cgDNAweb: a web interface to the cgDNA sequence-dependent coarse-grain model of double-stranded DNA.

PubMed

De Bruin, Lennart; Maddocks, John H

2018-06-14

The sequence-dependent statistical mechanical properties of fragments of double-stranded DNA is believed to be pertinent to its biological function at length scales from a few base pairs (or bp) to a few hundreds of bp, e.g. indirect read-out protein binding sites, nucleosome positioning sequences, phased A-tracts, etc. In turn, the equilibrium statistical mechanics behaviour of DNA depends upon its ground state configuration, or minimum free energy shape, as well as on its fluctuations as governed by its stiffness (in an appropriate sense). We here present cgDNAweb, which provides browser-based interactive visualization of the sequence-dependent ground states of double-stranded DNA molecules, as predicted by the underlying cgDNA coarse-grain rigid-base model of fragments with arbitrary sequence. The cgDNAweb interface is specifically designed to facilitate comparison between ground state shapes of different sequences. The server is freely available at cgDNAweb.epfl.ch with no login requirement.

Insights on genome size evolution from a miniature inverted repeat transposon driving a satellite DNA.

PubMed

Scalvenzi, Thibault; Pollet, Nicolas

2014-12-01

The genome size in eukaryotes does not correlate well with the number of genes they contain. We can observe this so-called C-value paradox in amphibian species. By analyzing an amphibian genome we asked how repetitive DNA can impact genome size and architecture. We describe here our discovery of a Tc1/mariner miniature inverted-repeat transposon family present in Xenopus frogs. These transposons named miDNA4 are unique since they contain a satellite DNA motif. We found that miDNA4 measured 331 bp, contained 25 bp long inverted terminal repeat sequences and a sequence motif of 119 bp present as a unique copy or as an array of 2-47 copies. We characterized the structure, dynamics, impact and evolution of the miDNA4 family and its satellite DNA in Xenopus frog genomes. This led us to propose a model for the evolution of these two repeated sequences and how they can synergize to increase genome size. Copyright © 2014 Elsevier Inc. All rights reserved.

Molecular cloning and characterization of satellite DNA sequences from constitutive heterochromatin of the habu snake (Protobothrops flavoviridis, Viperidae) and the Burmese python (Python bivittatus, Pythonidae).

PubMed

Matsubara, Kazumi; Uno, Yoshinobu; Srikulnath, Kornsorn; Seki, Risako; Nishida, Chizuko; Matsuda, Yoichi

2015-12-01

Highly repetitive DNA sequences of the centromeric heterochromatin provide valuable molecular cytogenetic markers for the investigation of genomic compartmentalization in the macrochromosomes and microchromosomes of sauropsids. Here, the relationship between centromeric heterochromatin and karyotype evolution was examined using cloned repetitive DNA sequences from two snake species, the habu snake (Protobothrops flavoviridis, Crotalinae, Viperidae) and Burmese python (Python bivittatus, Pythonidae). Three satellite DNA (stDNA) families were isolated from the heterochromatin of these snakes: 168-bp PFL-MspI from P. flavoviridis and 196-bp PBI-DdeI and 174-bp PBI-MspI from P. bivittatus. The PFL-MspI and PBI-DdeI sequences were localized to the centromeric regions of most chromosomes in the respective species, suggesting that the two sequences were the major components of the centromeric heterochromatin in these organisms. The PBI-MspI sequence was localized to the pericentromeric region of four chromosome pairs. The PFL-MspI and the PBI-DdeI sequences were conserved only in the genome of closely related species, Gloydius blomhoffii (Crotalinae) and Python molurus, respectively, although their locations on the chromosomes were slightly different. In contrast, the PBI-MspI sequence was also in the genomes of P. molurus and Boa constrictor (Boidae), and additionally localized to the centromeric regions of eight chromosome pairs in B. constrictor, suggesting that this sequence originated in the genome of a common ancestor of Pythonidae and Boidae, approximately 86 million years ago. The three stDNA sequences showed no genomic compartmentalization between the macrochromosomes and microchromosomes, suggesting that homogenization of the centromeric and/or pericentromeric stDNA sequences occurred in the macrochromosomes and microchromosomes of these snakes.

Organization of 5S rDNA in species of the fish Leporinus: two different genomic locations are characterized by distinct nontranscribed spacers.

PubMed

Martins, C; Galetti, P M

2001-10-01

To address understanding the organization of the 5S rRNA multigene family in the fish genome, the nucleotide sequence and organization array of 5S rDNA were investigated in the genus Leporinus, a representative freshwater fish group of South American fauna. PCR, subgenomic library screening, genomic blotting, fluorescence in situ hybridization, and DNA sequencing were employed in this study. Two arrays of 5S rDNA were identified for all species investigated, one consisting of monomeric repeat units of around 200 bp and another one with monomers of 900 bp. These 5S rDNA arrays were characterized by distinct NTS sequences (designated NTS-I and NTS-II for the 200- and 900-bp monomers, respectively); however, their coding sequences were nearly identical. The 5S rRNA genes were clustered in two chromosome loci, a major one corresponding to the NTS-I sites and a minor one corresponding to the NTS-II sites. The NTS-I sequence was variable among Leporinus spp., whereas the NTS-II was conserved among them and even in the related genus Schizodon. The distinct 5S rDNA arrays might characterize two 5S rRNA gene subfamilies that have been evolving independently in the genome.

The complete chloroplast genome sequence of Dianthus superbus var. longicalycinus.

PubMed

Gurusamy, Raman; Lee, Do-Hyung; Park, SeonJoo

2016-05-01

The complete chloroplast genome (cpDNA) sequence of Dianthus superbus var. longicalycinus is an economically important traditional Chinese medicine was reported and characterized. The cpDNA of Dianthus superbus var. longicalycinus is 149,539 bp, with 36.3% GC content. A pair of inverted repeats (IRs) of 24,803 bp is separated by a large single-copy region (LSC, 82,805 bp) and a small single-copy region (SSC, 17,128 bp). It encodes 85 protein-coding genes, 36 tRNA genes and 8 rRNA genes. Of 129 individual genes, 13 genes encoded one intron and three genes have two introns.

Introduction of a novel 18S rDNA gene arrangement along with distinct ITS region in the saline water microalga Dunaliella

PubMed Central

2010-01-01

Comparison of 18S rDNA gene sequences is a very promising method for identification and classification of living organisms. Molecular identification and discrimination of different Dunaliella species were carried out based on the size of 18S rDNA gene and, number and position of introns in the gene. Three types of 18S rDNA structure have already been reported: the gene with a size of ~1770 bp lacking any intron, with a size of ~2170 bp consisting one intron near 5' terminus, and with a size of ~2570 bp harbouring two introns near 5' and 3' termini. Hereby, we report a new 18S rDNA gene arrangement in terms of intron localization and nucleotide sequence in a Dunaliella isolated from Iranian salt lakes (ABRIINW-M1/2). PCR amplification with genus-specific primers resulted in production of a ~2170 bp DNA band, which is similar to that of D. salina 18S rDNA gene containing only one intron near 5' terminus. Whilst, sequence composition of the gene revealed the lack of any intron near 5' terminus in our isolate. Furthermore, another alteration was observed due to the presence of a 440 bp DNA fragment near 3' terminus. Accordingly, 18S rDNA gene of the isolate is clearly different from those of D. salina and any other Dunaliella species reported so far. Moreover, analysis of ITS region sequence showed the diversity of this region compared to the previously reported species. 18S rDNA and ITS sequences of our isolate were submitted with accesion numbers of EU678868 and EU927373 in NCBI database, respectively. The optimum growth rate of this isolate occured at the salinity level of 1 M NaCl. The maximum carotenoid content under stress condition of intense light (400 μmol photon m-2 s-1), high salinity (4 M NaCl) and deficiency of nitrate and phosphate nutritions reached to 240 ng/cell after 15 days. PMID:20377865

Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.

PubMed

He, Weiguo; Qin, Qinbo; Liu, Shaojun; Li, Tangluo; Wang, Jing; Xiao, Jun; Xie, Lihua; Zhang, Chun; Liu, Yun

2012-01-01

Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp) in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC) and only class IV from their male parent (TC). Triploid hybrids inherited class II and class III from their female parent (RCC) and class IV from their male parent (TC). Tetraploid hybrids gained class II and class III from their female parent (RCC), and generated a new 5S rDNA sequence (designated class I-N). The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

A DNA Sequence Element That Advances Replication Origin Activation Time in Saccharomyces cerevisiae

PubMed Central

Pohl, Thomas J.; Kolor, Katherine; Fangman, Walton L.; Brewer, Bonita J.; Raghuraman, M. K.

2013-01-01

Eukaryotic origins of DNA replication undergo activation at various times in S-phase, allowing the genome to be duplicated in a temporally staggered fashion. In the budding yeast Saccharomyces cerevisiae, the activation times of individual origins are not intrinsic to those origins but are instead governed by surrounding sequences. Currently, there are two examples of DNA sequences that are known to advance origin activation time, centromeres and forkhead transcription factor binding sites. By combining deletion and linker scanning mutational analysis with two-dimensional gel electrophoresis to measure fork direction in the context of a two-origin plasmid, we have identified and characterized a 19- to 23-bp and a larger 584-bp DNA sequence that are capable of advancing origin activation time. PMID:24022751

Submesoscale characteristics and transcription of a fatty acid elongase gene from a freshwater green microalgae, Myrmecia incisa Reisigl

NASA Astrophysics Data System (ADS)

Yu, Shuiyan; Liu, Shicheng; Li, Chunyang; Zhou, Zhigang

2011-01-01

Myrmecia incisa is a green coccoid freshwater microalgae, which is rich in arachidonic acid (ArA, C20: 4ω-6, δ5, 8, 11, 14), a long chain polyunsaturated fatty acid (PUFA), especially under nitrogen starvation stress. A cDNA library of M. incisa was constructed with λ phage vectors and a 545 nt expressed sequence tag (EST) was screened from this library as a putative elongase gene due to its 56% and 49% identity to Marchantia polymorpha L. and Ostreococcus tauri Courties et Chrétiennot-Dinet, respectively. Based upon this EST sequence, an elongase gene designated MiFAE was isolated from M. incisa via 5'/3' rapid amplification of cDNA ends (RACE). The cDNA sequence was 1 331 bp long and included a 33 bp 5'-untranslated region (UTR) and a 431 bp 3'-UTR with a typical poly-A tail. The 867 bp ORF encoded a predicted protein of 288 amino acids. This protein was characterized by a conserved histidine-rich box and a MYxYY motif that was present in other members of the elongase family. The genomic DNA sequence of MiFAE was found to be interrupted by three introns with splicing sites of Introns I (81 bp), II (81 bp), and III (67 bp) that conformed to the GT-AG rule. Quantitative real-time PCR showed that the transcription level of MiFAE in this microalga under nitrogen starvation was higher than that under normal condition. Prior to the ArA content accumulation, the transcription of MiFAE was enhanced, suggesting that it was possibly responsible for the ArA accumulation in this microalga cultured under nitrogen starvation conditions.

Cloning and sequence analysis of Hemonchus contortus HC58cDNA.

PubMed

Muleke, Charles I; Ruofeng, Yan; Lixin, Xu; Xinwen, Bo; Xiangrui, Li

2007-06-01

The complete coding sequence of Hemonchus contortus HC58cDNA was generated by rapid amplification of cDNA ends and polymerase chain reaction using primers based on the 5' and 3' ends of the parasite mRNA, accession no. AF305964. The HC58cDNA gene was 851 bp long, with open reading frame of 717 bp, precursors to 239 amino acids coding for approximately 27 kDa protein. Analysis of amino acid sequence revealed conserved residues of cysteine, histidine, asparagine, occluding loop pattern, hemoglobinase motif and glutamine of the oxyanion hole characteristic of cathepsin B like proteases (CBL). Comparison of the predicted amino acid sequences showed the protein shared 33.5-58.7% identity to cathepsin B homologues in the papain clan CA family (family C1). Phylogenetic analysis revealed close evolutionary proximity of the protein sequence to counterpart sequences in the CBL, suggesting that HC58cDNA was a member of the papain family.

DNA sequence analysis of ARS elements from chromosome III of Saccharomyces cerevisiae: identification of a new conserved sequence.

PubMed Central

Palzkill, T G; Oliver, S G; Newlon, C S

1986-01-01

Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

Structure of the highly repeated, long interspersed DNA family (LINE or L1Rn) of the rat.

PubMed Central

D'Ambrosio, E; Waitzkin, S D; Witney, F R; Salemme, A; Furano, A V

1986-01-01

We present the DNA sequence of a 6.7-kilobase member of the rat long interspersed repeated DNA family (LINE or L1Rn). This member (LINE 3) is flanked by a perfect 14-base-pair (bp) direct repeat and is a full-length, or close-to-full-length, member of this family. LINE 3 contains an approximately 100-bp A-rich right end, a number of long (greater than 400-bp) open reading frames, and a ca. 200-bp G + C-rich (ca. 60%) cluster near each terminus. Comparison of the LINE 3 sequence with the sequence of about one-half of another member, which we also present, as well as restriction enzyme analysis of the genomic copies of this family, indicates that in length and overall structure LINE 3 is quite typical of the 40,000 or so other genomic members of this family which would account for as much as 10% of the rat genome. Therefore, the rat LINE family is relatively homogeneous, which contrasts with the heterogeneous LINE families in primates and mice. Transcripts corresponding to the entire LINE sequence are abundant in the nuclear RNA of rat liver. The characteristics of the rat LINE family are discussed with respect to the possible function and evolution of this family of DNA sequences. Images PMID:3023845

Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.

PubMed

Schnitzler, P; Darai, G

1989-09-01

The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.

Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs.

PubMed

Yuan, Xiao-Long; Zhang, Zhe; Pan, Rong-Yang; Gao, Ning; Deng, Xi; Li, Bin; Zhang, Hao; Sangild, Per Torp; Li, Jia-Qi

2017-01-01

Reduced representation bisulfite sequencing (RRBS) has been widely used to profile genome-scale DNA methylation in mammalian genomes. However, the applications and technical performances of RRBS with different fragment sizes have not been systematically reported in pigs, which serve as one of the important biomedical models for humans. The aims of this study were to evaluate capacities of RRBS libraries with different fragment sizes to characterize the porcine genome. We found that the Msp I-digested segments between 40 and 220 bp harbored a high distribution peak at 74 bp, which were highly overlapped with the repetitive elements and might reduce the unique mapping alignment. The RRBS library of 110-220 bp fragment size had the highest unique mapping alignment and the lowest multiple alignment. The cost-effectiveness of the 40-110 bp, 110-220 bp and 40-220 bp fragment sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40-220 bp fragment sizes, and these detected CpG sties differently located in gene- and CpG island-related regions. In this study, our results demonstrated that selections of fragment sizes could affect the numbers and sequencing depth of detected CpG sites as well as the cost-efficiency. No single solution of RRBS is optimal in all circumstances for investigating genome-scale DNA methylation. This work provides the useful knowledge on designing and executing RRBS for investigating the genome-wide DNA methylation in tissues from pigs.

Extending the spectrum of DNA sequences retrieved from ancient bones and teeth

PubMed Central

Glocke, Isabelle; Meyer, Matthias

2017-01-01

The number of DNA fragments surviving in ancient bones and teeth is known to decrease with fragment length. Recent genetic analyses of Middle Pleistocene remains have shown that the recovery of extremely short fragments can prove critical for successful retrieval of sequence information from particularly degraded ancient biological material. Current sample preparation techniques, however, are not optimized to recover DNA sequences from fragments shorter than ∼35 base pairs (bp). Here, we show that much shorter DNA fragments are present in ancient skeletal remains but lost during DNA extraction. We present a refined silica-based DNA extraction method that not only enables efficient recovery of molecules as short as 25 bp but also doubles the yield of sequences from longer fragments due to improved recovery of molecules with single-strand breaks. Furthermore, we present strategies for monitoring inefficiencies in library preparation that may result from co-extraction of inhibitory substances during DNA extraction. The combination of DNA extraction and library preparation techniques described here substantially increases the yield of DNA sequences from ancient remains and provides access to a yet unexploited source of highly degraded DNA fragments. Our work may thus open the door for genetic analyses on even older material. PMID:28408382

Structure of genes and an insertion element in the methane producing archaebacterium Methanobrevibacter smithii.

PubMed

Hamilton, P T; Reeve, J N

1985-01-01

DNA fragments cloned from the methanogenic archaebacterium Methanobrevibacter smithii which complement mutations in the purE and proC genes of E. coli have been sequenced. Sequence analyses, transposon mutagenesis and expression in E. coli minicells indicate that purE and proC complementations result from the synthesis of M. smithii polypeptides with molecular weights of 36,697 and 27,836 respectively. The encoding genes appear to be located in operons. The M. smithii genome contains 69% A/T basepairs (bp) which is reflected in unusual codon usages and intergenic regions containing approximately 85% A/T bp. An insertion element, designated ISM1, was found within the cloned M. smithii DNA located adjacent to the proC complementing region. ISM1 is 1381 bp in length, has 29 bp terminal inverted repeat sequences and contains one major ORF encoded in 87% of the ISM1 sequence. ISM1 is mobile, present in approximately 10 copies per genome and integration duplicates 8 bp at the site of insertion. The duplicated sequences show homology with sequences within the 29 bp terminal repeat sequence of ISM1. Comparison of our data with sequences from halophilic archaebacteria suggests that 5'GAANTTTCA and 5'TTTTAATATAAA may be consensus promoter sequences for archaebacteria. These sequences closely resemble the consensus sequences which precede Drosophila heat-shock genes (Pelham 1982; Davidson et al. 1983). Methanogens appear to employ the eubacterial system of mRNA: 16SrRNA hybridization to ensure initiation of translation; the consensus ribosome binding sequence is 5'AGGTGA.

[An intriguing model for 5S rDNA sequences dispersion in the genome of freshwater stingray Potamotrygon motoro (Chondrichthyes: Potamotrygonidae)].

PubMed

Cruz, V P; Oliveira, C; Foresti, F

2015-01-01

5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.

Molecular structure and chromosome distribution of three repetitive DNA families in Anemone hortensis L. (Ranunculaceae).

PubMed

Mlinarec, Jelena; Chester, Mike; Siljak-Yakovlev, Sonja; Papes, Drazena; Leitch, Andrew R; Besendorfer, Visnja

2009-01-01

The structure, abundance and location of repetitive DNA sequences on chromosomes can characterize the nature of higher plant genomes. Here we report on three new repeat DNA families isolated from Anemone hortensis L.; (i) AhTR1, a family of satellite DNA (stDNA) composed of a 554-561 bp long EcoRV monomer; (ii) AhTR2, a stDNA family composed of a 743 bp long HindIII monomer and; (iii) AhDR, a repeat family composed of a 945 bp long HindIII fragment that exhibits some sequence similarity to Ty3/gypsy-like retroelements. Fluorescence in-situ hybridization (FISH) to metaphase chromosomes of A. hortensis (2n = 16) revealed that both AhTR1 and AhTR2 sequences co-localized with DAPI-positive AT-rich heterochromatic regions. AhTR1 sequences occur at intercalary DAPI bands while AhTR2 sequences occur at 8-10 terminally located heterochromatic blocks. In contrast AhDR sequences are dispersed over all chromosomes as expected of a Ty3/gypsy-like element. AhTR2 and AhTR1 repeat families include polyA- and polyT-tracks, AT/TA-motifs and a pentanucleotide sequence (CAAAA) that may have consequences for chromatin packing and sequence homogeneity. AhTR2 repeats also contain TTTAGGG motifs and degenerate variants. We suggest that they arose by interspersion of telomeric repeats with subtelomeric repeats, before hybrid unit(s) amplified through the heterochromatic domain. The three repetitive DNA families together occupy approximately 10% of the A. hortensis genome. Comparative analyses of eight Anemone species revealed that the divergence of the A. hortensis genome was accompanied by considerable modification and/or amplification of repeats.

Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

PubMed

Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

2000-05-31

cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

cDNA cloning of Brassica napus malonyl-CoA:ACP transacylase (MCAT) (fab D) and complementation of an E. coli MCAT mutant.

PubMed

Simon, J W; Slabas, A R

1998-09-18

The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.

Japanese Wolves are Genetically Divided into Two Groups Based on an 8-Nucleotide Insertion/Deletion within the mtDNA Control Region.

PubMed

Ishiguro, Naotaka; Inoshima, Yasuo; Yanai, Tokuma; Sasaki, Motoki; Matsui, Akira; Kikuchi, Hiroki; Maruyama, Masashi; Hongo, Hitomi; Vostretsov, Yuri E; Gasilin, Viatcheslav; Kosintsev, Pavel A; Quanjia, Chen; Chunxue, Wang

2016-02-01

The mitochondrial DNA (mtDNA) control region (198- to 598-bp) of four ancient Canis specimens (two Canis mandibles, a cranium, and a first phalanx) was examined, and each specimen was genetically identified as Japanese wolf. Two unique nucleotide substitutions, the 78-C insertion and the 482-G deletion, both of which are specific for Japanese wolf, were observed in each sample. Based on the mtDNA sequences analyzed, these four specimens and 10 additional Japanese wolf samples could be classified into two groups- Group A (10 samples) and Group B (4 samples)-which contain or lack an 8-bp insertion/deletion (indel), respectively. Interestingly, three dogs (Akita-b, Kishu 25, and S-husky 102) that each contained Japanese wolf-specific features were also classified into Group A or B based on the 8-bp indel. To determine the origin or ancestor of the Japanese wolf, mtDNA control regions of ancient continental Canis specimens were examined; 84 specimens were from Russia, and 29 were from China. However, none of these 113 specimens contained Japanese wolf-specific sequences. Moreover, none of 426 Japanese modern hunting dogs examined contained these Japanese wolf-specific mtDNA sequences. The mtDNA control region sequences of Groups A and B appeared to be unique to grey wolf and dog populations.

Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki

A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less

Plasmid origin of replication of herpesvirus papio: DNA sequence and enhancer function.

PubMed Central

Loeb, D D; Sung, N S; Pesano, R L; Sexton, C J; Hutchison, C; Pagano, J S

1990-01-01

Herpesvirus papio (HVP) is a lymphotropic virus of baboons which is related to Epstein-Barr virus (EBV) and produces latent infection. The nucleotide sequence of the 5,775-base-pair (bp) EcoRI K fragment of HVP, which has previously been shown to confer the ability to replicate autonomously, has been determined. Within this DNA fragment is a region which bears structural and sequence similarity to the ori-P region of EBV. The HVP ori-P region has a 10- by 26-bp tandem array which is related to the 20- by 30-bp tandem array from the EBV ori-P region. In HVP there is an intervening region of 764 bp followed by five partial copies of the 26-bp monomer. Both the EBV and HVP 3' regions have the potential to form dyad structures which, however, differ in arrangement. We also demonstrate that a transcriptional enhancer which requires transactivation by a virus-encoded factor is present in the HVP ori-P. Images PMID:2159548

Sequence-dependent base pair stepping dynamics in XPD helicase unwinding

PubMed Central

Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

2013-01-01

Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615

Burkholderia pseudomallei sequencing identifies genomic clades with distinct recombination, accessory, and epigenetic profiles

PubMed Central

Nandi, Tannistha; Holden, Matthew T.G.; Didelot, Xavier; Mehershahi, Kurosh; Boddey, Justin A.; Beacham, Ifor; Peak, Ian; Harting, John; Baybayan, Primo; Guo, Yan; Wang, Susana; How, Lee Chee; Sim, Bernice; Essex-Lopresti, Angela; Sarkar-Tyson, Mitali; Nelson, Michelle; Smither, Sophie; Ong, Catherine; Aw, Lay Tin; Hoon, Chua Hui; Michell, Stephen; Studholme, David J.; Titball, Richard; Chen, Swaine L.; Parkhill, Julian

2015-01-01

Burkholderia pseudomallei (Bp) is the causative agent of the infectious disease melioidosis. To investigate population diversity, recombination, and horizontal gene transfer in closely related Bp isolates, we performed whole-genome sequencing (WGS) on 106 clinical, animal, and environmental strains from a restricted Asian locale. Whole-genome phylogenies resolved multiple genomic clades of Bp, largely congruent with multilocus sequence typing (MLST). We discovered widespread recombination in the Bp core genome, involving hundreds of regions associated with multiple haplotypes. Highly recombinant regions exhibited functional enrichments that may contribute to virulence. We observed clade-specific patterns of recombination and accessory gene exchange, and provide evidence that this is likely due to ongoing recombination between clade members. Reciprocally, interclade exchanges were rarely observed, suggesting mechanisms restricting gene flow between clades. Interrogation of accessory elements revealed that each clade harbored a distinct complement of restriction-modification (RM) systems, predicted to cause clade-specific patterns of DNA methylation. Using methylome sequencing, we confirmed that representative strains from separate clades indeed exhibit distinct methylation profiles. Finally, using an E. coli system, we demonstrate that Bp RM systems can inhibit uptake of non-self DNA. Our data suggest that RM systems borne on mobile elements, besides preventing foreign DNA invasion, may also contribute to limiting exchanges of genetic material between individuals of the same species. Genomic clades may thus represent functional units of genetic isolation in Bp, modulating intraspecies genetic diversity. PMID:25236617

Identification by Subtractive Hybridization of a Novel Insertion Sequence Specific for Virulent Strains of Porphyromonas gingivalis

PubMed Central

Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji

1999-01-01

Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208

A new family of satellite DNA sequences as a major component of centromeric heterochromatin in owls (Strigiformes).

PubMed

Yamada, Kazuhiko; Nishida-Umehara, Chizuko; Matsuda, Yoichi

2004-03-01

We isolated a new family of satellite DNA sequences from HaeIII- and EcoRI-digested genomic DNA of the Blakiston's fish owl ( Ketupa blakistoni). The repetitive sequences were organized in tandem arrays of the 174 bp element, and localized to the centromeric regions of all macrochromosomes, including the Z and W chromosomes, and microchromosomes. This hybridization pattern was consistent with the distribution of C-band-positive centromeric heterochromatin, and the satellite DNA sequences occupied 10% of the total genome as a major component of centromeric heterochromatin. The sequences were homogenized between macro- and microchromosomes in this species, and therefore intraspecific divergence of the nucleotide sequences was low. The 174 bp element cross-hybridized to the genomic DNA of six other Strigidae species, but not to that of the Tytonidae, suggesting that the satellite DNA sequences are conserved in the same family but fairly divergent between the different families in the Strigiformes. Secondly, the centromeric satellite DNAs were cloned from eight Strigidae species, and the nucleotide sequences of 41 monomer fragments were compared within and between species. Molecular phylogenetic relationships of the nucleotide sequences were highly correlated with both the taxonomy based on morphological traits and the phylogenetic tree constructed by DNA-DNA hybridization. These results suggest that the satellite DNA sequence has evolved by concerted evolution in the Strigidae and that it is a good taxonomic and phylogenetic marker to examine genetic diversity between Strigiformes species.

The CentO satellite confers translational and rotational phasing on cenH3 nucleosomes in rice centromeres.

PubMed

Zhang, Tao; Talbert, Paul B; Zhang, Wenli; Wu, Yufeng; Yang, Zujun; Henikoff, Jorja G; Henikoff, Steven; Jiang, Jiming

2013-12-10

Plant and animal centromeres comprise megabases of highly repeated satellite sequences, yet centromere function can be specified epigenetically on single-copy DNA by the presence of nucleosomes containing a centromere-specific variant of histone H3 (cenH3). We determined the positions of cenH3 nucleosomes in rice (Oryza sativa), which has centromeres composed of both the 155-bp CentO satellite repeat and single-copy non-CentO sequences. We find that cenH3 nucleosomes protect 90-100 bp of DNA from micrococcal nuclease digestion, sufficient for only a single wrap of DNA around the cenH3 nucleosome core. cenH3 nucleosomes are translationally phased with 155-bp periodicity on CentO repeats, but not on non-CentO sequences. CentO repeats have an ∼10-bp periodicity in WW dinucleotides and in micrococcal nuclease cleavage, providing evidence for rotational phasing of cenH3 nucleosomes on CentO and suggesting that satellites evolve for translational and rotational stabilization of centromeric nucleosomes.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

A complete mitochondrial genome sequence of Asian black bear Sichuan subspecies (Ursus thibetanus mupinensis)

PubMed Central

Hou, Wan-ru; Chen, Yu; Wu, Xia; Hu, Jin-chu; Peng, Zheng-song; Yang, Jung; Tang, Zong-xiang; Zhou, Cai-Quan; Li, Yu-ming; Yang, Shi-kui; Du, Yu-jie; Kong, Ling-lu; Ren, Zheng-long; Zhang, Huai-yu; Shuai, Su-rong

2007-01-01

We obtained the complete mitochondrial genome of U.thibetanus mupinensis by DNA sequencing based on the PCR fragments of 18 primers we designed. The results indicate that the mtDNA is 16 868 bp in size, encodes 13 protein genes, 22 tRNA genes, and 2 rRNA genes, with an overall H-strand base composition of 31.2% A, 25.4% C, 15.5% G and 27.9% T. The sequence of the control region (CR) located between tRNA-Pro and tRNA-Phe is 1422 bp in size, consists of 8.43% of the whole genome, GC content is 51.9% and has a 6bp tandem repeat and two 10bp tandem repeats identified by using the Tandem Repeats Finder. U. thibetanus mupinensis mitochondrial genome shares high similarity with those of three other Ursidae: U. americanus (91.46%), U. arctos (89.25%) and U. maritimus (87.66%). PMID:17205108

Isolation of a sex-linked DNA sequence in cranes.

PubMed

Duan, W; Fuerst, P A

2001-01-01

A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.

DYZ1 arrays show sequence variation between the monozygotic males

PubMed Central

2014-01-01

Background Monozygotic twins (MZT) are an important resource for genetical studies in the context of normal and diseased genomes. In the present study we used DYZ1, a satellite fraction present in the form of tandem arrays on the long arm of the human Y chromosome, as a tool to uncover sequence variations between the monozygotic males. Results We detected copy number variation, frequent insertions and deletions within the sequences of DYZ1 arrays amongst all the three sets of twins used in the present study. MZT1b showed loss of 35 bp compared to that in 1a, whereas 2a showed loss of 31 bp compared to that in 2b. Similarly, 3b showed 10 bp insertion compared to that in 3a. MZT1a germline DNA showed loss of 5 bp and 1b blood DNA showed loss of 26 bp compared to that of 1a blood and 1b germline DNA, respectively. Of the 69 restriction sites detected in DYZ1 arrays, MboII, BsrI, TspEI and TaqI enzymes showed frequent loss and or gain amongst all the 3 pairs studied. MZT1 pair showed loss/gain of VspI, BsrDI, AgsI, PleI, TspDTI, TspEI, TfiI and TaqI restriction sites in both blood and germline DNA. All the three sets of MZT showed differences in the number of DYZ1 copies. FISH signals reflected somatic mosaicism of the DYZ1 copies across the cells. Conclusions DYZ1 showed both sequence and copy number variation between the MZT males. Sequence variation was also noticed between germline and blood DNA samples of the same individual as we observed at least in one set of sample. The result suggests that DYZ1 faithfully records all the genetical changes occurring after the twining which may be ascribed to the environmental factors. PMID:24495361

Modified midi- and mini-multiplex PCR systems for mitochondrial DNA control region sequence analysis in degraded samples.

PubMed

Kim, Na Young; Lee, Hwan Young; Park, Sun Joo; Yang, Woo Ick; Shin, Kyoung-Jin

2013-05-01

Two multiplex polymerase chain reaction (PCR) systems (Midiplex and Miniplex) were developed for the amplification of the mitochondrial DNA (mtDNA) control region, and the efficiencies of the multiplexes for amplifying degraded DNA were validated using old skeletal remains. The Midiplex system consisted of two multiplex PCRs to amplify six overlapping amplicons ranging in length from 227 to 267 bp. The Miniplex system consisted of three multiplex PCRs to amplify 10 overlapping short amplicons ranging in length from 142 to 185 bp. Most mtDNA control region sequences of several 60-year-old and 400-500-year-old skeletal remains were successfully obtained using both PCR systems and consistent with those previously obtained by monoplex amplification. The multiplex system consisting of smaller amplicons is effective for mtDNA sequence analyses of ancient and forensic degraded samples, saving time, cost, and the amount of DNA sample consumed during analysis. © 2013 American Academy of Forensic Sciences.

The complete chloroplast genome of Capsicum annuum var. glabriusculum using Illumina sequencing.

PubMed

Raveendar, Sebastin; Na, Young-Wang; Lee, Jung-Ro; Shim, Donghwan; Ma, Kyung-Ho; Lee, Sok-Young; Chung, Jong-Wook

2015-07-20

Chloroplast (cp) genome sequences provide a valuable source for DNA barcoding. Molecular phylogenetic studies have concentrated on DNA sequencing of conserved gene loci. However, this approach is time consuming and more difficult to implement when gene organization differs among species. Here we report the complete re-sequencing of the cp genome of Capsicum pepper (Capsicum annuum var. glabriusculum) using the Illumina platform. The total length of the cp genome is 156,817 bp with a 37.7% overall GC content. A pair of inverted repeats (IRs) of 50,284 bp were separated by a small single copy (SSC; 18,948 bp) and a large single copy (LSC; 87,446 bp). The number of cp genes in C. annuum var. glabriusculum is the same as that in other Capsicum species. Variations in the lengths of LSC; SSC and IR regions were the main contributors to the size variation in the cp genome of this species. A total of 125 simple sequence repeat (SSR) and 48 insertions or deletions variants were found by sequence alignment of Capsicum cp genome. These findings provide a foundation for further investigation of cp genome evolution in Capsicum and other higher plants.

Structural analysis of DNA binding by C.Csp231I, a member of a novel class of R-M controller proteins regulating gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shevtsov, M. B.; Streeter, S. D.; Thresh, S.-J.

2015-02-01

The structure of the new class of controller proteins (exemplified by C.Csp231I) in complex with its 21 bp DNA-recognition sequence is presented, and the molecular basis of sequence recognition in this class of proteins is discussed. An unusual extended spacer between the dimer binding sites suggests a novel interaction between the two C-protein dimers. In a wide variety of bacterial restriction–modification systems, a regulatory ‘controller’ protein (or C-protein) is required for effective transcription of its own gene and for transcription of the endonuclease gene found on the same operon. We have recently turned our attention to a new class ofmore » controller proteins (exemplified by C.Csp231I) that have quite novel features, including a much larger DNA-binding site with an 18 bp (∼60 Å) spacer between the two palindromic DNA-binding sequences and a very different recognition sequence from the canonical GACT/AGTC. Using X-ray crystallography, the structure of the protein in complex with its 21 bp DNA-recognition sequence was solved to 1.8 Å resolution, and the molecular basis of sequence recognition in this class of proteins was elucidated. An unusual aspect of the promoter sequence is the extended spacer between the dimer binding sites, suggesting a novel interaction between the two C-protein dimers when bound to both recognition sites correctly spaced on the DNA. A U-bend model is proposed for this tetrameric complex, based on the results of gel-mobility assays, hydrodynamic analysis and the observation of key contacts at the interface between dimers in the crystal.« less

Structure, organization and expression of common carp (Cyprinus carpio L.) SLP-76 gene.

PubMed

Huang, Rong; Sun, Xiao-Feng; Hu, Wei; Wang, Ya-Ping; Guo, Qiong-Lin

2008-05-01

SLP-76 is an important member of the SLP-76 family of adapters, and it plays a key role in TCR signaling and T cell function. Partial cDNA sequence of SLP-76 of common carp (Cyprinus carpio L.) was isolated from thymus cDNA library by the method of suppression subtractive hybridization (SSH). Subsequently, the full length cDNA of carp SLP-76 was obtained by means of 3' RACE and 5' RACE, respectively. The full length cDNA of carp SLP-76 was 2007 bp, consisting of a 5'-terminal untranslated region (UTR) of 285 bp, a 3'-terminal UTR of 240 bp, and an open reading frame of 1482 bp. Sequence comparison showed that the deduced amino acid sequence of carp SLP-76 had an overall similarity of 34-73% to that of other species homologues, and it was composed of an NH2-terminal domain, a central proline-rich domain, and a C-terminal SH2 domain. Amino acid sequence analysis indicated the existence of a Gads binding site R-X-X-K, a 10-aa-long sequence which binds to the SH3 domain of LCK in vitro, and three conserved tyrosine-containing sequence in the NH2-terminal domain. Then we used PCR to obtain a genomic DNA which covers the entire coding region of carp SLP-76. In the 9.2k-long genomic sequence, twenty one exons and twenty introns were identified. RT-PCR results showed that carp SLP-76 was expressed predominantly in hematopoietic tissues, and was upregulated in thymus tissue of four-month carp compared to one-year old carp. RT-PCR and virtual northern hybridization results showed that carp SLP-76 was also upregulated in thymus tissue of GH transgenic carp at the age of four-months. These results suggest that the expression level of SLP-76 gene may be related to thymocyte development in teleosts.

Real-time observation of DNA target interrogation and product release by the RNA-guided endonuclease CRISPR Cpf1 (Cas12a).

PubMed

Singh, Digvijay; Mallon, John; Poddar, Anustup; Wang, Yanbo; Tippana, Ramreddy; Yang, Olivia; Bailey, Scott; Ha, Taekjip

2018-05-22

CRISPR-Cas9, which imparts adaptive immunity against foreign genomic invaders in certain prokaryotes, has been repurposed for genome-engineering applications. More recently, another RNA-guided CRISPR endonuclease called Cpf1 (also known as Cas12a) was identified and is also being repurposed. Little is known about the kinetics and mechanism of Cpf1 DNA interaction and how sequence mismatches between the DNA target and guide-RNA influence this interaction. We used single-molecule fluorescence analysis and biochemical assays to characterize DNA interrogation, cleavage, and product release by three Cpf1 orthologs. Our Cpf1 data are consistent with the DNA interrogation mechanism proposed for Cas9. They both bind any DNA in search of protospacer-adjacent motif (PAM) sequences, verify the target sequence directionally from the PAM-proximal end, and rapidly reject any targets that lack a PAM or that are poorly matched with the guide-RNA. Unlike Cas9, which requires 9 bp for stable binding and ∼16 bp for cleavage, Cpf1 requires an ∼17-bp sequence match for both stable binding and cleavage. Unlike Cas9, which does not release the DNA cleavage products, Cpf1 rapidly releases the PAM-distal cleavage product, but not the PAM-proximal product. Solution pH, reducing conditions, and 5' guanine in guide-RNA differentially affected different Cpf1 orthologs. Our findings have important implications on Cpf1-based genome engineering and manipulation applications.

[Molecular identification and detection of moon jellyfish (Aurelia sp.) based on partial sequencing of mitochondrial 16S rDNA and COI].

PubMed

Wang, Jian-Yan; Zhen, Yu; Wang, Guo-shan; Mi, Tie-Zhu; Yu, Zhi-gang

2013-03-01

Taking the moon jellyfish Aurelia sp. commonly found in our coastal sea areas as test object, its genome DNA was extracted, the partial sequences of mt-16S rDNA (650 bp) and mt-COI (709 bp) were PCR-amplified, and, after purification, cloning, and sequencing, the sequences obtained were BLASTn-analyzed. The sequences of greater difference with those of the other jellyfish were chosen, and eight specific primers for the mt-16S rDNA and mt-COI of Aurelia sp. were designed, respectively. The specificity test indicated that the primer AS3 for the mt-16S rDNA and the primer AC3 for the mt-COI were excellent in rapidly detecting the target jellyfish from Rhopilema esculentum, Nemopilema nomurai, Cyanea nozakii, Acromitus sp., and Aurelia sp., and thus, the techniques for the molecular identification and detection of moon jellyfish were preliminarily established, which could get rid of the limitations in classical morphological identification of Aurelia sp. , being able to find the Aurelia sp. in the samples more quickly and accurately.

Structural basis of DNA sequence recognition by the response regulator PhoP in Mycobacterium tuberculosis.

PubMed

He, Xiaoyuan; Wang, Liqin; Wang, Shuishu

2016-04-15

The transcriptional regulator PhoP is an essential virulence factor in Mycobacterium tuberculosis, and it presents a target for the development of new anti-tuberculosis drugs and attenuated tuberculosis vaccine strains. PhoP binds to DNA as a highly cooperative dimer by recognizing direct repeats of 7-bp motifs with a 4-bp spacer. To elucidate the PhoP-DNA binding mechanism, we determined the crystal structure of the PhoP-DNA complex. The structure revealed a tandem PhoP dimer that bound to the direct repeat. The surprising tandem arrangement of the receiver domains allowed the four domains of the PhoP dimer to form a compact structure, accounting for the strict requirement of a 4-bp spacer and the highly cooperative binding of the dimer. The PhoP-DNA interactions exclusively involved the effector domain. The sequence-recognition helix made contact with the bases of the 7-bp motif in the major groove, and the wing interacted with the adjacent minor groove. The structure provides a starting point for the elucidation of the mechanism by which PhoP regulates the virulence of M. tuberculosis and guides the design of screening platforms for PhoP inhibitors.

Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.

PubMed

Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R

1987-01-01

The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.

Structural and Thermodynamic Signatures of DNA Recognition by Mycobacterium tuberculosis DnaA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsodikov, Oleg V.; Biswas, Tapan

An essential protein, DnaA, binds to 9-bp DNA sites within the origin of replication oriC. These binding events are prerequisite to forming an enigmatic nucleoprotein scaffold that initiates replication. The number, sequences, positions, and orientations of these short DNA sites, or DnaA boxes, within the oriCs of different bacteria vary considerably. To investigate features of DnaA boxes that are important for binding Mycobacterium tuberculosis DnaA (MtDnaA), we have determined the crystal structures of the DNA binding domain (DBD) of MtDnaA bound to a cognate MtDnaA-box (at 2.0 {angstrom} resolution) and to a consensus Escherichia coli DnaA-box (at 2.3 {angstrom}). Thesemore » structures, complemented by calorimetric equilibrium binding studies of MtDnaA DBD in a series of DnaA-box variants, reveal the main determinants of DNA recognition and establish the [T/C][T/A][G/A]TCCACA sequence as a high-affinity MtDnaA-box. Bioinformatic and calorimetric analyses indicate that DnaA-box sequences in mycobacterial oriCs generally differ from the optimal binding sequence. This sequence variation occurs commonly at the first 2 bp, making an in vivo mycobacterial DnaA-box effectively a 7-mer and not a 9-mer. We demonstrate that the decrease in the affinity of these MtDnaA-box variants for MtDnaA DBD relative to that of the highest-affinity box TTGTCCACA is less than 10-fold. The understanding of DnaA-box recognition by MtDnaA and E. coli DnaA enables one to map DnaA-box sequences in the genomes of M. tuberculosis and other eubacteria.« less

Influence of quasi-specific sites on kinetics of target DNA search by a sequence-specific DNA-binding protein.

PubMed

Kemme, Catherine A; Esadze, Alexandre; Iwahara, Junji

2015-11-10

Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such "quasi-specific" sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1's association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins.

Influence of Quasi-Specific Sites on Kinetics of Target DNA Search by a Sequence-Specific DNA-Binding Protein

PubMed Central

2015-01-01

Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such “quasi-specific” sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1’s association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins. PMID:26502071

The complete chloroplast genome of Tianshan Snow Lotus (Saussurea involucrata), a famous traditional Chinese medicinal plant of the family Asteraceae.

PubMed

Xie, Qing; Shen, Kang-Ning; Hao, Xiuying; Nam, Phan Nhut; Ngoc Hieu, Bui Thi; Chen, Ching-Hung; Zhu, Changqing; Lin, Yen-Chang; Hsiao, Chung-Der

2017-03-01

abtract We decoded the complete chloroplast DNA (cpDNA) sequence of the Tianshan Snow Lotus (Saussurea involucrata), a famous traditional Chinese medicinal plant of the family Asteraceae, by using next-generation sequencing technology. The genome consists of 152 490 bp containing a pair of inverted repeats (IRs) of 25 202 bp, which was separated by a large single-copy region and a small single-copy region of 83 446 bp and 18 639 bp, respectively. The genic regions account for 57.7% of whole cpDNA, and the GC content of the cpDNA was 37.7%. The S. involucrata cpDNA encodes 114 unigenes (82 protein-coding genes, 4 rRNA genes, and 28 tRNA genes). There are eight protein-coding genes (atpF, ndhA, ndhB, rpl2, rpoC1, rps16, clpP, and ycf3) and five tRNA genes (trnA-UGC, trnI-GAU, trnK-UUU, trnL-UAA, and trnV-UAC) containing introns. A phylogenetic analysis of the 11 complete cpDNA from Asteracease showed that S. involucrata is closely related to Centaurea diffusa (Diffuse Knapweed). The complete cpDNA of S. involucrata provides essential and important DNA molecular data for further phylogenetic and evolutionary analysis for Asteraceae.

Medium-sized tandem repeats represent an abundant component of the Drosophila virilis genome.

PubMed

Abdurashitov, Murat A; Gonchar, Danila A; Chernukhin, Valery A; Tomilov, Victor N; Tomilova, Julia E; Schostak, Natalia G; Zatsepina, Olga G; Zelentsova, Elena S; Evgen'ev, Michael B; Degtyarev, Sergey K H

2013-11-09

Previously, we developed a simple method for carrying out a restriction enzyme analysis of eukaryotic DNA in silico, based on the known DNA sequences of the genomes. This method allows the user to calculate lengths of all DNA fragments that are formed after a whole genome is digested at the theoretical recognition sites of a given restriction enzyme. A comparison of the observed peaks in distribution diagrams with the results from DNA cleavage using several restriction enzymes performed in vitro have shown good correspondence between the theoretical and experimental data in several cases. Here, we applied this approach to the annotated genome of Drosophila virilis which is extremely rich in various repeats. Here we explored the combined approach to perform the restriction analysis of D. virilis DNA. This approach enabled to reveal three abundant medium-sized tandem repeats within the D. virilis genome. While the 225 bp repeats were revealed previously in intergenic non-transcribed spacers between ribosomal genes of D. virilis, two other families comprised of 154 bp and 172 bp repeats were not described. Tandem Repeats Finder search demonstrated that 154 bp and 172 bp units are organized in multiple clusters in the genome of D. virilis. Characteristically, only 154 bp repeats derived from Helitron transposon are transcribed. Using in silico digestion in combination with conventional restriction analysis and sequencing of repeated DNA fragments enabled us to isolate and characterize three highly abundant families of medium-sized repeats present in the D. virilis genome. These repeats comprise a significant portion of the genome and may have important roles in genome function and structural integrity. Therefore, we demonstrated an approach which makes possible to investigate in detail the gross arrangement and expression of medium-sized repeats basing on sequencing data even in the case of incompletely assembled and/or annotated genomes.

A novel species-specific tandem repeat DNA family from Sinapis arvensis: detection of telomere-like sequences.

PubMed

Kapila, R; Das, S; Srivastava, P S; Lakshmikumaran, M

1996-08-01

DNA sequences representing a tandemly repeated DNA family of the Sinapis arvensis genome were cloned and characterized. The 700-bp tandem repeat family is represented by two clones, pSA35 and pSA52, which are 697 and 709 bp in length, respectively. Dot matrix analysis of the sequences indicates the presence of repeated elements within each monomeric unit. Sequence analysis of the repetitive region of clones pSA35 and pSA52 shows that there are several copies of a 7-bp repeat element organized in tandem. The consensus sequence of this repeat element is 5'-TTTAGGG-3'. These elements are highly mutated and the difference in length between the two clones is due to different copy numbers of these elements. The repetitive region of clone pSA35 has 26 copies of the element TTTAGGG, whereas clone pSA52 has 28 copies. The repetitive region in both clones is flanked on either side by inverted repeats that may be footprints of a transposition event. Sequence comparison indicates that the element TTTAGGG is identical to telomeric repeats present in Arabidopsis, maize, tomato, and other plants. However, Bal31 digestion kinetics indicates non-telomeric localization of the 700-bp tandem repeats. The clones represent a novel repeat family as (i) they contain telomere-like motifs as subrepeats within each unit; and (ii) they do not hybridize to related crucifers and are species-specific in nature.

Cloning of human prourokinase cDNA without the signal peptide and expression in Escherichia coli.

PubMed

Hu, B; Li, J; Yu, W; Fang, J

1993-01-01

Human prourokinase (pro-UK) cDNA without the signal peptide was obtained using synthetic oligonucleotide and DNA recombination techniques and was successfully expressed in E. coli. The plasmid pMMUK which contained pro-UK cDNA (including both the entire coding sequence and the sequence for signal peptide) was digested with Hind III and PstI, so that the N-terminal 371-bp fragment could be recovered. A 304-bp fragment was collected from the 371-bp fragment after partial digestion with Fnu4HI in order to remove the signal peptide sequence. An intermediate plasmid was formed after this 304-bp fragment and the synthetic oligonucleotide was ligated with pUC18. Correctness of the ligation was confirmed by enzyme digestion and sequencing. By joining the PstI-PstI fragment of pro-UK to the plasmid we obtained the final plasmid which contained the entire coding sequence of pro-UK without the signal peptide. The coding sequence with correct orientation was inserted into pBV220 under the control of the temperature-induced promoter PRPL, and mature pro-UK was expressed in E. coli at 42 degrees C. Both sonicated supernatant and inclusion bodies of the bacterial host JM101 showed positive results by ELISA and FAPA assays. After renaturation, the biological activity of the expressed product was increased from 500-1000IU/L to about 60,000IU/L. The bacterial pro-UK showed a molecular weight of about 47,000 daltons by Western blot analysis. It can be completely inhibited by UK antiserum but not by t-PA antiserum nor by normal rabbit serum.

Complete mitochondrial genome sequences from five Eimeria species (Apicomplexa; Coccidia; Eimeriidae) infecting domestic turkeys

PubMed Central

2014-01-01

Background Clinical and subclinical coccidiosis is cosmopolitan and inflicts significant losses to the poultry industry globally. Seven named Eimeria species are responsible for coccidiosis in turkeys: Eimeria dispersa; Eimeria meleagrimitis; Eimeria gallopavonis; Eimeria meleagridis; Eimeria adenoeides; Eimeria innocua; and, Eimeria subrotunda. Although attempts have been made to characterize these parasites molecularly at the nuclear 18S rDNA and ITS loci, the maternally-derived and mitotically replicating mitochondrial genome may be more suited for species level molecular work; however, only limited sequence data are available for Eimeria spp. infecting turkeys. The purpose of this study was to sequence and annotate the complete mitochondrial genomes from 5 Eimeria species that commonly infect the domestic turkey (Meleagris gallopavo). Methods Six single-oocyst derived cultures of five Eimeria species infecting turkeys were PCR-amplified and sequenced completely prior to detailed annotation. Resulting sequences were aligned and used in phylogenetic analyses (BI, ML, and MP) that included complete mitochondrial genomes from 16 Eimeria species or concatenated CDS sequences from each genome. Results Complete mitochondrial genome sequences were obtained for Eimeria adenoeides Guelph, 6211 bp; Eimeria dispersa Briston, 6238 bp; Eimeria meleagridis USAR97-01, 6212 bp; Eimeria meleagrimitis USMN08-01, 6165 bp; Eimeria gallopavonis Weybridge, 6215 bp; and Eimeria gallopavonis USKS06-01, 6215 bp). The order, orientation and CDS lengths of the three protein coding genes (COI, COIII and CytB) as well as rDNA fragments encoding ribosomal large and small subunit rRNA were conserved among all sequences. Pairwise sequence identities between species ranged from 88.1% to 98.2%; sequence variability was concentrated within CDS or between rDNA fragments (where indels were common). No phylogenetic reconstruction supported monophyly of Eimeria species infecting turkeys; Eimeria dispersa may have arisen via host switching from another avian host. Phylogenetic analyses suggest E. necatrix and E. tenella are related distantly to other Eimeria of chickens. Conclusions Mitochondrial genomes of Eimeria species sequenced to date are highly conserved with regard to gene content and structure. Nonetheless, complete mitochondrial genome sequences and, particularly the three CDS, possess sufficient sequence variability for differentiating Eimeria species of poultry. The mitochondrial genome sequences are highly suited for molecular diagnostics and phylogenetics of coccidia and, potentially, genetic markers for molecular epidemiology. PMID:25034633

Complete mitochondrial genome sequences from five Eimeria species (Apicomplexa; Coccidia; Eimeriidae) infecting domestic turkeys.

PubMed

Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Barta, John R

2014-07-17

Clinical and subclinical coccidiosis is cosmopolitan and inflicts significant losses to the poultry industry globally. Seven named Eimeria species are responsible for coccidiosis in turkeys: Eimeria dispersa; Eimeria meleagrimitis; Eimeria gallopavonis; Eimeria meleagridis; Eimeria adenoeides; Eimeria innocua; and, Eimeria subrotunda. Although attempts have been made to characterize these parasites molecularly at the nuclear 18S rDNA and ITS loci, the maternally-derived and mitotically replicating mitochondrial genome may be more suited for species level molecular work; however, only limited sequence data are available for Eimeria spp. infecting turkeys. The purpose of this study was to sequence and annotate the complete mitochondrial genomes from 5 Eimeria species that commonly infect the domestic turkey (Meleagris gallopavo). Six single-oocyst derived cultures of five Eimeria species infecting turkeys were PCR-amplified and sequenced completely prior to detailed annotation. Resulting sequences were aligned and used in phylogenetic analyses (BI, ML, and MP) that included complete mitochondrial genomes from 16 Eimeria species or concatenated CDS sequences from each genome. Complete mitochondrial genome sequences were obtained for Eimeria adenoeides Guelph, 6211 bp; Eimeria dispersa Briston, 6238 bp; Eimeria meleagridis USAR97-01, 6212 bp; Eimeria meleagrimitis USMN08-01, 6165 bp; Eimeria gallopavonis Weybridge, 6215 bp; and Eimeria gallopavonis USKS06-01, 6215 bp). The order, orientation and CDS lengths of the three protein coding genes (COI, COIII and CytB) as well as rDNA fragments encoding ribosomal large and small subunit rRNA were conserved among all sequences. Pairwise sequence identities between species ranged from 88.1% to 98.2%; sequence variability was concentrated within CDS or between rDNA fragments (where indels were common). No phylogenetic reconstruction supported monophyly of Eimeria species infecting turkeys; Eimeria dispersa may have arisen via host switching from another avian host. Phylogenetic analyses suggest E. necatrix and E. tenella are related distantly to other Eimeria of chickens. Mitochondrial genomes of Eimeria species sequenced to date are highly conserved with regard to gene content and structure. Nonetheless, complete mitochondrial genome sequences and, particularly the three CDS, possess sufficient sequence variability for differentiating Eimeria species of poultry. The mitochondrial genome sequences are highly suited for molecular diagnostics and phylogenetics of coccidia and, potentially, genetic markers for molecular epidemiology.

LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

PubMed

Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

2018-05-17

Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

Ancient DNA Reveals Late Pleistocene Existence of Ostriches in Indian Sub-Continent.

PubMed

Jain, Sonal; Rai, Niraj; Kumar, Giriraj; Pruthi, Parul Aggarwal; Thangaraj, Kumarasamy; Bajpai, Sunil; Pruthi, Vikas

2017-01-01

Ancient DNA (aDNA) analysis of extinct ratite species is of considerable interest as it provides important insights into their origin, evolution, paleogeographical distribution and vicariant speciation in congruence with continental drift theory. In this study, DNA hotspots were detected in fossilized eggshell fragments of ratites (dated ≥25000 years B.P. by radiocarbon dating) using confocal laser scanning microscopy (CLSM). DNA was isolated from five eggshell fragments and a 43 base pair (bp) sequence of a 16S rRNA mitochondrial-conserved region was successfully amplified and sequenced from one of the samples. Phylogenetic analysis of the DNA sequence revealed a 92% identity of the fossil eggshells to Struthio camelus and their position basal to other palaeognaths, consistent with the vicariant speciation model. Our study provides the first molecular evidence for the presence of ostriches in India, complementing the continental drift theory of biogeographical movement of ostriches in India, and opening up a new window into the evolutionary history of ratites.

Canis mtDNA HV1 database: a web-based tool for collecting and surveying Canis mtDNA HV1 haplotype in public database.

PubMed

Thai, Quan Ke; Chung, Dung Anh; Tran, Hoang-Dung

2017-06-26

Canine and wolf mitochondrial DNA haplotypes, which can be used for forensic or phylogenetic analyses, have been defined in various schemes depending on the region analyzed. In recent studies, the 582 bp fragment of the HV1 region is most commonly used. 317 different canine HV1 haplotypes have been reported in the rapidly growing public database GenBank. These reported haplotypes contain several inconsistencies in their haplotype information. To overcome this issue, we have developed a Canis mtDNA HV1 database. This database collects data on the HV1 582 bp region in dog mitochondrial DNA from the GenBank to screen and correct the inconsistencies. It also supports users in detection of new novel mutation profiles and assignment of new haplotypes. The Canis mtDNA HV1 database (CHD) contains 5567 nucleotide entries originating from 15 subspecies in the species Canis lupus. Of these entries, 3646 were haplotypes and grouped into 804 distinct sequences. 319 sequences were recognized as previously assigned haplotypes, while the remaining 485 sequences had new mutation profiles and were marked as new haplotype candidates awaiting further analysis for haplotype assignment. Of the 3646 nucleotide entries, only 414 were annotated with correct haplotype information, while 3232 had insufficient or lacked haplotype information and were corrected or modified before storing in the CHD. The CHD can be accessed at http://chd.vnbiology.com . It provides sequences, haplotype information, and a web-based tool for mtDNA HV1 haplotyping. The CHD is updated monthly and supplies all data for download. The Canis mtDNA HV1 database contains information about canine mitochondrial DNA HV1 sequences with reconciled annotation. It serves as a tool for detection of inconsistencies in GenBank and helps identifying new HV1 haplotypes. Thus, it supports the scientific community in naming new HV1 haplotypes and to reconcile existing annotation of HV1 582 bp sequences.

Systematics of the Dioryctria abietella Species Group (Lepidoptera: Pyralidae) Based on Mitochondrial DNA Ann

Treesearch

G. Roux-Morabito; N.E. Gillette; A. Roques; L. Dormont; J. Stein; F.A.H. Sperling

2008-01-01

Coneworms of the genus Dioryctria Zeller include several serious pests of conifer seeds that are notoriously difficult to distinguish as species. We surveyed mitochondrial DNA variation within the abietella species group by sequencing 451 bp of cytochrome oxidase subunit 1 (COI) and 572 bp of cytochrome oxidase subunit 2 (COII...

The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae).

PubMed

Pan, Hong-Chun; Fang, Hong-Yan; Li, Shi-Wei; Liu, Jun-Hong; Wang, Ying; Wang, An-Tai

2014-12-01

The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae) is composed of two linear DNA molecules. The mitochondrial DNA (mtDNA) molecule 1 is 8010 bp long and contains six protein-coding genes, large subunit rRNA, methionine and tryptophan tRNAs, two pseudogenes consisting respectively of a partial copy of COI, and terminal sequences at two ends of the linear mtDNA, while the mtDNA molecule 2 is 7576 bp long and contains seven protein-coding genes, small subunit rRNA, methionine tRNA, a pseudogene consisting of a partial copy of COI and terminal sequences at two ends of the linear mtDNA. COI gene begins with GTG as start codon, whereas other 12 protein-coding genes start with a typical ATG initiation codon. In addition, all protein-coding genes are terminated with TAA as stop codon.

The complete chloroplast genome sequence of Dendrobium officinale.

PubMed

Yang, Pei; Zhou, Hong; Qian, Jun; Xu, Haibin; Shao, Qingsong; Li, Yonghua; Yao, Hui

2016-01-01

The complete chloroplast sequence of Dendrobium officinale, an endangered and economically important traditional Chinese medicine, was reported and characterized. The genome size is 152,018 bp, with 37.5% GC content. A pair of inverted repeats (IRs) of 26,284 bp are separated by a large single-copy region (LSC, 84,944 bp) and a small single-copy region (SSC, 14,506 bp). The complete cp DNA contains 83 protein-coding genes, 39 tRNA genes and 8 rRNA genes. Fourteen genes contained one or two introns.

Molecular characterization of eimeria species naturally infecting egyptian baldi chickens.

PubMed

Gadelhaq, Sahar M; Arafa, Waleed M; Aboelhadid, Shawky M

2015-01-01

Coccidiosis is a serious protozoal disease of poultry. The identification of Eimeria species has important implications for diagnosis and control as well as for epidemiology. The molecular characterization of Eimeria species infecting Egyptian baladi chickens was investigated. Eimeria species oocysts were harvested from intestines of naturally infected Egyptian baldi chickens. The morphometry characterization of oocysts along with COCCIMORPH software was done. The DNA was extracted initially by freezing and thawing then the prepared samples was subjected to commercial DNA kits. The DNA products were analyzed through conventional polymerase chain reaction by using amplified region (SCAR) marker. The PCR results confirmed the presence of 7 Eimeria species in the examined fecal samples of Egyptian baldi breed with their specific ampilicon sizes being E. acervulina (811bp), E. brunette (626bp), E. tenella (539bp), E. maxima (272bp), E. necatrix (200bp), E. mitis (327bp) and E. praecopx (354bp). A sequencing of the two most predominant species of Eimeria was done, on E. tenella and E. máxima. Analysis of the obtained sequences revealed high identities 99% between Egyptian isolates and the reference one. Similarly, E. maxima isolated from Egyptian baldi chickens showed 98% nucleotide identities with the reference strain. Only single nucleotide substitution was observed among the Egyptian E. tenella isolates (A181G) when compared to the reference one. The Egyptian isolates acquired 4 unique mutations (A68T, C164T, G190A and C227G) in compared with the reference sequence. This is the first time to identify the 7 species of Eimeria from Egyptian baladi chickens.

Complete chloroplast DNA sequence from a Korean endemic genus, Megaleranthis saniculifolia, and its evolutionary implications.

PubMed

Kim, Young-Kyu; Park, Chong-wook; Kim, Ki-Joong

2009-03-31

The chloroplast DNA sequences of Megaleranthis saniculifolia, an endemic and monotypic endangered plant species, were completed in this study (GenBank FJ597983). The genome is 159,924 bp in length. It harbors a pair of IR regions consisting of 26,608 bp each. The lengths of the LSC and SSC regions are 88,326 bp and 18,382 bp, respectively. The structural organizations, gene and intron contents, gene orders, AT contents, codon usages, and transcription units of the Megaleranthis chloroplast genome are similar to those of typical land plant cp DNAs. However, the detailed features of Megaleranthis chloroplast genomes are substantially different from that of Ranunculus, which belongs to the same family, the Ranunculaceae. First, the Megaleranthis cp DNA was 4,797 bp longer than that of Ranunculus due to an expanded IR region into the SSC region and duplicated sequence elements in several spacer regions of the Megaleranthis cp genome. Second, the chloroplast genomes of Megaleranthis and Ranunculus evidence 5.6% sequence divergence in the coding regions, 8.9% sequence divergence in the intron regions, and 18.7% sequence divergence in the intergenic spacer regions, respectively. In both the coding and noncoding regions, average nucleotide substitution rates differed markedly, depending on the genome position. Our data strongly implicate the positional effects of the evolutionary modes of chloroplast genes. The genes evidencing higher levels of base substitutions also have higher incidences of indel mutations and low Ka/Ks ratios. A total of 54 simple sequence repeat loci were identified from the Megaleranthis cp genome. The existence of rich cp SSR loci in the Megaleranthis cp genome provides a rare opportunity to study the population genetic structures of this endangered species. Our phylogenetic trees based on the two independent markers, the nuclear ITS and chloroplast matK sequences, strongly support the inclusion of the Megaleranthis to the Trollius. Therefore, our molecular trees support Ohwi's original treatment of Megaleranthis saniculiforia to Trollius chosenensis Ohwi.

On the connection between inherent DNA flexure and preferred binding of hydroxymethyluracil-containing DNA by the type II DNA-binding protein TF1.

PubMed

Grove, A; Galeone, A; Mayol, L; Geiduschek, E P

1996-07-12

TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.

An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.

PubMed

Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel

2004-01-21

We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.

High Resolution Size Analysis of Fetal DNA in the Urine of Pregnant Women by Paired-End Massively Parallel Sequencing

PubMed Central

Tsui, Nancy B. Y.; Jiang, Peiyong; Chow, Katherine C. K.; Su, Xiaoxi; Leung, Tak Y.; Sun, Hao; Chan, K. C. Allen; Chiu, Rossa W. K.; Lo, Y. M. Dennis

2012-01-01

Background Fetal DNA in maternal urine, if present, would be a valuable source of fetal genetic material for noninvasive prenatal diagnosis. However, the existence of fetal DNA in maternal urine has remained controversial. The issue is due to the lack of appropriate technology to robustly detect the potentially highly degraded fetal DNA in maternal urine. Methodology We have used massively parallel paired-end sequencing to investigate cell-free DNA molecules in maternal urine. Catheterized urine samples were collected from seven pregnant women during the third trimester of pregnancies. We detected fetal DNA by identifying sequenced reads that contained fetal-specific alleles of the single nucleotide polymorphisms. The sizes of individual urinary DNA fragments were deduced from the alignment positions of the paired reads. We measured the fractional fetal DNA concentration as well as the size distributions of fetal and maternal DNA in maternal urine. Principal Findings Cell-free fetal DNA was detected in five of the seven maternal urine samples, with the fractional fetal DNA concentrations ranged from 1.92% to 4.73%. Fetal DNA became undetectable in maternal urine after delivery. The total urinary cell-free DNA molecules were less intact when compared with plasma DNA. Urinary fetal DNA fragments were very short, and the most dominant fetal sequences were between 29 bp and 45 bp in length. Conclusions With the use of massively parallel sequencing, we have confirmed the existence of transrenal fetal DNA in maternal urine, and have shown that urinary fetal DNA was heavily degraded. PMID:23118982

Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

PubMed

Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

2015-10-01

Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

Species-specific markers for the differential diagnosis of Trypanosoma cruzi and Trypanosoma rangeli and polymorphisms detection in Trypanosoma rangeli.

PubMed

Ferreira, Keila Adriana Magalhães; Fajardo, Emanuella Francisco; Baptista, Rodrigo P; Macedo, Andrea Mara; Lages-Silva, Eliane; Ramírez, Luis Eduardo; Pedrosa, André Luiz

2014-06-01

Trypanosoma cruzi and Trypanosoma rangeli are kinetoplastid parasites which are able to infect humans in Central and South America. Misdiagnosis between these trypanosomes can be avoided by targeting barcoding sequences or genes of each organism. This work aims to analyze the feasibility of using species-specific markers for identification of intraspecific polymorphisms and as target for diagnostic methods by PCR. Accordingly, primers which are able to specifically detect T. cruzi or T. rangeli genomic DNA were characterized. The use of intergenic regions, generally divergent in the trypanosomatids, and the serine carboxypeptidase gene were successful. Using T. rangeli genomic sequences for the identification of group-specific polymorphisms and a polymorphic AT(n) dinucleotide repeat permitted the classification of the strains into two groups, which are entirely coincident with T. rangeli main lineages, KP1 (+) and KP1 (-), previously determined by kinetoplast DNA (kDNA) characterization. The sequences analyzed totalize 622 bp (382 bp represent a hypothetical protein sequence, and 240 bp represent an anonymous sequence), and of these, 581 (93.3%) are conserved sites and 41 bp (6.7%) are polymorphic, with 9 transitions (21.9%), 2 transversions (4.9%), and 30 (73.2%) insertion/deletion events. Taken together, the species-specific markers analyzed may be useful for the development of new strategies for the accurate diagnosis of infections. Furthermore, the identification of T. rangeli polymorphisms has a direct impact in the understanding of the population structure of this parasite.

Molecular cloning and analysis of Schizosaccharomyces pombe Reb1p: sequence-specific recognition of two sites in the far upstream rDNA intergenic spacer.

PubMed Central

Zhao, A; Guo, A; Liu, Z; Pape, L

1997-01-01

The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645

'Mitominis': multiplex PCR analysis of reduced size amplicons for compound sequence analysis of the entire mtDNA control region in highly degraded samples.

PubMed

Eichmann, Cordula; Parson, Walther

2008-09-01

The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.

Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis.

PubMed

Buldyrev, S V; Goldberger, A L; Havlin, S; Mantegna, R N; Matsa, M E; Peng, C K; Simons, M; Stanley, H E

1995-05-01

An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis

NASA Technical Reports Server (NTRS)

Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Matsa, M. E.; Peng, C. K.; Simons, M.; Stanley, H. E.

1995-01-01

An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

Sequence variability in three mitochondrial genes among four roundworm species from wild animals in China.

PubMed

Chang, Qiao-Cheng; Gao, Jun-Feng; Sheng, Zhong-Hua; Lou, Yan; Zheng, Xu; Wang, Chun-Ren

2015-02-01

Sequence variability in three mitochondrial DNA (mtDNA) regions, namely portions of cytochrome c oxidase subunit 1 (pcox1), NADH dehydrogenase subunit 1 (pnad1) and NADH dehydrogenase subunit 4 (pnad4), for Toxocara canis. Baylisacaris transfuga. Ascaris suum and Parascaris equorum from Canis lupus. Ursus thibetanus. Sus scrofa and Equus burchelli in China were examined. The lengths of the sequences of pcox1, pnad1 and pnad4 were 711 bp, 648 bp and 666 bp, respectively. No intra-species differences were detected in pcox1 for the four examined ascarid species, in pnad1 for T. canis. A. suum and P. equorum, and in pnad4 for B. transfuga and P. equorum. Sequence differences in pnad4 for six roundworm samples of T. canis and P. equorum were 0-0.1% and 0-0.3%, respectively, and were 0-0.3% in pnad1 for six roundworm samples isolate of B. transfuga. The inter-specific sequence differences among four species were 8.7-12.4% for pcox1, 13.9-17.7% for pnad1, and 14.0-25.7% for pnad4. Phylogenetic analyses suggested that the three mtDNA fragments could be used to identify ascarid species in families Ascaridiae and Toxocaridae.

Structural analysis of the rDNA intergenic spacer of Brassica nigra: evolutionary divergence of the spacers of the three diploid Brassica species.

PubMed

Bhatia, S; Singh Negi, M; Lakshmikumaran, M

1996-11-01

EcoRI restriction of the B. nigra rDNA recombinants, isolated from a lambda genomic library, showed that the 3.9-kb fragment corresponded to the Intergenic Spacer (IGS), which was sequenced and found to be 3,928 bp in size. Sequence and dot-matrix analyses showed that the organization of the B. nigra rDNA IGS was typical of most rDNA spacers, consisting of a central repetitive region and flanking unique sequences on either side. The repetitive region was composed of two repeat families-RF 'A' and RF 'B.' The B. nigra RF 'A' consisted of a tandem array of three full-length copies of a 106-bp sequence element. RF 'B' was composed of 66 tandemly repeated elements. Each 'B' element was only 21-bp in size and this is the smallest repeat unit identified in plant rDNA to date. The putative transcription initiation site (TIS) was identified as nucleotide position 3,110. Based on the sequence analysis it was suggested that the present organization of the repeat families was generated by successive cycles of deletions and amplifications and was being maintained by homogenization processes such as gene conversion and crossing-over.A detailed comparison of the rDNA IGS sequences of the three diploid Brassica species-namely, B. nigra, B. campestris, and B. oleracea-was carried out. First, comparisons revealed that B. campestris and B. oleracea were close to each other as the repeat families in both showed high sequence homology between each other. Second, the repeat elements in both the species were organized in an interspersed manner. Third, a 52-bp sequence, present just downstream of the repeats in B. campestris, was found to be identical to the B. oleracea repeats, thereby suggesting a common progenitor. On the other hand, in B. nigra no interspersion pattern of organization of repeats was observed. Further, the B. nigra RF 'A' was identified as distinct from the repeat families of B. campestris and B. oleracea. Based on this analysis, it was suggested that during speciation B. campestris and B. oleracea evolved in one lineage whereas B. nigra diverged into a separate lineage. The comparative analysis of the IGS helped in identifying not only conserved ancestral sequence motifs of possible functional significance such as promoters and enhancers, but also sequences which showed variation between the three diploid species and were therefore identified as species-specific sequences.

Quantitation of normal CFTR mRNA in CF patients with splice-site mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Z.; Olsen, J.C.; Silverman, L.M.

Previously we identified two mutations in introns of the CFTR gene associated with partially active splice sites and unusual clinical phenotypes. One mutation in intron 19 (3849+10 kb C to T) is common in CF patients with normal sweat chloride values; an 84 bp sequence from intron 19, which contains a stop codon, is inserted between exon 19 and exon 20 in most nasal CFTR transcripts. The other mutation in intron 14B (2789+5 G to A) is associated with elevated sweat chloride levels, but mild pulmonary disease; exon 14B (38 bp) is spliced out of most nasal CFTR transcipts. Themore » remaining CFTR cDNA sequences, other than the 84 bp insertion of exon 14B deletion, are identical to the published sequence. To correlate genotype and phenotype, we used quantitative RT-PCR to determine the levels of normally-spliced CFTR mRNA in nasal epithelia from these patients. CFTR cDNA was amplified (25 cycles) by using primers specific for normally-spliced species, {gamma}-actin cDNA was amplified as a standard.« less

Comprehensive Survey of Genetic Diversity in Chloroplast Genomes and 45S nrDNAs within Panax ginseng Species

PubMed Central

Kim, Kyunghee; Lee, Sang-Choon; Lee, Junki; Lee, Hyun Oh; Joh, Ho Jun; Kim, Nam-Hoon; Park, Hyun-Seung; Yang, Tae-Jin

2015-01-01

We report complete sequences of chloroplast (cp) genome and 45S nuclear ribosomal DNA (45S nrDNA) for 11 Panax ginseng cultivars. We have obtained complete sequences of cp and 45S nrDNA, the representative barcoding target sequences for cytoplasm and nuclear genome, respectively, based on low coverage NGS sequence of each cultivar. The cp genomes sizes ranged from 156,241 to 156,425 bp and the major size variation was derived from differences in copy number of tandem repeats in the ycf1 gene and in the intergenic regions of rps16-trnUUG and rpl32-trnUAG. The complete 45S nrDNA unit sequences were 11,091 bp, representing a consensus single transcriptional unit with an intergenic spacer region. Comparative analysis of these sequences as well as those previously reported for three Chinese accessions identified very rare but unique polymorphism in the cp genome within P. ginseng cultivars. There were 12 intra-species polymorphisms (six SNPs and six InDels) among 14 cultivars. We also identified five SNPs from 45S nrDNA of 11 Korean ginseng cultivars. From the 17 unique informative polymorphic sites, we developed six reliable markers for analysis of ginseng diversity and cultivar authentication. PMID:26061692

Molecular cloning of the heat shock protein 20 gene from Paphia textile and its expression in response to heat shock

NASA Astrophysics Data System (ADS)

Li, Jiakai; Wu, Xiangwei; Tan, Jing; Zhao, Ruixiang; Deng, Lingwei; Liu, Xiande

2015-07-01

P. textile is an important aquaculture species in China and is mainly distributed in Fujian, Guangdong, and Guangxi Provinces. In this study, an HSP20 cDNA designated PtHSP20 was cloned from P. textile. The full-length cDNA of PtHSP20 is 1 090 bp long and contains a 5' untranslated region (UTR) of 93 bp, a 3' UTR of 475 bp, and an open reading frame (ORF) of 522 bp. The PtHSP20 cDNA encodes 173 amino acid residues and has a molecular mass of 20.22 kDa and an isoelectric point of 6.2. Its predicted amino acid sequence shows that PtHSP20 contains a typical α-crystallin domain (residues 77-171) and three polyadenylation signal-sequences at the C-terminus. According to an amino acid sequence alignment, PtHSP20 shows moderate homology to other mollusk sHSPs. PtHSP20 mRNA was present in all of the test tissues including the heart, digestive gland, adductor muscle, gonad, gill, and mantle, with the highest concentration found in the gonad. Under the stress of high temperature, the expression of PtHSP20 mRNA was down-regulated in all of the tissues except the adductor muscle and gonad.

Identification and transcription profiling of NDUFS8 in Aedes taeniorhynchus (Diptera:Culididae): developmental regulation and environmental response

USDA-ARS?s Scientific Manuscript database

The cDNA of a NADH dehydrogenase -ubiquinone Fe-S protein 8 subunit (NDUFS8) gene from Aedes (Ochlerotatus) taeniorhynchus Wiedemann has been cloned and sequenced. The full-length mRNA sequence (824 bp) of AetNDUFS8 encodes an open reading region of 651 bp (i.e., 217 amino acids). To detect whether ...

A simple, rapid, high-fidelity and cost-effective PCR-based two-step DNA synthesis method for long gene sequences.

PubMed

Xiong, Ai-Sheng; Yao, Quan-Hong; Peng, Ri-He; Li, Xian; Fan, Hui-Qin; Cheng, Zong-Ming; Li, Yi

2004-07-07

Chemical synthesis of DNA sequences provides a powerful tool for modifying genes and for studying gene function, structure and expression. Here, we report a simple, high-fidelity and cost-effective PCR-based two-step DNA synthesis (PTDS) method for synthesis of long segments of DNA. The method involves two steps. (i) Synthesis of individual fragments of the DNA of interest: ten to twelve 60mer oligonucleotides with 20 bp overlap are mixed and a PCR reaction is carried out with high-fidelity DNA polymerase Pfu to produce DNA fragments that are approximately 500 bp in length. (ii) Synthesis of the entire sequence of the DNA of interest: five to ten PCR products from the first step are combined and used as the template for a second PCR reaction using high-fidelity DNA polymerase pyrobest, with the two outermost oligonucleotides as primers. Compared with the previously published methods, the PTDS method is rapid (5-7 days) and suitable for synthesizing long segments of DNA (5-6 kb) with high G + C contents, repetitive sequences or complex secondary structures. Thus, the PTDS method provides an alternative tool for synthesizing and assembling long genes with complex structures. Using the newly developed PTDS method, we have successfully obtained several genes of interest with sizes ranging from 1.0 to 5.4 kb.

Molecular Characterization of Eimeria Species Naturally Infecting Egyptian Baldi Chickens

PubMed Central

GADELHAQ, Sahar M; ARAFA, Waleed M; ABOELHADID, Shawky M

2015-01-01

Background: Coccidiosis is a serious protozoal disease of poultry. The identification of Eimeria species has important implications for diagnosis and control as well as for epidemiology. The molecular characterization of Eimeria species infecting Egyptian baladi chickens was investigated. Methods: Eimeria species oocysts were harvested from intestines of naturally infected Egyptian baldi chickens. The morphometry characterization of oocysts along with COCCIMORPH software was done. The DNA was extracted initially by freezing and thawing then the prepared samples was subjected to commercial DNA kits. The DNA products were analyzed through conventional polymerase chain reaction by using amplified region (SCAR) marker. Results: The PCR results confirmed the presence of 7 Eimeria species in the examined fecal samples of Egyptian baldi breed with their specific ampilicon sizes being E. acervulina (811bp), E. brunette (626bp), E. tenella (539bp), E. maxima (272bp), E. necatrix (200bp), E. mitis (327bp) and E. praecopx (354bp). A sequencing of the two most predominant species of Eimeria was done, on E. tenella and E. máxima. Analysis of the obtained sequences revealed high identities 99% between Egyptian isolates and the reference one. Similarly, E. maxima isolated from Egyptian baldi chickens showed 98% nucleotide identities with the reference strain. Only single nucleotide substitution was observed among the Egyptian E. tenella isolates (A181G) when compared to the reference one. The Egyptian isolates acquired 4 unique mutations (A68T, C164T, G190A and C227G) in compared with the reference sequence. Conclusion: This is the first time to identify the 7 species of Eimeria from Egyptian baladi chickens. PMID:25904950

First ancient DNA sequences from the Late Pleistocene red deer (Cervus elaphus) in the Crimea, Ukraine

NASA Astrophysics Data System (ADS)

Stanković, Ana; Nadachowski, Adam; Doan, Karolina; Stefaniak, Krzysztof; Baca, Mateusz; Socha, Paweł; Wegleński, Piotr; Ridush, Bogdan

2010-05-01

The Late Pleistocene has been a period of significant population and species turnover and extinctions among the large mammal fauna. Massive climatic and environmental changes during Pleistocene significantly influenced the distribution and also genetic diversity of plants and animals. The model of glacial refugia and habitat contraction to southern peninsulas in Europe as areas for the survival of temperate animal species during unfavourable Pleistocene glaciations is at present widely accepted. However, both molecular data and the fossil record indicate the presence of northern and perhaps north-eastern refugia in Europe. In recent years, much new palaeontological data have been obtained in the Crimean Peninsula, Ukraine, following extensive investigations. The red deer (Cervus elaphus) samples for aDNA studies were collected in Emine-Bair-Khosar Cave, situated on the north edge of Lower Plateau of the Chatyrdag Massif (Crimean Mountains). The cave is a vertical shaft, which functioned as a huge mega-trap over a long period of time (probably most of the Pleistocene). The bone assemblages provided about 5000 bones belonging to more than 40 species. The C. elaphus bones were collected from three different stratigraphical levels, radiocarbon dated by accelerator mass spectrometry (AMS) method. The bone fragments of four specimens of red deer were used for the DNA isolation and analysis. The mtDNA (Cytochome b) was successfully isolated from three bone fragments and the cytochrome b sequences were amplified by multiplex PCR. The sequences obtained so far allowed for the reconstruction of only preliminary phylogenetic trees. A fragment of metatarsus from level dated to ca. 48,500±2,000 years BP, yielded a sequence of 513 bp, allowing to locate the specimen on the phylogenetic tree within modern C. elaphus specimens from southern and middle Europe. The second bone fragment, a fragment of mandible, collected from level dated approximately to ca. 33,500±400 years BP, yielded a sequence (696 bp) locating this specimen much closer to the modern C. elaphus specimens from China and Far East. From the third bone fragment (metatarsus), dated between ca. 12,000 years BP and 30,000 years BP, the sequence of only 346 bp has been obtained. It locates this specimen between European and Asiatic haplogroups. The preliminary results of analysis of the DNA from Crimean C. elaphus fossils reveal the great genetic heterogeneity and a complex phylogeographical pattern of the material studied. The obtained results support the opinion that Crimean Peninsula was the most north-eastern refugium in Europe during Late Pleistocene playing a major role in recolonization and dispersal processes of temperate species during and after the Late Pleistocene in this part of the Euro-Asian continent.

The complete mitochondrial genome structure of snow leopard Panthera uncia.

PubMed

Wei, Lei; Wu, Xiaobing; Jiang, Zhigang

2009-05-01

The complete mitochondrial genome (mtDNA) of snow leopard Panthera uncia was obtained by using the polymerase chain reaction (PCR) technique based on the PCR fragments of 30 primers we designed. The entire mtDNA sequence was 16 773 base pairs (bp) in length, and the base composition was: A-5,357 bp (31.9%); C-4,444 bp (26.5%); G-2,428 bp (14.5%); T-4,544 bp (27.1%). The structural characteristics [0] of the P. uncia mitochondrial genome were highly similar to these of Felis catus, Acinonyx jubatus, Neofelis nebulosa and other mammals. However, we found several distinctive features of the mitochondrial genome of Panthera unica. First, the termination codon of COIII was TAA, which differed from those of F. catus, A. jubatus and N. nebulosa. Second, tRNA(Ser) ((AGY)), which lacked the ''DHU'' arm, could not be folded into the typical cloverleaf-shaped structure. Third, in the control region, a long repetitive sequence in RS-2 (32 bp) region was found with 2 repeats while one short repetitive segment (9 bp) was found with 15 repeats in the RS-3 region. We performed phylogenetic analysis based on a 3 816 bp concatenated sequence of 12S rRNA, 16S rRNA, ND2, ND4, ND5, Cyt b and ATP8 for P. uncia and other related species, the result indicated that P. uncia and P. leo were the sister species, which was different from the previous findings.

Target capture enrichment of nuclear SNP markers for massively parallel sequencing of degraded and mixed samples.

PubMed

Bose, Nikhil; Carlberg, Katie; Sensabaugh, George; Erlich, Henry; Calloway, Cassandra

2018-05-01

DNA from biological forensic samples can be highly fragmented and present in limited quantity. When DNA is highly fragmented, conventional PCR based Short Tandem Repeat (STR) analysis may fail as primer binding sites may not be present on a single template molecule. Single Nucleotide Polymorphisms (SNPs) can serve as an alternative type of genetic marker for analysis of degraded samples because the targeted variation is a single base. However, conventional PCR based SNP analysis methods still require intact primer binding sites for target amplification. Recently, probe capture methods for targeted enrichment have shown success in recovering degraded DNA as well as DNA from ancient bone samples using next-generation sequencing (NGS) technologies. The goal of this study was to design and test a probe capture assay targeting forensically relevant nuclear SNP markers for clonal and massively parallel sequencing (MPS) of degraded and limited DNA samples as well as mixtures. A set of 411 polymorphic markers totaling 451 nuclear SNPs (375 SNPs and 36 microhaplotype markers) was selected for the custom probe capture panel. The SNP markers were selected for a broad range of forensic applications including human individual identification, kinship, and lineage analysis as well as for mixture analysis. Performance of the custom SNP probe capture NGS assay was characterized by analyzing read depth and heterozygote allele balance across 15 samples at 25 ng input DNA. Performance thresholds were established based on read depth ≥500X and heterozygote allele balance within ±10% deviation from 50:50, which was observed for 426 out of 451 SNPs. These 426 SNPs were analyzed in size selected samples (at ≤75 bp, ≤100 bp, ≤150 bp, ≤200 bp, and ≤250 bp) as well as mock degraded samples fragmented to an average of 150 bp. Samples selected for ≤75 bp exhibited 99-100% reportable SNPs across varied DNA amounts and as low as 0.5 ng. Mock degraded samples at 1 ng and 10 ng exhibited >90% reportable SNPs. Finally, two-person male-male mixtures were tested at 10 ng in contributor varying ratios. Overall, 85-100% of alleles unique to the minor contributor were observed at all mixture ratios. Results from these studies using the SNP probe capture NGS system demonstrates proof of concept for application to forensically relevant degraded and mixed DNA samples. Copyright © 2018 Elsevier B.V. All rights reserved.

Forensic strategy to ensure the quality of sequencing data of mitochondrial DNA in highly degraded samples.

PubMed

Adachi, Noboru; Umetsu, Kazuo; Shojo, Hideki

2014-01-01

Mitochondrial DNA (mtDNA) is widely used for DNA analysis of highly degraded samples because of its polymorphic nature and high number of copies in a cell. However, as endogenous mtDNA in deteriorated samples is scarce and highly fragmented, it is not easy to obtain reliable data. In the current study, we report the risks of direct sequencing mtDNA in highly degraded material, and suggest a strategy to ensure the quality of sequencing data. It was observed that direct sequencing data of the hypervariable segment (HVS) 1 by using primer sets that generate an amplicon of 407 bp (long-primer sets) was different from results obtained by using newly designed primer sets that produce an amplicon of 120-139 bp (mini-primer sets). The data aligned with the results of mini-primer sets analysis in an amplicon length-dependent manner; the shorter the amplicon, the more evident the endogenous sequence became. Coding region analysis using multiplex amplified product-length polymorphisms revealed the incongruence of single nucleotide polymorphisms between the coding region and HVS 1 caused by contamination with exogenous mtDNA. Although the sequencing data obtained using long-primer sets turned out to be erroneous, it was unambiguous and reproducible. These findings suggest that PCR primers that produce amplicons shorter than those currently recognized should be used for mtDNA analysis in highly degraded samples. Haplogroup motif analysis of the coding region and HVS should also be performed to improve the reliability of forensic mtDNA data. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

PubMed Central

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Mitochondrial DNA pattern of the fine shrimp Metapenaeus elegans (De Man, 1907) in the lagoon of Segara Anakan, Central Java, using Hind III

NASA Astrophysics Data System (ADS)

Nugraha, Fitra Arya Dwi; Holil, Kholifah; Kurniawan, Nia

2017-05-01

Ecological damages to the Lagoon of Segara Anakan, Central Java, as well as large-scale and continuous exploitation are threatening the sustainability of fine shrimp, Metapenaeus elegans, and resources. Information in regards to genetic resources is crucial to establish long-term conservation programs and to preserve germplasm quality. This study aims to evaluate the number and size of the fragment which is digested with restriction enzyme Hind III. Seven individuals of Metapenaeus elegans from the Lagoon of Segara Anakan were examined using Hind III. Amplification of mitochondrial DNA resulted in 950 bp, and the digestion using Hind III generated four fragments consisting of 114 bp, 200 bp, 250 bp, and 386 bp, which formed a monomorphic pattern. The restriction pattern showed the probability of homozygosity of alleles that restricted using Hind III. Homozygosity indicates no variation of DNA sequence.

A k-mer-based barcode DNA classification methodology based on spectral representation and a neural gas network.

PubMed

Fiannaca, Antonino; La Rosa, Massimo; Rizzo, Riccardo; Urso, Alfonso

2015-07-01

In this paper, an alignment-free method for DNA barcode classification that is based on both a spectral representation and a neural gas network for unsupervised clustering is proposed. In the proposed methodology, distinctive words are identified from a spectral representation of DNA sequences. A taxonomic classification of the DNA sequence is then performed using the sequence signature, i.e., the smallest set of k-mers that can assign a DNA sequence to its proper taxonomic category. Experiments were then performed to compare our method with other supervised machine learning classification algorithms, such as support vector machine, random forest, ripper, naïve Bayes, ridor, and classification tree, which also consider short DNA sequence fragments of 200 and 300 base pairs (bp). The experimental tests were conducted over 10 real barcode datasets belonging to different animal species, which were provided by the on-line resource "Barcode of Life Database". The experimental results showed that our k-mer-based approach is directly comparable, in terms of accuracy, recall and precision metrics, with the other classifiers when considering full-length sequences. In addition, we demonstrate the robustness of our method when a classification is performed task with a set of short DNA sequences that were randomly extracted from the original data. For example, the proposed method can reach the accuracy of 64.8% at the species level with 200-bp fragments. Under the same conditions, the best other classifier (random forest) reaches the accuracy of 20.9%. Our results indicate that we obtained a clear improvement over the other classifiers for the study of short DNA barcode sequence fragments. Copyright © 2015 Elsevier B.V. All rights reserved.

Characterization and chromosomal mapping of the human TFG gene involved in thyroid carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mencinger, M.; Panagopoulos, I.; Andreasson, P.

1997-05-01

Homology searches in the Expressed Sequence Tag Database were performed using SPYGQ-rich regions as query sequences to find genes encoding protein regions similar to the N-terminal parts of the sarcoma-associated EWS and FUS proteins. Clone 22911 (T74973), encoding a SPYGQ-rich region in its 5{prime} end, and several other clones that overlapped 22911 were selected. The combined data made it possible to assemble a full-length cDNA sequence. This cDNA sequence is 1677 bp, containing an initiation codon ATG, an open reading frame of 400 amino acids, a poly(A) signal, and a poly(A) tail. We found 100% identity between the 5{prime} partmore » of the consensus sequence and the 598-bp-long sequence named TFG. The TFG sequence is fused to the 3{prime} end of NTRK1, generating the TRK-T3 fusion transcript found in papillary thyroid carcinoma. The cDNA therefore represents the full-length transcript of the TFG gene. TFG was localized to 3q11-q12 by fluorescence in situ hybridization. The 3{prime} and the 5{prime} ends of the TFG cDNA probe hybridized to a 2.2-kb band on Northern blot filters in all tissues examined. 28 refs., 5 figs., 1 tab.« less

Complete mitochondrial genome of the giant African snail, Achatina fulica (Mollusca: Achatinidae): a novel location of putative control regions (CR) in the mitogenome within Pulmonate species.

PubMed

He, Zhang-Ping; Dai, Xia-Bin; Zhang, Shuai; Zhi, Ting-Ting; Lun, Zhao-Rong; Wu, Zhong-Dao; Yang, Ting-Bao

2016-01-01

The whole sequence (15,057 bp) of the mitochondrial DNA (mtDNA) of the terrestrial snail Achatina fulica (order Stylommatophora) was determined. The mitogenome, as the typical metazoan mtDNA, contains 13 protein-coding genes (PCG), 2 ribosomal RNA genes (rRNA) and 22 transfer RNA genes (tRNA). The tRNA genes include two trnS without standard secondary structure. Interestingly, among the known mitogenomes of Pulmonata species, we firstly characterized an unassigned lengthy sequence (551 bp) between the cox1 and the trnV which may be the CR for the sake of its AT bases usage bias (65.70%) and potential hairpin structure.

Complete Genome Sequence of Thermus thermophilus TMY, Isolated from a Geothermal Power Plant

PubMed Central

Fujino, Yasuhiro; Nagayoshi, Yuko; Ohshima, Toshihisa; Ogata, Seiya

2017-01-01

ABSTRACT Thermus thermophilus TMY (JCM 10668) was isolated from silica scale formed at a geothermal power plant in Japan. Here, we report the complete genome sequence for this strain, which contains a chromosomal DNA of 2,121,526 bp with 2,500 predicted genes and a pTMY plasmid of 19,139 bp, with 28 predicted genes. PMID:28153912

A PCR method for the detection and differentiation of Lentinus edodes and Trametes versicolor in defined-mixed cultures used for wastewater treatment.

PubMed

García-Mena, Jaime; Cano-Ramirez, Claudia; Garibay-Orijel, Claudio; Ramirez-Canseco, Sergio; Poggi-Varaldo, Héctor M

2005-06-01

A PCR-based method for the quantitative detection of Lentinus edodes and Trametes versicolor, two ligninolytic fungi applied for wastewater treatment and bioremediation, was developed. Genomic DNA was used to optimize a PCR method targeting the conserved copper-binding sequence of laccase genes. The method allowed the quantitative detection and differentiation of these fungi in single and defined-mixed cultures after fractionation of the PCR products by electrophoresis in agarose gels. Amplified products of about 150 bp for L. edodes, and about 200 bp for T. versicolor were purified and cloned. The PCR method showed a linear detection response in the 1.0 microg-1 ng range. The same method was tested with genomic DNA from a third fungus (Phanerochaete chrysosporium), yielding a fragment of about 400 bp. Southern-blot and DNA sequence analysis indicated that a specific PCR product was amplified from each genome, and that these corresponded to sequences of laccase genes. This PCR protocol permits the detection and differentiation of three ligninolytic fungi by amplifying DNA fragments of different sizes using a single pair of primers, without further enzymatic restriction of the PCR products. This method has potential use in the monitoring, evaluation, and improvement of fungal cultures used in wastewater treatment processes.

Comparative analysis and molecular characterization of a gene BANF1 encoded a DNA-binding protein during mitosis from the Giant Panda and Black Bear.

PubMed

Zeng, Yichun; Hou, Yi-Ling; Ding, Xiang; Hou, Wan-Ru; Li, Jian

2014-01-01

Barrier to autointegration factor 1 (BANF1) is a DNA-binding protein found in the nucleus and cytoplasm of eukaryotic cells that functions to establish nuclear architecture during mitosis. The cDNA and the genomic sequence of BANF1 were cloned from the Giant Panda (Ailuropoda melanoleuca) and Black Bear (Ursus thibetanus mupinensis) using RT-PCR technology and Touchdown-PCR, respectively. The cDNA of the BANF1 cloned from Giant Panda and Black Bear is 297 bp in size, containing an open reading frame of 270 bp encoding 89 amino acids. The length of the genomic sequence from Giant Panda is 521 bp, from Black Bear is 536 bp, which were found both to possess 2 exons. Alignment analysis indicated that the nucleotide sequence and the deduced amino acid sequence are highly conserved to some mammalian species studied. Topology prediction showed there is one Protein kinase C phosphorylation site, one Casein kinase II phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Giant Panda, and there is one Protein kinase C phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Black Bear. The BANF1 gene can be readily expressed in E. coli. Results showed that the protein BANF1 fusion with the N-terminally His-tagged form gave rise to the accumulation of an expected 14 kD polypeptide that formed inclusion bodies. The expression products obtained could be used to purify the proteins and study their function further.

Two synthetic Sp1-binding sites functionally substitute for the 21-base-pair repeat region to activate simian virus 40 growth in CV-1 cells.

PubMed Central

Lednicky, J; Folk, W R

1992-01-01

The 21-bp repeat region of simian virus 40 (SV40) activates viral transcription and DNA replication and contains binding sites for many cellular proteins, including Sp1, LSF, ETF, Ap2, Ap4, GT-1B, H16, and p53, and for the SV40 large tumor antigen. We have attempted to reduce the complexity of this region while maintaining its growth-promoting capacity. Deletion of the 21-bp repeat region from the SV40 genome delays the expression of viral early proteins and DNA replication and reduces virus production in CV-1 cells. Replacement of the 21-bp repeat region with two copies of DNA sequence motifs bound with high affinities by Sp1 promotes SV40 growth in CV-1 cells to nearly wild-type levels, but substitution by motifs bound less avidly by Sp1 or bound by other activator proteins does not restore growth. This indicates that Sp1 or a protein with similar sequence specificity is primarily responsible for the function of the 21-bp repeat region. We speculate about how Sp1 activates both SV40 transcription and DNA replication. Images PMID:1328672

Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

PubMed

Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

1999-09-01

We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

New record of Ascaridia nymphii (Secernentea: Ascaridiidae) from macaw parrot, Ara chloroptera, in China.

PubMed

Yang, Fang; Zhang, Pan; Shi, Xianli; Li, Kangxin; Wang, Minwei; Fu, Yeqi; Yan, Xinxin; Hang, Jianxiong; Li, Guoqing

2018-06-01

Present study was performed to identify the species of ascarids from macaw parrot, Ara chloroptera, in China. Total 6 ascarids (3 males and 3 females) were collected in the feces of 3 macaws at Guangzhou Zoo in Guangdong Province, China. Their morphological characteristics with dimensions were observed under a light microscope, and their genetic characters were analyzed with the partial 18S rDNA, ITS rDNA and nad4 gene sequences, respectively. Results showed that all worms have no interlabia but male worms have two alate spicules, well-developed precloacal sucker and a tail with ventrolateral caudal alae and 11 pairs of papillae. The partial 18S rDNA, ITS rDNA and nad4 sequences were 831bp, 1015bp and 394bp in length, respectively. They showed the highest similarity of 99.8% (18S rDNA) with Ascaridia nymphii, 93.8% identities (ITS rDNA) with A. columbae and 98.5% to 99.5% identities (nad4) with Ascaridia sp. from infected parrot. All Ascaridia nematodes from the macaws were clustered into one clade and formed monophyletic group of Ascaridia with A. columbae and A. galli in two phylogenetic trees. It is observed that the combining morphological and sequencing data from three loci, the present Ascaridia species was identified as Ascaridia nymphii, which is the first record of A. nymphii from macaw parrot in China. Copyright © 2018 Elsevier B.V. All rights reserved.

The complete chloroplast DNA sequence of Eleutherococcus senticosus (Araliaceae); comparative evolutionary analyses with other three asterids.

PubMed

Yi, Dong-Keun; Lee, Hae-Lim; Sun, Byung-Yun; Chung, Mi Yoon; Kim, Ki-Joong

2012-05-01

This study reports the complete chloroplast (cp) DNA sequence of Eleutherococcus senticosus (GenBank: JN 637765), an endangered endemic species. The genome is 156,768 bp in length, and contains a pair of inverted repeat (IR) regions of 25,930 bp each, a large single copy (LSC) region of 86,755 bp and a small single copy (SSC) region of 18,153 bp. The structural organization, gene and intron contents, gene order, AT content, codon usage, and transcription units of the E. senticosus chloroplast genome are similar to that of typical land plant cp DNA. We aligned and analyzed the sequences of 86 coding genes, 19 introns and 113 intergenic spacers (IGS) in three different taxonomic hierarchies; Eleutherococcus vs. Panax, Eleutherococcus vs. Daucus, and Eleutherococcus vs. Nicotiana. The distribution of indels, the number of polymorphic sites and nucleotide diversity indicate that positional constraint is more important than functional constraint for the evolution of cp genome sequences in Asterids. For example, the intron sequences in the LSC region exhibited base substitution rates 5-11-times higher than that of the IR regions, while the intron sequences in the SSC region evolved 7-14-times faster than those in the IR region. Furthermore, the Ka/Ks ratio of the gene coding sequences supports a stronger evolutionary constraint in the IR region than in the LSC or SSC regions. Therefore, our data suggest that selective sweeps by base collection mechanisms more frequently eliminate polymorphisms in the IR region than in other regions. Chloroplast genome regions that have high levels of base substitutions also show higher incidences of indels. Thirty-five simple sequence repeat (SSR) loci were identified in the Eleutherococcus chloroplast genome. Of these, 27 are homopolymers, while six are di-polymers and two are tri-polymers. In addition to the SSR loci, we also identified 18 medium size repeat units ranging from 22 to 79 bp, 11 of which are distributed in the IGS or intron regions. These medium size repeats may contribute to developing a cp genome-specific gene introduction vector because the region may use for specific recombination sites.

Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

PubMed Central

Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T

1993-01-01

A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

Sequence of interleukin-2 isolated from human placental poly A+ RNA: possible role in maintenance of fetal allograft.

PubMed

Chernicky, C L; Tan, H; Burfeind, P; Ilan, J; Ilan, J

1996-02-01

There are several cell types within the placenta that produce cytokines which can contribute to the regulatory mechanisms that ensure normal pregnancy. The immunological milieu at the maternofetal interface is considered to be crucial for survival of the fetus. Interleukin-2 (IL-2) is expressed by the syncytiotrophoblast, the cell layer between the mother and the fetus. IL-2 appears to be a key factor in maintenance of pregnancy. Therefore, it was important to determine the sequence of human placental interleukin-2. Direct sequencing of human placental IL-2 cDNA was determined for the coding region. Subclone sequencing was carried out for the 5'- and 3'-untranslated regions (5'-UTR and 3'-UTR). The 5'-UTR for human placental IL-2 cDNA is 294 bp, which is 247 nucleotides longer than that reported for cDNA IL-2 derived from T cells. The sequence of the coding region is identical to that reported for T cell IL-2, while sequence analysis of the polymerase chain reaction (PCR) product showed that the cDNA from the 3' end was the same as that reported for cDNA from T cells. Human placental IL-2 cDNA is 1,028 base pairs (excluding the poly A tail), which is 247 bp longer at the 5' end than that reported for IL-2 T cell cDNA. Therefore, the extended 5'-UTR of the placental IL-2 cDNA may be a consequence of alternative promoter utilization in the placenta.

Microhomology-mediated end joining induces hypermutagenesis at breakpoint junctions

PubMed Central

Li, Fuyang; Villarreal, Diana; Shim, Jae Hoon; Myung, Kyungjae; Shim, Eun Yong; Lee, Sang Eun

2017-01-01

Microhomology (MH) flanking a DNA double-strand break (DSB) drives chromosomal rearrangements but its role in mutagenesis has not yet been analyzed. Here we determined the mutation frequency of a URA3 reporter gene placed at multiple locations distal to a DSB, which is flanked by different sizes (15-, 18-, or 203-bp) of direct repeat sequences for efficient repair in budding yeast. Induction of a DSB accumulates mutations in the reporter gene situated up to 14-kb distal to the 15-bp MH, but more modestly to those carrying 18- and 203-bp or no homology. Increased mutagenesis in MH-mediated end joining (MMEJ) appears coupled to its slower repair kinetics and the extensive resection occurring at flanking DNA. Chromosomal translocations via MMEJ also elevate mutagenesis of the flanking DNA sequences 7.1 kb distal to the breakpoint junction as compared to those without MH. The results suggest that MMEJ could destabilize genomes by triggering structural alterations and increasing mutation burden. PMID:28419093

Influence of DNA sequence on the structure of minicircles under torsional stress

PubMed Central

Wang, Qian; Irobalieva, Rossitza N.; Chiu, Wah; Schmid, Michael F.; Fogg, Jonathan M.; Zechiedrich, Lynn

2017-01-01

Abstract The sequence dependence of the conformational distribution of DNA under various levels of torsional stress is an important unsolved problem. Combining theory and coarse-grained simulations shows that the DNA sequence and a structural correlation due to topology constraints of a circle are the main factors that dictate the 3D structure of a 336 bp DNA minicircle under torsional stress. We found that DNA minicircle topoisomers can have multiple bend locations under high torsional stress and that the positions of these sharp bends are determined by the sequence, and by a positive mechanical correlation along the sequence. We showed that simulations and theory are able to provide sequence-specific information about individual DNA minicircles observed by cryo-electron tomography (cryo-ET). We provided a sequence-specific cryo-ET tomogram fitting of DNA minicircles, registering the sequence within the geometric features. Our results indicate that the conformational distribution of minicircles under torsional stress can be designed, which has important implications for using minicircle DNA for gene therapy. PMID:28609782

Genetic Characterization of Fasciola Isolates from West Azerbaijan Province Iran Based on ITS1 and ITS2 Sequence of Ribosomal DNA

PubMed Central

GALAVANI, Hossein; GHOLIZADEH, Saber; HAZRATI TAPPEH, Khosrow

2016-01-01

Background: Fascioliasis, caused by Fasciola hepatica and F. gigantica, has medical and economic importance in the world. Molecular approaches comparing traditional methods using for identification and characterization of Fasciola spp. are precise and reliable. The aims of current study were molecular characterization of Fasciola spp. in West Azerbaijan Province, Iran and then comparative analysis of them using GenBank sequences. Methods: A total number of 580 isolates were collected from different hosts in five cities of West Azerbaijan Province, in 2014 from 90 slaughtered cattle (n=50) and sheep (n=40). After morphological identification and DNA extraction, designing specific primer were used to amplification of ITS1, 5.8s and ITS2 regions, 50 samples were conducted to sequence, randomly. Result: Using morphometric characters 99.14% and 0.86% of isolates identified as F. hepatica and F. gigantica, respectively. PCR amplification of 1081 bp fragment and sequencing result showed 100% similarity with F. hepatica in ITS1 (428 bp), 5.8s (158 bp), and ITS2 (366 bp) regions. Sequence comparison among current study sequences and GenBank data showed 98% identity with 11 nucleotide mismatches. However, in phylogenetic tree F. hepatica sequences of West Azerbaijan Province, Iran, were in a close relationship with Iranian, Asian, and African isolates. Conclusions: Only F. hepatica species is distributed among sheep and cattle in West Azerbaijan Province Iran. However, 5 and 6 bp variation in ITS1 and ITS2 regions, respectively, is not enough to separate of Fasciola spp. Therefore, more studies are essential for designing new molecular markers to correct species identification. PMID:27095969

Analysis of the DNA sequence of a 15,500 bp fragment near the left telomere of chromosome XV from Saccharomyces cerevisiae reveals a putative sugar transporter, a carboxypeptidase homologue and two new open reading frames.

PubMed

Gamo, F J; Lafuente, M J; Casamayor, A; Ariño, J; Aldea, M; Casas, C; Herrero, E; Gancedo, C

1996-06-15

We report the sequence of a 15.5 kb DNA segment located near the left telomere of chromosome XV of Saccharomyces cerevisiae. The sequence contains nine open reading frames (ORFs) longer than 300 bp. Three of them are internal to other ones. One corresponds to the gene LGT3 that encodes a putative sugar transporter. Three adjacent ORFs were separated by two stop codons in frame. These ORFs presented homology with the gene CPS1 that encodes carboxypeptidase S. The stop codons were not found in the same sequence derived from another yeast strain. Two other ORFs without significant homology in databases were also found. One of them, O0420, is very rich in serine and threonine and presents a series of repeated or similar amino acid stretches along the sequence.

In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

PubMed

Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

1994-01-01

The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

Comparative analysis of mitochondrial genomes between a wheat K-type cytoplasmic male sterility (CMS) line and its maintainer line.

PubMed

Liu, Huitao; Cui, Peng; Zhan, Kehui; Lin, Qiang; Zhuo, Guoyin; Guo, Xiaoli; Ding, Feng; Yang, Wenlong; Liu, Dongcheng; Hu, Songnian; Yu, Jun; Zhang, Aimin

2011-03-29

Plant mitochondria, semiautonomous organelles that function as manufacturers of cellular ATP, have their own genome that has a slow rate of evolution and rapid rearrangement. Cytoplasmic male sterility (CMS), a common phenotype in higher plants, is closely associated with rearrangements in mitochondrial DNA (mtDNA), and is widely used to produce F1 hybrid seeds in a variety of valuable crop species. Novel chimeric genes deduced from mtDNA rearrangements causing CMS have been identified in several plants, such as rice, sunflower, pepper, and rapeseed, but there are very few reports about mtDNA rearrangements in wheat. In the present work, we describe the mitochondrial genome of a wheat K-type CMS line and compare it with its maintainer line. The complete mtDNA sequence of a wheat K-type (with cytoplasm of Aegilops kotschyi) CMS line, Ks3, was assembled into a master circle (MC) molecule of 647,559 bp and found to harbor 34 known protein-coding genes, three rRNAs (18 S, 26 S, and 5 S rRNAs), and 16 different tRNAs. Compared to our previously published sequence of a K-type maintainer line, Km3, we detected Ks3-specific mtDNA (> 100 bp, 11.38%) and repeats (> 100 bp, 29 units) as well as genes that are unique to each line: rpl5 was missing in Ks3 and trnH was absent from Km3. We also defined 32 single nucleotide polymorphisms (SNPs) in 13 protein-coding, albeit functionally irrelevant, genes, and predicted 22 unique ORFs in Ks3, representing potential candidates for K-type CMS. All these sequence variations are candidates for involvement in CMS. A comparative analysis of the mtDNA of several angiosperms, including those from Ks3, Km3, rice, maize, Arabidopsis thaliana, and rapeseed, showed that non-coding sequences of higher plants had mostly divergent multiple reorganizations during the mtDNA evolution of higher plants. The complete mitochondrial genome of the wheat K-type CMS line Ks3 is very different from that of its maintainer line Km3, especially in non-coding sequences. Sequence rearrangement has produced novel chimeric ORFs, which may be candidate genes for CMS. Comparative analysis of several angiosperm mtDNAs indicated that non-coding sequences are the most frequently reorganized during mtDNA evolution in higher plants.

Small tandemly repeated DNA sequences of higher plants likely originate from a tRNA gene ancestor.

PubMed Central

Benslimane, A A; Dron, M; Hartmann, C; Rode, A

1986-01-01

Several monomers (177 bp) of a tandemly arranged repetitive nuclear DNA sequence of Brassica oleracea have been cloned and sequenced. They share up to 95% homology between one another and up to 80% with other satellite DNA sequences of Cruciferae, suggesting a common ancestor. Both strands of these monomers show more than 50% homology with many tRNA genes; the best homologies have been obtained with Lys and His yeast mitochondrial tRNA genes (respectively 64% and 60%). These results suggest that small tandemly repeated DNA sequences of plants may have evolved from a tRNA gene ancestor. These tandem repeats have probably arisen via a process involving reverse transcription of polymerase III RNA intermediates, as is the case for interspersed DNA sequences of mammalians. A model is proposed to explain the formation of such small tandemly repeated DNA sequences. Images PMID:3774553

Isolation of a complete circular virus genome sequence from an Alaskan black-capped chickadee (Poecile atricapillus) gastrointestinal tract sample.

USGS Publications Warehouse

Hanna, Zachary R.; Runckel, Charles; Fuchs, Jerome; DeRisi, Joseph L.; Mindell, David P.; Van Hemert, Caroline R.; Handel, Colleen M.; Dumbacher, John P.

2015-01-01

We report here the genome sequence of a circular virus isolated from samples of an Alaskan black-capped chickadee (Poecile atricapillus) gastrointestinal tract. The genome is 2,152 bp in length and is most similar (30 to 44.5% amino acid identity) to the genome sequences of other single-stranded DNA (ssDNA) circular viruses belonging to the gemycircularvirus group.

Molecular Targeting of Prostate Cancer During Androgen Ablation: Inhibition of CHES1/FOXN3

DTIC Science & Technology

2013-05-01

the DNA sequences (~25^6 reads/sample) were mapped to the human genome reference sequence (hg19...tumor the AR has a genomic abnormality, placing the novel sequence 3’ of the transcriptional start site. However, it is unclear if a genomic alteration...exon/intron organization of the CHES1 gene was determined by BLAST analysis of the human genome using the 1,473-bp CHES1 cDNA sequence

The 193-base pair Gsg2 (haspin) promoter region regulates germ cell-specific expression bidirectionally and synchronously.

PubMed

Tokuhiro, Keizo; Miyagawa, Yasushi; Yamada, Shuichi; Hirose, Mika; Ohta, Hiroshi; Nishimune, Yoshitake; Tanaka, Hiromitsu

2007-03-01

Haspin is a unique protein kinase expressed predominantly in haploid male germ cells. The genomic structure of haspin (Gsg2) has revealed it to be intronless, and the entire transcription unit is in an intron of the integrin alphaE (Itgae) gene. Transcription occurs from a bidirectional promoter that also generates an alternatively spliced integrin alphaE-derived mRNA (Aed). In mice, the testis-specific alternative splicing of Aed is expressed bidirectionally downstream from the Gsg2 transcription initiation site, and a segment consisting of 26 bp transcribes both genomic DNA strands between Gsg2 and the Aed transcription initiation sites. To investigate the mechanisms for this unique gene regulation, we cloned and characterized the Gsg2 promoter region. The 193-bp genomic fragment from the 5' end of the Gsg2 and Aed genes, fused with EGFP and DsRed genes, drove the expression of both proteins in haploid germ cells of transgenic mice. This promoter element contained only a GC-rich sequence, and not the previously reported DNA sequences known to bind various transcription factors--with the exception of E2F1, TCFAP2A1 (AP2), and SP1. Here, we show that the 193-bp DNA sequence is sufficient for the specific, bidirectional, and synchronous expression in germ cells in the testis. We also demonstrate the existence of germ cell nuclear factors specifically bound to the promoter sequence. This activity may be regulated by binding to the promoter sequence with germ cell-specific nuclear complex(es) without regulation via DNA methylation.

Mitochondrial Genome Sequence of the Legume Vicia faba

PubMed Central

Negruk, Valentine

2013-01-01

The number of plant mitochondrial genomes sequenced exceeds two dozen. However, for a detailed comparative study of different phylogenetic branches more plant mitochondrial genomes should be sequenced. This article presents sequencing data and comparative analysis of mitochondrial DNA (mtDNA) of the legume Vicia faba. The size of the V. faba circular mitochondrial master chromosome of cultivar Broad Windsor was estimated as 588,000 bp with a genome complexity of 387,745 bp and 52 conservative mitochondrial genes; 32 of them encoding proteins, 3 rRNA, and 17 tRNA genes. Six tRNA genes were highly homologous to chloroplast genome sequences. In addition to the 52 conservative genes, 114 unique open reading frames (ORFs) were found, 36 without significant homology to any known proteins and 29 with homology to the Medicago truncatula nuclear genome and to other plant mitochondrial ORFs, 49 ORFs were not homologous to M. truncatula but possessed sequences with significant homology to other plant mitochondrial or nuclear ORFs. In general, the unique ORFs revealed very low homology to known closely related legumes, but several sequence homologies were found between V. faba, Beta vulgaris, Nicotiana tabacum, Vitis vinifera, and even the monocots Oryza sativa and Zea mays. Most likely these ORFs arose independently during angiosperm evolution (Kubo and Mikami, 2007; Kubo and Newton, 2008). Computational analysis revealed in total about 45% of V. faba mtDNA sequence being homologous to the Medicago truncatula nuclear genome (more than to any sequenced plant mitochondrial genome), and 35% of this homology ranging from a few dozen to 12,806 bp are located on chromosome 1. Apparently, mitochondrial rrn5, rrn18, rps10, ATP synthase subunit alpha, cox2, and tRNA sequences are part of transcribed nuclear mosaic ORFs. PMID:23675376

(S)-3-hydroxy-3-methylglutaryl coenzyme A reductase, a product of the mva operon of Pseudomonas mevalonii, is regulated at the transcriptional level.

PubMed Central

Wang, Y L; Beach, M J; Rodwell, V W

1989-01-01

We have cloned and sequenced a 505-base-pair (bp) segment of DNA situated upstream of mvaA, the structural gene for (S)-3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.88) of Pseudomonas mevalonii. The DNA segment that we characterized includes the promoter region for the mva operon. Nuclease S1 mapping and primer extension analysis showed that mvaA is the promoter-proximal gene of the mva operon. Transcription initiates at -56 bp relative to the first A (+1) of the translation start site. Transcription in vivo was induced by mevalonate. Structural features of the mva promoter region include an 80-bp A + T-rich region, and -12, -24 consensus sequences that resemble sequences of sigma 54 promoters in enteric organisms. The relative amplitudes of catalytic activity, enzyme protein, and mvaA mRNA are consistent with a model of regulation of this operon at the transcriptional level. Images PMID:2477360

Identification of gyrB and rpoB gene mutations and differentially expressed proteins between a novobiocin-resistant Aeromonas hydrophila catfish vaccine strain and its virulent parent strain

USDA-ARS?s Scientific Manuscript database

Sequence comparison between the full-length 2412 bp DNA gyrase subunit B (gyrB) gene of a novobiocin resistant Aeromonas hydrophila AH11NOVO vaccine strain and that of its virulent parent strain AH11P revealed 10 missense mutations. Similarly, sequence comparison between the full-length 4092 bp RNA ...

Complete Genome Sequence of Thermus thermophilus TMY, Isolated from a Geothermal Power Plant.

PubMed

Fujino, Yasuhiro; Nagayoshi, Yuko; Ohshima, Toshihisa; Ogata, Seiya; Doi, Katsumi

2017-02-02

Thermus thermophilus TMY (JCM 10668) was isolated from silica scale formed at a geothermal power plant in Japan. Here, we report the complete genome sequence for this strain, which contains a chromosomal DNA of 2,121,526 bp with 2,500 predicted genes and a pTMY plasmid of 19,139 bp, with 28 predicted genes. Copyright © 2017 Fujino et al.

Development of ITS sequence based molecular marker to distinguish, Tribulus terrestris L. (Zygophyllaceae) from its adulterants.

PubMed

Balasubramani, Subramani Paranthaman; Murugan, Ramar; Ravikumar, Kaliamoorthy; Venkatasubramanian, Padma

2010-09-01

Tribulus terrestris L. (Zygophyllaceae) is one of the highly traded raw drugs and also used as a stimulative food additive in Europe and USA. While, Ayurvedic Pharmacopoeia of India recognizes T. terrestris as Goksura, Tribulus lanuginosus and T. subramanyamii are also traded by the same name raising issues of quality control. The nuclear ribosomal RNA genes and ITS (internal transcribed spacer) sequence were used to develop species-specific DNA markers. The species-specific markers efficiently amplified 295bp for T. terrestris (TT1F and TT1R), 300bp for T. lanuginosus (TL1F and TL1R) and 214bp for T. subramanyamii (TS1F and TS1R). These DNA markers can be used to distinguish T. terrestris from its adulterants. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Spiking of contemporary human template DNA with ancient DNA extracts induces mutations under PCR and generates nonauthentic mitochondrial sequences.

PubMed

Pusch, Carsten M; Bachmann, Lutz

2004-05-01

Proof of authenticity is the greatest challenge in palaeogenetic research, and many safeguards have become standard routine in laboratories specialized on ancient DNA research. Here we describe an as-yet unknown source of artifacts that will require special attention in the future. We show that ancient DNA extracts on their own can have an inhibitory and mutagenic effect under PCR. We have spiked PCR reactions including known human test DNA with 14 selected ancient DNA extracts from human and nonhuman sources. We find that the ancient DNA extracts inhibit the amplification of large fragments to different degrees, suggesting that the usual control against contaminations, i.e., the absence of long amplifiable fragments, is not sufficient. But even more important, we find that the extracts induce mutations in a nonrandom fashion. We have amplified a 148-bp stretch of the mitochondrial HVRI from contemporary human template DNA in spiked PCR reactions. Subsequent analysis of 547 sequences from cloned amplicons revealed that the vast majority (76.97%) differed from the correct sequence by single nucleotide substitutions and/or indels. In total, 34 positions of a 103-bp alignment are affected, and most mutations occur repeatedly in independent PCR amplifications. Several of the induced mutations occur at positions that have previously been detected in studies of ancient hominid sequences, including the Neandertal sequences. Our data imply that PCR-induced mutations are likely to be an intrinsic and general problem of PCR amplifications of ancient templates. Therefore, ancient DNA sequences should be considered with caution, at least as long as the molecular basis for the extract-induced mutations is not understood.

Identification of Simple Sequence Repeats in Chloroplast Genomes of Magnoliids Through Bioinformatics Approach.

PubMed

Srivastava, Deepika; Shanker, Asheesh

2016-12-01

Basal angiosperms or Magnoliids is an important clade of commercially important plants which mainly include spices and edible fruits. In this study, 17 chloroplast genome sequences belonging to clade Magnoliids were screened for the identification of chloroplast simple sequence repeats (cpSSRs). Simple sequence repeats or microsatellites are short stretches of DNA up to 1-6 base pair in length. These repeats are ubiquitous and play important role in the development of molecular markers and to study the mapping of traits of economic, medical or ecological interest. A total of 479 SSRs were detected, showing average density of 1 SSR/6.91 kb. Depending on the repeat units, the length of SSRs ranged from 12 to 24 bp for mono-, 12 to 18 bp for di-, 12 to 26 bp for tri-, 12 to 24 bp for tetra-, 15 bp for penta- and 18 bp for hexanucleotide repeats. Mononucleotide repeats were the most frequent (207, 43.21 %) followed by tetranucleotide repeats (130, 27.13 %). Penta- and hexanucleotide repeats were least frequent or absent in these chloroplast genomes.

Selection of homeotic proteins for binding to a human DNA replication origin.

PubMed

de Stanchina, E; Gabellini, D; Norio, P; Giacca, M; Peverali, F A; Riva, S; Falaschi, A; Biamonti, G

2000-06-09

We have previously shown that a cell cycle-dependent nucleoprotein complex assembles in vivo on a 74 bp sequence within the human DNA replication origin associated to the Lamin B2 gene. Here, we report the identification, using a one-hybrid screen in yeast, of three proteins interacting with the 74 bp sequence. All of them, namely HOXA13, HOXC10 and HOXC13, are orthologues of the Abdominal-B gene of Drosophila melanogaster and are members of the homeogene family of developmental regulators. We describe the complete open reading frame sequence of HOXC10 and HOXC13 along with the structure of the HoxC13 gene. The specificity of binding of these two proteins to the Lamin B2 origin is confirmed by both band-shift and in vitro footprinting assays. In addition, the ability of HOXC10 and HOXC13 to increase the activity of a promoter containing the 74 bp sequence, as assayed by CAT-assay experiments, demonstrates a direct interaction of these homeoproteins with the origin sequence in mammalian cells. We also show that HOXC10 expression is cell-type-dependent and positively correlates with cell proliferation. Copyright 2000 Academic Press.

Association between Chloroplast and Mitochondrial DNA sequences in Chinese Prunus genotypes (Prunus persica, Prunus domestica, and Prunus avium).

PubMed

Pervaiz, Tariq; Sun, Xin; Zhang, Yanyi; Tao, Ran; Zhang, Junhuan; Fang, Jinggui

2015-01-16

The nuclear DNA is conventionally used to assess the diversity and relatedness among different species, but variations at the DNA genome level has also been used to study the relationship among different organisms. In most species, mitochondrial and chloroplast genomes are inherited maternally; therefore it is anticipated that organelle DNA remains completely associated. Many research studies were conducted simultaneously on organelle genome. The objectives of this study was to analyze the genetic relationship between chloroplast and mitochondrial DNA in three Chinese Prunus genotypes viz., Prunus persica, Prunus domestica, and Prunus avium. We investigated the genetic diversity of Prunus genotypes using simple sequence repeat (SSR) markers relevant to the chloroplast and mitochondria. Most of the genotypes were genetically similar as revealed by phylogenetic analysis. The Y2 Wu Xing (Cherry) and L2 Hong Xin Li (Plum) genotypes have a high similarity index (0.89), followed by Zi Ye Li (0.85), whereas; L1 Tai Yang Li (plum) has the lowest genetic similarity (0.35). In case of cpSSR, Hong Tao (Peach) and L1 Tai Yang Li (Plum) genotypes demonstrated similarity index of 0.85 and Huang Tao has the lowest similarity index of 0.50. The mtSSR nucleotide sequence analysis revealed that each genotype has similar amplicon length (509 bp) except M5Y1 i.e., 505 bp with CCB256 primer; while in case of NAD6 primer, all genotypes showed different sizes. The MEHO (Peach), MEY1 (Cherry), MEL2 (Plum) and MEL1 (Plum) have 586 bps; while MEY2 (Cherry), MEZI (Plum) and MEHU (Peach) have 585, 584 and 566 bp, respectively. The CCB256 primer showed highly conserved sequences and minute single polymorphic nucleotides with no deletion or mutation. The cpSSR (ARCP511) microsatellites showed the harmonious amplicon length. The CZI (Plum), CHO (Peach) and CL1 (Plum) showed 182 bp; whileCHU (Peach), CY2 (Cherry), CL2 (Plum) and CY1 (Cherry) showed 181 bp amplicon lengths. These results demonstrated high conservation in chloroplast and mitochondrial genome among Prunus species during the evolutionary process. These findings are valuable to study the organelle DNA diversity in different species and genotypes of Prunus to provide in depth insight in to the mitochondrial and chloroplast genomes.

Cloning of a cDNA encoding 1-aminocyclopropane-1-carboxylate synthase and expression of its mRNA in ripening apple fruit.

PubMed

Dong, J G; Kim, W T; Yip, W K; Thompson, G A; Li, L; Bennett, A B; Yang, S F

1991-08-01

1-Aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) purified from apple (Malus sylvestris Mill.) fruit was subjected to trypsin digestion. Following separation by reversed-phase high-pressure liquid chromatography, ten tryptic peptides were sequenced. Based on the sequences of three tryptic peptides, three sets of mixed oligonucleotide probes were synthesized and used to screen a plasmid cDNA library prepared from poly(A)(+) RNA of ripe apple fruit. A 1.5-kb (kilobase) cDNA clone which hybridized to all three probes were isolated. The clone contained an open reading frame of 1214 base pairs (bp) encoding a sequence of 404 amino acids. While the polyadenine tail at the 3'-end was intact, it lacked a portion of sequence at the 5'-end. Using the RNA-based polymerase chain reaction, an additional sequence of 148 bp was obtained at the 5'-end. Thus, 1362 bp were sequenced and they encode 454 amino acids. The deduced amino-acid sequence contained peptide sequences corresponding to all ten tryptic fragments, confirming the identity of the cDNA clone. Comparison of the deduced amino-acid sequence between ACC synthase from apple fruit and those from tomato (Lycopersicon esculentum Mill.) and winter squash (Cucurbita maxima Duch.) fruits demonstrated the presence of seven highly conserved regions, including the previously identified region for the active site. The size of the translation product of ACC-synthase mRNA was similar to that of the mature protein on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), indicating that apple ACC-synthase undergoes only minor, if any, post-translational proteolytic processing. Analysis of ACC-synthase mRNA by in-vitro translation-immunoprecipitation, and by Northern blotting indicates that the ACC-synthase mRNA was undetectable in unripe fruit, but was accumulated massively during the ripening proccess. These data demonstrate that the expression of the ACC-synthase gene is developmentally regulated.

Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus.

PubMed

Chun, J; Huq, A; Colwell, R R

1999-05-01

Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae.

cDNA, genomic sequence cloning, and overexpression of EIF1 from the giant panda (Ailuropoda Melanoleuca) and the black bear (Ursus Thibetanus Mupinensis).

PubMed

Hou, Wan-ru; Tang, Yun; Hou, Yi-ling; Song, Yan; Zhang, Tian; Wu, Guang-fu

2010-07-01

Eukaryotic initiation factor (eIF) EIF1 is a universally conserved translation factor that is involved in translation initiation site selection. The cDNA and the genomic sequences of EIF1 were cloned successfully from the giant panda (Ailuropoda melanoleuca) and the black bear (Ursus thibetanus mupinensis) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-polymerase chain reaction, respectively. The cDNAs of the EIF1 cloned from the giant panda and the black bear are 418 bp in size, containing an open reading frame (ORF) of 342 bp encoding 113 amino acids. The length of the genomic sequence of the giant panda is 1909 bp, which contains four exons and three introns. The length of the genomic sequence of the black bear is 1897 bp, which also contains four exons and three introns. Sequence alignment indicates a high degree of homology to those of Homo sapiens, Mus musculus, Rattus norvegicus, and Bos Taurus at both amino acid and DNA levels. Topology prediction shows there are one N-glycosylation site, two Casein kinase II phosphorylation sites, and a Amidation site in the EIF1 protein of the giant panda and black bear. In addition, there is a protein kinase C phosphorylation site in EIF1 of the giant panda. The giant panda and the black bear EIF1 genes were overexpressed in E. coli BL21. The results indicated that the both EIF1 fusion proteins with the N-terminally His-tagged form gave rise to the accumulation of two expected 19 kDa polypeptide. The expression products obtained could be used to purify the proteins and study their function further.

Intramolecular transposition by a synthetic IS50 (Tn5) derivative

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomcsanyi, T.; Phadnis, S.H.; Berg, D.E.

1990-11-01

We report the formation of deletions and inversions by intramolecular transposition of Tn5-derived mobile elements. The synthetic transposons used contained the IS50 O and I end segments and the transposase gene, a contraselectable gene encoding sucrose sensitivity (sacB), antibiotic resistance genes, and a plasmid replication origin. Both deletions and inversions were associated with loss of a 300-bp segment that is designated the vector because it is outside of the transposon. Deletions were severalfold more frequent than inversions, perhaps reflecting constraints on DNA twisting or abortive transposition. Restriction and DNA sequence analyses showed that both types of rearrangements extended from onemore » transposon end to many different sites in target DNA. In the case of inversions, transposition generated 9-bp direct repeats of target sequences.« less

Determination of ABO genotypes with DNA extracted from formalin-fixed, paraffin-embedded tissues.

PubMed

Yamada, M; Yamamoto, Y; Tanegashima, A; Kane, M; Ikehara, Y; Fukunaga, T; Nishi, K

1994-01-01

The gene encoding the specific glycosyltransferases which catalyze the conversion of the H antigen to A or B antigens shows a slight but distinct variation in its allelic nucleotide sequence and can be divided into 6 genotypes when digested with specific restriction enzymes. We extracted DNA from formalin-fixed, paraffin-embedded tissues using SDS/proteinase K treatment followed by phenol/chloroform extraction. The sequence of nucleotides for the A, B and O genes was amplified by the polymerase chain reaction (PCR). DNA fragments of 128 bp and 200 bp could be amplified in the second round of PCR, using an aliquot of the first round PCR product as template. Degraded DNA from paraffin blocks stored for up to 10.7 years could be successfully typed. The ABO genotype was deduced from the digestion patterns with an appropriate combination of restriction enzymes and was compatible with the phenotype obtained from the blood sample.

Tandemly repeated sequences in mtDNA control region of whitefish, Coregonus lavaretus.

PubMed

Brzuzan, P

2000-06-01

Length variation of the mitochondrial DNA control region was observed with PCR amplification of a sample of 138 whitefish (Coregonus lavaretus). Nucleotide sequences of representative PCR products showed that the variation was due to the presence of an approximately 100-bp motif tandemly repeated two, three, or five times in the region between the conserved sequence block-3 (CSB-3) and the gene for phenylalanine tRNA. This is the first report on the tandem array composed of long repeat units in mitochondrial DNA of salmonids.

DNA Base-Calling from a Nanopore Using a Viterbi Algorithm

PubMed Central

Timp, Winston; Comer, Jeffrey; Aksimentiev, Aleksei

2012-01-01

Nanopore-based DNA sequencing is the most promising third-generation sequencing method. It has superior read length, speed, and sample requirements compared with state-of-the-art second-generation methods. However, base-calling still presents substantial difficulty because the resolution of the technique is limited compared with the measured signal/noise ratio. Here we demonstrate a method to decode 3-bp-resolution nanopore electrical measurements into a DNA sequence using a Hidden Markov model. This method shows tremendous potential for accuracy (∼98%), even with a poor signal/noise ratio. PMID:22677395

Molecular characterization of a gene POLR2H encoded an essential subunit for RNA polymerase II from the Giant Panda (Ailuropoda Melanoleuca).

PubMed

Du, Yu-Jie; Hou, Yi-Ling; Hou, Wan-Ru

2013-02-01

The Giant Panda is an endangered and valuable gene pool in genetic, its important functional gene POLR2H encodes an essential shared peptide H of RNA polymerases. The genomic DNA and cDNA sequences were cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) adopting touchdown-PCR and reverse transcription polymerase chain reaction (RT-PCR), respectively. The length of the genomic sequence of the Giant Panda is 3,285 bp, including five exons and four introns. The cDNA fragment cloned is 509 bp in length, containing an open reading frame of 453 bp encoding 150 amino acids. Alignment analysis indicated that both the cDNA and its deduced amino acid sequence were highly conserved. Protein structure prediction showed that there was one protein kinase C phosphorylation site, four casein kinase II phosphorylation sites and one amidation site in the POLR2H protein, further shaping advanced protein structure. The cDNA cloned was expressed in Escherichia coli, which indicated that POLR2H fusion with the N-terminally His-tagged form brought about the accumulation of an expected 20.5 kDa polypeptide in line with the predicted protein. On the basis of what has already been achieved in this study, further deep-in research will be conducted, which has great value in theory and practical significance.

Molecular characterization of a distinct begomovirus species from Vernonia cinerea and its associated DNA-beta using the bacteriophage Phi 29 DNA polymerase.

PubMed

Packialakshmi, R M; Srivastava, N; Girish, K R; Usha, R

2010-08-01

Vernonia cinerea plants with yellow vein symptoms were collected around crop fields in Madurai. A portion (550 bp) of the AV1 gene amplified using degenerate primers from the total DNA purified from diseased leaf sample was cloned and sequenced. Specific primers derived from the above sequence were used to amplify 2,745 nucleotides with the typical genome organization of begomoviral DNA A (EMBL Accession No. AM182232). Sequence comparison with other begomoviruses revealed the greatest identity (82.4%) with Emilia yellow vein virus (EmYVV-[Fz1]) from China and less than 80% with all other known begomoviruses. The International Committee on Taxonomy of Viruses (ICTV) has therefore recognized Vernonia yellow vein virus (VeYVV) as a distinct begomovirus species. Conventional PCR could not amplify the DNA B or DNA beta from the diseased tissue. However, the beta DNA (1364 bp) associated with the disease was obtained (Accession No. FN435836) by the rolling circle amplification-restriction fragment length polymorphism method (RCA-RFLP) using Phi 29 DNA polymerase. Sequence analysis shows that DNA beta of VeYVV has the highest identity (56.8%) with DNA beta of Sigesbeckia yellow vein Guangxi betasatellite (SibYVGxB-[CN: Gx111:05]) and 56-53% with DNA beta associated with other begomoviruses. This is the first report of the molecular characterization of VeYVV from V. cinerea in India. The complete molecular characterization, phylogenetic analysis, and putative recombination events in VeYVV are reported.

Sequence characterization of cDNA sequence of encoding of an antimicrobial Peptide with no disulfide bridge from the Iranian mesobuthus eupeus venomous glands.

PubMed

Farajzadeh-Sheikh, Ahmad; Jolodar, Abbas; Ghaemmaghami, Shamsedin

2013-01-01

Scorpion venom glands produce some antimicrobial peptides (AMP) that can rapidly kill a broad range of microbes and have additional activities that impact on the quality and effectiveness of innate responses and inflammation. In this study, we reported the identification of a cDNA sequence encoding cysteine-free antimicrobial peptides isolated from venomous glands of this species. Total RNA was extracted from the Iranian mesobuthus eupeus venom glands, and cDNA was synthesized by using the modified oligo (dT). The cDNA was used as the template for applying Semi-nested RT- PCR technique. PCR Products were used for direct nucleotide sequencing and the results were compared with Gen Bank database. A 213 BP cDNA fragment encoding the entire coding region of an antimicrobial toxin from the Iranian scorpion M. Eupeus venom glands were isolated. The full-length sequence of the coding region was 210 BP contained an open reading frame of 70 amino with a predicted molecular mass of 7970.48 Da and theoretical Pi of 9.10. The open reading frame consists of 210 BP encoding a precursor of 70 amino acid residues, including a signal peptide of 23 residues a propertied of 7 residues, and a mature peptide of 34 residues with no disulfide bridge. The peptide has detectable sequence identity to the Lesser Asian mesobuthus eupeus MeVAMP-2 (98%), MeVAMP-9 (60%) and several previously described AMPs from other scorpion venoms including mesobuthus martensii (94%) and buthus occitanus Israelis (82%). The secondary structure of the peptide mainly consisted of α-helical structure which was generally conserved by previously reported scorpion counterparts. The phylogenetic analysis showed that the Iranian MeAMP-like toxin was similar but not identical with that of venom antimicrobial peptides from lesser Asian scorpion mesobuthus eupeus.

Comparing COI and ITS as DNA barcode markers for mushrooms and allies (Agaricomycotina).

PubMed

Dentinger, Bryn T M; Didukh, Maryna Y; Moncalvo, Jean-Marc

2011-01-01

DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (~450 bp) representing ~100 morphospecies from ~650 collections of Agaricomycotina using several sets of new primers. Large introns (~1500 bp) at variable locations were detected in ~5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (~30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms.

Comparing COI and ITS as DNA Barcode Markers for Mushrooms and Allies (Agaricomycotina)

PubMed Central

Dentinger, Bryn T. M.; Didukh, Maryna Y.; Moncalvo, Jean-Marc

2011-01-01

DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (∼450 bp) representing ∼100 morphospecies from ∼650 collections of Agaricomycotina using several sets of new primers. Large introns (∼1500 bp) at variable locations were detected in ∼5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (∼30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms. PMID:21966418

Molecular cloning, overexpression, purification, and sequence analysis of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide.

PubMed

Fu, L; Hou, Y L; Ding, X; Du, Y J; Zhu, H Q; Zhang, N; Hou, W R

2016-08-30

The complementary DNA (cDNA) of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide (FTL) gene was successfully cloned using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing FTL cDNA and overexpressed it in Escherichia coli using pET28a plasmids. The expressed protein was then purified by nickel chelate affinity chromatography. The cloned cDNA fragment was 580 bp long and contained an open reading frame of 525 bp. The deduced protein sequence was composed of 175 amino acids and had an estimated molecular weight of 19.90 kDa, with an isoelectric point of 5.53. Topology prediction revealed one N-glycosylation site, two casein kinase II phosphorylation sites, one N-myristoylation site, two protein kinase C phosphorylation sites, and one cell attachment sequence. Alignment indicated that the nucleotide and deduced amino acid sequences are highly conserved across several mammals, including Homo sapiens, Cavia porcellus, Equus caballus, and Felis catus, among others. The FTL gene was readily expressed in E. coli, which gave rise to the accumulation of a polypeptide of the expected size (25.50 kDa, including an N-terminal polyhistidine tag).

Detection of trypanosomatid Phytomonas parasitic in plants by polymerase chain reaction amplification of small subunit ribosomal DNA.

PubMed

Teixeira, M M; Campaner, M; Camargo, E P

1994-01-01

To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.

Torque measurements reveal sequence-specific cooperative transitions in supercoiled DNA

PubMed Central

Oberstrass, Florian C.; Fernandes, Louis E.; Bryant, Zev

2012-01-01

B-DNA becomes unstable under superhelical stress and is able to adopt a wide range of alternative conformations including strand-separated DNA and Z-DNA. Localized sequence-dependent structural transitions are important for the regulation of biological processes such as DNA replication and transcription. To directly probe the effect of sequence on structural transitions driven by torque, we have measured the torsional response of a panel of DNA sequences using single molecule assays that employ nanosphere rotational probes to achieve high torque resolution. The responses of Z-forming d(pGpC)n sequences match our predictions based on a theoretical treatment of cooperative transitions in helical polymers. “Bubble” templates containing 50–100 bp mismatch regions show cooperative structural transitions similar to B-DNA, although less torque is required to disrupt strand–strand interactions. Our mechanical measurements, including direct characterization of the torsional rigidity of strand-separated DNA, establish a framework for quantitative predictions of the complex torsional response of arbitrary sequences in their biological context. PMID:22474350

An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

PubMed

Itzhaki, H; Maxson, J M; Woodson, W R

1994-09-13

The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

DNA sequence analysis of a 10 624 bp fragment of the left arm of chromosome XV from Saccharomyces cerevisiae reveals a RNA binding protein, a mitochondrial protein, two ribosomal proteins and two new open reading frames.

PubMed

Lafuente, M J; Gamo, F J; Gancedo, C

1996-09-01

We have determined the sequence of a 10624 bp DNA segment located in the left arm of chromosome XV of Saccharomyces cerevisiae. The sequence contains eight open reading frames (ORFs) longer than 100 amino acids. Two of them do not present significant homology with sequences found in the databases. The product of ORF o0553 is identical to the protein encoded by the gene SMF1. Internal to it there is another ORF, o0555 that is apparently expressed. The proteins encoded by ORFs o0559 and o0565 are identical to ribosomal proteins S19.e and L18 respectively. ORF o0550 encodes a protein with an RNA binding signature including RNP motifs and stretches rich in asparagine, glutamine and arginine.

Molecular characterization and physical localization of highly repetitive DNA sequences from Brazilian Alstroemeria species.

PubMed

Kuipers, A G J; Kamstra, S A; de Jeu, M J; Visser, R G F

2002-01-01

Highly repetitive DNA sequences were isolated from genomic DNA libraries of Alstroemeria psittacina and A. inodora. Among the repetitive sequences that were isolated, tandem repeats as well as dispersed repeats could be discerned. The tandem repeats belonged to a family of interlinked Sau3A subfragments with sizes varying from 68-127 bp, and constituted a larger HinfI repeat of approximately 400 bp. Southern hybridization showed a similar molecular organization of the tandem repeats in each of the Brazilian Alstroemeria species tested. None of the repeats hybridized with DNA from Chilean Alstroemeria species, which indicates that they are specific for the Brazilian species. In-situ localization studies revealed the tandem repeats to be localized in clusters on the chromosomes of A. inodora and A. psittacina: distal hybridization sites were found on chromosome arms 2PS, 6PL, 7PS, 7PL and 8PL, interstitial sites on chromosome arms 2PL, 3PL, 4PL and 5PL. The applicability of the tandem repeats for cytogenetic analysis of interspecific hybrids and their role in heterochromatin organization are discussed.

A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

PubMed

Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

2008-12-01

A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

Optimized mtDNA Control Region Primer Extension Capture Analysis for Forensically Relevant Samples and Highly Compromised mtDNA of Different Age and Origin

PubMed Central

Eduardoff, Mayra; Xavier, Catarina; Strobl, Christina; Casas-Vargas, Andrea; Parson, Walther

2017-01-01

The analysis of mitochondrial DNA (mtDNA) has proven useful in forensic genetics and ancient DNA (aDNA) studies, where specimens are often highly compromised and DNA quality and quantity are low. In forensic genetics, the mtDNA control region (CR) is commonly sequenced using established Sanger-type Sequencing (STS) protocols involving fragment sizes down to approximately 150 base pairs (bp). Recent developments include Massively Parallel Sequencing (MPS) of (multiplex) PCR-generated libraries using the same amplicon sizes. Molecular genetic studies on archaeological remains that harbor more degraded aDNA have pioneered alternative approaches to target mtDNA, such as capture hybridization and primer extension capture (PEC) methods followed by MPS. These assays target smaller mtDNA fragment sizes (down to 50 bp or less), and have proven to be substantially more successful in obtaining useful mtDNA sequences from these samples compared to electrophoretic methods. Here, we present the modification and optimization of a PEC method, earlier developed for sequencing the Neanderthal mitochondrial genome, with forensic applications in mind. Our approach was designed for a more sensitive enrichment of the mtDNA CR in a single tube assay and short laboratory turnaround times, thus complying with forensic practices. We characterized the method using sheared, high quantity mtDNA (six samples), and tested challenging forensic samples (n = 2) as well as compromised solid tissue samples (n = 15) up to 8 kyrs of age. The PEC MPS method produced reliable and plausible mtDNA haplotypes that were useful in the forensic context. It yielded plausible data in samples that did not provide results with STS and other MPS techniques. We addressed the issue of contamination by including four generations of negative controls, and discuss the results in the forensic context. We finally offer perspectives for future research to enable the validation and accreditation of the PEC MPS method for final implementation in forensic genetic laboratories. PMID:28934125

Morphology and genome organization of the virus PSV of the hyperthermophilic archaeal genera Pyrobaculum and Thermoproteus: a novel virus family, the Globuloviridae.

PubMed

Häring, Monika; Peng, Xu; Brügger, Kim; Rachel, Reinhard; Stetter, Karl O; Garrett, Roger A; Prangishvili, David

2004-06-01

A novel virus, termed Pyrobaculum spherical virus (PSV), is described that infects anaerobic hyperthermophilic archaea of the genera Pyrobaculum and Thermoproteus. Spherical enveloped virions, about 100 nm in diameter, contain a major multimeric 33-kDa protein and host-derived lipids. A viral envelope encases a superhelical nucleoprotein core containing linear double-stranded DNA. The PSV infection cycle does not cause lysis of host cells. The viral genome was sequenced and contains 28337 bp. The genome is unique for known archaeal viruses in that none of the genes, including that encoding the major structural protein, show any significant sequence matches to genes in public sequence databases. Exceptionally for an archaeal double-stranded DNA virus, almost all the recognizable genes are located on one DNA strand. The ends of the genome consist of 190-bp inverted repeats that contain multiple copies of short direct repeats. The two DNA strands are probably covalently linked at their termini. On the basis of the unusual morphological and genomic properties of this DNA virus, we propose to assign PSV to a new viral family, the Globuloviridae.

Molecular cloning of a cDNA coding for GTP cyclohydrolase I from Dictyostelium discoideum.

PubMed Central

Witter, K; Cahill, D J; Werner, T; Ziegler, I; Rödl, W; Bacher, A; Gütlich, M

1996-01-01

The GTP cyclohydrolase I (GTP-CH) gene of the cellular slime mould Dictyostelium discoideum has been cloned and sequenced. The 855 bp cDNA of this gene contains the open reading frame (ORF) encoding 232 amino acids with a predicted molecular mass of approx. 26 kDa. Southern blot analysis indicated the presence of a single gene for GTP-CH in Dictyostelium. PCR amplification of the ORF from chromosomal DNA and sequencing showed the existence of a 101 bp intron in the GTP-CH gene of Dictyostelium discoideum. The amino acid sequence has 47% and 49% positional identity to those of the human and yeast enzymes respectively. Most of the sequence variation between species is located in the N-terminal part of the protein. The overall identity with the E. coli protein is markedly lower. The enzyme was expressed in E. coli and purified as a 68 kDa fusion protein with the maltose-binding protein of E. coli. GTP-CH of Dictyostelium is heat-stable and showed maximal activity at 60 degrees C. The Km value for GTP is 50 microM. PMID:8870645

CENP-B binds a novel centromeric sequence in the Asian mouse Mus caroli.

PubMed Central

Kipling, D; Mitchell, A R; Masumoto, H; Wilson, H E; Nicol, L; Cooke, H J

1995-01-01

Minor satellite DNA, found at Mus musculus centromeres, is not present in the genome of the Asian mouse Mus caroli. This repetitive sequence family is speculated to have a role in centromere function by providing an array of binding sites for the centromere-associated protein CENP-B. The apparent absence of CENP-B binding sites in the M. caroli genome poses a major challenge to this hypothesis. Here we describe two abundant satellite DNA sequences present at M. caroli centromeres. These satellites are organized as tandem repeat arrays, over 1 Mb in size, of either 60- or 79-bp monomers. All autosomes carry both satellites and small amounts of a sequence related to the M. musculus major satellite. The Y chromosome contains small amounts of both major satellite and the 60-bp satellite, whereas the X chromosome carries only major satellite sequences. M. caroli chromosomes segregate in M. caroli x M. musculus interspecific hybrid cell lines, indicating that the two sets of chromosomes can interact with the same mitotic spindle. Using a polyclonal CENP-B antiserum, we demonstrate that M. caroli centromeres can bind murine CENP-B in such an interspecific cell line, despite the absence of canonical 17-bp CENP-B binding sites in the M. caroli genome. Sequence analysis of the 79-bp M. caroli satellite reveals a 17-bp motif that contains all nine bases previously shown to be necessary for in vitro binding of CENP-B. This M. caroli motif binds CENP-B from HeLa cell nuclear extract in vitro, as indicated by gel mobility shift analysis. We therefore suggest that this motif also causes CENP-B to associate with M. caroli centromeres in vivo. Despite the sequence differences, M. caroli presents a third, novel mammalian centromeric sequence producing an array of binding sites for CENP-B. PMID:7623797

Architecture of a Fur Binding Site: a Comparative Analysis

PubMed Central

Lavrrar, Jennifer L.; McIntosh, Mark A.

2003-01-01

Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

Sequencing of the large dsDNA genome of Oryctes rhinoceros nudivirus using multiple displacement amplification of nanogram amounts of virus DNA.

PubMed

Wang, Yongjie; Kleespies, Regina G; Ramle, Moslim B; Jehle, Johannes A

2008-09-01

The genomic sequence analysis of many large dsDNA viruses is hampered by the lack of enough sample materials. Here, we report a whole genome amplification of the Oryctes rhinoceros nudivirus (OrNV) isolate Ma07 starting from as few as about 10 ng of purified viral DNA by application of phi29 DNA polymerase- and exonuclease-resistant random hexamer-based multiple displacement amplification (MDA) method. About 60 microg of high molecular weight DNA with fragment sizes of up to 25 kbp was amplified. A genomic DNA clone library was generated using the product DNA. After 8-fold sequencing coverage, the 127,615 bp of OrNV whole genome was sequenced successfully. The results demonstrate that the MDA-based whole genome amplification enables rapid access to genomic information from exiguous virus samples.

Differential expression of copper-zinc superoxide dismutase gene of Polygonum sibiricum leaves, stems and underground stems, subjected to high-salt stress.

PubMed

Qu, Chun-Pu; Xu, Zhi-Ru; Liu, Guan-Jun; Liu, Chun; Li, Yang; Wei, Zhi-Gang; Liu, Gui-Feng

2010-01-01

In aerobic organisms, protection against oxidative damage involves the combined action of highly specialized antioxidant enzymes, such as copper-zinc superoxide dismutase. In this work, a cDNA clone which encodes a copper-zinc superoxide dismutase gene, named PS-CuZnSOD, has been identified from P. sibiricum Laxm. by the rapid amplification of cDNA ends method (RACE). Analysis of the nucleotide sequence reveals that the PS-CuZnSOD gene cDNA clone consists of 669 bp, containing 87 bp in the 5' untranslated region; 459 bp in the open reading frame (ORF) encoding 152 amino acids; and 123 bp in 3' untranslated region. The gene accession nucleotide sequence number in GenBank is GQ472846. Sequence analysis indicates that the protein, like most plant superoxide dismutases (SOD), includes two conserved ecCuZnSOD signatures that are from the amino acids 43 to 51, and from the amino acids 137 to 148, and it has a signal peptide extension in the front of the N-terminus (1-16 aa). Expression analysis by real-time quantitative PCR reveals that the PS-CuZnSOD gene is expressed in leaves, stems and underground stems. PS-CuZnSOD gene expression can be induced by 3% NaHCO(3). The different mRNA levels' expression of PS-CuZnSOD show the gene's different expression modes in leaves, stems and underground stems under the salinity-alkalinity stress.

Diversity of virophages in metagenomic data sets.

PubMed

Zhou, Jinglie; Zhang, Weijia; Yan, Shuling; Xiao, Jinzhou; Zhang, Yuanyuan; Li, Bailin; Pan, Yingjie; Wang, Yongjie

2013-04-01

Virophages, e.g., Sputnik, Mavirus, and Organic Lake virophage (OLV), are unusual parasites of giant double-stranded DNA (dsDNA) viruses, yet little is known about their diversity. Here, we describe the global distribution, abundance, and genetic diversity of virophages based on analyzing and mapping comprehensive metagenomic databases. The results reveal a distinct abundance and worldwide distribution of virophages, involving almost all geographical zones and a variety of unique environments. These environments ranged from deep ocean to inland, iced to hydrothermal lakes, and human gut- to animal-associated habitats. Four complete virophage genomic sequences (Yellowstone Lake virophages [YSLVs]) were obtained, as was one nearly complete sequence (Ace Lake Mavirus [ALM]). The genomes obtained were 27,849 bp long with 26 predicted open reading frames (ORFs) (YSLV1), 23,184 bp with 21 ORFs (YSLV2), 27,050 bp with 23 ORFs (YSLV3), 28,306 bp with 34 ORFs (YSLV4), and 17,767 bp with 22 ORFs (ALM). The homologous counterparts of five genes, including putative FtsK-HerA family DNA packaging ATPase and genes encoding DNA helicase/primase, cysteine protease, major capsid protein (MCP), and minor capsid protein (mCP), were present in all virophages studied thus far. They also shared a conserved gene cluster comprising the two core genes of MCP and mCP. Comparative genomic and phylogenetic analyses showed that YSLVs, having a closer relationship to each other than to the other virophages, were more closely related to OLV than to Sputnik but distantly related to Mavirus and ALM. These findings indicate that virophages appear to be widespread and genetically diverse, with at least 3 major lineages.

Two methods for construction of internal amplification controls for the detection of Escherichia coli O157 by polymerase chain reaction.

PubMed

Abdulmawjood, A; Roth, S; Bülte, M

2002-10-01

For the detection of food born bacteria by polymerase chain reaction (PCR) in food products, an internal amplification control (IAC) is required in order to prevent false negative results that might be caused by PCR inhibitors. In the present study, two IACs were constructed using two different methods. These IACs were designed in a way that the same primer pair can be used to amplify the target DNA and coamplify the IAC. The first IAC with a size of approximately 200 bp was constructed by deleting a part of the amplicon of the original target DNA (500 bp) between the two primer sites to produce an IAC smaller than the target DNA. The second IAC with a size of approximately 600 bp was synthesized in a one step PCR reaction. The primers used in this reaction possessed 5' over-hanging ends, which were identical to the primers used in the diagnostic reaction, whereas their 3' ends were complementary to the (pUC19) predetermined DNA sequence of defined length and sequence. The concentration of IACs appeared to be critical. Too much IAC DNA template would out-compete the target DNA template, thus giving a false negative result. However the use of an optimal IAC concentration increased the reliability of the PCR assays and appeared to be useful for food diagnostics.

53BP1 promotes microhomology-mediated end-joining in G1-phase cells

PubMed Central

Xiong, Xiahui; Du, Zhanwen; Wang, Ying; Feng, Zhihui; Fan, Pan; Yan, Chunhong; Willers, Henning; Zhang, Junran

2015-01-01

Alternative non-homologous end joining (alt-NHEJ) was originally identified as a backup repair mechanism in the absence of classical NHEJ (c-NHEJ) factors but recent studies have demonstrated that alt-NHEJ is active even when c-NHEJ as well as homologous recombination is available. The functions of 53BP1 in NHEJ processes are not well understood. Here, we report that 53BP1 promotes DNA double-strand break (DSB) repair and genomic stability not only in c-NHEJ-proficient but also -deficient human G1-phase cells. Using an array of repair substrates we show that these effects of 53BP1 are correlated with a promotion of microhomology-mediated end-joining (MMEJ), a subtype of alt-NHEJ, in G1-phase. Consistent with a specific role in MMEJ we confirm that 53BP1 status does not affect c-NHEJ. 53BP1 supports sequence deletion during MMEJ consistent with a putative role in facilitating end-resection. Interestingly, promotion of MMEJ by 53BP1 in G1-phase cells is only observed in the presence of functional BRCA1. Depletion of both 53BP1 and BRCA1 increases repair needing microhomology usage and augments loss of DNA sequence, suggesting that MMEJ is a highly regulated DSB repair process. Together, these findings significantly expand our understanding of the cell-cycle-dependent roles of 53BP1 in DSB repair. PMID:25586219

Pyrosequencing as a tool for the identification of common isolates of Mycobacterium sp.

PubMed

Tuohy, Marion J; Hall, Gerri S; Sholtis, Mary; Procop, Gary W

2005-04-01

Pyrosequencing technology, sequencing by addition, was evaluated for categorization of mycobacterial isolates. One hundred and eighty-nine isolates, including 18 ATCC and Trudeau Mycobacterial Culture Collection (TMC) strains, were studied. There were 38 Mycobacterium tuberculosis complex, 27 M. kansasii, 27 MAI complex, 21 M. marinum, 14 M. gordonae, 20 M. chelonae-abscessus group, 10 M. fortuitum, 5 M. xenopi, 3 M. celatum, 2 M. terrae complex, 20 M. mucogenicum, and 2 M. scrofulaceum. Nucleic acid extracts were prepared from solid media or MGIT broth. Traditional PCR was performed with one of the primers biotinylated; the assay targeted a portion of the 16S rRNA gene that contains a hypervariable region, which has been previously shown to be useful for the identification of mycobacteria. The PSQ Sample Preparation Kit was used, and the biotinylated PCR product was processed to a single-stranded DNA template. The sequencing primer was hybridized to the DNA template in a PSQ96 plate. Incorporation of the complementary nucleotides resulted in light generation peaks, forming a pyrogram, which was evaluated by the instrument software. Thirty basepairs were used for isolate categorization. Manual interpretation of the sequences was performed if the quality of the 30-bp sequence was in doubt or if more than 4 bp homopolymers were recognized. Sequences with more than 5 bp of bad quality were deemed unacceptable. When blasted against GenBank, 179 of 189 sequences (94.7%) assigned isolates to the correct molecular genus or group. Ten M. gordonae isolates had more than 5 bp of bad quality sequence and were not accepted. Pyrosequencing of this hypervariable region afforded rapid and acceptable characterization of common, routinely isolated clinical Mycobacterium sp. Algorithms are recommended for further differentiation with an additional sequencing primer or additional biochemicals.

Malassezia furfur in infantile seborrheic dermatitis.

PubMed

Wananukul, Siriwan; Chindamporn, Ariya; Yumyourn, Poomjit; Payungporn, Sunchai; Samathi, Chanchuree; Poovorawan, Yong

2005-01-01

Our objective was to study both incidence and various strains of Malassezia in infantile seborrheic dermatitis (ISD). Sixty infants between 2 weeks and 2 years old with clinical diagnosis of ISD at the Department of Pediatrics, King Chulalongkorn Memorial Hospital from May 2002 to April 2003 were recruited. Malassezia spp. were isolated from cultured skin samples of the patients, genomic DNA was extracted and the ITS1 rDNA region was amplified. The PCR product was examined by agarose gel electrophoresis and DNA sequences were determined. The ITS1 sequences were also subjected to phylogenetic analysis and species identification. ISD is most commonly found in infants below the age of 2 months (64%), followed by those between 2 and 4 months (28%) old. Cultures yielded yeast-like colonies in 15 specimens. PCR yielded 200-bp products (Candida) in 3 patients and 300-bp products (Malassezia furfur) in 12 patients (18%). Sugar fermentation using API 20C aux performed on the three 200-bp PCR products yielded Candida species. M. furfur was the only Malassezia recovered from skin scrapings of children with ISD.

Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

PubMed Central

Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

2011-01-01

Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

Description of polymerase chain reaction and sequencing DNA Mycobacterium tuberculosis from specimen sputum of tuberculosis patients in Medan

NASA Astrophysics Data System (ADS)

Lily; Siregar, Y.; Ilyas, S.

2018-03-01

This study purposed to describe the product Polymerase Chain Reaction (PCR) and sequencing of DNA Mycobacterium (M.) tuberculosis from sputum of tuberculosis (TB) patients in Medan. Sputum was collected from patients that diagnosed with pulmonary TB by a physician. Specimen processed by PCR method of Li et al. and sequencing at Macrogen Laboratory. All of 12 product PCR were showed brightness bands at 126 base pair (bp). These results indicated similarity to the study of Li et al. Sequencing analysis showed the presence of a mutation and non-mutation groups of M. tuberculosis. The reference and outcome berange of the mutation and non-mutation of M. tuberculosis were 56-107, 59-85, 60-120 and 63-94, respectively. The percentage bp difference between the outcome and references for mutation and non-mutation were 3.448-6.569and 3.278-7.428%, respectively. In conclusion, the successful amplification of PCR products in a 1.5% agarose gel electrophoresis where all 12 sputa contained rpoB-positive M. tuberculosis and 0.644% difference was found between the outcome with reference bp of the mutation and non-mutation M. tuberculosis groups.

Cloning of precursors for two MIH/VIH-related peptides in the prawn, Macrobrachium rosenbergii.

PubMed

Yang, W J; Rao, K R

2001-11-30

Two cDNA clones (634 and 1366 bp) encoding MIH/VIH (molt-inhibiting hormone/vitellogenesis-inhibiting hormone)-related peptides were isolated and sequenced from a Macrobrachium rosenbergii eyestalk ganglia cDNA library. The clones contain a 360 and 339 bp open-reading frame, and their conceptually translated peptides consist of a 41 and 34 amino acid signal peptide, respectively, and a 78 amino acid residue mature peptide hormone. The amino acid sequences of the peptides exhibit higher identities with other known MIHs and VIH (44-69%) than with CHHs (28-33%). This is the first report describing the cloning and sequencing of two MIH/VIH-related peptides in a single crustacean species. Transcription of these mRNAs was detected in the eyestalk ganglia, but not in the thoracic ganglia, hepatopancreas, gut, gill, heart, or muscle.

rpoB Gene Sequencing for Identification of Corynebacterium Species

PubMed Central

Khamis, Atieh; Raoult, Didier; La Scola, Bernard

2004-01-01

The genus Corynebacterium is a heterogeneous group of species comprising human and animal pathogens and environmental bacteria. It is defined on the basis of several phenotypic characters and the results of DNA-DNA relatedness and, more recently, 16S rRNA gene sequencing. However, the 16S rRNA gene is not polymorphic enough to ensure reliable phylogenetic studies and needs to be completely sequenced for accurate identification. The almost complete rpoB sequences of 56 Corynebacterium species were determined by both PCR and genome walking methods. In all cases the percent similarities between different species were lower than those observed by 16S rRNA gene sequencing, even for those species with degrees of high similarity. Several clusters supported by high bootstrap values were identified. In order to propose a method for strain identification which does not require sequencing of the complete rpoB sequence (approximately 3,500 bp), we identified an area with a high degree of polymorphism, bordered by conserved sequences that can be used as universal primers for PCR amplification and sequencing. The sequence of this fragment (434 to 452 bp) allows accurate species identification and may be used in the future for routine sequence-based identification of Corynebacterium species. PMID:15364970

Design of the hairpin ribozyme for targeting specific RNA sequences.

PubMed

Hampel, A; DeYoung, M B; Galasinski, S; Siwkowski, A

1997-01-01

The following steps should be taken when designing the hairpin ribozyme to cleave a specific target sequence: 1. Select a target sequence containing BN*GUC where B is C, G, or U. 2. Select the target sequence in areas least likely to have extensive interfering structure. 3. Design the conventional hairpin ribozyme as shown in Fig. 1, such that it can form a 4 bp helix 2 and helix 1 lengths up to 10 bp. 4. Synthesize this ribozyme from single-stranded DNA templates with a double-stranded T7 promoter. 5. Prepare a series of short substrates capable of forming a range of helix 1 lengths of 5-10 bp. 6. Identify these by direct RNA sequencing. 7. Assay the extent of cleavage of each substrate to identify the optimal length of helix 1. 8. Prepare the hairpin tetraloop ribozyme to determine if catalytic efficiency can be improved.

Mesorhizobium ciceri biovar biserrulae, a novel biovar nodulating the pasture legume Biserrula pelecinus L.

PubMed

Nandasena, Kemanthi G; O'Hara, Graham W; Tiwari, Ravi P; Willlems, Anne; Howieson, John G

2007-05-01

Biserrula pelecinus L. is a pasture legume species that forms a highly specific nitrogen-fixing symbiotic interaction with a group of bacteria that belong to Mesorhizobium. These mesorhizobia have >98.8 % sequence similarity to Mesorhizobium ciceri and Mesorhizobium loti for the 16S rRNA gene (1440 bp) and >99.3 % sequence similarity to M. ciceri for the dnaK gene (300 bp), and strain WSM1271 has 100 % sequence similarity to M. ciceri for GSII (600 bp). Strain WSM1271 had 85 % relatedness to M. ciceri LMG 14989(T) and 50 % relatedness to M. loti LMG 6125(T) when DNA-DNA hybridization was performed. WSM1271 also had a similar cellular fatty acid profile to M. ciceri. These results are strong evidence that the Biserrula mesorhizobia and M. ciceri belong to the same group of bacteria. Significant differences were revealed between the Biserrula mesorhizobia and M. ciceri in growth conditions, antibiotic resistance and carbon source utilization. The G+C content of the DNA of WSM1271 was 62.7 mol%, compared to 63-64 mol% for M. ciceri. The Biserrula mesorhizobia contained a plasmid ( approximately 500 bp), but the symbiotic genes were detected on a mobile symbiosis island and considerable variation was present in the symbiotic genes of Biserrula mesorhizobia and M. ciceri. There was <78.6 % sequence similarity for nodA and <66.9 % for nifH between Biserrula mesorhizobia and M. ciceri. Moreover, the Biserrula mesorhizobia did not nodulate the legume host of M. ciceri, Cicer arietinum, and M. ciceri did not nodulate B. pelecinus. These significant differences observed between Biserrula mesorhizobia and M. ciceri warrant the proposal of a novel biovar for Biserrula mesorhizobia within M. ciceri. The name Mesorhizobium ciceri biovar biserrulae is proposed, with strain WSM1271 (=LMG 23838=HAMBI 2942) as the reference strain.

Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.

PubMed

Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T

1996-10-31

Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.

Trichomonas vaginalis ribosomal RNA: identification and characterisation of the transcription promoter and terminator sequences.

PubMed

Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda

2012-09-01

Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.

Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

PubMed

Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

2014-07-04

Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was shared by mitochondrial genomes of CMS and male-fertile pepper lines, extensive genome rearrangements were detected. CMS candidate genes located on the edges of highly-rearranged CMS-specific DNA regions and near to repeat sequences. These characteristics were detected among CMS-associated genes in other species, implying a common mechanism might be involved in the evolution of CMS-associated genes.

DNA base-calling from a nanopore using a Viterbi algorithm.

PubMed

Timp, Winston; Comer, Jeffrey; Aksimentiev, Aleksei

2012-05-16

Nanopore-based DNA sequencing is the most promising third-generation sequencing method. It has superior read length, speed, and sample requirements compared with state-of-the-art second-generation methods. However, base-calling still presents substantial difficulty because the resolution of the technique is limited compared with the measured signal/noise ratio. Here we demonstrate a method to decode 3-bp-resolution nanopore electrical measurements into a DNA sequence using a Hidden Markov model. This method shows tremendous potential for accuracy (~98%), even with a poor signal/noise ratio. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

A Role for USP7 in DNA Replication

PubMed Central

Jagannathan, Madhav; Nguyen, Tin; Gallo, David; Luthra, Niharika; Brown, Grant W.; Saridakis, Vivian

2014-01-01

The minichromosome maintenance (MCM) complex, which plays multiple important roles in DNA replication, is loaded onto chromatin following mitosis, remains on chromatin until the completion of DNA synthesis, and then is unloaded by a poorly defined mechanism that involves the MCM binding protein (MCM-BP). Here we show that MCM-BP directly interacts with the ubiquitin-specific protease USP7, that this interaction occurs predominantly on chromatin, and that MCM-BP can tether USP7 to MCM proteins. Detailed biochemical and structure analyses of the USP7–MCM-BP interaction showed that the 155PSTS158 MCM-BP sequence mediates critical interactions with the TRAF domain binding pocket of USP7. Analysis of the effects of USP7 knockout on DNA replication revealed that lack of USP7 results in slowed progression through late S phase without globally affecting the fork rate or origin usage. Lack of USP7 also resulted in increased levels of MCM proteins on chromatin, and investigation of the cause of this increase revealed a defect in the dissociation of MCM proteins from chromatin in mid- to late S phase. This role of USP7 mirrors the previously described role for MCM-BP in MCM complex unloading and suggests that USP7 works with MCM-BP to unload MCM complexes from chromatin at the end of S phase. PMID:24190967

Development of SCAR Markers for the DNA-Based Detection of the Asian Long-Horned Beetle; Anoplophora glabripennis (Motschulsky)

Treesearch

Damodar R. Kethidi; David B. Roden; Tim R. Ladd; Peter J. Krell; Arthur Ratnakaran; Qili Feng

2003-01-01

DNA markers were identified for the molecular detection of the Asian long-horned beetle (ALB), Anoplophora glabripennis (Mot.), based on sequence charaterized amplified regions (SCARS) derived from random amplified polymorphic DNA (RAPD) fragments. A 2,740-bp DNA fragment that was present only in ALB and not in other Cerambycids was identified after...

Mutant type glutathione S-transferase theta 1 gene homologue to mTOR in myelodysplastic syndrome: possible clinical application of rapamycin.

PubMed

Maeda, Yasuhiro; Yamaguchi, Terufumi; Ueda, Satomi; Matsuo, Koki; Morita, Yasuyoshi; Naiki, Yoshito; Miyazato, Hajime; Shimada, Takahiro; Miyatake, Jun-Ichi; Matsuda, Mitsuhiro; Kanamaru, Akihisa

2003-07-01

In this study, we observed the expression of the GSTT-1 gene in patients with myelodysplastic syndrome (MDS) at the messenger RNA level. Reverse transcription-polymerase chain reaction (RT-PCR) for GSTT-1 was performed with a pair of primers complementary to the 5' coding section and the 3' coding section of the GSTT-1 cDNA for amplifying the 623-bp band. Among 20 patients with MDS, 8 patients showed the expected 623-bp band on RT-PCR, and 12 patients showed a 500-bp band on RT-PCR, indicating that a 123-bp sequence was deleted as a mutant of the GSTT-1 gene. Furthermore, a BLAST DNA search showed that the deletion of a 123 bp sequence creates a sequence that is 63% homologous to human FKBP-rapamycin associated protein (FRAP); this protein has been termed a mammalian target of rapamycin (mTOR). We respectively transfected the wild type and the mutant type GSTT-1 gene in an expression vector to two cell lines (K562 and HL-60). The stable transformants for the wild type and the mutant type GSTT-1 genes were made by G418 selection. Interestingly, rapamycin could induce significant growth inhibition of the stable transformants for mutant type GSTT-1, which was indicative of apoptosis, but not that of those for wild type GSTT-1. These results suggest that rapamycin could be included in the therapeutic modality for the patients with MDS who have the mTOR sequences in GSTT-1 gene.

[Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

PubMed

Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

2002-06-01

Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

mtDNA diversity in Azara's owl monkeys (Aotus azarai azarai) of the Argentinean Chaco.

PubMed

Babb, Paul L; Fernandez-Duque, Eduardo; Baiduc, Caitlin A; Gagneux, Pascal; Evans, Sian; Schurr, Theodore G

2011-10-01

Owl monkeys (Aotus spp.) inhabit much of South America yet represent an enigmatic evolutionary branch among primates. While morphological, cytogenetic, and immunological evidence suggest that owl monkey populations have undergone isolation and diversification since their emergence in the New World, problems with adjacent species ranges, and sample provenance have complicated efforts to characterize genetic variation within the genus. As a result, the phylogeographic history of owl monkey species and subspecies remains unclear, and the extent of genetic diversity at the population level is unknown. To explore these issues, we analyzed mitochondrial DNA (mt DNA) variation in a population of wild Azara's owl monkeys (Aotus azarai azarai) living in the Gran Chaco region of Argentina. We sequenced the complete mitochondrial genome from one individual (16,585 base pairs (bp)) and analyzed 1,099 bp of the hypervariable control region (CR) and 696 bp of the cytochrome oxidase II (COII) gene in 117 others. In addition, we sequenced the mitochondrial genome (16,472 bp) of one Nancy Ma's owl monkey (A. nancymaae). Based on the whole mtDNA and COII data, we observed an ancient phylogeographic discontinuity among Aotus species living north, south, and west of the Amazon River that began more than eight million years ago. Our population analyses identified three major CR lineages and detected a high level of haplotypic diversity within A. a. azarai. These data point to a recent expansion of Azara's owl monkeys into the Argentinean Chaco. Overall, we provide a detailed view of owl monkey mtDNA variation at genus, species, and population levels. Copyright © 2011 Wiley-Liss, Inc.

Mitochondrion-to-Chloroplast DNA Transfers and Intragenomic Proliferation of Chloroplast Group II Introns in Gloeotilopsis Green Algae (Ulotrichales, Ulvophyceae).

PubMed

Turmel, Monique; Otis, Christian; Lemieux, Claude

2016-09-19

To probe organelle genome evolution in the Ulvales/Ulotrichales clade, the newly sequenced chloroplast and mitochondrial genomes of Gloeotilopsis planctonica and Gloeotilopsis sarcinoidea (Ulotrichales) were compared with those of Pseudendoclonium akinetum (Ulotrichales) and of the few other green algae previously sampled in the Ulvophyceae. At 105,236 bp, the G planctonica mitochondrial DNA (mtDNA) is the largest mitochondrial genome reported so far among chlorophytes, whereas the 221,431-bp G planctonica and 262,888-bp G sarcinoidea chloroplast DNAs (cpDNAs) are the largest chloroplast genomes analyzed among the Ulvophyceae. Gains of non-coding sequences largely account for the expansion of these genomes. Both Gloeotilopsis cpDNAs lack the inverted repeat (IR) typically found in green plants, indicating that two independent IR losses occurred in the Ulvales/Ulotrichales. Our comparison of the Pseudendoclonium and Gloeotilopsis cpDNAs offered clues regarding the mechanism of IR loss in the Ulotrichales, suggesting that internal sequences from the rDNA operon were differentially lost from the two original IR copies during this process. Our analyses also unveiled a number of genetic novelties. Short mtDNA fragments were discovered in two distinct regions of the G sarcinoidea cpDNA, providing the first evidence for intracellular inter-organelle gene migration in green algae. We identified for the first time in green algal organelles, group II introns with LAGLIDADG ORFs as well as group II introns inserted into untranslated gene regions. We discovered many group II introns occupying sites not previously documented for the chloroplast genome and demonstrated that a number of them arose by intragenomic proliferation, most likely through retrohoming. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Mitochondrion-to-Chloroplast DNA Transfers and Intragenomic Proliferation of Chloroplast Group II Introns in Gloeotilopsis Green Algae (Ulotrichales, Ulvophyceae)

PubMed Central

Turmel, Monique; Otis, Christian; Lemieux, Claude

2016-01-01

Abstract To probe organelle genome evolution in the Ulvales/Ulotrichales clade, the newly sequenced chloroplast and mitochondrial genomes of Gloeotilopsis planctonica and Gloeotilopsis sarcinoidea (Ulotrichales) were compared with those of Pseudendoclonium akinetum (Ulotrichales) and of the few other green algae previously sampled in the Ulvophyceae. At 105,236 bp, the G. planctonica mitochondrial DNA (mtDNA) is the largest mitochondrial genome reported so far among chlorophytes, whereas the 221,431-bp G. planctonica and 262,888-bp G. sarcinoidea chloroplast DNAs (cpDNAs) are the largest chloroplast genomes analyzed among the Ulvophyceae. Gains of non-coding sequences largely account for the expansion of these genomes. Both Gloeotilopsis cpDNAs lack the inverted repeat (IR) typically found in green plants, indicating that two independent IR losses occurred in the Ulvales/Ulotrichales. Our comparison of the Pseudendoclonium and Gloeotilopsis cpDNAs offered clues regarding the mechanism of IR loss in the Ulotrichales, suggesting that internal sequences from the rDNA operon were differentially lost from the two original IR copies during this process. Our analyses also unveiled a number of genetic novelties. Short mtDNA fragments were discovered in two distinct regions of the G. sarcinoidea cpDNA, providing the first evidence for intracellular inter-organelle gene migration in green algae. We identified for the first time in green algal organelles, group II introns with LAGLIDADG ORFs as well as group II introns inserted into untranslated gene regions. We discovered many group II introns occupying sites not previously documented for the chloroplast genome and demonstrated that a number of them arose by intragenomic proliferation, most likely through retrohoming. PMID:27503298

DNA Methylation of Gene Expression in Acanthamoeba castellanii Encystation.

PubMed

Moon, Eun-Kyung; Hong, Yeonchul; Lee, Hae-Ahm; Quan, Fu-Shi; Kong, Hyun-Hee

2017-04-01

Encystation mediating cyst specific cysteine proteinase (CSCP) of Acanthamoeba castellanii is expressed remarkably during encystation. However, the molecular mechanism involved in the regulation of CSCP gene expression remains unclear. In this study, we focused on epigenetic regulation of gene expression during encystation of Acanthamoeba . To evaluate methylation as a potential mechanism involved in the regulation of CSCP expression, we first investigated the correlation between promoter methylation status of CSCP gene and its expression. A 2,878 bp of promoter sequence of CSCP gene was amplified by PCR. Three CpG islands (island 1-3) were detected in this sequence using bioinformatics tools. Methylation of CpG island in trophozoites and cysts was measured by bisulfite sequence PCR. CSCP promoter methylation of CpG island 1 (1,633 bp) was found in 8.2% of trophozoites and 7.3% of cysts. Methylation of CpG island 2 (625 bp) was observed in 4.2% of trophozoites and 5.8% of cysts. Methylation of CpG island 3 (367 bp) in trophozoites and cysts was both 3.6%. These results suggest that DNA methylation system is present in CSCP gene expression of Acanthamoeba . In addition, the expression of encystation mediating CSCP is correlated with promoter CpG island 1 hypomethylation.

Complete Chloroplast Genome Sequences of Important Oilseed Crop Sesamum indicum L

PubMed Central

Yi, Dong-Keun; Kim, Ki-Joong

2012-01-01

Sesamum indicum is an important crop plant species for yielding oil. The complete chloroplast (cp) genome of S. indicum (GenBank acc no. JN637766) is 153,324 bp in length, and has a pair of inverted repeat (IR) regions consisting of 25,141 bp each. The lengths of the large single copy (LSC) and the small single copy (SSC) regions are 85,170 bp and 17,872 bp, respectively. Comparative cp DNA sequence analyses of S. indicum with other cp genomes reveal that the genome structure, gene order, gene and intron contents, AT contents, codon usage, and transcription units are similar to the typical angiosperm cp genomes. Nucleotide diversity of the IR region between Sesamum and three other cp genomes is much lower than that of the LSC and SSC regions in both the coding region and noncoding region. As a summary, the regional constraints strongly affect the sequence evolution of the cp genomes, while the functional constraints weakly affect the sequence evolution of cp genomes. Five short inversions associated with short palindromic sequences that form step-loop structures were observed in the chloroplast genome of S. indicum. Twenty-eight different simple sequence repeat loci have been detected in the chloroplast genome of S. indicum. Almost all of the SSR loci were composed of A or T, so this may also contribute to the A-T richness of the cp genome of S. indicum. Seven large repeated loci in the chloroplast genome of S. indicum were also identified and these loci are useful to developing S. indicum-specific cp genome vectors. The complete cp DNA sequences of S. indicum reported in this paper are prerequisite to modifying this important oilseed crop by cp genetic engineering techniques. PMID:22606240

Randomized DNA libraries construction tool: a new 3-bp 'frequent cutter' TthHB27I/sinefungin endonuclease with chemically-induced specificity.

PubMed

Krefft, Daria; Papkov, Aliaksei; Prusinowski, Maciej; Zylicz-Stachula, Agnieszka; Skowron, Piotr M

2018-05-11

Acoustic or hydrodynamic shearing, sonication and enzymatic digestion are used to fragment DNA. However, these methods have several disadvantages, such as DNA damage, difficulties in fragmentation control, irreproducibility and under-representation of some DNA segments. The DNA fragmentation tool would be a gentle enzymatic method, offering cleavage frequency high enough to eliminate DNA fragments distribution bias and allow for easy control of partial digests. Only three such frequently cleaving natural restriction endonucleases (REases) were discovered: CviJI, SetI and FaiI. Therefore, we have previously developed two artificial enzymatic specificities, cleaving DNA approximately every ~ 3-bp: TspGWI/sinefungin (SIN) and TaqII/SIN. In this paper we present the third developed specificity: TthHB27I/SIN(SAM) - a new genomic tool, based on Type IIS/IIC/IIG Thermus-family REases-methyltransferases (MTases). In the presence of dimethyl sulfoxide (DMSO) and S-adenosyl-L-methionine (SAM) or its analogue SIN, the 6-bp cognate TthHB27I recognition sequence 5'-CAARCA-3' is converted into a combined 3.2-3.0-bp 'site' or its statistical equivalent, while a cleavage distance of 11/9 nt is retained. Protocols for various modes of limited DNA digestions were developed. In the presence of DMSO and SAM or SIN, TthHB27I is transformed from rare 6-bp cutter to a very frequent one, approximately 3-bp. Thus, TthHB27I/SIN(SAM) comprises a new tool in the very low-represented segment of such prototype REases specificities. Moreover, this modified TthHB27I enzyme is uniquely suited for controlled DNA fragmentation, due to partial DNA cleavage, which is an inherent feature of the Thermus-family enzymes. Such tool can be used for quasi-random libraries generation as well as for other DNA manipulations, requiring high frequency cleavage and uniform distribution of cuts along DNA.

A magnetic bead-based method for concentrating DNA from human urine for downstream detection.

PubMed

Bordelon, Hali; Russ, Patricia K; Wright, David W; Haselton, Frederick R

2013-01-01

Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3) to 5×10(8) copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6), 14×10(6), and 8×10(6) copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.

A Magnetic Bead-Based Method for Concentrating DNA from Human Urine for Downstream Detection

PubMed Central

Bordelon, Hali; Russ, Patricia K.; Wright, David W.; Haselton, Frederick R.

2013-01-01

Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×103 to 5×108 copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×106, 14×106, and 8×106 copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR. PMID:23861895

Building a model: developing genomic resources for common milkweed (Asclepias syriaca) with low coverage genome sequencing

PubMed Central

2011-01-01

Background Milkweeds (Asclepias L.) have been extensively investigated in diverse areas of evolutionary biology and ecology; however, there are few genetic resources available to facilitate and compliment these studies. This study explored how low coverage genome sequencing of the common milkweed (Asclepias syriaca L.) could be useful in characterizing the genome of a plant without prior genomic information and for development of genomic resources as a step toward further developing A. syriaca as a model in ecology and evolution. Results A 0.5× genome of A. syriaca was produced using Illumina sequencing. A virtually complete chloroplast genome of 158,598 bp was assembled, revealing few repeats and loss of three genes: accD, clpP, and ycf1. A nearly complete rDNA cistron (18S-5.8S-26S; 7,541 bp) and 5S rDNA (120 bp) sequence were obtained. Assessment of polymorphism revealed that the rDNA cistron and 5S rDNA had 0.3% and 26.7% polymorphic sites, respectively. A partial mitochondrial genome sequence (130,764 bp), with identical gene content to tobacco, was also assembled. An initial characterization of repeat content indicated that Ty1/copia-like retroelements are the most common repeat type in the milkweed genome. At least one A. syriaca microread hit 88% of Catharanthus roseus (Apocynaceae) unigenes (median coverage of 0.29×) and 66% of single copy orthologs (COSII) in asterids (median coverage of 0.14×). From this partial characterization of the A. syriaca genome, markers for population genetics (microsatellites) and phylogenetics (low-copy nuclear genes) studies were developed. Conclusions The results highlight the promise of next generation sequencing for development of genomic resources for any organism. Low coverage genome sequencing allows characterization of the high copy fraction of the genome and exploration of the low copy fraction of the genome, which facilitate the development of molecular tools for further study of a target species and its relatives. This study represents a first step in the development of a community resource for further study of plant-insect co-evolution, anti-herbivore defense, floral developmental genetics, reproductive biology, chemical evolution, population genetics, and comparative genomics using milkweeds, and A. syriaca in particular, as ecological and evolutionary models. PMID:21542930

Building a model: developing genomic resources for common milkweed (Asclepias syriaca) with low coverage genome sequencing.

PubMed

Straub, Shannon C K; Fishbein, Mark; Livshultz, Tatyana; Foster, Zachary; Parks, Matthew; Weitemier, Kevin; Cronn, Richard C; Liston, Aaron

2011-05-04

Milkweeds (Asclepias L.) have been extensively investigated in diverse areas of evolutionary biology and ecology; however, there are few genetic resources available to facilitate and compliment these studies. This study explored how low coverage genome sequencing of the common milkweed (Asclepias syriaca L.) could be useful in characterizing the genome of a plant without prior genomic information and for development of genomic resources as a step toward further developing A. syriaca as a model in ecology and evolution. A 0.5× genome of A. syriaca was produced using Illumina sequencing. A virtually complete chloroplast genome of 158,598 bp was assembled, revealing few repeats and loss of three genes: accD, clpP, and ycf1. A nearly complete rDNA cistron (18S-5.8S-26S; 7,541 bp) and 5S rDNA (120 bp) sequence were obtained. Assessment of polymorphism revealed that the rDNA cistron and 5S rDNA had 0.3% and 26.7% polymorphic sites, respectively. A partial mitochondrial genome sequence (130,764 bp), with identical gene content to tobacco, was also assembled. An initial characterization of repeat content indicated that Ty1/copia-like retroelements are the most common repeat type in the milkweed genome. At least one A. syriaca microread hit 88% of Catharanthus roseus (Apocynaceae) unigenes (median coverage of 0.29×) and 66% of single copy orthologs (COSII) in asterids (median coverage of 0.14×). From this partial characterization of the A. syriaca genome, markers for population genetics (microsatellites) and phylogenetics (low-copy nuclear genes) studies were developed. The results highlight the promise of next generation sequencing for development of genomic resources for any organism. Low coverage genome sequencing allows characterization of the high copy fraction of the genome and exploration of the low copy fraction of the genome, which facilitate the development of molecular tools for further study of a target species and its relatives. This study represents a first step in the development of a community resource for further study of plant-insect co-evolution, anti-herbivore defense, floral developmental genetics, reproductive biology, chemical evolution, population genetics, and comparative genomics using milkweeds, and A. syriaca in particular, as ecological and evolutionary models.

Complementary DNA sequences encoding the multimammate rat MHC class II DQ alpha and beta chains and cross-species sequence comparison in rodents.

PubMed

de Bellocq, J Goüy; Leirs, H

2009-09-01

Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.

Complete mitochondrial DNA sequence of the Eastern keelback mullet Liza affinis.

PubMed

Gong, Xiaoling; Zhu, Wenjia; Bao, Baolong

2016-05-01

Eastern keelback mullet (Liza affinis) inhabits inlet waters and estuaries of rivers. In this paper, we initially determined the complete mitochondrial genome of Liza affinis. The entire mtDNA sequence is 16,831 bp in length, including 2 rRNA genes, 22 tRNA genes, 13 protein-coding genes and 1 putative control region. Its order and numbers of genes are similar to most bony fishes.

Novel and canine genotypes of Giardia duodenalis in harbor seals ( Phoca vitulina richardsi).

PubMed

Gaydos, J K; Miller, W A; Johnson, C; Zornetzer, H; Melli, A; Packham, A; Jeffries, S J; Lance, M M; Conrad, P A

2008-12-01

Feces of harbor seals (Phoca vitulina richardsi) and hybrid glaucous-winged/western gulls (Larus glaucescens / occidentalis) from Washington State's inland marine waters were examined for Giardia and Cryptosporidium spp. to determine if genotypes carried by these wildlife species were the same genotypes that commonly infect humans and domestic animals. Using immunomagnetic separation followed by direct fluorescent antibody detection, Giardia spp. cysts were detected in 42% of seal fecal samples (41/97). Giardia-positive samples came from 90% of the sites (9/10) and the prevalence of positive seal fecal samples differed significantly among study sites. Fecal samples collected from seal haulout sites with over 400 animals were 4.7 times more likely to have Giardia spp. cysts than samples collected at smaller haulout sites. In gulls, a single Giardia sp. cyst was detected in 4% of fecal samples (3/78). Cryptosporidium spp. oocysts were not detected in any of the seals or gulls tested. Sequence analysis of a 398 bp segment of G. duodenalis DNA at the glutamate dehydrogenase locus suggested that 11 isolates originating from seals throughout the region were a novel genotype and 3 isolates obtained from a single site in south Puget Sound were the G. duodenalis canine genotype D. Real-time TaqMan PCR amplification and subsequent sequencing of a 52 bp small subunit ribosomal DNA region from novel harbor seal genotype isolates showed sequence homology to canine genotypes C and D. Sequence analysis of the 52 bp small subunit ribosomal DNA products from the 3 canine genotype isolates from seals produced mixed sequences at could not be evaluated.

Mechanistic insights into induction of vitellogenin gene expression by estrogens in Sydney rock oysters, Saccostrea glomerata.

PubMed

Tran, Thi Kim Anh; MacFarlane, Geoff R; Kong, Richard Yuen Chong; O'Connor, Wayne A; Yu, Richard Man Kit

2016-05-01

Marine molluscs, such as oysters, respond to estrogenic compounds with the induction of the egg yolk protein precursor, vitellogenin (Vtg), availing a biomarker for estrogenic pollution. Despite this application, the precise molecular mechanism through which estrogens exert their action to induce molluscan vitellogenesis is unknown. As a first step to address this question, we cloned a gene encoding Vtg from the Sydney rock oyster Saccostrea glomerata (sgVtg). Using primers designed from a partial sgVtg cDNA sequence available in Genbank, a full-length sgVtg cDNA of 8498bp was obtained by 5'- and 3'-RACE. The open reading frame (ORF) of sgVtg was determined to be 7980bp, which is substantially longer than the orthologs of other oyster species. Its deduced protein sequence shares the highest homology at the N- and C-terminal regions with other molluscan Vtgs. The full-length genomic DNA sequence of sgVtg was obtained by genomic PCR and genome walking targeting the gene body and flanking regions, respectively. The genomic sequence spans 20kb and consists of 30 exons and 29 introns. Computer analysis identified three closely spaced half-estrogen responsive elements (EREs) in the promoter region and a 210-bp CpG island 62bp downstream of the transcription start site. Upregulation of sgVtg mRNA expression was observed in the ovaries following in vitro (explants) and in vivo (tank) exposure to 17β-estradiol (E2). Notably, treatment with an estrogen receptor (ER) antagonist in vitro abolished the upregulation, suggesting a requirement for an estrogen-dependent receptor for transcriptional activation. DNA methylation of the 5' CpG island was analysed using bisulfite genomic sequencing of the in vivo exposed ovaries. The CpG island was found to be hypomethylated (with 0-3% methylcytosines) in both control and E2-exposed oysters. However, no significant differential methylation or any correlation between methylation and sgVtg expression levels was observed. Overall, the results support the possible involvement of an ERE-containing promoter and an estrogen-activated receptor in estrogen signalling in marine molluscs. Copyright © 2016 Elsevier B.V. All rights reserved.

Isolation and sequence characterization of DNA-A genome of a new begomovirus strain associated with severe leaf curling symptoms of Jatropha curcas L.

PubMed

Chauhan, Sushma; Rahman, Hifzur; Mastan, Shaik G; Pamidimarri, D V N Sudheer; Reddy, Muppala P

2018-07-20

Begomoviruses belong to the family Geminiviridae are associated with several disease symptoms, such as mosaic and leaf curling in Jatropha curcas. The molecular characterization of these viral strains will help in developing management strategies to control the disease. In this study, J. curcas that was infected with begomovirus and showed acute leaf curling symptoms were identified. DNA-A segment from pathogenic viral strain was isolated and sequenced. The sequenced genome was assembled and characterized in detail. The full-length DNA-A sequence was covered by primer walking. The genome sequence showed the general organization of DNA-A from begomovirus by the distribution of ORFs in both viral and anti-viral strands. The genome size ranged from 2844 bp-2852 bp. Three strains with minor nucleotide variations were identified, and a phylogenetic analysis was performed by comparing the DNA-A segments from other reported begomovirus isolates. The maximum sequence similarity was observed with Euphorbia yellow mosaic virus (FN435995). In the phylogenetic tree, no clustering was observed with previously reported begomovirus strains isolated from J. curcas host. The strains isolated in this study belong to new begomoviral strain that elicits symptoms of leaf curling in J. curcas. The results indicate that the probable origin of the strains is from Jatropha mosaic virus infecting J. gassypifolia. The strains isolated in this study are referred as Jatropha curcas leaf curl India virus (JCLCIV) based on the major symptoms exhibited by host J. curcas. Copyright © 2018 Elsevier B.V. All rights reserved.

Cloning and sequence analysis of a full-length cDNA of SmPP1cb encoding turbot protein phosphatase 1 beta catalytic subunit

NASA Astrophysics Data System (ADS)

Qi, Fei; Guo, Huarong; Wang, Jian

2008-02-01

Reversible protein phosphorylation, catalyzed by protein kinases and phosphatases, is an important and versatile mechanism by which eukaryotic cells regulate almost all the signaling processes. Protein phosphatase 1 (PP1) is the first and well-characterized member of the protein serine/threonine phosphatase family. In the present study, a full-length cDNA encoding the beta isoform of the catalytic subunit of protein phosphatase 1(PP1cb), was for the first time isolated and sequenced from the skin tissue of flatfish turbot Scophthalmus maximus, designated SmPP1cb, by the rapid amplification of cDNA ends (RACE) technique. The cDNA sequence of SmPP1cb we obtained contains a 984 bp open reading frame (ORF), flanked by a complete 39 bp 5' untranslated region and 462 bp 3' untranslated region. The ORF encodes a putative 327 amino acid protein, and the N-terminal section of this protein is highly acidic, Met-Ala-Glu-Gly-Glu-Leu-Asp-Val-Asp, a common feature for PP1 catalytic subunit but absent in protein phosphatase 2B (PP2B). And its calculated molecular mass is 37 193 Da and pI 5.8. Sequence analysis indicated that, SmPP1cb is extremely conserved in both amino acid and nucleotide acid levels compared with the PP1cb of other vertebrates and invertebrates, and its Kozak motif contained in the 5'UTR around ATG start codon is GXXAXXGXX ATGG, which is different from mammalian in two positions A-6 and G-3, indicating the possibility of different initiation of translation in turbot, and also the 3'UTR of SmPP1cb is highly diverse in the sequence similarity and length compared with other animals, especially zebrafish. The cloning and sequencing of SmPP1cb gene lays a good foundation for the future work on the biological functions of PP1 in the flatfish turbot.

Arginine kinase from the Tardigrade, Macrobiotus occidentalis: molecular cloning, phylogenetic analysis and enzymatic properties.

PubMed

Uda, Kouji; Ishida, Mikako; Matsui, Tohru; Suzuki, Tomohiko

2010-10-01

Arginine kinase (AK), which catalyzes the reversible transfer of phosphate from ATP to arginine to yield phosphoarginine and ADP, is widely distributed throughout the invertebrates. We determined the cDNA sequence of AK from the tardigrade (water bear) Macrobiotus occidentalis, cloned the sequence into pET30b plasmid, and expressed it in Escherichia coli as a 6x His-tag—fused protein. The cDNA is 1377 bp, has an open reading frame of 1080 bp, and has 5′- and 3′-untranslated regions of 116 and 297 bp, respectively. The open reading frame encodes a 359-amino acid protein containing the 12 residues considered necessary for substrate binding in Limulus AK. This is the first AK sequence from a tardigrade. From fragmented and non-annotated sequences available from DNA databases, we assembled 46 complete AK sequences: 26 from arthropods (including 19 from Insecta), 11 from nematodes, 4 from mollusks, 2 from cnidarians and 2 from onychophorans. No onychophoran sequences have been reported previously. The phylogenetic trees of 104 AKs indicated clearly that Macrobiotus AK (from the phylum Tardigrada) shows close affinity with Epiperipatus and Euperipatoides AKs (from the phylum Onychophora), and therefore forms a sister group with the arthropod AKs. Recombinant 6x His-tagged Macrobiotus AK was successfully expressed as a soluble protein, and the kinetic constants (K(m), K(d), V(ma) and k(cat)) were determined for the forward reaction. Comparison of these kinetic constants with those of AKs from other sources (arthropods, mollusks and nematodes) indicated that Macrobiotus AK is unique in that it has the highest values for k(cat) and K(d)K(m) (indicative of synergistic substrate binding) of all characterized AKs.

Diversity of Virophages in Metagenomic Data Sets

PubMed Central

Zhou, Jinglie; Zhang, Weijia; Yan, Shuling; Xiao, Jinzhou; Zhang, Yuanyuan; Li, Bailin; Pan, Yingjie

2013-01-01

Virophages, e.g., Sputnik, Mavirus, and Organic Lake virophage (OLV), are unusual parasites of giant double-stranded DNA (dsDNA) viruses, yet little is known about their diversity. Here, we describe the global distribution, abundance, and genetic diversity of virophages based on analyzing and mapping comprehensive metagenomic databases. The results reveal a distinct abundance and worldwide distribution of virophages, involving almost all geographical zones and a variety of unique environments. These environments ranged from deep ocean to inland, iced to hydrothermal lakes, and human gut- to animal-associated habitats. Four complete virophage genomic sequences (Yellowstone Lake virophages [YSLVs]) were obtained, as was one nearly complete sequence (Ace Lake Mavirus [ALM]). The genomes obtained were 27,849 bp long with 26 predicted open reading frames (ORFs) (YSLV1), 23,184 bp with 21 ORFs (YSLV2), 27,050 bp with 23 ORFs (YSLV3), 28,306 bp with 34 ORFs (YSLV4), and 17,767 bp with 22 ORFs (ALM). The homologous counterparts of five genes, including putative FtsK-HerA family DNA packaging ATPase and genes encoding DNA helicase/primase, cysteine protease, major capsid protein (MCP), and minor capsid protein (mCP), were present in all virophages studied thus far. They also shared a conserved gene cluster comprising the two core genes of MCP and mCP. Comparative genomic and phylogenetic analyses showed that YSLVs, having a closer relationship to each other than to the other virophages, were more closely related to OLV than to Sputnik but distantly related to Mavirus and ALM. These findings indicate that virophages appear to be widespread and genetically diverse, with at least 3 major lineages. PMID:23408616

Molecular cloning and responsive expression to injury stimulus of a defender against cell death 1 (DAD1) gene from bay scallops Argopecten irradians.

PubMed

Zhu, Ling; Song, Linsheng; Zhang, Huan; Zhao, Jianmin; Li, Chenghua; Xu, Wei

2008-06-01

Apoptosis is an active process of cell death, which is an integral part of growth and development in multicellular organisms. The defender against cell death 1 (DAD1), the regulatory protein to inhibit the apoptosis process, was first cloned from the bay scallop Argopecten irradians by randomly sequencing a whole tissue cDNA library and rapid amplification of cDNA end (RACE). The full-length cDNA of the A. irradians DAD1 was 607 bp, consist of a 5'-terminal untranslated region (UTR) of 63 bp, a 3'-terminal UTR of 205 bp with a canonical polyadenylation signal sequence AATAAA and a poly (A) tail, and an open reading frame of 339 bp. The deduced amino acid sequence of the A. irradians DAD1 showed 75.5% identity to Araneus ventricosus, 74.5% to Drosophila melanogaster, and 73.6% to Homo sapiens, Sus scrofa, Mesocricetus auratus, Rattus norvegicus and Mus musculus. Excluding the Saccharomyces cerevisiae DAD1 homologue, all animal DAD1 including A. irradians DAD1 homologue formed a subgroup and all plant DAD1 proteins formed another subgroup in the phylogenetic analysis. The A. irradians DAD1 was expressed in all examined tissues including adductor muscle, mantle, gills, digestive gland, gonad and hemolymph, suggesting that A. irradians DAD1 is expressed in most body tissues. Furthermore, the mRNA expression levels of A. irradians DAD1 gene of hemolymph were particularly high after injury, suggesting that the gene is responsive to injury stimuli.

Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

PubMed Central

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-01-01

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

New insights into replication origin characteristics in metazoans

PubMed Central

Puy, Aurore; Rialle, Stéphanie; Kaplan, Noam; Segal, Eran

2012-01-01

We recently reported the identification and characterization of DNA replication origins (Oris) in metazoan cell lines. Here, we describe additional bioinformatic analyses showing that the previously identified GC-rich sequence elements form origin G-rich repeated elements (OGREs) that are present in 67% to 90% of the DNA replication origins from Drosophila to human cells, respectively. Our analyses also show that initiation of DNA synthesis takes place precisely at 160 bp (Drosophila) and 280 bp (mouse) from the OGRE. We also found that in most CpG islands, an OGRE is positioned in opposite orientation on each of the two DNA strands and detected two sites of initiation of DNA synthesis upstream or downstream of each OGRE. Conversely, Oris not associated with CpG islands have a single initiation site. OGRE density along chromosomes correlated with previously published replication timing data. Ori sequences centered on the OGRE are also predicted to have high intrinsic nucleosome occupancy. Finally, OGREs predict G-quadruplex structures at Oris that might be structural elements controlling the choice or activation of replication origins. PMID:22373526

Identification of largemouth bass virus in the introduced Northern Snakehead inhabiting the Chesapeake Bay watershed.

PubMed

Iwanowicz, L; Densmore, C; Hahn, C; McAllister, P; Odenkirk, J

2013-09-01

The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.

Identification of largemouth bass virus in the introduced Northern snakehead inhabiting the Cheasapeake Bay watershed

USGS Publications Warehouse

Iwanowicz, Luke R.; Densmore, Christine L.; Hahn, Cassidy M.; McAllister, Phillip; Odenkirk, John

2013-01-01

The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.

Accelerating plant DNA barcode reference library construction using herbarium specimens: improved experimental techniques.

PubMed

Xu, Chao; Dong, Wenpan; Shi, Shuo; Cheng, Tao; Li, Changhao; Liu, Yanlei; Wu, Ping; Wu, Hongkun; Gao, Peng; Zhou, Shiliang

2015-11-01

A well-covered reference library is crucial for successful identification of species by DNA barcoding. The biggest difficulty in building such a reference library is the lack of materials of organisms. Herbarium collections are potentially an enormous resource of materials. In this study, we demonstrate that it is likely to build such reference libraries using the reconstructed (self-primed PCR amplified) DNA from the herbarium specimens. We used 179 rosaceous specimens to test the effects of DNA reconstruction, 420 randomly sampled specimens to estimate the usable percentage and another 223 specimens of true cherries (Cerasus, Rosaceae) to test the coverage of usable specimens to the species. The barcode rbcLb (the central four-sevenths of rbcL gene) and matK was each amplified in two halves and sequenced on Roche GS 454 FLX+. DNA from the herbarium specimens was typically shorter than 300 bp. DNA reconstruction enabled amplification fragments of 400-500 bp without bringing or inducing any sequence errors. About one-third of specimens in the national herbarium of China (PE) were proven usable after DNA reconstruction. The specimens in PE cover all Chinese true cherry species and 91.5% of vascular species listed in Flora of China. It is very possible to build well-covered reference libraries for DNA barcoding of vascular species in China. As exemplified in this study, DNA reconstruction and DNA-labelled next-generation sequencing can accelerate the construction of local reference libraries. By putting the local reference libraries together, a global library for DNA barcoding becomes closer to reality. © 2015 John Wiley & Sons Ltd.

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

DNA lability induced by nimustine and ramustine in rat glioma cells.

PubMed Central

Mineura, K; Fushimi, S; Itoh, Y; Kowada, M

1988-01-01

The DNA labile sites induced by two nitrosoureas, nimustine (ACNU) and ramustine (MCNU) synthesised in Japan, have been examined in highly reiterated DNA sequences of rat glioma cells. Reiterated fragments of 167 and 203 base pairs (bp), obtained after Hind III and Hae III restriction endonuclease digestion of rat glioma cells DNA, were used as target DNA sequences to determine the labile sites. In vitro reaction with ACNU and MCNU resulted in scission products corresponding to the locations of guanine. Subsequent piperidine hydrolysis produced more frequent breaks of the phosphodiester bonds at guanine positions, thus forming alkali-labile sites. Images PMID:3236017

Identification of Medically Important Yeasts Using PCR-Based Detection of DNA Sequence Polymorphisms in the Internal Transcribed Spacer 2 Region of the rRNA Genes

PubMed Central

Chen, Y. C.; Eisner, J. D.; Kattar, M. M.; Rassoulian-Barrett, S. L.; LaFe, K.; Yarfitz, S. L.; Limaye, A. P.; Cookson, B. T.

2000-01-01

Identification of medically relevant yeasts can be time-consuming and inaccurate with current methods. We evaluated PCR-based detection of sequence polymorphisms in the internal transcribed spacer 2 (ITS2) region of the rRNA genes as a means of fungal identification. Clinical isolates (401), reference strains (6), and type strains (27), representing 34 species of yeasts were examined. The length of PCR-amplified ITS2 region DNA was determined with single-base precision in less than 30 min by using automated capillary electrophoresis. Unique, species-specific PCR products ranging from 237 to 429 bp were obtained from 92% of the clinical isolates. The remaining 8%, divided into groups with ITS2 regions which differed by ≤2 bp in mean length, all contained species-specific DNA sequences easily distinguishable by restriction enzyme analysis. These data, and the specificity of length polymorphisms for identifying yeasts, were confirmed by DNA sequence analysis of the ITS2 region from 93 isolates. Phenotypic and ITS2-based identification was concordant for 427 of 434 yeast isolates examined using sequence identity of ≥99%. Seven clinical isolates contained ITS2 sequences that did not agree with their phenotypic identification, and ITS2-based phylogenetic analyses indicate the possibility of new or clinically unusual species in the Rhodotorula and Candida genera. This work establishes an initial database, validated with over 400 clinical isolates, of ITS2 length and sequence polymorphisms for 34 species of yeasts. We conclude that size and restriction analysis of PCR-amplified ITS2 region DNA is a rapid and reliable method to identify clinically significant yeasts, including potentially new or emerging pathogenic species. PMID:10834993

The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

PubMed Central

Pietan, Lucas L.; Spradling, Theresa A.

2016-01-01

In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

DNA nanomapping using CRISPR-Cas9 as a programmable nanoparticle.

PubMed

Mikheikin, Andrey; Olsen, Anita; Leslie, Kevin; Russell-Pavier, Freddie; Yacoot, Andrew; Picco, Loren; Payton, Oliver; Toor, Amir; Chesney, Alden; Gimzewski, James K; Mishra, Bud; Reed, Jason

2017-11-21

Progress in whole-genome sequencing using short-read (e.g., <150 bp), next-generation sequencing technologies has reinvigorated interest in high-resolution physical mapping to fill technical gaps that are not well addressed by sequencing. Here, we report two technical advances in DNA nanotechnology and single-molecule genomics: (1) we describe a labeling technique (CRISPR-Cas9 nanoparticles) for high-speed AFM-based physical mapping of DNA and (2) the first successful demonstration of using DVD optics to image DNA molecules with high-speed AFM. As a proof of principle, we used this new "nanomapping" method to detect and map precisely BCL2-IGH translocations present in lymph node biopsies of follicular lymphoma patents. This HS-AFM "nanomapping" technique can be complementary to both sequencing and other physical mapping approaches.

Triangulating the provenance of African elephants using mitochondrial DNA

PubMed Central

Ishida, Yasuko; Georgiadis, Nicholas J; Hondo, Tomoko; Roca, Alfred L

2013-01-01

African elephant mitochondrial (mt) DNA follows a distinctive evolutionary trajectory. As females do not migrate between elephant herds, mtDNA exhibits low geographic dispersal. We therefore examined the effectiveness of mtDNA for assigning the provenance of African elephants (or their ivory). For 653 savanna and forest elephants from 22 localities in 13 countries, 4258 bp of mtDNA was sequenced. We detected eight mtDNA subclades, of which seven had regionally restricted distributions. Among 108 unique haplotypes identified, 72% were found at only one locality and 84% were country specific, while 44% of individuals carried a haplotype detected only at their sampling locality. We combined 316 bp of our control region sequences with those generated by previous trans-national surveys of African elephants. Among 101 unique control region haplotypes detected in African elephants across 81 locations in 22 countries, 62% were present in only a single country. Applying our mtDNA results to a previous microsatellite-based assignment study would improve estimates of the provenance of elephants in 115 of 122 mis-assigned cases. Nuclear partitioning followed species boundaries and not mtDNA subclade boundaries. For taxa such as elephants in which nuclear and mtDNA markers differ in phylogeography, combining the two markers can triangulate the origins of confiscated wildlife products. PMID:23798975

Characterization of replication and conjugation of plasmid pWTY27 from a widely distributed Streptomyces species

PubMed Central

2012-01-01

Background Streptomyces species are widely distributed in natural habitats, such as soils, lakes, plants and some extreme environments. Replication loci of several Streptomyces theta-type plasmids have been reported, but are not characterized in details. Conjugation loci of some Streptomyces rolling-circle-type plasmids are identified and mechanism of conjugal transferring are described. Results We report the detection of a widely distributed Streptomyces strain Y27 and its indigenous plasmid pWTY27 from fourteen plants and four soil samples cross China by both culturing and nonculturing methods. The complete nucleotide sequence of pWTY27 consisted of 14,288 bp. A basic locus for plasmid replication comprised repAB genes and an adjacent iteron sequence, to a long inverted-repeat (ca. 105 bp) of which the RepA protein bound specifically in vitro, suggesting that RepA may recognize a second structure (e.g. a long stem-loop) of the iteron DNA. A plasmid containing the locus propagated in linear mode when the telomeres of a linear plasmid were attached, indicating a bi-directional replication mode for pWTY27. As for rolling-circle plasmids, a single traA gene and a clt sequence (covering 16 bp within traA and its adjacent 159 bp) on pWTY27 were required for plasmid transfer. TraA recognized and bound specifically to the two regions of the clt sequence, one containing all the four DC1 of 7 bp (TGACACC) and one DC2 (CCCGCCC) and most of IC1, and another covering two DC2 and part of IC1, suggesting formation of a high-ordered DNA-protein complex. Conclusions This work (i) isolates a widespread Streptomyces strain Y27 and sequences its indigenous theta-type plasmid pWTY27; (ii) identifies the replication and conjugation loci of pWTY27 and; (iii) characterizes the binding sequences of the RepA and TraA proteins. PMID:23134842

Sequence space coverage, entropy of genomes and the potential to detect non-human DNA in human samples

PubMed Central

Liu, Zhandong; Venkatesh, Santosh S; Maley, Carlo C

2008-01-01

Background Genomes store information for building and maintaining organisms. Complete sequencing of many genomes provides the opportunity to study and compare global information properties of those genomes. Results We have analyzed aspects of the information content of Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae, and Escherichia coli (K-12) genomes. Virtually all possible (> 98%) 12 bp oligomers appear in vertebrate genomes while < 2% of 19 bp oligomers are present. Other species showed different ranges of > 98% to < 2% of possible oligomers in D. melanogaster (12–17 bp), C. elegans (11–17 bp), A. thaliana (11–17 bp), S. cerevisiae (10–16 bp) and E. coli (9–15 bp). Frequencies of unique oligomers in the genomes follow similar patterns. We identified a set of 2.6 M 15-mers that are more than 1 nucleotide different from all 15-mers in the human genome and so could be used as probes to detect microbes in human samples. In a human sample, these probes would detect 100% of the 433 currently fully sequenced prokaryotes and 75% of the 3065 fully sequenced viruses. The human genome is significantly more compact in sequence space than a random genome. We identified the most frequent 5- to 20-mers in the human genome, which may prove useful as PCR primers. We also identified a bacterium, Anaeromyxobacter dehalogenans, which has an exceptionally low diversity of oligomers given the size of its genome and its GC content. The entropy of coding regions in the human genome is significantly higher than non-coding regions and chromosomes. However chromosomes 1, 2, 9, 12 and 14 have a relatively high proportion of coding DNA without high entropy, and chromosome 20 is the opposite with a low frequency of coding regions but relatively high entropy. Conclusion Measures of the frequency of oligomers are useful for designing PCR assays and for identifying chromosomes and organisms with hidden structure that had not been previously recognized. This information may be used to detect novel microbes in human tissues. PMID:18973670

Sequence space coverage, entropy of genomes and the potential to detect non-human DNA in human samples.

PubMed

Liu, Zhandong; Venkatesh, Santosh S; Maley, Carlo C

2008-10-30

Genomes store information for building and maintaining organisms. Complete sequencing of many genomes provides the opportunity to study and compare global information properties of those genomes. We have analyzed aspects of the information content of Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae, and Escherichia coli (K-12) genomes. Virtually all possible (> 98%) 12 bp oligomers appear in vertebrate genomes while < 2% of 19 bp oligomers are present. Other species showed different ranges of > 98% to < 2% of possible oligomers in D. melanogaster (12-17 bp), C. elegans (11-17 bp), A. thaliana (11-17 bp), S. cerevisiae (10-16 bp) and E. coli (9-15 bp). Frequencies of unique oligomers in the genomes follow similar patterns. We identified a set of 2.6 M 15-mers that are more than 1 nucleotide different from all 15-mers in the human genome and so could be used as probes to detect microbes in human samples. In a human sample, these probes would detect 100% of the 433 currently fully sequenced prokaryotes and 75% of the 3065 fully sequenced viruses. The human genome is significantly more compact in sequence space than a random genome. We identified the most frequent 5- to 20-mers in the human genome, which may prove useful as PCR primers. We also identified a bacterium, Anaeromyxobacter dehalogenans, which has an exceptionally low diversity of oligomers given the size of its genome and its GC content. The entropy of coding regions in the human genome is significantly higher than non-coding regions and chromosomes. However chromosomes 1, 2, 9, 12 and 14 have a relatively high proportion of coding DNA without high entropy, and chromosome 20 is the opposite with a low frequency of coding regions but relatively high entropy. Measures of the frequency of oligomers are useful for designing PCR assays and for identifying chromosomes and organisms with hidden structure that had not been previously recognized. This information may be used to detect novel microbes in human tissues.

The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

PubMed Central

Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

2017-01-01

Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.

PubMed

Neuhaus, H; Link, G

1987-01-01

The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.

Bioinformatic analysis of phage AB3, a phiKMV-like virus infecting Acinetobacter baumannii.

PubMed

Zhang, J; Liu, X; Li, X-J

2015-01-16

The phages of Acinetobacter baumannii has drawn increasing attention because of the multi-drug resistance of A. baumanni. The aim of this study was to sequence Acinetobacter baumannii phage AB3 and conduct bioinformatic analysis to lay a foundation for genome remodeling and phage therapy. We isolated and sequenced A. baumannii phage AB3 and attempted to annotate and analyze its genome. The results showed that the genome is a double-stranded DNA with a total length of 31,185 base pairs (bp) and 97 open reading frames greater than 100 bp. The genome includes 28 predicted genes, of which 24 are homologous to phage AB1. The entire coding sequence is located on the negative strand, representing 90.8% of the total length. The G+C mol% was 39.18%, without areas of high G+C content over 200 bp in length. No GC island, tRNA gene, or repeated sequence was identified. Gene lengths were 120-3099 bp, with an average of 1011 bp. Six genes were found to be greater than 2000 bp in length. Genomic alignment and phylogenetic analysis of the RNA polymerase gene showed that similar to phage AB1, phage AB3 is a phiKMV-like virus in the T7 phage family.

Genomic sequencing of Pleistocene cave bears

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noonan, James P.; Hofreiter, Michael; Smith, Doug

2005-04-01

Despite the information content of genomic DNA, ancient DNA studies to date have largely been limited to amplification of mitochondrial DNA due to technical hurdles such as contamination and degradation of ancient DNAs. In this study, we describe two metagenomic libraries constructed using unamplified DNA extracted from the bones of two 40,000-year-old extinct cave bears. Analysis of {approx}1 Mb of sequence from each library showed that, despite significant microbial contamination, 5.8 percent and 1.1 percent of clones in the libraries contain cave bear inserts, yielding 26,861 bp of cave bear genome sequence. Alignment of this sequence to the dog genome,more » the closest sequenced genome to cave bear in terms of evolutionary distance, revealed roughly the expected ratio of cave bear exons, repeats and conserved noncoding sequences. Only 0.04 percent of all clones sequenced were derived from contamination with modern human DNA. Comparison of cave bear with orthologous sequences from several modern bear species revealed the evolutionary relationship of these lineages. Using the metagenomic approach described here, we have recovered substantial quantities of mammalian genomic sequence more than twice as old as any previously reported, establishing the feasibility of ancient DNA genomic sequencing programs.« less

Complementary DNA cloning and functional characterization of cytochrome P450 3A138 in common carp (Cyprinus carpio L.).

PubMed

Ma, Junguo; Bu, Yanzhen; Li, Yao; Niu, Daichun; Li, Xiaoyu

2014-06-01

The full-length sequence of a cytochrome P450 3A 138 (CYP3A138) cDNA in common carp was cloned and sequenced. The transcriptional and microsome enzyme activities of CYP3A138 in the fish liver after rifampicin exposure were also determined in this study. The results showed that the full-length CYP3A138 cDNA is 1912 base pairs (bp) long and contains an open reading frame of 1551 bp encoding a protein of 517 amino acids. Sequence analysis revealed that CYP3A138 is highly conserved in fish. Furthermore, the results of quantitative real-time PCR revealed that CYP3A138 in common carp is constitutively expressed in all tissues, but mainly in the liver and intestine. Additionally, rifampicin exposure promoted both the expression of CYP3A138 at the transcriptional level and the activity of the protein, suggesting that CYP3A138 is a member of the CYP3A subfamily. © 2014 Wiley Periodicals, Inc.

Characterization and expression of the calpastatin gene in Cyprinus carpio.

PubMed

Chen, W X; Ma, Y

2015-07-03

Calpastatin, an important protein used to regulate meat quality traits in animals, is encoded by the CAST gene. The aim of the present study was to clone the cDNA sequence of the CAST gene and detect the expression of CAST in the tissues of Cyprinus carpio. The cDNA of the C. carpio CAST gene, amplified using rapid amplification of cDNA ends PCR, is 2834 bp in length (accession No. JX275386), contains a 2634-bp open reading frame, and encodes a protein with 877 amino acid residues. The amino acid sequence of the C. carpio CAST gene was 88, 80, and 59% identical to the sequences observed in grass carp, zebrafish, and other fish, respectively. The C. carpio CAST was observed to contain four conserved domains with 54 serine phosphorylation loci, 28 threonine phosphorylation loci, 1 tyrosine phosphorylation loci, and 6 specific protein kinase C phosphorylation loci. The CAST gene showed widespread expression in different tissues of C. carpio. Surprisingly, the relative expression of the CAST transcript in the muscle and heart tissues of C. carpio was significantly higher than in other tissues (P < 0.01).

Cloning of a cDNA encoding rat aldehyde dehydrogenase with high activity for retinal oxidation.

PubMed

Bhat, P V; Labrecque, J; Boutin, J M; Lacroix, A; Yoshida, A

1995-12-12

Retinoic acid (RA), an important regulator of cell differentiation, is biosynthesized from retinol via retinal by a two-step oxidation process. We previously reported the purification and partial amino acid (aa) sequence of a rat kidney aldehyde dehydrogenase (ALDH) isozyme that catalyzed the oxidation of 9-cis and all-trans retinal to corresponding RA with high efficiency [Labrecque et al. Biochem. J. 305 (1995) 681-684]. A rat kidney cDNA library was screened using a 291-bp PCR product generated from total kidney RNA using a pair of oligodeoxyribonucleotide primers matched with the aa sequence. The full-length rat kidney ALDH cDNA contains a 2315-bp (501 aa) open reading frame (ORF). The aa sequence of rat kidney ALDH is 89, 96 and 87% identical to that of the rat cytosolic ALDH, the mouse cytosolic ALDH and human cytosolic ALDH, respectively. Northern blot and RT-PCR-mediated analysis demonstrated that rat kidney ALDH is strongly expressed in kidney, lung, testis, intestine, stomach and trachea, but weakly in the liver.

Molecular structures of centromeric heterochromatin and karyotypic evolution in the Siamese crocodile (Crocodylus siamensis) (Crocodylidae, Crocodylia).

PubMed

Kawagoshi, Taiki; Nishida, Chizuko; Ota, Hidetoshi; Kumazawa, Yoshinori; Endo, Hideki; Matsuda, Yoichi

2008-01-01

Crocodilians have several unique karyotypic features, such as small diploid chromosome numbers (30-42) and the absence of dot-shaped microchromosomes. Of the extant crocodilian species, the Siamese crocodile (Crocodylus siamensis) has no more than 2n = 30, comprising mostly bi-armed chromosomes with large centromeric heterochromatin blocks. To investigate the molecular structures of C-heterochromatin and genomic compartmentalization in the karyotype, characterized by the disappearance of tiny microchromosomes and reduced chromosome number, we performed molecular cloning of centromeric repetitive sequences and chromosome mapping of the 18S-28S rDNA and telomeric (TTAGGG)( n ) sequences. The centromeric heterochromatin was composed mainly of two repetitive sequence families whose characteristics were quite different. Two types of GC-rich CSI-HindIII family sequences, the 305 bp CSI-HindIII-S (G+C content, 61.3%) and 424 bp CSI-HindIII-M (63.1%), were localized to the intensely PI-stained centric regions of all chromosomes, except for chromosome 2 with PI-negative heterochromatin. The 94 bp CSI-DraI (G+C content, 48.9%) was tandem-arrayed satellite DNA and localized to chromosome 2 and four pairs of small-sized chromosomes. The chromosomal size-dependent genomic compartmentalization that is supposedly unique to the Archosauromorpha was probably lost in the crocodilian lineage with the disappearance of microchromosomes followed by the homogenization of centromeric repetitive sequences between chromosomes, except for chromosome 2.

Improved efficiency in amplification of Escherichia coli o-antigen gene clusters using genome-wide sequence comparison

USDA-ARS?s Scientific Manuscript database

Background: In many bacteria including E. coli, genes encoding O-antigens are clustered in the chromosome, with a 39-bp JUMPstart sequence and gnd gene located upstream and downstream of the cluster, respectively. For determining the DNA sequence of the E. coli O-antigen gene cluster, one set of P...

Two circular chromosomes of unequal copy number make up the mitochondrial genome of the rotifer Brachionus plicatilis.

PubMed

Suga, Koushirou; Mark Welch, David B; Tanaka, Yukari; Sakakura, Yoshitaka; Hagiwara, Atsushi

2008-06-01

The monogonont rotifer Brachionus plicatilis is an emerging model system for a diverse array of questions in limnological ecosystem dynamics, the evolution of sexual recombination, cryptic speciation, and the phylogeny of basal metazoans. We sequenced the complete mitochondrial genome of B. plicatilis sensu strictu NH1L and found that it is composed of 2 circular chromosomes, designated mtDNA-I (11,153 bp) and mtDNA-II (12,672 bp). Hybridization to DNA isolated from mitochondria demonstrated that mtDNA-I is present at 4 times the copy number of mtDNA-II. The only nucleotide similarity between the 2 chromosomes is a 4.9-kbp region of 99.5% identity including a transfer RNA (tRNA) gene and an extensive noncoding region that contains putative D-loop and control sequence. The mtDNA-I chromosome encodes 4 proteins (ATP6, COB, NAD1, and NAD2), 13 tRNAs, and the large and small subunit ribosomal RNAs; mtDNA-II encodes 8 proteins (COX1-3, NAD3-6, and NAD4L) and 9 tRNAs. Gene order is not conserved between B. plicatilis and its closest relative with a sequenced mitochondrial genome, the acanthocephalan Leptorhynchoides thecatus, or other sequenced mitochondrial genomes. Polymerase chain reaction assays and Southern hybridization to DNA from 18 strains of Brachionus suggest that the 2-chromosome structure has been stable for millions of years. The novel organization of the B. plicatilis mitochondrial genome into 2 nearly equal chromosomes of 4-fold different copy number may provide insight into the evolution of metazoan mitochondria and the phylogenetics of rotifers and other basal animal phyla.

Mycobacterium smegmatis strain for detection of Mycobacterium tuberculosis by PCR used as internal control for inhibition of amplification and for quantification of bacteria.

PubMed Central

Kolk, A H; Noordhoek, G T; de Leeuw, O; Kuijper, S; van Embden, J D

1994-01-01

For the detection of Mycobacterium tuberculosis by PCR, the IS6110 sequence was used. A modified target was constructed by insertion of 56 nucleotides in the IS6110 insertion element of Mycobacterium bovis BCG. This modified insertion sequence was integrated into the genome of Mycobacterium smegmatis, a mycobacterium species which does not contain the IS6110 element. When DNA from the modified M. smegmatis 1008 strain was amplified with IS6110-specific primers INS1 and INS2, a band of 301 bp was seen on agarose gel, whereas the PCR product of M. tuberculosis complex DNA was a 245-bp fragment with these primers. The addition of a small number of M. smegmatis 1008 cells to clinical samples before DNA purification enables the detection of problems which may be due to the loss of DNA in the isolation procedure or to the presence of inhibitors. The presence of inhibitors of the amplification reaction can be confirmed by the addition of M. smegmatis 1008 DNA after the DNA isolation procedure. Furthermore, competition between the different target DNAs of M. smegmatis 1008 DNA and M. tuberculosis complex DNA enables the estimation of the number of IS6110 elements in the clinical sample. Images PMID:8051267

Molecular characterization of DnaJ 5 homologs in silkworm Bombyx mori and its expression during egg diapause.

PubMed

Sirigineedi, Sasibhushan; Vijayagowri, Esvaran; Murthy, Geetha N; Rao, Guruprasada; Ponnuvel, Kangayam M

2014-12-01

A comparison of the cDNA sequences (1 056 bp) of Bombyx mori DnaJ 5 homolog with B. mori genome revealed that unlike in other Hsps, it has an intron of 234 bp. The DnaJ 5 homolog contains 351 amino acids, of which 70 contain the conserved DnaJ domain at the N-terminal end. This homolog of B. mori has all desirable functional domains similar to other insects, and the 13 different DnaJ homologs identified in B. mori genome were distributed on different chromosomes. The expressed sequence tag database analysis of Hsp40 gene expression revealed higher expression in wing disc followed by diapause-induced eggs. Microarray analysis revealed higher expression of DnaJ 5 homolog at 18th h after oviposition in diapause-induced eggs. Further validation of DnaJ 5 expression through qPCR in diapause-induced and nondiapause eggs at different time intervals revealed higher expression in diapause eggs at 18 and 24 h after oviposition, which coincided with the expression of Hsp70 as the Hsp 40 is its co-chaperone. This study thus provides an outline of the genome organization of Hsp40 gene, and its role in egg diapause induction in B. mori. © 2013 Institute of Zoology, Chinese Academy of Sciences.

Characterization of complete genome sequence of the spring viremia of carp virus isolated from common carp (Cyprinus carpio) in China.

PubMed

Teng, Y; Liu, H; Lv, J Q; Fan, W H; Zhang, Q Y; Qin, Q W

2007-01-01

The complete genome of spring viraemia of carp virus (SVCV) strain A-1 isolated from cultured common carp (Cyprinus carpio) in China was sequenced and characterized. Reverse transcription-polymerase chain reaction (RT-PCR) derived clones were constructed and the DNA was sequenced. It showed that the entire genome of SVCV A-1 consists of 11,100 nucleotide base pairs, the predicted size of the viral RNA of rhabdoviruses. However, the additional insertions in bp 4633-4676 and bp 4684-4724 of SVCV A-1 were different from the other two published SVCV complete genomes. Five open reading frames (ORFs) of SVCV A-1 were identified and further confirmed by RT-PCR and DNA sequencing of their respective RT-PCR products. The 5 structural proteins encoded by the viral RNA were ordered 3'-N-P-M-G-L-5'. This is the first report of a complete genome sequence of SVCV isolated from cultured carp in China. Phylogenetic analysis indicates that SVCV A-1 is closely related to the members of the genus Vesiculovirus, family Rhabdoviridae.

Chromosome ends: different sequences may provide conserved functions.

PubMed

Louis, Edward J; Vershinin, Alexander V

2005-07-01

The structures of specific chromosome regions, centromeres and telomeres, present a number of puzzles. As functions performed by these regions are ubiquitous and essential, their DNA, proteins and chromatin structure are expected to be conserved. Recent studies of centromeric DNA from human, Drosophila and plant species have demonstrated that a hidden universal centromere-specific sequence is highly unlikely. The DNA of telomeres is more conserved consisting of a tandemly repeated 6-8 bp Arabidopsis-like sequence in a majority of organisms as diverse as protozoan, fungi, mammals and plants. However, there are alternatives to short DNA repeats at the ends of chromosomes and for telomere elongation by telomerase. Here we focus on the similarities and diversity that exist among the structural elements, DNA sequences and proteins, that make up terminal domains (telomeres and subtelomeres), and how organisms use these in different ways to fulfil the functions of end-replication and end-protection. Copyright (c) 2005 Wiley Periodicals, Inc.

Architecture of the 99 bp DNA-six-protein regulatory complex of the lambda att site.

PubMed

Sun, Xingmin; Mierke, Dale F; Biswas, Tapan; Lee, Sang Yeol; Landy, Arthur; Radman-Livaja, Marta

2006-11-17

The highly directional and tightly regulated recombination reaction used to site-specifically excise the bacteriophage lambda chromosome out of its E. coli host chromosome requires the binding of six sequence-specific proteins to a 99 bp segment of the phage att site. To gain structural insights into this recombination pathway, we measured 27 FRET distances between eight points on the 99 bp regulatory DNA bound with all six proteins. Triangulation of these distances using a metric matrix distance-geometry algorithm provided coordinates for these eight points. The resulting path for the protein-bound regulatory DNA, which fits well with the genetics, biochemistry, and X-ray crystal structures describing the individual proteins and their interactions with DNA, provides a new structural perspective into the molecular mechanism and regulation of the recombination reaction and illustrates a design by which different families of higher-order complexes can be assembled from different numbers and combinations of the same few proteins.

Identification and expression analysis of two pro-inflammatory cytokines, TNF-α and IL-8, in cobia (Rachycentron canadum L.) in response to Streptococcus dysgalactiae infection.

PubMed

Nguyen, Thuy Thi Thu; Nguyen, Hai Trong; Wang, Pei-Chyi; Chen, Shih-Chu

2017-08-01

Tumor necrosis factor-alpha (TNF-α) and interleukin-8 (IL-8/CXCL8) play pivotal roles in mediating inflammatory responses to invading pathogens. In this study, we identified and analyzed expressions of cobia TNF-α and IL-8 during Streptococcus dysgalactiae infection. The cloned cDNA transcript of cobia TNF-α comprised of 1281 base pairs (bp), with a 774 bp open reading frame (ORF) encoding 257 amino acids. The deduced amino acid sequence of cobia TNF-α showed a close relationship (84% similarity) with TNF-α of yellowtail amberjack. The cloned IL-8 cDNA sequence was 828 bp long, including a 300-bp ORF encoding 99 amino acids. The deduced amino acid sequence of cobia IL-8 shared 90% identity with IL-8 of striped trumpeter. Cobia challenged with a virulent S. dysgalactiae strain displayed an early significant up-regulation of TNF-α and IL-8 in head kidney, liver, and spleen. Notably, IL-8 expression level increased dramatically in the liver at the severe stage of infection (72 h). In conclusion, a better understanding of TNF-α and IL-8 allows more detailed investigation of immune responses in cobia and furthers study on controlling the infectious disease caused by S. dysgalactiae. Copyright © 2017 Elsevier Ltd. All rights reserved.

Adenovirus sequences required for replication in vivo.

PubMed Central

Wang, K; Pearson, G D

1985-01-01

We have studied the in vivo replication properties of plasmids carrying deletion mutations within cloned adenovirus terminal sequences. Deletion mapping located the adenovirus DNA replication origin entirely within the first 67 bp of the adenovirus inverted terminal repeat. This region could be further subdivided into two functional domains: a minimal replication origin and an adjacent auxillary region which boosted the efficiency of replication by more than 100-fold. The minimal origin occupies the first 18 to 21 bp and includes sequences conserved between all adenovirus serotypes. The adjacent auxillary region extends past nucleotide 36 but not past nucleotide 67 and contains the binding site for nuclear factor I. Images PMID:2991857

Suitability of partial 16S ribosomal RNA gene sequence analysis for the identification of dangerous bacterial pathogens.

PubMed

Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F

2007-03-01

In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.

The mitochondrial genome of the gymnosperm Cycas taitungensis contains a novel family of short interspersed elements, Bpu sequences, and abundant RNA editing sites.

PubMed

Chaw, Shu-Miaw; Shih, Arthur Chun-Chieh; Wang, Daryi; Wu, Yu-Wei; Liu, Shu-Mei; Chou, The-Yuan

2008-03-01

The mtDNA of Cycas taitungensis is a circular molecule of 414,903 bp, making it 2- to 6-fold larger than the known mtDNAs of charophytes and bryophytes, but similar to the average of 7 elucidated angiosperm mtDNAs. It is characterized by abundant RNA editing sites (1,084), more than twice the number found in the angiosperm mtDNAs. The A + T content of Cycas mtDNA is 53.1%, the lowest among known land plants. About 5% of the Cycas mtDNA is composed of a novel family of mobile elements, which we designated as "Bpu sequences." They share a consensus sequence of 36 bp with 2 terminal direct repeats (AAGG) and a recognition site for the Bpu 10I restriction endonuclease (CCTGAAGC). Comparison of the Cycas mtDNA with other plant mtDNAs revealed many new insights into the biology and evolution of land plant mtDNAs. For example, the noncoding sequences in mtDNAs have drastically expanded as land plants have evolved, with abrupt increases appearing in the bryophytes, and then in the seed plants. As a result, the genomic organizations of seed plant mtDNAs are much less compact than in other plants. Also, the Cycas mtDNA appears to have been exempted from the frequent gene loss observed in angiosperm mtDNAs. Similar to the angiosperms, the 3 Cycas genes nad1, nad2, and nad5 are disrupted by 5 group II intron squences, which have brought the genes into trans-splicing arrangements. The evolutionary origin and invasion/duplication mechanism of the Bpu sequences in Cycas mtDNA are hypothesized and discussed.

A periodic pattern of SNPs in the human genome

PubMed Central

Madsen, Bo Eskerod; Villesen, Palle; Wiuf, Carsten

2007-01-01

By surveying a filtered, high-quality set of SNPs in the human genome, we have found that SNPs positioned 1, 2, 4, 6, or 8 bp apart are more frequent than SNPs positioned 3, 5, 7, or 9 bp apart. The observed pattern is not restricted to genomic regions that are known to cause sequencing or alignment errors, for example, transposable elements (SINE, LINE, and LTR), tandem repeats, and large duplicated regions. However, we found that the pattern is almost entirely confined to what we define as “periodic DNA.” Periodic DNA is a genomic region with a high degree of periodicity in nucleotide usage. It turned out that periodic DNA is mainly small regions (average length 16.9 bp), widely distributed in the genome. Furthermore, periodic DNA has a 1.8 times higher SNP density than the rest of the genome and SNPs inside periodic DNA have a significantly higher genotyping error rate than SNPs outside periodic DNA. Our results suggest that not all SNPs in the human genome are created by independent single nucleotide mutations, and that care should be taken in analysis of SNPs from periodic DNA. The latter may have important consequences for SNP and association studies. PMID:17673700

Effect of sustained elevated temperature prior to amplification on template copy number estimation using digital polymerase chain reaction.

PubMed

Bhat, Somanath; McLaughlin, Jacob L H; Emslie, Kerry R

2011-02-21

Digital polymerase chain reaction (dPCR) has the potential to enable accurate quantification of target DNA copy number provided that all target DNA molecules are successfully amplified. Following duplex dPCR analysis from a linear DNA target sequence that contains single copies of two independent template sequences, we have observed that amplification of both templates in a single partition does not always occur. To investigate this finding, we heated the target DNA solution to 95 °C for increasing time intervals and then immediately chilled on ice prior to preparing the dPCR mix. We observed an exponential decline in estimated copy number (R(2)≥ 0.98) of the two template sequences when amplified from either a linearized plasmid or a 388 base pair (bp) amplicon containing the same two template sequences. The distribution of amplifiable templates and the final concentration (copies per µL) were both affected by heat treatment of the samples at 95 °C from 0 s to 30 min. The proportion of target sequences from which only one of the two templates was amplified in a single partition (either 1507 or hmg only) increased over time, while the proportion of target sequences where both templates were amplified (1507 and hmg) in each individual partition declined rapidly from 94% to 52% (plasmid) and 88% to 31% (388 bp amplicon) suggesting an increase in number of targets from which both templates no longer amplify. A 10 min incubation at 95 °C reduced the initial amplifiable template concentration of the plasmid and the 388 bp amplicon by 59% and 91%, respectively. To determine if a similar decrease in amplifiable target occurs during the default pre-activation step of typical PCR amplification protocol, we used mastermixes with a 20 s or 10 min hot-start. The choice of mastermix and consequent pre-activation time did not affect the estimated plasmid concentration. Therefore, we conclude that prolonged exposure of this DNA template to elevated temperatures could lead to significant bias in dPCR measurements. However, care must be taken when designing PCR and non-PCR based experiments by reducing exposure of the DNA template to sustained elevated temperatures in order to improve accuracy in copy number estimation and concentration determination.

2000 Year-old ancient equids: an ancient-DNA lesson from pompeii remains.

PubMed

Di Bernardo, Giovanni; Del Gaudio, Stefania; Galderisi, Umberto; Cipollaro, Marilena

2004-11-15

Ancient DNA extracted from 2000 year-old equine bones was examined in order to amplify mitochondrial and nuclear DNA fragments. A specific equine satellite-type sequence representing 3.7%-11% of the entire equine genome, proved to be a suitable target to address the question of the presence of aDNA in ancient bones. The PCR strategy designed to investigate this specific target also allowed us to calculate the molecular weight of amplifiable DNA fragments. Sequencing of a 370 bp DNA fragment of mitochondrial control region allowed the comparison of ancient DNA sequences with those of modern horses to assess their genetic relationship. The 16S rRNA mitochondrial gene was also examined to unravel the post-mortem base modification feature and to test the status of Pompeian equids taxon on the basis of a Mae III restriction site polymorphism. Copyright 2004 Wiley-Liss, Inc.

Complete nucleotide sequence of the gene for human heparin cofactor II and mapping to chromosomal band 22q11

DOE Office of Scientific and Technical Information (OSTI.GOV)

Herzog, R.; Lutz, S.; Blin, N.

1991-02-05

Heparin cofactor II (HCII) is a 66-kDa plasma glycoprotein that inhibits thrombin rapidly in the presence of dermatan sulfate or heparin. Clones comprising the entire HCII gene were isolated from a human leukocyte genomic library in EMBL-3 {lambda} phage. The sequence of the gene was determined on both strands of DNA (15,849 bp) and included 1,749 bp of 5{prime}-flanking sequence, five exons, four introns, and 476 bp of DNA 3{prime} to the polyadenylation site. Ten complete and one partial Alu repeats were identified in the introns and 5{prime}-flanking region. The HCII gene was regionally mapped on chromosome 22 using rodent-humanmore » somatic cell hybrids, carrying only parts of human chromosome 22, and the chronic myelogenous leukemia cell line K562. With the cDNA probe HCII7.2, containing the entire coding region of the gene, the HCII gene was shown to be amplified 10-20-fold in K562 cells by Southern analysis and in situ hybridization. From these data, the authors concluded that the HCII gene is localized on the chromosomal band 22q11 proximal to the breakpoint cluster region (BCR). Analysis by pulsed-field gel electrophoresis indicated that the amplified HCII gene in K562 cells maps at least 2 Mbp proximal to BCR-1. Furthermore, the HCII7.2 cDNA probe detected two frequent restriction fragment length polymorphisms with the restriction enzymes BamHI and Hind III.« less

Characterization of DNA-protein interactions using high-throughput sequencing data from pulldown experiments

NASA Astrophysics Data System (ADS)

Moreland, Blythe; Oman, Kenji; Curfman, John; Yan, Pearlly; Bundschuh, Ralf

Methyl-binding domain (MBD) protein pulldown experiments have been a valuable tool in measuring the levels of methylated CpG dinucleotides. Due to the frequent use of this technique, high-throughput sequencing data sets are available that allow a detailed quantitative characterization of the underlying interaction between methylated DNA and MBD proteins. Analyzing such data sets, we first found that two such proteins cannot bind closer to each other than 2 bp, consistent with structural models of the DNA-protein interaction. Second, the large amount of sequencing data allowed us to find rather weak but nevertheless clearly statistically significant sequence preferences for several bases around the required CpG. These results demonstrate that pulldown sequencing is a high-precision tool in characterizing DNA-protein interactions. This material is based upon work supported by the National Science Foundation under Grant No. DMR-1410172.

Fine structure of the 21S ribosomal RNA region on yeast mitochondrial DNA. III. Physical location of mitochondrial genetic markers and the molecular nature of omega.

PubMed

Heyting, C; Menke, H H

1979-01-11

1. We have determined the physical location of mitochondrial genetic markers in the 21S region of yeast mtDNA by genetic analysis of petite mutants whose mtDNA has been physically mapped on the wild-type mtDNA. 2. The order of loci, determined in this study, is in agreement with the order deduced from recombination analysis and coretention analysis except for the position of omega+: we conclude that omega+ is located between C321 (RIB-1) and E514 (RIB-3). 3. The marker E514 (RIB-3) has been localized on a DNA segment of 3800 bp, and the markers E354, E553 and cs23 (RIB-2) on a DNA segment of 1100 base pairs; both these segments overlap the 21S rRNA cistron. The marker C321 (RIB-1) has been localized within a segment of 240 bp which also overlaps the 21S rRNA cistron, and we infer on the basis of indirect evidence that this marker lies within this cistron. 4. In all our rho+ as well as rho- strains there is a one-to-one correlation between the omega+ phenotype, the ability to transmit the omega+ allele and the presence of a mtDNA segment of about 1000 bp long, located between sequences specifying RIB-3 and sequences corresponding to the loci RIB-1 and RIB-2. This segment may be inserted at this same position into omega- mtDNA by recombination. 5. The role which the different allelic forms of omega may play in the polarity of recombination is discussed.

Capturing the Biofuel Wellhead and Powerhouse: The Chloroplast and Mitochondrial Genomes of the Leguminous Feedstock Tree Pongamia pinnata

PubMed Central

Kazakoff, Stephen H.; Imelfort, Michael; Edwards, David; Koehorst, Jasper; Biswas, Bandana; Batley, Jacqueline; Scott, Paul T.; Gresshoff, Peter M.

2012-01-01

Pongamia pinnata (syn. Millettia pinnata) is a novel, fast-growing arboreal legume that bears prolific quantities of oil-rich seeds suitable for the production of biodiesel and aviation biofuel. Here, we have used Illumina® ‘Second Generation DNA Sequencing (2GS)’ and a new short-read de novo assembler, SaSSY, to assemble and annotate the Pongamia chloroplast (152,968 bp; cpDNA) and mitochondrial (425,718 bp; mtDNA) genomes. We also show that SaSSY can be used to accurately assemble 2GS data, by re-assembling the Lotus japonicus cpDNA and in the process assemble its mtDNA (380,861 bp). The Pongamia cpDNA contains 77 unique protein-coding genes and is almost 60% gene-dense. It contains a 50 kb inversion common to other legumes, as well as a novel 6.5 kb inversion that is responsible for the non-disruptive, re-orientation of five protein-coding genes. Additionally, two copies of an inverted repeat firmly place the species outside the subclade of the Fabaceae lacking the inverted repeat. The Pongamia and L. japonicus mtDNA contain just 33 and 31 unique protein-coding genes, respectively, and like other angiosperm mtDNA, have expanded intergenic and multiple repeat regions. Through comparative analysis with Vigna radiata we measured the average synonymous and non-synonymous divergence of all three legume mitochondrial (1.59% and 2.40%, respectively) and chloroplast (8.37% and 8.99%, respectively) protein-coding genes. Finally, we explored the relatedness of Pongamia within the Fabaceae and showed the utility of the organellar genome sequences by mapping transcriptomic data to identify up- and down-regulated stress-responsive gene candidates and confirm in silico predicted RNA editing sites. PMID:23272141

Capturing the biofuel wellhead and powerhouse: the chloroplast and mitochondrial genomes of the leguminous feedstock tree Pongamia pinnata.

PubMed

Kazakoff, Stephen H; Imelfort, Michael; Edwards, David; Koehorst, Jasper; Biswas, Bandana; Batley, Jacqueline; Scott, Paul T; Gresshoff, Peter M

2012-01-01

Pongamia pinnata (syn. Millettia pinnata) is a novel, fast-growing arboreal legume that bears prolific quantities of oil-rich seeds suitable for the production of biodiesel and aviation biofuel. Here, we have used Illumina® 'Second Generation DNA Sequencing (2GS)' and a new short-read de novo assembler, SaSSY, to assemble and annotate the Pongamia chloroplast (152,968 bp; cpDNA) and mitochondrial (425,718 bp; mtDNA) genomes. We also show that SaSSY can be used to accurately assemble 2GS data, by re-assembling the Lotus japonicus cpDNA and in the process assemble its mtDNA (380,861 bp). The Pongamia cpDNA contains 77 unique protein-coding genes and is almost 60% gene-dense. It contains a 50 kb inversion common to other legumes, as well as a novel 6.5 kb inversion that is responsible for the non-disruptive, re-orientation of five protein-coding genes. Additionally, two copies of an inverted repeat firmly place the species outside the subclade of the Fabaceae lacking the inverted repeat. The Pongamia and L. japonicus mtDNA contain just 33 and 31 unique protein-coding genes, respectively, and like other angiosperm mtDNA, have expanded intergenic and multiple repeat regions. Through comparative analysis with Vigna radiata we measured the average synonymous and non-synonymous divergence of all three legume mitochondrial (1.59% and 2.40%, respectively) and chloroplast (8.37% and 8.99%, respectively) protein-coding genes. Finally, we explored the relatedness of Pongamia within the Fabaceae and showed the utility of the organellar genome sequences by mapping transcriptomic data to identify up- and down-regulated stress-responsive gene candidates and confirm in silico predicted RNA editing sites.

Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomkinson, B.; Jonsson, A-K

1991-01-01

Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less

Cis-acting elements in the promoter region of the human aldolase C gene.

PubMed

Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F

1993-08-16

We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.

Complementary DNA cloning and constitutive expression of cytochrome P450 1C1 in the gills of carp (Cyprinus carpio).

PubMed

Itakura, Takao; El-Kady, Mohamed; Mitsuo, Ryoichi; Kaminishi, Yoshio

2005-01-01

Cytochrome P450 (CYP) enzymes constitute a multigene family of many endogenous and xenobiotic substances. The CYP1 family is of particular interest in environmental toxicology because its members are dominant in the metabolism of polycyclic aromatic hydrocarbons (PAHs), polychlorinated biphenyls (PCBs), and aryl amines. A new complementary DNA of the CYP1C subfamily encoding CYP1C1 was isolated from carp liver after intraperitoneal injection of beta-napthoflavone (BNF). The full-length cDNA obtained contained a 5' noncoding region of 244 bp, an open reading frame of 1572 bp coding for 524 amino acids, a stop codon, and a 3' noncoding region of 965 bp. The predicted molecular weight of the protein was approximately 59.3 kDa. The deduced amino acid sequence of this cDNA was 82.1% and 80.2% similar to Japanese eel and scup CYP1C1 sequences, respectively, while it exhibited a similarity of 74.9% with the scup CYP1C2 sequence. The deduced amino acid sequence of carp CYP1C1 showed similarities with those of the reported CYP1B1s of teleosts and mammals of 48.4, 48.8, 48.2, 48.6, 45.3, and 45.5% for carp CYP1B1, carp CYP1B2, plaice CYP1B1, and human, rat, and mouse CYP1B1, respectively. The phylogenetic tree constructed using fish and mammalian CYP1 sequences suggested a closer relationship of the CYP1C subfamily to CYP1B than to CYP1A. The tree showed the possibility of the existence of CYP1C subfamily genes in mammalian species. Northern blot analysis for the liver, intestine, gills, and kidney showed no detectable induced expression but constitutive expression in the gill organs.

Concurrent speciation in the eastern woodland salamanders (Genus Plethodon):DNA sequences of the complete albumin nuclear and partialmitochondrial 12s genes

USGS Publications Warehouse

Highton, Richard; Hastings, Amy Picard; Palmer, Catherine; Watts, Richard; Hass, Carla A.; Culver, Melanie; Arnold, Stevan

2012-01-01

Salamanders of the North American plethodontid genus Plethodon are important model organisms in a variety of studies that depend on a phylogenetic framework (e.g., chemical communication, ecological competition, life histories, hybridization, and speciation), and consequently their systematics has been intensively investigated over several decades. Nevertheless, we lack a synthesis of relationships among the species. In the analyses reported here we use new DNA sequence data from the complete nuclear albumin gene (1818 bp) and the 12s mitochondrial gene (355 bp), as well as published data for four other genes (Wiens et al., 2006), up to a total of 6989 bp, to infer relationships. We relate these results to past systematic work based on morphology, allozymes, and DNA sequences. Although basal relationships show a strong consensus across studies, many terminal relationships remain in flux despite substantial sequencing and other molecular and morphological studies. This systematic instability appears to be a consequence of contemporaneous bursts of speciation in the late Miocene and Pliocene, yielding many closely related extant species in each of the four eastern species groups. Therefore we conclude that many relationships are likely to remain poorly resolved in the face of additional sequencing efforts. On the other hand, the current classification of the 45 eastern species into four species groups is supported. The Plethodon cinereus group (10 species) is the sister group to the clade comprising the other three groups, but these latter groups (Plethodon glutinosus [28 species], Plethodon welleri [5 species], and Plethodon wehrlei [2 species]) probably diverged from each other at approximately the same time.

Lactobacillus cerevisiae sp. nov., isolated from a spoiled brewery sample.

PubMed

Koob, Jennifer; Jacob, Fritz; Wenning, Mareike; Hutzler, Mathias

2017-09-01

A Gram-stain-positive, non-motile, rod-shaped bacterium, designated TUM BP 140423000-2250T (=DSM 100836T=LMG 29073T), was isolated from spoiled beer. This bacterium did not form spores, and was catalase-negative and facultatively anaerobic. Its taxonomic position was determined in a polyphasic study. The 16S rRNA gene sequence similarity data showed that the strain belonged to the Lactobacillus genus with the nearest neighbours being Lactobacillus koreensis DCY50T (sequence similarity 99.5 %), Lactobacillus yonginensis THK-V8T (99.2 %) and Lactobacillus parabrevis LMG 11984T (98.7 %). Sequence comparisons of additional phylogenetic markers, pheS and rpoA, confirmed the 16S rRNA gene sequence tree topology. The maximum rpoA sequence similarity was 92.3 % with L. yonginensis THK-V8T. The DNA G+C content of the isolate was 50.0 mol%. The DNA-DNA relatedness showed that strain TUM BP 140423000-2250T could be clearly distinguished from L. koreensis DCY 50T (30.8±0.4 %) and L. yonginensis THK-V8T (23.6±5.9 %). The major fatty acids were C18 : 1ω9c, summed feature 7 (comprised of C19 : 0 cyclo ω10c/C19 : 1ω6c) and C16 : 0. Based on phenotypic and genotypic studies, the authors propose classifying the new isolate as a representative of a novel species of the genus Lactobacillus, Lactobacillus cerevisiae sp. nov. The type strain is deposited at the Research Centre Weihenstephan for Brewing and Food Quality as TUM BP 140423000-2250T (=DSM 100836T=LMG 29073T).

Characterization and expression analysis of Toll-like receptor 3 cDNA from Atlantic salmon (Salmo salar).

PubMed

Vidal, R; González, R; Gil, F

2015-06-10

Innate pathway activation is fundamental for early anti-viral defense in fish, but currently there is insufficient understanding of how salmonid fish identify viral molecules and activate these pathways. The Toll-like receptor (TLR) is believed to play a crucial role in host defense of pathogenic microbes in the innate immune system. In the present study, the full-length cDNA of Salmo salar TLR3 (ssTLR3) was cloned. The ssTLR3 cDNA sequence was 6071 bp long, containing an open reading frame of 2754 bp and encoding 971 amino acids. The TLR group motifs, such as leucine-rich repeat (LRR) domains and Toll-interleukin-1 receptor (TIR) domains, were maintained in ssTLR3, with sixteen LRR domains and one TIR domain. In contrast to descriptions of the TLR3 in rainbow trout and the murine (TATA-less), we found a putative TATA box in the proximal promoter region 29 bp upstream of the transcription start point of ssTLR3. Multiple-sequence alignment analysis of the ssTLR3 protein-coding sequence with other known TLR3 sequences showed the sequence to be conserved among all species analyzed, implying that the function of the TLR3 had been sustained throughout evolution. The ssTLR3 mRNA expression patterns were measured using real-time PCR. The results revealed that TLR3 is widely expressed in various healthy tissues. Individuals challenged with infectious pancreatic necrosis virus and immunostimulated with polyinosinic:polycytidylic acid exhibited increased expression of TLR3 at the mRNA level, indicating that ssTLR3 may be involved in pathogen recognition in the early innate immune system.

Strong transcription blockage mediated by R-loop formation within a G-rich homopurine–homopyrimidine sequence localized in the vicinity of the promoter

PubMed Central

Soo Shin, Jane Hae

2017-01-01

Abstract Guanine-rich (G-rich) homopurine–homopyrimidine nucleotide sequences can block transcription with an efficiency that depends upon their orientation, composition and length, as well as the presence of negative supercoiling or breaks in the non-template DNA strand. We report that a G-rich sequence in the non-template strand reduces the yield of T7 RNA polymerase transcription by more than an order of magnitude when positioned close (9 bp) to the promoter, in comparison to that for a distal (∼250 bp) location of the same sequence. This transcription blockage is much less pronounced for a C-rich sequence, and is not significant for an A-rich sequence. Remarkably, the blockage is not pronounced if transcription is performed in the presence of RNase H, which specifically digests the RNA strands within RNA–DNA hybrids. The blockage also becomes less pronounced upon reduced RNA polymerase concentration. Based upon these observations and those from control experiments, we conclude that the blockage is primarily due to the formation of stable RNA–DNA hybrids (R-loops), which inhibit successive rounds of transcription. Our results could be relevant to transcription dynamics in vivo (e.g. transcription ‘bursting’) and may also have practical implications for the design of expression vectors. PMID:28498974

Strong transcription blockage mediated by R-loop formation within a G-rich homopurine-homopyrimidine sequence localized in the vicinity of the promoter.

PubMed

Belotserkovskii, Boris P; Soo Shin, Jane Hae; Hanawalt, Philip C

2017-06-20

Guanine-rich (G-rich) homopurine-homopyrimidine nucleotide sequences can block transcription with an efficiency that depends upon their orientation, composition and length, as well as the presence of negative supercoiling or breaks in the non-template DNA strand. We report that a G-rich sequence in the non-template strand reduces the yield of T7 RNA polymerase transcription by more than an order of magnitude when positioned close (9 bp) to the promoter, in comparison to that for a distal (∼250 bp) location of the same sequence. This transcription blockage is much less pronounced for a C-rich sequence, and is not significant for an A-rich sequence. Remarkably, the blockage is not pronounced if transcription is performed in the presence of RNase H, which specifically digests the RNA strands within RNA-DNA hybrids. The blockage also becomes less pronounced upon reduced RNA polymerase concentration. Based upon these observations and those from control experiments, we conclude that the blockage is primarily due to the formation of stable RNA-DNA hybrids (R-loops), which inhibit successive rounds of transcription. Our results could be relevant to transcription dynamics in vivo (e.g. transcription 'bursting') and may also have practical implications for the design of expression vectors. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Phylogenic study of Lemnoideae (duckweeds) through complete chloroplast genomes for eight accessions.

PubMed

Ding, Yanqiang; Fang, Yang; Guo, Ling; Li, Zhidan; He, Kaize; Zhao, Yun; Zhao, Hai

2017-01-01

Phylogenetic relationship within different genera of Lemnoideae, a kind of small aquatic monocotyledonous plants, was not well resolved, using either morphological characters or traditional markers. Given that rich genetic information in chloroplast genome makes them particularly useful for phylogenetic studies, we used chloroplast genomes to clarify the phylogeny within Lemnoideae. DNAs were sequenced with next-generation sequencing. The duckweeds chloroplast genomes were indirectly filtered from the total DNA data, or directly obtained from chloroplast DNA data. To test the reliability of assembling the chloroplast genome based on the filtration of the total DNA, two methods were used to assemble the chloroplast genome of Landoltia punctata strain ZH0202. A phylogenetic tree was built on the basis of the whole chloroplast genome sequences using MrBayes v.3.2.6 and PhyML 3.0. Eight complete duckweeds chloroplast genomes were assembled, with lengths ranging from 165,775 bp to 171,152 bp, and each contains 80 protein-coding sequences, four rRNAs, 30 tRNAs and two pseudogenes. The identity of L. punctata strain ZH0202 chloroplast genomes assembled through two methods was 100%, and their sequences and lengths were completely identical. The chloroplast genome comparison demonstrated that the differences in chloroplast genome sizes among the Lemnoideae primarily resulted from variation in non-coding regions, especially from repeat sequence variation. The phylogenetic analysis demonstrated that the different genera of Lemnoideae are derived from each other in the following order: Spirodela , Landoltia , Lemna , Wolffiella , and Wolffia . This study demonstrates potential of whole chloroplast genome DNA as an effective option for phylogenetic studies of Lemnoideae. It also showed the possibility of using chloroplast DNA data to elucidate those phylogenies which were not yet solved well by traditional methods even in plants other than duckweeds.

Phylogenic study of Lemnoideae (duckweeds) through complete chloroplast genomes for eight accessions

PubMed Central

Ding, Yanqiang; Fang, Yang; Guo, Ling; Li, Zhidan; He, Kaize

2017-01-01

Background Phylogenetic relationship within different genera of Lemnoideae, a kind of small aquatic monocotyledonous plants, was not well resolved, using either morphological characters or traditional markers. Given that rich genetic information in chloroplast genome makes them particularly useful for phylogenetic studies, we used chloroplast genomes to clarify the phylogeny within Lemnoideae. Methods DNAs were sequenced with next-generation sequencing. The duckweeds chloroplast genomes were indirectly filtered from the total DNA data, or directly obtained from chloroplast DNA data. To test the reliability of assembling the chloroplast genome based on the filtration of the total DNA, two methods were used to assemble the chloroplast genome of Landoltia punctata strain ZH0202. A phylogenetic tree was built on the basis of the whole chloroplast genome sequences using MrBayes v.3.2.6 and PhyML 3.0. Results Eight complete duckweeds chloroplast genomes were assembled, with lengths ranging from 165,775 bp to 171,152 bp, and each contains 80 protein-coding sequences, four rRNAs, 30 tRNAs and two pseudogenes. The identity of L. punctata strain ZH0202 chloroplast genomes assembled through two methods was 100%, and their sequences and lengths were completely identical. The chloroplast genome comparison demonstrated that the differences in chloroplast genome sizes among the Lemnoideae primarily resulted from variation in non-coding regions, especially from repeat sequence variation. The phylogenetic analysis demonstrated that the different genera of Lemnoideae are derived from each other in the following order: Spirodela, Landoltia, Lemna, Wolffiella, and Wolffia. Discussion This study demonstrates potential of whole chloroplast genome DNA as an effective option for phylogenetic studies of Lemnoideae. It also showed the possibility of using chloroplast DNA data to elucidate those phylogenies which were not yet solved well by traditional methods even in plants other than duckweeds. PMID:29302399

The Paramecium germline genome provides a niche for intragenic parasitic DNA: evolutionary dynamics of internal eliminated sequences.

PubMed

Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

2012-01-01

Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of -45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a -10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated.

The Paramecium Germline Genome Provides a Niche for Intragenic Parasitic DNA: Evolutionary Dynamics of Internal Eliminated Sequences

PubMed Central

Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E.; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

2012-01-01

Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of ∼45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a ∼10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated. PMID:23071448

Sensitive and Specific Target Sequences Selected from Retrotransposons of Schistosoma japonicum for the Diagnosis of Schistosomiasis

PubMed Central

Xu, Jing; Zhu, Xing-Quan; Wang, Sheng-Yue; Xia, Chao-Ming

2012-01-01

Background Schistosomiasis japonica is a serious debilitating and sometimes fatal disease. Accurate diagnostic tests play a key role in patient management and control of the disease. However, currently available diagnostic methods are not ideal, and the detection of the parasite DNA in blood samples has turned out to be one of the most promising tools for the diagnosis of schistosomiasis. In our previous investigations, a 230-bp sequence from the highly repetitive retrotransposon SjR2 was identified and it showed high sensitivity and specificity for detecting Schistosoma japonicum DNA in the sera of rabbit model and patients. Recently, 29 retrotransposons were found in S. japonicum genome by our group. The present study highlighted the key factors for selecting a new perspective sensitive target DNA sequence for the diagnosis of schistosomiasis, which can serve as example for other parasitic pathogens. Methodology/Principal Findings In this study, we demonstrated that the key factors based on the bioinformatic analysis for selecting target sequence are the higher genome proportion, repetitive complete copies and partial copies, and active ESTs than the others in the chromosome genome. New primers based on 25 novel retrotransposons and SjR2 were designed and their sensitivity and specificity for detecting S. japonicum DNA were compared. The results showed that a new 303-bp sequence from non-long terminal repeat (LTR) retrotransposon (SjCHGCS19) had high sensitivity and specificity. The 303-bp target sequence was amplified from the sera of rabbit model at 3 d post-infection by nested-PCR and it became negative at 17 weeks post-treatment. Furthermore, the percentage sensitivity of the nested-PCR was 97.67% in 43 serum samples of S. japonicum-infected patients. Conclusions/Significance Our findings highlighted the key factors based on the bioinformatic analysis for selecting target sequence from S. japonicum genome, which provide basis for establishing powerful molecular diagnostic techniques that can be used for monitoring early infection and therapy efficacy to support schistosomiasis control programs. PMID:22479661

Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.

PubMed

Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J

2008-10-15

The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

PubMed

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

Biochemical Characterization of Novel Retroviral Integrase Proteins

PubMed Central

Ballandras-Colas, Allison; Naraharisetty, Hema; Li, Xiang; Serrao, Erik; Engelman, Alan

2013-01-01

Integrase is an essential retroviral enzyme, catalyzing the stable integration of reverse transcribed DNA into cellular DNA. Several aspects of the integration mechanism, including the length of host DNA sequence duplication flanking the integrated provirus, which can be from 4 to 6 bp, and the nucleotide preferences at the site of integration, are thought to cluster among the different retroviral genera. To date only the spumavirus prototype foamy virus integrase has provided diffractable crystals of integrase-DNA complexes, revealing unprecedented details on the molecular mechanisms of DNA integration. Here, we characterize five previously unstudied integrase proteins, including those derived from the alpharetrovirus lymphoproliferative disease virus (LPDV), betaretroviruses Jaagsiekte sheep retrovirus (JSRV), and mouse mammary tumor virus (MMTV), epsilonretrovirus walleye dermal sarcoma virus (WDSV), and gammaretrovirus reticuloendotheliosis virus strain A (Rev-A) to identify potential novel structural biology candidates. Integrase expressed in bacterial cells was analyzed for solubility, stability during purification, and, once purified, 3′ processing and DNA strand transfer activities in vitro. We show that while we were unable to extract or purify accountable amounts of WDSV, JRSV, or LPDV integrase, purified MMTV and Rev-A integrase each preferentially support the concerted integration of two viral DNA ends into target DNA. The sequencing of concerted Rev-A integration products indicates high fidelity cleavage of target DNA strands separated by 5 bp during integration, which contrasts with the 4 bp duplication generated by a separate gammaretrovirus, the Moloney murine leukemia virus (MLV). By comparing Rev-A in vitro integration sites to those generated by MLV in cells, we concordantly conclude that the spacing of target DNA cleavage is more evolutionarily flexible than are the target DNA base contacts made by integrase during integration. Given their desirable concerted DNA integration profiles, Rev-A and MMTV integrase proteins have been earmarked for structural biology studies. PMID:24124581

Characterization of mitochondrial genome of sea cucumber Stichopus horrens: a novel gene arrangement in Holothuroidea.

PubMed

Fan, SiGang; Hu, ChaoQun; Wen, Jing; Zhang, LvPing

2011-05-01

The complete mitochondrial DNA sequence contains useful information for phylogenetic analyses of metazoa. In this study, the complete mitochondrial DNA sequence of sea cucumber Stichopus horrens (Holothuroidea: Stichopodidae: Stichopus) is presented. The complete sequence was determined using normal and long PCRs. The mitochondrial genome of Stichopus horrens is a circular molecule 16257 bps long, composed of 13 protein-coding genes, two ribosomal RNA genes and 22 transfer RNA genes. Most of these genes are coded on the heavy strand except for one protein-coding gene (nad6) and five tRNA genes (tRNA ( Ser(UCN) ), tRNA ( Gln ), tRNA ( Ala ), tRNA ( Val ), tRNA ( Asp )) which are coded on the light strand. The composition of the heavy strand is 30.8% A, 23.7% C, 16.2% G, and 29.3% T bases (AT skew=0.025; GC skew=-0.188). A non-coding region of 675 bp was identified as a putative control region because of its location and AT richness. The intergenic spacers range from 1 to 50 bp in size, totaling 227 bp. A total of 25 overlapping nucleotides, ranging from 1 to 10 bp in size, exist among 11 genes. All 13 protein-coding genes are initiated with an ATG. The TAA codon is used as the stop codon in all the protein coding genes except nad3 and nad4 that use TAG as their termination codon. The most frequently used amino acids are Leu (16.29%), Ser (10.34%) and Phe (8.37%). All of the tRNA genes have the potential to fold into typical cloverleaf secondary structures. We also compared the order of the genes in the mitochondrial DNA from the five holothurians that are now available and found a novel gene arrangement in the mitochondrial DNA of Stichopus horrens.

Probabilistic topic modeling for the analysis and classification of genomic sequences

PubMed Central

2015-01-01

Background Studies on genomic sequences for classification and taxonomic identification have a leading role in the biomedical field and in the analysis of biodiversity. These studies are focusing on the so-called barcode genes, representing a well defined region of the whole genome. Recently, alignment-free techniques are gaining more importance because they are able to overcome the drawbacks of sequence alignment techniques. In this paper a new alignment-free method for DNA sequences clustering and classification is proposed. The method is based on k-mers representation and text mining techniques. Methods The presented method is based on Probabilistic Topic Modeling, a statistical technique originally proposed for text documents. Probabilistic topic models are able to find in a document corpus the topics (recurrent themes) characterizing classes of documents. This technique, applied on DNA sequences representing the documents, exploits the frequency of fixed-length k-mers and builds a generative model for a training group of sequences. This generative model, obtained through the Latent Dirichlet Allocation (LDA) algorithm, is then used to classify a large set of genomic sequences. Results and conclusions We performed classification of over 7000 16S DNA barcode sequences taken from Ribosomal Database Project (RDP) repository, training probabilistic topic models. The proposed method is compared to the RDP tool and Support Vector Machine (SVM) classification algorithm in a extensive set of trials using both complete sequences and short sequence snippets (from 400 bp to 25 bp). Our method reaches very similar results to RDP classifier and SVM for complete sequences. The most interesting results are obtained when short sequence snippets are considered. In these conditions the proposed method outperforms RDP and SVM with ultra short sequences and it exhibits a smooth decrease of performance, at every taxonomic level, when the sequence length is decreased. PMID:25916734

Factors influencing the specific interaction of Neisseria gonorrhoeae with transforming DNA.

PubMed Central

Goodman, S D; Scocca, J J

1991-01-01

The specific interaction of transformable Neisseria gonorrhoeae with DNA depends on the recognition of specific 10-residue target sequences. The relative affinity for DNA between 3 and 17 kb in size appears to be linearly related to the frequency of targets on the segment and is unaffected by absolute size. The average frequency of targets in chromosomal DNA of N. gonorrhoeae appears to be approximately one per 1,000 bp. PMID:1909325

Production of DNA minicircles less than 250 base pairs through a novel concentrated DNA circularization assay enabling minicircle design with NF-κB inhibition activity

PubMed Central

Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick

2017-01-01

Abstract Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. PMID:27899652

Myostatin-2 gene structure and polymorphism of the promoter and first intron in the marine fish Sparus aurata: evidence for DNA duplications and/or translocations.

PubMed

Nadjar-Boger, Elisabeth; Funkenstein, Bruria

2011-02-01

Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily that functions as a negative regulator of skeletal muscle development and growth in mammals. Fish express at least two genes for MSTN: MSTN-1 and MSTN-2. To date, MSTN-2 promoters have been cloned only from salmonids and zebrafish. Here we described the cloning and sequence analysis of MSTN-2 gene and its 5' flanking region in the marine fish Sparus aurata (saMSTN-2). We demonstrate the existence of three alleles of the promoter and three alleles of the first intron. Sequence comparison of the promoter region in the three alleles revealed that although the sequences of the first 1050 bp upstream of the translation start site are almost identical in the three alleles, a substantial sequence divergence is seen further upstream. Careful sequence analysis of the region upstream of the first 1050 bp in the three alleles identified several elements that appear to be repeated in some or all sequences, at different positions. This suggests that the promoter region of saMSTN-2 has been subjected to various chromosomal rearrangements during the course of evolution, reflecting either insertion or deletion events. Screening of several genomic DNA collections indicated differences in allele frequency, with allele 'b' being the most abundant, followed by allele 'c', whereas allele 'a' is relatively rare. Sequence analysis of saMSTN-2 gene also revealed polymorphism in the first intron, identifying three alleles. The length difference in alleles '1R' and '2R' of the first intron is due to the presence of one or two copies of a repeated block of approximately 150 bp, located at the 5' end of the first intron. The third allele, '4R', has an additional insertion of 323 bp located 116 bp upstream of the 3' end of the first intron. Analysis of several DNA collections showed that the '2R' allele is the most common, followed by the '4R' allele, whereas the '1R' allele is relatively rare. Progeny analysis of a full-sib family showed a Mendelian mode of inheritance of the two genetic loci. No clear association was found between the two genetic markers and growth rate. These results show for the first time a substantial degree of polymorphism in both the promoter and first intron of MSTN-2 gene in a perciform fish species which points to chromosomal rearrangements that took place during evolution.

A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

PubMed Central

Walker, M D; Park, C W; Rosen, A; Aronheim, A

1990-01-01

Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

Transcript profiles of mitochondrial and cytoplasmic manganese superoxide dismutases in Exopalaemon carinicauda under ammonia stress

NASA Astrophysics Data System (ADS)

Ren, Hai; Li, Jian; Li, Jitao; Liu, Ping; Liang, Zhongxiu; Wu, Jianhua

2015-05-01

Superoxide dismutase (SOD) is one of the most important antioxidant defense enzymes, and is considered as the first line against oxidative stress. In this study, we cloned a mitochondrial manganese (Mn) SOD ( mMnSOD) cDNA from the ridgetail white prawn Exopalaemon carinicauda by using rapid amplification of cDNA ends (RACE) methods. The full-length cDNA for mMnSOD was 1 014-bp long, containing a 5'-untranslated region (UTR) of 37-bp, a 3'-UTR of 321-bp with a poly (A) tail, and included a 657-bp open reading frame encoding a protein of 218 amino acids with a 16-amino-acid signal peptide. The protein had a calculated molecular weight of 23.87 kDa and a theoretical isoelectric point of 6.75. The mMnSOD sequence included two putative N-glycosylation sites (NHT and NLS), the MnSOD signature sequence 180DVWEHAYY187, and four putative Mn binding sites (H48, H96, D180, and H184). Sequence comparison showed that the mMnSOD deduced amino acid sequence of E. carinicauda shared 97%, 95%, 89%, 84%, 82%, 72%, and 69% identity with that of Macrobrachium rosenbergii, Macrobrachium nipponense, Fenneropeneaus chinensis, Callinectes sapidus, Perisesarma bidens, Danio rerio, and Homo sapiens, resectively. Quantitative real-time RT-PCR analysis showed that mMnSOD transcripts were present in all E. carinicauda tissues examined, with the highest levels in the hepatopancreas. During an ammonia stress treatment, the transcript levels of mMnSOD and cMnSOD were up-regulated at 12 h in hemocytes and at 24 h in the hepatopancreas. As the duration of the ammonia stress treatment extended to 72 h, the transcript levels of mMnSOD and cMnSOD significantly decreased both in hemocytes and hepatopancreas. These findings indicate that the SOD system is induced to respond to acute ammonia stress, and may be involved in environmental stress responses in E. carinicauda.

Analysis of mutational spectra by denaturant capillary electrophoresis

PubMed Central

Ekstrøm, Per O.; Khrapko, Konstantin; Li-Sucholeiki, Xiao-Cheng; Hunter, Ian W.; Thilly, William G.

2009-01-01

Numbers and kinds of point mutant within DNA from cells, tissues and human population may be discovered for nearly any 75–250bp DNA sequence. High fidelity DNA amplification incorporating a thermally stable DNA “clamp” is followed by separation by denaturing capillary electrophoresis (DCE). DCE allows for peak collection and verification sequencing. DCE in a mode of cycling temperature, e.g.+/− 5°C, CyDCE, permits high resolution of mutant sequences using computer defined analytes without preliminary optimization experiments. DNA sequencers have been modified to permit higher throughput CyDCE and a massively parallel,~25,000 capillary system, has been designed for pangenomic scans in large human populations. DCE has been used to define quantitative point mutational spectra for study a wide variety of genetic phenomena: errors of DNA polymerases, mutations induced in human cells by chemicals and irradiation, testing of human gene-common disease associations and the discovery of origins of point mutations in human development and carcinogenesis. PMID:18600220

Polymorphism of Paramecium pentaurelia (Ciliophora, Oligohymenophorea) strains revealed by rDNA and mtDNA sequences.

PubMed

Przyboś, Ewa; Tarcz, Sebastian; Greczek-Stachura, Magdalena; Surmacz, Marta

2011-05-01

Paramecium pentaurelia is one of 15 known sibling species of the Paramecium aurelia complex. It is recognized as a species showing no intra-specific differentiation on the basis of molecular fingerprint analyses, whereas the majority of other species are polymorphic. This study aimed at assessing genetic polymorphism within P. pentaurelia including new strains recently found in Poland (originating from two water bodies, different years, seasons, and clones of one strain) as well as strains collected from distant habitats (USA, Europe, Asia), and strains representing other species of the complex. We compared two DNA fragments: partial sequences (349 bp) of the LSU rDNA and partial sequences (618 bp) of cytochrome B gene. A correlation between the geographical origin of the strains and the genetic characteristics of their genotypes was not observed. Different genotypes were found in Kraków in two types of water bodies (Opatkowice-natural pond; Jordan's Park-artificial pond). Haplotype diversity within a single water body was not recorded. Likewise, seasonal haplotype differences between the strains within the artificial water body, as well as differences between clones originating from one strain, were not detected. The clustering of some strains belonging to different species was observed in the phylogenies. Copyright © 2010 Elsevier GmbH. All rights reserved.

Eurasian otters, Lutra lutra, have a dominant mtDNA haplotype from the Iberian Peninsula to Scandinavia.

PubMed

Ferrando, Ainhoa; Ponsà, Montserrat; Marmi, Josep; Domingo-Roura, Xavier

2004-01-01

The Eurasian otter, Lutra lutra, has a Palaearctic distribution and has suffered a severe decline throughout Europe during the last century. Previous studies in this and other mustelids have shown reduced levels of variability in mitochondrial DNA, although otter phylogeographic studies were restricted to central-western Europe. In this work we have sequenced 361 bp of the mtDNA control region in 73 individuals from eight countries and added our results to eight sequences available from GenBank and the literature. The range of distribution has been expanded in relation to previous works north towards Scandinavia, east to Russia and Belarus, and south to the Iberian Peninsula. We found a single dominant haplotype in 91.78% of the samples, and six more haplotypes deviating a maximum of two mutations from the dominant haplotype restricted to a single country. Variability was extremely low in western Europe but higher in eastern countries. This, together with the lack of phylogeographical structuring, supports the postglacial recolonization of Europe from a single refugium. The Eurasian otter mtDNA control region has a 220-bp variable minisatellite in Domain III that we sequenced in 29 otters. We found a total of 19 minisatellite haplotypes, but they showed no phylogenetic information.

Early Sex Identification in Date Palm by Male-Specific Sequence-Characterized Amplified Region (SCAR) Markers.

PubMed

Kharb, Pushpa; Mitra, Charu

2017-01-01

Date palm (Phoenix dactylifera L.) is a dioecious plant, and sex of the seedlings can be determined only at the time of first flowering which takes 4-5 years. Female date palm plants are of economic importance as they bear the fruit. Therefore, sex identification at an early stage is highly desirable. DNA-based markers are useful for early sex detection. In this chapter, we describe male-specific sequence-characterized amplified region (SCAR) markers to identify sex in date palm at the seedling stage. Genomic DNA is isolated separately from both male and female date palm genotypes. Amplification of this genomic DNA isolated from male and female plants using the SCAR primers results in an amplicon of 406 bp in both female and male samples and a unique amplicon of 354 bp only in male samples. Based on this amplification pattern, the sex of date palm seedlings can be predicted.

Phylogenetic Relationship in Different Commercial Strains of Pleurotus nebrodensis Based on ITS Sequence and RAPD.

PubMed

Alam, Nuhu; Shim, Mi Ja; Lee, Min Woong; Shin, Pyeong Gyun; Yoo, Young Bok; Lee, Tae Soo

2009-09-01

The molecular phylogeny in nine different commercial cultivated strains of Pleurotus nebrodensis was studied based on their internal transcribed spacer (ITS) region and RAPD. In the sequence of ITS region of selected strains, it was revealed that the total length ranged from 592 to 614 bp. The size of ITS1 and ITS2 regions varied among the strains from 219 to 228 bp and 211 to 229 bp, respectively. The sequence of ITS2 was more variable than ITS1 and the region of 5.8S sequences were identical. Phylogenetic tree of the ITS region sequences indicated that selected strains were classified into five clusters. The reciprocal homologies of the ITS region sequences ranged from 99 to 100%. The strains were also analyzed by RAPD with 20 arbitrary primers. Twelve primers were efficient to applying amplification of the genomic DNA. The sizes of the polymorphic fragments obtained were in the range of 200 to 2000 bp. RAPD and ITS analysis techniques were able to detect genetic variation among the tested strains. Experimental results suggested that IUM-1381, IUM-3914, IUM-1495 and AY-581431 strains were genetically very similar. Therefore, all IUM and NCBI gene bank strains of P. nebrodensis were genetically same with some variations.

Differential Detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii by a Single-Round PCR Assay

PubMed Central

Hamzah, Zulhainan; Petmitr, Songsak; Mungthin, Mathirut; Leelayoova, Saovanee; Chavalitshewinkoon-Petmitr, Porntip

2006-01-01

A single-round PCR assay was developed for detection and differential diagnosis of the three Entamoeba species found in humans, Entamoeba moshkovskii, Entamoeba histolytica, and Entamoeba dispar, that are morphologically identical as both cysts and trophozoites. A conserved forward primer was derived from the middle of the small-subunit rRNA gene, and reverse primers were designed from signature sequences specific to each of these three Entamoeba species. PCR generates a 166-bp product with E. histolytica DNA, a 752-bp product with E. dispar DNA, and a 580-bp product with E. moshkovskii DNA. Thirty clinical specimens were examined, and the species present were successfully detected and differentiated using this assay. It was possible to detect as little as 10 pg of E. moshkovskii and E. histolytica DNA, while for E. dispar the sensitivity was about 20 pg of DNA. Testing with DNA from different pathogens, including bacteria and other protozoa, confirmed the high specificity of the assay. We propose the use of this PCR assay as an accurate, rapid, and effective diagnostic method for the detection and discrimination of these three morphologically indistinguishable Entamoeba species in both routine diagnosis of amoebiasis and epidemiological surveys. PMID:16954247

Two different size classes of 5S rDNA units coexisting in the same tandem array in the razor clam Ensis macha: is this region suitable for phylogeographic studies?

PubMed

Fernández-Tajes, Juan; Méndez, Josefina

2009-12-01

For a study of 5S ribosomal genes (rDNA) in the razor clam Ensis macha, the 5S rDNA region was amplified and sequenced. Two variants, so-called type I or short repeat (approximately 430 bp) and type II or long repeat (approximately 735 bp), appeared to be the main components of the 5S rDNA of this species. Their spacers differed markedly, both in length and nucleotide composition. The organization of the two variants was investigated by amplifying the genomic DNA with primers based on the sequence of the type I and type II spacers. PCR amplification products with primers EMLbF and EMSbR showed that the long and short repeats are associated within the same tandem array, suggesting an intermixed arrangement of both spacers. Nevertheless, amplifications carried out with inverse primers EMSinvF/R and EMLinvF/R revealed that some short and long repeats are contiguous in the same tandem array. This is the first report of the coexistence of two variable spacers in the same tandem array in bivalve mollusks.

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

PubMed

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Analysis of conserved noncoding DNA in Drosophila reveals similar constraints in intergenic and intronic sequences.

PubMed

Bergman, C M; Kreitman, M

2001-08-01

Comparative genomic approaches to gene and cis-regulatory prediction are based on the principle that differential DNA sequence conservation reflects variation in functional constraint. Using this principle, we analyze noncoding sequence conservation in Drosophila for 40 loci with known or suspected cis-regulatory function encompassing >100 kb of DNA. We estimate the fraction of noncoding DNA conserved in both intergenic and intronic regions and describe the length distribution of ungapped conserved noncoding blocks. On average, 22%-26% of noncoding sequences surveyed are conserved in Drosophila, with median block length approximately 19 bp. We show that point substitution in conserved noncoding blocks exhibits transition bias as well as lineage effects in base composition, and occurs more than an order of magnitude more frequently than insertion/deletion (indel) substitution. Overall, patterns of noncoding DNA structure and evolution differ remarkably little between intergenic and intronic conserved blocks, suggesting that the effects of transcription per se contribute minimally to the constraints operating on these sequences. The results of this study have implications for the development of alignment and prediction algorithms specific to noncoding DNA, as well as for models of cis-regulatory DNA sequence evolution.

Constructing and detecting a cDNA library for mites.

PubMed

Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

2015-10-01

RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

The chloroplast and mitochondrial genome sequences of the charophyte Chaetosphaeridium globosum: Insights into the timing of the events that restructured organelle DNAs within the green algal lineage that led to land plants

PubMed Central

Turmel, Monique; Otis, Christian; Lemieux, Claude

2002-01-01

The land plants and their immediate green algal ancestors, the charophytes, form the Streptophyta. There is evidence that both the chloroplast DNA (cpDNA) and mitochondrial DNA (mtDNA) underwent substantial changes in their architecture (intron insertions, gene losses, scrambling in gene order, and genome expansion in the case of mtDNA) during the evolution of streptophytes; however, because no charophyte organelle DNAs have been sequenced completely thus far, the suite of events that shaped streptophyte organelle genomes remains largely unknown. Here, we have determined the complete cpDNA (131,183 bp) and mtDNA (56,574 bp) sequences of the charophyte Chaetosphaeridium globosum (Coleochaetales). At the levels of gene content (124 genes), intron composition (18 introns), and gene order, Chaetosphaeridium cpDNA is remarkably similar to land-plant cpDNAs, implying that most of the features characteristic of land-plant lineages were gained during the evolution of charophytes. Although the gene content of Chaetosphaeridium mtDNA (67 genes) closely resembles that of the bryophyte Marchantia polymorpha (69 genes), this charophyte mtDNA differs substantially from its land-plant relatives at the levels of size, intron composition (11 introns), and gene order. Our finding that it shares only one intron with its land-plant counterparts supports the idea that the vast majority of mitochondrial introns in land plants appeared after the emergence of these organisms. Our results also suggest that the events accounting for the spacious intergenic spacers found in land-plant mtDNAs took place late during the evolution of charophytes or coincided with the transition from charophytes to land plants. PMID:12161560

Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.

PubMed

Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B

1997-06-05

We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.

Complement component 3: characterization and association with mastitis resistance in Egyptian water buffalo and cattle.

PubMed

El-Halawany, Nermin; Abd-El-Monsif, Shawky A; Al-Tohamy Ahmed, F M; Hegazy, Lamees; Abdel-Shafy, Hamdy; Abdel-Latif, Magdy A; Ghazi, Yasser A; Neuhoff, Christiane; Salilew-Wondim, Dessie; Schellander, Karl

2017-03-01

Mastitis is an infectious disease of the mammary gland that leads to reduced milk production and change in milk composition. Complement component C3 plays a major role as a central molecule of the complement cascade involving in killing of microorganisms, either directly or in cooperation with phagocytic cells. C3 cDNA were isolated, from Egyptian buffalo and cattle, sequenced and characterized. The C3 cDNA sequences of buffalo and cattle consist of 5025 and 5019 bp, respectively. Buffalo and cattle C3 cDNAs share 99% of sequence identity with each other. The 4986 bp open reading frame in buffalo encodes a putative protein of 1661 amino acids-as in cattle-and includes all the functional domains. Further, analysis of the C3 cDNA sequences detected six novel single-nucleotide polymorphisms (SNPs) in buffalo and three novel SNPs in cattle. The association analysis of the detected SNPs with milk somatic cell score as an indicator of mastitis revealed that the most significant association in buffalo was found in the C>A substitution (ss: 1752816097) in exon 27, whereas in cattle it was in the C>T substitution (ss: 1752816085) in exon 12. Our findings provide preliminary information about the contribution of C3 polymorphisms to mastitis resistance in buffalo and cattle.

High-resolution phylogeography of zoonotic tapeworm Echinococcus granulosus sensu stricto genotype G1 with an emphasis on its distribution in Turkey, Italy and Spain.

PubMed

Kinkar, Liina; Laurimäe, Teivi; Simsek, Sami; Balkaya, Ibrahim; Casulli, Adriano; Manfredi, Maria Teresa; Ponce-Gordo, Francisco; Varcasia, Antonio; Lavikainen, Antti; González, Luis Miguel; Rehbein, Steffen; VAN DER Giessen, Joke; Sprong, Hein; Saarma, Urmas

2016-11-01

Echinococcus granulosus is the causative agent of cystic echinococcosis. The disease is a significant global public health concern and human infections are most commonly associated with E. granulosus sensu stricto (s. s.) genotype G1. The objectives of this study were to: (i) analyse the genetic variation and phylogeography of E. granulosus s. s. G1 in part of its main distribution range in Europe using 8274 bp of mtDNA; (ii) compare the results with those derived from previously used shorter mtDNA sequences and highlight the major differences. We sequenced a total of 91 E. granulosus s. s. G1 isolates from six different intermediate host species, including humans. The isolates originated from seven countries representing primarily Turkey, Italy and Spain. Few samples were also from Albania, Greece, Romania and from a patient originating from Algeria, but diagnosed in Finland. The analysed 91 sequences were divided into 83 haplotypes, revealing complex phylogeography and high genetic variation of E. granulosus s. s. G1 in Europe, particularly in the high-diversity domestication centre of western Asia. Comparisons with shorter mtDNA datasets revealed that 8274 bp sequences provided significantly higher phylogenetic resolution and thus more power to reveal the genetic relations between different haplotypes.

ITS2 as a molecular marker for the identification of Diatraea saccharalis and D. flavipennella and possible infection with Cotesia spp.

PubMed

Neto, M S Regueira; Barros, R P; Morais, M A J; Balbino, V Q; Loreto, V

2017-08-31

In Brazil, the species Diatraea flavipennella and D. saccharalis play an important role in the sugar and alcohol agribusiness by causing many damages in sugarcane fields. The egg, larva, pupa, and adult stages are very morphologically similar between these species, and the identification can be confused. The internal transcribed spacer 2 (ITS 2) from ribosomal DNA has important features as evolutionary divergence. It is a good marker for species identification, participates in the rDNA processing, and has been applied in phylogenetic and population studies. This study aimed to make available a molecular marker to assist on the identification method of pests' species of Diatraea and to identify possible traces of Cotesia in the resistant host. The DNA was extracted from the egg, larva, and adult samples. PCR amplicons were purified and sequenced. The sequences were analyzed in MEGA 5.01. The ITS 2 length was 410 bp in D. flavipennella and 448 bp in D. saccharalis. The GC content was similar between the species. Three microsatellite loci were present in D. saccharalis and absent in D. flavipennella, contributing to differences in ITS 2 length in the species. An additional 367-bp band was attributed to Cotesia spp. The differences among ITS 2 from D. flavipennella, D. saccharalis, and Cotesia sp were sufficient to identify them on electrophoresis gel and sequencing. The presence of Cotesia sp traits in adult D. flavipennella showed possible host refractoriness, but further studies are necessary.

The ura5 gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli.

PubMed

Le Chevanton, L; Leblon, G

1989-04-15

We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.

A study of the CCG polymorphism in the IT15 cDNA in the Scottish Huntington`s disease and normal populations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barron, L.H.; Rae, A.; Brock, D.J.H.

1994-09-01

The CCG rich sequence immediately 3{prime} to the CAG repeat that is expanded in Huntington`s disease (HD) has recently been shown to be polymorphic with at least 5 alleles differing by multiples of 3 bp being found in the normal population. We have studied the allele distribution in 200 Scottish HD families and have found very strong evidence for almost complete disequilibrium in this population. For all the families phase was unambiguously determined and 196 were shown to have a CCG repeat allele of 176 bp cosegregating with the HD chromosome. This observation is significantly different to the normal populationmore » distribution where 31% of people have an allele of 185 bp. This overrepresentation of the 176 bp allele is also seen in the normal population on chromosomes with greater than 26 CAG repeats. The DNA sequence across the CAG and CCG repeats has been obtained for the four HD patients that do not have a 176 bp CCG repeat size and will be presented. We present strong evidence of genetic heterogeneity in the Scottish HD population making it very unlikely that there is a founder effect in the Scottish HD population. These data suggest that we may have identified a region of the IT15 gene that is critical in the mechanism of Huntington`s disease CAG expansion.« less

The full mitochondrial genome sequence of Raillietina tetragona from chicken (Cestoda: Davaineidae).

PubMed

Liang, Jian-Ying; Lin, Rui-Qing

2016-11-01

In the present study, the complete mitochondrial DNA (mtDNA) sequence of Raillietina tetragona was sequenced and its gene contents and genome organizations was compared with that of other tapeworm. The complete mt genome sequence of R. tetragona is 14,444 bp in length. It contains 12 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and two non-coding region. All genes are transcribed in the same direction and have a nucleotide composition high in A and T. The contents of A + T of the complete mt genome are 71.4% for R. tetragona. The R. tetragona mt genome sequence provides novel mtDNA marker for studying the molecular epidemiology and population genetics of Raillietina and has implications for the molecular diagnosis of chicken cestodosis caused by Raillietina.

The complete genome sequence and proteomics of Yersinia pestis phage Yep-phi.

PubMed

Zhao, Xiangna; Wu, Weili; Qi, Zhizhen; Cui, Yujun; Yan, Yanfeng; Guo, Zhaobiao; Wang, Zuyun; Wang, Hu; Deng, Haijun; Xue, Yan; Chen, Weijun; Wang, Xiaoyi; Yang, Ruifu

2011-01-01

Yep-phi, a lytic phage of Yersinia pestis, was isolated in China and is routinely used as a diagnostic phage for the identification of the plague pathogen. Yep-phi has an isometric hexagonal head containing dsDNA and a short non-contractile conical tail. In this study, we sequenced the Yep-phi genome (GenBank accession no. HQ333270) and performed proteomics analysis. The genome consists of 38 ,616 bp of DNA, including direct terminal repeats of 222 bp, and is predicted to contain 45 ORFs. Most structural proteins were identified by proteomics analysis. Compared with the three available genome sequences of lytic phages for Y. pestis, the phages could be divided into two subgroups. Yep-phi displays marked homology to the bacteriophages Berlin (GenBank accession no. AM183667) and Yepe2 (GenBank accession no. EU734170), and these comprise one subgroup. The other subgroup is represented by bacteriophage ΦA1122 (GenBank accession no. AY247822). Potential recombination was detected among the Yep-phi subgroup.

First complete genome sequence of infectious laryngotracheitis virus

PubMed Central

2011-01-01

Background Infectious laryngotracheitis virus (ILTV) is an alphaherpesvirus that causes acute respiratory disease in chickens worldwide. To date, only one complete genomic sequence of ILTV has been reported. This sequence was generated by concatenating partial sequences from six different ILTV strains. Thus, the full genomic sequence of a single (individual) strain of ILTV has not been determined previously. This study aimed to use high throughput sequencing technology to determine the complete genomic sequence of a live attenuated vaccine strain of ILTV. Results The complete genomic sequence of the Serva vaccine strain of ILTV was determined, annotated and compared to the concatenated ILTV reference sequence. The genome size of the Serva strain was 152,628 bp, with a G + C content of 48%. A total of 80 predicted open reading frames were identified. The Serva strain had 96.5% DNA sequence identity with the concatenated ILTV sequence. Notably, the concatenated ILTV sequence was found to lack four large regions of sequence, including 528 bp and 594 bp of sequence in the UL29 and UL36 genes, respectively, and two copies of a 1,563 bp sequence in the repeat regions. Considerable differences in the size of the predicted translation products of 4 other genes (UL54, UL30, UL37 and UL38) were also identified. More than 530 single-nucleotide polymorphisms (SNPs) were identified. Most SNPs were located within three genomic regions, corresponding to sequence from the SA-2 ILTV vaccine strain in the concatenated ILTV sequence. Conclusions This is the first complete genomic sequence of an individual ILTV strain. This sequence will facilitate future comparative genomic studies of ILTV by providing an appropriate reference sequence for the sequence analysis of other ILTV strains. PMID:21501528

Is plant mitochondrial RNA editing a source of phylogenetic incongruence? An answer from in silico and in vivo data sets.

PubMed

Picardi, Ernesto; Quagliariello, Carla

2008-03-26

In plant mitochondria, the post-transcriptional RNA editing process converts C to U at a number of specific sites of the mRNA sequence and usually restores phylogenetically conserved codons and the encoded amino acid residues. Sites undergoing RNA editing evolve at a higher rate than sites not modified by the process. As a result, editing sites strongly affect the evolution of plant mitochondrial genomes, representing an important source of sequence variability and potentially informative characters. To date no clear and convincing evidence has established whether or not editing sites really affect the topology of reconstructed phylogenetic trees. For this reason, we investigated here the effect of RNA editing on the tree building process of twenty different plant mitochondrial gene sequences and by means of computer simulations. Based on our simulation study we suggest that the editing 'noise' in tree topology inference is mainly manifested at the cDNA level. In particular, editing sites tend to confuse tree topologies when artificial genomic and cDNA sequences are generated shorter than 500 bp and with an editing percentage higher than 5.0%. Similar results have been also obtained with genuine plant mitochondrial genes. In this latter instance, indeed, the topology incongruence increases when the editing percentage goes up from about 3.0 to 14.0%. However, when the average gene length is higher than 1,000 bp (rps3, matR and atp1) no differences in the comparison between inferred genomic and cDNA topologies could be detected. Our findings by the here reported in silico and in vivo computer simulation system seem to strongly suggest that editing sites contribute in the generation of misleading phylogenetic trees if the analyzed mitochondrial gene sequence is highly edited (higher than 3.0%) and reduced in length (shorter than 500 bp). In the current lack of direct experimental evidence the results presented here encourage, thus, the use of genomic mitochondrial rather than cDNA sequences for reconstructing phylogenetic events in land plants.

Swine and Poultry Pathogens: the Complete Genome Sequences of Two Strains of Mycoplasma hyopneumoniae and a Strain of Mycoplasma synoviae†

PubMed Central

Vasconcelos, Ana Tereza R.; Ferreira, Henrique B.; Bizarro, Cristiano V.; Bonatto, Sandro L.; Carvalho, Marcos O.; Pinto, Paulo M.; Almeida, Darcy F.; Almeida, Luiz G. P.; Almeida, Rosana; Alves-Filho, Leonardo; Assunção, Enedina N.; Azevedo, Vasco A. C.; Bogo, Maurício R.; Brigido, Marcelo M.; Brocchi, Marcelo; Burity, Helio A.; Camargo, Anamaria A.; Camargo, Sandro S.; Carepo, Marta S.; Carraro, Dirce M.; de Mattos Cascardo, Júlio C.; Castro, Luiza A.; Cavalcanti, Gisele; Chemale, Gustavo; Collevatti, Rosane G.; Cunha, Cristina W.; Dallagiovanna, Bruno; Dambrós, Bibiana P.; Dellagostin, Odir A.; Falcão, Clarissa; Fantinatti-Garboggini, Fabiana; Felipe, Maria S. S.; Fiorentin, Laurimar; Franco, Gloria R.; Freitas, Nara S. A.; Frías, Diego; Grangeiro, Thalles B.; Grisard, Edmundo C.; Guimarães, Claudia T.; Hungria, Mariangela; Jardim, Sílvia N.; Krieger, Marco A.; Laurino, Jomar P.; Lima, Lucymara F. A.; Lopes, Maryellen I.; Loreto, Élgion L. S.; Madeira, Humberto M. F.; Manfio, Gilson P.; Maranhão, Andrea Q.; Martinkovics, Christyanne T.; Medeiros, Sílvia R. B.; Moreira, Miguel A. M.; Neiva, Márcia; Ramalho-Neto, Cicero E.; Nicolás, Marisa F.; Oliveira, Sergio C.; Paixão, Roger F. C.; Pedrosa, Fábio O.; Pena, Sérgio D. J.; Pereira, Maristela; Pereira-Ferrari, Lilian; Piffer, Itamar; Pinto, Luciano S.; Potrich, Deise P.; Salim, Anna C. M.; Santos, Fabrício R.; Schmitt, Renata; Schneider, Maria P. C.; Schrank, Augusto; Schrank, Irene S.; Schuck, Adriana F.; Seuanez, Hector N.; Silva, Denise W.; Silva, Rosane; Silva, Sérgio C.; Soares, Célia M. A.; Souza, Kelly R. L.; Souza, Rangel C.; Staats, Charley C.; Steffens, Maria B. R.; Teixeira, Santuza M. R.; Urmenyi, Turan P.; Vainstein, Marilene H.; Zuccherato, Luciana W.; Simpson, Andrew J. G.; Zaha, Arnaldo

2005-01-01

This work reports the results of analyses of three complete mycoplasma genomes, a pathogenic (7448) and a nonpathogenic (J) strain of the swine pathogen Mycoplasma hyopneumoniae and a strain of the avian pathogen Mycoplasma synoviae; the genome sizes of the three strains were 920,079 bp, 897,405 bp, and 799,476 bp, respectively. These genomes were compared with other sequenced mycoplasma genomes reported in the literature to examine several aspects of mycoplasma evolution. Strain-specific regions, including integrative and conjugal elements, and genome rearrangements and alterations in adhesin sequences were observed in the M. hyopneumoniae strains, and all of these were potentially related to pathogenicity. Genomic comparisons revealed that reduction in genome size implied loss of redundant metabolic pathways, with maintenance of alternative routes in different species. Horizontal gene transfer was consistently observed between M. synoviae and Mycoplasma gallisepticum. Our analyses indicated a likely transfer event of hemagglutinin-coding DNA sequences from M. gallisepticum to M. synoviae. PMID:16077101

Compilation of DNA sequences of Escherichia coli (update 1991)

PubMed Central

Kröger, Manfred; Wahl, Ralf; Rice, Peter

1991-01-01

We have compiled the DNA sequence data for E.coli available from the GENBANK and EMBL data libraries and over a period of several years independently from the literature. This is the third listing replacing and increasing the former listing roughly by one fifth. However, in order to save space this printed version contains DNA sequence information only. The complete compilation is now available in machine readable form from the EMBL data library (ECD release 6). After deletion of all detected overlaps a total of 1 492 282 individual bp is found to be determined till the beginning of 1991. This corresponds to a total of 31.62% of the entire E.coli chromosome consisting of about 4,720 kbp. This number may actually be higher by some extra 2,5% derived from lysogenic bacteriophage lambda and various DNA sequences already received for statistical purposes only. PMID:2041799

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

NASA Astrophysics Data System (ADS)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Gating electrical transport through DNA molecules that bridge between silicon nanogaps.

PubMed

Takagi, Shogo; Takada, Tadao; Matsuo, Naoto; Yokoyama, Shin; Nakamura, Mitsunobu; Yamana, Kazushige

2012-03-21

DNA electronic devices were prepared on silicon-based three-terminal electrodes. Both ends of DNA molecules (400 bp long, mixed sequences) were bridged via chemical bonds between the source-drain nanogap (120 nm) electrodes. S-Shaped I-V curves were obtained and the electric current can be modulated by the gate voltage. The DNA molecules act as semiconducting p-type nanowires in the three-terminal device. This journal is © The Royal Society of Chemistry 2012

Stabilization of perfect and imperfect tandem repeats by single-strand DNA exonucleases

PubMed Central

Feschenko, Vladimir V.; Rajman, Luis A.; Lovett, Susan T.

2003-01-01

Rearrangements between tandemly repeated DNA sequences are a common source of genetic instability. Such rearrangements underlie several human genetic diseases. In many organisms, the mismatch-repair (MMR) system functions to stabilize repeats when the repeat unit is short or when sequence imperfections are present between the repeats. We show here that the action of single-stranded DNA (ssDNA) exonucleases plays an additional, important role in stabilizing tandem repeats, independent of their role in MMR. For perfect repeats of ≈100 bp in Escherichia coli that are not susceptible to MMR, exonuclease (Exo)-I, ExoX, and RecJ exonuclease redundantly inhibit deletion. Our data suggest that >90% of potential deletion events are avoided by the combined action of these three exonucleases. Imperfect tandem repeats, less prone to rearrangements, are stabilized by both the MMR-pathway and ssDNA-specific exonucleases. For 100-bp repeats containing four mispairs, ExoI alone aborts most deletion events, even in the presence of a functional MMR system. By genetic analysis, we show that the inhibitory effect of ssDNA exonucleases on deletion formation is independent of the MutS and UvrD proteins. Exonuclease degradation of DNA displaced during the deletion process may abort slipped misalignment. Exonuclease action is therefore a significant force in genetic stabilization of many forms of repetitive DNA. PMID:12538867

DNA sequence polymorphism within the bovine adenosine monophosphate deaminase 1 (AMPD1) is associated with production traits in Chinese cattle.

PubMed

Wei, C-B; Wang, J-Q; Chen, F-Y; Niu, H; Li, K

2015-02-06

The objectives of the present study were to detect an 18-bp deletion mutation in the bovine adenosine monophosphate deaminase 1 (AMPD1) gene and analyze its effect on growth traits in 2 Chinese cattle breeds using DNA sequencing and agarose electrophoresis. The five 19-bp polymerase chain reaction products of the AMPD1 gene exhibited 3 genotypes and 2 alleles: WW: homozygote genotype (wild-type); DD: homozygote genotype (mutant-type); WD: heterozygote genotype. Frequencies of the W allele varied from 66.15-70.35%. The associations between the 18-bp deletion mutation in the AMPD1 gene with production traits in 226 Jia-Xian red cattle was analyzed. The animals with genotype WW showed significantly higher heart girth and body weight than those with genotypes WD and DD at 24 months (P < 0.01). Our results indicate that the deletion mutation in the AMPD1 gene is associated with production traits, and may be used for marker-assisted selection in beef cattle breeding programs.

Legionella busanensis sp. nov., isolated from cooling tower water in Korea.

PubMed

Park, Mi-Yeoun; Ko, Kwan Soo; Lee, Hae Kyung; Park, Man-Suk; Kook, Yoon-Hoh

2003-01-01

Three Legionella-like micro-organisms, isolated from cooling tower water of a building in Busan, Korea, were characterized by a variety of biochemical and molecular phylogenetic tests. Analyses of whole-cell fatty acids and results of biochemical tests revealed that these three isolates are distinct from previously described Legionella species. Furthermore, results of comparative analyses of 16S rDNA (1476-1488 bp), mip (408 bp) and rpoB (300 bp) sequences also confirmed that these strains represent a novel species within the genus Legionella. The 16S rDNA sequences of the three Korean isolates had similarities of less than 95.8% to other Legionella species. Phylogenetic trees formed by analysis of the 16S rRNA, rpoB and mip genes revealed that the isolates formed a distinct cluster within the genus Legionella. Based on the evaluated phenotypic and phylogenetic characteristics, it is proposed that these Korean isolates from water be classified as a novel species, Legionella busanensis sp. nov.; the type strain is strain K9951T (=KCTC 12084T =ATCC BAA-518T).

The nucleotide sequence of the entire ribosomal DNA operon and the structure of the large subunit rRNA of Giardia muris.

PubMed

van Keulen, H; Gutell, R R; Campbell, S R; Erlandsen, S L; Jarroll, E L

1992-10-01

The total nucleotide sequence of the rDNA of Giardia muris, an intestinal protozoan parasite of rodents, has been determined. The repeat unit is 7668 basepairs (bp) in size and consists of a spacer of 3314 bp, a small-subunit rRNA (SSU-rRNA) gene of 1429, and a large-subunit rRNA (LSU-rRNA) gene of 2698 bp. The spacer contains long direct repeats and is heterogeneous in size. The LSU-rRNA of G. muris was compared to that of the human intestinal parasite Giardia duodenalis, to the bird parasite Giardia ardeae, and to that of Escherichia coli. The LSU-rRNA has a size comparable to the 23S rRNA of E. coli but shows structural features typical for eukaryotes. Some variable regions are typically small and account for the overall smaller size of this rRNA. The structure of the G. muris LSU-rRNA is similar to that of the other Giardia rRNA, but each rRNA has characteristic features residing in a number of variable regions.

Characterization of B-1, 3-glucanase gene in peanut (Arachis hypogaea L.) by cloning and genetic transformation

USDA-ARS?s Scientific Manuscript database

Plant ß-1,3-glucanase is commonly found to be involved in the disease resistance. A ß-1,3-glucanase gene was isolated from both the genomic DNA and cDNA of peanut variety Huayu20 by PCR and RT-PCR, respectively (GenBank Accession No. JQ801335). The genomic DNA sequence was 1,471 bp including two ext...

Inducible in vivo DNA footprints define sequences necessary for UV light activation of the parsley chalcone synthase gene.

PubMed Central

Schulze-Lefert, P; Dangl, J L; Becker-André, M; Hahlbrock, K; Schulz, W

1989-01-01

We began characterization of the protein--DNA interactions necessary for UV light induced transcriptional activation of the gene encoding chalcone synthase (CHS), a key plant defense enzyme. Three light dependent in vivo footprints appear on a 90 bp stretch of the CHS promoter with a time course correlated with the onset of CHS transcription. We define a minimal light responsive promoter by functional analysis of truncated CHS promoter fusions with a reporter gene in transient expression experiments in parsley protoplasts. Two of the three footprinted sequence 'boxes' reside within the minimal promoter. Replacement of 10 bp within either of these 'boxes' leads to complete loss of light responsiveness. We conclude that these sequences define the necessary cis elements of the minimal CHS promoter's light responsive element. One of the functionally defined 'boxes' is homologous to an element implicated in regulation of genes involved in photosynthesis. These data represent the first example in a plant defense gene of an induced change in protein--DNA contacts necessary for transcriptional activation. Also, our data argue strongly that divergent light induced biosynthetic pathways share common regulatory units. Images PMID:2566481

Molecular Cloning of an Immunogenic Protein of Baylisascaris procyonis and Expression in Escherichia coli for Use in Developing Improved Serodiagnostic Assays▿

PubMed Central

Dangoudoubiyam, Sriveny; Vemulapalli, Ramesh; Hancock, Kathy; Kazacos, Kevin R.

2010-01-01

Larva migrans caused by Baylisascaris procyonis is an important zoonotic disease. Current serological diagnostic assays for this disease depend on the use of the parasite's larval excretory-secretory (ES) antigens. In order to identify genes encoding ES antigens and to generate recombinant antigens for use in diagnostic assays, construction and immunoscreening of a B. procyonis third-stage larva cDNA expression library was performed and resulted in identification of a partial-length cDNA clone encoding an ES antigen, designated repeat antigen 1 (RAG1). The full-length rag1 cDNA contained a 753-bp open reading frame that encoded a protein of 250 amino acids with 12 tandem repeats of a 12-amino-acid long sequence. The rag1 genomic DNA revealed a single intron of 837 bp that separated the 753-bp coding sequence into two exons delimited by canonical splice sites. No nucleotide or amino acid sequences present in the GenBank databases had significant similarity with those of RAG1. We have cloned, expressed, and purified the recombinant RAG1 (rRAG1) and analyzed its diagnostic potential by enzyme-linked immunosorbent assay. Anti-Baylisascaris species-specific rabbit serum showed strong reactivity to rRAG1, while only minimal to no reactivity was observed with sera against the related ascarids Toxocara canis and Ascaris suum, strongly suggesting the specificity of rRAG1. On the basis of these results, the identified RAG1 appears to be a promising diagnostic antigen for the development of serological assays for specific detection of B. procyonis larva migrans. PMID:20926699

Sequence analysis of the genome of carnation (Dianthus caryophyllus L.).

PubMed

Yagi, Masafumi; Kosugi, Shunichi; Hirakawa, Hideki; Ohmiya, Akemi; Tanase, Koji; Harada, Taro; Kishimoto, Kyutaro; Nakayama, Masayoshi; Ichimura, Kazuo; Onozaki, Takashi; Yamaguchi, Hiroyasu; Sasaki, Nobuhiro; Miyahara, Taira; Nishizaki, Yuzo; Ozeki, Yoshihiro; Nakamura, Noriko; Suzuki, Takamasa; Tanaka, Yoshikazu; Sato, Shusei; Shirasawa, Kenta; Isobe, Sachiko; Miyamura, Yoshinori; Watanabe, Akiko; Nakayama, Shinobu; Kishida, Yoshie; Kohara, Mitsuyo; Tabata, Satoshi

2014-06-01

The whole-genome sequence of carnation (Dianthus caryophyllus L.) cv. 'Francesco' was determined using a combination of different new-generation multiplex sequencing platforms. The total length of the non-redundant sequences was 568,887,315 bp, consisting of 45,088 scaffolds, which covered 91% of the 622 Mb carnation genome estimated by k-mer analysis. The N50 values of contigs and scaffolds were 16,644 bp and 60,737 bp, respectively, and the longest scaffold was 1,287,144 bp. The average GC content of the contig sequences was 36%. A total of 1050, 13, 92 and 143 genes for tRNAs, rRNAs, snoRNA and miRNA, respectively, were identified in the assembled genomic sequences. For protein-encoding genes, 43 266 complete and partial gene structures excluding those in transposable elements were deduced. Gene coverage was ∼ 98%, as deduced from the coverage of the core eukaryotic genes. Intensive characterization of the assigned carnation genes and comparison with those of other plant species revealed characteristic features of the carnation genome. The results of this study will serve as a valuable resource for fundamental and applied research of carnation, especially for breeding new carnation varieties. Further information on the genomic sequences is available at http://carnation.kazusa.or.jp. © The Author 2013. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Cloning and characterization of the gene encoding the endopolygalacturonase-inhibiting protein (PGIP) of Phaseolus vulgaris L.

PubMed

Toubart, P; Desiderio, A; Salvi, G; Cervone, F; Daroda, L; De Lorenzo, G

1992-05-01

Polygalacturonase-inhibiting protein (PGIP) is a cell wall protein purified from hypocotyls of true bean (Phaseolus vulgaris L.). PGIP inhibits fungal endopolygalacturonases and is considered to be an important factor for plant resistance to phytopathogenic fungi (Albersheim and Anderson, 1971; Cervone et al., 1987). The amino acid sequences of the N-terminus and one internal tryptic peptide of the PGIP purified from P. vulgaris cv. Pinto were used to design redundant oligonucleotides that were successfully utilized as primers in a polymerase chain reaction (PCR) with total DNA of P. vulgaris as a template. A DNA band of 758 bp (a specific PCR amplification product of part of the gene coding for PGIP) was isolated and cloned. By using the 758-bp DNA as a hybridization probe, a lambda clone containing the PGIP gene was isolated from a genomic library of P. vulgaris cv. Saxa. The coding and immediate flanking regions of the PGIP gene, contained on a subcloned 3.3 kb SalI-SalI DNA fragment, were sequenced. A single, continuous ORF of 1026 nt (342 amino acids) was present in the genomic clone. The nucleotide and deduced amino acid sequences of the PGIP gene showed no significant similarity with any known databank sequence. Northern blotting analysis of poly(A)+ RNAs, isolated from various tissues of bean seedlings or from suspension-cultured bean cells, were also performed using the cloned PCR-generated DNA as a probe. A 1.2 kb transcript was detected in suspension-cultured cells and, to a lesser extent, in leaves, hypocotyls, and flowers.(ABSTRACT TRUNCATED AT 250 WORDS)

Re-examination of population structure and phylogeography of hawksbill turtles in the wider Caribbean using longer mtDNA sequences.

PubMed

Leroux, Robin A; Dutton, Peter H; Abreu-Grobois, F Alberto; Lagueux, Cynthia J; Campbell, Cathi L; Delcroix, Eric; Chevalier, Johan; Horrocks, Julia A; Hillis-Starr, Zandy; Troëng, Sebastian; Harrison, Emma; Stapleton, Seth

2012-01-01

Management of the critically endangered hawksbill turtle in the Wider Caribbean (WC) has been hampered by knowledge gaps regarding stock structure. We carried out a comprehensive stock structure re-assessment of 11 WC hawksbill rookeries using longer mtDNA sequences, larger sample sizes (N = 647), and additional rookeries compared to previous surveys. Additional variation detected by 740 bp sequences between populations allowed us to differentiate populations such as Barbados-Windward and Guadeloupe (F (st) = 0.683, P < 0.05) that appeared genetically indistinguishable based on shorter 380 bp sequences. POWSIM analysis showed that longer sequences improved power to detect population structure and that when N < 30, increasing the variation detected was as effective in increasing power as increasing sample size. Geographic patterns of genetic variation suggest a model of periodic long-distance colonization coupled with region-wide dispersal and subsequent secondary contact within the WC. Mismatch analysis results for individual clades suggest a general population expansion in the WC following a historic bottleneck about 100 000-300 000 years ago. We estimated an effective female population size (N (ef)) of 6000-9000 for the WC, similar to the current estimated numbers of breeding females, highlighting the importance of these regional rookeries to maintaining genetic diversity in hawksbills. Our results provide a basis for standardizing future work to 740 bp sequence reads and establish a more complete baseline for determining stock boundaries in this migratory marine species. Finally, our findings illustrate the value of maintaining an archive of specimens for re-analysis as new markers become available.

Divergence in centromere structure distinguishes related genomes in Coix lacryma-jobi and its wild relative.

PubMed

Han, Yonghua; Wang, Guixiang; Liu, Zhao; Liu, Jinhua; Yue, Wei; Song, Rentao; Zhang, Xueyong; Jin, Weiwei

2010-02-01

Knowledge about the composition and structure of centromeres is critical for understanding how centromeres perform their functional roles. Here, we report the sequences of one centromere-associated bacterial artificial chromosome clone from a Coix lacryma-jobi library. Two Ty3/gypsy-class retrotransposons, centromeric retrotransposon of C. lacryma-jobi (CRC) and peri-centromeric retrotransposon of C. lacryma-jobi, and a (peri)centromere-specific tandem repeat with a unit length of 153 bp were identified. The CRC is highly homologous to centromere-specific retrotransposons reported in grass species. An 80-bp DNA region in the 153-bp satellite repeat was found to be conserved to centromeric satellite repeats from maize, rice, and pearl millet. Fluorescence in situ hybridization showed that the three repetitive sequences were located in (peri-)centromeric regions of both C. lacryma-jobi and Coix aquatica. However, the 153-bp satellite repeat was only detected on 20 out of the 30 chromosomes in C. aquatica. Immunostaining with an antibody against rice CENH3 indicates that the 153-bp satellite repeat and CRC might be both the major components for functional centromeres, but not all the 153-bp satellite repeats or CRC sequences are associated with CENH3. The evolution of centromeric repeats of C. lacryma-jobi during the polyploidization was discussed.

The genome of Brucella melitensis.

PubMed

DelVecchio, Vito G; Kapatral, Vinayak; Elzer, Philip; Patra, Guy; Mujer, Cesar V

2002-12-20

The genome of Brucella melitensis strain 16M was sequenced and contained 3,294,931 bp distributed over two circular chromosomes. Chromosome I was composed of 2,117,144 bp and chromosome II has 1,177,787 bp. A total of 3,198 ORFs were predicted. The origins of replication of the chromosomes are similar to each other and to those of other alpha-proteobacteria. Housekeeping genes such as those that encode for DNA replication, protein synthesis, core metabolism, and cell-wall biosynthesis were found on both chromosomes. Genes encoding adhesins, invasins, and hemolysins were also identified.

Binding site size limit of the 2:1 pyrrole-imidazole polyamide-DNA motif.

PubMed Central

Kelly, J J; Baird, E E; Dervan, P B

1996-01-01

Polyamides containing N-methylimidazole (Im) and N-methylpyrrole (Py) amino acids can be combined in antiparallel side-by-side dimeric complexes for sequence-specific recognition in the minor groove of DNA. Six polyamides containing three to eight rings bind DNA sites 5-10 bp in length, respectively. Quantitative DNase I footprint titration experiments demonstrate that affinity maximizes and is similar at ring sizes of five, six, and seven. Sequence specificity decreases as the length of the polyamides increases beyond five rings. These results provide useful guidelines for the design of new polyamides that bind longer DNA sites with enhanced affinity and specificity. Images Fig. 4 PMID:8692930

Droplet-based pyrosequencing using digital microfluidics.

PubMed

Boles, Deborah J; Benton, Jonathan L; Siew, Germaine J; Levy, Miriam H; Thwar, Prasanna K; Sandahl, Melissa A; Rouse, Jeremy L; Perkins, Lisa C; Sudarsan, Arjun P; Jalili, Roxana; Pamula, Vamsee K; Srinivasan, Vijay; Fair, Richard B; Griffin, Peter B; Eckhardt, Allen E; Pollack, Michael G

2011-11-15

The feasibility of implementing pyrosequencing chemistry within droplets using electrowetting-based digital microfluidics is reported. An array of electrodes patterned on a printed-circuit board was used to control the formation, transportation, merging, mixing, and splitting of submicroliter-sized droplets contained within an oil-filled chamber. A three-enzyme pyrosequencing protocol was implemented in which individual droplets contained enzymes, deoxyribonucleotide triphosphates (dNTPs), and DNA templates. The DNA templates were anchored to magnetic beads which enabled them to be thoroughly washed between nucleotide additions. Reagents and protocols were optimized to maximize signal over background, linearity of response, cycle efficiency, and wash efficiency. As an initial demonstration of feasibility, a portion of a 229 bp Candida parapsilosis template was sequenced using both a de novo protocol and a resequencing protocol. The resequencing protocol generated over 60 bp of sequence with 100% sequence accuracy based on raw pyrogram levels. Excellent linearity was observed for all of the homopolymers (two, three, or four nucleotides) contained in the C. parapsilosis sequence. With improvements in microfluidic design it is expected that longer reads, higher throughput, and improved process integration (i.e., "sample-to-sequence" capability) could eventually be achieved using this low-cost platform.

Molecular cloning, sequence analysis, prokaryotic expression, and function prediction of foot-specific peroxidase in Hydra magnipapillata Chinese strain.

PubMed

Pan, H C; Yang, H Q; Zhao, F X; Qian, X C

2014-08-28

The cDNA sequence of foot-specific peroxidase PPOD1 from the Chinese strain of Hydra magnipapillata was cloned by reverse transcription-polymerase chain reaction. The cDNA sequence contained a coding region with an 873-bp open reading frame, a 31-bp 5'-untranslated region, and a 36-bp 3'-untranslated region. The structure prediction results showed that PPOD1 contains 10.34% of α-helix, 38.62% of extended strand, 12.41% of β-turn, and 38.62% of random coil. The structural core was α-helix at the N terminus. The GenBank protein blast server showed that PPOD1 contains 2 fascin-like domains. In addition, high-level PPOD1 activity was only present in the ectodermal epithelial cells located on the edge of the adhesive face of the basal disc, and that these cells extended lamellipodia and filopodia when the basal disc was tightly attached to a glass slide. The fascin-like domains of Hydra PPOD1 might contribute to the bundling of the actin filament of these cells, and hence, the formation of filopodia. In conclusion, these cells might play an important role in strengthening the adsorbability of the basal disc to substrates.

Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

PubMed

Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

1997-12-01

A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

Structural analysis of two length variants of the rDNA intergenic spacer from Eruca sativa.

PubMed

Lakshmikumaran, M; Negi, M S

1994-03-01

Restriction enzyme analysis of the rRNA genes of Eruca sativa indicated the presence of many length variants within a single plant and also between different cultivars which is unusual for most crucifers studied so far. Two length variants of the rDNA intergenic spacer (IGS) from a single individual E. sativa (cv. Itsa) plant were cloned and characterized. The complete nucleotide sequences of both the variants (3 kb and 4 kb) were determined. The intergenic spacer contains three families of tandemly repeated DNA sequences denoted as A, B and C. However, the long (4 kb) variant shows the presence of an additional repeat, denoted as D, which is a duplication of a 224 bp sequence just upstream of the putative transcription initiation site. Repeat units belonging to the three different families (A, B and C) were in the size range of 22 to 30 bp. Such short repeat elements are present in the IGS of most of the crucifers analysed so far. Sequence analysis of the variants (3 kb and 4 kb) revealed that the length heterogeneity of the spacer is located at three different regions and is due to the varying copy numbers of repeat units belonging to families A and B. Length variation of the spacer is also due to the presence of a large duplication (D repeats) in the 4 kb variant which is absent in the 3 kb variant. The putative transcription initiation site was identified by comparisons with the rDNA sequences from other plant species.

Overexpression of the Lactobacillus plantarum peptidoglycan biosynthesis murA2 gene increases the tolerance of Escherichia coli to alcohols and enhances ethanol production.

PubMed

Yuan, Yongbo; Bi, Changhao; Nicolaou, Sergios A; Zingaro, Kyle A; Ralston, Matthew; Papoutsakis, Eleftherios T

2014-10-01

A major challenge in producing chemicals and biofuels is to increase the tolerance of the host organism to toxic products or byproducts. An Escherichia coli strain with superior ethanol and more generally alcohol tolerance was identified by screening a library constructed by randomly integrating Lactobacillus plantarum genomic DNA fragments into the E. coli chromosome via Cre-lox recombination. Sequencing identified the inserted DNA fragment as the murA2 gene and its upstream intergenic 973-bp sequence, both coded on the negative genomic DNA strand. Overexpression of this murA2 gene and its upstream 973-bp sequence significantly enhanced ethanol tolerance in both E. coli EC100 and wild type E. coli MG1655 strains by 4.1-fold and 2.0-fold compared to control strains, respectively. Tolerance to n-butanol and i-butanol in E. coli MG1655 was increased by 1.85-fold and 1.91-fold, respectively. We show that the intergenic 973-bp sequence contains a native promoter for the murA2 gene along with a long 5' UTR (286 nt) on the negative strand, while a noncoding, small RNA, named MurA2S, is expressed off the positive strand. MurA2S is expressed in E. coli and may interact with murA2, but it does not affect murA2's ability to enhance alcohol tolerance in E. coli. Overexpression of murA2 with its upstream region in the ethanologenic E. coli KO11 strain significantly improved ethanol production in cultures that simulate the industrial Melle-Boinot fermentation process.

Mini-midi-mito: adapting the amplification and sequencing strategy of mtDNA to the degradation state of crime scene samples.

PubMed

Berger, Cordula; Parson, Walther

2009-06-01

The degradation state of some biological traces recovered from the crime scene requires the amplification of very short fragments to attain a useful mitochondrial (mt)DNA sequence. We have previously introduced two mini-multiplex assays that amplify 10 overlapping control region (CR) fragments in two separate multiplex PCRs, which brought successful CR consensus sequences from even highly degraded DNA extracts. This procedure requires a total of 20 sequencing reactions per sample, which is laborious and cost intensive. For only moderately degraded samples that we encounter more frequently with typical mtDNA casework material, we developed two new multiplex assays that use a subset of the mini-amplicon primers but embrace larger fragments (midis) and require only 10 sequencing reactions to build a double-stranded CR consensus sequence. We used a preceding mtDNA quantitation step by real-time PCR with two different target fragments (143 and 283 bp) that roughly correspond to the average fragment sizes of the different multiplex approaches to estimate size-dependent mtDNA quantities and to aid the choice of the appropriate PCR multiplexes with respect to quality of the results and required costs.

A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences

NASA Technical Reports Server (NTRS)

Ho, P. S.; Ellison, M. J.; Quigley, G. J.; Rich, A.

1986-01-01

The ease with which a particular DNA segment adopts the left-handed Z-conformation depends largely on the sequence and on the degree of negative supercoiling to which it is subjected. We describe a computer program (Z-hunt) that is designed to search long sequences of naturally occurring DNA and retrieve those nucleotide combinations of up to 24 bp in length which show a strong propensity for Z-DNA formation. Incorporated into Z-hunt is a statistical mechanical model based on empirically determined energetic parameters for the B to Z transition accumulated to date. The Z-forming potential of a sequence is assessed by ranking its behavior as a function of negative superhelicity relative to the behavior of similar sized randomly generated nucleotide sequences assembled from over 80,000 combinations. The program makes it possible to compare directly the Z-forming potential of sequences with different base compositions and different sequence lengths. Using Z-hunt, we have analyzed the DNA sequences of the bacteriophage phi X174, plasmid pBR322, the animal virus SV40 and the replicative form of the eukaryotic adenovirus-2. The results are compared with those previously obtained by others from experiments designed to locate Z-DNA forming regions in these sequences using probes which show specificity for the left-handed DNA conformation.

Involvement of two genetic lineages of Sarcoptes scabiei mites in a local mange epizootic of wild mammals in Japan.

PubMed

Makouloutou, Patrice; Suzuki, Kazuo; Yokoyama, Mayumi; Takeuchi, Masahiko; Yanagida, Tetsuya; Sato, Hiroshi

2015-01-01

Similar to wild mammals on the continents, mange caused by the mange mite, Sarcoptes scabiei (Acari: Sarcoptidae) is spreading in wild mammals in most of Japan. We collected crusted or alopetic skin from 120 raccoon dogs (Nyctereutes procyonoides viverrinus), three raccoons (Procyon lotor), six Japanese badgers (Meles anakuma), one Japanese marten (Martes melampus), one stray dog (Canis lupus familiaris), four wild boars (Sus scrofa leucomystax), and one Japanese serow (Capricornis crispus), mainly in an area where mangy wild animals have been increasingly noted in the past 4 yr. The second internal transcribed spacer (ITS2) region of the ribosomal RNA gene and the partial 16S and cytochrome c oxidase subunit I (cox-1) genes of mitochondrial DNA (mtDNA) were characterized in these skin samples. The ITS2 sequencing (404 base pairs [bp]) identified the causative mite for mangy skin lesions of 128 animals as S. scabiei, regardless of host origin. The cat mite (Notoedres cati) was the cause in one raccoon dog and one raccoon. Most mites had almost identical ITS2 nucleotide sequences to those recorded in a variety of mammals worldwide. Partial 16S and cox-1 fragments of mtDNA amplified and sequenced successfully (331 bp and 410 bp, respectively) showed an identical nucleotide sequence except for one site (C vs. T) for the former and four sites (G, C, C, C vs. A, T, T, T, respectively) for the latter fragment. These substitutions were always synchronized, with the two mitochondrial DNA haplotypes (i.e., C/GCCC and T/ATTT) appearing to separately colonize in geographic units. The T/ATTT haplotype fell into a clade where animal-derived mites worldwide dominated, whereas the C/GCCC haplotype formed a geographic branch unique to Japanese isolates. These results suggest that heterologous populations of monospecific S. scabiei are expanding their populations and distributions regardless of host species in an apparently local mange epizootic of wild mammals in Japan.

Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter.

PubMed

Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian

2018-03-12

ZmbZIP25 ( Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5' RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from -2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from -2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5'-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5'-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5'-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5'-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from -1117 to -957 that were responsible for the specificity of the ZmbZIP25 5'-flanking sequence.

Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter

PubMed Central

Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian

2018-01-01

ZmbZIP25 (Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5′ RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from −2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from −2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5′-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5′-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5′-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5′-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from −1117 to −957 that were responsible for the specificity of the ZmbZIP25 5′-flanking sequence. PMID:29534529

Molecular characterization and distribution of a 145-bp tandem repeat family in the genus Populus.

PubMed

Rajagopal, J; Das, S; Khurana, D K; Srivastava, P S; Lakshmikumaran, M

1999-10-01

This report aims to describe the identification and molecular characterization of a 145-bp tandem repeat family that accounts for nearly 1.5% of the Populus genome. Three members of this repeat family were cloned and sequenced from Populus deltoides and P. ciliata. The dimers of the repeat were sequenced in order to confirm the head-to-tail organization of the repeat. Hybridization-based analysis using the 145-bp tandem repeat as a probe on genomic DNA gave rise to ladder patterns which were identified to be a result of methylation and (or) sequence heterogeneity. Analysis of the methylation pattern of the repeat family using methylation-sensitive isoschizomers revealed variable methylation of the C residues and lack of methylation of the A residues. Sequence comparisons between the monomers revealed a high degree of sequence divergence that ranged between 6% and 11% in P. deltoides and between 4.2% and 8.3% in P. ciliata. This indicated the presence of sub-families within the 145-bp tandem family of repeats. Divergence was mainly due to the accumulation of point mutations and was concentrated in the central region of the repeat. The 145-bp tandem repeat family did not show significant homology to known tandem repeats from plants. A short stretch of 36 bp was found to show homology of 66.7% to a centromeric repeat from Chironomus plumosus. Dot-blot analysis and Southern hybridization data revealed the presence of the repeat family in 13 of the 14 Populus species examined. The absence of the 145-bp repeat from P. euphratica suggested that this species is relatively distant from other members of the genus, which correlates with taxonomic classifications. The widespread occurrence of the tandem family in the genus indicated that this family may be of ancient origin.

In silico analysis of 16S ribosomal RNA gene sequencing‐based methods for identification of medically important anaerobic bacteria

PubMed Central

Woo, Patrick C Y; Chung, Liliane M W; Teng, Jade L L; Tse, Herman; Pang, Sherby S Y; Lau, Veronica Y T; Wong, Vanessa W K; Kam, Kwok‐ling; Lau, Susanna K P; Yuen, Kwok‐Yung

2007-01-01

This study is the first study that provides useful guidelines to clinical microbiologists and technicians on the usefulness of full 16S rRNA sequencing, 5′‐end 527‐bp 16S rRNA sequencing and the existing MicroSeq full and 500 16S rDNA bacterial identification system (MicroSeq, Perkin‐Elmer Applied Biosystems Division, Foster City, California, USA) databases for the identification of all existing medically important anaerobic bacteria. Full and 527‐bp 16S rRNA sequencing are able to identify 52–63% of 130 Gram‐positive anaerobic rods, 72–73% of 86 Gram‐negative anaerobic rods and 78% of 23 anaerobic cocci. The existing MicroSeq databases are able to identify only 19–25% of 130 Gram‐positive anaerobic rods, 38% of 86 Gram‐negative anaerobic rods and 39% of 23 anaerobic cocci. These represent only 45–46% of those that should be confidently identified by full and 527‐bp 16S rRNA sequencing. To improve the usefulness of MicroSeq, bacterial species that should be confidently identified by full and/or 527‐bp 16S rRNA sequencing but not included in the existing MicroSeq databases should be included. PMID:17046845

Sequences spanning the leader-repeat junction mediate CRISPR adaptation to phage in Streptococcus thermophilus

PubMed Central

Wei, Yunzhou; Chesne, Megan T.; Terns, Rebecca M.; Terns, Michael P.

2015-01-01

CRISPR-Cas systems are RNA-based immune systems that protect prokaryotes from invaders such as phages and plasmids. In adaptation, the initial phase of the immune response, short foreign DNA fragments are captured and integrated into host CRISPR loci to provide heritable defense against encountered foreign nucleic acids. Each CRISPR contains a ∼100–500 bp leader element that typically includes a transcription promoter, followed by an array of captured ∼35 bp sequences (spacers) sandwiched between copies of an identical ∼35 bp direct repeat sequence. New spacers are added immediately downstream of the leader. Here, we have analyzed adaptation to phage infection in Streptococcus thermophilus at the CRISPR1 locus to identify cis-acting elements essential for the process. We show that the leader and a single repeat of the CRISPR locus are sufficient for adaptation in this system. Moreover, we identified a leader sequence element capable of stimulating adaptation at a dormant repeat. We found that sequences within 10 bp of the site of integration, in both the leader and repeat of the CRISPR, are required for the process. Our results indicate that information at the CRISPR leader-repeat junction is critical for adaptation in this Type II-A system and likely other CRISPR-Cas systems. PMID:25589547

Cloning and Expression of the Erwinia carotovora subsp. carotovora Gene Encoding the Low-Molecular-Weight Bacteriocin Carocin S1▿

PubMed Central

Chuang, Duen-yau; Chien, Yung-chei; Wu, Huang-Pin

2007-01-01

The purpose of this study was to clone the carocin S1 gene and express it in a non-carocin-producing strain of Erwinia carotovora. A mutant, TH22-10, which produced a high-molecular-weight bacteriocin but not a low-molecular-weight bacteriocin, was obtained by Tn5 insertional mutagenesis using H-rif-8-2 (a spontaneous rifampin-resistant mutant of Erwinia carotovora subsp. carotovora 89-H-4). Using thermal asymmetric interlaced PCR, the DNA sequence from the Tn5 insertion site and the DNA sequence of the contiguous 2,280-bp region were determined. Two complete open reading frames (ORF), designated ORF2 and ORF3, were identified within the sequence fragment. ORF2 and ORF3 were identified with the carocin S1 genes, caroS1K (ORF2) and caroS1I (ORF3), which, respectively, encode a killing protein (CaroS1K) and an immunity protein (CaroS1I). These genes were homologous to the pyocin S3 gene and the pyocin AP41 gene. Carocin S1 was expressed in E. carotovora subsp. carotovora Ea1068 and replicated in TH22-10 but could not be expressed in Escherichia coli (JM101) because a consensus sequence resembling an SOS box was absent. A putative sequence similar to the consensus sequence for the E. coli cyclic AMP receptor protein binding site (−312 bp) was found upstream of the start codon. Production of this bacteriocin was also induced by glucose and lactose. The homology search results indicated that the carocin S1 gene (between bp 1078 and bp 1704) was homologous to the pyocin S3 and pyocin AP41 genes in Pseudomonas aeruginosa. These genes encode proteins with nuclease activity (domain 4). This study found that carocin S1 also has nuclease activity. PMID:17071754

HMG-D is an architecture-specific protein that preferentially binds to DNA containing the dinucleotide TG.

PubMed Central

Churchill, M E; Jones, D N; Glaser, T; Hefner, H; Searles, M A; Travers, A A

1995-01-01

The high mobility group (HMG) protein HMG-D from Drosophila melanogaster is a highly abundant chromosomal protein that is closely related to the vertebrate HMG domain proteins HMG1 and HMG2. In general, chromosomal HMG domain proteins lack sequence specificity. However, using both NMR spectroscopy and standard biochemical techniques we show that binding of HMG-D to a single DNA site is sequence selective. The preferred duplex DNA binding site comprises at least 5 bp and contains the deformable dinucleotide TG embedded in A/T-rich sequences. The TG motif constitutes a common core element in the binding sites of the well-characterized sequence-specific HMG domain proteins. We show that a conserved aromatic residue in helix 1 of the HMG domain may be involved in recognition of this core sequence. In common with other HMG domain proteins HMG-D binds preferentially to DNA sites that are stably bent and underwound, therefore HMG-D can be considered an architecture-specific protein. Finally, we show that HMG-D bends DNA and may confer a superhelical DNA conformation at a natural DNA binding site in the Drosophila fushi tarazu scaffold-associated region. Images PMID:7720717

Next generation sequencing yields the complete mitochondrial genome of the Hornlip mullet Plicomugil labiosus (Teleostei: Mugilidae).

PubMed

Shen, Kang-Ning; Chen, Ching-Hung; Hsiao, Chung-Der

2016-05-01

In this study, the complete mitogenome sequence of hornlip mullet Plicomugil labiosus (Teleostei: Mugilidae) has been sequenced by next-generation sequencing method. The assembled mitogenome, consisting of 16,829 bp, had the typical vertebrate mitochondrial gene arrangement, including 13 protein coding genes, 22 transfer RNAs, 2 ribosomal RNAs genes and a non-coding control region of D-loop. D-loop contains 1057 bp length is located between tRNA-Pro and tRNA-Phe. The overall base composition of P. labiosus is 28.0% for A, 29.3% for C, 15.5% for G and 27.2% for T. The complete mitogenome may provide essential and important DNA molecular data for further population, phylogenetic and evolutionary analysis for Mugilidae.

Next generation sequencing yields the complete mitochondrial genome of the largescale mullet, Liza macrolepis (Teleostei: Mugilidae).

PubMed

Shen, Kang-Ning; Tsai, Shiou-Yi; Chen, Ching-Hung; Hsiao, Chung-Der; Durand, Jean-Dominique

2016-11-01

In this study, the complete mitogenome sequence of largescale mullet (Teleostei: Mugilidae) has been sequenced by the next-generation sequencing method. The assembled mitogenome, consisting of 16,832 bp, had the typical vertebrate mitochondrial gene arrangement, including 13 protein-coding genes, 22 transfer RNAs, two ribosomal RNAs genes, and a non-coding control region of D-loop. D-loop which has a length of 1094 bp is located between tRNA-Pro and tRNA-Phe. The overall base composition of largescale mullet is 27.8% for A, 30.1% for C, 16.2% for G, and 25.9% for T. The complete mitogenome may provide essential and important DNA molecular data for further phylogenetic and evolutionary analysis for Mugilidae.

DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

DOE PAGES

Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

2016-03-09

The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.

PubMed

Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S

2015-12-01

Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.

Molecular identification of Trichuris vulpis and Trichuris suis isolated from different hosts.

PubMed

Cutillas, Cristina; de Rojas, Manuel; Ariza, Concepción; Ubeda, José Manuel; Guevara, Diego

2007-01-01

Trichuris suis was isolated from the cecum of two different hosts (Sus scrofa domestica -- swine and Sus scrofa scrofa -- wild boar) and Trichuris vulpis from dogs in Sevilla, Spain. Genomic DNA was isolated and internal transcribed spacers (ITS)1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced using polymerase chain reaction techniques. The sequence of T. suis from both hosts was 1,396 bp in length while that of T. vulpis was 1,044 bp. ITS1 of both populations isolated of T. suis was 661 nucleotides in length, while the ITS2 was 534 nucleotides in length. Furthermore, the ITS1 of T. vulpis was 410 nucleotides in length, while the ITS2 was 433 nucleotides in length. One hundred fifty-four nucleotides were observed along the 5.8S gene of T. suis and T. vulpis. Intraindividual and intraspecific variations were detected in the rDNA of both species. The presence of microsatellites was observed in all the individuals assayed. Sequence analysis of the ITSs and the 5.8S gene has demonstrated no sequence differences between T. suis isolated from both hosts (S. scrofa domestica -- swine and S. scrofa scrofa -- wild boar). Nevertheless, clear differences were detected between the ITS1 and ITS2 of T. suis and T. vulpis. Furthermore, a comparative molecular analysis between both species and the previously published ITS1-5.8S-ITS2 sequence data of Trichuris ovis, Trichuris leporis, Trichuris muris, Trichuris arvicolae, and Trichuris skrjabini was carried out. A common homology zone was detected in the ITS1 sequence of all species of trichurids.

[A new herbs traceability method based on DNA barcoding-origin-morphology analysis--an example from an adulterant of 'Heiguogouqi'].

PubMed

Gu, Xuan; Zhang, Xiao-qin; Song, Xiao-na; Zang, Yi-mei; Li Yan-peng; Ma, Chang-hua; Zhao, Bai-xiao; Liu, Chun-sheng

2014-12-01

The fruit of Lycium ruthenicum is a common folk medicine in China. Now it is popular for its antioxidative effect and other medical functions. The adulterants of the herb confuse consumers. In order to identify a new adulterant of L. ruthenicum, a research was performed based on NCBI Nucleotide Database ITS Sequence, combined analysis of the origin and morphology of the adulterant to traceable varieties. Total genomic DNA was isolated from the materials, and nuclear DNA ITS sequences were amplified and sequenced; DNA fragments were collated and matched by using ContingExpress. Similarity identification of BLAST analysis was performed. Besides, the distribution of plant origin and morphology were considered to further identification and verification. Families and genera were identified by molecular identification method. The adulterant was identified as plant belonging to Berberis. Origin analysis narrowed the range of sample identification. Seven different kinds of plants in Berberis were potential sources of the sample. Adulterants variety was traced by morphological analysis. The united molecular identification-origin-morphology research proves to be a preceding way to medical herbs traceability with time-saving and economic advantages and the results showed the new adulterant of L. ruthenicum was B. kaschgarica. The main differences between B. kaschgarica and L. ruthenicum are as follows: in terms of the traits, the surface of B. kaschgarica is smooth and crispy, and that of L. ruthenicum is shrinkage, solid and hard. In microscopic characteristics, epicarp cells of B. aschgarica thickening like a string of beads, stone cells as the rectangle, and the stone cell walls of L. ruthenicum is wavy, obvious grain layer. In molecular sequences, the length of ITS sequence of B. kaschgarica is 606 bp, L. ruthenicum is 654 bp, the similarity of the two sequences is 53.32%.

Polynesian genetic affinities with Southeast Asian populations as identified by mtDNA analysis.

PubMed Central

Melton, T; Peterson, R; Redd, A J; Saha, N; Sofro, A S; Martinson, J; Stoneking, M

1995-01-01

Polynesian genetic affinities to populations of Asia were studied using mtDNA markers. A total of 1,037 individuals from 12 populations were screened for a 9-bp deletion in the intergenic region between the COII and tRNA(Lys) genes that approaches fixation in Polynesians. Sequence-specific oligonucleotide probes that identify specific mtDNA control region nucleotide substitutions were used to describe variation in individuals with the 9-bp deletion. The 9-bp deletion was not observed in northern Indians, Bangladeshis, or Pakistanis but was seen at low to moderate frequencies in the nine other Southeast Asian populations. Three substitutions in the control region at positions 16217, 16247, and 16261 have previously been observed at high frequency in Polynesian mtDNAs; this "Polynesian motif" was observed in 20% of east Indonesians with the 9-bp deletion but was observed in only one additional individual. mtDNA types related to the Polynesian motif are highest in frequency in the corridor from Taiwan south through the Philippines and east Indonesia, and the highest diversity for these types is in Taiwan. These results are consistent with linguistic evidence of a Taiwanese origin for the proto-Polynesian expansion, which spread throughout Oceania by way of Indonesia. PMID:7668267

A variant Tc4 transposable element in the nematode C. elegans could encode a novel protein.

PubMed Central

Li, W; Shaw, J E

1993-01-01

A variant C. elegans Tc4 transposable element, Tc4-rh1030, has been sequenced and is 3483 bp long. The Tc4 element that had been analyzed previously is 1605 bp long, consists of two 774-bp nearly perfect inverted terminal repeats connected by a 57-bp loop, and lacks significant open reading frames. In Tc4-rh1030, by comparison, a 2343-bp novel sequence is present in place of a 477-bp segment in one of the inverted repeats. The novel sequence of Tc4-rh1030 is present about five times per haploid genome and is invariably associated with Tc4 elements; we have used the designation Tc4v to denote this variant subfamily of Tc4 elements. Sequence analysis of three cDNA clones suggests that a Tc4v element contains at least five exons that could encode a novel basic protein of 537 amino acid residues. On northern blots, a 1.6-kb Tc4v-specific transcript was detected in the mutator strain TR679 but not in the wild-type strain N2; Tc4 elements are known to transpose in TR679 but appear to be quiescent in N2. We have analyzed transcripts produced by an unc-33 gene that has the Tc4-rh1030 insertional mutation in its transcribed region; all or almost all of the Tc4v sequence is frequently spliced out of the mutant unc-33 transcripts, sometimes by means of non-consensus splice acceptor sites. Images PMID:8382791

Production of DNA minicircles less than 250 base pairs through a novel concentrated DNA circularization assay enabling minicircle design with NF-κB inhibition activity.

PubMed

Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick; Malinge, Jean-Marc

2017-03-17

Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ryan, Q.C.

There are two nonallelic human {gamma} globin genes located on the short arm of chromosome No. 11 in the order 5{prime}-{sup G}{sub {gamma}}-{sup A}{sub {gamma}}-3{prime}. Various modifications of the two {gamma} genes have been reported and include: deletions, triplications, quadruplications and recently a quintuplication. These are generally created by one or more unequal crossovers in the {gamma} globin gene regions on adjacent chromosomes. During the course of looking for a {gamma}{sup {degree}} thalassemia, which might be due to a crossover of looking for a {gamma} genes, two cases were found in the family W. Bgl II mapping studies showed amore » 5 kb deletion at the {gamma} gene loci in these individuals. The Bgl II fragment from the {gamma} gene loci of R.W. was cloned into the phage vector QR1. Phage mapping showed that two out of the three Pst I sites within the Bgl II fragment were missing which suggested that the crossover might have occurred within the {gamma} gene, possibly within the {gamma}IVS II region. Sequence analysis of the cloned fragment revealed an unusual sequence which had no sequence homology with the {gamma} gene region except for a small 264 bp region near the 3{prime} end. The orientation of the 264 bp fragment is inverted relative to homologous sequences in the {sup G}{sub {gamma}} and {sup A}{sub {gamma}} IVS II. The unusual sequence was computer analyzed for homology with every DNA sequence file in the EMBL database and GenBank and did not show any significant homologies to all the available DNA sequences except for the 264 bp {gamma}IVS II homology.« less

Construction of C35 gene bait recombinants and T47D cell cDNA library.

PubMed

Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge

2017-11-20

C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.

Genome Sequences of Populus tremula Chloroplast and Mitochondrion: Implications for Holistic Poplar Breeding

PubMed Central

Mader, Malte; Le Paslier, Marie-Christine; Bounon, Rémi; Berard, Aurélie; Vettori, Cristina; Schroeder, Hilke; Leplé, Jean-Charles; Fladung, Matthias

2016-01-01

Complete Populus genome sequences are available for the nucleus (P. trichocarpa; section Tacamahaca) and for chloroplasts (seven species), but not for mitochondria. Here, we provide the complete genome sequences of the chloroplast and the mitochondrion for the clones P. tremula W52 and P. tremula x P. alba 717-1B4 (section Populus). The organization of the chloroplast genomes of both Populus clones is described. A phylogenetic tree constructed from all available complete chloroplast DNA sequences of Populus was not congruent with the assignment of the related species to different Populus sections. In total, 3,024 variable nucleotide positions were identified among all compared Populus chloroplast DNA sequences. The 5-prime part of the LSC from trnH to atpA showed the highest frequency of variations. The variable positions included 163 positions with SNPs allowing for differentiating the two clones with P. tremula chloroplast genomes (W52, 717-1B4) from the other seven Populus individuals. These potential P. tremula-specific SNPs were displayed as a whole-plastome barcode on the P. tremula W52 chloroplast DNA sequence. Three of these SNPs and one InDel in the trnH-psbA linker were successfully validated by Sanger sequencing in an extended set of Populus individuals. The complete mitochondrial genome sequence of P. tremula is the first in the family of Salicaceae. The mitochondrial genomes of the two clones are 783,442 bp (W52) and 783,513 bp (717-1B4) in size, structurally very similar and organized as single circles. DNA sequence regions with high similarity to the W52 chloroplast sequence account for about 2% of the W52 mitochondrial genome. The mean SNP frequency was found to be nearly six fold higher in the chloroplast than in the mitochondrial genome when comparing 717-1B4 with W52. The availability of the genomic information of all three DNA-containing cell organelles will allow a holistic approach in poplar molecular breeding in the future. PMID:26800039

Development of a Diagnostic Tool to Detect DNA Methylation Biomarkers for Early-Stage Lung Cancer

DTIC Science & Technology

2015-02-01

include: 1) a DNA recognition domain that recognizes the specific DNA sequence of interest and 2) one half of the leucine zipper pair. The second...piece will include 1) the second half of the leucine zipper pair, 2) a flexible linker flanked by a FRET pair that determines the local (within 30 bp...each other to determine the resolution of our probes. All DNA fragments are methylated using bacterial methyltransferase. Since only a single CG

Eukaryotic diversity in premise drinking water using 18S rDNA sequencing: implications for health risks

EPA Science Inventory

The goal of this study was to characterize microbial eukaryotes over a 12 month period, so as to provide insight into the occurrence of potentially important predators and bacterial hosts in hot and cold premise plumbing. Nearly 6,300 partial (600 bp) 18S rRNA gene sequences from...

Complete Genome Sequence of Pseudomonas aeruginosa Phage AAT-1

PubMed Central

Andrade-Domínguez, Andrés

2016-01-01

Aspects of the interaction between phages and animals are of interest and importance for medical applications. Here, we report the genome sequence of the lytic Pseudomonas phage AAT-1, isolated from mammalian serum. AAT-1 is a double-stranded DNA phage, with a genome of 57,599 bp, containing 76 predicted open reading frames. PMID:27563032

Sequence analysis of the 5.8S ribosomal DNA and internal transcribed spacers (ITS1 and ITS2) from five species of the Oxalis tuberosa alliance.

PubMed

Tosto, D S; Hopp, H E

1996-01-01

The internal transcribed spacer region (ITS1 and ITS2) of the 18S-25S nuclear ribosomal DNA sequence and the intervening 5.8S region from five species of the genus Oxalis was amplified by polymerase chain reaction and subjected to direct DNA sequencing. On the basis of cytogenetic studies some species of this genus were postulated to be related by the number of chromosomes. Sequence homologies in the ITS1, 5.8S and ITS2 among species are in good agreement with previous relationships established on the basis of chromosome numbers. We also identified a highly conserved sequence of six bp in the ITS1, reported to be present in a wide range of flowering plants, but not in the Oxalidaceae family to which the genus Oxalis belongs to.

Phylogenetic and gene-centric metagenomics of the canine intestinal microbiome reveals similarities with humans and mice

PubMed Central

Swanson, Kelly S; Dowd, Scot E; Suchodolski, Jan S; Middelbos, Ingmar S; Vester, Brittany M; Barry, Kathleen A; Nelson, Karen E; Torralba, Manolito; Henrissat, Bernard; Coutinho, Pedro M; Cann, Isaac KO; White, Bryan A; Fahey, George C

2011-01-01

This study is the first to use a metagenomics approach to characterize the phylogeny and functional capacity of the canine gastrointestinal microbiome. Six healthy adult dogs were used in a crossover design and fed a low-fiber control diet (K9C) or one containing 7.5% beet pulp (K9BP). Pooled fecal DNA samples from each treatment were subjected to 454 pyrosequencing, generating 503 280 (K9C) and 505 061 (K9BP) sequences. Dominant bacterial phyla included the Bacteroidetes/Chlorobi group and Firmicutes, both of which comprised ∼35% of all sequences, followed by Proteobacteria (13–15%) and Fusobacteria (7–8%). K9C had a greater percentage of Bacteroidetes, Fusobacteria and Proteobacteria, whereas K9BP had greater proportions of the Bacteroidetes/Chlorobi group and Firmicutes. Archaea were not altered by diet and represented ∼1% of all sequences. All archaea were members of Crenarchaeota and Euryarchaeota, with methanogens being the most abundant and diverse. Three fungi phylotypes were present in K9C, but none in K9BP. Less than 0.4% of sequences were of viral origin, with >99% of them associated with bacteriophages. Primary functional categories were not significantly affected by diet and were associated with carbohydrates; protein metabolism; DNA metabolism; cofactors, vitamins, prosthetic groups and pigments; amino acids and derivatives; cell wall and capsule; and virulence. Hierarchical clustering of several gastrointestinal metagenomes demonstrated phylogenetic and metabolic similarity between dogs, humans and mice. More research is required to provide deeper coverage of the canine microbiome, evaluate effects of age, genetics or environment on its composition and activity, and identify its role in gastrointestinal disease. PMID:20962874

Complete mitochondrial genome of the monogonont rotifer, Brachionus koreanus (Rotifera, Brachionidae).

PubMed

Hwang, Dae-Sik; Suga, Koushirou; Sakakura, Yoshitaka; Park, Heum Gi; Hagiwara, Atsushi; Rhee, Jae-Sung; Lee, Jae-Seong

2014-02-01

The complete mitochondrial genome was obtained from the assembled genome data sequenced by next generation sequencing (NGS) technology from the monogonont rotifer Brachionus koreanus. The mitochondrial genome of B. koreanus was composed of two circular chromosomes designated as mtDNA-I (10,421 bp) and mtDNA-II (11,923 bp). The gene contents of B. koreanus were identical with previously reported B. plicatilis mitochondrial genomes. However, gene orders of B. koreanus showed one rearrangement between the two species. Of 12 protein-coding genes (PCGs), 3 genes (ATP6, ND1, and ND3) had an incomplete stop codon. The A + T base composition of B. koreanus mitochondrial genome was high (68.81%). They also showed anti-G bias (12.03% and 10.97%) on the second and third position of PCGs as well as slight anti-C bias (15.96% and 14.31%) on the first and third position of PCGs.

Localization of human coagulation factor VIII (hFVIII) in transgenic rabbit by FISH-TSA: identification of transgene copy number and transmission to the next generation.

PubMed

Krylov, V; Tlapáková, T; Mácha, J; Curlej, J; Ryban, L; Chrenek, P

2008-01-01

For chromosomal localization of the hFVIII human transgene in F2 and F3 generation of transgenic rabbits, FISH-TSA was applied. A short cDNA probe (1250 bp) targeted chromosomes 3, 7, 8, 9 and 18 of an F2 male (animal 1-3-8). Two transgenic offspring (F3) revealed signal positions in chromosome 3 and chromosomes 3 and 7, respectively. Sequencing and structure analysis of the rabbit orthologous gene revealed high similarity to its human counterpart. Part of the sequenced cDNA (1310 bp) served as a probe for FISH-TSA analysis. The rabbit gene was localized in the q arm terminus of the X chromosome. This result is in agreement with reciprocal chromosome painting between the rabbit and the human. The presented FISH-TSA method provides strong signals without any interspecies reactivity.

Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

PubMed

Jorgez, Carolina J; Bischoff, Farideh Z

2009-01-01

Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

DNA barcoding of gypsy moths from China (Lepidoptera: Erebidae) reveals new haplotypes and divergence patterns within gypsy moth subspecies

Treesearch

Fang Chen; Youqing Luo; Melody A. Keena; Ying Wu; Peng Wu; Juan Shi

2015-01-01

The gypsy moth from Asia (two subspecies) is considered a greater threat to North America than European gypsy moth, because of a broader host range and females being capable of flight. Variation within and among gypsy moths from China (nine locations), one of the native countries of Asian gypsy moth, were compared using DNA barcode sequences (658 bp of mtDNA cytochrome...

Molecular cloning and sequence analysis of heat shock proteins 70 (HSP70) and 90 (HSP90) and their expression analysis when exposed to benzo(a)pyrene in the clam Ruditapes philippinarum.

PubMed

Liu, Tong; Pan, Luqing; Cai, Yuefeng; Miao, Jingjing

2015-01-25

HSP70 and HSP90 are the most important heat shock proteins (HSPs), which play the key roles in the cell as molecular chaperones and may involve in metabolic detoxification. The present research has obtained full-length cDNAs of genes HSP70 and HSP90 from the clam Ruditapes philippinarum and studied the transcriptional responses of the two genes when exposed to benzo(a)pyrene (BaP). The full-length RpHSP70 cDNA was 2336bp containing a 5' untranslated region (UTR) of 51bp, a 3' UTR of 335bp and an open reading frame (ORF) of 1950bp encoding 650 amino acid residues. The full-length RpHSP90 cDNA was 2839bp containing a 107-bp 5' UTR, a 554-bp 3' UTR and a 2178-bp ORF encoding 726 amino acid residues. The deduced amino acid sequences of RpHSP70 and RpHSP90 shared the highest identity with the sequences of Paphia undulata, and the phylogenetic trees showed that the evolutions of RpHSP70 and RpHSP90 were almost in accord with the evolution of species. The RpHSP70 and RpHSP90 mRNA expressions were detected in all tested tissues in the adult clams (digestive gland, gill, adductor muscle and mantle) and the highest mRNA expression level was observed in the digestive gland compared to other tissues. Quantitative real-time RT-PCR analysis revealed that mRNA expression levels of the clam RpHSP70, RpHSP90 and other xenobiotic metabolizing enzymes (XMEs) (AhR, DD, GST, GPx) in the digestive gland of R. philippinarum were induced by benzo(a)pyrene (BaP) and the absolute expression levels of these genes showed a temporal and dose-dependent response. The results suggested that RpHSP70 and RpHSP90 were involved in the metabolic detoxification of BaP in the clam R. philippinarum. Copyright © 2014 Elsevier B.V. All rights reserved.

A genome-specific repetitive DNA sequence from Oryza eichingeri: characterization, localization, and introgression to O. sativa.

PubMed

Yan, H. H.; Liu, G. Q.; Cheng, Z. K.; Li, X. B.; Liu, G. Z.; Min, S. K.; Zhu, L.H.

2002-02-01

In the course of transferring the brown planthopper resistance from a diploid, CC-genome wild rice species, Oryza eichingeri (IRGC acc. 105159 and 105163), to the cultivated rice variety 02428, we have isolated many alien addition and introgression lines. The O. eichingeri chromatin in some of these lines has previously been identified using genomic in situ hybridization and molecular-marker analysis. Here we cloned a tandemly repetitive DNA sequence from O. eichingeri IRGC acc105163, and detected it in 25 introgression lines. This repetitive DNA sequence showed high specificity to the rice CC genome, but was absent from all the four tetraploid species with BBCC or CCDD genomes. The monomer in this repetitive DNA sequence is 325-366-bp long, with a copy number of about 5,000 per 1 C of the O. eichingerigenome, showing 88% homology to a repetitive DNA sequence isolated from Oryza officinalis(2n=2 x=24, CC). Fluorescent in situ hybridization revealed 11 signals distributed over eight O. eichingeri chromosomes, mostly in terminal or subterminal regions.

The complete DNA sequence of lymphocystis disease virus.

PubMed

Tidona, C A; Darai, G

1997-04-14

Lymphocystis disease virus (LCDV) is the causative agent of lymphocystis disease, which has been reported to occur in over 100 different fish species worldwide. LCDV is a member of the family Iridoviridae and the type species of the genus Lymphocystivirus. The virions contain a single linear double-stranded DNA molecule, which is circularly permuted, terminally redundant, and heavily methylated at cytosines in CpG sequences. The complete nucleotide sequence of LCDV-1 (flounder isolate) was determined by automated cycle sequencing and primer walking. The genome of LCDV-1 is 102.653 bp in length and contains 195 open reading frames with coding capacities ranging from 40 to 1199 amino acids. Computer-assisted analyses of the deduced amino acid sequences led to the identification of several putative gene products with significant homologies to entries in protein data banks, such as the two major subunits of the viral DNA-dependent RNA polymerase, DNA polymerase, several protein kinases, two subunits of the ribonucleoside diphosphate reductase, DNA methyltransferase, the viral major capsid protein, insulin-like growth factor, and tumor necrosis factor receptor homolog.

Carboxy-terminal sequence variation of LMP1 gene in Epstein-Barr-virus-associated mononucleosis and tumors from Serbian patients.

PubMed

Banko, Ana; Lazarevic, Ivana; Cupic, Maja; Stevanovic, Goran; Boricic, Ivan; Jovanovic, Tanja

2012-04-01

Seven strains of Epstein-Barr virus (EBV) are defined based on C-terminal sequence variations of the latent membrane protein 1 (LMP1). Some strains, especially those with a 30-bp deletion, are thought to be related to tumorigenic activity and geographical localization. The aims of the study were to determine the prevalence of different LMP1 strains and to investigate sequence variation in the C-terminal region of LMP1 in Serbian isolates. This study included 53 EBV-DNA-positive plasma and tissue block samples from patients with mononucleosis syndrome, renal transplantation, and tumors, mostly nasopharyngeal carcinoma. The sequence of the 506-bp fragment of LMP1 C terminus was used for phylogenetic analyses and identification of LMP1 strains, deletions, and mutations. The majority of isolates were non-deleted (66%), and the rest had 30-bp, rare 69-bp, or yet unknown 27-bp deletions, which were not related to malignant or non-malignant isolate origin. However, the majority of 69-bp deletion isolates were derived from patients with nasopharyngeal carcinoma. Less than five 33-bp repeats were found in the majority of non-deleted isolates (68.6%), whereas most 69-bp deletion isolates (75%) had five or six repeats. Serbian isolates were assigned to four LMP1 strains: B95-8 (32.1%), China 1 (24.5%), North Carolina (NC; 18.9%), and Mediterranean (Med; 24.5%). In NC isolates, three new mutations unique for this strain were identified. EBV EBNA2 genotypes 1 and 2 were both found, with dominance of genotype 1 (90.7%). This study demonstrated noticeable geographical-associated characteristics in the LMP1 C terminus of investigated isolates. Copyright © 2012 Wiley Periodicals, Inc.

Characterization of Microbial Communities in Gas Industry Pipelines

PubMed Central

Zhu, Xiang Y.; Lubeck, John; Kilbane, John J.

2003-01-01

Culture-independent techniques, denaturing gradient gel electrophoresis (DGGE) analysis, and random cloning of 16S rRNA gene sequences amplified from community DNA were used to determine the diversity of microbial communities in gas industry pipelines. Samples obtained from natural gas pipelines were used directly for DNA extraction, inoculated into sulfate-reducing bacterium medium, or used to inoculate a reactor that simulated a natural gas pipeline environment. The variable V2-V3 (average size, 384 bp) and V3-V6 (average size, 648 bp) regions of bacterial and archaeal 16S rRNA genes, respectively, were amplified from genomic DNA isolated from nine natural gas pipeline samples and analyzed. A total of 106 bacterial 16S rDNA sequences were derived from DGGE bands, and these formed three major clusters: beta and gamma subdivisions of Proteobacteria and gram-positive bacteria. The most frequently encountered bacterial species was Comamonas denitrificans, which was not previously reported to be associated with microbial communities found in gas pipelines or with microbially influenced corrosion. The 31 archaeal 16S rDNA sequences obtained in this study were all related to those of methanogens and phylogenetically fall into three clusters: order I, Methanobacteriales; order III, Methanomicrobiales; and order IV, Methanosarcinales. Further microbial ecology studies are needed to better understand the relationship among bacterial and archaeal groups and the involvement of these groups in the process of microbially influenced corrosion in order to develop improved ways of monitoring and controlling microbially influenced corrosion. PMID:12957923

Complete Genome Sequence of EtG, the First Phage Sequenced from Erwinia tracheiphila.

PubMed

Andrade-Domínguez, Andrés; Kolter, Roberto; Shapiro, Lori R

2018-02-22

Erwinia tracheiphila is the causal agent of bacterial wilt of cucurbits. Here, we report the genome sequence of the temperate phage EtG, which was isolated from an E. tracheiphila -infected cucumber plant. Phage EtG has a linear 30,413-bp double-stranded DNA genome with cohesive ends and 45 predicted open reading frames. Copyright © 2018 Andrade-Domínguez et al.

Accuracy of the high-throughput amplicon sequencing to identify species within the genus Aspergillus.

PubMed

Lee, Seungeun; Yamamoto, Naomichi

2015-12-01

This study characterized the accuracy of high-throughput amplicon sequencing to identify species within the genus Aspergillus. To this end, we sequenced the internal transcribed spacer 1 (ITS1), β-tubulin (BenA), and calmodulin (CaM) gene encoding sequences as DNA markers from eight reference Aspergillus strains with known identities using 300-bp sequencing on the Illumina MiSeq platform, and compared them with the BLASTn outputs. The identifications with the sequences longer than 250 bp were accurate at the section rank, with some ambiguities observed at the species rank due to mostly cross detection of sibling species. Additionally, in silico analysis was performed to predict the identification accuracy for all species in the genus Aspergillus, where 107, 210, and 187 species were predicted to be identifiable down to the species rank based on ITS1, BenA, and CaM, respectively. Finally, air filter samples were analysed to quantify the relative abundances of Aspergillus species in outdoor air. The results were reproducible across biological duplicates both at the species and section ranks, but not strongly correlated between ITS1 and BenA, suggesting the Aspergillus detection can be taxonomically biased depending on the selection of the DNA markers and/or primers. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Polymerase chain reaction for detection of Leptospira spp. in clinical samples.

PubMed Central

Mérien, F; Amouriaux, P; Perolat, P; Baranton, G; Saint Girons, I

1992-01-01

A sensitive assay for Leptospira spp., the causative agent of leptospirosis, was developed on the basis of the polymerase chain reaction (PCR). A 331-bp sequence from the Leptospira interrogans serovar canicola rrs (16S) gene was amplified, and the PCR products were analyzed by DNA-DNA hybridization by using a 289-bp fragment internal to the amplified DNA. Specific PCR products also were obtained with DNA from the closely related nonpathogenic Leptospira biflexa but not with DNA from other spirochetes, such as Borrelia burgdorferi, Borrelia hermsii, Treponema denticola, Treponema pallidum, Spirochaeta aurantia, or more distant organisms such as Escherichia coli, Staphylococcus aureus, Mycobacterium tuberculosis, and Proteus mirabilis. The assay was able to detect as few as 10 bacteria. Leptospira DNA was detected in urine from experimentally infected mice. In addition, the test was found to be suitable for diagnosing leptospirosis in humans. Cerebrospinal fluid and urine from patients with leptospirosis were positive, whereas samples from control uninfected patients were negative. Images PMID:1400983

An ovary transcriptome for all maturational stages of the striped bass (Morone saxatilis), a highly advanced perciform fish.

PubMed

Reading, Benjamin J; Chapman, Robert W; Schaff, Jennifer E; Scholl, Elizabeth H; Opperman, Charles H; Sullivan, Craig V

2012-02-21

The striped bass and its relatives (genus Morone) are important fisheries and aquaculture species native to estuaries and rivers of the Atlantic coast and Gulf of Mexico in North America. To open avenues of gene expression research on reproduction and breeding of striped bass, we generated a collection of expressed sequence tags (ESTs) from a complementary DNA (cDNA) library representative of their ovarian transcriptome. Sequences of a total of 230,151 ESTs (51,259,448 bp) were acquired by Roche 454 pyrosequencing of cDNA pooled from ovarian tissues obtained at all stages of oocyte growth, at ovulation (eggs), and during preovulatory atresia. Quality filtering of ESTs allowed assembly of 11,208 high-quality contigs ≥ 100 bp, including 2,984 contigs 500 bp or longer (average length 895 bp). Blastx comparisons revealed 5,482 gene orthologues (E-value < 10-3), of which 4,120 (36.7% of total contigs) were annotated with Gene Ontology terms (E-value < 10-6). There were 5,726 remaining unknown unique sequences (51.1% of total contigs). All of the high-quality EST sequences are available in the National Center for Biotechnology Information (NCBI) Short Read Archive (GenBank: SRX007394). Informative contigs were considered to be abundant if they were assembled from groups of ESTs comprising ≥ 0.15% of the total short read sequences (≥ 345 reads/contig). Approximately 52.5% of these abundant contigs were predicted to have predominant ovary expression through digital differential display in silico comparisons to zebrafish (Danio rerio) UniGene orthologues. Over 1,300 Gene Ontology terms from Biological Process classes of Reproduction, Reproductive process, and Developmental process were assigned to this collection of annotated contigs. This first large reference sequence database available for the ecologically and economically important temperate basses (genus Morone) provides a foundation for gene expression studies in these species. The predicted predominance of ovary gene expression and assignment of directly relevant Gene Ontology classes suggests a powerful utility of this dataset for analysis of ovarian gene expression related to fundamental questions of oogenesis. Additionally, a high definition Agilent 60-mer oligo ovary 'UniClone' microarray with 8 × 15,000 probe format has been designed based on this striped bass transcriptome (eArray Group: Striper Group, Design ID: 029004).

Draft Genome Sequence of Mycobacterium boenickei CIP 107829.

PubMed

Bouam, Amar; Robert, Catherine; Croce, Olivier; Levasseur, Anthony; Drancourt, Michel

2017-05-04

Mycobacterium boenickei is a rapidly growing mycobacterium isolated for the first time from a leg wound in the United States. Its 6,506,908-bp draft genome exhibits a 66.77% G+C content, 6,279 protein-coding genes, and 59 predicted RNA genes. In silico DNA-DNA hybridization confirms its assignment to the Mycobacterium fortuitum complex. Copyright © 2017 Bouam et al.

Sex determination of ovine embryos by SRY and amelogenin (AMEL) genes using maternal circulating cell free DNA.

PubMed

Saberivand, Adel; Ahsan, Sima

2016-01-01

Simple and precise methods for sex determination in animals are a pre-requisite for a number of applications in animal production and forensics. Some of the existing methods depend only on the detection of Y-chromosome specific sequences. However, the detection of Y and X-chromosome specific sequences is advantageous. In the present study the accuracy of sex determination by SRY (sex-determining region Y) and AMEL (Amelogenin) gene detection was assessed using a polymerase chain reaction (PCR) of DNA extracted from free fetal cells in maternal blood, which is noninvasive for fetus and easier to collect. The PCR amplification of SRY primers produced a single band of 171bp from ewes bearing a male fetus, whereas no band was amplified from the DNA extracted from ewes pregnant to a female fetus. Moreover, two bands of 182 and 242bp in male and a single band of 242 in female fetuses were produced by AMEL gene primers in the PCR reaction. Using this technique 100% of samples were successfully sexed, excluding twins. In conclusion, we demonstrated that sex determination using DNA of free fetal cells in maternal plasma is efficient using both SRY and AMEL gene sequences. It also is evident that this method is not suitable for sex determination of twin pregnancies. Copyright © 2015 Elsevier B.V. All rights reserved.

Increased Sensitivity of Diagnostic Mutation Detection by Re-analysis Incorporating Local Reassembly of Sequence Reads.

PubMed

Watson, Christopher M; Camm, Nick; Crinnion, Laura A; Clokie, Samuel; Robinson, Rachel L; Adlard, Julian; Charlton, Ruth; Markham, Alexander F; Carr, Ian M; Bonthron, David T

2017-12-01

Diagnostic genetic testing programmes based on next-generation DNA sequencing have resulted in the accrual of large datasets of targeted raw sequence data. Most diagnostic laboratories process these data through an automated variant-calling pipeline. Validation of the chosen analytical methods typically depends on confirming the detection of known sequence variants. Despite improvements in short-read alignment methods, current pipelines are known to be comparatively poor at detecting large insertion/deletion mutations. We performed clinical validation of a local reassembly tool, ABRA (assembly-based realigner), through retrospective reanalysis of a cohort of more than 2000 hereditary cancer cases. ABRA enabled detection of a 96-bp deletion, 4-bp insertion mutation in PMS2 that had been initially identified using a comparative read-depth approach. We applied an updated pipeline incorporating ABRA to the entire cohort of 2000 cases and identified one previously undetected pathogenic variant, a 23-bp duplication in PTEN. We demonstrate the effect of read length on the ability to detect insertion/deletion variants by comparing HiSeq2500 (2 × 101-bp) and NextSeq500 (2 × 151-bp) sequence data for a range of variants and thereby show that the limitations of shorter read lengths can be mitigated using appropriate informatics tools. This work highlights the need for ongoing development of diagnostic pipelines to maximize test sensitivity. We also draw attention to the large differences in computational infrastructure required to perform day-to-day versus large-scale reprocessing tasks.

Identification of cDNAs encoding viper venom hyaluronidases: cross-generic sequence conservation of full-length and unusually short variant transcripts.

PubMed

Harrison, Robert A; Ibison, Frances; Wilbraham, Davina; Wagstaff, Simon C

2007-05-01

The immobilisation of prey by snakes is most efficiently achieved by the rapid dissemination of venom from its site of injection into the blood stream. Hyaluronidase is a common component of snake venoms and has been termed the "venom spreading factor". In the absence of nucleotide or protein sequence data to confirm the functional identity of this venom component, we interrogated a venom gland EST database for the saw-scaled viper, Echis ocellatus (Nigeria), using the gene ontology (GO) term "carbohydrate metabolism". A single hyalurononglucosaminadase-activity matching sequence (EOC00242) was found and used to design PCR primers to acquire the full-length cDNA sequence. Although very different from the bee venom and mammalian hyaluronidase sequences, the E. ocellatus sequence retained all the catalytic, positional and structural residues that characterise this class of carbohydrate metabolising hydrolases. An extraordinarily high level of sequence identity (>95%) was observed in analogous venom gland cDNA sequences isolated (by PCR) from another saw-scaled viper species, E. pyramidum leakeyi (Kenya), and from the sahara horned viper, Cerastes cerastes cerastes (Egypt) and the puff adder, Bitis arietans (Nigeria). Smaller amplicons, lacking hyaluronidase catalytic residues because of 768 bp or 855 bp central deletions, appear to encode either truncated peptides without hyaluronidase activity, or are non-translated transcripts because they lack consensus translation initiating motifs.

The complete chloroplast genome of Aconitum chiisanense Nakai (Ranunculaceae).

PubMed

Lim, Chae Eun; Kim, Goon-Bo; Baek, Seunghoon; Han, Su-Min; Yu, Hee-Ju; Mun, Jeong-Hwan

2017-01-01

We determined the complete chloroplast DNA sequence of Aconitum chiisanense Nakai, a rare Aconitum species endemic to Korea. The chloroplast genome is 155 934 bp in length and contains 4 rRNA, 30 tRNA, and 78 protein-coding genes. Phylogenetic analysis revealed that the chloroplast genome of A. chiisanense is closely related to that of A. barbatum var. puberulum. Sequence comparison with other Ranunculaceae chloroplasts identified a unique deletion in the rps16 gene of A. chiisanense chloroplast DNA that can serve as a molecular marker for species identification.

Repetitive sequences in plant nuclear DNA: types, distribution, evolution and function.

PubMed

Mehrotra, Shweta; Goyal, Vinod

2014-08-01

Repetitive DNA sequences are a major component of eukaryotic genomes and may account for up to 90% of the genome size. They can be divided into minisatellite, microsatellite and satellite sequences. Satellite DNA sequences are considered to be a fast-evolving component of eukaryotic genomes, comprising tandemly-arrayed, highly-repetitive and highly-conserved monomer sequences. The monomer unit of satellite DNA is 150-400 base pairs (bp) in length. Repetitive sequences may be species- or genus-specific, and may be centromeric or subtelomeric in nature. They exhibit cohesive and concerted evolution caused by molecular drive, leading to high sequence homogeneity. Repetitive sequences accumulate variations in sequence and copy number during evolution, hence they are important tools for taxonomic and phylogenetic studies, and are known as "tuning knobs" in the evolution. Therefore, knowledge of repetitive sequences assists our understanding of the organization, evolution and behavior of eukaryotic genomes. Repetitive sequences have cytoplasmic, cellular and developmental effects and play a role in chromosomal recombination. In the post-genomics era, with the introduction of next-generation sequencing technology, it is possible to evaluate complex genomes for analyzing repetitive sequences and deciphering the yet unknown functional potential of repetitive sequences. Copyright © 2014 The Authors. Production and hosting by Elsevier Ltd.. All rights reserved.

Molecular cloning and preliminary function study of iron responsive element binding protein 1 gene from cypermethrin-resistant Culex pipiens pallens

PubMed Central

2011-01-01

Background Insecticide resistance jeopardizes the control of mosquito populations and mosquito-borne disease control, which creates a major public health concern. Two-dimensional electrophoresis identified one protein segment with high sequence homology to part of Aedes aegypti iron-responsive element binding protein (IRE-BP). Method RT-PCR and RACE (rapid amplification of cDNA end) were used to clone a cDNA encoding full length IRE-BP 1. Real-time quantitative RT-PCR was used to evaluate the transcriptional level changes in the Cr-IRE strain Aedes aegypti compared to the susceptible strain of Cx. pipiens pallens. The expression profile of the gene was established in the mosquito life cycle. Methyl tritiated thymidine (3H-TdR) was used to observe the cypermethrin resistance changes in C6/36 cells containing the stably transfected IRE-BP 1 gene of Cx. pipiens pallens. Results The complete sequence of iron responsive element binding protein 1 (IRE-BP 1) has been cloned from the cypermethrin-resistant strain of Culex pipiens pallens (Cr-IRE strain). Quantitative RT-PCR analysis indicated that the IRE-BP 1 transcription level was 6.7 times higher in the Cr-IRE strain than in the susceptible strain of 4th instar larvae. The IRE-BP 1 expression was also found to be consistently higher throughout the life cycle of the Cr-IRE strain. A protein of predicted size 109.4 kDa has been detected by Western blotting in IRE-BP 1-transfected mosquito C6/36 cells. These IRE-BP 1-transfected cells also showed enhanced cypermethrin resistance compared to null-transfected or plasmid vector-transfected cells as determined by 3H-TdR incorporation. Conclusion IRE-BP 1 is expressed at higher levels in the Cr-IRE strain, and may confer some insecticide resistance in Cx. pipiens pallens. PMID:22075242

Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

PubMed

Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

2016-08-24

To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.

Comparison of Ion Personal Genome Machine Platforms for the Detection of Variants in BRCA1 and BRCA2.

PubMed

Hwang, Sang Mee; Lee, Ki Chan; Lee, Min Seob; Park, Kyoung Un

2018-01-01

Transition to next generation sequencing (NGS) for BRCA1 / BRCA2 analysis in clinical laboratories is ongoing but different platforms and/or data analysis pipelines give different results resulting in difficulties in implementation. We have evaluated the Ion Personal Genome Machine (PGM) Platforms (Ion PGM, Ion PGM Dx, Thermo Fisher Scientific) for the analysis of BRCA1 /2. The results of Ion PGM with OTG-snpcaller, a pipeline based on Torrent mapping alignment program and Genome Analysis Toolkit, from 75 clinical samples and 14 reference DNA samples were compared with Sanger sequencing for BRCA1 / BRCA2 . Ten clinical samples and 14 reference DNA samples were additionally sequenced by Ion PGM Dx with Torrent Suite. Fifty types of variants including 18 pathogenic or variants of unknown significance were identified from 75 clinical samples and known variants of the reference samples were confirmed by Sanger sequencing and/or NGS. One false-negative results were present for Ion PGM/OTG-snpcaller for an indel variant misidentified as a single nucleotide variant. However, eight discordant results were present for Ion PGM Dx/Torrent Suite with both false-positive and -negative results. A 40-bp deletion, a 4-bp deletion and a 1-bp deletion variant was not called and a false-positive deletion was identified. Four other variants were misidentified as another variant. Ion PGM/OTG-snpcaller showed acceptable performance with good concordance with Sanger sequencing. However, Ion PGM Dx/Torrent Suite showed many discrepant results not suitable for use in a clinical laboratory, requiring further optimization of the data analysis for calling variants.

Characterization of a linear DNA plasmid from the filamentous fungal plant pathogen Glomerella musae [Anamorph: Colletotrichum musae (Berk. and Curt.) arx.

USGS Publications Warehouse

Freeman, S.; Redman, R.S.; Grantham, G.; Rodriguez, R.J.

1997-01-01

A 7.4-kilobase (kb) DNA plasmid was isolated from Glomerella musae isolate 927 and designated pGML1. Exonuclease treatments indicated that pGML1 was a linear plasmid with blocked 5' termini. Cell-fractionation experiments combined with sequence-specific PCR amplification revealed that pGML1 resided in mitochondria. The pGML1 plasmid hybridized to cesium chloride-fractionated nuclear DNA but not to A + T-rich mitochondrial DNA. An internal 7.0-kb section of pGML1 was cloned and did not hybridize with either nuclear or mitochondrial DNA from G. musae. Sequence analysis revealed identical terminal inverted repeats (TIR) of 520 bp at the ends of the cloned 7.0-kb section of pGML1. The occurrence of pGML1 did not correspond with the pathogenicity of G. musae on banana fruit. Four additional isolates of G. musae possessed extrachromosomal DNA fragments similar in size and sequence to pGML1.

Isolation and sequencing of the gene encoding Sp23, a structural protein of spermatophore of the mealworm beetle, Tenebrio molitor.

PubMed

Feng, X; Happ, G M

1996-11-14

The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.

Spatial Organization of the Core Region of Yeast TFIIIB-DNA Complexes

PubMed Central

Persinger, Jim; Sengupta, Sarojini M.; Bartholomew, Blaine

1999-01-01

The interaction of yeast TFIIIB with the region upstream of the SUP4 tRNATyr gene was extensively probed by use of photoreactive phosphodiesters, deoxyuridines, and deoxycytidines that are site specifically incorporated into DNA. The TATA binding protein (TBP) was found to be in close proximity to the minor groove of a TATA-like DNA sequence that starts 30 nucleotides upstream of the start site of transcription. TBP was cross-linked to the phosphate backbone of DNA from bp −30 to −20 in the nontranscribed strand and from bp −28 to −24 in the transcribed strand (+1 denotes the start site of transcription). Most of the major groove of DNA in this region was shown not to be in close proximity to TBP, thus resembling the binding of TBP to the TATA box, with one notable exception. TBP was shown to interact with the major groove of DNA primarily at bp −23 and to a lesser degree at bp −25 in the transcribed strand. The stable interaction of TBP with the major groove at bp −23 was shown to require the B" subunit of TFIIIB. The S4 helix and flanking region of TBP were shown to be proximal to the major groove of DNA by peptide mapping of the region of TBP cross-linked at bp −23. Thus, TBP in the TFIIIB-SUP4 gene promoter region is bound in the same direction as TBP bound to the TATA box with respect to the transcription start site. The B" and TFIIB-related factor (BRF) subunits of TFIIIB are positioned on opposite sides of the TBP-DNA core of the TFIIIB complex, as indicated by correlation of cross-linking data to the crystal structure of the TBP-TATA box complex. Evidence is given for BRF binding near the C-terminal stirrup of TBP, similar to that of TFIIB near the TBP-TATA box complex. The protein clamp formed around the TBP-DNA complex by BRF and B" would help explain the long half-life of the TFIIIB-DNA complex and its resistance to polyanions and high salt. The path of DNA traversing the surface of TBP at the 3′ end of the TATA-like element in the SUP4 tRNA gene is not the same as that of TBP bound to a TATA box element, as shown by the cross-linking of TBP at bp −23. PMID:10373570

Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

PubMed

Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

2010-08-01

In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

Recent advances in rice genome and chromosome structure research by fluorescence in situ hybridization (FISH).

PubMed

Ohmido, Nobuko; Fukui, Kiichi; Kinoshita, Toshiro

2010-01-01

Fluorescence in situ hybridization (FISH) is an effective method for the physical mapping of genes and repetitive DNA sequences on chromosomes. Physical mapping of unique nucleotide sequences on specific rice chromosome regions was performed using a combination of chromosome identification and highly sensitive FISH. Increases in the detection sensitivity of smaller DNA sequences and improvements in spatial resolution have ushered in a new phase in FISH technology. Thus, it is now possible to perform in situ hybridization on somatic chromosomes, pachytene chromosomes, and even on extended DNA fibers (EDFs). Pachytene-FISH allows the integration of genetic linkage maps and quantitative chromosome maps. Visualization methods using FISH can reveal the spatial organization of the centromere, heterochromatin/euchromatin, and the terminal structures of rice chromosomes. Furthermore, EDF-FISH and the DNA combing technique can resolve a spatial distance of 1 kb between adjacent DNA sequences, and the detection of even a 300-bp target is now feasible. The copy numbers of various repetitive sequences and the sizes of various DNA molecules were quantitatively measured using the molecular combing technique. This review describes the significance of these advances in molecular cytology in rice and discusses future applications in plant studies using visualization techniques.

A PCR-based epidemiological survey of Hepatozoon canis in dogs in Nigeria.

PubMed

Sasaki, Mizuki; Omobowale, Olutayo; Ohta, Kaisaku; Tozuka, Morito; Matsuu, Aya; Hirata, Haruyuki; Nottidge, Helen Oyebukola; Ikadai, Hiromi; Oyamada, Takashi

2008-07-01

The prevalence of Hepatozoon canis infections in dogs in Nigeria was surveyed using molecular methods. DNA was extracted from blood samples obtained from 400 dogs. A primer set that amplified the Babesia canis 18S rRNA gene, which has high similarity to the H. canis 18S rRNA gene, was used for the PCR. As a result, samples from 81 dogs (20.3%) produced 757 bp bands, which differed from the 698 bp band that corresponded to B. canis infection. The sequence of the PCR products of 10 samples were determined, all of which corresponded with the H. canis sequence.

Mutations altering the cleavage specificity of a homing endonuclease

PubMed Central

Seligman, Lenny M.; Chisholm, Karen M.; Chevalier, Brett S.; Chadsey, Meggen S.; Edwards, Samuel T.; Savage, Jeremiah H.; Veillet, Adeline L.

2002-01-01

The homing endonuclease I-CreI recognizes and cleaves a particular 22 bp DNA sequence. The crystal structure of I-CreI bound to homing site DNA has previously been determined, leading to a number of predictions about specific protein–DNA contacts. We test these predictions by analyzing a set of endonuclease mutants and a complementary set of homing site mutants. We find evidence that all structurally predicted I-CreI/DNA contacts contribute to DNA recognition and show that these contacts differ greatly in terms of their relative importance. We also describe the isolation of a collection of altered specificity I-CreI derivatives. The in vitro DNA-binding and cleavage properties of two such endonucleases demonstrate that our genetic approach is effective in identifying homing endonucleases that recognize and cleave novel target sequences. PMID:12202772

High resolution optical DNA mapping

NASA Astrophysics Data System (ADS)

Baday, Murat

Many types of diseases including cancer and autism are associated with copy-number variations in the genome. Most of these variations could not be identified with existing sequencing and optical DNA mapping methods. We have developed Multi-color Super-resolution technique, with potential for high throughput and low cost, which can allow us to recognize more of these variations. Our technique has made 10--fold improvement in the resolution of optical DNA mapping. Using a 180 kb BAC clone as a model system, we resolved dense patterns from 108 fluorescent labels of two different colors representing two different sequence-motifs. Overall, a detailed DNA map with 100 bp resolution was achieved, which has the potential to reveal detailed information about genetic variance and to facilitate medical diagnosis of genetic disease.

Molecular detection and characterization of Anaplasma platys in dogs and ticks in Cuba.

PubMed

Silva, Claudia Bezerra da; Santos, Huarrisson Azevedo; Navarrete, Maylín González; Ribeiro, Carla Carolina Dias Uzedo; Gonzalez, Belkis Corona; Zaldivar, Maykelin Fuentes; Pires, Marcus Sandes; Peckle, Maristela; Costa, Renata Lins da; Vitari, Gabriela Lopes Vivas; Massard, Carlos Luiz

2016-07-01

Canine cyclic thrombocytopenia, an infectious disease caused by Anaplasma platys is a worldwide dog health problem. This study aimed to detect and characterize A. platys deoxyribonucleic acid (DNA) in dogs and ticks from Cuba using molecular methods. The study was conducted in four cities of Cuba (Habana del Este, Boyeros, Cotorro and San José de las Lajas). Blood samples were collected from 100 dogs in these cities. The animals were inspected for the detection of tick infestation and specimens were collected. Genomic DNA was extracted from dog blood and ticks using a commercial kit. Genomic DNA samples from blood and ticks were tested by a nested polymerase chain reaction (nPCR) to amplify 678 base pairs (bp) from the 16S ribosomal DNA (rDNA) of A. platys. Positive samples in nPCR were also subjected to PCR to amplify a fragment of 580bp from the citrate synthase (gltA) gene and the products were sequenced. Only Rhipicephalus sanguineus sensu lato (s.l.) was found on dogs, and 10.20% (n=5/49) of these ticks plus sixteen percent (16.0%, n=16/100) of dogs were considered positive for A. platys by nPCR targeting the 16S rDNA gene. All analyzed gltA and 16S rDNA sequences showed a 99-100% identity with sequences of A. platys reported in around the world. Phylogenetic analysis showed two defined clusters for the 16S rDNA gene and three defined clusters for the gltA gene. Based on the gltA gene, the deduced amino acid sequence showed two mutations at positions 88 and 168 compared with the sequence DQ525687 (GenBank ID from Italian sample), used as a reference in the alignment. A preliminary study on the epidemiological aspects associated with infection by A. platys showed no statistical association with the variables studied (p>0.05). This is the first evidence of the presence of A. platys in dogs and ticks in Cuba. Further studies are needed to evaluate the epidemiological aspects of A. platys infection in Cuban dogs. Copyright © 2016 Elsevier GmbH. All rights reserved.

Whole genome sequence and genome annotation of Colletotrichum acutatum, causal agent of anthracnose in pepper plants in South Korea.

PubMed

Han, Joon-Hee; Chon, Jae-Kyung; Ahn, Jong-Hwa; Choi, Ik-Young; Lee, Yong-Hwan; Kim, Kyoung Su

2016-06-01

Colletotrichum acutatum is a destructive fungal pathogen which causes anthracnose in a wide range of crops. Here we report the whole genome sequence and annotation of C. acutatum strain KC05, isolated from an infected pepper in Kangwon, South Korea. Genomic DNA from the KC05 strain was used for the whole genome sequencing using a PacBio sequencer and the MiSeq system. The KC05 genome was determined to be 52,190,760 bp in size with a G + C content of 51.73% in 27 scaffolds and to contain 13,559 genes with an average length of 1516 bp. Gene prediction and annotation were performed by incorporating RNA-Seq data. The genome sequence of the KC05 was deposited at DDBJ/ENA/GenBank under the accession number LUXP00000000.

Mitochondrial genomes of the jungle crow Corvus macrorhynchos (Passeriformes: Corvidae) from shed feathers and a phylogenetic analysis of genus Corvus using mitochondrial protein-coding genes.

PubMed

Krzeminska, Urszula; Wilson, Robyn; Rahman, Sadequr; Song, Beng Kah; Seneviratne, Sampath; Gan, Han Ming; Austin, Christopher M

2016-07-01

The complete mitochondrial genomes of two jungle crows (Corvus macrorhynchos) were sequenced. DNA was extracted from tissue samples obtained from shed feathers collected in the field in Sri Lanka and sequenced using the Illumina MiSeq Personal Sequencer. Jungle crow mitogenomes have a structural organization typical of the genus Corvus and are 16,927 bp and 17,066 bp in length, both comprising 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal subunit genes, and a non-coding control region. In addition, we complement already available house crow (Corvus spelendens) mitogenome resources by sequencing an individual from Singapore. A phylogenetic tree constructed from Corvidae family mitogenome sequences available on GenBank is presented. We confirm the monophyly of the genus Corvus and propose to use complete mitogenome resources for further intra- and interspecies genetic studies.

Site-Specific Integration of Foreign DNA into Minimal Bacterial and Human Target Sequences Mediated by a Conjugative Relaxase

PubMed Central

Agúndez, Leticia; González-Prieto, Coral; Machón, Cristina; Llosa, Matxalen

2012-01-01

Background Bacterial conjugation is a mechanism for horizontal DNA transfer between bacteria which requires cell to cell contact, usually mediated by self-transmissible plasmids. A protein known as relaxase is responsible for the processing of DNA during bacterial conjugation. TrwC, the relaxase of conjugative plasmid R388, is also able to catalyze site-specific integration of the transferred DNA into a copy of its target, the origin of transfer (oriT), present in a recipient plasmid. This reaction confers TrwC a high biotechnological potential as a tool for genomic engineering. Methodology/Principal Findings We have characterized this reaction by conjugal mobilization of a suicide plasmid to a recipient cell with an oriT-containing plasmid, selecting for the cointegrates. Proteins TrwA and IHF enhanced integration frequency. TrwC could also catalyze integration when it is expressed from the recipient cell. Both Y18 and Y26 catalytic tyrosil residues were essential to perform the reaction, while TrwC DNA helicase activity was dispensable. The target DNA could be reduced to 17 bp encompassing TrwC nicking and binding sites. Two human genomic sequences resembling the 17 bp segment were accepted as targets for TrwC-mediated site-specific integration. TrwC could also integrate the incoming DNA molecule into an oriT copy present in the recipient chromosome. Conclusions/Significance The results support a model for TrwC-mediated site-specific integration. This reaction may allow R388 to integrate into the genome of non-permissive hosts upon conjugative transfer. Also, the ability to act on target sequences present in the human genome underscores the biotechnological potential of conjugative relaxase TrwC as a site-specific integrase for genomic modification of human cells. PMID:22292089

Three closely related herpesviruses are associated with fibropapillomatosis in marine turtles

USGS Publications Warehouse

Quackenbush, S.L.; Work, Thierry M.; Balazs, George H.; Casey, Rufina N.; Rovnak, J.; Chaves, A.; duToit, L.; Baines, J.D.; Parrish, C.R.; Bowser, Paul R.; Casey, James W.

1998-01-01

Green turtle fibropapillomatosis is a neoplastic disease of increasingly significant threat to the survivability of this species. Degenerate PCR primers that target highly conserved regions of genes encoding herpesvirus DNA polymerases were used to amplify a DNA sequence from fibropapillomas and fibromas from Hawaiian and Florida green turtles. All of the tumors tested (n= 23) were found to harbor viral DNA, whereas no viral DNA was detected in skin biopsies from tumor-negative turtles. The tissue distribution of the green turtle herpesvirus appears to be generally limited to tumors where viral DNA was found to accumulate at approximately two to five copies per cell and is occasionally detected, only by PCR, in some tissues normally associated with tumor development. In addition, herpesviral DNA was detected in fibropapillomas from two loggerhead and four olive ridley turtles. Nucleotide sequencing of a 483-bp fragment of the turtle herpesvirus DNA polymerase gene determined that the Florida green turtle and loggerhead turtle sequences are identical and differ from the Hawaiian green turtle sequence by five nucleotide changes, which results in two amino acid substitutions. The olive ridley sequence differs from the Florida and Hawaiian green turtle sequences by 15 and 16 nucleotide changes, respectively, resulting in four amino acid substitutions, three of which are unique to the olive ridley sequence. Our data suggest that these closely related turtle herpesviruses are intimately involved in the genesis of fibropapillomatosis.

Molecular Population Genetics of the Alcohol Dehydrogenase Gene Region of DROSOPHILA MELANOGASTER

PubMed Central

Aquadro, Charles F.; Desse, Susan F.; Bland, Molly M.; Langley, Charles H.; Laurie-Ahlberg, Cathy C.

1986-01-01

Variation in the DNA restriction map of a 13-kb region of chromosome II including the alcohol dehydrogenase structural gene (Adh) was examined in Drosophila melanogaster from natural populations. Detailed analysis of 48 D. melanogaster lines representing four eastern United States populations revealed extensive DNA sequence variation due to base substitutions, insertions and deletions. Cloning of this region from several lines allowed characterization of length variation as due to unique sequence insertions or deletions [nine sizes; 21–200 base pairs (bp)] or transposable element insertions (several sizes, 340 bp to 10.2 kb, representing four different elements). Despite this extensive variation in sequences flanking the Adh gene, only one length polymorphism is clearly associated with altered Adh expression (a copia element approximately 250 bp 5' to the distal transcript start site). Nonetheless, the frequency spectra of transposable elements within and between Drosophila species suggests they are slightly deleterious. Strong nonrandom associations are observed among Adh region sequence variants, ADH allozyme (Fast vs. Slow), ADH enzyme activity and the chromosome inversion ln(2L) t. Phylogenetic analysis of restriction map haplotypes suggest that the major twofold component of ADH activity variation (high vs. low, typical of Fast and Slow allozymes, respectively) is due to sequence variation tightly linked to and possibly distinct from that underlying the allozyme difference. The patterns of nucleotide and haplotype variation for Fast and Slow allozyme lines are consistent with the recent increase in frequency and spread of the Fast haplotype associated with high ADH activity. These data emphasize the important role of evolutionary history and strong nonrandom associations among tightly linked sequence variation as determinants of the patterns of variation observed in natural populations. PMID:3026893

A novel deletion/insertion mutation in the mRNA transcribed from one {alpha}1(I) collagen allele in a family with dominant type III OI and germline mosaicism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, O.; Masters, C.; Lewis, M.B.

1994-09-01

In an 8-year-old girl and her father, both of whom have severe type III OI, we have previously used RNA/RNA hybrid analysis to demonstrate a mismatch in the region of {alpha}1(I) mRNA coding for aa 558-861. We used SSCP to further localize the abnormality to a subregion coding for aa 579-679. This region was subcloned and sequenced. Each patient`s cDNA has a deletion of the sequences coding for the last residue of exon 34, and all of exons 35 and 36 (aa 604-639), followed by an insertion of 156 nt from the 3{prime}-end of intron 36. PCR amplification of leukocytemore » DNA from the patients and the clinically normal paternal grandmother yielded two fragments: a 1007 bp fragment predicted from normal genomic sequences and a 445 bp fragment. Subcloning and sequencing of the shorter genomic PCR product confirmed the presence of a 565 bp genomic deletion from the end of exon 34 to the middle of intron 36. The abnormal protein is apparently synthesized and incorporated into helix. The inserted nucleotides are in frame with the collagenous sequence and contain no stop codons. They encode a 52 aa non-collagenous region. The fibroblast procollagen of the patients has both normal and electrophoretically delayed pro{alpha}(I) bands. The electrophoretically delayed procollagen is very sensitive to pepsin or trypsin digestion, as predicted by its non-collagenous sequence, and cannot be visualized as collagen. This unique OI collagen mutation is an excellent candidate for molecular targeting to {open_quotes}turn off{close_quotes} a dominant mutant allele.« less

Molecular phylogeny for marine turtles based on sequences of the ND4-leucine tRNA and control regions of mitochondrial DNA.

PubMed

Dutton, P H; Davis, S K; Guerra, T; Owens, D

1996-06-01

Marine turtles are divided into two families, the Dermochelyidae and the Cheloniidae. The majority of species are currently placed within the two tribes of the Cheloniidae, the Chelonini and the Carettini, but debate continues over generic and tribal affinities as well as species boundaries. We used nucleotide sequences (907 bp) from the ND4-LEU tRNA region and the control region (526 bp) of mitochondrial DNA to resolve areas of uncertainty in marine turtle (Chelonioidae) systematics. The ND4-LEU tRNA fragment was more conserved than the fragment from the control region, with sequence divergences ranging from 0.026 to 0.148 and 0.067 to 0.267, respectively. Parsimony analysis based only on the ND4-LEU tRNA data suggests that the hawksbill, Eretmochelys imbricata, lies within the tribe Carettni and is closely related to the genus Caretta, but could not resolve the position of the flatback, Natator depressus. A similar analysis based only on the control region sequence data suggested that N. depressus is affiliated with the Chelonini, but failed to resolve the position of E. imbricata and the loggerhead, Caretta caretta. In contrast to these results, the combination of both data sets with published cytochrome b data produced a phylogeny based on 1924 bp of sequence data which resolves the position of E. imbricata relative to Caretta and Lepidochelys and joins N. depressus as sister to the Carettini. Based on the molecular data, the Chelonini contains the Chelonia species, while the Carettini contains the remaining species of Cheloniidae. The control region sequence divergence between Pacific and Atlantic populations of the leatherback, Dermochelys coriacea, was relatively low (0.0081) when compared with the green turtle, Chelonia mydas (0.071-0.074). Atlantic and Pacific populations of Ch. mydas were found to be paraphyletic with respect to the black turtle, Ch. agassizi, suggesting that the current taxonomic designations within the Pacific Chelonia are questionable. This analysis shows the utility of combining sequence data for different regions of mtDNA that by themselves are insufficient to obtain robust phylogenies.

TopBP1 deficiency causes an early embryonic lethality and induces cellular senescence in primary cells.

PubMed

Jeon, Yoon; Ko, Eun; Lee, Kyung Yong; Ko, Min Ji; Park, Seo Young; Kang, Jeeheon; Jeon, Chang Hwan; Lee, Ho; Hwang, Deog Su

2011-02-18

TopBP1 plays important roles in chromosome replication, DNA damage response, and other cellular regulatory functions in vertebrates. Although the roles of TopBP1 have been studied mostly in cancer cell lines, its physiological function remains unclear in mice and untransformed cells. We generated conditional knock-out mice in which exons 5 and 6 of the TopBP1 gene are flanked by loxP sequences. Although TopBP1-deficient embryos developed to the blastocyst stage, no homozygous mutant embryos were recovered at E8.5 or beyond, and completely resorbed embryos were frequent at E7.5, indicating that mutant embryos tend to die at the peri-implantation stage. This finding indicated that TopBP1 is essential for cell proliferation during early embryogenesis. Ablation of TopBP1 in TopBP1(flox/flox) mouse embryonic fibroblasts and 3T3 cells using Cre recombinase-expressing retrovirus arrests cell cycle progression at the G(1), S, and G(2)/M phases. The TopBP1-ablated mouse cells exhibit phosphorylation of H2AX and Chk2, indicating that the cells contain DNA breaks. The TopBP1-ablated mouse cells enter cellular senescence. Although RNA interference-mediated knockdown of TopBP1 induced cellular senescence in human primary cells, it induced apoptosis in cancer cells. Therefore, TopBP1 deficiency in untransformed mouse and human primary cells induces cellular senescence rather than apoptosis. These results indicate that TopBP1 is essential for cell proliferation and maintenance of chromosomal integrity.

Porcine MAP3K5 analysis: molecular cloning, characterization, tissue expression pattern, and copy number variations associated with residual feed intake.

PubMed

Pu, L; Zhang, L C; Zhang, J S; Song, X; Wang, L G; Liang, J; Zhang, Y B; Liu, X; Yan, H; Zhang, T; Yue, J W; Li, N; Wu, Q Q; Wang, L X

2016-08-12

Mitogen-activated protein kinase kinase kinase 5 (MAP3K5) is essential for apoptosis, proliferation, differentiation, and immune responses, and is a candidate marker for residual feed intake (RFI) in pig. We cloned the full-length cDNA sequence of porcine MAP3K5 by rapid-amplification of cDNA ends. The 5451-bp gene contains a 5'-untranslated region (UTR) (718 bp), a coding region (3738 bp), and a 3'-UTR (995 bp), and encodes a peptide of 1245 amino acids, which shares 97, 99, 97, 93, 91, and 84% sequence identity with cattle, sheep, human, mouse, chicken, and zebrafish MAP3K5, respectively. The deduced MAP3K5 protein sequence contains two conserved domains: a DUF4071 domain and a protein kinase domain. Phylogenetic analysis showed that porcine MAP3K5 forms a separate branch to vicugna and camel MAP3K5. Tissue expression analysis using real-time quantitative polymerase chain reaction (qRT-PCR) revealed that MAP3K5 was expressed in the heart, liver, spleen, lung, kidney, muscle, fat, pancrea, ileum, and stomach tissues. Copy number variation was detected for porcine MAP3K5 and validated by qRT-PCR. Furthermore, a significant increase in average copy number was detected in the low RFI group when compared to the high RFI group in a Duroc pig population. These results provide useful information regarding the influence of MAP3K5 on RFI in pigs.

Complete Genome Sequences of 44 Arthrobacter Phages.

PubMed

Klyczek, Karen K; Jacobs-Sera, Deborah; Adair, Tamarah L; Adams, Sandra D; Ball, Sarah L; Benjamin, Robert C; Bonilla, J Alfred; Breitenberger, Caroline A; Daniels, Charles J; Gaffney, Bobby L; Harrison, Melinda; Hughes, Lee E; King, Rodney A; Krukonis, Gregory P; Lopez, A Javier; Monsen-Collar, Kirsten; Pizzorno, Marie C; Rinehart, Claire A; Staples, Amanda K; Stowe, Emily L; Garlena, Rebecca A; Russell, Daniel A; Cresawn, Steven G; Pope, Welkin H; Hatfull, Graham F

2018-02-01

We report here the complete genome sequences of 44 phages infecting Arthrobacter sp. strain ATCC 21022. These phages have double-stranded DNA genomes with sizes ranging from 15,680 to 70,707 bp and G+C contents from 45.1% to 68.5%. All three tail types (belonging to the families Siphoviridae , Myoviridae , and Podoviridae ) are represented. Copyright © 2018 Klyczek et al.

Complete Genome Sequences of 44 Arthrobacter Phages

PubMed Central

Klyczek, Karen K.; Adair, Tamarah L.; Adams, Sandra D.; Ball, Sarah L.; Benjamin, Robert C.; Bonilla, J. Alfred; Breitenberger, Caroline A.; Daniels, Charles J.; Gaffney, Bobby L.; Harrison, Melinda; Hughes, Lee E.; King, Rodney A.; Krukonis, Gregory P.; Lopez, A. Javier; Monsen-Collar, Kirsten; Pizzorno, Marie C.; Staples, Amanda K.; Stowe, Emily L.; Garlena, Rebecca A.; Russell, Daniel A.

2018-01-01

ABSTRACT We report here the complete genome sequences of 44 phages infecting Arthrobacter sp. strain ATCC 21022. These phages have double-stranded DNA genomes with sizes ranging from 15,680 to 70,707 bp and G+C contents from 45.1% to 68.5%. All three tail types (belonging to the families Siphoviridae, Myoviridae, and Podoviridae) are represented. PMID:29437090

Genomic and molecular analysis of phage CMP1 from Clavibacter michiganensis subspecies michiganensis

PubMed Central

Wittmann, Johannes; Gartemann, Karl-Heinz; Eichenlaub, Rudolf

2011-01-01

Bacteriophage CMP1 is a member of the Siphoviridae family that infects specifically the plant-pathogen Clavibacter michiganensis subsp. michiganensis. The linear double- stranded DNA is terminally redundant and not circularly permuted. The complete nucleotide sequence of the bacteriophage CMP1 genome consists of 58,652 bp including the terminal redundant ends of 791 bp. The G+C content of the phage (57%) is significantly lower than that of its host (72.66%). 74 potential open reading frames were identified and annotated by different bioinformatic tools. Two large clusters which encode the early and the late functions could be identified which are divergently transcribed. There are only a few hypothetical gene products with conserved domains and significant similarity to sequences from the databases. Functional analyses confirmed the activity of four gene products, an endonuclease, an exonuclease, a single-stranded DNA binding protein and a thymidylate synthase. Partial genomic sequences of CN77, a phage of Clavibacter michiganensis subsp. nebraskensis, revealed a similar genome structure and significant similarities on the level of deduced amino acid sequences. An endolysin with peptidase activity has been identified for both phages, which may be good tools for disease control of tomato plants against Clavibacter infections. PMID:21687530

Genomic and molecular analysis of phage CMP1 from Clavibacter michiganensis subspecies michiganensis.

PubMed

Wittmann, Johannes; Gartemann, Karl-Heinz; Eichenlaub, Rudolf; Dreiseikelmann, Brigitte

2011-01-01

Bacteriophage CMP1 is a member of the Siphoviridae family that infects specifically the plant-pathogen Clavibacter michiganensis subsp. michiganensis. The linear double- stranded DNA is terminally redundant and not circularly permuted. The complete nucleotide sequence of the bacteriophage CMP1 genome consists of 58,652 bp including the terminal redundant ends of 791 bp. The G+C content of the phage (57%) is significantly lower than that of its host (72.66%). 74 potential open reading frames were identified and annotated by different bioinformatic tools. Two large clusters which encode the early and the late functions could be identified which are divergently transcribed. There are only a few hypothetical gene products with conserved domains and significant similarity to sequences from the databases. Functional analyses confirmed the activity of four gene products, an endonuclease, an exonuclease, a single-stranded DNA binding protein and a thymidylate synthase. Partial genomic sequences of CN77, a phage of Clavibacter michiganensis subsp. nebraskensis, revealed a similar genome structure and significant similarities on the level of deduced amino acid sequences. An endolysin with peptidase activity has been identified for both phages, which may be good tools for disease control of tomato plants against Clavibacter infections.

Droplet-Based Pyrosequencing Using Digital Microfluidics

PubMed Central

Boles, Deborah J.; Benton, Jonathan L.; Siew, Germaine J.; Levy, Miriam H.; Thwar, Prasanna K.; Sandahl, Melissa A.; Rouse, Jeremy L.; Perkins, Lisa C.; Sudarsan, Arjun P.; Jalili, Roxana; Pamula, Vamsee K.; Srinivasan, Vijay; Fair, Richard B.; Griffin, Peter B.; Eckhardt, Allen E.; Pollack, Michael G.

2013-01-01

The feasibility of implementing pyrosequencing chemistry within droplets using electrowetting-based digital microfluidics is reported. An array of electrodes patterned on a printed-circuit board was used to control the formation, transportation, merging, mixing, and splitting of submicroliter-sized droplets contained within an oil-filled chamber. A three-enzyme pyrosequencing protocol was implemented in which individual droplets contained enzymes, deoxyribonucleotide triphosphates (dNTPs), and DNA templates. The DNA templates were anchored to magnetic beads which enabled them to be thoroughly washed between nucleotide additions. Reagents and protocols were optimized to maximize signal over background, linearity of response, cycle efficiency, and wash efficiency. As an initial demonstration of feasibility, a portion of a 229 bp Candida parapsilosis template was sequenced using both a de novo protocol and a resequencing protocol. The resequencing protocol generated over 60 bp of sequence with 100% sequence accuracy based on raw pyrogram levels. Excellent linearity was observed for all of the homopolymers (two, three, or four nucleotides) contained in the C. parapsilosis sequence. With improvements in microfluidic design it is expected that longer reads, higher throughput, and improved process integration (i.e., “sample-to-sequence” capability) could eventually be achieved using this low-cost platform. PMID:21932784

Construction of a cDNA library from female adult of Toxocara canis, and analysis of EST and immune-related genes expressions.

PubMed

Zhou, Rongqiong; Xia, Qingyou; Huang, Hancheng; Lai, Min; Wang, Zhenxin

2011-10-01

Toxocara canis is a widespread intestinal nematode parasite of dogs, which can also cause disease in humans. We employed an expressed sequence tag (EST) strategy in order to study gene-expression including development, digestion and reproduction of T. canis. ESTs provided a rapid way to identify genes, particularly in organisms for which we have very little molecular information. In this study, a cDNA library was constructed from a female adult of T. canis and 215 high-quality ESTs from 5'-ends of the cDNA clones representing 79 unigenes were obtained. The titer of the primary cDNA library was 1.83×10(6)pfu/mL with a recombination rate of 99.33%. Most of the sequences ranged from 300 to 900bp with an average length of 656bp. Cluster analysis of these ESTs allowed identification of 79 unique sequences containing 28 contigs and 51 singletons. BLASTX searches revealed that 18 unigenes (22.78% of the total) or 70 ESTs (32.56% of the total) were novel genes that had no significant matches to any protein sequences in the public databases. The rest of the 61 unigenes (77.22% of the total) or 145 ESTs (67.44% of the total) were closely matched to the known genes or sequences deposited in the public databases. These genes were classified into seven groups based on their known or putative biological functions. We also confirmed the gene expression patterns of several immune-related genes using RT-PCR examination. This work will provide a valuable resource for the further investigations in the stage-, sex- and tissue-specific gene transcription or expression. Copyright © 2011. Published by Elsevier Inc.

Na+/K+-ATPase α-subunit in swimming crab Portunus trituberculatus: molecular cloning, characterization, and expression under low salinity stress

NASA Astrophysics Data System (ADS)

Han, Xiaolin; Liu, Ping; Gao, Baoquan; Wang, Haofeng; Duan, Yafei; Xu, Wenfei; Chen, Ping

2015-07-01

Na+/K+-ATPases are membrane-associated enzymes responsible for the active transport of Na+ and K+ ions across cell membranes, generating chemical and electrical gradients. These enzymes' α-subunit provides catalytic function, binding and hydrolyzing ATP, and itself becoming phosphorylated during the transport cycle. In this study, Na+/K+-ATPase α-subunit cDNA was cloned from gill tissue of the swimming crab Portunus trituberculatus by reverse-transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end methods. Analysis of the nucleotide sequence revealed that the cDNA had a full-length of 3 833 base pairs (bp), with an open reading frame of 3 120 bp, 5' untranslated region (UTR) of 317 bp, and 3' UTR of 396 bp. The sequence encoded a 1 039 amino acid protein with a predicted molecular weight of 115.57 kDa and with estimated pI of 5.21. It was predicted here to possess all expected features of Na+/K+-ATPase members, including eight transmembrane domains, putative ATP-binding site, and phosphorylation site. Comparison of amino acid sequences showed that the P. trituberculatus α-subunit possessed an overall identity of 75%-99% to that of other organisms. Phylogenetic analysis revealed that this α-subunit was in the same category as those of crustaceans. Quantitative real-time RT-PCR analysis indicated that this α-subunit's transcript were most highly expressed in gill and lowest in muscle. RT-PCR analysis also revealed that α-subunit expression in crab gill decreased after 2 and 6 h, but increased after 12, 24, 48, and 72 h. In addition, α-subunit expression in hepatopancreas of crab decreased after 2-72 h. These facts indicated that the crab's Na+/K+-ATPase α-subunit was potentially involved in the observed acute response to low salinity stress.

Diagnostic application of polymerase chain reaction for detection of Ehrlichia risticii in equine monocytic ehrlichiosis (Potomac horse fever).

PubMed

Biswas, B; Mukherjee, D; Mattingly-Napier, B L; Dutta, S K

1991-10-01

Genomic amplification by the polymerase chain reaction (PCR) was used to identify a unique genomic sequence of Ehrlichia risticii directly in DNA isolated from peripheral-blood buffy coat cells of E. risticii-infected horses (Potomac horse fever) and from infected cell cultures. A specific primer pair, selected from a cloned, species-specific, 1-kb DNA fragment of the E. risticii genome as a template, was used for the amplification of the target DNA of 247 bp. The optimal number of 40 PCR cycles, determined by analyzing an amplification profile obtained with a constant Taq polymerase concentration, was used to achieve maximum amplification of the E. risticii DNA segment. Efficient amplification of target DNA was achieved with specimens processed by either the phenol extraction or rapid lysis method. The specificity of the amplified DNA product was confirmed by the proper size (247 bp) and appropriate restriction enzyme cleavage pattern of the amplified target DNA, as well as by the specific hybridization signal obtained by using a PCR-amplified 185-bp internal DNA probe. A 10(5)- to 10(6)-fold amplification of target DNA, which allowed detection of E. risticii from as few as two to three infected cells in culture and from a very small volume of buffy coat cells from infected horses, was achieved. This PCR amplification procedure was found to be highly specific and sensitive for the detection of E. risticii for the study of Potomac horse fever.

Partial structure of the phylloxin gene from the giant monkey frog, Phyllomedusa bicolor: parallel cloning of precursor cDNA and genomic DNA from lyophilized skin secretion.

PubMed

Chen, Tianbao; Gagliardo, Ron; Walker, Brian; Zhou, Mei; Shaw, Chris

2005-12-01

Phylloxin is a novel prototype antimicrobial peptide from the skin of Phyllomedusa bicolor. Here, we describe parallel identification and sequencing of phylloxin precursor transcript (mRNA) and partial gene structure (genomic DNA) from the same sample of lyophilized skin secretion using our recently-described cloning technique. The open-reading frame of the phylloxin precursor was identical in nucleotide sequence to that previously reported and alignment with the nucleotide sequence derived from genomic DNA indicated the presence of a 175 bp intron located in a near identical position to that found in the dermaseptins. The highly-conserved structural organization of skin secretion peptide genes in P. bicolor can thus be extended to include that encoding phylloxin (plx). These data further reinforce our assertion that application of the described methodology can provide robust genomic/transcriptomic/peptidomic data without the need for specimen sacrifice.

Development of a Reporter System to Explore MMEJ in the Context of Replacing Large Genomic Fragments.

PubMed

Yanik, Mert; Ponnam, Surya Prakash Goud; Wimmer, Tobias; Trimborn, Lennart; Müller, Carina; Gambert, Isabel; Ginsberg, Johanna; Janise, Annabella; Domicke, Janina; Wende, Wolfgang; Lorenz, Birgit; Stieger, Knut

2018-06-01

Common genome-editing strategies are either based on non-homologous end joining (NHEJ) or, in the presence of a template DNA, based on homologous recombination with long (homology-directed repair [HDR]) or short (microhomology-mediated end joining [MMEJ]) homologous sequences. In the current study, we aim to develop a model system to test the activity of MMEJ after CRISPR/Cas9-mediated cleavage in cell culture. Following successful proof of concept in an episomally based reporter system, we tested template plasmids containing a promoter-less luciferase gene flanked by microhomologous sequences (mhs) of different length (5, 10, 15, 20, 30, and 50 bp) that are complementary to the mouse retinitis pigmentosa GTPase regulator (RPGR)-ORF15, which is under the control of a CMV promoter stably integrated into a HEK293 cell line. Luciferase signal appearance represented successful recombination events and was highest when the mhs were 5 bp long, while longer mhs revealed lower luciferase signal. In addition, presence of Csy4 RNase was shown to increase luciferase signaling. The luciferase reporter system is a valuable tool to study the input of the different DNA repair mechanisms in the replacement of large DNA sequences by mhs. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Isolation and Characterization of the PKAr Gene From a Plant Pathogen, Curvularia lunata.

PubMed

Liu, T; Ma, B C; Hou, J M; Zuo, Y H

2014-09-01

By using EST database from a full-length cDNA library of Curvularia lunata, we have isolated a 2.9 kb cDNA, termed PKAr. An ORF of 1,383 bp encoding a polypeptide of 460 amino acids with molecular weight 50.1 kDa, (GeneBank Acc. No. KF675744) was cloned. The deduced amino acid sequence of the PKAr shows 90 and 88 % identity with cAMP-dependent protein kinase A regulatory subunit from Alternaria alternate and Pyrenophora tritici-repentis Pt-1C-BFP, respectively. Database analysis revealed that the deduced amino acid sequence of PKAr shares considerable similarity with that of PKA regulatory subunits in other organisms, particularly in the conserved regions. No introns were identified within the 1,383 bp of ORF compared with PKAr genomic DNA sequence. Southern blot indicated that PKAr existed as a single copy per genome. The mRNA expression level of PKAr in different development stages were demonstrated using real-time quantitative PCR. The results showed that the level of PKAr expression was highest in vegetative growth mycelium, which indicated it might play an important role in the vegetative growth of C. lunata. These results provided a fundamental supporting research on the function of PKAr in plant pathogen, C. lunata.

Genetic characterization of Pompeii and Herculaneum Equidae buried by Vesuvius in 79 AD.

PubMed

Di Bernardo, G; Galderisi, U; Del Gaudio, S; D'Aniello, A; Lanave, C; De Robertis, M T; Cascino, Antonino; Cipollaro, M

2004-05-01

DNA extracted from the skeletons of five equids discovered in a Pompeii stable and of a horse found in Herculaneum was investigated. Amino acid racemization level was consistent with the presence of DNA. Post-mortem base modifications were excluded by sequencing a 146 bp fragment of the 16S rRNA mitochondrial gene. Sequencing of a 370 bp fragment of mitochondrial (mt)DNA control region allowed the construction of a phylogenetic tree that, along with sequencing of nuclear genes (epsilon globin, gamma interferon, and p53) fragments, gave us the possibility to address some questions puzzling archaeologists. What animals-donkeys, horses, or crossbreeds-were they? And, given they had been evidently assigned to one specific job, were they all akin or were they animals with different mitochondrial haplotypes? The conclusions provided by molecular analysis show that the Pompeii remains are those of horses and mules. Furthermore one of the equids (CAV5) seems to belong to a haplotype, which is either not yet documented in the GenBank or has since disappeared. As its characteristics closely recall those of donkeys, which is the out group chosen to construct the tree, that appears to have evolved within the Equidae family much earlier than horses, this assumption seems to be nearer the truth.

cDNA nucleotide sequence coding for stearoyl-CoA desaturase and its expression in the zebrafish (Danio rerio) embryo.

PubMed

Hsieh, S L; Liu, R W; Wu, C H; Cheng, W T; Kuo, Ching-Ming

2003-12-01

A cDNA sequence of stearoyl-CoA desaturase (SCD) was determined from zebrafish (Danio rerio) and compared to the corresponding genes in several teleosts. Zebrafish SCD cDNA has a size of 1,061 bp, encodes a polypeptide of 325 amino acids, and shares 88, 85, 84, and 83% similarities with tilapia (Oreochromis mossambicus), grass carp (Ctenopharyngodon idella), common carp (Cyprinus carpio), and milkfish (Chanos chanos), respectively. This 1,061 bp sequence specifies a protein that, in common with other fatty acid desaturases, contains three histidine boxes, believed to be involved in catalysis. These observations suggested that SCD genes are highly conserved. In addition, an oligonucleotide probe complementary to zebrafish SCD mRNA was hybridized to mRNA of approximately 396 bases with Northern blot analysis. The Northern blot and RT-PCR analyses showed that the SCD mRNA was expressed predominantly in the liver, intestine, gill, and muscle, while a lower level was found in the brain. Furthermore, we utilized whole-mount in situ hybridization and real-time quantitative RT-PCR to identify expression of the zebrafish SCD gene at five different stages of development. This revealed that very high levels of transcripts were found in zebrafish at all stages during embryogenesis and early development. Copyright 2003 Wiley-Liss, Inc.

Phylogenetic Analysis of Ruminant Theileria spp. from China Based on 28S Ribosomal RNA Gene

PubMed Central

Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze

2013-01-01

Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode. PMID:24327775

Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.

PubMed

Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

2013-10-01

Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.

Identification of a cis-Regulatory Element Involved in Phytochrome Down-Regulated Expression of the Pea Small GTPase Gene pra21

PubMed Central

Inaba, Takehito; Nagano, Yukio; Sakakibara, Toshihiro; Sasaki, Yukiko

1999-01-01

The pra2 gene encodes a pea (Pisum sativum) small GTPase belonging to the YPT/rab family, and its expression is down-regulated by light, mediated by phytochrome. We have isolated and characterized a genomic clone of this gene and constructed a fusion DNA of its 5′-upstream region in front of the gene for firefly luciferase. Using this construct in a transient assay, we determined a pra2 cis-regulatory region sufficient to direct the light down-regulation of the luciferase reporter gene. Both 5′- and internal deletion analyses revealed that the 93-bp sequence between −734 and −642 from the transcriptional start site was important for phytochrome down-regulation. Gain-of-function analysis showed that this 93-bp region could confer light down-regulation when fused to the cauliflower mosaic virus 35S promoter. Furthermore, linker-scanning analysis showed that a 12-bp sequence within the 93-bp region mediated phytochrome down-regulation. Gel-retardation analysis showed the presence of a nuclear factor that was specifically bound to the 12-bp sequence in vitro. These results indicate that this element is a cis-regulatory element involved in phytochrome down-regulated expression. PMID:10364400

A novel 5-bp deletion in Clarin 1 in a family with Usher syndrome.

PubMed

Akoury, Elie; El Zir, Elie; Mansour, Ahmad; Mégarbané, André; Majewski, Jacek; Slim, Rima

2011-11-01

To identify the genetic defect in a Lebanese family with two sibs diagnosed with Usher Syndrome. Exome capture and sequencing were performed on DNA from one affected member using Agilent in solution bead capture, followed by Illumina sequencing. This analysis revealed the presence of a novel homozygous 5-bp deletion, in Clarin 1 (CLRN1), a known gene responsible for Usher syndrome type III. The deletion is inherited from both parents and segregates with the disease phenotype in the family. The 5-bp deletion, c.301_305delGTCAT, p.Val101SerfsX27, is predicted to result in a frameshift and protein truncation after 27 amino acids. Sequencing all the coding regions of the CLRN1 gene in the proband did not reveal any other mutation or variant. Here we describe a novel deletion in CLRN1. Our data support previously reported intra familial variability in the clinical features of Usher syndrome type I and III.

Pea chloroplast tRNA(Lys) (UUU) gene: transcription and analysis of an intron-containing gene.

PubMed

Boyer, S K; Mullet, J E

1988-07-01

The pea chloroplast trnK gene which encodes tRNA(Lys) (UUU) was sequenced. TrnK is located 210 bp upstream from the promoter of psbA and immediately downstream from the 3'-end of rbcL. The gene is transcribed from the same DNA strand as psbA and rbcL. A 2447 bp intron with class II features is located in the trnK anticodon loop. The intron contains a 506 amino acid open reading frame which could encode an RNA maturase. The primary transcript of trnK is 2.9 kb long; its 5'-end was identified as a site of transcription initiation by in vitro transcription experiments. The 5'-terminus is adjacent to DNA sequences previously identified as transcription promoter elements. The most abundant trnK transcript is 2.5 kb long with termini corresponding to the 5' and 3' ends of the trnK exons. Intron specific RNAs were not detected. This suggests that RNA processing which produces tRNA(Lys) leads to rapid degradation of intron sequences.

Recognition of the Xenopus ribosomal core promoter by the transcription factor xUBF involves multiple HMG box domains and leads to an xUBF interdomain interaction.

PubMed

Leblanc, B; Read, C; Moss, T

1993-02-01

The interaction of the ribosomal transcription factor xUBF with the RNA polymerase I core promoter of Xenopus laevis has been studied both at the DNA and protein levels. It is shown that a single xUBF-DNA complex forms over the 40S initiation site (+1) and involves at least the DNA sequences between -20 and +60 bp. DNA sequences upstream of +10 and downstream of +18 are each sufficient to direct complex formation independently. HMG box 1 of xUBF independently recognizes the sequences -20 to -1 and +1 to +22 and the addition of the N-terminal dimerization domain to HMG box 1 stabilizes its interaction with these sequences approximately 10-fold. HMG boxes 2/3 interact with the DNA downstream of +22 and can independently position xUBF across the initiation site. The C-terminal segment of xUBF, HMG boxes 4, 5 or the acidic domain, directly or indirectly interact with HMG box 1, making the core promoter sequences between -11 and -15 hypersensitive to DNase. This interaction also requires the DNA sequences between +17 and +32, i.e. the HMG box 2/3 binding site. The data suggest extensive folding of the core promoter within the xUBF complex.

Detecting cooperative sequences in the binding of RNA Polymerase-II

NASA Astrophysics Data System (ADS)

Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

2008-03-01

Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

Simultaneous detection of human mitochondrial DNA and nuclear-inserted mitochondrial-origin sequences (NumtS) using forensic mtDNA amplification strategies and pyrosequencing technology.

PubMed

Bintz, Brittania J; Dixon, Groves B; Wilson, Mark R

2014-07-01

Next-generation sequencing technologies enable the identification of minor mitochondrial DNA variants with higher sensitivity than Sanger methods, allowing for enhanced identification of minor variants. In this study, mixtures of human mtDNA control region amplicons were subjected to pyrosequencing to determine the detection threshold of the Roche GS Junior(®) instrument (Roche Applied Science, Indianapolis, IN). In addition to expected variants, a set of reproducible variants was consistently found in reads from one particular amplicon. A BLASTn search of the variant sequence revealed identity to a segment of a 611-bp nuclear insertion of the mitochondrial control region (NumtS) spanning the primer-binding sites of this amplicon (Nature 1995;378:489). Primers (Hum Genet 2012;131:757; Hum Biol 1996;68:847) flanking the insertion were used to confirm the presence or absence of the NumtS in buccal DNA extracts from twenty donors. These results further our understanding of human mtDNA variation and are expected to have a positive impact on the interpretation of mtDNA profiles using deep-sequencing methods in casework. © 2014 American Academy of Forensic Sciences.

GM2 Gangliosidosis in Shiba Inu Dogs with an In-Frame Deletion in HEXB.

PubMed

Kolicheski, A; Johnson, G S; Villani, N A; O'Brien, D P; Mhlanga-Mutangadura, T; Wenger, D A; Mikoloski, K; Eagleson, J S; Taylor, J F; Schnabel, R D; Katz, M L

2017-09-01

Consistent with a tentative diagnosis of neuronal ceroid lipofuscinosis (NCL), autofluorescent cytoplasmic storage bodies were found in neurons from the brains of 2 related Shiba Inu dogs with a young-adult onset, progressive neurodegenerative disease. Unexpectedly, no potentially causal NCL-related variants were identified in a whole-genome sequence generated with DNA from 1 of the affected dogs. Instead, the whole-genome sequence contained a homozygous 3 base pair (bp) deletion in a coding region of HEXB. The other affected dog also was homozygous for this 3-bp deletion. Mutations in the human HEXB ortholog cause Sandhoff disease, a type of GM2 gangliosidosis. Thin-layer chromatography confirmed that GM2 ganglioside had accumulated in an affected Shiba Inu brain. Enzymatic analysis confirmed that the GM2 gangliosidosis resulted from a deficiency in the HEXB encoded protein and not from a deficiency in products from HEXA or GM2A, which are known alternative causes of GM2 gangliosidosis. We conclude that the homozygous 3-bp deletion in HEXB is the likely cause of the Shiba Inu neurodegenerative disease and that whole-genome sequencing can lead to the early identification of potentially disease-causing DNA variants thereby refocusing subsequent diagnostic analyses toward confirming or refuting candidate variant causality. Copyright © 2017 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis.

PubMed

Sanjari, Sepideh; Shobbar, Zahra Sadat; Ebrahimi, Mohsen; Hasanloo, Tahereh; Sadat-Noori, Seyed-Ahmad; Tirnaz, Soodeh

2015-12-01

Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of CHS encoding genes in milk thistle plant can be of great importance. In the current research, fragments of CHS genes were amplified using degenerate primers based on the conserved parts of Asteraceae CHS genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of CHS gene family,SmCHS1 and SmCHS2. Third member, full-length cDNA (SmCHS3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants.Real-time PCR analysis indicated that SmCHS1 and SmCHS3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis.

Investigating Holocene human population history in North Asia using ancient mitogenomes.

PubMed

Kılınç, Gülşah Merve; Kashuba, Natalija; Yaka, Reyhan; Sümer, Arev Pelin; Yüncü, Eren; Shergin, Dmitrij; Ivanov, Grigorij Leonidovich; Kichigin, Dmitrii; Pestereva, Kjunnej; Volkov, Denis; Mandryka, Pavel; Kharinskii, Artur; Tishkin, Alexey; Ineshin, Evgenij; Kovychev, Evgeniy; Stepanov, Aleksandr; Alekseev, Aanatolij; Fedoseeva, Svetlana Aleksandrovna; Somel, Mehmet; Jakobsson, Mattias; Krzewińska, Maja; Storå, Jan; Götherström, Anders

2018-06-12

Archaeogenomic studies have largely elucidated human population history in West Eurasia during the Stone Age. However, despite being a broad geographical region of significant cultural and linguistic diversity, little is known about the population history in North Asia. We present complete mitochondrial genome sequences together with stable isotope data for 41 serially sampled ancient individuals from North Asia, dated between c.13,790 BP and c.1,380 BP extending from the Palaeolithic to the Iron Age. Analyses of mitochondrial DNA sequences and haplogroup data of these individuals revealed the highest genetic affinity to present-day North Asian populations of the same geographical region suggesting a possible long-term maternal genetic continuity in the region. We observed a decrease in genetic diversity over time and a reduction of maternal effective population size (N e ) approximately seven thousand years before present. Coalescent simulations were consistent with genetic continuity between present day individuals and individuals dating to 7,000 BP, 4,800 BP or 3,000 BP. Meanwhile, genetic differences observed between 7,000 BP and 3,000 BP as well as between 4,800 BP and 3,000 BP were inconsistent with genetic drift alone, suggesting gene flow into the region from distant gene pools or structure within the population. These results indicate that despite some level of continuity between ancient groups and present-day populations, the region exhibits a complex demographic history during the Holocene.

Genetic speciation of environmental Legionella isolates in Thailand.

PubMed

Paveenkittiporn, Wantana; Dejsirilert, Surang; Kalambaheti, Thareerat

2012-10-01

Legionella-like organisms were isolated during 2003-2007 from various water resources by culturing on selective media of Wadowsky-Yee-Okuda agar. The 256 isolates were identified as belonging to the Legionella genus based on detection of 108 bp PCR product of the 5S rRNA gene, while the inclusion as Legionella pneumophila were confirmed by PCR detection of a specific mip gene region of 168 bp. The 50 isolates, identified as non-pneumophila, were then subjected to DNA tree analysis, based on mip gene of ~650 bp and rnpB genes product ranged from 304 to 354 bp. Phylogenetic tree was constructed to predict their species in relative to the available database. The isolates of which their speciation, based on those two genes were inconclusive, were then investigated for the almost full-length of 16S rRNA sequences. The isolates were assigned as 16 known Legionella species, and proposed seven novel species based on their unique 16S rRNA sequence. Copyright © 2012 Elsevier B.V. All rights reserved.

Sunflower centromeres consist of a centromere-specific LINE and a chromosome-specific tandem repeat.

PubMed

Nagaki, Kiyotaka; Tanaka, Keisuke; Yamaji, Naoki; Kobayashi, Hisato; Murata, Minoru

2015-01-01

The kinetochore is a protein complex including kinetochore-specific proteins that plays a role in chromatid segregation during mitosis and meiosis. The complex associates with centromeric DNA sequences that are usually species-specific. In plant species, tandem repeats including satellite DNA sequences and retrotransposons have been reported as centromeric DNA sequences. In this study on sunflowers, a cDNA-encoding centromere-specific histone H3 (CENH3) was isolated from a cDNA pool from a seedling, and an antibody was raised against a peptide synthesized from the deduced cDNA. The antibody specifically recognized the sunflower CENH3 (HaCENH3) and showed centromeric signals by immunostaining and immunohistochemical staining analysis. The antibody was also applied in chromatin immunoprecipitation (ChIP)-Seq to isolate centromeric DNA sequences and two different types of repetitive DNA sequences were identified. One was a long interspersed nuclear element (LINE)-like sequence, which showed centromere-specific signals on almost all chromosomes in sunflowers. This is the first report of a centromeric LINE sequence, suggesting possible centromere targeting ability. Another type of identified repetitive DNA was a tandem repeat sequence with a 187-bp unit that was found only on a pair of chromosomes. The HaCENH3 content of the tandem repeats was estimated to be much higher than that of the LINE, which implies centromere evolution from LINE-based centromeres to more stable tandem-repeat-based centromeres. In addition, the epigenetic status of the sunflower centromeres was investigated by immunohistochemical staining and ChIP, and it was found that centromeres were heterochromatic.

Inter-individual and intragenomic variations in the ITS region of Clonorchis sinensis (Trematoda: Opisthorchiidae) from Russia and Vietnam.

PubMed

Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh

2017-11-01

Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.

The sequence of camelpox virus shows it is most closely related to variola virus, the cause of smallpox.

PubMed

Gubser, Caroline; Smith, Geoffrey L

2002-04-01

Camelpox virus (CMPV) and variola virus (VAR) are orthopoxviruses (OPVs) that share several biological features and cause high mortality and morbidity in their single host species. The sequence of a virulent CMPV strain was determined; it is 202182 bp long, with inverted terminal repeats (ITRs) of 6045 bp and has 206 predicted open reading frames (ORFs). As for other poxviruses, the genes are tightly packed with little non-coding sequence. Most genes within 25 kb of each terminus are transcribed outwards towards the terminus, whereas genes within the centre of the genome are transcribed from either DNA strand. The central region of the genome contains genes that are highly conserved in other OPVs and 87 of these are conserved in all sequenced chordopoxviruses. In contrast, genes towards either terminus are more variable and encode proteins involved in host range, virulence or immunomodulation. In some cases, these are broken versions of genes found in other OPVs. The relationship of CMPV to other OPVs was analysed by comparisons of DNA and predicted protein sequences, repeats within the ITRs and arrangement of ORFs within the terminal regions. Each comparison gave the same conclusion: CMPV is the closest known virus to variola virus, the cause of smallpox.

Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

PubMed Central

Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

2013-01-01

Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

PubMed

Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

2009-11-01

Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

Type III restriction-modification enzymes: a historical perspective.

PubMed

Rao, Desirazu N; Dryden, David T F; Bheemanaik, Shivakumara

2014-01-01

Restriction endonucleases interact with DNA at specific sites leading to cleavage of DNA. Bacterial DNA is protected from restriction endonuclease cleavage by modifying the DNA using a DNA methyltransferase. Based on their molecular structure, sequence recognition, cleavage position and cofactor requirements, restriction-modification (R-M) systems are classified into four groups. Type III R-M enzymes need to interact with two separate unmethylated DNA sequences in inversely repeated head-to-head orientations for efficient cleavage to occur at a defined location (25-27 bp downstream of one of the recognition sites). Like the Type I R-M enzymes, Type III R-M enzymes possess a sequence-specific ATPase activity for DNA cleavage. ATP hydrolysis is required for the long-distance communication between the sites before cleavage. Different models, based on 1D diffusion and/or 3D-DNA looping, exist to explain how the long-distance interaction between the two recognition sites takes place. Type III R-M systems are found in most sequenced bacteria. Genome sequencing of many pathogenic bacteria also shows the presence of a number of phase-variable Type III R-M systems, which play a role in virulence. A growing number of these enzymes are being subjected to biochemical and genetic studies, which, when combined with ongoing structural analyses, promise to provide details for mechanisms of DNA recognition and catalysis.

DNA motifs determining the accuracy of repeat duplication during CRISPR adaptation in Haloarcula hispanica

PubMed Central

Wang, Rui; Li, Ming; Gong, Luyao; Hu, Songnian; Xiang, Hua

2016-01-01

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) acquire new spacers to generate adaptive immunity in prokaryotes. During spacer integration, the leader-preceded repeat is always accurately duplicated, leading to speculations of a repeat-length ruler. Here in Haloarcula hispanica, we demonstrate that the accurate duplication of its 30-bp repeat requires two conserved mid-repeat motifs, AACCC and GTGGG. The AACCC motif was essential and needed to be ∼10 bp downstream from the leader-repeat junction site, where duplication consistently started. Interestingly, repeat duplication terminated sequence-independently and usually with a specific distance from the GTGGG motif, which seemingly served as an anchor site for a molecular ruler. Accordingly, altering the spacing between the two motifs led to an aberrant duplication size (29, 31, 32 or 33 bp). We propose the adaptation complex may recognize these mid-repeat elements to enable measuring the repeat DNA for spacer integration. PMID:27085805

Creation of a type IIS restriction endonuclease with a long recognition sequence

PubMed Central

Lippow, Shaun M.; Aha, Patti M.; Parker, Matthew H.; Blake, William J.; Baynes, Brian M.; Lipovšek, Daša

2009-01-01

Type IIS restriction endonucleases cleave DNA outside their recognition sequences, and are therefore particularly useful in the assembly of DNA from smaller fragments. A limitation of type IIS restriction endonucleases in assembly of long DNA sequences is the relative abundance of their target sites. To facilitate ligation-based assembly of extremely long pieces of DNA, we have engineered a new type IIS restriction endonuclease that combines the specificity of the homing endonuclease I-SceI with the type IIS cleavage pattern of FokI. We linked a non-cleaving mutant of I-SceI, which conveys to the chimeric enzyme its specificity for an 18-bp DNA sequence, to the catalytic domain of FokI, which cuts DNA at a defined site outside the target site. Whereas previously described chimeric endonucleases do not produce type IIS-like precise DNA overhangs suitable for ligation, our chimeric endonuclease cleaves double-stranded DNA exactly 2 and 6 nt from the target site to generate homogeneous, 5′, four-base overhangs, which can be ligated with 90% fidelity. We anticipate that these enzymes will be particularly useful in manipulation of DNA fragments larger than a thousand bases, which are very likely to contain target sites for all natural type IIS restriction endonucleases. PMID:19304757

Non-B-Form DNA Is Enriched at Centromeres

PubMed Central

Henikoff, Steven

2018-01-01

Abstract Animal and plant centromeres are embedded in repetitive “satellite” DNA, but are thought to be epigenetically specified. To define genetic characteristics of centromeres, we surveyed satellite DNA from diverse eukaryotes and identified variation in <10-bp dyad symmetries predicted to adopt non-B-form conformations. Organisms lacking centromeric dyad symmetries had binding sites for sequence-specific DNA-binding proteins with DNA-bending activity. For example, human and mouse centromeres are depleted for dyad symmetries, but are enriched for non-B-form DNA and are associated with binding sites for the conserved DNA-binding protein CENP-B, which is required for artificial centromere function but is paradoxically nonessential. We also detected dyad symmetries and predicted non-B-form DNA structures at neocentromeres, which form at ectopic loci. We propose that centromeres form at non-B-form DNA because of dyad symmetries or are strengthened by sequence-specific DNA binding proteins. This may resolve the CENP-B paradox and provide a general basis for centromere specification. PMID:29365169

Distinct patterns of alteration of myc genes associated with integration of human papillomavirus type 16 or type 45 DNA in two genital tumours.

PubMed

Sastre-Garau, X; Favre, M; Couturier, J; Orth, G

2000-08-01

We previously described two genital carcinomas (IC2, IC4) containing human papillomavirus type 16 (HPV-16)- or HPV-18-related sequences integrated in chromosomal bands containing the c-myc (8q24) or N-myc (2p24) gene, respectively. The c-myc gene was rearranged and amplified in IC2 cells without evidence of overexpression. The N-myc gene was amplified and highly transcribed in IC4 cells. Here, the sequence of an 8039 bp IC4 DNA fragment containing the integrated viral sequences and the cellular junctions is reported. A 3948 bp segment of the genome of HPV-45 encompassing the upstream regulatory region and the E6 and E7 ORFs was integrated into the untranslated part of N-myc exon 3, upstream of the N-myc polyadenylation signal. Both N-myc and HPV-45 sequences were amplified 10- to 20-fold. The 3' ends of the major N-myc transcript were mapped upstream of the 5' junction. A minor N-myc/HPV-45 fusion transcript was also identified, as well as two abundant transcripts from the HPV-45 E6-E7 region. Large amounts of N-myc protein were detected in IC4 cells. A major alteration of c-myc sequences in IC2 cells involved the insertion of a non-coding sequence into the second intron and their co-amplification with the third exon, without any evidence for the integration of HPV-16 sequences within or close to the gene. Different patterns of myc gene alterations may thus be associated with integration of HPV DNA in genital tumours, including the activation of the protooncogene via a mechanism of insertional mutagenesis and/or gene amplification.

Use of Lambda Phage DNA as a Hybrid Internal Control in a PCR-Enzyme Immunoassay To Detect Chlamydia pneumoniae

PubMed Central

Pham, Dien G.; Madico, Guillermo E.; Quinn, Thomas C.; Enzler, Mark J.; Smith, Thomas F.; Gaydos, Charlotte A.

1998-01-01

An inherent problem in the diagnostic PCR assay is the presence of ill-defined inhibitors of amplification which may cause false-negative results. Addition of an amplifiable fragment of foreign DNA in the PCR to serve as a hybrid internal control (HIC) would allow for a simple way to identify specimens containing inhibitors. Two oligonucleotide hybrid primers were synthesized to contain nucleic acid sequences of the Chlamydia pneumoniae 16S rRNA primers in a position flanking two primers that target the sequences of a 650-bp lambda phage DNA segment. By using the hybrid primers, hybrid DNA comprising a large sequence of lambda phage DNA flanked by short pieces of chlamydia DNA was subsequently generated by PCR, cloned into a plasmid vector, and purified. Plasmids containing the hybrid DNA were diluted and used as a HIC by adding them to each C. pneumoniae PCR test. Consequently, C. pneumoniae primers were able to amplify both chlamydia DNA and the HIC DNA. The production of a 689-bp HIC DNA band on an acrylamide gel indicated that the specimen contained no inhibitors and that internal conditions were compatible with PCR. Subsequently, a biotinylated RNA probe for the HIC was transcribed from a nested sequence of the HIC and was used for its hybridization. Detection of the HIC DNA-RNA hybrid was achieved by enzyme immunoassay (EIA). This PCR-EIA system with a HIC was initially tested with 12 previously PCR-positive and 14 previously PCR-negative specimens. Of the 12 PCR-positive specimens, 11 were reconfirmed as positive; 1 had a negative HIC value, indicating inhibition. Of the 14 previously PCR-negative specimens, 13 were confirmed as true negative; 1 had a negative HIC value, indicating inhibition. The assay was then used with 237 nasopharyngeal specimens from patients with pneumonia. Twenty-one of 237 (8.9%) were positive for C. pneumoniae, and 42 (17.7%) were found to inhibit the PCR. Specimens showing inhibitory activity were diluted 1:10 and were retested. Ten specimens were still inhibitory to the PCR and required further DNA purification. No additional positive samples were detected and 3 nasopharyngeal specimens remained inhibitory to PCR. Coamplification of a HIC DNA can help confirm true-negative PCR results by ruling out the presence of inhibitors of DNA amplification. PMID:9650936

A primer set to determine sex in the small Indian mongoose, Herpestes auropunctatus.

PubMed

Murata, C; Ogura, G; Kuroiwa, A

2011-03-01

To enable the accurate sexing of individuals of introduced populations of the small Indian mongoose, Herpestes auropunctatus, we designed a primer set for the amplification of the sex-specific fragments EIF2S3Y and EIF2S3X. Using this primer set, the expected amplification products were obtained for all samples of genomic DNA tested: males yielded two bands and females a single band. Sequencing of each PCR product confirmed that the 769-bp fragment amplified from DNA samples of both sexes was derived from EIF2S3X, whereas the 546-bp fragment amplified only from male DNA samples was derived from EIF2S3Y. The results indicated that this primer set is useful for sex identification in this species. © 2010 Blackwell Publishing Ltd.

Intraspecific phylogeography of Lasmigona subviridis (Bivalvia: Unionidae): Conservation implications of range discontinuity

USGS Publications Warehouse

King, T.L.; Eackles, M.S.; Gjetvaj, B.; Hoeh, W.R.

1999-01-01

A nucleotide sequence analysis of the first internal transcribed spacer region (ITS-1) between the 5.8S and 18S ribosomal DNA genes (640 bp) and cytochrome c oxidase subunit I (COI) of mitochondrial DNA (mtDNA) (576 bp) was conducted for the freshwater bivalve Lasmigona subviridis and three congeners to determine the utility of these regions in identifying phylogeographic and phylogenetic structure. Sequence analysis of the ITS-1 region indicated a zone of discontinuity in the genetic population structure between a group of L. subviridis populations inhabiting the Susquehanna and Potomac Rivers and more southern populations. Moreover, haplotype patterns resulting from variation in the COI region suggested an absence of gene exchange between tributaries within two different river drainages, as well as between adjacent rivers systems. The authors recommend that the northern and southern populations, which are reproductively isolated and constitute evolutionarily significant lineages, be managed as separate conservation units. Results from the COI region suggest that, in some cases, unionid relocations should be avoided between tributaries of the same drainage because these populations may have been reproductively isolated for thousands of generations. Therefore, unionid bivalves distributed among discontinuous habitats (e.g. Atlantic slope drainages) potentially should be considered evolutionarily distinct. The DNA sequence divergences observed in the nuclear and mtDNA regions among the Lasmigona species were congruent, although the level of divergence in the COI region was up to three times greater. The genus Lasmigona, as represented by the four species surveyed in this study, may not be monophyletic.

Identification of a DNA restriction-modification system in Pectobacterium carotovorum strains isolated from Poland.

PubMed

Waleron, K; Waleron, M; Osipiuk, J; Podhajska, A J; Lojkowska, E

2006-02-01

Polish isolates of pectinolytic bacteria from the species Pectobacterium carotovorum were screened for the presence of a DNA restriction-modification (R-M) system. Eighty-nine strains of P. carotovorum were isolated from infected potato plants. Sixty-six strains belonged to P. carotovorum ssp. atrosepticum and 23 to P. carotovorum ssp. carotovorum. The presence of restriction enzyme Pca17AI, which is an isoschizomer of EcoRII endonuclease, was observed in all isolates of P. c. atrosepticum but not in P. c. carotovorum. The biochemical properties, PCR amplification, and sequences of the Pca17AI restriction endonuclease and methyltransferase genes were compared with the prototype EcoRII R-M system genes. Only when DNA isolated from cells of P. c. atrosepticum was used as a template, amplification of a 680 bp homologous to the gene coding EcoRII endonuclease. Endonuclease Pca17AI, having a relatively low temperature optimum, was identified. PCR amplification revealed that the nucleotide sequence of genes for EcoRII and Pca17AI R-M are different. Dcm methylation was observed in all strains of Pectobacterium and other Erwinia species tested. The sequence of a DNA fragment coding Dcm methylase in P. carotovorum was different from that of Escherichia coli. Pca17AI is the first psychrophilic isoschizomer of EcoRII endonuclease. The presence of specific Dcm methylation in chromosomal DNA isolated from P. carotovorum is described for the first time. A 680 bp PCR product, unique for P. c. atrosepticum strains, could serve as a molecular marker for detection of these bacteria in environmental samples.

Human beta-globin gene polymorphisms characterized in DNA extracted from ancient bones 12,000 years old.

PubMed

Béraud-Colomb, E; Roubin, R; Martin, J; Maroc, N; Gardeisen, A; Trabuchet, G; Goosséns, M

1995-12-01

Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the beta-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for beta-globin frameworks by sequencing through two variable positions and for a polymorphic (AT) chi (T) gamma microsatellite 500 bp upstream of the beta-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible.

Binding sites for abundant nuclear factors modulate RNA polymerase I-dependent enhancer function in Saccharomyces cerevisiae.

PubMed

Kang, J J; Yokoi, T J; Holland, M J

1995-12-01

The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.

Molecular cloning and characterization of SoxB2 gene from Zhikong scallop Chlamys farreri

NASA Astrophysics Data System (ADS)

He, Yan; Bao, Zhenmin; Guo, Huihui; Zhang, Yueyue; Zhang, Lingling; Wang, Shi; Hu, Jingjie; Hu, Xiaoli

2013-11-01

The Sox proteins play critical roles during the development of animals, including sex determination and central nervous system development. In this study, the SoxB2 gene was cloned from a mollusk, the Zhikong scallop ( Chlamys farreri), and characterized with respect to phylogeny and tissue distribution. The full-length cDNA and genomic DNA sequences of C. farreri SoxB2 ( Cf SoxB2) were obtained by rapid amplification of cDNA ends and genome walking, respectively, using a partial cDNA fragment from the highly conserved DNA-binding domain, i.e., the High Mobility Group (HMG) box. The full-length cDNA sequence of Cf SoxB2 was 2 048 bp and encoded 268 amino acids protein. The genomic sequence was 5 551 bp in length with only one exon. Several conserved elements, such as the TATA-box, GC-box, CAAT-box, GATA-box, and Sox/sry-sex/testis-determining and related HMG box factors, were found in the promoter region. Furthermore, real-time quantitative reverse transcription PCR assays were carried out to assess the mRNA expression of Cf SoxB 2 in different tissues. SoxB2 was highly expressed in the mantle, moderately in the digestive gland and gill, and weakly expressed in the gonad, kidney and adductor muscle. In male and female gonads at different developmental stages of reproduction, the expression levels of Cf SoxB2 were similar. Considering the specific expression and roles of SoxB 2 in other animals, in particular vertebrates, and the fact that there are many pallial nerves in the mantle, cerebral ganglia in the digestive gland and gill nerves in gill, we propose a possible essential role in nervous tissue function for Sox B 2 in C. farreri.

Mitochondrial genome of the freshwater jellyfish Craspedacusta sowerbyi and phylogenetics of Medusozoa.

PubMed

Zou, Hong; Zhang, Jin; Li, Wenxiang; Wu, Shangong; Wang, Guitang

2012-01-01

The 17,922 base pairs (bp) nucleotide sequence of the linear mitochondrial DNA (mtDNA) molecule of the freshwater jellyfish Craspedacusta sowerbyi (Hydrozoa, Trachylina, Limnomedusae) has been determined. This sequence exhibits surprisingly low A+T content (57.1%), containing genes for 13 energy pathway proteins, a small and a large subunit rRNAs, and methionine and tryptophan tRNAs. Mitochondrial ancestral medusozoan gene order (AMGO) was found in the C. sowerbyi, as those found in Cubaia aphrodite (Hydrozoa, Trachylina, Limnomedusae), discomedusan Scyphozoa and Staurozoa. The genes of C. sowerbyi mtDNA are arranged in two clusters with opposite transcriptional polarities, whereby transcription proceeds toward the ends of the DNA molecule. Identical inverted terminal repeats (ITRs) flank the ends of the mitochondrial DNA molecule, a characteristic typical of medusozoans. In addition, two open reading frames (ORFs) of 354 and 1611 bp in length were found downstream of the large subunit rRNA gene, similar to the two ORFs of ORF314 and polB discovered in the linear mtDNA of C. aphrodite, discomedusan Scyphozoa and Staurozoa. Phylogenetic analyses of C. sowerbyi and other cnidarians were carried out based on both nucleotide and inferred amino acid sequences of the 13 mitochondrial energy pathway genes. Our working hypothesis supports the monophyletic Medusozoa being a sister group to Octocorallia (Cnidaria, Anthozoa). Within Medusozoa, the phylogenetic analysis suggests that Staurozoa may be the earliest diverging class and the sister group of all other medusozoans. Cubozoa and coronate Scyphozoa form a clade that is the sister group of Hydrozoa plus discomedusan Scyphozoa. Hydrozoa is the sister group of discomedusan Scyphozoa. Semaeostomeae is a paraphyletic clade with Rhizostomeae, while Limnomedusae (Trachylina) is the sister group of hydroidolinans and may be the earliest diverging lineage among Hydrozoa.

Mitochondrial Genome of the Freshwater Jellyfish Craspedacusta sowerbyi and Phylogenetics of Medusozoa

PubMed Central

Zou, Hong; Zhang, Jin; Li, Wenxiang; Wu, Shangong; Wang, Guitang

2012-01-01

The 17,922 base pairs (bp) nucleotide sequence of the linear mitochondrial DNA (mtDNA) molecule of the freshwater jellyfish Craspedacusta sowerbyi (Hydrozoa,Trachylina, Limnomedusae) has been determined. This sequence exhibits surprisingly low A+T content (57.1%), containing genes for 13 energy pathway proteins, a small and a large subunit rRNAs, and methionine and tryptophan tRNAs. Mitochondrial ancestral medusozoan gene order (AMGO) was found in the C. sowerbyi, as those found in Cubaia aphrodite (Hydrozoa, Trachylina, Limnomedusae), discomedusan Scyphozoa and Staurozoa. The genes of C. sowerbyi mtDNA are arranged in two clusters with opposite transcriptional polarities, whereby transcription proceeds toward the ends of the DNA molecule. Identical inverted terminal repeats (ITRs) flank the ends of the mitochondrial DNA molecule, a characteristic typical of medusozoans. In addition, two open reading frames (ORFs) of 354 and 1611 bp in length were found downstream of the large subunit rRNA gene, similar to the two ORFs of ORF314 and polB discovered in the linear mtDNA of C. aphrodite, discomedusan Scyphozoa and Staurozoa. Phylogenetic analyses of C. sowerbyi and other cnidarians were carried out based on both nucleotide and inferred amino acid sequences of the 13 mitochondrial energy pathway genes. Our working hypothesis supports the monophyletic Medusozoa being a sister group to Octocorallia (Cnidaria, Anthozoa). Within Medusozoa, the phylogenetic analysis suggests that Staurozoa may be the earliest diverging class and the sister group of all other medusozoans. Cubozoa and coronate Scyphozoa form a clade that is the sister group of Hydrozoa plus discomedusan Scyphozoa. Hydrozoa is the sister group of discomedusan Scyphozoa. Semaeostomeae is a paraphyletic clade with Rhizostomeae, while Limnomedusae (Trachylina) is the sister group of hydroidolinans and may be the earliest diverging lineage among Hydrozoa. PMID:23240028

Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

PubMed Central

Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

1994-01-01

We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

PubMed

Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

2012-05-01

The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

Complete Genome Sequence of Pseudomonas aeruginosa Phage AAT-1.

PubMed

Andrade-Domínguez, Andrés; Kolter, Roberto

2016-08-25

Aspects of the interaction between phages and animals are of interest and importance for medical applications. Here, we report the genome sequence of the lytic Pseudomonas phage AAT-1, isolated from mammalian serum. AAT-1 is a double-stranded DNA phage, with a genome of 57,599 bp, containing 76 predicted open reading frames. Copyright © 2016 Andrade-Domínguez and Kolter.

Successful isolation of Leishmania infantum from Rhipicephalus sanguineus sensu lato (Acari: Ixodidae) collected from naturally infected dogs.

PubMed

Medeiros-Silva, Viviane; Gurgel-Gonçalves, Rodrigo; Nitz, Nadjar; Morales, Lucia Emilia D' Anduraim; Cruz, Laurício Monteiro; Sobral, Isabele Gonçalves; Boité, Mariana Côrtes; Ferreira, Gabriel Eduardo Melim; Cupolillo, Elisa; Romero, Gustavo Adolfo Sierra

2015-10-09

The main transmission route of Leishmania infantum is through the bites of sand flies. However, alternative mechanisms are being investigated, such as through the bites of ticks, which could have epidemiological relevance. The objective of this work was to verify the presence of Leishmania spp. in Rhipicephalus sanguineus sensu lato collected from naturally infected dogs in the Federal District of Brazil. Ticks were dissected to remove their intestines and salivary glands for DNA extraction and the subsequent amplification of the conserved region of 120 bp of kDNA and 234 bp of the hsp70 gene of Leishmania spp. The amplified kDNA products were digested with endonucleases HaeIII and BstUI and were submitted to DNA sequencing. Isolated Leishmania parasites from these ticks were analyzed by multilocus enzyme electrophoresis, and the DNA obtained from this culture was subjected to microsatellite analyses. Overall, 130 specimens of R. sanguineus were collected from 27 dogs. Leishmania spp. were successfully isolated in culture from five pools of salivary glands and the intestines of ticks collected from four dogs. The amplified kDNA products from the dog blood samples and from the tick cultures, when digested by HaeIII and BstUI, revealed the presence of L. braziliensis and L. infantum. One strain was cultivated and characterized as L. infantum by enzyme electrophoresis. The amplified kDNA products from the blood of one dog showed a sequence homology with L. braziliensis; however, the amplified kDNA from the ticks collected from this dog showed a sequence homology to L. infantum. The results confirm that the specimens of R. sanguineus that feed on dogs naturally infected by L. infantum contain the parasite DNA in their intestines and salivary glands, and viable L. infantum can be successfully isolated from these ectoparasites.

Grandpaternal mosaicism in a family with isolated haemophilia A.

PubMed

Casey, G J; Rodgers, S E; Hall, J R; Rudzki, Z; Lloyd, J V

1999-12-01

About one third of cases of haemophilia A have no family history of the disorder, and 20% are thought to be due to a new mutation. In the family reported here, a 3 bp deletion was detected in DNA from the proband at the 3' end of exon 15. Direct sequencing of genomic DNA prepared from blood and buccal cells of the grandfather revealed both normal and mutant sequences, suggesting that he is a mosaic for this mutation. This highlights the usefulness of mutation detection, both for accurate genetic counselling and to determine the origin of new mutations of haemophilia.

Expression analysis of HSP70 in the testis of Octopus tankahkeei under thermal stress.

PubMed

Long, Ling-Li; Han, Ying-Li; Sheng, Zhang; Du, Chen; Wang, You-Fa; Zhu, Jun-Quan

2015-09-01

The gene encoding heat shock protein 70 (HSP70) was identified in Octopus tankahkeei by homologous cloning and rapid amplification of cDNA ends (RACE). The full-length cDNA (2471 bp) consists of a 5'-untranslated region (UTR) (89 bp), a 3'-UTR (426 bp), and an open reading frame (1956 bp) that encodes 651 amino acid residues with a predicted molecular mass of 71.8 kDa and an isoelectric point of 5.34. Based on the amino acid sequence analysis and multiple sequence alignment, this cDNA is a member of cytoplasmic hsp70 subfamily of the hsp70 family and was designated as ot-hsp70. Tissue expression analysis showed that HSP70 expression is highest in the testes when all examined organs were compared. Immunohistochemistry analysis, together with hematoxylin-eosin staining, revealed that the HSP70 protein was expressed in all spermatogenic cells, but not in fibroblasts. In addition, O. tankahkeei were heat challenged by exposure to 32 °C seawater for 2 h, then returned to 13 °C for various recovery time (0-24 h). Relative expression of ot-hsp70 mRNA in the testes was measured at different time points post-challenge by quantitative real-time PCR. A clear time-dependent mRNA expression of ot-hsp70 after thermal stress indicates that the HSP70 gene is inducible. Ultrastructural changes of the heat-stressed testis were observed by transmission electron microscopy. We suggest that HSP70 plays an important role in spermatogenesis and testis protection against thermal stress in O. tankahkeei. Copyright © 2015 Elsevier Inc. All rights reserved.

Molecular cloning of hsf1 and hsbp1 cDNAs, and the expression of hsf1, hsbp1 and hsp70 under heat stress in the sea cucumber Apostichopus japonicus.

PubMed

Xu, Dongxue; Sun, Lina; Liu, Shilin; Zhang, Libin; Yang, Hongsheng

2016-08-01

The heat shock response (HSR) is known for the elevated synthesis of heat shock proteins (HSPs) under heat stress, which is mediated primarily by heat shock factor 1 (HSF1). Heat shock factor binding protein 1 (HSBP1) and feedback control of heat shock protein 70 (HSP70) are major regulators of the activity of HSF1. We obtained full-length cDNA of genes hsf1 and hsbp1 in the sea cucumber Apostichopus japonicus, which are the second available for echinoderm (after Strongylocentrotus purpuratus), and the first available for holothurian. The full-length cDNA of hsf1 was 2208bp, containing a 1326bp open reading frame encoding 441 amino acids. The full-length cDNA of hsbp1 was 2850bp, containing a 225bp open reading frame encoding 74 amino acids. The similarities of A. japonicus HSF1 with other species are low, and much higher similarity identities of A. japonicus HSBP1 were shared. Phylogenetic trees showed that A. japonicus HSF1 and HSBP1 were clustered with sequences from S. purpuratus, and fell into distinct clades with sequences from mollusca, arthropoda and vertebrata. Analysis by real-time PCR showed hsf1 and hsbp1 mRNA was expressed constitutively in all tissues examined. The expression of hsf1, hsbp1 and hsp70 in the intestine at 26°C was time-dependent. The results of this study might provide new insights into the regulation of heat shock response in this species. Copyright © 2016. Published by Elsevier Inc.

Characterization of the complete mitochondrial genomes of Nematodirus oiratianus and Nematodirus spathiger of small ruminants

PubMed Central

2014-01-01

Background Nematodirus spp. are among the most common nematodes of ruminants worldwide. N. oiratianus and N. spathiger are distributed worldwide as highly prevalent gastrointestinal nematodes, which cause emerging health problems and economic losses. Accurate identification of Nematodirus species is essential to develop effective control strategies for Nematodirus infection in ruminants. Mitochondrial DNA (mtDNA) could provide powerful genetic markers for identifying these closely related species and resolving phylogenetic relationships at different taxonomic levels. Methods In the present study, the complete mitochondrial (mt) genomes of N. oiratianus and N. spathiger from small ruminants in China were obtained using Long-range PCR and sequencing. Results The complete mt genomes of N. oiratianus and N. spathiger were 13,765 bp and 13,519 bp in length, respectively. Both mt genomes were circular and consisted of 36 genes, including 12 genes encoding proteins, 2 genes encoding rRNA, and 22 genes encoding tRNA. Phylogenetic analyses based on the concatenated amino acid sequence data of all 12 protein-coding genes by Bayesian inference (BI), Maximum likelihood (ML) and Maximum parsimony (MP) showed that the two Nematodirus species (Molineidae) were closely related to Dictyocaulidae. Conclusions The availability of the complete mtDNA sequences of N. oiratianus and N. spathiger not only provides new mtDNA sources for a better understanding of nematode mt genomics and phylogeny, but also provides novel and useful genetic markers for studying diagnosis, population genetics and molecular epidemiology of Nematodirus spp. in small ruminants. PMID:25015379

Characterization of the complete mitochondrial genomes of Nematodirus oiratianus and Nematodirus spathiger of small ruminants.

PubMed

Zhao, Guang-Hui; Jia, Yan-Qing; Cheng, Wen-Yu; Zhao, Wen; Bian, Qing-Qing; Liu, Guo-Hua

2014-07-11

Nematodirus spp. are among the most common nematodes of ruminants worldwide. N. oiratianus and N. spathiger are distributed worldwide as highly prevalent gastrointestinal nematodes, which cause emerging health problems and economic losses. Accurate identification of Nematodirus species is essential to develop effective control strategies for Nematodirus infection in ruminants. Mitochondrial DNA (mtDNA) could provide powerful genetic markers for identifying these closely related species and resolving phylogenetic relationships at different taxonomic levels. In the present study, the complete mitochondrial (mt) genomes of N. oiratianus and N. spathiger from small ruminants in China were obtained using Long-range PCR and sequencing. The complete mt genomes of N. oiratianus and N. spathiger were 13,765 bp and 13,519 bp in length, respectively. Both mt genomes were circular and consisted of 36 genes, including 12 genes encoding proteins, 2 genes encoding rRNA, and 22 genes encoding tRNA. Phylogenetic analyses based on the concatenated amino acid sequence data of all 12 protein-coding genes by Bayesian inference (BI), Maximum likelihood (ML) and Maximum parsimony (MP) showed that the two Nematodirus species (Molineidae) were closely related to Dictyocaulidae. The availability of the complete mtDNA sequences of N. oiratianus and N. spathiger not only provides new mtDNA sources for a better understanding of nematode mt genomics and phylogeny, but also provides novel and useful genetic markers for studying diagnosis, population genetics and molecular epidemiology of Nematodirus spp. in small ruminants.

The Evolution of Dark Matter in the Mitogenome of Seed Beetles

PubMed Central

Sayadi, Ahmed; Immonen, Elina; Tellgren-Roth, Christian

2017-01-01

Abstract Animal mitogenomes are generally thought of as being economic and optimized for rapid replication and transcription. We use long-read sequencing technology to assemble the remarkable mitogenomes of four species of seed beetles. These are the largest circular mitogenomes ever assembled in insects, ranging from 24,496 to 26,613 bp in total length, and are exceptional in that some 40% consists of non-coding DNA. The size expansion is due to two very long intergenic spacers (LIGSs), rich in tandem repeats. The two LIGSs are present in all species but vary greatly in length (114–10,408 bp), show very low sequence similarity, divergent tandem repeat motifs, a very high AT content and concerted length evolution. The LIGSs have been retained for at least some 45 my but must have undergone repeated reductions and expansions, despite strong purifying selection on protein coding mtDNA genes. The LIGSs are located in two intergenic sites where a few recent studies of insects have also reported shorter LIGSs (>200 bp). These sites may represent spaces that tolerate neutral repeat array expansions or, alternatively, the LIGSs may function to allow a more economic translational machinery. Mitochondrial respiration in adult seed beetles is based almost exclusively on fatty acids, which reduces the need for building complex I of the oxidative phosphorylation pathway (NADH dehydrogenase). One possibility is thus that the LIGSs may allow depressed transcription of NAD genes. RNA sequencing showed that LIGSs are partly transcribed and transcriptional profiling suggested that all seven mtDNA NAD genes indeed show low levels of transcription and co-regulation of transcription across sexes and tissues. PMID:29048527

Analysis of a repetitive DNA sequence from Bordetella pertussis and its application to the diagnosis of pertussis using the polymerase chain reaction.

PubMed Central

Glare, E M; Paton, J C; Premier, R R; Lawrence, A J; Nisbet, I T

1990-01-01

A tandemly repeated 1,046-base-pair (bp) ClaI DNA fragment from Bordetella pertussis was cloned into Escherichia coli by using the vector pUC19. This fragment, when isolated, hybridized strongly to DNA from all 100 clinical isolates of B. pertussis tested. It was shown to have homology to single-copy sequences in Bordetella bronchiseptica but not Bordetella parapertussis and did not hybridize to lysate blots of a wide range of other bacteria, including members of the closely related genera Pasteurella, Alcaligenes, and Haemophilus. The 1,046-bp fragment was sequenced, and complementary synthetic oligonucleotides flanking a 153-bp region within the repeated element were used as primers for specific amplification of this region using the polymerase chain reaction (PCR). This procedure was then applied to the rapid (5-h) detection of B. pertussis in nasopharyngeal secretions collected from 332 children with suspected pertussis. The test yielded positive results in a total of 98 samples, compared with 66 for culture and 33 for direct immunofluorescence (IF). All of the IF-positive samples were PCR positive, as were 63 of the samples from which B. pertussis was eventually cultured. Two hundred thirty-one specimens which were negative by IF and culture were also negative in the PCR assay. However, 33 culture- and IF-negative specimens were positive by PCR assay. Several of these specimens were collected from close contacts of culture-proven pertussis patients, were follow-up specimens from such patients, or were from patients with serological evidence of pertussis and therefore may be true-rather than false-positives. Images PMID:2229381

Comparative analysis and molecular characterization of genomic sequences and proteins of FABP4 and FABP5 from the giant panda (Ailuropoda melanoleuca).

PubMed

Song, B; Hou, Y L; Ding, X; Wang, T; Wang, F; Zhong, J C; Xu, T; Zhong, J; Hou, W R; Shuai, S R

2014-02-20

Fatty acid binding proteins (FABPs) are a family of small, highly conserved cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. In this study, cDNA and genomic sequences of FABP4 and FABP5 were cloned successfully from the giant panda (Ailuropoda melanoleuca) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-PCR. The cDNAs of FABP4 and FABP5 cloned from the giant panda were 400 and 413 bp in length, containing an open reading frame of 399 and 408 bp, encoding 132 and 135 amino acids, respectively. The genomic sequences of FABP4 and FABP5 were 3976 and 3962 bp, respectively, which each contained four exons and three introns. Sequence alignment indicated a high degree of homology with reported FABP sequences of other mammals at both the amino acid and DNA levels. Topology prediction revealed seven protein kinase C phosphorylation sites, two casein kinase II phosphorylation sites, two N-myristoylation sites, and one cytosolic fatty acid-binding protein signature in the FABP4 protein, and three N-glycosylation sites, three protein kinase C phosphorylation sites, one casein kinase II phosphorylation site, one N-myristoylation site, one amidation site, and one cytosolic fatty acid-binding protein signature in the FABP5 protein. The FABP4 and FABP5 genes were overexpressed in Escherichia coli BL21 and they produced the expected 16.8- and 17.0-kDa polypeptides. The results obtained in this study provide information for further in-depth research of this system, which has great value of both theoretical and practical significance.

Next-generation sequencing yields the complete mitochondrial genome of the flathead mullet, Mugil cephalus cryptic species in East Australia (Teleostei: Mugilidae).

PubMed

Shen, Kang-Ning; Chen, Ching-Hung; Hsiao, Chung-Der; Durand, Jean-Dominique

2016-09-01

In this study, the complete mitogenome sequence of a cryptic species from East Australia (Mugil sp. H) belonging to the worldwide Mugil cephalus species complex (Teleostei: Mugilidae) has been sequenced by next-generation sequencing method. The assembled mitogenome, consisting of 16,845 bp, had the typical vertebrate mitochondrial gene arrangement, including 13 protein-coding genes, 22 transfer RNAs, 2 ribosomal RNAs genes and a non-coding control region of D-loop. D-loop consists of 1067 bp length, and is located between tRNA-Pro and tRNA-Phe. The overall base composition of East Australia M. cephalus is 28.4% for A, 29.3% for C, 15.4% for G and 26.9% for T. The complete mitogenome may provide essential and important DNA molecular data for further phylogenetic and evolutionary analysis for flathead mullet species complex.

Next generation sequencing yields the complete mitochondrial genome of the flathead mullet, Mugil cephalus cryptic species NWP2 (Teleostei: Mugilidae).

PubMed

Shen, Kang-Ning; Yen, Ta-Chi; Chen, Ching-Hung; Li, Huei-Ying; Chen, Pei-Lung; Hsiao, Chung-Der

2016-05-01

In this study, the complete mitogenome sequence of Northwestern Pacific 2 (NWP2) cryptic species of flathead mullet, Mugil cephalus (Teleostei: Mugilidae) has been amplified by long-range PCR and sequenced by next-generation sequencing method. The assembled mitogenome, consisting of 16,686 bp, had the typical vertebrate mitochondrial gene arrangement, including 13 protein-coding genes, 22 transfer RNAs, 2 ribosomal RNAs genes and a non-coding control region of D-loop. D-loop was 909 bp length and was located between tRNA-Pro and tRNA-Phe. The overall base composition of NWP2 M. cephalus was 28.4% for A, 29.8% for C, 26.5% for T and 15.3% for G. The complete mitogenome may provide essential and important DNA molecular data for further phylogenetic and evolutionary analysis for flathead mullet species complex.

Comparative Analysis of the Complete Chloroplast Genome of Four Endangered Herbals of Notopterygium

PubMed Central

Yang, Jiao; Yue, Ming; Niu, Chuan; Ma, Xiong-Feng; Li, Zhong-Hu

2017-01-01

Notopterygium H. de Boissieu (Apiaceae) is an endangered perennial herb endemic to China. A good knowledge of phylogenetic evolution and population genomics is conducive to the establishment of effective management and conservation strategies of the genus Notopterygium. In this study, the complete chloroplast (cp) genomes of four Notopterygium species (N. incisum C. C. Ting ex H. T. Chang, N. oviforme R. H. Shan, N. franchetii H. de Boissieu and N. forrestii H. Wolff) were assembled and characterized using next-generation sequencing. We investigated the gene organization, order, size and repeat sequences of the cp genome and constructed the phylogenetic relationships of Notopterygium species based on the chloroplast DNA and nuclear internal transcribed spacer (ITS) sequences. Comparative analysis of plastid genome showed that the cp DNA are the standard double-stranded molecule, ranging from 157,462 bp (N. oviforme) to 159,607 bp (N. forrestii) in length. The circular DNA each contained a large single-copy (LSC) region, a small single-copy (SSC) region, and a pair of inverted repeats (IRs). The cp DNA of four species contained 85 protein-coding genes, 37 transfer RNA (tRNA) genes and 8 ribosomal RNA (rRNA) genes, respectively. We determined the marked conservation of gene content and sequence evolutionary rate in the cp genome of four Notopterygium species. Three genes (psaI, psbI and rpoA) were possibly under positive selection among the four sampled species. Phylogenetic analysis showed that four Notopterygium species formed a monophyletic clade with high bootstrap support. However, the inconsistent interspecific relationships with the genus Notopterygium were identified between the cp DNA and ITS markers. The incomplete lineage sorting, convergence evolution or hybridization, gene infiltration and different sampling strategies among species may have caused the incongruence between the nuclear and cp DNA relationships. The present results suggested that Notopterygium species may have experienced a complex evolutionary history and speciation process. PMID:28422071

Global diversity and oceanic divergence of humpback whales (Megaptera novaeangliae).

PubMed

Jackson, Jennifer A; Steel, Debbie J; Beerli, P; Congdon, Bradley C; Olavarría, Carlos; Leslie, Matthew S; Pomilla, Cristina; Rosenbaum, Howard; Baker, C Scott

2014-07-07

Humpback whales (Megaptera novaeangliae) annually undertake the longest migrations between seasonal feeding and breeding grounds of any mammal. Despite this dispersal potential, discontinuous seasonal distributions and migratory patterns suggest that humpbacks form discrete regional populations within each ocean. To better understand the worldwide population history of humpbacks, and the interplay of this species with the oceanic environment through geological time, we assembled mitochondrial DNA control region sequences representing approximately 2700 individuals (465 bp, 219 haplotypes) and eight nuclear intronic sequences representing approximately 70 individuals (3700 bp, 140 alleles) from the North Pacific, North Atlantic and Southern Hemisphere. Bayesian divergence time reconstructions date the origin of humpback mtDNA lineages to the Pleistocene (880 ka, 95% posterior intervals 550-1320 ka) and estimate radiation of current Northern Hemisphere lineages between 50 and 200 ka, indicating colonization of the northern oceans prior to the Last Glacial Maximum. Coalescent analyses reveal restricted gene flow between ocean basins, with long-term migration rates (individual migrants per generation) of less than 3.3 for mtDNA and less than 2 for nuclear genomic DNA. Genetic evidence suggests that humpbacks in the North Pacific, North Atlantic and Southern Hemisphere are on independent evolutionary trajectories, supporting taxonomic revision of M. novaeangliae to three subspecies. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

Global diversity and oceanic divergence of humpback whales (Megaptera novaeangliae)

PubMed Central

Jackson, Jennifer A.; Steel, Debbie J.; Beerli, P.; Congdon, Bradley C.; Olavarría, Carlos; Leslie, Matthew S.; Pomilla, Cristina; Rosenbaum, Howard; Baker, C. Scott

2014-01-01

Humpback whales (Megaptera novaeangliae) annually undertake the longest migrations between seasonal feeding and breeding grounds of any mammal. Despite this dispersal potential, discontinuous seasonal distributions and migratory patterns suggest that humpbacks form discrete regional populations within each ocean. To better understand the worldwide population history of humpbacks, and the interplay of this species with the oceanic environment through geological time, we assembled mitochondrial DNA control region sequences representing approximately 2700 individuals (465 bp, 219 haplotypes) and eight nuclear intronic sequences representing approximately 70 individuals (3700 bp, 140 alleles) from the North Pacific, North Atlantic and Southern Hemisphere. Bayesian divergence time reconstructions date the origin of humpback mtDNA lineages to the Pleistocene (880 ka, 95% posterior intervals 550–1320 ka) and estimate radiation of current Northern Hemisphere lineages between 50 and 200 ka, indicating colonization of the northern oceans prior to the Last Glacial Maximum. Coalescent analyses reveal restricted gene flow between ocean basins, with long-term migration rates (individual migrants per generation) of less than 3.3 for mtDNA and less than 2 for nuclear genomic DNA. Genetic evidence suggests that humpbacks in the North Pacific, North Atlantic and Southern Hemisphere are on independent evolutionary trajectories, supporting taxonomic revision of M. novaeangliae to three subspecies. PMID:24850919

Gene encoding herbicide safener binding protein

DOEpatents

Walton, Jonathan D.; Scott-Craig, John S.

1999-01-01

The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is set forth in FIG. 5 and SEQ ID No. 1. The deduced amino acid sequence is provided in FIG. 5 and SEQ ID No. 2. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with said vectors and seeds from said plants.

Phylogeny of triatomine vectors of Trypanosoma cruzi suggested by mitochondrial DNA sequences.

PubMed

Sainz, Andrés C; Mauro, Laura V; Moriyama, Etsuko N; García, Beatriz A

2004-07-01

The subfamily Triatominae (Hemiptera: Reduviidae) comprises hematophagous insects, most of which are actual or potential vectors of Trypanosoma cruzi, the protozoan agent of Chagas' disease (American trypanosomiasis). DNA sequence comparisons of mitochondrial DNA (mtDNA) genes were used to infer phylogenetic relationships among 32 species of the subfamily Triatominae, 26 belonging to the genus Triatoma and six species of different genera. We analyzed mtDNA fragments of the 12S and 16S ribosomal RNA genes (totaling 848-851 bp) from each of the 32 species, as well as of the cytochrome oxidase I (COI, 1447 bp) gene from nine. The phylogenetic analyses unambiguously supported several clusters within the genus Triatoma. In the morphological classification, T. costalimai was placed tentatively within the infestans complex while T. guazu was not included in any Triatoma complex. The placement of these species in the molecular phylogeny indicated that both belong to the infestans complex. We confirmed with a strong support the inclusion of T. circummaculata, a member of a different complex based on morphology, within the infestans complex. On the other hand, the present phylogenetics analysis did not support the monophyly of the infestans complex species as it was suggested in our previous studies. While no strong inference of polyphyly of the genus Triatoma was provided by the bootstrap analyses, the other species belonging to Triatomini analyzed could not be distinguished from the species of Triatoma.

Genomic characterisation of the feline sarcoid-associated papillomavirus and proposed classification as Bos taurus papillomavirus type 14.

PubMed

Munday, John S; Thomson, Neroli; Dunowska, Magda; Knight, Cameron G; Laurie, Rebecca E; Hills, Simon

2015-06-12

Feline sarcoids are rare mesenchymal neoplasms of domestic and exotic cats. Previous studies have consistently detected short DNA sequences from a papillomavirus (PV), designated feline sarcoid-associated papillomavirus (FeSarPV), in these neoplasms. The FeSarPV sequence has never been detected in any non-sarcoid sample from cats but has been amplified from the skin of cattle suggesting that feline sarcoids are caused by cross-species infection by a bovine papillomavirus (BPV). The aim of the present study was to determine the genome of the PV that contains the FeSarPV sequence. Using the circular nature of PV DNA, four specifically designed 'outward facing' primers were used to amplify two approximately 4,000 bp DNA segments from a feline sarcoid. The two PCR products were sequenced using next generation sequencing and the full genome of the PV, consisting 7,966 bp, was assembled and analysed. Phylogenetic analysis revealed the PV was closely related to the species 4 delta BPVs-1, -2, and -13, but distantly related to any carnivoran PV genus. These results are consistent with feline sarcoids being caused by a BPV type and we propose a classification of BPV-14 for this novel PV. Initial analysis suggests that, like other delta BPVs, the BPV-14 E5 protein could cause mesenchymal proliferation by binding to the platelet derived growth factor beta receptor. Interestingly BPV-14 has not been detected in any equine sarcoid suggesting that BPV-14 has a host range that is limited to bovids and felids. Copyright © 2015 Elsevier B.V. All rights reserved.

Mitochondrial DNA diversity of the Amerindian populations living in the Andean Piedmont of Bolivia: Chimane, Moseten, Aymara and Quechua.

PubMed

Corella, Alfons; Bert, Francesc; Pérez-Pérez, Alejandro; Gené, Manel; Turbón, Daniel

2007-01-01

Chimane, Moseten Aymara and Quechua are Amerindian populations living in the Bolivian Piedmont, a characteristic ecoregion between the eastern slope of the Andean mountains and the Amazonian Llanos de Moxos. In both neighbouring areas, dense and complex societies have developed over the centuries. The Piedmont area is especially interesting from a human peopling perspective since there is no clear evidence regarding the genetic influence and peculiarities of these populations. This land has been used extensively as a territory of economic and cultural exchange between the Andes and Amazonia, however Chimane and Moseten populations have been sufficiently isolated from their neighbour groups to be recognized as distinct populations. Genetic information suggests that evolutionary processes, such as genetic drift, natural selection and genetic admixture have formed the history of the Piedmont populations. The objective of this study is to characterize the genetic diversity of the Piedmont populations, analysing the sequence variability of the HVR-I control region in the mitochondrial DNA (mtDNA). Haplogroup mtDNA data available from the whole of Central and South America were utilized to determine the relationship of the Piedmont populations with other Amerindian populations. Hair pulls were obtained in situ, and DNA from non-related individuals was extracted using a standard Chelex 100 method. A 401 bp DNA fragment of HVR-I region was amplified using standard procedures. Two independent 401 and 328 bp DNA fragments were sequenced separately for each sample. The sequence analyses included mismatch distribution and mean pairwise differences, median network analyses, AMOVA and principal component analyses. The genetic diversity of DNA sequences was measured and compared with other South Amerindian populations. The genetic diversity of 401 nucleotide mtDNA sequences, in the hypervariable Control Region, from positions 16 000-16 400, was characterized in a sample of 46 Amerindians living in the Piedmont area in the Beni Department of Bolivia. The results obtained indicate that the genetic diversity in the area is higher than that observed in other American groups living in much larger areas and despite the reduced size of the studied area the human groups analysed show high levels of inter-group variability. In addition, results show that Amerindian populations living in the Piedmont are genetically more related to those in the Andean than in the Amazonian populations.

Construction of a full-length cDNA Library from Chinese oak silkworm pupa and identification of a KK-42-binding protein gene in relation to pupa-diapause termination.

PubMed

Li, Yu-Ping; Xia, Run-Xi; Wang, Huan; Li, Xi-Sheng; Liu, Yan-Qun; Wei, Zhao-Jun; Lu, Cheng; Xiang, Zhong-Huai

2009-06-24

In this study we successfully constructed a full-length cDNA library from Chinese oak silkworm, Antheraea pernyi, the most well-known wild silkworm used for silk production and insect food. Total RNA was extracted from a single fresh female pupa at the diapause stage. The titer of the library was 5 x 10(5) cfu/ml and the proportion of recombinant clones was approximately 95%. Expressed sequence tag (EST) analysis was used to characterize the library. A total of 175 clustered ESTs consisting of 24 contigs and 151 singlets were generated from 250 effective sequences. Of the 175 unigenes, 97 (55.4%) were known genes but only five from A. pernyi, 37 (21.2%) were known ESTs without function annotation, and 41 (23.4%) were novel ESTs. By EST sequencing, a gene coding KK-42-binding protein in A. pernyi (named as ApKK42-BP; GenBank accession no. FJ744151) was identified and characterized. Protein sequence analysis showed that ApKK42-BP was not a membrane protein but an extracellular protein with a signal peptide at position 1-18, and contained two putative conserved domains, abhydro_lipase and abhydrolase_1, suggesting it may be a member of lipase superfamily. Expression analysis based on number of ESTs showed that ApKK42-BP was an abundant gene in the period of diapause stage, suggesting it may also be involved in pupa-diapause termination.

Construction of a full-length cDNA Library from Chinese oak silkworm pupa and identification of a KK-42-binding protein gene in relation to pupa-diapause termination

PubMed Central

Li, Yu-Ping; Xia, Run-Xi; Wang, Huan; Li, Xi-Sheng; Liu, Yan-Qun; Wei, Zhao-Jun; Lu, Cheng; Xiang, Zhong-Huai

2009-01-01

In this study we successfully constructed a full-length cDNA library from Chinese oak silkworm, Antheraea pernyi, the most well-known wild silkworm used for silk production and insect food. Total RNA was extracted from a single fresh female pupa at the diapause stage. The titer of the library was 5 × 105 cfu/ml and the proportion of recombinant clones was approximately 95%. Expressed sequence tag (EST) analysis was used to characterize the library. A total of 175 clustered ESTs consisting of 24 contigs and 151 singlets were generated from 250 effective sequences. Of the 175 unigenes, 97 (55.4%) were known genes but only five from A. pernyi, 37 (21.2%) were known ESTs without function annotation, and 41 (23.4%) were novel ESTs. By EST sequencing, a gene coding KK-42-binding protein in A. pernyi (named as ApKK42-BP; GenBank accession no. FJ744151) was identified and characterized. Protein sequence analysis showed that ApKK42-BP was not a membrane protein but an extracellular protein with a signal peptide at position 1-18, and contained two putative conserved domains, abhydro_lipase and abhydrolase_1, suggesting it may be a member of lipase superfamily. Expression analysis based on number of ESTs showed that ApKK42-BP was an abundant gene in the period of diapause stage, suggesting it may also be involved in pupa-diapause termination. PMID:19564928

Characterization of the cod (Gadus morhua) steroidogenic acute regulatory protein (StAR) sheds light on StAR gene structure in fish.

PubMed

Goetz, Frederick W; Norberg, Birgitta; McCauley, Linda A R; Iliev, Dimitar B

2004-03-01

The full-length cDNA for the cod (Gadus morhua) StAR was cloned by RT-PCR and library screening using ovarian RNA. From the library screening, 2 size classes of cDNA were obtained; a 1577 bp cDNA (cStAR1) and a 2851 bp cDNA (cStAR2). The cStAR1 cDNA presumably encodes a protein of 286 amino acids. The cStAR2 cDNA was composed of 6 separated sequences that contained all of the coding regions of cStAR1 when added together, but also contained 5 noncoding regions not observed in cStAR1. Polymerase chain reactions of cod genomic DNA produced products slightly larger than cStAR2. The sequence of these products were the same as cStAR2 but revealed one additional noncoding region (intron). Thus, the fish StAR gene contains the same number of exons (7) and introns (6) as observed in mammals, but is approximately half the size of the mammalian gene. Using Northern analysis and RT-PCR, cStAR1 expression was observed only in testes, ovaries and head kidneys. Polymerase chain reaction products were also observed using cDNA from steroidogenic tissues and primers designed to regions specific for cStAR2, indicating that cStAR2 is expressed in tissues and may account for the presence of larger transcripts observed on Northern blots.

High copy number of highly similar mariner-like transposons in planarian (Platyhelminthe): evidence for a trans-phyla horizontal transfer.

PubMed

Garcia-Fernàndez, J; Bayascas-Ramírez, J R; Marfany, G; Muñoz-Mármol, A M; Casali, A; Baguñà, J; Saló, E

1995-05-01

Several DNA sequences similar to the mariner element were isolated and characterized in the platyhelminthe Dugesia (Girardia) tigrina. They were 1,288 bp long, flanked by two 32 bp-inverted repeats, and contained a single 339 amino acid open-reading frame (ORF) encoding the transposase. The number of copies of this element is approximately 8,000 per haploid genome, constituting a member of the middle-repetitive DNA of Dugesia tigrina. Sequence analysis of several elements showed a high percentage of conservation between the different copies. Most of them presented an intact ORF and the standard signals of actively expressed genes, which suggests that some of them are or have recently been functional transposons. The high degree of similarity shared with other mariner elements from some arthropods, together with the fact that this element is undetectable in other planarian species, strongly suggests a case of horizontal transfer between these two distant phyla.

Characterization of GM-CSF-inhibitory factor and Uracil DNA glycosylase encoding genes from camel pseudocowpoxvirus.

PubMed

Nagarajan, G; Swami, Shelesh Kumar; Dahiya, Shyam Singh; Narnaware, S D; Mehta, S C; Singh, P K; Singh, Raghvendar; Tuteja, F C; Patil, N V

2015-06-01

The present study describes the PCR amplification of GM-CSF-inhibitory factor (GIF) and Uracil DNA glycosylase (UDG) encoding genes of pseudocowpoxvirus (PCPV) from the Indian Dromedaries (Camelus dromedarius) infected with contagious ecthyma using the primers based on the corresponding gene sequences of human PCPV and reindeer PCPV, respectively. The length of GIF gene of PCPV obtained from camel is 795 bp and due to the addition of one cytosine residue at position 374 and one adenine residue at position 516, the open reading frame (ORF) got altered, resulting in the production of truncated polypeptide. The ORF of UDG encoding gene of camel PCPV is 696 bp encoding a polypeptide of 26.0 kDa. Comparison of amino acid sequence homologies of GIF and UDG of camel PCPV revealed that the camel PCPV is closer to ORFV and PCPV (reference stains of both human and reindeer), respectively. Copyright © 2015 Elsevier Ltd. All rights reserved.

Navigating the tip of the genomic iceberg: Next-generation sequencing for plant systematics.

PubMed

Straub, Shannon C K; Parks, Matthew; Weitemier, Kevin; Fishbein, Mark; Cronn, Richard C; Liston, Aaron

2012-02-01

Just as Sanger sequencing did more than 20 years ago, next-generation sequencing (NGS) is poised to revolutionize plant systematics. By combining multiplexing approaches with NGS throughput, systematists may no longer need to choose between more taxa or more characters. Here we describe a genome skimming (shallow sequencing) approach for plant systematics. Through simulations, we evaluated optimal sequencing depth and performance of single-end and paired-end short read sequences for assembly of nuclear ribosomal DNA (rDNA) and plastomes and addressed the effect of divergence on reference-guided plastome assembly. We also used simulations to identify potential phylogenetic markers from low-copy nuclear loci at different sequencing depths. We demonstrated the utility of genome skimming through phylogenetic analysis of the Sonoran Desert clade (SDC) of Asclepias (Apocynaceae). Paired-end reads performed better than single-end reads. Minimum sequencing depths for high quality rDNA and plastome assemblies were 40× and 30×, respectively. Divergence from the reference significantly affected plastome assembly, but relatively similar references are available for most seed plants. Deeper rDNA sequencing is necessary to characterize intragenomic polymorphism. The low-copy fraction of the nuclear genome was readily surveyed, even at low sequencing depths. Nearly 160000 bp of sequence from three organelles provided evidence of phylogenetic incongruence in the SDC. Adoption of NGS will facilitate progress in plant systematics, as whole plastome and rDNA cistrons, partial mitochondrial genomes, and low-copy nuclear markers can now be efficiently obtained for molecular phylogenetics studies.

Length Variation, Heteroplasmy and Sequence Divergence in the Mitochondrial DNA of Four Species of Sturgeon (Acipenser)

PubMed Central

Brown, J. R.; Beckenbach, K.; Beckenbach, A. T.; Smith, M. J.

1996-01-01

The extent of mtDNA length variation and heteroplasmy as well as DNA sequences of the control region and two tRNA genes were determined for four North American sturgeon species: Acipenser transmontanus, A. medirostris, A. fulvescens and A. oxyrhnychus. Across the Continental Divide, a division in the occurrence of length variation and heteroplasmy was observed that was concordant with species biogeography as well as with phylogenies inferred from restriction fragment length polymorphisms (RFLP) of whole mtDNA and pairwise comparisons of unique sequences of the control region. In all species, mtDNA length variation was due to repeated arrays of 78-82-bp sequences each containing a D-loop strand synthesis termination associated sequence (TAS). Individual repeats showed greater sequence conservation within individuals and species rather than between species, which is suggestive of concerted evolution. Differences in the frequencies of multiple copy genomes and heteroplasmy among the four species may be ascribed to differences in the rates of recurrent mutation. A mechanism that may offset the high rate of mutation for increased copy number is suggested on the basis that an increase in the number of functional TAS motifs might reduce the frequency of successfully initiated H-strand replications. PMID:8852850

Cytochrome P450 1C1 complementary DNA cloning, sequence analysis and constitutive expression induced by benzo-a-pyrene in Nile tilapia (Oreochromis niloticus).

PubMed

Hassanin, Abeer A I; Kaminishi, Yoshino; Funahashi, Aki; Itakura, Takao

2012-03-01

CYP1C is the newest member of the CYP1 family of P450s; however, its physiological significance, inducers, and metabolic functions are unknown. In this study, a new complementary DNA of the CYP1C subfamily encoding CYP1C1 was isolated from Nile tilapia (Oreochromis niloticus) liver after intracoelomic injection with benzo-a-pyrene (BaP). The full-length cDNA was 2223 base pair (bp) long and contained an open reading frame of 1581 bp encoding a protein of 526 amino acids and a stop codon. The sequence exhibited 3' non-coding region of 642 bp. The deduced amino acid sequence of O. niloticus CYP1C1 shows similarities of 86, 82.5, 79.7, 78.7, 77.8, 75.5, 69.6 and 61.3% with scup CYP1C1, killifish CYP1C1,1C2, Japanese eel CYP1C1, zebra fish CYP1C1, common carp CYP1C1, scup CYP1C2, common carp CYP1C2 and zebra fish CYP1C2, respectively. Phylogenetic tree based on the amino acids sequences clearly shows tilapia CYP1C1 and scup CYP1C1 to be more closely related to each other than to CYP1C genes from other species. Furthermore, for measuring BaP induction of CYP1C1 mRNA in different organs of tilapia (O. niloticus), β-actin gene as internal control was selected based on previous studies to assess their expression variability. Real time RCR results revealed that there was a large increase in CYP1C1 mRNA in liver (43.1), intestine (5.1) and muscle (2.4). Copyright © 2011 Elsevier B.V. All rights reserved.

Characterization of Toll-like receptor 3 gene in large yellow croaker, Pseudosciaena crocea.

PubMed

Huang, Xue-Na; Wang, Zhi-Yong; Yao, Cui-Luan

2011-07-01

Toll-like receptor 3 (TLR3) plays an important role in innate immune responses. In this report, the full-length cDNA sequence and genomic structure of Pseudosciaena crocea TLR3 (PcTLR3) were identified and characterized. The full-length cDNA of PcTLR3 was of 3384 bp, including a 5'-terminal untranslated region (UTR) of 65 bp, a 3'-terminal UTR of 589 bp and an open reading frame (ORF) of 2730 bp encoding a polypeptide of 909 amino acid residues. The full-length genome sequence of PcTLR3 was composed of 5721 nucleotides, including five exons and four introns. The putative PcTLR3 protein contained a signal peptide sequence, 16 leucine-rich repeat (LRR) motifs, a transmembrane region and a Toll/interleukin-1 receptor (TIR) domain. Quantitative real-time reverse transcription PCR analysis revealed a broad expression of PcTLR3 in most tissues, with the predominant expression in liver, then intestine, and the weakest expression in blood cells. The expression of PcTLR3 after injection with poly inosinic:cytidylic (I:C) and Vibrio parahemolyticus was tested in spleen, blood cells and liver. The results indicated that PcTLR3 transcripts could be induced in the three tissues by injection with poly I:C. The highest expression was in the blood cells with 43.5 times (at 6h) greater expression than in the control (p<0.05). In addition, after V. parahemolyticus challenge, a moderate up-regulation and down-regulation of PcTLR3 was found in blood cells and liver, respectively. Our results suggested that PcTLR3 might play an important role in fish's defense against both viral and bacterial infection. Copyright © 2011 Elsevier Ltd. All rights reserved.

Cloning of Novel Isoforms of the Human Gli2 Oncogene and Their Activities To Enhance Tax-Dependent Transcription of the Human T-Cell Leukemia Virus Type 1 Genome

PubMed Central

Tanimura, Akira; Dan, Shingo; Yoshida, Mitsuaki

1998-01-01

The expression of human T-cell leukemia virus type 1 (HTLV-1) is activated by interaction of a viral transactivator protein, Tax, and cellular transcription factor, CREB (cyclic AMP response element binding protein), which bind to a 21-bp enhancer in the long terminal repeats (LTR). THP (Tax-helping protein) was previously determined to enhance the transactivation by Tax protein. Here we report novel forms of the human homolog of a member of the Gli oncogene family, Gli2 (also termed Gli2/THP), an extended form of a zinc finger protein, THP, which was described previously. Four possible isoforms (hGli2 α, β, γ, and δ) are formed by combinations of two independent alternative splicings, and all the isoforms could bind to a DNA motif, TRE2S, in the LTR. The longer isoforms, α and β, were abundantly expressed in various cell lines including HTLV-1-infected T-cell lines. Fusion proteins of the hGli2 isoforms with the DNA-binding domain of Gal4 activated transcription when the reporter contained a Gal4-binding site and one copy of the 21-bp sequence, to which CREB binds. This activation was observed only in the presence of Tax. The 21-bp sequence in the reporter was also essential for the activation. These results suggest that simultaneous binding of hGli2 and CREB to the respective sites in the reporter seems to be critical for Tax protein to activate transcription. Consequently, it is probable that the LTR can be regulated by two independent signals through hGli2 and CREB, since the LTR contains the 21-bp and TRE2S sequences in the vicinity. PMID:9557682

Characterization of the Complete Mitochondrial Genome Sequence of Spirometra erinaceieuropaei (Cestoda: Diphyllobothriidae) from China

PubMed Central

Liu, Guo-Hua; Li, Chun; Li, Jia-Yuan; Zhou, Dong-Hui; Xiong, Rong-Chuan; Lin, Rui-Qing; Zou, Feng-Cai; Zhu, Xing-Quan

2012-01-01

Sparganosis, caused by the plerocercoid larvae of members of the genus Spirometra, can cause significant public health problem and considerable economic losses. In the present study, the complete mitochondrial DNA (mtDNA) sequence of Spirometra erinaceieuropaei from China was determined, characterized and compared with that of S. erinaceieuropaei from Japan. The gene arrangement in the mt genome sequences of S. erinaceieuropaei from China and Japan is identical. The identity of the mt genomes was 99.1% between S. erinaceieuropaei from China and Japan, and the complete mtDNA sequence of S. erinaceieuropaei from China is slightly shorter (2 bp) than that from Japan. Phylogenetic analysis of S. erinaceieuropaei with other representative cestodes using two different computational algorithms [Bayesian inference (BI) and maximum likelihood (ML)] based on concatenated amino acid sequences of 12 protein-coding genes, revealed that S. erinaceieuropaei is closely related to Diphyllobothrium spp., supporting classification based on morphological features. The present study determined the complete mtDNA sequences of S. erinaceieuropaei from China that provides novel genetic markers for studying the population genetics and molecular epidemiology of S. erinaceieuropaei in humans and animals. PMID:22553464

A comparative study of ancient environmental DNA to pollen and macrofossils from lake sediments reveals taxonomic overlap and additional plant taxa

NASA Astrophysics Data System (ADS)

Pedersen, Mikkel Winther; Ginolhac, Aurélien; Orlando, Ludovic; Olsen, Jesper; Andersen, Kenneth; Holm, Jakob; Funder, Svend; Willerslev, Eske; Kjær, Kurt H.

2013-09-01

We use 2nd generation sequencing technology on sedimentary ancient DNA (sedaDNA) from a lake in South Greenland to reconstruct the local floristic history around a low-arctic lake and compare the results with those previously obtained from pollen and macrofossils in the same lake. Thirty-eight of thirty-nine samples from the core yielded putative DNA sequences. Using a multiple assignment strategy on the trnL g-h DNA barcode, consisting of two different phylogenetic and one sequence similarity assignment approaches, thirteen families of plants were identified, of which two (Scrophulariaceae and Asparagaceae) are absent from the pollen and macrofossil records. An age model for the sediment based on twelve radiocarbon dates establishes a chronology and shows that the lake record dates back to 10,650 cal yr BP. Our results suggest that sedaDNA analysis from lake sediments, although taxonomically less detailed than pollen and macrofossil analyses can be a complementary tool for establishing the composition of both terrestrial and aquatic local plant communities and a method for identifying additional taxa.

An unexpectedly large and loosely packed mitochondrial genome in the charophycean green alga Chlorokybus atmophyticus

PubMed Central

Turmel, Monique; Otis, Christian; Lemieux, Claude

2007-01-01

Background The Streptophyta comprises all land plants and six groups of charophycean green algae. The scaly biflagellate Mesostigma viride (Mesostigmatales) and the sarcinoid Chlorokybus atmophyticus (Chlorokybales) represent the earliest diverging lineages of this phylum. In trees based on chloroplast genome data, these two charophycean green algae are nested in the same clade. To validate this relationship and gain insight into the ancestral state of the mitochondrial genome in the Charophyceae, we sequenced the mitochondrial DNA (mtDNA) of Chlorokybus and compared this genome sequence with those of three other charophycean green algae and the bryophytes Marchantia polymorpha and Physcomitrella patens. Results The Chlorokybus genome differs radically from its 42,424-bp Mesostigma counterpart in size, gene order, intron content and density of repeated elements. At 201,763-bp, it is the largest mtDNA yet reported for a green alga. The 70 conserved genes represent 41.4% of the genome sequence and include nad10 and trnL(gag), two genes reported for the first time in a streptophyte mtDNA. At the gene order level, the Chlorokybus genome shares with its Chara, Chaetosphaeridium and bryophyte homologues eight to ten gene clusters including about 20 genes. Notably, some of these clusters exhibit gene linkages not previously found outside the Streptophyta, suggesting that they originated early during streptophyte evolution. In addition to six group I and 14 group II introns, short repeated sequences accounting for 7.5% of the genome were identified. Mitochondrial trees were unable to resolve the correct position of Mesostigma, due to analytical problems arising from accelerated sequence evolution in this lineage. Conclusion The Chlorokybus and Mesostigma mtDNAs exemplify the marked fluidity of the mitochondrial genome in charophycean green algae. The notion that the mitochondrial genome was constrained to remain compact during charophycean evolution is no longer tenable. Our data raise the possibility that the emergence of land plants was not associated with a substantial gain of intergenic sequences by the mitochondrial genome. PMID:17537252

Mechanisms of double-strand-break repair during gene targeting in mammalian cells.

PubMed Central

Ng, P; Baker, M D

1999-01-01

In the present study, the mechanism of double-strand-break (DSB) repair during gene targeting at the chromosomal immunoglobulin mu-locus in a murine hybridoma was examined. The gene-targeting assay utilized specially designed insertion vectors genetically marked in the region of homology to the chromosomal mu-locus by six diagnostic restriction enzyme site markers. The restriction enzyme markers permitted the contribution of vector-borne and chromosomal mu-sequences in the recombinant product to be determined. The use of the insertion vectors in conjunction with a plating procedure in which individual integrative homologous recombination events were retained for analysis revealed several important features about the mammalian DSB repair process:The presence of the markers within the region of shared homology did not affect the efficiency of gene targeting.In the majority of recombinants, the vector-borne marker proximal to the DSB was absent, being replaced with the corresponding chromosomal restriction enzyme site. This result is consistent with either formation and repair of a vector-borne gap or an "end" bias in mismatch repair of heteroduplex DNA (hDNA) that favored the chromosomal sequence. Formation of hDNA was frequently associated with gene targeting and, in most cases, began approximately 645 bp from the DSB and could encompass a distance of at least 1469 bp.The hDNA was efficiently repaired prior to DNA replication.The repair of adjacent mismatches in hDNA occurred predominantly on the same strand, suggesting the involvement of a long-patch repair mechanism. PMID:10049929

Complementary DNA cloning and organ expression of cytochrome P450 1C2 in carp (Cyprinus carpio).

PubMed

Kaminishi, Yoshio; El-Kady, Mohamed A H; Mitsuo, Ryoichi; Itakura, Takao

2007-01-01

Cytochrome P450 (CYP) genes, which make up a large gene superfamily, are known to play an important role in drug metabolism. The CYP1 family, one of the gene families of the CYP superfamily, has three subfamilies of genes whose sequences have been deposited in the GenBank/EMBL thus far: CYP1A, CYP1B, and CYP1C. Mammals as well as fish confront numerous foreign chemicals in the environment that may accumulate to toxic levels unless they are metabolized and eliminated by processes largely mediated by CYP enzymes. A new complementary DNA of the CYP1C subfamily encoding CYP1C2 was isolated from the carp liver after a single intraperitoneal injection of beta-napthoflavone (BNF). The full-length cDNA obtained contained a 5' noncoding region of 198 bp, an open reading frame of 1575 bp coding for 524 amino acids and a stop codon, and a 3' noncoding region of 531 bp. The predicted molecular weight of the protein was approximately 59.3 kDa. The amino acid sequence deduced from the carp CYP1C2 sequence showed a similarity of 76.6% with that deduced from our previously reported carp CYP1C1. It exhibited similarities of 77.3, 73.7, and 76.4% with those deduced from scup CYP1C2, scup CYP1C1, and Japanese eel CYP1C1 sequences, respectively. Carp CYP1C2 cDNA showed similarities with reported CYP1Bs of teleosts and mammals, namely, 47.6, 45.3, 45.7, 44.0, and 44.6% for carp, plaice, human, rat, and mouse CYP1B1s, respectively, while it exhibited a similarity of 49.0% with carp CYP1B2. The carp CYP1C2 sequence was aligned with the CYP1 sequences and has been deposited in the GenBank/EMBL data bank with the accession number AY437777. The phylogenetic tree constructed using fish and mammalian CYP1 sequences suggested a closer relationship of CYP1C with CYP1B than with CYP1A. The tree showed possibile existence of CYP1C subfamily genes in mammalian species. Northern blot analysis of the liver, intestines, kidneys, and gills revealed a distinct induced expression only in the kidneys, with no detectable constitutive expression in the other organs studied.

Complete mitochondrial DNA sequence of a tadpole shrimp (Triops cancriformis) and analysis of museum samples.

PubMed

Umetsu, Kazuo; Iwabuchi, Naruki; Yuasa, Isao; Saitou, Naruya; Clark, Paul F; Boxshall, Geoff; Osawa, Motoki; Igarashi, Keiji

2002-12-01

The complete mitochondrial DNA (mtNDA) of the tadpole shrimp Triops cancriformis was sequenced. The sequence consisted of 15,101 bp with an A+T content of 69%. Its gene arrangement was identical with those sequences of the water flea (Daphnia pulex) and giant tiger prawn (Penaeus monodon), whereas it differed from that of the brine shrimp (Artemia franciscana) in the arrangement of its genes for tRNAs. Phylogenetic analysis revealed T. cancriformis to be more closely related to the water flea than to the brine shrimp and giant tiger prawn. We also compared the 16S rRNA sequences of five formalin-fixed tadpole shrimps that had been collected in five different locations and stored in a museum. The sequence divergence was in the range of 0-1.51%, suggesting that those samples were closely related to each other.

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

Development of a peptide nucleic acid polymerase chain reaction clamping assay for semiquantitative evaluation of genetically modified organism content in food.

PubMed

Peano, C; Lesignoli, F; Gulli, M; Corradini, R; Samson, M C; Marchelli, R; Marmiroli, N

2005-09-15

In the present study a peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping method was developed and applied to the detection of genetically modified organisms (GMO), to test PCR products for band identity and to obtain a semiquantitative evaluation of GMO content. The minimal concentration of PNA necessary to block the PCR was determined by comparing PCRs containing a constant amount of DNA in the presence of increasing concentration of target-specific PNA. The lowest PNA concentration at which specific inhibition took place, by the inhibition of primer extension and/or steric hindrance, was the most efficient condition. Optimization of PCR clamping by PNA was observed by testing five different PNAs with a minimum of 13 bp to a maximum of 15 bp, designed on the target sequence of Roundup Ready soybean. The results obtained on the DNA extracted from Roundup Ready soybean standard flour were verified also on DNA extracted from standard flours of maize GA21, Bt176, Bt11, and MON810. A correlation between the PNA concentration necessary for inducing PCR clamping and the percentage of the GMO target sequence in the sample was found.

Insight into the validity of Leptobrachium guangxiense (Anura: Megophryidae): evidence from mitochondrial DNA sequences and morphological characters.

PubMed

Chen, Weicai; Zhang, Wei; Zhou, Shichu; Li, Ning; Huang, Yong; Mo, Yunming

2013-01-01

Lepobrachiun guangxiense Fei, Mo, Ye and Jiang, 2009 (Anura: Megophryidae), is presently thought to be endemic to Shangsi, Guangxi Province, China. A molecular phylogenetic analysis and morphological data were performed to gain insight into the phylogenetic position of this species. Maximum parsimony, maximum likelihood, and Bayesian inference methods were employed to reconstruct phylogenetic relationship, using 1914 bp of sequences from mtDNA genes of 12S rRNA, tRNAVal and 16S rRNA. Topologies revealed that L. guangxiense and Tam Dao (Vietnam) L. chapaense lineage (3A) formed a monophyletic group with well-supported values. The uncorrected p-distance of ~1.4k bp 16S rRNA data-sets between Tam Dao L. chapaense lineage (3A) and L. guangxiense is only 0.1%. Morphologically, L. guangxiense and Tam Dao L. chapaense lineage (3A) shared the same characters, and are distinguishable from "true" L. chapaense from the type locality in Sa Pa, Vietnam. Based on morphological characters and mitochondrial DNA, we suggested that the Tam Dao lineages of L. chapaense are conspecific with L. guangxiense. This represents a range extension for L. guangxiense, and a new country record for Vietnam.

Cloning of TPS gene from eelgrass species Zostera marina and its functional identification by genetic transformation in rice.

PubMed

Zhao, Feng; Li, Qiuying; Weng, Manli; Wang, Xiuliang; Guo, Baotai; Wang, Li; Wang, Wei; Duan, Delin; Wang, Bin

2013-12-01

The full-length cDNA sequence (2613 bp) of the trehalose-6-phosphate synthase (TPS) gene of eelgrass Zostera marina (ZmTPS) was identified and cloned. Z. marina is a kind of seed-plant growing in sea water during its whole life history. The open reading frame (ORF) region of ZmTPS gene encodes a protein of 870 amino acid residues and a stop codon. The corresponding genomic DNA sequence is 3770 bp in length, which contains 3 exons and 2 introns. The ZmTPS gene was transformed into rice variety ZH11 via Agrobacterium-mediated transformation method. After antibiotic screening, molecular characterization, salt-tolerance and trehalose content determinations, two transgenic lines resistant to 150 mM NaCL solutions were screened. Our study results indicated that the ZmTPS gene was integrated into the genomic DNA of the two transgenic rice lines and could be expressed well. Moreover, the detection of the transformed ZmTPS gene in the progenies of the two transgenic lines was performed from T1 to T4 generations; and results suggested that the transformed ZmTPS gene can be transmitted from parent to the progeny in transgenic rice. © 2013.

Surface salt bridges modulate DNA wrapping by the type II DNA-binding protein TF1.

PubMed

Grove, Anne

2003-07-29

The histone-like protein HU is involved in compaction of the bacterial genome. Up to 37 bp of DNA may be wrapped about some HU homologues in a process that has been proposed to depend on a linked disruption of surface salt bridges that liberates cationic side chains for interaction with the DNA. Despite significant sequence conservation between HU homologues, binding sites from 9 to 37 bp have been reported. TF1, an HU homologue that is encoded by Bacillus subtilis bacteriophage SPO1, has nM affinity for 37 bp preferred sites in DNA with 5-hydroxymethyluracil (hmU) in place of thymine. On the basis of electrophoretic mobility shift assays, we show that TF1-DNA complex formation is associated with a net release of only approximately 0.5 cations. The structure of TF1 suggests that Asp13 can form a dehydrated surface salt bridge with Lys23; substitution of Asp13 with Ala increases the net release of cations to approximately 1. These data are consistent with complex formation linked to disruption of surface salt bridges. Substitution of Glu90 with Ala, which would expose Lys87 predicted to contact DNA immediately distal to a proline-mediated DNA kink, causes an increase in affinity and an abrogation of the preference for hmU-containing DNA. We propose that hmU preference is due to finely tuned interactions at the sites of kinking that expose a differential flexibility of hmU- and T-containing DNA. Our data further suggest that the difference in binding site size for HU homologues is based on a differential ability to stabilize the DNA kinks.

Skipping of Exons by Premature Termination of Transcription and Alternative Splicing within Intron-5 of the Sheep SCF Gene: A Novel Splice Variant

PubMed Central

Saravanaperumal, Siva Arumugam; Pediconi, Dario; Renieri, Carlo; La Terza, Antonietta

2012-01-01

Stem cell factor (SCF) is a growth factor, essential for haemopoiesis, mast cell development and melanogenesis. In the hematopoietic microenvironment (HM), SCF is produced either as a membrane-bound (−) or soluble (+) forms. Skin expression of SCF stimulates melanocyte migration, proliferation, differentiation, and survival. We report for the first time, a novel mRNA splice variant of SCF from the skin of white merino sheep via cloning and sequencing. Reverse transcriptase (RT)-PCR and molecular prediction revealed two different cDNA products of SCF. Full-length cDNA libraries were enriched by the method of rapid amplification of cDNA ends (RACE-PCR). Nucleotide sequencing and molecular prediction revealed that the primary 1519 base pair (bp) cDNA encodes a precursor protein of 274 amino acids (aa), commonly known as ‘soluble’ isoform. In contrast, the shorter (835 and/or 725 bp) cDNA was found to be a ‘novel’ mRNA splice variant. It contains an open reading frame (ORF) corresponding to a truncated protein of 181 aa (vs 245 aa) with an unique C-terminus lacking the primary proteolytic segment (28 aa) right after the D175G site which is necessary to produce ‘soluble’ form of SCF. This alternative splice (AS) variant was explained by the complete nucleotide sequencing of splice junction covering exon 5-intron (5)-exon 6 (948 bp) with a premature termination codon (PTC) whereby exons 6 to 9/10 are skipped (Cassette Exon, CE 6–9/10). We also demonstrated that the Northern blot analysis at transcript level is mediated via an intron-5 splicing event. Our data refine the structure of SCF gene; clarify the presence (+) and/or absence (−) of primary proteolytic-cleavage site specific SCF splice variants. This work provides a basis for understanding the functional role and regulation of SCF in hair follicle melanogenesis in sheep beyond what was known in mice, humans and other mammals. PMID:22719917

Complete mitochondrial genome sequence of Melipona scutellaris, a Brazilian stingless bee.

PubMed

Pereira, Ulisses de Padua; Bonetti, Ana Maria; Goulart, Luiz Ricardo; Santos, Anderson Rodrigues Dos; Oliveira, Guilherme Correa de; Cuadros-Orellana, Sara; Ueira-Vieira, Carlos

2016-09-01

Melipona scutellaris is a Brazilian stingless bee species and a highly important native pollinator besides its use in rational rearing for honey production. In this study, we present the whole mitochondrial DNA sequence of M. scutellaris from a haploid male. The mitogenome has a size of 14,862 bp and harbors 13 protein-coding genes (PCGs), 2 rRNA genes and 21 tRNA genes.

CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

EPA Science Inventory

Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

Assembly of the draft genome of buckwheat and its applications in identifying agronomically useful genes.

PubMed

Yasui, Yasuo; Hirakawa, Hideki; Ueno, Mariko; Matsui, Katsuhiro; Katsube-Tanaka, Tomoyuki; Yang, Soo Jung; Aii, Jotaro; Sato, Shingo; Mori, Masashi

2016-06-01

Buckwheat (Fagopyrum esculentum Moench; 2n = 2x = 16) is a nutritionally dense annual crop widely grown in temperate zones. To accelerate molecular breeding programmes of this important crop, we generated a draft assembly of the buckwheat genome using short reads obtained by next-generation sequencing (NGS), and constructed the Buckwheat Genome DataBase. After assembling short reads, we determined 387,594 scaffolds as the draft genome sequence (FES_r1.0). The total length of FES_r1.0 was 1,177,687,305 bp, and the N50 of the scaffolds was 25,109 bp. Gene prediction analysis revealed 286,768 coding sequences (CDSs; FES_r1.0_cds) including those related to transposable elements. The total length of FES_r1.0_cds was 212,917,911 bp, and the N50 was 1,101 bp. Of these, the functions of 35,816 CDSs excluding those for transposable elements were annotated by BLAST analysis. To demonstrate the utility of the database, we conducted several test analyses using BLAST and keyword searches. Furthermore, we used the draft genome as a reference sequence for NGS-based markers, and successfully identified novel candidate genes controlling heteromorphic self-incompatibility of buckwheat. The database and draft genome sequence provide a valuable resource that can be used in efforts to develop buckwheat cultivars with superior agronomic traits. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Complete mitochondrial genome of the South Polar Skua Stercorarius maccormicki (Charadriiformes, Stercorariidae) in Antarctica.

PubMed

Han, Yeong-Deok; Baek, Ye-Seul; Kim, Jeong-Hoon; Choi, Han-Gu; Kim, Sanghee

2016-05-01

The South Polar Skua, gull-like seabirds is the most fascinating Antarctic seabirds that lay two eggs at sites free of snow and ice and predominantly hunt pelagic fish and penguins. Blood samples of the South Polar Skua Stercorarius maccormicki was collected during the summer activity near King Sejong station in Antarctica. The complete mitochondrial DNA sequence of S. maccormicki was 16,669 bp, showing conserved genome structure and orientation found in other avian species. The control region of S. maccormicki was 93- and 80 bp shorter compared to those of Chroicocephalus saundersi and Synthliboramphus antiquus respectively. Interestingly, there is a (CAACAAACAA)6 repeat sequence in the control region. Our results of S. maccormicki mt genome including the repeat sequence, may provide useful genetic information for phylogenetic and phylogeographic histories of the southern skua complex.

A novel RNA species from the turtle mitochondrial genome: induction and regulation of transcription and processing under anoxic and freezing stresses.

PubMed

Cai, Q; Storey, K B

1997-08-01

The present study identifies a previously cloned cDNA, pBTaR914, as homologous to the mitochondrial WANCY (tryptophan, alanine, asparagine, cysteine, and tyrosine) tRNA gene cluster. This cDNA clone has a 304-bp sequence and its homologue, pBTaR09, has a 158-bp sequence with a long poly(A)+ tail (more than 60 adenosines). RNA blotting analysis using pBTaR914 probe against the total RNA from the tissues of adult and hatchling turtles revealed five bands: 540, 1800, 2200, 3200, and 3900 nucleotides (nt). The 540-nt transcript is considered to be an intact mtRNA unit from a novel mtDNA gene designated WANCYHP that overlaps the WANCY tRNA gene cluster region. This transcript was highly induced by both anoxic and freezing stresses in turtle heart. The other transcripts are considered to be the processed intermediates of mtRNA transcripts with WANCYHP sequence. All these transcripts were differentially regulated by anoxia and freezing in different organs. The data suggest that mtRNA processing is sensitive to regulation by external stresses, oxygen deprivation, and freezing. Furthermore, the fact that the WANCYHP transcript is highly induced during anoxic exposure suggests that it may play an important role in the regulation of mitochondrial activities to coordinate the physiological adaptation to anoxia.

Is ITS-2 rDNA suitable marker for genetic characterization of Sarcoptes mites from different wild animals in different geographic areas?

PubMed

Alasaad, S; Soglia, D; Spalenza, V; Maione, S; Soriguer, R C; Pérez, J M; Rasero, R; Degiorgis, M P Ryser; Nimmervoll, H; Zhu, X Q; Rossi, L

2009-02-05

The present study examined the relationship among individual Sarcoptes scabiei mites from 13 wild mammalian populations belonging to nine species in four European countries using the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) as genetic marker. The ITS-2 plus primer flanking 5.8S and 28S rDNA (ITS-2+) was amplified from individual mites by polymerase chain reaction (PCR) and the amplicons were sequenced directly. A total of 148 ITS-2+ sequences of 404bp in length were obtained and 67 variable sites were identified (16.59%). UPGMA analyses did not show any geographical or host-specific clustering, and a similar outcome was obtained using population pairwise Fst statistics. These results demonstrated that ITS-2 rDNA does not appear to be suitable for examining genetic diversity among mite populations.

A septal chromosome segregator protein evolved into a conjugative DNA-translocator protein

PubMed Central

Sepulveda, Edgardo; Vogelmann, Jutta

2011-01-01

Streptomycetes, Gram-positive soil bacteria well known for the production of antibiotics feature a unique conjugative DNA transfer system. In contrast to classical conjugation which is characterized by the secretion of a pilot protein covalently linked to a single-stranded DNA molecule, in Streptomyces a double-stranded DNA molecule is translocated during conjugative transfer. This transfer involves a single plasmid encoded protein, TraB. A detailed biochemical and biophysical characterization of TraB, revealed a close relationship to FtsK, mediating chromosome segregation during bacterial cell division. TraB translocates plasmid DNA by recognizing 8-bp direct repeats located in a specific plasmid region clt. Similar sequences accidentally also occur on chromosomes and have been shown to be bound by TraB. We suggest that TraB mobilizes chromosomal genes by the interaction with these chromosomal clt-like sequences not relying on the integration of the conjugative plasmid into the chromosome. PMID:22479692

DNA detection rates of host mtDNA in bloodmeals of human body lice (Pediculus humanus L., 1758).

PubMed

Davey, J S; Casey, C S; Burgess, I F; Cable, J

2007-09-01

Using polymerase chain reaction, we investigated the extent to which digestion affects the potential to amplify 12S mitochondrial DNA sequences from bloodmeals of individual human body lice (Pediculus humanus L.) (Phthiraptera, Pediculidae) up to 72 h after feeding on a surrogate rabbit host (Oryctolagus cuniculus L.) (Lagomorpha, Leporidae). Two rabbit-specific primer pairs were developed to produce amplicons of 199 bp and 283 bp, the smaller of which was found to have a significantly slower decay rate. Median detection periods (T50) for the amplicons were 20 h and 12 h, with maximum detection periods of 24 h and 12 h, respectively, suggesting an inversely proportional linear relationship between amplicon size and digestion time. The data provide an indication of timeframes essential for the design of forensic sampling protocols and a basis for investigating the feeding frequency of human lice.

An efficient approach for cloning the dNDP-glucose synthase gene from actinomycetes and its application in Streptomyces spectabilis, a spectinomycin producer.

PubMed

Hyun, C; Kim, S S; Sohng, J K; Hahn, J; Kim, J; Suh, J

2000-02-01

Specifically designed PCR primers were applied to amplify a segment of dTDP-glucose synthase gene from six actinomycete strains. About 300-bp or 580-bp DNA fragments were obtained from all the organisms tested. By DNA sequence analysis, seven amplified fragments showed high homology with dTDP-glucose synthase genes that participate in the biosynthesis of secondary metabolites or in deoxy-sugar moieties in lipopolysaccharides. In addition, we have cloned a 45-kb region of DNA from Streptomyces spectabilis ATCC27741, a spectinomycin producer which contained the dTDP-glucose synthase and dTDP-glucose 4,6-dehydratase genes named spcD and spcE, respectively. The spcE gene was expressed in Escherichia coli and the activity was assayed in cell extracts. The enzyme showed substrate specificity only to dTDP-glucose.

RNA editing in the anticodon of tRNA Leu (CAA) occurs before group I intron splicing in plastids of a moss Takakia lepidozioides S. Hatt. & Inoue.

PubMed

Miyata, Y; Sugita, C; Maruyama, K; Sugita, M

2008-03-01

RNA editing of cytidine (C) to uridine (U) transitions occurs in plastids and mitochondria of most land plants. In this study, we amplified and sequenced the group I intron-containing tRNA Leu gene, trnL-CAA, from Takakia lepidozioides, a moss. DNA sequence analysis revealed that the T. lepidozioides tRNA Leu gene consisted of a 35-bp 5' exon, a 469-bp group I intron and a 50-bp 3' exon. The intron was inserted between the first and second position of the tRNA Leu anticodon. In general, plastid tRNA Leu genes with a group I intron code for a TAA anticodon in most land plants. This strongly suggests that the first nucleotide of the CAA anticodon could be edited in T. lepidozioides plastids. To investigate this possibility, we analysed cDNAs derived from the trnL-CAA transcripts. We demonstrated that the first nucleotide C of the anticodon was edited to create a canonical UAA anticodon in T. lepidozioides plastids. cDNA sequencing analyses of the spliced or unspliced tRNA Leu transcripts revealed that, while the spliced tRNA was completely edited, editing in the unspliced tRNAs were only partial. This is the first experimental evidence that the anticodon editing of tRNA occurs before RNA splicing in plastids. This suggests that this editing is a prerequisite to splicing of pre-tRNA Leu.

Structural basis of DNA target recognition by the B3 domain of Arabidopsis epigenome reader VAL1

PubMed Central

Sasnauskas, Giedrius; Kauneckaitė, Kotryna; Siksnys, Virginijus

2018-01-01

Abstract Arabidopsis thaliana requires a prolonged period of cold exposure during winter to initiate flowering in a process termed vernalization. Exposure to cold induces epigenetic silencing of the FLOWERING LOCUS C (FLC) gene by Polycomb group (PcG) proteins. A key role in this epigenetic switch is played by transcriptional repressors VAL1 and VAL2, which specifically recognize Sph/RY DNA sequences within FLC via B3 DNA binding domains, and mediate recruitment of PcG silencing machinery. To understand the structural mechanism of site-specific DNA recognition by VAL1, we have solved the crystal structure of VAL1 B3 domain (VAL1-B3) bound to a 12 bp oligoduplex containing the canonical Sph/RY DNA sequence 5′-CATGCA-3′/5′-TGCATG-3′. We find that VAL1-B3 makes H-bonds and van der Waals contacts to DNA bases of all six positions of the canonical Sph/RY element. In agreement with the structure, in vitro DNA binding studies show that VAL1-B3 does not tolerate substitutions at any position of the 5′-TGCATG-3′ sequence. The VAL1-B3–DNA structure presented here provides a structural model for understanding the specificity of plant B3 domains interacting with the Sph/RY and other DNA sequences. PMID:29660015

Unequal rates of Y chromosome gene divergence during speciation of the family Ursidae.

PubMed

Nakagome, Shigeki; Pecon-Slattery, Jill; Masuda, Ryuichi

2008-07-01

Evolution of the bear family Ursidae is well investigated in terms of morphological, paleontological, and genetic features. However, several phylogenetic ambiguities occur within the subfamily Ursinae (the family Ursidae excluding the giant panda and spectacled bear), which may correlate with behavioral traits of female philopatry and male-biased dispersal which form the basis of the observed matriarchal population structure in these species. In the process of bear evolution, we investigate the premise that such behavioral traits may be reflected in patterns of variation among genes with different modes of inheritance: matrilineal mitochondrial DNA (mtDNA), patrilineal Y chromosome, biparentally inherited autosomes, and the X chromosome. In the present study, we sequenced 3 Y-linked genes (3,453 bp) and 4 X-linked genes (4,960 bp) and reanalyzed previously published sequences from autosome genes (2,347 bp) in ursid species to investigate differences in evolutionary rates associated with patterns of inheritance. The results describe topological incongruence between sex-linked genes and autosome genes and between nuclear DNA and mtDNA. In more ancestral branches within the bear phylogeny, Y-linked genes evolved faster than autosome and X-linked genes, consistent with expectations based on male-driven evolution. However, this pattern changes among branches leading to each species within the lineage of Ursinae whereby the evolutionary rates of Y-linked genes have fewer than expected substitutions. This inconsistency between more recent nodes of the bear phylogeny with more ancestral nodes may reflect the influences of sex-biased dispersal as well as molecular evolutionary characteristics of the Y chromosome, and stochastic events in species natural history, and phylogeography unique to ursine bears.

The chloroplast genome sequence of the green alga Leptosira terrestris: multiple losses of the inverted repeat and extensive genome rearrangements within the Trebouxiophyceae

PubMed Central

de Cambiaire, Jean-Charles; Otis, Christian; Turmel, Monique; Lemieux, Claude

2007-01-01

Background In the Chlorophyta – the green algal phylum comprising the classes Prasinophyceae, Ulvophyceae, Trebouxiophyceae and Chlorophyceae – the chloroplast genome displays a highly variable architecture. While chlorophycean chloroplast DNAs (cpDNAs) deviate considerably from the ancestral pattern described for the prasinophyte Nephroselmis olivacea, the degree of remodelling sustained by the two ulvophyte cpDNAs completely sequenced to date is intermediate relative to those observed for chlorophycean and trebouxiophyte cpDNAs. Chlorella vulgaris (Chlorellales) is currently the only photosynthetic trebouxiophyte whose complete cpDNA sequence has been reported. To gain insights into the evolutionary trends of the chloroplast genome in the Trebouxiophyceae, we sequenced cpDNA from the filamentous alga Leptosira terrestris (Ctenocladales). Results The 195,081-bp Leptosira chloroplast genome resembles the 150,613-bp Chlorella genome in lacking a large inverted repeat (IR) but differs greatly in gene order. Six of the conserved genes present in Chlorella cpDNA are missing from the Leptosira gene repertoire. The 106 conserved genes, four introns and 11 free standing open reading frames (ORFs) account for 48.3% of the genome sequence. This is the lowest gene density yet observed among chlorophyte cpDNAs. Contrary to the situation in Chlorella but similar to that in the chlorophycean Scenedesmus obliquus, the gene distribution is highly biased over the two DNA strands in Leptosira. Nine genes, compared to only three in Chlorella, have significantly expanded coding regions relative to their homologues in ancestral-type green algal cpDNAs. As observed in chlorophycean genomes, the rpoB gene is fragmented into two ORFs. Short repeats account for 5.1% of the Leptosira genome sequence and are present mainly in intergenic regions. Conclusion Our results highlight the great plasticity of the chloroplast genome in the Trebouxiophyceae and indicate that the IR was lost on at least two separate occasions. The intriguing similarities of the derived features exhibited by Leptosira cpDNA and its chlorophycean counterparts suggest that the same evolutionary forces shaped the IR-lacking chloroplast genomes in these two algal lineages. PMID:17610731

The complete mitochondrial genome of the Asian tapirs (Tapirus indicus): the only extant Tapiridae species in the old world.

PubMed

Muangkram, Yuttamol; Wajjwalku, Worawidh; Kaolim, Nongnid; Buddhakosai, Waradee; Kamolnorranath, Sumate; Siriaroonrat, Boripat; Tipkantha, Wanlaya; Dongsaard, Khwanruean; Maikaew, Umaporn; Sanannu, Saowaphang

2016-01-01

Asian tapir (Tapirus indicus) is categorized as Endangered on the 2008 IUCN red list. The first full-length mitochondrial DNA (mtDNA) sequence of Asian tapir is 16,717 bp in length. Base composition shows 34.6% A, 27.2% T, 25.8% C and 12.3% G. Highest polymorphic site is on the control region as typical for many species.

A low-cost efficient multiplex PCR for prenatal sex determination in bovine fetus using free fetal DNA in maternal plasma.

PubMed

Davoudi, Arash; Seighalani, Ramin; Aleyasin, Seyed Ahmad; Tarang, Alireza; Salehi, Abdolreza Salehi; Tahmoressi, Farideh

2012-04-01

In order to establish a reliable non-invasive method for sex determination in a bovine fetus in a routine setting, the possibility of identifying specific sequence in the fetal X and Y-chromosomes has been evaluated in maternal plasma using conventional multiplex polymerase chain reaction (PCR) analysis. The aim of this study was to provide a rapid and reliable method for sexing bovine fetuses. In this experimental study, peripheral blood samples were taken from 38 pregnant heifers with 8 to 38 weeks of gestation. DNA template was extracted by phenol-chloroform method from 350 µl maternal plasma. Two primer pairs for bovine amelogenin gene (bAML) and BC1.2 were used to amplify fragments from X and Y chromosomes. A multiplex PCR reaction has been optimized for amplification of 467 bp and 341 bp fragments from X and Y bAML gene and a 190 bp fragment from BC1.2 related to Y chromosome. The 467 bp fragment was observed in all 38 samples. Both 341 and 190 bp fragments were detected only in 24 plasma samples from male calves. The sensitivity and specificity of test were 100% with no false negative or false positive results. The results showed that phenol-chloroform method is a simple and suitable method for isolation of fetal DNA in maternal plasma. The multiplex PCR method is an available non-invasive approach which is cost efficient and reliable for sexing bovine fetuses.

Complete mitochondrial genome sequence of black mustard (Brassica nigra; BB) and comparison with Brassica oleracea (CC) and Brassica carinata (BBCC).

PubMed

Yamagishi, Hiroshi; Tanaka, Yoshiyuki; Terachi, Toru

2014-11-01

Crop species of Brassica (Brassicaceae) consist of three monogenomic species and three amphidiploid species resulting from interspecific hybridizations among them. Until now, mitochondrial genome sequences were available for only five of these species. We sequenced the mitochondrial genome of the sixth species, Brassica nigra (nuclear genome constitution BB), and compared it with those of Brassica oleracea (CC) and Brassica carinata (BBCC). The genome was assembled into a 232 145 bp circular sequence that is slightly larger than that of B. oleracea (219 952 bp). The genome of B. nigra contained 33 protein-coding genes, 3 rRNA genes, and 17 tRNA genes. The cox2-2 gene present in B. oleracea was absent in B. nigra. Although the nucleotide sequences of 52 genes were identical between B. nigra and B. carinata, the second exon of rps3 showed differences including an insertion/deletion (indel) and nucleotide substitutions. A PCR test to detect the indel revealed intraspecific variation in rps3, and in one line of B. nigra it amplified a DNA fragment of the size expected for B. carinata. In addition, the B. carinata lines tested here produced DNA fragments of the size expected for B. nigra. The results indicate that at least two mitotypes of B. nigra were present in the maternal parents of B. carinata.

DNA barcoding of Clarias gariepinus, Coptodon zillii and Sarotherodon melanotheron from Southwestern Nigeria

PubMed Central

Falade, Mofolusho O.; Opene, Anthony J.; Benson, Otarigho

2016-01-01

DNA barcoding has been adopted as a gold standard rapid, precise and unifying identification system for animal species and provides a database of genetic sequences that can be used as a tool for universal species identification. In this study, we employed mitochondrial genes 16S rRNA (16S) and cytochrome oxidase subunit I (COI) for the identification of some Nigerian freshwater catfish and Tilapia species. Approximately 655 bp were amplified from the 5′ region of the mitochondrial cytochrome C oxidase subunit I (COI) gene whereas 570 bp were amplified for the 16S rRNA gene. Nucleotide divergences among sequences were estimated based on Kimura 2-parameter distances and the genetic relationships were assessed by constructing phylogenetic trees using the neighbour-joining (NJ) and maximum likelihood (ML) methods. Analyses of consensus barcode sequences for each species, and alignment of individual sequences from within a given species revealed highly consistent barcodes (99% similarity on average), which could be compared with deposited sequences in public databases. The nucleotide distance between species belonging to different genera based on COI ranged from 0.17% between Sarotherodon melanotheron and Coptodon zillii to 0.49% between Clarias gariepinus and C. zillii, indicating that S. melanotheron and C. zillii are closely related. Based on the data obtained, the utility of COI gene was confirmed in accurate identification of three fish species from Southwest Nigeria. PMID:27990256

Identification of the target DNA sequence and characterization of DNA binding features of HlyU, and suggestion of a redox switch for hlyA expression in the human pathogen Vibrio cholerae from in silico studies.

PubMed

Mukherjee, Debadrita; Pal, Aritrika; Chakravarty, Devlina; Chakrabarti, Pinak

2015-02-18

HlyU, a transcriptional regulator common in many Vibrio species, activates the hemolysin gene hlyA in Vibrio cholerae, the rtxA1 operon in Vibrio vulnificus and the genes of plp-vah1 and rtxACHBDE gene clusters in Vibrio anguillarum. The protein is also proposed to be a potential global virulence regulator for V. cholerae and V. vulnificus. Mechanisms of gene control by HlyU in V. vulnificus and V. anguillarum are reported. However, detailed elucidation of the interaction of HlyU in V. cholerae with its target DNA at the molecular level is not available. Here we report a 17-bp imperfect palindrome sequence, 5'-TAATTCAGACTAAATTA-3', 173 bp upstream of hlyA promoter, as the binding site of HlyU. This winged helix-turn-helix protein binds necessarily as a dimer with the recognition helices contacting the major grooves and the β-sheet wings, the minor grooves. Such interactions enhance hlyA promoter activity in vivo. Mutations affecting dimerization as well as those in the DNA-protein interface hamper DNA binding and transcription regulation. Molecular dynamic simulations show hydrogen bonding patterns involving residues at the mutation sites and confirmed their importance in DNA binding. On binding to HlyU, DNA deviates by ∼68º from linearity. Dynamics also suggest a possible redox control in HlyU. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Characterization of the novel antifungal protein PgAFP and the encoding gene of Penicillium chrysogenum.

PubMed

Rodríguez-Martín, Andrea; Acosta, Raquel; Liddell, Susan; Núñez, Félix; Benito, M José; Asensio, Miguel A

2010-04-01

The strain RP42C from Penicillium chrysogenum produces a small protein PgAFP that inhibits the growth of some toxigenic molds. The molecular mass of the protein determined by electrospray ionization mass spectrometry (ESI-MS) was 6 494Da. PgAFP showed a cationic character with an estimated pI value of 9.22. Upon chemical and enzymatic treatments of PgAFP, no evidence for N- or O-glycosylations was obtained. Five partial sequences of PgAFP were obtained by Edman degradation and by ESI-MS/MS after trypsin and chymotrypsin digestions. Using degenerate primers from these peptide sequences, a segment of 70bp was amplified by PCR from pgafp gene. 5'- and 3'-ends of pgafp were obtained by RACE-PCR with gene-specific primers designed from the 70bp segment. The complete pgafp sequence of 404bp was obtained using primers designed from 5'- and 3'-ends. Comparison of genomic and cDNA sequences revealed a 279bp coding region interrupted by two introns of 63 and 62bp. The precursor of the antifungal protein consists of 92 amino acids and appears to be processed to the mature 58 amino acids PgAFP. The deduced amino acid sequence of the mature protein shares 79% identity to the antifungal protein Anafp from Aspergillus niger. PgAFP is a new protein that belongs to the group of small, cysteine-rich, and basic proteins with antifungal activity produced by ascomycetes. Given that P. chrysogenum is regarded as safe mold commonly found in foods, PgAFP may be useful to prevent growth of toxigenic molds in food and agricultural products. Copyright (c) 2009 Elsevier Inc. All rights reserved.

Re-sequencing transgenic plants revealed rearrangements at T-DNA inserts, and integration of a short T-DNA fragment, but no increase of small mutations elsewhere.

PubMed

Schouten, Henk J; Vande Geest, Henri; Papadimitriou, Sofia; Bemer, Marian; Schaart, Jan G; Smulders, Marinus J M; Perez, Gabino Sanchez; Schijlen, Elio

2017-03-01

Transformation resulted in deletions and translocations at T-DNA inserts, but not in genome-wide small mutations. A tiny T-DNA splinter was detected that probably would remain undetected by conventional techniques. We investigated to which extent Agrobacterium tumefaciens-mediated transformation is mutagenic, on top of inserting T-DNA. To prevent mutations due to in vitro propagation, we applied floral dip transformation of Arabidopsis thaliana. We re-sequenced the genomes of five primary transformants, and compared these to genomic sequences derived from a pool of four wild-type plants. By genome-wide comparisons, we identified ten small mutations in the genomes of the five transgenic plants, not correlated to the positions or number of T-DNA inserts. This mutation frequency is within the range of spontaneous mutations occurring during seed propagation in A. thaliana, as determined earlier. In addition, we detected small as well as large deletions specifically at the T-DNA insert sites. Furthermore, we detected partial T-DNA inserts, one of these a tiny 50-bp fragment originating from a central part of the T-DNA construct used, inserted into the plant genome without flanking other T-DNA. Because of its small size, we named this fragment a T-DNA splinter. As far as we know this is the first report of such a small T-DNA fragment insert in absence of any T-DNA border sequence. Finally, we found evidence for translocations from other chromosomes, flanking T-DNA inserts. In this study, we showed that next-generation sequencing (NGS) is a highly sensitive approach to detect T-DNA inserts in transgenic plants.

The complete chloroplast genome sequence of Epipremnum aureum and its comparative analysis among eight Araceae species

PubMed Central

Han, Limin; Chen, Chen; Wang, Zhezhi

2018-01-01

Epipremnum aureum is an important foliage plant in the Araceae family. In this study, we have sequenced the complete chloroplast genome of E. aureum by using Illumina Hiseq sequencing platforms. This genome is a double-stranded circular DNA sequence of 164,831 bp that contains 35.8% GC. The two inverted repeats (IRa and IRb; 26,606 bp) are spaced by a small single-copy region (22,868 bp) and a large single-copy region (88,751 bp). The chloroplast genome has 131 (113 unique) functional genes, including 86 (79 unique) protein-coding genes, 37 (30 unique) tRNA genes, and eight (four unique) rRNA genes. Tandem repeats comprise the majority of the 43 long repetitive sequences. In addition, 111 simple sequence repeats are present, with mononucleotides being the most common type and di- and tetranucleotides being infrequent events. Positive selection pressure on rps12 in the E. aureum chloroplast has been demonstrated via synonymous and nonsynonymous substitution rates and selection pressure sites analyses. Ycf15 and infA are pseudogenes in this species. We constructed a Maximum Likelihood phylogenetic tree based on the complete chloroplast genomes of 38 species from 13 families. Those results strongly indicated that E. aureum is positioned as the sister of Colocasia esculenta within the Araceae family. This work may provide information for further study of the molecular phylogenetic relationships within Araceae, as well as molecular markers and breeding novel varieties by chloroplast genetic-transformation of E. aureum in particular. PMID:29529038

Molecular Characterization of a Catalase from Hydra vulgaris

PubMed Central

Dash, Bhagirathi; Phillips, Timothy D.

2012-01-01

Catalase, an antioxidant and hydroperoxidase enzyme protects the cellular environment from harmful effects of hydrogen peroxide by facilitating its degradation to oxygen and water. Molecular information on a cnidarian catalase and/or peroxidase is, however, limited. In this work an apparent full length cDNA sequence coding for a catalase (HvCatalase) was isolated from Hydra vulgaris using 3’- and 5’- (RLM) RACE approaches. The 1859 bp HvCatalase cDNA included an open reading frame of 1518 bp encoding a putative protein of 505 amino acids with a predicted molecular mass of 57.44 kDa. The deduced amino acid sequence of HvCatalase contained several highly conserved motifs including the heme-ligand signature sequence RLFSYGDTH and the active site signature FXRERIPERVVHAKGXGA. A comparative analysis showed the presence of conserved catalytic amino acids [His(71), Asn(145), and Tyr(354)] in HvCatalase as well. Homology modeling indicated the presence of the conserved features of mammalian catalase fold. Hydrae exposed to thermal, starvation, metal and oxidative stress responded by regulating its catalase mRNA transcription. These results indicated that the HvCatalase gene is involved in the cellular stress response and (anti)oxidative processes triggered by stressor and contaminant exposure. PMID:22521743

Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

PubMed Central

Li, Hongshan; Dai, Huaguo; Wei, Hui

2005-01-01

A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

Application of a mitochondrial DNA control region frequency database for UK domestic cats.

PubMed

Ottolini, Barbara; Lall, Gurdeep Matharu; Sacchini, Federico; Jobling, Mark A; Wetton, Jon H

2017-03-01

DNA variation in 402bp of the mitochondrial control region flanked by repeat sequences RS2 and RS3 was evaluated by Sanger sequencing in 152 English domestic cats, in order to determine the significance of matching DNA sequences between hairs found with a victim's body and the suspect's pet cat. Whilst 95% of English cats possessed one of the twelve globally widespread mitotypes, four new variants were observed, the most common of which (2% frequency) was shared with the evidential samples. No significant difference in mitotype frequency was seen between 32 individuals from the locality of the crime and 120 additional cats from the rest of England, suggesting a lack of local population structure. However, significant differences were observed in comparison with frequencies in other countries, including the closely neighbouring Netherlands, highlighting the importance of appropriate genetic databases when determining the evidential significance of mitochondrial DNA evidence. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Prospecting Metagenomic Enzyme Subfamily Genes for DNA Family Shuffling by a Novel PCR-based Approach*

PubMed Central

Wang, Qiuyan; Wu, Huili; Wang, Anming; Du, Pengfei; Pei, Xiaolin; Li, Haifeng; Yin, Xiaopu; Huang, Lifeng; Xiong, Xiaolong

2010-01-01

DNA family shuffling is a powerful method for enzyme engineering, which utilizes recombination of naturally occurring functional diversity to accelerate laboratory-directed evolution. However, the use of this technique has been hindered by the scarcity of family genes with the required level of sequence identity in the genome database. We describe here a strategy for collecting metagenomic homologous genes for DNA shuffling from environmental samples by truncated metagenomic gene-specific PCR (TMGS-PCR). Using identified metagenomic gene-specific primers, twenty-three 921-bp truncated lipase gene fragments, which shared 64–99% identity with each other and formed a distinct subfamily of lipases, were retrieved from 60 metagenomic samples. These lipase genes were shuffled, and selected active clones were characterized. The chimeric clones show extensive functional and genetic diversity, as demonstrated by functional characterization and sequence analysis. Our results indicate that homologous sequences of genes captured by TMGS-PCR can be used as suitable genetic material for DNA family shuffling with broad applications in enzyme engineering. PMID:20962349

Simple diazonium chemistry to develop specific gene sensing platforms.

PubMed

Revenga-Parra, M; García-Mendiola, T; González-Costas, J; González-Romero, E; Marín, A García; Pau, J L; Pariente, F; Lorenzo, E

2014-02-27

A simple strategy for covalent immobilizing DNA sequences, based on the formation of stable diazonized conducting platforms, is described. The electrochemical reduction of 4-nitrobenzenediazonium salt onto screen-printed carbon electrodes (SPCE) in aqueous media gives rise to terminal grafted amino groups. The presence of primary aromatic amines allows the formation of diazonium cations capable to react with the amines present at the DNA capture probe. As a comparison a second strategy based on the binding of aminated DNA capture probes to the developed diazonized conducting platforms through a crosslinking agent was also employed. The resulting DNA sensing platforms were characterized by cyclic voltammetry, electrochemical impedance spectroscopy and spectroscopic ellipsometry. The hybridization event with the complementary sequence was detected using hexaamineruthenium (III) chloride as electrochemical indicator. Finally, they were applied to the analysis of a 145-bp sequence from the human gene MRP3, reaching a detection limit of 210 pg μL(-1). Copyright © 2014 Elsevier B.V. All rights reserved.

TopBP1 functions with 53BP1 in the G1 DNA damage checkpoint

PubMed Central

Cescutti, Rachele; Negrini, Simona; Kohzaki, Masaoki; Halazonetis, Thanos D

2010-01-01

TopBP1 is a checkpoint protein that colocalizes with ATR at sites of DNA replication stress. In this study, we show that TopBP1 also colocalizes with 53BP1 at sites of DNA double-strand breaks (DSBs), but only in the G1-phase of the cell cycle. Recruitment of TopBP1 to sites of DNA replication stress was dependent on BRCT domains 1–2 and 7–8, whereas recruitment to sites of DNA DSBs was dependent on BRCT domains 1–2 and 4–5. The BRCT domains 4–5 interacted with 53BP1 and recruitment of TopBP1 to sites of DNA DSBs in G1 was dependent on 53BP1. As TopBP1 contains a domain important for ATR activation, we examined whether it contributes to the G1 cell cycle checkpoint. By monitoring the entry of irradiated G1 cells into S-phase, we observed a checkpoint defect after siRNA-mediated depletion of TopBP1, 53BP1 or ATM. Thus, TopBP1 may mediate the checkpoint function of 53BP1 in G1. PMID:20871591

TopBP1 functions with 53BP1 in the G1 DNA damage checkpoint.

PubMed

Cescutti, Rachele; Negrini, Simona; Kohzaki, Masaoki; Halazonetis, Thanos D

2010-11-03

TopBP1 is a checkpoint protein that colocalizes with ATR at sites of DNA replication stress. In this study, we show that TopBP1 also colocalizes with 53BP1 at sites of DNA double-strand breaks (DSBs), but only in the G1-phase of the cell cycle. Recruitment of TopBP1 to sites of DNA replication stress was dependent on BRCT domains 1-2 and 7-8, whereas recruitment to sites of DNA DSBs was dependent on BRCT domains 1-2 and 4-5. The BRCT domains 4-5 interacted with 53BP1 and recruitment of TopBP1 to sites of DNA DSBs in G1 was dependent on 53BP1. As TopBP1 contains a domain important for ATR activation, we examined whether it contributes to the G1 cell cycle checkpoint. By monitoring the entry of irradiated G1 cells into S-phase, we observed a checkpoint defect after siRNA-mediated depletion of TopBP1, 53BP1 or ATM. Thus, TopBP1 may mediate the checkpoint function of 53BP1 in G1.

Direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers.

PubMed

Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William

2011-12-01

Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.

Molecular identification and phylogenetic study of Demodex caprae.

PubMed

Zhao, Ya-E; Cheng, Juan; Hu, Li; Ma, Jun-Xian

2014-10-01

The DNA barcode has been widely used in species identification and phylogenetic analysis since 2003, but there have been no reports in Demodex. In this study, to obtain an appropriate DNA barcode for Demodex, molecular identification of Demodex caprae based on mitochondrial cox1 was conducted. Firstly, individual adults and eggs of D. caprae were obtained for genomic DNA (gDNA) extraction; Secondly, mitochondrial cox1 fragment was amplified, cloned, and sequenced; Thirdly, cox1 fragments of D. caprae were aligned with those of other Demodex retrieved from GenBank; Finally, the intra- and inter-specific divergences were computed and the phylogenetic trees were reconstructed to analyze phylogenetic relationship in Demodex. Results obtained from seven 429-bp fragments of D. caprae showed that sequence identities were above 99.1% among three adults and four eggs. The intraspecific divergences in D. caprae, Demodex folliculorum, Demodex brevis, and Demodex canis were 0.0-0.9, 0.5-0.9, 0.0-0.2, and 0.0-0.5%, respectively, while the interspecific divergences between D. caprae and D. folliculorum, D. canis, and D. brevis were 20.3-20.9, 21.8-23.0, and 25.0-25.3, respectively. The interspecific divergences were 10 times higher than intraspecific ones, indicating considerable barcoding gap. Furthermore, the phylogenetic trees showed that four Demodex species gathered separately, representing independent species; and Demodex folliculorum gathered with canine Demodex, D. caprae, and D. brevis in sequence. In conclusion, the selected 429-bp mitochondrial cox1 gene is an appropriate DNA barcode for molecular classification, identification, and phylogenetic analysis of Demodex. D. caprae is an independent species and D. folliculorum is closer to D. canis than to D. caprae or D. brevis.

Diversity of halophilic archaea from six hypersaline environments in Turkey.

PubMed

Ozcan, Birgul; Ozcengiz, Gulay; Coleri, Arzu; Cokmus, Cumhur

2007-06-01

The diversity of archaeal strains from six hypersaline environments in Turkey was analyzed by comparing their phenotypic characteristics and 16S rDNA sequences. Thirty-three isolates were characterized in terms of their phenotypic properties including morphological and biochemical characteristics, susceptibility to different antibiotics, and total lipid and plasmid contents, and finally compared by 16S rDNA gene sequences. The results showed that all isolates belong to the family Halobacteriaceae. Phylogenetic analyses using approximately 1,388 bp comparisions of 16S rDNA sequences demonstrated that all isolates clustered closely to species belonging to 9 genera, namely Halorubrum (8 isolates), Natrinema (5 isolates), Haloarcula (4 isolates), Natronococcus (4 isolates), Natrialba (4 isolates), Haloferax (3 isolates), Haloterrigena (3 isolates), Halalkalicoccus (1 isolate), and Halomicrobium (1 isolate). The results revealed a high diversity among the isolated halophilic strains and indicated that some of these strains constitute new taxa of extremely halophilic archaea.

A DNA Mini-Barcoding System for Authentication of Processed Fish Products.

PubMed

Shokralla, Shadi; Hellberg, Rosalee S; Handy, Sara M; King, Ian; Hajibabaei, Mehrdad

2015-10-30

Species substitution is a form of seafood fraud for the purpose of economic gain. DNA barcoding utilizes species-specific DNA sequence information for specimen identification. Previous work has established the usability of short DNA sequences-mini-barcodes-for identification of specimens harboring degraded DNA. This study aims at establishing a DNA mini-barcoding system for all fish species commonly used in processed fish products in North America. Six mini-barcode primer pairs targeting short (127-314 bp) fragments of the cytochrome c oxidase I (CO1) DNA barcode region were developed by examining over 8,000 DNA barcodes from species in the U.S. Food and Drug Administration (FDA) Seafood List. The mini-barcode primer pairs were then tested against 44 processed fish products representing a range of species and product types. Of the 44 products, 41 (93.2%) could be identified at the species or genus level. The greatest mini-barcoding success rate found with an individual primer pair was 88.6% compared to 20.5% success rate achieved by the full-length DNA barcode primers. Overall, this study presents a mini-barcoding system that can be used to identify a wide range of fish species in commercial products and may be utilized in high throughput DNA sequencing for authentication of heavily processed fish products.

[Molecular typing of 12 Brucella strains isolated in Guizhou province in 2010-2013].

PubMed

Wang, Yue; Chen, Hong; Liu, Ying; Zhou, Jingzhu; Li, Shijun; Hang, Yan; Tang, Guangpeng; Wang, Dingming; Chen, Guichun

2015-09-01

To identify and characterize the Brucella strains from Guizhou province in 2010-2013. A total of 12 strains of Brucella suspicious bacteria were isolated in Guizhou province from 2010 to 2013. Four strains (GZLL3, GZLL4, GZLL11 and SH2) were isolated from goat blood samples and eight strains (SH4, GZZY, GZSQ, GZZA, BR13001, BR13004, BR13005 and BR13006) were isolated from blood samples of patient 12 Brucella suspicious strains were identified and characterized using conventional methods. Brucella genus specific gene BCSP31-based PCR (BCSP31-PCR) was used to identify the genus of Brucella and IS711 insert sequence-based PCR (AMOS-PCR) was applied to identify the species of Brucella strains. Goats and patients originated Brucella strains were comparatively analysed using Pulse-field Gel Electrophoresis (PFGE). Both of conventional methods and PCR identified the 12 Brucella suspicious strains as B. melitensis biotype 3. BCSP31-PCR identification results showed that a specific DNA bands (223 bp) were detected in all the 12 strains and positive control samples with no DNA band in negative samples. AMOS-PCR amplified a 731 bp-DNA bands in all the 12 strains, with 731 bp, 498 bp and 275 bp in M5, S2 and A19 strains, respectively, and no DNA band was detected in the negative control samples. PFGE analysis showed that 12 Brucella isolates from patients and goats showed consistent PFGE patterns with the digestion of restriction enzyme Xba I. The epidemic species/type of Brucella in both human and animal in Guizhou province was B. melitensis biotype 3 and goat was the main animal source of infection of brucellosis in Guizhou province.

RIKEN Integrated Sequence Analysis (RISA) System—384-Format Sequencing Pipeline with 384 Multicapillary Sequencer

PubMed Central

Shibata, Kazuhiro; Itoh, Masayoshi; Aizawa, Katsunori; Nagaoka, Sumiharu; Sasaki, Nobuya; Carninci, Piero; Konno, Hideaki; Akiyama, Junichi; Nishi, Katsuo; Kitsunai, Tokuji; Tashiro, Hideo; Itoh, Mari; Sumi, Noriko; Ishii, Yoshiyuki; Nakamura, Shin; Hazama, Makoto; Nishine, Tsutomu; Harada, Akira; Yamamoto, Rintaro; Matsumoto, Hiroyuki; Sakaguchi, Sumito; Ikegami, Takashi; Kashiwagi, Katsuya; Fujiwake, Syuji; Inoue, Kouji; Togawa, Yoshiyuki; Izawa, Masaki; Ohara, Eiji; Watahiki, Masanori; Yoneda, Yuko; Ishikawa, Tomokazu; Ozawa, Kaori; Tanaka, Takumi; Matsuura, Shuji; Kawai, Jun; Okazaki, Yasushi; Muramatsu, Masami; Inoue, Yorinao; Kira, Akira; Hayashizaki, Yoshihide

2000-01-01

The RIKEN high-throughput 384-format sequencing pipeline (RISA system) including a 384-multicapillary sequencer (the so-called RISA sequencer) was developed for the RIKEN mouse encyclopedia project. The RISA system consists of colony picking, template preparation, sequencing reaction, and the sequencing process. A novel high-throughput 384-format capillary sequencer system (RISA sequencer system) was developed for the sequencing process. This system consists of a 384-multicapillary auto sequencer (RISA sequencer), a 384-multicapillary array assembler (CAS), and a 384-multicapillary casting device. The RISA sequencer can simultaneously analyze 384 independent sequencing products. The optical system is a scanning system chosen after careful comparison with an image detection system for the simultaneous detection of the 384-capillary array. This scanning system can be used with any fluorescent-labeled sequencing reaction (chain termination reaction), including transcriptional sequencing based on RNA polymerase, which was originally developed by us, and cycle sequencing based on thermostable DNA polymerase. For long-read sequencing, 380 out of 384 sequences (99.2%) were successfully analyzed and the average read length, with more than 99% accuracy, was 654.4 bp. A single RISA sequencer can analyze 216 kb with >99% accuracy in 2.7 h (90 kb/h). For short-read sequencing to cluster the 3′ end and 5′ end sequencing by reading 350 bp, 384 samples can be analyzed in 1.5 h. We have also developed a RISA inoculator, RISA filtrator and densitometer, RISA plasmid preparator which can handle throughput of 40,000 samples in 17.5 h, and a high-throughput RISA thermal cycler which has four 384-well sites. The combination of these technologies allowed us to construct the RISA system consisting of 16 RISA sequencers, which can process 50,000 DNA samples per day. One haploid genome shotgun sequence of a higher organism, such as human, mouse, rat, domestic animals, and plants, can be revealed by seven RISA systems within one month. PMID:11076861

Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis.

PubMed

Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T

2000-05-01

A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.

Morphological and molecular genetic diversity of Strongyluris calotis (Nematoda: Ascaridida: Heterakidae) in South East and East Asian lizards.

PubMed

Tran, Binh Thi; Ong, An Vinh; Luc, Pham Van; Sato, Hiroshi

2016-07-01

Strongyluris calotis is a heterakid nematode in the large intestine of agamid lizards (Reptilia: Sauria: Agamidae) from the Oriental Region. The standard light microscopic definition of the species counts the "caudal papillae" as 10 pairs on male worms. However, previous work from our group using scanning electron microscopy (SEM) on the heterakid from agamid lizards in Japan, Taiwan, and Singapore revealed that this counting contained a pair of phasmids and that two pairs of postcloacal papillae were completely fused to form a pair of united papillae, thus resulting in "10 pairs." In the present study, we examined S. calotis specimens from the Emma Gray's forest lizard, Calotes emma (Agamidae), living in the plain forest at low altitude, and the Vietnam false bloodsucker, Pseudocalotes brevipes (Agamidae), living in the mountainous forest at high altitude in the northern part of Vietnam. Using SEM, the arrangement of caudal papillae in male worms from an Emma Gray's forest lizard was found to be comparable to classical S. calotis specimens from agamid lizards collected in Japan, Taiwan, and Singapore. However, male worms from Vietnam false bloodsuckers did not have a pair of united papillae but had 10 pairs of independent caudal papillae with a pair of phasmids. Molecular genetic analyses of the ribosomal RNA gene (rDNA) of worms of the classical S. calotis morphotype from Japan and Singapore and two S. calotis morphotypes from Vietnam demonstrated absolutely identical nucleotide sequences of partial 18S rDNA (at least 1764 base pairs (bp)) and 5.8S rDNA (158 bp). However, intraspecific differences were detected in other regions of the rDNA, related to the geographical distribution of hosts regardless of morphotype: 97.8-98.5 % identity (443-446 bp/453 bp) in the internal transcribed spacer (ITS)-1 region, 96.6-98.0 % identity (425-431 bp/440 bp) in the ITS-2 region, and 99.6-99.7 % identity (1149-1151 bp/1154 bp) in the 28S rDNA. Thus, in the future, taxonomic relationships of S. calotis distributed widely in the Oriental Region as well as other nominal Oriental Strongyluris spp., currently six in number, need to be extensively explored based on molecular genetic analyses in addition to intensive morphological characterization.

Cloning and identification of a cDNA that encodes a novel human protein with thrombospondin type I repeat domain, hPWTSR.

PubMed

Chen, Jin-Zhong; Wang, Shu; Tang, Rong; Yang, Quan-Sheng; Zhao, Enpeng; Chao, Yaoqiong; Ying, Kang; Xie, Yi; Mao, Yu-Min

2002-09-01

A cDNA was isolated from the fetal brain cDNA library by high throughput cDNA sequencing. The 2390 bp cDNA with an open reading fragment (ORF) of 816 bp encodes a 272 amino acids putative protein with a thrombospondin type I repeat (TSR) domain and a cysteine-rich region at the N-terminus, so it is named hPWTSR. We used Northern blot detected two bands with length of about 3 kb and 4 kb respectively, which expressed in human adult tissues with different intensities. The expression pattern was verified by RT-PCR, revealing that the transcripts were expressed ubiquitously in fetal tissues and human tumor tissues too. However, the transcript was detected neither in ovarian carcinoma GI-102 nor in lung carcinoma LX-1. Blast analysis against NCBI database revealed that the new gene contained at least 5 exons and located in human chromosome 6q22.33. Our results demonstrate that the gene is a novel member of TSR supergene family.

Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

PubMed

Fisher, R P; Topper, J N; Clayton, D A

1987-07-17

Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

DNA Binding Mode Transitions of Escherichia coli HUαβ: Evidence for Formation of a Bent DNA – Protein Complex on Intact, Linear Duplex DNA

PubMed Central

Koh, Junseock; Saecker, Ruth M.; Record, M. Thomas

2008-01-01

Escherichia coli HUαβ, a major nucleoid associated protein (NAP), organizes the DNA chromosome and facilitates numerous DNA transactions. Using isothermal titration calorimetry (ITC), fluorescence resonance energy transfer (FRET) and a series of DNA lengths (8, 15, 34, 38 and 160 base pairs) we establish that HUαβ interacts with duplex DNA using three different nonspecific binding modes. Both the HU to DNA mole ratio ([HU]/[DNA]) and DNA length dictate the dominant HU binding mode. On sufficiently long DNA (≥ 34 base pairs), at low [HU]/[DNA], HU populates a noncooperative 34 bp binding mode with a binding constant of 2.1 (± 0.4) × 106 M−1, and a binding enthalpy of +7.7 (± 0.6) kcal/mol at 15 °C and 0.15 M Na+. With increasing [HU]/[DNA], HU bound in the noncooperative 34 bp mode progressively converts to two cooperative (ω ~ 20) modes with site sizes of 10 bp and 6 bp. These latter modes exhibit smaller binding constants (1.1 (± 0.2) × 105 M−1 for the 10 bp mode, 3.5 (± 1.4) × 104 M−1 for the 6 bp mode) and binding enthalpies (4.2 (± 0.3) kcal/mol for the 10 bp mode, −1.6 (±0.3) kcal/mol for the 6 bp mode). As DNA length increases to 34 bp or more at low [HU]/[DNA], the small modes are replaced by the 34 bp binding mode. FRET data demonstrate that the 34 bp mode bends DNA by 143 ± 6° whereas the 6 and 10 bp modes do not. The model proposed in this study provides a novel quantitative and comprehensive framework for reconciling previous structural and solution studies of HU, including single molecule (force extension measurement, AFM), fluorescence, and electrophoretic gel mobility shift assays. In particular, it explains how HU condenses or extends DNA depending on the relative concentrations of HU and DNA. PMID:18657548

Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.

PubMed

Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F

2000-08-01

Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.

Complete chloroplast genome sequences of Hordeum vulgare, Sorghum bicolor and Agrostis stolonifera, and comparative analyses with other grass genomes

PubMed Central

Saski, Christopher; Lee, Seung-Bum; Fjellheim, Siri; Guda, Chittibabu; Jansen, Robert K.; Luo, Hong; Tomkins, Jeffrey; Rognli, Odd Arne; Clarke, Jihong Liu

2009-01-01

Comparisons of complete chloroplast genome sequences of Hordeum vulgare, Sorghum bicolor and Agrostis stolonifera to six published grass chloroplast genomes reveal that gene content and order are similar but two microstructural changes have occurred. First, the expansion of the IR at the SSC/IRa boundary that duplicates a portion of the 5′ end of ndhH is restricted to the three genera of the subfamily Pooideae (Agrostis, Hordeum and Triticum). Second, a 6 bp deletion in ndhK is shared by Agrostis, Hordeum, Oryza and Triticum, and this event supports the sister relationship between the subfamilies Erhartoideae and Pooideae. Repeat analysis identified 19–37 direct and inverted repeats 30 bp or longer with a sequence identity of at least 90%. Seventeen of the 26 shared repeats are found in all the grass chloroplast genomes examined and are located in the same genes or intergenic spacer (IGS) regions. Examination of simple sequence repeats (SSRs) identified 16–21 potential polymorphic SSRs. Five IGS regions have 100% sequence identity among Zea mays, Saccharum officinarum and Sorghum bicolor, whereas no spacer regions were identical among Oryza sativa, Triticum aestivum, H. vulgare and A. stolonifera despite their close phylogenetic relationship. Alignment of EST sequences and DNA coding sequences identified six C–U conversions in both Sorghum bicolor and H. vulgare but only one in A. stolonifera. Phylogenetic trees based on DNA sequences of 61 protein-coding genes of 38 taxa using both maximum parsimony and likelihood methods provide moderate support for a sister relationship between the subfamilies Erhartoideae and Pooideae. PMID:17534593

Sequence homology and expression profile of genes associated with DNA repair pathways in Mycobacterium leprae.

PubMed

Sharma, Mukul; Vedithi, Sundeep Chaitanya; Das, Madhusmita; Roy, Anindya; Ebenezer, Mannam

2017-01-01

Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%), 11 hypothetical proteins (18%), and 14 pseudogenes (23%). All these genes have homologs in M. tuberculosis and 49 (80.32%) in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA). The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes) were analyzed using quantitative Polymerase Chain Reaction (qPCR) assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the direct repair pathway. This study provided preliminary information on the potential DNA repair pathways that are extant in M. leprae and the associated genes.