Tephra layers from Holocene lake sediments of the Sulmona Basin, central Italy: implications for volcanic activity in Peninsular Italy and tephrostratigraphy in the central Mediterranean area

NASA Astrophysics Data System (ADS)

Giaccio, B.; Messina, P.; Sposato, A.; Voltaggio, M.; Zanchetta, G.; Galadini, F.; Gori, S.; Santacroce, R.

2009-12-01

We present a new tephrostratigraphic record from the Holocene lake sediments of the Sulmona basin, central Italy. The Holocene succession is represented by whitish calcareous mud that is divided into two units, SUL2 (ca 32 m thick) and SUL1 (ca 8 m thick), for a total thickness of ca 40 m. These units correspond to the youngest two out of six sedimentary cycles recognised in the Sulmona basin that are related to the lake sedimentation since the Middle Pleistocene. Height concordant U series age determinations and additional chronological data constrain the whole Holocene succession to between ca 8000 and 1000 yrs BP. This includes a sedimentary hiatus that separates the SUL2 and SUL1 units, which is roughly dated between <2800 and ca 2000 yrs BP. A total of 31 and 6 tephra layers were identified within the SUL2 and SUL1 units, respectively. However, only 28 tephra layers yielded fresh micro-pumices or glass shards suitable for chemical analyses using a microprobe wavelength dispersive spectrometer. Chronological and compositional constraints suggest that 27 ash layers probably derive from the Mt. Somma-Vesuvius Holocene volcanic activity, and one to the Ischia Island eruption of the Cannavale tephra (2920 ± 450 cal yrs BP). The 27 ash layers compatible with Mt. Somma-Vesuvius activity are clustered in three different time intervals: from ca 2000 to >1000; from 3600 to 3100; and from 7600 to 4700 yrs BP. The first, youngest cluster, comprises six layers and correlates with the intense explosive activity of Mt. Somma-Vesuvius that occurred after the prominent AD 79 Pompeii eruption, but only the near-Plinian event of AD 472 has been tentatively recognised. The intermediate cluster (3600-3100 yrs BP) starts with tephra that chemically and chronologically matches the products from the "Pomici di Avellino" eruption (ca 3800 ± 200 yrs BP). This is followed by eight further layers, where the glasses exhibit chemical features that are similar in composition to the products from the so-called "Protohistoric" or AP eruptions; however, only the distal equivalents of three AP events (AP3, AP4 and AP6) are tentatively designated. Finally, the early cluster (7600-4700 yrs BP) comprises 12 layers that contain evidence of a surprising, previously unrecognised, activity of the Mt. Somma-Vesuvius volcano during its supposed period of quiescence, between the major Plinian "Pomici di Mercato" (ca 9000 yrs BP) and "Pomici di Avellino" eruptions. Alternatively, since at present there is no evidence of a similar significant activity in the proximal area of this well-known volcano, a hitherto unknown origin of these tephras cannot be role out. The results of the present study provide new data that enrich our previous knowledge of the Holocene tephrostratigraphy and tephrochronology in central Italy, and a new model for the recent explosive activity of the Peninsular Italy volcanoes and the dispersal of the related pyroclastic deposits.

The latest explosive eruptions of Ciomadul (Csomád) volcano, East Carpathians - A tephrostratigraphic approach for the 51-29 ka BP time interval

NASA Astrophysics Data System (ADS)

Karátson, D.; Wulf, S.; Veres, D.; Magyari, E. K.; Gertisser, R.; Timar-Gabor, A.; Novothny, Á.; Telbisz, T.; Szalai, Z.; Anechitei-Deacu, V.; Appelt, O.; Bormann, M.; Jánosi, Cs.; Hubay, K.; Schäbitz, F.

2016-06-01

The most recent, mainly explosive eruptions of Ciomadul, the youngest volcano in the Carpatho-Pannonian Region, have been constrained by detailed field volcanological studies, major element pumice glass geochemistry, luminescence and radiocarbon dating, and a critical evaluation of available geochronological data. These investigations were complemented by the first tephrostratigraphic studies of the lacustrine infill of Ciomadul's twin craters (St. Ana and Mohoş) that received tephra deposition during the last eruptions of the volcano. Our analysis shows that significant explosive activity, collectively called EPPA (Early Phreatomagmatic and Plinian Activity), started at Ciomadul in or around the present-day Mohoş, the older crater, at ≥ 51 ka BP. These eruptions resulted in a thick succession of pyroclastic-fall deposits found in both proximal and medial/distal localities around the volcano, characterized by highly silicic (rhyolitic) glass chemical compositions (ca. 75.2-79.8 wt.% SiO2). The EPPA stage was terminated by a subplinian/plinian eruption at ≥ 43 ka BP, producing pumiceous pyroclastic-fall and -flow deposits of similar glass composition, probably from a "Proto-St. Ana" vent located at or around the younger crater hosting the present-day Lake St. Ana. After a quiescent period with a proposed lava dome growth in the St. Ana crater, a new explosive stage began, defined as MPA (Middle Plinian Activity). In particular, a significant two-phase eruption occurred at 31.5 ka BP, producing pyroclastic flows from vulcanian explosions disrupting the preexisting lava dome of Sf. Ana, and followed by pumiceous fallout from a plinian eruption column. Related pyroclastic deposits show a characteristic, less evolved rhyolitic glass composition (ca. 70.2-74.5 wt.% SiO2) and occur both in proximal and medial/distal localities up to 21 km from source. The MPA eruptions, that may have pre-shaped a crater similar to, but possibly smaller than, the present-day St. Ana crater, was followed by a so far unknown, but likewise violent last eruptive stage from the same vent, creating the final morphology of the crater. This stage, referred to as LSPA (Latest St. Ana Phreatomagmatic Activity), produced pyroclastic-fall deposits of more evolved rhyolitic glass composition (ca. 72.8-78.8 wt.% SiO2) compared to that of the previous MPA stage. According to radiocarbon age constraints on bulk sediment, charcoal and organic matter from lacustrine sediments recovered from both craters, the last of these phreatomagmatic eruptions - that draped the landscape toward the east and southeast of the volcano - occurred at 29.6 ka BP, some 2000 years later than the previously suggested last eruption of Ciomadul.

CacyBP/SIP nuclear translocation regulates p27Kip1 stability in gastric cancer cells

PubMed Central

Niu, Ying-Lin; Li, Ya-Jun; Wang, Jing-Bo; Lu, Yuan-Yuan; Liu, Zhen-Xiong; Feng, Shan-Shan; Hu, Jian-Guo; Zhai, Hui-Hong

2016-01-01

AIM: To investigate the mechanism of calcyclin binding protein/Siah-1 interacting protein (CacyBP/SIP) nuclear translocation in promoting the proliferation of gastric cancer (GC) cells. METHODS: The effect of CacyBP/SIP nuclear translocation on cell cycle was investigated by cell cycle analysis. Western blot analysis was used to assess the change in expression of cell cycle regulatory proteins and proteasome-mediated degradation of p27Kip1. Co-immunoprecipitation (co-IP) analysis was performed to examine the binding of CacyBP/SIP with Skp1. A CacyBP/SIP truncation mutant which lacked the Skp1 binding site was constructed and fused to a fluorescent protein. Subsequently, the effect on Skp1 binding with the fusion protein was examined by co-IP, while localization of fluorescent fusion protein observed by confocal laser microscopy, and change in p27Kip1 protein expression assessed by Western blot analysis. RESULTS: CacyBP/SIP nuclear translocation induced by gastrin promoted progression of GC cells from G1 phase. However, while CacyBP/SIP nuclear translocation was inhibited using siRNA to suppress CacyBP/SIP expression, cell cycle was clearly inhibited. CacyBP/SIP nuclear translocation significantly decreased the level of cell cycle inhibitor p27Kip1, increased Cyclin E protein expression whereas the levels of Skp1, Skp2, and CDK2 were not affected. Upon inhibition of CacyBP/SIP nuclear translocation, there were no changes in protein levels of p27Kip1 and Cyclin E, while p27Kip1 decrease could be prevented by the proteasome inhibitor MG132. Moreover, CacyBP/SIP was found to bind to Skp1 by immunoprecipitation, an event that was abolished by mutant CacyBP/SIP, which also failed to stimulate p27Kip1 degradation, even though the mutant could still translocate into the nucleus. CONCLUSION: CacyBP/SIP nuclear translocation contributes to the proliferation of GC cells, and CacyBP/SIP exerts this effect, at least in part, by stimulating ubiquitin-mediated degradation of p27Kip1. PMID:27099442

BP Spill Sampling Data April-September 2010

EPA Pesticide Factsheets

This dataset provides all of the sampling data from the the British Petroleum Deepwater Horizon Rig Explosion Emergency Response. The data were collected between April 28, 2010 and September 29, 2010.

BP Spill Monitoring Data April-September 2010

EPA Pesticide Factsheets

This dataset provides all of the monitoring data from the the British Petroleum Deepwater Horizon Rig Explosion Emergency Response. The data were collected between April 28, 2010 and September 29, 2010.

Inhibin binding protein in rats: alternative transcripts and regulation in the pituitary across the estrous cycle.

PubMed

Bernard, D J; Woodruff, T K

2001-04-01

Inhibin binding protein (InhBP) and the transforming growth factor-beta (TGF beta) type III receptor, beta glycan, have been identified as putative inhibin coreceptors. Here we cloned the InhBP cDNA in rats and predict that it encodes a large membrane-spanning protein that is part of the Ig superfamily, as has been described for humans. Two abundant InhBP transcripts (4.4 and 1.8 kb) were detected in the adult rat pituitary. The larger transcript encodes the full-length protein while the 1.8-kb transcript (InhBP-short or InhBP-S) corresponds to a splice variant of the receptor. This truncated isoform contains only the N-terminal signal peptide and first two (of 12) Ig-like domains observed in the full-length InhBP (InhBP-long or InhBP-L). InhBP-S does not contain a transmembrane domain and is predicted to be a soluble protein. Beta glycan was also detected in the pituitary; however, it was most abundant within the intermediate lobe. Although we also observed beta glycan immunopositive cells in the anterior pituitary, they rarely colocalized with FSH beta-producing cells. We next examined physiological regulation of the coreceptors across the rat estrous cycle. Like circulating inhibin A and inhibin B levels, pituitary InhBP-L and InhBP-S mRNA levels were dynamically regulated across the cycle and were negatively correlated with serum FSH levels. Expression of both forms of InhBP was also positively correlated with serum inhibin B, but not inhibin A, levels. These data are particularly interesting in light of our in vitro observations that InhBP may function as an inhibin B-specific coreceptor. Pituitary beta glycan mRNA levels did not fluctuate across the cycle nor did they correlate with serum FSH. These observations, coupled with its pattern of expression within the pituitary, indicate that beta glycan likely functions as more than merely an inhibin coreceptor within the pituitary. A direct role for InhBP or beta glycan in regulation of pituitary FSH by inhibin in vivo has yet to be determined, but the demonstration of dynamic regulation of pituitary InhBP and its negative relation to serum FSH across the estrous cycle is an important step in this direction.

Levels of the E2 interacting protein TopBP1 modulate papillomavirus maintenance stage replication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanginakudru, Sriramana, E-mail: skangina@iu.edu; DeSmet, Marsha, E-mail: mdesmet@iupui.edu; Thomas, Yanique, E-mail: ysthomas@umail.iu.edu

2015-04-15

The evolutionarily conserved DNA topoisomerase II beta-binding protein 1 (TopBP1) functions in DNA replication, DNA damage response, and cell survival. We analyzed the role of TopBP1 in human and bovine papillomavirus genome replication. Consistent with prior reports, TopBP1 co-localized in discrete nuclear foci and was in complex with papillomavirus E2 protein. Similar to E2, TopBP1 is recruited to the region of the viral origin of replication during G1/S and early S phase. TopBP1 knockdown increased, while over-expression decreased transient virus replication, without affecting cell cycle. Similarly, using cell lines harboring HPV-16 or HPV-31 genome, TopBP1 knockdown increased while over-expression reducedmore » viral copy number relative to genomic DNA. We propose a model in which TopBP1 serves dual roles in viral replication: it is essential for initiation of replication yet it restricts viral copy number. - Highlights: • Protein interaction study confirmed In-situ interaction between TopBP1 and E2. • TopBP1 present at papillomavirus ori in G1/S and early S phase of cell cycle. • TopBP1 knockdown increased, over-expression reduced virus replication. • TopBP1 protein level change did not influence cell survival or cell cycle. • TopBP1 displaced from papillomavirus ori after initiation of replication.« less

Explosive eruptive record in the Katmai region, Alaska Peninsula: an overview

USGS Publications Warehouse

Fierstein, Judy

2007-01-01

At least 15 explosive eruptions from the Katmai cluster of volcanoes and another nine from other volcanoes on the Alaska Peninsula are preserved as tephra layers in syn- and post-glacial (Last Glacial Maximum) loess and soil sections in Katmai National Park, AK. About 400 tephra samples from 150 measured sections have been collected between Kaguyak volcano and Mount Martin and from Shelikof Strait to Bristol Bay (∼8,500 km2 ). Five tephra layers are distinctive and widespread enough to be used as marker horizons in the Valley of Ten Thousand Smokes area, and 140 radiocarbon dates on enclosing soils have established a time framework for entire soil–tephra sections to 10 ka; the white rhyolitic ash from the 1912 plinian eruption of Novarupta caps almost all sections. Stratigraphy, distribution and tephra characteristics have been combined with microprobe analyses of glass and Fe– Ti oxide minerals to correlate ash layers with their source vents. Microprobe analyses (typically 20–50 analyses per glass or oxide sample) commonly show oxide compositions to be more definitive than glass in distinguishing one tephra from another; oxides from the Kaguyak caldera-forming event are so compositionally coherent that they have been used as internal standards throughout this study. Other than the Novarupta and Trident eruptions of the last century, the youngest locally derived tephra is associated with emplacement of the Snowy Mountain summit dome (<250 14C years B.P.). East Mageik has erupted most frequently during Holocene time with seven explosive events (9,400 to 2,400 14C years B.P.) preserved as tephra layers. Mount Martin erupted entirely during the Holocene, with lava coulees (>6 ka), two tephras (∼3,700 and ∼2,700 14C years B.P.), and a summit scoria cone with a crater still steaming today. Mount Katmai has three times produced very large explosive plinian to sub-plinian events (in 1912; 12– 16 ka; and 23 ka) and many smaller pyroclastic deposits show that explosive activity has long been common there. Mount Griggs, fumarolically active and moderately productive during postglacial time (mostly andesitic lavas), has three nested summit craters, two of which are on top of a Holocene central cone. Only one ash has been found that is (tentatively) correlated with the most recent eruptive activity on Griggs (<3,460 14C years B.P.). Eruptions from other volcanoes NE and SW beyond the Katmai cluster represented in this area include: (1) coignimbrite ash from Kaguyak’s caldera-forming event (5,800 14C years B.P.); (2) the climactic event from Fisher caldera (∼9,100 14C years B.P.—tentatively correlated); (3) at least three eruptions most likely from Mount Peulik (∼700, ∼7,700 and ∼8,500 14C years B.P.); and (4) a phreatic fallout most likely from the Gas Rocks (∼2,300 14C years B.P.). Most of the radiocarbon dating has been done on loess, soil and peat enclosing this tephra. Ash correlations supported by stratigraphy and microprobe data are combined with radiocarbon dating to show that variably organics-bearing substrates can provide reliable limiting ages for ash layers, especially when data for several sites is available.>(<3,460 14C years B.P.).  Eruptions from other volcanoes NE and SW beyond the Katmai cluster represented in this area include: (1) coignimbrite ash from Kaguyak’s caldera-forming event (5,800 14C years B.P.); (2) the climactic event from Fisher caldera (∼9,100 14C years B.P.—tentatively correlated); (3) at least three eruptions most likely from Mount Peulik (∼700, ∼7,700 and ∼8,500 14C years B.P.); and (4) a phreatic fallout most likely from the Gas Rocks (∼2,300 14C years B.P.). Most of the radiocarbon dating has been done on loess, soil and peat enclosing this tephra. Ash correlations supported by stratigraphy and microprobe data are combined with radiocarbon dating to show that variably organics-bearing substrates can provide reliable limiting ages for ash layers, especially when data for several sites is available.

Estimation of Pulse Transit Time as a Function of Blood Pressure Using a Nonlinear Arterial Tube-Load Model.

PubMed

Gao, Mingwu; Cheng, Hao-Min; Sung, Shih-Hsien; Chen, Chen-Huan; Olivier, Nicholas Bari; Mukkamala, Ramakrishna

2017-07-01

pulse transit time (PTT) varies with blood pressure (BP) throughout the cardiac cycle, yet, because of wave reflection, only one PTT value at the diastolic BP level is conventionally estimated from proximal and distal BP waveforms. The objective was to establish a technique to estimate multiple PTT values at different BP levels in the cardiac cycle. a technique was developed for estimating PTT as a function of BP (to indicate the PTT value for every BP level) from proximal and distal BP waveforms. First, a mathematical transformation from one waveform to the other is defined in terms of the parameters of a nonlinear arterial tube-load model accounting for BP-dependent arterial compliance and wave reflection. Then, the parameters are estimated by optimally fitting the waveforms to each other via the model-based transformation. Finally, PTT as a function of BP is specified by the parameters. The technique was assessed in animals and patients in several ways including the ability of its estimated PTT-BP function to serve as a subject-specific curve for calibrating PTT to BP. the calibration curve derived by the technique during a baseline period yielded bias and precision errors in mean BP of 5.1 ± 0.9 and 6.6 ± 1.0 mmHg, respectively, during hemodynamic interventions that varied mean BP widely. the new technique may permit, for the first time, estimation of PTT values throughout the cardiac cycle from proximal and distal waveforms. the technique could potentially be applied to improve arterial stiffness monitoring and help realize cuff-less BP monitoring.

TopBP1 functions with 53BP1 in the G1 DNA damage checkpoint

PubMed Central

Cescutti, Rachele; Negrini, Simona; Kohzaki, Masaoki; Halazonetis, Thanos D

2010-01-01

TopBP1 is a checkpoint protein that colocalizes with ATR at sites of DNA replication stress. In this study, we show that TopBP1 also colocalizes with 53BP1 at sites of DNA double-strand breaks (DSBs), but only in the G1-phase of the cell cycle. Recruitment of TopBP1 to sites of DNA replication stress was dependent on BRCT domains 1–2 and 7–8, whereas recruitment to sites of DNA DSBs was dependent on BRCT domains 1–2 and 4–5. The BRCT domains 4–5 interacted with 53BP1 and recruitment of TopBP1 to sites of DNA DSBs in G1 was dependent on 53BP1. As TopBP1 contains a domain important for ATR activation, we examined whether it contributes to the G1 cell cycle checkpoint. By monitoring the entry of irradiated G1 cells into S-phase, we observed a checkpoint defect after siRNA-mediated depletion of TopBP1, 53BP1 or ATM. Thus, TopBP1 may mediate the checkpoint function of 53BP1 in G1. PMID:20871591

TopBP1 functions with 53BP1 in the G1 DNA damage checkpoint.

PubMed

Cescutti, Rachele; Negrini, Simona; Kohzaki, Masaoki; Halazonetis, Thanos D

2010-11-03

TopBP1 is a checkpoint protein that colocalizes with ATR at sites of DNA replication stress. In this study, we show that TopBP1 also colocalizes with 53BP1 at sites of DNA double-strand breaks (DSBs), but only in the G1-phase of the cell cycle. Recruitment of TopBP1 to sites of DNA replication stress was dependent on BRCT domains 1-2 and 7-8, whereas recruitment to sites of DNA DSBs was dependent on BRCT domains 1-2 and 4-5. The BRCT domains 4-5 interacted with 53BP1 and recruitment of TopBP1 to sites of DNA DSBs in G1 was dependent on 53BP1. As TopBP1 contains a domain important for ATR activation, we examined whether it contributes to the G1 cell cycle checkpoint. By monitoring the entry of irradiated G1 cells into S-phase, we observed a checkpoint defect after siRNA-mediated depletion of TopBP1, 53BP1 or ATM. Thus, TopBP1 may mediate the checkpoint function of 53BP1 in G1.

Explosive dome eruptions modulated by periodic gas-driven inflation

USGS Publications Warehouse

Johnson, Jeffrey B.; Lyons, John; Andrews, B. J.; Lees, J.M.

2014-01-01

Volcan Santiaguito (Guatemala) “breathes” with extraordinary regularity as the edifice's conduit system accumulates free gas, which periodically vents to the atmosphere. Periodic pressurization controls explosion timing, which nearly always occurs at peak inflation, as detected with tiltmeters. Tilt cycles in January 2012 reveal regular 26 ± 6 min inflation/deflation cycles corresponding to at least ~101 kg/s of gas fluxing the system. Very long period (VLP) earthquakes presage explosions and occur during cycles when inflation rates are most rapid. VLPs locate ~300 m below the vent and indicate mobilization of volatiles, which ascend at ~50 m/s. Rapid gas ascent feeds pyroclast-laden eruptions lasting several minutes and rising to ~1 km. VLPs are not observed during less rapid inflation episodes; instead, gas vents passively through the conduit producing no infrasound and no explosion. These observations intimate that steady gas exsolution and accumulation in shallow reservoirs may drive inflation cycles at open-vent silicic volcanoes.

Susceptibility of ornamental pepper banker plant candidates to common greenhouse pests

USDA-ARS?s Scientific Manuscript database

Susceptibility of four potential ornamental pepper banker plant candidates [Black Pearl (BP), Explosive Ember (EE), Masquerade (MA), Red Missile (RM), and a commercial pepper cultivar Blitz (BL)] were evaluated against three common greenhouse pests - Bemisia tabaci, Polyphagotarsonemus latus and Fra...

The Influence of Blood Pressure on Fetal Aortic Distensibility: An Animal Validation Study.

PubMed

Wohlmuth, Christoph; Moise, Kenneth J; Papanna, Ramesha; Gheorghe, Ciprian; Johnson, Anthony; Morales, Yisel; Gardiner, Helena M

2018-01-01

Aortic distension waveforms describe the change in diameter or cross-sectional area over the cardiac cycle. We aimed to validate the association of aortic fractional area change (AFAC) with blood pressure (BP) in a fetal lamb model. Four pregnant ewes underwent open fetal surgery under general anesthesia at 107-120 gestational days. A 4-Fr catheter was introduced into the fetal femoral artery and vein, or the carotid artery and jugular vein. The thoracic aorta was imaged using real-time ultrasound; AFAC was calculated using offline speckle tracking software. Measurements of invasive BP and AFAC were obtained simultaneously and averaged over 10 cardiac cycles. BP was increased by norepinephrine infusion and the association of aortic distensibility with BP was assessed. Baseline measurements were obtained from 4 lambs, and changes in aortic distensibility with increasing BP were recorded from 3 of them. A positive correlation was found between AFAC and systolic BP (r = 0.692, p = 0.001), diastolic BP (r = 0.647, p = 0.004), mean BP (r = 0.692, p = 0.001), and BP amplitude (r = 0.558, p = 0.016) controlled for heart rate. No association was found between BP and maximum or minimum aortic area. AFAC provides a quantifiable measure of aortic distensibility and correlates with systolic BP, diastolic BP, mean BP, and BP amplitude in a fetal lamb model. © 2017 S. Karger AG, Basel.

Selecting an ornamental pepper banker plant for Amblyseius swirskii in floriculture crops

USDA-ARS?s Scientific Manuscript database

Preference of phytoseiid mite Amblyseius swirskii (Athias-Henriot) was assessed on four cultivars of ornamental pepper banker plant candidates; Red Missile (RM), Masquerade (MA), Explosive Ember (EE), and Black Pearl (BP) for potential control of pestiferous insects in floriculture. Cultivar prefere...

Experimental Investigation of the Acoustic Nonlinear Behavior in Granular Polymer Bonded Explosives with Progressive Fatigue Damage

PubMed Central

Yang, Zhanfeng; Tian, Yong; Li, Weibin; Zhou, Haiqiang; Zhang, Weibin; Li, Jingming

2017-01-01

The measurement of acoustic nonlinear response is known as a promising technique to characterize material micro-damages. In this paper, nonlinear ultrasonic approach is used to characterize the evolution of fatigue induced micro-cracks in polymer bonded explosives. The variations of acoustic nonlinearity with respect to fatigue cycles in the specimens are obtained in this investigation. The present results show a significant increase of acoustic nonlinearity with respect to fatigue cycles. The experimental observation of the correlation between the acoustic nonlinearity and fatigue cycles in carbon/epoxy laminates, verifies that an acoustic nonlinear response can be used to evaluate the progressive fatigue damage in the granular polymer bonded explosives. The sensitivity comparison of nonlinear and linear parameters of ultrasonic waves in the specimens shows that nonlinear acoustic parameters are more promising indicators to fatigue induced micro-damage than linear ones. The feasibility study of the micro-damage assessment of polymer bonded explosives by nonlinear ultrasonic technique in this work can be applied to damage identification, material degradation monitoring, and lifetime prediction of the explosive parts. PMID:28773017

Experimental Investigation of the Acoustic Nonlinear Behavior in Granular Polymer Bonded Explosives with Progressive Fatigue Damage.

PubMed

Yang, Zhanfeng; Tian, Yong; Li, Weibin; Zhou, Haiqiang; Zhang, Weibin; Li, Jingming

2017-06-16

The measurement of acoustic nonlinear response is known as a promising technique to characterize material micro-damages. In this paper, nonlinear ultrasonic approach is used to characterize the evolution of fatigue induced micro-cracks in polymer bonded explosives. The variations of acoustic nonlinearity with respect to fatigue cycles in the specimens are obtained in this investigation. The present results show a significant increase of acoustic nonlinearity with respect to fatigue cycles. The experimental observation of the correlation between the acoustic nonlinearity and fatigue cycles in carbon/epoxy laminates, verifies that an acoustic nonlinear response can be used to evaluate the progressive fatigue damage in the granular polymer bonded explosives. The sensitivity comparison of nonlinear and linear parameters of ultrasonic waves in the specimens shows that nonlinear acoustic parameters are more promising indicators to fatigue induced micro-damage than linear ones. The feasibility study of the micro-damage assessment of polymer bonded explosives by nonlinear ultrasonic technique in this work can be applied to damage identification, material degradation monitoring, and lifetime prediction of the explosive parts.

53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis.

PubMed

Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan

2016-07-02

Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.

Weight fluctuations could increase blood pressure in android obese women.

PubMed

Guagnano, M T; Pace-Palitti, V; Carrabs, C; Merlitti, D; Sensi, S

1999-06-01

Recent studies have documented a relationship between increased morbidity and mortality from cardiovascular diseases and a history of weight cycling (WC) in obese subjects. We performed a cross-sectional analysis in 96 weight-cycling android obese women, matched with 96 non-weight-cycling android obese women by age, body mass index (BMI) and waist-to-hip ratio (WHR), to evaluate any increase in blood pressure (BP) levels in association with WC. The patients were all between 20 and 45 years old, were non-menopausal, did not smoke, did not take any medication, had normal glucose tolerance and were otherwise healthy. A history of WC was established on the basis of at least five weight losses in the previous 5 years due to dieting, with a weight loss of at least 4.5 kg per cycle. We documented higher levels of casual BP in the weight-cycling obese compared with the non-weight-cycling subjects: 147+/-12/90+/-8 mmHg versus 125+/-14/79+/-8 mmHg (P<0.001). The women with WC showed a statistically significant positive correlation between BP and age, weight, BMI, waist circumference, WHR, total weight regained and weight cycling index (WCI). However, in a multiple regression model only the WHR and WCI contributed significantly to the BP variability. These findings could support the hypothesis that it is the combined exposure of central-type obesity and WC that strongly raises the prediction of hypertension.

A Search for New Fuel Components in Explosive Mixtures with Ammonium Nitrate

DTIC Science & Technology

1981-04-30

i AP-PENIMY A. rol~our Tnd#Ix entrl-s for dyes tested for euatecticmixture form7ation with wnmoniua.i nitrate 12010 C.!. Snivent tR.. d 3...lirainhto. %k ith sodium hydroide itnd sodium ýhlnrate l1r6nner, BP 739 182 o d )r nitrate (GP I1S52q) lh-lftier, Gi’ 3628P 9 (1’. 1, 308) (it) Iaat...K -__ __ __ __ _ R___ __ _ __ LEVEL... 0 Final Report A SEARCH FOR NEW FUEL COMPONENTS IN EXPLOSIVE MIXTURES WITH AMMONIUM NITRATE -m i Dr. Maurice C

Antitumor action of 3-bromopyruvate implicates reorganized tumor growth regulatory components of tumor milieu, cell cycle arrest and induction of mitochondria-dependent tumor cell death.

PubMed

Yadav, Saveg; Kujur, Praveen Kumar; Pandey, Shrish Kumar; Goel, Yugal; Maurya, Babu Nandan; Verma, Ashish; Kumar, Ajay; Singh, Rana Pratap; Singh, Sukh Mahendra

2018-01-15

Evidences demonstrate that metabolic inhibitor 3-bromopyruvate (3-BP) exerts a potent antitumor action against a wide range of malignancies. However, the effect of 3-BP on progression of the tumors of thymic origin remains unexplored. Although, constituents of tumor microenvironment (TME) plays a pivotal role in regulation of tumor progression, it remains unclear if 3-BP can alter the composition of the crucial tumor growth regulatory components of the external surrounding of tumor cells. Thus, the present investigation attempts to understand the effect of 3-BP administration to a host bearing a progressively growing tumor of thymic origin on tumor growth regulatory soluble, cellular and biophysical components of tumor milieu vis-à-vis understanding its association with tumor progression, accompanying cell cycle events and mode of cell death. Further, the expression of cell survival regulatory molecules and hemodynamic characteristics of the tumor milieu were analysed to decipher mechanisms underlying the antitumor action of 3-BP. Administration of 3-BP to tumor-bearing hosts retarded tumor progression accompanied by induction of tumor cell death, cell cycle arrest, declined metabolism, inhibited mitochondrial membrane potential, elevated release of cytochrome c and altered hemodynamics. Moreover, 3-BP reconstituted the external milieu, in concurrence with deregulated glucose and pH homeostasis and increased tumor infiltration by NK cells, macrophages, and T lymphocytes. Further, 3-BP administration altered the expression of key regulatory molecules involved in glucose uptake, intracellular pH and tumor cell survival. The outcomes of this study will help in optimizing the therapeutic application of 3-BP by targeting crucial tumor growth regulatory components of tumor milieu. Copyright © 2017 Elsevier Inc. All rights reserved.

Inhibition of Breast Cancer-lnduced Bone Pain, Metastasis, and Osteolysis in Nude Mice by LOVAZA and DHA Fatty Acids

DTIC Science & Technology

2012-10-01

ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1

The impact of the BP Baker report.

PubMed

Rodríguez, Jennifer M; Payne, Stephanie C; Bergman, Mindy E; Beus, Jeremy M

2011-06-01

This study examined the impact of the British Petroleum (BP) Baker Panel Report, reviewing the March 2005 BP-Texas City explosion, on the field of process safety. Three hundred eighty-four subscribers of a process safety listserv responded to a survey two years after the BP Baker Report was published. Results revealed respondents in the field of process safety are familiar with the BP Baker Report, feel it is important to the future safety of chemical processing, and believe that the findings are generalizable to other plants beyond BP-Texas City. Respondents indicated that few organizations have administered the publicly available BP Process Safety Culture Survey. Our results also showed that perceptions of contractors varied depending on whether respondents were part of processing organizations (internal perspective) or government or consulting agencies (external perspective). This research provides some insight into the beliefs of chemical processing personnel regarding the transportability and generalizability of lessons learned from one organization to another. This study has implications for both organizational scientists and engineers in that it reveals perceptions about the primary mechanism used to share lessons learned within one industry about one major catastrophe (i.e., investigation reports). This study provides preliminary information about the perceived impact of a report such as this one. Copyright © 2011 National Safety Council and Elsevier Ltd. All rights reserved.

Fluctuation history of Great Salt Lake, Utah, during the last 13,000 years, part 2

NASA Technical Reports Server (NTRS)

Murchison, Stuart B.

1989-01-01

Great Salt Lake level fluctuations from 13,000 yr B.P. to the present were interpreted by examination of shoreline geomorphic features, shoreline deposits, archeologic sites, isotopic data, and palynologic data. After the conclusion of the Bonneville paleolake cycle, between 13,000 and 12,000 yr B.P. the lake regressed to levels low enough to deposit a littoral oxidized red bed stratum and a pelagic Glauber's salt layer. A late Pleistocene lake cycle occurred between 12,000 and 10,000 yr B.P. depositing several beaches, the highest reaching an altitude of about 4250 ft (1295.3 m). The lake regressed after 10,000 yr B.P., only to rise to 4230 ft (1289.2 m) between 9700 and 9400 yr B.P. and then gradually lower at least 15 ft (4.5 m) or more. Lake levels fluctuated between 4212 and 4180 ft (1284 and 1274 m) for the next 4000 years. A late Holocene lake cycle, constrained by radiocarbon ages between 3440 and 1400 yr B.P., is reported at a highest static level of 4221 ft (1286.5 m). After a lake level drop to altitudes ranging between 4210 and 4205 ft (1283.2 and 1281.6 m), a 4217 ft (1285.7 m) level was reached after 400 yr B.P. This level lowered to 4214 ft (1284.4 m) in the mid to late 1700 s A.D. The lake levels have since stabilized aroung a 4200 ft (1280 m) mean.

Development of chemiluminescent probe hybridization, RT-PCR and nucleic acid cycle sequencing assays of Sabin type 3 isolates to identify base pair 472 Sabin type 3 mutants associated with vaccine associated paralytic poliomyelitis.

PubMed

Old, M O; Logan, L H; Maldonado, Y A

1997-11-01

Sabin type 3 polio vaccine virus is the most common cause of poliovaccine associated paralytic poliomyelitis. Vaccine associated paralytic poliomyelitis cases have been associated with Sabin type 3 revertants containing a single U to C substitution at bp 472 of Sabin type 3. A rapid method of identification of Sabin type 3 bp 472 mutants is described. An enterovirus group-specific probe for use in a chemiluminescent dot blot hybridization assay was developed to identify enterovirus positive viral lysates. A reverse transcription-polymerase chain reaction (RT-PCR) assay producing a 319 bp PCR product containing the Sabin type 3 bp 472 mutation site was then employed to identify Sabin type 3 isolates. Chemiluminescent nucleic acid cycle sequencing of the purified 319 bp PCR product was then employed to identify nucleic acid sequences at bp 472. The enterovirus group probe hybridization procedure and isolation of the Sabin type 3 PCR product were highly sensitive and specific; nucleic acid cycle sequencing corresponded to the known sequence of stock Sabin type 3 isolates. These methods will be used to identify the Sabin type 3 reversion rate from sequential stool samples of infants obtained after the first and second doses of oral poliovirus vaccine.

The effect of dietary nitrate supplementation on the oxygen cost of cycling, walking performance and resting blood pressure in individuals with chronic obstructive pulmonary disease: A double blind placebo controlled, randomised control trial.

PubMed

Shepherd, Anthony I; Wilkerson, Daryl P; Dobson, Lee; Kelly, James; Winyard, Paul G; Jones, Andrew M; Benjamin, Nigel; Shore, Angela C; Gilchrist, Mark

2015-08-01

Chronic obstructive pulmonary disease (COPD) results in exercise intolerance. Dietary nitrate supplementation has been shown to lower blood pressure (BP), reduce the oxygen cost of exercise, and enhance exercise tolerance in healthy volunteers. This study assessed the effects of dietary nitrate on the oxygen cost of cycling, walking performance and BP in individuals with mild-moderate COPD. Thirteen patients with mild-moderate COPD were recruited. Participants consumed 70 ml of either nitrate-rich (6.77 mmol nitrate; beetroot juice) or nitrate-depleted beetroot juice (0.002 mmol nitrate; placebo) twice a day for 2.5 days, with the final supplement ~3 hours before testing. BP was measured before completing two bouts of moderate-intensity cycling, where pulmonary gas exchange was measured throughout. The six-minute walk test (6 MWT) was completed 30 minutes subsequent to the second cycling bout. Plasma nitrate concentration was significantly elevated following beetroot juice vs. placebo (placebo; 48 ± 86 vs. beetroot juice; 215 ± 84 µM, P = 0.002). No significant differences were observed between placebo vs. beetroot juice for oxygen cost of exercise (933 ± 323 vs. 939 ± 302 ml: min(-1); P = 0.88), distance covered in the 6 MWT (456 ± 86 vs. 449 ± 79 m; P = 0.37), systolic BP (123 ± 14 vs. 123 ± 14 mmHg; P = 0.91), or diastolic BP (77 ± 9 vs. 79 ± 9 mmHg; P = 0.27). Despite a large rise in plasma nitrate concentration, two days of nitrate supplementation did not reduce the oxygen cost of moderate intensity cycling, increase distance covered in the 6 MWT, or lower BP. Copyright © 2015 Elsevier Inc. All rights reserved.

Increased Postnatal Cardiac Hyperplasia Precedes Cardiomyocyte Hypertrophy in a Model of Hypertrophic Cardiomyopathy

PubMed Central

Farrell, Emily T.; Grimes, Adrian C.; de Lange, Willem J.; Armstrong, Annie E.; Ralphe, J. Carter

2017-01-01

Rationale: Hypertrophic cardiomyopathy (HCM) occurs in ~0.5% of the population and is a leading cause of sudden cardiac death (SCD) in young adults. Cardiomyocyte hypertrophy has been the accepted mechanism for cardiac enlargement in HCM, but the early signaling responsible for initiating hypertrophy is poorly understood. Mutations in cardiac myosin binding protein C (MYBPC3) are among the most common HCM-causing mutations. Ablation of Mybpc3 in an HCM mouse model (cMyBP-C−/−) rapidly leads to cardiomegaly by postnatal day (PND) 9, though hearts are indistinguishable from wild-type (WT) at birth. This model provides a unique opportunity to explore early processes involved in the dramatic postnatal transition to hypertrophy. Methods and Results: We performed microarray analysis, echocardiography, qPCR, immunohistochemistry (IHC), and isolated cardiomyocyte measurements to characterize the perinatal cMyBP-C−/− phenotype before and after overt hypertrophy. cMyBP-C−/− hearts showed elevated cell cycling at PND1 that transitioned to hypertrophy by PND9. An expanded time course revealed that increased cardiomyocyte cycling was associated with elevated heart weight to body weight ratios prior to cellular hypertrophy, suggesting that cell cycling resulted in cardiomyocyte proliferation. Animals heterozygous for the cMyBP-C deletion trended in the direction of the homozygous null, yet did not show increased heart size by PND9. Conclusions: Results indicate that altered regulation of the cell cycling pathway and elevated proliferation precedes hypertrophy in the cMyBP-C−/− HCM model, and suggests that increased cardiomyocyte number contributes to increased heart size in cMyBP-C−/− mice. This pre-hypertrophic period may reflect a unique time during which the commitment to HCM is determined and disease severity is influenced. PMID:28659827

Late Holocene stratigraphy of the Tetimpa archaeological sites, northeast flank of Popocatepetl volcano, central Mexico

USGS Publications Warehouse

Panfil, M.S.; Gardner, T.W.; Hirth, K.G.

1999-01-01

Late Holocene (240 km2 on the east side of the volcano with >25 cm of tephra. Lavas from eruptive sequence I dammed drainage in the lowland area near the town of San Nicolas and caused local upstream deposition of as much as 30 m of lacustrine silts, clays, and sands. These lacustrine deposits record an eruptive hiatus for the Tetimpa area of about 750 14C yr: between ca. 2100 and ca. 1350 yr B.P., no major tephras were deposited in the Tetimpa area. In upland areas, this time period is represented by an unconformity and by Entisols formed in the top of pumice deposits and lavas from eruptive sequence I. Artifacts, agricultural furrows, and dwellings record human reoccupation of this surface. At the end of this hiatus, several lahars were deposited above the lacustrine sequence and locally above the Entisol in upland positions adjacent to streams. Between ca. 1350 and ca. 1200 yr B.P., tephras from eruptive sequence II buried these paleosols, occupation sites, lacustrine sediments, and lahars. Andesitic (~62% SiO2) pumice lapilli deposits in the Tetimpa area record three pumice-fall eruptions directed northeast and east of the crater. The first and smallest of these (maximum Tetimpa area thickness = 12 cm; >52 km2 covered by >25 cm) took place at ca. 1350 yr B.P. and was accompanied by pyroclastic surge events preserved in the Tetimpa area by charcoal, sand waves, and cross-stratified sand-sized tephra. At ca. 1200 yr B.P., the products of two Plinian-style events and additional pyroclastic surges reached the Tetimpa area. The largest of these tephra-fall events covered the Tetimpa area with 0.5-1 m of tephra and blanketed an area of >230 km2 with a thickness of >25 cm. The Tetimpa record confirms two of the four periods of explosive volcanism recognized by studies conducted around Popocatepetl in the past 30 yr. Eruptive sequence I corresponds to the explosive period between 2100 and 2500 yr B.P., and eruptive sequence II corresponds to the period between 900 and 1400 yr B.P. The archaeology and lacustrine stratigraphy of the Tetimpa area help constrain the timing of the Plinian phase of eruptive sequence I to ca. 2100 yr B.P. and suggest that the pumice-fall eruptions of eruptive sequence II took place in at least two intervals between ca. 1350 and ca. 1200 yr B.P.

Development of a Blood Pressure Measurement Instrument with Active Cuff Pressure Control Schemes.

PubMed

Kuo, Chung-Hsien; Wu, Chun-Ju; Chou, Hung-Chyun; Chen, Guan-Ting; Kuo, Yu-Cheng

2017-01-01

This paper presents an oscillometric blood pressure (BP) measurement approach based on the active control schemes of cuff pressure. Compared with conventional electronic BP instruments, the novelty of the proposed BP measurement approach is to utilize a variable volume chamber which actively and stably alters the cuff pressure during inflating or deflating cycles. The variable volume chamber is operated with a closed-loop pressure control scheme, and it is activated by controlling the piston position of a single-acting cylinder driven by a screw motor. Therefore, the variable volume chamber could significantly eliminate the air turbulence disturbance during the air injection stage when compared to an air pump mechanism. Furthermore, the proposed active BP measurement approach is capable of measuring BP characteristics, including systolic blood pressure (SBP) and diastolic blood pressure (DBP), during the inflating cycle. Two modes of air injection measurement (AIM) and accurate dual-way measurement (ADM) were proposed. According to the healthy subject experiment results, AIM reduced 34.21% and ADM reduced 15.78% of the measurement time when compared to a commercial BP monitor. Furthermore, the ADM performed much consistently (i.e., less standard deviation) in the measurements when compared to a commercial BP monitor.

X-Ray, UV, and Optical Observations of Supernova 2006bp with Swift: Detection of Early X-Ray Emission

NASA Technical Reports Server (NTRS)

Immler, S.; Brown, P. J.; Milne, P.; Dessart, L.; Mazzali, P. A.; Landsman, W.; Gehrels, N.; Petre, R.; Burrows, D. N.; Nousek, J. A.;

Muscle power output properties using the stretch-shortening cycle of the upper limb and their relationships with a one-repetition maximum bench press.

PubMed

Miyaguchi, Kazuyoshi; Demura, Shinichi

2006-05-01

The purpose of this study was to examine the output properties of muscle power by the dominant upper limb using SSC, and the relationships between the power output by SSC and a one-repetition maximum bench press (1 RM BP) used as a strength indicator of the upper body. Sixteen male athletes (21.4+/-0.9 yr) participated in this study. They pulled a load of 40% of maximum voluntary contraction (MVC) at a stretch by elbow flexion of the dominant upper limb in the following three preliminary conditions: static relaxed muscle state (SR condition), isometric muscle contraction state (ISO condition), and using SSC (SSC condition). The velocity with a wire load via a pulley during elbow flexion was measured accurately using a power instrument with a rotary encoder, and the muscle power curve was drawn from the product of the velocity and load. Significant differences were found among all evaluation parameters of muscle power exerted from the above three conditions and the parameters regarding early power output during concentric contraction were larger in the SSC condition than the SR and ISO conditions. The parameters on initial muscle contraction velocity when only using SSC significantly correlated with 1 RM BP (r=0.60-0.62). The use of SSC before powerful elbow flexion may contribute largely to early explosive power output during concentric contraction. Bench press capacity relates to a development of the above early power output when using SSC.

BP, Corporate R&D, and the University

ERIC Educational Resources Information Center

Lea, Russ

2010-01-01

April 20, 2010, and the days following, provided the world with graphic images of a burning oil rig, a perception that the oil industry and state and federal governments were helpless, and a pervasive sense of the devastation wrought on coastal residents by the rig explosion and the oil spill. The residents of the Gulf Coast soon realized that…

The effects of short-cycle sprints on power, strength, and salivary hormones in elite rugby players.

PubMed

Crewther, Blair T; Cook, Christian J; Lowe, Tim E; Weatherby, Robert P; Gill, Nicholas

2011-01-01

This study examined the effects of short-cycle sprints on power, strength, and salivary hormones in elite rugby players. Thirty male rugby players performed an upper-body power and lower-body strength (UPLS) and/or a lower-body power and upper-body strength (LPUS) workout using a crossover design (sprint vs. control). A 40-second upper-body or lower-body cycle sprint was performed before the UPLS and LPUS workouts, respectively, with the control sessions performed without the sprints. Bench throw (BT) power and box squat (BS) 1 repetition maximum (1RM) strength were assessed in the UPLS workout, and squat jump (SJ) power and bench press (BP) 1RM strength were assessed in the LPUS workout. Saliva was collected across each workout and assayed for testosterone (Sal-T) and cortisol (Sal-C). The cycle sprints improved BS (2.6 ± 1.2%) and BP (2.8 ± 1.0%) 1RM but did not affect BT and SJ power. The lower-body cycle sprint produced a favorable environment for the BS by elevating Sal-T concentrations. The upper-body cycle sprint had no hormonal effect, but the workout differences (%) in Sal-T (r = -0.59) and Sal-C (r = 0.42) concentrations correlated to the BP, along with the Sal-T/C ratio (r = -0.49 to -0.66). In conclusion, the cycle sprints improved the BP and BS 1RM strength of elite rugby players but not power output in the current format. The improvements noted may be explained, in part, by the changes in absolute or relative hormone concentrations. These findings have practical implications for prescribing warm-up and training exercises.

Ribulose 1,5-bisphosphate carboxylase and phosphoribulokinase in Prochloron

NASA Technical Reports Server (NTRS)

Berhow, M. A.; Mcfadden, B. A.

1983-01-01

Ribulose 1,5-bisphosphate (RuBP) carboxylase and phosphoribulokinase, enzymes in the reductive pentose-phosphate cycle, were measured in cell-free extracts of Prochloran didemni. The partial purification and characterization of RuBP carboxylase were described. Prochloron RuBP carboxylase, when purified by isopycnic centrifugation in reoriented linear 0.2 to 0.8 M sucrose gradients, sedimented to a position which corresponded to that of the 520,000-dalton spinach enzyme. Sodium dodecyl sulfate polyacrylamide gel electrophoresis showed that the Prochloron enzyme was composed of large and small subunits (MW = 57,500 and 18,800). Though results established that the enzymes RuBP carboxylase and phosphoribulokinase were present in levels comparable to other CO2-fixing microorganisms, it was suggested that other enzymes in the Calvin cycle limit growth or that additional enzymic insufficiencies exist.

Are There Spatial or Temporal Patterns to Holocene Explosive Eruptions in the Aleutian Archipelago? A Work in Progress

NASA Astrophysics Data System (ADS)

Martin, C.; Nicolaysen, K. P.; McConville, K.; Hatfield, V.; West, D.

2013-12-01

By examining the existing geological and archeological record of radiocarbon dated Aleutian tephras of the last 12,000 years, this study sought to determine whether there were spatial or temporal patterns of explosive eruptive activity. The Holocene tephra record has important implications because two episodes of migration and colonization by humans of distinct cultures established the Unangan/Aleut peoples of the Aleutian Islands concurrently with the volcanic activity. From Aniakchak Volcano on the Alaska Peninsula to the Andreanof Islands (158 to 178° W longitude), 55 distinct tephras represent significant explosive eruptions of the last 12,000 years. Initial results suggest that the Andreanof and Fox Island regions of the archipelago have had frequent explosive eruptions whereas the Islands of Four Mountains, Rat, and Near Island regions have apparently had little or no eruptive activity. However, one clear result of the investigation is that sampling bias strongly influences the apparent spatial patterns. For example field reconnaissance in the Islands of Four Mountains documents two Holocene calderas and a minimum of 20 undated tephras in addition to the large ignimbrites. Only the lack of significant explosive activity in the Near Islands seems a valid spatial result as archeological excavations and geologic reports failed to document Holocene tephras there. An intriguing preliminary temporal pattern is the apparent absence of large explosive eruptions across the archipelago from ca. 4,800 to 6,000 yBP. To test the validity of apparent patterns, a statistical treatment of the compiled data grappled with the sampling bias by considering three confounding variables: larger island size allows more opportunity for geologic preservation of tephras; larger magnitude eruption promotes tephra preservation by creating thicker and more widespread deposits; the comprehensiveness of the tephra sampling of each volcano and island varies widely because of logistical and financial limitations. This initial statistical investigation proposes variables to mitigate the effects of sampling bias and makes recommendations for sampling strategies to enable statistically valid examination of research questions. Further, though caldera-forming eruptions occurred throughout the Holocene - and several remain undated - four of six dated eruptions occurred throughout the archipelago between 8,000-9,100 yBP, a period coinciding with some of the earliest human occupation (Early Anangula Phase) of the eastern Aleutians.

Sandwiched Thin-Film Anode of Chemically Bonded Black Phosphorus/Graphene Hybrid for Lithium-Ion Battery.

PubMed

Liu, Hanwen; Zou, Yuqin; Tao, Li; Ma, Zhaoling; Liu, Dongdong; Zhou, Peng; Liu, Hongbo; Wang, Shuangyin

2017-09-01

A facile vacuum filtration method is applied for the first time to construct sandwich-structure anode. Two layers of graphene stacks sandwich a composite of black phosphorus (BP), which not only protect BP from quickly degenerating but also serve as current collector instead of copper foil. The BP composite, reduced graphene oxide coated on BP via chemical bonding, is simply synthesized by solvothermal reaction at 140 °C. The sandwiched film anode used for lithium-ion battery exhibits reversible capacities of 1401 mAh g -1 during the 200th cycle at current density of 100 mA g -1 indicating superior cycle performance. Besides, this facile vacuum filtration method may also be available for other anode material with well dispersion in N-methyl pyrrolidone (NMP). © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Role of volcanism in climate and evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Axelrod, D.I.

1981-01-01

Several major episodes of Tertiary explosive volcanism coincided with sharply lowered temperature as inferred from oxygen-isotope composition of foraminiferal tests in deep-sea cores. At these times, fossil floras in the western interior recorded significant changes. Reductions in taxa that required warmth occurred early in the Paleogene. Later, taxa that demand ample summer rain were reduced during a progressive change reflecting growth of the subtropic high. Other ecosystem changes that appear to have responded to volcanically induced climatic modifications include tachytely in Equidae (12 to 10 m.y. B.P.), rapid evolution of grasses (7 to 5 m.y. B.P.), evolution of marine mammals,more » and plankton flucuations. Although Lake Cretaceous extinctions commenced as epeiric seas retreated, the pulses of sharply lowered temperature induced by explosive volcanism, together with widespread falls of volcanic ash, may have led to extinction of dinosaurs, ammonites, cycadeoids, and other Cretaceous taxa. earlier, as Pangaea was assembled, Permian extinctions resulted not only from the elimination of oceans, epeiric seas, and shorelines, and the spread of more-continental climates, bu also from the climatic effects of major pulses of global volcanism and Gondwana glaciation.« less

Three active volcanoes in China and their hazards

NASA Astrophysics Data System (ADS)

Wei, H.; Sparks, R. S. J.; Liu, R.; Fan, Q.; Wang, Y.; Hong, H.; Zhang, H.; Chen, H.; Jiang, C.; Dong, J.; Zheng, Y.; Pan, Y.

2003-02-01

The active volcanoes in China are located in the Changbaishan area, Jingbo Lake, Wudalianchi, Tengchong and Yutian. Several of these volcanoes have historical records of eruption and geochronological evidence of Holocene activity. Tianchi Volcano is a well-preserved Cenozoic polygenetic central volcano, and, due to its recent history of powerful explosive eruptions of felsic magmas, with over 100,000 people living on its flanks is a high-risk volcano. Explosive eruptions at 4000 and 1000 years BP involved plinian and ignimbrite phases. The Millennium eruption (1000 years BP) involved at least 20-30 km 3 of magma and was large enough to have a global impact. There are 14 Cenozoic monogenetic scoria cones and associated lavas with high-K basalt composition in the Wudalianchi volcanic field. The Laoheishan and Huoshaoshan cones and related lavas were formed in 1720-1721 and 1776 AD. There are three Holocene volcanoes, Dayingshan, Maanshan, and Heikongshan, among the 68 Quaternary volcanoes in the Tengchong volcanic province. Three of these volcanoes are identified as active, based on geothermal activity, geophysical evidence for magma, and dating of young volcanic rocks. Future eruptions of these Chinese volcanoes pose a significant threat to hundreds of thousands of people and are likely to cause substantial economic losses.

MCM-BP is required for repression of life-cycle specific genes transcribed by RNA polymerase I in the mammalian infectious form of Trypanosoma brucei.

PubMed

Kim, Hee-Sook; Park, Sung Hee; Günzl, Arthur; Cross, George A M

2013-01-01

Trypanosoma brucei variant surface glycoprotein (VSG) expression is a classic example of allelic exclusion. While the genome of T. brucei contains >2,000 VSG genes and VSG pseudogenes, only one allele is expressed at the surface of each infectious trypanosome and the others are repressed. Along with recombinatorial VSG switching, allelic exclusion provides a major host evasion mechanism for trypanosomes, a phenomenon known as antigenic variation. To extend our understanding of how trypanosomes escape host immunity by differential expression of VSGs, we attempted to identify genes that contribute to VSG silencing, by performing a loss-of-silencing screen in T. brucei using a transposon-mediated random insertional mutagenesis. One identified gene, which we initially named LOS1, encodes a T. brucei MCM-Binding Protein (TbMCM-BP). Here we show that TbMCM-BP is essential for viability of infectious bloodstream-form (BF) trypanosome and is required for proper cell-cycle progression. Tandem affinity purification of TbMCM-BP followed by mass spectrometry identified four subunits (MCM4-MCM7) of the T. brucei MCM complex, a replicative helicase, and MCM8, a subunit that is uniquely co-purified with TbMCM-BP. TbMCM-BP is required not only for repression of subtelomeric VSGs but also for silencing of life-cycle specific, insect-stage genes, procyclin and procyclin-associated genes (PAGs), that are normally repressed in BF trypanosomes and are transcribed by RNA polymerase I. Our study uncovers a functional link between chromosome maintenance and RNA pol I-mediated gene silencing in T. brucei.

The A.D. 79 eruption as a future explosive scenario in the Vesuvian area: evaluation of associated risk

NASA Astrophysics Data System (ADS)

Lirer, Lucio; Munno, Rosalba; Postiglione, Immacolata; Vinci, Anna; Vitelli, Livia

Due to the lack of an effective policy of planning and prevention, over the past decades the area around Mt. Vesuvio has undergone a steady increase in population and uncontrolled housing development. Consequently, it has become one of the most hazardous volcanic areas in the world. In order to mitigate the damage that the impact of an explosive event would cause in the area, the Department of Civil Defense has worked out an Emergency Management Plan using the A.D. 1631 subplinian eruption as the most probable short-term event. However, from 25 000 years B.P. to present, the activity of the Somma-Vesuvio volcano has shown a sequence of eight eruptive cycles, which always began with a strong plinian eruption. In this paper we utilize the A.D. 79 eruption as an example of a potential large explosive eruption that might occur again at Vesuvio. A detailed tephrostratigraphic analysis of the eruption products was processed by a multivariate statistical analysis. This analysis proved useful for identifying marker layers in the sequences, thus allowing the recognition of some major phases of synchronous deposition and hence the definition of the chronological and spatial evolution of the eruption. By combining this reconstruction with land-use maps, a scenario is proposed with time intervals in the eruptive sequence similar to those reported in Pliny's letter. Thus, it was calculated that, after 7h from the start of the eruption, a total area of approximately 300km2 would be covered with the eruption products. In the following 11h, a total area of approximately 500km2 would be involved. The third and last phase of deposition would not cause significant variation in the total area involved, but it would bring about an increase in the thickness of the pyroclastic deposits in the perivolcanic area.

Single source photoplethysmograph transducer for local pulse wave velocity measurement.

PubMed

Nabeel, P M; Joseph, Jayaraj; Awasthi, Vartika; Sivaprakasam, Mohanasankar

2016-08-01

Cuffless evaluation of arterial blood pressure (BP) using pulse wave velocity (PWV) has received attraction over the years. Local PWV based techniques for cuffless BP measurement has more potential in accurate estimation of BP parameters. In this work, we present the design and experimental validation of a novel single-source Photoplethysmograph (PPG) transducer for arterial blood pulse detection and cycle-to-cycle local PWV measurement. The ability of the transducer to continuously measure local PWV was verified using arterial flow phantom as well as by conducting an in-vivo study on 17 volunteers. The single-source PPG transducer could reliably acquire dual blood pulse waveforms, along small artery sections of length less than 28 mm. The transducer was able to perform repeatable measurements of carotid local PWV on multiple subjects with maximum beat-to-beat variation less than 12%. The correlation between measured carotid local PWV and brachial BP parameters were also investigated during the in-vivo study. Study results prove the potential use of newly proposed single-source PPG transducers in continuous cuffless BP measurement systems.

Flexible Black-Phosphorus Nanoflake/Carbon Nanotube Composite Paper for High-Performance All-Solid-State Supercapacitors.

PubMed

Yang, Bingchao; Hao, Chunxue; Wen, Fusheng; Wang, Bochong; Mu, Congpu; Xiang, Jianyong; Li, Lei; Xu, Bo; Zhao, Zhisheng; Liu, Zhongyuan; Tian, Yongjun

2017-12-27

We proposed a simple route for fabrication of the flexible BP nanoflake/carbon nanotube (CNT) composite paper as flexible electrodes in all-solid-state supercapacitors. The highly conductive CNTs not only play a role as active materials but also increase conductivity of the hybrid electrode, enhance electrolyte shuttling and prevent the restacking between BP nanoflakes. The fabricated flexible all-solid-state supercapacitor (ASSP) device at the mass proportion of BP/CNTs 1:4 was found to deliver the highest volumetric capacitance of up to 41.1 F/cm 3 at 0.005 V/s, superior to the ASSP based on the bare graphene or BP. The BP/CNTs (1:4) device delivers a rapid charging/discharging up to 500 V/s, which exhibits the characteristic of a high power density of 821.62 W/cm 3 , while having outstanding mechanical flexibility and high cycling stability over 10 000 cycles (91.5% capacitance retained). Moreover the BP/CNTs (1:4) ASSP device still retains large volumetric capacitance (35.7 F/cm 3 at the scan rate of 0.005 V/s) even after 11 months. In addition, the ASSP of BP/CNTs (1:4) exhibits high energy density of 5.71 mWh/cm 3 and high power density of 821.62 W/cm 3 . As indicated in our work, the strategy of assembling stacked-layer composites films will open up novel possibility for realizing BP and CNTs in new-concept thin-film energy storage devices.

Synthesis of TiCx Powder via the Underwater Explosion of an Explosive

NASA Astrophysics Data System (ADS)

Tanaka, Shigeru; Bataev, Ivan; Hamashima, Hideki; Tsurui, Akihiko; Hokamoto, Kazuyuki

2018-05-01

In this study, a novel approach to the explosive synthesis of titanium carbide (TiC) is discussed. Nonstoichiometric TiCx powder was produced via the underwater explosion of a Ti powder encapsulated within a spherical explosive charge. The explosion process, bubble formation, and synthesis process were visualized using high-speed camera imaging. It was concluded that synthesis occurred within the detonation gas during the first expansion/contraction cycle of the bubble, which was accompanied by a strong emission of light. The recovered powders were studied using scanning electron microscopy and X-ray diffraction. Submicron particles were generated during the explosion. An increase in the carbon content of the starting powder resulted in an increase in the carbon content of the final product. No oxide byproducts were observed within the recovered powders.

Screening the yeast genome for energetic metabolism pathways involved in a phenotypic response to the anti-cancer agent 3-bromopyruvate.

PubMed

Lis, Paweł; Jurkiewicz, Paweł; Cal-Bąkowska, Magdalena; Ko, Young H; Pedersen, Peter L; Goffeau, Andre; Ułaszewski, Stanisław

2016-03-01

In this study the detailed characteristic of the anti-cancer agent 3-bromopyruvate (3-BP) activity in the yeast Saccharomyces cerevisiae model is described, with the emphasis on its influence on energetic metabolism of the cell. It shows that 3-BP toxicity in yeast is strain-dependent and influenced by the glucose-repression system. Its toxic effect is mainly due to the rapid depletion of intracellular ATP. Moreover, lack of the Whi2p phosphatase results in strongly increased sensitivity of yeast cells to 3-BP, possibly due to the non-functional system of mitophagy of damaged mitochondria through the Ras-cAMP-PKA pathway. Single deletions of genes encoding glycolytic enzymes, the TCA cycle enzymes and mitochondrial carriers result in multiple effects after 3-BP treatment. However, it can be concluded that activity of the pentose phosphate pathway is necessary to prevent the toxicity of 3-BP, probably due to the fact that large amounts of NADPH are produced by this pathway, ensuring the reducing force needed for glutathione reduction, crucial to cope with the oxidative stress. Moreover, single deletions of genes encoding the TCA cycle enzymes and mitochondrial carriers generally cause sensitivity to 3-BP, while totally inactive mitochondrial respiration in the rho0 mutant resulted in increased resistance to 3-BP.

Screening the yeast genome for energetic metabolism pathways involved in a phenotypic response to the anti-cancer agent 3-bromopyruvate

PubMed Central

Lis, Paweł; Jurkiewicz, Paweł; Cal-Bąkowska, Magdalena; Ko, Young H.; Pedersen, Peter L.; Goffeau, Andre; Ułaszewski, Stanisław

2016-01-01

In this study the detailed characteristic of the anti-cancer agent 3-bromopyruvate (3-BP) activity in the yeast Saccharomyces cerevisiae model is described, with the emphasis on its influence on energetic metabolism of the cell. It shows that 3-BP toxicity in yeast is strain-dependent and influenced by the glucose-repression system. Its toxic effect is mainly due to the rapid depletion of intracellular ATP. Moreover, lack of the Whi2p phosphatase results in strongly increased sensitivity of yeast cells to 3-BP, possibly due to the non-functional system of mitophagy of damaged mitochondria through the Ras-cAMP-PKA pathway. Single deletions of genes encoding glycolytic enzymes, the TCA cycle enzymes and mitochondrial carriers result in multiple effects after 3-BP treatment. However, it can be concluded that activity of the pentose phosphate pathway is necessary to prevent the toxicity of 3-BP, probably due to the fact that large amounts of NADPH are produced by this pathway, ensuring the reducing force needed for glutathione reduction, crucial to cope with the oxidative stress. Moreover, single deletions of genes encoding the TCA cycle enzymes and mitochondrial carriers generally cause sensitivity to 3-BP, while totally inactive mitochondrial respiration in the rho0 mutant resulted in increased resistance to 3-BP. PMID:26862728

Volcanic Processes and Geology of Augustine Volcano, Alaska

USGS Publications Warehouse

Waitt, Richard B.; Beget, James E.

2009-01-01

Augustine Island (volcano) in lower Cook Inlet, Alaska, has erupted repeatedly in late-Holocene and historical times. Eruptions typically beget high-energy volcanic processes. Most notable are bouldery debris avalanches containing immense angular clasts shed from summit domes. Coarse deposits of these avalanches form much of Augustine's lower flanks. A new geologic map at 1:25,000 scale depicts these deposits, these processes. We correlate deposits by tephra layers calibrated by many radiocarbon dates. Augustine Volcano began erupting on the flank of a small island of Jurassic clastic-sedimentary rock before the late Wisconsin glaciation (late Pleistocene). The oldest known effusions ranged from olivine basalt explosively propelled by steam, to highly explosive magmatic eruptions of dacite or rhyodacite shed as pumice flows. Late Wisconsin piedmont glaciers issuing from the mountainous western mainland surrounded the island while dacitic eruptive debris swept down the south volcano flank. Evidence is scant for eruptions between the late Wisconsin and about 2,200 yr B.P. On a few south-flank inliers, thick stratigraphically low pumiceous pyroclastic-flow and fall deposits probably represent this period from which we have no radiocarbon dates on Augustine Island. Eruptions between about 5,350 and 2,200 yr B.P. we know with certainty by distal tephras. On Shuyak Island 100 km southeast of Augustine, two distal fall ashes of Augustinian chemical provenance (microprobe analysis of glass) date respectively between about 5,330 and 5,020 yr B.P. and between about 3,620 and 3,360 yr B.P. An Augustine ash along Kamishak Creek 70 km southwest of Augustine dates between about 3,850 and 3,660 yr B.P. A probably Augustinian ash lying within peat near Homer dates to about 2,275 yr B.P. From before 2,200 yr B.P. to the present, Augustine eruptive products abundantly mantle the island. During this period, numerous coarse debris avalanches swept beyond Augustine's coast, most recently in A.D. 1883. The decapitated summit after the 1883 eruption, replaced by andesite domes of six eruptions since, shows a general process: collapse of steep summit domes, then the summit regrown by later dome eruptions. The island's stratigraphy is based on six or seven coarse-pumice tephra 'marker beds'. In upward succession they are layers G (2,100 yr B.P.), I (1,700 yr B.P.), H (1,400 yr B.P.), C (1,200-1,000 yr B.P.), M (750 yr B.P.), and B (390 yr B.P.). A coarse, hummocky debris-avalanche deposit older than about 2,100 yr B.P. - or perhaps a stack of three of them - lies along the east coast, the oldest exposed such bouldery diamicts on Augustine Island. Two large debris avalanches swept east and southeast into the sea between about 2,100 and 1,800 yr B.P. A large debris avalanche shed east and east-northeast into the sea between 1,700 and 14,00 yr B.P. Between about 1,400 and 1,100 yr B.P. debris avalanches swept into the sea on the volcano's south, southwest, and north-northwest. Pumiceous pyroclastic fans spread to the southeast and southwest, lithic pyroclastic flows and lahars (?) to the south and southeast. Pyroclastic flows, pyroclastic surges, and lahars swept down the west and south flanks between about 1,000 and 750 yr B.P. A debris avalanche swept into the sea on the west, and a small one on the south-southeast, between about 750 and 400 yr B.P. Large lithic pyroclastic flows shed to the southeast; smaller ones descended existing swales on the southwest and south. Between about 400 yr B.P. and historical time (late 1770s), three debris avalanches swept into the sea on the west-northwest, north-northwest, and north flanks. One of them (West Island) was large and fast: most of it rode to sea far beyond a former sea cliff, and its surface includes geomorphic evidence of having initiating a tsunami. Augustine's only conspicuous lava flow erupted on the north flank. During this prehistoric period numerous domes grew at th

Self-Standing Polypyrrole/Black Phosphorus Laminated Film: Promising Electrode for Flexible Supercapacitor with Enhanced Capacitance and Cycling Stability.

PubMed

Luo, Shaojuan; Zhao, Jinlai; Zou, Jifei; He, Zhiliang; Xu, Changwen; Liu, Fuwei; Huang, Yang; Dong, Lei; Wang, Lei; Zhang, Han

2018-01-31

With the rapid development of portable electronics, solid-state flexible supercapacitors (SCs) are considered as one of the promising energy devices in powering electronics because of their intrinsic advantages. Polypyrrole (PPy) is an ideal electrode material in constructing flexible SCs owing to its high electrochemical activity and inherent flexibility, although its relatively low capacitance and poor cycling stability are still worthy of improvement. Herein, through the innovative introduction of black phosphorus (BP) nanosheets, we developed a laminated PPy/BP self-standing film with enhanced capacitance and cycling stability via a facile one-step electrochemical deposition method. The film exhibits a high capacitance of 497.5 F g -1 (551.7 F cm -3 ) and outstanding cycling stability of 10 000 charging/discharging cycles, thanks to BP nanosheets inducing laminated assembly which hinder dense and disordered stacking of PPy during electrodeposition, consequently providing a precise pathway for ion diffusion and electron transport together with alleviation of the structural deterioration during charge/discharge. The flexible SC fabricated by laminated films delivers a high capacitance of 452.8 F g -1 (7.7 F cm -3 ) besides its remarkable mechanical flexibility and cycling stability. Our facile strategy paves the way to improve the electrochemical performance of PPy-based SC that could serve as promising flexible energy device for portable electronics.

Involvement of 53BP1, a p53 Binding Protein, in Chk2 Phosphyorylation of p53 and DNA Damage Cell Cycle Checkpoints

DTIC Science & Technology

2006-05-01

between 53BP1 and the platelet derived growth factor (PDGF) was recently identified in a patient with a myeloproliferative disorder.32 The 53BP1-PDGF...receptor beta in a patient with a t(5;15)(q33;q22) and an imatinib-responsive eosinophilic myeloproliferative disorder. Cancer Res 2004; 64:7216-9

[Features of daily rhythm of arterial pressure in patients with primary arterial hypertension and neurogenic syncope conditions].

PubMed

Musaeva, Z A; Oknin, V Iu; Khapaev, B A; Fedotova, A V; Veĭn, A M

2002-01-01

A comparative analysis of parameters of systemic BP in patients with primary arterial hypotension (PAH) and in patients with neurogenic syncopes (NS) in the cycle sleep-awake. Blood pressure was investigated in 20 patients with PAH aged 16-44 years and 18 patients with NS aged 16-49 years. 24-h ambulatory monitoring of BP was made on the monitor ABPM-02/M (Meditech, Hungary). Rhythm indices of BP in NS patients corresponded to age normal criteria. 24-h arrhythmia of BP in PAH patients manifests with excessive drop of diastolic BP in sleep (55% patients were overdippers). PAH and NS patients differ maximally by hypotonic load in sleep: 1.0 +/- 0.7% in NS vs 15.4 +/- 3.2% in PAH. Hypotonia episodes in awake PAH patients were registered at each 4th-5th measurement of BP, in NS patients--at each 11th-13th. Heart rate in awake PAH patients is higher than in healthy subjects. Hypotonic load in sleep carries the highest differentially-diagnostic importance. This makes more perspective examinations of such patients in the cycle sleep-awake. The changes observed in PAH patients evidence for activation of cerebral sympathico-adrenal systems participating in baroreflex regulation.

Decadal Cycles in the Human Cardiovascular System

PubMed Central

Halberg, Franz; Cornelissen, Germaine; Sothern, Robert B.; Hillman, Dewayne; Watanabe, Yoshihiko; Haus, Erhard; Schwartzkopff, Othild; Best, William R.

2013-01-01

Seven of the eight authors of this report each performed physiologic self-surveillance, some around the clock for decades. We here document the presence of long cycles (decadals, including circaundecennians) in the time structure of systolic (S) and diastolic (D) blood pressure (BP) and heart rate (HR). Because of the non-stationary nature in time and space of these and other physiologic and environmental periodic components that, like the wind, can appear and disappear in a given or other geographic location at one or another time, they have been called “Aeolian”. The nonlinear estimation of the uncertainties of the periods (τs) of two or more variables being compared has been used to determine whether these components are congruent or not, depending on whether their CIs (95% confidence intervals) overlap or not. Among others, congruence has been found for components with τs clustering around 10 years in us and around us. There is a selective assortment among individuals, variables and cycle characteristics (mean and circadian amplitude and acrophase). Apart from basic interest, like other nonphotic solar signatures such as transyears with periods slightly longer than one year or about 33-year Brückner-Egeson-Lockyer (BEL) cycles, about 10-year and longer cycles present in 7 of 7 self-monitoring individuals are of interest in the diagnosis of Vascular Variability Anomalies (VVAs), including MESOR-hypertension, and others. Some of the other VVAs, such as a circadian overswing, i.e., CHAT (Circadian Hyper-Aplitude-Tension), or an excessive pulse pressure, based on repeated 7-day around-the-clock records, can represent a risk of severe cardiovascular events, greater than that of a high BP. The differential diagnosis of physiologic cycles, infradians (components with a τ longer than 28 hours) as well as circadians awaits the collection of reference values for the infradian parameters of the cycles described herein. Just as in stroke-prone spontaneously hypertensive rats during the weeks after weaning CHAT precedes an elevation of the BP MESOR, a decadal overswing seems to precede the occurrence of high BP in two of the subjects here examined. Only around-the-clock monitoring in health for the collection of reference values will allow on their basis the differential diagnosis of the onsets of a circadian versus a circadecadal overswing in BP and the specification whether, and if so, when to initiate hypotensive non-drug or drug treatment. PMID:24860279

MCM-BP Is Required for Repression of Life-Cycle Specific Genes Transcribed by RNA Polymerase I in the Mammalian Infectious Form of Trypanosoma brucei

PubMed Central

Kim, Hee-Sook; Park, Sung Hee; Günzl, Arthur; Cross, George A. M.

2013-01-01

Trypanosoma brucei variant surface glycoprotein (VSG) expression is a classic example of allelic exclusion. While the genome of T. brucei contains >2,000 VSG genes and VSG pseudogenes, only one allele is expressed at the surface of each infectious trypanosome and the others are repressed. Along with recombinatorial VSG switching, allelic exclusion provides a major host evasion mechanism for trypanosomes, a phenomenon known as antigenic variation. To extend our understanding of how trypanosomes escape host immunity by differential expression of VSGs, we attempted to identify genes that contribute to VSG silencing, by performing a loss-of-silencing screen in T. brucei using a transposon-mediated random insertional mutagenesis. One identified gene, which we initially named LOS1, encodes a T. brucei MCM-Binding Protein (TbMCM-BP). Here we show that TbMCM-BP is essential for viability of infectious bloodstream-form (BF) trypanosome and is required for proper cell-cycle progression. Tandem affinity purification of TbMCM-BP followed by mass spectrometry identified four subunits (MCM4-MCM7) of the T. brucei MCM complex, a replicative helicase, and MCM8, a subunit that is uniquely co-purified with TbMCM-BP. TbMCM-BP is required not only for repression of subtelomeric VSGs but also for silencing of life-cycle specific, insect-stage genes, procyclin and procyclin-associated genes (PAGs), that are normally repressed in BF trypanosomes and are transcribed by RNA polymerase I. Our study uncovers a functional link between chromosome maintenance and RNA pol I-mediated gene silencing in T. brucei. PMID:23451133

Magma flow instability and cyclic activity at soufriere hills volcano, montserrat, british west indies

PubMed

Voight; Sparks; Miller; Stewart; Hoblitt; Clarke; Ewart; Aspinall; Baptie; Calder; Cole; Druitt; Hartford; Herd; Jackson; Lejeune; Lockhart; Loughlin; Luckett; Lynch; Norton; Robertson; Watson; Watts; Young

1999-02-19

Dome growth at the Soufriere Hills volcano (1996 to 1998) was frequently accompanied by repetitive cycles of earthquakes, ground deformation, degassing, and explosive eruptions. The cycles reflected unsteady conduit flow of volatile-charged magma resulting from gas exsolution, rheological stiffening, and pressurization. The cycles, over hours to days, initiated when degassed stiff magma retarded flow in the upper conduit. Conduit pressure built with gas exsolution, causing shallow seismicity and edifice inflation. Magma and gas were then expelled and the edifice deflated. The repeat time-scale is controlled by magma ascent rates, degassing, and microlite crystallization kinetics. Cyclic behavior allows short-term forecasting of timing, and of eruption style related to explosivity potential.

Interplay between Amazonia Tropical Rain Forest Fires (Mesoscale distribution) and global carbon cycle

NASA Astrophysics Data System (ADS)

Cordeiro, R. C.; Turcq, B.; Sifeddine, A.

2009-12-01

Soil samples were collected at 9 different depths, from zero to 100 cm at six points distributed along a transect of 1700 m in upland and lowland areas of the Km 41 reserve near Manaus in Central Brazilian Amazonia, in order to compare the frequency, dimension and extension of past fires in different topographic environmental situations. The average charcoal mass distribution is higher in uplands than in lowlands. This distribution shows a gradient with a high correlation between the two topographic levels, demonstrating a characteristic depth distribution pattern. The highest charcoal concentrations were found at a depth of 20-50 cm in all the six profiles. These fires have affected the upland areas more severely than the lowlands, probably allowing the survival of the vegetation along the small streams.. Two periods of intense fire activity were identified through the distribution of the biomass of charcoal: from around 1320 cal yr BP (ca 1400 14C yr BP) to 1050 cal yr BP (ca 1100 14C yr BP), and between 610 cal yr BP (ca 600 14C yr BP) to 330 cal yr BP (ca 300 yr 14C yr BP). These forest fire phases were probably favored by dry climate which is recorded in other regions of Amazonia and South America by archaeological and palaeoecological data.. Observe that the data found in this article related to the disturbances of fire events in the Central Amazon region appear to be synchronous with events of disruption of populations and vegetation changes and background to the development of indigenous people. Thus it seems plausible that these disturbance phenomena may have an origin presumably climatic than anthropogenic. This possible relationship between climate and forest, ecosystems of high productivity and biomass, and humans should be look carefully in relation to the carbon cycle dynamics demonstrated by the air bubbles extracted of the ice core records.. Increase is observed in the CO2 concentration of the Taylor Dome record just after the increase in frequency and biomass burning at 1350 cal yr BP. The maximum increase of CO2, during the Holocene, is higher at 1220 cal yr BP almost simultaneously with the highest frequency of occurrence of charcoal/biomass of charcoal between 1350 and 1100 cal yr BP. Based on the present-day and future trend of drier climate and more irregular precipitation in this region, the frequency of Amazonian rainforest fires tend to increase and to may have an impact on the CO2 future global cycle.

The Plio-Pleistocene climatic evolution as a consequence of orbital forcing on the carbon cycle

NASA Astrophysics Data System (ADS)

Paillard, Didier

2017-09-01

Since the discovery of ice ages in the 19th century, a central question of climate science has been to understand the respective role of the astronomical forcing and of greenhouse gases, in particular changes in the atmospheric concentration of carbon dioxide. Glacial-interglacial cycles have been shown to be paced by the astronomy with a dominant periodicity of 100 ka over the last million years, and a periodicity of 41 ka between roughly 1 and 3 million years before present (Myr BP). But the role and dynamics of the carbon cycle over the last 4 million years remain poorly understood. In particular, the transition into the Pleistocene about 2.8 Myr BP or the transition towards larger glaciations about 0.8 Myr BP (sometimes referred to as the mid-Pleistocene transition, or MPT) are not easily explained as direct consequences of the astronomical forcing. Some recent atmospheric CO2 reconstructions suggest slightly higher pCO2 levels before 1 Myr BP and a slow decrease over the last few million years (Bartoli et al., 2011; Seki et al., 2010). But the dynamics and the climatic role of the carbon cycle during the Plio-Pleistocene period remain unclear. Interestingly, the δ13C marine records provide some critical information on the evolution of sources and sinks of carbon. In particular, a clear 400 kyr oscillation has been found at many different time periods and appears to be a robust feature of the carbon cycle throughout at least the last 100 Myr (e.g. Paillard and Donnadieu, 2014). This oscillation is also visible over the last 4 Myr but its relationship with the eccentricity appears less obvious, with the occurrence of longer cycles at the end of the record, and a periodicity which therefore appears shifted towards 500 kyr (see Wang et al., 2004). In the following we present a simple dynamical model that provides an explanation for these carbon cycle variations, and how they relate to the climatic evolution over the last 4 Myr. It also gives an explanation for the lowest pCO2 values observed in the Antarctic ice core around 600-700 kyr BP. More generally, the model predicts a two-step decrease in pCO2 levels associated with the 2.4 Myr modulation of the eccentricity forcing. These two steps occur respectively at the Plio-Pleistocene transition and at the MPT, which strongly suggests that these transitions are astronomically forced through the dynamics of the carbon cycle.

Circadian mechanisms of 24-hour blood pressure regulation and patterning.

PubMed

Smolensky, Michael H; Hermida, Ramón C; Portaluppi, Francesco

2017-06-01

In most persons, blood pressure (BP) rises slowly during late sleep, increases rapidly upon morning awakening and commencement of diurnal activity, exhibits two - morning and afternoon/early evening - daytime peaks, shows a minor midday nadir, and undergoes a decline during nighttime sleep by 10-20% in systolic BP and somewhat lesser amount in diastolic BP relative to wake-time means. Nyctohemeral cycles of ambient temperature, light, noise and behaviorally driven temporal patterns in food, liquid, salt, and stimulant consumption, mental/emotional stress, posture, and physical activity intensity plus circadian rhythms of wake/sleep, pineal gland melatonin synthesis, autonomic and central nervous, hypothalamic-pituitary-adrenal, hypothalamic-pituitary-thyroid, renin-angiotensin-aldosterone, renal hemodynamic, endothelial, vasoactive peptide, and opioid systems constitute the key regulators and determinants of the BP 24 h profile. Environmental and behavioral cycles are believed to be far more influential than circadian ones. However, the facts that the: i) BP 24 h pattern of secondary hypertension, e.g., diabetes and renal disease, is characterized by absence of BP fall during sleep, and ii) scheduling of conventional long-acting medications at bedtime, rather than morning, results in much better hypertension control and vascular risk reduction, presumably because highest drug concentration coincides closely with the peak of most key circadian determinants of the BP 24 h profile, indicate endogenous rhythmic influences are of greater importance than previously appreciated. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effects of two combined oral contraceptives containing ethinyl estradiol 30 microg combined with either gestodene or drospirenone on hemostatic parameters, lipid profiles and blood pressure.

PubMed

Yildizhan, Recep; Yildizhan, Begum; Adali, Ertan; Yoruk, Pinar; Birol, Fatih; Suer, Necdet

2009-08-01

The aim of this study is to compare the effect of ethinyl estradiol 0.03 mg/gestodene 0.075 mg (EE/GSD) with ethinylestradiol 0.03 mg/drospirenone 3 mg (EE/DRSP) administered according to conventional 21/7 regimen on body mass index (BMI), blood pressure (BP), lipid metabolism and hemostatic parameters. In this study, 160 healthy women were randomized to EE/GSD mg or EE/DRSP for 12 months. Mean differences in BMI, high density lipoprotein-cholesterol (HDL-C) and low density lipoprotein-cholesterol (LDL-C), total cholesterol (TC) levels and BP compared to baseline were assessed. One hundred and forty-five (89%) of the women completed all 12 treatment cycles. The subjects randomly assigned into two treatment groups. Group EE/GSD (n = 71) and group EE/DRSP (n = 72). In group B, BMI values were significantly lower than baseline at the sixth cycle. DRSP/EE had more favorable effects on BP than GSD/EE with the mean systolic and diastolic BPs remaining lower in the DRSP/EE group. The difference between the two preparations was not statistically significant at the end of the study. TC levels remained similar in both groups throughout the study period. In both groups LDL-C levels decreased, triglyceride and HDL-C levels significantly increased from baseline levels. These changes result in increasing HDL-C/LDL-C ratio, demonstrating anti-atherogenic effect. Menstrual cycle patterns and the incidence of adverse events were similar between groups. The duration of withdrawal bleeding decreased during the study for both groups and was similar. The EE/DRSP regimen provides good cycle control with reliable contraceptive efficacy and low incidence of adverse events. Compared with the EE/GSD preparation, the EE/DRSP preparation demonstrated a more favorable effect on BMI and BP with the mean BMI and mean BP remaining lower than baseline mean. The new formulation may be especially beneficial for women susceptible to body weight gain and rise in BP.

Tephrochronology of the southernmost Andean Southern Volcanic Zone, Chile

NASA Astrophysics Data System (ADS)

Weller, D. J.; Miranda, C. G.; Moreno, P. I.; Villa-Martínez, R.; Stern, C. R.

2015-12-01

Correlations among and identification of the source volcanoes for over 60 Late Glacial and Holocene tephras preserved in eight lacustrine sediment cores taken from small lakes near Coyhaique, Chile (46° S), were made based on the stratigraphic position of the tephra in the cores, lithostratigraphic data (tephra layer thickness and grain size), and tephra petrochemistry (glass color and morphology, phenocryst phases, and bulk-tephra trace element contents determined by ICP-MS). The cores preserve a record of explosive eruptions, since ˜17,800 calibrated years before present (cal years BP), of the volcanoes of the southernmost Andean Southern Volcanic Zone (SSVZ). The suggested source volcanoes for 55 of these tephras include Hudson (32 events), Mentolat (10 events), and either Macá or Cay or some of the many minor monogenetic eruptive centers (MECs; 13 events) in the area. Only four of these eruptions had been previously identified in tephra outcrops in the region, indicating the value of lake cores for identifying smaller eruptions in tephrochronologic studies. The tephra records preserved in these lake cores, combined with those in marine cores, which extend these records back to 20,000 cal years BP, prior to the Last Glacial Maximum, suggest that no significant temporal change in the frequency of explosive eruptions was associated with deglaciation. Over this time period, Hudson volcano, one of the largest and longest lived volcanoes in the Southern Andes, has had >55 eruptions (four of them were very large) and has produced >45 km3 of pyroclastic material, making it also one of the most active volcanoes in the SVZ in terms of both frequency and volume of explosive eruptions.

Late Holocene monsoon climate as evidenced by proxy records from a lacustrine sediment sequence in western Guangdong, South China

NASA Astrophysics Data System (ADS)

Zhong, Wei; Cao, jiayuan; Xue, Jibin; Ouyang, Jun; Tang, Xiaohong; Yin, Huanling; Liao, Congyun; Long, Kun

2014-02-01

The study of a 300-cm-thick exposed lacustrine sediment section in the Hedong village in Zhaoqing area which is located in sub-tropical west Guangdong Province in South China, demonstrates that the lacustrine sedimentary sequence possibly contains evidence for exploring variation of Asian monsoon climate. Multi-proxy records, including the humification intensity, total organic carbon, and grain size fractions, reveal a general trend towards dry and cold conditions in the late Holocene that this is because of a decrease in solar insolation on an orbital scale. Three intensified Asian summer monsoon (ASM) intervals (˜3300-3000 cal yr BP, ˜2600-1600 cal yr BP, and ˜900-600 cal yr BP), and three weakened ASM intervals (˜4000-3300 cal yr BP, ˜3000-2600 cal yr BP, and ˜1600-900 cal yr BP) are identified. Our humification record (HDcal) shows a good correlation on multi-centennial scale with the tree ring Δ14C record, a proxy of solar activity. A spectral analysis of HDcal reveals four significant cycles, i.e., ˜1250 yr, 300 yr, 110 yr, and 70 yr, and most of these cycles are related to the solar activity. Our findings indicate that solar output and oceanic-atmospheric circulation probably have influenced the late Holocene climate variability in the study region.

TopBP1 is required at mitosis to reduce transmission of DNA damage to G1 daughter cells

PubMed Central

Pedersen, Rune Troelsgaard; Kruse, Thomas; Nilsson, Jakob

2015-01-01

Genome integrity is critically dependent on timely DNA replication and accurate chromosome segregation. Replication stress delays replication into G2/M, which in turn impairs proper chromosome segregation and inflicts DNA damage on the daughter cells. Here we show that TopBP1 forms foci upon mitotic entry. In early mitosis, TopBP1 marks sites of and promotes unscheduled DNA synthesis. Moreover, TopBP1 is required for focus formation of the structure-selective nuclease and scaffold protein SLX4 in mitosis. Persistent TopBP1 foci transition into 53BP1 nuclear bodies (NBs) in G1 and precise temporal depletion of TopBP1 just before mitotic entry induced formation of 53BP1 NBs in the next cell cycle, showing that TopBP1 acts to reduce transmission of DNA damage to G1 daughter cells. Based on these results, we propose that TopBP1 maintains genome integrity in mitosis by controlling chromatin recruitment of SLX4 and by facilitating unscheduled DNA synthesis. PMID:26283799

Effects of lunar phases on short-term, explosive physical performance among young trained athletes.

PubMed

Yousfi, Narimen; Mejri, Mohamed Arbi; Rouissi, Mehdi; Hammami, Amri; Tabben, Montassar; Chaouachi, Anis; Haddad, Monoem; Chamari, Karim

2018-04-01

Beliefs that lunar phases affect human physiology started in ancient times. Research has recently revealed that a physical fitness index increased in sedentary students at the new moon (NM) and full moon (FM) compared to other moon phases. However, the effect of lunar cycle (moon illumination and gravitational pull) on physical performance in athletes was not examined. Therefore, this study aimed to evaluate whether short-term explosive performance can be influenced by the different phases of the lunar cycle. Fourteen young male Taekwondo athletes (age: 16.9 ± 0.7 years, height: 159.7 ± 50.6 cm, body mass: 62.85 ± 7.84 kg) performed the following tests to assess the explosive physical performance during the different phases of the lunar cycle (NM, FQ (first quarter), FM, and LQ (last quarter)): maximal isometric manual contraction (dominant hand (MIMCD) and non-dominant hand (MIMCND)), maximal back isometric contraction (MBIC), squat jump (SJ), countermovement jump (CMJ), and 10-m sprint (10 m). The testing sessions during the different moon phases were performed in a counterbalanced order. The order of tests remained the same (MIMCD, MIMCND, MBIC, SJ, CMJ, and 10 m), and all sessions were performed in the evening (6:00 to 8:00 p.m.) on the first day of each evaluated lunar phase. Each parameter was measured over two consecutive lunar months in the calendar. Analysis of variance tests showed that there was no significant effect of lunar cycle on all explosive test measures, p > 0.05. Our results failed to identify any effect of lunar phase on evening explosive performance (mainly involving phosphagen pathway-based efforts) among young trained athletes. Therefore, it appears that moon phase/illumination does not affect short-term physical performance in young trained adolescents.

Paleoeskimo Demographic History in the Canadian Arctic (ca. 4800-800 B.P.) and its Relationship to Mid-Late Holocene Climate Variability.

NASA Astrophysics Data System (ADS)

Savelle, J. M.

2014-12-01

Paleoeskimos were the first occupants of the central and eastern Canadian Arctic, spreading east from the Bering Strait region beginning approximately 4800 B.P., and occupied much of the Canadian Arctic through to their eventual disappearance ca. 800 B.P. Extensive regional archaeological site surveys throughout this area by the author and Arthur S. Dyke indicate that Paleoskimo populations underwent a series of population 'boom' (rapid expansion) and 'bust' (population declines and local extinctions) over the 4,000 year occupation history, including in the purported stable 'core area' of Foxe Basin. In this paper, we examine the contemporaneity of the local boom and bust cycles in a pan-Canadian Arctic context, and in turn examine the relationship of these cycles to mid-late Holocene climate variability.

BP Spill Sampling and Monitoring Data

EPA Pesticide Factsheets

This dataset analyzes waste from the the British Petroleum Deepwater Horizon Rig Explosion Emergency Response, providing opportunity to query data sets by metadata criteria and find resulting raw datasets in CSV format.The data query tool allows users to download EPA's air, water and sediment sampling and monitoring data that has been collected in response to the BP oil spill. All sampling and monitoring data that has been collected to date is available for download as raw structured data.The query tools enables CSV file creation to be refined based on the following search criteria: date range (between April 28, 2010 and 9/29/2010); location by zip, city, or county; media (solid waste, weathered oil, air, surface water, liquid waste, tar, sediment, water); substance categories (based on media selection) and substances (based on substance category selection).

Explosive desorption of icy grain mantles in dense clouds

NASA Technical Reports Server (NTRS)

Schutte, W. A.; Greenberg, J. M.

1991-01-01

The cycling of the condensible material in dense clouds between the gas phase and the icy grain mantles is investigated. In the model studied, desorption of the ice occurs due to grain mantle explosions when photochemically stored energy is released after transient heating by a cosmic ray particle. It is shown that, depending on the grain size distribution in dense clouds, explosive desorption can maintain up to about eight percent of the carbon in the form of CO in the gas phase at typical cloud densities.

Contributing factors to performance of a medicine ball explosive power test: a comparison between jump and nonjump athletes.

PubMed

Stockbrugger, Barry A; Haennel, Robert G

2003-11-01

The present study examined the factors contributing to performance of a backward overhead medicine ball throw (B-MBT) across 2 types of athletes. Twenty male volleyball players (jump athletes) and 20 wrestlers (nonjump athletes) were evaluated on 4 measures of power, including B-MBT, chest medicine ball throw (C-MBT), countermovement vertical jump (CMJ), and power index (PI). The athletes also completed 3 measures of strength: a 1-repetition-maximum (1RM) bench press (BP), a 1RM leg press (LP), and combined BP + LP strength. Jump athletes demonstrated greater absolute scores for CMJ, C-MBT, and B-MBT (p < 0.05), whereas nonjump athletes demonstrated greater strength scores for BP and for BP + LP (p < 0.05). When performances were examined on a relative basis, jump athletes achieved superior scores for C-MBT (p < 0.05), whereas nonjump athletes had greater scores for BP, LP, and BP + LP (p < 0.05). For both groups, B-MBT had strong correlations with PI (r = 0.817 [jump] and 0.917 [nonjump]), whereas for C-MBT, only nonjump athletes demonstrated a strong correlation (r = 0.842). When expressed in relative terms, B-MBT was strongly correlated with C-MBT (r = 0.762 [jump] and 0.835 [nonjump]) and CMJ (r = 0.899 [jump] and 0.945 [nonjump]). Only nonjump athletes demonstrated strong correlations with strength for absolute LP (r = 0.801) and BP + LP (r = 0.810) strength. The interaction of upper- and lower-body strength and power in the performance of a B-MBT appears complex, with the contributing factors differing for athletes with divergent skill sets and performance demands.

Blinatumomab activity in a patient with Down syndrome B-precursor acute lymphoblastic leukemia.

PubMed

Wadhwa, Aman; Kutny, Matthew A; Xavier, Ana C

2018-02-01

Persistent minimal residual disease (MRD) after consolidation may indicate chemotherapy insensitivity in B-precursor acute lymphoblastic leukemia (BP-ALL). Given the strong association of MRD and outcome in non-Down syndrome (non-DS) BP-ALL, it is likely that MRD levels are also of prognostic significance in DS BP-ALL. We report here the successful use of blinatumomab, a bispecific T-cell engager antibody construct, in a patient with DS BP-ALL and persistent MRD at the end of consolidation. Blinatumomab has been shown to have excellent results in patients with relapsed/refractory BP-ALL. This patient had no significant toxicity and achieved MRD negativity after only one cycle of blinatumomab. © 2017 Wiley Periodicals, Inc.

Holocene South Asian Monsoon Climate Change - Potential Mechanisms and Effects on Past Civilizations

NASA Astrophysics Data System (ADS)

Staubwasser, M.; Sirocko, F.; Grootes, P. M.; Erlenkeuser, H.; Segl, M.

2002-12-01

Planktonic oxygen isotope ratios from the laminated sediment core 63KA off the river Indus delta dated with 80 AMS radiocarbon ages reveal significant climate changes in the south Asian monsoon system throughout the Holocene. The most prominent event of the early-mid Holocene occurred after 8.4 ka BP and is within dating error of the GISP/GRIP event centered at 8.2 ka BP. The late Holocene is generally more variable, and shows non-periodic cycles in the multi-centennial frequency band. The largest change of the entire Holocene occurred at 4.2 ka BP and is concordant with the end of urban Harappan civilization in the Indus valley. Opposing isotopic trends across the northern Arabian Sea surface indicate a reduction in Indus river discharge at that time. Consequently, sustained drought may have initiated the archaeologically recorded interval of southeastward habitat tracking within the Harappan cultural domain. The hemispheric significance of the 4.2 ka BP event is evident from concordant climate change in the eastern Mediterranean and the Middle East. The late Holocene cycles in South Asia, which most likely represent drought cycles, vary between 250 and 800 years and are coherent with the evolution of cosmogenic radiocarbon production rates in the atmosphere. This suggests that solar variability is the fundamental cause behind late Holocene rainfall changes at least over south Asia.

Evolution of the El Nino-Southern Oscillation in the late Holocene and insolation driven change in the tropical annual SST cycle

NASA Astrophysics Data System (ADS)

Loubere, Paul; Creamer, Winifred; Haas, Jonathan

2013-01-01

South American lake sediment records indicate that El Nino events in the eastern equatorial Pacific (EEP) became more frequent after 3000 calendar years BP. The reason for this evolution of ENSO behavior remains in question. An important trigger for ocean-atmosphere state switching in the tropical ocean is the annual cycle of sea surface temperature south of the equator along the margin of South America. This annual cycle can be reconstructed from the oxygen isotope records of the surf clam Mesodesma donacium. We provide evidence that these isotope records, as preserved in archeological deposits in coastal central Peru, reflect seasonal paleo-SST. We find that the annual SST cycle in the eastern equatorial Pacific became larger over the 4500-2500 calendar year BP interval. This is consistent with increased ENSO variability. The magnification of the annual SST cycle can be attributed to changing insolation, indicating that ENSO is sensitive to the intensity and seasonal timing of solar heating of the southern EEP.

Optimization of burnable poison design for Pu incineration in fully fertile free PWR core

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fridman, E.; Shwageraus, E.; Galperin, A.

2006-07-01

The design challenges of the fertile-free based fuel (FFF) can be addressed by careful and elaborate use of burnable poisons (BP). Practical fully FFF core design for PWR reactor has been reported in the past [1]. However, the burnable poison option used in the design resulted in significant end of cycle reactivity penalty due to incomplete BP depletion. Consequently, excessive Pu loading were required to maintain the target fuel cycle length, which in turn decreased the Pu burning efficiency. A systematic evaluation of commercially available BP materials in all configurations currently used in PWRs is the main objective of thismore » work. The BP materials considered are Boron, Gd, Er, and Hf. The BP geometries were based on Wet Annular Burnable Absorber (WABA), Integral Fuel Burnable Absorber (IFBA), and Homogeneous poison/fuel mixtures. Several most promising combinations of BP designs were selected for the full core 3D simulation. All major core performance parameters for the analyzed cases are very close to those of a standard PWR with conventional UO{sub 2} fuel including possibility of reactivity control, power peaking factors, and cycle length. The MTC of all FFF cores was found at the full power conditions at all times and very close to that of the UO{sub 2} core. The Doppler coefficient of the FFF cores is also negative but somewhat lower in magnitude compared to UO{sub 2} core. The soluble boron worth of the FFF cores was calculated to be lower than that of the UO{sub 2} core by about a factor of two, which still allows the core reactivity control with acceptable soluble boron concentrations. The main conclusion of this work is that judicial application of burnable poisons for fertile free fuel has a potential to produce a core design with performance characteristics close to those of the reference PWR core with conventional UO{sub 2} fuel. (authors)« less

The carbon cycle since the LGM in the University of Victoria Earth System Climate Model: Implications of marine ice shelves and late-Holocene deforestation

NASA Astrophysics Data System (ADS)

Simmons, C. T.; Mysak, L. A.; Matthews, D.

2012-12-01

The University of Victoria Earth System Climate Model (version v.9) is used to investigate carbon cycle dynamics from the Last Glacial Maximum (21000 years Before Present (BP)) to the beginning of the Industrial Revolution (150 BP). A series of simulations with prescribed and freely-evolving CO2 infer that a combination of two factors, a faster overturning of the oceans during the interglacial and a release of carbon from deep-sea sediments, are likely responsible for a substantial proportion of the glacial-interglacial CO2 increase from 190 (23000 BP) to 280 ppm (150 BP). The simulations also indicate that a realistic glacial-interglacial change in the meridional overturning circulation can be generated without accounting for runoff from melting ice sheets. A series of model experiments also investigated the mechanisms behind the Holocene increase in CO2 after 8000 BP. Without the explicit representation of peatlands, permafrost, coral reefs, or human land use, the UVic model simulation of the natural carbon cycle over the period produced a decline in the atmospheric CO2 from 260 to around 250 ppm, in contrast to the increase from 260 to 280 ppm actually observed. Surprisingly, sensitivity simulations with global deforestation actually yielded lower CO2 concentrations (249-254 ppm) at 150 BP than the same simulations with no deforestation; however, deforestation of certain vegetation types lead to higher concentrations (~270 ppm). Even without deforestation, the decrease in CO2 is highly sensitive to the configuration of land ice shelves near Antarctica, with more extensive land ice leading to deeper local circulation in the Southern Ocean, less Antarctic-generated bottom waters globally, and a higher atmospheric CO2 concentrations (260 ppm) at 150 BP. The 5-8 ppm contribution of ice shelf extent may well be an important contributor to the higher analogue CO2 levels during the Holocene interglacial, as current data and reconstructions suggests that these ice shelves are indeed more extensive today than during many previous interglacial periods.

Volcanic history of El Chichon Volcano (Chiapas, Mexico) during the Holocene, and its impact on human activity

USGS Publications Warehouse

Espindola, J.M.; Macias, J.L.; Tilling, R.I.; Sheridan, M.F.

2000-01-01

Before its devastating eruption in 1982, El Chichon Volcano was little known and did not appear on any listings of hazardous volcanoes. Subsequent geologic studies, based on stratigraphic and radiocarbon investigations, showed that at least three explosive eruptions had occurred previously at this volcano. In this paper, we present the result of recent studies on the stratigraphy of the volcano and new radiocarbon ages which show that at least 11 eruptions have taken place at El Chichon in the past 8000 years. Explosive events, most of them producing block-and-ash flow and surge deposits, occurred around 550, 900, 1250, 1500, 1600, 1900, 2000, 2500, 3100, 3700 and 7700 years BP. The juvenile products of these eruptions have a trachyandesitic composition with similar degree of evolution, as evidenced from their SiO2 abundance and depletion in MgO, CaO, TiO2, as well as trace and rare earth elements. This suggests segregation of olivine and orthopyroxene from the melt. Since human settlements in southeast Mexico and Central America can be traced as far back as approximately 2500 years BP, most of these events probably affected human activity. In fact, there are reports of pottery shards and other artifacts in deposits from the eruption of 1250 BP. Pottery fragments in deposits of an eruption that took place 2500 BP are also reported in this paper. Thus, the impact of the volcano on human activities has been frequent, with most of the repose intervals lasting between 100 to 600 years. The impact of the eruptions was probably of greater than local extent, because airfall tephra could reach distant sites and possibly even affect weather. The eruptive history of El Chichon also offers clues in the investigation of the Maya civilization. Several researchers have considered the volcano as an important factor in the answer to some intriguing questions such as the extensive use of volcanic ash in Late Classic Maya ceramics or, of greater importance, the causes of the collapse of the Classic Maya civilization.

Cyclic Explosivity in High Elevation Phreatomagmatic Eruptions at Ocean Island Volcanoes: Implications for Aquifer Pressurization and Volcano Flank Destabilization.

NASA Astrophysics Data System (ADS)

Tarff, R.; Day, S. J.; Downes, H.; Seghedi, I.

2015-12-01

Groundwater heating and pressurization of aquifers trapped between dikes in ocean island volcanoes has been proposed as a mechanism for destabilizing and triggering large-volume flank collapses. Previous modelling has indicated that heat transfer from sustained magma flow through dikes during eruption has the potential to produce destabilizing levels of pressure on time scales of 4 to 400 days, if the aquifers remain confined. Here we revisit this proposal from a different perspective. We examine evidence for pressure variations in dike-confined aquifers during eruptions at high elevation vents on ocean island volcanoes. Initially magmatic, these eruptions change to mostly small-volume explosive phreatomagmatic activity. A recent example is the 1949 eruption on La Palma, Canary Islands. Some such eruptions involve sequences of larger-volume explosive phases or cycles, including production of voluminous low-temperature, pyroclastic density currents (PDC). Here we present and interpret data from the Cova de Paul crater eruption (Santo Antao, Cape Verde Islands). The phreatomagmatic part of this eruption formed two cycles, each culminating with eruption of PDCs. Compositional and textural variations in the products of both cycles indicate that the diatreme fill began as coarse-grained and permeable which allowed gas to escape. During the eruption, the fill evolved to a finer grained, poorly sorted, less permeable material, in which pore fluid pressures built up to produce violent explosive phases. This implies that aquifers adjacent to the feeder intrusion were not simply depressurized at the onset of phreatomagmatic explosivity but experienced fluctuations in pressure throughout the eruption as the vent repeatedly choked and emptied. In combination with fluctuations in magma supply rate, driving of aquifer pressurization by cyclical vent choking will further complicate the prediction of flank destabilization during comparable eruptions on ocean island volcanoes.

GSK3β phosphorylates newly identified site in the proline-alanine-rich region of cardiac myosin-binding protein C and alters cross-bridge cycling kinetics in human: short communication.

PubMed

Kuster, Diederik W D; Sequeira, Vasco; Najafi, Aref; Boontje, Nicky M; Wijnker, Paul J M; Witjas-Paalberends, E Rosalie; Marston, Steven B; Dos Remedios, Cristobal G; Carrier, Lucie; Demmers, Jeroen A A; Redwood, Charles; Sadayappan, Sakthivel; van der Velden, Jolanda

2013-02-15

Cardiac myosin-binding protein C (cMyBP-C) regulates cross-bridge cycling kinetics and, thereby, fine-tunes the rate of cardiac muscle contraction and relaxation. Its effects on cardiac kinetics are modified by phosphorylation. Three phosphorylation sites (Ser275, Ser284, and Ser304) have been identified in vivo, all located in the cardiac-specific M-domain of cMyBP-C. However, recent work has shown that up to 4 phosphate groups are present in human cMyBP-C. To identify and characterize additional phosphorylation sites in human cMyBP-C. Cardiac MyBP-C was semipurified from human heart tissue. Tandem mass spectrometry analysis identified a novel phosphorylation site on serine 133 in the proline-alanine-rich linker sequence between the C0 and C1 domains of cMyBP-C. Unlike the known sites, Ser133 was not a target of protein kinase A. In silico kinase prediction revealed glycogen synthase kinase 3β (GSK3β) as the most likely kinase to phosphorylate Ser133. In vitro incubation of the C0C2 fragment of cMyBP-C with GSK3β showed phosphorylation on Ser133. In addition, GSK3β phosphorylated Ser304, although the degree of phosphorylation was less compared with protein kinase A-induced phosphorylation at Ser304. GSK3β treatment of single membrane-permeabilized human cardiomyocytes significantly enhanced the maximal rate of tension redevelopment. GSK3β phosphorylates cMyBP-C on a novel site, which is positioned in the proline-alanine-rich region and increases kinetics of force development, suggesting a noncanonical role for GSK3β at the sarcomere level. Phosphorylation of Ser133 in the linker domain of cMyBP-C may be a novel mechanism to regulate sarcomere kinetics.

Molecular cloning and preliminary function study of iron responsive element binding protein 1 gene from cypermethrin-resistant Culex pipiens pallens

PubMed Central

2011-01-01

Background Insecticide resistance jeopardizes the control of mosquito populations and mosquito-borne disease control, which creates a major public health concern. Two-dimensional electrophoresis identified one protein segment with high sequence homology to part of Aedes aegypti iron-responsive element binding protein (IRE-BP). Method RT-PCR and RACE (rapid amplification of cDNA end) were used to clone a cDNA encoding full length IRE-BP 1. Real-time quantitative RT-PCR was used to evaluate the transcriptional level changes in the Cr-IRE strain Aedes aegypti compared to the susceptible strain of Cx. pipiens pallens. The expression profile of the gene was established in the mosquito life cycle. Methyl tritiated thymidine (3H-TdR) was used to observe the cypermethrin resistance changes in C6/36 cells containing the stably transfected IRE-BP 1 gene of Cx. pipiens pallens. Results The complete sequence of iron responsive element binding protein 1 (IRE-BP 1) has been cloned from the cypermethrin-resistant strain of Culex pipiens pallens (Cr-IRE strain). Quantitative RT-PCR analysis indicated that the IRE-BP 1 transcription level was 6.7 times higher in the Cr-IRE strain than in the susceptible strain of 4th instar larvae. The IRE-BP 1 expression was also found to be consistently higher throughout the life cycle of the Cr-IRE strain. A protein of predicted size 109.4 kDa has been detected by Western blotting in IRE-BP 1-transfected mosquito C6/36 cells. These IRE-BP 1-transfected cells also showed enhanced cypermethrin resistance compared to null-transfected or plasmid vector-transfected cells as determined by 3H-TdR incorporation. Conclusion IRE-BP 1 is expressed at higher levels in the Cr-IRE strain, and may confer some insecticide resistance in Cx. pipiens pallens. PMID:22075242

CacyBP/SIP nuclear translocation induced by gastrin promotes gastric cancer cell proliferation

PubMed Central

Zhai, Hui-Hong; Meng, Juan; Wang, Jing-Bo; Liu, Zhen-Xiong; Li, Yuan-Fei; Feng, Shan-Shan

2014-01-01

AIM: To investigate the role of nuclear translocation of calcyclin binding protein, also called Siah-1 interacting protein (CacyBP/SIP), in gastric carcinogenesis. METHODS: The expression of CacyBP/SIP protein in gastric cancer cell lines was detected by Western blot. Immunofluorescence experiments were performed on gastric cancer cell lines that had been either unstimulated or stimulated with gastrin. To confirm the immunofluorescence findings, the relative abundance of CacyBP/SIP in nuclear and cytoplasmic compartments was assessed by Western blot. The effect of nuclear translocation of CacyBP/SIP on cell proliferation was examined using MTT assay. The colony formation assay was used to measure clonogenic cell survival. The effect of CacyBP/SIP nuclear translocation on cell cycle progression was investigated. Two CacyBP/SIP-specific siRNA vectors were designed and constructed to inhibit CacyBP/SIP expression in order to reduce the nuclear translocation of CacyBP/SIP, and the expression of CacyBP/SIP in stably transfected cells was determined by Western blot. The effect of inhibiting CacyBP/SIP nuclear translocation on cell proliferation was then assessed. RESULTS: CacyBP/SIP protein was present in most of gastric cancer cell lines. In unstimulated cells, CacyBP/SIP was distributed throughout the cytoplasm; while in stimulated cells, CacyBP/SIP was found mainly in the perinuclear region. CacyBP/SIP nuclear translocation generated a growth-stimulatory effect on cells. The number of colonies in the CacyBP/SIP nuclear translocation group was significantly higher than that in the control group. The percentage of stimulated cells in G1 phase was significantly lower than that of control cells (69.70% ± 0.46% and 65.80% ± 0.60%, control cells and gastrin-treated SGC7901 cells, P = 0.008; 72.99% ± 0.46% and 69.36% ± 0.51%, control cells and gastrin-treated MKN45 cells, P = 0.022). CacyBP/SIPsi1 effectively down-regulated the expression of CacyBP/SIP, and cells stably transfected by CacyBP/SIPsi1 were then chosen for further cellular assays. In CacyBP/SIPsi1 stably transfected cells, CacyBP/SIP was shown to be distributed throughout the cytoplasm, irregardless of whether they were stimulated or not. After CacyBP/SIP nuclear translocation was reduced, there had no major effect on cell proliferation, as shown by MTT assay. There had no enhanced anchorage-dependent growth upon stimulation, as indicated by colony formation in flat plates. No changes appeared in the percentage of cells in G0-G1 phase in either cell line (71.09% ± 0.16% and 70.86% ± 0.25%, control cells and gastrin-treated SGC7901-CacyBP/SIPsi1 cells, P = 0.101; 74.17% ± 1.04% and 73.07% ± 1.00%, control cells and gastrin-treated MKN45-CacyBP/SIPsi1 cells, P = 0.225). CONCLUSION: CacyBP/SIP nuclear translocation promotes the proliferation and cell cycle progression of gastric cancer cells. PMID:25110433

CacyBP/SIP nuclear translocation induced by gastrin promotes gastric cancer cell proliferation.

PubMed

Zhai, Hui-Hong; Meng, Juan; Wang, Jing-Bo; Liu, Zhen-Xiong; Li, Yuan-Fei; Feng, Shan-Shan

2014-08-07

To investigate the role of nuclear translocation of calcyclin binding protein, also called Siah-1 interacting protein (CacyBP/SIP), in gastric carcinogenesis. The expression of CacyBP/SIP protein in gastric cancer cell lines was detected by Western blot. Immunofluorescence experiments were performed on gastric cancer cell lines that had been either unstimulated or stimulated with gastrin. To confirm the immunofluorescence findings, the relative abundance of CacyBP/SIP in nuclear and cytoplasmic compartments was assessed by Western blot. The effect of nuclear translocation of CacyBP/SIP on cell proliferation was examined using MTT assay. The colony formation assay was used to measure clonogenic cell survival. The effect of CacyBP/SIP nuclear translocation on cell cycle progression was investigated. Two CacyBP/SIP-specific siRNA vectors were designed and constructed to inhibit CacyBP/SIP expression in order to reduce the nuclear translocation of CacyBP/SIP, and the expression of CacyBP/SIP in stably transfected cells was determined by Western blot. The effect of inhibiting CacyBP/SIP nuclear translocation on cell proliferation was then assessed. CacyBP/SIP protein was present in most of gastric cancer cell lines. In unstimulated cells, CacyBP/SIP was distributed throughout the cytoplasm; while in stimulated cells, CacyBP/SIP was found mainly in the perinuclear region. CacyBP/SIP nuclear translocation generated a growth-stimulatory effect on cells. The number of colonies in the CacyBP/SIP nuclear translocation group was significantly higher than that in the control group. The percentage of stimulated cells in G1 phase was significantly lower than that of control cells (69.70% ± 0.46% and 65.80% ± 0.60%, control cells and gastrin-treated SGC7901 cells, P = 0.008; 72.99% ± 0.46% and 69.36% ± 0.51%, control cells and gastrin-treated MKN45 cells, P = 0.022). CacyBP/SIPsi1 effectively down-regulated the expression of CacyBP/SIP, and cells stably transfected by CacyBP/SIPsi1 were then chosen for further cellular assays. In CacyBP/SIPsi1 stably transfected cells, CacyBP/SIP was shown to be distributed throughout the cytoplasm, irregardless of whether they were stimulated or not. After CacyBP/SIP nuclear translocation was reduced, there had no major effect on cell proliferation, as shown by MTT assay. There had no enhanced anchorage-dependent growth upon stimulation, as indicated by colony formation in flat plates. No changes appeared in the percentage of cells in G0-G1 phase in either cell line (71.09% ± 0.16% and 70.86% ± 0.25%, control cells and gastrin-treated SGC7901-CacyBP/SIPsi1 cells, P = 0.101; 74.17% ± 1.04% and 73.07% ± 1.00%, control cells and gastrin-treated MKN45-CacyBP/SIPsi1 cells, P = 0.225). CacyBP/SIP nuclear translocation promotes the proliferation and cell cycle progression of gastric cancer cells.

Impact of the 1815 Tambora Eruption to global climate change

NASA Astrophysics Data System (ADS)

Djumarma Wirakusumah, Achmad; Rachmat, Heryadi

2017-06-01

Tambora volcano is located at Sumbawa island, Indonesia. Geological study shows a successive of geomorphological development of Tambora Volcano. During 190 to 86 K-Years BP, shield-like or effusive volcano were formed; During 86 to 4 K-Years BP, a strato or explosive-volcano was formed; However, during 80 to 4 K-Years BP flank eruptions occurred intermittently and cinders were formed; In April 1815, a paroxysmal destructive eruption occurred which were followed by caldera forming; Since 1815, lava domes and solphataric fields were formed. The 1815 Tambora eruption emitted 60 to 80 megatons of SO2 to the stratosphere (44 km high). The SO2 spread the tropics, circled the world and it was oxidized to form H2SO4 so called sulphate aerosols protecting the sunlight to reach the earth surface causing global change effects. The Year of 1816 as the year without summer in Europe, the depressed situation in Europe, the epidemic disease of Benggal were three of examples of the impacts of the 1815 Tambora paroxysmal eruption. Therefore, characteristics of Tambora activity before paroxysmal should be learned for mitigation purposes.

Wide Area Recovery and Resiliency Program (WARRP) Knowledge Enhancement Events: Waste Management Workshop After Action Report

DTIC Science & Technology

2012-03-01

approximately 2,300 curies of 137Cs (CsCl), and 1.5 tons of Ammonium nitrate / Fuel oil (ANFO). The explosive and the shielded CsCl sources are packaged into...previous findings. Experts also presented case studies on Hurricane Katrina, The British Petroleum (BP) Oil Spill, Fukushima Japan, Foot and Mouth...containers, conduct environmental monitoring. The waste streams were very organized into distinct categories. 1) oil , gasoline, pesticides, 2) batteries

The Ottaviano eruption of Somma-Vesuvio (8000 y B.P.): a magmatic alternating fall and flow-forming eruption

NASA Astrophysics Data System (ADS)

Rolandi, G.; Maraffi, S.; Petrosino, P.; Lirer, L.

1993-11-01

The Ottaviano eruption occurred in the late neolithic (8000 y B.P.). 2.40 km 3 of phonolitic pyroclastic material (0.61 km 3 DRE) were emplaced as pyroclastic flow, surge and fall deposits. The eruption began with a fall phase, with a model column height of 14 km, producing a pumice fall deposit (LA). This phase ended with short-lived weak explosive activity, giving rise to a fine-grained deposit (L1), passing to pumice fall deposits as the result of an increasing column height and mass discharge rate. The subsequent two fall phases (producing LB and LC deposits), had model column heights of 20 and 22 km with eruption rates of 2.5 × 10 7 and 2.81 × 10 7 kg/s, respectively. These phases ended with the deposition of ash layers (L2 and L3), related to a decreasing, pulsing explosive activity. The values of dynamic parameters calculated for the eruption classify it as a sub-plinian event. Each fall phase was characterized by variations in the eruptive intensity, and several pyroclastic flows were emplaced (F1 to F3). Alternating pumice and ash fall beds record the waning of the eruption. Finally, owing to the collapse of a eruptive column of low gas content, the last pyroclastic flow (F4) was emplaced.

Tephrostratigraphy of the late Quaternary record from Lake Chalco, central México

NASA Astrophysics Data System (ADS)

Ortega-Guerrero, Beatriz; Caballero García, Lizeth; Linares-López, Carlos

2018-01-01

Lacustrine sequences in active volcanic settings preserve the record of fall-out products (tephras) from explosive volcanic activity from both proximal and distal sources. Sediments of Lake Chalco, located in the western part of the Trans Mexican Volcanic Belt, offer the opportunity to develop a detailed tephrostratigraphy of proximal and distal sources, and to provide stratigraphic marker horizons for the correlation of paleoclimate records. Here, we present major oxide glass and pumice data from 18 tephra layers interbedded in the lacustrine sediments of Chalco, from 11.5 to 31.3 cal ka BP. Tephra glass compositions range from basaltic trachyandesitic to rhyolitic. Two tephras were successfully correlated with the Tutti Frutti Plinian Eruption of Popocatépetl volcano; and two tephra layers from the Nevado de Toluca Plinian activity: the Upper Toluca Pumice and the Lower Toluca Pumice. Although the source of most of the tephras analyzed is unknown, their geochemical characterization, coupled with a robust chronology, contributes to establish a detailed tephrostratigraphy for the region. This tephra record also contributes to improving the estimated frequency of explosive volcanic activity for future hazards in the Basin of México and surrounding areas, where more than 29 million people live. Our findings estimate a recurrence interval of volcanic activity of ca. 1100 years in the interval between ca. 32 and 11.5 cal ka BP, shorter than previously estimated.

Statistical Hotspot Model for Explosive Detonation

NASA Astrophysics Data System (ADS)

Nichols, Albert

2005-07-01

The presence and need for energy localization in the ignition and detonation of high explosives is a corner stone in our understanding of explosive behavior. This energy localization, known as hot spots, provides the match that starts the energetic response that is integral to the detonation. In our model, we use the life cycle of a hot spot to predict explosive response. This life cycle begins with a random distribution of inhomogeneities in the explosive that we describe as a potential hot spot. A shock wave can transform these into hot spots that can then grow by consuming the explosive around them. The fact that the shock wave can collapse a potential hot spot without causing ignition is required in order to model phenomena like dead pressing. The burn rate of the hot spot is taken directly from experimental data. In our approach we do not assume that every hot spot is burning in an identical environment, but rather we take a statistical approach to the burning process. We also do not make a uniform temperature assumption in order to close the mixture equation of state, but track the flow of energy from reactant to product. Finally, we include both the hot spot burn model and a thermal decomposition path, required to explain certain long time behaviors. Building on work performed by Reaugh et. al., we have developed a set of reaction parameters for an HMX based heterogeneous explosive. These parameters have been determined from computer models on the micron scale, and experimental data. This model will be compared to experimental rate stick data. This work was performed under the auspices of the U.S. Department of Energy by University of California, Lawrence Livermore National Laboratory under Contract W-7405-Eng-48.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ritter, Boyd

Insensitive high explosives (IHEs) based on 1,3,5-triamino 2,4,6-trinitro-benzene (TATB) are the IHEs of choice for use in nuclear warheads over conventional high explosives when safety is the only consideration, because they are very insensitive to thermal or mechanical initiation stimuli. It is this inherent insensitivity to high temperatures, shock, and impact, which provides detonation design challenges when designing TATB explosive systems while at the same time providing a significant level of protection against accidental initiation. Although classified as IHE, over the past few years the focus on explosive safety has demonstrated that the shock sensitivity of TATB is influenced withmore » respect to temperature. A number of studies have been performed on TATB and TATB formulations, plastic bonded explosives (PBX) 9502, and LX-17-01 (LX-17), which demonstrates the increase in shock sensitivity of the explosive after it has been preheated or thermally cycled over various temperature ranges. Many studies suggest the change in sensitivity is partly due to the decomposition rates of the temperature elevated TATB. Others point to the coefficient of thermal expansion, the crystalline structures of TATB and/or the combination of all factors, which create voids which can become active hot spots. During thermal cycling, TATB is known to undergo an irreversible increase in specific volume called ratchet growth. This increase in specific volume correlates to a decrease in density. This decrease in density and increase in volume, demonstrate the creations of additional void spaces which could serve as potential new initiation hot spots thus, increasing the overall sensitivity of the HE. This literature review evaluates the published works to understand why the shock sensitivity of TATB-based plastic bonded explosives (PBXs) changes with temperature.« less

BP Spill Sampling and Monitoring Data April-September 2010 - Data Download Tool

EPA Pesticide Factsheets

This dataset analyzes waste from the the British Petroleum Deepwater Horizon Rig Explosion Emergency Response, providing opportunity to query data sets by metadata criteria and find resulting raw datasets in CSV format.The data query tool allows users to download air, water and sediment sampling and monitoring data that has been collected in response to the BP oil spill. All sampling and monitoring data that has been collected to date is available for download as raw structured data.The query tools enables CSV file creation to be refined based on the following search criteria: date range (between April 28, 2010 and 9/29/2010); location by zip, city, or county; media (solid waste, weathered oil, air, surface water, liquid waste, tar, sediment, water); substance categories (based on media selection) and substances (based on substance category selection).

Tephro- and chemo-stratigraphy of the Vulcanello Peninsula (Vulcano, Aeolian Islands)

NASA Astrophysics Data System (ADS)

Rosi, M.; Fusillo, R.; di Traglia, F.; Pistolesi, M.; Todman, A.; Menzies, M. A.

2009-12-01

New stratigraphic studies of the Vulcanello Peninsula have been used to better define the small-scale evolution of this young (1000 AD and 325±100 BP) volcanic center and to re-investigate the last 1000 years of volcanic history for the Island of Vulcano (Aeolian Islands, Southern Italy). Vulcanello Peninsula is the northern-most part of the Island of Vulcano. It comprises a shoshonitic lava platform and a volcanic edifice made up of three overlying cones, which are shoshonitic to trachytic in composition. Volcanic activity in this area was coeval with the recent eruptions of the La Fossa Cone, the present-day active center of the island. Our goal is to constrain the recent volcanic development of this mafic volcano and to focus on the historic eruptive activity of the two other recent or active centres in the southern Aeolian Islands, Mt. Pilato (Island of Lipari) and La Fossa Cone. In order to do so, we reconstructed the stratigraphical setting of the proximal deposits of the three Vulcanello cones, through the investigation of 25 outcrops. We analyzed the stratigraphy of the tephra blankets deposited on the lava platform, studying 10 trenches. Our intention is to integrate morphological, textural and chemical data in order to correlate these deposits with the Vulcanello, La Fossa Cone or Mt Pilato. LA-MC-ICPMS (RHUL) analysis of juvenile clasts is underway in order to investigate the evolution of the Vulcanello juvenile clasts. In addition 14C dating is planned on selected organic matter from the volcanostratigraphic sections. Our preliminary data for the Vulcanello proximal deposits suggest that each of the three cones experienced several eruptions, with a wide spectrum of eruptive styles and a diversity of chemistry. The oldest cone (Vulcanello I) is characterised by four different eruptions separated by minor unconformities or reworking material indicative of little or not time breaks in the eruptive cycle. The eruptions shift from Violent Strombolian to Hawaiian in style, testifying to a reduction in fragmentation and dispersal. The second cone (Vulcanello II), contains volcanic deposits from Strombolian eruptions only. The third cone (Vulcanello III), displays a complex evolution with an initial effusive episode of a trachytic lava flow, followed by phreatic explosions, evident as altered fine ash layers. These deposits are interbedded with scoriaceous fall deposits, attesting the occurrence of some mild explosive activity during this eruptive phase. This detailed study of the effusive and explosive products from Vulcanello reveals rapid evolution of Vulcanello during the initial phases (1000 AD to 1200 AD) with voluminous mafic eruptions, both effusive and explosive. A progressive reduction in emitted volume is apparent. The presence of abundant explosive deposits related to phreatic explosions during the Vulcanello III phase, is related to the presence of water, a reduction in magma volume and the presence of intense hydrothermal activity in the latter stage of the evolution of Vulcanello evolution until 1878. This may indicate the presence of a stable shallow thermal anomaly.

Perfect 24-h management of hypertension: clinical relevance and perspectives.

PubMed

Kario, K

2017-04-01

Out-of-office blood pressure (BP) measured by home BP monitoring, or ambulatory BP monitoring, was demonstrated to be superior to office BP for the prediction of cardiovascular events. The J-HOP study of a nationwide Japanese cohort demonstrated that morning home BP is the best stroke predictor. In the prospective HONEST study of >21 000 hypertensives, on-treatment morning home BP was shown to be a strong predictor both of future coronary artery disease and stroke events. In subjects whose office BP was maintained at ⩾150 mm Hg, there was no increase in cardiovascular events when their morning systolic BP was well-controlled at <125 mm Hg. Since Asians show greater morning BP surges, it is particularly important for Asians to achieve 'perfect 24-hr BP control,' that is, the 24-h BP level, nocturnal BP dipping and BP variability including morning surge. The morning BP surge and the extremes of disrupted circadian rhythm (riser and extreme dipper patterns) are independent risks for stroke in hypertensives. A morning BP-guided approach is thus the first step toward perfect 24-h BP control, followed by the control of nocturnal hypertension. In the resonance hypothesis, the synergistic resonance of BP variability phenotypes would produce an extraordinary large 'dynamic BP surge' that can trigger a cardiovascular event, especially in high-risk patients with systemic hemodynamic atherothrombotic syndrome, a vicious cycle of exaggerated BP variability and vascular disease. In the future, information and communications technology and artificial intelligence technology with the innovation of wearable continuous surge BP monitoring will contribute to 'anticipation medicine' with the goal of zero cardiovascular events.

Postglacial diatom-climate responses in a small lake in the Pacific Northwest of North America

NASA Astrophysics Data System (ADS)

Egan, J.; Allott, T. E.; Fletcher, W.

2017-12-01

Understanding the variability of ocean-atmosphere interactions in the Pacific Northwest (PNW) of North America is essential for climate forecasting, particularly variations in the El Niño-Southern Oscillation (ENSO) and Pacific Decadal Oscillation (PDO). Research suggests that global warming is increasing the frequency of extreme El Niño events, which can have global climatic impacts (e.g. disrupting global weather patterns, affecting ecosystems and agriculture and extreme weather events (flood, drought, bushfires)). A diatom record spanning 14,500 Cal yr BP from Moss Lake, Washington is used to assess Holocene climate change in the PNW including evidence for periodicities related to ocean-atmosphere interactions and/or variations in solar output, and is directly compared to the Moss Lake pollen record. Three climate phases were identified: 1) the Late Pleistocene (until 11,800 Cal yr BP), with a cold climate evidenced by the low abundance of diatoms; 2) the early to mid-Holocene (11,800 - 7500 Cal yr BP), with warm climate, longer growing seasons and shorter periods of ice cover, indicated by the increase of Cyclotella pseudostelligera and decrease of Fragilaria taxa; and 3) the mid-to-late Holocene from 7500 Cal yr BP onwards, with a cooler climate reflected by a decrease in Cyclotella pseudostelligera and an increase in Fragilaria taxa. These climate shifts correlate with the regional and local pollen record. Fluctuations in Cyclotella pseudostelligera and Aulacoseira taxa suggest climatic cycles of varying amplitude throughout. RedFit and Wavelet analyses revealed periodicities of approximately 2000, 1300, and 450 yrs. The 2000 yr cycle is attributed to solar variation; the Hallstatt Oscillation. The 1300 yr and 450 yr cycles are attributed to ENSO and PDO like cycles. The 1300 periodicity is evident throughout the Late Pleistocene and Holocene and reflects shifts from El Niño/positive PDO (weak wind intensity, warm temperature) to La Niña/Negative PDO (high wind intensity, cool temperature). Between 11,800 and 7500 Cal yr BP the cycle amplitudes are reduced and frequency increased reflecting the 450 yr periodicity. Diatom data from Moss Lake provide a sensitive record of climate-related limnological responses and refine our understanding of Holocene climate change in the PNW.

Seasonal Variation in Blood Pressure in 162,135 Patients With Type 1 or Type 2 Diabetes Mellitus.

PubMed

Hermann, Julia M; Rosenbauer, Joachim; Dost, Axel; Steigleder-Schweiger, Claudia; Kiess, Wieland; Schöfl, Christof; Holl, Reinhard W

2016-04-01

Seasonal variation in blood pressure (BP) has been observed in different populations. However, only few studies have focused on BP seasonality in diabetic patients. This study examined the seasonal patterns in BP in 62,589 patients with type 1 diabetes mellitus (T1DM) and in 99,546 patients with type 2 diabetes mellitus (T2DM) from the German/Austrian Diabetes Follow-up Registry. Adjusted mean BP values revealed seasonal cycles of 12 months, with higher BP in colder months. Using harmonic regression models, the estimated systolic BP difference throughout the year was 2.28/2.48 mm Hg in T1DM/T2DM (both P<.001). Interestingly, seasonal variation in diastolic BP was larger in T1DM than in T2DM (1.24/0.64 mm Hg, P<.001). A sex difference was observed in T1DM only, while age differences occurred in both types of diabetes. Correlations between BP and potentially related factors such as outdoor temperature indicated that reasons underlying BP seasonality are likely to be complex and vary by subgroup. © 2015 Wiley Periodicals, Inc.

The MCM-associated protein MCM-BP is important for human nuclear morphology.

PubMed

Jagannathan, Madhav; Sakwe, Amos M; Nguyen, Tin; Frappier, Lori

2012-01-01

Mini-chromosome maintenance complex-binding protein (MCM-BP) was discovered as a protein that is strongly associated with human MCM proteins, known to be crucial for DNA replication in providing DNA helicase activity. The Xenopus MCM-BP homologue appears to play a role in unloading MCM complexes from chromatin after DNA synthesis; however, the importance of MCM-BP and its functional contribution to human cells has been unclear. Here we show that depletion of MCM-BP by sustained expression of short hairpin RNA (shRNA) results in highly abnormal nuclear morphology and centrosome amplification. The abnormal nuclear morphology was not seen with depletion of other MCM proteins and was rescued with shRNA-resistant MCM-BP. MCM-BP depletion was also found to result in transient activation of the G2 checkpoint, slowed progression through G2 and increased replication protein A foci, indicative of replication stress. In addition, MCM-BP depletion led to increased cellular levels of MCM proteins throughout the cell cycle including soluble MCM pools. The results suggest that MCM-BP makes multiple contributions to human cells that are not limited to unloading of the MCM complex.

A novel computational approach "BP-STOCH" to study ligand binding to finite lattice.

PubMed

Beshnova, Daria A; Bereznyak, Ekaterina G; Shestopalova, Anna V; Evstigneev, Maxim P

2011-03-01

We report a novel computational algorithm "BP-STOCH" to be used for studying single-type ligand binding with biopolymers of finite lengths, such as DNA oligonucleotides or oligopeptides. It is based on an idea to represent any type of ligand-biopolymer complex in a form of binary number, where "0" and "1" bits stand for vacant and engaged monomers of the biopolymer, respectively. Cycling over all binary numbers from the lowest 0 up to the highest 2(N) - 1 means a sequential generating of all possible configurations of vacant/engaged monomers, which, after proper filtering, results in a full set of possible types of complexes in solution between the ligand and the N-site lattice. The principal advantage of BP-STOCH algorithm is the possibility to incorporate into this cycle any conditions on computation of the concentrations and observed experimental parameters of the complexes in solution, and programmatic access to each monomer of the biopolymer within each binding site of every binding configuration. The latter is equivalent to unlimited extension of the basic reaction scheme and allows to use BP-STOCH algorithm as an alternative to conventional computational approaches.

Seismic monitoring of effusive-explosive activity and large lava dome collapses during 2013-2015 at Volcán de Colima, Mexico

NASA Astrophysics Data System (ADS)

Arámbula-Mendoza, Raúl; Reyes-Dávila, Gabriel; Vargas-Bracamontes Dulce, M.; González-Amezcua, Miguel; Navarro-Ochoa, Carlos; Martínez-Fierros, Alejandro; Ramírez-Vázquez, Ariel

2018-02-01

Volcán de Colima, the most active volcano in Mexico, started a new eruptive cycle in January 2013. Since this date, the volcano has presented effusive and explosive activity. The beginning of the cycle was marked by a moderate Vulcanian explosion which had hyperbolical behavior in its precursory seismicity, possibly related to a shallow rupture process. Then, during the whole eruptive stage, the effusive activity was accompanied by low to moderate explosions. The explosions had energies mainly of 106 joules and were located between 0 and 1600 m below the crater, whereas the locations of tremor sources were found to be deeper, reaching up to 3800 m beneath the crater. Very-long-period signals (VLPs) have been observed with Vulcanian explosions that produce pyroclastic flows. A few number of volcano-tectonic events (VTs) were recognized during the studied period (2013-2015), indicating that the volcano is an open system. This was particularly evidenced in July 2015, when a new batch of magma rose rapidly without large precursors, only an accelerated increase in the number of rockfalls and associated RSEM. This event generated two large lava dome collapses with several pulses of material and pyroclastic flows that travelled up to 10.3 km from the summit. The seismic monitoring of Volcán de Colima is currently the only tool in real-time employed to assess the state of the volcanic activity. It is thus necessary to integrate new seismic methods as well as other geophysical monitoring techniques able to detect precursory signals of an impending hazardous event.

Wavelet transform analysis to assess oscillations in pial artery pulsation at the human cardiac frequency.

PubMed

Winklewski, P J; Gruszecki, M; Wolf, J; Swierblewska, E; Kunicka, K; Wszedybyl-Winklewska, M; Guminski, W; Zabulewicz, J; Frydrychowski, A F; Bieniaszewski, L; Narkiewicz, K

2015-05-01

Pial artery adjustments to changes in blood pressure (BP) may last only seconds in humans. Using a novel method called near-infrared transillumination backscattering sounding (NIR-T/BSS) that allows for the non-invasive measurement of pial artery pulsation (cc-TQ) in humans, we aimed to assess the relationship between spontaneous oscillations in BP and cc-TQ at frequencies between 0.5 Hz and 5 Hz. We hypothesized that analysis of very short data segments would enable the estimation of changes in the cardiac contribution to the BP vs. cc-TQ relationship during very rapid pial artery adjustments to external stimuli. BP and pial artery oscillations during baseline (70s and 10s signals) and the response to maximal breath-hold apnea were studied in eighteen healthy subjects. The cc-TQ was measured using NIR-T/BSS; cerebral blood flow velocity, the pulsatility index and the resistive index were measured using Doppler ultrasound of the left internal carotid artery; heart rate and beat-to-beat systolic and diastolic blood pressure were recorded using a Finometer; end-tidal CO2 was measured using a medical gas analyzer. Wavelet transform analysis was used to assess the relationship between BP and cc-TQ oscillations. The recordings lasting 10s and representing 10 cycles with a frequency of ~1 Hz provided sufficient accuracy with respect to wavelet coherence and wavelet phase coherence values and yielded similar results to those obtained from approximately 70cycles (70s). A slight but significant decrease in wavelet coherence between augmented BP and cc-TQ oscillations was observed by the end of apnea. Wavelet transform analysis can be used to assess the relationship between BP and cc-TQ oscillations at cardiac frequency using signals intervals as short as 10s. Apnea slightly decreases the contribution of cardiac activity to BP and cc-TQ oscillations. Copyright © 2015 Elsevier Inc. All rights reserved.

From Vulcanian explosions to sustained explosive eruptions: The role of diffusive mass transfer in conduit flow dynamics

NASA Astrophysics Data System (ADS)

Mason, R. M.; Starostin, A. B.; Melnik, O. E.; Sparks, R. S. J.

2006-05-01

Magmatic explosive eruptions are influenced by mass transfer processes of gas diffusion into bubbles caused by decompression. Melnik and Sparks [Melnik, O.E., Sparks, R.S.J. 2002, Modelling of conduit flow dynamic during explosive activity at Soufriere Hills Volcano, Montserrat. In: Druitt, T.H., Kokelaar, B.P. (eds). The Eruption of Soufriere Hills Volcano, Montserrat, from 1995 to 1999. Geological Society, London, Memoirs, 21, 307-317] proposed two end member cases corresponding to complete equilibrium and complete disequilibrium. In the first case, diffusion is fast enough to maintain the system near equilibrium and a long-lived explosive eruption develops. In the latter case, pre-existing bubbles expand under conditions of explosive eruption and decompression, but diffusive gas transfer is negligible. This leads to a much shorter eruption. Here we develop this model to consider the role of mass transfer by investigating transient flows at the start of an explosive eruption triggered by a sudden decompression. The simulations reveal a spectrum of behaviours from sustained to short-lived highly non-equilibrium Vulcanian-style explosions lasting a few tens of seconds, through longer lasting eruptions that can be sustained for tens of minutes and finally to eruptions that can last hours or even days. Behaviour is controlled by a mass-transfer parameter, ω, which equals n*2/3D, where n* is the bubble number density and D is the diffusivity. The parameter ω is expected to vary between 10 - 5 and 1 s - 1 in nature and reflects a time-scale for efficient diffusion. The spectrum of model behaviours is consistent with variations in styles of explosive eruptions of silicic volcanoes. In the initial stages peak discharges occur over 10-20 s and then decline to low discharges. If a critical bubble overpressure is assumed to be the criterion for fragmentation then fragmentation may stop and start several times in the declining period causing several pulses of high-intensity discharge. For the cases of strong disequilibria, the fluxes can decrease to negligible values where other processes, such as gas escape through permeable magma, prevents explosive conditions becoming re-established so that explosive activity stops and dome growth can start. For cases closer to the equilibrium the eruption can evolve towards a quasi-steady sustained flow, never declining sufficiently for gas escape to become dominant.

Genetic and clinical predictors of ovarian response in assisted reproductive technology

NASA Astrophysics Data System (ADS)

Wiweko, B.; Damayanti, I.; Suryandari, D.; Natadisastra, M.; Pratama, G.; Sumapraja, K.; Meutia, K.; Iffanolia, P.; Harzief, A. K.; Hestiantoro, A.

2017-08-01

Several factors are known to influence ovarian response to rFSH stimulation such as age, antral follicle count (AFC), and basal FSH level, Mutation of allele Ser680Asn in FSHR gene was responsible to ovarian resistance toward exogenous FSH. The aim of this study is to develop a prediction model of ovarian response to COS in IVF. This study was a prospective cohort study. One hundred and thirteen women undergoing their first cycle of IVF in Yasmin IVF Clinic Jakarta were recruited to this study. Clinical datas included were age, BMI, and AFC. Basal FSH and E2 as well as serum AMH was measured from peripheral blood taken at second day of cycle. Bsr-1 enzyme is used to identify the polymorphism in exon 10 position 680 with RFLP technique. Three genotype polymorphism, Asn/Asn (255 bp ribbon), Asn/Ser (97 bp and 158 bp), and Ser/Ser (97 bp, 158 bp, and 255 bp). AFC has the highest predictor for ovarian response with AUC 0.922 (CI 95% 0.833-1.000). AMH also showed high predicting value (AUC 0.843 CI 95% 0.663-1.000). The multivariate analysis revealed combination of AFC, AMH, age, and basal FSH is a good model for ovarian response prediction (AUC=0.97). No significant relation between Asn/Asn, Asn/Ser, or Ser/Ser genotype FSHR polymorphism with ovarian response (p = 0.866) and total dose of rRSH (p = 0.08). This study showed that model combination of AFC, AMH, patient’s age and basal FSH are very good to predict number of mature oocytes.

Lava dome morphometry and geochronology of the youngest eruptive activity in Eastern Central Europe: Ciomadul (Csomád), East Carpathians, Romania

NASA Astrophysics Data System (ADS)

Karátson, D.; Telbisz, T.; Harangi, Sz.; Magyari, E.; Kiss, B.; Dunkl, I.; Veres, D.; Braun, M.

2012-04-01

Volcanic evolution of the Ciomadul (Csomád) lava dome complex, site of the youngest (Late Pleistocene, late Marine Isotope Stage 3) eruptive activity in the Carpathians, has been studied by advanced morphometry and radiometric (U/Pb, U/He and 14C) geochronology. The volcano produced alternating effusive and intermittent explosive eruptions from individual domes, typical of common andesitic-dacitic lava domes. A comparative morphometry shows steep ≥30° mean slopes of domes' upper flank and the Csomád domes fit well to the 100-200 ka domes worldwide. Morphometric ages obtained from the mean slope vs age precipitation correlation results in ≤100 ka ages. The morphometric approach is supported by U/Pb and U/He chronology: preliminary results of zircon dating indicate ages ranging between 200(250) and 30 ka. The youngest ages of the data set obtained both from lavas and pumiceous pyroclastics argue for a more or less coeval effusive and explosive volcanism. Based also on volcanological data, we propose vulcanian eruptions and explosive dome collapses especially toward the end of volcanic activity. Moreover, radiometric chronology suggests that, possibly subsequently to the peripheral domes, a central lava dome complex built up ≤100 ka ago. This dome complex, exhibiting even more violent, up to sub-plinian explosions, emplaced pumiceous pyroclastic flow and fall deposits as far as 17 km. We propose that the explosive activity produced caldera-forming eruptions as well, creating a half-caldera. This caldera rim is manifested by the asymmetric morphology of the central edifice: the present-day elevated ridge of Ciomadul Mare (Nagy Csomád), encompassing the twin craters of Mohoş (Mohos) peat bog and Sf. Ana (Szent [St.] Anna). These latter craters may have been formed subsequently, ca. ~100-30 ka ago, after the caldera formation. Drilling of lacustrine sediments in the St. Anna crater shows that beneath the Holocene gyttja several meters of Late Pleistocene sediment occurs. Although we did not reach the very bottom of the crater, radiometric dating of the lowest layer indicates that the formation of the crater exceeds 26,000 cal yr BP. This is in accordance with magnetic susceptibility curves and pollen results from the lake sediments, as well as the 31,450 cal yr BP radiocarbon age of the youngest dated eruption at Csomád. Research has been funded by Hungarian National Grants OTKA K68587 and NF101362.

Multi level optimization of burnable poison utilization for advanced PWR fuel management

NASA Astrophysics Data System (ADS)

Yilmaz, Serkan

The objective of this study was to develop an unique methodology and a practical tool for designing burnable poison (BP) pattern for a given PWR core. Two techniques were studied in developing this tool. First, the deterministic technique called Modified Power Shape Forced Diffusion (MPSFD) method followed by a fine tuning algorithm, based on some heuristic rules, was developed to achieve this goal. Second, an efficient and a practical genetic algorithm (GA) tool was developed and applied successfully to Burnable Poisons (BPs) placement optimization problem for a reference Three Mile Island-1 (TMI-1) core. This thesis presents the step by step progress in developing such a tool. The developed deterministic method appeared to perform as expected. The GA technique produced excellent BP designs. It was discovered that the Beginning of Cycle (BOC) Kinf of a BP fuel assembly (FA) design is a good filter to eliminate invalid BP designs created during the optimization process. By eliminating all BP designs having BOC Kinf above a set limit, the computational time was greatly reduced since the evaluation process with reactor physics calculations for an invalid solution is canceled. Moreover, the GA was applied to develop the BP loading pattern to minimize the total Gadolinium (Gd) amount in the core together with the residual binding at End-of-Cycle (EOC) and to keep the maximum peak pin power during core depletion and Soluble boron concentration at BOC both less than their limit values. The number of UO2/Gd2O3 pins and Gd 2O3 concentrations for each fresh fuel location in the core are the decision variables and the total amount of the Gd in the core and maximum peak pin power during core depletion are in the fitness functions. The use of different fitness function definition and forcing the solution movement towards to desired region in the solution space accelerated the GA runs. Special emphasize is given to minimizing the residual binding to increase core lifetime as well as minimizing the total Gd amount in the core. The GA code developed many good solutions that satisfy all of the design constraints. For these solutions, the EOC soluble boron concentration changes from 68.9 to 97.2 ppm. It is important to note that the difference of 28.3 ppm between the best and the worst solution in the good solutions region represent the potential of 12.5 Effective-Full-Power-Day (EPFD) savings in cycle length. As a comparison, the best BP loading design has 97.2 ppm soluble boron concentration at EOC while the BP loading with available vendors' U/Gd FA designs has 94.4 ppm SOB at EOC. It was estimated that the difference of 2.8 ppm reflected the potential savings of 1.25 EFPD in cycle length. Moreover, the total Gd amount was reduced by 6.89% in mass that provided extra savings in fuel cost compared to the BP loading pattern with available vendor's U/Gd FA designs. (Abstract shortened by UMI.)

A new alternative fuel for reduction of polycyclic aromatic hydrocarbon and particulate matter emissions from diesel engines.

PubMed

Yuan, Chung-Shin; Lin, Hsun-Yu; Lee, Wen-Jhy; Lin, Yuan-Chung; Wu, Tser-Son; Chen, Kung-Fu

2007-04-01

This study investigated the emissions of polycyclic aromatic hydrocarbons (PAHs), carcinogenic potential of PAH and particulate matter (PM), brake-specific fuel consumption (BSFC), and power from diesel engines under transient cycle testing of six test fuels: premium diesel fuel (PDF), B100 (100% palm biodiesel), B20 (20% palm biodiesel + 80% PDF), BP9505 (95% paraffinic fuel + 5% palm biodiesel), BP8020 (80% paraffinic fuel + 20% palm biodiesel), and BP100 (100% paraffinic fuel; Table 1). Experimental results indicated that B100, BP9505, BP8020, and BP100 were much safer when stored than PDF. However, we must use additives so that B100 and BP100 will not gel as quickly in a cold zone. Using B100, BP9505, and BP8020 instead of PDF reduced PM, THC, and CO emissions dramatically but increased CO2 slightly because of more complete combustion. The CO2-increased fraction of BP9505 was the lowest among test blends. Furthermore, using B100, B20, BP9505, and BP8020 as alternative fuels reduced total PAHs and total benzo[a]pyrene equivalent concentration (total BaPeq) emissions significantly. BP9505 had the lowest decreased fractions of power and torque and increased fraction of BSFC. These experimental results implied that BP9505 is feasible for traveling diesel vehicles. Moreover, paraffinic fuel will likely be a new alternative fuel in the future. Using BP9505 instead of PDF decreased PM (22.8%), THC (13.4%), CO (25.3%), total PAHs (88.9%), and total BaPeq (88.1%) emissions significantly.

Community Response to a Heavy Precipitation Event in High Temperature, Chemosynthetic Biofilms and Sediments

NASA Astrophysics Data System (ADS)

Meyer-Dombard, D. R.; Loiacono, S. T.; Shock, E.

2012-12-01

Coordinated analysis of the "Bison Pool" (BP) Environmental Genome and a complementary contextual geochemical dataset of ~75 parameters revealed biogeochemical cycling and metabolic and microbial community shifts in a Yellowstone National Park hot spring ecosystem (1). The >22m outflow of BP is a gradient of decreasing temperature, increasing dissolved oxygen, and changing availability of nutrients. Microbial life at BP transitions from a 92°C chemosynthetic community in the BP source pool to a 56°C photosynthetic mat community. Metagenomic data at BP showed the potential for both heterotrophic and autotrophic carbon metabolism (rTCA and acetyl-CoA cycles) in the highest temperature, chemosynthetic regions (1). This region of the outflow is dominated by Aquificales and Pyrococcus relatives, with smaller contributions of heterotrophic Bacteria. Following a 2h heavy precipitation event we observed an influx of exogenous organic material into the source pool supplied from the meadow surrounding the BP area. We sampled biomass and fluid at several locations within the outflow immediately following the event, and on several occasions for the next eight days. Elemental analysis and carbon and nitrogen isotopic analyses were conducted on biomass and sediment, and dissolved organic and inorganic carbon content and δ13C of fluids were analyzed. DNA and RNA were extracted, and following RT-PCR, nitrogen cycle functional gene expression was evaluated. Previous work at BP has shown that chemosynthetic biomass may carry isotopic signatures of fractionation during carbon fixation, via the acetyl-CoA and rTCA cycles (2). However, the addition of exogenous organic carbon during the rain event had an immediate and dramatic effect on the sediments and biofilms in the chemosynthetic zone of the outflow. Dissolved organic carbon was the highest measured in six years. Chemosynthetic biomass responded by incorporating the organic carbon. Carbon isotopic signatures in chemosynthetic biomass at "Bison Pool" have been previously measured at ~ -4‰ (2). However, immediately following the event, carbon in biomass was measured at ~ -25‰ (values similar to local soil and bison excrement). Biomass closest to the source of "Bison Pool" returned to ~ -4‰ within a few days, but biomass ~ 3m downstream was still ~ -14‰ eight days after the event. Carbon isotopic signatures of the dissolved inorganic carbon (DIC) were depleted relative to values measured in 2005-2009, possibly a result of a combination of added DIC in rain and heterotrophic waste produced using the exogenous depleted carbon; this depleted DIC persisted for the full study period. These results suggest that a shift from autotrophic to heterotrophic metabolism may occur following every significant precipitation event at BP, and support previous observations concerning potential periodic eutrophic conditions in this ecosystem (3). 1 Swingley, W.D. et al., PLoS ONE, 7(6): e38108. 2 Havig et al., 2011. JGR Biogeosciences, 116, G01005. 3 Loiacono, S.T. et al., 2012. EM, 14(5): 1272-1283.

Age and whole rock glass compositions of proximal pyroclastics from the major explosive eruptions of Somma-Vesuvius: A review as a tool for distal tephrostratigraphy

NASA Astrophysics Data System (ADS)

Santacroce, Roberto; Cioni, Raffaello; Marianelli, Paola; Sbrana, Alessandro; Sulpizio, Roberto; Zanchetta, Giovanni; Donahue, Douglas J.; Joron, Jean Louis

2008-10-01

A review of compositional data of the major explosive eruptions of Vesuvius is presented, comparing compositions (major elements) of whole rock with glass shards from the proximal deposits, hopefully useful for long-distance correlation. A critical review of published and new geochronological data is also provided. All available 14C ages are calibrated to give calendar ages useful for the reconstruction of the volcanological evolution of the volcanic complex. The pyroclastic deposits of the four major Plinian eruptions (22,000 yr cal BP "Pomici di Base", 8900 yr cal BP "Mercato Pumice", 4300 yr cal BP "Avellino Pumice", and A.D. 79 "Pompeii Pumice") are widely dispersed and allow a four-folded, Plinian to Plinian, stratigraphic division: 1. B-M (between Pomici di Base and Mercato); 2. M-A (between Mercato and Avellino); 3. A-P (between Avellino and Pompeii); 4. P-XX (from the Pompeii Pumice to the last erupted products of the XXth century). Within each interval, the age, lithologic and compositional features of pyroclastic deposits of major eruptions, potentially useful for tephrostratigraphic purposes on distal areas, are briefly discussed. The Vesuvius rocks are mostly high Potassic products, widely variable in terms of their silica saturation. They form three groups, different for both composition and age: 1. slightly undersaturated, older than Mercato eruption; 2. mildly undersaturated, from Mercato to Pompeii eruptions; 3. highly undersaturated, younger than Pompeii eruption. For whole rock analyses, the peculiar variations in contents of some major and trace elements as well as different trends in element/element ratios, allow a clear, unequivocal, easy diagnosis of the group they belong. Glass analyses show large compositional overlap between different groups, but selected element vs. element plots are distinctive for the three groups. The comparative analysis of glass and whole rock major element compositions provides reliable geochemical criteria helping in the recognition, frequently not obvious, of distal products from the different single eruptions.

Radiocarbon ages of lacustrine deposits in volcanic sequences of the Lomas Coloradas area, Socorro Island, Mexico

NASA Technical Reports Server (NTRS)

Farmer, J. D.; Farmer, M. C.; Berger, R.

1993-01-01

Extensive eruptions of alkalic basalt from low-elevation fissures and vents on the southern flank of the dormant volcano, Cerro Evermann, accompanied the most recent phase of volcanic activity on Socorro Island, and created the Lomas Coloradas, a broad, gently sloping terrain comprising the southern part of the island. We obtained 14C ages of 4690 +/- 270 BP (5000-5700 cal BP) and 5040 +/- 460 BP (5300-6300 cal BP) from lacustrine deposits that occur within volcanic sequences of the lower Lomas Coloradas. Apparently, the sediments accumulated within a topographic depression between two scoria cones shortly after they formed. The lacrustine environment was destroyed when the cones were breached by headward erosion of adjacent stream drainages. This was followed by the eruption of a thin basaltic flow from fissures near the base of the northernmost cone. The flow moved downslope for a short distance and into the drainages that presently bound the study area on the east and west. The flow postdates development of the present drainage system and may be very recent. Our 14C data, along with historical accounts of volcanic activity over the last century, including submarine eruptions that occurred a few km west of Socorro in early 1993, underscore the high risk for explosive volcanism in this region and the need for a detailed volcanic hazards plan and seismic monitoring.

The RanBP2/RanGAP1*SUMO1/Ubc9 SUMO E3 ligase is a disassembly machine for Crm1-dependent nuclear export complexes

PubMed Central

Ritterhoff, Tobias; Das, Hrishikesh; Hofhaus, Götz; Schröder, Rasmus R.; Flotho, Annette; Melchior, Frauke

2016-01-01

Continuous cycles of nucleocytoplasmic transport require disassembly of transport receptor/Ran-GTP complexes in the cytoplasm. A basic disassembly mechanism in all eukaryotes depends on soluble RanGAP and RanBP1. In vertebrates, a significant fraction of RanGAP1 stably interacts with the nucleoporin RanBP2 at a binding site that is flanked by FG-repeats and Ran-binding domains, and overlaps with RanBP2's SUMO E3 ligase region. Here, we show that the RanBP2/RanGAP1*SUMO1/Ubc9 complex functions as an autonomous disassembly machine with a preference for the export receptor Crm1. We describe three in vitro reconstituted disassembly intermediates, which show binding of a Crm1 export complex via two FG-repeat patches, cargo-release by RanBP2's Ran-binding domains and retention of free Crm1 at RanBP2 after Ran-GTP hydrolysis. Intriguingly, all intermediates are compatible with SUMO E3 ligase activity, suggesting that the RanBP2/RanGAP1*SUMO1/Ubc9 complex may link Crm1- and SUMO-dependent functions. PMID:27160050

Biotransformation of explosives by Reticulitermes flavipes--associated termite Endosymbionts.

PubMed

Indest, Karl J; Eaton, Hillary L; Jung, Carina M; Lounds, Caly B

2014-01-01

Termites have an important role in the carbon and nitrogen cycles despite their reputation as destructive pests. With the assistance of microbial endosymbionts, termites are responsible for the conversion of complex biopolymers into simple carbon substrates. Termites also rely on endosymbionts for fixing and recycling nitrogen. As a result, we hypothesize that termite bacterial endosymbionts are a novel source of metabolic pathways for the transformation of nitrogen-rich compounds like explosives. Explosives transformation capability of termite (Reticulitermes flavipes)-derived endosymbionts was determined in media containing the chemical constituents nitrotriazolone (NTO) and hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) that comprise new insensitive explosive formulations. Media dosed with 40 µg/ml of explosive was inoculated with surface-sterilized, macerated termites. Bacterial isolates capable of explosives transformation were characterized by 16S rRNA sequencing. Termite-derived enrichment cultures demonstrated degradation activity towards the explosives NTO, RDX, as well as the legacy explosive 2,4,6-trinitrotoluene (TNT). Three isolates with high similarity to the Enterobacteriaceae(Enterobacter, Klebsiella) were able to transform TNT and NTO within 2 days, while isolates with high similarity to Serratia marcescens and Lactococcus lactis were able to transform RDX. Termite endosymbionts harbor a range of metabolic activities and possess unique abilities to transform nitrogen-rich explosives. © 2014 S. Karger AG, Basel.

Multilevel D-loop PCR identification of hunting game.

PubMed

Parkanyi, V; Ondruska, L; Vasicek, D; Slamecka, J

2014-03-01

The control region of mtDNA (D-loop) was used for hair samples of the five hunting game species identification: red deer (Cervus elaphus), roe deer (Capreolus capreolus), fallow deer (Dama dama), mouflon (Ovis aries musimon), and wild boar (Sus scrofa). For D-loop multilevel PCR detection scheme was applied in six primers (CE CVZV 1 = 5'-GATCACGAGCTTGATCACCA-3'; CE CVZV 2 = 5'-AGGAGTGGGCGATTTTAGGT-3'; DD CVZV 3 = 5'-CGCGTGAAACCAACAACCCGC-3'; DD CVZV 4 = 5'-CCGGGTCGGGGCCTTAGACG-3'; SSW CVZV 5 = 5'-ACACGTGCGTACACGCGCATA-3'; SSW CVZV 6 = 5'-GGTGCCTGCT T TCGTAGCACG-3') designed to identify unknown biological samples of the hunting game animals. The PCR reaction volume was 25 μl at conditions 95 °C for 2 min, 94 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s, 35 cycles, with last extension at 72 °C for 10 min. D-loop mtDNA amplicons of the game animals are characterized with specific PCR product sizes depending on species: red deer = 163 bp and 140 bp, fallow deer = 280 bp and 138 bp, roe deer = 303 bp, 280 bp, 160 bp and 138 bp, mouflon = 299 bp and 178 bp, wild boar = 137 bp and 229 bp.

Frequent eruptions of Mount Rainier over the last ˜2,600 years

NASA Astrophysics Data System (ADS)

Sisson, T. W.; Vallance, J. W.

2009-08-01

Field, geochronologic, and geochemical evidence from proximal fine-grained tephras, and from limited exposures of Holocene lava flows and a small pyroclastic flow document ten-12 eruptions of Mount Rainier over the last 2,600 years, contrasting with previously published evidence for only 11-12 eruptions of the volcano for all of the Holocene. Except for the pumiceous subplinian C event of 2,200 cal year BP, the late-Holocene eruptions were weakly explosive, involving lava effusions and at least two block-and-ash pyroclastic flows. Eruptions were clustered from ˜2,600 to ˜2,200 cal year BP, an interval referred to as the Summerland eruptive period that includes the youngest lava effusion from the volcano. Thin, fine-grained tephras are the only known primary volcanic products from eruptions near 1,500 and 1,000 cal year BP, but these and earlier eruptions were penecontemporaneous with far-traveled lahars, probably created from newly erupted materials melting snow and glacial ice. The most recent magmatic eruption of Mount Rainier, documented geochemically, was the 1,000 cal year BP event. Products from a proposed eruption of Mount Rainier between AD 1820 and 1854 (X tephra of Mullineaux (US Geol Surv Bull 1326:1-83, 1974)) are redeposited C tephra, probably transported onto young moraines by snow avalanches, and do not record a nineteenth century eruption. We found no conclusive evidence for an eruption associated with the clay-rich Electron Mudflow of ˜500 cal year BP, and though rare, non-eruptive collapse of unstable edifice flanks remains as a potential hazard from Mount Rainier.

Integration of BpMADS4 on various linkage groups improves the utilization of the rapid cycle breeding system in apple.

PubMed

Weigl, Kathleen; Wenzel, Stephanie; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola

2015-02-01

Rapid cycle breeding in apple is a new approach for the rapid introgression of agronomically relevant traits (e.g. disease resistances) from wild apple species into domestic apple cultivars (Malus × domestica Borkh.). This technique drastically shortens the long-lasting juvenile phase of apple. The utilization of early-flowering apple lines overexpressing the BpMADS4 gene of the European silver birch (Betula pendula Roth.) in hybridization resulted in one breeding cycle per year. Aiming for the selection of non-transgenic null segregants at the end of the breeding process, the flower-inducing transgene and the gene of interest (e.g. resistance gene) that will be introgressed by hybridization need to be located on different chromosomes. To improve the flexibility of the existing approach in apple, this study was focused on the development and characterization of eleven additional BpMADS4 overexpressing lines of four different apple cultivars. In nine lines, the flowering gene was mapped to different linkage groups. The differences in introgressed T-DNA sequences and plant genome deletions post-transformation highlighted the unique molecular character of each line. However, transgenic lines demonstrated no significant differences in flower organ development and pollen functionality compared with non-transgenic plants. Hybridization studies using pollen from the fire blight-resistant wild species accession Malus fusca MAL0045 and the apple scab-resistant cultivar 'Regia' indicated that BpMADS4 introgression had no significant effect on the breeding value of each transgenic line. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Using Geo-Data Corporately on the Response Phase of Emergency Management

NASA Astrophysics Data System (ADS)

Demir Ozbek, E.; Ates, S.; Aydinoglu, A. C.

2015-08-01

Response phase of emergency management is the most complex phase in the entire cycle because it requires cooperation between various actors relating to emergency sectors. A variety of geo-data is needed at the emergency response such as; existing data provided by different institutions and dynamic data collected by different sectors at the time of the disaster. Disaster event is managed according to elaborately defined activity-actor-task-geodata cycle. In this concept, every activity of emergency response is determined with Standard Operation Procedure that enables users to understand their tasks and required data in any activity. In this study, a general conceptual approach for disaster and emergency management system is developed based on the regulations to serve applications in Istanbul Governorship Provincial Disaster and Emergency Directorate. The approach is implemented to industrial facility explosion example. In preparation phase, optimum ambulance locations are determined according to general response time of the ambulance to all injury cases in addition to areas that have industrial fire risk. Management of the industrial fire case is organized according to defined actors, activities, and working cycle that describe required geo-data. A response scenario was prepared and performed for an industrial facility explosion event to exercise effective working cycle of actors. This scenario provides using geo-data corporately between different actors while required data for each task is defined to manage the industrial facility explosion event. Following developing web technologies, this scenario based approach can be effective to use geo-data on the web corporately.

MicroRNA-129-1 acts as tumour suppressor and induces cell cycle arrest of GBM cancer cells through targeting IGF2BP3 and MAPK1.

PubMed

Kouhkan, Fatemeh; Mobarra, Naser; Soufi-Zomorrod, Mina; Keramati, Farid; Hosseini Rad, Seyed Mohammad Ali; Fathi-Roudsari, Mehrnoosh; Tavakoli, Rezvan; Hajarizadeh, Athena; Ziaei, Said; Lahmi, Reyhaneh; Hanif, Hamed; Soleimani, Masoud

2016-01-01

MicroRNA-129-1 (miR-129-1) seems to behave as a tumour suppressor since its decreased expression is associated with different tumours such as glioblastoma multiforme (GBM). GBM is the most common form of brain tumours originating from glial cells. The impact of miR-129-1 downregulation on GBM pathogenesis has yet to be elucidated. MiR-129-1 was overexpressed in GBM cells, and its effect on proliferation was investigated by cell cycle assay. MiR-129-1 predicted targets (CDK6, IGF1, HDAC2, IGF2BP3 and MAPK1) were also evaluated by western blot and luciferase assay. Restoration of miR-129-1 reduced cell proliferation and induced G1 accumulation, significantly. Several functional assays confirmed IGF2BP3, MAPK1 and CDK6 as targets of miR-129-1. Despite the fact that IGF1 expression can be suppressed by miR-129-1, through 3'-untranslated region complementary sequence, we could not find any association between IGF1 expression and GBM. MiR-129-1 expression inversely correlates with CDK6, IGF2BP3 and MAPK1 in primary clinical samples. This is the first study to propose miR129-1 as a negative regulator of IGF2BP3 and MAPK1 and also a cell cycle arrest inducer in GBM cells. Our data suggests miR-129-1 as a potential tumour suppressor and presents a rationale for the use of miR-129-1 as a novel strategy to improve treatment response in GBM. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

[Annual blood pressure dynamics and weather sensitivity in women].

PubMed

Varlamova, N G; Zenchenko, T A; Boyko, E R

To study the annual cycle of blood pressure (BP) and weather sensitivity in normotensive women aged 20-59 years. The same group of 25 non-smoking women who had been living in the European North of Russia (62° N, 51° E) almost since their birth and were engaged in moderate-intensity mental labor was daily examined. During a year, there were 11823 blood pressure measurements using the Korotkoff technique; heart rate was calculated by palpation. These meteorological parameters were taken at the websites: http://meteo.infospace.ru and ftp://ftp.ngdc.noaa.gov/stp/geomagnetic_data/indices/kp_ap. The statistical significance of differences in the indicators was determined using the Fisher's test and the Newman-Keuls test. The study used a correlation analysis with the calculation of the Spearman's rank correlation coefficient. The maximum systolic and diastolic BP values were revealed in February and January, respectively. The minimum values of systolic BP were detected in July; those of diastolic BP were in August. An individual-based analysis of sensitivity to environmental variations showed that about 88% of the women responded to atmospheric temperature; nearly 44% did to geomagnetic activity; almost 24% were sensitive to relative air humidity, and about 16% of the women were to atmospheric pressure. The dynamics of systolic and diastolic BP in the annual cycle of women depends on meteorological factors and suggests that there is a change in the priorities of its control in different periods of a year.

TopBP1 deficiency causes an early embryonic lethality and induces cellular senescence in primary cells.

PubMed

Jeon, Yoon; Ko, Eun; Lee, Kyung Yong; Ko, Min Ji; Park, Seo Young; Kang, Jeeheon; Jeon, Chang Hwan; Lee, Ho; Hwang, Deog Su

2011-02-18

TopBP1 plays important roles in chromosome replication, DNA damage response, and other cellular regulatory functions in vertebrates. Although the roles of TopBP1 have been studied mostly in cancer cell lines, its physiological function remains unclear in mice and untransformed cells. We generated conditional knock-out mice in which exons 5 and 6 of the TopBP1 gene are flanked by loxP sequences. Although TopBP1-deficient embryos developed to the blastocyst stage, no homozygous mutant embryos were recovered at E8.5 or beyond, and completely resorbed embryos were frequent at E7.5, indicating that mutant embryos tend to die at the peri-implantation stage. This finding indicated that TopBP1 is essential for cell proliferation during early embryogenesis. Ablation of TopBP1 in TopBP1(flox/flox) mouse embryonic fibroblasts and 3T3 cells using Cre recombinase-expressing retrovirus arrests cell cycle progression at the G(1), S, and G(2)/M phases. The TopBP1-ablated mouse cells exhibit phosphorylation of H2AX and Chk2, indicating that the cells contain DNA breaks. The TopBP1-ablated mouse cells enter cellular senescence. Although RNA interference-mediated knockdown of TopBP1 induced cellular senescence in human primary cells, it induced apoptosis in cancer cells. Therefore, TopBP1 deficiency in untransformed mouse and human primary cells induces cellular senescence rather than apoptosis. These results indicate that TopBP1 is essential for cell proliferation and maintenance of chromosomal integrity.

Explosives and pyrotechnic propellants for use in long term deep space missions

NASA Technical Reports Server (NTRS)

Gorzynski, C. S., Jr.; Maycock, J. N.

1973-01-01

Explosives and pyrotechnic propellant materials which will withstand heat sterilization cycling at 125 C and ten year deep space aging under 10 to the minus 6th power torr and 66 C have been selected. The selection was accomplished through a detailed literature survey and an analytical evaluation of the physicochemical properties of the materials. The chemical components of the electroexplosive devices used in U.S. missiles and spacecraft were categorized into primary explosives, secondary explosives, and propellant ingredients. Kinetic data on such parameters as thermal decomposition and sublimation were obtained for these materials and used as a basis for the ten year life prediction. From these experimental data and some analytical calculations, a listing of candidate materials for deep space missions was made.

HRV analysis and blood pressure monitoring on weighing scale using BCG.

PubMed

Shin, Jae Hyuk; Park, Kwang Suk

2012-01-01

Using the Ballistocardiogram(BCG) measured on weighing scale, heart rate variability(HRV) and blood pressure were estimated. BCG was measured while subjects were on weighing scale in resting state and under the Valsalva maneuver and static exercise condition to induce the change in cardiac autonomic rhythm. Time domain, frequency domain and nonlinear HRV parameters were estimated from the measured BCG and compared with the ones calculated from ECG measured simultaneously. For blood pressure(BP) estimation, ECG was measured additionally on the feet using dry electrodes simultaneously installed on weighing scale and R-J intervals were extracted as a BP correlated parameter at every beat cycle. HRV estimation results shows the correlation higher than 0.97, and the estimated BP was similar to the measured BP with a reliable correlations.

Serum levels of IGF-1 and IGF-BP3 are associated with event-free survival in adult Ewing sarcoma patients treated with chemotherapy.

PubMed

de Groot, Stefanie; Gelderblom, Hans; Fiocco, Marta; Bovée, Judith Vmg; van der Hoeven, Jacobus Jm; Pijl, Hanno; Kroep, Judith R

2017-01-01

Activation of the insulin-like growth factor 1 (IGF-1) pathway is involved in cell growth and proliferation and is associated with tumorigenesis, tumor progression, and therapy resistance in solid tumors. We examined whether variability in serum levels of IGF-1, IGF-2, and IGF-binding protein 3 (IGF-BP3) can predict event-free survival (EFS) and overall survival (OS) in Ewing sarcoma patients treated with chemotherapy. Serum levels of IGF-1, IGF-2, and IGF-BP3 of 22 patients with localized or metastasized Ewing sarcoma treated with six cycles of vincristine/ifosfamide/doxorubicin/etoposide (VIDE) chemotherapy were recorded. Baseline levels were compared with presixth cycle levels using paired t -tests and were tested for associations with EFS and OS. Continuous variables were dichotomized according to the Contal and O'Quigley procedure. Survival analyses were performed using Cox regression analysis. High baseline IGF-1 and IGF-BP3 serum levels were associated with EFS (hazard ratio [HR] 0.075, 95% confidence interval [CI] 0.009-0.602 and HR 0.090, 95% CI 0.011-0.712, respectively) in univariate and multivariate analyses (HR 0.063, 95% CI 0.007-0.590 and HR 0.057, 95% CI 0.005-0.585, respectively). OS was improved, but this was not statistically significant. IGF-BP3 and IGF-2 serum levels increased during treatment with VIDE chemotherapy ( P =0.055 and P =0.023, respectively). High circulating serum levels of IGF-1 and IGF-BP3 and the molar ratio of IGF-1:IGF-BP3 serum levels were associated with improved EFS and a trend for improved OS in Ewing sarcoma patients treated with VIDE chemotherapy. These findings suggest the need for further investigation of the IGF-1 pathway as a biomarker of disease progression in patients with Ewing sarcoma.

Predicting Out-of-Office Blood Pressure in the Clinic for the Diagnosis of Hypertension in Primary Care: An Economic Evaluation.

PubMed

Monahan, Mark; Jowett, Sue; Lovibond, Kate; Gill, Paramjit; Godwin, Marshall; Greenfield, Sheila; Hanley, Janet; Hobbs, F D Richard; Martin, Una; Mant, Jonathan; McKinstry, Brian; Williams, Bryan; Sheppard, James P; McManus, Richard J

2018-02-01

Clinical guidelines in the United States and United Kingdom recommend that individuals with suspected hypertension should have ambulatory blood pressure (BP) monitoring to confirm the diagnosis. This approach reduces misdiagnosis because of white coat hypertension but will not identify people with masked hypertension who may benefit from treatment. The Predicting Out-of-Office Blood Pressure (PROOF-BP) algorithm predicts masked and white coat hypertension based on patient characteristics and clinic BP, improving the accuracy of diagnosis while limiting subsequent ambulatory BP monitoring. This study assessed the cost-effectiveness of using this tool in diagnosing hypertension in primary care. A Markov cost-utility cohort model was developed to compare diagnostic strategies: the PROOF-BP approach, including those with clinic BP ≥130/80 mm Hg who receive ambulatory BP monitoring as guided by the algorithm, compared with current standard diagnostic strategies including those with clinic BP ≥140/90 mm Hg combined with further monitoring (ambulatory BP monitoring as reference, clinic, and home monitoring also assessed). The model adopted a lifetime horizon with a 3-month time cycle, taking a UK Health Service/Personal Social Services perspective. The PROOF-BP algorithm was cost-effective in screening all patients with clinic BP ≥130/80 mm Hg compared with current strategies that only screen those with clinic BP ≥140/90 mm Hg, provided healthcare providers were willing to pay up to £20 000 ($26 000)/quality-adjusted life year gained. Deterministic and probabilistic sensitivity analyses supported the base-case findings. The PROOF-BP algorithm seems to be cost-effective compared with the conventional BP diagnostic options in primary care. Its use in clinical practice is likely to lead to reduced cardiovascular disease, death, and disability. © 2017 American Heart Association, Inc.

BmCyclin B and BmCyclin B3 are required for cell cycle progression in the silkworm, Bombyx mori.

PubMed

Pan, Minhui; Hong, Kaili; Chen, Xiangyun; Pan, Chun; Chen, Xuemei; Kuang, Xiuxiu; Lu, Cheng

2013-04-01

Cyclin B is an important regulator of the cell cycle G2 to M phase transition. The silkworm genomic database shows that there are two Cyclin B genes in the silkworm (Bombyx mori), BmCyclin B and BmCyclin B3. Using silkworm EST data, the cyclin B3 (EU074796) gene was cloned. Its complete cDNA was 1665 bp with an ORF of 1536 bp derived from seven exons and six introns. The BmCyclin B3 gene encodes 511 amino acids, and the predicted molecular weight is 57.8 kD with an isoelectric point of 9.18. The protein contains one protein damage box and two cyclin boxes. RNA interference-mediated reduction of BmCyclin B and BmCyclin B3 expression induced cell cycle arrest in G2 or M phase in BmN-SWU1 cells, thus inhibiting cell proliferation. These results suggest that BmCyclin B and BmCyclin B3 are necessary for completing the cell cycle in silkworm cells.

Polyurethane Binder Systems for Polymer Bonded Explosives

DTIC Science & Technology

2006-12-01

Propulsion (2005), Santiago , Chile . 8. Huang, C.-C., Hwu, W.-H., Cheng, C.-S., Shyy, I.-N., and Yang, K.-K., Study on Thermal Decomposition of Composite...water or amines to form ureas (Figure 2). R NCO R N C O H+ H2O O H R NH2 - CO2 R NCO R N C O NR’ H H ureaamine Figure 2. Reaction of an isocyanate...Monoisocyanates are present as impurities in low concentration in most diisocyanates. Table 1. Common diisocyanates Isocyanate Structure B.p. (ºC

Suppressive effects of 3-bromopyruvate on the proliferation and the motility of hepatocellular carcinoma cells.

PubMed

Tomizawa, Minoru; Shinozaki, Fuminobu; Motoyoshi, Yasufumi; Sugiyama, Takao; Yamamoto, Shigenori; Ishige, Naoki

2016-01-01

The compound 3-bromopyruvate (3BP) is an analogue of pyruvate, which is the final product of glycolysis that enters the citric acid cycle. The present study aimed to investigate the suppressive effects of 3BP on the proliferation and motility of hepatocellular carcinoma (HCC) cells. HLF and PLC/PRF/5 cells were cultured with 3BP and subjected to an MTS assay. Apoptosis was analyzed by hematoxylin and eosin staining. Cell motility was analyzed using a scratch assay. Real-time quantitative polymerase chain reaction (PCR) was performed to determine the expression levels of cyclin D1 and matrix metalloproteinase (MMP)9. Proliferation of both cell lines was significantly suppressed by 3BP at 100 µM (P<0.05). The expression level of cyclin D1 was decreased after 3BP treatment at 100 µM in both cell lines (P<0.05). Pyknotic nuclei were observed in the cells cultured with 3BP at 100 µM. These results revealed that 3BP suppressed cell proliferation, decreased the expression of cyclin D1, and induced apoptosis in HCC cells. 3BP significantly suppressed motility in both cell lines (P<0.05). The expression level of MMP9 was significantly decreased (P<0.05). 3BP suppressed the proliferation and motility of HCC cells by decreasing the expression of cyclin D1 and MMP9.

Regulation of circadian blood pressure: from mice to astronauts.

PubMed

Agarwal, Rajiv

2010-01-01

Circadian variation is commonly seen in healthy people; aberration in these biological rhythms is an early sign of disease. Impaired circadian variation of blood pressure (BP) has been shown to be associated with greater target organ damage and with an elevated risk of cardiovascular events independent of the BP load. The purpose of this review is to examine the physiology of circadian BP variation and propose a tripartite model that explains the regulation of circadian BP. The time-keeper in mammals resides centrally in the suprachiasmatic nucleus. Apart from this central clock, molecular clocks exist in most peripheral tissues including vascular tissue and the kidney. These molecular clocks regulate sodium balance, sympathetic function and vascular tone. A physiological model is proposed that integrates our understanding of molecular clocks in mice with the circadian BP variation among humans. The master regulator in this proposed model is the sleep-activity cycle. The equivalents of peripheral clocks are endothelial and adrenergic functions. Thus, in the proposed model, the variation in circadian BP is dependent upon three major factors: physical activity, autonomic function, and sodium sensitivity. The integrated consideration of physical activity, autonomic function, and sodium sensitivity appears to explain the physiology of circadian BP variation and the pathophysiology of disrupted BP rhythms in various conditions and disease states. Our understanding of molecular clocks in mice may help to explain the provenance of blunted circadian BP variation even among astronauts.

Insight into the Role of Ca2+-Binding Protein 5 in Vesicle Exocytosis

PubMed Central

Sokal, Izabela

2011-01-01

Purpose. CaBP5 is a neuronal calmodulin-like Ca2+-binding protein that is expressed in the retina and in the cochlea. Although CaBP5 knockout mice displayed reduced sensitivity of retinal ganglion cell light responses, the function of CaBP5 in vivo is still unknown. To gain further insight into CaBP5 function, the authors screened for CaBP5-interacting partners. Methods. Potential retinal interacting partners for CaBP5 were identified using affinity chromatography followed by mass spectrometry and by yeast two-hybrid screening of a bovine retina cDNA library. Interacting partners were further analyzed using coimmunoprecipitation. Immunohistochemistry and subcellular fractionation were performed to determine their colocalization in the retina. The effect of CaBP5 on dopamine release and neurite outgrowth of PC12 cells was analyzed using ELISA and fluorescent labeling. Results. Using affinity chromatography, the authors identified Munc18–1 and myosin VI as interacting partners for CaBP5. Munc18–1 was also identified using the yeast two-hybrid system. Colocalization and coimmunoprecipitation of CaBP5 with these two proteins in retinal tissue further established their physiological interactions. Furthermore, CaBP5 expression in NGF-stimulated PC12 cells stimulates neurite outgrowth and dopamine exocytosis. Conclusions. This study shows that CaBP5 interacts with Munc18–1 and myosin VI, two proteins involved in the synaptic vesicle cycle. Together with the effect of CaBP5 in stimulating neurite outgrowth and vesicle exocytosis in PC12 cells, these results suggest that CaBP5 plays a role in neurotransmitter release. PMID:22039235

Vitamin D receptor-mediated control of Soggy, Wise, and Hairless gene expression in keratinocytes.

PubMed

Hsieh, Jui-Cheng; Estess, Rudolf C; Kaneko, Ichiro; Whitfield, G Kerr; Jurutka, Peter W; Haussler, Mark R

2014-02-01

The vitamin D receptor (VDR), but not its hormonal ligand, 1,25-dihydroxyvitamin D3 (1,25D), is required for the progression of the mammalian hair cycle. We studied three genes relevant to hair cycle signaling, DKKL1 (Soggy), SOSTDC1 (Wise), and HR (Hairless), to determine whether their expression is regulated by VDR and/or its 1,25D ligand. DKKL1 mRNA was repressed 49-72% by 1,25D in primary human and CCD-1106 KERTr keratinocytes; a functional vitamin D responsive element (VDRE) was identified at -9590 bp in murine Soggy. Similarly, SOSTDC1 mRNA was repressed 41-59% by 1,25D in KERTr and primary human keratinocytes; a functional VDRE was located at -6215 bp in human Wise. In contrast, HR mRNA was upregulated 1.56- to 2.77-fold by 1,25D in primary human and KERTr keratinocytes; a VDRE (TGGTGAgtgAGGACA) consisting of an imperfect direct repeat separated by three nucleotides (DR3) was identified at -7269 bp in the human Hairless gene that mediated dramatic induction, even in the absence of 1,25D ligand. In parallel, a DR4 thyroid hormone responsive element, TGGTGAggccAGGACA, was identified at +1304 bp in the human HR gene that conferred tri-iodothyronine (T3)-independent transcriptional activation. Because the thyroid hormone receptor controls HR expression in the CNS, whereas VDR functions in concert with the HR corepressor specifically in skin, a model is proposed wherein unliganded VDR upregulates the expression of HR, the gene product of which acts as a downstream comodulator to feedback-repress DKKL1 and SOSTDC1, resulting in integration of bone morphogenic protein and Wnt signaling to drive the mammalian hair cycle and/or influencing epidermal function.

Whitening Efficacy of Whitening Mouth Rinses Used Alone or in Conjunction With Carbamide Peroxide Home Whitening.

PubMed

Oliveira, Jbs; Sarlo, R S; Bresciani, E; Caneppele, Tmf

The aim of this study was to compare the effectiveness of whitening mouth rinses on teeth previously whitened or not, exposed to food dyes. One hundred twenty enamel-dentin specimens, 3 mm in diameter, were obtained from bovine incisors. The specimens were stained for 14 days in staining broth. After staining, the initial color reading was performed via a spectrophotometer CM-2600d (Konica Minolta). Half of specimens were submitted to whitening (10% carbamide peroxide [CP]) for 14 days. They were then divided into three groups and were submitted to cycles of staining (five minutes) and mouth rinses (two minutes) for 12 weeks, with the following: CP-LI, Listerine Whitening; CP-PL, Plax Whitening; CP-BP, bromelain + papain; CP-DW, deionized water. LI, PL, BP, and DW groups were submitted to the same cited cycles but with no prior bleaching. The color measurements were performed after four, eight, and 12 weeks of treatment with mouth rinses. Data were submitted to repeated measures analysis of variance (ANOVA) and Tukey's test for multiple comparisons, with significance level at 5%. The results showed that the CP-LI, CP-PL, LI, and PL groups had greater color change than did the others. The CP-BP and BP groups were similar to CP-DW and DW. We therefore conclude that Listerine Whitening mouth rinse presented the highest bleaching effect, followed by Plax Whitening mouth rinse. Both maintained CP bleaching effect after 12 weeks of dye-rinse cycles. However, none of these rinses were able to produce whitening similar to CP. Bromelain- and papain-containing mouth rinses did not show bleaching effect, being similar to the control groups.

Funnel Beaker weather (6200-4900 cal BP) - reconstructed from the palaeolimnological record of synchronously deposited varves in northern Germany

NASA Astrophysics Data System (ADS)

Dreibrodt, Stefan; Zahrer, Jürgen; Brauer, Achim

2013-04-01

Depositional patterns of synchronously deposited varves of Lake Belauer See and Lake Poggensee (northern Germany) were studied on thin sections under the microscope comparatively. Events and trends that occurred synchronously in the lake systems were detected and interpret as limnologic responses to supra-regional extrinsic (climate) drivers. The different thresholds of the compared lake systems implied by different lake size were utilized to infer about weather conditions. For Lake Belauer See microfacies types of sub-recent varves were proved to reflect responses of certain meteorological conditions (e.g. severity of winters). A short weather anomaly at around 5950 cal BP was detected. Cold summers of about 40 successive years (probably with sudden frost events) lead to breaks of the thermal summer stratification and the associated carbonate precipitation. Instead renewed blooms of planctic diatoms occurred. The subsequent interval of the Funnel Beaker Culture seems to have experienced a period with favorable wea¬ther conditions, with warm summers and not extra-ordinary severe winters. Between ca. 5400 and 5340 cal BP an interval with pronounced warm winters is indicated. The favorable weather conditions termina¬ted abruptly at around 5275 cal BP when the weather (in particular summers) became colder. The comparison of the sediment sequences also provides evidence for the asynchronic onset of anthropogenic activity in the catchment areas of the lakes. A significant increase of minerogenic matter (quartz grains) indication soil erosion in the lake catchment started at ca. 3850 cal BC in Lake Poggensee, and at ca. 3500 cal BC in Lake Belau. Cycles of minerogenic input have been detected with duration of 20-25 years. Whether these cycles could represent slash and burn cycles has to be studied further.

Countermeasures (iRED, ARED CEVIS, MEC, TVIS, T2, Periodic Fitness Evaluation, BP-ECG, HRM). Critical Readiness Review Increment 23 and 24

NASA Technical Reports Server (NTRS)

Toder, Carly; Gipson, Iona; Conly, Danielle; Nieschwitz, Linda; Perk, Austin

2010-01-01

This slide presentation reviews attempts to counteract the effects of being in space. It includes information on the Resistive Exercise Device (RED), the Advanced Resistive Exercise Device (ARED), Cycle Ergometer with Vibration Isolation and Stabilization (CEVIS), Treadmill with Vibration Isolation and Stabilization (TVIS) and periodic fitness evaluation with specific information on BP/ECG, heart rate monitor 2 and data distribution.

The extimated presence of differentiated higly explosive magmas beneath Vesuvius and Campi Flegrei: evidence from geochemical and textural studies.

NASA Astrophysics Data System (ADS)

Pappalardo, Lucia; Mastrolorenzo, Giuseppe

2010-05-01

Highly catastrophic explosive eruptions are supplied by Si-rich magmas, generated at shallower level in crust by the evolution of mantle liquids. The timescale of these evolution processes is a crucial factor, because of its control on the length of volcano repose interval leading to high explosive events. Campi Flegrei and Somma-Vesuvius alkaline volcanic systems, located respectively at few kilometers west and east of Neapolitan metropolitan area, produced a variety of eruptions ranging from not explosive lava flows and domes to highly destructive eruptions. Both these high risk volcanoes are in repose time since the last eruption occurred in the 1538 and 1944 BP, respectively. Since that time, the volcanoes experienced fumarolic activity, low level of seismicity with rare earthquakes swarms, as well as two bradyseismic crisis (1969-1972 and 1982-1984) localized in the center of Campi Flegrei caldera, that generated a net uplift of 3.5 m around the town of Pozzuoli. A wide low velocity layer interpreted as an extended magmatic body has been detected at 8-10 km depth beneath these volcanoes by seismic data. The capability of this reservoir to erupt explosively again strongly depends on magma differentiation degree, therefore the knowledge of the time lapse necessary at not explosive mafic liquids to differentiate toward explosive magmas is very crucial to predict the size of a possible short-term future eruption in Campanian area. Our petrologic data indicate that a multi-depth supply system was active under the Campanian Plain since 39 ka. Fractional crystallization during magma cooling associated with upward migration of less dense evolved liquids appears to be the prevalent differentiation process. Our results indicate that huge steam exolution occurred during the late stage of trachyte and phonolite crystallization thus accounting for the high Volcanic Explosivity Index (VEI) of eruptions supplied by these melts. Moreover our CSD data on phenocrysts reveal rapid crystallization and differentiation time for alkaline Campanian magmas (in the order of decades to few centuries). This evidence implies that the 400 km2 partial melting zone detected by tomography study at 8-10 km depth beneath Vesuvius and Campi Flegrei, should consist of differentiated magma already capable to produce also large scale (plinian) explosive events in case of renewal of the activity from the present closed-conduit state.

Holocene thermal optimal and climate variability of East Asian monsoon inferred from forest reconstruction of a subalpine pollen sequence, Taiwan

NASA Astrophysics Data System (ADS)

Liew, P. M.; Lee, C. Y.; Kuo, C. M.

2006-10-01

The East Asian monsoon Holocene optimal period has been debated both about duration and whether conditions were a maximum in thermal conditions or in precipitation. In this study we show Holocene climate variability inferred by a forest reconstruction of a subalpine pollen sequence from peat bog deposits in central Taiwan, based on modern analogues of various altitudinal biomes in the region. A warmer interval occurred between 8 and 4 ka BP (calibrated 14C years) when the subtropical forests were more extensive. The Holocene thermal optimum is represented by an altitudinal tropical forest at 6.1-5.9 ka BP and 6.9 ka BP and only the latter was accompanied by wet conditions, indicating decoupling of thermal and precipitation mechanism in the middle Holocene. Abrupt and relative severe cold phases, shown by biome changes, occurred at about 11.2-11.0 ka BP; 7.5 ka BP; 7.2 ka BP; 7.1 ka BP; 5.2 ka BP, 5.0 ka BP and 4.9 ka BP. A spectral analysis of pollen of a relatively cold taxon — Salix, reveals that the time series is dominated by a 1500 yr periodicity and similar to the cold cycle reported in the marine records of Indian and western Pacific Oceans. The cold-warm conditions inferred by the change of forests show close relationship to solar energy in comparison with the production rate of Be-10.

Use of UV Sources for Detection and Identification of Explosives

NASA Technical Reports Server (NTRS)

Hug, William; Reid, Ray; Bhartia, Rohit; Lane, Arthur

2009-01-01

Measurement of Raman and native fluorescence emission using ultraviolet (UV) sources (<400 nm) on targeted materials is suitable for both sensitive detection and accurate identification of explosive materials. When the UV emission data are analyzed using a combination of Principal Component Analysis (PCA) and cluster analysis, chemicals and biological samples can be differentiated based on the geometric arrangement of molecules, the number of repeating aromatic rings, associated functional groups (nitrogen, sulfur, hydroxyl, and methyl), microbial life cycles (spores vs. vegetative cells), and the number of conjugated bonds. Explosive materials can be separated from one another as well as from a range of possible background materials, which includes microbes, car doors, motor oil, and fingerprints on car doors, etc. Many explosives are comprised of similar atomic constituents found in potential background samples such as fingerprint oils/skin, motor oil, and soil. This technique is sensitive to chemical bonds between the elements that lead to the discriminating separability between backgrounds and explosive materials.

Frequent eruptions of Mount Rainier over the last ∼2,600 years

USGS Publications Warehouse

Sisson, T.W.; Vallance, J.W.

2009-01-01

Field, geochronologic, and geochemical evidence from proximal fine-grained tephras, and from limited exposures of Holocene lava flows and a small pyroclastic flow document ten–12 eruptions of Mount Rainier over the last 2,600 years, contrasting with previously published evidence for only 11–12 eruptions of the volcano for all of the Holocene. Except for the pumiceous subplinian C event of 2,200 cal year BP, the late-Holocene eruptions were weakly explosive, involving lava effusions and at least two block-and-ash pyroclastic flows. Eruptions were clustered from ∼2,600 to ∼2,200 cal year BP, an interval referred to as the Summerland eruptive period that includes the youngest lava effusion from the volcano. Thin, fine-grained tephras are the only known primary volcanic products from eruptions near 1,500 and 1,000 cal year BP, but these and earlier eruptions were penecontemporaneous with far-traveled lahars, probably created from newly erupted materials melting snow and glacial ice. The most recent magmatic eruption of Mount Rainier, documented geochemically, was the 1,000 cal year BP event. Products from a proposed eruption of Mount Rainier between AD 1820 and 1854 (X tephra of Mullineaux (US Geol Surv Bull 1326:1–83, 1974)) are redeposited C tephra, probably transported onto young moraines by snow avalanches, and do not record a nineteenth century eruption. We found no conclusive evidence for an eruption associated with the clay-rich Electron Mudflow of ∼500 cal year BP, and though rare, non-eruptive collapse of unstable edifice flanks remains as a potential hazard from Mount Rainier.

Cycles Tipping the Scale between Death and Survival (=``Life")

NASA Astrophysics Data System (ADS)

Halberg, F.; Cornélissen, G.; Sothern, R. B.; Katinas, G. S.; Schwartzkopff, O.; Otsuka, K.

Systematic chronobiologically interpreted ambulatory bloodpressure (BP) and heart rate (HR) monitoring (C-ABPM 7D/24H is now automatically possible; if continued around the clock over a week, this approach detects vascular variability disorders (VVDs) that include, among others, high BP itself and CHAT, short for circadian hyper-amplitude-tension. BP is never a constant ``true" (resting) value and can be more reliably diagnosed by CABPM 7d/24h as MESOR-hypertension, MH. CHAT carries a risk of hard events greater than MH and can be treated, among other VVDs, which if they coexist constitute vascular variability syndromes (VVSs). A project on The BIOsphere and the COSmos, BIOCOS (corne001@umn.edu), provides, in exchange for the data, cost-free analyses and the opportunity of obtaining monitors at a cost reduction of 80% complements the records from purely physical tools for surveilling the variable sun, by validating in the biosphere the reality of intermittent, aeolian envi ronmental spectral components that can be more consistent than their physical counterparts once they are coded in genes. C-ABPM 7D/24H indicates relevant associations of space weather with human health and ecology. Monitoring reveals, around and in living matter, a system of transdisciplinary cycles with common average periods, quantified with point-and-interval estimates of parameters. The cycles in space climate are critical in discussing global warming. The cycles' periods are described as congruent when their CIs (95\\ intervals) overlie or overlap and the amplitudes' CIs' lower limits are positive. Some congruent cycles in organisms, counterparts of the environmental day and the seasons, relate to electromagnetic radiation in the visible domain; these are the usually environmentally synchronized socio-photo-thermoperiodisms (photics). The biosphere also resonates with or is pulled or driven by nonstationary, environmental nonphotic cycles (nonphotics) -- particle emissi ons from the sun and the wider cosmos, cosmoheliogeomagnetics, ultraviolet flux, gravitation, acoustics and others. Nonphotics, a set of in part transdisciplinarily-novel spectral components, can be intermittent; when present, they coexist and compete with signatures of photic cycles, monitored, e.g., in BP and HR. Nonphotics of, e.g., about (˜) 1 week (circaseptans) and ˜17 months (transyears), characterize mood and performance, modulate and sometimes override society's (photic) schedules, even in dying suddenly either unintentionally or by one's own will or at the hand of others. Nonphotics persist, but are damped in physiology or in terrorism, when their environmental counterpart is not detected. Their elucidation provides information on how a set of cycles covering 18 orders of magnitude in the frequency domain of the biosphere bears on the question ``What is life?": a resonance of the biosphere with periods of its environment constitutes life itself.

Calcein represses human papillomavirus 16 E1-E2 mediated DNA replication via blocking their binding to the viral origin of replication.

PubMed

Das, Dipon; Smith, Nathan W; Wang, Xu; Richardson, Stacie L; Hartman, Matthew C T; Morgan, Iain M

2017-08-01

Human papillomaviruses are causative agents in several human diseases ranging from genital warts to ano-genital and oropharyngeal cancers. Currently only symptoms of HPV induced disease are treated; there are no antivirals available that directly target the viral life cycle. Previously, we determined that the cellular protein TopBP1 interacts with the HPV16 replication/transcription factor E2. This E2-TopBP1 interaction is essential for optimal E1-E2 DNA replication and for the viral life cycle. The drug calcein disrupts the interaction of TopBP1 with itself and other host proteins to promote cell death. Here we demonstrate that calcein blocks HPV16 E1-E2 DNA replication via blocking the viral replication complex forming at the origin of replication. This occurs at non-toxic levels of calcein and demonstrates specificity as it does not block the ability of E2 to regulate transcription. We propose that calcein or derivatives could be developed as an anti-HPV therapeutic. Copyright © 2017 Elsevier Inc. All rights reserved.

Effect of a Bicycling Unit on the Fitness of Middle School Students

ERIC Educational Resources Information Center

Lirgg, Cathy D.; Gorman, Dean R.; Merrie, Michael D.; Hadadi, Atyh A.

2018-01-01

Many physical educators today are teaching lifetime sports, including outdoor activities such as cycling. Even though cycling is a low impact exercise that aids stamina and fitness, little is known about additional benefits in other areas including agility, balance, and explosive power. The purpose of this study was to ascertain if there are…

Design of Explosion Blast Containment Vessels for Explosive Ordnance Disposal Units

DTIC Science & Technology

1975-06-01

gages installed on Vessels 1 and 3 were Type EP-08-250BF-350. ,hec: gages, which are special , annealed constantan foil, have a quoted strain range of...either 32 or 24 Vdc from automotive-type wet cell batteries, although large dry cells may be used with slightly reduced stability. The bridge output is...RST-CYCLE VESEL RESPONSE I. -- ~-~- --. - - ,--~ -- --- -~ - - -- ~ ~ -- 72 TABLE 10. DESCRIPTION OF BLACK POWDER SHOTS FIRED IN 3.0-FT VESSEL Shot

What factors control the superficial lava dome explosivity?

NASA Astrophysics Data System (ADS)

Boudon, Georges; Balcone-Boissard, Hélène; Villemant, Benoit; Morgan, Daniel J.

2015-04-01

Dome-forming eruption is a frequent eruptive style; lava domes result from intermittent, slow extrusion of viscous lava. Most dome-forming eruptions produce highly microcrystallized and highly- to almost totally-degassed magmas which have a low explosive potential. During lava dome growth, recurrent collapses of unstable parts are the main destructive process of the lava dome, generating concentrated pyroclastic density currents (C-PDC) channelized in valleys. These C-PDC have a high, but localized, damage potential that largely depends on the collapsed volume. Sometimes, a dilute ash cloud surge develops at the top of the concentrated flow with an increased destructive effect because it may overflow ridges and affect larger areas. In some cases, large lava dome collapses can induce a depressurization of the magma within the conduit, leading to vulcanian explosions. By contrast, violent, laterally directed, explosions may occur at the base of a growing lava dome: this activity generates dilute and turbulent, highly-destructive, pyroclastic density currents (D-PDC), with a high velocity and propagation poorly dependent on the topography. Numerous studies on lava dome behaviors exist, but the triggering of lava dome explosions is poorly understood. Here, seven dome-forming eruptions are investigated: in the Lesser Antilles arc: Montagne Pelée, Martinique (1902-1905, 1929-1932 and 650 y. BP eruptions), Soufrière Hills, Montserrat; in Guatemala, Santiaguito (1929 eruption); in La Chaîne des Puys, France (Puy de Dome and Puy Chopine eruptions). We propose a new model of superficial lava-dome explosivity based upon a textural and geochemical study (vesicularity, microcrystallinity, cristobalite distribution, residual water contents, crystal transit times) of clasts produced by these key eruptions. Superficial explosion of a growing lava dome may be promoted through porosity reduction caused by both vesicle flattening due to gas escape and syn-eruptive cristobalite precipitation. Both processes generate an impermeable and rigid carapace allowing overpressurisation of the inner parts of the lava dome by the rapid input of vesiculated magma batches. The thickness of the cristobalite-rich carapace is an inverse function of the external lava dome surface area. Thus the probability of a superficial lava dome explosion inversely depends on its size; explosive activity more likely occurs at the onset of the lava dome extrusion in agreement with observations. We evidence a two-step process in magma ascent with edification of the lava dome that may be accompanied by a rapid ascent of an undegassed batch of magma some days prior the explosive activity. This new result is of interest for the whole volcanological community and for risk management.

Cycles of explosive and effusive eruptions at Kīlauea Volcano, Hawai‘i

USGS Publications Warehouse

Swanson, Don; Rose, Timothy R.; Mucek, Adonara E; Garcia, Michael O.; Fiske, Richard S.; Mastin, Larry G.

2014-01-01

The subaerial eruptive activity at Kīlauea Volcano (Hawai‘i) for the past 2500 yr can be divided into 3 dominantly effusive and 2 dominantly explosive periods, each lasting several centuries. The prevailing style of eruption for 60% of this time was explosive, manifested by repeated phreatic and phreatomagmatic activity in a deep summit caldera. During dominantly explosive periods, the magma supply rate to the shallow storage volume beneath the summit dropped to only a few percent of that during mainly effusive periods. The frequency and duration of explosive activity are contrary to the popular impression that Kīlauea is almost unceasingly effusive. Explosive activity apparently correlates with the presence of a caldera intersecting the water table. The decrease in magma supply rate may result in caldera collapse, because erupted or intruded magma is not replaced. Glasses with unusually high MgO, TiO2, and K2O compositions occur only in explosive tephra (and one related lava flow) and are consistent with disruption of the shallow reservoir complex during caldera formation. Kīlauea is a complex, modulated system in which melting rate, supply rate, conduit stability (in both mantle and crust), reservoir geometry, water table, and many other factors interact with one another. The hazards associated with explosive activity at Kīlauea’s summit would have major impact on local society if a future dominantly explosive period were to last several centuries. The association of lowered magma supply, caldera formation, and explosive activity might characterize other basaltic volcanoes, but has not been recognized.

The interplinian activity at Somma-Vesuvius in the last 3500 years

USGS Publications Warehouse

Rolandi, G.; Petrosino, P.; Mc, Geehin J.

1998-01-01

Between 1884 B.C. and A.D. 472, eruptive activity at Somma-Vesuvius was dominated by the three plinian eruptions of Avellino (3550 yr B.P.), Pompei (A.D. 79) and A.D. 472 and, as a result, little attention has been given to the intervening interplinian activity. The interplinian events are here reconstructed using new data from twenty stratigraphic sections around the lower flanks of the volcano. Three main eruptions have been identified fro the protohistoric period (3550 yr B.P.-A.D. 79). The first two occurred shortly after the Avellino event and both show a progression from magmatic to phreatomagmatic behaviour. The third eruption (2700 B.P.) consisted of five phreatomagmetic episodes separated by the emplacement of mud flows. Only one event, the explosive erupton of A.D. 203, has been identified for the ancient historic period (A.D. 79-472). In contrast, the A.D. 472 eruption was followed during the medievel period (A.D. 472-1631) by comparatively vigorous interplinian activity, including four strombolian-phreatomagmatic events and extensive lava effusion, which formed a summit cone (destroyed in A.D. 1631) similar to that on Vesuvius today. Such regular alternations of plinian and interplinian events are evident only since 3550 yr B.P. and provide important constraints for forecasting future behaviour at Somma-Vesuvius.

53BP1 promotes microhomology-mediated end-joining in G1-phase cells

PubMed Central

Xiong, Xiahui; Du, Zhanwen; Wang, Ying; Feng, Zhihui; Fan, Pan; Yan, Chunhong; Willers, Henning; Zhang, Junran

2015-01-01

Alternative non-homologous end joining (alt-NHEJ) was originally identified as a backup repair mechanism in the absence of classical NHEJ (c-NHEJ) factors but recent studies have demonstrated that alt-NHEJ is active even when c-NHEJ as well as homologous recombination is available. The functions of 53BP1 in NHEJ processes are not well understood. Here, we report that 53BP1 promotes DNA double-strand break (DSB) repair and genomic stability not only in c-NHEJ-proficient but also -deficient human G1-phase cells. Using an array of repair substrates we show that these effects of 53BP1 are correlated with a promotion of microhomology-mediated end-joining (MMEJ), a subtype of alt-NHEJ, in G1-phase. Consistent with a specific role in MMEJ we confirm that 53BP1 status does not affect c-NHEJ. 53BP1 supports sequence deletion during MMEJ consistent with a putative role in facilitating end-resection. Interestingly, promotion of MMEJ by 53BP1 in G1-phase cells is only observed in the presence of functional BRCA1. Depletion of both 53BP1 and BRCA1 increases repair needing microhomology usage and augments loss of DNA sequence, suggesting that MMEJ is a highly regulated DSB repair process. Together, these findings significantly expand our understanding of the cell-cycle-dependent roles of 53BP1 in DSB repair. PMID:25586219

A Study of Energy Partitioning Using A Set of Related Explosive Formulations

NASA Astrophysics Data System (ADS)

Lieber, Mark; Foster, Joseph C., Jr.; Stewart, D. Scott

2011-06-01

Condensed phase high explosives convert potential energy stored in the electro-magnetic field structure of complex molecules to kinetic energy during the detonation process. This energy is manifest in the internal thermodynamic energy and the translational flow of the products. Historically, the explosive design problem has focused on intramolecular stoichiometry providing prompt reactions based on transport physics at the molecular scale. Modern material design has evolved to approaches that employee intermolecular ingredients to alter the spatial and temporal distribution of energy release. CHEETA has been used to produce data for a set of fictitious explosive formulations based on C-4 to study the partitioning of the available energy between internal and flow energy in the detonation. The equation of state information from CHEETA has been used in ALE3D to develop an understanding of the relationship between variations in the formulation parameters and the internal energy cycle in the products.

Time course of blood pressure changes immediately after maximal exercise.

PubMed

Nakahara, H; Miyamoto, T; Nakanishi, Y; Kinoshita, H

2006-12-01

The aim of this study was to investigate the effect of exhaustive exercise on the time course of arterial blood pressure (BP) and heart rate (HR) during upright resting (inactive) and loadless pedaling (active) recovery from a bicycle exercise to exhaustion. The subjects were 11 healthy normotensive males. Systolic, diastolic and mean BP, and HR were recorded every 20 s for the initial 6 min of the recovery period. The time course of all BP measures during inactive and active recovery was characterized by a marked and sudden drop during the initial 20-s period, followed by a quick rise. This was followed by a gradual decline till the end of the recovery period. The time course of HR recovery, on the other hand, exhibited a smooth decline without the initial drop. With active recovery, the initial drop of diastolic and mean BP was less than the inactive recovery. After the 20 s period, the diastolic BP and HR were kept slightly higher with the active recovery than the inactive recovery. A sudden drop of the BP occurred at the initial recovery period of postcycle exercise to exhaustion though HR did not show such a change. The initial BP drop could be attenuated by the actively pedaling the cycle without load.

Polo-like kinase 1 inhibits DNA damage response during mitosis

PubMed Central

Benada, Jan; Burdová, Kamila; Lidak, Tomáš; von Morgen, Patrick; Macurek, Libor

2015-01-01

In response to genotoxic stress, cells protect their genome integrity by activation of a conserved DNA damage response (DDR) pathway that coordinates DNA repair and progression through the cell cycle. Extensive modification of the chromatin flanking the DNA lesion by ATM kinase and RNF8/RNF168 ubiquitin ligases enables recruitment of various repair factors. Among them BRCA1 and 53BP1 are required for homologous recombination and non-homologous end joining, respectively. Whereas mechanisms of DDR are relatively well understood in interphase cells, comparatively less is known about organization of DDR during mitosis. Although ATM can be activated in mitotic cells, 53BP1 is not recruited to the chromatin until cells exit mitosis. Here we report mitotic phosphorylation of 53BP1 by Plk1 and Cdk1 that impairs the ability of 53BP1 to bind the ubiquitinated H2A and to properly localize to the sites of DNA damage. Phosphorylation of 53BP1 at S1618 occurs at kinetochores and in cytosol and is restricted to mitotic cells. Interaction between 53BP1 and Plk1 depends on the activity of Cdk1. We propose that activity of Cdk1 and Plk1 allows spatiotemporally controlled suppression of 53BP1 function during mitosis. PMID:25607646

Polo-like kinase 1 inhibits DNA damage response during mitosis.

PubMed

Benada, Jan; Burdová, Kamila; Lidak, Tomáš; von Morgen, Patrick; Macurek, Libor

2015-01-01

In response to genotoxic stress, cells protect their genome integrity by activation of a conserved DNA damage response (DDR) pathway that coordinates DNA repair and progression through the cell cycle. Extensive modification of the chromatin flanking the DNA lesion by ATM kinase and RNF8/RNF168 ubiquitin ligases enables recruitment of various repair factors. Among them BRCA1 and 53BP1 are required for homologous recombination and non-homologous end joining, respectively. Whereas mechanisms of DDR are relatively well understood in interphase cells, comparatively less is known about organization of DDR during mitosis. Although ATM can be activated in mitotic cells, 53BP1 is not recruited to the chromatin until cells exit mitosis. Here we report mitotic phosphorylation of 53BP1 by Plk1 and Cdk1 that impairs the ability of 53BP1 to bind the ubiquitinated H2A and to properly localize to the sites of DNA damage. Phosphorylation of 53BP1 at S1618 occurs at kinetochores and in cytosol and is restricted to mitotic cells. Interaction between 53BP1 and Plk1 depends on the activity of Cdk1. We propose that activity of Cdk1 and Plk1 allows spatiotemporally controlled suppression of 53BP1 function during mitosis.

Variable magma reservoir depths for Tongariro Volcanic Complex eruptive deposits from 10,000 years to present

NASA Astrophysics Data System (ADS)

Arpa, Maria Carmencita; Zellmer, Georg F.; Christenson, Bruce; Lube, Gert; Shellnutt, Gregory

2017-07-01

Mineral, groundmass and bulk rock chemical analyses of samples from the Tongariro Volcanic Complex were made to estimate depths of magma reservoirs for selected eruptive deposits. The sample set consists of two units from the 11,000 cal. years bp Mangamate Formation (Te Rato and Wharepu) and more recent deposits from near 1717 cal. years bp (Ngauruhoe and Red Crater) to 1975 (Ngauruhoe). The depths of crystallization were determined by established thermobarometers. Results show that the Mangamate eruptions of Te Rato and Wharepu originated from a deeper magma reservoir of about 28-35 km and likely ascended rapidly, whereas explosive eruption deposits from Ngauruhoe have depths of crystallization in the lower to mid-crust or about 7 to 22 km depth. A Red Crater lava flow had a possible magma reservoir depth from 4 to 9 km. The different eruptions sampled for this study tapped different reservoir levels, and the oldest and largest eruptions were sourced from the deepest reservoir.

Large mid-Holocene and late Pleistocene earthquakes on the Oquirrh fault zone, Utah

USGS Publications Warehouse

Olig, S.S.; Lund, W.R.; Black, B.D.

1994-01-01

The Oquirrh fault zone is a range-front normal fault that bounds the east side of Tooele Valley and it has long been recognized as a potential source for large earthquakes that pose a significant hazard to population centers along the Wasatch Front in central Utah. Scarps of the Oquirrh fault zone offset the Provo shoreline of Lake Bonneville and previous studies of scarp morphology suggested that the most recent surface-faulting earthquake occurred between 9000 and 13,500 years ago. Based on a potential rupture length of 12 to 21 km from previous mapping, moment magnitude (Mw) estimates for this event range from 6.3 to 6.6 In contrast, our results from detailed mapping and trench excavations at two sites indicate that the most-recent event actually occurred between 4300 and 6900 yr B.P. (4800 and 7900 cal B.P.) and net vertical displacements were 2.2 to 2.7 m, much larger than expected considering estimated rupture lengths for this event. Empirical relations between magnitude and displacement yield Mw 7.0 to 7.2. A few, short discontinuous fault scarps as far south as Stockton, Utah have been identified in a recent mapping investigation and our results suggest that they may be part of the Oquirrh fault zone, increasing the total fault length to 32 km. These results emphasize the importance of integrating stratigraphic and geomorphic information in fault investigations for earthquake hazard evaluations. At both the Big Canyon and Pole Canyon sites, trenches exposed faulted Lake Bonneville sediments and thick wedges of fault-scarp derived colluvium associated with the most-recent event. Bulk sediment samples from a faulted debris-flow deposit at the Big Canyon site yield radiocarbon ages of 7650 ?? 90 yr B.P. and 6840 ?? 100 yr B.P. (all lab errors are ??1??). A bulk sediment sample from unfaulted fluvial deposits that bury the fault scarp yield a radiocarbon age estimate of 4340 ?? 60 yr B.P. Stratigraphic evidence for a pre-Bonneville lake cycle penultimate earthquake was exposed at the Pole Canyon site, and although displacement is not well constrained, the penultimate event colluvial wedge is comparable in size to the most-recent event wedges. Charcoal from a marsh deposit, which overlies the penultimate event colluvium and was deposited during the Bonneville lake cycle transgression, yields an AMS radiocarbon age of 20,370 ?? 120 yr B.P. Multiple charcoal fragments from fluvial deposits faulted during the penultimate event yield an AMS radiocarbon age of 26,200 ?? 200 yr B.P. Indirect stratigraphic evidence for an antepenultimate event was also exposed at Pole Canyon. Charcoal from fluvial sediments overlying the eroded free-face for this event yields an AMS age of 33,950 ?? 1160 yr B.P., providing a minimum limiting age on the antepenultimate event. Ages for the past two events on the Oquirrh fault zone yield a recurrence interval of 13,300 to 22,100 radiocarbon years and estimated slip rates of 0.1 to 0.2 mm/yr. Temporal clustering of earthquakes on the nearby Wasatch fault zone in the late Holocene does not appear to have influenced activity on the Oquirrh fault zone. However, consistent with findings on the Wasatch fault zone and with some other Quaternary faults within the Bonneville basin, we found evidence for higher rates of activity during interpluvial periods than during the Bonneville lake cycle. If a causal relation between rates of strain release along faults and changes in loads imposed by the lake does exist, it may have implications for fault dips and mechanics. However, our data are only complete for one deep-lake cycle (the past 32,000 radiocarbon years), and whether this pattern persisted during the previous Cutler Dam and Little Valley deep-lake cycles is unknown. ?? 1994.

RAAS polymorphisms alter the acute blood pressure response to aerobic exercise among men with hypertension.

PubMed

Blanchard, Bruce E; Tsongalis, Gregory J; Guidry, Margaux A; LaBelle, Lisa A; Poulin, Michelle; Taylor, Amy L; Maresh, Carl M; Devaney, Joseph; Thompson, Paul D; Pescatello, Linda S

2006-05-01

Limited evidence suggests renin-angiotensin-aldosterone system (RAAS) polymorphisms alter the blood pressure (BP) response to aerobic exercise training. We examined if RAAS polymorphisms influenced postexercise hypotension in men with high normal to Stage 1 hypertension. Forty-seven men (44.2+/-1.4 years, 145.1+/-1.6/85.5+/-1.1 mmHg) randomly completed three experiments: seated rest (control) and two cycle exercise bouts at 40% (LITE) and 60% (MOD) of maximal oxygen consumption. Ambulating BP was measured for 14 h after each experiment. RAAS polymorphisms associated with hypertension (i.e. angiotensin converting I enzyme, ACE I/D; angiotensin II type 1 receptor, AT1R A/C; and intron 2 of aldosterone synthase, Int2 W/C) were analyzed using polymerase chain reaction and restriction enzyme digestion. Repeated measure ANOVA tested if BP differed between experimental conditions by RAAS genotypes. Compared to men with 0-2 variant alleles, men with > or =3 combined RAAS variant alleles had lower average systolic BP (SBP) (P=0.030) and lower average diastolic BP (DBP) (P=0.009) for 14 h only after LITE. In contrast, average BP was not different for MOD and control between RAAS variant allele groups over this time period (P> or =0.05). LITE reduced BP in men with > or =3 variant RAAS alleles for 14 h, whereas MOD had no influence on BP in these men. In order to optimally prescribe exercise for its BP lowering benefits in those with hypertension, additional knowledge of how genetic variation affects the BP response to exercise is needed.

Comparison of the Force-, Velocity- and Power-Time Curves Between the Concentric-Only and Eccentric-Concentric Bench Press Exercises.

PubMed

Pérez-Castilla, Alejandro; Comfort, Paul; McMahon, John J; Pestaña-Melero, Francisco Luis; García-Ramos, Amador

2018-01-17

The aim of this study was to compare the temporal and mechanical variables between the concentric-only and eccentric-concentric bench press (BP) variants. Twenty-one men (age: 22.0±4.2 years, body mass: 73.4±7.7 kg, height: 177.2±8.0 cm; one-repetition maximum [1RM]: 1.12±0.12 kg⋅kg) were evaluated during the concentric-only and eccentric-concentric BP variants using 80% 1RM. Temporal (concentric phase duration, propulsive phase duration, and time to reach the maximum values of force, velocity, and power) and mechanical variables (force, velocity, and power), determined using a linear velocity transducer, were compared between both BP variants. All temporal variables were significantly lower during the eccentric-concentric BP compared to the concentric-only BP (P < 0.05; effect size [ES] range: 0.80-2.52). Maximum force as well as the mean values of velocity and power were significantly higher for the eccentric-concentric BP compared to the concentric-only BP (all P < 0.001; ES range: 2.87-3.58). However, trivial to small differences between both BP variants were observed for mean force (ES: 0.00-0.36) as well as for maximum velocity (ES: 0.40) and power (ES: 0.41). The stretch-shortening cycle (i.e., eccentric-concentric BP) mainly enhanced force production at the early portion of the concentric phase, but this potentiation effect gradually reduced over the latter part of the movement. Finally, force was higher for the concentric-only BP during 49% of the concentric phase duration. These results suggest that both BP variants should be included during resistance training programs in order to optimize force output at different points of the concentric phase.

Climatic Oscillations 10,000-155,000 yr B.P. at Owens Lake, California Reflected in Glacial Rock Flour Abundance and Lake Salinity in Core OL-92

NASA Astrophysics Data System (ADS)

Bischoff, James L.; Menking, Kirsten M.; Fitts, Jeffrey P.; Fitzpatrick, John A.

1997-11-01

Chemical analyses of the acid-soluble and clay-size fractions of sediment samples (1500-yr resolution) reveal oscillations of lake salinity and of glacial advances in core OL-92 back to 155,000 yr B.P. Relatively saline conditions are indicated by the abundance of carbonate and smectite (both pedogenic and authigenic), reflected by Ca, Sr, and Mg in the acid-soluble suite, and by Cs 2O, excess MgO, and LOI (loss on ignition) in the clay-size fraction. Rock flour produced during glacial advances is represented by the abundance of detrital plagioclase and biotite in the clay-size fraction, the ratio of which remains essentially constant over the entire time span. These phases are quantitatively represented by Na 2O, TiO 2, Ba, and Mn in the clay fraction. The rock-flour record indicates two major ice-advances during the penultimate glacial cycle corresponding to marine isotope stage (MIS) 6, no major advances during the last interglaciation (entire MIS 5), and three major advances during the last glacial cycle (MIS 2, 3, and 4). The ages of the latter three correspond rather well to 36Cl dates reported for Sierra Nevada moraines. The onset of the last interglaciation is shown by abrupt increases in authigenic CaCO 3and an abrupt decrease in rock flour, at about 118,000 yr B.P. according to our time scale. In contrast, the boundary appears to be gradual in the δ 18O record in which the change from light to heavy values begins at about 140,000 yrs B.P. The exact position of the termination, therefore, may be proxy-dependent. Conditions of high carbonate and low rock flour prevailed during the entire period from 118,000 yr B.P. until the glacial advance at 53,000 yr B.P. signaled the end of this long interglaciation.

Continuous and Cuffless Blood Pressure Monitoring Based on ECG and SpO2 Signals ByUsing Microsoft Visual C Sharp.

PubMed

Younessi Heravi, M A; Khalilzadeh, M A; Joharinia, S

2014-03-01

One of the main problems especially in operating room and monitoring devices is measurement of Blood Pressure (BP) by sphygmomanometer cuff. Objective :In this study we designed a new method to measure BP changes continuously for detecting information between cuff inflation times by using vital signals in monitoring devices. This will be achieved by extraction of the time difference between each cardiac cycle and a relative pulse wave. Finger pulse and ECG signals in lead I were recorded by a monitoring device. The output of monitoring device wasinserted in a computer by serial network communication. A software interface (Microsoft Visual C#.NET ) was used to display and process the signals in the computer. Time difference between each cardiac cycle and pulse signal was calculated throughout R wave detection in ECG and peak of pulse signal by the software. The relation between time difference in two waves and BP was determined then the coefficients of equation were obtained in different physical situations. The results of estimating BP were compared with the results of sphygmomanometer method and the error rate was calculated. In this study, 25 subjects participated among them 15 were male and 10 were female. The results showed that BP was linearly related to time difference. Average of coefficient correlation was 0.9±0.03 for systolic and 0.82±0.04 for diastolic blood pressure. The highest error percentage was calculated 8% for male and 11% for female group. Significant difference was observed between the different physical situation and arm movement changes. The relationship between time difference and age was estimated in a linear relationship with a correlation coefficient of 0.76. By determining linear relation values with high accuracy, BP can be measured with insignificant error. Therefore it can be suggested as a new method to measure the blood pressure continuously.

Climatic Oscillations 10,000-155,000 yr B.P. at Owens Lake, California Reflected in Glacial Rock Flour Abundance and Lake Salinity in Core OL-92

USGS Publications Warehouse

Bischoff, J.L.; Menking, K.M.; Fitts, J.P.; Fitzpatrick, J.A.

1997-01-01

Chemical analyses of the acid-soluble and clay-size fractions of sediment samples (1500-yr resolution) reveal oscillations of lake salinity and of glacial advances in core OL-92 back to 155,000 yr B.P. Relatively saline conditions are indicated by the abundance of carbonate and smectite (both pedogenic and authigenic), reflected by Ca, Sr, and Mg in the acid-soluble suite, and by Cs2O, excess MgO, and LOI (loss on ignition) in the clay-size fraction. Rock flour produced during glacial advances is represented by the abundance of detrital plagioclase and biotite in the clay-size fraction, the ratio of which remains essentially constant over the entire time span. These phases are quantitatively represented by Na2O, TiO2, Ba, and Mn in the clay fraction. The rock-flour record indicates two major ice-advances during the penultimate glacial cycle corresponding to marine isotope stage (MIS) 6, no major advances during the last interglaciation (entire MIS 5), and three major advances during the last glacial cycle (MIS 2, 3, and 4). The ages of the latter three correspond rather well to 36Cl dates reported for Sierra Nevada moraines. The onset of the last interglaciation is shown by abrupt increases in authigenic CaCO3 and an abrupt decrease in rock flour, at about 118,000 yr B.P. according to our time scale. In contrast, the boundary appears to be gradual in the ??18O record in which the change from light to heavy values begins at about 140,000 yrs B.P. The exact position of the termination, therefore, may be proxy-dependent. Conditions of high carbonate and low rock flour prevailed during the entire period from 118,000 yr B.P. until the glacial advance at 53,000 yr B.P. signaled the end of this long interglaciation. ?? 1997 University of Washington.

Palaeolithic Timekeepers Looking At The Golden Gate Of The Ecliptic; The Lunar Cycle And The Pleiades In The Cave Of La-TETe-Du-Lion (Ardéche, France) - 21,000 BP

NASA Astrophysics Data System (ADS)

Rappenglück, Michael A.

Decades of research work done by several scientists all over the world since the beginning of the 20th century confirmed the idea, that Palaeolithic man looked up to the starry sky and recognized prominent patterns of stars as well as the course of the celestial bodies. Though sometimes highly speculative, the investigations made clear, that time-factored notations played an important role in the archaic cultures of Palaeolithic epochs (from 33,000 to 10,000 BP). There are some distinct and detailed examples of lunar-, solar- and lunisolar-calendars sometimes combined with pictures of seasonality, mostly discovered on transportable bones and stones, but also on the fixed walls of certain caves. The investigations showed that in Palaeolithic epochs time-reckoning, in particular the lunar cycle, had been related to the pregnancy of women too (Figure 2a-d). Recently I showed, that in the Magdalenian time (16,000-12,000 BP) man also recognized single and very complex star patterns, including the Milky Way: the Northern Crown in the cave of El Castillo (Spain), the Pleiades in the cave of Lascaux (France) and the main constellations of the sky at the same location. They were used by the Palaeolithic hunter-gatherers for orientation in space and for time-reckoning. These star patterns also played an important role in the cosmovisions of archaic cultures. Together with the depictions of the course of the moon and the sun, they helped to organize the spatiotemporal structure of daily and spiritual life of Palaeolithic man. Now I present a rock panel in the cave of La-T^ete-du-Lion (France) that shows the combination of a star pattern - Aldebaran in the Bull and the Pleiades - with a drawing of the moons cycle above. This picture comes from the Solutrean epoch ca 21,000-22,000 BP. It shows not only a remarkable similarity with the representation in the Lascaux cave, but clearly connects the star pattern with a part of the lunar cycle.

Cardiac Myosin Binding Protein C Phosphorylation Affects Cross-Bridge Cycle's Elementary Steps in a Site-Specific Manner

PubMed Central

Wang, Li; Sadayappan, Sakthivel; Kawai, Masakata

2014-01-01

Based on our recent finding that cardiac myosin binding protein C (cMyBP-C) phosphorylation affects muscle contractility in a site-specific manner, we further studied the force per cross-bridge and the kinetic constants of the elementary steps in the six-state cross-bridge model in cMyBP-C mutated transgenic mice for better understanding of the influence of cMyBP-C phosphorylation on contractile functions. Papillary muscle fibres were dissected from cMyBP-C mutated mice of ADA (Ala273-Asp282-Ala302), DAD (Asp273-Ala282-Asp302), SAS (Ser273-Ala282-Ser302), and t/t (cMyBP-C null) genotypes, and the results were compared to transgenic mice expressing wide-type (WT) cMyBP-C. Sinusoidal analyses were performed with serial concentrations of ATP, phosphate (Pi), and ADP. Both t/t and DAD mutants significantly reduced active tension, force per cross-bridge, apparent rate constant (2πc), and the rate constant of cross-bridge detachment. In contrast to the weakened ATP binding and enhanced Pi and ADP release steps in t/t mice, DAD mice showed a decreased ADP release without affecting the ATP binding and the Pi release. ADA showed decreased ADP release, and slightly increased ATP binding and cross-bridge detachment steps, whereas SAS diminished the ATP binding step and accelerated the ADP release step. t/t has the broadest effects with changes in most elementary steps of the cross-bridge cycle, DAD mimics t/t to a large extent, and ADA and SAS predominantly affect the nucleotide binding steps. We conclude that the reduced tension production in DAD and t/t is the result of reduced force per cross-bridge, instead of the less number of strongly attached cross-bridges. We further conclude that cMyBP-C is an allosteric activator of myosin to increase cross-bridge force, and its phosphorylation status modulates the force, which is regulated by variety of protein kinases. PMID:25420047

Seychelles coral record of changes in sea surface temperature bimodality in the western Indian Ocean from the Mid-Holocene to the present

NASA Astrophysics Data System (ADS)

Zinke, J.; Pfeiffer, M.; Park, W.; Schneider, B.; Reuning, L.; Dullo, W.-Chr.; Camoin, G. F.; Mangini, A.; Schroeder-Ritzrau, A.; Garbe-Schönberg, D.; Davies, G. R.

2014-08-01

We report fossil coral records from the Seychelles comprising individual time slices of 14-20 sclerochronological years between 2 and 6.2 kyr BP to reconstruct changes in the seasonal cycle of western Indian Ocean sea surface temperature (SST) compared to the present (1990-2003). These reconstructions allowed us to link changes in the SST bimodality to orbital changes, which were causing a reorganization of the seasonal insolation pattern. Our results reveal the lowest seasonal SST range in the Mid-Holocene (6.2-5.2 kyr BP) and around 2 kyr BP, while the highest range is observed around 4.6 kyr BP and between 1990 and 2003. The season of maximum temperature shifts from austral spring (September to November) to austral autumn (March to May), following changes in seasonal insolation over the past 6 kyr. However, the changes in SST bimodality do not linearly follow the insolation seasonality. For example, the 5.2 and 6.2 kyr BP corals show only subtle SST differences in austral spring and autumn. We use paleoclimate simulations of a fully coupled atmosphere-ocean general circulation model to compare with proxy data for the Mid-Holocene around 6 kyr BP. The model results show that in the Mid-Holocene the austral winter and spring seasons in the western Indian Ocean were warmer while austral summer was cooler. This is qualitatively consistent with the coral data from 6.2 to 5.2 kyr BP, which shows a similar reduction in the seasonal amplitude compared to the present day. However, the pattern of the seasonal SST cycle in the model appears to follow the changes in insolation more directly than indicated by the corals. Our results highlight the importance of ocean-atmosphere interactions for Indian Ocean SST seasonality throughout the Holocene. In order to understand Holocene climate variability in the countries surrounding the Indian Ocean, we need a much more comprehensive analysis of seasonally resolved archives from the tropical Indian Ocean. Insolation data alone only provides an incomplete picture.

Cardiac myosin binding protein C phosphorylation affects cross-bridge cycle's elementary steps in a site-specific manner.

PubMed

Wang, Li; Sadayappan, Sakthivel; Kawai, Masakata

2014-01-01

Based on our recent finding that cardiac myosin binding protein C (cMyBP-C) phosphorylation affects muscle contractility in a site-specific manner, we further studied the force per cross-bridge and the kinetic constants of the elementary steps in the six-state cross-bridge model in cMyBP-C mutated transgenic mice for better understanding of the influence of cMyBP-C phosphorylation on contractile functions. Papillary muscle fibres were dissected from cMyBP-C mutated mice of ADA (Ala273-Asp282-Ala302), DAD (Asp273-Ala282-Asp302), SAS (Ser273-Ala282-Ser302), and t/t (cMyBP-C null) genotypes, and the results were compared to transgenic mice expressing wide-type (WT) cMyBP-C. Sinusoidal analyses were performed with serial concentrations of ATP, phosphate (Pi), and ADP. Both t/t and DAD mutants significantly reduced active tension, force per cross-bridge, apparent rate constant (2πc), and the rate constant of cross-bridge detachment. In contrast to the weakened ATP binding and enhanced Pi and ADP release steps in t/t mice, DAD mice showed a decreased ADP release without affecting the ATP binding and the Pi release. ADA showed decreased ADP release, and slightly increased ATP binding and cross-bridge detachment steps, whereas SAS diminished the ATP binding step and accelerated the ADP release step. t/t has the broadest effects with changes in most elementary steps of the cross-bridge cycle, DAD mimics t/t to a large extent, and ADA and SAS predominantly affect the nucleotide binding steps. We conclude that the reduced tension production in DAD and t/t is the result of reduced force per cross-bridge, instead of the less number of strongly attached cross-bridges. We further conclude that cMyBP-C is an allosteric activator of myosin to increase cross-bridge force, and its phosphorylation status modulates the force, which is regulated by variety of protein kinases.

Volcanic sulfur dioxide index and volcanic explosivity index inferred from eruptive volume of volcanoes in Jeju Island, Korea: application to volcanic hazard mitigation

NASA Astrophysics Data System (ADS)

Ko, Bokyun; Yun, Sung-Hyo

2016-04-01

Jeju Island located in the southwestern part of Korea Peninsula is a volcanic island composed of lavaflows, pyroclasts, and around 450 monogenetic volcanoes. The volcanic activity of the island commenced with phreatomagmatic eruptions under subaqueous condition ca. 1.8-2.0 Ma and lasted until ca. 1,000 year BP. For evaluating volcanic activity of the most recently erupted volcanoes with reported age, volcanic explosivity index (VEI) and volcanic sulfur dioxide index (VSI) of three volcanoes (Ilchulbong tuff cone, Songaksan tuff ring, and Biyangdo scoria cone) are inferred from their eruptive volumes. The quantity of eruptive materials such as tuff, lavaflow, scoria, and so on, is calculated using a model developed in Auckland Volcanic Field which has similar volcanic setting to the island. The eruptive volumes of them are 11,911,534 m3, 24,987,557 m3, and 9,652,025 m3, which correspond to VEI of 3, 3, and 2, respectively. According to the correlation between VEI and VSI, the average quantity of SO2 emission during an eruption with VEI of 3 is 2-8 × 103 kiloton considering that the island was formed under intraplate tectonic setting. Jeju Island was regarded as an extinct volcano, however, several studies have recently reported some volcanic eruption ages within 10,000 year BP owing to the development in age dating technique. Thus, the island is a dormant volcano potentially implying high probability to erupt again in the future. The volcanoes might have explosive eruptions (vulcanian to plinian) with the possibility that SO2 emitted by the eruption reaches stratosphere causing climate change due to backscattering incoming solar radiation, increase in cloud reflectivity, etc. Consequently, recommencement of volcanic eruption in the island is able to result in serious volcanic hazard and this study provides fundamental and important data for volcanic hazard mitigation of East Asia as well as the island. ACKNOWLEDGMENTS: This research was supported by a grant [MPSS-NH-2015-81] through the Natural Hazard Mitigation Research Group funded by Ministry of Public Safety and Security of Korean government.

Assessing cutoff values for increased exercise blood pressure to predict incident hypertension in a general population.

PubMed

Lorbeer, Roberto; Ittermann, Till; Völzke, Henry; Gläser, Sven; Ewert, Ralf; Felix, Stephan B; Dörr, Marcus

2015-07-01

Cutoff values for increased exercise blood pressure (BP) are not established in hypertension guidelines. The aim of the study was to assess optimal cutoff values for increased exercise BP to predict incident hypertension. Data of 661 normotensive participants (386 women) aged 25-77 years from the Study of Health in Pomerania (SHIP-1) with a 5-year follow-up were used. Exercise BP was measured at a submaximal level of 100 W and at maximum level of a symptom-limited cycle ergometry test. Cutoff values for increased exercise BP were defined at the maximum sum of sensitivity and specificity for the prediction of incident hypertension. The area under the receiver-operating characteristic curve (AUC) and net reclassification index (NRI) were calculated to investigate whether increased exercise BP adds predictive value for incident hypertension beyond established cardiovascular risk factors. In men, values of 160  mmHg (100  W level; AUC = 0.7837; NRI = 0.534, P < 0.001) and 210  mmHg (maximum level; AUC = 0.7677; NRI = 0.340, P = 0.003) were detected as optimal cutoff values for the definition of increased exercise SBP. A value of 190  mmHg (AUC = 0.8347; NRI = 0.519, P < 0.001) showed relevance for the definition of increased exercise SBP in women at the maximum level. According to our analyses, 190 and 210  mmHg are clinically relevant cutoff values for increased exercise SBP at the maximum exercise level of cycle ergometry test for women and men, respectively. In addition, for men, our analyses provided a cutoff value of 160  mmHg for increased exercise SBP at the 100  W level.

Climatic and cultural changes in the west Congo Basin forests over the past 5000 years

PubMed Central

Oslisly, Richard; White, Lee; Bentaleb, Ilham; Favier, Charly; Fontugne, Michel; Gillet, Jean-François; Sebag, David

2013-01-01

Central Africa includes the world's second largest rainforest block. The ecology of the region remains poorly understood, as does its vegetation and archaeological history. However, over the past 20 years, multidisciplinary scientific programmes have enhanced knowledge of old human presence and palaeoenvironments in the forestry block of Central Africa. This first regional synthesis documents significant cultural changes over the past five millennia and describes how they are linked to climate. It is now well documented that climatic conditions in the African tropics underwent significant changes throughout this period and here we demonstrate that corresponding shifts in human demography have had a strong influence on the forests. The most influential event was the decline of the strong African monsoon in the Late Holocene, resulting in serious disturbance of the forest block around 3500 BP. During the same period, populations from the north settled in the forest zone; they mastered new technologies such as pottery and fabrication of polished stone tools, and seem to have practised agriculture. The opening up of forests from 2500 BP favoured the arrival of metallurgist populations that impacted the forest. During this long period (2500–1400 BP), a remarkable increase of archaeological sites is an indication of a demographic explosion of metallurgist populations. Paradoxically, we have found evidence of pearl millet (Pennisetum glaucum) cultivation in the forest around 2200 BP, implying a more arid context. While Early Iron Age sites (prior to 1400 BP) and recent pre-colonial sites (two to eight centuries BP) are abundant, the period between 1600 and 1000 BP is characterized by a sharp decrease in human settlements, with a population crash between 1300 and 1000 BP over a large part of Central Africa. It is only in the eleventh century that new populations of metallurgists settled into the forest block. In this paper, we analyse the spatial and temporal distribution of 328 archaeological sites that have been reliably radiocarbon dated. The results allow us to piece together changes in the relationships between human populations and the environments in which they lived. On this basis, we discuss interactions between humans, climate and vegetation during the past five millennia and the implications of the absence of people from the landscape over three centuries. We go on to discuss modern vegetation patterns and African forest conservation in the light of these events. PMID:23878334

Acute physiological responses to low-intensity blood flow restriction cycling.

PubMed

Thomas, H J; Scott, B R; Peiffer, J J

2018-04-09

Blood flow restriction (BFR) during interval cycling may stimulate aerobic and anaerobic adaptations. However, acute physiological responses to BFR interval cycling have not been extensively investigated. Eighteen males completed low-intensity (LI), low-intensity with BFR (LI BFR ) and high-intensity (HI) interval cycling sessions in randomised and counterbalanced order. These included a standardised warm-up and three two-min intervals interspersed with two-min recovery. Interval intensity during HI, LI and LI BFR were 85%, 40% and 40% of peak power output obtained during graded exercise tests. During LI BFR , 80% arterial occlusion was applied to both legs during the interval efforts and removed during recovery. Continuous measures of heart rate (HR), cardiac output (CO) and oxygen consumption (V˙O 2 ) were recorded. Blood pressure (BP) and rating of perceived exertion (RPE) were measured following intervals. Blood lactate concentration was measured pre- and post-exercise. BP, HR, CO, V˙O 2 , lactate and RPE were greatest during HI. During the active intervals, BP, HR and CO were greater during LI BFR than LI. V˙O 2 during recovery periods were greater in LI BFR than LI. Post-session lactate was greater during LI BFR than LI. Importantly, mean arterial pressure during interval three was significantly greater in LI BFR (124±2mmHg) than HI (114±3mmHg). LI BFR increases cardiovascular and metabolic stress compared with LI and could provide an alternative aerobic training method for individuals unable to perform high-intensity exercise. However, increases in mean arterial pressure during LI BFR indicates high myocardial workload, and practitioners should therefore use caution if prescribing LI BFR for vascular compromised individuals. Copyright © 2018 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

Interactions of the Human MCM-BP Protein with MCM Complex Components and Dbf4

PubMed Central

Nguyen, Tin; Jagannathan, Madhav; Shire, Kathy; Frappier, Lori

2012-01-01

MCM-BP was discovered as a protein that co-purified from human cells with MCM proteins 3 through 7; results which were recapitulated in frogs, yeast and plants. Evidence in all of these organisms supports an important role for MCM-BP in DNA replication, including contributions to MCM complex unloading. However the mechanisms by which MCM-BP functions and associates with MCM complexes are not well understood. Here we show that human MCM-BP is capable of interacting with individual MCM proteins 2 through 7 when co-expressed in insect cells and can greatly increase the recovery of some recombinant MCM proteins. Glycerol gradient sedimentation analysis indicated that MCM-BP interacts most strongly with MCM4 and MCM7. Similar gradient analyses of human cell lysates showed that only a small amount of MCM-BP overlapped with the migration of MCM complexes and that MCM complexes were disrupted by exogenous MCM-BP. In addition, large complexes containing MCM-BP and MCM proteins were detected at mid to late S phase, suggesting that the formation of specific MCM-BP complexes is cell cycle regulated. We also identified an interaction between MCM-BP and the Dbf4 regulatory component of the DDK kinase in both yeast 2-hybrid and insect cell co-expression assays, and this interaction was verified by co-immunoprecipitation of endogenous proteins from human cells. In vitro kinase assays showed that MCM-BP was not a substrate for DDK but could inhibit DDK phosphorylation of MCM4,6,7 within MCM4,6,7 or MCM2-7 complexes, with little effect on DDK phosphorylation of MCM2. Since DDK is known to activate DNA replication through phosphorylation of these MCM proteins, our results suggest that MCM-BP may affect DNA replication in part by regulating MCM phosphorylation by DDK. PMID:22540012

Interactions of the human MCM-BP protein with MCM complex components and Dbf4.

PubMed

Nguyen, Tin; Jagannathan, Madhav; Shire, Kathy; Frappier, Lori

2012-01-01

MCM-BP was discovered as a protein that co-purified from human cells with MCM proteins 3 through 7; results which were recapitulated in frogs, yeast and plants. Evidence in all of these organisms supports an important role for MCM-BP in DNA replication, including contributions to MCM complex unloading. However the mechanisms by which MCM-BP functions and associates with MCM complexes are not well understood. Here we show that human MCM-BP is capable of interacting with individual MCM proteins 2 through 7 when co-expressed in insect cells and can greatly increase the recovery of some recombinant MCM proteins. Glycerol gradient sedimentation analysis indicated that MCM-BP interacts most strongly with MCM4 and MCM7. Similar gradient analyses of human cell lysates showed that only a small amount of MCM-BP overlapped with the migration of MCM complexes and that MCM complexes were disrupted by exogenous MCM-BP. In addition, large complexes containing MCM-BP and MCM proteins were detected at mid to late S phase, suggesting that the formation of specific MCM-BP complexes is cell cycle regulated. We also identified an interaction between MCM-BP and the Dbf4 regulatory component of the DDK kinase in both yeast 2-hybrid and insect cell co-expression assays, and this interaction was verified by co-immunoprecipitation of endogenous proteins from human cells. In vitro kinase assays showed that MCM-BP was not a substrate for DDK but could inhibit DDK phosphorylation of MCM4,6,7 within MCM4,6,7 or MCM2-7 complexes, with little effect on DDK phosphorylation of MCM2. Since DDK is known to activate DNA replication through phosphorylation of these MCM proteins, our results suggest that MCM-BP may affect DNA replication in part by regulating MCM phosphorylation by DDK.

Mesoscale evolution of voids and microstructural changes in HMX-based explosives during heating through the β-δ phase transition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willey, Trevor M., E-mail: willey1@llnl.gov; Lauderbach, Lisa; Gagliardi, Franco

HMX-based explosives LX-10 and PBX-9501 were heated through the β-δ phase transition. Ultra-small angle x-ray scattering (USAXS) and molecular diffraction were simultaneously recorded as the HMX was heated. Mesoscale voids and structure dramatically change promptly with the β-δ phase transition, rather than with other thermal effects. Also, x-ray induced damage, observed in the USAXS, occurs more readily at elevated temperatures; as such, the dose was reduced to mitigate this effect. Optical microscopy performed during a similar heating cycle gives an indication of changes on longer length scales, while x-ray microtomography, performed before and after heating, shows the character of extensivemore » microstructural damage resulting from the temperature cycle and solid-state phase transition.« less

Mesoscale evolution of voids and microstructural changes in HMX-based explosives during heating through the β-δ phase transition

DOE PAGES

Willey, Trevor M.; Lauderbach, Lisa; Gagliardi, Franco; ...

2015-08-07

HMX-based explosives LX-10 and PBX-9501 were heated through the β-δ phase transition. Ultra-small angle x-ray scattering (USAXS) and molecular diffraction were simultaneously recorded as the HMX was heated. Mesoscale voids and structure dramatically change promptly with the β-δ phase transition, rather than with other thermal effects. Also, x-ray induced damage, observed in the USAXS, occurs more readily at elevated temperatures; as such, the dose was reduced to mitigate this effect. Optical microscopy performed during a similar heating cycle gives an indication of changes on longer length scales, while x-ray microtomography, performed before and after heating, shows the character of extensivemore » microstructural damage resulting from the temperature cycle and solid-state phase transition.« less

Holocene Record Of The Cuitzeo Lake, Michoacan, Central Mexico

NASA Astrophysics Data System (ADS)

Israde-Alcantar, I.; Bischoff, J.; Cram, S.; Ruiz-Fernandez, C.; Barron, J.; Lozano-Garcia, S.; Ortega-Guerrero, B.; Garduño-Monroy, V. H.

2007-05-01

A 205 cm-long core spanning the last ca.10,000 years was taken in the western basin of Lake Cuitzeo, located in the tectonic depressions of central Mexico. Age control for the core is provided by four AMS dates on organic sediment. The uppermost 30 cm of the core appears to be highly bioturbated according to Pb210 chronologies. A time plot of mass-accumulation rates of sediment (g/cm2/kyr) shows high rates from 10,000 to 6000 yrs BP, strikingly reduced mid-Holocene rates, and increasing rates post 1000 yrs (which could be due to introduction of European ranching and agriculture). Organic and inorganic carbon (TOC. TIC), diatoms, iron and titanium concentrations were analyzed and used to infer variations in the hydrological cycle and climatic conditions. The lower part of the core (ca.8000 C14 yr B.P.) is characterized by high percents of CaCO3 (more than 35 percent) which rapidly declines to values less than 20 percent after ca. 6000 C14 yr B.P., likely reflecting reduced summer precipitation due to decline summer insolation. Coincident with this decline in percents CaCO3 there is a decline greater that two-fold sediment accumulation rates and an increase in percents TOC. Two peaks TOC are recorded at 909 and 6744 C14 yr B.P. suggesting increased precipitation. The TOC peak at 909 C14 yr B.P. may be associated with increased precipitation during the Medieval Warm Period. The middle Holocene TOC peak at 6744 C14 yr B.P. coincides with a period of increased precipitation in the Cariaco Basin of Venezuela. These changes in precipitation are similar to those recorded in lake records from Guatemala and the marine record of the Cariaco Basin and can be explained by shifts in the mean latitude of the Atlantic Intertropical Convergence Zone (ITCZ). The upper 100 cm of the core was studied at 1 cm intervals for metals (Al, Fe, Ti, Pb, etc.) using ICPMS geochemistry. These metals show strong cycles throughout the studied interval which may reflect wet-dry cycles. A two fold reduction in percent Ti between ca. 56 and 31 cm in the core may reflect increased aridity between ca. 2,400 and 800 C14 yr B.P. A greater than three-fold increase in Ti mass accumulation rates in the uppermost part of the core likely is due to increase erosion caused by agriculture during the past ca. 400 years. Diatom, magnetic susceptibility and pollen analyses that are in progress on the Lake Cutizeo core will refine the paleoenvironmental history of this central Mexican lake and will be compared with other continental and marine Holocene records.

Characterization of a Bvg-regulated fatty acid methyl-transferase in Bordetella pertussis.

PubMed

Rivera-Millot, Alex; Lesne, Elodie; Solans, Luis; Coutte, Loic; Bertrand-Michel, Justine; Froguel, Philippe; Dhennin, Véronique; Hot, David; Locht, Camille; Antoine, Rudy; Jacob-Dubuisson, Françoise

2017-01-01

The whooping cough agent Bordetella pertussis controls the expression of its large virulence regulon in a coordinated manner through the two-component signal transduction system BvgAS. In addition to the genes coding for bona fide virulence factors, the Bvg regulon comprises genes of unknown function. In this work, we characterized a new Bvg-activated gene called BP2936. Homologs of BP2936 are found in other pathogenic Bordetellae and in several other species, including plant pathogens and environmental bacteria. We showed that the gene product of BP2936 is a membrane-associated methyl-transferase of free fatty acids. We thus propose to name it FmtB, for fatty acid methyl-transferase of Bordetella. The role of this protein was tested in cellular and animal models of infection, but the loss of BP2936 did not appear to affect host-pathogen interactions in those assays. The high level of conservation of BP2936 among B. pertussis isolates nevertheless argues that it probably plays a role in the life cycle of this pathogen.

Flexible black phosphorus ambipolar transistors, circuits and AM demodulator.

PubMed

Zhu, Weinan; Yogeesh, Maruthi N; Yang, Shixuan; Aldave, Sandra H; Kim, Joon-Seok; Sonde, Sushant; Tao, Li; Lu, Nanshu; Akinwande, Deji

2015-03-11

High-mobility two-dimensional (2D) semiconductors are desirable for high-performance mechanically flexible nanoelectronics. In this work, we report the first flexible black phosphorus (BP) field-effect transistors (FETs) with electron and hole mobilities superior to what has been previously achieved with other more studied flexible layered semiconducting transistors such as MoS2 and WSe2. Encapsulated bottom-gated BP ambipolar FETs on flexible polyimide afforded maximum carrier mobility of about 310 cm(2)/V·s with field-effect current modulation exceeding 3 orders of magnitude. The device ambipolar functionality and high-mobility were employed to realize essential circuits of electronic systems for flexible technology including ambipolar digital inverter, frequency doubler, and analog amplifiers featuring voltage gain higher than other reported layered semiconductor flexible amplifiers. In addition, we demonstrate the first flexible BP amplitude-modulated (AM) demodulator, an active stage useful for radio receivers, based on a single ambipolar BP transistor, which results in audible signals when connected to a loudspeaker or earphone. Moreover, the BP transistors feature mechanical robustness up to 2% uniaxial tensile strain and up to 5000 bending cycles.

MOF phosphorylation by ATM regulates 53BP1-mediated DSB repair pathway choice

PubMed Central

Gupta, Arun; Hunt, Clayton R.; Hegdec, Muralidhar L.; Chakraborty, Sharmistha; Udayakumar, Durga; Horikoshi, Nobuo; Singh1, Mayank; Ramnarain, Deepti B.; Hittelman, Walter N.; Namjoshi, Sarita; Asaithamby, Aroumougame; Hazra, Tapas K.; Ludwig, Thomas; Pandita, Raj K.; Tyler, Jessica K.; Pandita, Tej K.

2014-01-01

Cell cycle phase is a critical determinant of the choice between DNA damage repair by non-homologous end joining (NHEJ) or homologous recombination (HR). Here we report that DSBs induce ATM-dependent MOF (a histone H4 acetyl-transferase) phosphorylation (p-T392-MOF) and that phosphorylated MOF co-localizes with γ-H2AX, ATM, and 53BP1 foci. Mutation of the phosphorylation site (MOF-T392A) impedes DNA repair in S- and G2-phase but not G1-phase cells. Expression of MOF-T392A also reverses the reduction in DSB associated 53BP1 seen in wild type S/G2-phase cells, resulting in enhanced 53BP1 and reduced BRCA1 association. Decreased BRCA1 levels at DSB sites correlates with defective repairosome formation, reduced HR repair and decreased cell survival following irradiation. These data support a model whereby ATM mediated MOF-T392 phosphorylation modulates 53BP1 function to facilitate the subsequent recruitment of HR repair proteins, uncovering a regulatory role for MOF in DSB repair pathway choice during S/G2-phase. PMID:24953651

Characterization of a Bvg-regulated fatty acid methyl-transferase in Bordetella pertussis

PubMed Central

Rivera-Millot, Alex; Lesne, Elodie; Solans, Luis; Coutte, Loic; Bertrand-Michel, Justine; Froguel, Philippe; Dhennin, Véronique; Hot, David; Locht, Camille; Antoine, Rudy

2017-01-01

The whooping cough agent Bordetella pertussis controls the expression of its large virulence regulon in a coordinated manner through the two-component signal transduction system BvgAS. In addition to the genes coding for bona fide virulence factors, the Bvg regulon comprises genes of unknown function. In this work, we characterized a new Bvg-activated gene called BP2936. Homologs of BP2936 are found in other pathogenic Bordetellae and in several other species, including plant pathogens and environmental bacteria. We showed that the gene product of BP2936 is a membrane-associated methyl-transferase of free fatty acids. We thus propose to name it FmtB, for fatty acid methyl-transferase of Bordetella. The role of this protein was tested in cellular and animal models of infection, but the loss of BP2936 did not appear to affect host-pathogen interactions in those assays. The high level of conservation of BP2936 among B. pertussis isolates nevertheless argues that it probably plays a role in the life cycle of this pathogen. PMID:28493897

Supernova simulations from a 3D progenitor model - Impact of perturbations and evolution of explosion properties

NASA Astrophysics Data System (ADS)

Müller, Bernhard; Melson, Tobias; Heger, Alexander; Janka, Hans-Thomas

2017-11-01

We study the impact of large-scale perturbations from convective shell burning on the core-collapse supernova explosion mechanism using 3D multigroup neutrino hydrodynamics simulations of an 18M⊙ progenitor. Seed asphericities in the O shell, obtained from a recent 3D model of O shell burning, help trigger a neutrino-driven explosion 330 ms after bounce whereas the shock is not revived in a model based on a spherically symmetric progenitor for at least another 300 ms. We tentatively infer a reduction of the critical luminosity for shock revival by ˜ 20 {per cent} due to pre-collapse perturbations. This indicates that convective seed perturbations play an important role in the explosion mechanism in some progenitors. We follow the evolution of the 18M⊙ model into the explosion phase for more than 2 s and find that the cycle of accretion and mass ejection is still ongoing at this stage. With a preliminary value of 7.7 × 1050 erg for the diagnostic explosion energy, a baryonic neutron star mass of 1.85M⊙, a neutron star kick of ˜ 600 km s^{-1} and a neutron star spin period of ˜ 20 ms at the end of the simulation, the explosion and remnant properties are slightly atypical, but still lie comfortably within the observed distribution. Although more refined simulations and a larger survey of progenitors are still called for, this suggests that a solution to the problem of shock revival and explosion energies in the ballpark of observations is within reach for neutrino-driven explosions in 3D.

Association of cardiac myosin binding protein-C with the ryanodine receptor channel: putative retrograde regulation?

PubMed

Stanczyk, Paulina J; Seidel, Monika; White, Judith; Viero, Cedric; George, Christopher H; Zissimopoulos, Spyros; Lai, F Anthony

2018-06-21

The cardiac muscle ryanodine receptor-Ca 2+ release channel (RyR2) constitutes the sarcoplasmic reticulum (SR) Ca 2+ efflux mechanism that initiates myocyte contraction, while cardiac myosin binding protein-C (cMyBP-C) mediates regulation of acto-myosin cross-bridge cycling. In this report, we provide the first evidence for the presence of direct interaction between these two proteins, forming a RyR2:cMyBP-C complex. The C-terminus of cMyBP-C binds with the RyR2 N-terminus in mammalian cells and is not mediated by a fibronectin-like domain. Notably, we detected complex formation between both recombinant cMyBP-C and RyR2, as well as with the native proteins in cardiac tissue. Cellular Ca 2+ dynamics in HEK293 cells is altered upon co-expression of cMyBP-C and RyR2, with lowered frequency of RyR2-mediated spontaneous Ca 2+ oscillations, suggesting cMyBP-C exerts a potential inhibitory effect on RyR2-dependent Ca 2+ release. Discovery of a functional RyR2 association with cMyBP-C provides direct evidence for a putative mechanistic link between cytosolic soluble cMyBP-C and SR-mediated Ca 2+ release, via RyR2. Importantly, this interaction may have clinical relevance to the observed cMyBP-C and RyR2 dysfunction in cardiac pathologies, such as hypertrophic cardiomyopathy. © 2018. Published by The Company of Biologists Ltd.

Characteristics of 24 h Telemetered Blood Pressure in eNOS-Knockout and C57Bl/6J Control Mice

PubMed Central

Van Vliet, Bruce N; Chafe, Linda L; Montani, Jean-Pierre

2003-01-01

The purpose of the present study was to characterize in detail the 24 h blood pressure (BP) phenotype of mice lacking the gene for endothelial nitric oxide synthase (eNOS−/−) and the corresponding control strain (C57Bl/6J). Twenty-four hour BP recordings were made in conscious 12- to 16-week-old male mice 10 days following the implantation of a BP telemeter (n = 9 per group). The BP and heart rate of both strains were markedly affected by brief locomotor activity cycles, resulting in bimodal distributions of BP and heart rate within both light and dark periods. Data from active periods were associated with the higher of the two modes, whereas data from inactive periods were associated with the lower of the two modes. In eNOS−/− mice, the 24 h average BP level was significantly elevated (+15 %, 104 ± 2 vs. 119 ± 1 mmHg), as was its daily range (+44 %), its coefficient of variation (+26 %), dark-light difference (+48 %), and the separation of the two modes of its distribution (+41 %). Pulse pressure was also significantly greater (+23 %) in eNOS−/− mice. The 24 h heart rate level did not differ between control and eNOS−/− mice. Considerable variation was noted among previously published values of BP in eNOS−/− mice, but not in the corresponding control mice. Our results indicate that eNOS−/− mice have mild hypertension that is accompanied by more pronounced increases in BP lability and/or reactivity. Our results also demonstrate a marked effect of locomotor activity on BP in mice, which may confound short-term measurements of BP. PMID:12665600

Modifying scoping codes to accurately calculate TMI-cores with lifetimes greater than 500 effective full-power days

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bai, D.; Levine, S.L.; Luoma, J.

1992-01-01

The Three Mile Island unit 1 core reloads have been designed using fast but accurate scoping codes, PSUI-LEOPARD and ADMARC. PSUI-LEOPARD has been normalized to EPRI-CPM2 results and used to calculate the two-group constants, whereas ADMARC is a modern two-dimensional, two-group diffusion theory nodal code. Problems in accuracy were encountered for cycles 8 and higher as the core lifetime was increased beyond 500 effective full-power days. This is because the heavier loaded cores in both {sup 235}U and {sup 10}B have harder neutron spectra, which produces a change in the transport effect in the baffle reflector region, and the burnablemore » poison (BP) simulations were not accurate enough for the cores containing the increased amount of {sup 10}B required in the BP rods. In the authors study, a technique has been developed to take into account the change in the transport effect in the baffle region by modifying the fast neutron diffusion coefficient as a function of cycle length and core exposure or burnup. A more accurate BP simulation method is also developed, using integral transport theory and CPM2 data, to calculate the BP contribution to the equivalent fuel assembly (supercell) two-group constants. The net result is that the accuracy of the scoping codes is as good as that produced by CASMO/SIMULATE or CPM2/SIMULATE when comparing with measured data.« less

Exercise Thresholds on Trial: Are They Really Equivalent?

PubMed

Caen, Kevin; Vermeire, Kobe; Bourgois, Jan G; Boone, Jan

2018-06-01

The interchangeable use of whole-body exercise thresholds and breakpoints (BP) in the local oxygenation response, as measured via near-infrared spectroscopy, has recently been questioned in scientific literature. Therefore, the present study aimed to longitudinally investigate the interrelationship of four commonly used exercise thresholds: critical power (CP), the respiratory compensation point (RCP), and BP in muscle (m[HHb]BP) and brain (c[O2Hb]BP) oxygenation. Nine male participants (21.8 ± 1.2 yr) completed 6 wk of cycling interval training. Before and after this intervention period, subjects performed a ramp incremental exercise protocol to determine RCP, m[HHb]BP, and c[O2Hb]BP and four constant work rate (WR) tests to calculate CP. WR associated with CP, RCP, m[HHB]BP, and c[O2Hb]BP increased by 7.7% ± 4.2%, 13.6% ± 9.0%, 9.8% ± 5.7%, and 11.3% ± 11.1%, respectively. CP was lower (pre: 260 ± 32 W, post: 280 ± 41 W; P < 0.05) than the WR associated with RCP (pre: 281 ± 28 W, post: 318 ± 36 W) and c[O2Hb]BP (pre: 283 ± 36 W, post: 313 ± 32 W) which occurred concomitantly (P = 0.683). M[HHb]BP occurred at the highest WR and differed from all others (pre: 313 ± 23 W, post: 344 ± 32 W; P < 0.05). Training-induced WR differences (ΔWR) did not contrast between thresholds, and initial parameter differences were not affected by the intervention (P = 0.253). Thresholds were partly correlated before (R = 0.67-0.85, P < 0.05) and after (R = 0.83-0.96, P < 0.05) training, but ΔWR values were not associated (P > 0.05). Results of the present study strongly question true equivalence of CP, RCP, m[HHb]BP, and c[O2Hb]BP during ramp incremental exercise. Therefore, these exercise thresholds should not be used interchangeably.

Strong hydrothermal eruption 600 BP inside Golovnin caldera, Kunashir Island, Kurile arc

NASA Astrophysics Data System (ADS)

Belousov, Alexander; Belousova, Marina; Kozlov, Dmitry

2017-04-01

Hydrothermal explosions are difficult to predict and thus they pose serious hazard to visitors of hydrothermal areas. Here we present results of mapping of airfall deposit of strong prehistoric hydrothermal eruption that was the latest eruptive event in the limits of Golovnin caldera in the southern part of Kunashir Island, Kurile arc. This caldera was formed 30 Ka BP (Razhigaeva et al. 1998) that was followed by extrusion of two dacitic lava domes in the central part of the caldera. The studied hydrothermal eruption occurred at active hydrothermal area located at the southern foot of the Vostochny (Eastern) lava dome. This eruption formed a 350-m wide and 40 m deep crater surrounded by low-profile ring of the ejected material. Part of the crater is occupied by 17-m-deep Kipiashee Lake having intensive hydrothermal discharge on its bottom. The ejected material is represented by yellow-white and yellow-brown poorly sorted sandy gravels and sands with admixture of clay. This clastic material was formed by fragmentation of hydrothermally altered pumice tuffs (former sediments of the intracaldera lake). The airfall deposit has nearly circular distribution around the crater. The deposit thickness decreases from 5-7 m at the crater rim to 5 cm on the distances 2-3 km; thickness half-distance (bt) is estimated as 4.1. Volume of the deposit calculated by the method of Fierstein and Nathenson (1992) is 0.007 cub.km. Radiocarbon dating of soil buried directly under the deposit provided calibrated age 1300-1420 AD. This eruption can be considered as a model for future hydrothermal explosions inside the Golovnin caldera. This study was supported by grant of Russian Science Foundation #15-17-20011.

Oscillometric estimation of central blood pressure: validation of the Mobil-O-Graph in comparison with the SphygmoCor device.

PubMed

Weiss, Wolfgang; Gohlisch, Christopher; Harsch-Gladisch, Christl; Tölle, Markus; Zidek, Walter; van der Giet, Markus

2012-06-01

Hypertension is a major risk factor for a wide range of cardiovascular diseases and is typically identified by measuring blood pressure (BP) at the brachial artery. Although such a measurement may accurately determine diastolic BP, systolic BP is not reflected accurately. Current noninvasive techniques for assessing central aortic BP require additional recording of an arterial pressure wave using a high-fidelity applanation tonometer. Within one measurement cycle, the Mobil-O-Graph BP device uses brachial oscillometric BP waves for a noninvasive estimation of central BP. We therefore validated the Mobil-O-Graph against the SphygmoCor device, which is widely known as the commonly used approach for a noninvasive estimation of central BP. For each individual, we compared three readings of the central BP values obtained by the Mobil-O-Graph and SphygmoCor device consecutively. One hundred individuals (mean age 56.1 ± 15.4 years) were recruited for measurement.Differences between the central BP values of the test device and the SphygmoCor device were calculated for each measurement. The mean difference (95% confidence interval) for the estimated central systolic BP between both devices was -0.6 ± 3.7 mmHg. Comparison of the central BP values measured by the two devices showed a statistically significant linear correlation (R=0.91, P<0.0001). The mean between-method difference was 0.50 mmHg for central systolic BP estimation. The intrarater reproducibility between both the devices was also comparable. Bland and Altman analyses showed that the mean differences (95% confidence interval) between repeated measurements were 1.89 (0.42-3.36) mmHg and 1.36 (-0.16 to 2.83) mmHg for the SphygmoCor and the Mobil-O-Graph device, respectively. Thus, neither of these differences was statistically significantly different from 0. The limits of agreement were -16.34 to 19.73 and -15.23 to 17.17 mmHg for the SphygmoCor and the Mobil-O-Graph device, respectively. Oscillometric noninvasive estimation of central BP with the Mobil-O-Graph BP device is as effective as using the well-established SphygmoCor applanation tonometry device. In comparison, the Mobil-O-Graph combines the widespread benefits of brachial BP measurement and also provides central BP within one measurement.

Vegetation, fire, climate and human disturbance history in the southwestern Mediterranean area during the late Holocene

NASA Astrophysics Data System (ADS)

Jiménez-Moreno, Gonzalo; García-Alix, Antonio; Hernández-Corbalán, María Dolores; Anderson, R. Scott; Delgado-Huertas, Antonio

2013-03-01

Detailed pollen, charcoal, isotope and magnetic susceptibility data from an alpine lake sediment core from Sierra Nevada, southern Spain record changes in vegetation, fire history and lake sedimentation since ca. 4100 cal yr BP. The proxies studied record an arid period from ca. 3800 to 3100 cal yr BP characterized by more xerophytic vegetation and lower lake levels. A humid period is recorded between ca. 3100 and 1850 cal yr BP, which occurred in two steps: (1) an increase in evergreen Quercus between 3100 and 2500 cal yr BP, indicating milder conditions than previously and (2) an increase in deciduous Quercus and higher lake levels, between ca. 2500 and 1850 cal yr BP, indicating a further increase in humidity and reduction in seasonal contrast. Humid maxima occurred during the Roman Humid Period, previously identified in other studies in the Mediterranean region. Intensified fire activity at this time could be related to an increase in fuel load and/or in human disturbance. An arid period subsequently occurred between 1850 and 650 cal yr BP, though a decrease in Quercus and an increase in xerophytes. The alternation of persistent North Atlantic Oscillation modes probably played an important role in controlling these humid-arid cycles.

Geochemical and isotopic (Nd-Pb-Sr-O) variations bearing on the genesis of volcanic rocks from Vesuvius, Italy

USGS Publications Warehouse

Ayuso, R.A.; de Vivo, B.; Rolandi, G.; Seal, R.R.; Paone, A.

1998-01-01

Alkaline volcanism produced by Monte Somma-Vesuvius volcano includes explosive plinian and subplinian activity in addition to effusive lava flows. Pumice, scoria, and lava (150 samples) exhibit major- and trace-element gradients as a function of SiO2 (58.9-47.2 wt%) and MgO (0-7.8 wt%); Mg value are ???50. Internally gradational chemical groups or cycles are distinguished by age: (1) 25 000 to 14 000 yr B.P.; (2) 8000 yr B.P. to A.D. 79; and (3) A.D. 79 to 1944. A small number of lavas, dikes and scora were also analysed from the Somma formation (~ 35 000 to 25 000 yr B.P.). Within each group, contents of Na2O + K2O increas with decreasing MgO along distinct rocks. Nb/Y values are variable from 0.66 to 3.14 (at SiO2 ??? 50 wt%) generally in the range of alkaline and ultra-alkaline rocks. Variations in contents of some majro elements (e.g., P and Ti), and trace elements (e.g., Th, Nb, Ta, Zr, Hf, Pb, La, and Sc), as well as contrasting trends in ratios of various elements (e.g., Ta/Yb, Hf/U, Th/Ta, Th/Hf, Th/Yb, etc.) are also generally consistent with the group subdivisions. For example, Th/Hf increases from ??? 5 to ??? 10 with decreasing age for the Vesuvius system as a whole, yielding similar compositions in the least evolved rocks (low-silica, high-MgO, imcompatible element-poor) erupted at the end of each cycle. Internal variations within individual eruptions also systematically changed generally towards a common mafic composition at the end of each cycle, thus reflecting the dominanit volume in the magma chamber. At the start of a new eruptive cycle, the rocks are relatively enriched in incompatible elements; younger groups also contain higher abundances than other groups. N-MORB-normalized multielement diagrams exhibit selective enrichments of Sr, K, Rb, Th, and the light rare-earth elements; deep Nb and Ta negative anomalies commonly seen in rocks generated at orogenic margins are absent in the light rare-earth elements; deep Nb and Ta netgative anomalies commonly seen in rocks generated at orogenic margins are absent in our samples. Sr isotopic compositions are known to be variable within some of the units, in agreement with our data (87Sr/86Sr ~ 0.70699 to 0.70803) and with contributions from several isotopic components. Isotopic compositions for ??18O (7.3 to 10.2%), Pb for mineral separates and whole rocks (206Pb/204Pb ~ 18.947 to 19.178, 207Pb/204/Pb ~ 15.617 to 15.769, 208Pb/204Pb ~38.915 to 39.345), and Nd (143Nd ~ 0.51228 to 0.51251) also show variability. Oxygen isotope data show that pumices have higher ??18O values than cogenetic lavas, and that ??18O values and SiO2 are correlated. Radiogenic and stable isotope data plot within range of isotopic compositions for the Roman comagmatic province. Fractional crystallization cannot account for the radiogenic isotopic compositions of the Vesuvius magmas. We favor instead the combined effects of heterogeneous magma sources, together with isotopic exchange near the roof of the magma chamber. We suggest that metasomatized continental mantle lithosphere is the principal source of the magmas. This kind of enriched mantle was melted and reactivated in an area of continental extension (incipient rift setting) without direct reliance on contemporaneous subduction processes but possibly with input from mantle sources that resemble those that produce ocean island basalts.

Bombyx mori cyclin-dependent kinase inhibitor is involved in regulation of the silkworm cell cycle.

PubMed

Tang, X-F; Zhou, X-L; Zhang, Q; Chen, P; Lu, C; Pan, M-H

2018-06-01

Cyclin-dependent kinase inhibitors (CKIs) are negative regulators of the cell cycle. They can bind to cyclin-dependent kinase (CDK)-cyclin complexes and inhibit CDK activities. We identified a single homologous gene of the CDK interacting protein/kinase inhibitory protein (Cip/Kip) family, BmCKI, in the silkworm, Bombyx mori. The gene transcribes two splice variants: a 654-bp-long BmCKI-L (the longer splice variant) encoding a protein with 217 amino acids and a 579-bp-long BmCKI-S (the shorter splice variant) encoding a protein with 192 amino acids. BmCKI-L and BmCKI-S contain the Cip/Kip family conserved cyclin-binding domain and the CDK-binding domain. They are localized in the nucleus and have an unconventional bipartite nuclear localization signal at amino acid residues 181-210. Overexpression of BmCKI-L or BmCKI-S affected cell cycle progression; the cell cycle was arrested in the first gap phase of cell cycle (G1). RNA interference of BmCKI-L or BmCKI-S led to cells accumulating in the second gap phase and the mitotic phase of cell cycle (G2/M). Both BmCKI-L and BmCKI-S are involved in cell cycle regulation and probably have similar effects. The transgenic silkworm with BmCKI-L overexpression (BmCKI-L-OE), exhibited embryonic lethal, larva developmental retardation and lethal phenotypes. These results suggest that BmCKI-L might regulate the growth and development of silkworm. These findings clarify the function of CKIs and increase our understanding of cell cycle regulation in the silkworm. © 2018 The Royal Entomological Society.

Modeling Explosion Induced Aftershocks

NASA Astrophysics Data System (ADS)

Kroll, K.; Ford, S. R.; Pitarka, A.; Walter, W. R.; Richards-Dinger, K. B.

2017-12-01

Many traditional earthquake-explosion discrimination tools are based on properties of the seismic waveform or their spectral components. Common discrimination methods include estimates of body wave amplitude ratios, surface wave magnitude scaling, moment tensor characteristics, and depth. Such methods are limited by station coverage and noise. Ford and Walter (2010) proposed an alternate discrimination method based on using properties of aftershock sequences as a means of earthquakeexplosion differentiation. Previous studies have shown that explosion sources produce fewer aftershocks that are generally smaller in magnitude compared to aftershocks of similarly sized earthquake sources (Jarpe et al., 1994, Ford and Walter, 2010). It has also been suggested that the explosion-induced aftershocks have smaller Gutenberg- Richter b-values (Ryall and Savage, 1969) and that their rates decay faster than a typical Omori-like sequence (Gross, 1996). To discern whether these observations are generally true of explosions or are related to specific site conditions (e.g. explosion proximity to active faults, tectonic setting, crustal stress magnitudes) would require a thorough global analysis. Such a study, however, is hindered both by lack of evenly distributed explosion-sources and the availability of global seismicity data. Here, we employ two methods to test the efficacy of explosions at triggering aftershocks under a variety of physical conditions. First, we use the earthquake rate equations from Dieterich (1994) to compute the rate of aftershocks related to an explosion source assuming a simple spring-slider model. We compare seismicity rates computed with these analytical solutions to those produced by the 3D, multi-cycle earthquake simulator, RSQSim. We explore the relationship between geological conditions and the characteristics of the resulting explosion-induced aftershock sequence. We also test hypothesis that aftershock generation is dependent upon the frequency content of the passing dynamic seismic waves as suggested by Parsons and Velasco (2009). Lastly, we compare all results of explosion-induced aftershocks with aftershocks generated by similarly sized earthquake sources. Prepared by LLNL under Contract DE-AC52-07NA27344.

Quasi-periodic Oscillation of a Coronal Bright Point

NASA Astrophysics Data System (ADS)

Samanta, Tanmoy; Banerjee, Dipankar; Tian, Hui

2015-06-01

Coronal bright points (BPs) are small-scale luminous features seen in the solar corona. Quasi-periodic brightenings are frequently observed in the BPs and are generally linked with underlying magnetic flux changes. We study the dynamics of a BP seen in the coronal hole using the Atmospheric Imaging Assembly images, the Helioseismic and Magnetic Imager magnetogram on board the Solar Dynamics Observatory, and spectroscopic data from the newly launched Interface Region Imaging Spectrograph (IRIS). The detailed analysis shows that the BP evolves throughout our observing period along with changes in underlying photospheric magnetic flux and shows periodic brightenings in different EUV and far-UV images. With the highest possible spectral and spatial resolution of IRIS, we attempted to identify the sources of these oscillations. IRIS sit-and-stare observation provided a unique opportunity to study the time evolution of one footpoint of the BP as the slit position crossed it. We noticed enhanced line profile asymmetry, enhanced line width, intensity enhancements, and large deviation from the average Doppler shift in the line profiles at specific instances, which indicate the presence of sudden flows along the line-of-sight direction. We propose that transition region explosive events originating from small-scale reconnections and the reconnection outflows are affecting the line profiles. The correlation between all these parameters is consistent with the repetitive reconnection scenario and could explain the quasi-periodic nature of the brightening.

Source of Quasi-Periodic Brightenings of Solar Coronal Bright Points: Waves or Repeated Reconnections

NASA Astrophysics Data System (ADS)

Samanta, Tanmoy; Tian, Hui; Banerjee, Dipankar

2016-07-01

Coronal bright points (BPs) are small-scale luminous features seen in the solar corona. Quasi-periodic brightenings are frequently observed in the BPs and are generally linked with underlying magnetic flux changes. We study the dynamics of a BP seen in the coronal hole using the Atmospheric Imaging Assembly images, the Helioseismic and Magnetic Imager magnetogram on board the Solar Dynamics Observatory, and spectroscopic data from the newly launched Interface Region Imaging Spectrograph (IRIS). The detailed analysis shows that the BP evolves throughout our observing period along with changes in underlying photospheric magnetic flux and shows periodic brightenings in different EUV and far-UV images. With the highest possible spectral and spatial resolution of IRIS, we attempted to identify the sources of these oscillations. IRIS sit-and-stare observation provided a unique opportunity to study the time evolution of one footpoint of the BP as the slit position crossed it. We noticed enhanced line profile asymmetry, enhanced line width, intensity enhancements, and large deviation from the average Doppler shift in the line profiles at specific instances, which indicate the presence of sudden flows along the line-of-sight direction. We propose that transition region explosive events originating from small-scale reconnections and the reconnection outflows are affecting the line profiles. The correlation between all these parameters is consistent with the repetitive reconnection scenario and could explain the quasi-periodic nature of the brightening.

Gas explosions and thermal runaways during external heating abuse of commercial lithium-ion graphite-LiCoO2 cells at different levels of ageing

NASA Astrophysics Data System (ADS)

Larsson, Fredrik; Bertilsson, Simon; Furlani, Maurizio; Albinsson, Ingvar; Mellander, Bengt-Erik

2018-01-01

Commercial 6.8 Ah lithium-ion cells with different ageing/status have been abused by external heating in an oven. Prior to the abuse test, selected cells were aged either by C/2 cycling up to 300 cycles or stored at 60 °C. Gas emissions were measured by FTIR and three separate vents were identified, two well before the thermal runaway while the third occurred simultaneously with the thermal runaway releasing heavy smoke and gas. Emissions of toxic carbon monoxide (CO), hydrogen fluoride (HF) and phosphorous oxyfluoride (POF3) were detected in the third vent, regardless if there was a fire or not. All abused cells went into thermal runaway and emitted smoke and gas, the working cells also released flames as well as sparks. The dead cells were however less reactive but still underwent thermal runaway. For about half of the working cells, for all levels of cycle ageing, ignition of the accumulated battery released gases occurred about 15 s after the thermal runaway resulting in a gas explosion. The thermal runaway temperature, about 190 °C, varied somewhat for the different cell ageing/status where a weak local minimum was found for cells cycled between 100 and 200 times.

Thermal history of the Acoculco geothermal system, eastern Mexico: Insights from numerical modeling and radiocarbon dating

NASA Astrophysics Data System (ADS)

Canet, Carles; Trillaud, Frederic; Prol-Ledesma, Rosa María; González-Hernández, Galia; Peláez, Berenice; Hernández-Cruz, Berenice; Sánchez-Córdova, María M.

2015-10-01

Acoculco is a geothermal prospective area hosted by a volcanic caldera complex in the eastern Trans-Mexican Volcanic Belt. Surface manifestations are scarce and consist of gas discharges (CO2-rich) and acid-sulfate springs of low temperature, whereas hydrothermal explosive activity is profusely manifested by meter-scale craters and mounds of hydrothermal debris and breccias. Silicic alteration extends for several square kilometers around the zone with gas manifestations and explosive features, affecting surficial volcanic rocks, primarily tuffs and breccias. In the subsurface, an argillic alteration zone (ammonium illite) extends down to a depth of ∼ 600 m, and underneath it a propylitic zone (epidote-calcite-chlorite) occurs down to ∼ 1000 m. Thermal logs from an exploratory borehole (EAC-1, drilled in 1995 down to 1810 m) showed a conductive heat transfer regime under high geothermal gradient (∼ 140 °C/1000 m). In contrast, the thermal profile established from temperatures of homogenization of fluid inclusions-measured on core samples from the same drill hole-suggests that convection occurred in the past through the upper ~ 1400 m of the geothermal system. A drop in permeability due to the precipitation of alteration minerals would have triggered the cessation of the convective heat transfer regime to give place to a conductive one. With the purpose of determining when the transition of heat transfer regime occurred, we developed a 1D model that simulates the time-depth distribution of temperature. According to our numerical simulations, this transition happened ca. 7000 years ago; this date is very recent compared to the lifespan of the geothermal system. In addition, radiocarbon chronology indicates that the hydrothermal explosive activity postdates the end of the convective heat transfer regime, having dated at least three explosive events, at 4867-5295, 1049-1417 and 543-709 y cal. BP. Therefore, hydrothermal explosions arise from the self-sealing of the Acoculco geothermal system, involving a natural hazard that could affect future geothermal-power infrastructure.

Delayed systolic blood pressure recovery following exercise as a mechanism of masked uncontrolled hypertension in chronic kidney disease.

PubMed

Agarwal, Rajiv; Pappas, Maria K

2017-10-01

Among people treated for hypertension, the presence of elevated blood pressure (BP) out of the clinic but normal BP in the clinic is called masked uncontrolled hypertension (MUCH). What causes MUCH remains unknown. The purpose of this study was to answer the question of whether patients with MUCH have an increased hemodynamic reactivity to exercise and delayed hemodynamic recovery following exercise. Four groups were compared: controlled hypertension (CH, n = 58), MUCH (n = 34) and uncontrolled hypertension (UCH, n = 12), all of which had chronic kidney disease (CKD), and a group of healthy normal volunteers who did not have hypertension or CKD (n = 16). All participants underwent assessment of 24-h ambulatory BP monitoring, BP measurement during a graded symptom-limited exercise using a cycle ergometer and BP recovery over 7 min following exercise. Exercise-induced increase in systolic BP was similar among the four groups. When compared with healthy controls, recovery of systolic BP following termination of exercise was blunted among the CKD groups in unadjusted (P < 0.0001) and adjusted (P < 0.001) models. During recovery, the healthy control group had 5.9% decline in systolic BP per minute. In contrast, MUCH had only 3.3% per minute reduction and the UCH group had 0.3% reduction per minute. A test of linear trend was significant (P = 0.002, adjusted model). Because there was no impairment in the heart rate recovery among groups, we speculate that the parasympathetic pathway appears intact among treated hypertensives with CKD. However, the failure to withdraw sympathetic tone upon termination of exercise causes ongoing vasoconstriction and delayed systolic BP recovery providing a biological basis for MUCH. Delayed recovery from exercise-induced hypertension in those with poorly controlled BP provides potentially a new target to assure round-the-clock BP control. Published by Oxford University Press on behalf of ERA-EDTA 2016. This work is written by US Government employees and is in the public domain in the US.

TRIM25 enhances cell growth and cell survival by modulating p53 signals via interaction with G3BP2 in prostate cancer.

PubMed

Takayama, Ken-Ichi; Suzuki, Takashi; Tanaka, Tomoaki; Fujimura, Tetsuya; Takahashi, Satoru; Urano, Tomohiko; Ikeda, Kazuhiro; Inoue, Satoshi

2018-04-01

Prostate cancer growth is promoted by the gene regulatory action of androgen receptor (AR) and its downstream signals. The aberrant dysfunction of tumor suppressor p53 has an important role in the prognosis of cancer. We previously found that androgen treatments translocate p53 to the cytoplasm. The mechanism of this translocation depends on sumoylation of p53 by complex of SUMO E3 ligase RanBP2 with androgen-induced GTPase-activating protein-binding protein 2 (G3BP2). Here, we identified tripartite motif-containing protein 25 (TRIM25)/estrogen-responsive finger protein (Efp) as a novel interacting partner of G3BP2 protein complex. Then, we demonstrated that TRIM25 knockdown resulted in p53 downstream activation for cell cycle inhibition and apoptosis induction in LNCaP and 22Rv1 cells. In contrast, overexpression of TRIM25 promoted prostate cancer cell proliferation and inhibited apoptosis by docetaxel treatment in LNCaP cells. We observed that p53 activity was reduced by mechanism of G3BP2-mediated nuclear export in TRIM25-overexpressing prostate cancer cells. We also found TRIM25 is important for G3BP2/RanBP2-mediated p53 modification. Clinically, we newly demonstrated that TRIM25 is a prognostic factor for prostate cancer patients. Expression of TRIM25 is significantly associated with cytoplasmic p53 expression and G3BP2. Moreover, TRIM25 knockdown results in reduced tumor growth and increased p53 activity in the mouse xenograft model of prostate cancer. Thus, our findings show that overexpression of TRIM25 promoted prostate cancer cell proliferation and cell survival by modulating p53 nuclear export mechanism with G3BP2 interaction.

Sythesis of MCMC and Belief Propagation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahn, Sungsoo; Chertkov, Michael; Shin, Jinwoo

Markov Chain Monte Carlo (MCMC) and Belief Propagation (BP) are the most popular algorithms for computational inference in Graphical Models (GM). In principle, MCMC is an exact probabilistic method which, however, often suffers from exponentially slow mixing. In contrast, BP is a deterministic method, which is typically fast, empirically very successful, however in general lacking control of accuracy over loopy graphs. In this paper, we introduce MCMC algorithms correcting the approximation error of BP, i.e., we provide a way to compensate for BP errors via a consecutive BP-aware MCMC. Our framework is based on the Loop Calculus (LC) approach whichmore » allows to express the BP error as a sum of weighted generalized loops. Although the full series is computationally intractable, it is known that a truncated series, summing up all 2-regular loops, is computable in polynomial-time for planar pair-wise binary GMs and it also provides a highly accurate approximation empirically. Motivated by this, we first propose a polynomial-time approximation MCMC scheme for the truncated series of general (non-planar) pair-wise binary models. Our main idea here is to use the Worm algorithm, known to provide fast mixing in other (related) problems, and then design an appropriate rejection scheme to sample 2-regular loops. Furthermore, we also design an efficient rejection-free MCMC scheme for approximating the full series. The main novelty underlying our design is in utilizing the concept of cycle basis, which provides an efficient decomposition of the generalized loops. In essence, the proposed MCMC schemes run on transformed GM built upon the non-trivial BP solution, and our experiments show that this synthesis of BP and MCMC outperforms both direct MCMC and bare BP schemes.« less

Effects of general, specific and combined warm-up on explosive muscular performance

PubMed Central

Henriquez–Olguín, C; Beltrán, AR; Ramírez, MA; Labarca, C; Cornejo, M; Álvarez, C; Ramírez-Campillo, R

2015-01-01

The purpose of this study was to compare the acute effects of general, specific and combined warm-up (WU) on explosive performance. Healthy male (n = 10) subjects participated in six WU protocols in a crossover randomized study design. Protocols were: passive rest (PR; 15 min of passive rest), running (Run; 5 min of running at 70% of maximum heart rate), stretching (STR; 5 min of static stretching exercise), jumping [Jump; 5 min of jumping exercises – 3x8 countermovement jumps (CMJ) and 3x8 drop jumps from 60 cm (DJ60)], and combined (COM; protocols Run+STR+Jump combined). Immediately before and after each WU, subjects were assessed for explosive concentric-only (i.e. squat jump – SJ), slow stretch-shortening cycle (i.e. CMJ), fast stretch-shortening cycle (i.e. DJ60) and contact time (CT) muscle performance. PR significantly reduced SJ performance (p =0.007). Run increased SJ (p =0.0001) and CMJ (p =0.002). STR increased CMJ (p =0.048). Specific WU (i.e. Jump) increased SJ (p =0.001), CMJ (p =0.028) and DJ60 (p =0.006) performance. COM increased CMJ performance (p =0.006). Jump was superior in SJ performance vs. PR (p =0.001). Jump reduced (p =0.03) CT in DJ60. In conclusion, general, specific and combined WU increase slow stretch-shortening cycle (SSC) muscle performance, but only specific WU increases fast SSC muscle performance. Therefore, to increase fast SSC performance, specific fast SSC muscle actions must be included during the WU. PMID:26060335

Association Between Serum Levels of Uric Acid and Blood Pressure Tracking in Childhood.

PubMed

Park, Bohyun; Lee, Hye Ah; Lee, Sung Hee; Park, Bo Mi; Park, Eun Ae; Kim, Hae Soon; Cho, Su Jin; Park, Hyesook

2017-07-01

Recent studies suggest that high levels of serum uric acid of very early life are a result of the in-utero environment and may lead to elevated blood pressure (BP) in adulthood. However, serum uric acid levels can change throughout life. We investigated the effect of serum uric acid levels in childhood on the BP tracking and analysed BP according to changes in serum uric acid levels in early life. A total of 449 children from the Ewha Birth and Growth Cohort study underwent at least 2 follow-up examinations. Data were collected across 3 check-up cycles. Serum uric acid levels, BP, and anthropometric characteristics were assessed at 3, 5, and 7 years of age. Children with a serum uric acid level higher than the median values had significantly increased systolic BP (SBP) and diastolic BP at 3 years of age. Baseline serum uric acid levels measured at 3 years of age, significantly affected subsequent BP in the sex and body mass index adjusted longitudinal data analysis (P < 0.05). Considering the changing pattern of serum uric acid over time, subjects with high uric acid levels at both 3 and 5 years of age had the highest SBP at 7 years of age. These findings suggest the importance of maintaining an adequate level of serum uric acids from the early life. Appropriate monitoring and intervention of uric acid levels in a high-risk group can reduce the risk of a future increased BP. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Degassing Processes at Persistently Active Explosive Volcanoes

NASA Astrophysics Data System (ADS)

Smekens, Jean-Francois

Among volcanic gases, sulfur dioxide (SO2) is by far the most commonly measured. More than a monitoring proxy for volcanic degassing, SO 2 has the potential to alter climate patterns. Persistently active explosive volcanoes are characterized by short explosive bursts, which often occur at periodic intervals numerous times per day, spanning years to decades. SO 2 emissions at those volcanoes are poorly constrained, in large part because the current satellite monitoring techniques are unable to detect or quantify plumes of low concentration in the troposphere. Eruption plumes also often show high concentrations of ash and/or aerosols, which further inhibit the detection methods. In this work I focus on quantifying volcanic gas emissions at persistently active explosive volcanoes and their variations over short timescales (minutes to hours), in order to document their contribution to natural SO2 flux as well as investigate the physical processes that control their behavior. In order to make these measurements, I first develop and assemble a UV ground-based instrument, and validate it against an independently measured source of SO2 at a coal-burning power plant in Arizona. I establish a measurement protocol and demonstrate that the instrument measures SO 2 fluxes with < 20 % error. Using the same protocol, I establish a record of the degassing patterns at Semeru volcano (Indonesia), a volcano that has been producing cycles of repeated explosions with periods of minutes to hours for the past several decades. Semeru produces an average of 21-71 tons of SO2 per day, amounting to a yearly output of 8-26 Mt. Using the Semeru data, along with a 1-D transient numerical model of magma ascent, I test the validity of a model in which a viscous plug at the top of the conduit produces cycles of eruption and gas release. I find that it can be a valid hypothesis to explain the observed patterns of degassing at Semeru. Periodic behavior in such a system occurs for a very narrow range of conditions, for which the mass balance between magma flux and open-system gas escape repeatedly generates a viscous plug, pressurizes the magma beneath the plug, and then explosively disrupts it.

MOF phosphorylation by ATM regulates 53BP1-mediated double-strand break repair pathway choice.

PubMed

Gupta, Arun; Hunt, Clayton R; Hegde, Muralidhar L; Chakraborty, Sharmistha; Chakraborty, Sharmistha; Udayakumar, Durga; Horikoshi, Nobuo; Singh, Mayank; Ramnarain, Deepti B; Hittelman, Walter N; Namjoshi, Sarita; Asaithamby, Aroumougame; Hazra, Tapas K; Ludwig, Thomas; Pandita, Raj K; Tyler, Jessica K; Pandita, Tej K

2014-07-10

Cell-cycle phase is a critical determinant of the choice between DNA damage repair by nonhomologous end-joining (NHEJ) or homologous recombination (HR). Here, we report that double-strand breaks (DSBs) induce ATM-dependent MOF (a histone H4 acetyl-transferase) phosphorylation (p-T392-MOF) and that phosphorylated MOF colocalizes with γ-H2AX, ATM, and 53BP1 foci. Mutation of the phosphorylation site (MOF-T392A) impedes DNA repair in S and G2 phase but not G1 phase cells. Expression of MOF-T392A also blocks the reduction in DSB-associated 53BP1 seen in wild-type S/G2 phase cells, resulting in enhanced 53BP1 and reduced BRCA1 association. Decreased BRCA1 levels at DSB sites correlates with defective repairosome formation, reduced HR repair, and decreased cell survival following irradiation. These data support a model whereby ATM-mediated MOF-T392 phosphorylation modulates 53BP1 function to facilitate the subsequent recruitment of HR repair proteins, uncovering a regulatory role for MOF in DSB repair pathway choice during S/G2 phase. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Postexercise hypotension in an endurance-trained population of men and women following high-intensity interval and steady-state cycling.

PubMed

Rossow, Lindy; Yan, Huimin; Fahs, Christopher A; Ranadive, Sushant M; Agiovlasitis, Stamatis; Wilund, Kenneth R; Baynard, Tracy; Fernhall, Bo

2010-04-01

The acute effect of high-intensity interval exercise (HI) on blood pressure (BP) is unknown although this type of exercise has similar or greater cardiovascular benefits compared to steady-state aerobic exercise (SS). This study examined postexercise hypotension (PEH) and potential mechanisms of this response in endurance-trained subjects following acute SS and HI. Sex differences were also evaluated. A total of 25 endurance-trained men (n = 15) and women (n = 10) performed a bout of HI and a bout of SS cycling in randomized order on separate days. Before exercise, 30 min postexercise, and 60 min postexercise, we measured brachial and aortic BP. Cardiac output (CO), stroke volume (SV), end diastolic volume (EDV), end systolic volume (ESV), and left ventricular wall-velocities were measured using ultrasonography with tissue Doppler capabilities. Ejection fraction and fractional shortening (FS), total peripheral resistance (TPR), and calf vascular resistance were calculated from the above variables and measures of leg blood flow. BP, ejection fraction, and FS decreased by a similar magnitude following both bouts but changes in CO, heart rate (HR), TPR, and calf vascular resistance were greater in magnitude following HI than following SS. Men and women responded similarly to HI. Although men and women exhibited a similar PEH following SS, they showed differential changes in SV, EDV, and TPR. HI acutely reduces BP similarly to SS. The mechanistic response to HI appears to differ from that of SS, and endurance-trained men and women may exhibit differential mechanisms for PEH following SS but not HI.

Effects of a daily mixed nutritional supplement on physical performance, body composition, and circulating anabolic hormones during 8 weeks of arduous military training.

PubMed

Fortes, Matthew B; Diment, Bethany C; Greeves, Julie P; Casey, Anna; Izard, Rachel; Walsh, Neil P

2011-12-01

The aim of this work was to investigate the effect of a daily mixed nutritional supplement upon body composition, physical performance, and circulating anabolic hormones in soldiers undergoing arduous training. Thirty males received either a habitual diet alone (CON, n = 15) or with the addition of a daily mixed supplement (SUP, n = 15) of ∼5.1 MJ·d⁻¹ during 8 weeks of training. Body composition (DEXA), maximal dynamic lift strength (MDLS), and vertical jump (VJ) were assessed, and resting blood samples were collected before and after training. Blood analysis included insulin-like growth factors (IGF-1, IGF BP-1, and IGF BP-3), testosterone, and cortisol. There were no group differences at baseline. Body mass loss (mean ± SD) (CON 5.0 ± 2.3, SUP 1.6 ± 1.5 kg), lean mass loss (CON 2.0 ± 1.5, SUP 0.7 ± 1.5 kg), and fat mass loss (CON 3.0 ± 1.6, SUP 0.9 ± 1.8 kg) were significantly blunted by SUP. CON experienced significant decrements in MDLS (14%), VJ (10%), and explosive leg power (11%) that were prevented by SUP. Military training significantly reduced circulating IGF-1 (28%), testosterone (19%), and the testosterone:cortisol ratio (24%) with no effect of SUP. Circulating IGF BP-1 concentration and cortisol remained unchanged throughout, although SUP abolished the significant decrease in circulating IGF BP-3 (20%) on CON. In conclusion, a daily mixed nutritional supplement attenuated decreases in body mass and lean mass and prevented the decrease in physical performance during an arduous military training program.

53BP1 loss suppresses the radiosensitizing effect of icotinib hydrochloride in colorectal cancer cells.

PubMed

Huang, Ai; Yao, Jing; Liu, Tao; Lin, Zhenyu; Zhang, Sheng; Zhang, Tao; Ma, Hong

2018-04-01

This study aimed to investigate the influence of the expression of P53-binding protein 1 (53BP1), a key component in DNA damage repair pathways, on the radiosensitizing effect of icotinib hydrochloride in colorectal cancer and to elucidate the mechanisms underlying this influence. Real-time RT-PCR and Western blotting were performed to verify the gene-knockout effect of 53BP1 small hairpin RNA (ShRNA), and colony formation assay was employed to investigate the influence of 53BP1 downregulation on the radiosensitizing effect of icotinib hydrochloride in HCT116 cells. Cell apoptosis, cell cycle distributions, and histone H2AX (γ-H2AX) fluorescence foci after 53BP1 knockdown were evaluated. Relative protein expression in the ataxia telangiectasia mutated kinase (ATM)-checkpoint kinase-2 (CHK2)-P53 pathway was measured by Western blot analysis to unravel the molecular mechanisms linking the pathway to the above phenomena. Icotinib hydrochloride increased the radiosensitivity of HCT116 cells; however, this effect was suppressed by the downregulation of 53BP1 expression, a change that inhibited cell apoptosis, increased the percentage of HCT116 cells arrested in S-phase and inhibited the protein expression of key molecules in the ATM-CHK2-P53 apoptotic pathway. Our studies confirmed that the loss of 53BP1 serves as a negative regulator of the radiosensitizing effect of icotinib in part by suppressing the ATM-CHK2-P53 apoptotic pathway.

Mount St. Helens a decade after the 1980 eruptions: magmatic models, chemical cycles, and a revised hazards assessment

USGS Publications Warehouse

Pallister, J.S.; Hoblitt, R.P.; Crandell, D.R.; Mullineaux, D.R.

1992-01-01

Available geophysical and geologic data provide a simplified model of the current magmatic plumbing system of Mount St. Helens (MSH). This model and new geochemical data are the basis for the revised hazards assessment presented here. The assessment is weighted by the style of eruptions and the chemistry of magmas erupted during the past 500 years, the interval for which the most detailed stratigraphic and geochemical data are available. This interval includes the Kalama (A. D. 1480-1770s?), Goat Rocks (A.D. 1800-1857), and current eruptive periods. In each of these periods, silica content decreased, then increased. The Kalama is a large amplitude chemical cycle (SiO2: 57%-67%), produced by mixing of arc dacite, which is depleted in high field-strength and incompatible elements, with enriched (OIB-like) basalt. The Goat Rocks and current cycles are of small amplitude (SiO2: 61%-64% and 62%-65%) and are related to the fluid dynamics of magma withdrawal from a zoned reservoir. The cyclic behavior is used to forecast future activity. The 1980-1986 chemical cycle, and consequently the current eruptive period, appears to be virtually complete. This inference is supported by the progressively decreasing volumes and volatile contents of magma erupted since 1980, both changes that suggest a decreasing potential for a major explosive eruption in the near future. However, recent changes in seismicity and a series of small gas-release explosions (beginning in late 1989 and accompanied by eruption of a minor fraction of relatively low-silica tephra on 6 January and 5 November 1990) suggest that the current eruptive period may continue to produce small explosions and that a small amount of magma may still be present within the conduit. The gas-release explosions occur without warning and pose a continuing hazard, especially in the crater area. An eruption as large or larger than that of 18 May 1980 (???0.5 km3 dense-rock equivalent) probably will occur only if magma rises from an inferred deep (???7 km), relative large (5-7 km3) reservoir. A conservative approach to hazard assessment is to assume that this deep magma is rich in volatiles and capable of erupting explosively to produce voluminous fall deposits and pyroclastic flows. Warning of such an eruption is expectable, however, because magma ascent would probably be accompanied by shallow seismicity that could be detected by the existing seismic-monitoring system. A future large-volume eruption (???0.1 km3) is virtually certain; the eruptive history of the past 500 years indicates the probability of a large explosive eruption is at least 1% annually. Intervals between large eruptions at Mount St. Helens have varied widely; consequently, we cannot confidently forecast whether the next large eruption will be years decades, or farther in the future. However, we can forecast the types of hazards, and the areas that will be most affected by future large-volume eruptions, as well as hazards associated with the approaching end of the current eruptive period. ?? 1992 Springer-Verlag.

Climate Change in Lowland Central America During the Late Deglacial and Early Holocene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hillesheim, M B; Hodell, D A; Leyden, B W

2005-02-08

The transition from arid glacial to moist early Holocene conditions represented a profound change in northern lowland Neotropical climate. Here we report a detailed record of changes in moisture availability during the latter part of this transition ({approx}11,250 to 7,500 cal yr BP) inferred from sediment cores retrieved in Lake Peten Itza, northern Guatemala. Pollen assemblages demonstrate that a mesic forest had been largely established by {approx}11,250 cal yr BP, but sediment properties indicate that lake level was more than 35 m below modern stage. From 11,250 to 10,350 cal yr BP, during the Preboreal period, lithologic changes in sedimentsmore » from deep-water cores (>50 m below modern water level) indicate several wet-dry cycles that suggest distinct changes in effective moisture. Four dry events (designated PBE1-4) occurred at 11,200, 10,900, 10,700, and 10,400 cal yr BP and correlate with similar variability observed in the Cariaco Basin titanium record and glacial meltwater pulses into the Gulf of Mexico. After 10,350 cal yr BP, multiple sediment proxies suggest a shift to a more persistently moist early Holocene climate. Comparison of results from Lake Peten Itza with other records from the circum-Caribbean demonstrates a coherent climate response during the entire span of our record. Furthermore, lowland Neotropical climate during the late deglacial and early Holocene period appears to be tightly linked to climate change in the high-latitude North Atlantic. We speculate that the observed changes in lowland Neotropical precipitation were related to the intensity of the annual cycle and associated displacements in the mean latitudinal position of the Intertropical Convergence Zone and Azores-Bermuda high-pressure system. This mechanism operated on millennial-to-submillennial timescales and may have responded to changes in solar radiation, glacial meltwater, North Atlantic sea ice, and the Atlantic meridional overturning circulation (MOC).« less

Ultrastructural evidence of the ehrlichial developmental cycle in naturally infected Ixodes persulcatus ticks in the course of coinfection with Rickettsia, Borrelia, and a flavivirus.

PubMed

Popov, Vsevolod L; Korenberg, Edward I; Nefedova, Valentina V; Han, Violet C; Wen, Julie W; Kovalevskii, Yurii V; Gorelova, Natalia B; Walker, David H

2007-01-01

Ehrlichiae are small gram-negative obligately intracellular bacteria that multiply within vacuoles of their host cells and are associated for a part of their life cycle with ticks, which serve as vectors for vertebrate hosts. Two morphologically and physiologically different ehrlichial cell types, reticulate cells (RC) and dense-cored cells (DC), are observed during experimental infection of cell cultures, mice, and ticks. Dense-cored cells and reticulate cells in vertebrate cell lines alternate in a developmental cycle. We observed ultrastructure of RC and DC of Ehrlichia muris in morulae in salivary gland cells and coinfection with Borrelia burgdorferi sensu lato (sl), "Candidatus Rickettsia tarasevichiae," and a flavivirus (presumably, tick-borne encephalitis virus [TBEV]) of Ixodes persulcatusticks collected in the Cis-Ural region of Russia. Polymerase chain reaction revealed 326 (81.5%) of 400 ticks carrying at least one infectious agent, and 41.5% (166 ticks) were coinfected with two to four agents. Ehrlichiae and rickettsiae were identified by sequencing of 359 bp of the 16S rRNA gene of E. muris and of 440 bp of the 16S rRNA gene and 385 bp of the gltA gene of "R. tarasevichiae." Different organs of the same tick harbored different microorganisms: TBEV in salivary gland and borreliae in midgut; E. muris in salivary gland; and "R. tarasevichiae" in midgut epithelium. Salivary gland cells contained both RC and DC, a finding that confirmed the developmental cycle in naturally infected ticks. Dense-cored cells in tick salivary glands were denser and of more irregular shape than DC in cell cultures. Ehrlichia-infected salivary gland cells had lysed cytoplasm, suggesting pathogenicity of E. muris for the tick host at the cellular level, as well as potential transmission during feeding. Rickettsiae in the midgut epithelial cells multiplied to significant numbers without altering the host cell ultrastructure. This is the first demonstration of E. muris, "R. tarasevichiae," and the ehrlichial developmental cycle in naturally infected I. persulcatus sticks.

Influence of catchment vegetation on mercury accumulation in lake sediments from a long-term perspective.

PubMed

Rydberg, Johan; Rösch, Manfred; Heinz, Emanuel; Biester, Harald

2015-12-15

Organic matter (OM) cycling has a large impact on the cycling of mercury (Hg) in the environment. Hence, it is important to have a thorough understanding on how changes in, e.g., catchment vegetation - through its effect on OM cycling - affect the behavior of Hg. To test whether shifts in vegetation had an effect on Hg-transport to lakes we investigated a sediment record from Herrenwieser See (Southern Germany). This lake has a well-defined Holocene vegetation history: at ~8700years BP Corylus avellana (hazel) was replaced by Quercus robur (oak), which was replaced by Abies alba (fir) and Fagus sylvatica (beech) ~5700years BP). We were particularly interested in testing if coniferous vegetation leads to a larger export of Hg to aquatic systems than deciduous vegetation. When hazel was replaced by oak, reduced soil erosion and increased transport of DOM-bound mercury from the catchment resulted in increases in both Hg-concentrations and accumulation rates (61ngg(-1) and 5.5ngcm(-2)yr.(-)(1) to 118ngg(-1) and 8.5ngcm(-2)yr.(-)(1)). However, even if Hg-concentrations increased also in association with the introduction of fir and beech (173ngg(-1)), as a result of higher Hg:C, there was no increase in Hg-accumulation rates (7.6ngcm(-2)yr.(-)(1)), because of a decreased input of OM. At around 2500years BP Hg-accumulation rates and Hg-concentration indicated an additional input of Hg to the sediment (316ngg(-1) and 10.3ngcm(-2)yr.(-)(1)), which might be due to increased human activities in the area, e.g., forest burning or mining. Our results contrast those of several paired-catchment studies that suggest a higher release of Hg from coniferous than deciduous forest, and there is a need for studies with a long-term perspective to increase our understanding of the effects of slow and gradual processes on mercury cycling. Copyright © 2015 Elsevier B.V. All rights reserved.

The resonant structure of ^18Ne and its relevance in the breakout of the Hot CNO cycle

NASA Astrophysics Data System (ADS)

Almaraz-Calderon, S.; Tan, W.; Aprahamian, A.; Bucher, B.; Gorres, J.; Roberts, A.; Villano, A.; Wiescher, M.; Brune, C.; Heinen, Z.; Massey, T.; Mach, H.; Guray, N.; Guray, R. T.

2009-10-01

In explosive hydrogen burning environments such as Novae and X-ray bursts, temperatures and densities achieved are sufficiently high to bypass the beta decay of the waiting points of the hot CNO cycle by alpha captures, leading to a thermonuclear runaway via the rp-process. One of the two paths to a breakout from the hot CNO cycle is the route starting from ^14O(α,p)^17F followed by ^17F(p,γ)^18Ne and ^18Ne(α,p). The ^14O(α,p) reaction proceeds through resonant states in ^18Ne, making the reaction rate dependent on the excitation energies and spins as well as partial and total widths of these resonances. We used the ^16O(^3He,n) reaction and charged particle-neutron coincidences to measure the structure details of levels in ^18Ne. In particular, the α and proton decay branching ratios via ground state and excited states in ^17F were measured. The analysis of the data will allow us to provide crucial information to be included in the reaction network calculations that could have great impact on the nuclear energy generation and nucleosynthesis that occur in these explosive environments.

Symptoms of depression as possible markers of bipolar II disorder.

PubMed

Benazzi, Franco

2006-05-01

Underdiagnosis and misdiagnosis of bipolar-II disorder (BP-II) as a major depressive disorder (MDD) are frequently reported. The study aim was to find which symptoms of depression could be possible cross-sectional markers of BP-II, in order to reduce underdiagnosing BP-II. Consecutive 379 BP-II and 271 MDD major depressive episode (MDE) outpatients were interviewed with the Structured Clinical Interview for DSM-IV, the Hypomania Interview Guide, and the Family History Screen, by a senior psychiatrist in a private practice. Inside-MDE hypomanic symptoms (elevated mood and increased self-esteem always absent by definition) were systematically assessed. Mixed depression was defined as an MDE plus 3 or more inside-MDE hypomanic symptoms, a definition validated by Akiskal and Benazzi. The MDE symptoms significantly more common in BP-II versus MDD were weight gain, increased eating, hypersomnia, psychomotor agitation, worthlessness, and diminished ability to concentrate. The inside-MDE hypomanic symptoms significantly more common in BP-II were distractibility, racing/crowded thoughts, irritability, psychomotor agitation, more talkativeness, increased risky and goal-directed activities. Multiple logistic regression showed that hypersomnia, racing/crowded thoughts, irritability, and psychomotor agitation were independent predictors of BP-II. Irritability had the most balanced combination of sensitivity and specificity predicting BP-II. Psychomotor agitation had the highest specificity but the lowest sensitivity. Racing/crowded thoughts had the highest sensitivity but the lowest specificity. These symptoms had a similar positive predictive value (PPV) for BP-II, which was around 70% (PPV is more clinically useful than sensitivity and specificity), which in turn was similar to the PPV of mixed depression and atypical depression (two diagnostic clinical markers of BP-II). All possible combinations of these symptoms had a PPV similar to that of the individual symptoms. The validity as BP-II markers of these symptoms was supported by a significant association with bipolar family history. Hypersomnia, racing/crowded thoughts, irritability, and psychomotor agitation may be useful, cross-sectional markers of BP-II. Finding these symptoms in depression should lead the clinician to careful probing for history of hypomania, which should reduce the BP-II misdiagnosed as MDD. Results may also have treatment impacts, as antidepressants used alone (i.e., no concurrent mood stabilising agent) in BP-II depression misdiagnosed as MDD may increase cycling.

Mid-late Holocene climate and vegetation in northeastern part of the Altai Mountains recorded in Lake Teletskoye

NASA Astrophysics Data System (ADS)

Rudaya, Natalia; Nazarova, Larisa; Novenko, Elena; Babich, Valery; Kalugin, Ivan; Daryin, Andrei

2015-04-01

We report the first high-resolution (with intervals ca. 20-50 years) late-Holocene (4200 yr BP) pollen record from Lake Teletskoye, Altai Mountains, obtained from the underwater Ridge of Sofia Lepneva in 2006 (core Tel 2006). The study presents (i) the results of palynological analysis of Tel 2006; (ii) the results of spectral analysis of natural cycles based on the periodical fluctuation of taiga-biome curve; and (iii) quantitative reconstructions of the late-Holocene regional vegetation, woody coverage and climate in northern part of the Altai Mountains in order to define place of Northeast Altai on the map of the late-Holocene Central Asian environmental history. Late Holocene vegetation of the northeastern part of Altai recorded in Tel 2006 core is characterized by spread of dark-coniferous forest with structure similar to modern. Dominant trees, Siberian pine (Pinus sibirica) and Siberian fir (Abies sibirica), are the most ecological sensitive taxa between Siberian conifers (Shumilova, 1962), that as a whole suggests mild and humid climatic conditions during last 4200 years. However, changes of pollen taxa percentages and results of numerical analysis reveal pronounced fluctuation of climate and vegetation. Relatively cool and dry stage occurred prior to ca. 3500 cal yr BP. Open vegetation was widespread in the region with maximum deforestation and minimal July temperatures between 3800-3500 cal yr BP. Steppe-like communities with Artemisia, Chenopodiaceae and Cyperaceae could grow on the open sites around Lake Teletskoye. Reconstructed woody coverage is very low and varies between 29-35%. After ca. 3500 cal yr BP the area of dark-coniferous mountain taiga has significantly enlarged with maximums of woody coverages and taiga biome scores between ca. 2470-1040 cal yr BP. In the period of ~3500-2500 cal yr BP the averages July temperatures increased more than 1 0C. Climate became warmer and wetter. During last millennium (after 1040 cal yr BP) average July temperatures fell to 17.04 0C. Minimums of July temperatures related to AD1560-1650 and may reflect Little Ice Age in the northeastern Altai. This assumption is in an agreement with previous data from Lake Teletskoye (core Tel 2001-02 covered last 1000 years) where the period with relatively cold and dry climate was revealed between AD1560 and 1820 (Andreev et al., 2007). The coldest period in Tuva according to dendrochronological data (Myglan, Oidupaa, Vaganov, 2012) was in 17-19 centuries with minimum of June-July temperatures at AD1778-1819. Pollen records from the Chuya basin (southeastern part of Russian Altai) revealed the onset of LIA around AD1600 (Schluetz&Lehmkuhl, 2007). Open steppe-like vegetation slightly enlarged after ~AD1700 with increasing of continentality. Modern Index of Continentality mapping for the Altai Mountains is in range of 50-59 (Grieser et al., 2006). The average Index of Continentality calculated for last 30 years using data from Barnaul meteostation, located 300 km northwest of the lake in forest-steppe zone, is 40.6; the average Index of Continentality for Yailu meteostation (north shore of Lake Teletskoye) is 20. Index of Continentality reconstructed from Tel 2006 varies in limits of 48-58 and obviously shows regional but not local situation. Throughout the Tel 2006 record woody coverages vary between 29.0% at the 3890 cal yr BP and 50.3% at the AD1830. Woody coverage greater than 65% is associated with the Siberian mid-latitudinal zonal taiga. Areas north and south of the taiga zone have moderate forest coverage (25-45%), suggesting greater landscape openness (Tarasov et al., 2007). Regarding to VCF data, modern woody cover in 20 km around the lake is ca. 55% (http://glcf.umiacs.umd.edu/data/vcf). Reconstructed woody coverage is lower than observed and reflect probably forest development in the whole lake catchment basin. Spectral analysis of Tel 2006 data demonstrates periodic changes of taiga-biome curve of ~1050, ~470 and ~210 years intervals during the Late Holocene. Kravchinsky et al. (2013) presume that the 1000- and 500-year periodicities recorded in magnetic properties of soil layers correspond to solar activity induced climate changes in Southern Siberia; however, Stuiver&Braziunas (1993) relate the ~500-yr cycle to flux oscillations in the Atlantic Ocean thermohaline circulation. The ˜210-year periodicities may reflect the ~200-year solar de Vries cycle that is commonly believed to be one of the most intense solar cycles (e.g. Wagner G. et al., 2001; Damon&Peristykh, 2000; Stuiver&Braziunas, 1993). Dendrochronlogical data obtained from the Tien Shan and Qinghai-Tibetan Plateau confirm the existence of 200-year climatic cycles associated with solar activity in Central Asia (Raspopov et al., 2008). Absence of 1500-year climatic cycles (Bond events) in Tel 2006 record may be explained by deep intercontinental location of the Lake Teletskoye whereas 1500-year cycles are linked with the North Atlantic oceanic circulation (Bond et al., 2001; Debret et al., 2007).

Overexpression of high molecular weight FGF-2 forms inhibits glioma growth by acting on cell-cycle progression and protein translation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lemiere, Sylvie; University Bordeaux1, Talence, F-33405; Azar, Rania

2008-12-10

In order to clarify the role of HMW FGF-2 in glioma development and angiogenesis, we over-expressed different human FGF-2 isoforms in C6 rat glioma cell line using a tetracycline-regulated expression system. Phenotypic modifications were analyzed in vitro and compared to untransfected cells or to cells over-expressing 18 kDa FGF-2 or all FGF-2 isoforms. In particular, we demonstrate that HMW FGF-2 has unique features in inhibiting glioma cell proliferation. HMW FGF-2 expressing cells showed a cell-cycle arrest at the G2M, demonstrating a role of HMW FGF-2 in controlling the entry in mitosis. Moreover, hydroxyurea was ineffective in blocking cells at themore » G1S boundary when HMW FGF-2 was expressed. We also show that the HMW FGF-2 isoforms inhibit 4E-BP1 phosphorylation at critical sites restoring the translation inhibitory activity of 4E-BP1. In vivo, inhibition of tumor growth was observed when cells expressed HMW FGF-2. This indicates that HMW FGF-2 inhibits tumor growth in glioma cells by acting on cell-cycle progression and protein translation.« less

Magmatic controls on eruption dynamics of the 1950 yr B.P. eruption of San Antonio Volcano, Tacaná Volcanic Complex, Mexico-Guatemala

NASA Astrophysics Data System (ADS)

Mora, Juan Carlos; Gardner, James Edward; Macías, José Luis; Meriggi, Lorenzo; Santo, Alba Patrizia

2013-07-01

San Antonio Volcano, in the Tacaná Volcanic Complex, erupted ~ 1950 yr. B.P., with a Pelean type eruption that produced andesitic pyroclastic surges and block-and-ash flows destroying part of the volcano summit and producing a horse-shoe shaped crater open to the SW. Between 1950 and 800 yr B.P. the eruption continued with effusive andesites followed by a dacite lava flow and a summit dome, all from a single magma batch. All products consist of phenocrysts and microphenocrysts of zoned plagioclase, amphibole, pyroxene, magnetite ± ilmenite, set in partially crystallized groundmass of glass and microlites of the same mineral phases, except for the lack of amphibole. Included in the andesitic blocks of the block-and-ash flow deposit are basaltic andesite enclaves with elongated and ellipsoidal forms and chilled margins. The enclaves have intersertal textures with brown glass between microphenocrysts of plagioclase, hornblende, pyroxene, and olivine, and minor proportions of phenocrysts of plagioclase, hornblende, and pyroxene. A compositional range obtained of blocks and enclaves resulted from mixing between andesite (866 °C ± 22) and basaltic andesite (enclaves, 932 °C ± 22), which may have triggered the explosive Pelean eruption. Vestiges of that mixing are preserved as complex compositional zones in plagioclase and clinopyroxene-rich reaction rims in amphibole in the andesite. Whole-rock chemistry, geothermometry, experimental petrology and modeling results suggest that after the mixing event the eruption tapped hybrid andesitic magma (≤ 900 °C) and ended with effusive dacitic magma (~ 825 °C), all of which were stored at ~ 200 MPa water pressure. A complex open-system evolution that involved crustal end-members best explains the generation of effusive dacite from the hybrid andesite. Amphibole in the dacite is rimmed by reaction products of plagioclase, orthopyroxene, and Fe-Ti oxides produced by decompression during ascent. Amphibole in the andesite, however, lacks such rims. Because the andesite was at 866 ± 22 °C and the dacite was at ~ 825 °C, the reaction rims indicate that the andesitic magma ascended at 0.023 m s- 1 during the explosive phase of the eruption, whereas the dacitic magma rose more slowly at ~ 0.002-0.004 m s- 1.

Molecular docking studies of 3-bromopyruvate and its derivatives to metabolic regulatory enzymes: Implication in designing of novel anticancer therapeutic strategies

PubMed Central

Yadav, Saveg; Pandey, Shrish Kumar; Singh, Vinay Kumar; Goel, Yugal; Kumar, Ajay

2017-01-01

Altered metabolism is an emerging hallmark of cancer, as malignant cells display a mammoth up-regulation of enzymes responsible for steering their bioenergetic and biosynthetic machinery. Thus, the recent anticancer therapeutic strategies focus on the targeting of metabolic enzymes, which has led to the identification of specific metabolic inhibitors. One of such inhibitors is 3-bromopyruvate (3-BP), with broad spectrum of anticancer activity due to its ability to inhibit multiple metabolic enzymes. However, the molecular characterization of its binding to the wide spectrum of target enzymes remains largely elusive. Therefore, in the present study we undertook in silico investigations to decipher the molecular nature of the docking of 3-BP with key target enzymes of glycolysis and TCA cycle by PatchDock and YASARA docking tools. Additionally, derivatives of 3-BP, dibromopyruvate (DBPA) and propionic acid (PA), with reported biological activity, were also investigated for docking to important target metabolic enzymes of 3-BP, in order to predict their therapeutic efficacy versus that of 3-BP. A comparison of the docking scores with respect to 3-BP indicated that both of these derivatives display a better binding strength to metabolic enzymes. Further, analysis of the drug likeness of 3-BP, DBPA and PA by Lipinski filter, admetSAR and FAF Drug3 indicated that all of these agents showed desirable drug-like criteria. The outcome of this investigation sheds light on the molecular characteristics of the binding of 3-BP and its derivatives with metabolic enzymes and thus may significantly contribute in designing and optimizing therapeutic strategies against cancer by using these agents. PMID:28463978

Molecular docking studies of 3-bromopyruvate and its derivatives to metabolic regulatory enzymes: Implication in designing of novel anticancer therapeutic strategies.

PubMed

Yadav, Saveg; Pandey, Shrish Kumar; Singh, Vinay Kumar; Goel, Yugal; Kumar, Ajay; Singh, Sukh Mahendra

2017-01-01

Altered metabolism is an emerging hallmark of cancer, as malignant cells display a mammoth up-regulation of enzymes responsible for steering their bioenergetic and biosynthetic machinery. Thus, the recent anticancer therapeutic strategies focus on the targeting of metabolic enzymes, which has led to the identification of specific metabolic inhibitors. One of such inhibitors is 3-bromopyruvate (3-BP), with broad spectrum of anticancer activity due to its ability to inhibit multiple metabolic enzymes. However, the molecular characterization of its binding to the wide spectrum of target enzymes remains largely elusive. Therefore, in the present study we undertook in silico investigations to decipher the molecular nature of the docking of 3-BP with key target enzymes of glycolysis and TCA cycle by PatchDock and YASARA docking tools. Additionally, derivatives of 3-BP, dibromopyruvate (DBPA) and propionic acid (PA), with reported biological activity, were also investigated for docking to important target metabolic enzymes of 3-BP, in order to predict their therapeutic efficacy versus that of 3-BP. A comparison of the docking scores with respect to 3-BP indicated that both of these derivatives display a better binding strength to metabolic enzymes. Further, analysis of the drug likeness of 3-BP, DBPA and PA by Lipinski filter, admetSAR and FAF Drug3 indicated that all of these agents showed desirable drug-like criteria. The outcome of this investigation sheds light on the molecular characteristics of the binding of 3-BP and its derivatives with metabolic enzymes and thus may significantly contribute in designing and optimizing therapeutic strategies against cancer by using these agents.

Study of continuous blood pressure estimation based on pulse transit time, heart rate and photoplethysmography-derived hemodynamic covariates.

PubMed

Feng, Jingjie; Huang, Zhongyi; Zhou, Congcong; Ye, Xuesong

2018-06-01

It is widely recognized that pulse transit time (PTT) can track blood pressure (BP) over short periods of time, and hemodynamic covariates such as heart rate, stiffness index may also contribute to BP monitoring. In this paper, we derived a proportional relationship between BP and PPT -2 and proposed an improved method adopting hemodynamic covariates in addition to PTT for continuous BP estimation. We divided 28 subjects from the Multi-parameter Intelligent Monitoring for Intensive Care database into two groups (with/without cardiovascular diseases) and utilized a machine learning strategy based on regularized linear regression (RLR) to construct BP models with different covariates for corresponding groups. RLR was performed for individuals as the initial calibration, while recursive least square algorithm was employed for the re-calibration. The results showed that errors of BP estimation by our method stayed within the Association of Advancement of Medical Instrumentation limits (- 0.98 ± 6.00 mmHg @ SBP, 0.02 ± 4.98 mmHg @ DBP) when the calibration interval extended to 1200-beat cardiac cycles. In comparison with other two representative studies, Chen's method kept accurate (0.32 ± 6.74 mmHg @ SBP, 0.94 ± 5.37 mmHg @ DBP) using a 400-beat calibration interval, while Poon's failed (- 1.97 ± 10.59 mmHg @ SBP, 0.70 ± 4.10 mmHg @ DBP) when using a 200-beat calibration interval. With additional hemodynamic covariates utilized, our method improved the accuracy of PTT-based BP estimation, decreased the calibration frequency and had the potential for better continuous BP estimation.

An Arabidopsis Ran-binding protein, AtRanBP1c, is a co-activator of Ran GTPase-activating protein and requires the C-terminus for its cytoplasmic localization

NASA Technical Reports Server (NTRS)

Kim, Soo-Hwan; Roux, Stanley J.

2003-01-01

Ran-binding proteins (RanBPs) are a group of proteins that bind to Ran (Ras-related nuclear small GTP-binding protein), and thus either control the GTP/GDP-bound states of Ran or help couple the Ran GTPase cycle to a cellular process. AtRanBP1c is a Ran-binding protein from Arabidopsis thaliana (L.) Heynh. that was recently shown to be critically involved in the regulation of auxin-induced mitotic progression [S.-H. Kim et al. (2001) Plant Cell 13:2619-2630]. Here we report that AtRanBP1c inhibits the EDTA-induced release of GTP from Ran and serves as a co-activator of Ran-GTPase-activating protein (RanGAP) in vitro. Transient expression of AtRanBP1c fused to a beta-glucuronidase (GUS) reporter reveals that the protein localizes primarily to the cytosol. Neither the N- nor C-terminus of AtRanBP1c, which flank the Ran-binding domain (RanBD), is necessary for the binding of PsRan1-GTP to the protein, but both are needed for the cytosolic localization of GUS-fused AtRanBP1c. These findings, together with a previous report that AtRanBP1c is critically involved in root growth and development, imply that the promotion of GTP hydrolysis by the Ran/RanGAP/AtRanBP1c complex in the cytoplasm, and the resulting concentration gradient of Ran-GDP to Ran-GTP across the nuclear membrane could be important in the regulation of auxin-induced mitotic progression in root tips of A. thaliana.

Assessment of Non-traditional Isotopic Ratios by Mass Spectrometry for Analysis of Nuclear Activities. Annual Report 2011

DOE Office of Scientific and Technical Information (OSTI.GOV)

Biegalski, Steven R.; Buchholz, Bruce A.

2011-08-24

The objective of this work is to identify isotopic ratios suitable for analysis via mass spectrometry that distinguish between commercial nuclear reactor fuel cycles, fuel cycles for weapons grade plutonium, and products from nuclear weapons explosions. Methods will also be determined to distinguish the above from medical and industrial radionuclide sources. Mass spectrometry systems will be identified that are suitable for field measurement of such isotopes in an expedient manner.

Eruption dynamics and explosive-effusive transitions during the 1400 cal BP eruption of Opala volcano, Kamchatka, Russia

NASA Astrophysics Data System (ADS)

Andrews, Benjamin J.; Dufek, Josef; Ponomareva, Vera

2018-05-01

Deposits and pumice from the 1400 cal BP eruption of Opala volcano record activity that occurred at the explosive-effusive transition, resulting in intermittent, or stop-start, behavior, where explosive activity resumed following a pause. The eruption deposited distinctive, biotite-bearing rhyolite tephra across much of Kamchatka, and its stratigraphy consists of a lithic-rich pumice fall, overlain by pumice falls and pyroclastic density deposits, with the proportion of the latter increasing with height. This sequence repeats such that the middle of the total deposit is marked by a lithic-rich fall with abundant obsidian clasts. Notably, the eruptive pumice are poorly vesiculated, with vesicle textures that record fragmentation of a partially collapsed magmatic foam. The eruption vent, Baranii Amphitheater is filled with obsidian lavas of the same composition as the rhyolite tephra. Based upon the stratigraphic and compositional relations, we divide the eruption into four phases. Phase I initiated with eruption of a lithic-rich pumice fall, followed by eruption of Plinian falls and pyroclastic density currents. During Phase II, the eruption paused for at least 5-6 h; in this time, microlites nucleated and began to grow in the magma. Phase III essentially repeated the Phase I sequence. Obsidian lavas were emplaced during Phase IV. The pumice textures suggest that the magma ascended very near the threshold decompression rate for the transition between explosive (fast) and effusive (slow) behavior. The pause during Phase II likely occurred as decompression slowed enough for the magma to develop sufficient permeability for gas to escape resulting in collapse of the magmatic foam, stopping the eruption and temporarily sealing the conduit. After about 5-6 h, eruption resumed with, once again, magma decompressing very near the explosive-effusive transition. Phase III ended when the decompression rate slowed and lava dome emplacement began. Distributions of pumice and lithic clasts, and inclusion of data from previous workers, indicate minimum deposit volumes of 0.75 and 0.75-1.15 km3 (DRE) and eruption column heights of 18 and 20 km for Phases I and III, respectively. Phases I-III had a likely total duration of 60-80 h, including a pause in activity of 5-6 h during Phase II. This study demonstrates that analysis of vesicle textures from numerous pumice combined with stratigraphic data can reveal syn-eruptive changes in and links between magma permeability, decompression rate, and eruption style. OP-22-Pum is a typical Opala pumice. XRCT scans reveal that vesicles in pumice without obvious banding in hand sample are highly elongate and strongly aligned in different regions. The first half of the animation shows vesicles (white) and the second half shows the solid portions of the pumice (yellow). The field of view is 930 × 930 × 520 μm. OP-22-PumGlass is a pumice with alternating glassy and pumiceous domains. XRCT scans show that the glassy regions contain only small, sparse vesicles, whereas the pumiceous regions comprise elongate, aligned, and interconnected vesicles. The white domains are vesicles. The field of view is 1300 × 1950 × 520 μm.

Study of energy partitioning using a set of related explosive formulations

NASA Astrophysics Data System (ADS)

Lieber, Mark; Foster, Joseph C.; Stewart, D. Scott

2012-03-01

Condensed phase high explosives convert potential energy stored in the electro-magnetic field structure of complex molecules to high power output during the detonation process. Historically, the explosive design problem has focused on intramolecular energy storage. The molecules of interest are derived via molecular synthesis providing near stoichiometric balance on the physical scale of the molecule. This approach provides prompt reactions based on transport physics at the molecular scale. Modern material design has evolved to approaches that employ intermolecular ingredients to alter the spatial and temporal distribution of energy release. State of the art continuum methods have been used to study this approach to the materials design. Cheetah has been used to produce data for a set of fictitious explosive formulations based on C-4 to study the partitioning of the available energy between internal and kinetic energy in the detonation. The equation of state information from Cheetah has been used in ALE3D to develop an understanding of the relationship between variations in the formulation parameters and the internal energy cycle in the products.

The generation and evolution of anisotropic gas-permeability during viscous deformation in conduit-filling ignimbrites

NASA Astrophysics Data System (ADS)

Kolzenburg, Stephan; Russell, Kelly

2015-04-01

Gas-permeability plays a governing role in the pre-explosive pressurization of volcanic edifices. Pressurization may only occur once the total volume flux of gases emitted by an underlying magmatic or hydrothermal source exceeds the flow capacity of the permeable pathways present in the edifice. We have measured the physical properties (strain, porosity, permeability and ultrasonic wave velocities) of breadcrust bombs recovered from the deposits of the 2350 B.P. eruption of Mt Meager, BC, Canada. These rocks represent a conduit-infilling pyroclastic breccia that underwent various degrees of welding and deformation and present a remarkable opportunity to constrain the nature and timescale of mechanical processes operating within explosive volcanic conduits during repose periods between eruptive cycles. Here we present data from permeability measurements along the directions of maximum and minimum shortening which help quantifying the effect of vesicle microstructure on permeability. Permeability is measured by applying a range of confining pressures (between 3.4 and 17.2 MPa) to each sample and imposing a constant head (of 0.2 to 3.5 MPa) across the sample. The permeability is then determined using a modified version of Darcy's law applicable to compressible fluids. These rocks display a profound directionality in the measured physical properties resulting from the deformation-induced fabric. For all samples the permeability across the elongation fabric is highly correlated to the sample porosity whereas along the elongation fabric there is little effect of porosity on permeability. At porosity values of about 20% the permeability seems to reach a minimum at 10-16 m2 and does not change significantly with further reduction of porosity. Further, the effect of confining pressure on the permeability of these samples appears to be more pronounced across the elongation fabric than along the elongation fabric. The deformation fabric has a significant effect on the gas-permeability of the deposit. Porosity, on the other hand, appears to play a secondary role. This, fabric dependent, anisotropic permeability evolution of fragmental deposits during welding directly affects the gas escape from, and transport through the deposit and, therewith, plays a key role in the gas-pressure distribution and evolution within the volcano.

Eruption cycles in a basaltic andesite system: insights from numerical modeling

NASA Astrophysics Data System (ADS)

Smekens, J. F.; Clarke, A. B.; De'Michieli Vitturi, M.

2015-12-01

Persistently active explosive volcanoes are characterized by short explosive bursts, which often occur at periodic intervals numerous times per day, spanning years to decades. Many of these systems present relatively evolved compositions (andesite to rhyolite), and their cyclic activity has been the subject of extensive work (e.g., Soufriere Hills Volcano, Montserrat). However, the same periodic behavior can also be observed at open systems of more mafic compositions, such as Semeru in Indonesia or Karymsky in Kamchatka for example. In this work, we use DOMEFLOW, a 1D transient numerical model of magma ascent, to identify the conditions that lead to and control periodic eruptions in basaltic andesite systems, where the viscosity of the liquid phase can be drastically lower. Periodic behavior occurs for a very narrow range of conditions, for which the mass balance between magma flux and open-system gas escape repeatedly generates a viscous plug, pressurizes the magma beneath the plug, and then explosively disrupts it. The characteristic timescale and magnitude of the eruptive cycles are controlled by the overall viscosity of the magmatic mixture, with higher viscosities leading to longer cycles and lower flow rates at the top of the conduit. Cyclic eruptions in basaltic andesite systems are observed for higher crystal contents, smaller conduit radii, and over a wider range of chamber pressures than the andesitic system, all of which are the direct consequence of a decrease in viscosity of the melt phase, and in turn in the intensity of the viscous forces generated by the system. Results suggest that periodicity can exist in more mafic systems with relatively lower chamber pressures than andesite and rhyolite systems, and may explain why more mafic magmas sometimes remain active for decades.

Interface interactions in benzophenone doped by multiwalled carbon nanotubes

NASA Astrophysics Data System (ADS)

Lebovka, N. I.; Goncharuk, A.; Melnyk, V. I.; Puchkovska, G. A.

2009-08-01

The interface interactions were studied by methods of conductometry, low-temperature phosphorescence and differential scanning calorimetry (DSC) in multiwalled carbon nanotubes (MWCNT) and benzophenone (BP) composite. The concentration of MWCNTs was varied within 0-1 wt%. A percolative threshold was found at MWCNT concentrations exceeding 0.1 wt%. The integration of MWCNTs caused melting temperature increase (≈3 K for 1 wt% of MWCNTs). The effect of positive thermal resistively coefficient, as well as substantial hysteretic behaviour of electrical conductivity σ in a heating-cooling cycle, was observed near the melting point of BP ( T m=321.5 K). The activation-type temperature behaviour of electrical conductivity was observed in the temperature range of supercooled BP. The activation energy was decreasing with increase of MWCNT concentration. The observed nonlinear dependencies of electrical conductivity σ vs. applied voltage U reflect the transport mechanism of the charge carriers through amorphous interface films formed near the surface of the MWCNTs. The thermal shifts of phosphorescence spectra measured within the temperature range 5-200 K evidence existence of such interface films of amorphous BP with width of the order of 0.1 μm.

In situ SUMOylation analysis reveals a modulatory role of RanBP2 in the nuclear rim and PML bodies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saitoh, Noriko; Uchimura, Yasuhiro; The 21st Century Center of Excellence, Kumamoto University, 2-2-1 Honjo, Kumamoto 860-0811

2006-05-01

SUMO modification plays a critical role in a number of cellular functions including nucleocytoplasmic transport, gene expression, cell cycle and formation of subnuclear structures such as promyelocytic leukemia (PML) bodies. In order to identify the sites where SUMOylation takes place in the cell, we developed an in situ SUMOylation assay using a semi-intact cell system and subsequently combined it with siRNA-based knockdown of nucleoporin RanBP2, also known as Nup358, which is one of the known SUMO E3 proteins. With the in situ SUMOylation assay, we found that both nuclear rim and PML bodies, besides mitotic apparatuses, are major targets formore » active SUMOylation. The ability to analyze possible SUMO conjugation sites would be a valuable tool to investigate where SUMO E3-like activities and/or SUMO substrates exist in the cell. Specific knockdown of RanBP2 completely abolished SUMOylation along the nuclear rim and dislocated RanGAP1 from the nuclear pore complexes. Interestingly, the loss of RanBP2 markedly reduced the number of PML bodies, in contrast to other, normal-appearing nuclear compartments including the nuclear lamina, nucleolus and chromatin, suggesting a novel link between RanBP2 and PML bodies. SUMOylation facilitated by RanBP2 at the nuclear rim may be a key step for the formation of a particular subnuclear organization. Our data imply that SUMO E3 proteins like RanBP2 facilitate spatio-temporal SUMOylation for certain nuclear structure and function.« less

Human T-cell leukemia virus-I tax oncoprotein functionally targets a subnuclear complex involved in cellular DNA damage-response.

PubMed

Haoudi, Abdelali; Daniels, Rodney C; Wong, Eric; Kupfer, Gary; Semmes, O John

2003-09-26

The virally encoded oncoprotein Tax has been implicated in HTLV-1-mediated cellular transformation. The exact mechanism by which this protein contributes to the oncogenic process is not known. However, it has been hypothesized that Tax induces genomic instability via repression of cellular DNA repair. We examined the effect of de novo Tax expression upon the cell cycle, because appropriate activation of cell cycle checkpoints is essential to a robust damage-repair response. Upon induction of tax expression, Jurkat T-cells displayed a pronounced accumulation in G2/M that was reversible by caffeine. We examined the G2-specific checkpoint signaling response in these cells and found activation of the ATM/chk2-mediated pathway, whereas the ATR/chk1-mediated response was unaffected. Immunoprecipitation with anti-chk2 antibody results in co-precipitation of Tax demonstrating a direct interaction of Tax with a chk2-containing complex. We also show that Tax targets a discrete nuclear site and co-localizes with chk2 and not chk1. This nuclear site, previously identified as Tax Speckled Structures (TSS), also contains the early damage response factor 53BP1. The recruitment of 53BP1 to TSS is dependent upon ATM signaling and requires expression of Tax. Specifically, Tax expression induces redistribution of diffuse nuclear 53BP1 to the TSS foci. Taken together these data suggest that the TSS describe a unique nuclear site involved in DNA damage recognition, repair response, and cell cycle checkpoint activation. We suggest that association of Tax with this multifunctional subnuclear site results in disruption of a subset of the site-specific activities and contributes to cellular genomic instability.

Effect of oral contraceptive containing ethinyl estradiol combined with drospirenone vs. desogestrel on clinical and biochemical parameters in patients with polycystic ovary syndrome.

PubMed

Kriplani, Alka; Periyasamy, Anurekha Janaki; Agarwal, Nutan; Kulshrestha, Vidushi; Kumar, Anand; Ammini, Ariachery Chinnama

2010-08-01

A prospective randomized trial was conducted to compare efficacy of a drospirenone-containing combined oral contraceptives (COC) with desogestrel-containing COC in women with polycystic ovary-syndrome (PCOS) not desirous of child-bearing. Sixty women were randomized into study group [ethinylestradiol (EE) 30 mcg+drospirenone 3 mg] and control group (EE 30 mcg+desogestrel 150 mcg), treated for 6 months and followed up at 1 month, 3 months, 6 months, during treatment and 3 and 6 months post-treatment. Acne and hirsutism scoring, bodyweight, body mass index (BMI), blood pressure (BP), ultrasound parameters, lipid profile, glycemic profile and hormonal profile were compared. Cycles were regular in both groups during treatment. Effect of regular cycles persisted in 44.83% (13/30) vs. 17.24% (5/30) in study vs. control group at 6 months post-treatment with 33.3% decreased hirsutism score in the study group (versus no change in control group) even at 6 months after stopping treatment. With treatment, BMI fell by 0.52 kg/m(2) in the study group; systolic and diastolic BP fell in the study group while it rose in the control group. Low-density lipoprotein significantly decreased and high-density lipoprotein was elevated in the study group (p<.05). The study group showed a significant fall in fasting/postprandial blood sugar and insulin and total testosterone against a rise in the control group. In women with PCOS, a drospirenone containing COC has better outcome in terms of persistent regular cycles, antiandrogenic effect, fall in BMI and BP, better lipid profile, favorable glycemic and hormonal profile than desogestrel-containing COC. Copyright 2010 Elsevier Inc. All rights reserved.

Millennial-scale variability in south-east Australian hydroclimate between 30,000 and 10,000 years ago

NASA Astrophysics Data System (ADS)

Falster, Georgina; Tyler, Jonathan; Grant, Katharine; Tibby, John; Turney, Chris; Löhr, Stefan; Jacobsen, Geraldine; Kershaw, A. Peter

2018-07-01

Global climate variability during the late Quaternary is commonly investigated within the framework of the 'bipolar seesaw' pattern of asynchronous temperature variations in the northern and southern polar latitudes. The terrestrial hydrological response to this pattern in south-eastern Australia is not fully understood, as continuous, high-resolution, well-dated proxy records for the hydrological cycle in the region are sparse. Here we present a well-dated, highly resolved record of moisture balance spanning 30000-10000 calendar years before present (30-10 ka BP), based on x-ray fluorescence and organic carbon isotope (δ13COM) measurements of a sedimentary sequence from Lake Surprise in south-eastern Australia. The data provide a locally coherent record of the hydrological cycle. Elevated Si (reflecting windblown quartz and clays), and relatively high δ13COM, indicate an extended period of relative aridity between 28 and 18.5 ka BP, interrupted by millennial-scale episodes of decreased Si and δ13COM, suggesting increased moisture balance. This was followed by a rapid deglacial shift to low Si and δ13COM at 18.5 ka BP, indicative of wetter conditions. We find that these changes are coeval with other records from south-eastern Australia and New Zealand, and use a Monte Carlo Empirical Orthogonal Function approach to extract a common trend from three high-resolution records. Our analyses suggest that drivers of the regional hydrological cycle have varied on multi-millennial time scales, in response to major shifts in global atmosphere-ocean dynamics during the last glacial-interglacial transition. Southern Ocean processes were the dominant control on hydroclimate during glacial times, via a strong influence of cold sea surface temperatures on moisture uptake and delivery onshore. Following the last deglaciation (around 18 ka BP), the southward migration of cold Southern Ocean fronts likely resulted in the establishment of conditions more like those of the present day. Millennial-scale variability in records from the region is dominated by a persistent ca. 2300-year periodicity, consistent with other records across the Southern Hemisphere mid-latitudes; however, this pervasive periodicity is not obviously linked to the 'bipolar seesaw' and the mechanism remains equivocal.

Titer-plate formatted continuous flow thermal reactors: Design and performance of a nanoliter reactor

PubMed Central

Chen, Pin-Chuan; Park, Daniel S.; You, Byoung-Hee; Kim, Namwon; Park, Taehyun; Soper, Steven A.; Nikitopoulos, Dimitris E.; Murphy, Michael C.

2010-01-01

Arrays of continuous flow thermal reactors were designed, configured, and fabricated in a 96-device (12 × 8) titer-plate format with overall dimensions of 120 mm × 96 mm, with each reactor confined to a 8 mm × 8 mm footprint. To demonstrate the potential, individual 20-cycle (740 nL) and 25-cycle (990 nL) reactors were used to perform the continuous flow polymerase chain reaction (CFPCR) for amplification of DNA fragments of different lengths. Since thermal isolation of the required temperature zones was essential for optimal biochemical reactions, three finite element models, executed with ANSYS (v. 11.0, Canonsburg, PA), were used to characterize the thermal performance and guide system design: (1) a single device to determine the dimensions of the thermal management structures; (2) a single CFPCR device within an 8 mm × 8 mm area to evaluate the integrity of the thermostatic zones; and (3) a single, straight microchannel representing a single loop of the spiral CFPCR device, accounting for all of the heat transfer modes, to determine whether the PCR cocktail was exposed to the proper temperature cycling. In prior work on larger footprint devices, simple grooves between temperature zones provided sufficient thermal resistance between zones. For the small footprint reactor array, 0.4 mm wide and 1.2 mm high fins were necessary within the groove to cool the PCR cocktail efficiently, with a temperature gradient of 15.8°C/mm, as it flowed from the denaturation zone to the renaturation zone. With temperature tolerance bands of ±2°C defined about the nominal temperatures, more than 72.5% of the microchannel length was located within the desired temperature bands. The residence time of the PCR cocktail in each temperature zone decreased and the transition times between zones increased at higher PCR cocktail flow velocities, leading to less time for the amplification reactions. Experiments demonstrated the performance of the CFPCR devices as a function of flow velocity, fragment length, and copy number. A 99 bp DNA fragment was successfully amplified at flow velocities from 1 mm/s to 3 mm/s, requiring from 8.16 minutes for 20 cycles (24.48 s/cycle) to 2.72 minutes for 20 cycles (8.16 s/cycle), respectively. Yield compared to the same amplification sequence performed using a bench top thermal cycler decreased nonlinearly from 73% (at 1 mm/s) to 13% (at 3 mm/s) with shorter residence time at the optimal temperatures for the reactions due to increased flow rate primarily responsible. Six different DNA fragments with lengths between 99 bp and 997 bp were successfully amplified at 1 mm/s. Repeatable, successful amplification of a 99 bp fragment was achieved with a minimum of 8000 copies of the DNA template. This is the first demonstration and characterization of continuous flow thermal reactors within the 8 mm × 8 mm footprint of a 96-well micro-titer plate and is the smallest continuous flow PCR to date. PMID:20871807

Pyroclastic deposits as a guide for reconstructing the multi-stage evolution of the Somma-Vesuvius Caldera

NASA Astrophysics Data System (ADS)

Cioni, Raffaello; Santacroce, Roberto; Sbrana, Alessandro

The evolution of the Somma-Vesuvius caldera has been reconstructed based on geomorphic observations, detailed stratigraphic studies, and the distribution and facies variations of pyroclastic and epiclastic deposits produced by the past 20,000years of volcanic activity. The present caldera is a multicyclic, nested structure related to the emptying of large, shallow reservoirs during Plinian eruptions. The caldera cuts a stratovolcano whose original summit was at 1600-1900m elevation, approximately 500m north of the present crater. Four caldera-forming events have been recognized, each occurring during major Plinian eruptions (18,300 BP "Pomici di Base", 8000 BP "Mercato Pumice", 3400 BP "Avellino Pumice" and AD 79 "Pompeii Pumice"). The timing of each caldera collapse is defined by peculiar "collapse-marking" deposits, characterized by large amounts of lithic clasts from the outer margins of the magma chamber and its apophysis as well as from the shallow volcanic and sedimentary units. In proximal sites the deposits consist of coarse breccias resulting from emplacement of either dense pyroclastic flows (Pomici di Base and Pompeii eruptions) or fall layers (Avellino eruption). During each caldera collapse, the destabilization of the shallow magmatic system induced decompression of hydrothermal-magmatic and hydrothermal fluids hosted in the wall rocks. This process, and the magma-ground water interaction triggered by the fracturing of the thick Mesozoic carbonate basement hosting the aquifer system, strongly enhanced the explosivity of the eruptions.

Over-expressing the C3 photosynthesis cycle enzyme Sedoheptulose-1-7 Bisphosphatase improves photosynthetic carbon gain and yield under fully open air CO2 fumigation (FACE)

PubMed Central

2011-01-01

Background Biochemical models predict that photosynthesis in C3 plants is most frequently limited by the slower of two processes, the maximum capacity of the enzyme Rubisco to carboxylate RuBP (Vc,max), or the regeneration of RuBP via electron transport (J). At current atmospheric [CO2] levels Rubisco is not saturated; consequently, elevating [CO2] increases the velocity of carboxylation and inhibits the competing oxygenation reaction which is also catalyzed by Rubisco. In the future, leaf photosynthesis (A) should be increasingly limited by RuBP regeneration, as [CO2] is predicted to exceed 550 ppm by 2050. The C3 cycle enzyme sedoheptulose-1,7 bisphosphatase (SBPase, EC 3.1.3.17) has been shown to exert strong metabolic control over RuBP regeneration at light saturation. Results We tested the hypothesis that tobacco transformed to overexpressing SBPase will exhibit greater stimulation of A than wild type (WT) tobacco when grown under field conditions at elevated [CO2] (585 ppm) under fully open air fumigation. Growth under elevated [CO2] stimulated instantaneous A and the diurnal photosynthetic integral (A') more in transformants than WT. There was evidence of photosynthetic acclimation to elevated [CO2] via downregulation of Vc,max in both WT and transformants. Nevertheless, greater carbon assimilation and electron transport rates (J and Jmax) for transformants led to greater yield increases than WT at elevated [CO2] compared to ambient grown plants. Conclusion These results provide proof of concept that increasing content and activity of a single photosynthesis enzyme can enhance carbon assimilation and yield of C3 crops grown at [CO2] expected by the middle of the 21st century. PMID:21884586

A reconstruction of atmospheric carbon dioxide and its stable carbon isotopic composition from the penultimate glacial maximum to the last glacial inception

NASA Astrophysics Data System (ADS)

Schneider, R.; Schmitt, J.; Köhler, P.; Joos, F.; Fischer, H.

2013-11-01

The reconstruction of the stable carbon isotope evolution in atmospheric CO2 (δ13Catm), as archived in Antarctic ice cores, bears the potential to disentangle the contributions of the different carbon cycle fluxes causing past CO2 variations. Here we present a new record of δ13Catm before, during and after the Marine Isotope Stage 5.5 (155 000 to 105 000 yr BP). The dataset is archived on the data repository PANGEA® (www.pangea.de) under 10.1594/PANGAEA.817041. The record was derived with a well established sublimation method using ice from the EPICA Dome C (EDC) and the Talos Dome ice cores in East Antarctica. We find a 0.4‰ shift to heavier values between the mean δ13Catm level in the Penultimate (~ 140 000 yr BP) and Last Glacial Maximum (~ 22 000 yr BP), which can be explained by either (i) changes in the isotopic composition or (ii) intensity of the carbon input fluxes to the combined ocean/atmosphere carbon reservoir or (iii) by long-term peat buildup. Our isotopic data suggest that the carbon cycle evolution along Termination II and the subsequent interglacial was controlled by essentially the same processes as during the last 24 000 yr, but with different phasing and magnitudes. Furthermore, a 5000 yr lag in the CO2 decline relative to EDC temperatures is confirmed during the glacial inception at the end of MIS5.5 (120 000 yr BP). Based on our isotopic data this lag can be explained by terrestrial carbon release and carbonate compensation.

Synergistic antitumor effect of 3-bromopyruvate and 5-fluorouracil against human colorectal cancer through cell cycle arrest and induction of apoptosis.

PubMed

Chong, Dianlong; Ma, Linyan; Liu, Fang; Zhang, Zhirui; Zhao, Surong; Huo, Qiang; Zhang, Pei; Zheng, Hailun; Liu, Hao

2017-09-01

3-Bromopyruvic acid (3-BP) is a well-known inhibitor of energy metabolism. It has been proposed as an anticancer agent as well as a chemosensitizer for use in combination with anticancer drugs. 5-Fluorouracil (5-FU) is the first-line chemotherapeutic agent for colorectal cancer; however, most patients develop resistance to 5-FU through various mechanisms. The aim of this study was to investigate whether 3-BP has a synergistic antitumor effect with 5-FU on human colorectal cancer cells. In our study, combined 3-BP and 5-FU treatment upregulated p53 and p21, whereas cyclin-dependent kinase CDK4 and CDK2 were downregulated, which led to G0/G1 phase arrest. Furthermore, there was an increase in reactive oxygen species levels and a decrease in adenosine triphosphate levels. It was also observed that Bax expression increased, whereas Bcl-2 expression reduced, which were indicative of mitochondria-dependent apoptosis. In addition, the combination of 3-BP and 5-FU significantly suppressed tumor growth in the BALB/c mice in vivo. Therefore, 3-BP inhibits tumor proliferation and induces S and G2/M phase arrest. It also exerts a synergistic antitumor effect with 5-FU on SW480 cells.

Optimizing the Placement of Burnable Poisons in PWRs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yilmaz, Serkan; Ivanov, Kostadin; Levine, Samuel

2005-07-15

The principal focus of this work is on developing a practical tool for designing the minimum amount of burnable poisons (BPs) for a pressurized water reactor using a typical Three Mile Island Unit 1 2-yr cycle as the reference design. The results of this study are to be applied to future reload designs. A new method, the Modified Power Shape Forced Diffusion (MPSFD) method, is presented that initially computes the BP cross section to force the power distribution into a desired shape. The method employs a simple formula that expresses the BP cross section as a function of the differencemore » between the calculated radial power distributions (RPDs) and the limit set for the maximum RPD. This method places BPs into all fresh fuel assemblies (FAs) having an RPD greater than the limit. The MPSFD method then reduces the BP content by reducing the BPs in fresh FAs with the lowest RPDs. Finally, the minimum BP content is attained via a heuristic fine-tuning procedure.This new BP design program has been automated by incorporating the new MPSFD method in conjunction with the heuristic fine-tuning program. The program has automatically produced excellent results for the reference core, and has the potential to reduce fuel costs and save manpower.« less

Bomb swab: Can trace explosive particle sampling and detection be improved?

PubMed

Fisher, Danny; Zach, Raya; Matana, Yossef; Elia, Paz; Shustack, Shiran; Sharon, Yarden; Zeiri, Yehuda

2017-11-01

The marked increase in international terror in recent years requires the development of highly efficient methods to detect trace amounts of explosives at airports, border crossings and check points. The preferred analytical method worldwide is the ion mobility spectrometry (IMS) that is capable of detecting most explosives at the nano-gram level. Sample collection for the IMS analysis is based on swabbing of a passenger's belongings to collect possible explosive residues. The present study examines a wide range of issues related to swab-based particle collection and analysis, in the hope of gaining deeper understanding into this technique that will serve to improve the detection process. The adhesion of explosive particles to three typical materials, plastic, metal and glass, were measured using atomic force microscopy (AFM). We found that a strong contribution of capillary forces to adhesion on glass and metal surfaces renders these substrates more promising materials upon which to find and collect explosive residues. The adhesion of explosives to different swipe materials was also examined. Here we found that Muslin, Nomex ® and polyamide membrane surfaces are the most promising materials for use as swipes. Subsequently, the efficiency of multiple swipe use - for collecting explosive residues from a glass surface using Muslin, Nomex ® and Teflon™ swipes - was examined. The study suggests that swipes used in about 5-10 "sampling and analysis cycles" have higher efficiency as compared to new unused swipes. The reason for this behavior was found to be related to the increased roughness of the swipe surface following a few swab measurements. Lastly, GC-MS analysis was employed to examine the nature of contaminants collected by the three types of swipe. The relative amounts of different contaminants are reported. The existence and interference of these contaminants have to be considered in relation to the detection efficiency of the various explosives by the IMS. Copyright © 2017 Elsevier B.V. All rights reserved.

Distinct kinetics of DNA repair protein accumulation at DNA lesions and cell cycle-dependent formation of γH2AX- and NBS1-positive repair foci.

PubMed

Suchánková, Jana; Kozubek, Stanislav; Legartová, Soňa; Sehnalová, Petra; Küntziger, Thomas; Bártová, Eva

2015-12-01

The DNA damage response is a fundamental, well-regulated process that occurs in the genome to recognise DNA lesions. Here, we studied kinetics of proteins involved in DNA repair pathways and their recruitment to DNA lesions during the cell cycle. In non-irradiated and irradiated cells, we analysed the distribution pattern and spatiotemporal dynamics of γH2AX, 53BP1, BMI1, MDC1, NBS1, PCNA, coilin and BRCA1 proteins. We observed that spontaneous and irradiation-induced foci (IRIF) demonstrated a high abundance of phosphorylated H2AX, which was consistent with 53BP1 and BMI1 protein accumulation. However, NBS1 and MDC1 proteins were recruited to nuclear bodies (NBs) to a lesser extent. Irradiation by γ-rays significantly increased the number of 53BP1- and γH2AX-positive IRIF, but cell cycle-dependent differences were only observed for γH2AX-positive foci in both non-irradiated and γ-irradiated cells. In non-irradiated cells, the G2 phase was characterised by an increased number of spontaneous γH2AX-foci; this increase was more pronounced after γ-irradiation. Cells in G2 phase had the highest number of γH2AX-positive foci. Similarly, γ-irradiation increased the number of NBS1-positive NBs only in G2 phase. Moreover, NBS1 accumulated in nucleoli after γ-irradiation showed the slowest recovery after photobleaching. Analysis of protein accumulation kinetics at locally induced DNA lesions showed that in HeLa cells, BMI1, PCNA and coilin were rapidly recruited to the lesions, 10-15 s after UVA-irradiation, whereas among the other proteins studied, BRCA1 demonstrated the slowest recruitment: BRCA1 appeared at the lesion 20 min after local micro-irradiation by UVA laser. We show that the kinetics of the accumulation of selected DNA repair-related proteins is protein specific at locally induced DNA lesions, and that the formation of γH2AX- and NBS1-positive foci, but not 53BP1-positive NBs, is cell cycle dependent in HeLa cells. Moreover, γH2AX is the most striking protein present not only at DNA lesions, but also spreading out in their vicinity. Our conclusions highlight the significant role of the spatiotemporal dynamics of DNA repair-related proteins and their specific assembly/disassembly at DNA lesions, which can be cell type- and cell cycle dependent. © 2015 Société Française des Microscopies and Société de Biologie Cellulaire de France. Published by John Wiley & Sons Ltd.

[Carl Friedrich von Weizsäcker and the Bethe-Weizsäcker cycle].

PubMed

Wiescher, Michael

2014-01-01

The Carbon- or Bethe-Weizsäcker Cycle plays an important role in astrophysics as one of the most important energy sources for a quiescent and explosive hydrogen burning in stars. This paper presents the historical background and the contributions by Carl Friedrich von Weizsäcker and Hans Bethe who provided the first predictions of the cycle. Furthermore, it discussed the experimental verification of the predicted process in the following decades. Also discussed is the extension of the initial Carbon cycle to the CNO multi-cycles and the hot CNO cycles which followed from the detailed experimental studies of the associated nuclear reactions. Finally discussed is the impact of the experimental and theoretical results on our present understanding of hydrogen burning in different stellar environments and on our understanding of the chemical evolution of our universe.

Use of natural diamonds to monitor 14C AMS instrument backgrounds

NASA Astrophysics Data System (ADS)

Taylor, R. E.; Southon, John

2007-06-01

To examine one component of the instrument-based background in the University of California Keck Carbon Cycle AMS spectrometer, we have obtained measurements on a set of natural diamonds pressed into sample holders. Natural diamond samples (N = 14) from different sources within rock formations with geological ages greatly in excess of 100 Ma yielded a range of currents (∼110-250 μA 12C- where filamentous graphite typically yields ∼150 μA 12C-) and apparent 14C ages (64.9 ± 0.4 ka BP [0.00031 ± 0.00002 fm] to 80.0 ± 1.1 ka BP [0.00005 ± 0.00001 fm]). Six fragments cut from a single diamond exhibited essentially identical 14C values - 69.3 ± 0.5 ka-70.6 ± 0.5 ka BP. The oldest 14C age equivalents were measured on natural diamonds which exhibited the highest current yields.

Favorable effect of aerobic exercise on arterial pressure and aortic pulse wave velocity during stress testing.

PubMed

Milatz, Florian; Ketelhut, Sascha; Ketelhut, Sascha; Ketelhut, Reinhard G

2015-07-01

Increased central pulse wave velocity is a major risk factor for cardiovascular disease. The favorable influence of exercise on arterial stiffness (AS) and blood pressure (BP) has been reported exclusively at rest. The present study investigated the influence of a single bout of acute cycling on AS and BP during recovery and, moreover, during cold pressor stress testing. 32 healthy men (33.7 ± 8 years, BMI 24 ± 2.5 kg/m²) performed a 60 minute endurance exercise on a bicycle ergometer (45 % VO2max). Before and after exercise aortic pulse wave velocity (aPWV) as well as central and peripheral BP were measured non-invasively at rest and at the end of a 2 minute cold pressor test (CPT). Even after 60 minutes of recovery aPWV (- 0.22 ± 0.3 m / sec) was significantly reduced (p < 0.01). Exercise decreased peripheral (- 8 ± 7 mmHg) and central (- 7 ± 8 mmHg) systolic BP as well as peripheral (- 3 ± 5 mmHg) and central (- 4 ± 7 mmHg) diastolic BP (p < 0.01). In comparison to measurements during CPT pre-exercise, there was a significant reduction in aPWV (- 0.19 ± 0.3 m / sec), peripheral (- 6 ± 10 mmHg) and central (- 5 ± 8 mmHg) systolic BP as well as peripheral (- 3 ± 6 mmHg) and central (- 3 ± 6 mmHg) diastolic BP during CPT after exercise (p < 0.01). The present study suggests that acute endurance exercise leads not only to decreased BP but even more reduces aPWV as a measure of AS even after 60 minutes of recovery. In particular, the investigation provides evidence that acute moderate-intensity exercise has a favorable effect on BP and aPWV during stress testing.

Climate change, humans, and the extinction of the woolly mammoth.

PubMed

Nogués-Bravo, David; Rodríguez, Jesús; Hortal, Joaquín; Batra, Persaram; Araújo, Miguel B

2008-04-01

Woolly mammoths inhabited Eurasia and North America from late Middle Pleistocene (300 ky BP [300,000 years before present]), surviving through different climatic cycles until they vanished in the Holocene (3.6 ky BP). The debate about why the Late Quaternary extinctions occurred has centred upon environmental and human-induced effects, or a combination of both. However, testing these two hypotheses-climatic and anthropogenic-has been hampered by the difficulty of generating quantitative estimates of the relationship between the contraction of the mammoth's geographical range and each of the two hypotheses. We combined climate envelope models and a population model with explicit treatment of woolly mammoth-human interactions to measure the extent to which a combination of climate changes and increased human pressures might have led to the extinction of the species in Eurasia. Climate conditions for woolly mammoths were measured across different time periods: 126 ky BP, 42 ky BP, 30 ky BP, 21 ky BP, and 6 ky BP. We show that suitable climate conditions for the mammoth reduced drastically between the Late Pleistocene and the Holocene, and 90% of its geographical range disappeared between 42 ky BP and 6 ky BP, with the remaining suitable areas in the mid-Holocene being mainly restricted to Arctic Siberia, which is where the latest records of woolly mammoths in continental Asia have been found. Results of the population models also show that the collapse of the climatic niche of the mammoth caused a significant drop in their population size, making woolly mammoths more vulnerable to the increasing hunting pressure from human populations. The coincidence of the disappearance of climatically suitable areas for woolly mammoths and the increase in anthropogenic impacts in the Holocene, the coup de grâce, likely set the place and time for the extinction of the woolly mammoth.

Optimization of Intermittent Hyperbaric Oxygen Exposures by Duration of Oxygen Cycles

DTIC Science & Technology

2012-01-01

IL-1β, IL-6 as a marker of HBO2 toxicity; and (2) by gene expression of heat shock protein 70 (HSP70) as a potential protective factor against... potential use in clinical and military exposures and dives. For this reason, alternation of 30 and 60 min HBO2 cycles with 10 min hyperbaric air breaks was... potential fire/explosion hazards of exposure to several atmospheres of 100% O2. In addition, environmental factors, such as CO2 buildup

A mechanism regulating G protein-coupled receptor signaling that requires cycles of protein palmitoylation and depalmitoylation.

PubMed

Jia, Lixia; Chisari, Mariangela; Maktabi, Mohammad H; Sobieski, Courtney; Zhou, Hao; Konopko, Aaron M; Martin, Brent R; Mennerick, Steven J; Blumer, Kendall J

2014-02-28

Reversible attachment and removal of palmitate or other long-chain fatty acids on proteins has been hypothesized, like phosphorylation, to control diverse biological processes. Indeed, palmitate turnover regulates Ras trafficking and signaling. Beyond this example, however, the functions of palmitate turnover on specific proteins remain poorly understood. Here, we show that a mechanism regulating G protein-coupled receptor signaling in neuronal cells requires palmitate turnover. We used hexadecyl fluorophosphonate or palmostatin B to inhibit enzymes in the serine hydrolase family that depalmitoylate proteins, and we studied R7 regulator of G protein signaling (RGS)-binding protein (R7BP), a palmitoylated allosteric modulator of R7 RGS proteins that accelerate deactivation of Gi/o class G proteins. Depalmitoylation inhibition caused R7BP to redistribute from the plasma membrane to endomembrane compartments, dissociated R7BP-bound R7 RGS complexes from Gi/o-gated G protein-regulated inwardly rectifying K(+) (GIRK) channels and delayed GIRK channel closure. In contrast, targeting R7BP to the plasma membrane with a polybasic domain and an irreversibly attached lipid instead of palmitate rendered GIRK channel closure insensitive to depalmitoylation inhibitors. Palmitate turnover therefore is required for localizing R7BP to the plasma membrane and facilitating Gi/o deactivation by R7 RGS proteins on GIRK channels. Our findings broaden the scope of biological processes regulated by palmitate turnover on specific target proteins. Inhibiting R7BP depalmitoylation may provide a means of enhancing GIRK activity in neurological disorders.

Response of marine bacterioplankton to a massive under-ice phytoplankton bloom in the Chukchi Sea (Western Arctic Ocean)

NASA Astrophysics Data System (ADS)

Ortega-Retuerta, E.; Fichot, C. G.; Arrigo, K. R.; Van Dijken, G. L.; Joux, F.

2014-07-01

The activity of heterotrophic bacterioplankton and their response to changes in primary production in the Arctic Ocean is essential to understand biogenic carbon flows in the area. In this study, we explored the patterns of bacterial abundance (BA) and bacterial production (BP) in waters coinciding with a massive under-ice phytoplankton bloom in the Chukchi Sea in summer 2011, where chlorophyll a (chl a) concentrations were up to 38.9 mg m-3. Contrary to our expectations, BA and BP did not show their highest values coinciding with the bloom. In fact, bacterial biomass was only 3.5% of phytoplankton biomass. Similarly, average DOC values were similar inside (average 57.2±3.1 μM) and outside (average 64.3±4.8 μM) the bloom patch. Regression analyses showed relatively weak couplings, in terms of slope values, between chl a or primary production and BA or BP. Multiple regression analyses indicated that both temperature and chl a explained BA and BP variability in the Chukchi Sea. This temperature dependence was confirmed experimentally, as higher incubation temperatures (6.6 °C vs. 2.2 °C) enhanced BA and BP, with Q10 values of BP up to 20.0. Together, these results indicate that low temperatures in conjunction with low dissolved organic matter release can preclude bacteria to efficiently process a higher proportion of carbon fixed by phytoplankton, with further consequences on the carbon cycling in the area.

Physical and chemical microstructural damage in pressed CL-20 explosives

NASA Astrophysics Data System (ADS)

Demol, Gauthier; Sandusky, Harold W.

2000-04-01

The ultimate utility of CL-20 as an ingredient in explosive and propellant formulations will depend upon the ability to understand the factors that are responsible for batch-to-batch variability with respect to sensitivity, and also to control the sensitivity in formulations within acceptable limits. We used light microscopy of cold-mounted, polished samples to characterize CL-20 at various stages in its life cycle. The evolution of damage from the initial neat crystals of CL-20 to the ready-to-use pressed pellets shows that processing seriously damages the crystals. These crystals are very brittle, and several explanations are proposed.

Incidence of back pain in adolescent athletes: a prospective study.

PubMed

Mueller, Steffen; Mueller, Juliane; Stoll, Josefine; Prieske, Olaf; Cassel, Michael; Mayer, Frank

2016-01-01

Recently, the incidence rate of back pain (BP) in adolescents has been reported at 21%. However, the development of BP in adolescent athletes is unclear. Hence, the purpose of this study was to examine the incidence of BP in young elite athletes in relation to gender and type of sport practiced. Subjective BP was assessed in 321 elite adolescent athletes (m/f 57%/43%; 13.2 ± 1.4 years; 163.4 ± 11.4 cm; 52.6 ± 12.6 kg; 5.0 ± 2.6 training yrs; 7.6 ± 5.3 training h/week). Initially, all athletes were free of pain. The main outcome criterion was the incidence of back pain [%] analyzed in terms of pain development from the first measurement day (M1) to the second measurement day (M2) after 2.0 ± 1.0 year. Participants were classified into athletes who developed back pain (BPD) and athletes who did not develop back pain (nBPD). BP (acute or within the last 7 days) was assessed with a 5-step face scale (face 1-2 = no pain; face 3-5 = pain). BPD included all athletes who reported faces 1 and 2 at M1 and faces 3 to 5 at M2. nBPD were all athletes who reported face 1 or 2 at both M1 and M2. Data was analyzed descriptively. Additionally, a Chi 2 test was used to analyze gender- and sport-specific differences ( p  = 0.05). Thirty-two athletes were categorized as BPD (10%). The gender difference was 5% (m/f: 12%/7%) but did not show statistical significance ( p  = 0.15). The incidence of BP ranged between 6 and 15% for the different sport categories. Game sports (15%) showed the highest, and explosive strength sports (6%) the lowest incidence. Anthropometrics or training characteristics did not significantly influence BPD ( p  = 0.14 gender to p  = 0.90 sports; r 2  = 0.0825). BP incidence was lower in adolescent athletes compared to young non-athletes and even to the general adult population. Consequently, it can be concluded that high-performance sports do not lead to an additional increase in back pain incidence during early adolescence. Nevertheless, back pain prevention programs should be implemented into daily training routines for sport categories identified as showing high incidence rates.

The ``Problem of the quaternary'' and the taxonomic rank of the late cenozoic in the international stratigraphic scale

NASA Astrophysics Data System (ADS)

Zubakov, V. A.

2011-02-01

An international scientific conflict has arisen around the International Stratigraphic Scale, the main document that regulates the rules of reading of geological records and, hence, concerns all Earth sciences. The matter of debate is the geological time scale of 2004, developed by the International Commission on Stratigraphy, where the Quaternary system was abandoned. This ICS decision triggered a protest among Quaternary geologists, members of INQUA, and became the subject of much controversy. This article provides a comprehensive analysis of the Quaternary problem and proposes a reasonable scientific solution that may be appropriate for both parties. The subject of Late Cenozoic geology is discussed: glaciations, human evolution, and recent deposits. In contrast to Charles Lyell's definition of the Plio-Pleistocene according to the percentage of modern mollusk species, it is defined here as a blanket formation, which is correlative to the topography and consists of mapped stratogens hosting fossils of modern biogeocenoses. Features of the description of the Plio-Pleistocene in terms of gravitational orbital tuning are considered. Four paleogeographic phases of modern environment evolution are recognized and ranked as stages: (1) The Messinian evolutionary explosion involved the appearance of many biogeocenoses and the bipedal walking of our extinct ancestors armed with sticks. It was a consequence of the Early Greenland (7.6 Ma BP) and Patagonian (6.7 Ma BP) hyperglaciations. (2) The Zanclean age is marked by climatic and hydrological but not evolutionary boundaries. (3) The appearance of the Villafranchian animal assemblage and Australopithecus, who used stones as weapon: 4.0-3.6 Ma BP. Orogeny and isolation of the Arctic Ocean changed the global climate dramatically. (4) The sexual revolution became the third evolutionary jump: the appearance of the first woman, "Eve", and the genus Homo with her: 1.9 Ma BP. According to the current view, the Plio-Pleistocene, as defined by Lyell, consists of nineteen chronozones, four stages and two series. Hence, it is a true system, Pliocene-Pleistocene = Hologene, with a GSSP at 7.6 Ma BP, complying with all rules of scientific stratigraphical subdivision, rather than the mere beginning of the archaic Quaternary pseudo system with GSSPs at 1.8 or 2.6 Ma BP

Hemodynamic and psychological responses to laboratory stressors in women: Assessing the roles of menstrual cycle phase, premenstrual symptomatology, and sleep characteristics

PubMed Central

Lustyk, M. Kathleen B.; Douglas, Haley A.C.; Shilling, Elizabeth A.; Woods, Nancy F.

2016-01-01

This study assessed whether premenstrual symptomatology and/or sleep characteristics explain increased luteal phase psychophysiological reactivity to laboratory stressors. We hypothesized that: (1) premenstrual symptoms and sleep characteristics would explain greater luteal versus follicular phase psychophysiological reactivity, (2) symptoms and sleep characteristics would differentially predict psychophysiological reactivity within each cycle phase, and (3) symptoms and sleep characteristics would interact to affect luteal but not follicular reactivity. Freely cycling women (N=87) completed two laboratory sessions, one follicular (cycle days 5–9) and one luteal (days 7–10 post-ovulation). We employed two stressors: one physical (cold pressor task) and the other cognitive in nature (Paced Auditory Serial Addition Task). During testing, electrocardiography monitored heart rate (HR) while a timed and auto-inflatable sphygmomanometer assessed blood pressure (BP). Participants also completed a one-time self-report measure of sleep characteristics and premenstrual symptomatology as well as a measure of state anxiety pre-post stressor. Results revealed greater luteal HR and systolic BP reactivity compared to follicular reactivity (p<0.001 for both analyses), however neither premenstrual symptoms nor sleep characteristics explained this luteal increase. Within cycle analyses revealed that symptoms and sleep characteristics interacted to affect luteal phase state anxiety reactivity (R2=.32, p=.002) with negative affect being associated with more reactivity when sleep hours were low (β=.333, p=.04). Overall, significant relationships existed during the luteal phase only. Findings are discussed in terms of clinical utility and methodological challenges related to performing laboratory stress testing in women. PMID:23092740

Complete genome sequence of Hirschia baltica type strain (IFAM 1418T)

PubMed Central

Chertkov, Olga; Brown, Pamela J.B.; Kysela, David T.; de Pedro, Miguel A.; Lucas, Susan; Copeland, Alex; Lapidus, Alla; Del Rio, Tijana Glavina; Tice, Hope; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Detter, John C.; Han, Cliff; Larimer, Frank; Chang, Yun-juan; Jeffries, Cynthia D.; Land, Miriam; Hauser, Loren; Kyrpides, Nikos C.; Ivanova, Natalia; Ovchinnikova, Galina; Tindall, Brian J.; Göker, Markus; Klenk, Hans-Peter; Brun, Yves V.

2011-01-01

The family Hyphomonadaceae within the Alphaproteobacteria is largely comprised of bacteria isolated from marine environments with striking morphologies and an unusual mode of cell growth. Here, we report the complete genome sequence Hirschia baltica, which is only the second a member of the Hyphomonadaceae with a published genome sequence. H. baltica is of special interest because it has a dimorphic life cycle and is a stalked, budding bacterium. The 3,455,622 bp long chromosome and 84,492 bp plasmid with a total of 3,222 protein-coding and 44 RNA genes were sequenced as part of the DOE Joint Genome Institute Program CSP 2008. PMID:22675580

Construction Operations Building Information Exchange (COBIE)

DTIC Science & Technology

2007-06-01

10 MIMOSA ...objectives. MIMOSA The goals of the Machinery Information Management Open Systems Alli- ance ( MIMOSA ) organization include the creation of open...information standards for life-cycle asset management [Johnson 2004]. As shown in Table 2-1 [BP 2004], MIMOSA is one of many standards that have been

Phreatic explosions during basaltic fissure eruptions: Kings Bowl lava field, Snake River Plain, USA

NASA Astrophysics Data System (ADS)

Hughes, Scott S.; Kobs Nawotniak, Shannon E.; Sears, Derek W. G.; Borg, Christian; Garry, William Brent; Christiansen, Eric H.; Haberle, Christopher W.; Lim, Darlene S. S.; Heldmann, Jennifer L.

2018-02-01

Physical and compositional measurements are made at the 7 km-long ( 2200 years B.P.) Kings Bowl basaltic fissure system and surrounding lava field in order to further understand the interaction of fissure-fed lavas with phreatic explosive events. These assessments are intended to elucidate the cause and potential for hazards associated with phreatic phases that occur during basaltic fissure eruptions. In the present paper we focus on a general understanding of the geological history of the site. We utilize geospatial analysis of lava surfaces, lithologic and geochemical signatures of lava flows and explosively ejected blocks, and surveys via ground observation and remote sensing. Lithologic and geochemical signatures readily distinguish between Kings Bowl and underlying pre-Kings Bowl lava flows, both of which comprise phreatic ejecta from the Kings Bowl fissure. These basalt types, as well as neighboring lava flows from the contemporaneous Wapi lava field and the older Inferno Chasm vent and outflow channel, fall compositionally within the framework of eastern Snake River Plain olivine tholeiites. Total volume of lava in the Kings Bowl field is estimated to be 0.0125 km3, compared to a previous estimate of 0.005 km3. The main (central) lava lake lost a total of 0.0018 km3 of magma by either drain-back into the fissure system or breakout flows from breached levees. Phreatic explosions along the Kings Bowl fissure system occurred after magma supply was cut off, leading to fissure evacuation, and were triggered by magma withdrawal. The fissure system produced multiple phreatic explosions and the main pit is accompanied by others that occur as subordinate pits and linear blast corridors along the fissure. The drop in magma supply and the concomitant influx of groundwater were necessary processes that led to the formation of Kings Bowl and other pits along the fissure. A conceptual model is presented that has relevance to the broader range of low-volume, monogenetic basaltic fissure eruptions on Earth, the Moon and other planetary bodies.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sekiyama, Naotaka; Arthanari, Haribabu; Papadopoulos, Evangelos

The eIF4E-binding protein (4E-BP) is a phosphorylation-dependent regulator of protein synthesis. The nonphosphorylated or minimally phosphorylated form binds translation initiation factor 4E (eIF4E), preventing binding of eIF4G and the recruitment of the small ribosomal subunit. Signaling events stimulate serial phosphorylation of 4E-BP, primarily by mammalian target of rapamycin complex 1 (mTORC1) at residues T 37/T 46, followed by T 70 and S 65. Hyperphosphorylated 4E-BP dissociates from eIF4E, allowing eIF4E to interact with eIF4G and translation initiation to resume. Because overexpression of eIF4E is linked to cellular transformation, 4E-BP is a tumor suppressor, and up-regulation of its activity is amore » goal of interest for cancer therapy. A recently discovered small molecule, eIF4E/eIF4G interaction inhibitor 1 (4EGI-1), disrupts the eIF4E/eIF4G interaction and promotes binding of 4E-BP1 to eIF4E. Structures of 14- to 16-residue 4E-BP fragments bound to eIF4E contain the eIF4E consensus binding motif, 54YXXXXLΦ 60 (motif 1) but lack known phosphorylation sites. We report in this paper a 2.1-Å crystal structure of mouse eIF4E in complex with m 7GTP and with a fragment of human 4E-BP1, extended C-terminally from the consensus-binding motif (4E-BP1 50–84). The extension, which includes a proline-turn-helix segment (motif 2) followed by a loop of irregular structure, reveals the location of two phosphorylation sites (S 65 and T 70). Our major finding is that the C-terminal extension (motif 3) is critical to 4E-BP1–mediated cell cycle arrest and that it partially overlaps with the binding site of 4EGI-1. Finally, the binding of 4E-BP1 and 4EGI-1 to eIF4E is therefore not mutually exclusive, and both ligands contribute to shift the equilibrium toward the inhibition of translation initiation.« less

Young cumulate complex beneath Veniaminof caldera, Aleutian arc, dated by zircon in erupted plutonic blocks

USGS Publications Warehouse

Bacon, C.R.; Sison, T.W.; Mazdab, F.K.

2007-01-01

Mount Veniaminof volcano, Alaska Peninsula, provides an opportunity to relate Quaternary volcanic rocks to a coeval intrusive complex. Veniaminof erupted tholeiitic basalt through dacite in the past ???260 k.y. Gabbro, diorite, and miarolitic granodiorite blocks, ejected 3700 14C yr B.P. in the most recent caldera-forming eruption, are fragments of a shallow intrusive complex of cumulate mush and segregated vapor-saturated residual melts. Sensitive high-resolution ion microprobe (SHRIMP) analyses define 238U-230Th isochron ages of 17.6 ?? 2.7 ka, 5+11/-10 ka, and 10.2 ?? 4.0 ka (2??) for zircon in two granodiorites and a diorite, respectively. Sparse zircons from two gabbros give 238-230Th model ages of 36 ?? 8 ka and 26 ?? 7 ka. Zircons from granodiorite and diorite crystallized in the presence of late magmatic aqueous fluid. Although historic eruptions have been weakly explosive Strombolian fountaining and small lava effusions, the young ages of plutonic blocks, as well as late Holocene dacite pumice, are evidence that the intrusive complex remains active and that evolved magmas can segregate at shallow levels to fuel explosive eruptions. ?? 2007 The Geological Society of America.

Effects of water drinking on cardiovascular responses to supine exercise and on orthostatic hypotension after exercise in pure autonomic failure.

PubMed

Humm, A M; Mason, L M; Mathias, C J

2008-10-01

Patients with pure autonomic failure (PAF) have an abnormal fall in blood pressure (BP) with supine exercise and exacerbation of orthostatic hypotension (OH) after exercise. This study assessed the pressor effect of water on the cardiovascular responses to supine exercise and on OH after exercise. 8 patients with PAF underwent a test protocol consisting of standing for 5 min, supine rest for 10 min, supine exercise by pedalling a cycle ergometer at workloads of 25, 50 and 75 W (each for 3 min), supine rest for 10 min and standing for 5 min. The test protocol was performed without water ingestion and on a separate occasion after 480 ml of distilled water immediately after pre-exercise standing. Beat to beat cardiovascular indices were measured with the Portapres II device with subsequent Modelflow analysis. All patients had severe OH pre-exercise (BP fall systolic 65.0 (26.1) mm Hg, diastolic 22.7 (13.5) mm Hg), with prompt recovery of BP in the supine position. 5 min after water drinking, there was a significant rise in BP in the supine position. With exercise, there was a clear fall in BP (systolic 42.1 (24.4) mm Hg, diastolic 25.9 (10.0) mm Hg) with a modest rise in heart rate; this occurred even after water ingestion (BP fall systolic 49.8 (18.9) mm Hg, diastolic 26.0 (9.1) mm Hg). BP remained low after exercise but was significantly higher after water intake, resulting in better tolerance of post-exercise standing. Water drinking did not change the abnormal cardiovascular responses to supine exercise. However, water drinking improved orthostatic tolerance post-exercise.

Effect of the α(2)-adrenoceptor antagonist yohimbine on vascular regulation of the middle cerebral artery and the ophthalmic artery in healthy subjects.

PubMed

Kaya, S; Kolodjaschna, J; Berisha, F; Polska, E; Pemp, B; Garhöfer, G; Schmetterer, L

2011-01-01

There is evidence that vascular beds distal to the ophthalmic artery (OA) show vasoconstriction in response to a step decrease in systemic blood pressure (BP). The mediators of this response are mostly unidentified. The aim of the current study was to test the hypothesis that α2-adrenoreceptors may contribute to the regulatory process in response to a decrease in BP. In this randomized, double-masked, placebo-controlled study 14 healthy male volunteers received either 22mg yohimbine hydrochloride or placebo. Beat-to-beat BP was measured by analysis of arterial pressure waveform; blood flow velocities in the middle cerebral artery (MCA) and the OA were measured with Doppler ultrasound. Measurements were done before, during and after a step decrease in BP. The step decrease in BP was induced by bilateral thigh cuffs at a suprasystolic pressure followed by a rapid cuff deflation. After cuff deflation, BP returned to baseline after 7-8 pulse cycles (PC). Blood velocities in the MCA returned to baseline earlier (4 PC) than BP indicating peripheral vasodilatation. Blood velocities in the OA returned to baseline later (15-20 PC) indicating peripheral vasoconstriction. Yohimbine did not affect the blood velocity response in the MCA, but significantly shortened the time of OA blood velocities to return to baseline values (6-7 PC, p<0.05). In conclusion, our results indicate that yohimbine did not alter the regulatory response in the MCA, but modified the response of vascular beds distal to the OA. This suggests that α2-adrenoceptors play a role in the vasoconstrictor response of the vasculatures distal to the OA. 2010 Elsevier Inc. All rights reserved.

Trailer siting issues: BP Texas City.

PubMed

Kaszniak, Mark; Holmstrom, Donald

2008-11-15

On 23 March, 2005, a series of explosions and fires occurred at the BP Texas City refinery during the startup of an isomerization (ISOM) process unit. Fifteen workers were killed and about 180 others were injured. All of the fatalities were contract workers; the deaths and most of the serious injuries occurred in and around temporary office trailers that had been sited near a blowdown drum and stack open to the atmosphere as part of ongoing turnaround activities in an adjacent unit. Due to problems that developed during the ISOM startup, flammable hydrocarbon liquid overfilled the blowdown drum and stack which resulted in a geyser-like release out the top into the atmosphere. The flammable hydrocarbons fell to the ground releasing vapors that were likely ignited from a nearby idling diesel pickup truck. A total of 44 trailers were damaged by the blast pressure wave that propagated through the refinery when the vapor cloud exploded. Thirteen trailers were totally destroyed and workers were injured in trailers as far as 479ft away from the release. The focus of this paper will be on trailer siting issues, including: need for work/office trailers within process units, adequacy of risk analysis methods in API RP 752, and minimum safe distance requirements

An 18,000 year-long eruptive record from Volcán Chaitén, northwestern Patagonia: Paleoenvironmental and hazard-assessment implications

NASA Astrophysics Data System (ADS)

Alloway, Brent V.; Pearce, Nick J. G.; Moreno, Patricio I.; Villarosa, Gustavo; Jara, Ignacio; De Pol-Holz, Ricardo; Outes, Valeria

2017-07-01

The 2008 eruption of Volcán Chaitén (VCha) in northwestern Patagonia was the first explosive rhyolitic eruption to have occurred within a century and provided an unprecedented scientific opportunity to examine all facets of the eruption ranging from magma rheology/ascent rates to ash-fall effects on biota and infrastructure. Up to very recently it was thought that the latest eruption prior to the 2008 event occurred c. 9750 cal. a BP. Although a number of researchers have recognised additional eruptive products, but their stratigraphy, age, and geochemical attributes have not been systematically described and/or recorded. In this study, we provide a detailed examination of andic cover-beds and tephra-bearing lake sequences located both proximally and distally to VCha, which record a series of hitherto unknown rhyolitic eruptive products and place all previous observations firmly within a coherent stratigraphic framework. Through major- and trace-element glass shard geochemistry we are able to confidently verify eruptive source. A total of 20 discrete tephra beds are recognised, with at least 10 having widespread areal distributions and/or depositional imprints broadly comparable to, or greater than, the 2008-tephra event. This record indicates that VCha has been continuously but intermittently active as far back as the end of the Last Glacial Maximum (c. 18,000 cal a BP) with two dominant, genetically related magma types and an intermediary 'mixed' type. Before this the eruptive record has been largely obscured and/or erased by widespread Andean piedmont glaciation. However, based on the tempo of VCha activity over the last c. 18,000 years, older VCha eruptives can be anticipated to occur as well as future hazardous explosive events. The new eruptive inventory will ultimately be useful for correlating equivalent-aged sequences and refining long-term eruptive tempo as well as corresponding temporal changes in magmatic evolution.

Explosive processes during the 2015 eruption of Axial Seamount, as recorded by seafloor hydrophones

NASA Astrophysics Data System (ADS)

Caplan-Auerbach, J.; Dziak, R. P.; Haxel, J.; Bohnenstiehl, D. R.; Garcia, C.

2017-04-01

Following the installation of the Ocean Observatories Initiative cabled array, the 2015 eruption of Axial Seamount, Juan de Fuca ridge, became the first submarine eruption to be captured in real time by seafloor seismic and acoustic instruments. This eruption also marked the first instance where the entire eruption cycle of a submarine volcano, from the previous eruption in 2011 to the end of the month-long 2015 event, was monitored continuously using autonomous ocean bottom hydrophones. Impulsive sounds associated with explosive lava-water interactions are identified within hydrophone records during both eruptions. Explosions within the caldera are acoustically distinguishable from those occurring in association with north rift lava flows erupting in 2015. Acoustic data also record a series of broadband diffuse events, occurring in the waning phase of the eruption, and are interpreted as submarine Hawaiian explosions. This transition from gas-poor to gas-rich eruptive activity coincides with an increase in water temperature within the caldera and with a decrease in the rate of deflation. The last recorded diffuse events coincide with the end of the eruption, represented by the onset of inflation. All the observed explosion signals couple strongly into the water column, and only weakly into the solid Earth, demonstrating the importance of hydroacoustic observations as a complement to seismic and geodetic studies of submarine eruptions.

How Does Circadian Rhythm Impact Salt Sensitivity of Blood Pressure in Mice? A Study in Two Close C57Bl/6 Substrains.

PubMed

Combe, Roy; Mudgett, John; El Fertak, Lahcen; Champy, Marie-France; Ayme-Dietrich, Estelle; Petit-Demoulière, Benoit; Sorg, Tania; Herault, Yann; Madwed, Jeffrey B; Monassier, Laurent

2016-01-01

Mouse transgenesis has provided the unique opportunity to investigate mechanisms underlying sodium kidney reabsorption as well as end organ damage. However, understanding mouse background and the experimental conditions effects on phenotypic readouts of engineered mouse lines such as blood pressure presents a challenge. Despite the ability to generate high sodium and chloride plasma levels during high-salt diet, observed changes in blood pressure are not consistent between wild-type background strains and studies. The present work was designed in an attempt to determine guidelines in the field of salt-induced hypertension by recording continuously blood pressure by telemetry in mice submitted to different sodium and potassium loaded diets and changing experimental conditions in both C57BL/6N and C57BL/6J mice strain (Normal salt vs. Low salt vs. High-salt/normal potassium vs. High salt/low potassium, standard vs. modified light cycle, Non-invasive tail cuff blood pressure vs. telemetry). In this study, we have shown that, despite a strong blood pressure (BP) basal difference between C57BL/6N and C57BL/6J mice, High salt/normal potassium diet increases BP and heart rate during the active phase only (dark period) in the same extent in both strains. On the other hand, while potassium level has no effect on salt-induced hypertension in C57BL/6N mice, high-salt/low potassium diet amplifies the effect of the high-salt challenge only in C57BL/6J mice. Indeed, in this condition, salt-induced hypertension can also be detected during light period even though this BP increase is lower compared to the one occurring during the dark period. Finally, from a methodological perspective, light cycle inversion has no effect on this circadian BP phenotype and tail-cuff method is less sensitive than telemetry to detect BP phenotypes due to salt challenges. Therefore, to carry investigations on salt-induced hypertension in mice, chronic telemetry and studies in the active phase are essential prerequisites.

Identifying isotropic events using a regional moment tensor inversion

DOE PAGES

Ford, Sean R.; Dreger, Douglas S.; Walter, William R.

2009-01-17

We calculate the deviatoric and isotropic source components for 17 explosions at the Nevada Test Site, as well as 12 earthquakes and 3 collapses in the surrounding region of the western United States, using a regional time domain full waveform inversion for the complete moment tensor. The events separate into specific populations according to their deviation from a pure double-couple and ratio of isotropic to deviatoric energy. The separation allows for anomalous event identification and discrimination between explosions, earthquakes, and collapses. Confidence regions of the model parameters are estimated from the data misfit by assuming normally distributed parameter values. Wemore » investigate the sensitivity of the resolved parameters of an explosion to imperfect Earth models, inaccurate event depths, and data with low signal-to-noise ratio (SNR) assuming a reasonable azimuthal distribution of stations. In the band of interest (0.02–0.10 Hz) the source-type calculated from complete moment tensor inversion is insensitive to velocity model perturbations that cause less than a half-cycle shift (<5 s) in arrival time error if shifting of the waveforms is allowed. The explosion source-type is insensitive to an incorrect depth assumption (for a true depth of 1 km), and the goodness of fit of the inversion result cannot be used to resolve the true depth of the explosion. Noise degrades the explosive character of the result, and a good fit and accurate result are obtained when the signal-to-noise ratio is greater than 5. We assess the depth and frequency dependence upon the resolved explosive moment. As the depth decreases from 1 km to 200 m, the isotropic moment is no longer accurately resolved and is in error between 50 and 200%. Furthermore, even at the most shallow depth the resultant moment tensor is dominated by the explosive component when the data have a good SNR.« less

Cardiorespiratory and autonomic interactions during snoring related resistive breathing.

PubMed

Mateika, J H; Mitru, G

2001-03-15

We hypothesized that blood pressure (BP) is less during snoring as compared to periods of non-snoring in non-apneic individuals. Furthermore, we hypothesized that this reduction may be accompanied by a simultaneous decrease in sympathetic (SNSA) and parasympathetic (PNSA) nervous system activity and an increase in heart rate (HR). N/A. N/A. N/A. The variables mentioned above in addition to breathing frequency were measured in 9 subjects during NREM sleep. In addition, the lowest systolic (SBP) and diastolic blood pressure (DBP) during inspiration and the highest SBP and DBP during expiration was determined breath-by-breath from segments selected from each NREM cycle. Heart rate variability was used as a marker of autonomic nervous system activity. Our results showed that BP during snoring decreased compared to non-snoring and the breath-by-breath BP analysis suggested that this difference may have been mediated by changes in intrathoracic pressure. In conjunction with the decrease in BP, SNSA decreased and HR increased however PNSA remained constant. Thus, a decrease in PNSA was likely not the primary mechanism responsible for the HR response. We conclude that BP responses and SNSA during snoring are similar to that reported previously in non-snoring individuals. However, the causal mechanisms maybe different and manifested in other measures such as HR. Thus, nocturnal cardiovascular and autonomic function maybe uniquely different in non-apneic snoring individuals.

Exposure to benzophenone-3 and reproductive toxicity: A systematic review of human and animal studies.

PubMed

Ghazipura, Marya; McGowan, Richard; Arslan, Alan; Hossain, Tanzib

2017-10-01

Hydroxy-4-methoxybenzophenone, also known as benzophenone-3 (BP-3), is a commonly used ultraviolet filter in skincare and as a food additive. Large concentrations of similar phenolic compounds have been detected in urine, amniotic fluid, and placental tissue, thereby raising questions about its impact on reproduction. The objective of this paper was to investigate the reproductive toxicity of BP-3 in humans and animals. In humans, studies showed that high levels of BP-3 exposure could be linked to an increase in male birth weight but a decline in female birth weight and male gestational age. In fish, BP-3 exposure resulted in a decline in egg production, hatching, and testosterone, along with a down-regulation of steroidogenic genes. In rats, a decrease in epididymal sperm density and a prolonged estrous cycle for females was observed. These positive associations may be attributed to an altered estrogen and testosterone balance as a result of endocrine disrupting effects of BP-3. However, the current body of literature is limited by non-uniform exposure and outcome measurements in studies both across and within species and future studies will need to be conducted in a standardized fashion to allow for a more significant contribution to the literature that allows for better comparison across studies. Copyright © 2017 Elsevier Inc. All rights reserved.

Growth arrest specific gene 2 in tilapia (Oreochromis niloticus): molecular characterization and functional analysis under low-temperature stress.

PubMed

Yang, ChangGeng; Wu, Fan; Lu, Xing; Jiang, Ming; Liu, Wei; Yu, Lijuan; Tian, Juan; Wen, Hua

2017-07-17

Growth arrest specific 2 (gas2) gene is a component of the microfilament system that plays a major role in the cell cycle, regulation of microfilaments, and cell morphology during apoptotic processes. However, little information is available on fish gas2. In this study, the tilapia (Oreochromis niloticus) gas2 gene was cloned and characterized for the first time. The open reading frame was 1020 bp, encoding 340 amino acids; the 5'-untranslated region (UTR) was 140 bp and the 3'-UTR was 70 bp, with a poly (A) tail. The highest promoter activity occurred in the regulatory region (-3000 to -2400 bp). The Gas2-GFP fusion protein was distributed within the cytoplasm. Quantitative reverse transcription-polymerase chain reaction and western blot analyses revealed that gas2 gene expression levels in the liver, muscle, and brain were clearly affected by low temperature stress. The results of gas2 RNAi showed decreased expression of the gas2 and P53 genes. These results suggest that the tilapia gas2 gene may be involved in low temperature stress-induced apoptosis.

Multi-proxy dating of Holocene maar lakes and Pleistocene dry maar sediments in the Eifel, Germany

NASA Astrophysics Data System (ADS)

Sirocko, Frank; Dietrich, Stephan; Veres, Daniel; Grootes, Pieter M.; Schaber-Mohr, Katja; Seelos, Klemens; Nadeau, Marie-Josée; Kromer, Bernd; Rothacker, Leo; Röhner, Marieke; Krbetschek, Matthias; Appleby, Peter; Hambach, Ulrich; Rolf, Christian; Sudo, Masafumi; Grim, Stephanie

2013-02-01

During the last twelve years the ELSA Project (Eifel Laminated Sediment Archive) at Mainz University has drilled a total of about 52 cores from 27 maar lakes and filled-in maar basins in the Eifel/Germany. Dating has been completed for the Holocene cores using 6 different methods (210Pb and 137Cs activities, palynostratigraphy, event markers, varve counting, 14C). In general, the different methods consistently complement one another within error margins. Event correlation was used for relating typical lithological changes with historically known events such as the two major Holocene flood events at 1342 AD and ca 800 BC. Dating of MIS2-MIS3 core sections is based on greyscale tuning, radiocarbon and OSL dating, magnetostratigraphy and tephrochronology. The lithological changes in the sediment cores demonstrate a sequence of events similar to the North Atlantic rapid climate variability of the Last Glacial Cycle. The warmest of the MIS3 interstadials was GI14, when a forest with abundant spruce covered the Eifel area from 55 to 48 ka BP, i.e. during a time when also other climate archives in Europe suggested very warm conditions. The forest of this "Early Stage 3 warm phase" developed subsequently into a steppe with scattered birch and pine, and finally into a glacial desert at around 25 ka BP. Evidence for Mono Lake and Laschamp geomagnetic excursions is found in two long cores. Several large eruptions during Middle and Late Pleistocene (Ulmener Maar - 11,000 varve years BP, Laacher See - 12,900 varve years BP, Mosenberg volcanoes/Meerfelder Maar 41-45 cal ka BP, Dümpel Maar 116 ka BP, Glees Maar - 151 ka BP) produced distinct ash-layers crucial for inter-core and inter-site correlations. The oldest investigated maar of the Eifel is 40Ar/39Ar dated to the time older than 520 ka BP.

Cross-correlation of instantaneous phase increments in pressure-flow fluctuations: Applications to cerebral autoregulation

NASA Astrophysics Data System (ADS)

Chen, Zhi; Hu, Kun; Stanley, H. Eugene; Novak, Vera; Ivanov, Plamen Ch.

2006-03-01

We investigate the relationship between the blood flow velocities (BFV) in the middle cerebral arteries and beat-to-beat blood pressure (BP) recorded from a finger in healthy and post-stroke subjects during the quasisteady state after perturbation for four different physiologic conditions: supine rest, head-up tilt, hyperventilation, and CO2 rebreathing in upright position. To evaluate whether instantaneous BP changes in the steady state are coupled with instantaneous changes in the BFV, we compare dynamical patterns in the instantaneous phases of these signals, obtained from the Hilbert transform, as a function of time. We find that in post-stroke subjects the instantaneous phase increments of BP and BFV exhibit well-pronounced patterns that remain stable in time for all four physiologic conditions, while in healthy subjects these patterns are different, less pronounced, and more variable. We propose an approach based on the cross-correlation of the instantaneous phase increments to quantify the coupling between BP and BFV signals. We find that the maximum correlation strength is different for the two groups and for the different conditions. For healthy subjects the amplitude of the cross-correlation between the instantaneous phase increments of BP and BFV is small and attenuates within 3-5 heartbeats. In contrast, for post-stroke subjects, this amplitude is significantly larger and cross-correlations persist up to 20 heartbeats. Further, we show that the instantaneous phase increments of BP and BFV are cross-correlated even within a single heartbeat cycle. We compare the results of our approach with three complementary methods: direct BP-BFV cross-correlation, transfer function analysis, and phase synchronization analysis. Our findings provide insight into the mechanism of cerebral vascular control in healthy subjects, suggesting that this control mechanism may involve rapid adjustments (within a heartbeat) of the cerebral vessels, so that BFV remains steady in response to changes in peripheral BP.

Cross-correlation of instantaneous phase increments in pressure-flow fluctuations: applications to cerebral autoregulation.

PubMed

Chen, Zhi; Hu, Kun; Stanley, H Eugene; Novak, Vera; Ivanov, Plamen Ch

2006-03-01

We investigate the relationship between the blood flow velocities (BFV) in the middle cerebral arteries and beat-to-beat blood pressure (BP) recorded from a finger in healthy and post-stroke subjects during the quasisteady state after perturbation for four different physiologic conditions: supine rest, head-up tilt, hyperventilation, and CO2 rebreathing in upright position. To evaluate whether instantaneous BP changes in the steady state are coupled with instantaneous changes in the BFV, we compare dynamical patterns in the instantaneous phases of these signals, obtained from the Hilbert transform, as a function of time. We find that in post-stroke subjects the instantaneous phase increments of BP and BFV exhibit well-pronounced patterns that remain stable in time for all four physiologic conditions, while in healthy subjects these patterns are different, less pronounced, and more variable. We propose an approach based on the cross-correlation of the instantaneous phase increments to quantify the coupling between BP and BFV signals. We find that the maximum correlation strength is different for the two groups and for the different conditions. For healthy subjects the amplitude of the cross-correlation between the instantaneous phase increments of BP and BFV is small and attenuates within 3-5 heartbeats. In contrast, for post-stroke subjects, this amplitude is significantly larger and cross-correlations persist up to 20 heartbeats. Further, we show that the instantaneous phase increments of BP and BFV are cross-correlated even within a single heartbeat cycle. We compare the results of our approach with three complementary methods: direct BP-BFV cross-correlation, transfer function analysis, and phase synchronization analysis. Our findings provide insight into the mechanism of cerebral vascular control in healthy subjects, suggesting that this control mechanism may involve rapid adjustments (within a heartbeat) of the cerebral vessels, so that BFV remains steady in response to changes in peripheral BP.

Volcaniclastic stratigraphy of Gede volcano in West Java

NASA Astrophysics Data System (ADS)

Belousov, A.; Belousova, M.; Zaennudin, A.; Prambada, O.

2012-12-01

Gede volcano (2958 m a.s.l.) and the adjacent Pangrango volcano (3019 m a.s.l.) form large (base diameter 35 km) volcanic massif 60 km south of Jakarta. While Pangrango has no recorded eruptions, Gede is one of the most active volcanoes in Indonesia: eruptions were reported 26 times starting from 1747 (Petroeschevsky 1943; van Bemmelen 1949). Historic eruptions were mildly explosive (Vulcanian) with at least one lava flow. Modern activity of the volcano includes persistent solfataric activity in the summit crater and periodic seismic swarms - in 1990, 1991, 1992, 1995, 1996, 1997, 2000, 2010, and 2012 (CVGHM). Lands around the Gede-Pangrango massif are densely populated with villages up to 1500-2000 m a.s.l. Higher, the volcano is covered by rain forest of the Gede-Pangrango Natural Park, which is visited every day by numerous tourists who camp in the summit area. We report the results of the detailed reinvestigation of volcaniclastic stratigraphy of Gede volcano. This work has allowed us to obtain 24 new radiocarbon dates for the area. As a result the timing and character of activity of Gede in Holocene has been revealed. The edifice of Gede volcano consists of main stratocone (Gumuruh) with 1.8 km-wide summit caldera; intra-caldera lava cone (Gede proper) with a 900 m wide summit crater, having 2 breaches toward N-NE; and intra-crater infill (lava dome/flow capped with 3 small craters surrounded by pyroclastic aprons). The Gumuruh edifice, composed mostly of lava flows, comprises more than 90% of the total volume of the volcano. Deep weathering of rocks and thick (2-4 m) red laterite soil covering Gumuruh indicates its very old age. Attempts to get 14C dates in 4 different locations of Gumuruh (including a large debris avalanche deposit on its SE foot) provided ages older than 45,000 years - beyond the limit for 14C dating. Outside the summit caldera, notable volumes of fresh, 14C datable volcaniclastic deposits were found only in the NNE sector of the volcano where they form a fan below the breached summit crater. The fan is composed of pyroclastic flows (PFs) and lahars of Holocene age that were deposited in 4 major stages: ~ 10 000 BP - voluminous PF of black scoria; ~ 4000 BP - two PFs of mingled grey/black scoria; ~ 1200 BP - multiple voluminous PFs strongly enriched by accidental material; ~ 1000 BP - a small scale debris avalanche (breaching of the crater wall) followed by small scale PFs of black scoria. The intra-crater lava dome/flow was erupted in 1840 (Petroeschevsky, 1943). Three small craters on the top of the lava dome were formed by multiple post-1840 small-scale phreatomagmatic eruptions. Ejected pyroclasts are lithic hydrothermally altered material containing a few breadcrust bombs. The Holocene eruptive history of Gede indicates that the volcano can produce moderately strong (VEI 3-4) explosive eruptions and send PFs and lahars onto the NE foot of the volcano.

Molecular mechanism of the dual activity of 4EGI-1: Dissociating eIF4G from eIF4E but stabilizing the binding of unphosphorylated 4E-BP1

DOE PAGES

Sekiyama, Naotaka; Arthanari, Haribabu; Papadopoulos, Evangelos; ...

2015-07-13

The eIF4E-binding protein (4E-BP) is a phosphorylation-dependent regulator of protein synthesis. The nonphosphorylated or minimally phosphorylated form binds translation initiation factor 4E (eIF4E), preventing binding of eIF4G and the recruitment of the small ribosomal subunit. Signaling events stimulate serial phosphorylation of 4E-BP, primarily by mammalian target of rapamycin complex 1 (mTORC1) at residues T 37/T 46, followed by T 70 and S 65. Hyperphosphorylated 4E-BP dissociates from eIF4E, allowing eIF4E to interact with eIF4G and translation initiation to resume. Because overexpression of eIF4E is linked to cellular transformation, 4E-BP is a tumor suppressor, and up-regulation of its activity is amore » goal of interest for cancer therapy. A recently discovered small molecule, eIF4E/eIF4G interaction inhibitor 1 (4EGI-1), disrupts the eIF4E/eIF4G interaction and promotes binding of 4E-BP1 to eIF4E. Structures of 14- to 16-residue 4E-BP fragments bound to eIF4E contain the eIF4E consensus binding motif, 54YXXXXLΦ 60 (motif 1) but lack known phosphorylation sites. We report in this paper a 2.1-Å crystal structure of mouse eIF4E in complex with m 7GTP and with a fragment of human 4E-BP1, extended C-terminally from the consensus-binding motif (4E-BP1 50–84). The extension, which includes a proline-turn-helix segment (motif 2) followed by a loop of irregular structure, reveals the location of two phosphorylation sites (S 65 and T 70). Our major finding is that the C-terminal extension (motif 3) is critical to 4E-BP1–mediated cell cycle arrest and that it partially overlaps with the binding site of 4EGI-1. Finally, the binding of 4E-BP1 and 4EGI-1 to eIF4E is therefore not mutually exclusive, and both ligands contribute to shift the equilibrium toward the inhibition of translation initiation.« less

Comparative carbon cycle dynamics of the present and last interglacial

NASA Astrophysics Data System (ADS)

Brovkin, Victor; Brücher, Tim; Kleinen, Thomas; Zaehle, Sönke; Joos, Fortunat; Roth, Raphael; Spahni, Renato; Schmitt, Jochen; Fischer, Hubertus; Leuenberger, Markus; Stone, Emma J.; Ridgwell, Andy; Chappellaz, Jérôme; Kehrwald, Natalie; Barbante, Carlo; Blunier, Thomas; Dahl Jensen, Dorthe

2016-04-01

Changes in temperature and carbon dioxide during glacial cycles recorded in Antarctic ice cores are tightly coupled. However, this relationship does not hold for interglacials. While climate cooled towards the end of both the last (Eemian) and present (Holocene) interglacials, CO2 remained stable during the Eemian while rising in the Holocene. We identify and review twelve biogeochemical mechanisms of terrestrial (vegetation dynamics and CO2 fertilization, land use, wildfire, accumulation of peat, changes in permafrost carbon, subaerial volcanic outgassing) and marine origin (changes in sea surface temperature, carbonate compensation to deglaciation and terrestrial biosphere regrowth, shallow-water carbonate sedimentation, changes in the soft tissue pump, and methane hydrates), which potentially may have contributed to the CO2 dynamics during interglacials but which remain not well quantified. We use three Earth System Models (ESMs) of intermediate complexity to compare effects of selected mechanisms on the interglacial CO2 and δ13CO2 changes, focusing on those with substantial potential impacts: namely carbonate sedimentation in shallow waters, peat growth, and (in the case of the Holocene) human land use. A set of specified carbon cycle forcings could qualitatively explain atmospheric CO2 dynamics from 8 ka BP to the pre-industrial. However, when applied to Eemian boundary conditions from 126 to 115 ka BP, the same set of forcings led to disagreement with the observed direction of CO2 changes after 122 ka BP. This failure to simulate late-Eemian CO2 dynamics could be a result of the imposed forcings such as prescribed CaCO3 accumulation and/or an incorrect response of simulated terrestrial carbon to the surface cooling at the end of the interglacial. These experiments also reveal that key natural processes of interglacial CO2 dynamics - shallow water CaCO3 accumulation, peat and permafrost carbon dynamics - are not well represented in the current ESMs. Global-scale modeling of these long-term carbon cycle components started only in the last decade, and uncertainty in parameterization of these mechanisms is a main limitation in the successful modeling of interglacial CO2 dynamics.

Brain-Heart Pathways to Blood Pressure-Related Hypoalgesia.

PubMed

Ottaviani, Cristina; Fagioli, Sabrina; Mattei, Eugenio; Censi, Federica; Edwards, Louisa; Macaluso, Emiliano; Bozzali, Marco; Critchley, Hugo; Calcagnini, Giovanni

2018-03-28

High blood pressure (BP) is associated with reduced pain sensitivity, known as BP-related hypoalgesia. The underlying neural mechanisms remain uncertain, yet arterial baroreceptor signaling, occurring at cardiac systole, is implicated. We examined normotensives using functional neuroimaging (fMRI) and pain stimulation during distinct phases of the cardiac cycle to test the hypothesized neural mediation of baroreceptor-induced attenuation of pain. Eighteen participants (10 women; 32.7 ± 6.5 years) underwent BP monitoring over one week at home, and individual pain thresholds were determined in the lab. Subsequently, participants were administered unpredictable painful and non-painful electrocutaneous shocks (stimulus type), timed to occur either at systole or diastole (cardiac phase) in an event-related design. After each trial, participants evaluated their subjective experience. Subjective pain was lower for painful stimuli administered at systole compared to diastole, F1, 2283 = 4.82; p = 0.03. Individuals with higher baseline BP demonstrated overall lower pain perception, F1, 2164 = 10.47; p < 0.0001. Within the brain, painful stimulation activated somatosensory areas, prefrontal cortex, cingulate cortex, posterior insula, amygdala, and the thalamus. Stimuli delivered during systole (concurrent with baroreceptor discharge) activated areas associated with heightened parasympathetic drive. No stimulus type x cardiac phase interaction emerged except for a small cluster located in the right parietal cortex. We confirm the negative associations between BP and pain, highlighting the antinociceptive impact of baroreceptor discharge. Neural substrates associated with baroreceptor/BP-related hypoalgesia include superior parietal lobule, precentral and lingual gyrus, regions typically involved in the cognitive aspects of pain experience.

Glossary of Terms and Definitions Concerning the Safety and Suitability for Service of Munitions, Explosives and Related Products (Glossaire de Termes et Definitions sur la Securite et L’Aptitude au Service de Munitions, Matieres Explosives et Produits Associes)

DTIC Science & Technology

2002-04-01

de mines à la mar jettisoned mine L lancement launch largage jettison largage de détresse en condition de sécurité safe...configuration logistique Etat des conditions d’un matériel prévu pour le stockage et le transport par voies de communication. Pour les munition...durée de vie en service, durée de vie opérationnelle, cycle de vie, conditions de stockage et de transit] ANNEX C to /ANNEXE C à

Involvement of 53BP1, a p53 Binding Protein, in Chk2 Phosphorylation of p53 and DNA Damage Cell Cycle Checkpoints

DTIC Science & Technology

2005-05-01

NaC1, 1 mM EDTA, 1% NP40 supplemented required for cell survival. Mal. Cell. Biol. 22, 555-566 (2002). with protease inhibitors (Roche) and Benzonase...response is delayed or inhibited by treatment with the PIK this fact. inhibitors caffeine and wortmannin. 53BP1 foci also overlap I1 A fellow of the U...ltr Xbal __BTK_ _ WT 2,6 kB VICTR54 LTR NEO PGK BTK LT 8A 4DSI) inutant 1.5 LII + 13 D A +C +1tr rtrtr Neo 2 kR-’ c +i+ +i+tr tr/tr 2 3 A b

Fluctuation traits of Litchi wholesale price in China

NASA Astrophysics Data System (ADS)

Yan, F. F.; Qi, W. E.; Ouyang, X.

2017-07-01

This paper chose the wholesale price of litchi as research object based on the daily data of 11 main sales markets in China -- Beijing, Chengdu, Guangzhou, Hefei, Jiaxing, Nanjing, Shanghai, Shenyang, Changsha, Zhengzhou and Chongqing from April 1, 2012 to September 30, 2016. After analyzing the fluctuation characteristics with BP filter method and H-P filter method, and the fluctuation trends of litchi wholesale price in China obtained by BP filter are roughly consistent with the trends obtained by H-P filter. The main conclusions are as follows: there is strong cyclicality in the fluctuation of litchi wholesale price; the period of fluctuations of litchi wholesale prices are not repeatable; litchi wholesale price fluctuates asymmetrically in one fluctuation cycle.

Alignment, orientation, and Coulomb explosion of difluoroiodobenzene studied with the pixel imaging mass spectrometry (PImMS) camera.

PubMed

Amini, Kasra; Boll, Rebecca; Lauer, Alexandra; Burt, Michael; Lee, Jason W L; Christensen, Lauge; Brauβe, Felix; Mullins, Terence; Savelyev, Evgeny; Ablikim, Utuq; Berrah, Nora; Bomme, Cédric; Düsterer, Stefan; Erk, Benjamin; Höppner, Hauke; Johnsson, Per; Kierspel, Thomas; Krecinic, Faruk; Küpper, Jochen; Müller, Maria; Müller, Erland; Redlin, Harald; Rouzée, Arnaud; Schirmel, Nora; Thøgersen, Jan; Techert, Simone; Toleikis, Sven; Treusch, Rolf; Trippel, Sebastian; Ulmer, Anatoli; Wiese, Joss; Vallance, Claire; Rudenko, Artem; Stapelfeldt, Henrik; Brouard, Mark; Rolles, Daniel

2017-07-07

Laser-induced adiabatic alignment and mixed-field orientation of 2,6-difluoroiodobenzene (C 6 H 3 F 2 I) molecules are probed by Coulomb explosion imaging following either near-infrared strong-field ionization or extreme-ultraviolet multi-photon inner-shell ionization using free-electron laser pulses. The resulting photoelectrons and fragment ions are captured by a double-sided velocity map imaging spectrometer and projected onto two position-sensitive detectors. The ion side of the spectrometer is equipped with a pixel imaging mass spectrometry camera, a time-stamping pixelated detector that can record the hit positions and arrival times of up to four ions per pixel per acquisition cycle. Thus, the time-of-flight trace and ion momentum distributions for all fragments can be recorded simultaneously. We show that we can obtain a high degree of one-and three-dimensional alignment and mixed-field orientation and compare the Coulomb explosion process induced at both wavelengths.

Isotopic signature of atmospheric xenon released from light water reactors.

PubMed

Kalinowski, Martin B; Pistner, Christoph

2006-01-01

A global monitoring system for atmospheric xenon radioactivity is being established as part of the International Monitoring System to verify compliance with the Comprehensive Nuclear-Test-Ban Treaty (CTBT). The isotopic activity ratios of (135)Xe, (133m)Xe, (133)Xe and (131m)Xe are of interest for distinguishing nuclear explosion sources from civilian releases. Simulations of light water reactor (LWR) fuel burn-up through three operational reactor power cycles are conducted to explore the possible xenon isotopic signature of nuclear reactor releases under different operational conditions. It is studied how ratio changes are related to various parameters including the neutron flux, uranium enrichment and fuel burn-up. Further, the impact of diffusion and mixing on the isotopic activity ratio variability are explored. The simulations are validated with reported reactor emissions. In addition, activity ratios are calculated for xenon isotopes released from nuclear explosions and these are compared to the reactor ratios in order to determine whether the discrimination of explosion releases from reactor effluents is possible based on isotopic activity ratios.

Enhancement of enzymatic saccharification of Eucalyptus globulus: steam explosion versus steam treatment.

PubMed

Martin-Sampedro, Raquel; Revilla, Esteban; Villar, Juan C; Eugenio, Maria E

2014-09-01

Steam explosion and steam pre-treatment have proved capable of enhancing enzymatic saccharification of lignocellulosic materials. However, until now, these methods had not been compared under the same operational conditions and using the same raw material. Both pre-treatments lead to increased yields in the saccharification of Eucalyptus globulus; but results have been better with steam pre-treatments, despite the more accessible surface of exploded samples. The reason for this finding could be enzymatic inhibition: steam explosion causes a more extensive extraction of hemicelluloses and releases a greater amount of degradation products which can inhibit enzymatic action. Enzymatic inhibition is also dependent on the amount and chemical structure of lignin, which was also a contributing factor to the lower enzymatic yields obtained with the most severe pre-treatment. Thus, the highest yields (46.7% glucose and 73.4% xylose yields) were obtained after two cycle of steam treatment, of 5 and 3 min, at 183°C. Copyright © 2014 Elsevier Ltd. All rights reserved.

Ageing of Insensitive DNAN Based Melt-Cast Explosives

DTIC Science & Technology

2014-08-01

diurnal cycle (representative of the MEAO climate). Analysis of the ingredient composition, sensitiveness, mechanical and thermal properties was...first test condition was chosen to provide a worst-case scenario. Analysis of the ingredient composition, theoretical maximum density, sensitiveness...5 4.1.1 ARX-4027 Ingredient Analysis .............................................................. 5 4.1.2 ARX-4028 Ingredient Analysis

'Butterfly effect' in porous Bénard convection heated from below

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siri, Z.; Liew, K. Y.; Ibrahim, R. I.

2014-07-10

Transition from steady to chaos for the onset of Bénard convection in porous medium was analyzed. The governing equation is reduced to ordinary differential equation and solved using built in MATLAB ODE45. The transition from steady to chaos take over from a limit cycle followed by homoclinic explosion.

Methods for nuclear air-cleaning-system accident-consequence assessment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andrae, R.W.; Bolstad, J.W.; Gregory, W.S.

1982-01-01

This paper describes a multilaboratory research program that is directed toward addressing many questions that analysts face when performing air cleaning accident consequence assessments. The program involves developing analytical tools and supportive experimental data that will be useful in making more realistic assessments of accident source terms within and up to the atmospheric boundaries of nuclear fuel cycle facilities. The types of accidents considered in this study includes fires, explosions, spills, tornadoes, criticalities, and equipment failures. The main focus of the program is developing an accident analysis handbook (AAH). We will describe the contents of the AAH, which include descriptionsmore » of selected nuclear fuel cycle facilities, process unit operations, source-term development, and accident consequence analyses. Three computer codes designed to predict gas and material propagation through facility air cleaning systems are described. These computer codes address accidents involving fires (FIRAC), explosions (EXPAC), and tornadoes (TORAC). The handbook relies on many illustrative examples to show the analyst how to approach accident consequence assessments. We will use the FIRAC code and a hypothetical fire scenario to illustrate the accident analysis capability.« less

A precisely substituted benzopyran targets androgen refractory prostate cancer cells through selective modulation of estrogen receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Rajeev; Verma, Vikas; Sharma, Vikas

Dietary consumption of phytoestrogens like genistein has been linked with lower incidence of prostate cancer. The estradiol-like benzopyran core of genistein confers estrogen receptor-β (ER-β) selectivity that imparts weak anti-proliferative activity against prostate cancer cells. DL-2-[4-(2-piperidinoethoxy)phenyl]-3-phenyl-2H-1-benzopyran (BP), a SERM designed with benzopyran core, targeted androgen independent prostate cancer (PC-3) cells 14-times more potently than genistein, ~ 25% more efficiently than tamoxifen and 6.5-times more actively than ICI-182780, without forfeiting significant specificity in comparison to genistein. BP increased apoptosis (annexin-V and TUNEL labeling), arrested cell cycle, and significantly increased caspase-3 activity along with mRNA expressions of estrogen receptor (ER)-β and FasLmore » (qPCR) in PC-3 cells. In classical ERE-luc reporter assay BP behaved as a potent ER-α antagonist and ER-β agonist. Accordingly, it decreased expression of ER-α target PS2 (P < 0.01) and increased expression of ER-β target TNF-α (P < 0.05) genes in PC-3. ER-β deficient PC-3 (siRNA-transfected) was resistant to apoptotic and anti-proliferative actions of SERMs, including stimulation of FasL expression by BP. BP significantly inhibited phosphorylation of Akt and ERK-1/2, JNK and p38 in PC-3 (immunoblotting), and thus adopted a multi-pathway mechanism to exert a more potent anti-proliferative activity against prostate cancer cells than natural and synthetic SERMs. Its precise ER-subtype specific activity presents a unique lead structure for further optimization. - Highlights: • BP with benzopyran core of genistein was identified for ER-β selective action. • BP was 14-times more potent than genistien in targeting prostate cancer cells. • It behaved as a potent ER-β agonist and ER-α antagonist in gene reporter assays. • BP's anti-proliferative action was inhibited significantly in ER-β deficient cells. • BP — a unique lead structure for further optimization.« less

Lead isotope constraints on the origin of andesite and dacite magmas at Tungurahua volcano (Ecuador)

NASA Astrophysics Data System (ADS)

Nauret, Francois; Ancellin, Marie-Anne; Vlastelic, Ivan; Tournigand, Pierre-Yves; Samaniego, Pablo; Le Pennec, Jean Luc; Gannoun, Mouhcine; Hidalgo, Silvana; Schiano, Pierre

2016-04-01

Understanding the occurrence of large explosive eruptions involving silica-rich magmas at mostly andesitic volcanoes is crucial for volcanic hazard assessment Here we focus on the well-known active Tungurahua volcano (Ecuador), specifically its eruptive sequence for the last 3000 years BP, which are characterized by VEI 3 explosive events involving mostly homogeneous andesitic compositions (56-59 wt.% SiO2). However, some large eruptions (VEI ≥ 4) involving andesitic and dacitic magmas (up to 66 wt.% SiO2) also occur at 3000 BP, 1250 BP and 1886 AD. An additional outburst of siliceous magmas occurred during the last eruptive eruption of this volcano in 2006 [1]. Volcanic products at Tungurahua are described as been generated by a binary mixing between a silica-rich and a silica-poor end-member, but the origin of these components was not discussed [2]. Major, trace elements and Sr-Nd-Pb isotopes were used to investigate the genesis of the andesites and dacites. Andesites are heterogeneous in terms of Pb isotopes (206Pb/204Pb: 18.189-19.154, 207Pb/204Pb:15.658-15.696, 208Pb/204Pb: 38.752-38.918, 207Pb/206Pb: 0.8240-0.8275) but homogeneous in terms of major-trace element. Dacite are characterized by homogenous and low 207Pb/206Pb (0.8235±0.0001), very low Nb/U (1.97 to 4.49) and Ce/Pb (2.52-2.99) and high Th/La ratios (0.24 to 0.49). Triangular distribution of data in major element or trace element ratio vs. Pb isotopes plots suggests that at least three components control geochemical variability at Tungurahua. We interpret andesite compositions as reflecting mainly a deep mixture of two mantle components, with small addition of crustal material. We suggest that dacite results from a mixing between various andesite compositions and a larger amount of a contaminant derived from the volcanic basement of the Tungurahua made of late Cretaceous to Palaeogene oceanic plateau basalts and volcano-sedimentary rocks volcanic. Since andesite and dacite occur during the same eruption, we suggest that crustal contaminated magmas are stored into the crust and are sporadically sampled by andesite magmas ascending from greater depths.. As a result, the amount of assimilated crust (and thus the amount of silica-rich magma) may be used as a proxy of the magnitude of the eruption. [1] Samaniego et al. JVGR (2011) [2] Schiano, P., et al. Contrib. Mineral. Petrol. 160(2010) 297-312.

Construction Operations Building Information Exchange (COBIE): Requirements Definition and Pilot Implementation Standard

DTIC Science & Technology

2007-06-01

10 MIMOSA ...objectives. MIMOSA The goals of the Machinery Information Management Open Systems Alli- ance ( MIMOSA ) organization include the creation of open...information standards for life-cycle asset management [Johnson 2004]. As shown in Table 2-1 [BP 2004], MIMOSA is one of many standards that have been

Ranges of diurnal variation and the pattern of body temperature, blood pressure and heart rate in laboratory beagle dogs.

PubMed

Miyazaki, Hiroyasu; Yoshida, Mutsumi; Samura, Keiji; Matsumoto, Hiroyoshi; Ikemoto, Fumihiko; Tagawa, Masahiro

2002-01-01

Ranges in diurnal variation and the patterns of body temperature (T), blood pressure (BP), heart rate (HR) and locomotor activity (LA) in 61 laboratory beagle dogs were analyzed using a telemetry system. Body temperature, BP, HR and LA increased remarkably at feeding time. Locomotor activity increased sporadically during the other periods. Body temperature was maintained at the higher value after feeding but had decreased by 0.2 C by early the next morning. Blood pressure fell to a lower value after feeding but had increased by 2.8% by early the next morning. Heart rate decreased progressively after feeding and was 14.5% lower the next morning. This study determined that in laboratory beagles the ranges of diurnal variation and patterns of T, BP and HR are significantly different from those reported in humans and rodents, and that over 24 hr these physiological changes were associated with their sporadic wake-sleep cycles of the dogs.

Abr1, a Transposon-Like Element in the Genome of the Cultivated Mushroom Agaricus bisporus (Lange) Imbach

PubMed Central

Sonnenberg, Anton S. M.; Baars, Johan J. P.; Mikosch, Thomas S. P.; Schaap, Peter J.; Van Griensven, Leo J. L. D.

1999-01-01

A 300-bp repetitive element was found in the genome of the white button mushroom, Agaricus bisporus, and designated Abr1. It is present in ∼15 copies per haploid genome in the commercial strain Horst U1. Analysis of seven copies showed 89 to 97% sequence identity. The repeat has features typical of class II transposons (i.e., terminal inverted repeats, subterminal repeats, and a target site duplication of 7 bp). The latter shows a consensus sequence. When used as probe on Southern blots, Abr1 identifies relatively little variation within traditional and present-day commercial strains, indicating that most strains are identical or have a common origin. In contrast to these cultivars, high variation is found among field-collected strains. Furthermore, a remarkable difference in copy numbers of Abr1 was found between A. bisporus isolates with a secondarily homothallic life cycle and those with a heterothallic life cycle. Abr1 is a type II transposon not previously reported in basidiomycetes and appears to be useful for the identification of strains within the species A. bisporus. PMID:10427018

Regular moist snuff dipping does not affect endurance exercise performance.

PubMed

Björkman, Frida; Edin, Fredrik; Mattsson, C Mikael; Larsen, Filip; Ekblom, Björn

2017-01-01

Physiological and medical effects of snuff have previously been obtained either in cross-sectional studies or after snuff administration to non-tobacco users. The effects of snuff cessation after several years of daily use are unknown. 24 participants with >2 years of daily snuff-use were tested before and after >6 weeks snuff cessation (SCG). A control group (CO) of 11 snuff users kept their normal habits. Resting heart rate (HR) and blood pressure (BP) were significantly lower in SCG after snuff cessation, and body mass was increased by 1.4 ± 1.7 kg. Total cholesterol increased from 4.12 ± 0.54 (95% CI 3.89-4.35) to 4.46 ± 0.70 (95% CI 4.16-4.75) mM L-1 in SCG, due to increased LDL, and this change was significantly different from CO. Resting values of HDL, C-reactive protein, and free fatty acids (FFA) remained unchanged in both groups. In SCG group, both HR and BP were reduced during a four-stage incremental cycling test (from 50 to 80% of VO2max) and a prolonged cycling test (60 min at 50% of VO2max). Oxygen uptake (VO2), respiratory exchange ratio, blood lactate (bLa) and blood glucose (bGlu) concentration, and rate of perceived exertion (RPE) were unchanged. In CO group, all measurements were unchanged. During the prolonged cycling test, FFA was reduced, but with no significant difference between groups. During the maximal treadmill running test peak values of VO2, pulmonary ventilation (VE), time to exhaustion and bLa were unchanged in both groups. In conclusion, endurance exercise performance (VO2max and maximal endurance time) does not seem to be affected by prolonged snuff use, while effects on cardiovascular risk factors are contradictory. HR and BP during rest and submaximal exercise are reduced after cessation of regular use of snuff. Evidently, the long-time adrenergic stress on circulation is reversible.

Paleoenvironmental analyses of an organic deposit from an erosional landscape remnant, Arctic Coastal Plain of Alaska

USGS Publications Warehouse

Eisner, Wendy R.; Bockheim, James G.; Hinkel, Kenneth M.; Brown, Thomas A.; Nelson, Frederick E.; Peterson, Kim M.; Jones, Benjamin M.

2005-01-01

The dominant landscape process on the Arctic Coastal Plain of northern Alaska is the formation and drainage of thaw lakes. Lakes and drained thaw-lake basins account for approximately 75% of the modern surface expression of the Barrow Peninsula. The thaw-lake cycle usually obliterates lacustrine or peat sediments from previous cycles, which could otherwise be used for paleoecological reconstruction of long-term landscape and vegetation changes. Several possible erosional remnants of a former topographic surface that predates the formation of the thaw lakes have been tentatively identified. These remnants are characterized by a higher elevation, a thick organic layer with very high ground ice content in the upper permafrost and a plant community somewhat atypical of the region. Ten soil cores were collected from one site, and one core was intensively sampled for soil organic carbon content, pollen analysis and 14C dating. The lowest level of the organic sediments represents the earliest phase of plant growth and dates to ca. 9000 cal BP. Palynological evidence indicates the presence of mesic shrub tundra (including sedge, birch, willow and heath vegetation), and microfossil indicators point to wetter eutrophic conditions during this period. Carbon accumulation was rapid due to high net primary productivity in a relatively nutrient-rich environment. These results are interpreted as the local response to ameliorating climate during the early Holocene. The middle Holocene portion of the record contains an unconformity, indicating that between 8200 and 4200 cal BP sediments were eroded from the site, presumably in response to wind activity during a drier period centered around 4500 cal BP. The modern vegetation community of the erosional remnant was established after 4200 cal BP and peat growth resumed. During the late Holocene, carbon accumulation rates (CARs) were greatly reduced in response to the combined effects of declining productivity associated with climatic cooling, and increased nutrient stress as paludification and permafrost aggradation sequestered mineral nutrients.

Mid-late Holocene changes in sedimentary organic matter on the inner shelf of the East China Sea

NASA Astrophysics Data System (ADS)

Wu, Xiuning; Xing, Lei; Zhang, Ting; Xiang, Rong

2018-04-01

Marginal seas are important transitional zones for the delivery of terrestrial organic matter (TOM) from land to the open sea, and they play an important role in the carbon cycle. Tracing the source of sedimentary organic matter (SOM) deposited in marginal seas is fundamental to our understanding of the dispersal, degradation, migration, and conversion of organic matter. This paper presents high-resolution records of bulk organic matter and biomarker proxies from Core T08 that was recovered from the inner shelf of the East China Sea (ECS), and aims to identify the contributions of marine and terrestrial organic matter over the past 3725 yrs. Total organic carbon (TOC) values were low (0.50%) and showed no significant change between 3725 and 1800 yr BP (Period I), and increased continuously from 0.40% to 0.86% after 1800 yr BP (Period II: 1800-750 yr BP; Period III: 750 yr BP-present). The TMBR‧ (ratio of terrestrial to marine biomarkers) and δ13CTOC (δ13C of TOC) values showed steady TOM contribution during Period I and higher TOM contribution driven by the increased Changjiang River (CR)-derived TOM under strong East Asian Summer Monsoon (EASM) and El Niño during Period II. During Period III, the increase in marine organic matter (MOM) contribution was indicated by the TMBR‧, and this was caused by enhanced marine productivity related to intensified vertical mixture that was driven by the strengthened East Asian Winter Monsoon (EAWM). δ13CTOC shows a contrary trend to the TMBR‧ during Period III, probably influenced by variations in the C3 vegetation type during this period. Spectral analysis of the TMBR‧ series for the last 1200 yrs shows cycles with periods of 119, 75-85, and 54 yrs, confirming that climate-related events influenced the variation in SOM under the modulation of solar activity and solar irradiance at the centennial scale.

Paleoenvironmental analyses of an organic deposit from an erosional landscape remnant, Arctic Coastal Plain of Alaska

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eisner, W R; Bockheim, J G; Hinkel, K M

2005-01-02

The dominant landscape process on the Arctic Coastal Plain of northern Alaska is the formation and drainage of thaw lakes. Lakes and drained thaw lake basins account for approximately 75% of the modern surface expression of the Barrow Peninsula. The thaw lake cycle usually obliterates lacustrine or peat sediments from previous cycles which could otherwise be used for paleoecological reconstruction of long-term landscape and vegetation changes. Several possible erosional remnants of a former topographic surface that predates the formation of the thaw lakes have been tentatively identified. These remnants are characterized by a higher elevation, a thick organic layer withmore » very high ground ice content in the upper permafrost, and a plant community somewhat atypical of the region. Ten soil cores were collected from one site, and one core was intensively sampled for soil organic carbon content, pollen analysis, and {sup 14}C dating. The lowest level of the organic sediments represents the earliest phase of plant growth and dates to ca. 9000 cal BP. Palynological evidence indicates the presence of mesic shrub tundra (including sedge, birch, willow, and heath vegetation); and microfossil indicators point to wetter eutrophic conditions during this period. Carbon accumulation was rapid due to high net primary productivity in a relatively nutrient-rich environment. These results are interpreted as the local response to ameliorating climate during the early Holocene. The middle Holocene portion of the record contains an unconformity, indicating that between 8200 and 4200 cal BP sediments were eroded from the site, presumably in response to wind activity during a drier period centered around 4500 cal BP. The modern vegetation community of the erosional remnant was established after 4200 cal BP, and peat growth resumed. During the late Holocene, carbon accumulation rates were greatly reduced in response to the combined effects of declining productivity associated with climatic cooling, and increased nutrient stress as paludification and permafrost aggradation sequestered mineral nutrients.« less

The Averno 2 fissure eruption: a recent small-size explosive event at the Campi Flegrei Caldera (Italy)

NASA Astrophysics Data System (ADS)

di Vito, Mauro Antonio; Arienzo, Ilenia; Braia, Giuseppe; Civetta, Lucia; D'Antonio, Massimo; di Renzo, Valeria; Orsi, Giovanni

2011-04-01

The Averno 2 eruption (3,700 ± 50 a B.P.) was an explosive low-magnitude event characterized by magmatic and phreatomagmatic explosions, generating mainly fall and surge beds, respectively. It occurred in the Western sector of the Campi Flegrei caldera (Campanian Region, South Italy) at the intersection of two active fault systems, oriented NE and NW. The morphologically complex crater area, largely filled by the Averno lake, resulted from vent activation and migration along the NE-trending fault system. The eruption generated a complex sequence of pyroclastic deposits, including pumice fall deposits in the lower portion, and prevailing surge beds in the intermediate-upper portion. The pyroclastic sequence has been studied through stratigraphical, morphostructural and petrological investigations, and subdivided into three members named A through C. Member A was emplaced during the first phase of the eruption mainly by magmatic explosions which generated columns reaching a maximum height of 10 km. During this phase the eruption reached its climax with a mass discharge rate of 3.2 106 kg/s. Intense fracturing and fault activation favored entry of a significant amount of water into the system, which produced explosions driven by variably efficient water-magma interaction. These explosions generated wet to dry surge deposits that emplaced Member B and C, respectively. Isopachs and isopleths maps, as well as areal distribution of ballistic fragments and facies variation of surge deposits allow definition of four vents that opened along a NE oriented, 2 km long fissure. The total volume of magma extruded during the eruption has been estimated at about 0.07 km3 (DRE). The erupted products range in composition from initial, weakly peralkaline alkali-trachyte, to last-emplaced alkali-trachyte. Isotopic data and modeling suggest that mixing occurred during the Averno 2 eruption between a more evolved, less radiogenic stored magma, and a less evolved, more radiogenic magma that entered the shallow reservoir to trigger the eruption. The early phases of the eruption, during which the vent migrated from SW to the center of the present lake, were fed by the more evolved, uppermost magma, while the following phases extruded the less evolved, lowermost magma. Integration of the geological and petrological results suggests that the Averno 2 complex eruption was fed from a dyke-shaped shallow reservoir intruded into the NE-SW fault system bordering to the west the La Starza resurgent block, within the caldera floor.

Alluvial plain dynamics and human occupation in SW Amazonia during the Holocene: A paleosol-based reconstruction

NASA Astrophysics Data System (ADS)

Lombardo, Umberto; Rodrigues, Leonor; Veit, Heinz

2018-01-01

The present study reconstructs Holocene fluvial dynamics in the southern Amazonian foreland basin through the analysis of 36 stratigraphic profiles taken along a 300 km long transect across the Llanos de Moxos (LM), in the Bolivian Amazon. Based on 50 radiocarbon ages from paleosols intercalated with fluvial sediments, the most important changes in floodplain dynamics on a millennial scale are reconstructed and the links between pre-Columbian cultural processes and environmental change in the region explored. Results show that the frequency of river avulsions and crevasses, as inferred from the number and age of the cored paleosols, is stable from 8k cal. yrs BP to 4k cal. yrs BP and increases significantly from 4k to 2k cal. yrs BP, following the strengthening of el Niño/la Niña cycle and an increase in average precipitation. Fluvial activity then decreases and reaches its minimum after 2k cal BP. A comparison between the stratigraphic record and the archaeological record shows a match between periods of landscape stability in SW Amazonia (low river activity) and periods of pre-Columbian human occupation. The first Amazonians lived in the LM until 4k yrs. BP, when an abrupt increase in the frequency of river avulsions and crevasses forced the abandonment of the region. After two thousand years of archaeological hiatus, which matches the period of highest river activity in the region, agriculturists reoccupied the Bolivian Amazon.

Separate aftereffects of morning and evening exercise on ambulatory blood pressure in prehypertensive men.

PubMed

Brito, Leandro C; Rezende, Rafael A; Mendes, Caroline; Silva-Junior, Natan D; Tinucci, Taís; Cipolla-Neto, José; de Moraes Forjaz, Cláudia L

2018-01-01

Clinic postexercise hypotension (PEH) is different after aerobic exercise performed in the morning and in the evening. Thus, ambulatory PEH should also differ after exercises conducted at different times of day. However, because of the circadian pattern of blood pressure (BP), ambulatory PEH should be assessed considering a control condition. Thus, this study was designed to verify the effects of morning and evening exercises on postexercise ambulatory BP averages and circadian parameters by comparing responses obtained at each time of day after an exercise and a control session. Thirteen prehypertensive men underwent four sessions (randomized order): two in the morning (9 am) and two in the evening (6:30 pm). At each time of day, a control (C) and an exercise (E: cycle ergometer 45 min, 50% VO2peak) sessions were performed. After the sessions, an ambulatory BP and heart rate (HR) monitoring was started for 24 h. Paired t-test or Wilcoxon Signed Rank Test were used to compare the E and the C sessions at each time of day. In the morning, 24 h, daytime and nighttime HR were higher after the E than the C session. In the evening, nighttime systolic BP (116±11 vs. 120±10 mmHg, P=0.04) and rate pressure product (7981±1294 vs. 8583±1523 mmHg.bpm, P=0.04), as well as MESOR (128±11 vs. 130±10 mmHg, P=0.03) were lower in the E than the C session. In prehypertensive men, morning exercise increased ambulatory HR, while evening exercise decreased nighttime BP and cardiac work, reducing the MESOR of systolic BP.

The History and Impact of the CNO Cycles in Nuclear Astrophysics

NASA Astrophysics Data System (ADS)

Wiescher, Michael

2018-03-01

The carbon cycle, or Bethe-Weizsäcker cycle, plays an important role in astrophysics as one of the most important energy sources for quiescent and explosive hydrogen burning in stars. This paper presents the intellectual and historical background of the idea of the correlation between stellar energy production and the synthesis of the chemical elements in stars on the example of this cycle. In particular, it addresses the contributions of Carl Friedrich von Weizsäcker and Hans Bethe, who provided the first predictions of the carbon cycle. Further, the experimental verification of the predicted process as it developed over the following decades is discussed, as well as the extension of the initial carbon cycle to the carbon-nitrogen-oxygen (CNO) multi-cycles and the hot CNO cycles. This development emerged from the detailed experimental studies of the associated nuclear reactions over more than seven decades. Finally, the impact of the experimental and theoretical results on our present understanding of hydrogen burning in different stellar environments is presented, as well as the impact on our understanding of the chemical evolution of our universe.

Mechanical constraints on the triggering of vulcanian explosions at Santiaguito volcano, Guatemala

NASA Astrophysics Data System (ADS)

Hornby, Adrian; Lavallée, Yan; Collinson, Amy; Neuberg, Jurgen; De Angelis, Silvio; Kendrick, Jackie; Lamur, Anthony

2016-04-01

Gas- and ash explosions at Santiaguito volcano occur at regular 20-200 minute intervals, exiting through arcuate fractures in the summit dome of the Caliente vent. Infrasound, ground deformation and seismic monitoring collected during a long term monitoring survey conducted by the University of Liverpool have constrained a stable, repeatable source for these explosions. The explosions maintain similar magnitudes and (low) erupted mass throughout examined period. Ground deformation reveals stable ~25 minute inflation-deflation cycles, which culminate in either explosions or passive outgassing. Inversion of infrasound sources has revealed that faster inflation rates during the final minutes before peak inflation lead to explosions. These explosions fragment a consistently small-volume pressurized, gas-rich domain within magma located below a denser, lower permeability magma plug. Rapid decompression of this gas-rich domain occurs through fracturing and faulting, creating a highly permeable connection with atmospheric pressures near to the dome surface. We surmise that the dominant fracture mode at these shallow depths is tensile due to the volumetric strain exerted by a pressurising source below the magma plug, however a component of shear is also detected during explosive events. Fractures may either propagate downwards from the dome surface (due to greater magma stiffness and lower confining pressure) or upwards from the gas-rich domain (due to higher strain rates at the deformation source in the case of viscous deformation). In order to constrain the origin and evolution of these fractures we have conducted Brazilian tensile stress tests on lavas from the Caliente vent at strain rates from 10-3-10-5, porosities 3-30% and temperatures 20-800 °C. Across the expected conduit temperature range (750-800 °C) the dome material becomes highly sensitive to strain rate, showing a range of response from elastic failure to viscous flow. The total strain accommodated prior to failure shows a non-linear increase as viscous deformation becomes more important (i.e. temperature is increased or strain rate decreased). This allows us to constrain timescales for fracture propagation for given temperature-strain rate scenarios. We use these results, together with monitoring data and the results of numerical modelling to compare the probability of fractures propagating from the top-down or bottom-up prior to explosions at Santiaguito. Thus, we shed light on the triggers and signals leading to vulcanian explosions, which may be widely applicable to vulcanian explosions at active volcanoes.

Core-collapse supernova simulations

NASA Astrophysics Data System (ADS)

Mueller, Bernhard

2017-01-01

Core-collapse supernovae, the deaths of massive stars, are among the most spectacular phenomena in astrophysics: Not only can supernovae outshine their host galaxy for weeks; they are also laboratories for the behavior of matter at supranuclear densities, and one of the few environments where collective neutrino effects can become important. Moreover, supernovae play a central role in the cosmic matter cycle, e.g., as the dominant producers of oxygen in the Universe. Yet the mechanism by which massive stars explode has eluded us for decades, partly because classical astronomical observations across the electromagnetic spectrum cannot directly probe the supernovae ``engine''. Numerical simulations are thus our primary tool for understanding the explosion mechanism(s) of massive stars. Rigorous modeling needs to take a host of important physical ingredients into account, such as the emission and partial reabsorption of neutrinos from the young proto-neutron star, multi-dimensional fluid motions, general relativistic gravity, the equation of state of nuclear matter, and magnetic fields. This is a challenging multi-physics problem that has not been fully solved yet. Nonetheless, as I shall argue in this talk, recent first-principle 3D simulations have gone a long way towards demonstrating the viability of the most popular explosion scenario, the ``neutrino-driven mechanism''. Focusing on successful explosion models of the MPA-QUB-Monash collaboration, I will discuss possible requirements for robust explosions across a wide range of progenitors, such as accurate neutrino opacities, stellar rotation, and seed asymmetries from convective shell burning. With the advent of successful explosion models, supernova theory can also be confronted with astronomical observations. I will show that recent 3D models come closer to matching observed explosion parameters (explosion energies, neutron star kicks) than older 2D models, although there are still discrepancies. This work has been supported by the ARC (grant DE150101145), NSF (PHY-1430152, JINA-CEE) and the supercomputing centers/initiatives NCI, Pawsey, and DiRAC.

76 FR 59742 - Petitions for Modification of Application of Existing Mandatory Safety Standards

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-27

... system. The petitioner states that: (1) The heater recaptures kiln gases to preheat the crushed limestone.... Cardox safety heaters are low grade explosives that use CO \\2\\, a gas that is commonly found in fire... diluting and rendering harmless methane gas that is released in the mine atmosphere during the mining cycle...

The volcanic, sedimentologic, and paleolimnologic history of the Crater Lake caldera floor, Oregon:Evidence for small caldera evolution

USGS Publications Warehouse

Nelson, C. Hans; Bacon, Charles R.; Robinson, Stephen W.; Adam, David P.; Bradbury, J. Platt; Barber, John H.; Schwartz, Deborah; Vagenas, Ginger

1994-01-01

Apparent phreatic explosion craters, caldera-floor volcanic cones, and geothermal features outline a ring fracture zone along which Mount Mazama collapsed to form the Crater Lake caldera during its climactic eruption about 6,850 yr B.P. Within a few years, subaerial deposits infilled the phreatic craters and then formed a thick wedge (10-20 m) of mass flow deposits shed from caldera walls. Intense volcanic activity (phreatic explosions, subaerial flows, and hydrothermal venting) occurred during this early postcaldera stage, and a central platform of subaerial andesite flows and scoria formed on the caldera floor.Radiocarbon ages suggest that deposition of Iacustrine hemipelagic sediment began on the central platform about 150 yr after the caldera collapse. This is the minimum time to fill the lake halfway with water and cover the platform assuming present hydrologic conditions of precipitation and evaporation but with negligible leakage of lake water. Wizard Island formed during the final part of the 300-yr lake-filling period as shown by its (1) upper subaerial lava flows from 0 to -70 m below present water level and lower subaqueous lava flows from -70 to -500 m and by (2) lacustrine turbidite sand derived from Wizard Island that was deposited on the central platform about 350 yr after the caldera collapse. Pollen stratigraphy indicates that the warm and dry climate of middle Holocene time correlates with the early lake deposits. Diatom stratigraphy also suggests a more thermally stratified and phosphate-rich environment associated respectively with this climate and greater hydrothermal activity during the early lake history.Apparent coarse-grained and thick-bedded turbidites of the early lake beds were deposited throughout northwest, southwest, and eastern basins during the time that volcanic and seismic activity formed the subaqueous Wizard Island, Merriam Cone, and rhyodacite dome. The last known postcaldera volcanic activity produced a subaqueous rhyodacite ash bed and dome about 4,240 yr B.P. The late lake beds with base-of-slope aprons and thin, fine-grained basin-plain turbidites were deposited during the volcanically quiescent period of the past 4,000 yr.Deposits in Crater Lake and on similar caldera floors suggest that four stages characterize the postcaldera evolution of smaller (≤10 km in diameter) terrestrial caldera lake floors: (1) initial-stage caldera collapse forms the ring fracture zone that controls location of the main volcanic eruptive centers and sedimentary basin depocenters on the caldera floor; (2) early-stage subaerial sedimentation rapidly fills ring-fracture depressions and constructs basin-floor debris fans from calderawall landslides; (3) first-stage subaqueous sedimentation deposits thick flat-lying lake turbidites throughout basins, while a thin blanket of hemipelagic sediment covers volcanic edifices that continue to form concurrently with lake sedimentation; and (4) second-stage subaqueous sedimentation after the waning of major volcanic activity and the earlier periods of most rapid sedimentation develops small sili-ciclastic basin base-of-slope turbidite aprons and central basin plains. Renewed volcanic activity or lake destruction could cause part or all of the cycle to repeat.

South Asian climate change at the end of urban Harappan (Indus valley) civilization and mechanisms of Holocene monsoon variability

NASA Astrophysics Data System (ADS)

Staubwasser, M.; Sirocko, F.; Erlenkeuser, H.; Grootes, P. M.; Segl, M.

2003-04-01

Planktonic oxygen isotope ratios from the well-dated laminated sediment core 63KA off the river Indus delta are presented. The record reveals significant climate changes in the south Asian monsoon system throughout the Holocene. The most prominent event of the early-mid Holocene occurred after 8.4 ka BP and is within dating error of the GISP/GRIP event centered at 8.2 ka BP. The late Holocene is generally more variable and the largest change of the entire Holocene occurred at 4.2 ka BP. This event is concordant with the end of urban Harappan civilization in the Indus valley. Opposing isotopic trends across the northern Arabian Sea surface indicate a reduction in Indus river discharge at that time. Consequently, sustained drought may have initiated the archaeologically recorded interval of southeastward habitat tracking within the Harappan cultural domain. The hemispheric significance of the 4.2 ka BP event is evident from concordant climate change in the eastern Mediterranean and the Middle East. The remainder of the late Holocene shows drought cycles of approximately 700 years that are coherent with the evolution of cosmogenic radiocarbon production rates in the atmosphere. This suggests that solar variability is one fundamental cause behind late Holocene rainfall changes over south Asia.

DNA barcodes to identify species and explore diversity in the Adelgidae (Insecta: Hemiptera: Aphidoidea)

Treesearch

R.G. Foottit; H.E.L. Maw; N.P. Havill; R.G. Ahern; M.E. Montgomery

2009-01-01

The Adelgidae are relatively small, cryptic insects, exhibiting complex life cycles with parthenogenetic reproduction. Due to these characteristics, the taxonomy of the group is problematic. Here, we test the effectiveness of the standard 658-bp barcode fragment from the 5'-end of the mitochondrial cytochrome c oxidase 1 gene (COI) in...

Exercise Intensity Thresholds: Identifying the Boundaries of Sustainable Performance.

PubMed

Keir, Daniel A; Fontana, Federico Y; Robertson, Taylor C; Murias, Juan M; Paterson, Donald H; Kowalchuk, John M; Pogliaghi, Silvia

2015-09-01

Critical power (CP), respiratory compensation point (RCP), maximal lactate steady state (MLSS), and deoxyhemoglobin breakpoint ([HHb]BP) are alternative functional indices that are thought to demarcate the highest exercise intensity that can be tolerated for long durations. We tested the hypothesis that CP, RCP, MLSS, and [HHb]BP occur at the same metabolic intensity by examining the pulmonary oxygen uptake (V˙)O2p and power output (PO) associated with each "threshold." Twelve healthy men (mean ± SD age, 27 ± 3 yr) performed the following tests on a cycle ergometer: i) four to five exhaustive tests for determination of CP, ii) two to three 30-min constant-power trials for MLSS determination, and iii) a ramp incremental exercise test from which the V˙O2p and PO at RCP and [HHb]BP were determined. During each trial, breath-by-breath V˙O2p and ventilatory variables were measured with a metabolic cart and flowmeter turbine; near-infrared spectroscopy-derived [HHb] was monitored using a frequency domain multidistance system, and arterialized capillary blood lactate was sampled at regular intervals. There were no differences (P > 0.05) among the V˙O2p values associated with CP, RCP, MLSS, and [HHb]BP (CP, 3.29 ± 0.48; RCP, 3.34 ± 0.45; MLSS, 3.27 ± 0.44; [HHb]BP, 3.41 ± 0.46 L·min(-1)); however, the PO associated with RCP (262 ± 48 W) and [HHb]BP (273 ± 41 W) were greater (P < 0.05) than both CP (226 ± 45 W) and MLSS (223 ± 39 W), which, themselves, were not different (P > 0.05). Although the standard methods for determination of CP, RCP, MLSS, and [HHb]BP are different, these indices occur at the same V˙O2p, suggesting that i) they may manifest as a result of similar physiological phenomenon and ii) each provides a valid delineation between tolerable and intolerable constant-power exercise.

Geochronology and subsurface stratigraphy of Pukapuka and Rakahanga atolls, Cook Islands: Late Quaternary reef growth and sea level history

USGS Publications Warehouse

Gray, S.C.; Hein, J.R.; Hausmann, R.; Radtke, U.

1992-01-01

Eustatic sea-level cycles superposed on thermal subsidence of an atoll produce layers of high sea-level reefs separated by erosional unconformities. Coral samples from these reefs from cores drilled to 50 m beneath the lagoons of Pukapuka and Rakahanga atolls, northern Cook Islands give electron spin resonance (ESR) and U-series ages ranging from the Holocene to 600,000 yr B.P. Subgroups of these ages and the stratigraphic position of their bounding unconformities define at least 5 periods of reef growth and high sea-level (0-9000 yr B.P., 125,000-180,000 yr B.P., 180,000-230,000 yr B.P., 300,000-460,000 yr B.P., 460,000-650,000 yr B.P.). Only two ages fall within error of the last interglacial high sea-level stand (???125,000-135,000 yr B.P.). This paucity of ages may result from extensive erosion of the last intergracial reef. In addition, post-depositional isotope exchange may have altered the time ages of three coral samples to apparent ages that fall within glacial stage 6. For the record to be preserved, vertical accretion during rising sea-level must compensate for surface lowering from erosion during sea-level lowstands and subsidence of the atoll; erosion rates (6-63 cm/1000 yr) can therefore be calculated from reef accretion rates (100-400 cm/1000 yr), subsidence rates (2-6 cm/1000 yr), and the duration of island submergence (8-15% of the last 600,000 yr). The stratigraphy of coral ages indicates island subsidence rates of 4.5 ?? 2.8 cm/1000 yr for both islands. A model of reef growth and erosion based on the stratigraphy of the Cook Islands atolls suggests average subsidence and erosion rates of between 3-6 and 15-20 cm/1000 yr, respectively. ?? 1992.

Pathway-Enriched Gene Signature Associated with 53BP1 Response to PARP Inhibition in Triple-Negative Breast Cancer.

PubMed

Hassan, Saima; Esch, Amanda; Liby, Tiera; Gray, Joe W; Heiser, Laura M

2017-12-01

Effective treatment of patients with triple-negative (ER-negative, PR-negative, HER2-negative) breast cancer remains a challenge. Although PARP inhibitors are being evaluated in clinical trials, biomarkers are needed to identify patients who will most benefit from anti-PARP therapy. We determined the responses of three PARP inhibitors (veliparib, olaparib, and talazoparib) in a panel of eight triple-negative breast cancer cell lines. Therapeutic responses and cellular phenotypes were elucidated using high-content imaging and quantitative immunofluorescence to assess markers of DNA damage (53BP1) and apoptosis (cleaved PARP). We determined the pharmacodynamic changes as percentage of cells positive for 53BP1, mean number of 53BP1 foci per cell, and percentage of cells positive for cleaved PARP. Inspired by traditional dose-response measures of cell viability, an EC 50 value was calculated for each cellular phenotype and each PARP inhibitor. The EC 50 values for both 53BP1 metrics strongly correlated with IC 50 values for each PARP inhibitor. Pathway enrichment analysis identified a set of DNA repair and cell cycle-associated genes that were associated with 53BP1 response following PARP inhibition. The overall accuracy of our 63 gene set in predicting response to olaparib in seven breast cancer patient-derived xenograft tumors was 86%. In triple-negative breast cancer patients who had not received anti-PARP therapy, the predicted response rate of our gene signature was 45%. These results indicate that 53BP1 is a biomarker of response to anti-PARP therapy in the laboratory, and our DNA damage response gene signature may be used to identify patients who are most likely to respond to PARP inhibition. Mol Cancer Ther; 16(12); 2892-901. ©2017 AACR . ©2017 American Association for Cancer Research.

sigmaR, an RNA polymerase sigma factor that modulates expression of the thioredoxin system in response to oxidative stress in Streptomyces coelicolor A3(2).

PubMed Central

Paget, M S; Kang, J G; Roe, J H; Buttner, M J

1998-01-01

We have identified an RNA polymerase sigma factor, sigmaR, that is part of a system that senses and responds to thiol oxidation in the Gram-positive, antibiotic-producing bacterium Streptomyces coelicolor A3(2). Deletion of the gene (sigR) encoding sigmaR caused sensitivity to the thiol-specific oxidant diamide and to the redox cycling compounds menadione and plumbagin. This correlated with reduced levels of disulfide reductase activity and an inability to induce this activity on exposure to diamide. The trxBA operon, encoding thioredoxin reductase and thioredoxin, was found to be under the direct control of sigmaR. trxBA is transcribed from two promoters, trxBp1 and trxBp2, separated by 5-6 bp. trxBp1 is transiently induced at least 50-fold in response to diamide treatment in a sigR-dependent manner. Purified sigmaR directed transcription from trxBp1 in vitro, indicating that trxBp1 is a target for sigmaR. Transcription of sigR itself initiates at two promoters, sigRp1 and sigRp2, which are separated by 173 bp. The sigRp2 transcript was undetectable in a sigR-null mutant, and purified sigmaR could direct transcription from sigRp2 in vitro, indicating that sigR is positively autoregulated. Transcription from sigRp2 was also transiently induced (70-fold) following treatment with diamide. We propose a model in which sigmaR induces expression of the thioredoxin system in response to cytoplasmic disulfide bond formation. Upon reestablishment of normal thiol levels, sigmaR activity is switched off, resulting in down-regulation of trxBA and sigR. We present evidence that the sigmaR system also functions in the actinomycete pathogen Mycobacterium tuberculosis. PMID:9755177

sigmaR, an RNA polymerase sigma factor that modulates expression of the thioredoxin system in response to oxidative stress in Streptomyces coelicolor A3(2).

PubMed

Paget, M S; Kang, J G; Roe, J H; Buttner, M J

1998-10-01

We have identified an RNA polymerase sigma factor, sigmaR, that is part of a system that senses and responds to thiol oxidation in the Gram-positive, antibiotic-producing bacterium Streptomyces coelicolor A3(2). Deletion of the gene (sigR) encoding sigmaR caused sensitivity to the thiol-specific oxidant diamide and to the redox cycling compounds menadione and plumbagin. This correlated with reduced levels of disulfide reductase activity and an inability to induce this activity on exposure to diamide. The trxBA operon, encoding thioredoxin reductase and thioredoxin, was found to be under the direct control of sigmaR. trxBA is transcribed from two promoters, trxBp1 and trxBp2, separated by 5-6 bp. trxBp1 is transiently induced at least 50-fold in response to diamide treatment in a sigR-dependent manner. Purified sigmaR directed transcription from trxBp1 in vitro, indicating that trxBp1 is a target for sigmaR. Transcription of sigR itself initiates at two promoters, sigRp1 and sigRp2, which are separated by 173 bp. The sigRp2 transcript was undetectable in a sigR-null mutant, and purified sigmaR could direct transcription from sigRp2 in vitro, indicating that sigR is positively autoregulated. Transcription from sigRp2 was also transiently induced (70-fold) following treatment with diamide. We propose a model in which sigmaR induces expression of the thioredoxin system in response to cytoplasmic disulfide bond formation. Upon reestablishment of normal thiol levels, sigmaR activity is switched off, resulting in down-regulation of trxBA and sigR. We present evidence that the sigmaR system also functions in the actinomycete pathogen Mycobacterium tuberculosis.

Experimental investigation of detonation waves instabilities in liquid high explosives

NASA Astrophysics Data System (ADS)

Sosikov, V. A.; Torunov, S. I.; Utkin, A. V.; Mochalova, V. M.; Rapota, D. Yu

2018-01-01

Experimental investigation of unstable detonation front structure in mixtures of liquid high explosives (nitromethane and FEFO—bis-(2-fluor-2.2-dinitroethyl)-formal) with inert diluents (acetone, methanol, DETA—diethylene triamine) has been carried out. Inhomogeneities have been registered by electro-optical camera NANOGATE 4BP allowing to make 4 frames with the exposure time 10 ns. According to experimental results the detonation front in nitromethane-acetone mixture is unstable. It is evident that pulsations on detonation front do not form spatial periodic structure and their dimensions differ several times. But mean longitudinal size of pulsation is about 500 μm at 20 wt% of acetone concentration. This means that the typical size of cell equals to reaction zone width. The same structure of cellular front have been registered in 70/30 FEFO-methanol mixture. Second kind of instability, failure waves, was observed in neat nitromethane at the free surface. In this case the stability loss result in turbulent flow which is clearly detected in the shots obtained. Adding small amount of DETA (0.5 wt%) results in disappearance of the failure waves and flow stabilization. The effect is caused by the fact that DETA sharply accelerates initial rate of chemical reaction because it is sensitizer for nitromethane.

Phase Behavior of Three PBX Elastomers in High-Pressure Chlorodifluoromethane

NASA Astrophysics Data System (ADS)

Lee, Byung-Chul

2017-10-01

The phase equilibrium behavior data are presented for three kinds of commercial polymer-bonded explosive (PBX) elastomers in chlorodifluoromethane (HCFC22). Levapren^{{registered }} ethylene- co-vinyl acetate (LP-EVA), HyTemp^{{registered }} alkyl acrylate copolymer (HT-ACM), and Viton^{{registered }} fluoroelastomer (VT-FE) were used as the PBX elastomers. For each elastomer + HCFC22 system, the cloud point (CP) and/or bubble point (BP) pressures were measured while varying the temperature and elastomer composition using a phase equilibrium apparatus fitted with a variable-volume view cell. The elastomers examined in this study indicated a lower critical solution temperature phase behavior in the HCFC22 solvent. LP-EVA showed the CPs at temperatures of 323 K to 343 K and at pressures of 3 MPa to 10 MPa, whereas HT-ACM showed the CPs at conditions between 338 K and 363 K and between 4 MPa and 12 MPa. For the LP-EVA and HT-ACM elastomers, the BP behavior was observed at temperatures below about 323 K. For the VT-FE + HCFC22 system, only the CP behavior was observed at temperatures between 323 K and 353 K and at pressures between 6 MPa and 21 MPa. As the elastomer composition increased, the CP pressure increased, reached a maximum value at a specific elastomer composition, and then remained almost constant.

Underestimated risks of recurrent long-range ash dispersal from northern Pacific Arc volcanoes

PubMed Central

Bourne, A. J.; Abbott, P. M.; Albert, P. G.; Cook, E.; Pearce, N. J. G.; Ponomareva, V.; Svensson, A.; Davies, S. M.

2016-01-01

Widespread ash dispersal poses a significant natural hazard to society, particularly in relation to disruption to aviation. Assessing the extent of the threat of far-travelled ash clouds on flight paths is substantially hindered by an incomplete volcanic history and an underestimation of the potential reach of distant eruptive centres. The risk of extensive ash clouds to aviation is thus poorly quantified. New evidence is presented of explosive Late Pleistocene eruptions in the Pacific Arc, currently undocumented in the proximal geological record, which dispersed ash up to 8000 km from source. Twelve microscopic ash deposits or cryptotephra, invisible to the naked eye, discovered within Greenland ice-cores, and ranging in age between 11.1 and 83.7 ka b2k, are compositionally matched to northern Pacific Arc sources including Japan, Kamchatka, Cascades and Alaska. Only two cryptotephra deposits are correlated to known high-magnitude eruptions (Towada-H, Japan, ca 15 ka BP and Mount St Helens Set M, ca 28 ka BP). For the remaining 10 deposits, there is no evidence of age- and compositionally-equivalent eruptive events in regional volcanic stratigraphies. This highlights the inherent problem of under-reporting eruptions and the dangers of underestimating the long-term risk of widespread ash dispersal for trans-Pacific and trans-Atlantic flight routes. PMID:27445233

Acupuncture's Cardiovascular Actions: A Mechanistic Perspective.

PubMed

Longhurst, John

2013-04-01

Over the last several decades, there has been an explosion of articles on acupuncture, including studies that have begun to explore mechanisms underlying its analgesic and cardiovascular actions. Modulation of cardiovascular function is most effective during manual and low-frequency, low-intensity electroacupuncture (EA) at a select set of acupoints situated along meridians located over deep somatic nerves on the upper and lower extremities. Stimulation at these acupoints activates underlying sensory neural pathways that project to a number of regions in the central nervous system (CNS) that ultimately regulate autonomic outflow and hence cardiovascular function. A long-loop pathway involving the hypothalamus, midbrain, and medulla underlies EA modulation of reflex increases in blood pressure (BP). Actions of excitatory and inhibitory neurotransmitters in the supraspinal CNS underlie processing of the somatic input and adjustment of autonomic outflow during EA. Acupuncture also decreases elevated blood pressure through actions in the thoracic spinal cord. Reflexes that lower BP likewise are modulated by EA through its actions on sympathetic and parasympathetic nuclei in the medulla. The autonomic influence of acupuncture is slow in onset but prolonged in duration, typically lasting beyond the period of stimulation. Clinical studies suggest that acupuncture can be used to treat cardiac diseases, such as myocardial ischemia and hypertension, associated with overactivity of the sympathetic nervous system.

Acupuncture's Cardiovascular Actions: A Mechanistic Perspective

PubMed Central

2013-01-01

Abstract Over the last several decades, there has been an explosion of articles on acupuncture, including studies that have begun to explore mechanisms underlying its analgesic and cardiovascular actions. Modulation of cardiovascular function is most effective during manual and low-frequency, low-intensity electroacupuncture (EA) at a select set of acupoints situated along meridians located over deep somatic nerves on the upper and lower extremities. Stimulation at these acupoints activates underlying sensory neural pathways that project to a number of regions in the central nervous system (CNS) that ultimately regulate autonomic outflow and hence cardiovascular function. A long-loop pathway involving the hypothalamus, midbrain, and medulla underlies EA modulation of reflex increases in blood pressure (BP). Actions of excitatory and inhibitory neurotransmitters in the supraspinal CNS underlie processing of the somatic input and adjustment of autonomic outflow during EA. Acupuncture also decreases elevated blood pressure through actions in the thoracic spinal cord. Reflexes that lower BP likewise are modulated by EA through its actions on sympathetic and parasympathetic nuclei in the medulla. The autonomic influence of acupuncture is slow in onset but prolonged in duration, typically lasting beyond the period of stimulation. Clinical studies suggest that acupuncture can be used to treat cardiac diseases, such as myocardial ischemia and hypertension, associated with overactivity of the sympathetic nervous system. PMID:24761168

Underestimated risks of recurrent long-range ash dispersal from northern Pacific Arc volcanoes.

PubMed

Bourne, A J; Abbott, P M; Albert, P G; Cook, E; Pearce, N J G; Ponomareva, V; Svensson, A; Davies, S M

2016-07-21

Widespread ash dispersal poses a significant natural hazard to society, particularly in relation to disruption to aviation. Assessing the extent of the threat of far-travelled ash clouds on flight paths is substantially hindered by an incomplete volcanic history and an underestimation of the potential reach of distant eruptive centres. The risk of extensive ash clouds to aviation is thus poorly quantified. New evidence is presented of explosive Late Pleistocene eruptions in the Pacific Arc, currently undocumented in the proximal geological record, which dispersed ash up to 8000 km from source. Twelve microscopic ash deposits or cryptotephra, invisible to the naked eye, discovered within Greenland ice-cores, and ranging in age between 11.1 and 83.7 ka b2k, are compositionally matched to northern Pacific Arc sources including Japan, Kamchatka, Cascades and Alaska. Only two cryptotephra deposits are correlated to known high-magnitude eruptions (Towada-H, Japan, ca 15 ka BP and Mount St Helens Set M, ca 28 ka BP). For the remaining 10 deposits, there is no evidence of age- and compositionally-equivalent eruptive events in regional volcanic stratigraphies. This highlights the inherent problem of under-reporting eruptions and the dangers of underestimating the long-term risk of widespread ash dispersal for trans-Pacific and trans-Atlantic flight routes.

Rootless tephra stratigraphy and emplacement processes

NASA Astrophysics Data System (ADS)

Hamilton, Christopher W.; Fitch, Erin P.; Fagents, Sarah A.; Thordarson, Thorvaldur

2017-01-01

Volcanic rootless cones are the products of thermohydraulic explosions involving rapid heat transfer from active lava (fuel) to external sources of water (coolant). Rootless eruptions are attributed to molten fuel-coolant interactions (MFCIs), but previous studies have not performed systematic investigations of rootless tephrostratigraphy and grain-size distributions to establish a baseline for evaluating relationships between environmental factors, MFCI efficiency, fragmentation, and patterns of tephra dispersal. This study examines a 13.55-m-thick vertical section through an archetypal rootless tephra sequence, which includes a rhythmic succession of 28 bed pairs. Each bed pair is interpreted to be the result of a discrete explosion cycle, with fine-grained basal material emplaced dominantly as tephra fall during an energetic opening phase, followed by the deposition of coarser-grained material mainly as ballistic ejecta during a weaker coda phase. Nine additional layers are interleaved throughout the stratigraphy and are interpreted to be dilute pyroclastic density current (PDC) deposits. Overall, the stratigraphy divides into four units: unit 1 contains the largest number of sediment-rich PDC deposits, units 2 and 3 are dominated by a rhythmic succession of bed pairs, and unit 4 includes welded layers. This pattern is consistent with a general decrease in MFCI efficiency due to the depletion of locally available coolant (i.e., groundwater or wet sediments). Changing conduit/vent geometries, mixing conditions, coolant and melt temperatures, and/or coolant impurities may also have affected MFCI efficiency, but the rhythmic nature of the bed pairs implies a periodic explosion process, which can be explained by temporary increases in the water-to-lava mass ratio during cycles of groundwater recharge.

Emerging Insights on Brazilian Pepper Tree (Schinus terebinthifolius) Invasion: The Potential Role of Soil Microorganisms

PubMed Central

Dawkins, Karim; Esiobu, Nwadiuto

2016-01-01

Invasive plant species constitute a major ecological and economic problem worldwide, often distorting trophic levels and ecosystem balance. Numerous studies implicate factors ranging from environmental plasticity, competition for nutrient and space, and allelopathy in the success of invasive species in general. The Brazilian Pepper tree (BP) was introduced to the United States in the 1800s and has since become a category one invasive plant in Florida. It has aggressively spread to about 3000 km2 of terrestrial surface, fueled in part by the prevalence of the hybrid genotypes and environmental perturbations. It displays some of the well-established invasive mechanisms but there is a serious dearth of knowledge on the plant–microbe–soil interactions and whether the rhizobiome plays any roles in the displacement of native flora and the range expansion of BP. Several control measures, including chemical, mechanical, and biological antagonism have been used with limited success while restoration of natives in soils from which BP was removed has proved problematic partly due to a poorly understood phenomenon described as the “BP legacy effect.” Emerging evidence suggests that allelopathy, selective recruitment of beneficial soil microbes, disruption of microbial community structure and alteration of nutrient cycling, exhibited by many other invasive plant species may also be involved in the case of BP. This brief review discusses the well-established BP invasion mechanisms and highlights the current understanding of the molecular, below-ground processes. It also points out the gaps in studies on the potential role of microbial interactions in the success of BP invasion. These hitherto poorly studied mechanisms could further explain the aggressive spread of BP and could potentially contribute significantly to effective control measures and enable appropriate strategies for restoring native plants. The review advocates for the use of cutting-edge techniques in advancing the plant microbiome science. Ultimately, comparing metagenomic analyses of the rhizobiome of invasive plants grown in native and non-native soils could lead to a better understanding of the microbial determinants of biotic resistance, potentially empowering environmental managers with some predictive power of future trends of plant invasion. PMID:27252726

Record of late holocene debris avalanches and lahars at Iliamna Volcano, Alaska

USGS Publications Warehouse

Waythomas, C.F.; Miller, T.P.; Beget, J.E.

2000-01-01

Iliamna Volcano is a 3053-meter high, glaciated stratovolcano in the southern Cook Inlet region of Alaska and is one of seven volcanoes in this region that have erupted multiple times during the past 10,000 yr. Prior to our studies of Iliamna Volcano, little was known about the frequency, magnitude, and character of Holocene volcanic activity. Here we present geologic evidence of the most recent eruptive activity of the volcano and provide the first outline of Late Holocene debris-avalanche and lahar formation. Iliamna has had no documented historical eruptions but our recent field investigations indicate that the volcano has erupted at least twice in the last 300 yr. Clay-rich lahar deposits dated by radiocarbon to ???1300 and ???90 yr BP are present in two major valleys that head on the volcano. These deposits indicate that at least two large, possibly deep-seated, flank failures of the volcanic edifice have occurred in the last 1300 yr. Noncohesive lahar deposits likely associated with explosive pyroclastic eruptions date to 2400-1300,>1500,???300, and <305 yr BP. Debris-avalanche deposits from recent and historical small-volume slope failures of the hydrothermally altered volcanic edifice cover most of the major glaciers on the volcano. Although these deposits consist almost entirely of hydrothermally altered rock debris and snow and ice, none of the recently generated debris avalanches evolved to lahars. A clay-rich lahar deposit that formed <90??60 radiocarbon yr BP and entered the Johnson River Valley southeast of the volcano cannot be confidently related to an eruption of Iliamna Volcano, which has had no known historical eruptions. This deposit may record an unheralded debris avalanche and lahar. ?? 2000 Elsevier Science B.V. All rights reserved.

Surprise Realistic Mock Disasters—The Most Effective Means of Disaster Training

PubMed Central

Campanale, Ralph P.

1964-01-01

Realism introduced in several large scale surprise mock-disaster tests proved to be a real challenge to a disaster-conscious hospital staff that had previously undergone fairly extensive disaster training and testing, utilizing conventional methods. Serious weaknesses, flaws, omissions and deficiencies in disaster capability were dramatically and conclusively revealed by use of what appeared to be a “live” disaster setting with smoke, fire, explosions; adverse weather and light conditions; realistically-simulated “casualites” especially prepared not only to look but to act the part; selected harassment incidents from well-documented disasters, such as utility failures, automobile accident on the main access route, overload of telephone switchboard, and invasion of hospital and disaster site by distraught relatives and the morbidly curious. Imagesp436-ap436-bp436-c PMID:14232161

SU-F-T-665: Confocal Microscopy Imaging of Cell Cycle Distribution in Cells Treated with Pegylated Gold Nanoshells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sadetaporn, D; The University of Texas MD Anderson Cancer Center, Houston, TX; Flint, D

Purpose: To use confocal microscopy to distinguish cells in different phases of the cell cycle before and after treatment with pegylated gold nanoshells (PEG-AuNSs). Methods: Transfected fibrosarcoma cells (HT1080-EYFP-53BP1-FUCCI) were cultured in T-25 flasks and seeded in glass bottom dishes. These cells express the fluorescent probe AmCyan during the G2/S phases of the cell cycle, mCherry during the G1 phase, and EYFP tagged to the DNA repair protein 53BP1. After allowing cells 4 h to adhere to dishes, PEG-AuNS (Nanospectra Biosciences, Houston, TX) at a concentration of 0.15 OD were administered. At time points of 8, 16 and 24 hmore » following treatment, the PEG-AuNS-treated and control samples were washed with phosphate buffered saline (PBS) and fixed using 4% paraformaldehyde in PBS. Samples were imaged with an Olympus FV1200 confocal microscope using 473, 543, and 641 nm excitation lasers. We used band-pass filters to select AmCyan and mCherry fluorescence. Reflection from the 641 nm laser was used to detect PEG-AuNSs. Z-stack images were analyzed to assess cell cycle distribution through fluorescent probe expression. Live cells were imaged after PEG-AuNS treatment using a confocal microscope with a stage top CO2 incubator. Results: We were able to obtain high-resolution images of cells with internalized AuNSs. We were also able to distinguish cells in different phases of the cell cycle. Conclusion: This work demonstrates a new assay to investigate the effect of AuNSs on the cell cycle phase in live cells. Future work will employ confocal microscopy and flow cytometry to focus on effects of AuNS treatment on cell cycle distribution. This research was supported by the Sister Institution Network Fund and the Center for Radiation Oncology Research at The University of Texas MD Anderson Cancer Center and Cancer Prevention and Research Institute of Texas. Gabriel Sawakuchi has research support from Elekta Inc.« less

DNA Damage Signaling Is Induced in the Absence of Epstein-Barr Virus (EBV) Lytic DNA Replication and in Response to Expression of ZEBRA.

PubMed

Wang'ondu, Ruth; Teal, Stuart; Park, Richard; Heston, Lee; Delecluse, Henri; Miller, George

2015-01-01

Epstein Barr virus (EBV), like other oncogenic viruses, modulates the activity of cellular DNA damage responses (DDR) during its life cycle. Our aim was to characterize the role of early lytic proteins and viral lytic DNA replication in activation of DNA damage signaling during the EBV lytic cycle. Our data challenge the prevalent hypothesis that activation of DDR pathways during the EBV lytic cycle occurs solely in response to large amounts of exogenous double stranded DNA products generated during lytic viral DNA replication. In immunofluorescence or immunoblot assays, DDR activation markers, specifically phosphorylated ATM (pATM), H2AX (γH2AX), or 53BP1 (p53BP1), were induced in the presence or absence of viral DNA amplification or replication compartments during the EBV lytic cycle. In assays with an ATM inhibitor and DNA damaging reagents in Burkitt lymphoma cell lines, γH2AX induction was necessary for optimal expression of early EBV genes, but not sufficient for lytic reactivation. Studies in lytically reactivated EBV-positive cells in which early EBV proteins, BGLF4, BGLF5, or BALF2, were not expressed showed that these proteins were not necessary for DDR activation during the EBV lytic cycle. Expression of ZEBRA, a viral protein that is necessary for EBV entry into the lytic phase, induced pATM foci and γH2AX independent of other EBV gene products. ZEBRA mutants deficient in DNA binding, Z(R183E) and Z(S186E), did not induce foci of pATM. ZEBRA co-localized with HP1β, a heterochromatin associated protein involved in DNA damage signaling. We propose a model of DDR activation during the EBV lytic cycle in which ZEBRA induces ATM kinase phosphorylation, in a DNA binding dependent manner, to modulate gene expression. ATM and H2AX phosphorylation induced prior to EBV replication may be critical for creating a microenvironment of viral and cellular gene expression that enables lytic cycle progression.

An isotopic investigation of the temperature response of young and old soil organic matter respiration

NASA Astrophysics Data System (ADS)

Burns, Nancy; Cloy, Joanna; Garnett, Mark; Reay, David; Smith, Keith; Otten, Wilfred

2010-05-01

The effect of temperature on rates of soil respiration is critical to our understanding of the terrestrial carbon cycle and potential feedbacks to climate change. The relative temperature sensitivity of labile and recalcitrant soil organic matter (SOM) is still controversial; different studies have produced contrasting results, indicating limited understanding of the underlying relationships between stabilisation processes and temperature. Current global carbon cycle models still rely on the assumption that SOM pools with different decay rates have the same temperature response, yet small differences in temperature response between pools could lead to very different climate feedbacks. This study examined the temperature response of soil respiration and the age of soil carbon respired from radiocarbon dated fractions of SOM (free, intra-aggregate and mineral-bound) and whole soils (organic and mineral layers). Samples were collected from a peaty gley soil from Harwood Forest, Northumberland, UK. SOM fractions were isolated from organic layer (5 - 17 cm) material using high density flotation and ultrasonic disaggregation - designated as free (< 1.8 g cm-3), intra-aggregate (< 1.8 g cm-3 within aggregates > 1.8 g cm-3) and mineral-bound (> 1.8 g cm-3) SOM. Fractions were analysed for chemical composition (FTIR, CHN analysis, ICP-OES), 14C (AMS), δ13C and δ15N (MS) and thermal properties (DSC). SOM fractions and bulk soil from the organic layer and the mineral layer (20 - 30 cm) were incubated in sealed vessels at 30 ° C and 10 ° C for 3 or 9 months to allow accumulation of CO2 sufficient for sampling. Accumulated respired CO2 samples were collected on zeolite molecular sieve cartridges and used for AMS radiocarbon dating. In parallel, material from the same fractions and layers were incubated at 10 ° C, 15 ° C, 25 ° C and 30 ° C for 6 months and sampled weekly for CO2 flux measurements using GC chromatography. Initial data have shown radiocarbon ages ranging from modern to 219 y BP in bulk soil from the organic layer (5 - 17 cm depth), while free OM ranged from modern to 74 y BP, intra-aggregate OM 413 - 657 y BP and mineral-bound material 562 - 646 y BP. Bulk soil from the mineral layer (20 - 30 cm) was considerably older, at 2142 - 2216 y BP. These results indicate that within the upper layer of soil, mineral-bound OM represents a slow-cycling or recalcitrant pool of SOM; intra-aggregate OM is slightly less recalcitrant than mineral-bound OM, while free OM represents a fast-cycling, labile pool of SOM. Bulk soil from the mineral layer (20 - 30 cm) is much older than mineral-bound OM in the upper layers, suggesting the involvement of other stabilising factors associated with depth besides mineral interactions. The link between age and recalcitrance is corroborated by measured CO2 flux rates, which increase with decreasing age of fractions. Results for the 14C contents and calculated ages of isolated SOM fractions, bulk organic and mineral soils and their respired CO2 at different temperatures will be discussed and compared with long term trends in soil/SOM fraction CO2 fluxes and their temperature sensitivity. Data on soil chemical characteristics and δ13C values will also be presented.

Cyclic sedimentation pattern in Lake Veetka, southeast Estonia: a case study

NASA Astrophysics Data System (ADS)

Saarse, Leili

2015-03-01

A sediment core from Lake Veetka, southeast Estonia, 1077 cm in length and covering 10,500 calibrated years, was examined using loss-on-ignition, grain-size distribution and AMS 14C dating to reconstruct depositional dynamics. The studied core, recovered from the northern part of the lake, shows a cyclic pattern of organic and mineral matter concentration with cycle durations of 100-400 years. Cyclicity is displayed better in sediments laid down between 9,200 and 5,600 cal BP. Within two time windows (5,600-5,100 cal BP and from 1,200 cal BP to the present), sediment composition changed drastically on account of a high and fluctuating mineral matter content, obviously driven by different factors. Little Ice Age cooling is characterised by the highest proportion of mineral matter, and the Medieval Warm Period is typified by high organic matter content. The cyclic change of organic and mineral matter has been related to climate dynamics, most likely an alternation of wet and dry conditions, changes in the water level of the lake and differences in bioproduction

Magnetic plethysmograph transducers for local blood pulse wave velocity measurement.

PubMed

Nabeel, P M; Joseph, Jayaraj; Sivaprakasam, Mohanasankar

2014-01-01

We present the design of magnetic plethysmograph (MPG) transducers for detection of blood pulse waveform and evaluation of local pulse wave velocity (PWV), for potential use in cuffless blood pressure (BP) monitoring. The sensors utilize a Hall effect magnetic field sensor to capture the blood pulse waveform. A strap based design is performed to enable reliable capture of large number of cardiac cycles with relative ease. The ability of the transducer to consistently detect the blood pulse is verified by in-vivo trials on few volunteers. A duality of such transducers is utilized to capture the local PWV at the carotid artery. The pulse transit time (PTT) between the two detected pulse waveforms, measured along a small section of the carotid artery, was evaluated using automated algorithms to ensure consistency of measurements. The correlation between the measured values of local PWV and BP was also investigated. The developed transducers provide a reliable, easy modality for detecting pulse waveform on superficial arteries. Such transducers, used for measurement of local PWV, could potentially be utilized for cuffless, continuous evaluation of BP at various superficial arterial sites.

Quantitation of normal CFTR mRNA in CF patients with splice-site mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Z.; Olsen, J.C.; Silverman, L.M.

Previously we identified two mutations in introns of the CFTR gene associated with partially active splice sites and unusual clinical phenotypes. One mutation in intron 19 (3849+10 kb C to T) is common in CF patients with normal sweat chloride values; an 84 bp sequence from intron 19, which contains a stop codon, is inserted between exon 19 and exon 20 in most nasal CFTR transcripts. The other mutation in intron 14B (2789+5 G to A) is associated with elevated sweat chloride levels, but mild pulmonary disease; exon 14B (38 bp) is spliced out of most nasal CFTR transcipts. Themore » remaining CFTR cDNA sequences, other than the 84 bp insertion of exon 14B deletion, are identical to the published sequence. To correlate genotype and phenotype, we used quantitative RT-PCR to determine the levels of normally-spliced CFTR mRNA in nasal epithelia from these patients. CFTR cDNA was amplified (25 cycles) by using primers specific for normally-spliced species, {gamma}-actin cDNA was amplified as a standard.« less

Cdk1 Activates Pre-mitotic Nuclear Envelope Dynein Recruitment and Apical Nuclear Migration in Neural Stem Cells.

PubMed

Baffet, Alexandre D; Hu, Daniel J; Vallee, Richard B

2015-06-22

Dynein recruitment to the nuclear envelope is required for pre-mitotic nucleus-centrosome interactions in nonneuronal cells and for apical nuclear migration in neural stem cells. In each case, dynein is recruited to the nuclear envelope (NE) specifically during G2 via two nuclear pore-mediated mechanisms involving RanBP2-BicD2 and Nup133-CENP-F. The mechanisms responsible for cell-cycle control of this behavior are unknown. We now find that Cdk1 serves as a direct master controller for NE dynein recruitment in neural stem cells and HeLa cells. Cdk1 phosphorylates conserved sites within RanBP2 and activates BicD2 binding and early dynein recruitment. Late recruitment is triggered by a Cdk1-induced export of CENP-F from the nucleus. Forced NE targeting of BicD2 overrides Cdk1 inhibition, fully rescuing dynein recruitment and nuclear migration in neural stem cells. These results reveal how NE dynein recruitment is cell-cycle regulated and identify the trigger mechanism for apical nuclear migration in the brain. Copyright © 2015 Elsevier Inc. All rights reserved.

Evaluation on carbon nanocapsules for supercapacitors using a titanium cavity electrode

NASA Astrophysics Data System (ADS)

Wu, Cheng-Yeou; Wu, Pu-Wei; Lin, Pang

We synthesize carbon nanocapsules (CNCs) by a flame combustion method and evaluate their potential as the electrode material for electrochemical double layer capacitor using a titanium cavity electrode (TCE). Identical process is conducted on commercially available carbonaceous materials such as Vulcan XC72R, Black Pearl 2000 (BP2000), multi-walled carbon nanotubes (MWCNTs), and active carbon (AC1100) for comparison purposes. Images from Scanning electron microscope and Transmission electron microscope on the CNCs demonstrate irregular-shaped particles in average size of 10-20 nm with graphene layers on perimeter compassing a hollow core. Electrochemical characterizations including cyclic voltammetry (CV), current reversal chronopotentiometry (CRC), and impedance spectroscopy are carried out in 1N H 2SO 4 to determine the specific capacitance and cycle life time. Among these samples, the BP2000 still delivers the highest specific capacitance in F g -1 but the CNCs demonstrate the largest value in μF cm 2. In addition, the CNCs exhibit impressive life time for 5000 cycles without notable degradation. Consistent results are obtained by CV, CRC, and impedance measurements, validating the TCE as a facile tool to perform reliable electrochemical evaluations.

Effects of myofascial release after high-intensity exercise: a randomized clinical trial.

PubMed

Arroyo-Morales, Manuel; Olea, Nicolas; Martinez, Manuel; Moreno-Lorenzo, Carmen; Díaz-Rodríguez, Lourdes; Hidalgo-Lozano, Amparo

2008-03-01

The usefulness of massage as a recovery method after high-intensity exercise has yet to be established. We aimed to investigate the effects of whole-body massage on heart rate variability (HRV) and blood pressure (BP) after repeated high-intensity cycling exercise under controlled and standardized pretest conditions. The study included 62 healthy active individuals. After baseline measurements, the subjects performed standardized warm-up exercises followed by three 30-second Wingate tests. After completing the exercise protocol, the subjects were randomly assigned to a massage (myofascial release) or placebo (sham treatment with disconnected ultrasound and magnetotherapy equipment) group for a 40-minute recovery period. Holter recording and BP measurements were taken after exercise protocol and after the intervention. After the exercise protocol, both groups showed a significant decrease in normal-to-normal interval, HRV index, diastolic BP (P > .001), and low-frequency domain values (P = .006). After the recovery period, HRV index (P = .42) and high-frequency (HF) (P = .94) values were similar to baseline levels in the massage group, whereas the HRV index tended (P = .05) to be lower and the HF was significantly (P < .01) lower vs baseline values in the placebo group, which also showed a tendency (P = .06) for HF to be lower than after the exercise. Likewise, diastolic BP returned to baseline levels in the massage group (P = .45) but remained lower in the placebo group (P = .02). Myofascial release massage favors the recovery of HRV and diastolic BP after high-intensity exercise (3 Wingate tests) to preexercise levels.

Alteration/deficiency in activation-3 (Ada3) plays a critical role in maintaining genomic stability

PubMed Central

Mirza, Sameer; Katafiasz, Bryan J.; Kumar, Rakesh; Wang, Jun; Mohibi, Shakur; Jain, Smrati; Gurumurthy, Channabasavaiah Basavaraju; Pandita, Tej K.; Dave, Bhavana J.; Band, Hamid; Band, Vimla

2012-01-01

Cell cycle regulation and DNA repair following damage are essential for maintaining genome integrity. DNA damage activates checkpoints in order to repair damaged DNA prior to exit to the next phase of cell cycle. Recently, we have shown the role of Ada3, a component of various histone acetyltransferase complexes, in cell cycle regulation, and loss of Ada3 results in mouse embryonic lethality. Here, we used adenovirus-Cre-mediated Ada3 deletion in Ada3fl/fl mouse embryonic fibroblasts (MEFs) to assess the role of Ada3 in DNA damage response following exposure to ionizing radiation (IR). We report that Ada3 depletion was associated with increased levels of phospho-ATM (pATM), γH2AX, phospho-53BP1 (p53BP1) and phospho-RAD51 (pRAD51) in untreated cells; however, radiation response was intact in Ada3−/− cells. Notably, Ada3−/− cells exhibited a significant delay in disappearance of DNA damage foci for several critical proteins involved in the DNA repair process. Significantly, loss of Ada3 led to enhanced chromosomal aberrations, such as chromosome breaks, fragments, deletions and translocations, which further increased upon DNA damage. Notably, the total numbers of aberrations were more clearly observed in S-phase, as compared with G₁ or G₂ phases of cell cycle with IR. Lastly, comparison of DNA damage in Ada3fl/fl and Ada3−/− cells confirmed higher residual DNA damage in Ada3−/− cells, underscoring a critical role of Ada3 in the DNA repair process. Taken together, these findings provide evidence for a novel role for Ada3 in maintenance of the DNA repair process and genomic stability. PMID:23095635

Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis.

PubMed

Nath, B Surendra; Gupta, S K; Bajpai, A K

2012-12-01

The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.

Nonlinear assessment of cerebral autoregulation from spontaneous blood pressure and cerebral blood flow fluctuations.

PubMed

Hu, Kun; Peng, C K; Czosnyka, Marek; Zhao, Peng; Novak, Vera

2008-03-01

Cerebral autoregulation (CA) is an most important mechanism responsible for the relatively constant blood flow supply to brain when cerebral perfusion pressure varies. Its assessment in nonacute cases has been relied on the quantification of the relationship between noninvasive beat-to-beat blood pressure (BP) and blood flow velocity (BFV). To overcome the nonstationary nature of physiological signals such as BP and BFV, a computational method called multimodal pressure-flow (MMPF) analysis was recently developed to study the nonlinear BP-BFV relationship during the Valsalva maneuver (VM). The present study aimed to determine (i) whether this method can estimate autoregulation from spontaneous BP and BFV fluctuations during baseline rest conditions; (ii) whether there is any difference between the MMPF measures of autoregulation based on intra-arterial BP (ABP) and based on cerebral perfusion pressure (CPP); and (iii) whether the MMPF method provides reproducible and reliable measure for noninvasive assessment of autoregulation. To achieve these aims, we analyzed data from existing databases including: (i) ABP and BFV of 12 healthy control, 10 hypertensive, and 10 stroke subjects during baseline resting conditions and during the Valsalva maneuver, and (ii) ABP, CPP, and BFV of 30 patients with traumatic brain injury (TBI) who were being paralyzed, sedated, and ventilated. We showed that autoregulation in healthy control subjects can be characterized by specific phase shifts between BP and BFV oscillations during the Valsalva maneuver, and the BP-BFV phase shifts were reduced in hypertensive and stroke subjects (P < 0.01), indicating impaired autoregulation. Similar results were found during baseline condition from spontaneous BP and BFV oscillations. The BP-BFV phase shifts obtained during baseline and during VM were highly correlated (R > 0.8, P < 0.0001), showing no statistical difference (paired-t test P > 0.47). In TBI patients there were strong correlations between phases of ABP and CPP oscillations (R = 0.99, P < 0.0001) and, thus, between ABP-BFV and CPP-BFV phase shifts (P < 0.0001, R = 0.76). By repeating the MMPF 4 times on data of TBI subjects, each time on a selected cycle of spontaneous BP and BFV oscillations, we showed that MMPF had better reproducibility than traditional autoregulation index. These results indicate that the MMPF method, based on instantaneous phase relationships between cerebral blood flow velocity and peripheral blood pressure, has better performance than the traditional standard method, and can reliably assess cerebral autoregulation dynamics from ambulatory blood pressure and cerebral blood flow during supine rest conditions.

Continuing a Snapshot Survey of the Sites of Recent, Nearby Supernovae: Cycles 25 & 26

NASA Astrophysics Data System (ADS)

Filippenko, Alex

2017-08-01

During the past two decades, robotic (or highly automated) searches for supernovae (SNe), including our Lick Observatory Supernova Search (LOSS), have found over 1000 SNe, many of them in quite nearby galaxies (cz < 4000 km/s). Most of the objects were discovered before maximum brightness, and have follow-up photometry and spectroscopy; they include some of the best-studied SNe to date. We propose to continue our successful program of imaging the sites of some of these nearby objects, to obtain late-time photometry that will help reveal the origin of their lingering energy. We will also search for possible stellar remnants of Type Iax SNe, an intriguing new possibility. Moreover, the images will provide high-resolution information on the local environments of SNe that are far superior to what we can procure from the ground. For example, we will obtain color-magnitude diagrams of stars in these SN sites, to constrain the reddening and SN progenitor masses. We will search for light echoes around SNe, an important clue to their progenitor systems. We also propose to image some SN impostors - faint SNe IIn with massive progenitors - to verify whether they are indeed superoutbursts of luminous blue variables and survived the explosions, or a new/weak class of massive-star explosions. Our proposed snapshots in Cycles 25 and 26 will complement and extend the set of targets we imaged in previous Cycles under this program.

Complete genome sequence of Thauera aminoaromatica strain MZ1T

PubMed Central

Jiang, Ke; Sanseverino, John; Chauhan, Archana; Lucas, Susan; Copeland, Alex; Lapidus, Alla; Del Rio, Tijana Glavina; Dalin, Eileen; Tice, Hope; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Sims, David; Brettin, Thomas; Detter, John C.; Han, Cliff; Chang, Y.J.; Larimer, Frank; Land, Miriam; Hauser, Loren; Kyrpides, Nikos C.; Mikhailova, Natalia; Moser, Scott; Jegier, Patricia; Close, Dan; DeBruyn, Jennifer M.; Wang, Ying; Layton, Alice C.; Allen, Michael S.; Sayler, Gary S.

2012-01-01

Thauera aminoaromatica strain MZ1T, an isolate belonging to genus Thauera, of the family Rhodocyclaceae and the class the Betaproteobacteria, has been characterized for its ability to produce abundant exopolysaccharide and degrade various aromatic compounds with nitrate as an electron acceptor. These properties, if fully understood at the genome-sequence level, can aid in environmental processing of organic matter in anaerobic cycles by short-circuiting a central anaerobic metabolite, acetate, from microbiological conversion to methane, a critical greenhouse gas. Strain MZ1T is the first strain from the genus Thauera with a completely sequenced genome. The 4,496,212 bp chromosome and 78,374 bp plasmid contain 4,071 protein-coding and 71 RNA genes, and were sequenced as part of the DOE Community Sequencing Program CSP_776774. PMID:23407619

Dinucleotide repeat polymorphisms in waterfowl (family Anatidae): Characterization of a sex-linked (Z-specific) and 14 autosomal loci

USGS Publications Warehouse

Buchholz, W.G.; Pearce, J.M.; Pierson, B.J.; Scribner, K.T.

1998-01-01

Canada goose (Branta Canadensis) and harlequin duck (Histrionicus histrionicus) DNAs were digested with Sau3AI, and size selected (300-700 bp) fragments were ligated into BamHI-digested pBluscriptII KS+. The enrichment protocol of Ostrander et al.1 was followed. The resulting libraries were screened using a [ƴ-32P]ATP end-labelled (CA)20 oligonucleotides as a hybridization probe. Positive clones were sequenced using cycle-sequencing protocols (Epicentre Technologies, Madison, WI) and primers flanking the inserts. PCR primers were designed to amplify the repeat and yield amplification products of ≈100-200 bp. DNA  samples were screened for variation at these loci using [ƴ-32P]ATP end-labelled primers. The products were resolved using 6% denaturing polyacrylamide gels and autoradiography.

Characterization of a novel ADAM protease expressed by Pneumocystis carinii.

PubMed

Kennedy, Cassie C; Kottom, Theodore J; Limper, Andrew H

2009-08-01

Pneumocystis species are opportunistic fungal pathogens that cause severe pneumonia in immunocompromised hosts. Recent evidence has suggested that unidentified proteases are involved in Pneumocystis life cycle regulation. Proteolytically active ADAM (named for "a disintegrin and metalloprotease") family molecules have been identified in some fungal organisms, such as Aspergillus fumigatus and Schizosaccharomyces pombe, and some have been shown to participate in life cycle regulation. Accordingly, we sought to characterize ADAM-like molecules in the fungal opportunistic pathogen, Pneumocystis carinii (PcADAM). After an in silico search of the P. carinii genomic sequencing project identified a 329-bp partial sequence with homology to known ADAM proteins, the full-length PcADAM sequence was obtained by PCR extension cloning, yielding a final coding sequence of 1,650 bp. Sequence analysis detected the presence of a typical ADAM catalytic active site (HEXXHXXGXXHD). Expression of PcADAM over the Pneumocystis life cycle was analyzed by Northern blot. Southern and contour-clamped homogenous electronic field blot analysis demonstrated its presence in the P. carinii genome. Expression of PcADAM was observed to be increased in Pneumocystis cysts compared to trophic forms. The full-length gene was subsequently cloned and heterologously expressed in Saccharomyces cerevisiae. Purified PcADAMp protein was proteolytically active in casein zymography, requiring divalent zinc. Furthermore, native PcADAMp extracted directly from freshly isolated Pneumocystis organisms also exhibited protease activity. This is the first report of protease activity attributable to a specific, characterized protein in the clinically important opportunistic fungal pathogen Pneumocystis.

Pre-eruptive storage conditions of the Holocene dacite erupted from Kizimen Volcano, Kamchatka

USGS Publications Warehouse

Browne, B.; Izbekov, P.; Eichelberger, J.; Churikova, T.

2010-01-01

This study describes an investigation of the pre-eruptive conditions (T, P and fO2) of dacite magma erupted during the KZI cycle (12,000-8400 years ago) of Kizimen Volcano, Kamchatka, the earliest, most voluminous and most explosive eruption cycle in the Kizimen record. Hydrothermal, water-saturated experiments on KZI dacite pumice coupled with titanomagnetite-ilmenite geothermometry calculations require that the KZI dacite existed at a temperature of 823 ?? 20??C and pressures of 125-150 MPa immediately prior to eruption. This estimate corresponds to a lithologic contact between Miocene volcaniclastic rocks and Pliocene-Pleistocene volcanic rocks located at a depth of 5-6 km beneath the Kizimen edifice, which may have facilitated the accumulation of atypically large volumes of gas-rich dacite during the KZI cycle.

Origin and age of the Volcanic Rocks of Tláloc Volcano, Sierra Nevada, Central Mexico

NASA Astrophysics Data System (ADS)

Meier, M.; Grobéty, B.; Arce, J. L.; Rueda, H.

2007-05-01

The Tláloc volcano (TV) is a 4125 m high stratovolcano of the Trans Mexican Volcanic Belt (TMVB) and is located in the northern end of the N-S trending Sierra Nevada, 30 km NE of Mexico City. Few data on the petrological and temporal evolution of TV have been published to date. Recently dated deposits gave ages between 32'000 and 34'500±500 years BP (Huddart and Gonzalez, 2004). Mapping and sampling of extrusive rocks in the summit region of TV revealed a dome structure with radiating lava flows consisting of dacitic rocks containing plagioclase and hornblende phenocrysts. Some flows, however, seem to be associated with a collapse structure E of the main summit. Crossing relationships indicate that this structure is older (“Paleo Tláloc”). A stratigraphy of the pyroclastic deposits was established along the northern slope of TV. From the numerous pyroclastic flows, separated by paleosoils and fluviatile deposits, only two pumice and one block and ash flow (BAF) have regional extent. Their thickness - distance relationship and their granulometry point to major explosive events. A carbonized wood sample from the BAF deposit gave ages similar to the previous ages (33'180±550 yr BP and 23'170±270 yr BP), a sample from a pyroclastic flow gave even a younger age (16'620±110 yr BP), suggesting that TV remained active also after the volcanoes Iztaccíhuatl and Popocatépetl further to the South started their activity. Based on these preliminary data it may be necessary to reconsider the accepted scenario of the temporal evolution of the central section of the TMVB, which assumes that the activity migrates from North to South with time. Huddart, D. and Gonzalez, S., 2004. Pyroclastic flows and associated sediments, Tláloc-Telapón, piedmont fringe of the eastern basin of Mexico. In: G.J. Aguirre-Diaz, Macías, J.L., and Siebe, C., (Editor), Penrose Conference. UNAM, Metepec, Puebla, Mexico, pp. 35.

Modeling the growth and decay of the Antarctic Peninsula Ice Sheet

NASA Astrophysics Data System (ADS)

Payne, A. J.; Sugden, D. E.; Clapperton, C. M.

1989-03-01

A model of the growth and decay of the Antarctic Peninsula Ice Sheet during the last glacial/interglacial cycle is used to identify the main controls on ice sheet behavior. Using as input glaciological assumptions derived by W. F. Budd and I. N. Smith (1982, Annals of Glaciology3, 42-49), bedrock topography, isostatic compensation, and mass balance relationships, the model is driven by sea-level change over the last 40,000 yr in association with assumed changes in the rate of melting beneath ice shelves. An ice sheet dome over 3.5 km thick grows on the offshore shelf and straits west of the Antarctic Peninsula and reaches a maximum at 18,000 yr B.P. Collapse begins at 14,000 yr B.P. but becomes rapid and continuous after 10,000 yr B.P. The present stable ice cover is achieved at 6500 yr B.P. Ice growth and decay are characterized by thresholds which separate periods of steady state from periods of rapid transition; the thresholds usually relate to topography. Tests show that ice sheet behavior is most sensitive to sea-level change, basal marine melting, and accumulation and is less sensitive to isostasy, spatial variation in accumulation, calving rates, and ice flow parameterization. Tests of the model against field evidence show good agreement in places, as well as discrepancies which require further work.

Chronology and dispersal characteristics of recently (last 5000 years) erupted tephra of Cotopaxi (Ecuador): implications for long-term eruptive forecasting

NASA Astrophysics Data System (ADS)

Barberi, F.; Coltelli, M.; Frullani, A.; Rosi, M.; Almeida, E.

1995-12-01

Cotopaxi, the highest active volcano on earth and one of the most dangerous of Ecuador is constituted by a composite cone made up of lava and tephra erupted from the summit crater. The activity of the present volcano begun with large-volume plinian eruptions followed by a succession of small-volume lava emissions and pyroclastic episodes which led to the edification of a symmetrical cone. The growth of the cone was broken by an episode of slope failure, the scar of which is now obliterated by recent and historical products. Volcanic history, eruptive frequency and characteristics of the activity were investigated by studying the stratigraphy of tephra and carrying out fifteen new 14C dating on paleosols and charcoals. The investigated period is comprised between the slope failure and the present. The deposit of the volcanic landside (dry debris avalanche of Rio Pita), previously believed to be between 13,000 and 25,000 yr B.P., is now considered to have an age slightly older than 5000 yr B.P. The stratigraphy of tephra of the last 2000 years reveals the existence of 22 fallout layers. Seven of them were dated with 14C whereas three were ascribed to the eruptions of 1534, 1768 and 1877 on the basis of comparison with historical information. Maximum clast size distribution (isopleths) of 9 tephra layers points out that the sustained explosive eruptions of Cotopaxi during the last 2000 years are characterized by very high dispersive power (plinian plumes with column heights between 28 and 39 km) and high intensity (peak mass discharges from 1.1 to 4.1 × 10 8kg/s). The magnitude (mass) of tephra fallout deposits calculated from distribution of thickness (isopaches) are, however, moderate (from 0.8 to 7.2 × 10 11 kg). The limited volume of magma erupted during each explosive episode is consistent with the lack of caldera collapses. Small-volume pyroclastic flows and surges virtually accompanied all identified tephra fallouts. During such an activity large scale snow/ice melting of the summit glacier produced devastating mudflows comparable in scale to those of 1877 eruption. By assuming a 1:1 correspondence between fallout episodes and generation of large-scale lahar, we have estimated an average recurrence of one explosive, lahartriggering event every 117 years over the last two millennia. This value compares well with that calculated by considering the period since Spanish Conquest. The probability of having an eruption like this in 100 or 200 years is respectively of 0.57 and 0.82. Such an high probability underscores the need for quick actions aimed at the mitigation of Cotopaxi lahar hazard along all the main valleys which originate from the volcano.

Esmolol acutely alters oxygen supply-demand balance in exercising muscles of healthy humans.

PubMed

Proctor, David N; Luck, J Carter; Maman, Stephan R; Leuenberger, Urs A; Muller, Matthew D

2018-04-01

Beta-adrenoreceptor antagonists (β blockers) reduce systemic O 2 delivery and blood pressure (BP) during exercise, but the subsequent effects on O 2 extraction within the active limb muscles are unknown. In this study, we examined the effects of the fast-acting, β 1 selective blocker esmolol on systemic hemodynamics and leg muscle O 2 saturation (near infrared spectroscopy, NIRS) during submaximal leg ergometry. Our main hypothesis was that esmolol would augment exercise-induced reductions in leg muscle O 2 saturation. Eight healthy adults (6 men, 2 women; 23-67 year) performed light and moderate intensity bouts of recumbent leg cycling before (PRE), during (β 1 -blocked), and 45 min following (POST) intravenous infusion of esmolol. Oxygen uptake, heart rate (HR), BP, and O 2 saturation (SmO 2 ) of the vastus lateralis (VL) and medial gastrocnemius (MG) muscles were measured continuously. Esmolol attenuated the increases in HR and systolic BP during light (-12 ± 9 bpm and -26 ± 12 mmHg vs. PRE) and moderate intensity (-20 ± 10 bpm and -40 ± 18 mmHg vs. PRE) cycling (all P < 0.01). Exercise-induced reductions in SmO 2 occurred to a greater extent during the β 1 -blockade trial in both the VL (P = 0.001 vs. PRE) and MG muscles (P = 0.022 vs. PRE). HR, SBP and SmO 2 were restored during POST (all P < 0.01 vs. β 1 -blocked). In conclusion, esmolol rapidly and reversibly increases O 2 extraction within exercising muscles of healthy humans. © 2018 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

Leaf-age effects on temperature responses of photosynthesis and respiration of an alpine oak, Quercus aquifolioides, in southwestern China.

PubMed

Zhou, Haoran; Xu, Ming; Pan, Hongli; Yu, Xiubo

2015-11-01

Temperature responses and sensitivity of photosynthesis (A(n_)T) and respiration for leaves at different ages are crucial to modeling ecosystem carbon (C) cycles and productivity of evergreen forests. Understanding the mechanisms and processes of temperature sensitivity may further shed lights on temperature acclimation of photosynthesis and respiration with leaf aging. The current study examined temperature responses of photosynthesis and respiration of young leaves (YLs) (fully expanded in current growth season) and old leaves (OLs) (fully expanded in last growth season) of Quercus aquifolioides Rehder and E.H. Wilson in an alpine oak forest, southwestern China. Temperature responses of dark respiration (R(dark)), net assimilation (A(n)), maximal velocity of carboxylation (V(cmax)) and maximum rate of electron transport (J(max)) were significantly different between the two leaf ages. Those differences implied different temperature response parameters should be used for leaves of different ages in modeling vegetation productivity and ecosystem C cycles in Q. aquifolioides forests and other evergreen forests. We found that RuBP carboxylation determined the downward shift of A(n_)T in OLs, while RuBP regeneration and the balance between Rubisco carboxylation and RuBP regeneration made little contribution. Sensitivity of stomatal conductance to vapor pressure deficit changed in OLs and compensated part of the downward shift. We also found that OLs of Q. aquifolioides had lower An due to lower stomatal conductance, higher stomatal conductance limitation and deactivation of the biochemical processes. In addition, the balance between R(dark) and A(n) changed between OLs and YLs, which was represented by a higher R(dark)/A(n) ratio for OLs. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Ocean-atmosphere interactions as drivers of mid-to-late Holocene rapid climate changes: Evidence from high-resolution stalagmite records at DeSoto Caverns, Southeast USA

NASA Astrophysics Data System (ADS)

Aharon, Paul; Dhungana, Rajesh

2017-08-01

Oxygen and carbon isotope time-series derived from an actively growing aragonitic stalagmite in DeSoto Caverns exhibit with unusual clarity rapid hydroclimate changes in the mid-to-late Holocene. Data consist of 1884 δ18O and δ13C determinations whose chronology is anchored on 35 230Th/234U absolute dates in the interval 6.0-1.1 cal ka BP. Exceptional 18O and 13C-enrichments centered at 4.8 ± 0.14 cal ka BP likely represent the imprints of a severe drought. Isotope cycles from 4.7 to 1.3 cal ka BP, exhibit a dominant periodicity of 68 ± 4 yrs. A gradual cooling trend of ∼0.6 °C/103 yrs is attributed to a declining seasonal contrast in insolation. The synchronicity of the mega-drought in the Southeast US with the (1) termination of the African Humid Period; (ii) abrupt reduction of the North Atlantic Deep Water production, and (iii) rapid sea-ice expansion in the polar regions of both Hemispheres testifies to the global extent and rapidity of the "5 ka" event and points to the North Atlantic Deep Water variability as the likely controlling factor. The multidecadal cycles are consistent with alternating dry and wet summers occurring during a long-term switch in the seasonal rainfall amount dominance from winter to summer. The periodic summer droughts in the Southeast US support climate models that predict profound hydroclimate changes in the late Holocene governed by the Atlantic Multidecadal Oscillation. The relatively short and rapid hydroclimate phase transitions documented in this study introduce a complication in the correlation of late Holocene drought events that had significant societal impacts.

TCF7L1 recruits CtBP and HDAC1 to repress DICKKOPF4 gene expression in human colorectal cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eshelman, Melanie A.; Shah, Meera; Raup-Konsavage, Wesley M.

The T-cell factor/Lymphoid enhancer factor (TCF/LEF; hereafter TCF) family of transcription factors are critical regulators of colorectal cancer (CRC) cell growth. Of the four TCF family members, TCF7L1 functions predominantly as a repressor of gene expression. Few studies have addressed the role of TCF7L1 in CRC and only a handful of target genes regulated by this repressor are known. By silencing TCF7L1 expression in HCT116 cells, we show that it promotes cell proliferation and tumorigenesis in vivo by driving cell cycle progression. Microarray analysis of transcripts differentially expressed in control and TCF7L1-silenced CRC cells identified genes that control cell cycle kinetics andmore » cancer pathways. Among these, expression of the Wnt antagonist DICKKOPF4 (DKK4) was upregulated when TCF7L1 levels were reduced. We found that TCF7L1 recruits the C-terminal binding protein (CtBP) and histone deacetylase 1 (HDAC1) to the DKK4 promoter to repress DKK4 gene expression. In the absence of TCF7L1, TCF7L2 and β-catenin occupancy at the DKK4 promoter is stimulated and DKK4 expression is increased. These findings uncover a critical role for TCF7L1 in repressing DKK4 gene expression to promote the oncogenic potential of CRCs. - Highlights: • TCF7L1 promotes colorectal cancer cell proliferation and tumorigenesis. • DICKKOPF4 is directly regulated by TCF7L1. • TCF7L1 recruits CtBP and HDAC1 to repress DKK4 gene expression.« less

Late Holocene Permafrost Aggradation in the Western Kenai Lowlands, Alaska: Implications for Climate Reconstruction and Carbon Cycling.

NASA Astrophysics Data System (ADS)

Hoefke, K.; Jones, M.; Jones, B. M.

2017-12-01

Rapid permafrost thaw is occurring throughout the permafrost zone, particularly at the southern margins, where mean annual air temperatures are above 0°C. As the Kenai lowlands experience ecosystem shifts due to human disturbance and climate change, understanding permafrost history is of particular interest given the direct impacts on hydrology, vegetation, and carbon cycling. Across the northern high latitudes, permafrost peatlands within the sporadic and isolated permafrost zone store 95 Pg of C and permafrost formation processes (i.e., syngenetic versus epigenetic) are thought to influence the degree of carbon loss following thaw. This study uses plant macrofossils and radiocarbon dating to determine the timing of permafrost aggradation of a recently-thawed (since 1950 CE) peatland located directly adjacent to a 5-meter thick permafrost plateau landform in the Kenai Peninsula lowlands in south-central Alaska. The coring site was selected using remote sensing imagery to identify areas where permafrost plateaus have been thawing since 1950 CE. Preliminary results show dominance of brown moss (Paludella squarrosa, Drepanocladus spp., Tomenthypnum nitens) and sedge (Carex spp.) from peat inception 11,700 cal yr BP to 3,000 cal yr BP indicative of a permafrost-free rich fen. A transition to silvic peat (Betula nana, Vaccinium oxycoccus, Ledum groenlandicum, ericaceous shrub macrofossils) 3,000 cal yr BP (indicates that permafrost aggradation coincided with neoglacial cooling. Since permafrost aggraded 9000 years after peat accumulation began and permafrost deepened to 5 m into unfrozen peat, this suggests mean annual air temperatures decreased significantly below 0ºC for several millennia in the late Holocene on the Kenai lowlands. This study will also examine impacts of permafrost aggradation and degradation on rates of carbon accumulation and loss.

In Situ Chemical Reduction for Organic Explosives in Soil

DTIC Science & Technology

2009-05-01

DARAMEND®  Implementation  Results  Degradation and Toxicity  Summary Presentation Outline www.AdventusGroup.com March 2008 © Copyright Adventus...2008 © Copyright Adventus Intellectual Property Inc. 9 DARAMEND ® Technology Applications Cycled Anaerobic/Aerobic • chlorinated pesticides and...Consistency • Fungus www.AdventusGroup.com March 2008 © Copyright Adventus Intellectual Property Inc. 17 Implementation - Full Scale • Conducted inside

Modelling of mineral dust for interglacial and glacial climate conditions with a focus on Antarctica

DOE PAGES

Sudarchikova, Natalia; Mikolajewicz, Uwe; Timmreck, C.; ...

2015-05-19

The mineral dust cycle responds to climate variations and plays an important role in the climate system by affecting the radiative balance of the atmosphere and modifying biogeochemistry. Polar ice cores provide unique information about deposition of aeolian dust particles transported over long distances. These cores are a palaeoclimate proxy archive of climate variability thousands of years ago. The current study is a first attempt to simulate past interglacial dust cycles with a global aerosol–climate model ECHAM5-HAM. The results are used to explain the dust deposition changes in Antarctica in terms of quantitative contribution of different processes, such as emission,more » atmospheric transport and precipitation, which will help to interpret palaeodata from Antarctic ice cores. The investigated periods include four interglacial time slices: the pre-industrial control (CTRL), mid-Holocene (6000 yr BP; hereafter referred to as \\"6 kyr\\"), last glacial inception (115 000 yr BP; hereafter \\"115 kyr\\") and Eemian (126 000 yr BP; hereafter \\"126 kyr\\"). One glacial time interval, the Last Glacial Maximum (LGM) (21 000 yr BP; hereafter \\"21 kyr\\"), was simulated as well to be a reference test for the model. Results suggest an increase in mineral dust deposition globally, and in Antarctica, in the past interglacial periods relative to the pre-industrial CTRL simulation. Approximately two-thirds of the increase in the mid-Holocene and Eemian is attributed to enhanced Southern Hemisphere dust emissions. Slightly strengthened transport efficiency causes the remaining one-third of the increase in dust deposition. The moderate change in dust deposition in Antarctica in the last glacial inception period is caused by the slightly stronger poleward atmospheric transport efficiency compared to the pre-industrial. Maximum dust deposition in Antarctica was simulated for the glacial period. LGM dust deposition in Antarctica is substantially increased due to 2.6 times higher Southern Hemisphere dust emissions, 2 times stronger atmospheric transport towards Antarctica, and 30% weaker precipitation over the Southern Ocean. The model is able to reproduce the order of magnitude of dust deposition globally and in Antarctica for the pre-industrial and LGM climates.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sudarchikova, Natalia; Mikolajewicz, Uwe; Timmreck, C.

The mineral dust cycle responds to climate variations and plays an important role in the climate system by affecting the radiative balance of the atmosphere and modifying biogeochemistry. Polar ice cores provide unique information about deposition of aeolian dust particles transported over long distances. These cores are a palaeoclimate proxy archive of climate variability thousands of years ago. The current study is a first attempt to simulate past interglacial dust cycles with a global aerosol–climate model ECHAM5-HAM. The results are used to explain the dust deposition changes in Antarctica in terms of quantitative contribution of different processes, such as emission,more » atmospheric transport and precipitation, which will help to interpret palaeodata from Antarctic ice cores. The investigated periods include four interglacial time slices: the pre-industrial control (CTRL), mid-Holocene (6000 yr BP; hereafter referred to as \\"6 kyr\\"), last glacial inception (115 000 yr BP; hereafter \\"115 kyr\\") and Eemian (126 000 yr BP; hereafter \\"126 kyr\\"). One glacial time interval, the Last Glacial Maximum (LGM) (21 000 yr BP; hereafter \\"21 kyr\\"), was simulated as well to be a reference test for the model. Results suggest an increase in mineral dust deposition globally, and in Antarctica, in the past interglacial periods relative to the pre-industrial CTRL simulation. Approximately two-thirds of the increase in the mid-Holocene and Eemian is attributed to enhanced Southern Hemisphere dust emissions. Slightly strengthened transport efficiency causes the remaining one-third of the increase in dust deposition. The moderate change in dust deposition in Antarctica in the last glacial inception period is caused by the slightly stronger poleward atmospheric transport efficiency compared to the pre-industrial. Maximum dust deposition in Antarctica was simulated for the glacial period. LGM dust deposition in Antarctica is substantially increased due to 2.6 times higher Southern Hemisphere dust emissions, 2 times stronger atmospheric transport towards Antarctica, and 30% weaker precipitation over the Southern Ocean. The model is able to reproduce the order of magnitude of dust deposition globally and in Antarctica for the pre-industrial and LGM climates.« less

Comparison of freely-moving telemetry Chinese Miniature Experiment Pigs (CMEPs) to beagle dogs in cardiovascular safety pharmacology studies.

PubMed

Yuan, Haitao; Zhao, Jing; Guo, Jiabin; Wu, Ruiqin; He, Li; Cui, Yaxiong; Feng, Min; Zhang, Tingfen; Hou, Mingyue; Guo, Qian; Zhang, Lijun; Jia, Li; Huang, Chang; Ye, Lin; Peng, Shuangqing

2014-01-01

Telemetry beagle dogs are the most frequently used species in cardiovascular telemetry assessments. However, beagle dogs may not be always suitable for all of the tests. Recently minipigs have received increased attention for these studies. Differences between the two species regarding the response of their cardiovascular systems to environmental stimuli are unclear. This study investigates how the telemetry minipig compares to beagle dog as a test subject and also refines the experimental protocols necessary to obtain accurate data. Beagle dogs and Chinese Miniature Experiment Pigs (CMEPs) were implanted with telemetry transmitters and the influences of gavage, feeding and the circadian cycle on various cardiovascular parameters were investigated. ECG signal quality from CMEPs was superior to that of the beagle dogs. Poor ECG signal quality, elevated HR, BP and locomotor activity associated with gavage and feeding were observed in both species. ECG signal quality, BP and locomotor activity recovered more quickly in the CMEPs than in the beagle dogs. Residual elevation of HR found in CMEPs lasted approximately 4h post-feeding, which has a profound influence on the circadian cycle. A diurnal rhythm in CMEP with a significant increase of body temperature during the dark period and a clear circadian rhythm of locomotor activity in both species were observed. The present data demonstrated that gavage, feeding and circadian cycle were having an enormous influence on BP, HR and locomotor activity in both species. If drug-induced effects are expected rapidly after oral administration and feeding, CMEP seems to be a favorable choice. Also, due to the effects of feeding on HR, CMEPs should fast at least 5h before the start of recording or should not be fed during the study where the Tmax of a given compound might occur very late. It also should be taken into consideration when the test article has a potential effect on body temperature by using CMEPs. In summary, the telemetry CMEP is a valuable alternative to the beagle dog for cardiovascular telemetry studies. Copyright © 2014 Elsevier Inc. All rights reserved.

Source characterization for an explosion during the 2009 eruption of Redoubt Volcano from very-long-period seismic waves

USGS Publications Warehouse

Haney, Matthew M.; Chouet, Bernard A.; Dawson, Phillip B.; Power, John A.

2013-01-01

The 2009 eruption of Redoubt produced several very-long-period (VLP) signals associated with explosions. We invert for the source location and mechanism of an explosion at Redoubt volcano using waveform methods applied to broadband recordings. Such characterization of the source carries information on the geometry of the conduit and the physics of the explosion process. Inversions are carried out assuming the volcanic source can be modeled as a point source, with mechanisms described by a) a set of 3 orthogonal forces, b) a moment tensor consisting of force couples, and c) both forces and moment tensor components. We find that the source of the VLP seismic waves during the explosion is well-described by either a combined moment/force source located northeast of the crater and at an elevation of 1.6 km ASL or a moment source at an elevation of 800 m to the southwest of the crater. The moment tensors for the solutions with moment and force and moment-only share similar characteristics. The source time functions for both moment tensors begin with inflation (pressurization) and execute two cycles of deflation-reinflation (depressurization–repressurization). Although the moment/force source provides a better fit to the data, we find that owing to the limited coverage of the broadband stations at Redoubt the moment-only source is the more robust and reliable solution. Based on the moment-only solution, we estimate a volume change of 19,000 m3 and a pressure change of 7 MPa in a dominant sill and an out-of-phase volume change of 5000 m3 and pressure change of 1.8 MPa in a subdominant dike at the source location. These results shed new light on the magmatic plumbing system beneath Redoubt and complement previous studies on Vulcanian explosions at other volcanoes.

Let-7b Regulates Myoblast Proliferation by Inhibiting IGF2BP3 Expression in Dwarf and Normal Chicken

PubMed Central

Lin, Shumao; Luo, Wen; Ye, Yaqiong; Bekele, Endashaw J.; Nie, Qinghua; Li, Yugu; Zhang, Xiquan

2017-01-01

The sex-linked dwarf chicken is caused by the mutation of growth hormone receptor (GHR) gene and characterized by shorter shanks, lower body weight, smaller muscle fiber diameter and fewer muscle fiber number. However, the precise regulatory pathways that lead to the inhibition of skeletal muscle growth in dwarf chickens still remain unclear. Here we found a let-7b mediated pathway might play important role in the regulation of dwarf chicken skeletal muscle growth. Let-7b has higher expression in the skeletal muscle of dwarf chicken than in normal chicken, and the expression of insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3), which is a translational activator of IGF2, showed opposite expression trend to let-7b. In vitro cellular assays validated that let-7b directly inhibits IGF2BP3 expression through binding to its 3′UTR region, and the protein level but not mRNA level of IGF2 would be reduced in let-7b overexpressed chicken myoblast. Let-7b can inhibit cell proliferation and induce cell cycle arrest in chicken myoblast through let-7b-IGF2BP3-IGF2 signaling pathway. Additionally, let-7b can also regulate skeletal muscle growth through let-7b-GHR-GHR downstream genes pathway, but this pathway is non-existent in dwarf chicken because of the deletion mutation of GHR 3′UTR. Notably, as the loss binding site of GHR for let-7b, let-7b has enhanced its binding and inhibition on IGF2BP3 in dwarf myoblast, suggesting that the miRNA can balance its inhibiting effect through dynamic regulate its binding to target genes. Collectively, these results not only indicate that let-7b can inhibit skeletal muscle growth through let-7b-IGF2BP3-IGF2 signaling pathway, but also show that let-7b regulates myoblast proliferation by inhibiting IGF2BP3 expression in dwarf and normal chickens. PMID:28736533

Molecular characterization of a genomic region in a Lactococcus bacteriophage that is involved in its sensitivity to the phage defense mechanism AbiA.

PubMed

Dinsmore, P K; Klaenhammer, T R

1997-05-01

A spontaneous mutant of the lactococcal phage phi31 that is insensitive to the phage defense mechanism AbiA was characterized in an effort to identify the phage factor(s) involved in sensitivity of phi31 to AbiA. A point mutation was localized in the genome of the AbiA-insensitive phage (phi31A) by heteroduplex analysis of a 9-kb region. The mutation (G to T) was within a 738-bp open reading frame (ORF245) and resulted in an arginine-to-leucine change in the predicted amino acid sequence of the protein. The mutant phi31A-ORF245 reduced the sensitivity of phi31 to AbiA when present in trans, indicating that the mutation in ORF245 is responsible for the AbiA insensitivity of phi31A. Transcription of ORF245 occurs early in the phage infection cycles of phi31 and phi31A and is unaffected by AbiA. Expansion of the phi31 sequence revealed ORF169 (immediately upstream of ORF245) and ORF71 (which ends 84 bp upstream of ORF169). Two inverted repeats lie within the 84-bp region between ORF71 and ORF169. Sequence analysis of an independently isolated AbiA-insensitive phage, phi31B, identified a mutation (G to A) in one of the inverted repeats. A 118-bp fragment from phi31, encompassing the 84-bp region between ORF71 and ORF169, eliminates AbiA activity against phi31 when present in trans, establishing a relationship between AbiA and this fragment. The study of this region of phage phi31 has identified an open reading frame (ORF245) and a 118-bp DNA fragment that interact with AbiA and are likely to be involved in the sensitivity of this phage to AbiA.

Coordinating Environmental Genomics and Geochemistry Reveals Metabolic Transitions in a Hot Spring Ecosystem

PubMed Central

Swingley, Wesley D.; Meyer-Dombard, D’Arcy R.; Shock, Everett L.; Alsop, Eric B.; Falenski, Heinz D.; Havig, Jeff R.; Raymond, Jason

2012-01-01

We have constructed a conceptual model of biogeochemical cycles and metabolic and microbial community shifts within a hot spring ecosystem via coordinated analysis of the “Bison Pool” (BP) Environmental Genome and a complementary contextual geochemical dataset of ∼75 geochemical parameters. 2,321 16S rRNA clones and 470 megabases of environmental sequence data were produced from biofilms at five sites along the outflow of BP, an alkaline hot spring in Sentinel Meadow (Lower Geyser Basin) of Yellowstone National Park. This channel acts as a >22 m gradient of decreasing temperature, increasing dissolved oxygen, and changing availability of biologically important chemical species, such as those containing nitrogen and sulfur. Microbial life at BP transitions from a 92°C chemotrophic streamer biofilm community in the BP source pool to a 56°C phototrophic mat community. We improved automated annotation of the BP environmental genomes using BLAST-based Markov clustering. We have also assigned environmental genome sequences to individual microbial community members by complementing traditional homology-based assignment with nucleotide word-usage algorithms, allowing more than 70% of all reads to be assigned to source organisms. This assignment yields high genome coverage in dominant community members, facilitating reconstruction of nearly complete metabolic profiles and in-depth analysis of the relation between geochemical and metabolic changes along the outflow. We show that changes in environmental conditions and energy availability are associated with dramatic shifts in microbial communities and metabolic function. We have also identified an organism constituting a novel phylum in a metabolic “transition” community, located physically between the chemotroph- and phototroph-dominated sites. The complementary analysis of biogeochemical and environmental genomic data from BP has allowed us to build ecosystem-based conceptual models for this hot spring, reconstructing whole metabolic networks in order to illuminate community roles in shaping and responding to geochemical variability. PMID:22675512

Hot Galactic Arms Point To Vicious Cycle

NASA Astrophysics Data System (ADS)

2001-12-01

NASA's Chandra X-ray Observatory has revealed the aftermath of a titanic explosion that wracked the elliptical galaxy known as NGC 4636. This eruption could be the latest episode in a cycle of violence that is triggered by gas falling into a central massive black hole. Chandra's images of NGC 4636 show spectacular symmetric arms, or arcs, of hot gas extending 25,000 light years into a huge cloud of multimillion-degree-Celsius gas that envelopes the galaxy. At a temperature of 10 million degrees, the arms are 30 percent hotter than the surrounding gas cloud. "The temperature jump, together with the symmetry and scale of the arms, suggests that we are observing the effects of a tremendous outburst that occurred in the center of the galaxy," said Christine Jones of the Harvard-Smithsonian Center for Astrophysics in Cambridge, Mass., lead author of a paper on these observations scheduled for publication in Astrophysical Journal Letters. "The energy of this explosion would be the equivalent of several hundred thousand supernovas." The arms appear to be the leading edges of a galaxy-sized shock wave that is racing outward at 700 kilometers per second, or 1.6 million miles per hour. At this speed, it would take 3 million years for the structures to attain their present size. Cavities detected in the hot gas cloud to the east and west of the center of the galaxy support the shockwave explanation. The authors suggest that the explosion is part of a majestic cosmic feedback process that keeps the galaxy in a state of turmoil. Over a period of a few million years, a hot gas cloud that envelops the stars in the galaxy cools and falls inward toward a central, massive black hole. The feeding of the black hole by the infalling material leads to an explosion that heats the hot gaseous envelope, starting the cycle anew. NGC 4636 NGC 4636 Background Subtracted This feedback cycle may explain one puzzling feature of the galaxy - the lack of a strong radio source of the type that is usually observed in connection with galactic outbursts. "It may be that we are seeing an early stage of the cycle before the radio source has turned on," said team member William Forman also of the Harvard-Smithsonian Center for Astrophysics. "Or, it could be a new type of outburst that is not accompanied by strong radio emission." Other members of the team included Alexey Vikhlinin, Maxim Markevitch, Laurence David, Aryeh Warmflash, all of the CfA, and Paul Nulsen of the University of Wollongong in Australia. Chandra observed NGC 4636, an elliptical galaxy in the constellation Virgo some 50 million light years from Earth, with the Advanced CCD Imaging Spectrometer (ACIS) on Dec. 4-5, 1999 for 11,000 sec, and Jan. 26-27, 2000 for 53,000 seconds as part of a program led by Richard Mushotzky of NASA's Goddard Space Flight Center to study X-ray emission from elliptical galaxies. The ACIS instrument was developed for NASA by Pennsylvania State University, University Park, and Massachusetts Institute of Technology, Cambridge. NASA's Marshall Space Flight Center in Huntsville, Ala., manages the Chandra program, and TRW, Inc., Redondo Beach, Calif., is the prime contractor for the spacecraft. The Smithsonian's Chandra X-ray Center controls science and flight operations from Cambridge, Mass.

Surface Nutrient Utilisation and Productivity During Glacial-Interglacial Periods from the Equatorial Indian Ocean

NASA Astrophysics Data System (ADS)

R, C. K.; Bhushan, R.; Agnihotri, R.; Sawlani, R.; Jull, A. J. T.

2016-12-01

Seawaters and underlying sediments off Sri Lanka provide a unique marine realm affected by both branches of Northern Indian Ocean i.e. Arabian Sea (AS) and Bay of Bengal (BOB). AS and BOB are known for their distinct response to southwest monsoon. AS experiencing mainly winds and upwelling while BOB receives precipitation driven surface runoff from the Indian sub-continent. Multiple proxies were measured on a radiocarbon dated sediment core raised off Sri Lanka; their down core variations were used to understand oceanic history (nutrient utilisation, surface productivity, nature of organic matter) spanning last glacial-interglacial cycle ( 26 to 2.5 ka BP). Variations in CaCO3, biogenic silica (BSi) and δ15N from 26 ka to 12.5 ka BP indicate the region was experiencing high surface productivity with probably reduced surface nutrient utilisation efficiency. Sedimentary δ15N depth profile is decoupled from down core variations of major productivity indices (e.g. CaCO3, OC), hinting plausibly partial utilization of nutrients in the mixed layer (photic zone). δ13C of OC and C/N (wt. ratio) clearly reveal the terrestrial origin of organic matter at 15 ka BP, a period known for witnessing onset of deglaciation in northern hemisphere. δ13C minimum at 9 ka BP indicates intense monsoonal activity during this time coinciding well with solar insolation (June) maximum of the northern hemisphere. With the onset of Holocene ( 11 ka BP), δ15N variations appear to correlate with BSi and Ba/Ti indicating enhanced utilization of available nutrients at surface. Suggesting surface productivity over the region was probably micro-nutrient limited. The increased inventory of terrestrial runoff in Holocene probably demonstrates enhanced carbon sequestration capability of the region.

The Fission Yeast Minichromosome Maintenance (MCM)-binding Protein (MCM-BP), Mcb1, Regulates MCM Function during Prereplicative Complex Formation in DNA Replication*

PubMed Central

Santosa, Venny; Martha, Sabrina; Hirose, Noriaki; Tanaka, Katsunori

2013-01-01

The minichromosome maintenance (MCM) complex is a replicative helicase, which is essential for chromosome DNA replication. In recent years, the identification of a novel MCM-binding protein (MCM-BP) in most eukaryotes has led to numerous studies investigating its function and its relationship to the MCM complex. However, the mechanisms by which MCM-BP functions and associates with MCM complexes are not well understood; in addition, the functional role of MCM-BP remains controversial and may vary between model organisms. The present study aims to elucidate the nature and biological function of the MCM-BP ortholog, Mcb1, in fission yeast. The Mcb1 protein continuously interacts with MCM proteins during the cell cycle in vivo and can interact with any individual MCM subunit in vitro. To understand the detailed characteristics of mcb1+, two temperature-sensitive mcb1 gene mutants (mcb1ts) were isolated. Extensive genetic analysis showed that the mcb1ts mutants were suppressed by a mcm5+ multicopy plasmid and displayed synthetic defects with many S-phase-related gene mutants. Moreover, cyclin-dependent kinase modulation by Cig2 repression or Rum1 overproduction suppressed the mcb1ts mutants, suggesting the involvement of Mcb1 in pre-RC formation during DNA replication. These data are consistent with the observation that Mcm7 loading onto replication origins is reduced and S-phase progression is delayed in mcb1ts mutants. Furthermore, the mcb1ts mutation led to the redistribution of MCM subunits to the cytoplasm, and this redistribution was dependent on an active nuclear export system. These results strongly suggest that Mcb1 promotes efficient pre-RC formation during DNA replication by regulating the MCM complex. PMID:23322785

The fission yeast minichromosome maintenance (MCM)-binding protein (MCM-BP), Mcb1, regulates MCM function during prereplicative complex formation in DNA replication.

PubMed

Santosa, Venny; Martha, Sabrina; Hirose, Noriaki; Tanaka, Katsunori

2013-03-08

The minichromosome maintenance (MCM) complex is a replicative helicase, which is essential for chromosome DNA replication. In recent years, the identification of a novel MCM-binding protein (MCM-BP) in most eukaryotes has led to numerous studies investigating its function and its relationship to the MCM complex. However, the mechanisms by which MCM-BP functions and associates with MCM complexes are not well understood; in addition, the functional role of MCM-BP remains controversial and may vary between model organisms. The present study aims to elucidate the nature and biological function of the MCM-BP ortholog, Mcb1, in fission yeast. The Mcb1 protein continuously interacts with MCM proteins during the cell cycle in vivo and can interact with any individual MCM subunit in vitro. To understand the detailed characteristics of mcb1(+), two temperature-sensitive mcb1 gene mutants (mcb1(ts)) were isolated. Extensive genetic analysis showed that the mcb1(ts) mutants were suppressed by a mcm5(+) multicopy plasmid and displayed synthetic defects with many S-phase-related gene mutants. Moreover, cyclin-dependent kinase modulation by Cig2 repression or Rum1 overproduction suppressed the mcb1(ts) mutants, suggesting the involvement of Mcb1 in pre-RC formation during DNA replication. These data are consistent with the observation that Mcm7 loading onto replication origins is reduced and S-phase progression is delayed in mcb1(ts) mutants. Furthermore, the mcb1(ts) mutation led to the redistribution of MCM subunits to the cytoplasm, and this redistribution was dependent on an active nuclear export system. These results strongly suggest that Mcb1 promotes efficient pre-RC formation during DNA replication by regulating the MCM complex.

The septal bulge--an early echocardiographic sign in hypertensive heart disease.

PubMed

Gaudron, Philipp Daniel; Liu, Dan; Scholz, Friederike; Hu, Kai; Florescu, Christiane; Herrmann, Sebastian; Bijnens, Bart; Ertl, Georg; Störk, Stefan; Weidemann, Frank

2016-01-01

Patients in the early stage of hypertensive heart disease tend to have normal echocardiographic findings. The aim of this study was to investigate whether pathology-specific echocardiographic morphologic and functional parameters can help to detect subclinical hypertensive heart disease. One hundred ten consecutive patients without a history and medication for arterial hypertension (AH) or other cardiac diseases were enrolled. Standard echocardiography and two-dimensional speckle-tracking-imaging analysis were performed. Resting blood pressure (BP) measurement, cycle ergometer test (CET), and 24-hour ambulatory BP monitoring (ABPM) were conducted. Patients were referred to "septal bulge (SB)" group (basal-septal wall thickness ≥ 2 mm thicker than mid-septal wall thickness) or "no-SB" group. Echocardiographic SB was found in 48 (43.6%) of 110 patients. In this SB group, 38 (79.2%) patients showed AH either by CET or ABPM. In contrast, in the no-SB group (n = 62), 59 (95.2%) patients had no positive test for AH by CET or ABPM. When AH was solely defined by resting BP, SB was a reasonable predictive sign for AH (sensitivity 73%, specificity 76%). However, when AH was confirmed by CET or ABPM the echocardiographic SB strongly predicted clinical AH (sensitivity 93%, specificity 86%). In addition, regional myocardial deformation of the basal-septum in SB group was significantly lower than in no-SB group (14 ± 4% vs. 17 ± 4%; P < .001). In conclusion, SB is a morphologic echocardiographic sign for early hypertensive heart disease. Sophisticated BP evaluation including resting BP, ABPM, and CET should be performed in all patients with an accidental finding of a SB in echocardiography. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

AMS 14C and 230Th/U dating on stalagmites from North Altai Mountain, Siberia, Russia

NASA Astrophysics Data System (ADS)

Li, H. C.; Yin, J. J.; Blyakharchuk, T.; Shen, C. C.

2017-12-01

Three stalagmites, two from Lunnaya Cave (LUN-1 and LUN-2, 52º40.729'N, 88º43.854' E, 481 m a.s.l.), one from Nadezhda Cave (HOP-1, 52º38.872'N, 88º39.194'E, 550 m a.s.l.) located along Mrassy River in the northern Altai Mountains, Siberia, Russia were collected in the summer of 2016 for paleoclimate reconstruction. HOP-1 is a 21-cm long stalagmite which contains very low U content (238U = 70 ppb) and relatively high Th content (232Th = 2 9.3 ppb), resulting in unsuccessful 230Th/U dating (-262 ± 284 yr BP in the top and -19,935 ± 22,246 yr BP). Thirty one AMS 14C dates from 27 horizons of the stalagmite provide a detailed chronology, showing that the stalagmite grew from 6,350 ± 45 yr BP to 490 ± 10 Calib. yr BP. Both LUN-1 and LUN-2 are about 20-cm long. The growth feature of LUN-2 is similar to that of HOP-1 with continuous growth, clear bands of depositional cycles in white non-transparent calcite, whereas LUN-1 has light yellow transparent calcite in the center part with multiple growth hiatuses. The 230Th/U dates show that LUN-1 from 2725 ± 775 yr BP at 193 mm depth to 823 ± 28 yr BP at 12 mm depth with very fast growth rate during 900 1500 yr BP. The AMS 14C dates of LUN-1 provide similar growth pattern with very fast growth between the first hiatus at 12 mm depth and the second hiatus at 155 cm depth. Six 14C dates from this fast growth period are all around 1500 Calib. yr BP without a correct age sequence. Two 14C dates from the top 12 mm exhibit "nuclear bomb signal" (percentage of modern carbon >100%). Similar ages of AMS 14C and 230Th/U dating results in the lower part indicate that dead carbon influence in radiocarbon ages are negligible. 230Th/U dating is not successful for LUN-2. The preliminary AMS 14C dating on LUN-2 shows that the stalagmite continuously deposited from 13335 ± 150 Calib. yr BP. All three stalagmites do not have growth deposition during the Little Ice Age due to cold and dry climates. Further work on stable isotope analyses will provide us high-resolution paleoclimate changes since the deglaciation in the study area.

Circadian Differences in the Contribution of the Brain Renin-Angiotensin System in Genetically Hypertensive Mice

PubMed Central

Jackson, Kristy L.; Marques, Francine Z.; Lim, Kyungjoon; Davern, Pamela J.; Head, Geoffrey A.

2018-01-01

Objective: Genetically hypertensive BPH/2J mice are recognized as a neurogenic model of hypertension, primarily based on sympathetic overactivity and greater neuronal activity in cardiovascular regulatory brain regions. Greater activity of the central renin angiotensin system (RAS) and reactive oxygen species (ROS) reportedly contribute to other models of hypertension. Importantly the peripheral RAS contributes to the hypertension in BPH/2J mice, predominantly during the dark period of the 24 h light cycle. The aim of the present study was to determine whether central AT1 receptor stimulation and the associated ROS signaling contribute to hypertension in BPH/2J mice in a circadian dependent manner. Methods: Blood pressure (BP) was measured in BPH/2J and normotensive BPN/3J mice (n = 7–8) via pre-implanted telemetry devices. Acute intracerebroventricular (ICV) microinjections of AT1 receptor antagonist, candesartan, and the superoxide dismutase (SOD) mimetic, tempol, were administered during the dark and light period of the 24 h light cycle via a pre-implanted ICV guide cannula. In separate mice, the BP effect of ICV infusion of the AT1 receptor antagonist losartan for 7 days was compared with subcutaneous infusion to determine the contribution of the central RAS to hypertension in BPH/2J mice. Results: Candesartan administered ICV during the dark period induced depressor responses which were 40% smaller in BPH/2J than BPN/3J mice (Pstrain < 0.05), suggesting AT1 receptor stimulation may contribute less to BP maintenance in BPH/2J mice. During the light period candesartan had minimal effect on BP in either strain. ICV tempol had comparable effects on BP between strains during the light and dark period (Pstrain > 0.08), suggesting ROS signaling is also not contributing to the hypertension in BPH/2J mice. Chronic ICV administration of losartan (22 nmol/h) had minimal effect on BPN/3J mice. By contrast in BPH/2J mice, both ICV and subcutaneously administered losartan induced similar hypotensive responses (−12.1 ± 1.8 vs. −14.7 ± 1.8 mmHg, Proute = 0.31). Conclusion: While central effects of peripheral losartan cannot be excluded, we suggest the hypotensive effect of chronic ICV losartan was likely peripherally mediated. Thus, based on both acute and chronic AT1 receptor inhibition and acute ROS inhibition, our findings suggest that greater activation of central AT1 receptors or ROS are unlikely to be mediating the hypertension in BPH/2J mice. PMID:29615926

Mitigation of Syngas Cooler Plugging and Fouling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bockelie, Michael J.

This Final Report summarizes research performed to develop a technology to mitigate the plugging and fouling that occurs in the syngas cooler used in many Integrated Gasification Combined Cycle (IGCC) plants. The syngas cooler is a firetube heat exchanger located downstream of the gasifier. It offers high thermal efficiency, but its’ reliability has generally been lower than other process equipment in the gasification island. The buildup of ash deposits that form on the fireside surfaces in the syngas cooler (i.e., fouling) lead to reduced equipment life and increased maintenance costs. Our approach to address this problem is that fouling ofmore » the syngas cooler cannot be eliminated, but it can be better managed. The research program was funded by DOE using two budget periods: Budget Period 1 (BP1) and Budget Period 2 (BP2). The project used a combination of laboratory scale experiments, analysis of syngas cooler deposits, modeling and guidance from industry to develop a better understanding of fouling mechanisms and to develop and evaluate strategies to mitigate syngas cooler fouling and thereby improve syngas cooler performance. The work effort in BP 1 and BP 2 focused on developing a better understanding of the mechanisms that lead to syngas cooler plugging and fouling and investigating promising concepts to mitigate syngas cooler plugging and fouling. The work effort focused on the following: • analysis of syngas cooler deposits and fuels provided by an IGCC plant collaborating with this project; • performing Jet cleaning tests in the University of Utah Laminar Entrained Flow Reactor to determine the bond strength between an ash deposit to a metal plate, as well as implementing planned equipment modifications to the University of Utah Laminar Entrained Flow Reactor and the one ton per day, pressurized Pilot Scale Gasifier; • performing Computational Fluid Dynamic modeling of industrially relevant syngas cooler configurations to develop a better understanding of deposit formation mechanisms; • performing Techno-Economic-Analysis for a representative IGCC plant to investigate the impact on plant economics, in particular the impacts on the Cost of Electricity (COE), due to plant shutdowns caused by syngas cooler plugging and fouling and potential benefits to plant economics of developing strategies to mitigate syngas cooler fouling; and • performing modeling and pilot scale tests to investigate the potential benefits of using a sorbent (fuel additive) to capture the vaporized metals that result in syngas cooler fouling. All project milestones for BP 1 and BP 2 were achieved. DOE was provided a briefing on our accomplishments in BP1 and BP2 and our proposed plans for Budget Period 3 (BP 3). Based on our research the mitigation technology selected to investigate in BP 3 was the use of a sorbent that can be injected into the gasifier with the fuel slurry to capture vaporized metals that lead to the deposit formation in the syngas cooler. The work effort proposed for BP 3 would have focused on addressing concerns raised by gasification industry personnel for the impacts on gasifier performance of sorbent injection, so that at the end of BP 3 the use of sorbent injection would be at “pre-commercial” stage and ready for use in a Field Demonstration that could be funded by industry or DOE. A Budget Continuation Application (BCA) was submitted to obtain funding for BP3 DOE but DOE chose to not fund the proposed BP3 effort.« less

A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

NASA Astrophysics Data System (ADS)

Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen S.; Skov, Julia; Sun, Yi; Duong Bang, Dang; Pedersen, Michael E.; Hansen, Mikkel F.; Wolff, Anders

2013-07-01

We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence signal from Rhodamine B. The method was validated with the PCR amplification of mecA gene (162 bp) from methicillin-resistant Staphylococcus aureus bacterium (MRSA), where the time for 30 cycles was reduced from 50 min (without over- and undershooting) to 20 min.

Field analysis for explosives: TNT and RDX

DOE Office of Scientific and Technical Information (OSTI.GOV)

Elcoate, W.; Mapes, J.

The EPA has listed as hazardous many of the compounds used in the production of ammunitions and other explosive ordnance. The contamination of soil with TNT (2,4,6-trinitrotoluene), the major component of many munitions formulations and to a lesser degree RDX (hexhydro-1,3,5-trinitro-1,3,5-trizine) is a significant problem at many ammunition manufacturing facilities, depots, and ordnance disposal sites. Field test kits for explosives TNT and RDX (hexhydro-1,3,5-trinitro-1,3,5-triazine) were developed based on the methods of T.F. Jenkins and M.E. Walsh and T.F Jenkins. EnSys Environmental Products, Inc. with technical support from T.F. Jenkins took the original TNT procedure, modified it for easier field use,more » performed validation studies to ensure that it met or exceeded the method specifications for both the T.F. Jenkins and SW-846 methods, and developed an easy to use test format for the field testing of TNT. The RDX procedure has gone through the development cycle and is presently in the field validation phase. This paper describes the test protocol and performance characteristics of the TNT test procedure.« less

Tracing the Cycling and Fate of the Explosive 2,4,6-Trinitrotoluene in Coastal Marine Systems with a Stable Isotopic Tracer, (15)N-[TNT].

PubMed

Smith, Richard W; Vlahos, Penny; Böhlke, J K; Ariyarathna, Thivanka; Ballentine, Mark; Cooper, Christopher; Fallis, Stephen; Groshens, Thomas J; Tobias, Craig

2015-10-20

2,4,6-Trinitrotoluene (TNT) has been used as a military explosive for over a hundred years. Contamination concerns have arisen as a result of manufacturing and use on a large scale; however, despite decades of work addressing TNT contamination in the environment, its fate in marine ecosystems is not fully resolved. Here we examine the cycling and fate of TNT in the coastal marine systems by spiking a marine mesocosm containing seawater, sediments, and macrobiota with isotopically labeled TNT ((15)N-[TNT]), simultaneously monitoring removal, transformation, mineralization, sorption, and biological uptake over a period of 16 days. TNT degradation was rapid, and we observed accumulation of reduced transformation products dissolved in the water column and in pore waters, sorbed to sediments and suspended particulate matter (SPM), and in the tissues of macrobiota. Bulk δ(15)N analysis of sediments, SPM, and tissues revealed large quantities of (15)N beyond that accounted for in identifiable derivatives. TNT-derived N was also found in the dissolved inorganic N (DIN) pool. Using multivariate statistical analysis and a (15)N mass balance approach, we identify the major transformation pathways of TNT, including the deamination of reduced TNT derivatives, potentially promoted by sorption to SPM and oxic surface sediments.

Tracing the cycling and fate of the explosive 2,4,6-trinitrotoluene in coastal marine systems with a stable isotopic tracer, 15N-[TNT

USGS Publications Warehouse

Smith, Richard W.; Vlahos, Penny; Böhlke, John Karl; Ariyarathna, Thivanka; Ballentine, Mark; Cooper, Christopher; Fallis, Stephen; Groshens, Thomas J.; Tobias, Craig

2015-01-01

2,4,6-Trinitrotoluene (TNT) has been used as a military explosive for over a hundred years. Contamination concerns have arisen as a result of manufacturing and use on a large scale; however, despite decades of work addressing TNT contamination in the environment, its fate in marine ecosystems is not fully resolved. Here we examine the cycling and fate of TNT in the coastal marine systems by spiking a marine mesocosm containing seawater, sediments, and macrobiota with isotopically labeled TNT (15N-[TNT]), simultaneously monitoring removal, transformation, mineralization, sorption, and biological uptake over a period of 16 days. TNT degradation was rapid, and we observed accumulation of reduced transformation products dissolved in the water column and in pore waters, sorbed to sediments and suspended particulate matter (SPM), and in the tissues of macrobiota. Bulk δ15N analysis of sediments, SPM, and tissues revealed large quantities of 15N beyond that accounted for in identifiable derivatives. TNT-derived N was also found in the dissolved inorganic N (DIN) pool. Using multivariate statistical analysis and a 15N mass balance approach, we identify the major transformation pathways of TNT, including the deamination of reduced TNT derivatives, potentially promoted by sorption to SPM and oxic surface sediments.

DNA typing from skeletal remains following an explosion in a military fort--first experience in Ecuador (South-America).

PubMed

González-Andrade, Fabricio; Sánchez, Dora

2005-10-01

We present individual body identification efforts, to identify skeletal remains and relatives of missing persons of an explosion took place inside one of the munitions recesses of the Armoured Brigade of the Galapagos Armoured Cavalry, in the city of Riobamba, Ecuador, on Wednesday, November 20, 2002. Nineteen samples of bone remains and two tissue samples (a blood stain on a piece of fabric) from the zero zone were analysed. DNA extraction was made by Isoamilic Phenol-Chloroform-Alcohol, and proteinase K. We increased PCR cycles to identify DNA from bones to 35 cycles in some cases. An ABI 310 sequencer was used. Determination of the fragment size and the allelic designation of the different loci was carried out by comparison with the allelic ladders of the PowerPlex 16 kit and Gene Scan Analysis Software programme. Five possible family groups were established and were compared with the profiles found. Classical Bayesian methods were used to calculate the Likelihood Ratio and it was possible to identify five different genetic profiles in our country. This paper is important because is a novel experience for our forensic services, because this was the first time DNA had been used as an identification method in disasters, and it was validated by Ecuadorian justice like a very effective method.

The activity of the Colima volcano and morphological changes in the summit between 2004 and 2013

NASA Astrophysics Data System (ADS)

Suarez-Plascencia, C.; Nunez-Cornu, F. J.; Camarena Garcia, M. A.

2013-05-01

Colima Volcano, located in the West of the Volcanic Mexican Belt (19° 30.696 N, 103° 37.026 W), has shown a new cycle of explosive activity beginning May 30 1999, and reaching its maximum in March-April of 2005 and January 2013. In the 2005 the explosive activity increased gradually, having the largest event on May 23, when a new dome was created. Hours later this dome was destroyed by a strong explosion, forming an ash column 5.6 km high with subsequent pyroclastic flows that reached a distance of 4.2 km flowing along the ravines of the South sector. On May 30 the most intense explosion in 1999 occurred, when the plume reached heights in excess of 4.4 km above the crater, and pyroclastic flows were created. On the same year in July two explosive events occurred of characteristics similar to those in May. These constant explosions caused continuous morphological changes in the summit, the most significant being the collapse of the North and South walls of the crater, in the first week of June of 2005, and the creation of a new crater in July. In 2006 the most significant explosive activity took place during April, May and July, when the eruptive columns reached heights of more than 1500 meters above the crater, occasionally forming small pyroclastic flows. In May of 2007 morphological changes were observed in the summit. Among them a crater explosion on the East side, a dome was formed on the West side, with 20 m in high and 50 m in diameter. Since the end of 2008 to December of 2012 the volcano remained calm, with a dome diameter of 220 m and height of 60 m, in January 2013 three explosions occurred, destroying the dome and throwing a volume of 1.5 million cubic meters. The eruptive column reached a height of 3000 above the crater. It reported light ashfall to the NE to 100 km away from the volcano. The explosive events continue to date, but they have diminished in size and intensity. This activity was similar to the one observed in 1902-1903 and reported by Severo Diaz and J.M. Arreola (1906), but without reaching the maximum levels of activity reported for 1903, where it had levels of three to five maximum explosive events per day. The photographs and the digital mapping have provided detailed information to quantify the dynamic evolution of the volcanic structures that developed on the summit of the volcano in the course of the last for years. The cartographic and database information obtained will be the basis for updating the Operational Plan of the Colima Volcano by the State Civil & Fire Protection Unit of Jalisco, Mexico, and the urban development plans of surrounding municipalities, in order to reduce their vulnerability to the hazards of the volcanic activity.

Selection of homeotic proteins for binding to a human DNA replication origin.

PubMed

de Stanchina, E; Gabellini, D; Norio, P; Giacca, M; Peverali, F A; Riva, S; Falaschi, A; Biamonti, G

2000-06-09

We have previously shown that a cell cycle-dependent nucleoprotein complex assembles in vivo on a 74 bp sequence within the human DNA replication origin associated to the Lamin B2 gene. Here, we report the identification, using a one-hybrid screen in yeast, of three proteins interacting with the 74 bp sequence. All of them, namely HOXA13, HOXC10 and HOXC13, are orthologues of the Abdominal-B gene of Drosophila melanogaster and are members of the homeogene family of developmental regulators. We describe the complete open reading frame sequence of HOXC10 and HOXC13 along with the structure of the HoxC13 gene. The specificity of binding of these two proteins to the Lamin B2 origin is confirmed by both band-shift and in vitro footprinting assays. In addition, the ability of HOXC10 and HOXC13 to increase the activity of a promoter containing the 74 bp sequence, as assayed by CAT-assay experiments, demonstrates a direct interaction of these homeoproteins with the origin sequence in mammalian cells. We also show that HOXC10 expression is cell-type-dependent and positively correlates with cell proliferation. Copyright 2000 Academic Press.

Late glacial ice advances in the Strait of Magellan, Southern Chile

NASA Astrophysics Data System (ADS)

Mcculloch, Robert D.; Bentley, Michael J.

During the last glacial cycle low gradient glaciers repeatedly drained north-eastward into the Strait of Magellan and dammed extensive proglacial lakes in the central section of the strait. This paper focuses on the two most recent glacial advances in the strait, culminating over 150 and 80 km from the present ice limits. The timing of the first of the two advances has, up to now, been ambiguous and depended on the interpretation of anomously older dates of 16,590-15,800 yr BP for deglaciation at Puerto del Hambre. Here, we show there is evidence from seismic data and truncated shorelines that the Puerto del Hambre basin has been tectonically displaced and that the dates do not represent minimums for deglaciation. Several other dates show that the advance occurred sometime before 14,260 yr BP. The timing of the second advance has been investigated using a refined tephrochronology for the region, which has also enabled a palaeoshoreline and glaciolacustrine sediments to be linked to a moraine limit. 14C dating of peat and a key tephra layer, above and below the glaciolacustrine deposits, respectively suggest that the advance culminated in the Strait of Magellan between 12,010 and 10,050 yr BP.

Maximizing PTH Anabolic Osteoporosis Therapy

DTIC Science & Technology

2015-09-01

SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18 . NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC a. REPORT U b. ABSTRACT U c...normalization or endogenous controls and calculates fold 263 changes with P values. Gene expression data were normalized to five endogenous controls ( 18S ...adapters were ligated and the sample was size-fractionated (200-300 bp) on an agarose gel. After a final 294 PCR amplification step ( 18 cycles), the

Prevention of Human Mammary Carcinogenesis

DTIC Science & Technology

1995-06-30

selected naturally-occurring agents (-)- epigallocatechin gallate ( EGCG ), indole-3-carbinol (13C) and genistein (GEN) for growth inhibition of 184-B5...mechanisms of BP-induced and GEN-induced alterations in cell cycle are being investigated in the ongoing studies. In addition, effects of 13C and EGCG are...rodent mammary tumorigenesis. The maximally nontoxic doses of EGCG , 13C and GEN identified by initial dose-response experiments, were used. The data

Optimization of VLf/ELF Wave Generation using Beam Painting

NASA Astrophysics Data System (ADS)

Robinson, A.; Moore, R. C.

2017-12-01

A novel optimized beam painting algorithm (OBP) is used to generate high amplitude very low frequency (VLF) and extremely low frequency (ELF) waves in the D-region of the ionosphere above the High-frequency Active Auroral Research Program (HAARP) observatory. The OBP method creates a phased array of sources in the ionosphere by varying the azimuth and zenith angles of the high frequency (HF) transmitter to capitalize on the constructive interference of propagating VLF/ELF waves. OBP generates higher amplitude VLF/ELF signals than any other previously proposed method. From April through June during 2014, OBP was performed at HAARP over 1200 times. We compare the BP generated signals against vertical amplitude modulated transmissions at 50 % duty cycle (V), oblique amplitude modulated transmissions at 15 degrees zenith and 81 degrees azimuth at 50 % duty cycle (O), and geometric (circle-sweep) modulation at 15 degrees off-zenith angle at 1562.5 Hz, 3125 Hz, and 5000 Hz. We present an analysis of the directional dependence of each signal, its polarization, and its dependence on the properties of the different source region elements. We find that BP increases the received signal amplitudes of VLF and ELF waves when compared to V, O, and GM methods over a statistically significant number of trials.

The ibrutinib B-cell proliferation inhibition is potentiated in vitro by dexamethasone: Application to chronic lymphocytic leukemia.

PubMed

Manzoni, Delphine; Catallo, Régine; Chebel, Amel; Baseggio, Lucile; Michallet, Anne-Sophie; Roualdes, Olivier; Magaud, Jean-Pierre; Salles, Gilles; Ffrench, Martine

2016-08-01

New B-cell receptor-targeted therapies such as ibrutinib, a Bruton tyrosine kinase inhibitor, are now proposed for lymphoid pathologies. The putative benefits of its combination with glucocorticoids were evaluated here. We compared the effects of dexamethasone (DXM), ibrutinib and their in vitro combination on proliferation and metabolic stress markers in stimulated normal B-lymphocytes and in malignant lymphocytes from chronic lymphocytic leukemia (CLL) patients. In both cellular models, cell cycle progression was globally inhibited by DXM and/or ibrutinib. This inhibition was significantly amplified by DXM addition to ibrutinib and was related to a significant decrease in the expression of the cell cycle regulatory proteins CDK4 and cyclin E. Apoptosis increased especially with DXM/ibrutinib combination and was associated with a significant decrease in Mcl-1 expression. Treatment effects on metabolic stress were evaluated by DNA damage recognition after 53BP1 foci labeling. The percentage of cells with more than five 53BP1 foci decreased significantly with ibrutinib in normal and CLL lymphocytes. This decrease was strongly reinforced, in CLL, by DXM addition. Our data indicated that, in vitro, DXM potentiated antiproliferative effects of ibrutinib and decreased DNA damage in lymphoid B-cells. Thus their combination may be proposed for CLL treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

Enzymatic redox properties of novel nitrotriazole explosives implications for their toxicity.

PubMed

Sarlauskas, Jonas; Nemeikaite-Ceniene, Ausra; Anusevicius, Zilvinas; Miseviciene, Lina; Maroziene, Audrone; Markevicius, Arvydas; Cenas, Narimantas

2004-01-01

The toxicity of conventional nitroaromatic explosives like 2,4,6-trinitrotoluene (TNT) is caused by their enzymatic free radical formation with the subsequent oxidative stress, the formation of alkylating nitroso and/or hydroxylamino metabolites, and oxyhemoglobin oxidation into methemoglobin. In order to get an insight into the mechanisms of toxicity of the novel explosives NTO (5-nitro-1,2,4-triazol-3-one) and ANTA (5-nitro-1,2,4-triazol-3-amine), we examined their reactions with the single-electron transferring flavoenzymes NADPH: cytochrome P-450 reductase and ferredoxin:NADP+ reductase, two-electron transferring flavoenzymes mammalian NAD(P)H:quinone oxidoreductase (DT-diaphorase), and Enterobacter cloacae NAD(P)H:nitroreductase, and their reactions with oxyhemoglobin. The reactivity of NTO and ANTA in the above reactions was markedly lower than that of TNT. The toxicity of NTO and ANTA in bovine leukemia virus-transformed lamb kidney fibroblasts (line FLK) was partly prevented by desferrioxamine and the antioxidant N,N'-diphenyl-p-phenylene diamine, and potentiated by 1,3-bis-(2-chloroethyl)-1-nitrosourea. This points to the involvement of oxidative stress in their cytotoxicity, presumably to the redox cycling of free radicals. The FLK cell line cytotoxicity and the methemoglobin formation in isolated human erythrocytes of NTO and ANTA were also markedly lower than those of TNT, and similar to those of nitrobenzene. Taken together, our data demonstrate that the low toxicity of nitrotriazole explosives may be attributed to their low electron-accepting properties.

The Incredibly Long-Lived SN 2005ip

NASA Astrophysics Data System (ADS)

Fox, Ori

2016-10-01

Type IIn supernovae (SNe IIn) are defined by their relatively narrow spectral line features associated with a dense circumstellar medium (CSM) formed by the progenitor star. The nature of the progenitor and mass loss remains relatively unknown. Shock interaction with the dense CSM can often result in significant UV emission for several years post-explosion, thereby probing the CSM characteristics, progenitor mass loss history and, ultimately, the progenitor itself. The Type IIn SN 2005ip proves to be one of the most interesting and well-studied targets within this subclass. Compared to all other supernovae, SN 2005ip is the most luminous for its age. Now more than 11 years post-explosion, the SN has released >10^51 erg throughout its lifetime as the forward shock continues to collide with a dense CSM. Here we propose HST/STIS-MAMA UV observations of SN 2005ip to investigate the massive CSM. When accounting for the shock travel time, these observations will probe material lost from the progenitor more than 1000 years prior to the explosion. We already have a single HST/STIS spectrum of SN 2005ip from 2014, which was obtained while the shock was still within a higher mass regime. With just 5 orbits, a second spectrum will allow us to directly trace the evolution of the CSM and produce new constraints on the pre-SN mass-loss history. Coinciding with Cycle 24's UV Initiative, this program offers new insight regarding both the progenitor and explosion characteristics of the SN IIn subclass.

Transient hydrodynamics within intercratonic sedimentary basins during glacial cycles

NASA Astrophysics Data System (ADS)

Bense, V. F.; Person, M. A.

2008-12-01

The hydrodynamic consequences of a glaciation/deglaciation cycle within an intercratonic sedimentary basin on subsurface transport processes is assessed using numerical models. In our analysis we consider the effects of mechanical ice sheet loading, permafrost formation, variable density fluids, and lithospheric flexure on solute/isotope transport, groundwater residence times, and transient hydraulic head distributions. The simulations are intended to apply, in a generic sense, to intercratonic sedimentary basins that would have been near the southern limit of the Laurentide Ice Sheet during the last glacial maximum (˜20 ka B.P.), such as the Williston, Michigan, and Illinois basins. We show that in such basins fluid flow and recharge rates are strongly elevated during glaciation as compared to nonglacial periods. Furthermore, our results illustrate that steady state hydrodynamic conditions in these basins are probably never reached during a 32.5 ka cycle of advance and retreat of a wet-based ice sheet. Present-day hydrogeological conditions across formerly glaciated areas are likely to still reflect the impact of the last glaciation and associated processes that ended locally more than 10 ka B.P. Our results reveal characteristic spatial patterns of underpressure and overpressure that occur in aquitards and aquifers, respectively, as a result of recent glaciation. The calculated emplacement of low salinity, isotopically light glacial meltwater along basin margins is roughly consistent with observations from formerly glaciated basins in North America. The modeling presented in this study will help to improve the management of groundwater resources in formerly glaciated basins as well as to evaluate the viability on geological timescales of nuclear waste repositories located at high latitudes.

Hemodynamic and arterial stiffness differences between African-Americans and Caucasians after maximal exercise.

PubMed

Yan, Huimin; Ranadive, Sushant M; Heffernan, Kevin S; Lane, Abbi D; Kappus, Rebecca M; Cook, Marc D; Wu, Pei-Tzu; Sun, Peng; Harvey, Idethia S; Woods, Jeffrey A; Wilund, Kenneth R; Fernhall, Bo

2014-01-01

African-American (AA) men have higher arterial stiffness and augmentation index (AIx) than Caucasian-American (CA) men. Women have greater age-associated increases in arterial stiffness and AIx than men. This study examined racial and sex differences in arterial stiffness and central hemodynamics at rest and after an acute bout of maximal exercise in young healthy individuals. One hundred young, healthy individuals (28 AA men, 24 AA women, 25 CA men, and 23 CA women) underwent measurements of aortic blood pressure (BP) and arterial stiffness at rest and 15 and 30 min after an acute bout of graded maximal aerobic exercise. Aortic BP and AIx were derived from radial artery applanation tonometry. Aortic stiffness (carotid-femoral) was measured via pulse wave velocity. Aortic stiffness was increased in AA subjects but not in CA subjects (P < 0.05) after an acute bout of maximal cycling exercise, after controlling for body mass index. Aortic BP decreased after exercise in CA subjects but not in AA subjects (P < 0.05). Women exhibited greater reductions in AIx after maximal aerobic exercise compared with men (P < 0.05). In conclusion, race and sex impact vascular and central hemodynamic responses to exercise. Young AA and CA subjects exhibited differential responses in central stiffness and central BP after acute maximal exercise. Premenopausal women had greater augmented pressure at rest and after maximal aerobic exercise than men. Future research is needed to examine the potential mechanisms.

Hemodynamic and arterial stiffness differences between African-Americans and Caucasians after maximal exercise

PubMed Central

Ranadive, Sushant M.; Heffernan, Kevin S.; Lane, Abbi D.; Kappus, Rebecca M.; Cook, Marc D.; Wu, Pei-Tzu; Sun, Peng; Harvey, Idethia S.; Woods, Jeffrey A.; Wilund, Kenneth R.; Fernhall, Bo

2013-01-01

African-American (AA) men have higher arterial stiffness and augmentation index (AIx) than Caucasian-American (CA) men. Women have greater age-associated increases in arterial stiffness and AIx than men. This study examined racial and sex differences in arterial stiffness and central hemodynamics at rest and after an acute bout of maximal exercise in young healthy individuals. One hundred young, healthy individuals (28 AA men, 24 AA women, 25 CA men, and 23 CA women) underwent measurements of aortic blood pressure (BP) and arterial stiffness at rest and 15 and 30 min after an acute bout of graded maximal aerobic exercise. Aortic BP and AIx were derived from radial artery applanation tonometry. Aortic stiffness (carotid-femoral) was measured via pulse wave velocity. Aortic stiffness was increased in AA subjects but not in CA subjects (P < 0.05) after an acute bout of maximal cycling exercise, after controlling for body mass index. Aortic BP decreased after exercise in CA subjects but not in AA subjects (P < 0.05). Women exhibited greater reductions in AIx after maximal aerobic exercise compared with men (P < 0.05). In conclusion, race and sex impact vascular and central hemodynamic responses to exercise. Young AA and CA subjects exhibited differential responses in central stiffness and central BP after acute maximal exercise. Premenopausal women had greater augmented pressure at rest and after maximal aerobic exercise than men. Future research is needed to examine the potential mechanisms. PMID:24186094

Molecular cloning and expression profiles of IGFBP-1a in common carp (Cyprinus carpio) and its expression regulation by growth hormone in hepatocytes.

PubMed

Chen, Wenbo; Lin, Haoran; Li, Wensheng

2018-04-23

In this study, we cloned and determined IGFBP-1a cDNA from common carp (Cyprinus carpio) liver. The 1655 bp full-length cDNA consisted of a 96 bp 5-untranslated region (UTR), a 789 bp open reading frame encoding 262 amino acid residues and a 770 bp 3-UTR containing seven mRNA instability motifs. Northern blot revealed a 1.8 kb IGFBP-1a transcript. IGFBP-1a mRNA was widely distributed in all tissues examined and predominantly expressed in the liver. During embryogenesis, IGFBP-1a mRNA was firstly observed in blastula stage, and significant increases were observed in body segment stage, lens formation stage and blood cycling stage. After hatching, its expression increased more than twenty times. Furthermore, hypoxia could significantly up-regulate IGFBP-1a expression in the liver and brain. IGFBP-1a expression increased with ovarian maturation and decreased at regressed stage. In testis, IGFBP-1a mRNA maintained relatively higher levels at recrudescing and matured stages, while it sharply declined at regressed stage. In primary cultured hepatocytes, IGFBP-1a gene was greatly down-regulated by growth hormone via the MAPK and PI3 kinase signaling pathways. These results suggest that IGFBP-1a may be involved in the IGF system regulating growth, development and reproduction in common carp. Copyright © 2018. Published by Elsevier Inc.

Proto-oncogene FBI-1 (Pokemon/ZBTB7A) represses transcription of the tumor suppressor Rb gene via binding competition with Sp1 and recruitment of co-repressors.

PubMed

Jeon, Bu-Nam; Yoo, Jung-Yoon; Choi, Won-Il; Lee, Choong-Eun; Yoon, Ho-Geun; Hur, Man-Wook

2008-11-28

FBI-1 (also called Pokemon/ZBTB7A) is a BTB/POZ-domain Krüppel-like zinc-finger transcription factor. Recently, FBI-1 was characterized as a proto-oncogenic protein, which represses tumor suppressor ARF gene transcription. The expression of FBI-1 is increased in many cancer tissues. We found that FBI-1 potently represses transcription of the Rb gene, a tumor suppressor gene important in cell cycle arrest. FBI-1 binds to four GC-rich promoter elements (FREs) located at bp -308 to -188 of the Rb promoter region. The Rb promoter also contains two Sp1 binding sites: GC-box 1 (bp -65 to -56) and GC-box 2 (bp -18 to -9), the latter of which is also bound by FBI-1. We found that FRE3 (bp -244 to -236) is also a Sp1 binding element. FBI-1 represses transcription of the Rb gene not only by binding to the FREs, but also by competing with Sp1 at the GC-box 2 and the FRE3. By binding to the FREs and/or the GC-box, FBI-1 represses transcription of the Rb gene through its POZ-domain, which recruits a co-repressor-histone deacetylase complex and deacetylates histones H3 and H4 at the Rb gene promoter. FBI-1 inhibits C2C12 myoblast cell differentiation by repressing Rb gene expression.

Mass inflation and chaotic behaviour inside hairy black holes

NASA Astrophysics Data System (ADS)

Breitenlohner, Peter; Lavrelashvili, George; Maison, Dieter

1998-07-01

We analyze the interior geometry of static, spherically symmetric black holes of the Einstein-Yang-Mills-Higgs theory. Generically the solutions exhibit a behaviour that may be described as ``mass inflation'', although with a remarkable difference between the cases with and without a Higgs field. Without Higgs field the YM field induces a kind of cyclic behaviour leading to repeated cycles of mass inflation - taking the form of violent explosions - interrupted by quiescent periods and subsequent approaches to an almost Cauchy horizon. With the Higgs field no such cycles occur in the asymptotic behaviour. In addition there are non-generic families with a Schwarzschild and a Reissner-Nordstrøm type singularity at r=0, respectively.

Tantalum coatings for inertial confinement fusion dry wall designs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taylor, L.H.; Green, L.

1996-12-31

The coating on a dry first wall inertial confinement fusion reactor must survive the target explosion and be ductile, inexpensive, and compatible with the materials in the target, i.e. have a high atomic number Z. Calculations indicate that tantalum is the best choice for the coating material. As a test of this design 1 mm tantalum coatings were plasma sprayed onto ferrite steel tubes. They were then subjected to 100 heating-cooling cycles which simulated the stressful thermal cycling which would be encountered during five years of plant startups and shutdowns. The coatings were undamaged and continued to bond well tomore » the steel. Furthermore, chemical reactions should not degrade tantalum coatings.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willey, Trevor M.; Lauderbach, Lisa; Gagliardi, Franco

HMX-based explosives LX-10 and PBX-9501 were heated through the β-δ phase transition. Ultra-small angle x-ray scattering (USAXS) and molecular diffraction were simultaneously recorded as the HMX was heated. Mesoscale voids and structure dramatically change promptly with the β-δ phase transition, rather than with other thermal effects. Also, x-ray induced damage, observed in the USAXS, occurs more readily at elevated temperatures; as such, the dose was reduced to mitigate this effect. Optical microscopy performed during a similar heating cycle gives an indication of changes on longer length scales, while x-ray microtomography, performed before and after heating, shows the character of extensivemore » microstructural damage resulting from the temperature cycle and solid-state phase transition.« less

The efficiency of combustion turbines with constant-pressure combustion

NASA Technical Reports Server (NTRS)

Piening, Werner

1941-01-01

Of the two fundamental cycles employed in combustion turbines, namely, the explosion (or constant-volume) cycle and the constant-pressure cycle, the latter is considered more in detail and its efficiency is derived with the aid of the cycle diagrams for the several cases with adiabatic and isothermal compression and expansion strokes and with and without utilization of the exhaust heat. Account is also taken of the separate efficiencies of the turbine and compressor and of the pressure losses and heat transfer in the piping. The results show that without the utilization of the exhaust heat the efficiencies for the two cases of adiabatic and isothermal compression is offset by the increase in the heat supplied. It may be seen from the curves that it is necessary to attain separate efficiencies of at least 80 percent in order for useful results to be obtained. There is further shown the considerable effect on the efficiency of pressure losses in piping or heat exchangers.

Urbanization and the Carbon Cycle: Synthesis of Ongoing Research

NASA Astrophysics Data System (ADS)

Gurney, K. R.; Duren, R. M.; Hutyra, L.; Ehleringer, J. R.; Patarasuk, R.; Song, Y.; Huang, J.; Davis, K.; Kort, E. A.; Shepson, P. B.; Turnbull, J. C.; Lauvaux, T.; Rao, P.; Eldering, A.; Miller, C. E.; Wofsy, S.; McKain, K.; Mendoza, D. L.; Lin, J. C.; Sweeney, C.; Miles, N. L.; Richardson, S.; Cambaliza, M. O. L.

2015-12-01

Given the explosive growth in urbanization and its dominant role in current and future global greenhouse gas emissions, urban areas have received increasing research attention from the carbon cycle science community. The emerging focus is driven by the increasingly dense atmospheric observing capabilities - ground and space-based - in addition to the rising profile of cities within international climate change policymaking. Dominated by anthropogenic emissions, urban carbon cycle research requires a cross-disciplinary perspective with contributions from disciplines such as engineering, economics, social theory, and atmospheric science. We review the recent results from a sample of the active urban carbon research efforts including the INFLUX experiment (Indianapolis), the Megacity carbon project (Los Angeles), Salt Lake City, and Boston. Each of these efforts represent unique approaches in pursuit of different scientific and policy questions and assist in setting priorities for future research. From top-down atmospheric measurement systems to bottom-up estimation, these research efforts offer a view of the challenges and opportunities in urban carbon cycle research.

Non-technical skills: enhancing safety in operating theatres (and drilling rigs).

PubMed

Flin, Rhona

2014-03-01

On April 20th 2010, a large Transocean drilling rig called the Deepwater Horizon was operating in the Gulf of Mexico to drill the Macondo well, for the oil company BP. The job was six weeks behind schedule and $58 million over budget and had not been without difficulty: it was a high pressure well, 2.5 miles below the seabed. At 5.45 am, the Halliburton cementing engineer sent an email to say: 'We have completed the job and it went well'. At 9.43 pm, 16 hours later, there was a release of hydrocarbons into the well bore and the drilling rig experienced a catastrophic blowout as the high pressure oil and gas escaped onto the rig and into the ocean. The resulting explosions and fire killed 11 of the crew of 126, injured many more and created an enormous oil spill across the Gulf.

Infrared radiation from explosions in a spark-ignition engine

NASA Technical Reports Server (NTRS)

Marvin, Charles F , Jr; Caldwell, Frank R; Steele, Sydney

1935-01-01

This report presents the results of an investigation to determine the variations in intensity and spectral distribution of the radiant energy emitted by the flames during normal and knocking explosions in an engine. Radiation extending into the infrared was transmitted by a window of fluorite, placed either near the spark plug or over the detonation zone at opposite ends of the combustion chamber. Concave, surface-silvered mirrors focused the beam, first at the slit of a stroboscope which opened for about 2 degrees of crank angle at any desired point in the engine cycle, and then upon the target of a sensitive thermocouple for measuring radiation intensity. Spectral distribution of the radiant energy was determined by placing over the window, one at a time, a series of five filters selected with a view to identifying, as far as possible without the use of a spectrograph, the characteristic emissions of water vapor, carbon dioxide, and incandescent carbon.

Development of a Detonation Diffuser

DTIC Science & Technology

2014-03-27

detonation frequency is adjustable from 8 Hz to 40 Hz, and the ignition can be set to operate in “burst mode” firing for a predetermined number of cycles... resistance were tried, but the strain on the windows caused the coating to fracture. Without a scratch- resistant coating, the windows regularly suffered... abrasion from the Shock wave Strain waves 35 test articles. The heat from local explosions did burn away a small amount of the window surface

Basaltic scoria fallout deposits from Ambrym volcano (Vanuatu archipelago): Textural and geochemical evidence of plinian eruptive styles

NASA Astrophysics Data System (ADS)

Balcone-Boissard, H.; Boudon, G.; Poulain, P.

2017-12-01

Plinian eruptions are among the most threatening volcanic hazard responsible of gas and solid particles release into atmosphere leading to potential damages at various spatial and time scales. Such explosive activity generally involves differentiated magmas, silica-rich enough to behave as viscous media and volatile-rich enough to generate significant overpressure in ascending magma. In some rare cases, Plinian eruptions can occur with more basic magmas as basalts. Few eruptions are now recognized on Earth, on Etna (122 BC), Masaya (Fontana) or Tarawera (1886). On Ambrym volcano (Vanuatu), the caldera formation was the result of several large eruptions including some Plinian events dated around 2000 yr. BP. By applying joint textural and geochemical investigations of a representative stratigraphic section of one of these eruptions we present new arguments to discuss the origin of such explosivity for basic magma. To achieve this goal we establish a degassing budget (H2O, CO2, SO2, F, Cl) through the petrological investigation by comparing melt inclusion and residual glass. We compare these results to those of quantitative textural description of pumice clasts through SEM images treated using Image J software, thus linking textural and geochemical arguments. We thus highlight that a low volatile content is not responsible of the overpressure leading to explosivity. Textural characteristics evidence vesicle organisation and low microlite content close that described for Plinian eruption involving differentiated melt. Degassing processes occur following a closed-system degassing evolution well correlated with textural parameters. By comparison to deposits of other basaltic Plinian eruptions, we show that for 122 BC eruption of Mt Etna, textural signature is diverse although we also evidence closed-system degassing processes. This study also permits to confirm that Ambrym is a valuable contributor to halogen release into the atmosphere at a time of reflexion on volcanic halogen contribution to atmosphere budget.

A complete terrestrial radiocarbon record for 11.2 to 52.8 kyr B.P.

PubMed

Bronk Ramsey, Christopher; Staff, Richard A; Bryant, Charlotte L; Brock, Fiona; Kitagawa, Hiroyuki; van der Plicht, Johannes; Schlolaut, Gordon; Marshall, Michael H; Brauer, Achim; Lamb, Henry F; Payne, Rebecca L; Tarasov, Pavel E; Haraguchi, Tsuyoshi; Gotanda, Katsuya; Yonenobu, Hitoshi; Yokoyama, Yusuke; Tada, Ryuji; Nakagawa, Takeshi

2012-10-19

Radiocarbon ((14)C) provides a way to date material that contains carbon with an age up to ~50,000 years and is also an important tracer of the global carbon cycle. However, the lack of a comprehensive record reflecting atmospheric (14)C prior to 12.5 thousand years before the present (kyr B.P.) has limited the application of radiocarbon dating of samples from the Last Glacial period. Here, we report (14)C results from Lake Suigetsu, Japan (35°35'N, 135°53'E), which provide a comprehensive record of terrestrial radiocarbon to the present limit of the (14)C method. The time scale we present in this work allows direct comparison of Lake Suigetsu paleoclimatic data with other terrestrial climatic records and gives information on the connection between global atmospheric and regional marine radiocarbon levels.

Triphenylphosphine-based functional porous polymer as an efficient heterogeneous catalyst for the synthesis of cyclic carbonates from CO2

NASA Astrophysics Data System (ADS)

Wu, Siduo; Teng, Chao; Cai, Sheng; Jiang, Biwang; Wang, Yong; Meng, Hong; Tao, Huchun

2017-11-01

A novel triphenylphosphine-based porous polymer (TPDB) with a high Brunauer-Emmett-Teller (BET) surface area was synthesized through Friedel-Crafts alkylation of triphenylphosphine and α-dibromo- p-xylene. Then, the functional hydroxyl groups were successfully grafted onto the polymer framework by post modification of TPDB with 3-bromo-1-propanol (BP) and triethanolamine (TEA). The resulting sample TPDB-BP-TEA was characterized by various techniques such as FT-IR, TG, SEM, EDS mapping, ICP-MS, and N2 adsorption-desorption. This new polymer was tested as the catalyst in the solvent-free cycloaddition reaction of CO2 with epoxides, which exhibited excellent performance, with high yield, selectivity, and stable recyclability for several catalytic cycles. The comparison experiment results demonstrate that the bromide ions and hydroxyl groups, as well as high surface area, are key factors in improving the catalytic activity of this new catalyst.

Environmental change and economic development in coastal Peru between 5,800 and 3,600 years ago

PubMed Central

Sandweiss, Daniel H.; Solís, Ruth Shady; Moseley, Michael E.; Keefer, David K.; Ortloff, Charles R.

2009-01-01

Between ≈5,800 and 3,600 cal B.P. the biggest architectural monuments and largest settlements in the Western Hemisphere flourished in the Supe Valley and adjacent desert drainages of the arid Peruvian coast. Intensive net fishing, irrigated orchards, and fields of cotton with scant comestibles successfully sustained centuries of increasingly complex societies that did not use ceramics or loom-based weaving. This unique socioeconomic adaptation was abruptly abandoned and gradually replaced by societies more reliant on food crops, pottery, and weaving. Here, we review evidence and arguments for a severe cycle of natural disasters—earthquakes, El Niño flooding, beach ridge formation, and sand dune incursion—at ≈3,800 B.P. and hypothesize that ensuing physical changes to marine and terrestrial environments contributed to the demise of early Supe settlements. PMID:19164564

The solar energetic particle propagation of solar flare events on 24th solar cycle.

NASA Astrophysics Data System (ADS)

Paluk, P.; Khumlumlert, T.; Kanlayaprasit, N.; Aiemsa-ad, N.

2017-09-01

Now the Sun is in the 24th solar cycle. The peak of solar cycle correspond to the number of the Sun activities, which one of them is solar flare. The solar flare is the violent explosion at the solar atmosphere and releases the high energy ion from the Sun to the interplanetary medium. Solar energetic particles or solar cosmic ray have important effect on the Earth, such as disrupt radio communication. We analyze the particle transport of the solar flare events on August 9, 2011, January 27, 2012, and November 3, 2013 in 24th solar cycle. The particle data for each solar flare was obtained from SIS instrument on ACE spacecraft. We simulate the particle transport with the equation of Ruffolo 1995, 1998. We solve the transport equation with the numerical technique of finite different. We find the injection duration from the Sun to the Earth by the compared fitting method of piecewise linear function between the simulation results and particle data from spacecraft. The position of these solar flare events are on the west side of the Sun, which are N18W68, N33W85, and S12W16. We found that mean free path is roughly constant for a single event. This implies that the interplanetary scattering is approximately energy independent, but the level of scattering varies with time. The injection duration decreases with increasing energy. We found the resultant variation of the highest energy and lowest energy, because the effect of space environments and the number of the detected data was small. The high mean free path of the high energy particles showed the transport capability of particles along to the variable magnetic field line. The violent explosion of these solar flares didn’t affect on the Earth magnetic field with Kp-index less than 3.

Shortening tobacco life cycle accelerates functional gene identification in genomic research.

PubMed

Ning, G; Xiao, X; Lv, H; Li, X; Zuo, Y; Bao, M

2012-11-01

Definitive allocation of function requires the introduction of genetic mutations and analysis of their phenotypic consequences. Novel, rapid and convenient techniques or materials are very important and useful to accelerate gene identification in functional genomics research. Here, over-expression of PmFT (Prunus mume), a novel FT orthologue, and PtFT (Populus tremula) lead to shortening of the tobacco life cycle. A series of novel short life cycle stable tobacco lines (30-50 days) were developed through repeated self-crossing selection breeding. Based on the second transformation via a gusA reporter gene, the promoter from BpFULL1 in silver birch (Betula pendula) and the gene (CPC) from Arabidopsis thaliana were effectively tested using short life cycle tobacco lines. Comparative analysis among wild type, short life cycle tobacco and Arabidopsis transformation system verified that it is optional to accelerate functional gene studies by shortening host plant material life cycle, at least in these short life cycle tobacco lines. The results verified that the novel short life cycle transgenic tobacco lines not only combine the advantages of economic nursery requirements and a simple transformation system, but also provide a robust, effective and stable host system to accelerate gene analysis. Thus, shortening tobacco life cycle strategy is feasible to accelerate heterologous or homologous functional gene identification in genomic research. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.

Product differentiation during continuous-flow thermal gradient PCR.

PubMed

Crews, Niel; Wittwer, Carl; Palais, Robert; Gale, Bruce

2008-06-01

A continuous-flow PCR microfluidic device was developed in which the target DNA product can be detected and identified during its amplification. This in situ characterization potentially eliminates the requirement for further post-PCR analysis. Multiple small targets have been amplified from human genomic DNA, having sizes of 108, 122, and 134 bp. With a DNA dye in the PCR mixture, the amplification and unique melting behavior of each sample is observed from a single fluorescent image. The melting behavior of the amplifying DNA, which depends on its molecular composition, occurs spatially in the thermal gradient PCR device, and can be observed with an optical resolution of 0.1 degrees C pixel(-1). Since many PCR cycles are within the field of view of the CCD camera, melting analysis can be performed at any cycle that contains a significant quantity of amplicon, thereby eliminating the cycle-selection challenges typically associated with continuous-flow PCR microfluidics.

Molecular characterization of a novel algal glutamine synthetase (GS) and an algal glutamate synthase (GOGAT) from the colorful outer mantle of the giant clam, Tridacna squamosa, and the putative GS-GOGAT cycle in its symbiotic zooxanthellae.

PubMed

Fam, Rachel R S; Hiong, Kum C; Choo, Celine Y L; Wong, Wai P; Chew, Shit F; Ip, Yuen K

2018-05-20

Giant clams harbor symbiotic zooxanthellae (Symbiodinium), which are nitrogen-deficient, mainly in the fleshy and colorful outer mantle. This study aimed to sequence and characterize the algal Glutamine Synthetase (GS) and Glutamate Synthase (GLT), which constitute the glutamate synthase cycle (or GS-GOGAT cycle, whereby GOGAT is the protein acronym of GLT) of nitrogen assimilation, from the outer mantle of the fluted giant clam, Tridacna squamosa. We had identified a novel GS-like cDNA coding sequence of 2325 bp, and named it as T. squamosa Symbiodinium GS1 (TSSGS1). The deduced TSSGS1 sequence had 774 amino acids with a molecular mass of 85 kDa, and displayed the characteristics of GS1 and Nucleotide Diphosphate Kinase. The cDNA coding sequence of the algal GLT, named as T. squamosa Symbiodinium GLT (TSSGLT), comprised 6399 bp, encoding a protein of 2133 amino acids and 232.4 kDa. The zooxanthellal origin of TSSGS1 and TSSGOGAT was confirmed by sequence comparison and phylogenetic analyses. Indeed, TSSGS1 and TSSGOGAT were expressed predominately in the outer mantle, which contained the majority of the zooxanthellae. Immunofluorescence microscopy confirmed the expression of TSSGS1 and TSSGOGAT in the cytoplasm and the plastids, respectively, of the zooxanthellae in the outer mantle. It can be concluded that the symbiotic zooxanthellae of T. squamosa possesses a glutamate synthase (TSSGS1-TSSGOGAT) cycle that can assimilate endogenous ammonia produced by the host clam into glutamate, which can act as a substrate for amino acid syntheses. Thus, our results provide insights into why intact giant clam-zooxanthellae associations do not excrete ammonia under normal circumstances. Copyright © 2018 Elsevier B.V. All rights reserved.

Climate Events and Cycles During the Last Glacial-Interglacial Transition

NASA Astrophysics Data System (ADS)

Lee, Eun Hee; Lee, Dae-Young; Park, Mi-Young

2017-09-01

During the last glacial-interglacial transition, there were multiple intense climatic events such as the Bølling-Allerød warming and Younger Dryas cooling. These events show abrupt and rapid climatic changes. In this study, the climate events and cycles during this interval are examined through wavelet analysis of Arctic and Antarctic ice-core 18O and tropical marine 14C records. The results show that periods of 1383-1402, 1029-1043, 726-736, 441-497 and 202-247 years are dominant in the Arctic region, whereas periods of 1480, 765, 518, 311, and 207 years are prominent in the Antarctic TALDICE. In addition, cycles of 1019, 515, and 209 years are distinct in the tropical region. Among these variations, the de Vries cycle of 202-209 years, correlated with variations in solar activity, was detected globally. In particular, this cycle shows a strong signal in the Antarctic between about 13,000 and 10,500 yr before present (BP). In contrast, the Eddy cycle of 1019-1043 years was prominent in Greenland and the tropical region, but was not detected in the Antarctic TALDICE records. Instead, these records showed that the Heinrich cycle of 1480 year was very strong and significant throughout the last glacial-interglacial interval.

The metabolic syndrome and the immediate antihypertensive effects of aerobic exercise: a randomized control design.

PubMed

Pescatello, Linda S; Blanchard, Bruce E; Van Heest, Jaci L; Maresh, Carl M; Gordish-Dressman, Heather; Thompson, Paul D

2008-06-10

The metabolic syndrome (Msyn) affects about 40% of those with hypertension. The Msyn and hypertension have a common pathophysiology. Exercise is recommended for their treatment, prevention and control. The influence of the Msyn on the antihypertensive effects of aerobic exercise is not known. We examined the influence of the Msyn on the blood pressure (BP) response following low (LIGHT, 40% peak oxygen consumption, VO2peak) and moderate (MODERATE, 60% VO2peak) intensity, aerobic exercise. Subjects were 46 men (44.3 +/- 1.3 yr) with pre- to Stage 1 hypertension (145.5 +/- 1.6/86.3 +/- 1.2 mmHg) and borderline dyslipidemia. Men with Msyn (n = 18) had higher fasting insulin, triglycerides and homeostasis model assessment (HOMA) and lower high density lipoprotein than men without Msyn (n = 28) (p < 0.01). Subjects consumed a standard meal and 2 hr later completed one of three randomized experiments separated by 48 hr. The experiments were a non-exercise control session of seated rest and two cycle bouts (LIGHT and MODERATE). BP, insulin and glucose were measured before, during and after the 40 min experiments. Subjects left the laboratory wearing an ambulatory BP monitor for the remainder of the day. Repeated measure ANCOVA tested if BP, insulin and glucose differed over time among experiments in men without and with the Msyn with HOMA as a covariate. Multivariable regression analyses examined associations among BP, insulin, glucose and the Msyn. Systolic BP (SBP) was reduced 8 mmHg (p < 0.05) and diastolic BP (DBP) 5 mmHg (p = 0.052) after LIGHT compared to non-exercise control over 9 hr among men without versus with Msyn. BP was not different after MODERATE versus non-exercise control between Msyn groups (p > or = 0.05). The factors accounting for 17% of the SBP response after LIGHT were baseline SBP (beta = -0.351, r2 = 0.123, p = 0.020), Msyn (beta = 0.277, r2 = 0.077, p = 0.069), and HOMA (beta = -0.124, r2 = 0.015, p = 0.424). Msyn (r2 = 0.096, p = 0.036) was the only significant correlate of the DBP response after LIGHT. Men without the Msyn respond more favorably to the antihypertensive effects of lower intensity, aerobic exercise than men with the Msyn. If future work confirms our findings, important new knowledge will be gained for the personalization of exercise prescriptions among those with hypertension and the Msyn.

The biogeophysical climatic impacts of anthropogenic land use change during the Holocene

NASA Astrophysics Data System (ADS)

Smith, M. Clare; Singarayer, Joy S.; Valdes, Paul J.; Kaplan, Jed O.; Branch, Nicholas P.

2016-04-01

The first agricultural societies were established around 10 ka BP and had spread across much of Europe and southern Asia by 5.5 ka BP with resultant anthropogenic deforestation for crop and pasture land. Various studies (e.g. Joos et al., 2004; Kaplan et al., 2011; Mitchell et al., 2013) have attempted to assess the biogeochemical implications for Holocene climate in terms of increased carbon dioxide and methane emissions. However, less work has been done to examine the biogeophysical impacts of this early land use change. In this study, global climate model simulations with Hadley Centre Coupled Model version 3 (HadCM3) were used to examine the biogeophysical effects of Holocene land cover change on climate, both globally and regionally, from the early Holocene (8 ka BP) to the early industrial era (1850 CE). Two experiments were performed with alternative descriptions of past vegetation: (i) one in which potential natural vegetation was simulated by Top-down Representation of Interactive Foliage and Flora Including Dynamics (TRIFFID) but without land use changes and (ii) one where the anthropogenic land use model Kaplan and Krumhardt 2010 (KK10; Kaplan et al., 2009, 2011) was used to set the HadCM3 crop regions. Snapshot simulations were run at 1000-year intervals to examine when the first signature of anthropogenic climate change can be detected both regionally, in the areas of land use change, and globally. Results from our model simulations indicate that in regions of early land disturbance such as Europe and south-east Asia detectable temperature changes, outside the normal range of variability, are encountered in the model as early as 7 ka BP in the June-July-August (JJA) season and throughout the entire annual cycle by 2-3 ka BP. Areas outside the regions of land disturbance are also affected, with virtually the whole globe experiencing significant temperature changes (predominantly cooling) by the early industrial period. The global annual mean temperature anomalies found in our single model simulations were -0.22 at 1850 CE, -0.11 at 2 ka BP, and -0.03 °C at 7 ka BP. Regionally, the largest temperature changes were in Europe with anomalies of -0.83 at 1850 CE, -0.58 at 2 ka BP, and -0.24 °C at 7 ka BP. Large-scale precipitation features such as the Indian monsoon, the Intertropical Convergence Zone (ITCZ), and the North Atlantic storm track are also impacted by local land use and remote teleconnections. We investigated how advection by surface winds, mean sea level pressure (MSLP) anomalies, and tropospheric stationary wave train disturbances in the mid- to high latitudes led to remote teleconnections.

A Million-Year Record of Glaciation in the Tropical Andes

NASA Astrophysics Data System (ADS)

Smith, J. A.; Seltzer, G. O.; Rodbell, D. T.; Farber, D. L.; Finkel, R. C.

2004-12-01

We present a longterm record of glaciation in the tropical Andes based on cosmogenic dating (10Be) of boulders on moraines. Well-preserved moraines in deglaciated valleys bordering the Junin Plain in central Peru ( ˜11° S, 76° W, 4000 m) were deposited during several glacial cycles extending back more than one million years before present (1 Myr BP). The presence of boulders with zero-erosion 10Be exposure ages >1 Myr constrains boulder erosion rates to relatively low values. For boulders at high altitudes, however, even low boulder erosion rates (0.3 to 0.5 m/Myr) make calculated old exposure ages markedly older [e.g., ˜20% older for a zero-erosion age of 400,000 10Be years (400 10Be kyr)]. Exposure ages recalculated with boulder erosion rates of 0.3 m/Myr straddle interglacial marine isotope stage (MIS) 11 ( ˜430-390 kyr BP), fall within glacial MIS 12 ( ˜480-430 kyr BP), but skip over glacial MIS 16 ( ˜670-630 kyr BP), perhaps the largest ice volume of the past 2 Myr. Increasing the erosion rate used in the calculations to 0.5 m/Myr moves ages into both MIS 11 and MIS 16. If we assume that the older Andean glaciations were indeed synchronous with global ice volume, our data suggest that boulder preservation cannot be treated as a simple linear process. Conversely, the data may be suggesting correctly that glaciation of the tropical Andes was not synchronous with the global glaciations as inferred from the marine isotope record. Our chronology for the last glacial maximum (LGM) in the region supports the idea of asynchrony between the global ice volume record and the terrestrial record of glaciation in the tropical Andes. The LGM in the Junin region of Peru and in the Cordillera Real of Bolivia (16° S 68° W) occurred ˜34 to 22 10Be kyr BP and was less extensive than older glaciations. Asynchrony between the LGM in the Northern Hemisphere ( ˜21 kyr BP) and the tropical Andes suggests that previous glaciations in the tropical Andes may have been similarly out of step.

Prevalence of Hypertension in Children with Early-Stage ADPKD.

PubMed

Massella, Laura; Mekahli, Djalila; Paripović, Dušan; Prikhodina, Larisa; Godefroid, Nathalie; Niemirska, Anna; Ağbaş, Ayşe; Kalicka, Karolina; Jankauskiene, Augustina; Mizerska-Wasiak, Malgorzata; Afonso, Alberto Caldas; Salomon, Rémi; Deschênes, Georges; Ariceta, Gema; Özçakar, Z Birsin; Teixeira, Ana; Duzova, Ali; Harambat, Jérôme; Seeman, Tomáš; Hrčková, Gabriela; Lungu, Adrian Catalin; Papizh, Svetlana; Peco-Antic, Amira; De Rechter, Stéphanie; Giordano, Ugo; Kirchner, Marietta; Lutz, Teresa; Schaefer, Franz; Devuyst, Olivier; Wühl, Elke; Emma, Francesco

2018-04-19

Autosomal dominant polycystic kidney disease is the most common inheritable kidney disease, frequently thought to become symptomatic in adulthood. However, patients with autosomal dominant polycystic kidney disease may develop signs or symptoms during childhood, in particular hypertension. Although ambulatory BP monitoring is the preferred method to diagnose hypertension in pediatrics, data in children with autosomal dominant polycystic kidney disease are limited. Our retrospective multicenter study was conducted to collect ambulatory BP monitoring recordings from patients with autosomal dominant polycystic kidney disease age <18 years old. Basic anthropometric parameters as well as data on kidney function, BP treatment, and kidney ultrasound were also collected. Data from 310 children with autosomal dominant polycystic kidney disease with a mean age of 11.5±4.1 years old were collected at 22 European centers. At the time when ambulatory BP monitoring was performed, 95% of children had normal kidney function. Reference data for ambulatory BP monitoring were available for 292 patients. The prevalence rates of children with hypertension and/or those who were treated with antihypertensive drugs were 31%, 42%, and 35% during daytime, nighttime, or the entire 24-hour cycle, respectively. In addition, 52% of participants lacked a physiologic nocturnal BP dipping, and 18% had isolated nocturnal hypertension. Logistic regression analysis showed a significant association between a categorical cyst score that was calculated on the basis of the number of cysts >1 cm per kidney and daytime hypertension (odds ratio, 1.70; 95% confidence interval, 1.21 to 2.4; P =0.002), nighttime hypertension (odds ratio, 1.31; 95% confidence interval, 1.05 to 1.63; P =0.02), or 24-hour hypertension (odds ratio, 1.39; 95% confidence interval, 1.08 to 1.81; P =0.01). Kidney length, expressed as SD score, was also significantly associated with nighttime hypertension (odds ratio, 1.23; 95% confidence interval, 1.06 to 1.42; P =0.10). These data indicate high prevalence of hypertension in children with autosomal dominant polycystic kidney disease starting at young ages. Copyright © 2018 by the American Society of Nephrology.

Aortic arch shape is not associated with hypertensive response to exercise in patients with repaired congenital heart diseases.

PubMed

Ntsinjana, Hopewell N; Biglino, Giovanni; Capelli, Claudio; Tann, Oliver; Giardini, Alessandro; Derrick, Graham; Schievano, Silvia; Taylor, Andrew M

2013-11-12

Aortic arch geometry is linked to abnormal blood pressure (BP) response to maximum exercise. This study aims to quantitatively assess whether aortic arch geometry plays a role in blood pressure (BP) response to exercise. 60 age- and BSA-matched subjects--20 post-aortic coarctation (CoA) repair, 20 transposition of great arteries post arterial switch operation (ASO) and 20 healthy controls--had a three-dimensional (3D), whole heart magnetic resonance angiography (MRA) at 1.5 Tesla, 3D geometric reconstructions created from the MRA. All subjects underwent cardiopulmonary exercise test on the same day as MRA using an ergometer cycle with manual BP measurements. Geometric analysis and their correlation with BP at peak exercise were assessed. Arch curvature was similarly acute in both the post-CoA and ASO cases [0.05 ± 0.01 vs. 0.05 ± 0.01 (1/mm/m²); p = 1.0] and significantly different to that of normal healthy controls [0.05 ± 0.01 vs. 0.03 ± 0.01 (1/mm/m²), p < 0.001]. Indexed transverse arch cross sectional area were significantly abnormal in the post-CoA cases compared to the ASO cases (117.8 ± 47.7 vs. 221.3 ± 44.6; p < 0.001) and controls (117.8 ± 47.7 vs. 157.5 ± 27.2 mm²; p = 0.003). BP response to peak exercise did not correlate with arch curvature (r = 0.203, p = 0.120), but showed inverse correlation with indexed minimum cross sectional area of transverse arch and isthmus (r = -0.364, p = 0.004), and ratios of minimum arch area/ descending diameter (r = -0.491, p < 0.001). Transverse arch and isthmus hypoplasia, rather than acute arch angulation plays a role in the pathophysiology of BP response to peak exercise following CoA repair.

Vegetation and Carbon Cycle Dynamics in the High-Resolution Transient Holocene Simulations Using the MPI Earth System Model

NASA Astrophysics Data System (ADS)

Brovkin, V.; Lorenz, S.; Raddatz, T.; Claussen, M.; Dallmeyer, A.

2017-12-01

One of the interesting periods to investigate a climatic role of terrestrial biosphere is the Holocene, when, despite of the relatively steady global climate, the atmospheric CO2 grew by about 20 ppm from 7 kyr BP to pre-industrial. We use a new setup of the Max Planck Institute Earth System Model MPI-ESM1 consisting of the latest version of the atmospheric model ECHAM6, including the land surface model JSBACH3 with carbon cycle and vegetation dynamics, coupled to the ocean circulation model MPI-OM, which includes the HAMOCC model of ocean biogeochemistry. The model has been run for several simulations over the Holocene period of the last 8000 years under the forcing data sets of orbital insolation, atmospheric greenhouse gases, volcanic aerosols, solar irradiance and stratospheric ozone, as well as land-use changes. In response to this forcing, the land carbon storage increased by about 60 PgC between 8 and 4 kyr BP, stayed relatively constant until 2 kyr BP, and decreased by about 90 PgC by 1850 AD due to land use changes. At 8 kyr BP, vegetation cover was much denser in Africa, mainly due to increased rainfall in response to the orbital forcing. Boreal forests moved northward in both, North America and Eurasia. The boreal forest expansion in North America is much less pronounced than in Eurasia. Simulated physical ocean fields, including surface temperatures and meridional overturning, do not change substantially in the Holocene. Carbonate ion concentration in deep ocean decreases in both, prescribed and interactive CO2simulations. Comparison with available proxies for terrestrial vegetation and for the ocean carbonate chemistry will be presented. Vegetation and soil carbon changes significantly affected atmospheric CO2 during the periods of strong volcanic eruptions. In response to the eruption-caused cooling, the land initially stores more carbon as respiration decreases, but then it releases even more carbon die to productivity decrease. This decadal-scale variability helps to quantify the vegetation and land carbon feedbacks during the past periods when the temporal resolution of the ice-core CO2 record is not sufficient to capture fast CO2 variations. From a set of Holocene simulations with prescribed or interactive atmospheric CO2, we get estimates of climate-carbon feedback useful for future climate studies.

Relationships between coastal bacterioplankton growth rates and biomass production: comparison of leucine and thymidine uptake with single-cell physiological characteristics.

PubMed

Franco-Vidal, Leticia; Morán, Xosé Anxelu G

2011-02-01

Specific growth rates of heterotrophic bacterioplankton have been frequently estimated from in situ bacterial production (BP) to biomass (BB) ratios, using a series of assumptions that may result in serious discrepancies with values obtained from predator-free cultures. Here, we used both types of approaches together with a comprehensive assessment of single-cell physiological characteristics (membrane integrity, nucleic acid content, and active respiration) of coastal bacterioplankton during a complete annual cycle (February 2007-January 2008) in the southern Bay of Biscay off Xixón, Spain. Both leucine and thymidine incorporation rates were used in conjunction with empirical tracer to carbon or cells conversion factors (eCFs) to accurately derive BP. Leu and TdR incorporation rates covaried year-round, as did the corresponding eCFs at 0 and 50 m depth. eCFs peaked in autumn, with mean annual values close to the theoretical ones (3.4 kg C mol Leu(-1) and 2.0 × 10(18) cells mol TdR(-1)). Bacterial abundance (0.2-1.5 × 10(6) cells L(-1)) showed a bimodal distribution with maxima in May and October and minima in March. Live (membrane-intact) cells dominated year-round (79-97%), with high nucleic acid cells (42-88%) and actively respiring bacteria (CTC+, 1-16%) showing distinct surface maxima in April and July, respectively. BB (557-1,558 mg C m(-2)) and BP (7-139 mg C m(-2) day(-1)) presented two distinct peaks in spring and autumn, both of similar size due to a strong upwelling event observed in September. Specific growth rates (0.35-3.8 day(-1)) were one order of magnitude higher in predator-free incubations than bacterial turnover rates derived from integrated BP:BB ratios (0.01-0.16 and 0.01-0.09 day(-1), for Leu and TdR, respectively) and were not correlated, probably due to a significant contribution of low activity cells to total standing stocks. The Leu:TdR molar ratio averaged for the water column (6.6-25.5) decreased significantly with higher integrated BB, indicating that low standing stocks tend to present unbalanced growth. Discrepancies about the true magnitude of specific growth rates must be solved before fully appreciating the role of bacteria in the ocean carbon cycle.

Review of the OSHA-NIOSH Response to the Deepwater Horizon Oil Spill: Protecting the Health and Safety of Cleanup Workers

PubMed Central

Michaels, David; Howard, John

2012-01-01

Introduction: The fire and explosion of the Deepwater Horizon oil rig resulted in an enormous oil spill that threatened large distances of coastline. The overall response was led by the United States Coast Guard and involved the oil company BP, federal agencies, and state and local governments of five states. Methods: The Occupational Safety and Health Administration and the National Institute for Occupational Safety and Health focused extensive resources on ensuring that BP and its contractors provided safe working conditions for thousands of workers involved in the response. Federal personnel visited worksites daily, identifying hazards and means of abatement; assessed training programs to ensure that workers were adequately trained in languages they could understand; monitored chemical exposures and determined that the proper personal protective equipment was deployed; insisted on implementation of a heat mitigation program; rostered thousands of workers; and conducted extensive outreach in communities impacted by the spill. Results: Advance planning, immediate deployment, and collaboration across agencies helped ensure that the response operations resulted in no worker fatalities, and relatively few injuries and illnesses. Conclusions: For future responses, improvements should be made in how safety and health information, as well as the process behind safety and health decisions, are communicated to the public. Citation: Michaels D, Howard J. Review of the OSHA-NIOSH Response to the Deepwater Horizon Oil Spill: Protecting the Health and Safety of Cleanup Workers. PLoS Currents Disasters. 2012 Jul 18 PMID:24678440

Review of the OSHA-NIOSH Response to the Deepwater Horizon Oil Spill: Protecting the Health and Safety of Cleanup Workers.

PubMed

Michaels, David; Howard, John

2012-07-18

The fire and explosion of the Deepwater Horizon oil rig resulted in an enormous oil spill that threatened large distances of coastline. The overall response was led by the United States Coast Guard and involved the oil company BP, federal agencies, and state and local governments of five states. The Occupational Safety and Health Administration and the National Institute for Occupational Safety and Health focused extensive resources on ensuring that BP and its contractors provided safe working conditions for thousands of workers involved in the response. Federal personnel visited worksites daily, identifying hazards and means of abatement; assessed training programs to ensure that workers were adequately trained in languages they could understand; monitored chemical exposures and determined that the proper personal protective equipment was deployed; insisted on implementation of a heat mitigation program; rostered thousands of workers; and conducted extensive outreach in communities impacted by the spill. Advance planning, immediate deployment, and collaboration across agencies helped ensure that the response operations resulted in no worker fatalities, and relatively few injuries and illnesses. For future responses, improvements should be made in how safety and health information, as well as the process behind safety and health decisions, are communicated to the public. Michaels D, Howard J. Review of the OSHA-NIOSH Response to the Deepwater Horizon Oil Spill: Protecting the Health and Safety of Cleanup Workers. PLoS Currents Disasters. 2012 Jul 18.

Comparative Analysis of Transcriptomes of Macrophage Revealing the Mechanism of the Immunoregulatory Activities of a Novel Polysaccharide Isolated from Boletus speciosus Frost.

PubMed

Ding, Xiang; Zhu, Hongqing; Hou, Yiling; Hou, Wanru; Zhang, Nan; Fu, Lei

2017-01-01

The mechanism of the immunoregulatory activities of polysaccharide is still not clear. Here, we performed the B-cell, T-cell, and macrophage cell proliferation, the cell cycle analysis of macrophage cells, sequenced the transcriptomes of control group macrophages, and Boletus speciosus Frost polysaccharide (BSF-1) group macrophages using Illumina sequencing technology to identify differentially expressed genes (DEGs) to determine the molecular mechanisms of immunomodulatory activity of BSF-1 in macrophages. These results suggested that BSF-1 could promote the proliferation of B-cell, T-cell, and macrophages, promote the proliferation of macrophage cells by abolishing cell cycle arrests in the G0/G1 phases, and promote cell cycle progression in S-phase and G2/M phase, which might induce cell division. A total of 12,498,414 and 11,840,624 bp paired-end reads were obtained for the control group and BSF-1 group, respectively, and they corresponded to a total size of 12.5 G bp and 11.8 G bp, respectively, after the low-quality reads and adapter sequences were removed. Approximately 81.83% of the total number of genes (8,257) were expressed reads per kilobase per million mapped reads (RPKM ≥1) and more than 1366 genes were highly expressed (RPKM >60) in the BSF-1 group. A gene ontology-enrichment analysis generated 13,042 assignments to cellular components, 13,094 assignments to biological processes, and 13,135 assignments to molecular functions. A Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis showed that the mitogen-activated protein kinase (MAPK) signaling pathways are significantly enriched for DEGs between the two cell groups. An analysis of transcriptome resources enabled us to examine gene expression profiles, verify differential gene expression, and select candidate signaling pathways as the mechanisms of the immunomodulatory activity of BSF-1. Based on the experimental data, we believe that the significant antitumor activities of BSF-1 in vivo mainly involve the MAPK signaling pathways. Boletus speciosus Frost-1 (BSF-1) could promote the proliferation of B-cell, T-cell, and macrophages, promote the proliferation of macrophage cells by abolishing cell cycle arrests in the G0/G1 phases, and promote cell cycle progression in S-phase and G2/M phase, which might induce cell divisionApproximately 81.83% of the total number of genes (8257) were expressed (reads per kilobase per million mapped reads [RPKM] =1) and more than 1366 genes were highly expressed (RPKM >60) in the BSF-1 groupA gene ontology-enrichment analysis generated 13,042 assignments to cellular components, 13,094 assignments to biological processes, and 13,135 assignments to molecular functionsA Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis showed that the mitogen-activated protein kinase signaling pathways are significantly enriched for DEGs between the two cell groups. Abbreviations used: BSF-1: Boletus speciosus Frost polysaccharide.

The vegetation history of the last glacial-interglacial cycle in eastern New South Wales, Australia

NASA Astrophysics Data System (ADS)

Williams, N. J.; Harle, K. J.; Gale, S. J.; Heijnis, H.

2006-10-01

We present a reconstruction of the vegetation history of the last glacial-interglacial cycle (ca. 75 k cal. yr BP-present) at Redhead Lagoon, an enclosed lake basin in coastal, eastern New South Wales, Australia. The sequence of vegetation change at the site is broadly comparable with the pattern of climatically induced changes observed in many other pollen records in southeast Australia. Open woodland-herbland and woodland-forest communities correspond with glacial and interglacial periods respectively, with an additional change towards a more open understorey vegetation assemblage over the last 40 000 yr. The driest conditions appear to have occurred during the height of the last glacial (some time between 30 and 20 k cal. yr BP). This is consistent with other records from southeast Australia, and provides support for a poleward shift in the subtropical anticyclone belt and, less certainly, for the thesis that the Southern Hemisphere westerlies intensified during this period. In marked contrast to most sites in southeast Australia, Casuarinaceae dominates the pollen record through the height of the last glacial period and into the Holocene. The postglacial climatic amelioration is accompanied by the general reappearance of tree pollen in the record, by the disappearance of several open and disturbed environment indicator taxa, by increases in organic sediment deposition and pollen taxon diversity, and by higher water balances. While climate appears to have been the major control on patterns of vegetation change at this site throughout most of the last glacial-interglacial cycle, changes in depositional environment and hydrology have also played a role. Significantly, substantial increases in the rate and magnitude of many indicators of environmental disturbance since European settlement suggest that humans are now the most important mechanism for environmental change. Copyright

Influence of Pleistocene glacial/interglacial cycles on the genetic structure of the mistletoe cactus Rhipsalis baccifera (Cactaceae) in Mesoamerica.

PubMed

Ornelas, Juan Francisco; Rodríguez-Gómez, Flor

2015-01-01

Phylogeographical work on cloud forest-adapted species provides inconsistent evidence on cloud forest dynamics during glacial cycles. A study of Rhipsalis baccifera (Cactaceae), a bird-dispersed epiphytic mistletoe cactus, was conducted to investigate genetic variation at sequence data from nuclear [internal transcribed spacer (ITS), 677 bp] and chloroplast (rpl32-trnL, 1092bp) DNA for 154 individuals across the species range in Mesoamerica to determine if such patterns are consistent with the expansion/contraction model of cloud forest during glacial cycles. We conducted population and spatial genetic analyses as well as gene flow and divergence time estimates between 24 populations comprising the distribution of R. baccifera in Mexico and Guatemala to gain insight of the evolutionary history of these populations, and a complementary species distribution modeling approach to frame information derived from the genetic analyses into an explicit paleoecological context. The results revealed a phylogeographical break at the Isthmus of Tehuantepec, and high levels of genetic diversity among populations and cloud forest areas. Despite the genetic differentiation of some R. baccifera populations, the widespread ITS ribotypes suggest effective nuclear gene flow via pollen and population differentiation shown by the rpl32-trnL suggests more restricted seed flow. Predictions of species distribution models under past last glacial maximum (LGM) climatic conditions and a significant signal of demographic expansion suggest that R. baccifera populations experienced a range expansion tracking the conditions of the cloud forest distribution and shifted to the lowlands with population connectivity during the LGM. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Substrate interactions and promiscuity in a viral DNA packaging motor.

PubMed

Aathavan, K; Politzer, Adam T; Kaplan, Ariel; Moffitt, Jeffrey R; Chemla, Yann R; Grimes, Shelley; Jardine, Paul J; Anderson, Dwight L; Bustamante, Carlos

2009-10-01

The ASCE (additional strand, conserved E) superfamily of proteins consists of structurally similar ATPases associated with diverse cellular activities involving metabolism and transport of proteins and nucleic acids in all forms of life. A subset of these enzymes consists of multimeric ringed pumps responsible for DNA transport in processes including genome packaging in adenoviruses, herpesviruses, poxviruses and tailed bacteriophages. Although their mechanism of mechanochemical conversion is beginning to be understood, little is known about how these motors engage their nucleic acid substrates. Questions remain as to whether the motors contact a single DNA element, such as a phosphate or a base, or whether contacts are distributed over several parts of the DNA. Furthermore, the role of these contacts in the mechanochemical cycle is unknown. Here we use the genome packaging motor of the Bacillus subtilis bacteriophage varphi29 (ref. 4) to address these questions. The full mechanochemical cycle of the motor, in which the ATPase is a pentameric-ring of gene product 16 (gp16), involves two phases-an ATP-loading dwell followed by a translocation burst of four 2.5-base-pair (bp) steps triggered by hydrolysis product release. By challenging the motor with a variety of modified DNA substrates, we show that during the dwell phase important contacts are made with adjacent phosphates every 10-bp on the 5'-3' strand in the direction of packaging. As well as providing stable, long-lived contacts, these phosphate interactions also regulate the chemical cycle. In contrast, during the burst phase, we find that DNA translocation is driven against large forces by extensive contacts, some of which are not specific to the chemical moieties of DNA. Such promiscuous, nonspecific contacts may reflect common translocase-substrate interactions for both the nucleic acid and protein translocases of the ASCE superfamily.

Substrate Interactions and Promiscuity in a Viral DNA Packaging Motor

PubMed Central

Aathavan, K.; Politzer, Adam T.; Kaplan, Ariel; Moffitt, Jeffrey R.; Chemla, Yann R.; Grimes, Shelley; Jardine, Paul J.; Anderson, Dwight L.; Bustamante, Carlos

2009-01-01

The ASCE superfamily of proteins consists of structurally similar ATPases associated with diverse cellular activities involving metabolism and transport of proteins and nucleic acids in all forms of life1. A subset of these enzymes are multimeric ringed pumps responsible for DNA transport in processes including genome packaging in adenoviruses, herpesviruses, poxviruses, and tailed bacteriophages2. While their mechanism of mechanochemical conversion is beginning to be understood3, little is known about how these motors engage their nucleic acid substrates. Do motors contact a single DNA element, such as a phosphate or a base, or are contacts distributed over multiple parts of the DNA? In addition, what role do these contacts play in the mechanochemical cycle? Here we use the genome packaging motor of the Bacillus subtilis bacteriophage φ294 to address these questions. The full mechanochemical cycle of the motor, whose ATPase is a pentameric-ring5 of gene product 16, involves two phases-- an ATP loading dwell followed by a translocation burst of four 2.5-bp steps6 triggered by hydrolysis product release7. By challenging the motor with a variety of modified DNA substrates, we find that during the dwell phase important contacts are made with adjacent phosphates every 10-bp on the 5’-3’ strand in the direction of packaging. In addition to providing stable, long-lived contacts, these phosphate interactions also regulate the chemical cycle. In contrast, during the burst phase, we find that DNA translocation is driven against large forces by extensive contacts, some of which are not specific to the chemical moieties of DNA. Such promiscuous, non-specific contacts may reflect common translocase-substrate interactions for both the nucleic acid and protein translocases of the ASCE superfamily1. PMID:19794496

On the habitability of universes without stable deuterium

NASA Astrophysics Data System (ADS)

Adams, Fred C.; Grohs, Evan

2017-05-01

In both stars and in the early universe, the production of deuterium is the first step on the way to producing heavier nuclei. If the strong force were slightly weaker, then deuterium would not be stable, and many authors have noted that nuclesynthesis would be compromised so that helium production could not proceed through standard reaction chains. Motivated by the possibility that other regions of space-time could have different values for the fundamental constants, this paper considers stellar evolution in universes without stable deuterium and argues that such universes can remain habitable. Even in universes with no stellar nucleosynthesis, stars can form and will generate energy through gravitational contraction. Using both analytic estimates and a state-of-the-art stellar evolution code, we show that such stars can be sufficiently luminous and long-lived to support life. Stars with initial masses that exceed the Chandrasekhar mass cannot be supported by degeneracy pressure and will explode at the end of their contraction phase. The resulting explosive nucleosynthesis can thus provide the universe with some heavy elements. We also explore the possibility that helium can be produced in stellar cores through a triple-nucleon reaction that is roughly analogous to the triple-alpha reaction that operates in our universe. Stars burning hydrogen through this process are somewhat hotter than those in our universe, but otherwise play the same role. Next we show that with even trace amounts (metallicity Z ∼10-10) of heavy elements - produced through the triple-nucleon process or by explosive nucleosynthesis - the CNO cycle can operate and allow stars to function. Finally, we consider Big Bang Nucleosynthesis without stable deuterium and find that only trace amounts of helium are produced, with even smaller abundances of other nuclei. With stars evolving through gravitational contraction, explosive nucleosynthesis, the triple-nucleon reaction, and the CNO cycle, universes with no stable deuterium are thus potentially habitable, contrary to many previous claims.

Proto-oncogene FBI-1 (Pokemon/ZBTB7A) Represses Transcription of the Tumor Suppressor Rb Gene via Binding Competition with Sp1 and Recruitment of Co-repressors*S⃞

PubMed Central

Jeon, Bu-Nam; Yoo, Jung-Yoon; Choi, Won-Il; Lee, Choong-Eun; Yoon, Ho-Geun; Hur, Man-Wook

2008-01-01

FBI-1 (also called Pokemon/ZBTB7A) is a BTB/POZ-domain Krüppel-like zinc-finger transcription factor. Recently, FBI-1 was characterized as a proto-oncogenic protein, which represses tumor suppressor ARF gene transcription. The expression of FBI-1 is increased in many cancer tissues. We found that FBI-1 potently represses transcription of the Rb gene, a tumor suppressor gene important in cell cycle arrest. FBI-1 binds to four GC-rich promoter elements (FREs) located at bp –308 to –188 of the Rb promoter region. The Rb promoter also contains two Sp1 binding sites: GC-box 1 (bp –65 to –56) and GC-box 2 (bp –18 to –9), the latter of which is also bound by FBI-1. We found that FRE3 (bp –244 to –236) is also a Sp1 binding element. FBI-1 represses transcription of the Rb gene not only by binding to the FREs, but also by competing with Sp1 at the GC-box 2 and the FRE3. By binding to the FREs and/or the GC-box, FBI-1 represses transcription of the Rb gene through its POZ-domain, which recruits a co-repressor-histone deacetylase complex and deacetylates histones H3 and H4 at the Rb gene promoter. FBI-1 inhibits C2C12 myoblast cell differentiation by repressing Rb gene expression. PMID:18801742

Cyclic changes of Asian monsoon intensity during the early mid-Holocene from annually-laminated stalagmites, central China

NASA Astrophysics Data System (ADS)

Liu, Dianbing; Wang, Yongjin; Cheng, Hai; Edwards, R. L.; Kong, Xinggong

2015-08-01

Climate during the early Holocene was highly variable due to the complex interplay of external and internal forcing mechanisms. The relative importance for them on the Asian monsoon (AM) evolution yet remains to be resolved. Here we present two-to six-yr-resolution oxygen isotope (δ18O) records of five stalagmites, four of which are annually-laminated, from Qingtian Cave, central China, revealing detailed AM variability between 10.9 and 6.1 ka BP. Over the contemporaneous periods, the δ18O records agree well with each other at multi-decadal to centennial timescales. When pieced together with the previously published isotopic data from the same cave, the final δ18O record reveals detailed AM variability from the last deglaciation to the mid-Holocene, consistent with other cave records. The most striking feature of the δ18O record is the recurrence of centennial-scale oscillations, especially during the annually-counted period (8.8-6.1 ka BP). Cross-wavelet analyses between the δ18O record and solar proxies show strong coherence at 200-yr cycle, suggesting that solar output was actively involved as a primary contributor. The AM depression at 8.2 ka BP is indistinguishable in amplitude and pattern from a series of weak AM events after 8 ka BP. We speculate that these centennial-scale AM changes might be regulated by the positive feedbacks of oceanic/atmospheric interactions to the solar activity under the condition of the retreat of continental ice-sheets.

Holocene peatland and ice-core data constraints on the timing and magnitude of CO2 emissions from past land use

PubMed Central

Massa, Charly

2017-01-01

CO2 emissions from preindustrial land-use change (LUC) are subject to large uncertainties. Although atmospheric CO2 records suggest only a small land carbon (C) source since 5,000 y before present (5 kyBP), the concurrent C sink by peat buildup could mask large early LUC emissions. Here, we combine updated continuous peat C reconstructions with the land C balance inferred from double deconvolution analyses of atmospheric CO2 and δ13C at different temporal scales to investigate the terrestrial C budget of the Holocene and the last millennium and constrain LUC emissions. LUC emissions are estimated with transient model simulations for diverging published scenarios of LU area change and shifting cultivation. Our results reveal a large terrestrial nonpeatland C source after the Mid-Holocene (66 ± 25 PgC at 7–5 kyBP and 115 ± 27 PgC at 5–3 kyBP). Despite high simulated per-capita CO2 emissions from LUC in early phases of agricultural development, humans emerge as a driver with dominant global C cycle impacts only in the most recent three millennia. Sole anthropogenic causes for particular variations in the CO2 record (∼20 ppm rise after 7 kyBP and ∼10 ppm fall between 1500 CE and 1600 CE) are not supported. This analysis puts a strong constraint on preindustrial vs. industrial-era LUC emissions and suggests that upper-end scenarios for the extent of agricultural expansion before 1850 CE are not compatible with the C budget thereafter. PMID:28137849

Evaluation of Rhenium Joining Methods

NASA Technical Reports Server (NTRS)

Reed, Brian D.; Morren, Sybil H.

1995-01-01

Coupons of rhenium-to-Cl03 flat plate joints, formed by explosive and diffusion bonding, were evaluated in a series of shear tests. Shear testing was conducted on as-received, thermally-cycled (100 cycles, from 21 to 1100 C), and thermally-aged (3 and 6 hrs at 1100 C) joint coupons. Shear tests were also conducted on joint coupons with rhenium and/or Cl03 electron beam welded tabs to simulate the joint's incorporation into a structure. Ultimate shear strength was used as a figure of merit to assess the effects of the thermal treatment and the electron beam welding of tabs on the joint coupons. All of the coupons survived thermal testing intact and without any visible degradation. Two different lots of as-received, explosively-bonded joint coupons had ultimate shear strengths of 281 and 310 MPa and 162 and 223 MPa, respectively. As-received, diffusion-bonded coupons had ultimate shear strengths of 199 and 348 MPa. For the most part, the thermally-treated and rhenium weld tab coupons had shear strengths slightly reduced or within the range of the as-received values. Coupons with Cl03 weld tabs experienced a significant reduction in shear strength. The degradation of strength appeared to be the result of a poor heat sink provided during the electron beam welding. The Cl03 base material could not dissipate heat as effectively as rhenium, leading to the formation of a brittle rhenium-niobium intermetallic.

100- kyr cyclicity in volcanic ash emplacement: evidence from a 1.1 Myr tephra record from the NW Pacific.

PubMed

Schindlbeck, Julie C; Jegen, Marion; Freundt, Armin; Kutterolf, Steffen; Straub, Susanne M; Mleneck-Vautravers, Maryline J; McManus, Jerry F

2018-03-13

It is a longstanding observation that the frequency of volcanism periodically changes at times of global climate change. The existence of causal links between volcanism and Earth's climate remains highly controversial, partly because most related studies only cover one glacial cycle. Longer records are available from marine sediment profiles in which the distribution of tephras records frequency changes of explosive arc volcanism with high resolution and time precision. Here we show that tephras of IODP Hole U1437B (northwest Pacific) record a cyclicity of explosive volcanism within the last 1.1 Myr. A spectral analysis of the dataset yields a statistically significant spectral peak at the ~100 kyr period, which dominates the global climate cycles since the Middle Pleistocene. A time-domain analysis of the entire eruption and δ 18 O record of benthic foraminifera as climate/sea level proxy shows that volcanism peaks after the glacial maximum and ∼13 ± 2 kyr before the δ 18 O minimum right at the glacial/interglacial transition. The correlation is especially good for the last 0.7 Myr. For the period 0.7-1.1 Ma, during the Middle Pleistocene Transition (MPT), the correlation is weaker, since the 100 kyr periodicity in the δ 18 O record diminishes, while the tephra record maintains its strong 100 kyr periodicity.

Dynamics of the Yellowstone hydrothermal system

USGS Publications Warehouse

Hurwitz, Shaul; Lowenstern, Jacob B.

2014-01-01

The Yellowstone Plateau Volcanic Field is characterized by extensive seismicity, episodes of uplift and subsidence, and a hydrothermal system that comprises more than 10,000 thermal features, including geysers, fumaroles, mud pots, thermal springs, and hydrothermal explosion craters. The diverse chemical and isotopic compositions of waters and gases derive from mantle, crustal, and meteoric sources and extensive water-gas-rock interaction at variable pressures and temperatures. The thermal features are host to all domains of life that utilize diverse inorganic sources of energy for metabolism. The unique and exceptional features of the hydrothermal system have attracted numerous researchers to Yellowstone beginning with the Washburn and Hayden expeditions in the 1870s. Since a seminal review published a quarter of a century ago, research in many fields has greatly advanced our understanding of the many coupled processes operating in and on the hydrothermal system. Specific advances include more refined geophysical images of the magmatic system, better constraints on the time scale of magmatic processes, characterization of fluid sources and water-rock interactions, quantitative estimates of heat and magmatic volatile fluxes, discovering and quantifying the role of thermophile microorganisms in the geochemical cycle, defining the chronology of hydrothermal explosions and their relation to glacial cycles, defining possible links between hydrothermal activity, deformation, and seismicity; quantifying geyser dynamics; and the discovery of extensive hydrothermal activity in Yellowstone Lake. Discussion of these many advances forms the basis of this review.

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

PubMed

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

Cloning and characterization of a cell cycle-regulated gene encoding topoisomerase I from Nicotiana tabacum that is inducible by light, low temperature and abscisic acid.

PubMed

Mudgil, Y; Singh, B N; Upadhyaya, K C; Sopory, S K; Reddy, M K

2002-05-01

We have cloned a full-length 2874-bp cDNA coding for tobacco topoisomerase I, with an ORF of 2559 bp encoding a protein of 852 amino acids with a calculated molecular mass of 95 kDa and an estimated pI of 9.51. The deduced amino acid sequence shows homology to other eukaryotic topoisomerases I. Tobacco topoisomerase I was over-expressed in Escherichia coli, and the purified recombinant protein was found to relax both positively and negatively super-coiled DNA in the absence of the divalent cation Mg(2+)and ATP. These characteristic features indicate that the tobacco enzyme is a type I topoisomerase. The recombinant protein could be phosphorylated at (a) threonine residue(s) by protein kinase C. However, phosphorylation did not cause any change in its enzymatic activity. The genomic organization of the topoisomerase I gene revealed the presence of 8 exons and 7 introns in the region corresponding to the ORF and one intron in the 3' UTR region. Transcript analysis using RT-PCR showed basal constitutive expression in all organs examined, and the gene was expressed at all stages of the cell cycle--but the level of expression increased during the G1-S phase. The transcript level also increased following exposure to light, low-temperature stress and abscisic acid, a stress hormone.

Fake ballistics and real explosions: field-scale experiments on the ejection and emplacement of volcanic bombs during vent-clearing explosive activity

NASA Astrophysics Data System (ADS)

Taddeucci, J.; Valentine, G.; Gaudin, D.; Graettinger, A. H.; Lube, G.; Kueppers, U.; Sonder, I.; White, J. D.; Ross, P.; Bowman, D. C.

2013-12-01

Ballistics - bomb-sized pyroclasts that travel from volcanic source to final emplacement position along ballistic trajectories - represent a prime source of volcanic hazard, but their emplacement range, size, and density is useful to inverse model key eruption parameters related to their initial ejection velocity. Models and theory, however, have so far focused on the trajectory of ballistics after leaving the vent, neglecting the complex dynamics of their initial acceleration phase in the vent/conduit. Here, we use field-scale buried explosion experiments to study the ground-to-ground ballistic emplacement of particles through their entire acceleration-deceleration cycle. Twelve blasts were performed at the University at Buffalo Large Scale Experimental Facility with a range of scaled depths (burial depth divided by the cubic root of the energy of the explosive charge) and crater configurations. In all runs, ballistic analogs were placed on the ground surface at variable distance from the vertical projection of the buried charge, resulting in variable ejection angle. The chosen analogs are tennis and ping-pong balls filled with different materials, covering a limited range of sizes and densities. The analogs are tracked in multiple high-speed and high-definition videos, while Particle Image Velocimetry is used to detail ground motion in response to the buried blasts. In addition, after each blast the emplacement position of all analog ballistics was mapped with respect to the blast location. Preliminary results show the acceleration history of ballistics to be quite variable, from very short and relatively simple acceleration coupled with ground motion, to more complex, multi-stage accelerations possibly affected not only by the initial ground motion but also by variable coupling with the gas-particle mixture generated by the blasts. Further analysis of the experimental results is expected to provide new interpretative tools for ballistic deposits and better hazard assessment, with particular emphasis for the case of vent-opening eruptions driven by explosive gas expansion beneath loose debris.

Modelling silicon supply during the Last Interglacial (MIS 5e) at Lake Baikal

NASA Astrophysics Data System (ADS)

Panizzo, V. N.; Swann, G. E. A.; Mackay, A. W.; Pashley, V.; Horstwood, M. S. A.

2018-06-01

Limnological reconstructions of primary productivity have demonstrated its response over Quaternary timescales to drivers such as climate change, landscape evolution and lake ontogeny. In particular, sediments from Lake Baikal, Siberia, provide a valuable uninterrupted and continuous sequence of biogenic silica (BSi) records, which document orbital and sub-orbital frequencies of regional climate change. We here extend these records via the application of stable isotope analysis of silica in diatom opal (δ30Sidiatom) from sediments covering the Last Interglacial cycle (Marine Isotope Stage [MIS] 5e; c. 130 to 115 ka BP) as a means to test the hypothesis that it was more productive than the Holocene. δ30Sidiatom data for the Last Interglacial range between +1.29 and +1.78‰, with highest values between c. 127 to 124 ka BP (+1.57 to +1.78‰). Results show that diatom dissolved silicon (DSi) utilisation, was significantly higher (p = 0.001) during MIS 5e than the current interglacial, which reflects increased diatom productivity over this time (concomitant with high diatom biovolume accumulation rates [BVAR] and warmer pollen-inferred vegetation reconstructions). Diatom BVAR are used, in tandem with δ30Sidiatom data, to model DSi supply to Lake Baikal surface waters, which shows that highest delivery was between c. 123 to 120 ka BP (reaching peak supply at c. 120 ka BP). When constrained by sedimentary mineralogical archives of catchment weathering indices (e.g. the Hydrolysis Index), data highlight the small degree of weathering intensity and therefore representation that catchment-weathering DSi sources had, over the duration of MIS 5e. Changes to DSi supply are therefore attributed to variations in within-lake conditions (e.g. turbulent mixing) over the period, where periods of both high productivity and modelled-DSi supply (e.g. strong convective mixing) account for the decreasing trend in δ30Sidiatom compositions (after c. 124 ka BP).

The endothelial nitric oxide synthase -786 T>C polymorphism and the exercise-induced blood pressure and nitric oxide responses among men with elevated blood pressure.

PubMed

Augeri, Amanda L; Tsongalis, Gregory J; Van Heest, Jaci L; Maresh, Carl M; Thompson, Paul D; Pescatello, Linda S

2009-06-01

A polymorphism (-786 T>C) in the promoter region of the endothelial nitric oxide synthase gene (eNOS) has important functional characteristics. We examined the influence of eNOS -786 T>C (rs2070744) on the BP and NO response to acute dynamic exercise. Subjects (n=49, 43.7+/-1.4 yr) had pre- to Stage-1 hypertension (145.6+/-1.5/85.9+/-1.1 mmHg). Volunteers performed three experiments; a non-exercise control session, and two cycle exercise bouts at 40% (LIGHT) and 60% (MODERATE) of peak oxygen consumption. Subjects wore an ambulatory BP monitor upon leaving the laboratory. NO was measured by chemiluminescence assay before (baseline), during, and after the experiments. eNOS genotypes were determined by polymerase chain reaction and restriction enzyme digestion. Repeated measure ANOVA tested if BP and NO differed over time among experiments and by eNOS genotypes (n=25, TT; n=24, TC/CC). Among carriers of the eNOS C(786) allele, systolic BP (SBP) was reduced 5.3+/-2.4 mmHg after MODERATE versus non-exercise control over 9h compared to those with the eNOS T786T genotype (p<0.05). Under these conditions, SBP tended to be lower 4.6+/-2.9 mmHg after LIGHT (p=0.076). The exercise-induced diastolic BP and NO responses were not different from non-exercise control between eNOS genotype (p>0.05). Men who were carriers of the eNOS C(786) allele responded more favorably to the antihypertensive effects of aerobic exercise than men with the eNOS T786T genotype. The eNOS C(786) allele is associated with reduced eNOS gene transcription and promoter activity. Future work is needed to determine how exercise may override genetic predispositions to down regulate eNOS gene activity.

Body fat, resting and exercise blood pressure and the angiotensinogen M235T polymorphism: the heritage family study.

PubMed

Rankinen, T; Gagnon, J; Pérusse, L; Rice, T; Leon, A S; Skinner, J S; Wilmore, J H; Rao, D C; Bouchard, C

1999-09-01

The association of resting and exercise blood pressure (BP) and fat mass with the angiotensinogen (AGT) M235T polymorphism was investigated in 522 sedentary Caucasian subjects from 99 families. Resting BP was measured on two separate days, three times each day, and the mean of six valid measurements was used. Exercise BP was measured during a cycle ergometer test at a constant power output (50 W). Body composition was derived from under-water weighing and the AGT M235T polymorphism was typed with a polymerase chain reaction-based method. Neither resting nor exercise BP was associated with the AGT genotypes. In mothers, the homozygotes for the T allele showed 8.8 kg and 7.1 kg greater (p=0.017) age-adjusted body fat mass (FM) than the MM homozygotes and heterozygotes, respectively. Sixty-nine percent of all TT homozygotes were found in the highest FM tertile, whereas only 16% of the MM homozygotes fell in the same tertile (p = 0.008). Moreover, a significant interaction was seen between FM and T-allele carrier status in women with regard to resting diastolic BP (p = 0.002). Among women with a FM> or =24 kg, carriers of the T allele showed a 6.3 mmHg higher diastolic blood pressure (DBP) than non-carriers whereas no difference was found in women with a FM less than 24 kg. A similar trend toward an interaction term was evident with resting systolic blood pressure (p = 0.011) and exercise DBP (p = 0.012). Body fat was not associated with the AGT polymorphism in fathers or in offspring. These data suggest that the AGT M235T polymorphism is associated with body fatness in women, and that the relationship between DBP and AGT M235T polymorphism is dependent on FM in middle-aged sedentary normotensive women.

Late Quaternary vegetational and climate dynamics in northeastern Brazil, inferences from marine core GeoB 3104-1

NASA Astrophysics Data System (ADS)

Behling, Hermann; W. Arz, Helge; Pätzold, Jürgen; Wefer, Gerold

2000-06-01

Late Quaternary paleoenvironments from northeastern (NE) Brazil have been studied by pollen analysis of marine sediment. The studied core GeoB 3104-1 (3°40' S, 37°43' W, 767 m b.s.l.) from the upper continental slope off NE Brazil is 517 cm long and >42,000 14C yr BP old. Chronological control was obtained by 12 radiocarbon (AMS) dates from individuals of the foraminiferal species Globigerinoides sacculifer. Modern pollen analogs were received from 15 river, lake and forest soil surface samples from NE Brazil. Marine pollen dates indicate the predominance of semi-arid caatinga vegetation in NE Brazil during the recorded period between >42,000 and 8500 14C yr BP. The increased fluvial input of terrigenous material, with high concentrations of pollen and specially fern spores, into the marine deposits, about 40,000, 33,000 and 24,000 14C yr BP and between 15,500 and 11,800 14C yr BP, indicate short-term periods of strong rainfall on the NE Brazilian continent. The expansion of mountain, floodplain and gallery forests characterize the interval between 15,500 and 11,800 14C yr BP as the wettest recorded period in NE Brazil, which allowed floristic exchanges between Atlantic rain forest and Amazonian rain forest, and vice versa. The paleodata from core GeoB 3104-1 confirm the, in general, dry pre-Last Glacial Maximum (LGM) and LGM conditions and the change to wet Lateglacial environments in tropical South America. The annual movement of the intertropical convergence zone over NE Brazil, the strong influence of the Antarctic cold fronts and changes of the high-pressure cell over the southern Atlantic, may explain the very wet Lateglacial period in NE Brazil. The documented NE Brazilian short-term signals correlate with the documented Dansgaard-Oeschger cycles and Heinrich events from the northern Hemisphere and suggest strong teleconnections.

Long-term deforestation in NW Spain: linking the Holocene fire history to vegetation change and human activities

NASA Astrophysics Data System (ADS)

Kaal, Joeri; Carrión Marco, Yolanda; Asouti, Eleni; Martín Seijo, Maria; Martínez Cortizas, Antonio; Costa Casáis, Manuela; Criado Boado, Felipe

2011-01-01

The Holocene fire regime is thought to have had a key role in deforestation and shrubland expansion in Galicia (NW Spain) but the contribution of past societies to vegetation burning remains poorly understood. This may be, in part, due to the fact that detailed fire records from areas in close proximity to archaeological sites are scarce. To fill this gap, we performed charcoal analysis in five colluvial soils from an archaeological area (Campo Lameiro) and compared the results to earlier studies from this area and palaeo-ecological literature from NW Spain. This analysis allowed for the reconstruction of the vegetation and fire dynamics in the area during the last ca 11 000 yrs. In the Early Holocene, Fabaceae and Betula sp. were dominant in the charcoal record. Quercus sp. started to replace these species around 10 000 cal BP, forming a deciduous forest that prevailed during the Holocene Thermal Maximum until ˜5500 cal BP. Following that, several cycles of potentially fire-induced forest regression with subsequent incomplete recovery eventually led to the formation of an open landscape dominated by shrubs (Erica sp. and Fabaceae). Major episodes of forest regression were (1) ˜5500-5000 cal BP, which marks the mid-Holocene cooling after the Holocene Thermal Maximum, but also the period during which agropastoral activities in NW Spain became widespread, and (2) ˜2000-1500 cal BP, which corresponds roughly to the end of the Roman Warm Period and the transition from the Roman to the Germanic period. The low degree of chronological precision, which is inherent in fire history reconstructions from colluvial soils, made it impossible to distinguish climatic from human-induced fires. Nonetheless, the abundance of synanthropic pollen indicators (e.g. Plantago lanceolata and Urtica dioica) since at least ˜6000 cal BP strongly suggests that humans used fire to generate and maintain pasture.

Millennial scale impact on the marine biogeochemical cycle of mercury from early mining on the Iberian Peninsula

NASA Astrophysics Data System (ADS)

Serrano, O.; Martínez-Cortizas, A.; Mateo, M. A.; Biester, H.; Bindler, R.

2013-01-01

The high-resolution mercury record of a Posidonia oceanica mat in the northwest Mediterranean provides an unprecedented testimony of changes in environmental mercury (Hg) loading to the coastal marine environment over the past 4315 yr BP. The period reconstructed made it possible to establish tentative preanthropogenic background Hg levels for the area (6.8 ± 1.5 ng g-1 in bulk sediments). A small, but significant, anthropogenic Hg increase was identifiable by 2500 yr BP, in agreement with the beginning of intense mining in Spain. Changes in the record suggest four major periods of anthropogenic Hg pollution inputs to the Mediterranean: first, during the Roman Empire (2100-1800 yr BP); second, in the Late Middle Ages (970-650 yr BP); third, in the modern historical era (530-380 yr BP); and fourth, in the industrial period (last 250 years), with Hg concentrations two-, four-, five-, and tenfold higher than background concentrations, respectively. Hg from anthropogenic sources has dominated during the last millennium (increase from 12 to 100 ng g-1), which can be related to the widespread historical exploitation of ore resources on the Iberian Peninsula. The chronology of Hg concentrations in the mat archive, together with other Hg pollution records from the Iberian Peninsula, suggests regional-scale Hg transport and deposition and shows earlier marine Hg pollution than elsewhere in Europe. Moreover, the mat also records a higher number of historic contamination phases, in comparison with other natural archives, probably due to the fact that the bioaccumulating capacity of P. oceanica magnify environmental changes in Hg concentrations. In this study, we demonstrate the uniqueness of P. oceanica meadows as a long-term archive recording trends in Hg abundance in the marine coastal environment, as well as its potential role in the Mediterranean as a long-term Hg sink.

Somma-Vesuvius ground deformation over the last glacial cycle

NASA Astrophysics Data System (ADS)

Marturano, Aldo; Aiello, Giuseppe; Barra, Diana

2013-04-01

Vertical ground movements at Somma-Vesuvius during the last glacial cycle have been inferred from micropalaeontological and petrochemical analyses of rock samples from boreholes drilled at the archaeological sites of Herculaneum and Pompeii as well as on the apron of the volcano and the adjacent Sebeto and Sarno Valleys. Opposing movements occurred during the periods preceding and following the Last Glacial Maximum (LGM). The uplift began 20 ka ago with marine deposits rising several tens of metres up to 25 m a.s.l., recovering previous subsidence which occurred during the Late glacial period, suggesting a strict connection between volcano-tectonic and glacial cycles. Here we present the analysis of deposits predating the LGM, which confirms subsidence of the Campanian Plain where Mt. Somma-Vesuvius is located, shows variable surface loading effects and highlights the volcano-tectonic stages experienced by the volcano. The self-balancing mechanism of the volcanic system, evolving towards an explosive, subaerial activity 60 ka ago, is testified to by a large ground oscillation in phase with sea level change during the last glacial cycle.

Culture-Independent Identification of Manganese-Oxidizing Genes from Deep-Sea Hydrothermal Vent Chemoautotrophic Ferromanganese Microbial Communities Using a Metagenomic Approach

NASA Astrophysics Data System (ADS)

Davis, R.; Tebo, B. M.

2013-12-01

Microbial activity has long been recognized as being important to the fate of manganese (Mn) in hydrothermal systems, yet we know very little about the organisms that catalyze Mn oxidation, the mechanisms by which Mn is oxidized or the physiological function that Mn oxidation serves in these hydrothermal systems. Hydrothermal vents with thick ferromanganese microbial mats and Mn oxide-coated rocks observed throughout the Pacific Ring of Fire are ideal models to study the mechanisms of microbial Mn oxidation, as well as primary productivity in these metal-cycling ecosystems. We sampled ferromanganese microbial mats from Vai Lili Vent Field (Tmax=43°C) located on the Eastern Lau Spreading Center and Mn oxide-encrusted rhyolytic pumice (4°C) from Niua South Seamount on the Tonga Volcanic Arc. Metagenomic libraries were constructed and assembled from these samples and key genes known to be involved in Mn oxidation and carbon fixation pathways were identified in the reconstructed genomes. The Vai Lili metagenome assembled to form 121,157 contiguous sequences (contigs) greater than 1000bp in length, with an N50 of 8,261bp and a total metagenome size of 593 Mbp. Contigs were binned using an emergent self-organizing map of tetranucleotide frequencies. Putative homologs of the multicopper Mn-oxidase MnxG were found in the metagenome that were related to both the Pseudomonas-like and Bacillus-like forms of the enzyme. The bins containing the Pseudomonas-like mnxG genes are most closely related to uncultured Deltaproteobacteria and Chloroflexi. The Deltaproteobacteria bin appears to be an obligate anaerobe with possible chemoautotrophic metabolisms, while the Chloroflexi appears to be a heterotrophic organism. The metagenome from the Mn-stained pumice was assembled into 122,092 contigs greater than 1000bp in length with an N50 of 7635 and a metagenome size of 385 Mbp. Both forms of mnxG genes are present in this metagenome as well as the genes encoding the putative Mn oxidases McoA and MopA. The greater diversity of Mn oxidase pathways in this metagenome suggests a more diverse Mn oxidizing microbial community in the cold pumice sample. Key enzymes for four of the six known carbon fixation pathways (the Calvin Cycle, the reductive TCA cycle, the Wood-Ljungdahl pathway, and the 3-hydroxypropionate/4-hydroxybutyrate Cycle) were also identified in both samples indicating primary production occurs via a diverse community of carbon fixing organisms. Together, these samples contain active, diverse populations of Mn oxidizing bacteria living in association with microbial communities supported by chemoautotrophic carbon fixation.

Testing electroexplosive devices by programmed pulsing techniques

NASA Technical Reports Server (NTRS)

Rosenthal, L. A.; Menichelli, V. J.

1976-01-01

A novel method for testing electroexplosive devices is proposed wherein capacitor discharge pulses, with increasing energy in a step-wise fashion, are delivered to the device under test. The size of the energy increment can be programmed so that firing takes place after many, or after only a few, steps. The testing cycle is automatically terminated upon firing. An energy-firing contour relating the energy required to the programmed step size describes the single-pulse firing energy and the possible sensitization or desensitization of the explosive device.

Changes of environments and human activity at the Sannai-Maruyama ruins in Japan during the mid-Holocene Hypsithermal climatic interval

NASA Astrophysics Data System (ADS)

Kawahata, Hodaka; Yamamoto, Hisashi; Ohkushi, Ken'ichi; Yokoyama, Yusuke; Kimoto, Katsunori; Ohshima, Hideki; Matsuzaki, Hiroyuki

2009-05-01

Sannai-Maruyama is one of the most famous and best-researched mid-Holocene (mid-Jomon) archaeological sites in Japan, because of a large community of people for a long period. Archaeological studies have shown that the Jomon people inhabi1ted the Sannai-Maruyama site from 5.9 to 4.2 ± 0.1 cal kyr BP However, a continuous record of the terrestrial and marine environments around the site has not been available. Core KT05-7 PC-02, was recovered from Mutsu Bay, only 20 km from the site, for the reconstruction of high-resolution time series of environmental records, including sea surface temperature (SST). C 37 alkenone SSTs showed clear fluctuations, with four periods of high (8.4-7.9, 7.0-5.9, 5.1-4.1, and 2.3-1.4 cal kyr BP) and four of low (-8.4, 7.9-7.0, 5.9-5.1, and 4.1-2.3 cal kyr BP) SST. Thus, each SST cycle lasted 1.0-2.0 kyr, and the amplitude of fluctuation was about 1.5-2.0 °C. Total organic carbon (TOC) and C 37 alkenone contents, and the TOC/total nitrogen ratio indicate that marine biogenic production was low before 7.0 cal kyr BP, but was clearly increased between 5.9 and 4.0 cal kyr BP, because of stronger vertical mixing. During the period when the community at the site prospered (between 5.9 and 4.2 ± 0.1 cal kyr BP), the terrestrial climate was relatively warm. The high relative abundance of pollen of both Castanea and Quercus subgen. Cyclobalanopsis supports the interpretation that the local climate was optimal for human habitation. Between 5.9 and 5.1 cal kyr BP, in spite of warm terrestrial climates, the C 37 alkenone SST was low; this apparent discrepancy may be attributed to the water column structure in the Tsugaru Strait, which differed from the modern condition. The evidence suggests that at about 5.9 cal kyr B.P, high productivity of marine resources such as fish and shellfish and a warm terrestrial climate led to the establishment of a human community at the Sannai-Maruyama site. Then, at about 4.1 ± 0.1 cal kyr BP, abrupt marine and terrestrial cooling, indicated by a decrease of about 2 °C in the C 37 alkenone SST and an increase in the pollen of taxa of cooler climates, led to a reduced terrestrial food supply, causing the people to abandon the site. The timing of the abandonment is consistent with the timing (around 4.0-4.3 cal kyr BP) of the decline of civilizations in north Mesopotamia and along the Yangtze River. These findings suggest that a temperature rise of ˜2 °C in this century as a result of global warming could have a great impact on the human community and especially on agriculture, despite the advances of contemporary society.

A Study of Enabling Factors for Rapid Fielding: Combined Practices to Balance Speed and Stability

DTIC Science & Technology

2013-05-01

as contributors to the success of Agile projects, such as Scrum status meetings, continuous integration, test-driven development, etc. A second...Management Approach Type Product Size Team Size Sprint length / Prod Release Cycle A-P1 Pre- release Scrum Case management system ᝺M...SLOC 10-20 2 weeks/ TBD B-P1 12 years Scrum Analysis support system ᝺M SLOC 10-20 2 weeks/ 6 months – 1 year C-P1 3 years Scrum Training

Dietary calcium intake and renin angiotensin system polymorphisms alter the blood pressure response to aerobic exercise: a randomized control design.

PubMed

Pescatello, Linda S; Turner, Debbie; Rodriguez, Nancy; Blanchard, Bruce E; Tsongalis, Gregory J; Maresh, Carl M; Duffy, Valerie; Thompson, Paul D

2007-01-04

Dietary calcium intake and the renin angiotensin system (RAS) regulate blood pressure (BP) by modulating calcium homeostasis. Despite similar BP regulatory effects, the influence of dietary calcium intake alone and combined with RAS polymorphisms on the BP response following acute aerobic exercise (i.e., postexercise hypotension) has not been studied. Thus, we examined the effect of dietary calcium intake and selected RAS polymorphisms on postexercise hypotension. Subjects were men (n = 50, 43.8 +/- 1.3 yr) with high BP (145.3 +/- 1.5/85.9 +/- 1.1 mm Hg). They completed three experiments: non-exercise control and two cycle bouts at 40% and 60% of maximal oxygen consumption (VO2max). Subjects provided 3 d food records on five protocol-specific occasions. Dietary calcium intake was averaged and categorized as low (<880 mg/d = LowCa) or high (> or = 880 mg/d = HighCa). RAS polymorphisms (angiotensin converting enzyme insertion/deletion, ACE I/D; angiotensin II type 1 receptor, AT1R A/C) were analyzed with molecular methods. Genotypes were reduced from three to two: ACE II/ID and ACE DD; or AT1R AA and AT1R CC/AC. Repeated measure ANCOVA tested if BP differed among experiments, dietary calcium intake level and RAS polymorphisms. Systolic BP (SBP) decreased 6 mm Hg after 40% and 60% VO2max compared to non-exercise control for 10 h with LowCa (p < 0.01), but not with HighCa (p > or = 0.05). Under these conditions, diastolic BP (DBP) did not differ between dietary calcium intake levels (p > or = 0.05). With LowCa, SBP decreased after 60% VO2max versus non-exercise control for 10 h among ACE II/ID (6 mm Hg) and AT1R AA (8 mm Hg); and by 8 mm Hg after 40% VO2max among ACE DD and AT1R CC/CA (p < 0.01). With HighCa, SBP (8 mm Hg) and DBP (4 mm Hg) decreased after 60% VO2max compared to non-exercise control for 10 h (p < 0.05), but not after 40% VO2max (p > or = 0.05). SBP decreased after exercise compared to non-exercise control among men with low but not high dietary calcium intake. Dietary calcium intake interacted with the ACE I/D and AT1R A/C polymorphisms to further modulate postexercise hypotension. Interactions among dietary calcium intake, exercise intensity and RAS polymorphisms account for some of the variability in the BP response to exercise.

Personal, closed-cycle cooling and protective apparatus and thermal battery therefor

DOEpatents

Klett, James W.; Klett, Lynn B.

2004-07-20

A closed-cycle apparatus for cooling a living body includes a heat pickup body or garment which permits evaporation of an evaporating fluid, transmission of the vapor to a condenser, and return of the condensate to the heat pickup body. A thermal battery cooling source is provided for removing heat from the condenser. The apparatus requires no external power and provides a cooling system for soldiers, race car drivers, police officers, firefighters, bomb squad technicians, and other personnel who may utilize protective clothing to work in hostile environments. An additional shield layer may simultaneously provide protection from discomfort, illness or injury due to harmful atmospheres, projectiles, edged weapons, impacts, explosions, heat, poisons, microbes, corrosive agents, or radiation, while simultaneously removing body heat from the wearer.

Physical and Chemical Microstructural Damage in Pressed CL-20 explosives

NASA Astrophysics Data System (ADS)

Demol, Gauthier; Sandusky, Harold W.

1999-06-01

Based upon its molecular composition, its structure, and its heat of formation, it was expected that CL-20 (hexanitrohexaazaisowurtzitane) would be more energetic and more sensitive than RDX and HMX. Reports of batch-to-batch variations in the sensitivity of neat CL-20 have led to its sensitivity being ranked in the range between the sensitivity of RDX and that of PETN. The ultimate utility of CL-20 as an ingredient in explosive and propellant formulations will depend upon the ability to understand the factors that are responsible for this batch-to-batch variability, and to control the sensitivity in formulations within acceptable limits. This work is a characterization of CL-20 at various stages in its life cycle. The evolution of damage from the initial neat crystals of CL-20 to the ready-to-use pressed pellets will be described. This characterization includes physical documentation using light microscopy and Scanning Electron Microscopy. Spatially resolved chemical analysis is also performed using Fourier-Transform Infrared Spectroscopy.

Shock Initiation of Thermally Expanded TATB

NASA Astrophysics Data System (ADS)

Mulford, Roberta; Swift, Damian

2011-06-01

The plastic-bonded explosive PBX-9502 undergoes unusual hysteretic thermal expansion, or ``ratchet growth'' as a consequence of the uniaxial thermal expansion of the graphitic structure of the major component, TATB explosive. Upon thermal cycling, the density of the material can be reduced by as much as 9%, resulting in a distinct increase in the shock sensitivity of the solid. Run distances to detonation have been measured in thermally expanded samples of PBX-9502, using embedded particle velocity gauges and shock tracker gauges. Uniaxial shocks were generated using a light gas gun, to provide a repeatable stimulus for initiation of detonation. We have applied a porosity model to adjust standard Pop plot data to the reduced density of our samples, to investigate whether the sensitivity of the PBX 9502 increases ideally with the decreasing density, or whether the microscopically non-uniform expansion that occurs during ``ratchet growth'' leads to abnormal sensitivity, possibly as a result of cracking or debonding from the binder, as observed in micrographs of the sample.

Physiological profiles of young boys training in ballet.

PubMed Central

Pekkarinen, H; Litmanen, H; Mahlamäki, S

1989-01-01

In order to evaluate physiological characteristics in young male ballet dancers, 27 boys (aged 9 to 16 years) who participated in a boys' dance course during the Kuopio Dance and Music Festival in June 1988 were studied. In general, the boys had started dancing at the age of 8.6 years and had been training for 4.1 years. They had, on average, three dancing sessions per week and the mean time spent on dancing was four hours per week. In the study, some anthropometric measurements were taken, the maximal oxygen uptake (VO2 max) was measured by a cycle ergometer test and the explosive strength and the mechanical power of lower extremities were evaluated by a jumping test. The results indicate that boys who train in ballet are in general moderately lean, have relatively small body size and a high degree of flexibility. The younger boys especially have only moderate aerobic power, but both explosive strength and mechanical power in leg muscles are good in ballet trained boys. PMID:2630002

Initial Assessment, Surveillance, and Management of Blood Pressure in Patients Receiving Vascular Endothelial Growth Factor Signaling Pathway Inhibitors

PubMed Central

Bakris, George L.; Black, Henry R.; Chen, Helen X.; Durand, Jean-Bernard; Elliott, William J.; Ivy, S. Percy; Leier, Carl V.; Lindenfeld, JoAnn; Liu, Glenn; Remick, Scot C.; Steingart, Richard; Tang, W. H. Wilson

2010-01-01

Hypertension is a mechanism-based toxic effect of drugs that inhibit the vascular endothelial growth factor signaling pathway (VSP). Substantial evidence exists for managing hypertension as a chronic condition, but there are few prospectively collected data on managing acute hypertension caused by VSP inhibitors. The Investigational Drug Steering Committee of the National Cancer Institute convened an interdisciplinary cardiovascular toxicities expert panel to evaluate this problem, to make recommendations to the Cancer Therapy Evaluation Program on further study, and to structure an approach for safe management by treating physicians. The panel reviewed: the published literature on blood pressure (BP), hypertension, and specific VSP inhibitors; abstracts from major meetings; shared experience with the development of VSP inhibitors; and established principles of hypertension care. The panel generated a consensus report including the recommendations on clinical concerns summarized here. To support the greatest possible number of patients to receive VSP inhibitors safely and effectively, the panel had four recommendations: 1) conduct and document a formal risk assessment for potential cardiovascular complications, 2) recognize that preexisting hypertension will be common in cancer patients and should be identified and addressed before initiation of VSP inhibitor therapy, 3) actively monitor BP throughout treatment with more frequent assessments during the first cycle of treatment, and 4) manage BP with a goal of less than 140/90 mmHg for most patients (and to lower, prespecified goals in patients with specific preexisting cardiovascular risk factors). Proper agent selection, dosing, and scheduling of follow-up should enable maintaining VSP inhibition while avoiding the complications associated with excessive or prolonged elevation in BP. PMID:20351338

Paleoenvironmental and Paleoclimate Changes Since 21,000 Cal Years BP in the Northeastern part of Brazil Inferred From Sediment Records in Lagoa do Caco (Maranhao State, Brazil)

NASA Astrophysics Data System (ADS)

Sifeddine, A.; Meyers, P. A.; Gustavo, A.; Spadano Albuquerque, A. L.; Turcq, B.; Campbello Cordeiro, R.; Abrao, J. J.

2004-12-01

Two cores from Caco Lake, Maranhao State (North Brazil) record different histories of sediment accumulation on the margin and center of the lake that reflect changes in lake level. Seismic profiles, mineralogy and organic geochemical studies, backed by radiocarbon dating, reveal variable climatic and environmental conditions over the last 21 Cal Kyr BP. During the Last Glacial Maximum, regional climate was predominantly dry but was interrupted by short humid phases as reflected by a succession of very thin layers of sand and organic matter. The late glacial climate was relatively wet and included two rapid lake-level increases accompanied by forest expansion. The two wet phases were separated by a phase where the lake level remained stable and the forest changes were marked by the development of cool "Podocarpus" forest. These humid climate periods differed significantly from present warm tropical conditions.. The Holocene period is characterized by progressive increase of lake level, which reaches his maximum at around 7,000 Cal years BP. The period between 4,000 Cal years BP and the present shows high variability in lake level. Comparing with other South American and African records, we conclude that Late Glacial humid conditions were controlled by intensification of the ITCZ or shifts of its position, resulting in southeasterly trade wind variations and in interconnection between northern South America and the Atlantic tropical ocean-atmosphere system. The climatic variability during the Holocene is probably the result of sub-Milankovitch solar cycles and regional responses to these global forcings that are related to Atlantic and Pacific variability and their interconnections.

The influence of water ingestion on postexercise hypotension and standing haemodynamics.

PubMed

Mendonca, Goncalo V; Fernhall, Bo

2016-11-01

In young healthy adults, postexercise hypotension (PEH) occurs after a single bout of dynamic exercise due to peripheral vasodilation. Gravitational stress may further aggravate the magnitude of PEH, thus predisposing to orthostatic intolerance. As water drinking activates sympathetic vasoconstriction, it might offset PEH via enhanced α-adrenergic vascular responsiveness. We hypothesized that water ingestion before exercise would decrease the magnitude of PEH and improve the haemodynamic reaction to active standing postmaximal exercise. In a randomized fashion, 17 healthy adults (nine men; eight women, 21·2 ± 1·6 years) ingested 50 and 500 ml of water before completing resting, cycle ergometer and recovery protocols on two separate days. After exercise, measurements [arterial blood pressure (BP), heart rate and spectral heart rate variability (HRV)] were taken in the seated position followed by 5 min of active standing. Compared to that seen post-50 ml of water, the 500 ml volume elicited an overall increase in BP (P < 0·05). Nevertheless, the magnitude of PEH was not different after either volume of water. There was an overall bradycardic effect of water, and this was accompanied by increased high-frequency power (P < 0·05). Finally, no BP, heart rate or HRV differences were found between conditions in response to active standing. These data suggest that, despite being well preserved after maximal exercise, the water pressor response does not affect the magnitude of PEH. They also indicate that drinking 500 ml of water does not impact the BP, heart rate or HRV response to 5 min of active standing during recovery postmaximal exercise. © 2015 Scandinavian Society of Clinical Physiology and Nuclear Medicine. Published by John Wiley & Sons Ltd.

Heart rate at the onset of muscle contraction and during passive muscle stretch in humans: a role for mechanoreceptors

PubMed Central

Gladwell, V F; Coote, J H

2002-01-01

Previous evidence suggests that the heart rate (HR) increase observed with isometric exercise is dependent on different afferent mechanisms to those eliciting the increase in blood pressure (BP). Central command and muscle metaboreceptors have been shown to contribute to this differential effect. However, in experimental animals passive stretch of the hindlimb increases HR suggesting that small fibre mechanoreceptors could also have a role. This has not been previously shown in humans and was investigated in this study. Healthy human volunteers were instrumented to record BP, ECG, respiration, EMG of rectus femoris and gastrocnemius and contraction force of triceps surae. Voluntary isometric contraction of triceps surae elicited a significant HR change in the first three respiratory cycles at 40 % of maximum voluntary contraction whereas BP did not change significantly until after 30 s. This suggests that different mechanisms are involved in the initiation of the cardiovascular changes. Sustained passive stretch of triceps surae for 1 min, by dorsiflexion of the foot, caused a significant (P < 0.05) increase in HR (5 ± 2.6 beats min−1) with no significant change in BP. A time domain measure of cardiac vagal activity was reduced significantly during passive stretch from 69.7 ± 12.9 to 49.6 ± 8.9 ms. Rapid rhythmic passive stretch (0.5 Hz for 1 min) was without significant effect suggesting that large muscle proprioreceptors are not involved. We conclude that in man small fibre muscle mechanoreceptors responding to stretch, inhibit cardiac vagal activity and thus increase HR. These afferents could contribute to the initial cardiac acceleration in response to muscle contraction. PMID:11986394

Holocene peatland and ice-core data constraints on the timing and magnitude of CO2 emissions from past land use.

PubMed

Stocker, Benjamin David; Yu, Zicheng; Massa, Charly; Joos, Fortunat

2017-02-14

CO 2 emissions from preindustrial land-use change (LUC) are subject to large uncertainties. Although atmospheric CO 2 records suggest only a small land carbon (C) source since 5,000 y before present (5 kyBP), the concurrent C sink by peat buildup could mask large early LUC emissions. Here, we combine updated continuous peat C reconstructions with the land C balance inferred from double deconvolution analyses of atmospheric CO 2 and [Formula: see text]C at different temporal scales to investigate the terrestrial C budget of the Holocene and the last millennium and constrain LUC emissions. LUC emissions are estimated with transient model simulations for diverging published scenarios of LU area change and shifting cultivation. Our results reveal a large terrestrial nonpeatland C source after the Mid-Holocene (66 [Formula: see text] 25 PgC at 7-5 kyBP and 115 [Formula: see text] 27 PgC at 5-3 kyBP). Despite high simulated per-capita CO 2 emissions from LUC in early phases of agricultural development, humans emerge as a driver with dominant global C cycle impacts only in the most recent three millennia. Sole anthropogenic causes for particular variations in the CO 2 record ([Formula: see text]20 ppm rise after 7 kyBP and [Formula: see text]10 ppm fall between 1500 CE and 1600 CE) are not supported. This analysis puts a strong constraint on preindustrial vs. industrial-era LUC emissions and suggests that upper-end scenarios for the extent of agricultural expansion before 1850 CE are not compatible with the C budget thereafter.

Precisely dated multidecadally resolved Asian summer monsoon dynamics 113.5-86.6 thousand years ago

NASA Astrophysics Data System (ADS)

Jiang, Xiuyang; Wang, Xiaoyan; He, Yaoqi; Hu, Hsun-Ming; Li, Zhizhong; Spötl, Christoph; Shen, Chuan-Chou

2016-07-01

We present a new 230Th-dated absolute chronology of Asian summer monsoon (ASM) variability from 113.5 to 86.6 kyr BP (before 1950 AD). This integrated multidecadally resolved record, based on 1435 oxygen isotope data and 46 230Th dates with 2-sigma errors as low as ±0.3 kyr from three stalagmites collected in Sanxing Cave, southwestern China, can be a new reference for calibrating paleoclimate proxy sequences. The Sanxing δ18O record follows the 23 kyr precessional cycle of insolation and is punctuated by prominent millennial-scale oscillations of the Chinese Interstadials (CIS) 25 to 22, corresponding to Greenland Interstadials (GIS) 25 to 22. The onset of CIS 25, 24, 23 and 22 is dated to 113.1 ± 0.4, 108.1 ± 0.3, 103.7 ± 0.3 and 91.4 ± 0.6 kyr BP in the Sanxing record, respectively. The end of CIS 24 and CIS 22 is constrained to 105.5 ± 0.4 and 87.7 ± 0.3 kyr BP, respectively. A centennial-scale precursor event at 104.1 ± 0.3 kyr BP preceding CIS 23 is clearly registered. These events in the Sanxing record are synchronous with those identified in stalagmites from the European Alps (NALPS), except for the onset of GIS 25 and the end of GIS 22, and differ by up to 2.3 kyr from the corresponding ones in Greenland ice core records. The high degree of similarity of the δ18O records between Sanxing Cave and Greenland supports a Northern Hemisphere forcing of the ASM. The anti-phase relationship of δ18O records between Sanxing stalagmites and Antarctic ice cores suggests an additional ASM linkage to the Southern Hemisphere.

Muscle coordination changes during intermittent cycling sprints.

PubMed

Billaut, François; Basset, Fabien A; Falgairette, Guy

2005-06-03

Maximal muscle power is reported to decrease during explosive cyclical exercises owing to metabolic disturbances, muscle damage, and adjustments in the efferent neural command. The aim of the present study was to analyze the influence of inter-muscle coordination in fatigue occurrence during 10 intermittent 6-s cycling sprints, with 30-s recovery through electromyographic activity (EMG). Results showed a decrease in peak power output with sprint repetitions (sprint 1 versus sprint 10: -11%, P<0.01) without any significant modifications in the integrated EMG. The timing between the knee extensor and the flexor EMG activation onsets was reduced in sprint 10 (sprint 1 versus sprint 10: -90.2 ms, P<0.05), owing to an earlier antagonist activation with fatigue occurrence. In conclusion, the maximal power output, developed during intermittent cycling sprints of short duration, decreased possibly due to the inability of muscles to maintain maximal force. This reduction in maximal power output occurred in parallel to changes in the muscle coordination pattern after fatigue.

New therapeutic directions for advanced pancreatic cancer: cell cycle inhibitors, stromal modifiers and conjugated therapies.

PubMed

Matera, Robert; Saif, Muhammad Wasif

2017-09-01

Pancreatic adenocarcinoma is a devastating malignancy with an extremely poor prognosis. These tumors progress rapidly and somewhat silently with few specific symptoms and are relatively resistant to chemotherapeutic agents. Many agents, including cell cycle inhibitors, are under development for the treatment of this cancer for which there are disappointingly few treatment options. Areas covered: Here we outline the existing approved treatments for advanced pancreatic disease and discuss a range of novel therapies currently under development including cell cycle inhibitors, stromal modifiers and conjugated therapies. We also describe the current state of the pancreatic cancer therapeutics market both past and future. Expert opinion: Despite the recent explosion of novel therapies with an array of unique targets, the core treatment of pancreatic cancer still with traditional cytotoxic agents with a few exceptions. However, as these novel treatments move through the pipeline, we are hopeful that there will soon be a number of effective options for patients with advanced pancreatic cancer.

Nonlinear Assessment of Cerebral Autoregulation from Spontaneous Blood Pressure and Cerebral Blood Flow Fluctuations

PubMed Central

Peng, C. K.; Czosnyka, Marek; Zhao, Peng

2009-01-01

Cerebral autoregulation (CA) is an most important mechanism responsible for the relatively constant blood flow supply to brain when cerebral perfusion pressure varies. Its assessment in nonacute cases has been relied on the quantification of the relationship between noninvasive beat-to-beat blood pressure (BP) and blood flow velocity (BFV). To overcome the nonstationary nature of physiological signals such as BP and BFV, a computational method called multimodal pressure-flow (MMPF) analysis was recently developed to study the nonlinear BP–BFV relationship during the Valsalva maneuver (VM). The present study aimed to determine (i) whether this method can estimate autoregulation from spontaneous BP and BFV fluctuations during baseline rest conditions; (ii) whether there is any difference between the MMPF measures of autoregulation based on intra-arterial BP (ABP) and based on cerebral perfusion pressure (CPP); and (iii) whether the MMPF method provides reproducible and reliable measure for noninvasive assessment of autoregulation. To achieve these aims, we analyzed data from existing databases including: (i) ABP and BFV of 12 healthy control, 10 hypertensive, and 10 stroke subjects during baseline resting conditions and during the Valsalva maneuver, and (ii) ABP, CPP, and BFV of 30 patients with traumatic brain injury (TBI) who were being paralyzed, sedated, and ventilated. We showed that autoregulation in healthy control subjects can be characterized by specific phase shifts between BP and BFV oscillations during the Valsalva maneuver, and the BP–BFV phase shifts were reduced in hypertensive and stroke subjects (P < 0.01), indicating impaired autoregulation. Similar results were found during baseline condition from spontaneous BP and BFV oscillations. The BP–BFV phase shifts obtained during baseline and during VM were highly correlated (R > 0.8, P < 0.0001), showing no statistical difference (paired-t test P > 0.47). In TBI patients there were strong correlations between phases of ABP and CPP oscillations (R = 0.99, P < 0.0001) and, thus, between ABP–BFV and CPP–BFV phase shifts (P < 0.0001, R = 0.76). By repeating the MMPF 4 times on data of TBI subjects, each time on a selected cycle of spontaneous BP and BFV oscillations, we showed that MMPF had better reproducibility than traditional autoregulation index. These results indicate that the MMPF method, based on instantaneous phase relationships between cerebral blood flow velocity and peripheral blood pressure, has better performance than the traditional standard method, and can reliably assess cerebral autoregulation dynamics from ambulatory blood pressure and cerebral blood flow during supine rest conditions. PMID:18080758

Hillslope gullying in the Solway Firth — Morecambe Bay region, Great Britain: Responses to human impact and/or climatic deterioration?

NASA Astrophysics Data System (ADS)

Chiverrell, R. C.; Harvey, A. M.; Foster, G. C.

2007-02-01

In the Solway Firth — Morecambe Bay region of Great Britain there is evidence for heightened hillslope instability during the late Holocene (after 3000 cal. BP). Little or no hillslope geomorphic activity has been identified occurring during the early Holocene, but there is abundant evidence for late Holocene hillslope erosion (gullying) and associated alluvial fan and valley floor deposition. Interpretation of the regional radiocarbon chronology available from organic matter buried beneath alluvial fan units suggests much of this geomorphic activity can be attributed to four phases of more extensive gullying identified after 2500-2200, 1300-1000, 1000-800 and 500 cal. BP. Both climate and human impact models can be evoked to explain the crossing of geomorphic thresholds: and palaeoecological data on climatic change (bog surface wetness) and human impact (pollen), together with archaeological and documentary evidence of landscape history, provide a context for addressing the causes of late Holocene geomorphic instability. High magnitude storm events are the primary agent responsible for gully incision, but neither such events nor cooler/wetter climatic episodes appear to have produced gully systems in the region before 3000 cal. BP. Increased gullying after 2500-2200 cal. BP coincides with population expansion during Iron Age and Romano-British times. The widespread and extensive gullying after 1300-1000 cal. BP and after 1000-800 cal. BP coincides with periods of population expansion and a growing rural economy identified during Norse times, 9-10th centuries AD, and during the Medieval Period, 12-13th centuries AD. These periods were separated by a downturn associated with the 'harrying of the north' AD 1069 to 1070. The gullying episode after 500 cal. BP also coincides with increased anthropogenic pressure on the uplands, with population growth and agricultural expansion after AD 1500 following 150 years of malaise caused by livestock and human (the Black Death) plagues, poor harvests and conflicts on the Scottish/English border. The increased susceptibility to erosion of gullies is a response to increased anthropogenic pressure on upland hillslopes during the late Holocene, and the role of this pressure appears crucial in priming hillslopes before subsequent major storm events. In particular, the cycles of expansion and contraction in both population and agriculture appear to have affected the susceptibility of the upland landscape to erosion, and the hillslope gullying record in the region, therefore, contributes to understanding of the timing and spatial pattern of human exploitation of the upland landscape.

Early Holocene Great Salt Lake

USGS Publications Warehouse

Oviatt, Charles G.; Madsen, David B.; Miller, David; Thompson, Robert S.; McGeehin, John P.

2015-01-01

Shorelines and surficial deposits (including buried forest-floor mats and organic-rich wetland sediments) show that Great Salt Lake did not rise higher than modern lake levels during the earliest Holocene (11.5–10.2 cal ka BP; 10–9 14C ka BP). During that period, finely laminated, organic-rich muds (sapropel) containing brine-shrimp cysts and pellets and interbedded sodium-sulfate salts were deposited on the lake floor. Sapropel deposition was probably caused by stratification of the water column — a freshwater cap possibly was formed by groundwater, which had been stored in upland aquifers during the immediately preceding late-Pleistocene deep-lake cycle (Lake Bonneville), and was actively discharging on the basin floor. A climate characterized by low precipitation and runoff, combined with local areas of groundwater discharge in piedmont settings, could explain the apparent conflict between evidence for a shallow lake (a dry climate) and previously published interpretations for a moist climate in the Great Salt Lake basin of the eastern Great Basin.

Historical Isotopic Temperature Record from the Vostok Ice Core (420,000 years BP-present)

DOE Data Explorer

Petit, J. R. [Laboratoire de Glaciogie et Geophysique de l'Environnement; Raynaud, D. [Laboratoire de Glaciogie et Geophysique de l'Environnement; Lorius, C. [Laboratoire de Glaciogie et Geophysique de l'Environnement; Jouzel, J. [Laboratoire des Sciences du Climat et de l'Environnement; Delaygue, G. [Laboratoire des Sciences du Climat et de l'Environnement; Barkov, N. I. [Arctic and Antarctic Research Inst. (AARI), St. Petersburg (Russian Federation); Kotlyakov, V. M. [Institute of Geography, Russia

2000-01-01

Because isotopic fractions of the heavier oxygen-18 (18O) and deuterium (D) in snowfall are temperature-dependent and a strong spatial correlation exists between the annual mean temperature and the mean isotopic ratio (18O or δD) of precipitation, it is possible to derive ice-core climate records. The record presented by Jouzel et al. (1987) was the first ice core record to span a full glacial-interglacial cycle. That record was based on an ice core drilled at the Russian Vostok station in central east Antarctica. The 2083-m ice core was obtained during a series of drillings in the early 1970s and 1980s and was the result of collaboration between French and former-Soviet scientists. Drilling continued at Vostok and was completed in January 1998, reaching a depth of 3623 m, the deepest ice core ever recovered (Petit et al. 1997, 1999). The resulting core allows the ice core record of climate properties at Vostok to be extended to ~420 kyr BP.

Late Pleistocene-Holocene cataclysmic eruptions at Nevado de Toluca and Jocotitlan volcanoes, central Mexico

USGS Publications Warehouse

Macias, J.L.; Garcia, P.A.; Arce, J.L.; Siebe, C.; Espindola, J.M.; Komorowski, J.C.; Scott, K.

1997-01-01

This field guide describes a five day trip to examine deposits of Late Pleistocene-Holocene cataclysmic eruptions at Nevado de Toluca and Jocotitlan volcanoes in central Mexico. We will discuss the stratigraphy, petrology, and sedimentological characteristics of these deposits which provide insights into the eruptive history, type of volcanic activity, and transport and emplacement mechanisms of pyroclastic materials. These parameters will allow us to discuss the kinds of hazards and the risk that they pose to populations around these volcanoes. The area to be visited is tectonically complex thus we will also discuss the location of the volcanoes with respect to the tectonic environment. The first four days of the field trip will be dedicated to Nevado de Toluca Volcano (19 degrees 09'N; 99 degrees 45'W) located at 23 km. southwest of the City of Toluca, and is the fourth highest peak in the country, reaching an elevation of 4,680 meters above sea level (m.a.s.l.). Nevado de Toluca is an andesitic-dacitic stratovolcano, composed of a central vent excavated upon the remains of older craters destroyed by former events. Bloomfield and Valastro, (1974, 1977) concluded that the last cycle of activity occurred nearly equal 11,600 yr. ago. For this reason Nevado de Toluca has been considered an extinct volcano. Our studies, however, indicate that Nevado de Toluca has had at least two episodes of cone destruction by sector collapse as well as several explosive episodes including plinian eruptions and dome-destruction events. These eruptions occurred during the Pleistocene but a very young eruption characterized by surge and ash flows occurred ca. 3,300 yr. BP. This new knowledge of the volcano's eruptive history makes the evaluation of its present state of activity and the geological hazards necessary. This is important because the area is densely populated and large cities such as Toluca and Mexico are located in its proximity.

High resolution climatic variations recorded by mollusk fauna at Nussloch (Rhine valley, Germany) during the last glaciation

NASA Astrophysics Data System (ADS)

Moine, O.; Rousseau, D. D.; Antoine, P.

2003-04-01

Between 31 and 19 kyr B.P. important eolian sediments deposited in Western Europe at Nussloch favored by the enhanced atmospheric circulation at mid-latitudes and large areas of deflation providing quantities of material. The 10m-high studied sequence is composed of an alternation of nine gley-loess cycles deposited in a steppic environment. During gley formations, the climate is less windy, colder and more humid, and the malacofaunas have lower diversity and equitability than during the loess deposition. Top of the gleys is characterized by the thaw of the permafrost, when it is present, and by a demographic explosion of the mollusk fauna. Similar lithological alternations have been evidenced in all the Late Pleistocene deposits in Western Europe. They suggest that global climatic variations had a strong influence on the continental domain in Europe during this interval. Using the GRIP timescale, previously adapted to our loess sequence, we showed that the terrestrial mollusk abundance matches with the d18O of the Greenland ice-core. Thus, the high biological abundances regularly occurring in the sequence is interpreted be related to climate ameliorations. Nevertheless, the system is disturbed in the upper part of the sequence due to a strong increase in local moisture indicated by a decrease in both mollusk species richness and in d13C of the organic matter of the soil, restraining the development of the malacofauna during climatic improvements. The comparison with marine proxies indicates that the composition of the assemblages during the Heinrich 3 event had a higher proportion of semi-open environment species than during Heinrich 2 event, that could suggest a less severe climate. Furthermore, Heinrich 3 event is preceding by few particular assemblages typical of a very cold and humid environment. A strong amount of precipitation could have occurred at this time on the European continent, and could explain the important expansion of the Scandinavian ice-sheet southward just before the Last Glacial Maximum.

Comparative Analysis of Transcriptomes of Macrophage Revealing the Mechanism of the Immunoregulatory Activities of a Novel Polysaccharide Isolated from Boletus speciosus Frost

PubMed Central

Ding, Xiang; Zhu, Hongqing; Hou, Yiling; Hou, Wanru; Zhang, Nan; Fu, Lei

2017-01-01

Background: The mechanism of the immunoregulatory activities of polysaccharide is still not clear. Materials and Methods: Here, we performed the B-cell, T-cell, and macrophage cell proliferation, the cell cycle analysis of macrophage cells, sequenced the transcriptomes of control group macrophages, and Boletus speciosus Frost polysaccharide (BSF-1) group macrophages using Illumina sequencing technology to identify differentially expressed genes (DEGs) to determine the molecular mechanisms of immunomodulatory activity of BSF-1 in macrophages. Results: These results suggested that BSF-1 could promote the proliferation of B-cell, T-cell, and macrophages, promote the proliferation of macrophage cells by abolishing cell cycle arrests in the G0/G1 phases, and promote cell cycle progression in S-phase and G2/M phase, which might induce cell division. A total of 12,498,414 and 11,840,624 bp paired-end reads were obtained for the control group and BSF-1 group, respectively, and they corresponded to a total size of 12.5 G bp and 11.8 G bp, respectively, after the low-quality reads and adapter sequences were removed. Approximately 81.83% of the total number of genes (8,257) were expressed reads per kilobase per million mapped reads (RPKM ≥1) and more than 1366 genes were highly expressed (RPKM >60) in the BSF-1 group. A gene ontology-enrichment analysis generated 13,042 assignments to cellular components, 13,094 assignments to biological processes, and 13,135 assignments to molecular functions. A Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis showed that the mitogen-activated protein kinase (MAPK) signaling pathways are significantly enriched for DEGs between the two cell groups. Conclusion: An analysis of transcriptome resources enabled us to examine gene expression profiles, verify differential gene expression, and select candidate signaling pathways as the mechanisms of the immunomodulatory activity of BSF-1. Based on the experimental data, we believe that the significant antitumor activities of BSF-1 in vivo mainly involve the MAPK signaling pathways. SUMMARY Boletus speciosus Frost-1 (BSF-1) could promote the proliferation of B-cell, T-cell, and macrophages, promote the proliferation of macrophage cells by abolishing cell cycle arrests in the G0/G1 phases, and promote cell cycle progression in S-phase and G2/M phase, which might induce cell divisionApproximately 81.83% of the total number of genes (8257) were expressed (reads per kilobase per million mapped reads [RPKM] =1) and more than 1366 genes were highly expressed (RPKM >60) in the BSF-1 groupA gene ontology-enrichment analysis generated 13,042 assignments to cellular components, 13,094 assignments to biological processes, and 13,135 assignments to molecular functionsA Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis showed that the mitogen-activated protein kinase signaling pathways are significantly enriched for DEGs between the two cell groups. Abbreviations used: BSF-1: Boletus speciosus Frost polysaccharide. PMID:28839373

Subunit interface dynamics in hexadecameric rubisco.

PubMed

van Lun, Michiel; van der Spoel, David; Andersson, Inger

2011-09-02

Ribulose-1,5-bisphosphate (RuBP) carboxylase/oxygenase (Rubisco) plays an important role in the global carbon cycle as a hub for biomass. Rubisco catalyzes not only the carboxylation of RuBP with carbon dioxide but also a competing oxygenation reaction of RuBP with a negative impact on photosynthetic yield. The functional active site is built from two large (L) subunits that form a dimer. The octameric core of four L(2) dimers is held at each end by a cluster of four small (S) subunits, forming a hexadecamer. Each large subunit contacts more than one S subunit. These interactions exploit the dynamic flexibility of Rubisco, which we address in this study. Here, we describe seven different types of interfaces of hexadecameric Rubisco. We have analyzed these interfaces with respect to the size of the interface area and the number of polar interactions, including salt bridges and hydrogen bonds in a variety of Rubisco enzymes from different organisms and different kingdoms of life, including the Rubisco-like proteins. We have also performed molecular dynamics simulations of Rubisco from Chlamydomonas reinhardtii and mutants thereof. From our computational analyses, we propose structural checkpoints of the S subunit to ensure the functionality and/or assembly of the Rubisco holoenzyme. These checkpoints appear to fine-tune the dynamics of the enzyme in a way that could influence enzyme performance. Copyright © 2011 Elsevier Ltd. All rights reserved.

On the identification of a Pliocene time slice for data–model comparison

USGS Publications Warehouse

Haywood, Alan M.; Dolan, Aisling M.; Pickering, Steven J.; Dowsett, Harry J.; McClymont, Erin L.; Prescott, Caroline L.; Salzmann, Ulrich; Hill, Daniel J.; Hunter, Stephen J.; Lunt, Daniel J.; Pope, James O.; Valdes, Paul J.

2013-01-01

The characteristics of the mid-Pliocene warm period (mPWP: 3.264–3.025 Ma BP) have been examined using geological proxies and climate models. While there is agreement between models and data, details of regional climate differ. Uncertainties in prescribed forcings and in proxy data limit the utility of the interval to understand the dynamics of a warmer than present climate or evaluate models. This uncertainty comes, in part, from the reconstruction of a time slab rather than a time slice, where forcings required by climate models can be more adequately constrained. Here, we describe the rationale and approach for identifying a time slice(s) for Pliocene environmental reconstruction. A time slice centred on 3.205 Ma BP (3.204–3.207 Ma BP) has been identified as a priority for investigation. It is a warm interval characterized by a negative benthic oxygen isotope excursion (0.21–0.23‰) centred on marine isotope stage KM5c (KM5.3). It occurred during a period of orbital forcing that was very similar to present day. Climate model simulations indicate that proxy temperature estimates are unlikely to be significantly affected by orbital forcing for at least a precession cycle centred on the time slice, with the North Atlantic potentially being an important exception.

Biochar based remediation of water and soil contaminated by phenanthrene and pentachlorophenol.

PubMed

Rao, Maria A; Di Rauso Simeone, Giuseppe; Scelza, Rosalia; Conte, Pellegrino

2017-11-01

Phenanthrene (Phe) and pentachlorophenol (PCP) are classified as persistent organic pollutants and represent serious concern for the environment as they are toxic and ubiquitous. Biochar based remediation is an emerging technology used in water and soil contamination. In this study we used poplar (BP) and conifer (BC) biochars to remediate water and soil contaminated by Phe and PCP. BP and BC were able to remove completely either Phe or PCP from contaminated water within one to three days. When biochar was confined in a porous membrane, BC and BP maintained their sorption efficiency for several remediation cycles. However, in these conditions BC allowed faster Phe removal. In soil remediation experiments, addition of two biochar rates, i.e. 2.5 and 5 mg g -1 , strongly reduced Phe extractability (up to 2.7% of the initially added Phe with the larger BC dose). This was similar to the behavior observed when compost was applied in order to verify the role of soil organic matter in the fate of both contaminants. PCP extractability was reduced only up to 75% (in average) in all samples including those with compost amendment. Only larger amount of biochar (20 and 50 mg g -1 ) allowed reduction of the extractable PCP and nullified phytotoxicity of the contaminant. Copyright © 2017 Elsevier Ltd. All rights reserved.

Adults with initial metabolic syndrome have altered muscle deoxygenation during incremental exercise.

PubMed

Machado, Alessandro da Costa; Barbosa, Thales Coelho; Kluser Sales, Allan Robson; de Souza, Marcio Nogueira; da Nóbrega, Antonio Claudio Lucas; Silva, Bruno Moreira

2017-02-01

Reduced aerobic power is independently associated with metabolic syndrome (MetS) incidence and prevalence in adults. This study investigated whether muscle deoxygenation (proxy of microvascular O 2 extraction) during incremental exercise is altered in MetS and associated with reduced oxygen consumption ( V˙O 2peak ). Twelve men with initial MetS (no overt diseases and medication-naive; mean ± SD, age 38 ± 7 years) and 12 healthy controls (HCs) (34 ± 7 years) completed an incremental cycling test to exhaustion, in which pulmonary ventilation and gas exchange (metabolic analyzer), as well as vastus lateralis deoxygenation (near infrared spectroscopy), were measured. Subjects with MetS, in contrast to HCs, showed lower V˙O 2peak normalized to total lean mass, similar V˙O 2 response to exercise, and earlier break point (BP) in muscle deoxygenation. Consequently, deoxygenation slope from BP to peak exercise was greater. Furthermore, absolute V˙O 2peak was positively associated with BP in correlations adjusted for total lean mass. MetS, without overt diseases, altered kinetics of muscle deoxygenation during incremental exercise, particularly at high-intensity exercise. Therefore, the balance between utilization and delivery of O 2 within skeletal muscle is impaired early in MetS natural history, which may contribute to the reduction in aerobic power. © 2017 The Obesity Society.

On the identification of a Pliocene time slice for data–model comparison

PubMed Central

Haywood, Alan M.; Dolan, Aisling M.; Pickering, Steven J.; Dowsett, Harry J.; McClymont, Erin L.; Prescott, Caroline L.; Salzmann, Ulrich; Hill, Daniel J.; Hunter, Stephen J.; Lunt, Daniel J.; Pope, James O.; Valdes, Paul J.

2013-01-01

The characteristics of the mid-Pliocene warm period (mPWP: 3.264–3.025 Ma BP) have been examined using geological proxies and climate models. While there is agreement between models and data, details of regional climate differ. Uncertainties in prescribed forcings and in proxy data limit the utility of the interval to understand the dynamics of a warmer than present climate or evaluate models. This uncertainty comes, in part, from the reconstruction of a time slab rather than a time slice, where forcings required by climate models can be more adequately constrained. Here, we describe the rationale and approach for identifying a time slice(s) for Pliocene environmental reconstruction. A time slice centred on 3.205 Ma BP (3.204–3.207 Ma BP) has been identified as a priority for investigation. It is a warm interval characterized by a negative benthic oxygen isotope excursion (0.21–0.23‰) centred on marine isotope stage KM5c (KM5.3). It occurred during a period of orbital forcing that was very similar to present day. Climate model simulations indicate that proxy temperature estimates are unlikely to be significantly affected by orbital forcing for at least a precession cycle centred on the time slice, with the North Atlantic potentially being an important exception. PMID:24043865

Holocene phreatomagmatic eruptions alongside the densely populated northern shoreline of Lake Kivu, East African Rift: timing and hazard implications

NASA Astrophysics Data System (ADS)

Poppe, Sam; Smets, Benoît; Fontijn, Karen; Rukeza, Montfort Bagalwa; De Marie Fikiri Migabo, Antoine; Milungu, Albert Kyambikwa; Namogo, Didier Birimwiragi; Kervyn, François; Kervyn, Matthieu

2016-11-01

The Virunga Volcanic Province (VVP) represents the most active zone of volcanism in the western branch of the East African Rift System. While the VVP's two historically active volcanoes, Nyamulagira and Nyiragongo, have built scoria cones and lava flows in the adjacent lava fields, several small phreatomagmatic eruptive centers lie along Lake Kivu's northern shoreline, highlighting the potential for explosive magma-water interaction. Their presence in the densely urbanized Sake-Goma-Gisenyi area necessitates an assessment of their eruptive mechanisms and chronology. Some of these eruptive centers possess multiple vents, and depositional contacts suggest distinct eruptive phases within a single structure. Depositional facies range from polymict tuff breccia to tuff and loose lapilli, often impacted by blocks and volcanic bombs. Along with the presence of dilute pyroclastic density current (PDC) deposits, indicators of magma-water interaction include the presence of fine palagonitized ash, ash aggregates, cross-bedding, and ballistic impact sags. We estimate that at least 15 phreatomagmatic eruptions occurred in the Holocene, during which Lake Kivu rose to its current water level. Radiocarbon dates of five paleosols in the top of volcanic tuff deposits range between ˜2500 and ˜150 cal. year bp and suggest centennial- to millennial-scale recurrence of phreatomagmatic activity. A vast part of the currently urbanized zone on the northern shoreline of Lake Kivu was most likely impacted by products from phreatomagmatic activity, including PDC events, during the Late Holocene, highlighting the need to consider explosive magma-water interaction as a potential scenario in future risk assessments.

Century to Millennium-Scale Late Quaternary Natural Climate Variability in the Midwestern United States

NASA Astrophysics Data System (ADS)

Jaumann, Peter Josef

1995-01-01

Estimates of past natural climatic variability on long time scales (centuries to millennia) are crucial in testing climate models. The process of model validation takes advantage of long general circulation model (GCM) integrations, instrumental and satellite observations, and paleoclimatic records. Here I use paleoclimatic proxy records from central North America spanning the last 150 ka to characterize climatic variability on sub-orbital time scales. A terrestrial last interglacial (~ 130 to 75 kyr BP) pollen sequence from south-central Illinois, U.S.A., contains climatic variance in frequency bands between 1 cycle/10 kyr and 1 cycle/1 kyr. The temporal variance is best developed as alternating cycles of pollen assemblages indicative of wet and dry conditions. Spectral cross-correlations between selected pollen types and potential forcings (ETP (eccentricity, tilt, precession), SPECMAP delta^{18}O) implicate oceanic and solar processes as possible mechanisms driving last interglacial vegetation and climate change in the Midwestern U.S. During the last glacial stage (LGS; 20 to 16 kyr BP) a lacustrine sequence from the central Mississippi River valley experienced major flooding events caused by intermittent melting of the Laurentide ice sheet. Rock -magnetic and grain size data confirm the physical record of flood clays. Correlation of the flood clays to the Greenland (GRIP) ice core is weak. However, the Laurentide melting events seem to fall temporally between the releases of minor LGS iceberg discharges into the North Atlantic. The GRIP delta^{18}O and the Midwestern U.S. magnetic susceptibility time series indicate sub-Milankovitch climate variability modes. Mapping, multivariate, and time series analyses of Holocene (8 to 1 ka) pollen sequences from central North America suggest spatial patterns of vegetation and climate change on sub-orbital to millennial time scales. The rate, magnitude, and spatial patterns of change varied considerably over the study region. Major climatic variance contained in several well-dated pollen time series ranges between 1 cycle/6 kyr and 1 cycle/0.6 kyr. Singular and cross -spectral analyses, again, suggest solar and oceanic forcing. Although it is difficult to attribute past climatic changes to specific forcings, the geologic record of past global change will prove invaluable in the assessment of long-term future climate change and prediction.

Physical volcanology of the prehistoric Hekla 3 and Hekla 4 eruptions, Iceland.

NASA Astrophysics Data System (ADS)

Stevenson, John; Larsen, Gudrun; Thordarson, Thor

2015-04-01

Hekla is the third most active volcano in Iceland, with 18 eruptions since the island was settled around 871 AD. Furthermore, having produced at least 9 of the 22 most prominent and widely-distributed ash marker layers found in European soils and lakes, it is the primary source of volcanic ash fall within the UK. The Hekla 3 (2879+/-34 14C BP) and Hekla 4 (3826+/-12 14C BP) are the two largest explosive eruptions of the Holocene. Both deposited at least 1 cm tephra over 80% of the surface of Iceland and are important teprochronological markers in Europe. We present the first results from a modern re-evaluation of the eruptions. New isopach maps give freshly-fallen volumes of 11.2 and 13.3 km3 for Hekla 3 and Hekla 4, respectively. This contrasts with previous estimates of 12 and 9 km3. In general, Hekla 4 tephra is notable for being much finer-grained than that from Hekla 3. Hekla 3 can be divided into 3 phases, whose axes rotate from NE to NW as the eruption proceeds. Hekla 4 is divided into 4 phases. The first three phases were deposited to the N, NE and E of Hekla. The fourth, which represents a less powerful but long-lasting eruption of less-evolved 'gunmetal blue' tephra, is dispersed in all directions around the volcano. Ongoing analysis will resolve isopachs, isopleths and plume heights for each phase of both eruptions, leading onto calculation of their total deposit grainsize distributions. Some of these results will be included here.

TBS and BMD at the end of AI-therapy: A prospective study of the B-ABLE cohort.

PubMed

María, Rodríguez-Sanz; Marta, Pineda-Moncusí; Sonia, Servitja; Natalia, Garcia-Giralt; Tamara, Martos; Ignasi, Tusquets; Maria, Martínez-García; Jaime, Rodriguez-Morera; Adolfo, Diez-Perez; Joan, Albanell; Xavier, Nogués

2016-11-01

Patients with breast cancer under aromatase inhibitor (AI) treatment often develop osteoporosis and their average bone loss rate is twice that of natural reduction during menopause, increasing fracture risk. As the current diagnostic technique based on bone mineral density (BMD) provides no information on bone quality, the Trabecular Bone Score (TBS) has been proposed to reflect bone microarchitecture status. The present study was designed to assess prospective changes in TBS and lumbar spine (LS) BMD in postmenopausal women with breast cancer at completion of AI treatment. B-ABLE is a prospective cohort of 735 women with breast cancer treated with AIs according to American Society of Clinical Oncology recommendations: 5years of AI starting within 6weeks post-surgery or 1month after the last cycle of chemotherapy (5y-AI group), or switching to an AI to complete 5-year therapy after 2-3years of tamoxifen (pTMX-AI group). Patients with osteoporosis were treated with oral bisphosphonates (BP). TBS and LS-BMD changes at completion of AI therapy were evaluated by Student t-test for paired samples. Pearson correlation coefficients were computed for correlations between LS-BMD and TBS. AI treatment was completed by 277 women. Of these, 70 (25.3%) were allocated to BP therapy. The non-BP-treated patients (74.7%) showed significant decreases in TBS (-2.94% in pTMX-AI and -2.93% in 5y-AI groups) and in LS-BMD (-4.14% in pTMX-AI and -2.28% in 5y-AI groups) at the end of AI treatment. In BP-treated patients, TBS remained stable at the end of AI treatment, whereas LS-BMD showed significant increases (+2.30% in pTMX-AI and +5.33% in 5y-AI groups). Moderate associations between TBS and LS-BMD values at baseline and at the end of AI treatment (r=0.4; P<0.001) were observed. At the end of treatment, changes in spine BMD and TBS were weakly correlated (r=0.1, P<0.01). AI therapy induces significant decreases in TBS, comparable to BMD loss. BP-treated patients maintained TBS values, whereas BMD increased. AI treatment leads to deterioration of bone microarchitecture, which seems to be attenuated by BP therapy. Copyright © 2016 Elsevier Inc. All rights reserved.

Long-term treatment of bile duct-ligated rats with rapamycin (sirolimus) significantly attenuates liver fibrosis: analysis of the underlying mechanisms.

PubMed

Biecker, Erwin; De Gottardi, Andrea; Neef, Markus; Unternährer, Matthias; Schneider, Vreni; Ledermann, Monika; Sägesser, Hans; Shaw, Sidney; Reichen, Jürg

2005-06-01

Rapamycin is an immunosuppressant with antiproliferative properties. We investigated whether rapamycin treatment of bile duct-ligated (BDL) rats is capable of inhibiting liver fibrosis and thereby affecting hemodynamics. Following BDL, rats were treated for 28 days with rapamycin (BDL SIR). BDL animals without drug treatment (BDL CTR) and sham-operated animals served as controls. After 28 days, hemodynamics were measured, and livers were harvested for histology/immunohistochemistry. Liver mRNA levels of transforming growth factor (TGF)-beta1, connective tissue growth factor (CTGF), platelet-derived growth factor (PDGF)-beta, cyclin-dependent kinase inhibitor p27(kip) (p27), and cyclin-dependent kinase inhibitor p21(WAF1/CIP1) (p21) were quantified by real-time polymerase chain reaction. Liver protein levels of p27, p21, p70 S6 kinase (p70(s6k)), phosphorylated p70(s6k) (p-p70(s6k)), eukaryotic initiation factor 4E-binding protein (4E-BP1), p-4E-BP1 (Thr37/46), and p-4E-BP1 (Ser65/Thr70) were determined by Western blotting. Portal vein pressure was lower in BDL SIR than in BDL CTR animals. Volume fractions of connective tissue, bile duct epithelial, and desmin- and actin-positive cells were lower in BDL SIR than in BDL CTR rats. On the mRNA level, TGF-beta1, CTGF, and PDGF were decreased by rapamycin. p27 and p21 mRNA did not differ. On the protein level, rapamycin increased p27 and decreased p21 levels. Levels of nonphosphorylated p70(s6k) and 4E-BP1 did not vary between groups, but levels of p-p70(s6k) were decreased by rapamycin. Rapamycin had no effect on p-4E-BP1 (Thr37/46) and p-4E-BP1 (Ser65/Thr70) levels. In BDL rats, rapamycin inhibits liver fibrosis and ameliorates portal hypertension. This is paralleled by decreased levels of TGF-beta1, CTGF, and PDGF. Rapamycin influences the cell cycle by up-regulation of p27, down-regulation of p21, and inhibition of p70(s6k) phosphorylation.

Inferences about winter temperatures and summer rains from the late Quaternary record of C4 perennial grasses and C3 desert shrubs in the northern Chihuahuan Desert

USGS Publications Warehouse

Holmgren, Camille A.; Norris, Jodi; Betancourt, Julio L.

2007-01-01

Late Quaternary histories of two North American desert biomes—C4 grasslands and C3 shrublands—are poorly known despite their sensitivity and potential value in reconstructing summer rains and winter temperatures. Plant macrofossil assemblages from packrat midden series in the northern Chihuahuan Desert show that C4 grasses and annuals typical of desert grassland persisted near their present northern limits throughout the last glacial-interglacial cycle. By contrast, key C3 desert shrubs appeared somewhat abruptly after 5000cal.yrBP. Bioclimatic envelopes for select C4 and C3 species are mapped to interpret the glacial-interglacial persistence of desert grassland and the mid-to-late Holocene expansion of desert shrublands. The envelopes suggest relatively warm Pleistocene temperatures with moist summers allowed for persistence of C4 grasses, whereas winters were probably too cold (or too wet) for C3 desert shrubs. Contrary to climate model results, core processes associated with the North American Monsoon and moisture transport to the northern Chihuahuan Desert remained intact throughout the last glacial-interglacial cycle. Mid-latitude effects, however, truncated midsummer (July-August) moisture transport north of 35° N. The sudden expansion of desert shrublands after 5000cal.yrBP may be a threshold response to warmer winters associated with increasing boreal winter insolation, and enhanced El Niño-Southern Oscillation variability.

Combining charcoal and elemental black carbon analysis in sedimentary archives: Implications for past fire regimes, the pyrogenic carbon cycle, and the human-climate interactions

NASA Astrophysics Data System (ADS)

Thevenon, Florian; Williamson, David; Bard, Edouard; Anselmetti, Flavio S.; Beaufort, Luc; Cachier, Hélène

2010-07-01

This paper addresses the quantification of combustion-derived products in oceanic and continental sediments by optical and chemical approaches, and the interest of combining such methods for reconstructing past biomass burning activity and the pyrogenic carbon cycle. In such context, the dark particles > 0.2 µm 2 remaining after the partial digestion of organic matter are optically counted by automated image analysis and defined as charcoal, while the elemental carbon remaining after thermal and chemical oxidative treatments is quantified as black carbon (BC). The obtained pyrogenic carbon records from three sediment core-based case studies, (i) the Late Pleistocene equatorial Pacific Ocean, (ii) the mid-Holocene European Lake Lucerne, and (iii) the Late Holocene African Lake Masoko, are interpreted as proxy records of regional transportation mechanisms and biomass burning activities. The results show that the burial of dark carbon-rich particles in the 360 kyr-long record from the west equatorial Pacific is controlled by the combination of sea-level changes and low-latitude atmospheric circulation patterns (summer monsoon dynamics). However, the three fold increases in charcoal and BC sediment influxes between 53-43 and 12-10 kyr BP suggest that major shifts in fire activity occur synchronously with human colonization in the Indo/Pacific region. The coarse charcoal distribution from a 7.2 kyr record from Lake Lucerne in Switzerland closely matches the regional timing of major technical, land-use, and socio-economic changes during the Neolithic (between ca. 5.7 and 5.2 kyr BP and 4.9-4.5 kyr BP), the Bronze and Iron Ages (at ca. 3.3 and 2.4 kyr BP, respectively), and the industrialization (after AD 1838), pointing to the key impact of human activities on the sources, transportation processes and reservoirs of refractory carbon during the Holocene. In the tropical Masoko maar lake in Tanzania, where charcoal and BC records are highly sensitive to the local climate and environment, surface runoffs from forested areas and/or aerial transportation over short distances are also important sources for detrital charred particles. However, this 4.3 kyr-long record exhibits a major increase in charcoal and BC sediment influxes between 1.8 and 0.6 kyr BP, synchronously with the regional extent of Late Iron Age and agricultural innovations. Therefore, in both marine and terrestrial depositional environments, the climate- and vegetation-controlled fire regimes appear to be strongly associated to societal changes, or directly affected by human practices. In fact, the anthropogenic effect associated to past human activities (e.g. settlement, agriculture, and metallurgy) has temporarily at least tripled the emissions of pyrogenic carbon in the environment. However, the data from the three Late Pleistocene to Holocene sequences also show that the redistribution of fossil particles by runoff and erosion processes is a significant source of pyrogenic carbon that should be understood as a prerequisite for interpreting sedimentary records of biomass burning.

Marked genetic divergence among sky island populations of Sedum lanceolatum (Crassulaceae) in the Rocky Mountains.

PubMed

Dechaine, Eric G; Martin, Andrew P

2005-03-01

Climate change during the Quaternary played an important role in the differentiation and evolution of plants. A prevailing hypothesis is that alpine and arctic species survived glacial periods in refugia at the periphery of glaciers. Though the Rocky Mountains, south of the southernmost extent of continental ice, served as an important glacial refuge, little is known about how climate cycles influenced populations within this region. We inferred the phylogeography of Sedum lanceolatum (Crassulaceae) within the Rocky Mountain refugium to assess how this high-elevation plant responded to glacial cycles. We sequenced 884 base pairs (bp) of cpDNA intergenic spacers (tRNA-L to tRNA-F and tRNA-S to tRNA-G) for 333 individuals from 18 alpine populations. Our highly variable markers allowed us to infer that populations persisted across the latitudinal range throughout the climate cycles, exhibited significant genetic structure, and experienced cycles of range expansion and fragmentation. Genetic differentiation in S. lanceolatum was most likely a product of short-distance elevational migration in response to climate change, low seed dispersal, and vegetative reproduction. To the extent that Sedum is a good model system, paleoclimatic cycles were probably a major factor preserving genetic variation and promoting divergence in high-elevation flora of the Rocky Mountains.

Maturity Gonad Sea Cucumber Holothuria scabra Under The Month Cycle

NASA Astrophysics Data System (ADS)

Penina Tua Rahantoknam, Santi

2017-10-01

Gonad maturity level of the sea cucumber Holothuria scabra is important to note for selection of parent ready spawn. Sea cucumbers are giving a reaction to the treatment of excitatory spawn mature individuals only. For the determination of the level of maturity of gonads of sea cucumbers, the necessary observation of the gonads are microscopic, macroscopic and gonad maturity gonado somatic indeks (GSI). GSI value is important to know the changes that occur in the gonads quantitatively, so that time can be presumed spawning (Effendie, 1997). Reproductive cycle can be determined by observing the evolution of GSI. The study of sea cucumbers Holothuria scabra gonad maturity conducted in Langgur, Southeast Maluku. Observations were made at every cycle of the moon is the full moon phase (BP) and new moon (BB) in the period January 29, 2017 until July 23, 2017. Observations H. scabra gonad maturity level is done with surgery, observation and calculation GSI gonad histology. GSI highest value obtained in May that full moon cycle at 90% of individuals that are in the spawning stage (phase 5), then 70% of the individuals that are in the spawning stage (phase 5) in March that the full moon cycle. The results obtained show that the peak spawning H. scabra period January 2017 to July 2017 occurred on the full moon cycle in May.

Making an IMPAKT; Improving care of Chronic Kidney Disease patients in the community through collaborative working and utilizing Information Technology.

PubMed

Xu, Gang; Major, Rupert; Shepherd, David; Brunskill, Nigel

2017-01-01

Chronic kidney disease (CKD) is a serious long-term condition, which if left untreated causes significant cardiovascular sequele. It is well recognized management of modifiable risk factors, such as blood pressure (BP), can lead to improved long-term outcomes. A novel information technology (IT) solution presents a possible solution to help clinicians in the community identify and manage at risk patients more efficiently. The IMproving Patient care and Awareness of Kidney disease progression Together (IMPAKT) IT tool was used to identify patients with CKD and uncontrolled hypertension in the community. A CKD nurse utilized the tool at primary care practices to identify patients who warranted potential intervention and disseminated this information to clinical staff. Blood pressure management targets and incidence of coded CKD were used to evaluate the project. Altogether 48 practices participated in an 18 month project from April 2014, and data from 20 practices, with a total adult population of 121,362, was available for analysis. Two full consecutive QI (Quality Improvement) audit cycles were completed. There was an increase in the mean recorded prevalence of coded CKD patients over the course of the project. Similarly, there was an increase in the percentage of patients with BP been recorded and importantly there was an accompanying significant increase in CKD patients achieving BP targets. At the end of the project an additional 345 individuals with CKD achieved better blood pressure control. This could potentially prevent 9 cardiovascular events in the CKD group, translating to a cost saving of £320,000 for the 20 practices involved. The most significant change in clinical markers occurred during cycle 1 of the audit, the improvement was maintained throughout cycle 2 of the audit. Our results show the real-life clinical impact of a relatively simple and easy to implement QI project, to help improve outcomes in patients with CKD. This was achieved through more efficient working by targeting of high-risk groups, and improved communication between primary/secondary care. The project could be adapted for other chronic disease conditions. Despite the recorded improvements in blood pressure management, a large proportion of high-risk patients remained above ideal blood pressure, additional interventions in this area need to be explored. Through collaborative and multi-professional working and utilizing IT resources, we have shown it is possible to deliver measurable and sustainable improvements in blood pressure control for patients with CKD in a real life clinical setting.

Differences in physical fitness and throwing velocity among elite and amateur male handball players.

PubMed

Gorostiaga, E M; Granados, C; Ibáñez, J; Izquierdo, M

2005-04-01

This study compared physical characteristics (body height, body mass [BM], body fat [BF], and free fatty mass [FFM]), one repetition maximum bench-press (1RM (BP)), jumping explosive strength (VJ), handball throwing velocity, power-load relationship of the leg and arm extensor muscles, 5- and 15-m sprint running time, and running endurance in two handball male teams: elite team, one of the world's leading teams (EM, n = 15) and amateur team, playing in the Spanish National Second Division (AM, n = 15). EM had similar values in body height, BF, VJ, 5- and 15-m sprint running time and running endurance than AM. However, the EM group gave higher values in BM (95.2 +/- 13 kg vs. 82.4 +/- 10 kg, p < 0.05), FFM (81.7 +/- 9 kg vs. 72.4 +/- 7 kg, p < 0.05), 1RM (BP) (107 +/- 12 kg vs. 83 +/- 10 kg, p < 0.001), muscle power during bench-press (18 - 21 %, p < 0.05) and half squat (13 - 17 %), and throwing velocities at standing (23.8 +/- 1.9 m . s (-1) vs. 21.8 +/- 1.6 m . s (-1), p < 0.05) and 3-step running (25.3 +/- 2.2 m . s (-1) vs. 22.9 +/- 1.4 m . s (-1), p < 0.05) actions than the AM group. Significant correlations (r = 0.67 - 0.71, p < 0.05 - 0.01) were observed in EM and AM between individual values of velocity at 30 % of 1RM (BP) and individual values of ball velocity during a standing throw. Significant correlations were observed in EM, but not in AM, between the individual values of velocity during 3-step running throw and the individual values of velocity at 30 % of 1RM (BP) (r = 0.72, p < 0.05), as well as the individual values of power at 100 % of body mass during half-squat actions (r = 0.62, p < 0.05). The present results suggest that more muscular and powerful players are at an advantage in handball. The differences observed in free fatty mass could partly explain the differences observed between groups in absolute maximal strength and muscle power. In EM, higher efficiency in handball throwing velocity may be associated with both upper and lower extremity power output capabilities, whereas in AM this relationship may be different. Endurance capacity does not seem to represent a limitation for elite performance in handball.

The ~ 2500 yr B.P. Chicoral non-cohesive debris flow from Cerro Machín Volcano, Colombia

NASA Astrophysics Data System (ADS)

Murcia, H. F.; Hurtado, B. O.; Cortés, G. P.; Macías, J. L.; Cepeda, H.

2008-04-01

Cerro Machín Volcano (CMV) is located in the central part of the Colombian Andes (2750 m asl), 150 km southwest of Bogotá. It is considered the most dangerous active volcano of Colombia. CMV has experienced at least six major explosive eruptions during the last 5000 years. These eruptions have emplaced many types of pyroclastic deposits with associated lahars that have traveled more than 100 km. One of these lahars is called Chicoral Debris Flow Deposit (DFD2). This deposit is exposed as discontinuous terraces (3-20 m thick) along the Coello and Magdalena rivers up to 109 km from the source. The DFD2 covers a minimum area of 62 km 2 and has a minimum volume of 0.57 km 3. It comprises two dacite-rich volcaniclastic units. Grain-size analysis reveals that the matrix content and sorting increase with distance while the average grain size decreases. The clay content of the DFD2 matrix is approximately 1%, thus categorizing it as a non-cohesive debris flow. Radiocarbon dates obtained from underlying and overlying paleosols yielded ages of 2505 + 65 and 1640 + 45 yr B.P., respectively. These dates suggest that DFD2 is related to the ~ 2600 yr B.P. El Guaico eruption of CMV. This eruption produced a block-and-ash flow that filled and blocked the Toche River up to 5 km from the volcano. Subsequent remobilization of this loose material by runoff water generated a massive debris flow that traveled 91 km along the Toche and Coello rivers and continued across the Espinal Alluvial Fan debouching into the Magdalena River where it continued another 18 km prior to its transformation into a sediment-laden flow. Because the last eruption of the volcano occurred ca. 900 years ago, no historic activity of CMV is known among inhabitants of the region. Hence the region has developed without awareness of volcanic hazards. Therefore an assessment of volcanic hazards is essential for understanding and evaluating the vulnerability and risk to which people are exposed in case of a future eruption. Such assessment is critical for urban planning, development, contingency, emergency and education planning.

Sunspots, Space Weather and Climate

NASA Technical Reports Server (NTRS)

Hathaway, David H.

2009-01-01

Four hundred years ago this year the telescope was first used for astronomical observations. Within a year, Galileo in Italy and Harriot in England reported seeing spots on the surface of the Sun. Yet, it took over 230 years of observations before a Swiss amateur astronomer noticed that the sunspots increased and decreased in number over a period of about 11 years. Within 15 years of this discovery of the sunspot cycle astronomers made the first observations of a flare on the surface of the Sun. In the 150 years since that discovery we have learned much about sunspots, the sunspot cycle, and the Sun s explosive events - solar flares, prominence eruptions and coronal mass ejections that usually accompany the sunspots. These events produce what is called Space Weather. The conditions in space are dramatically affected by these events. Space Weather can damage our satellites, harm our astronauts, and affect our lives here on the surface of planet Earth. Long term changes in the sunspot cycle have been linked to changes in our climate as well. In this public lecture I will give an introduction to sunspots, the sunspot cycle, space weather, and the possible impact of solar variability on our climate.

Adding the Third Dimension to Virus Life Cycles: Three-Dimensional Reconstruction of Icosahedral Viruses from Cryo-Electron Micrographs

PubMed Central

Baker, T. S.; Olson, N. H.; Fuller, S. D.

1999-01-01

Viruses are cellular parasites. The linkage between viral and host functions makes the study of a viral life cycle an important key to cellular functions. A deeper understanding of many aspects of viral life cycles has emerged from coordinated molecular and structural studies carried out with a wide range of viral pathogens. Structural studies of viruses by means of cryo-electron microscopy and three-dimensional image reconstruction methods have grown explosively in the last decade. Here we review the use of cryo-electron microscopy for the determination of the structures of a number of icosahedral viruses. These studies span more than 20 virus families. Representative examples illustrate the use of moderate- to low-resolution (7- to 35-Å) structural analyses to illuminate functional aspects of viral life cycles including host recognition, viral attachment, entry, genome release, viral transcription, translation, proassembly, maturation, release, and transmission, as well as mechanisms of host defense. The success of cryo-electron microscopy in combination with three-dimensional image reconstruction for icosahedral viruses provides a firm foundation for future explorations of more-complex viral pathogens, including the vast number that are nonspherical or nonsymmetrical. PMID:10585969

49 CFR 172.522 - EXPLOSIVES 1.1, EXPLOSIVES 1.2 and EXPLOSIVES 1.3 placards.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false EXPLOSIVES 1.1, EXPLOSIVES 1.2 and EXPLOSIVES 1.3... INFORMATION, TRAINING REQUIREMENTS, AND SECURITY PLANS Placarding § 172.522 EXPLOSIVES 1.1, EXPLOSIVES 1.2 and EXPLOSIVES 1.3 placards. (a) Except for size and color, the EXPLOSIVES 1.1, EXPLOSIVES 1.2 and EXPLOSIVES 1.3...

49 CFR 172.522 - EXPLOSIVES 1.1, EXPLOSIVES 1.2 and EXPLOSIVES 1.3 placards.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 49 Transportation 2 2011-10-01 2011-10-01 false EXPLOSIVES 1.1, EXPLOSIVES 1.2 and EXPLOSIVES 1.3... INFORMATION, TRAINING REQUIREMENTS, AND SECURITY PLANS Placarding § 172.522 EXPLOSIVES 1.1, EXPLOSIVES 1.2 and EXPLOSIVES 1.3 placards. (a) Except for size and color, the EXPLOSIVES 1.1, EXPLOSIVES 1.2 and EXPLOSIVES 1.3...

The Influence of Directed Air Flow on Combustion in Spark-Ignition Engine

NASA Technical Reports Server (NTRS)

Rothrock, A M; Spencer, R C

1939-01-01

The air movement within the cylinder of the NACA combustion apparatus was regulated by using shrouded inlet valves and by fairing the inlet passage. Rates of combustion were determined at different inlet-air velocities with the engine speed maintained constant and at different engine speeds with the inlet-air velocity maintained approximately constant. The rate of combustion increased when the engine speed was doubled without changing the inlet-air velocity; the observed increase was about the same as the increase in the rate of combustion obtained by doubling the inlet-air velocity without changing the engine speed. Certain types of directed air movement gave great improvement in the reproducibility of the explosions from cycle to cycle, provided that other variables were controlled. Directing the inlet air past the injection valve during injection increased the rate of burning.

Teleseismic Lg of Semipalatinsk and Novaya Zemlya Nuclear Explosions Recorded by the GRF (Gräfenberg) Array: Comparison with Regional Lg (BRV) and their Potential for Accurate Yield Estimation

NASA Astrophysics Data System (ADS)

Schlittenhardt, J.

- A comparison of regional and teleseismic log rms (root-mean-square) Lg amplitude measurements have been made for 14 underground nuclear explosions from the East Kazakh test site recorded both by the BRV (Borovoye) station in Kazakhstan and the GRF (Gräfenberg) array in Germany. The log rms Lg amplitudes observed at the BRV regional station at a distance of 690km and at the teleseismic GRF array at a distance exceeding 4700km show very similar relative values (standard deviation 0.048 magnitude units) for underground explosions of different sizes at the Shagan River test site. This result as well as the comparison of BRV rms Lg magnitudes (which were calculated from the log rms amplitudes using an appropriate calibration) with magnitude determinations for P waves of global seismic networks (standard deviation 0.054 magnitude units) point to a high precision in estimating the relative source sizes of explosions from Lg-based single station data. Similar results were also obtained by other investigators (Patton, 1988; Ringdaletal., 1992) using Lg data from different stations at different distances.Additionally, GRF log rms Lg and P-coda amplitude measurements were made for a larger data set from Novaya Zemlya and East Kazakh explosions, which were supplemented with mb(Lg) amplitude measurements using a modified version of Nuttli's (1973, 1986a) method. From this test of the relative performance of the three different magnitude scales, it was found that the Lg and P-coda based magnitudes performed equally well, whereas the modified Nuttli mb(Lg) magnitudes show greater scatter when compared to the worldwide mb reference magnitudes. Whether this result indicates that the rms amplitude measurements are superior to the zero-to-peak amplitude measurement of a single cycle used for the modified Nuttli method, however, cannot be finally assessed, since the calculated mb(Lg) magnitudes are only preliminary until appropriate attenuation corrections are available for the specific path to GRF.

Major, trace element and isotope geochemistry (Sr-Nd-Pb) of interplinian magmas from Mt. Somma-Vesuvius (Southern Italy)

USGS Publications Warehouse

Somma, R.; Ayuso, R.A.; de Vivo, B.; Rolandi, G.

2001-01-01

Major, trace element and isotopic (Sr, Nd, Pb) data are reported for representative samples of interplinian (Protohistoric, Ancient Historic and Medieval Formations) activity of Mt. Somma-Vesuvius volcano during the last 3500 years. Tephra and lavas exhibit significant major, trace element and isotopic variations. Integration of these data with those obtained by previous studies on the older Somma suites and on the latest activity, allows to better trace a complete petrological and geochemical evolution of the Mt. Somma-Vesuvius magmatism. Three main groups of rocks are recognized. A first group is older than 12.000 yrs, and includes effusive-explosive activity of Mt. Somma. The second group (8000-2700 yrs B.P.) includes the products emitted by the Ottaviano (8000 yrs. B.P.) and Avellino (3550 yrs B.P.) plinian eruptions and the interplinian activity associated with the Protohistoric Formation. Ancient Historic Formation (79-472 A.D.), Medieval Formation (472-1139 A.D.) and Recent interplinian activity (1631-1944 A.D.) belong to the third group of activity (79-1944 A.D.). The three groups of rocks display distinct positive trends of alkalis vs. silica, which become increasingly steeper with age. In the first group there is an increase in silica and alkalis with time, whereas an opposite tendency is observed in the two younger groups. Systematic variations are also evident among the incompatible (Pb, Zr, Hf, Ta, Th, U, Nb, Rb, Cs, Ba) and compatible elements (Sr, Co, Cr). REE document variable degrees of fractionation, with recent activity displaying higher La/Yb ratios than Medieval and Ancient Historic products with the same degree of evolution. N-MORB normalized multi-element diagrams for interplinian rocks show enrichment in Rb, Th, Nb, Zr and Sm (> *10 N-MORB). Sr isotope ratios are variable, with Protohistoric rocks displaying 87Sr/86Sr= 0.70711-0.70810, Ancient Historic 87Sr/86Sr=0.70665-0.70729, and Medieval 87Sr/86Sr=0.70685-0.70803. Neodymium isotopic compositions in the interplinian rocks show a tendency to become slightly more radiogenic with age, from the Protohistoric (143Nd/144Nd=0.51240-0.51247) to Ancient Historic (143Nd/144Nd=0.51245-0.51251). Medieval interplinian activity (143Nd/144Nd: 0.51250-0.51241) lacks meaningful internal trends. All the interplinian rocks have virtually homogeneous compositions of 207Pb/204Pb and 208Pb/204Pb in acid-leached residues (207Pb/204Pb ???15.633 to 15.687, 208Pb/204Pb ???38.947 to 39.181). Values of 206Pb/204Pb are very distinctive, however, and discriminate among the three interplinian cycles of activity (Protohistoric: 18.929-18.971, Ancient Historic: 19.018-19.088, Medieval: 18.964-19.053). Compositional trends of major, trace element and isotopic compositions clearly demonstrate strong temporal variations of the magma types feeding the Somma-Vesuvius activity. These different trends are unlikely to be related only to low pressure evolutionary processes, and reveal variations of parental melt composition. Geochemical data suggest a three component mixing scheme for the interplinian activity. These involve HIMU-type and DMM-type mantle and Calabrian-type lower crust. Interaction between these components has taken place in the source; however, additional quantitative constraints must be acquired in order to better discriminate between magma characteristics inherited from the sources and those acquired during shallow level evolution.

Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points

PubMed Central

Miga, Karen H.; Sekulic, Nikolina; Soni, Gautam V.; Kim, Dong Hyun; Wong, Adeline K.; Lee, Ah Young; Nguyen, Kristen; Dekker, Cees; Ren, Bing; Black, Ben E.

2017-01-01

Chromatin assembled with centromere protein A (CENP-A) is the epigenetic mark of centromere identity. Using new reference models, we now identify sites of CENP-A and histone H3.1 binding within the megabase, α-satellite repeat–containing centromeres of 23 human chromosomes. The overwhelming majority (97%) of α-satellite DNA is found to be assembled with histone H3.1–containing nucleosomes with wrapped DNA termini. In both G1 and G2 cell cycle phases, the 2–4% of α-satellite assembled with CENP-A protects DNA lengths centered on 133 bp, consistent with octameric nucleosomes with DNA unwrapping at entry and exit. CENP-A chromatin is shown to contain equimolar amounts of CENP-A and histones H2A, H2B, and H4, with no H3. Solid-state nanopore analyses show it to be nucleosomal in size. Thus, in contrast to models for hemisomes that briefly transition to octameric nucleosomes at specific cell cycle points or heterotypic nucleosomes containing both CENP-A and histone H3, human CENP-A chromatin complexes are octameric nucleosomes with two molecules of CENP-A at all cell cycle phases. PMID:28235947

Explosively Joining Dissimilar Metal Tubes.

DTIC Science & Technology

1979-11-01

specimens were tested in axial tension-tension fatigue in a Satec high cycle fatigue test machine at 30 Hz. The applied max stress for each test was...BACK CHIP A3 ROTARY FILE ,S AR .STO P9 WIRE BRUSH y es IDENTIFY {STEEL STAMP) N INSPECT ICA) YES GRIND WEtD [LEID k R IJ CA/S. BASE METAL PPEPARATION...Type: Dog bone Test Equipment: Satec SF-1U-1099 Specimen Max. Static Dynamic F a i1 u r e Width Thickness i(No.) Stress Stress Stress(KS0 (KSI) (KSI

Transition to Double Mach Stem for Nuclear Explosion at 104 ft Height of Burst.

DTIC Science & Technology

1981-11-17

P ROIS, 0 L BOOK UNCLASS II D NP.l--4630Mhhnnmmmnmhunm *uunummmummuuuu EllllIhllllllIIIIIIIII VA . L, BOK -- Wotk~ ~ ~ hit ftIlum Zsm Noe4be 01 NOV1...resolved on the mesh. By the time it occupies a region of 15 cells high and 35 cells wide, the peak pressures are in good agreement with the HE data and...2800 3220 2800 32 RADIUS- cm RADIUS -cm 35 1 kt AT 104 f t HOB TIME =5.47 nisec CYCLE= 5400 PRESSURE VELOC IT Y 350

Control Technology for Depainting Operations: Estimation of Life-Cycle Costs of Controlling Methylene Chloride in Aircraft-Depainting Operations Versus Alternative Processes

DTIC Science & Technology

1997-11-24

2343 Calle Del Mundo Santa Clara, CA 95054-1008 Tel.: (408)727-8282 POC: J. A. Gotterba Durr Industries Environmental Systems Division 40600...1) LESS THAN 1 IV. FIRE AND EXPLOSION DATA FLASH POINT (TEST METHOD) ABOVE 200*P AUTO IGNITION ABOVE TEMPERATURE iJfJO’P...IST METHOD, ?oo.._r T,CCT CxriNOUISHINO Mt 01A WATER AUTO IGNITION ABOVB I rLAM**BLt »•’•’"’• TEMPERATURE ^QQly | IN AIR

Tephra from andesitic Shiveluch volcano, Kamchatka, NW Pacific: chronology of explosive eruptions and geochemical fingerprinting of volcanic glass

NASA Astrophysics Data System (ADS)

Ponomareva, Vera; Portnyagin, Maxim; Pevzner, Maria; Blaauw, Maarten; Kyle, Philip; Derkachev, Alexander

2015-07-01

The ~16-ka-long record of explosive eruptions from Shiveluch volcano (Kamchatka, NW Pacific) is refined using geochemical fingerprinting of tephra and radiocarbon ages. Volcanic glass from 77 prominent Holocene tephras and four Late Glacial tephra packages was analyzed by electron microprobe. Eruption ages were estimated using 113 radiocarbon dates for proximal tephra sequence. These radiocarbon dates were combined with 76 dates for regional Kamchatka marker tephra layers into a single Bayesian framework taking into account the stratigraphic ordering within and between the sites. As a result, we report ~1,700 high-quality glass analyses from Late Glacial-Holocene Shiveluch eruptions of known ages. These define the magmatic evolution of the volcano and provide a reference for correlations with distal fall deposits. Shiveluch tephras represent two major types of magmas, which have been feeding the volcano during the Late Glacial-Holocene time: Baidarny basaltic andesites and Young Shiveluch andesites. Baidarny tephras erupted mostly during the Late Glacial time (~16-12.8 ka BP) but persisted into the Holocene as subordinate admixture to the prevailing Young Shiveluch andesitic tephras (~12.7 ka BP-present). Baidarny basaltic andesite tephras have trachyandesite and trachydacite (SiO2 < 71.5 wt%) glasses. The Young Shiveluch andesite tephras have rhyolitic glasses (SiO2 > 71.5 wt%). Strongly calc-alkaline medium-K characteristics of Shiveluch volcanic glasses along with moderate Cl, CaO and low P2O5 contents permit reliable discrimination of Shiveluch tephras from the majority of other large Holocene tephras of Kamchatka. The Young Shiveluch glasses exhibit wave-like variations in SiO2 contents through time that may reflect alternating periods of high and low frequency/volume of magma supply to deep magma reservoirs beneath the volcano. The compositional variability of Shiveluch glass allows geochemical fingerprinting of individual Shiveluch tephra layers which along with age estimates facilitates their use as a dating tool in paleovolcanological, paleoseismological, paleoenvironmental and archeological studies. Electronic tables accompanying this work offer a tool for statistical correlation of unknown tephras with proximal Shiveluch units taking into account sectors of actual tephra dispersal, eruption size and expected age. Several examples illustrate the effectiveness of the new database. The data are used to assign a few previously enigmatic wide-spread tephras to particular Shiveluch eruptions. Our finding of Shiveluch tephras in sediment cores in the Bering Sea at a distance of ~600 km from the source permits re-assessment of the maximum dispersal distances for Shiveluch tephras and provides links between terrestrial and marine paleoenvironmental records.

The biogeophysical climatic impacts of anthropogenic land use change during the Holocene

NASA Astrophysics Data System (ADS)

Smith, M. C.; Singarayer, J. S.; Valdes, P. J.; Kaplan, J. O.; Branch, N. P.

2015-10-01

The first agricultural societies were established around 10 ka BP and had spread across much of Europe and southern Asia by 5.5 ka BP with resultant anthropogenic deforestation for crop and pasture land. Various studies have attempted to assess the biogeochemical implications for Holocene climate in terms of increased carbon dioxide and methane emissions. However, less work has been done to examine the biogeophysical impacts of this early land use change. In this study, global climate model simulations with HadCM3 were used to examine the biogeophysical effects of Holocene land cover change on climate, both globally and regionally, from the early Holocene (8 ka BP) to the early industrial era (1850 CE). Two experiments were performed with alternative descriptions of past vegetation: (i) potential natural vegetation simulated by TRIFFID but no land-use changes, and (ii) where the anthropogenic land use model, KK10 (Kaplan et al., 2009, 2011) has been used to set the HadCM3 crop regions. Snapshot simulations have been run at 1000 year intervals to examine when the first signature of anthropogenic climate change can be detected both regionally, in the areas of land use change, and globally. Results indicate that in regions of early land disturbance such as Europe and S.E. Asia detectable temperature changes, outside the normal range of variability, are encountered in the model as early as 7 ka BP in the June/July/August (JJA) season and throughout the entire annual cycle by 2-3 ka BP. Areas outside the regions of land disturbance are also affected, with virtually the whole globe experiencing significant temperature changes (predominantly cooling) by the early industrial period. Large-scale precipitation features such as the Indian monsoon, the intertropical convergence zone (ITCZ), and the North Atlantic storm track are also impacted by local land use and remote teleconnections. We investigated how advection by surface winds, mean sea level pressure (MSLP) anomalies, and tropospheric stationary wave train disturbances in the mid- to high-latitudes led to remote teleconnections.

Quadriceps Muscles O2 Extraction and EMG Breakpoints during a Ramp Incremental Test

PubMed Central

Iannetta, Danilo; Qahtani, Ahmad; Millet, Guillaume Y.; Murias, Juan M.

2017-01-01

Muscle deoxygenated breakpoint ([HHb]BP) has been found to be associated with other indices of exercise tolerance in the vastus lateralis (VL) muscle but not in the vastus medialis (VM) and rectus femoris (RF). Purpose: To investigate whether the [HHb]BP occurs also in the VM and RF muscles and whether or not it is associated with other physiological indices of exercise tolerance, such as the EMG threshold (EMGt) and the respiratory compensation point (RCP). Methods: Twelve young endurance trained participants performed maximal ramp incremental (RI) cycling tests (25–30 W·min−1 increments). Muscle oxygen extraction and activity as well as ventilatory and gas exchange parameters were measured. After accounting for the mean response time, the oxygen uptake (V·O2) corresponding to the RCP, [HHb]BP, and the EMGt was determined. Results: Peak power output (POpeak) was 359 ± 48 W. Maximal oxygen consumption (V·O2max) was 3.87 ± 0.46 L·min−1. The V·O2 at the RCP was 3.39 ± 0.41 L·min−1. The V·O2 (L·min−1) corresponding to the [HHb]BP and EMGt were: 3.49 ± 0.46 and 3.40 ± 0.44; 3.44 ± 0.61 and 3.43 ± 0.49; 3.59 ± 0.52, and 3.48 ± 0.46 for VL, VM, and RF, respectively. Pearson's correlation between these thresholds ranged from 0.90 to 0.97 (P < 0.05). No difference was found for the absolute V·O2 and the normalized PO (%) at which the thresholds occurred in all three muscles investigated (P > 0.05). Although in eight out of 12 participants, the [HHb]BP in the RF led to a steeper increase instead of leading to a plateau-like response as observed in the VL and VM, the V·O2 at the breakpoints still coincided with that at the RCP. Conclusions: This study demonstrated that local indices of exercise tolerance derived from different portions of the quadriceps are not different to the systemic index of the RCP. PMID:28970805

The alpha-adducin Gly460Trp polymorphism and the antihypertensive effects of exercise among men with high blood pressure.

PubMed

Pescatello, Linda S; Blanchard, Bruce E; Tsongalis, Gregory J; Maresh, Carl M; O'Connell, Ann; Thompson, Paul D

2007-09-01

The alpha-adducin Gly460Trp polymorphism alters renal sodium transport and is associated with hypertension. Despite the immediate sodium- and volume-depleting effects of aerobic exercise, the influence of the alpha-adducin Gly460Trp polymorphism on PEH (postexercise hypotension) has not been studied. In the present study we examined the effects of the alpha-adducin Gly460Trp polymorphism on PEH among 48 men (42.6+/-1.6 years; mean+/-S.E.M.) with high BP (blood pressure; 144.0+/-1.7/84.7+/-1.1 mmHg). Subjects completed three experiments: non-exercise control and two cycle exercise sessions at 40% (light exercise) and 60% (moderate exercise) of maximal oxygen consumption. Subjects left the laboratory wearing an ambulatory BP monitor. PCR and restriction enzyme digestion determined the genotypes. No subjects had the Trp460Trp genotype due to the low frequency of 5% in the population. Repeated measure ANCOVA tested whether BP differed over time between experimental conditions and genotypes (Gly460Gly, n=36; Gly460Trp, n=12). Among Gly460Gly genotypes, SBP (systolic BP) was reduced by 5.2+/-1.4 mmHg after moderate exercise compared with non-exercise controls over 9 h (P<0.01). Among Gly460Trp genotypes, SBP was lowered by 7.8+/-2.3 mmHg; after light exercise compared with non-exercise controls over 9 h (P<0.05). The SBP reductions after light exercise (0.6+/-1.3 compared with 7.8+/-2.3 mmHg; P<0.05) but not moderate exercise (5.2+/-1.4 compared with 3.8+/-2.4 mmHg; P> or =0.05) differed between the Gly460Gly and Gly460Trp genotypes respectively. Men with Gly460Gly had a reduced SBP after moderate exercise, whereas men with Gly460Trp had a reduced SBP after light exercise. However, only the SBP reductions after light exercise differed between genotypes. Our findings indicate that the alpha-adducin Gly460Trp genotype may be useful in identifying men who have a reduced BP after lower intensity aerobic exercise.

Biomarker reconstruction of phytoplankton productivity and community structure changes in the mud area southwest off Cheju Island during the past 9 ka

NASA Astrophysics Data System (ADS)

Wang, Z. C.; Xiao, X.; Yuan, Z. N.; Wang, F.; Xing, L.; Li, L.; Zhao, M.

2017-12-01

High-resolution biomarker records from the mud area southwest off Cheju Island in the East China Sea reveal the variabilities of the phytoplankton productivity and community structure during the past 9 ka. This area has undergone dramatic environmental changes during the last glacial cycle, as eustatic sea-level fluctuations resulting in major migration of the coastline. We use the brassicasterol, dinosterol and alkenones records in three sediment cores (B3-1: 31.62°N, 125.75°E; F10: 31.75°N, 126.11°E; F11: 31.88°N, 126.35°E) to reconstruct diatom community, dinoflagellate community and haptophyte community, respectively. The low content of alkenones and relative high contents of brassicasterol and dinosterol of the three sediment cores indicated that diatoms and dinoflagellates were the main marine productivity during the Holocene. The phytoplankton productivity was generally low during the early-Holocene (9-5 ka BP) because of the low input of nutrient. The phytoplankton productivity increased during the mid-Holocene (5-3 ka BP) in response to the upwelling which complemented the nutrient to the upper layer. High content of alkenones in F11 during this period caused by the establishment of the modern circulation pattern around 5-6 ka BP because the intrusion of the Yellow Sea Warm Current (YSWC) brought the high-temperature and high-salinity waters to the core site which provide the suitable living conditions for the haptophytes growth in the east of the mud area. In contrast, the decreased trend of alkenones in F11 around 4 ka BP revealed a weakened YSWC. During the late-Holocene (3-1 ka BP), the phytoplankton productivity showed increasing trend in three sediment cores. The inverse relationships of SST and brassicasterol/dinosterol between B3-1 and F11 indicated the migration of the cold center in this area during this time interval. The hydrology change resulted in a spatial difference in the mud area during the late Holocene.

The Glacial-Interglacial summer monsoon recorded in southwest Sulawesi speleothems: Evidence for sea level thresholds driving tropical monsoon strength

NASA Astrophysics Data System (ADS)

Kimbrough, A. K.; Gagan, M. K.; Dunbar, G. B.; Krause, C.; Di Nezio, P. N.; Hantoro, W. S.; Cheng, H.; Edwards, R. L.; Shen, C. C.; Sun, H.; Cai, B.; Rifai, H.

2016-12-01

Southwest Sulawesi lies within the Indo-Pacific Warm Pool (IPWP), at the center of atmospheric convection for two of the largest circulation cells on the planet, the meridional Hadley Cell and zonal Indo-Pacific Walker Circulation. Due to the geographic coincidence of these circulation cells, southwest Sulawesi serves as a hotspot for changes in tropical Pacific climate variability and Australian-Indonesian summer monsoon (AISM) strength over glacial-interglacial (G-I) timescales. The work presented here spans 386 - 127 ky BP, including glacial terminations IV ( 340 ky BP) and both phases of TIII (TIII 248 ky BP and TIIIa 217 ky BP). This record, along with previous work from southwest Sulawesi spanning the last 40 kyr, reveals coherent climatic features over three complete G-I cycles. The multi-stalagmite Sulawesi speleothem δ18O record demonstrates that on G-I timescales, the strength of the AISM is most sensitive to changes in sea level and its impact on the regional distribution of land and shallow ocean. Stalagmite δ18O and trace element (Mg/Ca) data indicate a rapid increase in rainfall at glacial terminations and wet interglacials. TIV, TIII, TIIIa, and TI are each characterized by an abrupt 3‰ decrease in δ18O that coincides with sea level rise and flooding of the Sunda and Sahul shelves. Strong evidence for a sea level (flooding/exposure) threshold is found throughout the southwest Sulawesi record. This is most clearly demonstrated over the period 230 - 212 ky BP (MIS 7d-7c), when a sea level fall to only -80 to -60 m for 10 kyr results in a weakened AISM and glacial conditions, followed by a full termination. Taken together, both glaciations and glacial terminations imply a sea level threshold driving the AISM between two primary levels of intensity (`interglacial' & `glacial'). These massive, sea-level driven shifts in AISM strength are superimposed on precession-scale variability associated with boreal fall insolation at the equator, indicating sensitivity to tropical Pacific influence on warm pool convection.

Combinatorial explosion in model gene networks

NASA Astrophysics Data System (ADS)

Edwards, R.; Glass, L.

2000-09-01

The explosive growth in knowledge of the genome of humans and other organisms leaves open the question of how the functioning of genes in interacting networks is coordinated for orderly activity. One approach to this problem is to study mathematical properties of abstract network models that capture the logical structures of gene networks. The principal issue is to understand how particular patterns of activity can result from particular network structures, and what types of behavior are possible. We study idealized models in which the logical structure of the network is explicitly represented by Boolean functions that can be represented by directed graphs on n-cubes, but which are continuous in time and described by differential equations, rather than being updated synchronously via a discrete clock. The equations are piecewise linear, which allows significant analysis and facilitates rapid integration along trajectories. We first give a combinatorial solution to the question of how many distinct logical structures exist for n-dimensional networks, showing that the number increases very rapidly with n. We then outline analytic methods that can be used to establish the existence, stability and periods of periodic orbits corresponding to particular cycles on the n-cube. We use these methods to confirm the existence of limit cycles discovered in a sample of a million randomly generated structures of networks of 4 genes. Even with only 4 genes, at least several hundred different patterns of stable periodic behavior are possible, many of them surprisingly complex. We discuss ways of further classifying these periodic behaviors, showing that small mutations (reversal of one or a few edges on the n-cube) need not destroy the stability of a limit cycle. Although these networks are very simple as models of gene networks, their mathematical transparency reveals relationships between structure and behavior, they suggest that the possibilities for orderly dynamics in such networks are extremely rich and they offer novel ways to think about how mutations can alter dynamics.

Combinatorial explosion in model gene networks.

PubMed

Edwards, R.; Glass, L.

2000-09-01

The explosive growth in knowledge of the genome of humans and other organisms leaves open the question of how the functioning of genes in interacting networks is coordinated for orderly activity. One approach to this problem is to study mathematical properties of abstract network models that capture the logical structures of gene networks. The principal issue is to understand how particular patterns of activity can result from particular network structures, and what types of behavior are possible. We study idealized models in which the logical structure of the network is explicitly represented by Boolean functions that can be represented by directed graphs on n-cubes, but which are continuous in time and described by differential equations, rather than being updated synchronously via a discrete clock. The equations are piecewise linear, which allows significant analysis and facilitates rapid integration along trajectories. We first give a combinatorial solution to the question of how many distinct logical structures exist for n-dimensional networks, showing that the number increases very rapidly with n. We then outline analytic methods that can be used to establish the existence, stability and periods of periodic orbits corresponding to particular cycles on the n-cube. We use these methods to confirm the existence of limit cycles discovered in a sample of a million randomly generated structures of networks of 4 genes. Even with only 4 genes, at least several hundred different patterns of stable periodic behavior are possible, many of them surprisingly complex. We discuss ways of further classifying these periodic behaviors, showing that small mutations (reversal of one or a few edges on the n-cube) need not destroy the stability of a limit cycle. Although these networks are very simple as models of gene networks, their mathematical transparency reveals relationships between structure and behavior, they suggest that the possibilities for orderly dynamics in such networks are extremely rich and they offer novel ways to think about how mutations can alter dynamics. (c) 2000 American Institute of Physics.

Deep mantle roots and continental hypsometry: implications for whole-Earth elemental cycling, long-term climate, and the Cambrian explosion

NASA Astrophysics Data System (ADS)

Lee, C. T.

2016-12-01

Most of Earth's continents today are above sea level, but the presence of thick packages of ancient sediments on top of the stable cores of continents indicates that continents must have been submerged at least once in their past. Elevations of continents are controlled by the interplay between crustal thickness, mantle root thickness and the temperature of the ambient convecting mantle. The history of a continent begins with mountain building through magmatic or tectonic crustal thickening, during which exhumation of deep-seated igneous and metamorphic rocks are highest. Mountain building is followed by a long interval of subsidence as a result of continued, but decreasing erosion and thermal relaxation, the latter in the form of a growing thermal boundary layer. Subsidence is manifest first as a boring interval in which no sedimentary record is preserved, followed by continent-scale submergence wherein sediments are deposited directly on deep-seated igneous/metamorphic basement, generating a major disconformity. The terminal resting elevation of a mature continent, however, is defined by the temperature of the ambient convecting mantle: below sea level when the mantle is hot and above sea level when the mantle is cold. Using thermobarometric constraints on secular cooling of Earth's mantle, our results suggest that Earth, for most of its history, must have been a water world, with regions of land confined to narrow orogenic belts and oceans characterized by deep basins and shallow continental seas, the latter serving as repositories of sediments and key redox-sensitive biological nutrients, such as phosphorous. Cooling of the Earth led to the gradual and irreversible rise of the continents, culminating in rapid emergence, through fits and starts and possible instabilities in climate, between 500-1000 Ma. Such emergence fundamentally altered marine biogeochemical cycling, continental weathering and the global hydrologic cycle, defining the backdrop for the Cambrian explosion, the largest biological diversification event in Earth's history.

A random-walk/giant-loop model for interphase chromosomes.

PubMed Central

Sachs, R K; van den Engh, G; Trask, B; Yokota, H; Hearst, J E

1995-01-01

Fluorescence in situ hybridization data on distances between defined genomic sequences are used to construct a quantitative model for the overall geometric structure of a human chromosome. We suggest that the large-scale geometry during the G0/G1 part of the cell cycle may consist of flexible chromatin loops, averaging approximately 3 million bp, with a random-walk backbone. A fully explicit, three-parametric polymer model of this random-walk/giant-loop structure can account well for the data. More general models consistent with the data are briefly discussed. PMID:7708711

Technology Assessment of Gasses Useful as Coolants in Open Cycle Joule-Thomson Cyrostat Coolers

DTIC Science & Technology

1989-09-30

t By ,1 3 T’’ i LIST OF TABLES TABLE TITLE PAGE 3-1 List of Refrigerants Not Acceptable 6-7 B.P. > -78"C at 1 Atmosphere Pressure 3-2 List of...criteria consisted of six steps as follows: 1 1. The boiling point at one atmosphere pressure must be less than - 100 degrees Centigrade, (’C...is inside the seeker head covered by a dome which is normally pressurized to one (1) atmosphere and as the gas flows to cool the detector, the gas

Description of Simulated Small Satellite Operation Data Sets

NASA Technical Reports Server (NTRS)

Kulkarni, Chetan S.; Guarneros Luna, Ali

2018-01-01

A set of two BP930 batteries (Identified as PK31 and PK35) were operated continuously for a simulated satellite operation profile completion for single cycle. The battery packs were charged to an initial voltage of around 8.35 V for 100% SOC before the experiment was started. This document explains the structure of the battery data sets. Please cite this paper when using this dataset: Z. Cameron, C. Kulkarni, A. Guarneros, K. Goebel, S. Poll, "A Battery Certification Testbed for Small Satellite Missions", IEEE AUTOTESTCON 2015, Nov 2-5, 2015, National Harbor, MA

Peroxisomal monodehydroascorbate reductase. Genomic clone characterization and functional analysis under environmental stress conditions.

PubMed

Leterrier, Marina; Corpas, Francisco J; Barroso, Juan B; Sandalio, Luisa M; del Río, Luis A

2005-08-01

In plant cells, ascorbate is a major antioxidant that is involved in the ascorbate-glutathione cycle. Monodehydroascorbate reductase (MDAR) is the enzymatic component of this cycle involved in the regeneration of reduced ascorbate. The identification of the intron-exon organization and the promoter region of the pea (Pisum sativum) MDAR 1 gene was achieved in pea leaves using the method of walking polymerase chain reaction on genomic DNA. The nuclear gene of MDAR 1 comprises nine exons and eight introns, giving a total length of 3,770 bp. The sequence of 544 bp upstream of the initiation codon, which contains the promoter and 5' untranslated region, and 190 bp downstream of the stop codon were also determined. The presence of different regulatory motifs in the promoter region of the gene might indicate distinct responses to various conditions. The expression analysis in different plant organs by northern blots showed that fruits had the highest level of MDAR. Confocal laser scanning microscopy analysis of pea leaves transformed with Agrobacterium tumefaciens having the binary vectors pGD, which contain the autofluorescent proteins enhanced green fluorescent protein and enhanced yellow fluorescent protein with the full-length cDNA for MDAR 1 and catalase, indicated that the MDAR 1 encoded the peroxisomal isoform. The functional analysis of MDAR by activity and protein expression was studied in pea plants grown under eight stress conditions, including continuous light, high light intensity, continuous dark, mechanical wounding, low and high temperature, cadmium, and the herbicide 2,4-dichlorophenoxyacetic acid. This functional analysis is representative of all the MDAR isoforms present in the different cell compartments. Results obtained showed a significant induction by high light intensity and cadmium. On the other hand, expression studies, performed by semiquantitative reverse transcription-polymerase chain reaction demonstrated differential expression patterns of peroxisomal MDAR 1 transcripts in pea plants grown under the mentioned stress conditions. These findings show that the peroxisomal MDAR 1 has a differential regulation that could be indicative of its specific function in peroxisomes. All these biochemical and molecular data represent a significant step to understand the specific physiological role of each MDAR isoenzyme and its participation in the antioxidant mechanisms of plant cells.

The Glacial-Interglacial Monsoon Recorded by Speleothems from Sulawesi, Indonesia

NASA Astrophysics Data System (ADS)

Kimbrough, A. K.; Gagan, M. K.; Dunbar, G. B.; Krause, C.; Hantoro, W. S.; Cheng, H.; Edwards, R. L.; Shen, C. C.; Sun, H.; Cai, B.; Hellstrom, J. C.; Rifai, H.

2015-12-01

The Indo-Pacific Warm Pool is a primary source of heat and moisture to the global atmosphere and a key player in tropical and global climate variability. There is mounting evidence that atmospheric convection and oceanic processes in the tropics can modulate global climate on orbital and sub-orbital timescales. Glacial-interglacial cycles represent the largest natural climate changes over the last 800 kyr with each cycle terminated by rapid global warming and sea level rise. Our understanding of the role and response of tropical atmospheric convection during these periods of dramatic warming is limited. We present the first speleothem paleomonsoon record for southwest Sulawesi (5ºS, 119ºE), spanning two glacial-interglacial cycles, including glacial termination IV (~340 kyr BP) and both phases of termination III (~248 and ~220 kyr BP). This unique record is constructed from multiple stalagmites from two separate caves and is based on a multi-proxy approach (δ18O, δ13C, Mg/Ca, Sr/Ca) that provides insight into the mechanisms controlling Australian-Indonesian summer monsoon variability. Speleothem δ18O and trace element data indicate a rapid increase in rainfall at glacial terminations and wet interglacials. Terminations IV, III, and I are each characterized by an abrupt 3‰ decrease in δ18O. Variability in δ18O leading-in to glacial terminations is also similar, and corresponds to October insolation. Prior to deglaciation, there is a distinct shift to higher δ18O that is synchronized with weak monsoon intervals in Chinese speleothem records. The remarkably consistent pattern among terminations implies that the response of tropical convection to changing background climates is well regulated. Furthermore, we find that speleothem δ13C leads δ18O by ~5 kyr during glacial terminations. The early decrease in speleothem δ13C may reflect the response of tropical vegetation to rising atmospheric CO2 and temperature, rather than regional changes in rainfall.

Antispasmodic, bronchodilator, vasorelaxant and cardiosuppressant effects of Buxus papillosa.

PubMed

Khan, Arif-Ullah; Ali, Shamsher; Gilani, Anwarul-Hassan; Ahmed, Manzoor; Choudhary, Muhammad Iqbal

2017-01-18

The present research was carried out to investigate pharmacological properties of Buxus papillosa C.K. Schneid. (Buxaceae). Buxus papillosa extracts of leaves (BpL), stem (BpS), roots (BpR) and BpL fractions: hexane (BpL-H), aqueous (BpL-A) also plant constituent, cyclomicrobuxine effect were studied in jejunum, atria, aorta and tracheal preparations from rabbit and guine-peg. Ca ++ antagonistic effect of BpS, BpR, BpL-H, BpL-A and cyclomicrobuxine were conclusively suggested, when spontaneous contractions of rabbit jejunal preparation was relaxed along with subsequent relaxation of potassium chloride (80 mM) induced contractions. Ca ++ antagonistic effect was further confirmed, when a prominent right shift like that of verapamil was observed in Ca ++ concentration-response curves, drawn in a tissue pretreated with BpL (0.3-1.0 mg/mL). In rabbit tracheal tissues BpL, BpS, BpR, BpL-H and BpL-A produced a prominent relaxation in contractions induced by potassium chloride (80 mM) and carbachol (1 μm). When tested in rabbit aortic rings, BpL, BpS, BpR, BpL-H and BpL-A showed concentration-dependent (0.1-3.0 mg/mL) vasorelaxant effect against phenylephrine (1 μM) and high K + -induced contractions. In isolated guinea-pig right atria, BpL, BpS, BpR, BpL-H and BpL-A suppressed atrial force of spontaneous contractions, with BpL-A being most potent. Our results reveal that Buxus papillosa possesses gut, airways and cardiovascular inhibitory actions.

Examination of chromosome 7p22 candidate genes RBaK, PMS2 and GNA12 in familial hyperaldosteronism type II.

PubMed

Jeske, Y W A; So, A; Kelemen, L; Sukor, N; Willys, C; Bulmer, B; Gordon, R D; Duffy, D; Stowasser, M

2008-04-01

1. There are two types of familial hyperaldosteronism (FH): FH-I and FH-II. FH-I is caused by a hybrid CYP11B1/CYP11B2 gene mutation. The genetic cause of FH-II, which is more common, is unknown. Adrenal hyperplasia and adenomas are features. We previously reported linkage of FH-II to a approximately 5 Mb region on chromosome 7p22. We subsequently reported finding no causative mutations in the retinoblastoma-associated Kruppel-associated box gene (RBaK), a candidate at 7p22 involved in tumorigenesis and cell cycle control. 2. In the current study we investigated RBaK regulatory regions and two other candidate genes: postmeiotic segregation increased 2 (PMS2, involved in DNA mismatch repair and tumour predisposition) and guanine nucleotide-binding protein alpha-12 (GNA12, a transforming oncogene). 3. The GNA12 and PMS2 genes were examined in two affected (A1, A2) and two unaffected (U1, U2) subjects from a large 7p22-linked FH-II family (family 1). No mutations were found. 4. The RBaK and PMS2 distal promoters were sequenced to -2150 bp from the transcription start site for RBaK and-2800 bp for PMS2. Five unreported single nucleotide polymorphisms (SNPs) were found in subjects A1, A2 but not in U1 or U2; A(-2031 bp)T, T(-2030 bp)G, G(-834 bp)C, C(-821 bp)G in RBaK and A(-876 bp)G in PMS2. Additional affected and unaffected subjects from family 1 and from two other 7p22-linked FH-II families and 58 unrelated normotensive control subjects were genotyped for these SNPs. 5. The five novel SNPs were found to be present in a significant proportion of normotensive controls. The four RBaK promoter SNPs were found to be in linkage disequilibrium in the normal population. The RBaK promoter (-)2031T/2030G/834C/821T allele was found to be in linkage disequilibrium with the causative mutation in FH-II family 1, but not in families 2 and 3. The PMS2 promoter (-)876G allele was also found to be linked to affected phenotypes in family 1. 6. The RBaK and PMS2 promoter SNPs alter the binding sites for several transcription factors. Although present in the normal population, it is possible that the RBaK (-)2031T/2030G/834C/821T and PMS2 (-)876G alleles may have functional roles contributing to the FH-II phenotype in family 1.

Benzophenone-type UV filters in surface waters: An assessment of profiles and ecological risks in Shanghai, China.

PubMed

Wu, Ming-Hong; Xie, Deng-Guo; Xu, Gang; Sun, Rui; Xia, Xiao-Yu; Liu, Wen-Long; Tang, Liang

2017-07-01

Benzophenone-type UV filters (BP-UV filters) are frequently introduced into aquatic environment from several sources. The occurrence and fate of select BP-UV filters and their metabolites were investigated in this study. All target compounds were detected in water samples, except for 2, 3, 4-trihydroxybenzophenone (2, 3, 4-OH-BP). The concentration reached up 131ngL -1 for 5-benzoyl-4-hydroxy-2-ethoxybenzenesulfonic acid (BP-4), 30.0ngL -1 for 2-hydroxy-4-methoxybenzophenone (BP-3), and mean value of 158ngL -1 for benzophenone (BP). Concentrations of BP-UV filters were not related to recreational waters but with high population frequencies. In addition, five BP-UV filters, namely 2,2',4,4'-tetrahydroxybenzophenone (BP-2), 2,3,4-OH-BP, 2,4-dihydroxybenzophenone (BP-1), 4-hydroxybenzophenone (4-OH-BP) and BP were investigated for probable sources, and found that they originate from BP-3 metabolism. There is a similar source for BP-3, BP-4, BP-1, 4-OH-BP and BP. Environmental risk assessment (ERA) showed that risk quotients (RQs) of BP-4, BP-3 and BP were 2.7, 0.8 and 0.5, respectively. Copyright © 2017 Elsevier Inc. All rights reserved.

Diagnostic application of polymerase chain reaction for detection of Ehrlichia risticii in equine monocytic ehrlichiosis (Potomac horse fever).

PubMed

Biswas, B; Mukherjee, D; Mattingly-Napier, B L; Dutta, S K

1991-10-01

Genomic amplification by the polymerase chain reaction (PCR) was used to identify a unique genomic sequence of Ehrlichia risticii directly in DNA isolated from peripheral-blood buffy coat cells of E. risticii-infected horses (Potomac horse fever) and from infected cell cultures. A specific primer pair, selected from a cloned, species-specific, 1-kb DNA fragment of the E. risticii genome as a template, was used for the amplification of the target DNA of 247 bp. The optimal number of 40 PCR cycles, determined by analyzing an amplification profile obtained with a constant Taq polymerase concentration, was used to achieve maximum amplification of the E. risticii DNA segment. Efficient amplification of target DNA was achieved with specimens processed by either the phenol extraction or rapid lysis method. The specificity of the amplified DNA product was confirmed by the proper size (247 bp) and appropriate restriction enzyme cleavage pattern of the amplified target DNA, as well as by the specific hybridization signal obtained by using a PCR-amplified 185-bp internal DNA probe. A 10(5)- to 10(6)-fold amplification of target DNA, which allowed detection of E. risticii from as few as two to three infected cells in culture and from a very small volume of buffy coat cells from infected horses, was achieved. This PCR amplification procedure was found to be highly specific and sensitive for the detection of E. risticii for the study of Potomac horse fever.

Late-glacial and Holocene Vegetation and Climate Variability, Including Major Droughts, in the Sky Lakes Region of Southeastern New York State

NASA Technical Reports Server (NTRS)

Menking, Kirsten M.; Peteet, Dorothy M.; Anderson, Roger Y.

2012-01-01

Sediment cores from Lakes Minnewaska and Mohonk in the Shawangunk Mountains of southeastern New York were analyzed for pollen, plantmacrofossils, macroscopic charcoal, organic carbon content, carbon isotopic composition, carbon/nitrogen ratio, and lithologic changes to determine the vegetation and landscape history of the greater Catskill Mountain region since deglaciation. Pollen stratigraphy generally matches the New England pollen zones identified by Deevey (1939) and Davis (1969), with boreal genera (Picea, Abies) present during the late Pleistocene yielding to a mixed Pinus, Quercus and Tsuga forest in the early Holocene. Lake Minnewaska sediments record the Younger Dryas and possibly the 8.2 cal kyr BP climatic events in pollen and sediment chemistry along with an 1400 cal yr interval of wet conditions (increasing Tsuga and declining Quercus) centered about 6400 cal yr BP. BothMinnewaska andMohonk reveal a protracted drought interval in themiddle Holocene, 5700-4100 cal yr BP, during which Pinus rigida colonized the watershed, lake levels fell, and frequent fires led to enhanced hillslope erosion. Together, the records show at least three wet-dry cycles throughout the Holocene and both similarities and differences to climate records in New England and central New York. Drought intervals raise concerns for water resources in the New York City metropolitan area and may reflect a combination of enhanced La Niña, negative phase NAO, and positive phase PNA climatic patterns and/or northward shifts of storm tracks.

Psychophysiological correlates of relaxation induced by standard autogenic training.

PubMed

Mishima, N; Kubota, S; Nagata, S

1999-01-01

The present study aimed to determine the psychophysiological changes induced in subjects by standard autogenic training (AT). Physiological measurements were taken under strict experimental conditions. Thirty-one healthy students were divided randomly into two groups: the AT group and the control group. In the first session, the physiological variables were measured for all students before and after all were asked to relax in their own way. The AT group were then taught AT for 3 months, after which time the measurements were repeated. In the second session, the AT group practised the standard AT exercise, while the control group repeated their own form of simple relaxation. Electrocardiogram, plethysmogram (PTG) and blood pressure (BP) were measured while the students carried out a breathing rate of 15 cycles/min. The R-R intervals and BP were analysed by an autoregressive model for spectral analysis, and the data were compared by repeated-measures ANOVA. The AT group had a significant increase in the mean R-R interval and a significant decrease in the baseline deflection of the PTG in the second session. There were no significant changes in sympathetic activity except for the change in the PTG, although low frequency amplitude of systolic BP decreased slightly. AT was found to induce significant changes that were independent of respiration in healthy students, although paced breathing might have operated as a mental stress. The increase in mean R-R interval and the decrease in baseline deflection of the PTG were the most robust correlates of AT.

Neutron diffraction measurements and micromechanical modelling of temperature-dependent variations in TATB lattice parameters

DOE PAGES

Yeager, John D.; Luscher, Darby J.; Vogel, Sven C.; ...

2016-02-02

Triaminotrinitrobenzene (TATB) is a highly anisotropic molecular crystal used in several plastic-bonded explosive (PBX) formulations. TATB-based explosives exhibit irreversible volume expansion (“ratchet growth”) when thermally cycled. A theoretical understanding of the relationship between anisotropy of the crystal, crystal orientation distribution (texture) of polycrystalline aggregates, and the intergranular interactions leading to this irreversible growth is necessary to accurately develop physics-based predictive models for TATB-based PBXs under various thermal environments. In this work, TATB lattice parameters were measured using neutron diffraction during thermal cycling of loose powder and a pressed pellet. The measured lattice parameters help clarify conflicting reports in the literaturemore » as these new results are more consistent with one set of previous results than another. The lattice parameters of pressed TATB were also measured as a function of temperature, showing some differences from the powder. This data is used along with anisotropic single-crystal stiffness moduli reported in the literature to model the nominal stresses associated with intergranular constraints during thermal expansion. The texture of both specimens were characterized and the pressed pellet exhibits preferential orientation of (001) poles along the pressing direction, whereas no preferred orientation was found for the loose powder. Lastly, thermal strains for single-crystal TATB computed from lattice parameter data for the powder is input to a self-consistent micromechanical model, which predicts the lattice parameters of the constrained TATB crystals within the pellet. The agreement of these model results with the diffraction data obtained from the pellet is discussed along with future directions of research.« less

Usefulness of Enzyme-linked Immunosorbent Assay Using Recombinant BP180 and BP230 for Serodiagnosis and Monitoring Disease Activity of Bullous Pemphigoid

PubMed Central

Lee, Eui Hyung; Kim, Yeon Hee; Kim, Sinyoung; Kim, Song-ee

2012-01-01

Background Bullous pemphigoid (BP) is an autoimmune subepidermal bullous disease associated with autoantibodies against BP180 and BP230. Enzyme-linked immunosorbent assay (ELISA) is a sensitive tool for the detection of immunoglobulin G (IgG) anti-BP180 and anti-BP230 autoantibodies. Objective The aim of this study was to evaluate the usefulness of ELISA for diagnosing and monitoring the disease activity of BP. Methods We evaluated serum IgG levels of anti-BP180 and anti-BP230 autoantibodies in 47 BP patients, 16 epidermolysis bullosa aquisita patients, and 15 healthy volunteers using ELISA. Through retrospective review of the medical records, the clinical characteristics of BP including disease activity, duration, pruritus severity and peripheral blood eosinophil counts were assessed. Results The sensitivity of BP180 ELISA was 97.9%, BP230 ELISA 72.3%, and a combination of the two was 100%. The specificity of BP180 ELISA was 90.3%, BP230 ELISA 100%, and a combination of the two was 90.3%. BP180 ELISA scores showed strong associations with disease activity, pruritus severity, peripheral blood eosinophil counts, and disease duration, whereas BP230 ELISA scores did not. Conclusion BP180 and BP230 ELISAs are highly sensitive methods for the diagnosis of BP, and BP180 ELISA, in particular, is a sensitive tool for monitoring the disease activity of BP. PMID:22363155

Identification, measurement, and assessment of water cycle of unhusked rice agricultural phases: Case study at Tangerang paddy field, Indonesia

NASA Astrophysics Data System (ADS)

Hartono, N.; Laurence; Johannes, H. P.

2017-11-01

According to one of UN reports, water scarcity has happened all around the world, including Indonesia. Irrigation sector takes up 70% of world water consumption and potentially increases 20% due to the population explosion. Rice is accounted for 69% of agricultural products contributions in Indonesia’s water footprint. Therefore, evaluation of water cycle was essential to raise awareness among practitioners. Data collections were conducted in the functional unit of one-hectare rice field located in Tangerang. This study used CropWat 8.0 and SimaPro software. Identification involved data such as climate, crop, and soil. Nursery became the highest water consumed phase, requiring 419 mm in height. Measurement through water footprint resulted in consumption of green water footprint for 8,183,618.5 liters (62.9%), followed by grey for 4,805,733.2 liters (36.9%) and blue for 23,902.36 liters (0.2%). The grey consumption was exceeding the average, which indicated high doses of pesticides. Life Cycle Assessment showed negative impacts of fertilizers that caused damages like fossil depletion, respiratory health, and eutrophication.

Calcium signaling in neuronal cells exposed to the munitions compound Cyclotrimethylenetrinitramine (RDX).

PubMed

Ehrich, Marion; Wu, Xiaohua; Werre, Stephen R; Major, Michael A; McCain, Wilfred C; Reddy, Gunda

2009-01-01

Cyclotrimethylenetrinitramine (RDX) has been used extensively as an explosive in military munitions. Mechanisms for seizure production, seen in past animal studies, have not been described. Increased calcium levels contribute to excitotoxicity, so in this study neuroblastoma cells are loaded with calcium-indicating dye before application of 1.5 microM to 7.5 mM RDX, with fluorescence recorded for 30 cycles of 11 seconds each. The lowest concentration of RDX increases calcium fluorescence significantly above baseline for cycles 2 to 8; millimolar concentrations increase calcium fluorescence significantly above baseline for cycles 2 to 30. Increases in calcium, like those of 200 nM carbachol, are prevented with 10 mM of calcium chelator ethylene glycol-bis(beta-aminoethyl ether)-N,N,N,N tetra-acetic acid (EGTA, tetrasodium salt). Calcium channel blocker verapamil (20 microM), Ca(2+)-ATPase inhibitor thapsigargin (5 microM), and general membrane stabilizer lidocaine (10 mM) partially attenuate carbachol- and RDX-induced increases in calcium, suggesting that RDX transiently increases intracellular calcium by multiple mechanisms.

27 CFR 555.182 - Exceptions.

Code of Federal Regulations, 2013 CFR

2013-04-01

... testing of new or modified explosive materials; (2) Training in explosives detection or development or testing of explosives detection equipment; or (3) Forensic science purposes; or (b) Was plastic explosive... EXPLOSIVES, DEPARTMENT OF JUSTICE EXPLOSIVES COMMERCE IN EXPLOSIVES Marking of Plastic Explosives § 555.182...

27 CFR 555.182 - Exceptions.

Code of Federal Regulations, 2014 CFR

2014-04-01

... testing of new or modified explosive materials; (2) Training in explosives detection or development or testing of explosives detection equipment; or (3) Forensic science purposes; or (b) Was plastic explosive... EXPLOSIVES, DEPARTMENT OF JUSTICE EXPLOSIVES COMMERCE IN EXPLOSIVES Marking of Plastic Explosives § 555.182...

Impact of climate variability on terrestrial environment in Western Europe between 45 and 9 kyr cal. BP: vegetation dynamics recorded by the Bergsee Lake (Black Forest, Germany).

NASA Astrophysics Data System (ADS)

Duprat-Oualid, Fanny; Begeot, Carole; Rius, Damien; Millet, Laurent; Magny, Michel

2016-04-01

Between 9 and 45 kyr cal. BP, two great transitions lead the global climate system to evolve from the Last-Glacial period (115-14.7 kyr cal. BP), to two successive warmer periods, the Late-Glacial Interstadial (14.7-11.7 kyr cal. BP) and the Holocene (11.7-0 kyr cal. BP). δ18O variations recorded in Greenland ice cores (GRIP & NGRIP) revealed high frequency climate variability within the Last Glacial. These reference isotopic records highlighted a succession of centennial-to-millennial warm/cold events, the so-called Greenland Interstadials (GI) and Greenland Stadials (GS). The number continental records about the period 14.7-0 kyr cal. BP is substantial. This allowed to understand the vegetation dynamics in response to climate changes this period at the North-Atlantic scale. However, sequences covering the glacial period (beyond 20 kyr cal.BP) remain rare, because of hiatuses mostly due to local glaciers. Therefore, sedimentary continuous records of vegetation dynamics are still needed to better understand climate changes during the Last Glacial in Western Europe (Heiri et al. 2014). Here we present a new high-resolution pollen record from Lake Bergsee (47°34'20''N, 7°56'11''E, 382 m a.s.l). This lake is located south of Black Forest and north of the Alps, beyond the zone of glaciers maximal extension. Therefore it could have recorded the whole last climatic cycle, i.e. 120-0 kyr cal. BP. In 2013, a 29 m long core was extracted from the Bergsee. According to the depth-age model based on 14C AMS dating and the Laacher See Tephra (LST), the record spans continuously at least the last 45 kyrs. The first series of pollen analysis, focused on the 45-9 kyr cal. BP time window, allows us to reconstruct a precise, faithful and continuous vegetation history at the centennial scale. This high temporal resolution enabled to assess the response of vegetation to secular climate events (e.g. GI-4 = 200 yrs). First, our results show that vegetation responded to climate changes at millennial/pluri-millennial scale. The well-known afforestation of the Late-Glacial interstadial and the Holocene (with pine and hazel-dominated forests respectively) are recorded. Our results also reveal a three-phase sequence in the Last-Glacial. The persistence of very cold conditions between 24 and 30 kyr cal. BP favored a drastic steppe grassland. In contrast, trees proportion increased during the two other periods (14.7-24 and 30-45 kyr cal. BP) in correlation with a relative favorable climate. Second, the respons of vegetation to centennial scale climatic events is characterized by the successive rapid establishment of two different landscapes. GS are dominated by steppic taxa (Artemisia, Helianthemum), whereas more or less complete ecological successions Juniperus-Betula-Pinus seem to occur for most GIs when edaphic conditions became more favorable. Therefore, we suggest a global forcing defined by the strong impact of the climate variability on vegetation changes. We also propose the contribution of local characteristics (latitude, topography) which favored flora migration and long distance pollen inputs from refuge areas. Heiri O., Koinig K.A., Spötl C., Barrett S, Brauer A., Drescher-Schneider R., Gaar D., Ivy-Ochs S., Kerschner H., Luetscher M., Moran A., Nicolussi K., Preusser F., Schmidt R., Schoeneich P., Schwörer C., Sprafke T., Terhorst B., Tinner W. -2014- "Palaeoclimate records 60-8 ka in the Austrian and Swiss Alps and their forelands", Quaternary Science Review, 106 : 186-205.

Metabolism of UV-filter benzophenone-3 by rat and human liver microsomes and its effect on endocrine-disrupting activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, Yoko, E-mail: y-watanabe@nichiyaku.ac.jp; Nihon Pharmaceutical University, Komuro 10281, Ina-machi, Saitama 362-0806; Kojima, Hiroyuki

2015-01-15

Benzophenone-3 (2-hydroxy-4-methoxybenzophenone; BP-3) is widely used as sunscreen for protection of human skin and hair from damage by ultraviolet (UV) radiation. In this study, we examined the metabolism of BP-3 by rat and human liver microsomes, and the estrogenic and anti-androgenic activities of the metabolites. When BP-3 was incubated with rat liver microsomes in the presence of NADPH, 2,4,5-trihydroxybenzophenone (2,4,5-triOH BP) and 3-hydroxylated BP-3 (3-OH BP-3) were newly identified as metabolites, together with previously detected metabolites 5-hydroxylated BP-3 (5-OH BP-3), a 4-desmethylated metabolite (2,4-diOH BP) and 2,3,4-trihydroxybenzophenone (2,3,4-triOH BP). In studies with recombinant rat cytochrome P450, 3-OH BP-3 and 2,4,5-triOHmore » BP were mainly formed by CYP1A1. BP-3 was also metabolized by human liver microsomes and CYP isoforms. In estrogen reporter (ER) assays using estrogen-responsive CHO cells, 2,4-diOH BP exhibited stronger estrogenic activity, 2,3,4-triOH BP exhibited similar activity, and 5-OH BP-3, 2,4,5-triOH BP and 3-OH BP-3 showed lower activity as compared to BP-3. Structural requirements for activity were investigated in a series of 14 BP-3 derivatives. When BP-3 was incubated with liver microsomes from untreated rats or phenobarbital-, 3-methylcholanthrene-, or acetone-treated rats in the presence of NADPH, estrogenic activity was increased. However, liver microsomes from dexamethasone-treated rats showed decreased estrogenic activity due to formation of inactive 5-OH BP-3 and reduced formation of active 2,4-diOH BP. Anti-androgenic activity of BP-3 was decreased after incubation with liver microsomes. - Highlights: • Metabolic modification of the endocrine-disrupting activity of BP-3 was examined. • 2,4,5-TriOH BP and 3-OH BP-3 were identified as new BP-3 metabolites. • 2,4-DiOH BP and 2,3,4-triOH BP exhibited high or similar estrogenic activities. • Estrogenic activity of BP-3 was enhanced by incubation with rat liver microsomes. • Structural requirements for the activities of BP-3 derivatives were demonstrated.« less