Lr29, Lr35, and a simple sequenced repeat (SSR) marker for Lr39. The selected STS markers for resistance genes Lr9, Lr10, Lr19, Lr24 and Lr28 were identified in seven accessions by seven European laboratories. Near-isogenic lines of the spring wheat Thatcher were used as positive controls. Markers for resistance genes Lr9, Lr10, Lr19, Lr24 were identified in all seven laboratories as amplification products of 1100 bp, 310 bp, 130 bp and 310 bp, respectively. The STS markers linked to resistance genes Lr9, Lr10, Lr19, Lr24, Lr29, Lr35 and the SSR marker for Lr39 were robust and highly specific for these genes and will be useful in marker-assisted selection in wheat. However, the amplification product of 378 bp that corresponded with resistance gene Lr28 was detected in all accessions including genotypes lacking this gene in all seven laboratories. This marker needs to be improved.

  19. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    NASA Astrophysics Data System (ADS)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  20. BP Piscium: its flaring disc imaged with SPHERE/ZIMPOL★

    NASA Astrophysics Data System (ADS)

    de Boer, J.; Girard, J. H.; Canovas, H.; Min, M.; Sitko, M.; Ginski, C.; Jeffers, S. V.; Mawet, D.; Milli, J.; Rodenhuis, M.; Snik, F.; Keller, C. U.

    2017-03-01

    Whether BP Piscium (BP Psc) is either a pre-main sequence T Tauri star at d ≈ 80 pc, or a post-main sequence G giant at d ≈ 300 pc is still not clear. As a first-ascent giant, it is the first to be observed with a molecular and dust disc. Alternatively, BP Psc would be among the nearest T Tauri stars with a protoplanetary disc (PPD). We investigate whether the disc geometry resembles typical PPDs, by comparing polarimetric images with radiative transfer models. Our Very Large Telescope/Spectro-Polarimetric High-contrast Exoplanet REsearch (SPHERE)/Zurich IMaging Polarimeter (ZIMPOL) observations allow us to perform polarimetric differential imaging, reference star differential imaging, and Richardson-Lucy deconvolution. We present the first visible light polarization and intensity images of the disc of BP Psc. Our deconvolution confirms the disc shape as detected before, mainly showing the southern side of the disc. In polarized intensity the disc is imaged at larger detail and also shows the northern side, giving it the typical shape of high-inclination flared discs. We explain the observed disc features by retrieving the large-scale geometry with MCMAX radiative transfer modelling, which yields a strongly flared model, atypical for discs of T Tauri stars.

  1. Identification of hamster inducible nitric oxide synthase (iNOS) promoter sequences that influence basal and inducible iNOS expression

    PubMed Central

    Saldarriaga, Omar A.; Travi, Bruno L.; Choudhury, Goutam Ghosh; Melby, Peter C.

    2012-01-01

    IFN-γ/LPS-activated hamster (Mesocricetus auratus) macrophages express significantly less iNOS (NOS2) than activated mouse macrophages, which contributes to the hamster's susceptibility to intracellular pathogens. We determined a mechanism responsible for differences in iNOS promoter activity in hamsters and mice. The HtPP (1.2 kb) showed low basal and inducible promoter activity when compared with the mouse, and sequences within a 100-bp region (−233 to −133) of the mouse and hamster promoters influenced this activity. Moreover, within this 100 bp, we identified a smaller region (44 bp) in the mouse promoter, which recovered basal promoter activity when swapped into the hamster promoter. The mouse homolog (100-bp region) contained a cis-element for NF-IL-6 (−153/−142), which was absent in the hamster counterpart. EMSA and supershift assays revealed that the hamster sequence did not support the binding of NF-IL-6. Introduction of a functional NF-IL-6 binding sequence into the hamster promoter or its alteration in the mouse promoter revealed the critical importance of this transcription factor for full iNOS promoter activity. Furthermore, the binding of NF-IL-6 to the iNOS promoter (−153/−142) in vivo was increased in mouse cells but was reduced in hamster cells after IFN-γ/LPS stimulation. Differences in the activity of the iNOS promoters were evident in mouse and hamster cells, so they were not merely a result of species-specific differences in transcription factors. Thus, we have identified unique DNA sequences and a critical transcription factor, NF-IL-6, which contribute to the overall basal and inducible expression of hamster iNOS. PMID:22517919

  2. Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus.

    PubMed

    Chun, J; Huq, A; Colwell, R R

    1999-05-01

    Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae.

  3. The Complete Chloroplast Genome of Banana (Musa acuminata, Zingiberales): Insight into Plastid Monocotyledon Evolution

    PubMed Central

    Martin, Guillaume; Baurens, Franc-Christophe; Cardi, Céline; Aury, Jean-Marc; D’Hont, Angélique

    2013-01-01

    Background Banana (genus Musa) is a crop of major economic importance worldwide. It is a monocotyledonous member of the Zingiberales, a sister group of the widely studied Poales. Most cultivated bananas are natural Musa inter-(sub-)specific triploid hybrids. A Musa acuminata reference nuclear genome sequence was recently produced based on sequencing of genomic DNA enriched in nucleus. Methodology/Principal Findings The Musa acuminata chloroplast genome was assembled with chloroplast reads extracted from whole-genome-shotgun sequence data. The Musa chloroplast genome is a circular molecule of 169,972 bp with a quadripartite structure containing two single copy regions, a Large Single Copy region (LSC, 88,338 bp) and a Small Single Copy region (SSC, 10,768 bp) separated by Inverted Repeat regions (IRs, 35,433 bp). Two forms of the chloroplast genome relative to the orientation of SSC versus LSC were found. The Musa chloroplast genome shows an extreme IR expansion at the IR/SSC boundary relative to the most common structures found in angiosperms. This expansion consists of the integration of three additional complete genes (rps15, ndhH and ycf1) and part of the ndhA gene. No such expansion has been observed in monocots so far. Simple Sequence Repeats were identified in the Musa chloroplast genome and a new set of Musa chloroplastic markers was designed. Conclusion The complete sequence of M. acuminata ssp malaccensis chloroplast we reported here is the first one for the Zingiberales order. As such it provides new insight in the evolution of the chloroplast of monocotyledons. In particular, it reinforces that IR/SSC expansion has occurred independently several times within monocotyledons. The discovery of new polymorphic markers within Musa chloroplast opens new perspectives to better understand the origin of cultivated triploid bananas. PMID:23840670

  4. The complete chloroplast genome of banana (Musa acuminata, Zingiberales): insight into plastid monocotyledon evolution.

    PubMed

    Martin, Guillaume; Baurens, Franc-Christophe; Cardi, Céline; Aury, Jean-Marc; D'Hont, Angélique

    2013-01-01

    Banana (genus Musa) is a crop of major economic importance worldwide. It is a monocotyledonous member of the Zingiberales, a sister group of the widely studied Poales. Most cultivated bananas are natural Musa inter-(sub-)specific triploid hybrids. A Musa acuminata reference nuclear genome sequence was recently produced based on sequencing of genomic DNA enriched in nucleus. The Musa acuminata chloroplast genome was assembled with chloroplast reads extracted from whole-genome-shotgun sequence data. The Musa chloroplast genome is a circular molecule of 169,972 bp with a quadripartite structure containing two single copy regions, a Large Single Copy region (LSC, 88,338 bp) and a Small Single Copy region (SSC, 10,768 bp) separated by Inverted Repeat regions (IRs, 35,433 bp). Two forms of the chloroplast genome relative to the orientation of SSC versus LSC were found. The Musa chloroplast genome shows an extreme IR expansion at the IR/SSC boundary relative to the most common structures found in angiosperms. This expansion consists of the integration of three additional complete genes (rps15, ndhH and ycf1) and part of the ndhA gene. No such expansion has been observed in monocots so far. Simple Sequence Repeats were identified in the Musa chloroplast genome and a new set of Musa chloroplastic markers was designed. The complete sequence of M. acuminata ssp malaccensis chloroplast we reported here is the first one for the Zingiberales order. As such it provides new insight in the evolution of the chloroplast of monocotyledons. In particular, it reinforces that IR/SSC expansion has occurred independently several times within monocotyledons. The discovery of new polymorphic markers within Musa chloroplast opens new perspectives to better understand the origin of cultivated triploid bananas.

  5. cDNA, genomic sequence cloning, and overexpression of EIF1 from the giant panda (Ailuropoda Melanoleuca) and the black bear (Ursus Thibetanus Mupinensis).

    PubMed

    Hou, Wan-ru; Tang, Yun; Hou, Yi-ling; Song, Yan; Zhang, Tian; Wu, Guang-fu

    2010-07-01

    Eukaryotic initiation factor (eIF) EIF1 is a universally conserved translation factor that is involved in translation initiation site selection. The cDNA and the genomic sequences of EIF1 were cloned successfully from the giant panda (Ailuropoda melanoleuca) and the black bear (Ursus thibetanus mupinensis) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-polymerase chain reaction, respectively. The cDNAs of the EIF1 cloned from the giant panda and the black bear are 418 bp in size, containing an open reading frame (ORF) of 342 bp encoding 113 amino acids. The length of the genomic sequence of the giant panda is 1909 bp, which contains four exons and three introns. The length of the genomic sequence of the black bear is 1897 bp, which also contains four exons and three introns. Sequence alignment indicates a high degree of homology to those of Homo sapiens, Mus musculus, Rattus norvegicus, and Bos Taurus at both amino acid and DNA levels. Topology prediction shows there are one N-glycosylation site, two Casein kinase II phosphorylation sites, and a Amidation site in the EIF1 protein of the giant panda and black bear. In addition, there is a protein kinase C phosphorylation site in EIF1 of the giant panda. The giant panda and the black bear EIF1 genes were overexpressed in E. coli BL21. The results indicated that the both EIF1 fusion proteins with the N-terminally His-tagged form gave rise to the accumulation of two expected 19 kDa polypeptide. The expression products obtained could be used to purify the proteins and study their function further.

  6. Cloning and characterization of an inulinase gene from the marine yeast Candida membranifaciens subsp. flavinogenie W14-3 and its expression in Saccharomyces sp. W0 for ethanol production.

    PubMed

    Zhang, Lin-Lin; Tan, Mei-Juan; Liu, Guang-Lei; Chi, Zhe; Wang, Guang-Yuan; Chi, Zhen-Ming

    2015-04-01

    The INU1 gene encoding an exo-inulinase from the marine-derived yeast Candida membranifaciens subsp. flavinogenie W14-3 was cloned and characterized. It had an open reading frame of 1,536 bp long encoding an inulinase. The coding region of it was not interrupted by any intron. The cloned gene encoded 512 amino acid residues of a protein with a putative signal peptide of 23 amino acids and a calculated molecular mass of 57.8 kDa. The protein sequence deduced from the inulinase gene contained the inulinase consensus sequences (WMNDPNGL), (RDP), ECP FS and Q. The protein also had six conserved putative N-glycosylation sites. The deduced inulinase from the yeast strain W14-3 was found to be closely related to that from Candida kutaonensis sp. nov. KRF1, Kluyveromyces marxianus, and Cryptococcus aureus G7a. The inulinase gene with its signal peptide encoding sequence was subcloned into the pMIRSC11 expression vector and expressed in Saccharomyces sp. W0. The recombinant yeast strain W14-3-INU-112 obtained could produce 16.8 U/ml of inulinase activity and 12.5 % (v/v) ethanol from 250 g/l of inulin within 168 h. The monosaccharides were detected after the hydrolysis of inulin with the crude inulinase (the yeast culture). All the results indicated that the cloned gene and the recombinant yeast strain W14-3-INU-112 had potential applications in biotechnology.

  7. The mitochondrial genome of the quiet-calling katydids, Xizicus fascipes (Orthoptera: Tettigoniidae: Meconematinae).

    PubMed

    Yang, Ming Ru; Zhou, Zhi Jun; Chang, Yan Lin; Zhao, Le Hong

    2012-08-01

    To help determine whether the typical arthropod arrangement was a synapomorphy for the whole Tettigoniidae, we sequenced the mitochondrial genome (mitogenome) of the quiet-calling katydids, Xizicus fascipes (Orthoptera: Tettigoniidae: Meconematinae). The 16,166-bp nucleotide sequences of X. fascipes mitogenome contains the typical gene content, gene order, base composition, and codon usage found in arthropod mitogenomes. As a whole, the X. fascipes mitogenome contains a lower A+T content (70.2%) found in the complete orthopteran mitogenomes determined to date. All protein-coding genes started with a typical ATN codon. Ten of the 13 protein-coding genes have a complete termination codon, but the remaining three genes (COIII, ND5 and ND4) terminate with incomplete T. All tRNAs have the typical clover-leaf structure of mitogenome tRNA, except for tRNA(Ser(AGN)), in which lengthened anticodon stem (9 bp) with a bulged nuleotide in the middle, an unusual T-stem (6 bp in constrast to the normal 5 bp), a mini DHU arm (2 bp) and no connector nucleotides. In the A+T-rich region, two (TA)n conserved blocks that were previously described in Ensifera and two 150-bp tandem repeats plus a partial copy of the composed at 61 bp of the beginning were present. Phylogenetic analysis found: i) the monophyly of Conocephalinae was interrupted by Elimaea cheni from Phaneropterinae; and ii) Meconematinae was the most basal group among these five subfamilies.

  8. Using the peptide BP100 as a cell-penetrating tool for the chemical engineering of actin filaments within living plant cells.

    PubMed

    Eggenberger, Kai; Mink, Christian; Wadhwani, Parvesh; Ulrich, Anne S; Nick, Peter

    2011-01-03

    The delivery of externally applied macromolecules or nanoparticles into living cells still represents a critically limiting step before the full capabilities of chemical engineering can be explored. Molecular transporters such as cell-penetrating peptides, peptoids, and other mimetics can be used to carry cargo across the cellular membrane, but it is still difficult to find suitable sequences that operate efficiently for any particular type of cell. Here we report that BP100 (KKLFKKILKYL-amide), originally designed as an antimicrobial peptide against plant pathogens, can be employed as a fast and efficient cell-penetrating agent to transport fluorescent test cargoes into the cytosol of walled plant cells. The uptake of BP100 proceeds slightly more slowly than the endocytosis of fluorescent dextranes, but BP100 accumulates more efficiently and to much higher levels (by an order of magnitude). The entry of BP100 can be efficiently blocked by latrunculin B; this suggests that actin filaments are essential to the uptake mechanism. To test whether this novel transporter can also be used to deliver functional cargoes, we designed a fusion construct of BP100 with the actin-binding Lifeact peptide (MGVADLIKKFESISKEE). We demonstrated that the short BP100 could transport the attached 17-residue sequence quickly and efficiently into tobacco cells. The Lifeact construct retained its functionality as it successfully labeled the actin bundles that tether the nucleus in the cell center.

  9. Whole genome sequence and genome annotation of Colletotrichum acutatum, causal agent of anthracnose in pepper plants in South Korea.

    PubMed

    Han, Joon-Hee; Chon, Jae-Kyung; Ahn, Jong-Hwa; Choi, Ik-Young; Lee, Yong-Hwan; Kim, Kyoung Su

    2016-06-01

    Colletotrichum acutatum is a destructive fungal pathogen which causes anthracnose in a wide range of crops. Here we report the whole genome sequence and annotation of C. acutatum strain KC05, isolated from an infected pepper in Kangwon, South Korea. Genomic DNA from the KC05 strain was used for the whole genome sequencing using a PacBio sequencer and the MiSeq system. The KC05 genome was determined to be 52,190,760 bp in size with a G + C content of 51.73% in 27 scaffolds and to contain 13,559 genes with an average length of 1516 bp. Gene prediction and annotation were performed by incorporating RNA-Seq data. The genome sequence of the KC05 was deposited at DDBJ/ENA/GenBank under the accession number LUXP00000000.

  10. Analysis of the DNA sequence of a 15,500 bp fragment near the left telomere of chromosome XV from Saccharomyces cerevisiae reveals a putative sugar transporter, a carboxypeptidase homologue and two new open reading frames.

    PubMed

    Gamo, F J; Lafuente, M J; Casamayor, A; Ariño, J; Aldea, M; Casas, C; Herrero, E; Gancedo, C

    1996-06-15

    We report the sequence of a 15.5 kb DNA segment located near the left telomere of chromosome XV of Saccharomyces cerevisiae. The sequence contains nine open reading frames (ORFs) longer than 300 bp. Three of them are internal to other ones. One corresponds to the gene LGT3 that encodes a putative sugar transporter. Three adjacent ORFs were separated by two stop codons in frame. These ORFs presented homology with the gene CPS1 that encodes carboxypeptidase S. The stop codons were not found in the same sequence derived from another yeast strain. Two other ORFs without significant homology in databases were also found. One of them, O0420, is very rich in serine and threonine and presents a series of repeated or similar amino acid stretches along the sequence.

  11. Mitochondrial genomes of the jungle crow Corvus macrorhynchos (Passeriformes: Corvidae) from shed feathers and a phylogenetic analysis of genus Corvus using mitochondrial protein-coding genes.

    PubMed

    Krzeminska, Urszula; Wilson, Robyn; Rahman, Sadequr; Song, Beng Kah; Seneviratne, Sampath; Gan, Han Ming; Austin, Christopher M

    2016-07-01

    The complete mitochondrial genomes of two jungle crows (Corvus macrorhynchos) were sequenced. DNA was extracted from tissue samples obtained from shed feathers collected in the field in Sri Lanka and sequenced using the Illumina MiSeq Personal Sequencer. Jungle crow mitogenomes have a structural organization typical of the genus Corvus and are 16,927 bp and 17,066 bp in length, both comprising 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal subunit genes, and a non-coding control region. In addition, we complement already available house crow (Corvus spelendens) mitogenome resources by sequencing an individual from Singapore. A phylogenetic tree constructed from Corvidae family mitogenome sequences available on GenBank is presented. We confirm the monophyly of the genus Corvus and propose to use complete mitogenome resources for further intra- and interspecies genetic studies.

  12. Molecular Characterization and Transcriptional Regulation Analysis of the Bovine PDHB Gene.

    PubMed

    Li, Anning; Zhang, Yaran; Zhao, Zhidong; Wang, Mingming; Zan, Linsen

    2016-01-01

    The pyruvate dehydrogenase beta subunit (PDHB) is a subunit of pyruvate dehydrogenase (E1), which catalyzes pyruvate into acetyl-CoA and provides a linkage between the tricarboxylic acid cycle (TCA) and the glycolysis pathway. Previous studies demonstrated PDHB to be positively related to the intramuscular fat (IMF) content. However, the transcriptional regulation of PDHB remains unclear. In our present study, the cDNA of bovine PDHB was cloned and the genomic structure was analyzed. The phylogenetic tree showed bovine PDHB to be closely related to goat and sheep, and least related to chicken. Spatial expression pattern analysis revealed the products of bovine PDHB to be widely expressed with the highest level in the fat of testis. To understand the transcriptional regulation of bovine PDHB, 1899 base pairs (bp) of the 5'-regulatory region was cloned. Sequence analysis neither found consensus TATA-box nor CCAAT-box in the 5'-flanking region of bovine PDHB. However, a CpG island was predicted from nucleotides -284 to +117. Serial deletion constructs of the 5'-flanking region, evaluated in dual-luciferase reporter assay, revealed the core promoter to be located 490bp upstream from the transcription initiation site (+1). Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP) in combination with asite-directed mutation experiment indicated both myogenin (MYOG) and the CCAAT/enhancer-binding protein beta (C/EBPß) to be important transcription factors for bovine PDHB in skeletal muscle cells and adipocytes. Our results provide an important basis for further investigation of the bovine PDHB function and regulation in cattle.

  13. Molecular Characterization and Transcriptional Regulation Analysis of the Bovine PDHB Gene

    PubMed Central

    Li, Anning; Zhang, Yaran; Zhao, Zhidong; Wang, Mingming; Zan, Linsen

    2016-01-01

    The pyruvate dehydrogenase beta subunit (PDHB) is a subunit of pyruvate dehydrogenase (E1), which catalyzes pyruvate into acetyl-CoA and provides a linkage between the tricarboxylic acid cycle (TCA) and the glycolysis pathway. Previous studies demonstrated PDHB to be positively related to the intramuscular fat (IMF) content. However, the transcriptional regulation of PDHB remains unclear. In our present study, the cDNA of bovine PDHB was cloned and the genomic structure was analyzed. The phylogenetic tree showed bovine PDHB to be closely related to goat and sheep, and least related to chicken. Spatial expression pattern analysis revealed the products of bovine PDHB to be widely expressed with the highest level in the fat of testis. To understand the transcriptional regulation of bovine PDHB, 1899 base pairs (bp) of the 5’-regulatory region was cloned. Sequence analysis neither found consensus TATA-box nor CCAAT-box in the 5’-flanking region of bovine PDHB. However, a CpG island was predicted from nucleotides -284 to +117. Serial deletion constructs of the 5’-flanking region, evaluated in dual-luciferase reporter assay, revealed the core promoter to be located 490bp upstream from the transcription initiation site (+1). Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP) in combination with asite-directed mutation experiment indicated both myogenin (MYOG) and the CCAAT/enhancer-binding protein beta (C/EBPß) to be important transcription factors for bovine PDHB in skeletal muscle cells and adipocytes. Our results provide an important basis for further investigation of the bovine PDHB function and regulation in cattle. PMID:27379520

  14. Using a color-coded ambigraphic nucleic acid notation to visualize conserved palindromic motifs within and across genomes

    PubMed Central

    2014-01-01

    Background Ambiscript is a graphically-designed nucleic acid notation that uses symbol symmetries to support sequence complementation, highlight biologically-relevant palindromes, and facilitate the analysis of consensus sequences. Although the original Ambiscript notation was designed to easily represent consensus sequences for multiple sequence alignments, the notation’s black-on-white ambiguity characters are unable to reflect the statistical distribution of nucleotides found at each position. We now propose a color-augmented ambigraphic notation to encode the frequency of positional polymorphisms in these consensus sequences. Results We have implemented this color-coding approach by creating an Adobe Flash® application ( http://www.ambiscript.org) that shades and colors modified Ambiscript characters according to the prevalence of the encoded nucleotide at each position in the alignment. The resulting graphic helps viewers perceive biologically-relevant patterns in multiple sequence alignments by uniquely combining color, shading, and character symmetries to highlight palindromes and inverted repeats in conserved DNA motifs. Conclusion Juxtaposing an intuitive color scheme over the deliberate character symmetries of an ambigraphic nucleic acid notation yields a highly-functional nucleic acid notation that maximizes information content and successfully embodies key principles of graphic excellence put forth by the statistician and graphic design theorist, Edward Tufte. PMID:24447494

  15. The complete chloroplast genomes of two Wisteria species, W. floribunda and W. sinensis (Fabaceae).

    PubMed

    Kim, Na-Rae; Kim, Kyunghee; Lee, Sang-Choon; Lee, Jung-Hoon; Cho, Seong-Hyun; Yu, Yeisoo; Kim, Young-Dong; Yang, Tae-Jin

    2016-11-01

    Wisteria floribunda and Wisteria sinensis are ornamental woody vines in the Fabaceae. The complete chloroplast genome sequences of the two species were generated by de novo assembly using whole genome next generation sequences. The chloroplast genomes of W. floribunda and W. sinensis were 130 960 bp and 130 561 bp long, respectively, and showed inverted repeat (IR)-lacking structures as those reported in IRLC in the Fabaceae. The chloroplast genomes of both species contained same number of protein-coding sequences (77), tRNA genes (30), and rRNA genes (4). The phylogenetic analysis with the reported chloroplast genomes confirmed close taxonomical relationship of W. floribunda and W. sinensis.

  16. Defining a Conformational Consensus Motif in Cotransin-Sensitive Signal Sequences: A Proteomic and Site-Directed Mutagenesis Study

    PubMed Central

    Klein, Wolfgang; Westendorf, Carolin; Schmidt, Antje; Conill-Cortés, Mercè; Rutz, Claudia; Blohs, Marcus; Beyermann, Michael; Protze, Jonas; Krause, Gerd; Krause, Eberhard; Schülein, Ralf

    2015-01-01

    The cyclodepsipeptide cotransin was described to inhibit the biosynthesis of a small subset of proteins by a signal sequence-discriminatory mechanism at the Sec61 protein-conducting channel. However, it was not clear how selective cotransin is, i.e. how many proteins are sensitive. Moreover, a consensus motif in signal sequences mediating cotransin sensitivity has yet not been described. To address these questions, we performed a proteomic study using cotransin-treated human hepatocellular carcinoma cells and the stable isotope labelling by amino acids in cell culture technique in combination with quantitative mass spectrometry. We used a saturating concentration of cotransin (30 micromolar) to identify also less-sensitive proteins and to discriminate the latter from completely resistant proteins. We found that the biosynthesis of almost all secreted proteins was cotransin-sensitive under these conditions. In contrast, biosynthesis of the majority of the integral membrane proteins was cotransin-resistant. Cotransin sensitivity of signal sequences was neither related to their length nor to their hydrophobicity. Instead, in the case of signal anchor sequences, we identified for the first time a conformational consensus motif mediating cotransin sensitivity. PMID:25806945

  17. The corepressor CtBP interacts with Evi-1 to repress transforming growth factor beta signaling.

    PubMed

    Izutsu, K; Kurokawa, M; Imai, Y; Maki, K; Mitani, K; Hirai, H

    2001-05-01

    Evi-1 is a zinc finger nuclear protein whose inappropriate expression leads to leukemic transformation of hematopoietic cells in mice and humans. This was previously shown to block the antiproliferative effect of transforming growth factor beta (TGF-beta). Evi-1 represses TGF-beta signaling by direct interaction with Smad3 through its first zinc finger motif. Here, it is demonstrated that Evi-1 represses Smad-induced transcription by recruiting C-terminal binding protein (CtBP) as a corepressor. Evi-1 associates with CtBP1 through one of the consensus binding motifs, and this association is required for efficient inhibition of TGF-beta signaling. A specific inhibitor for histone deacetylase (HDAc) alleviates Evi-1-mediated repression of TGF-beta signaling, suggesting that HDAc is involved in the transcriptional repression by Evi-1. This identifies a novel function of Evi-1 as a member of corepressor complexes and suggests that aberrant recruitment of corepressors is one of the mechanisms for Evi-1-induced leukemogenesis.

  18. rpoB Gene Sequencing for Identification of Corynebacterium Species

    PubMed Central

    Khamis, Atieh; Raoult, Didier; La Scola, Bernard

    2004-01-01

    The genus Corynebacterium is a heterogeneous group of species comprising human and animal pathogens and environmental bacteria. It is defined on the basis of several phenotypic characters and the results of DNA-DNA relatedness and, more recently, 16S rRNA gene sequencing. However, the 16S rRNA gene is not polymorphic enough to ensure reliable phylogenetic studies and needs to be completely sequenced for accurate identification. The almost complete rpoB sequences of 56 Corynebacterium species were determined by both PCR and genome walking methods. In all cases the percent similarities between different species were lower than those observed by 16S rRNA gene sequencing, even for those species with degrees of high similarity. Several clusters supported by high bootstrap values were identified. In order to propose a method for strain identification which does not require sequencing of the complete rpoB sequence (approximately 3,500 bp), we identified an area with a high degree of polymorphism, bordered by conserved sequences that can be used as universal primers for PCR amplification and sequencing. The sequence of this fragment (434 to 452 bp) allows accurate species identification and may be used in the future for routine sequence-based identification of Corynebacterium species. PMID:15364970

  19. Nucleotide sequences, genetic organization, and distribution of pEU30 and pEL60 from Erwinia amylovora.

    PubMed

    Foster, Gayle C; McGhee, Gayle C; Jones, Alan L; Sundin, George W

    2004-12-01

    The nucleotide sequences, genetic organization, and distribution of plasmids pEU30 (30,314 bp) and pEL60 (60,145 bp) from the plant pathogen Erwinia amylovora are described. The newly characterized pEU30 and pEL60 plasmids inhabited strains isolated in the western United States and Lebanon, respectively. The gene content of pEU30 resembled plasmids found in plant-associated bacteria, while that of pEL60 was most similar to IncL/M plasmids inhabiting enteric bacteria.

  20. Complete mitochondrial genome of Korean yellow-throated marten, Martes flavigula (Carnivora, Mustelidae).

    PubMed

    Jang, Kuem Hee; Hwang, Ui Wook

    2016-05-01

    The complete mitogenome sequence of Martes flavigula, which is an endangered and endemic species in South Korea, was determined. The genome is 16,533 bp in length and its gene arrangement pattern, gene content, and gene organization is identical to those of martens. The control region was located between the tRNAPro and tRNAPhe genes and is 1087 bp in length. This mitogenome sequence data might be an important role in the preservation of genetic resources by allowing researchers to conduct phylogenetic and systematic analyses of Mustelidae.

Top