454-pyrosequencing: A tool for discovery and biomarker development

USDA-ARS?s Scientific Manuscript database

The Roche GS-FLX (454) sequencer has made possible what was thought impossible just a few years ago: sequence >1 million high-quality nucleotide reads (mean 400 bp) in less than 12 h. This technology provides valuable species-specific sequence information, and is a valuable tool to discover and und...

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

PubMed Central

D'Souza, T M; Boominathan, K; Reddy, C A

1996-01-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

PubMed

Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

2000-05-31

cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

Molecular identification of Trichuris vulpis and Trichuris suis isolated from different hosts.

PubMed

Cutillas, Cristina; de Rojas, Manuel; Ariza, Concepción; Ubeda, José Manuel; Guevara, Diego

2007-01-01

Trichuris suis was isolated from the cecum of two different hosts (Sus scrofa domestica -- swine and Sus scrofa scrofa -- wild boar) and Trichuris vulpis from dogs in Sevilla, Spain. Genomic DNA was isolated and internal transcribed spacers (ITS)1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced using polymerase chain reaction techniques. The sequence of T. suis from both hosts was 1,396 bp in length while that of T. vulpis was 1,044 bp. ITS1 of both populations isolated of T. suis was 661 nucleotides in length, while the ITS2 was 534 nucleotides in length. Furthermore, the ITS1 of T. vulpis was 410 nucleotides in length, while the ITS2 was 433 nucleotides in length. One hundred fifty-four nucleotides were observed along the 5.8S gene of T. suis and T. vulpis. Intraindividual and intraspecific variations were detected in the rDNA of both species. The presence of microsatellites was observed in all the individuals assayed. Sequence analysis of the ITSs and the 5.8S gene has demonstrated no sequence differences between T. suis isolated from both hosts (S. scrofa domestica -- swine and S. scrofa scrofa -- wild boar). Nevertheless, clear differences were detected between the ITS1 and ITS2 of T. suis and T. vulpis. Furthermore, a comparative molecular analysis between both species and the previously published ITS1-5.8S-ITS2 sequence data of Trichuris ovis, Trichuris leporis, Trichuris muris, Trichuris arvicolae, and Trichuris skrjabini was carried out. A common homology zone was detected in the ITS1 sequence of all species of trichurids.

Molecular characterization of eimeria species naturally infecting egyptian baldi chickens.

PubMed

Gadelhaq, Sahar M; Arafa, Waleed M; Aboelhadid, Shawky M

2015-01-01

Coccidiosis is a serious protozoal disease of poultry. The identification of Eimeria species has important implications for diagnosis and control as well as for epidemiology. The molecular characterization of Eimeria species infecting Egyptian baladi chickens was investigated. Eimeria species oocysts were harvested from intestines of naturally infected Egyptian baldi chickens. The morphometry characterization of oocysts along with COCCIMORPH software was done. The DNA was extracted initially by freezing and thawing then the prepared samples was subjected to commercial DNA kits. The DNA products were analyzed through conventional polymerase chain reaction by using amplified region (SCAR) marker. The PCR results confirmed the presence of 7 Eimeria species in the examined fecal samples of Egyptian baldi breed with their specific ampilicon sizes being E. acervulina (811bp), E. brunette (626bp), E. tenella (539bp), E. maxima (272bp), E. necatrix (200bp), E. mitis (327bp) and E. praecopx (354bp). A sequencing of the two most predominant species of Eimeria was done, on E. tenella and E. máxima. Analysis of the obtained sequences revealed high identities 99% between Egyptian isolates and the reference one. Similarly, E. maxima isolated from Egyptian baldi chickens showed 98% nucleotide identities with the reference strain. Only single nucleotide substitution was observed among the Egyptian E. tenella isolates (A181G) when compared to the reference one. The Egyptian isolates acquired 4 unique mutations (A68T, C164T, G190A and C227G) in compared with the reference sequence. This is the first time to identify the 7 species of Eimeria from Egyptian baladi chickens.

A new family of satellite DNA sequences as a major component of centromeric heterochromatin in owls (Strigiformes).

PubMed

Yamada, Kazuhiko; Nishida-Umehara, Chizuko; Matsuda, Yoichi

2004-03-01

We isolated a new family of satellite DNA sequences from HaeIII- and EcoRI-digested genomic DNA of the Blakiston's fish owl ( Ketupa blakistoni). The repetitive sequences were organized in tandem arrays of the 174 bp element, and localized to the centromeric regions of all macrochromosomes, including the Z and W chromosomes, and microchromosomes. This hybridization pattern was consistent with the distribution of C-band-positive centromeric heterochromatin, and the satellite DNA sequences occupied 10% of the total genome as a major component of centromeric heterochromatin. The sequences were homogenized between macro- and microchromosomes in this species, and therefore intraspecific divergence of the nucleotide sequences was low. The 174 bp element cross-hybridized to the genomic DNA of six other Strigidae species, but not to that of the Tytonidae, suggesting that the satellite DNA sequences are conserved in the same family but fairly divergent between the different families in the Strigiformes. Secondly, the centromeric satellite DNAs were cloned from eight Strigidae species, and the nucleotide sequences of 41 monomer fragments were compared within and between species. Molecular phylogenetic relationships of the nucleotide sequences were highly correlated with both the taxonomy based on morphological traits and the phylogenetic tree constructed by DNA-DNA hybridization. These results suggest that the satellite DNA sequence has evolved by concerted evolution in the Strigidae and that it is a good taxonomic and phylogenetic marker to examine genetic diversity between Strigiformes species.

Erwinia carotovora subsp. carotovora extracellular protease: characterization and nucleotide sequence of the gene.

PubMed Central

Kyöstiö, S R; Cramer, C L; Lacy, G H

1991-01-01

The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878

Isolation and characterization of the gene coding for Escherichia coli arginyl-tRNA synthetase.

PubMed Central

Eriani, G; Dirheimer, G; Gangloff, J

1989-01-01

The gene coding for Escherichia coli arginyl-tRNA synthetase (argS) was isolated as a fragment of 2.4 kb after analysis and subcloning of recombinant plasmids from the Clarke and Carbon library. The clone bearing the gene overproduces arginyl-tRNA synthetase by a factor 100. This means that the enzyme represents more than 20% of the cellular total protein content. Sequencing revealed that the fragment contains a unique open reading frame of 1734 bp flanked at its 5' and 3' ends respectively by 247 bp and 397 bp. The length of the corresponding protein (577 aa) is well consistent with earlier Mr determination (about 70 kd). Primer extension analysis of the ArgRS mRNA by reverse transcriptase, located its 5' end respectively at 8 and 30 nucleotides downstream of a TATA and a TTGAC like element (CTGAC) and 60 nucleotides upstream of the unusual translation initiation codon GUG; nuclease S1 analysis located the 3'-end at 48 bp downstream of the translation termination codon. argS has a codon usage pattern typical for highly expressed E. coli genes. With the exception of the presence of a HVGH sequence similar to the HIGH consensus element, ArgRS has no relevant sequence homologies with other aminoacyl-tRNA synthetases. Images PMID:2668891

Novel Mutations in pncA Gene of Pyrazinamide Resistant Clinical Isolates of Mycobacterium tuberculosis.

PubMed

Kahbazi, Manijeh; Sarmadian, Hossein; Ahmadi, Azam; Didgar, Farshideh; Sadrnia, Maryam; Poolad, Toktam; Arjomandzadegan, Mohammad

2018-04-16

In clinical isolates of Mycobacterium tuberculosis (MTB), resistance to pyrazinamide occurs by mutations in any positions of the pncA gene (NC_000962.3) especially in nucleotides 359 and 374. In this study we examined the pncA gene sequence in clinical isolates of MTB. Genomic DNA of 33 clinical isolates of MTB was extracted by the Chelex100 method. The polymerase chain reactions (PCR) were performed using specific primers for amplification of 744 bp amplicon comprising the coding sequences (CDS) of the pncA gene. PCR products were sequenced by an automated sequencing Bioscience system. Additionally, semi Nested-allele specific (sNASP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods were carried out for verification of probable mutations in nucleotides 359 and 374. Sequencing results showed that from 33 MTB clinical isolates, nine pyrazinamide-resistant isolates have mutations. Furthermore, no mutation was detected in 24 susceptible strains in the entire 561 bp of the pncA gene. Moreover, new mutations of G→A at position 3 of the pncA gene were identified in some of the resistant isolates. Results showed that the sNASP method could detect mutations in nucleotide 359 and 374 of the pncA gene, but the PCR-RFLP method by the SacII enzyme could not detect these mutations. In conclusion, the identification of new mutations in the pncA gene confirmed the probable occurrence of mutations in any nucleotides of the pncA gene sequence in resistant isolates of MTB.

Sequence of pNL194, a 79.3-Kilobase IncN Plasmid Carrying the blaVIM-1 Metallo-β-Lactamase Gene in Klebsiella pneumoniae▿

PubMed Central

Miriagou, V.; Papagiannitsis, C. C.; Kotsakis, S. D.; Loli, A.; Tzelepi, E.; Legakis, N. J.; Tzouvelekis, L. S.

2010-01-01

The nucleotide sequence of pNL194, a VIM-1-encoding plasmid, is described in this study. pNL194 (79,307 bp) comprised an IncN-characteristic segment (38,940 bp) and a mosaic structure (40,367 bp) including blaVIM-1, aacA7, aadA1, aadA2, dfrA1, dfrA12, aphA1, strA, strB, and sul1. Tn1000 or Tn5501 insertion within fipA probably facilitated recruitment of additional mobile elements carrying resistance genes. PMID:20660690

Molecular Characterization of Eimeria Species Naturally Infecting Egyptian Baldi Chickens

PubMed Central

GADELHAQ, Sahar M; ARAFA, Waleed M; ABOELHADID, Shawky M

2015-01-01

Background: Coccidiosis is a serious protozoal disease of poultry. The identification of Eimeria species has important implications for diagnosis and control as well as for epidemiology. The molecular characterization of Eimeria species infecting Egyptian baladi chickens was investigated. Methods: Eimeria species oocysts were harvested from intestines of naturally infected Egyptian baldi chickens. The morphometry characterization of oocysts along with COCCIMORPH software was done. The DNA was extracted initially by freezing and thawing then the prepared samples was subjected to commercial DNA kits. The DNA products were analyzed through conventional polymerase chain reaction by using amplified region (SCAR) marker. Results: The PCR results confirmed the presence of 7 Eimeria species in the examined fecal samples of Egyptian baldi breed with their specific ampilicon sizes being E. acervulina (811bp), E. brunette (626bp), E. tenella (539bp), E. maxima (272bp), E. necatrix (200bp), E. mitis (327bp) and E. praecopx (354bp). A sequencing of the two most predominant species of Eimeria was done, on E. tenella and E. máxima. Analysis of the obtained sequences revealed high identities 99% between Egyptian isolates and the reference one. Similarly, E. maxima isolated from Egyptian baldi chickens showed 98% nucleotide identities with the reference strain. Only single nucleotide substitution was observed among the Egyptian E. tenella isolates (A181G) when compared to the reference one. The Egyptian isolates acquired 4 unique mutations (A68T, C164T, G190A and C227G) in compared with the reference sequence. Conclusion: This is the first time to identify the 7 species of Eimeria from Egyptian baladi chickens. PMID:25904950

Identification of single nucleotide polymorphism in ginger using expressed sequence tags

PubMed Central

Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J

2009-01-01

Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184

The ura5 gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli.

PubMed

Le Chevanton, L; Leblon, G

1989-04-15

We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.

The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

PubMed

Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

2008-04-01

The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

PubMed Central

Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

2008-01-01

The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

The mitochondrial genome of the quiet-calling katydids, Xizicus fascipes (Orthoptera: Tettigoniidae: Meconematinae).

PubMed

Yang, Ming Ru; Zhou, Zhi Jun; Chang, Yan Lin; Zhao, Le Hong

2012-08-01

To help determine whether the typical arthropod arrangement was a synapomorphy for the whole Tettigoniidae, we sequenced the mitochondrial genome (mitogenome) of the quiet-calling katydids, Xizicus fascipes (Orthoptera: Tettigoniidae: Meconematinae). The 16,166-bp nucleotide sequences of X. fascipes mitogenome contains the typical gene content, gene order, base composition, and codon usage found in arthropod mitogenomes. As a whole, the X. fascipes mitogenome contains a lower A+T content (70.2%) found in the complete orthopteran mitogenomes determined to date. All protein-coding genes started with a typical ATN codon. Ten of the 13 protein-coding genes have a complete termination codon, but the remaining three genes (COIII, ND5 and ND4) terminate with incomplete T. All tRNAs have the typical clover-leaf structure of mitogenome tRNA, except for tRNA(Ser(AGN)), in which lengthened anticodon stem (9 bp) with a bulged nuleotide in the middle, an unusual T-stem (6 bp in constrast to the normal 5 bp), a mini DHU arm (2 bp) and no connector nucleotides. In the A+T-rich region, two (TA)n conserved blocks that were previously described in Ensifera and two 150-bp tandem repeats plus a partial copy of the composed at 61 bp of the beginning were present. Phylogenetic analysis found: i) the monophyly of Conocephalinae was interrupted by Elimaea cheni from Phaneropterinae; and ii) Meconematinae was the most basal group among these five subfamilies.

Plasmid origin of replication of herpesvirus papio: DNA sequence and enhancer function.

PubMed Central

Loeb, D D; Sung, N S; Pesano, R L; Sexton, C J; Hutchison, C; Pagano, J S

1990-01-01

Herpesvirus papio (HVP) is a lymphotropic virus of baboons which is related to Epstein-Barr virus (EBV) and produces latent infection. The nucleotide sequence of the 5,775-base-pair (bp) EcoRI K fragment of HVP, which has previously been shown to confer the ability to replicate autonomously, has been determined. Within this DNA fragment is a region which bears structural and sequence similarity to the ori-P region of EBV. The HVP ori-P region has a 10- by 26-bp tandem array which is related to the 20- by 30-bp tandem array from the EBV ori-P region. In HVP there is an intervening region of 764 bp followed by five partial copies of the 26-bp monomer. Both the EBV and HVP 3' regions have the potential to form dyad structures which, however, differ in arrangement. We also demonstrate that a transcriptional enhancer which requires transactivation by a virus-encoded factor is present in the HVP ori-P. Images PMID:2159548

The primary structure of the thymidine kinase gene of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Handermann, M; Szépe, O; Darai, G

1991-06-01

The DNA nucleotide sequence of the thymidine kinase (TK) gene of fish lymphocystis disease virus (FLDV) which has been localized between the coordinates 0.678 to 0.688 of the viral genome was determined. The analysis of the DNA nucleotide sequence located between the recognition sites of HindIII (0.669 map unit; nucleotide position 1) and AccI (nucleotide position 2032) revealed the presence of an open reading frame of 954 bp on the lower strand of this region between nucleotide positions 1868 (ATG) and 915 (TAA). It encodes for a protein of 318 amino acid residues. The evolutionary relationships of the TK gene of FLDV to the other known TK genes was investigated using the method of progressive sequence alignment. These analyses revealed a high degree of diversity between the protein sequence of FLDV TK gene and the amino acid composition of other TKs tested. However, significant conservations were detected at several regions of amino acid residues of the FLDV TK protein when compared to the amino acid sequence of TKs of African swine fever virus, fowlpox virus, shope fibroma virus, and vaccinia virus and to the amino acid sequences of the cellular cytoplasmic TK of chicken, mouse, and man.

The complete mitochondrial genome of Plodia interpunctella (Lepidoptera: Pyralidae) and comparison with other Pyraloidea insects.

PubMed

Liu, Qiu-Ning; Chai, Xin-Yue; Bian, Dan-Dan; Zhou, Chun-Lin; Tang, Bo-Ping

2016-01-01

The mitochondrial (mt) genome can provide important information for the understanding of phylogenetic relationships. The complete mt genome of Plodia interpunctella (Lepidoptera: Pyralidae) has been sequenced. The circular genome is 15 287 bp in size, encoding 13 protein-coding genes (PCGs), 2 rRNA genes, 22 tRNA genes, and a control region. The AT skew of this mt genome is slightly negative, and the nucleotide composition is biased toward A+T nucleotides (80.15%). All PCGs start with the typical ATN (ATA, ATC, ATG, and ATT) codons, except for the cox1 gene which may start with the CGA codon. Four of the 13 PCGs harbor the incomplete termination codon T or TA. All the tRNA genes are folded into the typical clover-leaf structure of mitochondrial tRNA, except for trnS1 (AGN) in which the DHU arm fails to form a stable stem-loop structure. The overlapping sequences are 35 bp in total and are found in seven different locations. A total of 240 bp of intergenic spacers are scattered in 16 regions. The control region of the mt genome is 327 bp in length and consisted of several features common to the sequenced lepidopteran insects. Phylogenetic analysis based on 13 PCGs using the Maximum Likelihood method shows that the placement of P. interpunctella was within the Pyralidae.

The complete chloroplast genome of Sinopodophyllum hexandrum Ying (Berberidaceae).

PubMed

Meng, Lihua; Liu, Ruijuan; Chen, Jianbing; Ding, Chenxu

2017-05-01

The complete nucleotide sequence of the Sinopodophyllum hexandrum Ying chloroplast genome (cpDNA) was determined based on next-generation sequencing technologies in this study. The genome was 157 203 bp in length, containing a pair of inverted repeat (IRa and IRb) regions of 25 960 bp, which were separated by a large single-copy (LSC) region of 87 065 bp and a small single-copy (SSC) region of 18 218 bp, respectively. The cpDNA contained 148 genes, including 96 protein-coding genes, 8 ribosomal RNA genes, and 44 tRNA genes. In these genes, eight harbored a single intron, and two (ycf3 and clpP) contained a couple of introns. The cpDNA AT content of S. hexandrum cpDNA is 61.5%.

Detection of a new bat gammaherpesvirus in the Philippines.

PubMed

Watanabe, Shumpei; Ueda, Naoya; Iha, Koichiro; Masangkay, Joseph S; Fujii, Hikaru; Alviola, Phillip; Mizutani, Tetsuya; Maeda, Ken; Yamane, Daisuke; Walid, Azab; Kato, Kentaro; Kyuwa, Shigeru; Tohya, Yukinobu; Yoshikawa, Yasuhiro; Akashi, Hiroomi

2009-08-01

A new bat herpesvirus was detected in the spleen of an insectivorous bat (Hipposideros diadema, family Hipposideridae) collected on Panay Island, the Philippines. PCR analyses were performed using COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOPs) targeting the herpesvirus DNA polymerase (DPOL) gene. Although we obtained PCR products with CODEHOPs, direct sequencing using the primers was not possible because of high degree of degeneracy. Direct sequencing technology developed in our rapid determination system of viral RNA sequences (RDV) was applied in this study, and a partial DPOL nucleotide sequence was determined. In addition, a partial gB gene nucleotide sequence was also determined using the same strategy. We connected the partial gB and DPOL sequences with long-distance PCR, and a 3741-bp nucleotide fragment, including the 3' part of the gB gene and the 5' part of the DPOL gene, was finally determined. Phylogenetic analysis showed that the sequence was novel and most similar to those of the subfamily Gammaherpesvirinae.

Isolation of a sex-linked DNA sequence in cranes.

PubMed

Duan, W; Fuerst, P A

2001-01-01

A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.

Duplication polymorphisms in exon 4 of κ-casein gene in yak breeds/populations.

PubMed

Pingcuo, S; Gao, J; Jiang, Z R; Jin, S Y; Fu, C Y; Liu, X; Huang, L; Zheng, Y C

2015-08-28

The objective of this study was to compare 12 bp-duplication polymorphisms in exon 4 of the κ-casein gene among 3 breeds/populations of yak (Bos grunniens). Genomic DNA was extracted from yak blood or muscle samples (N = 211) and a partial sequence of exon 4 of κ-casein gene was amplified by polymerase chain reaction. A polyacrylamide gel electrophoresis assay of the products (169 bp) revealed 2 variants. These variants differed in a 12-bp duplication of the nucleotide sequence corresponding to amino acids 147-150 (Glu-Ala-Ser-Pro) or 148-151 (Ala-Ser-Pro-Glu). The genotype frequency and gene frequency of the 2 κ-casein variants differed among the 3 yak breeds/populations. The long form of the κ-casein gene was the predominant allele, and the Jiulong yak showed the highest frequency of the short form variant of the κ-casein gene. In addition, 2 nucleotide differences resulting in amino acid substitutions were also identified in yaks. These results are significant for designing a breeding strategy to improve the genetic makeup of yak herds.

The nucleotide sequence of the entire ribosomal DNA operon and the structure of the large subunit rRNA of Giardia muris.

PubMed

van Keulen, H; Gutell, R R; Campbell, S R; Erlandsen, S L; Jarroll, E L

1992-10-01

The total nucleotide sequence of the rDNA of Giardia muris, an intestinal protozoan parasite of rodents, has been determined. The repeat unit is 7668 basepairs (bp) in size and consists of a spacer of 3314 bp, a small-subunit rRNA (SSU-rRNA) gene of 1429, and a large-subunit rRNA (LSU-rRNA) gene of 2698 bp. The spacer contains long direct repeats and is heterogeneous in size. The LSU-rRNA of G. muris was compared to that of the human intestinal parasite Giardia duodenalis, to the bird parasite Giardia ardeae, and to that of Escherichia coli. The LSU-rRNA has a size comparable to the 23S rRNA of E. coli but shows structural features typical for eukaryotes. Some variable regions are typically small and account for the overall smaller size of this rRNA. The structure of the G. muris LSU-rRNA is similar to that of the other Giardia rRNA, but each rRNA has characteristic features residing in a number of variable regions.

The Complete Chloroplast and Mitochondrial Genome Sequences of Boea hygrometrica: Insights into the Evolution of Plant Organellar Genomes

PubMed Central

Wang, Xumin; Deng, Xin; Zhang, Xiaowei; Hu, Songnian; Yu, Jun

2012-01-01

The complete nucleotide sequences of the chloroplast (cp) and mitochondrial (mt) genomes of resurrection plant Boea hygrometrica (Bh, Gesneriaceae) have been determined with the lengths of 153,493 bp and 510,519 bp, respectively. The smaller chloroplast genome contains more genes (147) with a 72% coding sequence, and the larger mitochondrial genome have less genes (65) with a coding faction of 12%. Similar to other seed plants, the Bh cp genome has a typical quadripartite organization with a conserved gene in each region. The Bh mt genome has three recombinant sequence repeats of 222 bp, 843 bp, and 1474 bp in length, which divide the genome into a single master circle (MC) and four isomeric molecules. Compared to other angiosperms, one remarkable feature of the Bh mt genome is the frequent transfer of genetic material from the cp genome during recent Bh evolution. We also analyzed organellar genome evolution in general regarding genome features as well as compositional dynamics of sequence and gene structure/organization, providing clues for the understanding of the evolution of organellar genomes in plants. The cp-derived sequences including tRNAs found in angiosperm mt genomes support the conclusion that frequent gene transfer events may have begun early in the land plant lineage. PMID:22291979

Nucleotide sequence and expression of a novel pectate lyase gene (pel-3) and a closely linked endopolygalacturonase gene (peh-1) of Erwinia carotovora subsp. carotovora 71.

PubMed Central

Liu, Y; Chatterjee, A; Chatterjee, A K

1994-01-01

Our previous genetic analysis (J. W. Willis, J. K. Engwall, and A. K. Chatterjee, Phytopathology 77:1199-1205, 1987) had revealed a tight linkage between pel-3 (pel, pectate lyase gene) and peh-1 (peh, polygalacturonase gene) within the chromosome of Erwinia carotovora subsp. carotovora 71. Nucleotide sequencing, transcript assays, and expression of enzymatic activities in Escherichia coli have now confirmed that a 3,500-bp segment contains the open reading frames (ORFs) for Pel-3 and Peh-1. The 1,041-bp pel-3 ORF and the 1,206-bp peh-1 ORF are separated by a 579-bp sequence. The genes are transcribed divergently from their own promoters. In E. coli and E. carotovora subsp. carotovora 71, peh-1 is better expressed than pel-3. However, plant signals activate the expression of both the genes in E. carotovora subsp. carotovora. A consensus integration host factor (IHF)-binding sequence upstream of pel-3 appears physiologically significant, since pel-3 promoter activity is higher in an E. coli IHF+ strain than in an IHF- strain. While peh-1 has extensive homology with plant and bacterial peh genes, pel-3 appears not to have significant homology with the pel genes belonging to the pelBC, pelADE, or periplasmic pel families. Pel-3 also is unusual in that it is predicted to contain an ATP- and GTP-binding site motif A (P-loop) not found in the other Pels. Images PMID:8074530

Determination of ABO genotypes with DNA extracted from formalin-fixed, paraffin-embedded tissues.

PubMed

Yamada, M; Yamamoto, Y; Tanegashima, A; Kane, M; Ikehara, Y; Fukunaga, T; Nishi, K

1994-01-01

The gene encoding the specific glycosyltransferases which catalyze the conversion of the H antigen to A or B antigens shows a slight but distinct variation in its allelic nucleotide sequence and can be divided into 6 genotypes when digested with specific restriction enzymes. We extracted DNA from formalin-fixed, paraffin-embedded tissues using SDS/proteinase K treatment followed by phenol/chloroform extraction. The sequence of nucleotides for the A, B and O genes was amplified by the polymerase chain reaction (PCR). DNA fragments of 128 bp and 200 bp could be amplified in the second round of PCR, using an aliquot of the first round PCR product as template. Degraded DNA from paraffin blocks stored for up to 10.7 years could be successfully typed. The ABO genotype was deduced from the digestion patterns with an appropriate combination of restriction enzymes and was compatible with the phenotype obtained from the blood sample.

Japanese Wolves are Genetically Divided into Two Groups Based on an 8-Nucleotide Insertion/Deletion within the mtDNA Control Region.

PubMed

Ishiguro, Naotaka; Inoshima, Yasuo; Yanai, Tokuma; Sasaki, Motoki; Matsui, Akira; Kikuchi, Hiroki; Maruyama, Masashi; Hongo, Hitomi; Vostretsov, Yuri E; Gasilin, Viatcheslav; Kosintsev, Pavel A; Quanjia, Chen; Chunxue, Wang

2016-02-01

The mitochondrial DNA (mtDNA) control region (198- to 598-bp) of four ancient Canis specimens (two Canis mandibles, a cranium, and a first phalanx) was examined, and each specimen was genetically identified as Japanese wolf. Two unique nucleotide substitutions, the 78-C insertion and the 482-G deletion, both of which are specific for Japanese wolf, were observed in each sample. Based on the mtDNA sequences analyzed, these four specimens and 10 additional Japanese wolf samples could be classified into two groups- Group A (10 samples) and Group B (4 samples)-which contain or lack an 8-bp insertion/deletion (indel), respectively. Interestingly, three dogs (Akita-b, Kishu 25, and S-husky 102) that each contained Japanese wolf-specific features were also classified into Group A or B based on the 8-bp indel. To determine the origin or ancestor of the Japanese wolf, mtDNA control regions of ancient continental Canis specimens were examined; 84 specimens were from Russia, and 29 were from China. However, none of these 113 specimens contained Japanese wolf-specific sequences. Moreover, none of 426 Japanese modern hunting dogs examined contained these Japanese wolf-specific mtDNA sequences. The mtDNA control region sequences of Groups A and B appeared to be unique to grey wolf and dog populations.

Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa.

PubMed

Shahin, Arwa; van Kaauwen, Martijn; Esselink, Danny; Bargsten, Joachim W; van Tuyl, Jaap M; Visser, Richard G F; Arens, Paul

2012-11-20

Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Two transcriptome sets were built that are valuable resources for marker development, comparative genomic studies and candidate gene approaches. Next generation sequencing of leaf transcriptome is very effective; however, deeper sequencing and using more tissues and stages is advisable for extended comparative studies.

Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout

USGS Publications Warehouse

Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.

2010-01-01

The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

Comparative sequence analyses of sixteen reptilian paramyxoviruses

USGS Publications Warehouse

Ahne, W.; Batts, W.N.; Kurath, G.; Winton, J.R.

1999-01-01

Viral genomic RNA of Fer-de-Lance virus (FDLV), a paramyxovirus highly pathogenic for reptiles, was reverse transcribed and cloned. Plasmids with significant sequence similarities to the hemagglutinin-neuraminidase (HN) and polymerase (L) genes of mammalian paramyxoviruses were identified by BLAST search. Partial sequences of the FDLV genes were used to design primers for amplification by nested polymerase chain reaction (PCR) and sequencing of 518-bp L gene and 352-bp HN gene fragments from a collection of 15 previously uncharacterized reptilian paramyxoviruses. Phylogenetic analyses of the partial L and HN sequences produced similar trees in which there were two distinct subgroups of isolates that were supported with maximum bootstrap values, and several intermediate isolates. Within each subgroup the nucleotide divergence values were less than 2.5%, while the divergence between the two subgroups was 20-22%. This indicated that the two subgroups represent distinct virus species containing multiple virus strains. The five intermediate isolates had nucleotide divergence values of 11-20% and may represent additional distinct species. In addition to establishing diversity among reptilian paramyxoviruses, the phylogenetic groupings showed some correlation with geographic location, and clearly demonstrated a low level of host species-specificity within these viruses. Copyright (C) 1999 Elsevier Science B.V.

Droplet-based pyrosequencing using digital microfluidics.

PubMed

Boles, Deborah J; Benton, Jonathan L; Siew, Germaine J; Levy, Miriam H; Thwar, Prasanna K; Sandahl, Melissa A; Rouse, Jeremy L; Perkins, Lisa C; Sudarsan, Arjun P; Jalili, Roxana; Pamula, Vamsee K; Srinivasan, Vijay; Fair, Richard B; Griffin, Peter B; Eckhardt, Allen E; Pollack, Michael G

2011-11-15

The feasibility of implementing pyrosequencing chemistry within droplets using electrowetting-based digital microfluidics is reported. An array of electrodes patterned on a printed-circuit board was used to control the formation, transportation, merging, mixing, and splitting of submicroliter-sized droplets contained within an oil-filled chamber. A three-enzyme pyrosequencing protocol was implemented in which individual droplets contained enzymes, deoxyribonucleotide triphosphates (dNTPs), and DNA templates. The DNA templates were anchored to magnetic beads which enabled them to be thoroughly washed between nucleotide additions. Reagents and protocols were optimized to maximize signal over background, linearity of response, cycle efficiency, and wash efficiency. As an initial demonstration of feasibility, a portion of a 229 bp Candida parapsilosis template was sequenced using both a de novo protocol and a resequencing protocol. The resequencing protocol generated over 60 bp of sequence with 100% sequence accuracy based on raw pyrogram levels. Excellent linearity was observed for all of the homopolymers (two, three, or four nucleotides) contained in the C. parapsilosis sequence. With improvements in microfluidic design it is expected that longer reads, higher throughput, and improved process integration (i.e., "sample-to-sequence" capability) could eventually be achieved using this low-cost platform.

[Study on the genetic difference of SEO type Hantaviruses].

PubMed

Zhang, X; Zhou, S; Wang, H; Hu, J; Guan, Z; Liu, H

2000-10-01

To understand the genetic type of Hantaviruses and the difference between them caused by rodents in Beijing and to furhter explore the source of the infectious factors. Hantavirus RNA, isolated from lungs of rodents captured in Beijing and positive with Hantavirus antigens with frozen sectioning and Immunofluorescent assay, were reverse-transcribed and amplified with PCR with Hantavirus-specific primers. Five of the PCR amplifications were discovered and sequenced with 300 bp sequence data of M segments (from 2003 - 2302nt according cDNA of seoul 8039 strain). Nucleotide sequence homology showed that they were sequences of SEO-type Hantavirus. Compared with SEO type Hantavirus, the nucleotide sequence homology of these samples was more than 94% while the homology of amonia acid sequence was more than 98%. When compared with HNT type Hantavirus, the homology of nucleotide sequence became less than 72% with the homology of amonia acid sequence less than 81%. Similar to other Hantavirus of SEO type, their nucleotide sequences and deduced amino acid sequences were highly preserved. Phylogenetic tree analysis showed that the five viruses could be divided into at least 4 branches. It was quite likely that there were at least two sub-type SEO viruses with 4 branches that were circulating in Beijing.

[Cloning and sequence analysis of full-length cDNA of secoisolariciresinol dehydrogenase of Dysosma versipellis].

PubMed

Xu, Li; Ding, Zhi-Shan; Zhou, Yun-Kai; Tao, Xue-Fen

2009-06-01

To obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis by RACE PCR,then investigate the character of Secoisolariciresinol Dehydrogenase gene. The full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene was obtained by 3'-RACE and 5'-RACE from Dysosma versipellis. We first reported the full cDNA sequences of Secoisolariciresinol Dehydrogenase in Dysosma versipellis. The acquired gene was 991bp in full length, including 5' untranslated region of 42bp, 3' untranslated region of 112bp with Poly (A). The open reading frame (ORF) encoding 278 amino acid with molecular weight 29253.3 Daltons and isolectric point 6.328. The gene accession nucleotide sequence number in GeneBank was EU573789. Semi-quantitative RT-PCR analysis revealed that the Secoisolariciresinol Dehydrogenase gene was highly expressed in stem. Alignment of the amino acid sequence of Secoisolariciresinol Dehydrogenase indicated there may be some significant amino acid sequence difference among different species. Obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis.

Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.

PubMed

Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R

1987-01-01

The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.

The complete chloroplast genome of North American ginseng, Panax quinquefolius.

PubMed

Han, Zeng-Jie; Li, Wei; Liu, Yuan; Gao, Li-Zhi

2016-09-01

We report complete nucleotide sequence of the Panax quinquefolius chloroplast genome using next-generation sequencing technology. The genome size is 156 359 bp, including two inverted repeats (IRs) of 52 153 bp, separated by the large single-copy (LSC 86 184 bp) and small single-copy (SSC 18 081 bp) regions. This cp genome encodes 114 unigenes (80 protein-coding genes, four rRNA genes, and 30 tRNA genes), in which 18 are duplicated in the IR regions. Overall GC content of the genome is 38.08%. A phylogenomic analysis of the 10 complete chloroplast genomes from Araliaceae using Daucus carota from Apiaceae as outgroup showed that P. quinquefolius is closely related to the other two members of the genus Panax, P. ginseng and P. notoginseng.

Complete mitochondrial genome of Helicoverpa zea (Boddie) and expression profiles of mitochondrial-encoded genes in early and late embryos

USDA-ARS?s Scientific Manuscript database

The mitochondrial genome of the bollworm, Helicoverpa zea, was assembled using paired-end nucleotide sequence reads generated with a next-generation sequencing platform. Assembly resulted in a mitogenome of 15,348 bp with greater than 17,000-fold average coverage. Organization of the H. zea mitogen...

Differential expression of copper-zinc superoxide dismutase gene of Polygonum sibiricum leaves, stems and underground stems, subjected to high-salt stress.

PubMed

Qu, Chun-Pu; Xu, Zhi-Ru; Liu, Guan-Jun; Liu, Chun; Li, Yang; Wei, Zhi-Gang; Liu, Gui-Feng

2010-01-01

In aerobic organisms, protection against oxidative damage involves the combined action of highly specialized antioxidant enzymes, such as copper-zinc superoxide dismutase. In this work, a cDNA clone which encodes a copper-zinc superoxide dismutase gene, named PS-CuZnSOD, has been identified from P. sibiricum Laxm. by the rapid amplification of cDNA ends method (RACE). Analysis of the nucleotide sequence reveals that the PS-CuZnSOD gene cDNA clone consists of 669 bp, containing 87 bp in the 5' untranslated region; 459 bp in the open reading frame (ORF) encoding 152 amino acids; and 123 bp in 3' untranslated region. The gene accession nucleotide sequence number in GenBank is GQ472846. Sequence analysis indicates that the protein, like most plant superoxide dismutases (SOD), includes two conserved ecCuZnSOD signatures that are from the amino acids 43 to 51, and from the amino acids 137 to 148, and it has a signal peptide extension in the front of the N-terminus (1-16 aa). Expression analysis by real-time quantitative PCR reveals that the PS-CuZnSOD gene is expressed in leaves, stems and underground stems. PS-CuZnSOD gene expression can be induced by 3% NaHCO(3). The different mRNA levels' expression of PS-CuZnSOD show the gene's different expression modes in leaves, stems and underground stems under the salinity-alkalinity stress.

Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.

PubMed

Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T

1996-10-31

Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.

Detection of a novel herpesvirus from bats in the Philippines.

PubMed

Sano, Kaori; Okazaki, Sachiko; Taniguchi, Satoshi; Masangkay, Joseph S; Puentespina, Roberto; Eres, Eduardo; Cosico, Edison; Quibod, Niña; Kondo, Taisuke; Shimoda, Hiroshi; Hatta, Yuuki; Mitomo, Shumpei; Oba, Mami; Katayama, Yukie; Sassa, Yukiko; Furuya, Tetsuya; Nagai, Makoto; Une, Yumi; Maeda, Ken; Kyuwa, Shigeru; Yoshikawa, Yasuhiro; Akashi, Hiroomi; Omatsu, Tsutomu; Mizutani, Tetsuya

2015-08-01

Bats are natural hosts of many zoonotic viruses. Monitoring bat viruses is important to detect novel bat-borne infectious diseases. In this study, next generation sequencing techniques and conventional PCR were used to analyze intestine, lung, and blood clot samples collected from wild bats captured at three locations in Davao region, in the Philippines in 2012. Different viral genes belonging to the Retroviridae and Herpesviridae families were identified using next generation sequencing. The existence of herpesvirus in the samples was confirmed by PCR using herpesvirus consensus primers. The nucleotide sequences of the resulting PCR amplicons were 166-bp. Further phylogenetic analysis identified that the virus from which this nucleotide sequence was obtained belonged to the Gammaherpesvirinae subfamily. PCR using primers specific to the nucleotide sequence obtained revealed that the infection rate among the captured bats was 30 %. In this study, we present the partial genome of a novel gammaherpesvirus detected from wild bats. Our observations also indicate that this herpesvirus may be widely distributed in bat populations in Davao region.

Landscape of Insertion Polymorphisms in the Human Genome

PubMed Central

Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.

2015-01-01

Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018

Complete genome sequence of the biofilm-forming Curtobacterium sp. strain BH-2-1-1, isolated from lettuce (Lactuca sativa) originating from a conventional field in Norway.

PubMed

Dees, Merete Wiken; Brurberg, May Bente; Lysøe, Erik

2016-12-01

Here, we present the 3,795,952 bp complete genome sequence of the biofilm-forming Curtobacterium sp. strain BH-2-1-1, isolated from conventionally grown lettuce ( Lactuca sativa ) from a field in Vestfold, Norway. The nucleotide sequence of this genome was deposited into NCBI GenBank under the accession CP017580.

Complete Chloroplast Genome Sequence of Tartary Buckwheat (Fagopyrum tataricum) and Comparative Analysis with Common Buckwheat (F. esculentum)

PubMed Central

Cho, Kwang-Soo; Yun, Bong-Kyoung; Yoon, Young-Ho; Hong, Su-Young; Mekapogu, Manjulatha; Kim, Kyung-Hee; Yang, Tae-Jin

2015-01-01

We report the chloroplast (cp) genome sequence of tartary buckwheat (Fagopyrum tataricum) obtained by next-generation sequencing technology and compared this with the previously reported common buckwheat (F. esculentum ssp. ancestrale) cp genome. The cp genome of F. tataricum has a total sequence length of 159,272 bp, which is 327 bp shorter than the common buckwheat cp genome. The cp gene content, order, and orientation are similar to those of common buckwheat, but with some structural variation at tandem and palindromic repeat frequencies and junction areas. A total of seven InDels (around 100 bp) were found within the intergenic sequences and the ycf1 gene. Copy number variation of the 21-bp tandem repeat varied in F. tataricum (four repeats) and F. esculentum (one repeat), and the InDel of the ycf1 gene was 63 bp long. Nucleotide and amino acid have highly conserved coding sequence with about 98% homology and four genes—rpoC2, ycf3, accD, and clpP—have high synonymous (Ks) value. PCR based InDel markers were applied to diverse genetic resources of F. tataricum and F. esculentum, and the amplicon size was identical to that expected in silico. Therefore, these InDel markers are informative biomarkers to practically distinguish raw or processed buckwheat products derived from F. tataricum and F. esculentum. PMID:25966355

Short-Read Sequencing for Genomic Analysis of the Brown Rot Fungus Fibroporia radiculosa

Treesearch

J. D. Tang; A. D. Perkins; T. S. Sonstegard; S. G. Schroeder; S. C. Burgess; S. V. Diehl

2012-01-01

The feasibility of short-read sequencing for genomic analysis was demonstrated for Fibroporia radiculosa, a copper-tolerant fungus that causes brown rot decay of wood. The effect of read quality on genomic assembly was assessed by filtering Illumina GAIIx reads from a single run of a paired-end library (75-nucleotide read length and 300-bp fragment...

Droplet-Based Pyrosequencing Using Digital Microfluidics

PubMed Central

Boles, Deborah J.; Benton, Jonathan L.; Siew, Germaine J.; Levy, Miriam H.; Thwar, Prasanna K.; Sandahl, Melissa A.; Rouse, Jeremy L.; Perkins, Lisa C.; Sudarsan, Arjun P.; Jalili, Roxana; Pamula, Vamsee K.; Srinivasan, Vijay; Fair, Richard B.; Griffin, Peter B.; Eckhardt, Allen E.; Pollack, Michael G.

2013-01-01

The feasibility of implementing pyrosequencing chemistry within droplets using electrowetting-based digital microfluidics is reported. An array of electrodes patterned on a printed-circuit board was used to control the formation, transportation, merging, mixing, and splitting of submicroliter-sized droplets contained within an oil-filled chamber. A three-enzyme pyrosequencing protocol was implemented in which individual droplets contained enzymes, deoxyribonucleotide triphosphates (dNTPs), and DNA templates. The DNA templates were anchored to magnetic beads which enabled them to be thoroughly washed between nucleotide additions. Reagents and protocols were optimized to maximize signal over background, linearity of response, cycle efficiency, and wash efficiency. As an initial demonstration of feasibility, a portion of a 229 bp Candida parapsilosis template was sequenced using both a de novo protocol and a resequencing protocol. The resequencing protocol generated over 60 bp of sequence with 100% sequence accuracy based on raw pyrogram levels. Excellent linearity was observed for all of the homopolymers (two, three, or four nucleotides) contained in the C. parapsilosis sequence. With improvements in microfluidic design it is expected that longer reads, higher throughput, and improved process integration (i.e., “sample-to-sequence” capability) could eventually be achieved using this low-cost platform. PMID:21932784

Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.

PubMed

Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A

2018-06-01

Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.

Molecular characterization of long direct repeat (LDR) sequences expressing a stable mRNA encoding for a 35-amino-acid cell-killing peptide and a cis-encoded small antisense RNA in Escherichia coli.

PubMed

Kawano, Mitsuoki; Oshima, Taku; Kasai, Hiroaki; Mori, Hirotada

2002-07-01

Genome sequence analyses of Escherichia coli K-12 revealed four copies of long repetitive elements. These sequences are designated as long direct repeat (LDR) sequences. Three of the repeats (LDR-A, -B, -C), each approximately 500 bp in length, are located as tandem repeats at 27.4 min on the genetic map. Another copy (LDR-D), 450 bp in length and nearly identical to LDR-A, -B and -C, is located at 79.7 min, a position that is directly opposite the position of LDR-A, -B and -C. In this study, we demonstrate that LDR-D encodes a 35-amino-acid peptide, LdrD, the overexpression of which causes rapid cell killing and nucleoid condensation of the host cell. Northern blot and primer extension analysis showed constitutive transcription of a stable mRNA (approximately 370 nucleotides) encoding LdrD and an unstable cis-encoded antisense RNA (approximately 60 nucleotides), which functions as a trans-acting regulator of ldrD translation. We propose that LDR encodes a toxin-antitoxin module. LDR-homologous sequences are not pre-sent on any known plasmids but are conserved in Salmonella and other enterobacterial species.

Genetic diversity and classification of Tibetan yak populations based on the mtDNA COIII gene.

PubMed

Song, Q Q; Chai, Z X; Xin, J W; Zhao, S J; Ji, Q M; Zhang, C F; Ma, Z J; Zhong, J C

2015-03-13

To determine the level of genetic diversity and phylogenetic relationships among Tibetan yak populations, the mitochondrial DNA cytochrome c oxidase subunit 3 (COIII) genes of 378 yak individuals from 16 populations were analyzed in this study. The results showed that the length of cytochrome c oxidase subunit 3 gene sequences was 781 bp, with nucleotide frequencies of 29.2, 29.4, 26.1, and 15.2% for T, C, A, and G, respectively. A total of 26 haplotypes were identified, with 69 polymorphic sites, including 11 parsimony-informative sites and 58 single-nucleotide polymorphism sites. No deletions/insertions were found in sequence comparison, indicating that nucleotide mutation types were transitions and transversions. Haplotype and nucleotide diversities were 0.562 and 0.00138, respectively, indicating a high level of genetic diversity in Tibetan yak populations. Phylogenetic relationship analysis indicated that Tibetan yak populations are divided into 2 groups.

Analysis of Complete Nucleotide Sequences of 12 Gossypium Chloroplast Genomes: Origin and Evolution of Allotetraploids

PubMed Central

Xu, Qin; Xiong, Guanjun; Li, Pengbo; He, Fei; Huang, Yi; Wang, Kunbo; Li, Zhaohu; Hua, Jinping

2012-01-01

Background Cotton (Gossypium spp.) is a model system for the analysis of polyploidization. Although ascertaining the donor species of allotetraploid cotton has been intensively studied, sequence comparison of Gossypium chloroplast genomes is still of interest to understand the mechanisms underlining the evolution of Gossypium allotetraploids, while it is generally accepted that the parents were A- and D-genome containing species. Here we performed a comparative analysis of 13 Gossypium chloroplast genomes, twelve of which are presented here for the first time. Methodology/Principal Findings The size of 12 chloroplast genomes under study varied from 159,959 bp to 160,433 bp. The chromosomes were highly similar having >98% sequence identity. They encoded the same set of 112 unique genes which occurred in a uniform order with only slightly different boundary junctions. Divergence due to indels as well as substitutions was examined separately for genome, coding and noncoding sequences. The genome divergence was estimated as 0.374% to 0.583% between allotetraploid species and A-genome, and 0.159% to 0.454% within allotetraploids. Forty protein-coding genes were completely identical at the protein level, and 20 intergenic sequences were completely conserved. The 9 allotetraploids shared 5 insertions and 9 deletions in whole genome, and 7-bp substitutions in protein-coding genes. The phylogenetic tree confirmed a close relationship between allotetraploids and the ancestor of A-genome, and the allotetraploids were divided into four separate groups. Progenitor allotetraploid cotton originated 0.43–0.68 million years ago (MYA). Conclusion Despite high degree of conservation between the Gossypium chloroplast genomes, sequence variations among species could still be detected. Gossypium chloroplast genomes preferred for 5-bp indels and 1–3-bp indels are mainly attributed to the SSR polymorphisms. This study supports that the common ancestor of diploid A-genome species in Gossypium is the maternal source of extant allotetraploid species and allotetraploids have a monophyletic origin. G. hirsutum AD1 lineages have experienced more sequence variations than other allotetraploids in intergenic regions. The available complete nucleotide sequences of 12 Gossypium chloroplast genomes should facilitate studies to uncover the molecular mechanisms of compartmental co-evolution and speciation of Gossypium allotetraploids. PMID:22876273

Isolation and expression analysis of EcbZIP17 from different finger millet genotypes shows conserved nature of the gene.

PubMed

Chopperla, Ramakrishna; Singh, Sonam; Mohanty, Sasmita; Reddy, Nanja; Padaria, Jasdeep C; Solanke, Amolkumar U

2017-10-01

Basic leucine zipper (bZIP) transcription factors comprise one of the largest gene families in plants. They play a key role in almost every aspect of plant growth and development and also in biotic and abiotic stress tolerance. In this study, we report isolation and characterization of EcbZIP17 , a group B bZIP transcription factor from a climate smart cereal, finger millet ( Eleusine coracana L.). The genomic sequence of EcbZIP17 is 2662 bp long encompassing two exons and one intron with ORF of 1722 bp and peptide length of 573 aa. This gene is homologous to AtbZIP17 ( Arabidopsis ), ZmbZIP17 (maize) and OsbZIP60 (rice) which play a key role in endoplasmic reticulum (ER) stress pathway. In silico analysis confirmed the presence of basic leucine zipper (bZIP) and transmembrane (TM) domains in the EcbZIP17 protein. Allele mining of this gene in 16 different genotypes by Sanger sequencing revealed no variation in nucleotide sequence, including the 618 bp long intron. Expression analysis of EcbZIP17 under heat stress exhibited similar pattern of expression in all the genotypes across time intervals with highest upregulation after 4 h. The present study established the conserved nature of EcbZIP17 at nucleotide and expression level.

High throughput SNP discovery and genotyping in grapevine (Vitis vinifera L.) by combining a re-sequencing approach and SNPlex technology

PubMed Central

Lijavetzky, Diego; Cabezas, José Antonio; Ibáñez, Ana; Rodríguez, Virginia; Martínez-Zapater, José M

2007-01-01

Background Single-nucleotide polymorphisms (SNPs) are the most abundant type of DNA sequence polymorphisms. Their higher availability and stability when compared to simple sequence repeats (SSRs) provide enhanced possibilities for genetic and breeding applications such as cultivar identification, construction of genetic maps, the assessment of genetic diversity, the detection of genotype/phenotype associations, or marker-assisted breeding. In addition, the efficiency of these activities can be improved thanks to the ease with which SNP genotyping can be automated. Expressed sequence tags (EST) sequencing projects in grapevine are allowing for the in silico detection of multiple putative sequence polymorphisms within and among a reduced number of cultivars. In parallel, the sequence of the grapevine cultivar Pinot Noir is also providing thousands of polymorphisms present in this highly heterozygous genome. Still the general application of those SNPs requires further validation since their use could be restricted to those specific genotypes. Results In order to develop a large SNP set of wide application in grapevine we followed a systematic re-sequencing approach in a group of 11 grape genotypes corresponding to ancient unrelated cultivars as well as wild plants. Using this approach, we have sequenced 230 gene fragments, what represents the analysis of over 1 Mb of grape DNA sequence. This analysis has allowed the discovery of 1573 SNPs with an average of one SNP every 64 bp (one SNP every 47 bp in non-coding regions and every 69 bp in coding regions). Nucleotide diversity in grape (π = 0.0051) was found to be similar to values observed in highly polymorphic plant species such as maize. The average number of haplotypes per gene sequence was estimated as six, with three haplotypes representing over 83% of the analyzed sequences. Short-range linkage disequilibrium (LD) studies within the analyzed sequences indicate the existence of a rapid decay of LD within the selected grapevine genotypes. To validate the use of the detected polymorphisms in genetic mapping, cultivar identification and genetic diversity studies we have used the SNPlex™ genotyping technology in a sample of grapevine genotypes and segregating progenies. Conclusion These results provide accurate values for nucleotide diversity in coding sequences and a first estimate of short-range LD in grapevine. Using SNPlex™ genotyping we have shown the application of a set of discovered SNPs as molecular markers for cultivar identification, linkage mapping and genetic diversity studies. Thus, the combination a highly efficient re-sequencing approach and the SNPlex™ high throughput genotyping technology provide a powerful tool for grapevine genetic analysis. PMID:18021442

Molecular identification and characterization of clustered regularly interspaced short palindromic repeats (CRISPRs) in a urease-positive thermophilic Campylobacter sp. (UPTC).

PubMed

Tasaki, E; Hirayama, J; Tazumi, A; Hayashi, K; Hara, Y; Ueno, H; Moore, J E; Millar, B C; Matsuda, M

2012-02-01

Novel clustered regularly-interspaced short palindromic repeats (CRISPRs) locus [7,500 base pairs (bp) in length] occurred in the urease-positive thermophilic Campylobacter (UPTC) Japanese isolate, CF89-12. The 7,500 bp gene loci consisted of the 5'-methylaminomethyl-2-thiouridylate methyltransferase gene, putative (P) CRISPR associated (p-Cas), putative open reading frames, Cas1 and Cas2, leader sequence region (146 bp), 12 CRISPRs consensus sequence repeats (each 36 bp) separated by a non-repetitive unique spacer region of similar length (26-31 bp) and the phosphatidyl glycerophosphatase A gene. When the CRISPRs loci in the UPTC CF89-12 and five C. jejuni isolates were compared with one another, these six isolates contained p-Cas, Cas1 and Cas2 within the loci. Four to 12 CRISPRs consensus sequence repeats separated by a non-repetitive unique spacer region occurred in six isolates and the nucleotide sequences of those repeats gave approximately 92-100% similarity with each other. However, no sequence similarity occurred in the unique spacer regions among these isolates. The putative σ(70) transcriptional promoter and the hypothetical ρ-independent terminator structures for the CRISPRs and Cas were detected. No in vivo transcription of p-Cas, Cas1 and Cas2 was confirmed in the UPTC cells.

DNA Barcodes of Asian Houbara Bustard (Chlamydotis undulata macqueenii)

PubMed Central

Arif, Ibrahim A.; Khan, Haseeb A.; Williams, Joseph B.; Shobrak, Mohammad; Arif, Waad I.

2012-01-01

Populations of Houbara Bustards have dramatically declined in recent years. Captive breeding and reintroduction programs have had limited success in reviving population numbers and thus new technological solutions involving molecular methods are essential for the long term survival of this species. In this study, we sequenced the 694 bp segment of COI gene of the four specimens of Asian Houbara Bustard (Chlamydotis undulata macqueenii). We also compared these sequences with earlier published barcodes of 11 individuals comprising different families of the orders Gruiformes, Ciconiiformes, Podicipediformes and Crocodylia (out group). The pair-wise sequence comparison showed a total of 254 variable sites across all the 15 sequences from different taxa. Three of the four specimens of Houbara Bustard had an identical sequence of COI gene and one individual showed a single nucleotide difference (G > A transition at position 83). Within the bustard family (Otididae), comparison among the three species (Asian Houbara Bustard, Great Bustard (Otis tarda) and the Little Bustard (Tetrax tetrax)), representing three different genera, showed 116 variable sites. For another family (Rallidae), the intra-family variable sites among the individuals of four different genera were found to be 146. The COI genetic distances among the 15 individuals varied from 0.000 to 0.431. Phylogenetic analysis using 619 bp nucleotide segment of COI clearly discriminated all the species representing different genera, families and orders. All the four specimens of Houbara Bustard formed a single clade and are clearly separated from other two individuals of the same family (Otis tarda and Tetrax tetrax). The nucleotide sequence of partial segment of COI gene effectively discriminated the closely related species. This is the first study reporting the barcodes of Houbara Bustard and would be helpful in future molecular studies, particularly for the conservation of this threatened bird in Saudi Arabia. PMID:22408462

Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa

PubMed Central

2012-01-01

Background Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Results Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Conclusions Two transcriptome sets were built that are valuable resources for marker development, comparative genomic studies and candidate gene approaches. Next generation sequencing of leaf transcriptome is very effective; however, deeper sequencing and using more tissues and stages is advisable for extended comparative studies. PMID:23167289

Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

PubMed Central

Li, Hongshan; Dai, Huaguo; Wei, Hui

2005-01-01

A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

rpoB-Based Identification of Nonpigmented and Late-Pigmenting Rapidly Growing Mycobacteria

PubMed Central

Adékambi, Toïdi; Colson, Philippe; Drancourt, Michel

2003-01-01

Nonpigmented and late-pigmenting rapidly growing mycobacteria (RGM) are increasingly isolated in clinical microbiology laboratories. Their accurate identification remains problematic because classification is labor intensive work and because new taxa are not often incorporated into classification databases. Also, 16S rRNA gene sequence analysis underestimates RGM diversity and does not distinguish between all taxa. We determined the complete nucleotide sequence of the rpoB gene, which encodes the bacterial β subunit of the RNA polymerase, for 20 RGM type strains. After using in-house software which analyzes and graphically represents variability stretches of 60 bp along the nucleotide sequence, our analysis focused on a 723-bp variable region exhibiting 83.9 to 97% interspecies similarity and 0 to 1.7% intraspecific divergence. Primer pair Myco-F-Myco-R was designed as a tool for both PCR amplification and sequencing of this region for molecular identification of RGM. This tool was used for identification of 63 RGM clinical isolates previously identified at the species level on the basis of phenotypic characteristics and by 16S rRNA gene sequence analysis. Of 63 clinical isolates, 59 (94%) exhibited <2% partial rpoB gene sequence divergence from 1 of 20 species under study and were regarded as correctly identified at the species level. Mycobacterium abscessus and Mycobacterium mucogenicum isolates were clearly distinguished from Mycobacterium chelonae; Mycobacterium mageritense isolates were clearly distinguished from “Mycobacterium houstonense.” Four isolates were not identified at the species level because they exhibited >3% partial rpoB gene sequence divergence from the corresponding type strain; they belonged to three taxa related to M. mucogenicum, Mycobacterium smegmatis, and Mycobacterium porcinum. For M. abscessus and M. mucogenicum, this partial sequence yielded a high genetic heterogeneity within the clinical isolates. We conclude that molecular identification by analysis of the 723-bp rpoB sequence is a rapid and accurate tool for identification of RGM. PMID:14662964

First complete genome sequence of infectious laryngotracheitis virus

PubMed Central

2011-01-01

Background Infectious laryngotracheitis virus (ILTV) is an alphaherpesvirus that causes acute respiratory disease in chickens worldwide. To date, only one complete genomic sequence of ILTV has been reported. This sequence was generated by concatenating partial sequences from six different ILTV strains. Thus, the full genomic sequence of a single (individual) strain of ILTV has not been determined previously. This study aimed to use high throughput sequencing technology to determine the complete genomic sequence of a live attenuated vaccine strain of ILTV. Results The complete genomic sequence of the Serva vaccine strain of ILTV was determined, annotated and compared to the concatenated ILTV reference sequence. The genome size of the Serva strain was 152,628 bp, with a G + C content of 48%. A total of 80 predicted open reading frames were identified. The Serva strain had 96.5% DNA sequence identity with the concatenated ILTV sequence. Notably, the concatenated ILTV sequence was found to lack four large regions of sequence, including 528 bp and 594 bp of sequence in the UL29 and UL36 genes, respectively, and two copies of a 1,563 bp sequence in the repeat regions. Considerable differences in the size of the predicted translation products of 4 other genes (UL54, UL30, UL37 and UL38) were also identified. More than 530 single-nucleotide polymorphisms (SNPs) were identified. Most SNPs were located within three genomic regions, corresponding to sequence from the SA-2 ILTV vaccine strain in the concatenated ILTV sequence. Conclusions This is the first complete genomic sequence of an individual ILTV strain. This sequence will facilitate future comparative genomic studies of ILTV by providing an appropriate reference sequence for the sequence analysis of other ILTV strains. PMID:21501528

Pstl repeat: a family of short interspersed nucleotide element (SINE)-like sequences in the genomes of cattle, goat, and buffalo.

PubMed

Sheikh, Faruk G; Mukhopadhyay, Sudit S; Gupta, Prabhakar

2002-02-01

The PstI family of elements are short, highly repetitive DNA sequences interspersed throughout the genome of the Bovidae. We have cloned and sequenced some members of the PstI family from cattle, goat, and buffalo. These elements are approximately 500 bp, have a copy number of 2 x 10(5) - 4 x 10(5), and comprise about 4% of the haploid genome. Studies of nucleotide sequence homology indicate that the buffalo and goat PstI repeats (type II) are similar types of short interspersed nucleotide element (SINE) sequences, but the cattle PstI repeat (type I) is considerably more divergent. Additionally, the goat PstI sequence showed significant sequence homology with bovine serine tRNA, and is therefore likely derived from serine tRNA. Interestingly, Southern hybridization suggests that both types of SINEs (I and II) are present in all the species of Bovidae. Dendrogram analysis indicates that cattle PstI SINE is similar to bovine Alu-like SINEs. Goat and buffalo SINEs formed a separate cluster, suggesting that these two types of SINEs evolved separately in the genome of the Bovidae.

Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

PubMed

Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

2009-10-01

A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

EPA Science Inventory

Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

Survey of bat populations from Mexico and Paraguay for rabies.

PubMed

Sheeler-Gordon, L L; Smith, J S

2001-07-01

A mammalian survey was conducted in Mexico (October 1994-January 1996) and in Paraguay (August 1996-March 1997); a complete specimen was collected for each bat in the survey, including primary voucher specimen, ectoparasites, karyotype, and various frozen tissues. The surveys combined provided 937 brain samples (65 bat species) for rabies diagnosis. One male Lasiurus ega, collected in Paraguay, tested positive for the rabies virus (overall prevalence rate of 0.1%). Nucleotide sequence from a 300 bp region of the rabies nucleoprotein gene was compared with sequence obtained from representative rabies virus samples in the repository at the Centers for Disease Control and Prevention (Atlanta, Georgia, USA). Rabies virus extracted from the brain material of L. ega differed by only one nucleotide from a 300 bp consensus sequence (>99% homology) derived from samples for the variant of rabies virus transmitted by Lasiurus cinereus. Lasiurus ego differed by approximately 15% for the variant transmitted by Desmodus rotundus. Phylogenetic analysis found no evidence to suggest L. ego is a reservoir for rabies antigenic variant 6. The most likely explanation for rabies in L. ega was infection following contact with a rabid L. cinereus.

Complete mitochondrial genome sequence of black mustard (Brassica nigra; BB) and comparison with Brassica oleracea (CC) and Brassica carinata (BBCC).

PubMed

Yamagishi, Hiroshi; Tanaka, Yoshiyuki; Terachi, Toru

2014-11-01

Crop species of Brassica (Brassicaceae) consist of three monogenomic species and three amphidiploid species resulting from interspecific hybridizations among them. Until now, mitochondrial genome sequences were available for only five of these species. We sequenced the mitochondrial genome of the sixth species, Brassica nigra (nuclear genome constitution BB), and compared it with those of Brassica oleracea (CC) and Brassica carinata (BBCC). The genome was assembled into a 232 145 bp circular sequence that is slightly larger than that of B. oleracea (219 952 bp). The genome of B. nigra contained 33 protein-coding genes, 3 rRNA genes, and 17 tRNA genes. The cox2-2 gene present in B. oleracea was absent in B. nigra. Although the nucleotide sequences of 52 genes were identical between B. nigra and B. carinata, the second exon of rps3 showed differences including an insertion/deletion (indel) and nucleotide substitutions. A PCR test to detect the indel revealed intraspecific variation in rps3, and in one line of B. nigra it amplified a DNA fragment of the size expected for B. carinata. In addition, the B. carinata lines tested here produced DNA fragments of the size expected for B. nigra. The results indicate that at least two mitotypes of B. nigra were present in the maternal parents of B. carinata.

DNA barcoding of Clarias gariepinus, Coptodon zillii and Sarotherodon melanotheron from Southwestern Nigeria

PubMed Central

Falade, Mofolusho O.; Opene, Anthony J.; Benson, Otarigho

2016-01-01

DNA barcoding has been adopted as a gold standard rapid, precise and unifying identification system for animal species and provides a database of genetic sequences that can be used as a tool for universal species identification. In this study, we employed mitochondrial genes 16S rRNA (16S) and cytochrome oxidase subunit I (COI) for the identification of some Nigerian freshwater catfish and Tilapia species. Approximately 655 bp were amplified from the 5′ region of the mitochondrial cytochrome C oxidase subunit I (COI) gene whereas 570 bp were amplified for the 16S rRNA gene. Nucleotide divergences among sequences were estimated based on Kimura 2-parameter distances and the genetic relationships were assessed by constructing phylogenetic trees using the neighbour-joining (NJ) and maximum likelihood (ML) methods. Analyses of consensus barcode sequences for each species, and alignment of individual sequences from within a given species revealed highly consistent barcodes (99% similarity on average), which could be compared with deposited sequences in public databases. The nucleotide distance between species belonging to different genera based on COI ranged from 0.17% between Sarotherodon melanotheron and Coptodon zillii to 0.49% between Clarias gariepinus and C. zillii, indicating that S. melanotheron and C. zillii are closely related. Based on the data obtained, the utility of COI gene was confirmed in accurate identification of three fish species from Southwest Nigeria. PMID:27990256

RNA editing in the anticodon of tRNA Leu (CAA) occurs before group I intron splicing in plastids of a moss Takakia lepidozioides S. Hatt. & Inoue.

PubMed

Miyata, Y; Sugita, C; Maruyama, K; Sugita, M

2008-03-01

RNA editing of cytidine (C) to uridine (U) transitions occurs in plastids and mitochondria of most land plants. In this study, we amplified and sequenced the group I intron-containing tRNA Leu gene, trnL-CAA, from Takakia lepidozioides, a moss. DNA sequence analysis revealed that the T. lepidozioides tRNA Leu gene consisted of a 35-bp 5' exon, a 469-bp group I intron and a 50-bp 3' exon. The intron was inserted between the first and second position of the tRNA Leu anticodon. In general, plastid tRNA Leu genes with a group I intron code for a TAA anticodon in most land plants. This strongly suggests that the first nucleotide of the CAA anticodon could be edited in T. lepidozioides plastids. To investigate this possibility, we analysed cDNAs derived from the trnL-CAA transcripts. We demonstrated that the first nucleotide C of the anticodon was edited to create a canonical UAA anticodon in T. lepidozioides plastids. cDNA sequencing analyses of the spliced or unspliced tRNA Leu transcripts revealed that, while the spliced tRNA was completely edited, editing in the unspliced tRNAs were only partial. This is the first experimental evidence that the anticodon editing of tRNA occurs before RNA splicing in plastids. This suggests that this editing is a prerequisite to splicing of pre-tRNA Leu.

Phylogenetic position of the genus Perkinsus (Protista, Apicomplexa) based on small subunit ribosomal RNA.

PubMed

Goggin, C L; Barker, S C

1993-07-01

Parasites of the genus Perkinsus destroy marine molluscs worldwide. Their phylogenetic position within the kingdom Protista is controversial. Nucleotide sequence data (1792 bp) from the small subunit rRNA gene of Perkinsus sp. from Anadara trapezia (Mollusca: Bivalvia) from Moreton Bay, Queensland, was used to examine the phylogenetic affinities of this enigmatic genus. These data were aligned with nucleotide sequences from 6 apicomplexans, 3 ciliates, 3 flagellates, a dinoflagellate, 3 fungi, maize and human. Phylogenetic trees were constructed after analysis with maximum parsimony and distance matrix methods. Our analyses indicate that Perkinsus is phylogenetically closer to dinoflagellates and to coccidean and piroplasm apicomplexans than to fungi or flagellates.

Characterization of Trichuris trichiura from humans and T. suis from pigs in China using internal transcribed spacers of nuclear ribosomal DNA.

PubMed

Liu, G H; Zhou, W; Nisbet, A J; Xu, M J; Zhou, D H; Zhao, G H; Wang, S K; Song, H Q; Lin, R Q; Zhu, X Q

2014-03-01

Trichuris trichiura and Trichuris suis parasitize (at the adult stage) the caeca of humans and pigs, respectively, causing trichuriasis. Despite these parasites being of human and animal health significance, causing considerable socio-economic losses globally, little is known of the molecular characteristics of T. trichiura and T. suis from China. In the present study, the entire first and second internal transcribed spacer (ITS-1 and ITS-2) regions of nuclear ribosomal DNA (rDNA) of T. trichiura and T. suis from China were amplified by polymerase chain reaction (PCR), the representative amplicons were cloned and sequenced, and sequence variation in the ITS rDNA was examined. The ITS rDNA sequences for the T. trichiura and T. suis samples were 1222-1267 bp and 1339-1353 bp in length, respectively. Sequence analysis revealed that the ITS-1, 5.8S and ITS-2 rDNAs of both whipworms were 600-627 bp and 655-661 bp, 154 bp, and 468-486 bp and 530-538 bp in size, respectively. Sequence variation in ITS rDNA within and among T. trichiura and T. suis was examined. Excluding nucleotide variations in the simple sequence repeats, the intra-species sequence variation in the ITS-1 was 0.2-1.7% within T. trichiura, and 0-1.5% within T. suis. For ITS-2 rDNA, the intra-species sequence variation was 0-1.3% within T. trichiura and 0.2-1.7% within T. suis. The inter-species sequence differences between the two whipworms were 60.7-65.3% for ITS-1 and 59.3-61.5% for ITS-2. These results demonstrated that the ITS rDNA sequences provide additional genetic markers for the characterization and differentiation of the two whipworms. These data should be useful for studying the epidemiology and population genetics of T. trichiura and T. suis, as well as for the diagnosis of trichuriasis in humans and pigs.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lapidus, Alla L.

From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly ofmore » whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.« less

Complete Genome Sequence of Frog virus 3, Isolated from a Strawberry Poison Frog (Oophaga pumilio) Imported from Nicaragua into the Netherlands

PubMed Central

Hughes, Joseph; van Beurden, Steven J.; Suárez, Nicolás M.; Haenen, Olga L. M.; Voorbergen-Laarman, Michal; Gröne, Andrea; Kik, Marja J. L.

2017-01-01

ABSTRACT Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the reference Frog virus 3 isolate. PMID:28860243

Mitochondrial genome sequence of the Tibetan wild ass (Equus kiang).

PubMed

Luo, Yongjun; Chen, Yu; Liu, Fuyu; Jiang, Chunhua; Gao, Yuqi

2011-02-01

The Tibetan wild ass, or kiang (Equus kiang) is endemic to the cold and hypoxic (4000-7000 m above sea level) climates of the montane and alpine grasslands of the Tibetan Plateau. We report here the complete nucleotide sequence of the E. kiang mitochondrial genome. Our results show that E. kiang mitochondrial DNA is 16,634 bp long, and predicted to encode all the 37 genes that are typical for vertebrates.

Genomic analysis reveals Nairobi sheep disease virus to be highly diverse and present in both Africa, and in India in the form of the Ganjam virus variant.

PubMed

Yadav, Pragya D; Vincent, Martin J; Khristova, Marina; Kale, Charuta; Nichol, Stuart T; Mishra, Akhilesh C; Mourya, Devendra T

2011-07-01

Nairobi sheep disease (NSD) virus, the prototype tick-borne virus of the genus Nairovirus, family Bunyaviridae is associated with acute hemorrhagic gastroenteritis in sheep and goats in East and Central Africa. The closely related Ganjam virus found in India is associated with febrile illness in humans and disease in livestock. The complete S, M and L segment sequences of Ganjam and NSD virus and partial sequence analysis of Ganjam viral RNA genome S, M and L segments encoding regions (396 bp, 701 bp and 425 bp) of the viral nucleocapsid (N), glycoprotein precursor (GPC) and L polymerase (L) proteins, respectively, was carried out for multiple Ganjam virus isolates obtained from 1954 to 2002 and from various regions of India. M segments of NSD and Ganjam virus encode a large ORF for the glycoprotein precursor (GPC), (1627 and 1624 amino acids in length, respectively) and their L segments encode a very large L polymerase (3991 amino acids). The complete S, M and L segments of NSD and Ganjam viruses were more closely related to one another than to other characterized nairoviruses, and no evidence of reassortment was found. However, the NSD and Ganjam virus complete M segment differed by 22.90% and 14.70%, for nucleotide and amino acid respectively, and the complete L segment nucleotide and protein differing by 9.90% and 2.70%, respectively among themselves. Ganjam and NSD virus, complete S segment differed by 9.40-10.40% and 3.2-4.10 for nucleotide and proteins while among Ganjam viruses 0.0-6.20% and 0.0-1.4%, variation was found for nucleotide and amino acids. Ganjam virus isolates differed by up to 17% and 11% at the nucleotide level for the partial S and L gene fragments, respectively, with less variation observed at the deduced amino acid level (10.5 and 2%, S and L, respectively). However, the virus partial M gene fragment (which encodes the hypervariable mucin-like domain) of these viruses differed by as much as 56% at the nucleotide level. Phylogenetic analysis of partial sequence differences suggests considerable mixing and movement of Ganjam virus strains within India, with no clear relationship between genetic lineages and virus geographic origin or year of isolation. Surprisingly, NSD virus does not represent a distinct lineage, but appears as a variant with other Ganjam virus among NSD virus group. Copyright © 2011 Elsevier B.V. All rights reserved.

Identification and characterization of tandem repeats in exon III of dopamine receptor D4 (DRD4) genes from different mammalian species.

PubMed

Larsen, Svend Arild; Mogensen, Line; Dietz, Rune; Baagøe, Hans Jørgen; Andersen, Mogens; Werge, Thomas; Rasmussen, Henrik Berg

2005-12-01

In this study we have identified and characterized dopamine receptor D4 (DRD4) exon III tandem repeats in 33 public available nucleotide sequences from different mammalian species. We found that the tandem repeat in canids could be described in a novel and simple way, namely, as a structure composed of 15- and 12- bp modules. Tandem repeats composed of 18-bp modules were found in sequences from the horse, zebra, onager, and donkey, Asiatic bear, polar bear, common raccoon, dolphin, harbor porpoise, and domestic cat. Several of these sequences have been analyzed previously without a tandem repeat being found. In the domestic cow and gray seal we identified tandem repeats composed of 36-bp modules, each consisting of two closely related 18-bp basic units. A tandem repeat consisting of 9-bp modules was identified in sequences from mink and ferret. In the European otter we detected an 18-bp tandem repeat, while a tandem repeat consisting of 27-bp modules was identified in a sequence from European badger. Both these tandem repeats were composed of 9-bp basic units, which were closely related with the 9-bp repeat modules identified in the mink and ferret. Tandem repeats could not be identified in sequences from rodents. All tandem repeats possessed a high GC content with a strong bias for C. On phylogenetic analysis of the tandem repeats evolutionary related species were clustered into the same groups. The degree of conservation of the tandem repeats varied significantly between species. The deduced amino acid sequences of most of the tandem repeats exhibited a high propensity for disorder. This was also the case with an amino acid sequence of the human DRD4 exon III tandem repeat, which was included in the study for comparative purposes. We identified proline-containing motifs for SH3 and WW domain binding proteins, potential phosphorylation sites, PDZ domain binding motifs, and FHA domain binding motifs in the amino acid sequences of the tandem repeats. The numbers of potential functional sites varied pronouncedly between species. Our observations provide a platform for future studies of the architecture and evolution of the DRD4 exon III tandem repeat, and they suggest that differences in the structure of this tandem repeat contribute to specialization and generation of diversity in receptor function.

Inter-individual and intragenomic variations in the ITS region of Clonorchis sinensis (Trematoda: Opisthorchiidae) from Russia and Vietnam.

PubMed

Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh

2017-11-01

Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.

Comparison of the nucleotide and amino acid sequences of the RsrI and EcoRI restriction endonucleases.

PubMed

Stephenson, F H; Ballard, B T; Boyer, H W; Rosenberg, J M; Greene, P J

1989-12-21

The RsrI endonuclease, a type-II restriction endonuclease (ENase) found in Rhodobacter sphaeroides, is an isoschizomer of the EcoRI ENase. A clone containing an 11-kb BamHI fragment was isolated from an R. sphaeroides genomic DNA library by hybridization with synthetic oligodeoxyribonucleotide probes based on the N-terminal amino acid (aa) sequence of RsrI. Extracts of E. coli containing a subclone of the 11-kb fragment display RsrI activity. Nucleotide sequence analysis reveals an 831-bp open reading frame encoding a polypeptide of 277 aa. A 50% identity exists within a 266-aa overlap between the deduced aa sequences of RsrI and EcoRI. Regions of 75-100% aa sequence identity correspond to key structural and functional regions of EcoRI. The type-II ENases have many common properties, and a common origin might have been expected. Nevertheless, this is the first demonstration of aa sequence similarity between ENases produced by different organisms.

Genetic Characterization of Fasciola Isolates from West Azerbaijan Province Iran Based on ITS1 and ITS2 Sequence of Ribosomal DNA

PubMed Central

GALAVANI, Hossein; GHOLIZADEH, Saber; HAZRATI TAPPEH, Khosrow

2016-01-01

Background: Fascioliasis, caused by Fasciola hepatica and F. gigantica, has medical and economic importance in the world. Molecular approaches comparing traditional methods using for identification and characterization of Fasciola spp. are precise and reliable. The aims of current study were molecular characterization of Fasciola spp. in West Azerbaijan Province, Iran and then comparative analysis of them using GenBank sequences. Methods: A total number of 580 isolates were collected from different hosts in five cities of West Azerbaijan Province, in 2014 from 90 slaughtered cattle (n=50) and sheep (n=40). After morphological identification and DNA extraction, designing specific primer were used to amplification of ITS1, 5.8s and ITS2 regions, 50 samples were conducted to sequence, randomly. Result: Using morphometric characters 99.14% and 0.86% of isolates identified as F. hepatica and F. gigantica, respectively. PCR amplification of 1081 bp fragment and sequencing result showed 100% similarity with F. hepatica in ITS1 (428 bp), 5.8s (158 bp), and ITS2 (366 bp) regions. Sequence comparison among current study sequences and GenBank data showed 98% identity with 11 nucleotide mismatches. However, in phylogenetic tree F. hepatica sequences of West Azerbaijan Province, Iran, were in a close relationship with Iranian, Asian, and African isolates. Conclusions: Only F. hepatica species is distributed among sheep and cattle in West Azerbaijan Province Iran. However, 5 and 6 bp variation in ITS1 and ITS2 regions, respectively, is not enough to separate of Fasciola spp. Therefore, more studies are essential for designing new molecular markers to correct species identification. PMID:27095969

Structure-Function Model for Kissing Loop Interactions That Initiate Dimerization of Ty1 RNA

PubMed Central

Gamache, Eric R.; Doh, Jung H.; Ritz, Justin; Laederach, Alain; Bellaousov, Stanislav; Mathews, David H.; Curcio, M. Joan

2017-01-01

The genomic RNA of the retrotransposon Ty1 is packaged as a dimer into virus-like particles. The 5′ terminus of Ty1 RNA harbors cis-acting sequences required for translation initiation, packaging and initiation of reverse transcription (TIPIRT). To identify RNA motifs involved in dimerization and packaging, a structural model of the TIPIRT domain in vitro was developed from single-nucleotide resolution RNA structural data. In general agreement with previous models, the first 326 nucleotides of Ty1 RNA form a pseudoknot with a 7-bp stem (S1), a 1-nucleotide interhelical loop and an 8-bp stem (S2) that delineate two long, structured loops. Nucleotide substitutions that disrupt either pseudoknot stem greatly reduced helper-Ty1-mediated retrotransposition of a mini-Ty1, but only mutations in S2 destabilized mini-Ty1 RNA in cis and helper-Ty1 RNA in trans. Nested in different loops of the pseudoknot are two hairpins with complementary 7-nucleotide motifs at their apices. Nucleotide substitutions in either motif also reduced retrotransposition and destabilized mini- and helper-Ty1 RNA. Compensatory mutations that restore base-pairing in the S2 stem or between the hairpins rescued retrotransposition and RNA stability in cis and trans. These data inform a model whereby a Ty1 RNA kissing complex with two intermolecular kissing-loop interactions initiates dimerization and packaging. PMID:28445416

Complete mitochondrial genomes of the yellow-bellied slider turtle Trachemys scripta scripta and anoxia tolerant red-eared slider Trachemys scripta elegans.

PubMed

Yu, Danna; Fang, Xindong; Storey, Kenneth B; Zhang, Yongpu; Zhang, Jiayong

2016-05-01

The complete mitochondrial genomes of the yellow-bellied slider (Trachemys scripta scripta) and anoxia tolerant red-eared slider (Trachemys scripta elegans) turtles were sequenced to analyze gene arrangement. The complete mt genomes of T. s. scripta and elegans were circular molecules of 16,791 bp and 16,810 bp in length, respectively, and included an A + 1 frameshift insertion in ND3 and ND4L genes. The AT content of the overall base composition of scripta and elegans was 61.2%. Nucleotide sequence divergence of the mt-genome (p distance) between scripta and elegans was 0.4%. A detailed comparison between the mitochondrial genomes of the two subspecies is shown.

Complete mitochondrial genome of Ostrea denselamellosa (Bivalvia, Ostreidae).

PubMed

Yu, Hong; Kong, Lingfeng; Li, Qi

2016-01-01

The complete mitochondrial (mt) genome of the flat oyster, Ostrea denselamellosa, was determined using Long-PCR and genome walking techniques in this study. The total length of the mt genome sequence of O. denselamellosa was 16,227 bp, which is the smallest reported Ostreidae mt genome to date. It contained 12 protein-coding genes (lacking of ATP8), 23 transfer RNA genes, and two ribosomal RNA genes. A bias towards a higher representation of nucleotides A and T (60.7%) was detected in the mt genome of O. denselamellosa. The rrnL was split into two fragments (3' half, 711 bp; 5' half, 509 bp), which seems to be the unique characteristics of Ostreidae mt genomes.

Canis mtDNA HV1 database: a web-based tool for collecting and surveying Canis mtDNA HV1 haplotype in public database.

PubMed

Thai, Quan Ke; Chung, Dung Anh; Tran, Hoang-Dung

2017-06-26

Canine and wolf mitochondrial DNA haplotypes, which can be used for forensic or phylogenetic analyses, have been defined in various schemes depending on the region analyzed. In recent studies, the 582 bp fragment of the HV1 region is most commonly used. 317 different canine HV1 haplotypes have been reported in the rapidly growing public database GenBank. These reported haplotypes contain several inconsistencies in their haplotype information. To overcome this issue, we have developed a Canis mtDNA HV1 database. This database collects data on the HV1 582 bp region in dog mitochondrial DNA from the GenBank to screen and correct the inconsistencies. It also supports users in detection of new novel mutation profiles and assignment of new haplotypes. The Canis mtDNA HV1 database (CHD) contains 5567 nucleotide entries originating from 15 subspecies in the species Canis lupus. Of these entries, 3646 were haplotypes and grouped into 804 distinct sequences. 319 sequences were recognized as previously assigned haplotypes, while the remaining 485 sequences had new mutation profiles and were marked as new haplotype candidates awaiting further analysis for haplotype assignment. Of the 3646 nucleotide entries, only 414 were annotated with correct haplotype information, while 3232 had insufficient or lacked haplotype information and were corrected or modified before storing in the CHD. The CHD can be accessed at http://chd.vnbiology.com . It provides sequences, haplotype information, and a web-based tool for mtDNA HV1 haplotyping. The CHD is updated monthly and supplies all data for download. The Canis mtDNA HV1 database contains information about canine mitochondrial DNA HV1 sequences with reconciled annotation. It serves as a tool for detection of inconsistencies in GenBank and helps identifying new HV1 haplotypes. Thus, it supports the scientific community in naming new HV1 haplotypes and to reconcile existing annotation of HV1 582 bp sequences.

The human myelin oligodendrocyte glycoprotein (MOG) gene: Complete nucleotide sequence and structural characterization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paule Roth, M.; Malfroy, L.; Offer, C.

1995-07-20

Human myelin oligodendrocyte glycoprotein (MOG), a myelin component of the central nervous system, is a candidate target antigen for autoimmune-mediated demyelination. We have isolated and sequenced part of a cosmid clone that contains the entire human MOG gene. The primary nuclear transcript, extending from the putative start of transcription to the site of poly(A) addition, is 15,561 nucleotides in length. The human MOG gene contains 8 exons, separated by 7 introns; canonical intron/exon boundary sites are observed at each junction. The introns vary in size from 242 to 6484 bp and contain numerous repetitive DNA elements, including 14 Alu sequencesmore » within 3 introns. Another Alu element is located in the 3{prime}-untranslated region of the gene. Alu sequences were classified with respect to subfamily assignment. Seven hundred sixty-three nucleotides 5{prime} of the transcription start and 1214 nucleotides 3{prime} of the poly(A) addition sites were also sequenced. The 5{prime}-flanking region revealed the presence of several consensus sequences that could be relevant in the transcription of the MOG gene, in particular binding sites in common with other myelin gene promoters. Two polymorphic intragenic dinucleotide (CA){sub n} and tetranucleotide (TAAA){sub n} repeats were identified and may provide genetic marker tools for association and linkage studies. 50 refs., 3 figs., 3 tabs.« less

Complete Genome Sequence of Frog virus 3, Isolated from a Strawberry Poison Frog (Oophaga pumilio) Imported from Nicaragua into the Netherlands.

PubMed

Saucedo, Bernardo; Hughes, Joseph; van Beurden, Steven J; Suárez, Nicolás M; Haenen, Olga L M; Voorbergen-Laarman, Michal; Gröne, Andrea; Kik, Marja J L

2017-08-31

Frog virus 3 was isolated from a strawberry poison frog ( Oophaga pumilio ) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op /2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the reference Frog virus 3 isolate. Copyright © 2017 Saucedo et al.

Identification and characterization of RAPD-SCAR markers linked to glyphosate-susceptible and -resistant biotypes of Eleusine indica (L.) Gaertn.

PubMed

Cha, Thye San; Anne-Marie, Kaben; Chuah, Tse Seng

2014-02-01

Eleusine indica is one of the most common weed species found in agricultural land worldwide. Although herbicide-glyphosate provides good control of the weed, its frequent uses has led to abundant reported cases of resistance. Hence, the development of genetic markers for quick detection of glyphosate-resistance in E. indica population is imperative for the control and management of the weed. In this study, a total of 14 specific random amplified polymorphic DNA (RAPD) markers were identified and two of the markers, namely S4R727 and S26R6976 were further sequence characterized. Sequence alignment revealed that marker S4R727 showing a 12-bp nucleotides deletion in resistant biotypes, while marker S26R6976 contained a 167-bp nucleotides insertion in the resistant biotypes. Based on these sequence differences, three pairs of new sequence characterized amplified region (SCAR) primers were developed. The specificity of these primer pairs were further validated with genomic DNA extracted from ten individual plants of one glyphosate-susceptible and five glyphosate-resistant (R2, R4, R6, R8 and R11) populations. The resulting RAPD-SCAR markers provided the basis for assessing genetic diversity between glyphosate-susceptible and -resistant E. indica biotypes, as well for the identification of genetic locus link to glyphosate-resistance event in the species.

Complete sequence of Tvv1, a family of Ty 1 copia-like retrotransposons of Vitis vinifera L., reconstituted by chromosome walking.

PubMed

Pelsy, F.; Merdinoglu, D.

2002-09-01

A chromosome-walking strategy was used to sequence and characterize retrotransposons in the grapevine genome. The reconstitution of a family of retroelements, named Tvv1, was achieved by six successive steps. These elements share a single, highly conserved open reading frame 4,153 nucleotides-long, putatively encoding the gag, pro, int, rt and rh proteins. Comparison of the Tvv1 open reading frame coding potential with those of drosophila copia and tobacco Tnt1, revealed that Tvv1 is closely related to Ty 1 copia-like retrotransposons. A highly variable untranslated leader region, upstream of the open reading frame, allowed us to differentiate Tvv1 variants, which represent a family of at least 28 copies, in varying sizes. This internal region is flanked by two long terminal repeats in direct orientation, sized between 149 and 157 bp. Among elements theoretically sized from 4,970 to 5,550 bp, we describe the full-length sequence of a reference element Tvv1-1, 5,343 nucleotides-long. The full-length sequence of Tvv1-1 compared to pea PDR1 shows a 53.3% identity. In addition, both elements contain long terminal repeats of nearly the same size in which the U5 region could be entirely absent. Therefore, we assume that Tvv1 and PDR1 could constitute a particular class of short LTRs retroelements.

Isolation and characterization of two cryptic plasmids in the ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11.

PubMed

Yamagata, A; Kato, J; Hirota, R; Kuroda, A; Ikeda, T; Takiguchi, N; Ohtake, H

1999-06-01

Two plasmids were discovered in the ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11, which was isolated from activated sludge. The plasmids, designated pAYS and pAYL, were relatively small, being approximately 1.9 kb long. They were cryptic plasmids, having no detectable plasmid-linked antibiotic resistance or heavy metal resistance markers. The complete nucleotide sequences of pAYS and pAYL were determined, and their physical maps were constructed. There existed two major open reading frames, ORF1 in pAYS and ORF2 in pAYL, each of which was more than 500 bp long. The predicted product of ORF2 was 28% identical to part of the replication protein of a Bacillus plasmid, pBAA1. However, no significant similarity to any known protein sequences was detected with the predicted product of ORF1. pAYS and pAYL had a highly homologous region, designated HHR, of 262 bp. The overall identity was 98% between the two nucleotide sequences. Interestingly, HHR-homologous sequences were also detected in the genomes of ENI-11 and the plasmidless strain Nitrosomonas europaea IFO14298. Deletion analysis of pAYS and pAYL indicated that HHR, together with either ORF1 or ORF2, was essential for plasmid maintenance in ENI-11. To our knowledge, pAYS and pAYL are the first plasmids found in the ammonia-oxidizing autotrophic bacteria.

Tandemly repeated sequences in mtDNA control region of whitefish, Coregonus lavaretus.

PubMed

Brzuzan, P

2000-06-01

Length variation of the mitochondrial DNA control region was observed with PCR amplification of a sample of 138 whitefish (Coregonus lavaretus). Nucleotide sequences of representative PCR products showed that the variation was due to the presence of an approximately 100-bp motif tandemly repeated two, three, or five times in the region between the conserved sequence block-3 (CSB-3) and the gene for phenylalanine tRNA. This is the first report on the tandem array composed of long repeat units in mitochondrial DNA of salmonids.

Complete genome sequence of the biofilm-forming Microbacterium sp. strain BH-3-3-3, isolated from conventional field-grown lettuce (Lactuca sativa) in Norway.

PubMed

Dees, Merete Wiken; Brurberg, May Bente; Lysøe, Erik

2017-03-01

The genus Microbacterium contains bacteria that are ubiquitously distributed in various environments and includes plant-associated bacteria that are able to colonize tissue of agricultural crop plants. Here, we report the 3,508,491 bp complete genome sequence of Microbacterium sp. strain BH-3-3-3, isolated from conventionally grown lettuce ( Lactuca sativa ) from a field in Vestfold, Norway. The nucleotide sequence of this genome was deposited into NCBI GenBank under the accession CP017674.

Second generation DNA sequencing of the mitogenome of the Chinstrap penguin and comparative genomics of Antarctic penguins.

PubMed

Subramanian, Sankar; Lingala, Syamala Gowri; Swaminathan, Siva; Huynen, Leon; Lambert, David

2014-08-01

The complete mitochondrial genome of the Chinstrap penguin (Pygoscelis antarcticus) was sequenced and compared with other penguin mitogenomes. The genome is 15,972 bp in length with the number and order of protein coding genes and RNAs being very similar to that of other known penguin mitogenomes. Comparative nucleotide analysis showed the Chinstrap mitogenome shares 94% homology with the mitogenome of its sister species, Pygoscelis adelie (Adélie penguin). Divergence at nonsynonymous nucleotide positions was found to be up to 23 times less than that observed in synonymous positions of protein coding genes, suggesting high selection constraints. The complete mitogenome data will be useful for genetic and evolutionary studies of penguins.

Adaptive microclimatic evolution of the dehydrin 6 gene in wild barley at "Evolution Canyon", Israel.

PubMed

Yang, Zujun; Zhang, Tao; Li, Guangrong; Nevo, Eviatar

2011-12-01

Dehydrins are one of the major stress-induced gene families, and the expression of dehydrin 6 (Dhn6) is strictly related to drought in barley. In order to investigate how the evolution of the Dhn6 gene is associated with adaptation to environmental changes, we examined 48 genotypes of wild barley, Hordeum spontaneum, from "Evolution Canyon" at Mount Carmel, Israel. The Dhn6 sequences of the 48 genotypes were identified, and a recent insertion of 342 bp at 5'UTR was found in the sequences of 11 genotypes. Both nucleotide and haplotype diversity of single nucleotide polymorphism in Dhn6 coding regions were higher on the AS ("African" slope or dry slope) than on the ES ("European" slope or humid slope), and the applied Tajima D and Fu-Li test rejected neutrality of SNP diversity. Expression analysis indicated that the 342 bp insertion at 5'UTR was associated with the earlier up-regulation of Dhn6 after dehydration. The genetic divergence of amino acids sequences indicated significant positive selection of Dhn6 among the wild barley populations. The diversity of Dhn6 in microclimatic divergence slopes suggested that Dhn6 has been subjected to natural selection and adaptively associated with drought resistance of wild barley at "Evolution Canyon".

A combination of PhP typing and β-d-glucuronidase gene sequence variation analysis for differentiation of Escherichia coli from humans and animals.

PubMed

Masters, N; Christie, M; Katouli, M; Stratton, H

2015-06-01

We investigated the usefulness of the β-d-glucuronidase gene variance in Escherichia coli as a microbial source tracking tool using a novel algorithm for comparison of sequences from a prescreened set of host-specific isolates using a high-resolution PhP typing method. A total of 65 common biochemical phenotypes belonging to 318 E. coli strains isolated from humans and domestic and wild animals were analysed for nucleotide variations at 10 loci along a 518 bp fragment of the 1812 bp β-d-glucuronidase gene. Neighbour-joining analysis of loci variations revealed 86 (76.8%) human isolates and 91.2% of animal isolates were correctly identified. Pairwise hierarchical clustering improved assignment; where 92 (82.1%) human and 204 (99%) animal strains were assigned to their respective cluster. Our data show that initial typing of isolates and selection of common types from different hosts prior to analysis of the β-d-glucuronidase gene sequence improves source identification. We also concluded that numerical profiling of the nucleotide variations can be used as a valuable approach to differentiate human from animal E. coli. This study signifies the usefulness of the β-d-glucuronidase gene as a marker for differentiating human faecal pollution from animal sources.

Molecular detection and serotyping of infectious bronchitis virus from FTA filter paper.

PubMed

Moscoso, Hugo; Raybon, Erine O; Thayer, Stephan G; Hofacre, Charles L

2005-03-01

We investigated the feasibility of using Flinders Technology Associates (FTA) filter cards for the storage of allantoic fluid containing an infectious bronchitis virus (IBV), such as Arkansas-DPI, Connecticut, and Massachusetts, and for their identification by reverse transcriptase (RT)-polymerase chain reaction (PCR) and characterization by restriction fragment length polymorphism (RFLP) or nucleotide sequencing. FTA paper is a cotton-based cellulose membrane containing lyophilized chemicals that lyses many types of bacteria and viruses. IBV was inactivated upon contact with the FTA, as shown by the inability of the virus to be propagated in embryonating chicken eggs. RT-PCR of the S1 gene showed that viral RNA in allantoic fluid remained stable after storage on FTA filter cards and that the stability was time and temperature sensitive for the large (1700 base pair [bp]) but not the small (383 bp) PCR products. Analysis of the amplified products showed that molecular characterization is feasible in allantoic fluid stored on FTA under nonfavorable environmental conditions (41 C) for at least 15 days. The use of FTA cards for the collection, transport, and storage of IBV-containing samples is safe, inexpensive, and adequate for molecular diagnosis. We propose that specimens coming from overseas on FTA cards would be first analyzed by RT-PCR with primers yielding a 1700-bp product followed by RFLP of the positive cases. Negative cases would be analyzed with primers yielding a 383-bp product (to exdude detrimental effect of the storage conditions) followed by nucleotide sequencing of the positive cases.

The genomes and comparative genomics of Lactobacillus delbrueckii phages.

PubMed

Riipinen, Katja-Anneli; Forsman, Päivi; Alatossava, Tapani

2011-07-01

Lactobacillus delbrueckii phages are a great source of genetic diversity. Here, the genome sequences of Lb. delbrueckii phages LL-Ku, c5 and JCL1032 were analyzed in detail, and the genetic diversity of Lb. delbrueckii phages belonging to different taxonomic groups was explored. The lytic isometric group b phages LL-Ku (31,080 bp) and c5 (31,841 bp) showed a minimum nucleotide sequence identity of 90% over about three-fourths of their genomes. The genomic locations of their lysis modules were unique, and the genomes featured several putative overlapping transcription units of genes. LL-Ku and c5 virions displayed peptidoglycan hydrolytic activity associated with a ~36-kDa protein similar in size to the endolysin. Unexpectedly, the 49,433-bp genome of the prolate phage JCL1032 (temperate, group c) revealed a conserved gene order within its structural genes. Lb. delbrueckii phages representing groups a (a phage LL-H), b and c possessed only limited protein sequence homology. Genomic comparison of LL-Ku and c5 suggested that diversification of Lb. delbrueckii phages is mainly due to insertions, deletions and recombination. For the first time, the complete genome sequences of group b and c Lb. delbrueckii phages are reported.

Low-coverage MiSeq next generation sequencing reveals the mitochondrial genome of the Eastern Rock Lobster, Sagmariasus verreauxi.

PubMed

Doyle, Stephen R; Griffith, Ian S; Murphy, Nick P; Strugnell, Jan M

2015-01-01

The complete mitochondrial genome of the Eastern Rock lobster, Sagmariasus verreauxi, is reported for the first time. Using low-coverage, long read MiSeq next generation sequencing, we constructed and determined the mtDNA genome organization of the 15,470 bp sequence from two isolates from Eastern Tasmania, Australia and Northern New Zealand, and identified 46 polymorphic nucleotides between the two sequences. This genome sequence and its genetic polymorphisms will likely be useful in understanding the distribution and population connectivity of the Eastern Rock Lobster, and in the fisheries management of this commercially important species.

Full Genome Sequence of Egg Drop Syndrome Virus Strain FJ12025 Isolated from Muscovy Duckling.

PubMed

Fu, Guanghua; Chen, Hongmei; Huang, Yu; Cheng, Longfei; Fu, Qiuling; Shi, Shaohua; Wan, Chunhe; Chen, Cuiteng; Lin, Jiansheng

2013-08-22

Egg drop syndrome virus (EDSV) strain FJ12025 was isolated from a 9-day-old Muscovy duckling. The results of the sequence showed that the genome of strain FJ12025 is 33,213 bp in length, with a G+C content of 43.03%. When comparing the genome sequence of strain FJ12025 to that of laying duck original strain AV-127, we found 50 single-nucleotide polymorphisms (SNPs) between the two viral genome sequences. A genomic sequence comparison of FJ12025 and AV-127 will help to understand the phenotypic differences between the two viruses.

Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

PubMed

O'Sullivan, D J; O'Gara, F

1991-08-01

An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

Sequencing Bands of Ribosomal Intergenic Spacer Analysis Fingerprints for Characterization and Microscale Distribution of Soil Bacterium Populations Responding to Mercury Spiking

PubMed Central

Ranjard, Lionel; Brothier, Elisabeth; Nazaret, Sylvie

2000-01-01

Two major emerging bands (a 350-bp band and a 650-bp band) within the RISA (ribosomal intergenic spacer analysis) profile of a soil bacterial community spiked with Hg(II) were selected for further identification of the populations involved in the response of the community to the added metal. The bands were cut out from polyacrylamide gels, cloned, characterized by restriction analysis, and sequenced for phylogenetic affiliation of dominant clones. The sequences were the intergenic spacer between the rrs and rrl genes and the first 130 nucleotides of the rrl gene. Comparison of sequences derived from the 350-bp band to The GenBank database permitted us to identify the bacteria as being mostly close relatives to low G+C firmicutes (Clostridium-like genera), while the 650-bp band permitted us to identify the bacteria as being mostly close relatives to β-proteobacteria (Ralstonia-like genera). Oligonucleotide probes specific for the identified dominant bacteria were designed and hybridized with the RISA profiles derived from the control and spiked communities. These studies confirmed the contribution of these populations to the community response to the metal. Hybridization of the RISA profiles from subcommunities (bacterial pools associated with different soil microenvironments) also permitted to characterize the distribution and the dynamics of these populations at a microscale level following mercury spiking. PMID:11097911

Graphical classification of DNA sequences of HLA alleles by deep learning.

PubMed

Miyake, Jun; Kaneshita, Yuhei; Asatani, Satoshi; Tagawa, Seiichi; Niioka, Hirohiko; Hirano, Takashi

2018-04-01

Alleles of human leukocyte antigen (HLA)-A DNAs are classified and expressed graphically by using artificial intelligence "Deep Learning (Stacked autoencoder)". Nucleotide sequence data corresponding to the length of 822 bp, collected from the Immuno Polymorphism Database, were compressed to 2-dimensional representation and were plotted. Profiles of the two-dimensional plots indicate that the alleles can be classified as clusters are formed. The two-dimensional plot of HLA-A DNAs gives a clear outlook for characterizing the various alleles.

Organization of 5S rDNA in species of the fish Leporinus: two different genomic locations are characterized by distinct nontranscribed spacers.

PubMed

Martins, C; Galetti, P M

2001-10-01

To address understanding the organization of the 5S rRNA multigene family in the fish genome, the nucleotide sequence and organization array of 5S rDNA were investigated in the genus Leporinus, a representative freshwater fish group of South American fauna. PCR, subgenomic library screening, genomic blotting, fluorescence in situ hybridization, and DNA sequencing were employed in this study. Two arrays of 5S rDNA were identified for all species investigated, one consisting of monomeric repeat units of around 200 bp and another one with monomers of 900 bp. These 5S rDNA arrays were characterized by distinct NTS sequences (designated NTS-I and NTS-II for the 200- and 900-bp monomers, respectively); however, their coding sequences were nearly identical. The 5S rRNA genes were clustered in two chromosome loci, a major one corresponding to the NTS-I sites and a minor one corresponding to the NTS-II sites. The NTS-I sequence was variable among Leporinus spp., whereas the NTS-II was conserved among them and even in the related genus Schizodon. The distinct 5S rDNA arrays might characterize two 5S rRNA gene subfamilies that have been evolving independently in the genome.

Deletion within the metallothionein locus of cadmium-tolerant Synechococcus PCC 6301 involving a highly iterated palindrome (HIP1).

PubMed

Gupta, A; Morby, A P; Turner, J S; Whitton, B A; Robinson, N J

1993-01-01

Genomic rearrangements involving amplification of metallothionein (MT) genes have been reported in metal-tolerant eukaryotes. Similarly, we have recently observed amplification and rearrangement of a prokaryotic MT locus, smt, in cells of Synechococcus PCC 6301 selected for Cd tolerance. Following the characterization of this locus, the altered smt region has now been isolated from a Cd-tolerant cell line, C3.2, and its nucleotide sequence determined. This has identified a deletion within smtB, which encodes a trans-acting repressor of smt transcription. Two identical palindromic octanucleotides (5'-GCGATC-GC-3') traverse both borders of the excised element. This palindromic sequence is highly represented in the smt locus (7 occurrences in 1326 nucleotides) and analysis of the GenBank/EMBL/DDBJ DNA Nucleotide Sequence Data Libraries reveals that this is a highly iterated palindrome (HIP1) in other known sequences from Synechococcus strains (estimated to occur at an average frequency of once every c. 664 bp). HIP1 is also abundant in the genomes of other cyanobacteria. The functional significance of smtB deletion and the possible role of HIP1 in genome plasticity and adaptation in cyanobacteria are discussed.

Genetic Relatedness of Clostridium difficile Isolates from Various Origins Determined by Triple-Locus Sequence Analysis Based on Toxin Regulatory Genes tcdC, tcdR, and cdtR▿

PubMed Central

Bouvet, Philippe J. M.; Popoff, Michel R.

2008-01-01

A triple-locus nucleotide sequence analysis based on toxin regulatory genes tcdC, tcdR and cdtR was initiated to assess the sequence variability of these genes among Clostridium difficile isolates and to study the genetic relatedness between isolates. A preliminary investigation of the variability of the tcdC gene was done with 57 clinical and veterinary isolates. Twenty-three isolates representing nine main clusters were selected for tcdC, tcdR, and cdtR analysis. The numbers of alleles found for tcdC, tcdR and cdtR were nine, six, and five, respectively. All strains possessed the cdtR gene except toxin A-negative toxin B-positive variants. All but one binary toxin CDT-positive isolate harbored a deletion (>1 bp) in the tcdC gene. The combined analyses of the three genes allowed us to distinguish five lineages correlated with the different types of deletion in tcdC, i.e., 18 bp (associated or not with a deletion at position 117), 36 bp, 39 bp, and 54 bp, and with the wild-type tcdC (no deletion). The tcdR and tcdC genes, though located within the same pathogenicity locus, were found to have evolved separately. Coevolution of the three genes was noted only with strains harboring a 39-bp or a 54-bp deletion in tcdC that formed two homogeneous, separate divergent clusters. Our study supported the existence of the known clones (PCR ribotype 027 isolates and toxin A-negative toxin B-positive C. difficile variants) and evidence for clonality of isolates with a 39-bp deletion (toxinotype V, PCR ribotype 078) that are frequently isolated worldwide from human infections and from food animals. PMID:18832125

Partial structure of the phylloxin gene from the giant monkey frog, Phyllomedusa bicolor: parallel cloning of precursor cDNA and genomic DNA from lyophilized skin secretion.

PubMed

Chen, Tianbao; Gagliardo, Ron; Walker, Brian; Zhou, Mei; Shaw, Chris

2005-12-01

Phylloxin is a novel prototype antimicrobial peptide from the skin of Phyllomedusa bicolor. Here, we describe parallel identification and sequencing of phylloxin precursor transcript (mRNA) and partial gene structure (genomic DNA) from the same sample of lyophilized skin secretion using our recently-described cloning technique. The open-reading frame of the phylloxin precursor was identical in nucleotide sequence to that previously reported and alignment with the nucleotide sequence derived from genomic DNA indicated the presence of a 175 bp intron located in a near identical position to that found in the dermaseptins. The highly-conserved structural organization of skin secretion peptide genes in P. bicolor can thus be extended to include that encoding phylloxin (plx). These data further reinforce our assertion that application of the described methodology can provide robust genomic/transcriptomic/peptidomic data without the need for specimen sacrifice.

Pyrosequencing as a tool for the identification of common isolates of Mycobacterium sp.

PubMed

Tuohy, Marion J; Hall, Gerri S; Sholtis, Mary; Procop, Gary W

2005-04-01

Pyrosequencing technology, sequencing by addition, was evaluated for categorization of mycobacterial isolates. One hundred and eighty-nine isolates, including 18 ATCC and Trudeau Mycobacterial Culture Collection (TMC) strains, were studied. There were 38 Mycobacterium tuberculosis complex, 27 M. kansasii, 27 MAI complex, 21 M. marinum, 14 M. gordonae, 20 M. chelonae-abscessus group, 10 M. fortuitum, 5 M. xenopi, 3 M. celatum, 2 M. terrae complex, 20 M. mucogenicum, and 2 M. scrofulaceum. Nucleic acid extracts were prepared from solid media or MGIT broth. Traditional PCR was performed with one of the primers biotinylated; the assay targeted a portion of the 16S rRNA gene that contains a hypervariable region, which has been previously shown to be useful for the identification of mycobacteria. The PSQ Sample Preparation Kit was used, and the biotinylated PCR product was processed to a single-stranded DNA template. The sequencing primer was hybridized to the DNA template in a PSQ96 plate. Incorporation of the complementary nucleotides resulted in light generation peaks, forming a pyrogram, which was evaluated by the instrument software. Thirty basepairs were used for isolate categorization. Manual interpretation of the sequences was performed if the quality of the 30-bp sequence was in doubt or if more than 4 bp homopolymers were recognized. Sequences with more than 5 bp of bad quality were deemed unacceptable. When blasted against GenBank, 179 of 189 sequences (94.7%) assigned isolates to the correct molecular genus or group. Ten M. gordonae isolates had more than 5 bp of bad quality sequence and were not accepted. Pyrosequencing of this hypervariable region afforded rapid and acceptable characterization of common, routinely isolated clinical Mycobacterium sp. Algorithms are recommended for further differentiation with an additional sequencing primer or additional biochemicals.

Three closely related herpesviruses are associated with fibropapillomatosis in marine turtles

USGS Publications Warehouse

Quackenbush, S.L.; Work, Thierry M.; Balazs, George H.; Casey, Rufina N.; Rovnak, J.; Chaves, A.; duToit, L.; Baines, J.D.; Parrish, C.R.; Bowser, Paul R.; Casey, James W.

1998-01-01

Green turtle fibropapillomatosis is a neoplastic disease of increasingly significant threat to the survivability of this species. Degenerate PCR primers that target highly conserved regions of genes encoding herpesvirus DNA polymerases were used to amplify a DNA sequence from fibropapillomas and fibromas from Hawaiian and Florida green turtles. All of the tumors tested (n= 23) were found to harbor viral DNA, whereas no viral DNA was detected in skin biopsies from tumor-negative turtles. The tissue distribution of the green turtle herpesvirus appears to be generally limited to tumors where viral DNA was found to accumulate at approximately two to five copies per cell and is occasionally detected, only by PCR, in some tissues normally associated with tumor development. In addition, herpesviral DNA was detected in fibropapillomas from two loggerhead and four olive ridley turtles. Nucleotide sequencing of a 483-bp fragment of the turtle herpesvirus DNA polymerase gene determined that the Florida green turtle and loggerhead turtle sequences are identical and differ from the Hawaiian green turtle sequence by five nucleotide changes, which results in two amino acid substitutions. The olive ridley sequence differs from the Florida and Hawaiian green turtle sequences by 15 and 16 nucleotide changes, respectively, resulting in four amino acid substitutions, three of which are unique to the olive ridley sequence. Our data suggest that these closely related turtle herpesviruses are intimately involved in the genesis of fibropapillomatosis.

Characterization and phylogenetic analysis of the swine leukocyte antigen 3 gene from Korean native pigs.

PubMed

Chung, H Y; Choi, Y C; Park, H N

2015-05-18

We investigated the phylogenetic relationships between pig breeds, compared the genetic similarity between humans and pigs, and provided basic genetic information on Korean native pigs (KNPs), using genetic variants of the swine leukocyte antigen 3 (SLA-3) gene. Primers were based on sequences from GenBank (accession Nos. AF464010 and AF464009). Polymerase chain reaction analysis amplified approximately 1727 bp of segments, which contained 1086 bp of coding regions and 641 bp of the 3'- and 5'-untranslated regions. Bacterial artificial chromosome clones of miniature pigs were used for sequencing the SLA-3 genomic region, which was 3114 bp in total length, including the coding (1086 bp) and non-coding (2028 bp) regions. Sequence analysis detected 53 single nucleotide polymorphisms (SNPs), based on a minor allele frequency greater than 0.01, which is low compared with other pig breeds, and the results suggest that there is low genetic variability in KNPs. Comparative analysis revealed that humans possess approximately three times more genetic variation than do pigs. Approximately 71% of SNPs in exons 2 and 3 were detected in KNPs, and exon 5 in humans is a highly polymorphic region. Newly identified sequences of SLA-3 using KNPs were submitted to GenBank (accession No. DQ992512-18). Cluster analysis revealed that KNPs were grouped according to three major alleles: SLA-3*0502 (DQ992518), SLA-3*0302 (DQ992513 and DQ992516), and SLA-3*0303 (DQ992512, DQ992514, DQ992515, and DQ992517). Alignments revealed that humans have a relatively close genetic relationship with pigs and chimpanzees. The information provided by this study may be useful in KNP management.

Analysis of the Type IV Fimbrial-Subunit Gene fimA of Xanthomonas hyacinthi: Application in PCR-Mediated Detection of Yellow Disease in Hyacinths

PubMed Central

van Doorn, J.; Hollinger, T. C.; Oudega, B.

2001-01-01

A sensitive and specific detection method was developed for Xanthomonas hyacinthi; this method was based on amplification of a subsequence of the type IV fimbrial-subunit gene fimA from strain S148. The fimA gene was amplified by PCR with degenerate DNA primers designed by using the N-terminal and C-terminal amino acid sequences of trypsin fragments of FimA. The nucleotide sequence of fimA was determined and compared with the nucleotide sequences coding for the fimbrial subunits in other type IV fimbria-producing bacteria, such as Xanthomonas campestris pv. vesicatoria, Neisseria gonorrhoeae, and Moraxella bovis. In a PCR internal primers JAAN and JARA, designed by using the nucleotide sequences of the variable central and C-terminal region of fimA, amplified a 226-bp DNA fragment in all X. hyacinthi isolates. This PCR was shown to be pathovar specific, as assessed by testing 71 Xanthomonas pathovars and bacterial isolates belonging to other genera, such as Erwinia and Pseudomonas. Southern hybridization experiments performed with the labelled 226-bp DNA amplicon as a probe suggested that there is only one structural type IV fimbrial-gene cluster in X. hyacinthi. Only two Xanthomonas translucens pathovars cross-reacted weakly in PCR. Primers amplifying a subsequence of the fimA gene of X. campestris pv. vesicatoria (T. Ojanen-Reuhs, N. Kalkkinen, B. Westerlund-Wikström, J. van Doorn, K. Haahtela, E.-L. Nurmiaho-Lassila, K. Wengelink, U. Bonas, and T. K. Korhonen, J. Bacteriol. 179: 1280–1290, 1997) were shown to be pathovar specific, indicating that the fimbrial-subunit sequences are more generally applicable in xanthomonads for detection purposes. Under laboratory conditions, approximately 1,000 CFU of X. hyacinthi per ml could be detected. In inoculated leaves of hyacinths the threshold was 5,000 CFU/ml. The results indicated that infected hyacinths with early symptoms could be successfully screened for X. hyacinthi with PCR. PMID:11157222

Complete chloroplast DNA sequence from a Korean endemic genus, Megaleranthis saniculifolia, and its evolutionary implications.

PubMed

Kim, Young-Kyu; Park, Chong-wook; Kim, Ki-Joong

2009-03-31

The chloroplast DNA sequences of Megaleranthis saniculifolia, an endemic and monotypic endangered plant species, were completed in this study (GenBank FJ597983). The genome is 159,924 bp in length. It harbors a pair of IR regions consisting of 26,608 bp each. The lengths of the LSC and SSC regions are 88,326 bp and 18,382 bp, respectively. The structural organizations, gene and intron contents, gene orders, AT contents, codon usages, and transcription units of the Megaleranthis chloroplast genome are similar to those of typical land plant cp DNAs. However, the detailed features of Megaleranthis chloroplast genomes are substantially different from that of Ranunculus, which belongs to the same family, the Ranunculaceae. First, the Megaleranthis cp DNA was 4,797 bp longer than that of Ranunculus due to an expanded IR region into the SSC region and duplicated sequence elements in several spacer regions of the Megaleranthis cp genome. Second, the chloroplast genomes of Megaleranthis and Ranunculus evidence 5.6% sequence divergence in the coding regions, 8.9% sequence divergence in the intron regions, and 18.7% sequence divergence in the intergenic spacer regions, respectively. In both the coding and noncoding regions, average nucleotide substitution rates differed markedly, depending on the genome position. Our data strongly implicate the positional effects of the evolutionary modes of chloroplast genes. The genes evidencing higher levels of base substitutions also have higher incidences of indel mutations and low Ka/Ks ratios. A total of 54 simple sequence repeat loci were identified from the Megaleranthis cp genome. The existence of rich cp SSR loci in the Megaleranthis cp genome provides a rare opportunity to study the population genetic structures of this endangered species. Our phylogenetic trees based on the two independent markers, the nuclear ITS and chloroplast matK sequences, strongly support the inclusion of the Megaleranthis to the Trollius. Therefore, our molecular trees support Ohwi's original treatment of Megaleranthis saniculiforia to Trollius chosenensis Ohwi.

Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis.

PubMed

Buldyrev, S V; Goldberger, A L; Havlin, S; Mantegna, R N; Matsa, M E; Peng, C K; Simons, M; Stanley, H E

1995-05-01

An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis

NASA Technical Reports Server (NTRS)

Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Matsa, M. E.; Peng, C. K.; Simons, M.; Stanley, H. E.

1995-01-01

An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

Complete chloroplast genome sequence and comparative analysis of loblolly pine (Pinus taeda L.) with related species

PubMed Central

Khan, Abdul Latif; Khan, Muhammad Aaqil; Shahzad, Raheem; Lubna; Kang, Sang Mo; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung

2018-01-01

Pinaceae, the largest family of conifers, has a diversified organization of chloroplast (cp) genomes with two typical highly reduced inverted repeats (IRs). In the current study, we determined the complete sequence of the cp genome of an economically and ecologically important conifer tree, the loblolly pine (Pinus taeda L.), using Illumina paired-end sequencing and compared the sequence with those of other pine species. The results revealed a genome size of 121,531 base pairs (bp) containing a pair of 830-bp IR regions, distinguished by a small single copy (42,258 bp) and large single copy (77,614 bp) region. The chloroplast genome of P. taeda encodes 120 genes, comprising 81 protein-coding genes, four ribosomal RNA genes, and 35 tRNA genes, with 151 randomly distributed microsatellites. Approximately 6 palindromic, 34 forward, and 22 tandem repeats were found in the P. taeda cp genome. Whole cp genome comparison with those of other Pinus species exhibited an overall high degree of sequence similarity, with some divergence in intergenic spacers. Higher and lower numbers of indels and single-nucleotide polymorphism substitutions were observed relative to P. contorta and P. monophylla, respectively. Phylogenomic analyses based on the complete genome sequence revealed that 60 shared genes generated trees with the same topologies, and P. taeda was closely related to P. contorta in the subgenus Pinus. Thus, the complete P. taeda genome provided valuable resources for population and evolutionary studies of gymnosperms and can be used to identify related species. PMID:29596414

The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.

PubMed

Neuhaus, H; Link, G

1987-01-01

The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.

The ferredoxin-thioredoxin reductase variable subunit gene from Anacystis nidulans.

PubMed

Szekeres, M; Droux, M; Buchanan, B B

1991-03-01

The ferredoxin-thioredoxin reductase variable subunit gene of Anacystis nidulans was cloned, and its nucleotide sequence was determined. A single-copy 219-bp open reading frame encoded a protein of 73 amino acid residues, with a calculated Mr of 8,400. The monocistronic transcripts were represented in a 400-base and a less abundant 300-base mRNA form.

A comprehensive analysis of three Asiatic black bear mitochondrial genomes (subspecies ussuricus, formosanus and mupinensis), with emphasis on the complete mtDNA sequence of Ursus thibetanus ussuricus (Ursidae).

PubMed

Hwang, Dae-Sik; Ki, Jang-Seu; Jeong, Dong-Hyuk; Kim, Bo-Hyun; Lee, Bae-Keun; Han, Sang-Hoon; Lee, Jae-Seong

2008-08-01

In the present paper, we describe the mitochondrial genome sequence of the Asiatic black bear (Ursus thibetanus ussuricus) with particular emphasis on the control region (CR), and compared with mitochondrial genomes on molecular relationships among the bears. The mitochondrial genome sequence of U. thibetanus ussuricus was 16,700 bp in size with mostly conserved structures (e.g. 13 protein-coding, two rRNA genes, 22 tRNA genes). The CR consisted of several typical conserved domains such as F, E, D, and C boxes, and a conserved sequence block. Nucleotide sequences and the repeated motifs in the CR were different among the bear species, and their copy numbers were also variable according to populations, even within F1 generations of U. thibetanus ussuricus. Comparative analyses showed that the CR D1 region was highly informative for the discrimination of the bear family. These findings suggest that nucleotide sequences of both repeated motifs and CR D1 in the bear family are good markers for species discriminations.

Complete nucleotide sequence of pig (Sus scrofa) mitochondrial genome and dating evolutionary divergence within Artiodactyla.

PubMed

Lin, C S; Sun, Y L; Liu, C Y; Yang, P C; Chang, L C; Cheng, I C; Mao, S J; Huang, M C

1999-08-05

The complete nucleotide sequence of the pig (Sus scrofa) mitochondrial genome, containing 16613bp, is presented in this report. The genome is not a specific length because of the presence of the variable numbers of tandem repeats, 5'-CGTGCGTACA in the displacement loop (D-loop). Genes responsible for 12S and 16S rRNAs, 22 tRNAs, and 13 protein-coding regions are found. The genome carries very few intergenic nucleotides with several instances of overlap between protein-coding or tRNA genes, except in the D-loop region. For evaluating the possible evolutionary relationships between Artiodactyla and Cetacea, the nucleotide substitutions and amino acid sequences of 13 protein-coding genes were aligned by pairwise comparisons of the pig, cow, and fin whale. By comparing these sequences, we suggest that there is a closer relationship between the pig and cow than that between either of these species and fin whale. In addition, the accumulation of transversions and gaps in pig 12S and 16S rRNA genes was compared with that in other eutherian species, including cow, fin whale, human, horse, and harbor seal. The results also reveal a close phylogenetic relationship between pig and cow, as compared to fin whale and others. Thus, according to the sequence differences of mitochondrial rRNA genes in eutherian species, the evolutionary separation of pig and cow occurred about 53-60 million years ago.

Characterization of mango (Mangifera indica L.) transcriptome and chloroplast genome.

PubMed

Azim, M Kamran; Khan, Ishtaiq A; Zhang, Yong

2014-05-01

We characterized mango leaf transcriptome and chloroplast genome using next generation DNA sequencing. The RNA-seq output of mango transcriptome generated >12 million reads (total nucleotides sequenced >1 Gb). De novo transcriptome assembly generated 30,509 unigenes with lengths in the range of 300 to ≥3,000 nt and 67× depth of coverage. Blast searching against nonredundant nucleotide databases and several Viridiplantae genomic datasets annotated 24,593 mango unigenes (80% of total) and identified Citrus sinensis as closest neighbor of mango with 9,141 (37%) matched sequences. The annotation with gene ontology and Clusters of Orthologous Group terms categorized unigene sequences into 57 and 25 classes, respectively. More than 13,500 unigenes were assigned to 293 KEGG pathways. Besides major plant biology related pathways, KEGG based gene annotation pointed out active presence of an array of biochemical pathways involved in (a) biosynthesis of bioactive flavonoids, flavones and flavonols, (b) biosynthesis of terpenoids and lignins and (c) plant hormone signal transduction. The mango transcriptome sequences revealed 235 proteases belonging to five catalytic classes of proteolytic enzymes. The draft genome of mango chloroplast (cp) was obtained by a combination of Sanger and next generation sequencing. The draft mango cp genome size is 151,173 bp with a pair of inverted repeats of 27,093 bp separated by small and large single copy regions, respectively. Out of 139 genes in mango cp genome, 91 found to be protein coding. Sequence analysis revealed cp genome of C. sinensis as closest neighbor of mango. We found 51 short repeats in mango cp genome supposed to be associated with extensive rearrangements. This is the first report of transcriptome and chloroplast genome analysis of any Anacardiaceae family member.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

PubMed

Li, Chao; Chang, Wei Shan

2014-01-01

Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia

PubMed Central

Chang, Wei Shan

2014-01-01

Objective Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. Material and methods In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. Results The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. Conclusions We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application. PMID:26155117

Identification and characterization of single nucleotide polymorphisms (SNPs) in Culex theileri (Diptera: Culicidae).

PubMed

Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent

2012-05-01

Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.

Association between Chloroplast and Mitochondrial DNA sequences in Chinese Prunus genotypes (Prunus persica, Prunus domestica, and Prunus avium).

PubMed

Pervaiz, Tariq; Sun, Xin; Zhang, Yanyi; Tao, Ran; Zhang, Junhuan; Fang, Jinggui

2015-01-16

The nuclear DNA is conventionally used to assess the diversity and relatedness among different species, but variations at the DNA genome level has also been used to study the relationship among different organisms. In most species, mitochondrial and chloroplast genomes are inherited maternally; therefore it is anticipated that organelle DNA remains completely associated. Many research studies were conducted simultaneously on organelle genome. The objectives of this study was to analyze the genetic relationship between chloroplast and mitochondrial DNA in three Chinese Prunus genotypes viz., Prunus persica, Prunus domestica, and Prunus avium. We investigated the genetic diversity of Prunus genotypes using simple sequence repeat (SSR) markers relevant to the chloroplast and mitochondria. Most of the genotypes were genetically similar as revealed by phylogenetic analysis. The Y2 Wu Xing (Cherry) and L2 Hong Xin Li (Plum) genotypes have a high similarity index (0.89), followed by Zi Ye Li (0.85), whereas; L1 Tai Yang Li (plum) has the lowest genetic similarity (0.35). In case of cpSSR, Hong Tao (Peach) and L1 Tai Yang Li (Plum) genotypes demonstrated similarity index of 0.85 and Huang Tao has the lowest similarity index of 0.50. The mtSSR nucleotide sequence analysis revealed that each genotype has similar amplicon length (509 bp) except M5Y1 i.e., 505 bp with CCB256 primer; while in case of NAD6 primer, all genotypes showed different sizes. The MEHO (Peach), MEY1 (Cherry), MEL2 (Plum) and MEL1 (Plum) have 586 bps; while MEY2 (Cherry), MEZI (Plum) and MEHU (Peach) have 585, 584 and 566 bp, respectively. The CCB256 primer showed highly conserved sequences and minute single polymorphic nucleotides with no deletion or mutation. The cpSSR (ARCP511) microsatellites showed the harmonious amplicon length. The CZI (Plum), CHO (Peach) and CL1 (Plum) showed 182 bp; whileCHU (Peach), CY2 (Cherry), CL2 (Plum) and CY1 (Cherry) showed 181 bp amplicon lengths. These results demonstrated high conservation in chloroplast and mitochondrial genome among Prunus species during the evolutionary process. These findings are valuable to study the organelle DNA diversity in different species and genotypes of Prunus to provide in depth insight in to the mitochondrial and chloroplast genomes.

Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms.

PubMed

Zhang, Wei; Qi, Weihong; Albert, Thomas J; Motiwala, Alifiya S; Alland, David; Hyytia-Trees, Eija K; Ribot, Efrain M; Fields, Patricia I; Whittam, Thomas S; Swaminathan, Bala

2006-06-01

Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7x10(-9) per site per year), we estimate that the most recent common ancestor of the contemporary beta-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens.

Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms

PubMed Central

Zhang, Wei; Qi, Weihong; Albert, Thomas J.; Motiwala, Alifiya S.; Alland, David; Hyytia-Trees, Eija K.; Ribot, Efrain M.; Fields, Patricia I.; Whittam, Thomas S.; Swaminathan, Bala

2006-01-01

Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7 × 10−9 per site per year), we estimate that the most recent common ancestor of the contemporary β-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens. PMID:16606700

Formation of cis-diamminedichloroplatinum(II) 1,2-intrastrand cross-links on DNA is flanking-sequence independent.

PubMed

Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J

2000-11-01

Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.

A comparative analysis of MC4R gene sequence, polymorphism, and chromosomal localization in Chinese raccoon dog and Arctic fox.

PubMed

Skorczyk, Anna; Flisikowski, Krzysztof; Switonski, Marek

2012-05-01

Numerous mutations of the human melanocortin receptor type 4 (MC4R) gene are responsible for monogenic obesity, and some of them appear to be associated with predisposition or resistance to polygenic obesity. Thus, this gene is considered a functional candidate for fat tissue accumulation and body weight in domestic mammals. The aim of the study was comparative analysis of chromosome localization, nucleotide sequence, and polymorphism of the MC4R gene in two farmed species of the Canidae family, namely the Chinese raccoon dog (Nycterutes procyonoides procyonoides) and the arctic fox (Alopex lagopus). The whole coding sequence, including fragments of 3'UTR and 5'UTR, shows 89% similarity between the arctic fox (1276 bp) and Chinese raccoon dog (1213 bp). Altogether, 30 farmed Chinese raccoon dogs and 30 farmed arctic foxes were searched for polymorphisms. In the Chinese raccoon dog, only one silent substitution in the coding sequence was identified; whereas in the arctic fox, four InDels and two single-nucleotide polymorphisms (SNPs) in the 5'UTR and six silent SNPs in the exon were found. The studied gene was mapped by FISH to the Chinese raccoon dog chromosome 9 (NPP9q1.2) and arctic fox chromosome 24 (ALA24q1.2-1.3). The obtained results are discussed in terms of genome evolution of species belonging to the family Canidae and their potential use in animal breeding.

Structural analysis of the 5{prime} region of mouse and human Huntington disease genes reveals conservation of putative promoter region and Di- and trinucleotide polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Biaoyang; Nasir, J.; Kalchman, M.A.

1995-02-10

We have previously cloned and characterized the murine homologue of the Huntington disease (HD) gene and shown that it maps to mouse chromosome 5 within a region of conserved synteny with human chromosome 4p16.3. Here we present a detailed comparison of the sequence of the putative promoter and the organization of the 5{prime} genomic region of the murine (Hdh) and human HD genes encompassing the first five exons. We show that in this region these two genes share identical exon boundaries, but have different-size introns. Two dinucleotide (CT) and one trinucleotide intronic polymorphism in Hdh and an intronic CA polymorphismmore » in the HD gene were identified. Comparison of 940-bp sequence 5{prime} to the putative translation start site reveals a highly conserved region (78.8% nucleotide identity) between Hdh and the HD gene from nucleotide -56 to -206 (of Hdh). Neither Hdh nor the HD gene have typical TATA or CCAAT elements, but both show one putative AP2 binding site and numerous potential Sp1 binding sites. The high sequence identity between Hdh and the HD gene for approximately 200 bp 5{prime} to the putative translation start site indicates that these sequences may play a role in regulating expression of the Huntington disease gene. 30 refs., 4 figs., 2 tabs.« less

Isolation and Characterization of Two Cryptic Plasmids in the Ammonia-Oxidizing Bacterium Nitrosomonas sp. Strain ENI-11

PubMed Central

Yamagata, Akira; Kato, Junichi; Hirota, Ryuichi; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao

1999-01-01

Two plasmids were discovered in the ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11, which was isolated from activated sludge. The plasmids, designated pAYS and pAYL, were relatively small, being approximately 1.9 kb long. They were cryptic plasmids, having no detectable plasmid-linked antibiotic resistance or heavy metal resistance markers. The complete nucleotide sequences of pAYS and pAYL were determined, and their physical maps were constructed. There existed two major open reading frames, ORF1 in pAYS and ORF2 in pAYL, each of which was more than 500 bp long. The predicted product of ORF2 was 28% identical to part of the replication protein of a Bacillus plasmid, pBAA1. However, no significant similarity to any known protein sequences was detected with the predicted product of ORF1. pAYS and pAYL had a highly homologous region, designated HHR, of 262 bp. The overall identity was 98% between the two nucleotide sequences. Interestingly, HHR-homologous sequences were also detected in the genomes of ENI-11 and the plasmidless strain Nitrosomonas europaea IFO14298. Deletion analysis of pAYS and pAYL indicated that HHR, together with either ORF1 or ORF2, was essential for plasmid maintenance in ENI-11. To our knowledge, pAYS and pAYL are the first plasmids found in the ammonia-oxidizing autotrophic bacteria. PMID:10348848

Complete Chloroplast Genome Sequences of Important Oilseed Crop Sesamum indicum L

PubMed Central

Yi, Dong-Keun; Kim, Ki-Joong

2012-01-01

Sesamum indicum is an important crop plant species for yielding oil. The complete chloroplast (cp) genome of S. indicum (GenBank acc no. JN637766) is 153,324 bp in length, and has a pair of inverted repeat (IR) regions consisting of 25,141 bp each. The lengths of the large single copy (LSC) and the small single copy (SSC) regions are 85,170 bp and 17,872 bp, respectively. Comparative cp DNA sequence analyses of S. indicum with other cp genomes reveal that the genome structure, gene order, gene and intron contents, AT contents, codon usage, and transcription units are similar to the typical angiosperm cp genomes. Nucleotide diversity of the IR region between Sesamum and three other cp genomes is much lower than that of the LSC and SSC regions in both the coding region and noncoding region. As a summary, the regional constraints strongly affect the sequence evolution of the cp genomes, while the functional constraints weakly affect the sequence evolution of cp genomes. Five short inversions associated with short palindromic sequences that form step-loop structures were observed in the chloroplast genome of S. indicum. Twenty-eight different simple sequence repeat loci have been detected in the chloroplast genome of S. indicum. Almost all of the SSR loci were composed of A or T, so this may also contribute to the A-T richness of the cp genome of S. indicum. Seven large repeated loci in the chloroplast genome of S. indicum were also identified and these loci are useful to developing S. indicum-specific cp genome vectors. The complete cp DNA sequences of S. indicum reported in this paper are prerequisite to modifying this important oilseed crop by cp genetic engineering techniques. PMID:22606240

Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

PubMed

Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

2013-06-01

Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and reliable genotyping tool to assist hybrid cotton breeding.

Avian influenza virus and Newcastle disease virus (NDV) surveillance in commercial breeding farm in China and the characterization of Class I NDV isolates.

PubMed

Hu, Beixia; Huang, Yanyan; He, Yefeng; Xu, Chuantian; Lu, Xishan; Zhang, Wei; Meng, Bin; Yan, Shigan; Zhang, Xiumei

2010-07-29

In order to determine the actual prevalence of avian influenza virus (AIV) and Newcastle disease virus (NDV) in ducks in Shandong province of China, extensive surveillance studies were carried out in the breeding ducks of an intensive farm from July 2007 to September 2008. Each month cloacal and tracheal swabs were taken from 30 randomly selected birds that appeared healthy. All of the swabs were negative for influenza A virus recovery, whereas 87.5% of tracheal swabs and 100% cloacal swabs collected in September 2007, were positive for Newcastle disease virus isolation. Several NDV isolates were recovered from tracheal and cloacal swabs of apparently healthy ducks. All of the isolates were apathogenic as determined by the MDT and ICPI. The HN gene and the variable region of F gene (nt 47-420) of four isolates selected at random were sequenced. A 374 bp region of F gene and the full length of HN gene were used for phylogenetic analysis. Four isolates were identified as the same isolate based on nucleotide sequences identities of 99.2-100%, displaying a closer phylogenetic relationship to lentogenic Class I viruses. There were 1.9-9.9% nucleotide differences between the isolates and other Class I virus in the variable region of F gene (nt 47-420), whereas there were 38.5-41.2% nucleotide difference between the isolates and Class II viruses. The amino acid sequences of the F protein cleavage sites in these isolates were 112-ERQERL-117. The full length of HN gene of these isolates was 1851 bp, coding 585 amino acids. The homology analysis of the nucleotide sequence of HN gene indicated that there were 2.0-4.2% nucleotide differences between the isolates and other Class I viruses, whereas there were 29.5-40.9% differences between the isolates and Class II viruses. The results shows that these isolates are not phylogenetically related to the vaccine strain (LaSota). This study adds to the understanding of the ecology of influenza viruses and Newcastle disease viruses in ducks and emphasizes the need for constant surveillance in times of an ongoing and expanding epidemic of AIV and NDV. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Characterization of complete genome sequence of the spring viremia of carp virus isolated from common carp (Cyprinus carpio) in China.

PubMed

Teng, Y; Liu, H; Lv, J Q; Fan, W H; Zhang, Q Y; Qin, Q W

2007-01-01

The complete genome of spring viraemia of carp virus (SVCV) strain A-1 isolated from cultured common carp (Cyprinus carpio) in China was sequenced and characterized. Reverse transcription-polymerase chain reaction (RT-PCR) derived clones were constructed and the DNA was sequenced. It showed that the entire genome of SVCV A-1 consists of 11,100 nucleotide base pairs, the predicted size of the viral RNA of rhabdoviruses. However, the additional insertions in bp 4633-4676 and bp 4684-4724 of SVCV A-1 were different from the other two published SVCV complete genomes. Five open reading frames (ORFs) of SVCV A-1 were identified and further confirmed by RT-PCR and DNA sequencing of their respective RT-PCR products. The 5 structural proteins encoded by the viral RNA were ordered 3'-N-P-M-G-L-5'. This is the first report of a complete genome sequence of SVCV isolated from cultured carp in China. Phylogenetic analysis indicates that SVCV A-1 is closely related to the members of the genus Vesiculovirus, family Rhabdoviridae.

Comparison of the complete mitochondrial genome of the stonefly Sweltsa longistyla (Plecoptera: Chloroperlidae) with mitogenomes of three other stoneflies.

PubMed

Chen, Zhi-Teng; Du, Yu-Zhou

2015-03-01

The complete mitochondrial genome of the stonefly, Sweltsa longistyla Wu (Plecoptera: Chloroperlidae), was sequenced in this study. The mitogenome of S. longistyla is 16,151bp and contains 37 genes including 13 protein-coding genes (PCGs), 22 tRNA genes, two rRNA genes, and a large non-coding region. S. longistyla, Pteronarcys princeps Banks, Kamimuria wangi Du and Cryptoperla stilifera Sivec belong to the Plecoptera, and the gene order and orientation of their mitogenomes were similar. The overall AT content for the four stoneflies was below 72%, and the AT content of tRNA genes was above 69%. The four genomes were compact and contained only 65-127bp of non-coding intergenic DNAs. Overlapping nucleotides existed in all four genomes and ranged from 24 (P. princeps) to 178bp (K. wangi). There was a 7-bp motif ('ATGATAA') of overlapping DNA and an 8-bp motif (AAGCCTTA) conserved in three stonefly species (P. princeps, K. wangi and C. stilifera). The control regions of four stoneflies contained a stem-loop structure. Four conserved sequence blocks (CSBs) were present in the A+T-rich regions of all four stoneflies. Copyright © 2014 Elsevier B.V. All rights reserved.

The complete mitochondrial genomes of five Eimeria species infecting domestic rabbits.

PubMed

Liu, Guo-Hua; Tian, Si-Qin; Cui, Ping; Fang, Su-Fang; Wang, Chun-Ren; Zhu, Xing-Quan

2015-12-01

Rabbit coccidiosis caused by members of the genus Eimeria can cause enormous economic impact worldwide, but the genetics, epidemiology and biology of these parasites remain poorly understood. In the present study, we sequenced and annotated the complete mitochondrial (mt) genomes of five Eimeria species that commonly infect the domestic rabbits. The complete mt genomes of Eimeria intestinalis, Eimeria flavescens, Eimeria media, Eimeria vejdovskyi and Eimeria irresidua were 6261bp, 6258bp, 6168bp, 6254bp, 6259bp in length, respectively. All of the mt genomes consist of 3 genes for proteins (cytb, cox1, and cox3), 14 gene fragments for the large subunit (LSU) rRNA and 11 gene fragments for the small subunit (SSU) rRNA, but no transfer RNA (tRNA) genes. The gene order of the mt genomes is similar to that of Plasmodium, but distinct from Haemosporida and Theileria. Phylogenetic analyses based on full nucleotide sequences using Bayesian analysis revealed that the monophyly of the Eimeria of rabbits was strongly statistically supported with a Bayesian posterior probabilities. These data provide novel mtDNA markers for studying the population genetics and molecular epidemiology of the Eimeria species, and should have implications for the molecular diagnosis, prevention and control of coccidiosis in rabbits. Copyright © 2015 Elsevier Inc. All rights reserved.

Complete mitochondrial genome sequences of three bats species and whole genome mitochondrial analyses reveal patterns of codon bias and lend support to a basal split in Chiroptera.

PubMed

Meganathan, P R; Pagan, Heidi J T; McCulloch, Eve S; Stevens, Richard D; Ray, David A

2012-01-15

Order Chiroptera is a unique group of mammals whose members have attained self-powered flight as their main mode of locomotion. Much speculation persists regarding bat evolution; however, lack of sufficient molecular data hampers evolutionary and conservation studies. Of ~1200 species, complete mitochondrial genome sequences are available for only eleven. Additional sequences should be generated if we are to resolve many questions concerning these fascinating mammals. Herein, we describe the complete mitochondrial genomes of three bats: Corynorhinus rafinesquii, Lasiurus borealis and Artibeus lituratus. We also compare the currently available mitochondrial genomes and analyze codon usage in Chiroptera. C. rafinesquii, L. borealis and A. lituratus mitochondrial genomes are 16438 bp, 17048 bp and 16709 bp, respectively. Genome organization and gene arrangements are similar to other bats. Phylogenetic analyses using complete mitochondrial genome sequences support previously established phylogenetic relationships and suggest utility in future studies focusing on the evolutionary aspects of these species. Comprehensive analyses of available bat mitochondrial genomes reveal distinct nucleotide patterns and synonymous codon preferences corresponding to different chiropteran families. These patterns suggest that mutational and selection forces are acting to different extents within Chiroptera and shape their mitochondrial genomes. Copyright © 2011 Elsevier B.V. All rights reserved.

Polymorphisms in the GNB3 and ADD1 genes and blood pressure in a Chinese population.

PubMed

Chen, Shufeng; Wang, Hongwei; Lu, Xiangfeng; Liu, De-Pei; Chen, Jing; Jaquish, Cashell E; Rao, Dabeeru C; Hixson, James E; Kelly, Tanika N; Hou, Liping; Wang, Laiyuan; Huang, Jianfeng; Chen, Chung-Shiuan; Rice, Treva K; Whelton, Paul K; He, Jiang; Gu, Dongfeng

2010-08-01

A large proportion of the phenotypic variation in blood pressure (BP) appears to be inherited as a polygenic trait. This study examined the association between 12 single nucleotide polymorphisms (SNPs) in the guanine nucleotide binding protein beta polypeptide 3 (GNB3) and adducin 1 alpha (ADD1) genes and systolic (SBP), diastolic (DBP), and mean arterial (MAP) BP. A total of 3,142 individuals from 636 families were recruited from rural north China, and 2,746 met the eligibility criteria for analysis. BP measurements were obtained using a random-zero sphygmomanometer. Genetic variants were determined using SNPlex assays on an automated DNA Sequencer. A mixed linear model was used to estimate the association between each SNP and BP level. After Bonferroni correction, marker rs4963516 of the GNB3 gene remained significantly associated with DBP (corrected P values = 0.006, 0.007 and 0.002 for co-dominant, additive, and recessive models, respectively) and MAP (corrected P values = 0.02, 0.049, and 0.005, respectively). Compared to carriers of the major A allele, CC homozygotes had higher mean DBP (75.81 +/- 0.62 vs. 73.46 +/- 0.25 mmHg, P = 0.0002) and MAP (91.87 +/- 0.68 vs. 89.42 +/- 0.28 mmHg, P = 0.0004) after adjusting for covariates of age, gender, BMI, study site, and room temperature during BP measurement. In summary, these data support a role for the GNB3 gene in BP regulation in the Chinese population. Future studies aimed at replicating these novel findings are warranted.

Detection and molecular characterization of infectious bronchitis virus isolated from recent outbreaks in broiler flocks in Thailand.

PubMed

Pohuang, Tawatchai; Chansiripornchai, Niwat; Tawatsin, Achara; Sasipreeyajan, Jiroj

2009-09-01

Thirteen field isolates of infectious bronchitis virus (IBV) were isolated from broiler flocks in Thailand between January and June 2008. The 878-bp of the S1 gene covering a hypervariable region was amplified and sequenced. Phylogenetic analysis based on that region revealed that these viruses were separated into two groups (I and II). IBV isolates in group I were not related to other IBV strains published in the GenBank database. Group 1 nucleotide sequence identities were less than 85% and amino acid sequence identities less than 84% in common with IBVs published in the GenBank database. This group likely represents the strains indigenous to Thailand. The isolates in group II showed a close relationship with Chinese IBVs. They had nucleotide sequence identities of 97-98% and amino acid sequence identities 96-98% in common with Chinese IBVs (strain A2, SH and QXIBV). This finding indicated that the recent Thai IBVs evolved separately and at least two groups of viruses are circulating in Thailand.

Cloning and molecular characterization of the betaine aldehyde dehydrogenase involved in the biosynthesis of glycine betaine in white shrimp (Litopenaeus vannamei).

PubMed

Delgado-Gaytán, María F; Rosas-Rodríguez, Jesús A; Yepiz-Plascencia, Gloria; Figueroa-Soto, Ciria G; Valenzuela-Soto, Elisa M

2017-10-01

The enzyme betaine aldehyde dehydrogenase (BADH) catalyzes the irreversible oxidation of betaine aldehyde to glycine betaine (GB), a very efficient osmolyte accumulated during osmotic stress. In this study, we determined the nucleotide sequence of the cDNA for the BADH from the white shrimp Litopenaeus vannamei (LvBADH). The cDNA was 1882 bp long, with a complete open reading frame of 1524 bp, encoding 507 amino acids with a predicted molecular mass of 54.15 kDa and a pI of 5.4. The predicted LvBADH amino acid sequence shares a high degree of identity with marine invertebrate BADHs. Catalytic residues (C-298, E-264 and N-167) and the decapeptide VTLELGGKSP involved in nucleotide binding and highly conserved in BADHs were identified in the amino acid sequence. Phylogenetic analyses classified LvBADH in a clade that includes ALDH9 sequences from marine invertebrates. Molecular modeling of LvBADH revealed that the protein has amino acid residues and sequence motifs essential for the function of the ALDH9 family of enzymes. LvBADH modeling showed three potential monovalent cation binding sites, one site is located in an intra-subunit cavity; other in an inter-subunit cavity and a third in a central-cavity of the protein. The results show that LvBADH shares a high degree of identity with BADH sequences from marine invertebrates and enzymes that belong to the ALDH9 family. Our findings suggest that the LvBADH has molecular mechanisms of regulation similar to those of other BADHs belonging to the ALDH9 family, and that BADH might be playing a role in the osmoregulation capacity of L. vannamei. Copyright © 2017 Elsevier B.V. All rights reserved.

A genome sequence resource for the aye-aye (Daubentonia madagascariensis), a nocturnal lemur from Madagascar.

PubMed

Perry, George H; Reeves, Darryl; Melsted, Páll; Ratan, Aakrosh; Miller, Webb; Michelini, Katelyn; Louis, Edward E; Pritchard, Jonathan K; Mason, Christopher E; Gilad, Yoav

2012-01-01

We present a high-coverage draft genome assembly of the aye-aye (Daubentonia madagascariensis), a highly unusual nocturnal primate from Madagascar. Our assembly totals ~3.0 billion bp (3.0 Gb), roughly the size of the human genome, comprised of ~2.6 million scaffolds (N50 scaffold size = 13,597 bp) based on short paired-end sequencing reads. We compared the aye-aye genome sequence data with four other published primate genomes (human, chimpanzee, orangutan, and rhesus macaque) as well as with the mouse and dog genomes as nonprimate outgroups. Unexpectedly, we observed strong evidence for a relatively slow substitution rate in the aye-aye lineage compared with these and other primates. In fact, the aye-aye branch length is estimated to be ~10% shorter than that of the human lineage, which is known for its low substitution rate. This finding may be explained, in part, by the protracted aye-aye life-history pattern, including late weaning and age of first reproduction relative to other lemurs. Additionally, the availability of this draft lemur genome sequence allowed us to polarize nucleotide and protein sequence changes to the ancestral primate lineage-a critical period in primate evolution, for which the relevant fossil record is sparse. Finally, we identified 293,800 high-confidence single nucleotide polymorphisms in the donor individual for our aye-aye genome sequence, a captive-born individual from two wild-born parents. The resulting heterozygosity estimate of 0.051% is the lowest of any primate studied to date, which is understandable considering the aye-aye's extensive home-range size and relatively low population densities. Yet this level of genetic diversity also suggests that conservation efforts benefiting this unusual species should be prioritized, especially in the face of the accelerating degradation and fragmentation of Madagascar's forests.

Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

PubMed Central

Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

2011-01-01

Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

High-throughput SNP genotyping of historical and modern samples of five bird species via sequence capture of ultraconserved elements.

PubMed

Lim, Haw Chuan; Braun, Michael J

2016-09-01

Sample availability limits population genetics research on many species, especially taxa from regions with high diversity. However, many such species are well represented in museum collections assembled before the molecular era. Development of techniques to recover genetic data from these invaluable specimens will benefit biodiversity science. Using a mixture of freshly preserved and historical tissue samples, and a sequence capture probe set targeting >5000 loci, we produced high-confidence genotype calls on thousands of single nucleotide polymorphisms (SNPs) in each of five South-East Asian bird species and their close relatives (N = 27-43). On average, 66.2% of the reads mapped to the pseudo-reference genome of each species. Of these mapped reads, an average of 52.7% was identified as PCR or optical duplicates. We achieved deeper effective sequencing for historical samples (122.7×) compared to modern samples (23.5×). The number of nucleotide sites with at least 8× sequencing depth was high, with averages ranging from 0.89 × 10(6)  bp (Arachnothera, modern samples) to 1.98 × 10(6)  bp (Stachyris, modern samples). Linear regression revealed that the amount of sequence data obtained from each historical sample (represented by per cent of the pseudo-reference genome recovered with ≥8× sequencing depth) was positively and significantly (P ≤ 0.013) related to how recently the sample was collected. We observed characteristic post-mortem damage in the DNA of historical samples. However, we were able to reduce the error rate significantly by truncating ends of reads during read mapping (local alignment) and conducting stringent SNP and genotype filtering. © 2016 John Wiley & Sons Ltd.

In silico analysis of β-mannanases and β-mannosidase from Aspergillus flavus and Trichoderma virens UKM1

NASA Astrophysics Data System (ADS)

Yee, Chai Sin; Murad, Abdul Munir Abdul; Bakar, Farah Diba Abu

2013-11-01

A gene encoding an endo-β-1,4-mannanase from Trichoderma virens UKM1 (manTV) and Aspergillus flavus UKM1 (manAF) was analysed with bioinformatic tools. In addition, A. flavus NRRL 3357 genome database was screened for a β-mannosidase gene and analysed (mndA-AF). These three genes were analysed to understand their gene properties. manTV and manAF both consists of 1,332-bp and 1,386-bp nucleotides encoding 443 and 461 amino acid residues, respectively. Both the endo-β-1,4-mannanases belong to the glycosyl hydrolase family 5 and contain a carbohydrate-binding module family 1 (CBM1). On the other hand, mndA-AF which is a 2,745-bp gene encodes a protein sequence of 914 amino acid residues. This β-mannosidase belongs to the glycosyl hydrolase family 2. Predicted molecular weight of manTV, manAF and mndA-AF are 47.74 kDa, 49.71 kDa and 103 kDa, respectively. All three predicted protein sequences possessed signal peptide sequence and are highly conserved among other fungal β-mannanases and β-mannosidases.

The genome sequence of the plant pathogen Xylella fastidiosa. The Xylella fastidiosa Consortium of the Organization for Nucleotide Sequencing and Analysis.

PubMed

Simpson, A J; Reinach, F C; Arruda, P; Abreu, F A; Acencio, M; Alvarenga, R; Alves, L M; Araya, J E; Baia, G S; Baptista, C S; Barros, M H; Bonaccorsi, E D; Bordin, S; Bové, J M; Briones, M R; Bueno, M R; Camargo, A A; Camargo, L E; Carraro, D M; Carrer, H; Colauto, N B; Colombo, C; Costa, F F; Costa, M C; Costa-Neto, C M; Coutinho, L L; Cristofani, M; Dias-Neto, E; Docena, C; El-Dorry, H; Facincani, A P; Ferreira, A J; Ferreira, V C; Ferro, J A; Fraga, J S; França, S C; Franco, M C; Frohme, M; Furlan, L R; Garnier, M; Goldman, G H; Goldman, M H; Gomes, S L; Gruber, A; Ho, P L; Hoheisel, J D; Junqueira, M L; Kemper, E L; Kitajima, J P; Krieger, J E; Kuramae, E E; Laigret, F; Lambais, M R; Leite, L C; Lemos, E G; Lemos, M V; Lopes, S A; Lopes, C R; Machado, J A; Machado, M A; Madeira, A M; Madeira, H M; Marino, C L; Marques, M V; Martins, E A; Martins, E M; Matsukuma, A Y; Menck, C F; Miracca, E C; Miyaki, C Y; Monteriro-Vitorello, C B; Moon, D H; Nagai, M A; Nascimento, A L; Netto, L E; Nhani, A; Nobrega, F G; Nunes, L R; Oliveira, M A; de Oliveira, M C; de Oliveira, R C; Palmieri, D A; Paris, A; Peixoto, B R; Pereira, G A; Pereira, H A; Pesquero, J B; Quaggio, R B; Roberto, P G; Rodrigues, V; de M Rosa, A J; de Rosa, V E; de Sá, R G; Santelli, R V; Sawasaki, H E; da Silva, A C; da Silva, A M; da Silva, F R; da Silva, W A; da Silveira, J F; Silvestri, M L; Siqueira, W J; de Souza, A A; de Souza, A P; Terenzi, M F; Truffi, D; Tsai, S M; Tsuhako, M H; Vallada, H; Van Sluys, M A; Verjovski-Almeida, S; Vettore, A L; Zago, M A; Zatz, M; Meidanis, J; Setubal, J C

2000-07-13

Xylella fastidiosa is a fastidious, xylem-limited bacterium that causes a range of economically important plant diseases. Here we report the complete genome sequence of X. fastidiosa clone 9a5c, which causes citrus variegated chlorosis--a serious disease of orange trees. The genome comprises a 52.7% GC-rich 2,679,305-base-pair (bp) circular chromosome and two plasmids of 51,158 bp and 1,285 bp. We can assign putative functions to 47% of the 2,904 predicted coding regions. Efficient metabolic functions are predicted, with sugars as the principal energy and carbon source, supporting existence in the nutrient-poor xylem sap. The mechanisms associated with pathogenicity and virulence involve toxins, antibiotics and ion sequestration systems, as well as bacterium-bacterium and bacterium-host interactions mediated by a range of proteins. Orthologues of some of these proteins have only been identified in animal and human pathogens; their presence in X. fastidiosa indicates that the molecular basis for bacterial pathogenicity is both conserved and independent of host. At least 83 genes are bacteriophage-derived and include virulence-associated genes from other bacteria, providing direct evidence of phage-mediated horizontal gene transfer.

The bipartite mitochondrial genome of Ruizia karukerae (Rhigonematomorpha, Nematoda).

PubMed

Kim, Taeho; Kern, Elizabeth; Park, Chungoo; Nadler, Steven A; Bae, Yeon Jae; Park, Joong-Ki

2018-05-10

Mitochondrial genes and whole mitochondrial genome sequences are widely used as molecular markers in studying population genetics and resolving both deep and shallow nodes in phylogenetics. In animals the mitochondrial genome is generally composed of a single chromosome, but mystifying exceptions sometimes occur. We determined the complete mitochondrial genome of the millipede-parasitic nematode Ruizia karukerae and found its mitochondrial genome consists of two circular chromosomes, which is highly unusual in bilateral animals. Chromosome I is 7,659 bp and includes six protein-coding genes, two rRNA genes and nine tRNA genes. Chromosome II comprises 7,647 bp, with seven protein-coding genes and 16 tRNA genes. Interestingly, both chromosomes share a 1,010 bp sequence containing duplicate copies of cox2 and three tRNA genes (trnD, trnG and trnH), and the nucleotide sequences between the duplicated homologous gene copies are nearly identical, suggesting a possible recent genesis for this bipartite mitochondrial genome. Given that little is known about the formation, maintenance or evolution of abnormal mitochondrial genome structures, R. karukerae mtDNA may provide an important early glimpse into this process.

Characteristics of MHC class I genes in house sparrows Passer domesticus as revealed by long cDNA transcripts and amplicon sequencing.

PubMed

Karlsson, Maria; Westerdahl, Helena

2013-08-01

In birds the major histocompatibility complex (MHC) organization differs both among and within orders; chickens Gallus gallus of the order Galliformes have a simple arrangement, while many songbirds of the order Passeriformes have a more complex arrangement with larger numbers of MHC class I and II genes. Chicken MHC genes are found at two independent loci, classical MHC-B and non-classical MHC-Y, whereas non-classical MHC genes are yet to be verified in passerines. Here we characterize MHC class I transcripts (α1 to α3 domain) and perform amplicon sequencing using a next-generation sequencing technique on exon 3 from house sparrow Passer domesticus (a passerine) families. Then we use phylogenetic, selection, and segregation analyses to gain a better understanding of the MHC class I organization. Trees based on the α1 and α2 domain revealed a distinct cluster with short terminal branches for transcripts with a 6-bp deletion. Interestingly, this cluster was not seen in the tree based on the α3 domain. 21 exon 3 sequences were verified in a single individual and the average numbers within an individual were nine and five for sequences with and without a 6-bp deletion, respectively. All individuals had exon 3 sequences with and without a 6-bp deletion. The sequences with a 6-bp deletion have many characteristics in common with non-classical MHC, e.g., highly conserved amino acid positions were substituted compared with the other alleles, low nucleotide diversity and just a single site was subject to positive selection. However, these alleles also have characteristics that suggest they could be classical, e.g., complete linkage and absence of a distinct cluster in a tree based on the α3 domain. Thus, we cannot determine for certain whether or not the alleles with a 6-bp deletion are non-classical based on our present data. Further analyses on segregation patterns of these alleles in combination with dating the 6-bp deletion through MHC characterization across the genus Passer may solve this matter in the future.

The First Complete Chloroplast Genome Sequences in Actinidiaceae: Genome Structure and Comparative Analysis.

PubMed

Yao, Xiaohong; Tang, Ping; Li, Zuozhou; Li, Dawei; Liu, Yifei; Huang, Hongwen

2015-01-01

Actinidia chinensis is an important economic plant belonging to the basal lineage of the asterids. Availability of a complete Actinidia chloroplast genome sequence is crucial to understanding phylogenetic relationships among major lineages of angiosperms and facilitates kiwifruit genetic improvement. We report here the complete nucleotide sequences of the chloroplast genomes for Actinidia chinensis and A. chinensis var deliciosa obtained through de novo assembly of Illumina paired-end reads produced by total DNA sequencing. The total genome size ranges from 155,446 to 157,557 bp, with an inverted repeat (IR) of 24,013 to 24,391 bp, a large single copy region (LSC) of 87,984 to 88,337 bp and a small single copy region (SSC) of 20,332 to 20,336 bp. The genome encodes 113 different genes, including 79 unique protein-coding genes, 30 tRNA genes and 4 ribosomal RNA genes, with 16 duplicated in the inverted repeats, and a tRNA gene (trnfM-CAU) duplicated once in the LSC region. Comparisons of IR boundaries among four asterid species showed that IR/LSC borders were extended into the 5' portion of the psbA gene and IR contraction occurred in Actinidia. The clap gene has been lost from the chloroplast genome in Actinidia, and may have been transferred to the nucleus during chloroplast evolution. Twenty-seven polymorphic simple sequence repeat (SSR) loci were identified in the Actinidia chloroplast genome. Maximum parsimony analyses of a 72-gene, 16 taxa angiosperm dataset strongly support the placement of Actinidiaceae in Ericales within the basal asterids.

The ferredoxin-thioredoxin reductase variable subunit gene from Anacystis nidulans.

PubMed Central

Szekeres, M; Droux, M; Buchanan, B B

1991-01-01

The ferredoxin-thioredoxin reductase variable subunit gene of Anacystis nidulans was cloned, and its nucleotide sequence was determined. A single-copy 219-bp open reading frame encoded a protein of 73 amino acid residues, with a calculated Mr of 8,400. The monocistronic transcripts were represented in a 400-base and a less abundant 300-base mRNA form. Images PMID:1705544

Characterization of a Novel Cutaneous Human Papillomavirus Genotype HPV-125

PubMed Central

Kovanda, Anja; Kocjan, Boštjan J.; Potočnik, Marko; Poljak, Mario

2011-01-01

The DNA genome of a novel HPV genotype, HPV-125, isolated from a hand wart of an immuno-competent 19-year old male was fully cloned, sequenced and characterized. The full genome of HPV-125 is 7,809-bp in length with a GC content of 46.4%. By comparing the nucleotide sequence of the complete L1 gene, HPV-125 is phylogenetically placed within cutaneotrophic species 2 of Alphapapillomaviruses, and is most closely related to HPV-3 and HPV-28. HPV-125 has a typical genomic organization of Alphapapillomaviruses and contains genes coding for five early proteins, E6, E7, E1, E2 and E4 and two late capsid proteins, L1 and L2. The genome contains two non-coding regions: the first located between the L1 and E6 genes (nucleotide positions 7,137–7,809, length 673-bp) and the second between genes E2 and L2 (nucleotide positions 3,757–4,216, length 460-bp). The E6 protein of HPV-125 contains two regular zinc-binding domains at amino acid positions 29 and 102, whereas the E7 protein exhibits one such domain at position 50. HPV-125 lacks the regular pRb-binding core sequence within its E7 protein. In order to assess the tissue predilection and clinical significance of HPV-125, a quantitative type-specific real-time PCR was developed. The 95% limit-of-detection of the assay was 2.5 copies per reaction (range 1.7–5.7) and the intra- and inter-assay coefficients of variation were 0.47 and 2.00 for 100 copies per reaction, and 1.15 and 2.15 for 10 copies per reaction, respectively. Testing of a representative collection of HPV-associated mucosal and cutaneous benign and malignant neoplasms and hair follicles (a total of 601 samples) showed that HPV-125 is a relatively rare HPV genotype, with cutaneous tropism etiologically linked with sporadic cases of common warts. PMID:21811601

A periodic pattern of SNPs in the human genome

PubMed Central

Madsen, Bo Eskerod; Villesen, Palle; Wiuf, Carsten

2007-01-01

By surveying a filtered, high-quality set of SNPs in the human genome, we have found that SNPs positioned 1, 2, 4, 6, or 8 bp apart are more frequent than SNPs positioned 3, 5, 7, or 9 bp apart. The observed pattern is not restricted to genomic regions that are known to cause sequencing or alignment errors, for example, transposable elements (SINE, LINE, and LTR), tandem repeats, and large duplicated regions. However, we found that the pattern is almost entirely confined to what we define as “periodic DNA.” Periodic DNA is a genomic region with a high degree of periodicity in nucleotide usage. It turned out that periodic DNA is mainly small regions (average length 16.9 bp), widely distributed in the genome. Furthermore, periodic DNA has a 1.8 times higher SNP density than the rest of the genome and SNPs inside periodic DNA have a significantly higher genotyping error rate than SNPs outside periodic DNA. Our results suggest that not all SNPs in the human genome are created by independent single nucleotide mutations, and that care should be taken in analysis of SNPs from periodic DNA. The latter may have important consequences for SNP and association studies. PMID:17673700

Complete mitochondrial genome sequences of Brassica rapa (Chinese cabbage and mizuna), and intraspecific differentiation of cytoplasm in B. rapa and Brassica juncea.

PubMed

Hatono, Saki; Nishimura, Kaori; Murakami, Yoko; Tsujimura, Mai; Yamagishi, Hiroshi

2017-09-01

The complete sequence of the mitochondrial genome was determined for two cultivars of Brassica rapa . After determining the sequence of a Chinese cabbage variety, 'Oushou hakusai', the sequence of a mizuna variety, 'Chusei shiroguki sensuji kyomizuna', was mapped against the sequence of Chinese cabbage. The precise sequences where the two varieties demonstrated variation were ascertained by direct sequencing. It was found that the mitochondrial genomes of the two varieties are identical over 219,775 bp, with a single nucleotide polymorphism (SNP) between the genomes. Because B. rapa is the maternal species of an amphidiploid crop species, Brassica juncea , the distribution of the SNP was observed both in B. rapa and B. juncea . While the mizuna type SNP was restricted mainly to cultivars of mizuna (japonica group) in B. rapa , the mizuna type was widely distributed in B. juncea . The finding that the two Brassica species have these SNP types in common suggests that the nucleotide substitution occurred in wild B. rapa before both mitotypes were domesticated. It was further inferred that the interspecific hybridization between B. rapa and B. nigra took place twice and resulted in the two mitotypes of cultivated B. juncea .

Involvement of two genetic lineages of Sarcoptes scabiei mites in a local mange epizootic of wild mammals in Japan.

PubMed

Makouloutou, Patrice; Suzuki, Kazuo; Yokoyama, Mayumi; Takeuchi, Masahiko; Yanagida, Tetsuya; Sato, Hiroshi

2015-01-01

Similar to wild mammals on the continents, mange caused by the mange mite, Sarcoptes scabiei (Acari: Sarcoptidae) is spreading in wild mammals in most of Japan. We collected crusted or alopetic skin from 120 raccoon dogs (Nyctereutes procyonoides viverrinus), three raccoons (Procyon lotor), six Japanese badgers (Meles anakuma), one Japanese marten (Martes melampus), one stray dog (Canis lupus familiaris), four wild boars (Sus scrofa leucomystax), and one Japanese serow (Capricornis crispus), mainly in an area where mangy wild animals have been increasingly noted in the past 4 yr. The second internal transcribed spacer (ITS2) region of the ribosomal RNA gene and the partial 16S and cytochrome c oxidase subunit I (cox-1) genes of mitochondrial DNA (mtDNA) were characterized in these skin samples. The ITS2 sequencing (404 base pairs [bp]) identified the causative mite for mangy skin lesions of 128 animals as S. scabiei, regardless of host origin. The cat mite (Notoedres cati) was the cause in one raccoon dog and one raccoon. Most mites had almost identical ITS2 nucleotide sequences to those recorded in a variety of mammals worldwide. Partial 16S and cox-1 fragments of mtDNA amplified and sequenced successfully (331 bp and 410 bp, respectively) showed an identical nucleotide sequence except for one site (C vs. T) for the former and four sites (G, C, C, C vs. A, T, T, T, respectively) for the latter fragment. These substitutions were always synchronized, with the two mitochondrial DNA haplotypes (i.e., C/GCCC and T/ATTT) appearing to separately colonize in geographic units. The T/ATTT haplotype fell into a clade where animal-derived mites worldwide dominated, whereas the C/GCCC haplotype formed a geographic branch unique to Japanese isolates. These results suggest that heterologous populations of monospecific S. scabiei are expanding their populations and distributions regardless of host species in an apparently local mange epizootic of wild mammals in Japan.

The first complete chloroplast genome sequence of a lycophyte,Huperzia lucidula (Lycopodiaceae)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wolf, Paul G.; Karol, Kenneth G.; Mandoli, Dina F.

2005-02-01

We used a unique combination of techniques to sequence the first complete chloroplast genome of a lycophyte, Huperzia lucidula. This plant belongs to a significant clade hypothesized to represent the sister group to all other vascular plants. We used fluorescence-activated cell sorting (FACS) to isolate the organelles, rolling circle amplification (RCA) to amplify the genome, and shotgun sequencing to 8x depth coverage to obtain the complete chloroplast genome sequence. The genome is 154,373bp, containing inverted repeats of 15,314 bp each, a large single-copy region of 104,088 bp, and a small single-copy region of 19,671 bp. Gene order is more similarmore » to those of mosses, liverworts, and hornworts than to gene order for other vascular plants. For example, the Huperziachloroplast genome possesses the bryophyte gene order for a previously characterized 30 kb inversion, thus supporting the hypothesis that lycophytes are sister to all other extant vascular plants. The lycophytechloroplast genome data also enable a better reconstruction of the basaltracheophyte genome, which is useful for inferring relationships among bryophyte lineages. Several unique characters are observed in Huperzia, such as movement of the gene ndhF from the small single copy region into the inverted repeat. We present several analyses of evolutionary relationships among land plants by using nucleotide data, amino acid sequences, and by comparing gene arrangements from chloroplast genomes. The results, while still tentative pending the large number of chloroplast genomes from other key lineages that are soon to be sequenced, are intriguing in themselves, and contribute to a growing comparative database of genomic and morphological data across the green plants.« less

The short interspersed repetitive element of Trypanosoma cruzi, SIRE, is part of VIPER, an unusual retroelement related to long terminal repeat retrotransposons

PubMed Central

Vázquez, Martín; Ben-Dov, Claudia; Lorenzi, Hernan; Moore, Troy; Schijman, Alejandro; Levin, Mariano J.

2000-01-01

The short interspersed repetitive element (SIRE) of Trypanosoma cruzi was first detected when comparing the sequences of loci that encode the TcP2β genes. It is present in about 1,500–3,000 copies per genome, depending on the strain, and it is distributed in all chromosomes. An initial analysis of SIRE sequences from 21 genomic fragments allowed us to derive a consensus nucleotide sequence and structure for the element, consisting of three regions (I, II, and III) each harboring distinctive features. Analysis of 158 transcribed SIREs demonstrates that the consensus is highly conserved. The sequences of 51 cDNAs show that SIRE is included in the 3′ end of several mRNAs, always transcribed from the sense strand, contributing the polyadenylation site in 63% of the cases. This study led to the characterization of VIPER (vestigial interposed retroelement), a 2,326-bp-long unusual retroelement. VIPER's 5′ end is formed by the first 182 bp of SIRE, whereas its 3′ end is formed by the last 220 bp of the element. Both SIRE moieties are connected by a 1,924-bp-long fragment that carries a unique ORF encoding a complete reverse transcriptase-RNase H gene whose 15 C-terminal amino acids derive from codons specified by SIRE's region II. The amino acid sequence of VIPER's reverse transcriptase-RNase H shares significant homology to that of long terminal repeat retrotransposons. The fact that SIRE and VIPER sequences are found only in the T. cruzi genome may be of relevance for studies concerning the evolution and the genome flexibility of this protozoan parasite. PMID:10688909

Detection of Rickettsia helvetica and Candidatus R. tarasevichiae DNA in Ixodes persulcatus ticks collected in Northeastern European Russia (Komi Republic).

PubMed

Kartashov, Mikhail Yu; Glushkova, Ludmila I; Mikryukova, Tamara P; Korabelnikov, Igor V; Egorova, Yulia I; Tupota, Natalia L; Protopopova, Elena V; Konovalova, Svetlana N; Ternovoi, Vladimir A; Loktev, Valery B

2017-06-01

The number of tick-borne infections in the northern European regions of Russia has increased considerably in the last years. In the present study, 676 unfed adult Ixodes persulcatus ticks were collected in the Komi Republic from 2011 to 2013 to study tick-borne rickettsioses. Rickettsia spp. DNA was detected by PCR in 51 (7.6%) ticks. The nucleotide sequence analysis of gltA fragments (765bp) from 51 ticks indicated that 60.8% and 39.2% of the ticks were infected with Rickettsia helvetica and Candidatus R. tarasevichiae, respectively. The gltA fragments showed 100% identity with those of Candidatus R. tarasevichiae previously discovered in Siberia and China, whereas R. helvetica showed 99.9% sequence identity with European isolates. The ompB had 8 nucleotide substitutions, 6 of which resulted in amino acid substitutions. In the sca9 gene, 3 nucleotide substitutions were detected, and only one resulted in amino acid substitution. The smpA, ompW, and β-lactamase genes of R. helvetica also showed a high level of sequence identity. Copyright © 2017 Elsevier GmbH. All rights reserved.

High levels of MHC class II allelic diversity in lake trout from Lake Superior

USGS Publications Warehouse

Dorschner, M.O.; Duris, T.; Bronte, C.R.; Burnham-Curtis, M. K.; Phillips, R.B.

2000-01-01

Sequence variation in a 216 bp portion of the major histocompatibility complex (MHC) II B1 domain was examined in 74 individual lake trout (Salvelinus namaycush) from different locations in Lake Superior. Forty-three alleles were obtained which encoded 71-72 amino acids of the mature protein. These sequences were compared with previous data obtained from five Pacific salmon species and Atlantic salmon using the same primers. Although all of the lake trout alleles clustered together in the neighbor-joining analysis of amino acid sequences, one amino acid allelic lineage was shared with Atlantic salmon (Salmo salar), a species in another genus which probably diverged from Salvelinus more than 10-20 million years ago. As shown previously in other salmonids, the level of nonsynonymous nucleotide substitution (d(N)) exceeded the level of synonymous substitution (d(S)). The level of nucleotide diversity at the MHC class II B1 locus was considerably higher in lake trout than in the Pacific salmon (genus Oncorhynchus). These results are consistent with the hypothesis that lake trout colonized Lake Superior from more than one refuge following the Wisconsin glaciation. Recent population bottlenecks may have reduced nucleotide diversity in Pacific salmon populations.

Characterization of replication and conjugation of plasmid pWTY27 from a widely distributed Streptomyces species

PubMed Central

2012-01-01

Background Streptomyces species are widely distributed in natural habitats, such as soils, lakes, plants and some extreme environments. Replication loci of several Streptomyces theta-type plasmids have been reported, but are not characterized in details. Conjugation loci of some Streptomyces rolling-circle-type plasmids are identified and mechanism of conjugal transferring are described. Results We report the detection of a widely distributed Streptomyces strain Y27 and its indigenous plasmid pWTY27 from fourteen plants and four soil samples cross China by both culturing and nonculturing methods. The complete nucleotide sequence of pWTY27 consisted of 14,288 bp. A basic locus for plasmid replication comprised repAB genes and an adjacent iteron sequence, to a long inverted-repeat (ca. 105 bp) of which the RepA protein bound specifically in vitro, suggesting that RepA may recognize a second structure (e.g. a long stem-loop) of the iteron DNA. A plasmid containing the locus propagated in linear mode when the telomeres of a linear plasmid were attached, indicating a bi-directional replication mode for pWTY27. As for rolling-circle plasmids, a single traA gene and a clt sequence (covering 16 bp within traA and its adjacent 159 bp) on pWTY27 were required for plasmid transfer. TraA recognized and bound specifically to the two regions of the clt sequence, one containing all the four DC1 of 7 bp (TGACACC) and one DC2 (CCCGCCC) and most of IC1, and another covering two DC2 and part of IC1, suggesting formation of a high-ordered DNA-protein complex. Conclusions This work (i) isolates a widespread Streptomyces strain Y27 and sequences its indigenous theta-type plasmid pWTY27; (ii) identifies the replication and conjugation loci of pWTY27 and; (iii) characterizes the binding sequences of the RepA and TraA proteins. PMID:23134842

Superstatistical model of bacterial DNA architecture

NASA Astrophysics Data System (ADS)

Bogachev, Mikhail I.; Markelov, Oleg A.; Kayumov, Airat R.; Bunde, Armin

2017-02-01

Understanding the physical principles that govern the complex DNA structural organization as well as its mechanical and thermodynamical properties is essential for the advancement in both life sciences and genetic engineering. Recently we have discovered that the complex DNA organization is explicitly reflected in the arrangement of nucleotides depicted by the universal power law tailed internucleotide interval distribution that is valid for complete genomes of various prokaryotic and eukaryotic organisms. Here we suggest a superstatistical model that represents a long DNA molecule by a series of consecutive ~150 bp DNA segments with the alternation of the local nucleotide composition between segments exhibiting long-range correlations. We show that the superstatistical model and the corresponding DNA generation algorithm explicitly reproduce the laws governing the empirical nucleotide arrangement properties of the DNA sequences for various global GC contents and optimal living temperatures. Finally, we discuss the relevance of our model in terms of the DNA mechanical properties. As an outlook, we focus on finding the DNA sequences that encode a given protein while simultaneously reproducing the nucleotide arrangement laws observed from empirical genomes, that may be of interest in the optimization of genetic engineering of long DNA molecules.

Sequence Analysis of Mitochondrial Genome of Toxascaris leonina from a South China Tiger.

PubMed

Li, Kangxin; Yang, Fang; Abdullahi, A Y; Song, Meiran; Shi, Xianli; Wang, Minwei; Fu, Yeqi; Pan, Weida; Shan, Fang; Chen, Wu; Li, Guoqing

2016-12-01

Toxascaris leonina is a common parasitic nematode of wild mammals and has significant impacts on the protection of rare wild animals. To analyze population genetic characteristics of T. leonina from South China tiger, its mitochondrial (mt) genome was sequenced. Its complete circular mt genome was 14,277 bp in length, including 12 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 2 non-coding regions. The nucleotide composition was biased toward A and T. The most common start codon and stop codon were TTG and TAG, and 4 genes ended with an incomplete stop codon. There were 13 intergenic regions ranging 1 to 10 bp in size. Phylogenetically, T. leonina from a South China tiger was close to canine T. leonina . This study reports for the first time a complete mt genome sequence of T. leonina from the South China tiger, and provides a scientific basis for studying the genetic diversity of nematodes between different hosts.

Sequence space coverage, entropy of genomes and the potential to detect non-human DNA in human samples

PubMed Central

Liu, Zhandong; Venkatesh, Santosh S; Maley, Carlo C

2008-01-01

Background Genomes store information for building and maintaining organisms. Complete sequencing of many genomes provides the opportunity to study and compare global information properties of those genomes. Results We have analyzed aspects of the information content of Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae, and Escherichia coli (K-12) genomes. Virtually all possible (> 98%) 12 bp oligomers appear in vertebrate genomes while < 2% of 19 bp oligomers are present. Other species showed different ranges of > 98% to < 2% of possible oligomers in D. melanogaster (12–17 bp), C. elegans (11–17 bp), A. thaliana (11–17 bp), S. cerevisiae (10–16 bp) and E. coli (9–15 bp). Frequencies of unique oligomers in the genomes follow similar patterns. We identified a set of 2.6 M 15-mers that are more than 1 nucleotide different from all 15-mers in the human genome and so could be used as probes to detect microbes in human samples. In a human sample, these probes would detect 100% of the 433 currently fully sequenced prokaryotes and 75% of the 3065 fully sequenced viruses. The human genome is significantly more compact in sequence space than a random genome. We identified the most frequent 5- to 20-mers in the human genome, which may prove useful as PCR primers. We also identified a bacterium, Anaeromyxobacter dehalogenans, which has an exceptionally low diversity of oligomers given the size of its genome and its GC content. The entropy of coding regions in the human genome is significantly higher than non-coding regions and chromosomes. However chromosomes 1, 2, 9, 12 and 14 have a relatively high proportion of coding DNA without high entropy, and chromosome 20 is the opposite with a low frequency of coding regions but relatively high entropy. Conclusion Measures of the frequency of oligomers are useful for designing PCR assays and for identifying chromosomes and organisms with hidden structure that had not been previously recognized. This information may be used to detect novel microbes in human tissues. PMID:18973670

Sequence space coverage, entropy of genomes and the potential to detect non-human DNA in human samples.

PubMed

Liu, Zhandong; Venkatesh, Santosh S; Maley, Carlo C

2008-10-30

Genomes store information for building and maintaining organisms. Complete sequencing of many genomes provides the opportunity to study and compare global information properties of those genomes. We have analyzed aspects of the information content of Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae, and Escherichia coli (K-12) genomes. Virtually all possible (> 98%) 12 bp oligomers appear in vertebrate genomes while < 2% of 19 bp oligomers are present. Other species showed different ranges of > 98% to < 2% of possible oligomers in D. melanogaster (12-17 bp), C. elegans (11-17 bp), A. thaliana (11-17 bp), S. cerevisiae (10-16 bp) and E. coli (9-15 bp). Frequencies of unique oligomers in the genomes follow similar patterns. We identified a set of 2.6 M 15-mers that are more than 1 nucleotide different from all 15-mers in the human genome and so could be used as probes to detect microbes in human samples. In a human sample, these probes would detect 100% of the 433 currently fully sequenced prokaryotes and 75% of the 3065 fully sequenced viruses. The human genome is significantly more compact in sequence space than a random genome. We identified the most frequent 5- to 20-mers in the human genome, which may prove useful as PCR primers. We also identified a bacterium, Anaeromyxobacter dehalogenans, which has an exceptionally low diversity of oligomers given the size of its genome and its GC content. The entropy of coding regions in the human genome is significantly higher than non-coding regions and chromosomes. However chromosomes 1, 2, 9, 12 and 14 have a relatively high proportion of coding DNA without high entropy, and chromosome 20 is the opposite with a low frequency of coding regions but relatively high entropy. Measures of the frequency of oligomers are useful for designing PCR assays and for identifying chromosomes and organisms with hidden structure that had not been previously recognized. This information may be used to detect novel microbes in human tissues.

Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

PubMed

Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

2014-07-04

Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was shared by mitochondrial genomes of CMS and male-fertile pepper lines, extensive genome rearrangements were detected. CMS candidate genes located on the edges of highly-rearranged CMS-specific DNA regions and near to repeat sequences. These characteristics were detected among CMS-associated genes in other species, implying a common mechanism might be involved in the evolution of CMS-associated genes.

Complete genome sequences of Geobacillus sp. WCH70, a thermophilic strain isolated from wood compost

DOE PAGES

Brumm, Phillip; Land, Miriam L.; Mead, David

2016-04-27

Geobacillus sp. WCH70 was one of several thermophilic organisms isolated from hot composts in the Middleton, WI area. Comparison of 16 S rRNA sequences showed the strain may be a new species, and is most closely related to G. galactosidasius and G. toebii. The genome was sequenced, assembled, and annotated by the DOE Joint Genome Institute and deposited at the NCBI in December 2009 (CP001638). The genome of Geobacillus species WCH70 consists of one circular chromosome of 3,893,306 bp with an average G + C content of 43 %, and two circular plasmids of 33,899 and 10,287 bp with anmore » average G + C content of 40 %. Among sequenced organisms, Geobacillus sp. WCH70 shares highest Average Nucleotide Identity (86 %) with G. thermoglucosidasius strains, as well as similar genome organization. Geobacillus sp. WCH70 appears to be a highly adaptable organism, with an exceptionally high 125 annotated transposons in the genome. The organism also possesses four predicted restriction-modification systems not found in other Geobacillus species.« less

Complete genome sequences of Geobacillus sp. WCH70, a thermophilic strain isolated from wood compost

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brumm, Phillip; Land, Miriam L.; Mead, David

Geobacillus sp. WCH70 was one of several thermophilic organisms isolated from hot composts in the Middleton, WI area. Comparison of 16 S rRNA sequences showed the strain may be a new species, and is most closely related to G. galactosidasius and G. toebii. The genome was sequenced, assembled, and annotated by the DOE Joint Genome Institute and deposited at the NCBI in December 2009 (CP001638). The genome of Geobacillus species WCH70 consists of one circular chromosome of 3,893,306 bp with an average G + C content of 43 %, and two circular plasmids of 33,899 and 10,287 bp with anmore » average G + C content of 40 %. Among sequenced organisms, Geobacillus sp. WCH70 shares highest Average Nucleotide Identity (86 %) with G. thermoglucosidasius strains, as well as similar genome organization. Geobacillus sp. WCH70 appears to be a highly adaptable organism, with an exceptionally high 125 annotated transposons in the genome. The organism also possesses four predicted restriction-modification systems not found in other Geobacillus species.« less

Mitochondrial DNA sequence variation and phylogeography of the scarlet kingsnake (Lampropeltis elapsoides).

PubMed

Friedman, Michael; Schaffer, Les

2011-02-01

BACKGROUND AND AIMS. With the goal of assessing population structure and geographic distribution of haplotype lineages among Lampropeltis elapsoides, we sequenced the ND4 mitochondrial DNA locus from 96 specimens of this snake across its area of distribution. MATERIALS AND METHODS. We relied heavily on formalin-fixed museum specimens to accomplish this analysis. RESULTS. The sequence alignment consisted of 491 bp of the selected gene, with 28% missing data. A simulation used to assess the effect of missing data on population genetic and phylogenetic resolution indicated increased character conflict, but with minimal loss of phylogenetic structure. CONCLUSION. This limited dataset suggests that L. elapsoides constitutes a largely unstructured population, with both widespread haplotypes and large number of private haplotypes, a moderate level of nucleotide diversity, and a low, but significant, degree of north-south population differentiation. Haplotype structure and frequency, nucleotide frequency, and values for Tajima's D and Fu's F(S) indicate a recent range or population expansion following a historic bottleneck.

Molecular characterization of kudoid parasites (Myxozoa: Multivalvulida) from somatic muscles of Pacific bluefin (Thunnus orientalis) and yellowfin (T. albacores) tuna.

PubMed

Abe, Niichiro; Maehara, Tomofumi

2013-06-01

The public health importance of Kudoa infection in fish remains unclear. Recently in Japan a Kudoa species, K. septempunctata, was newly implicated as a causative agent of unidentified food poisoning related to the consumption of raw olive flounder. Other marine fishery products are also suspected as causative raw foods of unidentified food poisoning. For this study, we detected kudoid parasites from sliced raw muscle tissues of a young Pacific bluefin and an adult yellowfin tuna. No cyst or pseudocyst was evident in muscles macroscopically, but pseudocysts were detected in both samples histologically. One substitution (within 1100 bp overlap) and ten substitutions (within 753 bp overlap) were found respectively between the partial sequences of 18S and 28S rDNAs from both isolates. Nucleotide sequence similarity searching of 18S and 28S rDNAs from both isolates showed the highest identity with those of K. neothunni from tuna. Based on the spore morphology, the mode of parasitism, and the nucleotide sequence similarity, these isolates from a Pacific bluefin and a yellowfin tuna were identified as K. neothunni. Phylogenetic analysis of the 28S rDNA sequence revealed that K. neothunni is classifiable into two genotypes: one from Pacific bluefin and the other from yellowfin tuna. Recently, an unidentified kudoid parasite morphologically and genetically similar K. neothunni were detected from stocked tuna samples in unidentified food poisoning cases in Japan. The possibility exists that K. neothunni, especially from the Pacific bluefin tuna, causes food poisoning, as does K. septempunctata.

Divergence and evolution of homologous regions of Bombyx mori nuclear polyhedrosis virus.

PubMed Central

Majima, K; Kobara, R; Maeda, S

1993-01-01

Homologous regions (hrs) (hr1,hr2-left,hr2-right,hr3,hr4-left,hr 4-right, and hr5) similar to those found in the Autographa californica nuclear polyhedrosis virus (AcNPV) genome were found in the Bombyx mori NPV (BmNPV) genome. The BmNPV hrs contained two to eight repeats of a homologous nucleotide sequence which were on average about 75 bp long. All of these homologous sequence repeats contained a 26-bp-long palindrome motif with an EcoRI or EcoRI-like site at its core. The consensus sequence of the BmNPV hrs showed 95% conservation with respect to those found in AcNPV. Nucleotide sequence analysis indicated that hr2-left and hr2-right of BmNPV evolved from an ancestor similar to hr2 of AcNPV by inversion, cleavage, and ligation. The polarities of the BmNPV and AcNPV hrs were conserved except for that of hr4-left. Within hr4-right of BmNPV, four repeats of a previously underscribed palindrome motif were found. Bmhr5D, a BmNPV mutant which lacked hr5, replicated at a rate similar to that of wild-type BmNPV in BmN cells and silkworm larvae, indicating that hr5 was not essential for viral replication. After ten passages of Bmhr5D in BmN cells, no detectable changes in its genome were observed by restriction endonuclease analysis. The evolution and divergence of the BmNPV genome are also discussed. Images PMID:8230471

Prehistoric introduction of domestic pigs onto the Okinawa Islands: ancient mitochondrial DNA evidence.

PubMed

Watanobe, Takuma; Ishiguro, Naotaka; Nakano, Masuo; Takamiya, Hiroto; Matsui, Akira; Hongo, Hitomi

2002-08-01

Ancient DNAs of Sus scrofa specimens excavated from archaeological sites on the Okinawa islands were examined to clarify the genetic relationships among prehistoric Sus scrofa, modern wild boars and domestic pigs inhabiting the Ryukyu archipelago, the Japanese islands, and the Asian continent. We extracted remain DNA from 161 bone specimens excavated from 12 archaeological sites on the Okinawa islands and successfully amplified mitochondrial DNA control region fragments from 33 of 161 specimens. Pairwise difference between prehistoric and modern S. scrofa nucleotide sequences showed that haplotypes of the East Asian domestic pig lineage were found from archaeological specimens together with Ryukyu wild boars native to the Ryukyu archipelago. Phylogenetic analysis of 14 ancient sequences (11 haplotypes; 574 bp) indicated that S. scrofa specimens from two Yayoi-Heian sites (Kitahara and Ara shellmiddens) and two Recent Times sites (Wakuta Kiln and Kiyuna sites) are grouped with modern East Asian domestic pigs. Sus scrofa specimens from Shimizu shellmidden (Yayoi-Heian Period) were very closely related to modern Sus scrofa riukiuanus but had a unique nucleotide insertion, indicating that the population is genetically distinct from the lineage of modern Ryukyu wild boars. This genetic evidence suggests that domestic pigs from the Asian continent were introduced to the Okinawa islands in the early Yayoi-Heian period (1700-2000 BP), or earlier.

The complete chloroplast DNA sequence of Eleutherococcus senticosus (Araliaceae); comparative evolutionary analyses with other three asterids.

PubMed

Yi, Dong-Keun; Lee, Hae-Lim; Sun, Byung-Yun; Chung, Mi Yoon; Kim, Ki-Joong

2012-05-01

This study reports the complete chloroplast (cp) DNA sequence of Eleutherococcus senticosus (GenBank: JN 637765), an endangered endemic species. The genome is 156,768 bp in length, and contains a pair of inverted repeat (IR) regions of 25,930 bp each, a large single copy (LSC) region of 86,755 bp and a small single copy (SSC) region of 18,153 bp. The structural organization, gene and intron contents, gene order, AT content, codon usage, and transcription units of the E. senticosus chloroplast genome are similar to that of typical land plant cp DNA. We aligned and analyzed the sequences of 86 coding genes, 19 introns and 113 intergenic spacers (IGS) in three different taxonomic hierarchies; Eleutherococcus vs. Panax, Eleutherococcus vs. Daucus, and Eleutherococcus vs. Nicotiana. The distribution of indels, the number of polymorphic sites and nucleotide diversity indicate that positional constraint is more important than functional constraint for the evolution of cp genome sequences in Asterids. For example, the intron sequences in the LSC region exhibited base substitution rates 5-11-times higher than that of the IR regions, while the intron sequences in the SSC region evolved 7-14-times faster than those in the IR region. Furthermore, the Ka/Ks ratio of the gene coding sequences supports a stronger evolutionary constraint in the IR region than in the LSC or SSC regions. Therefore, our data suggest that selective sweeps by base collection mechanisms more frequently eliminate polymorphisms in the IR region than in other regions. Chloroplast genome regions that have high levels of base substitutions also show higher incidences of indels. Thirty-five simple sequence repeat (SSR) loci were identified in the Eleutherococcus chloroplast genome. Of these, 27 are homopolymers, while six are di-polymers and two are tri-polymers. In addition to the SSR loci, we also identified 18 medium size repeat units ranging from 22 to 79 bp, 11 of which are distributed in the IGS or intron regions. These medium size repeats may contribute to developing a cp genome-specific gene introduction vector because the region may use for specific recombination sites.

Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

PubMed

Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

2008-01-01

A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

Lactobacillus Strain Diversity Based on Partial hsp60 Gene Sequences and Design of PCR-Restriction Fragment Length Polymorphism Assays for Species Identification and Differentiation▿ †

PubMed Central

Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

2008-01-01

A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages. PMID:17993558

Pervasive sequence patents cover the entire human genome.

PubMed

Rosenfeld, Jeffrey A; Mason, Christopher E

2013-01-01

The scope and eligibility of patents for genetic sequences have been debated for decades, but a critical case regarding gene patents (Association of Molecular Pathologists v. Myriad Genetics) is now reaching the US Supreme Court. Recent court rulings have supported the assertion that such patents can provide intellectual property rights on sequences as small as 15 nucleotides (15mers), but an analysis of all current US patent claims and the human genome presented here shows that 15mer sequences from all human genes match at least one other gene. The average gene matches 364 other genes as 15mers; the breast-cancer-associated gene BRCA1 has 15mers matching at least 689 other genes. Longer sequences (1,000 bp) still showed extensive cross-gene matches. Furthermore, 15mer-length claims from bovine and other animal patents could also claim as much as 84% of the genes in the human genome. In addition, when we expanded our analysis to full-length patent claims on DNA from all US patents to date, we found that 41% of the genes in the human genome have been claimed. Thus, current patents for both short and long nucleotide sequences are extraordinarily non-specific and create an uncertain, problematic liability for genomic medicine, especially in regard to targeted re-sequencing and other sequence diagnostic assays.

Comparative analyses of the mitochondrial genome of the sheep ked Melophagus ovinus (Diptera: Hippoboscidae) from different geographical origins in China.

PubMed

Tang, Jia-Min; Li, Fen; Cheng, Tian-Yin; Duan, De-Yong; Liu, Guo-Hua

2018-05-22

The sheep ked Melophagus ovinus is mainly found in Europe, Northwestern Africa, and Asia. Although M. ovinus is an important ectoparasite of sheep in many countries, the population genetics, molecular biology, and systematics of this ectoparasite remain poorly understood. Herein, we determined the mitochondrial (mt) genome of M. ovinus from Gansu Province, China (MOG) and compared with that of M. ovinus Xinjiang Uygur Autonomous Region, China (MOX). The mt genome sequence (15,044 bp) of M. ovinus MOG was significantly shorter (529 bp) than M. ovinus MOX. Nucleotide sequence difference in the whole mt genome except for non-coding region was 0.37% between M. ovinus MOG and MOX. For the 13 protein-coding genes, comparison revealed sequence divergences at both the nucleotide (0-1.1%) and amino acid (0-0.59%) levels between M. ovinus MOG and MOX, respectively. Interestingly, the cox1 gene of M. ovinus MOX is predicted to employ unusual mt start codons AAA, which has not been predicted previously for any parasite genome. Phylogenetic analyses showed that M. ovinus (Hippoboscoidea) is related to the superfamilies Oestroidea + Muscoidea. Our results have also indicated the paraphylies of the four families (Anthomyiidae, Calliphoridae, Muscidae, and Oestridae) and two superfamilies (Oestroidea and Muscoidea). This mt genome of M. ovinus provides useful molecular markers for studies into the population genetics, molecular biology, and systematics of this ectoparasite.

De Novo Transcriptomic Analysis of an Oleaginous Microalga: Pathway Description and Gene Discovery for Production of Next-Generation Biofuels

PubMed Central

Wan, LingLin; Han, Juan; Sang, Min; Li, AiFen; Wu, Hong; Yin, ShunJi; Zhang, ChengWu

2012-01-01

Background Eustigmatos cf. polyphem is a yellow-green unicellular soil microalga belonging to the eustimatophyte with high biomass and considerable production of triacylglycerols (TAGs) for biofuels, which is thus referred to as an oleaginous microalga. The paucity of microalgae genome sequences, however, limits development of gene-based biofuel feedstock optimization studies. Here we describe the sequencing and de novo transcriptome assembly for a non-model microalgae species, E. cf. polyphem, and identify pathways and genes of importance related to biofuel production. Results We performed the de novo assembly of E. cf. polyphem transcriptome using Illumina paired-end sequencing technology. In a single run, we produced 29,199,432 sequencing reads corresponding to 2.33 Gb total nucleotides. These reads were assembled into 75,632 unigenes with a mean size of 503 bp and an N50 of 663 bp, ranging from 100 bp to >3,000 bp. Assembled unigenes were subjected to BLAST similarity searches and annotated with Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) orthology identifiers. These analyses identified the majority of carbohydrate, fatty acids, TAG and carotenoids biosynthesis and catabolism pathways in E. cf. polyphem. Conclusions Our data provides the construction of metabolic pathways involved in the biosynthesis and catabolism of carbohydrate, fatty acids, TAG and carotenoids in E. cf. polyphem and provides a foundation for the molecular genetics and functional genomics required to direct metabolic engineering efforts that seek to enhance the quantity and character of microalgae-based biofuel feedstock. PMID:22536352

Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki

A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less

Characterization and phylogenetic analysis of complete mitochondrial genomes for two desert cyprinodontoid fishes, Empetrichthys latos and Crenichthys baileyi.

PubMed

Jimenez, Miguel; Goodchild, Shawn C; Stockwell, Craig A; Lema, Sean C

2017-08-30

The Pahrump poolfish (Empetrichthys latos) and White River springfish (Crenichthys baileyi) are small-bodied teleost fishes (order Cyprinodontiformes) endemic to the arid Great Basin and Mojave Desert regions of western North America. These taxa survive as small, isolated populations in remote streams and springs and evolved to tolerate extreme conditions of high temperature and low dissolved oxygen. Both species have experienced severe population declines over the last 50-60years that led to some subspecies being categorized with protected status under the U.S. Endangered Species Act. Here we report the first sequencing of the complete mitochondrial DNA genomes for both E. l. latos and the moapae subspecies of C. baileyi. Complete mitogenomes of 16,546bp nucleotides were obtained from two E. l. latos individuals collected from introduced populations at Spring Mountain Ranch State Park and Shoshone Ponds Natural Area, Nevada, USA, while a single mitogenome of 16,537bp was sequenced for C. b. moapae. The mitogenomes of both species contain 13 protein-encoding genes, twenty-two tRNAs, and two rRNAs (12S and 18S) following the syntenic arrangement typical of Actinopterygiian fish mitogenomes, as well as D-loop control regions of 858bp for E. latos and 842bp for C. baileyi moapae. The two E. latos individuals exhibited only 0.0181% nucleotide sequence divergence across the entire mitogenome, implying little intraspecific mtDNA genetic variation. Comparative phylogenetic analysis of the poolfish and springfish mitochondrial genomes to available mitogenomes of other Cyprinodontoid fishes confirmed the close relationship of these oviparous Empetrichthys and Crenichthys genera to the viviparous goodeid fishes of central Mexico, and showed the combined clade of these fishes to be a sister group to the Profundulidae killifishes. Despite several significant life history and morphological differences between the Empetrichthyinae and Goodienae, estimates of evolutionary genetic distances using two partial regions of mtDNA point to inclusion of the Empetrichthys and Crenichthys genera within the family Goodeidae along with the goodeid fishes of central Mexico. Copyright © 2017 Elsevier B.V. All rights reserved.

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

PubMed Central

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a potential effect on fiber cell development, mediated by TGA-element containing sequences, via the auxin-signaling pathway. PMID:27597995

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

PubMed

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a potential effect on fiber cell development, mediated by TGA-element containing sequences, via the auxin-signaling pathway.

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

PubMed

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Whole Genome Sequences of Three Treponema pallidum ssp. pertenue Strains: Yaws and Syphilis Treponemes Differ in Less than 0.2% of the Genome Sequence

PubMed Central

Chen, Lei; Pospíšilová, Petra; Strouhal, Michal; Qin, Xiang; Mikalová, Lenka; Norris, Steven J.; Muzny, Donna M.; Gibbs, Richard A.; Fulton, Lucinda L.; Sodergren, Erica; Weinstock, George M.; Šmajs, David

2012-01-01

Background The yaws treponemes, Treponema pallidum ssp. pertenue (TPE) strains, are closely related to syphilis causing strains of Treponema pallidum ssp. pallidum (TPA). Both yaws and syphilis are distinguished on the basis of epidemiological characteristics, clinical symptoms, and several genetic signatures of the corresponding causative agents. Methodology/Principal Findings To precisely define genetic differences between TPA and TPE, high-quality whole genome sequences of three TPE strains (Samoa D, CDC-2, Gauthier) were determined using next-generation sequencing techniques. TPE genome sequences were compared to four genomes of TPA strains (Nichols, DAL-1, SS14, Chicago). The genome structure was identical in all three TPE strains with similar length ranging between 1,139,330 bp and 1,139,744 bp. No major genome rearrangements were found when compared to the four TPA genomes. The whole genome nucleotide divergence (dA) between TPA and TPE subspecies was 4.7 and 4.8 times higher than the observed nucleotide diversity (π) among TPA and TPE strains, respectively, corresponding to 99.8% identity between TPA and TPE genomes. A set of 97 (9.9%) TPE genes encoded proteins containing two or more amino acid replacements or other major sequence changes. The TPE divergent genes were mostly from the group encoding potential virulence factors and genes encoding proteins with unknown function. Conclusions/Significance Hypothetical genes, with genetic differences, consistently found between TPE and TPA strains are candidates for syphilitic treponemes virulence factors. Seventeen TPE genes were predicted under positive selection, and eleven of them coded either for predicted exported proteins or membrane proteins suggesting their possible association with the cell surface. Sequence changes between TPE and TPA strains and changes specific to individual strains represent suitable targets for subspecies- and strain-specific molecular diagnostics. PMID:22292095

Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

PubMed

Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

2015-01-01

The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

Cloning of Russian sturgeon (Acipenser gueldenstaedtii) growth hormone and insulin-like growth factor I and their expression in male and female fish during the first period of growth.

PubMed

Yom Din, S; Hurvitz, A; Goldberg, D; Jackson, K; Levavi-Sivan, B; Degani, G

2008-03-01

In this study, the GH and IGF-I of the Russian sturgeon (rs), Acipenser gueldenstaedtii, were cloned and sequenced, and their mRNA gene expression determined. In addition, to improve our understanding of the GH function, the expression of this hormone was assessed in young males and females. Moreover, IGF-I expression was quantified in young males and compared to that in older ones. The nucleotide sequence of the rsGH cDNA was 980 bp long and had an open reading frame of 642 bp, beginning with the first ATG codon at position 39 and ending with the stop codon at position 683. A putative polyadenylation signal, AATAAA, was recognized 42 bp upstream of the poly (A) tail. The position of the signal- peptide cleavage site was predicted to be at position 111, yielding a signal peptide of 24 amino-acids (aa) and a mature peptide of 190 aa. When the rsGH aa sequence was compared with other species, the highest degree of identity was found to be with mammalians (66-70% identity), followed by anguilliformes and amphibia (61%) and other fish (39-47%). The level of rsGH mRNA was discovered to be similar in pituitaries of females and males of 5 age groups (1, 2, 3, 4, and 5- yr-old). In females and males, the levels did not change dramatically during the first 5 yr of growth. The partial nucleotide sequence of the rsIGF-I was 445 bp long and had an open reading frame of 396 bp, beginning with the ATG codon at position 50. The position of the signal-peptide cleavage site was predicted to be at position 187, yielding a signal peptide of 44 aa. The highest level of IGF-I mRNA expression was recorded in the kidney of adult sturgeons. The IGF-I mRNA expression levels in the intestine, pituitary gland, and liver were not significantly different. Low levels of expression were found in the brain, heart, and muscle. In most tissues, there was no significant difference between mRNA levels of one and 5-yr-old fish. In conclusion, based on the GH-sequence analysis, A. gueldenstaedtii is genetically distant from other teleosts. The expression of the GH mRNA was similar in males and females, and its level remained constant during the first 5 yr of growth. While the IGF-I mRNA expression differed amongst various tissues, the level in each tissue was similar in 1 and 5-yr-old fish.

L1-mediated retrotransposition of murine B1 and B2 SINEs recapitulated in cultured cells.

PubMed

Dewannieux, Marie; Heidmann, Thierry

2005-06-03

SINEs are short interspersed nucleotide elements with transpositional activity, present at a high copy number (up to a million) in mammalian genomes. They are 80-400 bp long, non-coding sequences which derive either from the 7SL RNA (e.g. human Alus, murine B1s) or tRNA (e.g. murine B2s) polymerase III-driven genes. We have previously demonstrated that Alus very efficiently divert the enzymatic machinery of the autonomous L1 LINE (long interspersed nucleotide element) retrotransposons to transpose at a high rate. Here we show, using an ex vivo assay for transposition, that both B1 and B2 SINEs can be mobilized by murine LINEs, with the hallmarks of a bona fide retrotransposition process, including target site duplications of varying lengths and integrations into A-rich sequences. Despite different phylogenetic origins, transposition of the tRNA-derived B2 sequences is as efficient as that of the human Alus, whereas that of B1s is 20-100-fold lower despite a similar high copy number of these elements in the mouse genome. We provide evidence, via an appropriate nucleotide substitution within the B1 sequence in a domain essential for its intracellular targeting, that the current B1 SINEs are not optimal for transposition, a feature most probably selected for the host sake in the course of evolution.

Abundance and Characterization of Perfect Microsatellites on the Cattle Y Chromosome.

PubMed

Ma, Zhi-Jie

2017-07-03

Microsatellites or simple sequence repeats (SSRs) are found in most organisms and play an important role in genomic organization and function. To characterize the abundance of SSRs (1-6 base-pairs [bp]) on the cattle Y chromsome, the relative frequency and density of perfect or uninterrupted SSRs based on the published Y chromosome sequence were examined. A total of 17,273 perfect SSRs were found, with total length of 324.78 kb, indicating that approximately 0.75% of the cattle Y chromosome sequence (43.30 Mb) comprises perfect SSRs, with an average length of 18.80 bp. The relative frequency and density were 398.92 loci/Mb and 7500.62 bp/Mb, respectively. The proportions of the six classes of perfect SSRs were highly variable on the cattle Y chromosome. Mononucleotide repeats had a total number of 8073 (46.74%) and an average length of 15.45 bp, and were the most abundant SSRs class, while the percentages of di-, tetra-, tri-, penta-, and hexa-nucleotide repeats were 22.86%, 11.98%, 11.58%, 6.65%, and 0.19%, respectively. Different classes of SSRs varied in their repeat number, with the highest being 42 for dinucleotides. Results reveal that repeat categories A, AC, AT, AAC, AGC, GTTT, CTTT, ATTT, and AACTG predominate on the Y chromosome. This study provides insight into the organization of cattle Y chromosome repetitive DNA, as well as information useful for developing more polymorphic cattle Y-chromosome-specific SSRs.

Absence of ancient DNA in sub-fossil insect inclusions preserved in 'Anthropocene' Colombian copal.

PubMed

Penney, David; Wadsworth, Caroline; Fox, Graeme; Kennedy, Sandra L; Preziosi, Richard F; Brown, Terence A

2013-01-01

Insects preserved in copal, the sub-fossilized resin precursor of amber, have potential value in molecular ecological studies of recently-extinct species and of extant species that have never been collected as living specimens. The objective of the work reported in this paper was therefore to determine if ancient DNA is present in insects preserved in copal. We prepared DNA libraries from two stingless bees (Apidae: Meliponini: Trigonisca ameliae) preserved in 'Anthropocene' Colombian copal, dated to 'post-Bomb' and 10,612±62 cal yr BP, respectively, and obtained sequence reads using the GS Junior 454 System. Read numbers were low, but were significantly higher for DNA extracts prepared from crushed insects compared with extracts obtained by a non-destructive method. The younger specimen yielded sequence reads up to 535 nucleotides in length, but searches of these sequences against the nucleotide database revealed very few significant matches. None of these hits was to stingless bees though one read of 97 nucleotides aligned with two non-contiguous segments of the mitochondrial cytochrome oxidase subunit I gene of the East Asia bumblebee Bombus hypocrita. The most significant hit was for 452 nucleotides of a 470-nucleotide read that aligned with part of the genome of the root-nodulating bacterium Bradyrhizobium japonicum. The other significant hits were to proteobacteria and an actinomycete. Searches directed specifically at Apidae nucleotide sequences only gave short and insignificant alignments. All of the reads from the older specimen appeared to be artefacts. We were therefore unable to obtain any convincing evidence for the preservation of ancient DNA in either of the two copal inclusions that we studied, and conclude that DNA is not preserved in this type of material. Our results raise further doubts about claims of DNA extraction from fossil insects in amber, many millions of years older than copal.

Absence of Ancient DNA in Sub-Fossil Insect Inclusions Preserved in ‘Anthropocene’ Colombian Copal

PubMed Central

Penney, David; Wadsworth, Caroline; Fox, Graeme; Kennedy, Sandra L.; Preziosi, Richard F.; Brown, Terence A.

2013-01-01

Insects preserved in copal, the sub-fossilized resin precursor of amber, have potential value in molecular ecological studies of recently-extinct species and of extant species that have never been collected as living specimens. The objective of the work reported in this paper was therefore to determine if ancient DNA is present in insects preserved in copal. We prepared DNA libraries from two stingless bees (Apidae: Meliponini: Trigonisca ameliae) preserved in ‘Anthropocene’ Colombian copal, dated to ‘post-Bomb’ and 10,612±62 cal yr BP, respectively, and obtained sequence reads using the GS Junior 454 System. Read numbers were low, but were significantly higher for DNA extracts prepared from crushed insects compared with extracts obtained by a non-destructive method. The younger specimen yielded sequence reads up to 535 nucleotides in length, but searches of these sequences against the nucleotide database revealed very few significant matches. None of these hits was to stingless bees though one read of 97 nucleotides aligned with two non-contiguous segments of the mitochondrial cytochrome oxidase subunit I gene of the East Asia bumblebee Bombus hypocrita. The most significant hit was for 452 nucleotides of a 470-nucleotide read that aligned with part of the genome of the root-nodulating bacterium Bradyrhizobium japonicum. The other significant hits were to proteobacteria and an actinomycete. Searches directed specifically at Apidae nucleotide sequences only gave short and insignificant alignments. All of the reads from the older specimen appeared to be artefacts. We were therefore unable to obtain any convincing evidence for the preservation of ancient DNA in either of the two copal inclusions that we studied, and conclude that DNA is not preserved in this type of material. Our results raise further doubts about claims of DNA extraction from fossil insects in amber, many millions of years older than copal. PMID:24039876

Complete nucleotide sequences and genome characterization of a novel double-stranded RNA virus infecting Rosa multiflora.

PubMed

Salem, Nidá M; Golino, Deborah A; Falk, Bryce W; Rowhani, Adib

2008-01-01

The three double-stranded (ds) RNAs were detected in Rosa multiflora plants showing rose spring dwarf (RSD) symptoms. Northern blot analysis revealed three dsRNAs in preparations of both dsRNA and total RNA from R. multiflora plants. The complete sequences of the dsRNAs (referred to as dsRNA 1, dsRNA 2 and dsRNA 3) were determined based on a combination of shotgun cloning of dsRNA cDNAs and reverse transcription-polymerase chain reaction (RT-PCR). The largest dsRNA (dsRNA 1) was 1,762 bp long with a single open reading frame (ORF) that encoded a putative polypeptide containing 479 amino acid residues with a molecular mass of 55.9 kDa. This polypeptide contains amino acid sequence motifs conserved in the RNA-dependent RNA polymerases (RdRp) of members of the family Partitiviridae. Both dsRNA 2 (1,475 bp) and dsRNA 3 (1,384 bp) contained single ORFs, encoding putative proteins of unknown function. The 5' untranslated regions (UTR) of all three segments shared regions of high sequence homology. Phylogenetic analysis using the RdRp sequences of the various partitiviruses revealed that the new sequences would constitute the genome of a virus in family Partitiviridae. This virus would cluster with Fragaria chiloensis cryptic virus and Raphanus sativus cryptic virus 2. We suggest that the three dsRNA segments constitute the genome of a novel cryptic virus infecting roses; we propose the name Rosa multiflora cryptic virus (RMCV). Detection primers were developed and used for RT-PCR detection of RMCV in rose plants.

PCR amplification and sequence analysis of the major capsid protein gene of megalocytiviruses isolated in Taiwan.

PubMed

Wang, C S; Chao, S Y; Ku, C C; Wen, C M; Shih, H H

2009-06-01

Viruses belonging to the genus Megalocytivirus in the family Iridoviridae are one of the major agents causing mass mortalities in marine and freshwater fish in Asian countries. Outbreaks of iridovirus disease have been reported among various fish species in Taiwan. However, the genotypes of these iridoviruses have not yet been determined. In this study, seven megalocytivirus isolates from four fish species: king grouper, Epinephelus lanceolatus (Bloch), barramundi perch, Lates calcarifer (Bloch), silver sea bream, Rhabdosargus sarba (Forsskal), and common ponyfish, Leiognathus equulus (Forsskal), cultured in three different regions of Taiwan were collected. The full open reading frame encoding the viral major capsid protein gene was amplified using PCR. The PCR products of approximately 1581 bp were cloned and the nucleotide sequences were phylogenetically analysed. Results showed that all seven PCR products contained a unique open reading frame with 1362 nucleotides and encoded a structural protein with 453 amino acids. Even though the nucleotide sequences were not identical, these seven megalocytiviruses were classified into one cluster and showed very high homology with red sea bream iridovirus (RSIV) with more than 97% identity. Thus, the seven iridovirus strains isolated from cultured marine fish in Taiwan were closer to the RSIV genotype than the infectious spleen and kidney necrosis virus genotype.

Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

PubMed

He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

2013-09-04

To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects.

PubMed

Hong, Mee Yeon; Lee, Eun Mee; Jo, Yong Hun; Park, Hae Chul; Kim, Seong Ryul; Hwang, Jae Sam; Jin, Byung Rae; Kang, Pil Don; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

2008-04-30

The 15,360-bp long complete mitogenome of Caligula boisduvalii possesses a gene arrangement and content identical to other completely sequenced lepidopteran mitogenomes, but different from the common arrangement found in most insect order, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA Ile. The 330-bp A+T-rich region is apparently capable of forming a stem-and-loop structure, which harbors the conserved flanking sequences at both ends. Dissimilar to what has been seen in other sequenced lepidopteran insects, the initiation codon for C. boisduvalii COI appears to be TTG, which is a rare, but apparently possible initiation codon. The ATP8, ATP6, ND4L, and ND6 genes, which neighbor another PCG at their 3' end, all harbored potential sequences for the formation of a hairpin structure. This is suggestive of the importance of such structures for the precise cleavage of the mRNA of mature PCGs. Phylogenetic analyses of available sequenced species of Bombycoidea, Pyraloidea, and Tortricidea supported the morphology-based current hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (Antheraea pernyi and C. boisduvalii) formed a reciprocal monophyletic group.

A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences

NASA Technical Reports Server (NTRS)

Ho, P. S.; Ellison, M. J.; Quigley, G. J.; Rich, A.

1986-01-01

The ease with which a particular DNA segment adopts the left-handed Z-conformation depends largely on the sequence and on the degree of negative supercoiling to which it is subjected. We describe a computer program (Z-hunt) that is designed to search long sequences of naturally occurring DNA and retrieve those nucleotide combinations of up to 24 bp in length which show a strong propensity for Z-DNA formation. Incorporated into Z-hunt is a statistical mechanical model based on empirically determined energetic parameters for the B to Z transition accumulated to date. The Z-forming potential of a sequence is assessed by ranking its behavior as a function of negative superhelicity relative to the behavior of similar sized randomly generated nucleotide sequences assembled from over 80,000 combinations. The program makes it possible to compare directly the Z-forming potential of sequences with different base compositions and different sequence lengths. Using Z-hunt, we have analyzed the DNA sequences of the bacteriophage phi X174, plasmid pBR322, the animal virus SV40 and the replicative form of the eukaryotic adenovirus-2. The results are compared with those previously obtained by others from experiments designed to locate Z-DNA forming regions in these sequences using probes which show specificity for the left-handed DNA conformation.

New chloroplast microsatellite markers suitable for assessing genetic diversity of Lolium perenne and other related grass species

PubMed Central

Diekmann, Kerstin; Hodkinson, Trevor R.; Barth, Susanne

2012-01-01

Background and Aims Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne ‘Cashel’. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Methods Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. Key Results All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A8 mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. Conclusions The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species. PMID:22419761

New chloroplast microsatellite markers suitable for assessing genetic diversity of Lolium perenne and other related grass species.

PubMed

Diekmann, Kerstin; Hodkinson, Trevor R; Barth, Susanne

2012-11-01

Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne 'Cashel'. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A(8) mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species.

Identification of cDNAs encoding viper venom hyaluronidases: cross-generic sequence conservation of full-length and unusually short variant transcripts.

PubMed

Harrison, Robert A; Ibison, Frances; Wilbraham, Davina; Wagstaff, Simon C

2007-05-01

The immobilisation of prey by snakes is most efficiently achieved by the rapid dissemination of venom from its site of injection into the blood stream. Hyaluronidase is a common component of snake venoms and has been termed the "venom spreading factor". In the absence of nucleotide or protein sequence data to confirm the functional identity of this venom component, we interrogated a venom gland EST database for the saw-scaled viper, Echis ocellatus (Nigeria), using the gene ontology (GO) term "carbohydrate metabolism". A single hyalurononglucosaminadase-activity matching sequence (EOC00242) was found and used to design PCR primers to acquire the full-length cDNA sequence. Although very different from the bee venom and mammalian hyaluronidase sequences, the E. ocellatus sequence retained all the catalytic, positional and structural residues that characterise this class of carbohydrate metabolising hydrolases. An extraordinarily high level of sequence identity (>95%) was observed in analogous venom gland cDNA sequences isolated (by PCR) from another saw-scaled viper species, E. pyramidum leakeyi (Kenya), and from the sahara horned viper, Cerastes cerastes cerastes (Egypt) and the puff adder, Bitis arietans (Nigeria). Smaller amplicons, lacking hyaluronidase catalytic residues because of 768 bp or 855 bp central deletions, appear to encode either truncated peptides without hyaluronidase activity, or are non-translated transcripts because they lack consensus translation initiating motifs.

A novel site-specific recombination system derived from bacteriophage phiMR11.

PubMed

Rashel, Mohammad; Uchiyama, Jumpei; Ujihara, Takako; Takemura, Iyo; Hoshiba, Hiroshi; Matsuzaki, Shigenobu

2008-04-04

We report identification of a novel site-specific DNA recombination system that functions in both in vivo and in vitro, derived from lysogenic Staphylococcus aureus phage phiMR11. In silico analysis of the phiMR11 genome indicated orf1 as a putative integrase gene. Phage and bacterial attachment sites (attP and attB, respectively) and attachment junctions were determined and their nucleotide sequences decoded. Sequences of attP and attB were mostly different to each other except for a two bp common core that was the crossover point. We found several inverted repeats adjacent to the core sequence of attP as potential protein binding sites. The precise and efficient integration properties of phiMR11 integrase were shown on attP and attB in Escherichia coli and the minimum size of attP was found to be 34bp. In in vitro assays using crude or purified integrase, only buffer and substrate DNAs were required for the recombination reaction, indicating that other bacterially encoded factors are not essential for activity.

Genome Survey Sequencing for the Characterization of the Genetic Background of Rosa roxburghii Tratt and Leaf Ascorbate Metabolism Genes.

PubMed

Lu, Min; An, Huaming; Li, Liangliang

2016-01-01

Rosa roxburghii Tratt is an important commercial horticultural crop in China that is recognized for its nutritional and medicinal values. In spite of the economic significance, genomic information on this rose species is currently unavailable. In the present research, a genome survey of R. roxburghii was carried out using next-generation sequencing (NGS) technologies. Total 30.29 Gb sequence data was obtained by HiSeq 2500 sequencing and an estimated genome size of R. roxburghii was 480.97 Mb, in which the guanine plus cytosine (GC) content was calculated to be 38.63%. All of these reads were technically assembled and a total of 627,554 contigs with a N50 length of 1.484 kb and furthermore 335,902 scaffolds with a total length of 409.36 Mb were obtained. Transposable elements (TE) sequence of 90.84 Mb which comprised 29.20% of the genome, and 167,859 simple sequence repeats (SSRs) were identified from the scaffolds. Among these, the mono-(66.30%), di-(25.67%), and tri-(6.64%) nucleotide repeats contributed to nearly 99% of the SSRs, and sequence motifs AG/CT (28.81%) and GAA/TTC (14.76%) were the most abundant among the dinucleotide and trinucleotide repeat motifs, respectively. Genome analysis predicted a total of 22,721 genes which have an average length of 2311.52 bp, an average exon length of 228.15 bp, and average intron length of 401.18 bp. Eleven genes putatively involved in ascorbate metabolism were identified and its expression in R. roxburghii leaves was validated by quantitative real-time PCR (qRT-PCR). This is the first report of genome-wide characterization of this rose species.

An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.

PubMed

Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel

2004-01-21

We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.

A Genome Sequence Resource for the Aye-Aye (Daubentonia madagascariensis), a Nocturnal Lemur from Madagascar

PubMed Central

Perry, George H.; Reeves, Darryl; Melsted, Páll; Ratan, Aakrosh; Miller, Webb; Michelini, Katelyn; Louis, Edward E.; Pritchard, Jonathan K.; Mason, Christopher E.; Gilad, Yoav

2012-01-01

We present a high-coverage draft genome assembly of the aye-aye (Daubentonia madagascariensis), a highly unusual nocturnal primate from Madagascar. Our assembly totals ∼3.0 billion bp (3.0 Gb), roughly the size of the human genome, comprised of ∼2.6 million scaffolds (N50 scaffold size = 13,597 bp) based on short paired-end sequencing reads. We compared the aye-aye genome sequence data with four other published primate genomes (human, chimpanzee, orangutan, and rhesus macaque) as well as with the mouse and dog genomes as nonprimate outgroups. Unexpectedly, we observed strong evidence for a relatively slow substitution rate in the aye-aye lineage compared with these and other primates. In fact, the aye-aye branch length is estimated to be ∼10% shorter than that of the human lineage, which is known for its low substitution rate. This finding may be explained, in part, by the protracted aye-aye life-history pattern, including late weaning and age of first reproduction relative to other lemurs. Additionally, the availability of this draft lemur genome sequence allowed us to polarize nucleotide and protein sequence changes to the ancestral primate lineage—a critical period in primate evolution, for which the relevant fossil record is sparse. Finally, we identified 293,800 high-confidence single nucleotide polymorphisms in the donor individual for our aye-aye genome sequence, a captive-born individual from two wild-born parents. The resulting heterozygosity estimate of 0.051% is the lowest of any primate studied to date, which is understandable considering the aye-aye's extensive home-range size and relatively low population densities. Yet this level of genetic diversity also suggests that conservation efforts benefiting this unusual species should be prioritized, especially in the face of the accelerating degradation and fragmentation of Madagascar's forests. PMID:22155688

Mutations in the Norrie disease gene.

PubMed

Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B

1995-01-01

We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)

Molecular characterization of Indian rabies virus isolates by partial sequencing of nucleoprotein (N) and phosphoprotein (P) genes.

PubMed

Reddy, G B Manjunatha; Singh, R; Singh, R P; Singh, K P; Gupta, P K; Mahadevan, Anita; Desai, Anita; Shankar, S K; Ramakrishnan, M A; Verma, Rishendra

2011-08-01

Rabies is endemic and an important zoonosis in India. There are very few reports available on molecular epidemiology of rabies virus of Indian origin. In this study to know the dynamics of rabies virus, a total of 41 rabies positive brain samples from dogs, cats, domestic animals, wildlife, and humans from 11 states were subjected to RT-PCR amplification of N gene between nucleotide N521-N1262 (742 bp) and P gene between nucleotide P239-P750 (512 bp). The N gene could be amplified from 30, while P gene from 41 samples, using specific sets of primers. The N gene-based phylogenetic analysis indicated that all Indian virus isolates are genetically closely related with a single cluster under arctic/arctic-like viruses. However, two distinct clusters were realized in P gene-based phylogeny viz., Rabies virus isolates of Punjab and Rabies virus isolates of remaining parts of India (other than Punjab). All the Indian rabies virus isolates were closely related to geography (>95% homology), but not to host species.

Phylogenetic analysis of two goat-origin PCV2 isolates in China.

PubMed

Wang, Xiaomin; Li, Wenliang; Xu, Xianglan; Wang, Wei; He, Kongwang; Fan, Hongjie

2018-04-20

Complete genome characterization of non-porcine origin Porcine circovirus type 2 (PCV2) was first described in 2014 in China. In the present study, we first identified PCV2 nucleotides in goat samples and the prevalence of PCV2 in goat was 6.15%. However, only two new strains, Goat2014-4 and Goat2014-5, could be completely sequenced. The genome of the strain Goat2014-4, which collected from the goat infected with PPRV, contains 1766 nt; strain Goat2014-5, which originated from a healthy goat, is comprised of 1767 nt. The results showed that they shared the highest nucleotide identity with BDH and the lowest similarity with DK1980PMWSfree strain and they belonged only to genotype PCV2d. Meanwhile, they shared higher homology with porcine-origin PCV2 strains than others. Moreover, a detailed analysis of the capsid amino acid sequences revealed that there were distinct differences for goat2014-4 (708 bp) and goat2014-5 (705 bp); strain Goat2014-4 showed an elongation of two amino acids, and strains Goat2014-5 showed an elongation of one amino acid compared with other reference strains. This is the first report of the genetic analysis of goat-origin PCV2 isolates. It also provides an additional supported evidence for cross-species transmission of PCV2. Copyright © 2018 Elsevier B.V. All rights reserved.

Genomic and molecular analysis of phage CMP1 from Clavibacter michiganensis subspecies michiganensis

PubMed Central

Wittmann, Johannes; Gartemann, Karl-Heinz; Eichenlaub, Rudolf

2011-01-01

Bacteriophage CMP1 is a member of the Siphoviridae family that infects specifically the plant-pathogen Clavibacter michiganensis subsp. michiganensis. The linear double- stranded DNA is terminally redundant and not circularly permuted. The complete nucleotide sequence of the bacteriophage CMP1 genome consists of 58,652 bp including the terminal redundant ends of 791 bp. The G+C content of the phage (57%) is significantly lower than that of its host (72.66%). 74 potential open reading frames were identified and annotated by different bioinformatic tools. Two large clusters which encode the early and the late functions could be identified which are divergently transcribed. There are only a few hypothetical gene products with conserved domains and significant similarity to sequences from the databases. Functional analyses confirmed the activity of four gene products, an endonuclease, an exonuclease, a single-stranded DNA binding protein and a thymidylate synthase. Partial genomic sequences of CN77, a phage of Clavibacter michiganensis subsp. nebraskensis, revealed a similar genome structure and significant similarities on the level of deduced amino acid sequences. An endolysin with peptidase activity has been identified for both phages, which may be good tools for disease control of tomato plants against Clavibacter infections. PMID:21687530

Genomic and molecular analysis of phage CMP1 from Clavibacter michiganensis subspecies michiganensis.

PubMed

Wittmann, Johannes; Gartemann, Karl-Heinz; Eichenlaub, Rudolf; Dreiseikelmann, Brigitte

2011-01-01

Bacteriophage CMP1 is a member of the Siphoviridae family that infects specifically the plant-pathogen Clavibacter michiganensis subsp. michiganensis. The linear double- stranded DNA is terminally redundant and not circularly permuted. The complete nucleotide sequence of the bacteriophage CMP1 genome consists of 58,652 bp including the terminal redundant ends of 791 bp. The G+C content of the phage (57%) is significantly lower than that of its host (72.66%). 74 potential open reading frames were identified and annotated by different bioinformatic tools. Two large clusters which encode the early and the late functions could be identified which are divergently transcribed. There are only a few hypothetical gene products with conserved domains and significant similarity to sequences from the databases. Functional analyses confirmed the activity of four gene products, an endonuclease, an exonuclease, a single-stranded DNA binding protein and a thymidylate synthase. Partial genomic sequences of CN77, a phage of Clavibacter michiganensis subsp. nebraskensis, revealed a similar genome structure and significant similarities on the level of deduced amino acid sequences. An endolysin with peptidase activity has been identified for both phages, which may be good tools for disease control of tomato plants against Clavibacter infections.

Molecular cloning, overexpression, purification, and sequence analysis of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide.

PubMed

Fu, L; Hou, Y L; Ding, X; Du, Y J; Zhu, H Q; Zhang, N; Hou, W R

2016-08-30

The complementary DNA (cDNA) of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide (FTL) gene was successfully cloned using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing FTL cDNA and overexpressed it in Escherichia coli using pET28a plasmids. The expressed protein was then purified by nickel chelate affinity chromatography. The cloned cDNA fragment was 580 bp long and contained an open reading frame of 525 bp. The deduced protein sequence was composed of 175 amino acids and had an estimated molecular weight of 19.90 kDa, with an isoelectric point of 5.53. Topology prediction revealed one N-glycosylation site, two casein kinase II phosphorylation sites, one N-myristoylation site, two protein kinase C phosphorylation sites, and one cell attachment sequence. Alignment indicated that the nucleotide and deduced amino acid sequences are highly conserved across several mammals, including Homo sapiens, Cavia porcellus, Equus caballus, and Felis catus, among others. The FTL gene was readily expressed in E. coli, which gave rise to the accumulation of a polypeptide of the expected size (25.50 kDa, including an N-terminal polyhistidine tag).

First molecular cloning and characterisation of caspase-9 gene in fish and its involvement in a gram negative septicaemia.

PubMed

Reis, Marta I R; do Vale, Ana; Pinto, Cristina; Nascimento, Diana S; Costa-Ramos, Carolina; Silva, Daniela S P; Silva, Manuel T; Dos Santos, Nuno M S

2007-03-01

Caspase-9 is an initiator caspase in the apoptotic process whose function is to activate effector caspases that are downstream in the mitochondrial pathway of apoptosis. This work reports for the first time the complete sequencing and characterisation of caspase-9 in fish. A 1924bp cDNA of sea bass caspase-9 was obtained, consisting of 1308bp open reading frame coding for 435 amino acids, 199bp of the 5'-UTR and 417bp of the 3'-UTR including a canonical polyadenilation signal 10 nucleotides upstream the polyadenilation tail. The sequence retains the pentapeptide active-site motif (QACGG) and the putative cleavage sites at Asp(121), Asp(325) and Asp(343). The sequence of sea bass caspase-9 exhibits a very close homology to the sequences of caspase-9 from other vertebrates, particularly with the putative caspases-9 of Danio rerio and Tetraodon nigroviridis (77.5 and 75.4% similarity, respectively), justifying the fact that the phylogenetic analysis groups these species together with sea bass. The sea bass caspase-9 gene exists as a single copy gene and is organised in 9 introns and 10 exons. The sea bass caspase-9 showed a basal expression in all the organs analysed, although weaker in spleen. The expression of sea bass caspase-9 in the head kidney of sea bass infected with the Photobacterium damselae ssp. piscicida (Phdp) strain PP3, showed increased expression from 0 to 12h returning to control levels at 24h. Caspase-9 activity was detected in Phdp infected sea bass head kidney from 18 to 48h post-infection, when the fish were with advanced septicaemia.

Comparative analysis and molecular characterization of a gene BANF1 encoded a DNA-binding protein during mitosis from the Giant Panda and Black Bear.

PubMed

Zeng, Yichun; Hou, Yi-Ling; Ding, Xiang; Hou, Wan-Ru; Li, Jian

2014-01-01

Barrier to autointegration factor 1 (BANF1) is a DNA-binding protein found in the nucleus and cytoplasm of eukaryotic cells that functions to establish nuclear architecture during mitosis. The cDNA and the genomic sequence of BANF1 were cloned from the Giant Panda (Ailuropoda melanoleuca) and Black Bear (Ursus thibetanus mupinensis) using RT-PCR technology and Touchdown-PCR, respectively. The cDNA of the BANF1 cloned from Giant Panda and Black Bear is 297 bp in size, containing an open reading frame of 270 bp encoding 89 amino acids. The length of the genomic sequence from Giant Panda is 521 bp, from Black Bear is 536 bp, which were found both to possess 2 exons. Alignment analysis indicated that the nucleotide sequence and the deduced amino acid sequence are highly conserved to some mammalian species studied. Topology prediction showed there is one Protein kinase C phosphorylation site, one Casein kinase II phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Giant Panda, and there is one Protein kinase C phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Black Bear. The BANF1 gene can be readily expressed in E. coli. Results showed that the protein BANF1 fusion with the N-terminally His-tagged form gave rise to the accumulation of an expected 14 kD polypeptide that formed inclusion bodies. The expression products obtained could be used to purify the proteins and study their function further.

Linear Chromosome-generating System of Agrobacterium tumefaciens C58: Protelomerase Generates and Protects Hairpin Ends

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Wai Mun; DaGloria, Jeanne; Fox, Heather

2012-09-05

Agrobacterium tumefaciens C58, the pathogenic bacteria that causes crown gall disease in plants, harbors one circular and one linear chromosome and two circular plasmids. The telomeres of its unusual linear chromosome are covalently closed hairpins. The circular and linear chromosomes co-segregate and are stably maintained in the organism. We have determined the sequence of the two ends of the linear chromosome thus completing the previously published genome sequence of A. tumefaciens C58. We found that the telomeres carry nearly identical 25-bp sequences at the hairpin ends that are related by dyad symmetry. We further showed that its Atu2523 gene encodesmore » a protelomerase (resolvase) and that the purified enzyme can generate the linear chromosomal closed hairpin ends in a sequence-specific manner. Agrobacterium protelomerase, whose presence is apparently limited to biovar 1 strains, acts via a cleavage-and-religation mechanism by making a pair of transient staggered nicks invariably at 6-bp spacing as the reaction intermediate. The enzyme can be significantly shortened at both the N and C termini and still maintain its enzymatic activity. Although the full-length enzyme can uniquely bind to its product telomeres, the N-terminal truncations cannot. The target site can also be shortened from the native 50-bp inverted repeat to 26 bp; thus, the Agrobacterium hairpin-generating system represents the most compact activity of all hairpin linear chromosome- and plasmid-generating systems to date. The biochemical analyses of the protelomerase reactions further revealed that the tip of the hairpin telomere may be unusually polymorphically capable of accommodating any nucleotide.« less

Extracellular proteins of Vibrio cholerae: molecular cloning, nucleotide sequence and characterization of the deoxyribonuclease (DNase) together with its periplasmic localization in Escherichia coli K-12.

PubMed

Focareta, T; Manning, P A

1987-01-01

The gene encoding the extracellular DNase of Vibrio cholerae was cloned into Escherichia coli K-12. A maximal coding region of 1.2 kb and a minimal region of 0.6 kb were determined by transposon mutagenesis and deletion analysis. The nucleotide sequence of this region contained a single open reading frame of 690 bp corresponding to a protein of Mr 26,389 with a typical N-terminal signal sequence of 18 aa which, when removed, would give a mature protein of Mr 24,163. This is in good agreement with the size of 24 kDa, calculated directly by Coomassie blue staining following sodium dodecyl sulphate-polyacrylamide gel electrophoresis and indirectly via a DNA-hydrolysis assay. The protein is located in the periplasmic space of E. coli K-12 unlike in V. cholerae where it is excreted into the extracellular medium. The introduction of the DNase gene into a periplasmic (tolA) leaky mutant of E. coli K-12 facilitates the release of the protein, further confirming the periplasmic location.

Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8)

PubMed Central

Russo, James J.; Bohenzky, Roy A.; Chien, Ming-Cheng; Chen, Jing; Yan, Ming; Maddalena, Dawn; Parry, J. Preston; Peruzzi, Daniela; Edelman, Isidore S.; Chang, Yuan; Moore, Patrick S.

1996-01-01

The genome of the Kaposi sarcoma-associated herpesvirus (KSHV or HHV8) was mapped with cosmid and phage genomic libraries from the BC-1 cell line. Its nucleotide sequence was determined except for a 3-kb region at the right end of the genome that was refractory to cloning. The BC-1 KSHV genome consists of a 140.5-kb-long unique coding region flanked by multiple G+C-rich 801-bp terminal repeat sequences. A genomic duplication that apparently arose in the parental tumor is present in this cell culture-derived strain. At least 81 ORFs, including 66 with homology to herpesvirus saimiri ORFs, and 5 internal repeat regions are present in the long unique region. The virus encodes homologs to complement-binding proteins, three cytokines (two macrophage inflammatory proteins and interleukin 6), dihydrofolate reductase, bcl-2, interferon regulatory factors, interleukin 8 receptor, neural cell adhesion molecule-like adhesin, and a D-type cyclin, as well as viral structural and metabolic proteins. Terminal repeat analysis of virus DNA from a KS lesion suggests a monoclonal expansion of KSHV in the KS tumor. PMID:8962146

A base substitution in the donor site of intron 12 of KIT gene is responsible for the dominant white coat colour of blue fox (Alopex lagopus).

PubMed

Yan, S Q; Hou, J N; Bai, C Y; Jiang, Y; Zhang, X J; Ren, H L; Sun, B X; Zhao, Z H; Sun, J H

2014-04-01

The dominant white coat colour of farmed blue fox is inherited as a monogenic autosomal dominant trait and is suggested to be embryonic lethal in the homozygous state. In this study, the transcripts of KIT were identified by RT-PCR for a dominant white fox and a normal blue fox. Sequence analysis showed that the KIT transcript in normal blue fox contained the full-length coding sequence of 2919 bp (GenBank Acc. No KF530833), but in the dominant white individual, a truncated isoform lacking the entire exon 12 specifically co-expressed with the normal transcript. Genomic DNA sequencing revealed that a single nucleotide polymorphism (c.1867+1G>T) in intron 12 appeared only in the dominant white individuals and a 1-bp ins/del polymorphism in the same intron showed in individuals representing two different coat colours. Genotyping results of the SNP with PCR-RFLP in 185 individuals showed all 90 normal blue foxes were homozygous for the G allele, and all dominant white individuals were heterozygous. Due to the truncated protein with a deletion of 35 amino acids and an amino acid replacement (p.Pro623Ala) located in the conserved ATP binding domain, we propose that the mutant receptor had absent tyrosine kinase activity. These findings reveal that the base substitution at the first nucleotide of intron 12 of KIT gene, resulting in skipping of exon 12, is a causative mutation responsible for the dominant white phenotype of blue fox. © 2013 Stichting International Foundation for Animal Genetics.

Short-read, high-throughput sequencing technology for STR genotyping

PubMed Central

Bornman, Daniel M.; Hester, Mark E.; Schuetter, Jared M.; Kasoji, Manjula D.; Minard-Smith, Angela; Barden, Curt A.; Nelson, Scott C.; Godbold, Gene D.; Baker, Christine H.; Yang, Boyu; Walther, Jacquelyn E.; Tornes, Ivan E.; Yan, Pearlly S.; Rodriguez, Benjamin; Bundschuh, Ralf; Dickens, Michael L.; Young, Brian A.; Faith, Seth A.

2013-01-01

DNA-based methods for human identification principally rely upon genotyping of short tandem repeat (STR) loci. Electrophoretic-based techniques for variable-length classification of STRs are universally utilized, but are limited in that they have relatively low throughput and do not yield nucleotide sequence information. High-throughput sequencing technology may provide a more powerful instrument for human identification, but is not currently validated for forensic casework. Here, we present a systematic method to perform high-throughput genotyping analysis of the Combined DNA Index System (CODIS) STR loci using short-read (150 bp) massively parallel sequencing technology. Open source reference alignment tools were optimized to evaluate PCR-amplified STR loci using a custom designed STR genome reference. Evaluation of this approach demonstrated that the 13 CODIS STR loci and amelogenin (AMEL) locus could be accurately called from individual and mixture samples. Sensitivity analysis showed that as few as 18,500 reads, aligned to an in silico referenced genome, were required to genotype an individual (>99% confidence) for the CODIS loci. The power of this technology was further demonstrated by identification of variant alleles containing single nucleotide polymorphisms (SNPs) and the development of quantitative measurements (reads) for resolving mixed samples. PMID:25621315

Novel Detection of Insecticide Resistance Related P450 Genes and Transcriptome Analysis of the Hemimetabolous Pest Erthesina fullo (Thunberg) (Hemiptera: Heteroptera).

PubMed

Liu, Yang; Wu, Haoyang; Xie, Qiang; Bu, Wenjun

2015-01-01

Erthesina fullo (Thunberg, 1783) is an economically important heteropteran species in China. Since only three nucleotide sequences of this species (COI, 16S rRNA, and 18S rRNA) appear in the GenBank database so far, no analysis of the molecular mechanisms underlying E. fullo's resistance to insecticide and environmental stress has been accomplished. We reported a de novo assembled and annotated transcriptome for adult E. fullo using the Illumina sequence system. A total of 53,359,458 clean reads of 4.8 billion nucleotides (nt) were assembled into 27,488 unigenes with an average length of 750 bp, of which 17,743 (64.55%) were annotated. In the present study, we identified 88 putative cytochrome P450 sequences and analyzed the evolution of cytochrome P450 superfamilies, genes of the CYP3 clan related to metabolizing xenobiotics and plant natural compounds, in E. fullo, increasing the candidate genes for the molecular mechanisms of insecticide resistance in P450. The sequenced transcriptome greatly expands the available genomic information and could allow a better understanding of the mechanisms of insecticide resistance at the systems biology level.

Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis.

PubMed

Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T

2000-05-01

A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.

Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

PubMed

Wolf, P

1997-10-01

Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

The full mitochondrial genome sequence of Raillietina tetragona from chicken (Cestoda: Davaineidae).

PubMed

Liang, Jian-Ying; Lin, Rui-Qing

2016-11-01

In the present study, the complete mitochondrial DNA (mtDNA) sequence of Raillietina tetragona was sequenced and its gene contents and genome organizations was compared with that of other tapeworm. The complete mt genome sequence of R. tetragona is 14,444 bp in length. It contains 12 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and two non-coding region. All genes are transcribed in the same direction and have a nucleotide composition high in A and T. The contents of A + T of the complete mt genome are 71.4% for R. tetragona. The R. tetragona mt genome sequence provides novel mtDNA marker for studying the molecular epidemiology and population genetics of Raillietina and has implications for the molecular diagnosis of chicken cestodosis caused by Raillietina.

Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences

PubMed Central

Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.

2003-01-01

A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936

Comparison of Ion Personal Genome Machine Platforms for the Detection of Variants in BRCA1 and BRCA2.

PubMed

Hwang, Sang Mee; Lee, Ki Chan; Lee, Min Seob; Park, Kyoung Un

2018-01-01

Transition to next generation sequencing (NGS) for BRCA1 / BRCA2 analysis in clinical laboratories is ongoing but different platforms and/or data analysis pipelines give different results resulting in difficulties in implementation. We have evaluated the Ion Personal Genome Machine (PGM) Platforms (Ion PGM, Ion PGM Dx, Thermo Fisher Scientific) for the analysis of BRCA1 /2. The results of Ion PGM with OTG-snpcaller, a pipeline based on Torrent mapping alignment program and Genome Analysis Toolkit, from 75 clinical samples and 14 reference DNA samples were compared with Sanger sequencing for BRCA1 / BRCA2 . Ten clinical samples and 14 reference DNA samples were additionally sequenced by Ion PGM Dx with Torrent Suite. Fifty types of variants including 18 pathogenic or variants of unknown significance were identified from 75 clinical samples and known variants of the reference samples were confirmed by Sanger sequencing and/or NGS. One false-negative results were present for Ion PGM/OTG-snpcaller for an indel variant misidentified as a single nucleotide variant. However, eight discordant results were present for Ion PGM Dx/Torrent Suite with both false-positive and -negative results. A 40-bp deletion, a 4-bp deletion and a 1-bp deletion variant was not called and a false-positive deletion was identified. Four other variants were misidentified as another variant. Ion PGM/OTG-snpcaller showed acceptable performance with good concordance with Sanger sequencing. However, Ion PGM Dx/Torrent Suite showed many discrepant results not suitable for use in a clinical laboratory, requiring further optimization of the data analysis for calling variants.

Isolation, cloning, and characterization of a partial novel aro A gene in common reed (Phragmites australis).

PubMed

Taravat, Elham; Zebarjadi, Alireza; Kahrizi, Danial; Yari, Kheirollah

2015-05-01

Among the essential amino acids, phenylalanine, tryptophan, and tyrosine are aromatic amino acids which are synthesized by the shikimate pathway in plants and bacteria. Herbicide glyphosate can inhibit the biosynthesis of these amino acids. So, identification of the gene tolerant to glyphosate is very important. It has been shown that the common reed or Phragmites australis Cav. (Poaceae) is relatively tolerant to glyphosate. The aim of the current research is identification, cloning, sequencing, and registering of partial aro A gene of the common reed P. australis. The partial aro A gene of common reed (P. australis) was cloned in Escherichia coli and the amino acid sequence was identified/determined for the first time. This is the first report for isolation, cloning, and sequencing of a part of aro A gene from the common reed. A 670 bp fragment including two introns (86 bp and 289 bp) was obtained. The open reading frame (ORF) region in part of gene was encoded for 98 amino acids. Alignment showed high similarity among this region with Zea mays (L.) (Poaceae) (94.6%), Eleusine indica L. Gaertn (Poaceae) (94.2%), and Zoysia japonica Steud. (Poaceae) (94.2%). The alignment of amino acid sequence of the investigated part of the gene showed a homology with aro A from several other plants. This conserved region forms the enzyme active site. The alignment results of nucleotide and amino acid residues with related sequences showed that there are some differences among them. The relative glyphosate tolerance in the common reed may be related to these differences.

Comparative genome analysis identifies two large deletions in the genome of highly-passaged attenuated Streptococcus agalactiae strain YM001 compared to the parental pathogenic strain HN016.

PubMed

Wang, Rui; Li, Liping; Huang, Yan; Luo, Fuguang; Liang, Wanwen; Gan, Xi; Huang, Ting; Lei, Aiying; Chen, Ming; Chen, Lianfu

2015-11-04

Streptococcus agalactiae (S. agalactiae), also known as group B Streptococcus (GBS), is an important pathogen for neonatal pneumonia, meningitis, bovine mastitis, and fish meningoencephalitis. The global outbreaks of Streptococcus disease in tilapia cause huge economic losses and threaten human food hygiene safety as well. To investigate the mechanism of S. agalactiae pathogenesis in tilapia and develop attenuated S. agalactiae vaccine, this study sequenced and comparatively analyzed the whole genomes of virulent wild-type S. agalactiae strain HN016 and its highly-passaged attenuated strain YM001 derived from tilapia. We performed Illumina sequencing of DNA prepared from strain HN016 and YM001. Sequencedreads were assembled and nucleotide comparisons, single nucleotide polymorphism (SNP) , indels were analyzed between the draft genomes of HN016 and YM001. Clustered regularly interspaced short palindromic repeats (CRISPRs) and prophage were detected and analyzed in different S. agalactiae strains. The genome of S. agalactiae YM001 was 2,047,957 bp with a GC content of 35.61 %; it contained 2044 genes and 88 RNAs. Meanwhile, the genome of S. agalactiae HN016 was 2,064,722 bp with a GC content of 35.66 %; it had 2063 genes and 101 RNAs. Comparative genome analysis indicated that compared with HN016, YM001 genome had two significant large deletions, at the sizes of 5832 and 11,116 bp respectively, resulting in the deletion of three rRNA and ten tRNA genes, as well as the deletion and functional damage of ten genes related to metabolism, transport, growth, anti-stress, etc. Besides these two large deletions, other ten deletions and 28 single nucleotide variations (SNVs) were also identified, mainly affecting the metabolism- and growth-related genes. The genome of attenuated S. agalactiae YM001 showed significant variations, resulting in the deletion of 10 functional genes, compared to the parental pathogenic strain HN016. The deleted and mutated functional genes all encode metabolism- and growth-related proteins, not the known virulence proteins, indicating that the metabolism- and growth-related genes are important for the pathogenesis of S. agalactiae.

Genotyping of Chromobacterium violaceum isolates by recA PCR-RFLP analysis.

PubMed

Scholz, Holger Christian; Witte, Angela; Tomaso, Herbert; Al Dahouk, Sascha; Neubauer, Heinrich

2005-03-15

Intraspecies variation of Chromobacterium violaceum was examined by comparative sequence - and by restriction fragment length polymorphism analysis of the recombinase A gene (recA-PCR-RFLP). Primers deduced from the known recA gene sequence of the type strain C. violaceum ATCC 12472(T) allowed the specific amplification of a 1040bp recA fragment from each of the 13 C. violaceum strains investigated, whereas other closely related organisms tested negative. HindII-PstI-recA RFLP analysis generated from 13 representative C. violaceum strains enabled us to identify at least three different genospecies. In conclusion, analysis of the recA gene provides a rapid and robust nucleotide sequence-based approach to specifically identify and classify C. violaceum on genospecies level.

Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis.

PubMed

Sanjari, Sepideh; Shobbar, Zahra Sadat; Ebrahimi, Mohsen; Hasanloo, Tahereh; Sadat-Noori, Seyed-Ahmad; Tirnaz, Soodeh

2015-12-01

Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of CHS encoding genes in milk thistle plant can be of great importance. In the current research, fragments of CHS genes were amplified using degenerate primers based on the conserved parts of Asteraceae CHS genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of CHS gene family,SmCHS1 and SmCHS2. Third member, full-length cDNA (SmCHS3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants.Real-time PCR analysis indicated that SmCHS1 and SmCHS3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis.

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

The glucose transporter 1 -GLUT1- from the white shrimp Litopenaeus vannamei is up-regulated during hypoxia.

PubMed

Martínez-Quintana, José A; Peregrino-Uriarte, Alma B; Gollas-Galván, Teresa; Gómez-Jiménez, Silvia; Yepiz-Plascencia, Gloria

2014-12-01

During hypoxia the shrimp Litopenaeus vannamei accelerates anaerobic glycolysis to obtain energy; therefore, a correct supply of glucose to the cells is needed. Facilitated glucose transport across the cells is mediated by a group of membrane embedded integral proteins called GLUT; being GLUT1 the most ubiquitous form. In this work, we report the first cDNA nucleotide and deduced amino acid sequences of a glucose transporter 1 from L. vannamei. A 1619 bp sequence was obtained by RT-PCR and RACE approaches. The 5´ UTR is 161 bp and the poly A tail is exactly after the stop codon in the mRNA. The ORF is 1485 bp and codes for 485 amino acids. The deduced protein sequence has high identity to GLUT1 proteins from several species and contains all the main features of glucose transporter proteins, including twelve transmembrane domains, the conserved motives and amino acids involved in transport activity, ligands binding and membrane anchor. Therefore, we decided to name this sequence, glucose transporter 1 of L. vannamei (LvGLUT1). A partial gene sequence of 8.87 Kbp was also obtained; it contains the complete coding sequence divided in 10 exons. LvGlut1 expression was detected in hemocytes, hepatopancreas, intestine gills, muscle and pleopods. The higher relative expression was found in gills and the lower in hemocytes. This indicates that LvGlut1 is ubiquitously expressed but its levels are tissue-specific and upon short-term hypoxia, the GLUT1 transcripts increase 3.7-fold in hepatopancreas and gills. To our knowledge, this is the first evidence of expression of GLUT1 in crustaceans.

Comparative genomic analysis of the false killer whale (Pseudorca crassidens) LMBR1 locus.

PubMed

Kim, Dae-Won; Choi, Sang-Haeng; Kim, Ryong Nam; Kim, Sun-Hong; Paik, Sang-Gi; Nam, Seong-Hyeuk; Kim, Dong-Wook; Kim, Aeri; Kang, Aram; Park, Hong-Seog

2010-09-01

The sequencing and comparative genomic analysis of LMBR1 loci in mammals or other species, including human, would be very important in understanding evolutionary genetic changes underlying the evolution of limb development. In this regard, comparative genomic annotation of the false killer whale LMBR1 locus could shed new light on the evolution of limb development. We sequenced two false killer whale BAC clones, corresponding to 156 kb and 144 kb, respectively, harboring the tightly linked RNF32, LMBR1, and NOM1 genes. Our annotation of the false killer whale LMBR1 gene showed that it consists of 17 exons (1473 bp), in contrast to 18 exons (1596 bp) in human, and it displays 93.1% and 95.6% nucleotide and amino acid sequence similarity, respectively, compared with the human gene. In particular, we discovered that exon 10, deleted in the false killer whale LMBR1 gene, is present only in primates, and this fact strongly implies that exon 10 might be crucial in determining primate-specific limb development. ZRS and TFBS sequences have been well conserved across 11 species, suggesting that these regions could be involved in an important function of limb development and limb patterning. The neighboring gene RNF32 showed several lineage-conserved exons, such as exons 2 through 9 conserved in eutherian mammals, exons 3 through 9 conserved in mammals, and exons 5 through 9 conserved in vertebrates. The other neighboring gene, NOM1, had undergone a substitution (ATG→GTA) at the start codon, giving rise to a 36 bp shorter N-terminal sequence compared with the human sequence. Our comparative analysis of the false killer whale LMBR1 genomic locus provides important clues regarding the genetic regions that may play crucial roles in limb development and patterning.

Molecular Population Genetics of the Alcohol Dehydrogenase Gene Region of DROSOPHILA MELANOGASTER

PubMed Central

Aquadro, Charles F.; Desse, Susan F.; Bland, Molly M.; Langley, Charles H.; Laurie-Ahlberg, Cathy C.

1986-01-01

Variation in the DNA restriction map of a 13-kb region of chromosome II including the alcohol dehydrogenase structural gene (Adh) was examined in Drosophila melanogaster from natural populations. Detailed analysis of 48 D. melanogaster lines representing four eastern United States populations revealed extensive DNA sequence variation due to base substitutions, insertions and deletions. Cloning of this region from several lines allowed characterization of length variation as due to unique sequence insertions or deletions [nine sizes; 21–200 base pairs (bp)] or transposable element insertions (several sizes, 340 bp to 10.2 kb, representing four different elements). Despite this extensive variation in sequences flanking the Adh gene, only one length polymorphism is clearly associated with altered Adh expression (a copia element approximately 250 bp 5' to the distal transcript start site). Nonetheless, the frequency spectra of transposable elements within and between Drosophila species suggests they are slightly deleterious. Strong nonrandom associations are observed among Adh region sequence variants, ADH allozyme (Fast vs. Slow), ADH enzyme activity and the chromosome inversion ln(2L) t. Phylogenetic analysis of restriction map haplotypes suggest that the major twofold component of ADH activity variation (high vs. low, typical of Fast and Slow allozymes, respectively) is due to sequence variation tightly linked to and possibly distinct from that underlying the allozyme difference. The patterns of nucleotide and haplotype variation for Fast and Slow allozyme lines are consistent with the recent increase in frequency and spread of the Fast haplotype associated with high ADH activity. These data emphasize the important role of evolutionary history and strong nonrandom associations among tightly linked sequence variation as determinants of the patterns of variation observed in natural populations. PMID:3026893

A novel deletion/insertion mutation in the mRNA transcribed from one {alpha}1(I) collagen allele in a family with dominant type III OI and germline mosaicism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, O.; Masters, C.; Lewis, M.B.

1994-09-01

In an 8-year-old girl and her father, both of whom have severe type III OI, we have previously used RNA/RNA hybrid analysis to demonstrate a mismatch in the region of {alpha}1(I) mRNA coding for aa 558-861. We used SSCP to further localize the abnormality to a subregion coding for aa 579-679. This region was subcloned and sequenced. Each patient`s cDNA has a deletion of the sequences coding for the last residue of exon 34, and all of exons 35 and 36 (aa 604-639), followed by an insertion of 156 nt from the 3{prime}-end of intron 36. PCR amplification of leukocytemore » DNA from the patients and the clinically normal paternal grandmother yielded two fragments: a 1007 bp fragment predicted from normal genomic sequences and a 445 bp fragment. Subcloning and sequencing of the shorter genomic PCR product confirmed the presence of a 565 bp genomic deletion from the end of exon 34 to the middle of intron 36. The abnormal protein is apparently synthesized and incorporated into helix. The inserted nucleotides are in frame with the collagenous sequence and contain no stop codons. They encode a 52 aa non-collagenous region. The fibroblast procollagen of the patients has both normal and electrophoretically delayed pro{alpha}(I) bands. The electrophoretically delayed procollagen is very sensitive to pepsin or trypsin digestion, as predicted by its non-collagenous sequence, and cannot be visualized as collagen. This unique OI collagen mutation is an excellent candidate for molecular targeting to {open_quotes}turn off{close_quotes} a dominant mutant allele.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kerr, J.M.; Fisher, L.W.; Termine, J.D.

The authors have isolated and partially sequenced the human bone sialoprotein gene (IBSP). IBSP has been sublocalized by in situ hybridization to chromosome 4q38-q31 and is composed of six small exons (51 to 159 bp) and 1 large exon ([approximately]2.6 kb). The intron/exon junctions defined by sequence analysis are of class O, retaining an intact coding triplet. Sequence analysis of the 5[prime] upstream region revealed a TATAA (nucleotides -30 to-25 from the transcriptional start point) and a CCAAT (nucleotides -56 to-52) box, both in the reverse orientation. Intron 1 contains interesting structural elements composed of polypyrimidine repeats followed by amore » poly(AC)[sub n] tract. Both types of structural elements have been detected in promoter regions of other genes and have been implicated in transcriptional regulation. Several differences between the previously published cDNA sequence and the authors' sequence have been identified, most of which are contained within the untranslated exon 1. Three base revisions in the coding region include a G to T (Gly to Val, amino acid 195), T to C (Val to Ala, amino acid 268), and T to A (Glu to Asp, amino acid 270). In conclusion, the genomic organization and potential regulatory elements of human IBSP have been elucidated. 42 refs., 4 figs., 1 tab.« less

Sequence requirement of the ade6-4095 meiotic recombination hotspot in Schizosaccharomyces pombe.

PubMed

Foulis, Steven J; Fowler, Kyle R; Steiner, Walter W

2018-02-01

Homologous recombination occurs at a greatly elevated frequency in meiosis compared to mitosis and is initiated by programmed double-strand DNA breaks (DSBs). DSBs do not occur at uniform frequency throughout the genome in most organisms, but occur preferentially at a limited number of sites referred to as hotspots. The location of hotspots have been determined at nucleotide-level resolution in both the budding and fission yeasts, and while several patterns have emerged regarding preferred locations for DSB hotspots, it remains unclear why particular sites experience DSBs at much higher frequency than other sites with seemingly similar properties. Short sequence motifs, which are often sites for binding of transcription factors, are known to be responsible for a number of hotspots. In this study we identified the minimum sequence required for activity of one of such motif identified in a screen of random sequences capable of producing recombination hotspots. The experimentally determined sequence, GGTCTRGACC, closely matches the previously inferred sequence. Full hotspot activity requires an effective sequence length of 9.5 bp, whereas moderate activity requires an effective sequence length of approximately 8.2 bp and shows significant association with DSB hotspots. In combination with our previous work, this result is consistent with a large number of different sequence motifs capable of producing recombination hotspots, and supports a model in which hotspots can be rapidly regenerated by mutation as they are lost through recombination.

Introduction of a novel 18S rDNA gene arrangement along with distinct ITS region in the saline water microalga Dunaliella

PubMed Central

2010-01-01

Comparison of 18S rDNA gene sequences is a very promising method for identification and classification of living organisms. Molecular identification and discrimination of different Dunaliella species were carried out based on the size of 18S rDNA gene and, number and position of introns in the gene. Three types of 18S rDNA structure have already been reported: the gene with a size of ~1770 bp lacking any intron, with a size of ~2170 bp consisting one intron near 5' terminus, and with a size of ~2570 bp harbouring two introns near 5' and 3' termini. Hereby, we report a new 18S rDNA gene arrangement in terms of intron localization and nucleotide sequence in a Dunaliella isolated from Iranian salt lakes (ABRIINW-M1/2). PCR amplification with genus-specific primers resulted in production of a ~2170 bp DNA band, which is similar to that of D. salina 18S rDNA gene containing only one intron near 5' terminus. Whilst, sequence composition of the gene revealed the lack of any intron near 5' terminus in our isolate. Furthermore, another alteration was observed due to the presence of a 440 bp DNA fragment near 3' terminus. Accordingly, 18S rDNA gene of the isolate is clearly different from those of D. salina and any other Dunaliella species reported so far. Moreover, analysis of ITS region sequence showed the diversity of this region compared to the previously reported species. 18S rDNA and ITS sequences of our isolate were submitted with accesion numbers of EU678868 and EU927373 in NCBI database, respectively. The optimum growth rate of this isolate occured at the salinity level of 1 M NaCl. The maximum carotenoid content under stress condition of intense light (400 μmol photon m-2 s-1), high salinity (4 M NaCl) and deficiency of nitrate and phosphate nutritions reached to 240 ng/cell after 15 days. PMID:20377865

Identification, Classification, and Phylogeny of the Pathogenic Species Exophiala jeanselmei and Related Species by Mitochondrial Cytochrome b Gene Analysis

PubMed Central

Wang, Li; Yokoyama, Koji; Miyaji, Makoto; Nishimura, Kazuko

2001-01-01

We analyzed a 402-bp sequence of the mitochondrial cytochrome b gene of 34 strains of Exophiala jeanselmei and 16 strains representing 12 related species. The strains of E. jeanselmei were classified into 20 DNA types and 17 amino acid types. The differences between these strains were found in 1 to 60 nucleotides and 1 to 17 amino acids. On the basis of the identities and similarities of nucleotide and amino acid sequences, some strains were reidentified: i.e., two strains of E. jeanselmei var. hetermorpha and one strain of E. castellanii as E. dermatitidis (including the type strain), three strains of E. jeanselmei as E. jeanselmei var. lecanii-corni (including the type strain), three strains of E. jeanselmei as E. bergeri (including the type strain), seven strains of E. jeanselmei as E. pisciphila (including the type strain), seven strains of E. jeanselmei as E. jeanselmei var. jeanselmei (including the type strain), one strain of E. jeanselmei as Fonsecaea pedrosoi (including the type strain), and one strain of E. jeanselmei as E. spinifera (including the type strain). Some E. jeanselmei strains showed distinct nucleotide and amino acid sequences. The amino-acid-based UPGMA (unweighted pair group method with the arithmetic mean) tree exhibited nearly the same topology as those of the DNA-based trees obtained by neighbor joining, maximum parsimony, and maximum likelihood methods. PMID:11724862

Incidence of three Kudoa spp., K. neothunni, K. hexapunctata, and K. thunni (Myxosporea: Multivalvulida), in Thunnus tunas distributed in the western Pacific Ocean.

PubMed

Kasai, Akihiro; Tsuduki, Hideaki; Jimenez, Lea Angsinco; Li, Ying-Chun; Tanaka, Shuhei; Sato, Hiroshi

2017-04-01

A variety of tunas of the genus Thunnus are consumed daily in Japan as sliced raw fish (sashimi and sushi). The consumption of fresh sliced raw fish, i.e., unfrozen or uncooked, can sometimes cause food poisoning that is manifested by transient diarrhea and vomiting for a single day. One of the causes of this type of food poisoning has been identified as live Kudoa septempunctata (Myxosporea: Multivalvulida) in the olive flounder (Paralichthys olivaceus). Furthermore, raw slices of fresh tunas are highly suspected to be a possible causative fish of similar food poisoning in Japan. In the present study, we conducted a survey of kudoid infections in tunas (the yellowfin tuna Thunnus albacares, the Pacific bluefin tuna Thunnus orientalis, and the longtail tuna Thunnus tonggol) fished in the western Pacific Ocean off Japan and several East Asian countries and characterized morphologically and genetically the kudoid myxospores in pseudocysts or cysts dispersed in the trunk muscles. Pseudocysts of solely Kudoa hexapunctata were identified in the Pacific bluefin tuna (four isolates), whereas in the yellowfin tuna (21 isolates) pseudocysts of Kudoa neothunni and K. hexapunctata were detected at a ratio of 15:6, respectively, in addition to cyst-forming Kudoa thunni in five yellowfin tunas. In the trunk muscles of six longtail tunas examined, pseudocysts of K. neothunni (all six fish) and K. hexapunctata (two fish) were densely dispersed. The myxospores of K. neothunni found in these longtail tunas had seven shell valves and polar capsules (SV/PC) instead of the more common six SV/PC arranged symmetrically. Nucleotide sequences of the 18S and 28S ribosomal RNA gene (rDNA), some with the internal transcribed spacer regions as well, of K. hexapunctata and K. neothunni from the three Thunnus spp., including the seven-SV/PC morphotype, were very similar to previously characterized nucleotide sequences of each species, whereas the 18S and 28S rDNA of four isolates of K. thunni from yellowfin tunas showed a range of nucleotide variations of 99.0-99.9% identity over 1752-1763-bp long partial 18S rDNA and 97.4-99.9% identity over 797-802-bp long partial 28S rDNA. Therefore, this rather high variation of the rDNA nucleotide sequences of K. thunni proved to be contrary to the few variations of K. neothunni and K. hexapunctata rDNA nucleotide sequences. The present study provides a new host record of the longtail tuna for K. neothunni and K. hexapunctata and reveals a high prevalence of the seven-SV/PC myxospore morphotype of K. neothunni in this tuna host.

Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer).

PubMed

Chelomina, Galina N; Rozhkovan, Konstantin V; Voronova, Anastasia N; Burundukova, Olga L; Muzarok, Tamara I; Zhuravlev, Yuri N

2016-04-01

Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440-640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine.

Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer)

PubMed Central

Chelomina, Galina N.; Rozhkovan, Konstantin V.; Voronova, Anastasia N.; Burundukova, Olga L.; Muzarok, Tamara I.; Zhuravlev, Yuri N.

2015-01-01

Background Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. Methods The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. Results In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440–640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. Conclusion This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine. PMID:27158239

PpRT1: the first complete gypsy-like retrotransposon isolated in Pinus pinaster.

PubMed

Rocheta, Margarida; Cordeiro, Jorge; Oliveira, M; Miguel, Célia

2007-02-01

We have isolated and characterized a complete retrotransposon sequence, named PpRT1, from the genome of Pinus pinaster. PpRT1 is 5,966 bp long and is closely related to IFG7 gypsy retrotransposon from Pinus radiata. The long terminal repeats (LTRs) have 333 bp each and show a 5.4% sequence divergence between them. In addition to the characteristic polypurine tract (PPT) and the primer binding site (PBS), PpRT1 carries internal regions with homology to retroviral genes gag and pol. The pol region contains sequence motifs related to the enzymes protease, reverse transcriptase, RNAseH and integrase in the same typical order known for Ty3/gypsy-like retrotransposons. PpRT1 was extended from an EST database sequence indicating that its transcription is occurring in pine tissues. Southern blot analyses indicate however, that PpRT1 is present in a unique or a low number of copies in the P. pinaster genome. The differences in nucleotide sequence found between PpRT1 and IFG7 may explain the strikingly different copy number in the two pine species genome. Based on the homologies observed when comparing LTR region among different gypsy elements we propose that the highly conserved LTR regions may be useful to amplify other retrotransposon sequences of the same or close retrotransposon family.

Strong transcription blockage mediated by R-loop formation within a G-rich homopurine–homopyrimidine sequence localized in the vicinity of the promoter

PubMed Central

Soo Shin, Jane Hae

2017-01-01

Abstract Guanine-rich (G-rich) homopurine–homopyrimidine nucleotide sequences can block transcription with an efficiency that depends upon their orientation, composition and length, as well as the presence of negative supercoiling or breaks in the non-template DNA strand. We report that a G-rich sequence in the non-template strand reduces the yield of T7 RNA polymerase transcription by more than an order of magnitude when positioned close (9 bp) to the promoter, in comparison to that for a distal (∼250 bp) location of the same sequence. This transcription blockage is much less pronounced for a C-rich sequence, and is not significant for an A-rich sequence. Remarkably, the blockage is not pronounced if transcription is performed in the presence of RNase H, which specifically digests the RNA strands within RNA–DNA hybrids. The blockage also becomes less pronounced upon reduced RNA polymerase concentration. Based upon these observations and those from control experiments, we conclude that the blockage is primarily due to the formation of stable RNA–DNA hybrids (R-loops), which inhibit successive rounds of transcription. Our results could be relevant to transcription dynamics in vivo (e.g. transcription ‘bursting’) and may also have practical implications for the design of expression vectors. PMID:28498974

Strong transcription blockage mediated by R-loop formation within a G-rich homopurine-homopyrimidine sequence localized in the vicinity of the promoter.

PubMed

Belotserkovskii, Boris P; Soo Shin, Jane Hae; Hanawalt, Philip C

2017-06-20

Guanine-rich (G-rich) homopurine-homopyrimidine nucleotide sequences can block transcription with an efficiency that depends upon their orientation, composition and length, as well as the presence of negative supercoiling or breaks in the non-template DNA strand. We report that a G-rich sequence in the non-template strand reduces the yield of T7 RNA polymerase transcription by more than an order of magnitude when positioned close (9 bp) to the promoter, in comparison to that for a distal (∼250 bp) location of the same sequence. This transcription blockage is much less pronounced for a C-rich sequence, and is not significant for an A-rich sequence. Remarkably, the blockage is not pronounced if transcription is performed in the presence of RNase H, which specifically digests the RNA strands within RNA-DNA hybrids. The blockage also becomes less pronounced upon reduced RNA polymerase concentration. Based upon these observations and those from control experiments, we conclude that the blockage is primarily due to the formation of stable RNA-DNA hybrids (R-loops), which inhibit successive rounds of transcription. Our results could be relevant to transcription dynamics in vivo (e.g. transcription 'bursting') and may also have practical implications for the design of expression vectors. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

PubMed Central

Hiesel, Rudolf; Brennicke, Axel

1983-01-01

The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

In silico analysis of subtilisin from Glaciozyma antarctica PI12

NASA Astrophysics Data System (ADS)

Mustafha, Siti Mardhiah; Murad, Abdul Munir Abdul; Mahadi, Nor Muhammad; Kamaruddin, Shazilah; Bakar, Farah Diba Abu

2015-09-01

Subtilisin constitute as a major player in industrial enzymes that has a wide range of application especially in the detergent industry. In this study, a cDNA encoding for subtilisin (GaSUBT) was extracted from the psychrophilic yeast, Glaciozyma antarctica PI12, PCR amplified and sequenced. Various bioinformatics tools were used to characterize the GaSUBT. GaSUBT contains 1587 bp nucleotides encoding for 529 amino acids. The predicted molecular weight of the deduced protein is 55.34 kDa with an isoelectric point of 6.25. GaSUBT was predicted to possess a signal peptide and pro-peptide consisting of a peptidase inhibitor I9 sequence. From the sequence alignment analysis of deduced amino acids with other subtilisins in the NCBI database showed that the sequences surrounding the catalytic triad that forms the catalytic domain are well conserved.

Molecular cloning, sequence characterization and recombinant expression of Nanog gene in goat fibroblast cells using lentiviral based expression system.

PubMed

Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Kumar, Surender; Kumar, Sudarshan; Mohanty, Ashok K; Kaushik, Jai K; Malakar, Dhruba

2014-01-01

Nanog is a homeodomain containing protein which plays important roles in regulation of signaling pathways for maintenance and induction of pluripotency in stem cells. Because of its unique expression in stem cells it is also regarded as pluripotency marker. In this study goat Nanog (gNanog) gene has been amplified, cloned and characterized at sequence level with successful over-expression in CHO-K1 cell line using a lentiviral based system. gNanog ORF is 903 bp long which codes for Nanog protein of size 300 amino acids (aas). Complete nucleotide sequence shows some evolutionary mutation in goat in comparision to other species. Protein sequence of goat is highly similar to other species. Overall, gNanog nucleotide sequence and predicted protein sequence showed high similarity and minimum divergence with cattle (96 % identity/4 % divergence) and buffalo (94/5 %) while low similarity and high divergence with pig (84/15 %), human (81/23 %) and mouse (69/40 %) indicating evolutionary closeness of gNanog to cattle and buffalo. gNanog lentiviral expression construct was prepared for over-expression of Nanog gene in adult goat fibroblast cells. Lentiviral expression construct of Nanog enabled continuous protein expression for induction and maintenance of pluripotency. Western blotting revealed the expression of Nanog gene at protein level which supported that the lentiviral expression system is highly promising for Nanog protein expression in differentiated goat cell.

IG and TR single chain fragment variable (scFv) sequence analysis: a new advanced functionality of IMGT/V-QUEST and IMGT/HighV-QUEST.

PubMed

Giudicelli, Véronique; Duroux, Patrice; Kossida, Sofia; Lefranc, Marie-Paule

2017-06-26

IMGT®, the international ImMunoGeneTics information system® ( http://www.imgt.org ), was created in 1989 in Montpellier, France (CNRS and Montpellier University) to manage the huge and complex diversity of the antigen receptors, and is at the origin of immunoinformatics, a science at the interface between immunogenetics and bioinformatics. Immunoglobulins (IG) or antibodies and T cell receptors (TR) are managed and described in the IMGT® databases and tools at the level of receptor, chain and domain. The analysis of the IG and TR variable (V) domain rearranged nucleotide sequences is performed by IMGT/V-QUEST (online since 1997, 50 sequences per batch) and, for next generation sequencing (NGS), by IMGT/HighV-QUEST, the high throughput version of IMGT/V-QUEST (portal begun in 2010, 500,000 sequences per batch). In vitro combinatorial libraries of engineered antibody single chain Fragment variable (scFv) which mimic the in vivo natural diversity of the immune adaptive responses are extensively screened for the discovery of novel antigen binding specificities. However the analysis of NGS full length scFv (~850 bp) represents a challenge as they contain two V domains connected by a linker and there is no tool for the analysis of two V domains in a single chain. The functionality "Analyis of single chain Fragment variable (scFv)" has been implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST for the analysis of the two V domains of IG and TR scFv. It proceeds in five steps: search for a first closest V-REGION, full characterization of the first V-(D)-J-REGION, then search for a second V-REGION and full characterization of the second V-(D)-J-REGION, and finally linker delimitation. For each sequence or NGS read, positions of the 5'V-DOMAIN, linker and 3'V-DOMAIN in the scFv are provided in the 'V-orientated' sense. Each V-DOMAIN is fully characterized (gene identification, sequence description, junction analysis, characterization of mutations and amino changes). The functionality is generic and can analyse any IG or TR single chain nucleotide sequence containing two V domains, provided that the corresponding species IMGT reference directory is available. The "Analysis of single chain Fragment variable (scFv)" implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST provides the identification and full characterization of the two V domains of full-length scFv (~850 bp) nucleotide sequences from combinatorial libraries. The analysis can also be performed on concatenated paired chains of expressed antigen receptor IG or TR repertoires.

Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

PubMed Central

Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

2010-01-01

Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

PubMed

Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

2010-04-01

Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

Identification and characterization of a NBS–LRR class resistance gene analog in Pistacia atlantica subsp. Kurdica

PubMed Central

Bahramnejad, Bahman

2014-01-01

P. atlantica subsp. Kurdica, with the local name of Baneh, is a wild medicinal plant which grows in Kurdistan, Iran. The identification of resistance gene analogs holds great promise for the development of resistant cultivars. A PCR approach with degenerate primers designed according to conserved NBS-LRR (nucleotide binding site-leucine rich repeat) regions of known disease-resistance (R) genes was used to amplify and clone homologous sequences from P. atlantica subsp. Kurdica. A DNA fragment of the expected 500-bp size was amplified. The nucleotide sequence of this amplicon was obtained through sequencing and the predicted amino acid sequence compared to the amino acid sequences of known R-genes revealed significant sequence similarity. Alignment of the deduced amino acid sequence of P. atlantica subsp. Kurdica resistance gene analog (RGA) showed strong identity, ranging from 68% to 77%, to the non-toll interleukin receptor (non-TIR) R-gene subfamily from other plants. A P-loop motif (GMMGGEGKTT), a conserved and hydrophobic motif GLPLAL, a kinase-2a motif (LLVLDDV), when replaced by IAVFDDI in PAKRGA1 and a kinase-3a (FGPGSRIII) were presented in all RGA. A phylogenetic tree, based on the deduced amino-acid sequences of PAKRGA1 and RGAs from different species indicated that they were separated in two clusters, PAKRGA1 being on cluster II. The isolated NBS analogs can be eventually used as guidelines to isolate numerous R-genes in Pistachio. PMID:27843981

The Complete Nucleotide Sequence of the Mitochondrial Genome of Bactrocera minax (Diptera: Tephritidae)

PubMed Central

Zhang, Bin; Nardi, Francesco; Hull-Sanders, Helen; Wan, Xuanwu; Liu, Yinghong

2014-01-01

The complete 16,043 bp mitochondrial genome (mitogenome) of Bactrocera minax (Diptera: Tephritidae) has been sequenced. The genome encodes 37 genes usually found in insect mitogenomes. The mitogenome information for B. minax was compared to the homologous sequences of Bactrocera oleae, Bactrocera tryoni, Bactrocera philippinensis, Bactrocera carambolae, Bactrocera papayae, Bactrocera dorsalis, Bactrocera correcta, Bactrocera cucurbitae and Ceratitis capitata. The analysis indicated the structure and organization are typical of, and similar to, the nine closely related species mentioned above, although it contains the lowest genome-wide A+T content (67.3%). Four short intergenic spacers with a high degree of conservation among the nine tephritid species mentioned above and B. minax were observed, which also have clear counterparts in the control regions (CRs). Correlation analysis among these ten tephritid species revealed close positive correlation between the A+T content of zero-fold degenerate sites (P0FD), the ratio of nucleotide substitution frequency at P0FD sites to all degenerate sites (zero-fold degenerate sites, two-fold degenerate sites and four-fold degenerate sites) and amino acid sequence distance (ASD) were found. Further, significant positive correlation was observed between the A+T content of four-fold degenerate sites (P4FD) and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites; however, we found significant negative correlation between ASD and the A+T content of P4FD, and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites. A higher nucleotide substitution frequency at non-synonymous sites compared to synonymous sites was observed in nad4, the first time that has been observed in an insect mitogenome. A poly(T) stretch at the 5′ end of the CR followed by a [TA(A)]n-like stretch was also found. In addition, a highly conserved G+A-rich sequence block was observed in front of the poly(T) stretch among the ten tephritid species and two tandem repeats were present in the CR. PMID:24964138

Design of character-based DNA barcode motif for species identification: A computational approach and its validation in fishes.

PubMed

Chakraborty, Mohua; Dhar, Bishal; Ghosh, Sankar Kumar

2017-11-01

The DNA barcodes are generally interpreted using distance-based and character-based methods. The former uses clustering of comparable groups, based on the relative genetic distance, while the latter is based on the presence or absence of discrete nucleotide substitutions. The distance-based approach has a limitation in defining a universal species boundary across the taxa as the rate of mtDNA evolution is not constant throughout the taxa. However, character-based approach more accurately defines this using a unique set of nucleotide characters. The character-based analysis of full-length barcode has some inherent limitations, like sequencing of the full-length barcode, use of a sparse-data matrix and lack of a uniform diagnostic position for each group. A short continuous stretch of a fragment can be used to resolve the limitations. Here, we observe that a 154-bp fragment, from the transversion-rich domain of 1367 COI barcode sequences can successfully delimit species in the three most diverse orders of freshwater fishes. This fragment is used to design species-specific barcode motifs for 109 species by the character-based method, which successfully identifies the correct species using a pattern-matching program. The motifs also correctly identify geographically isolated population of the Cypriniformes species. Further, this region is validated as a species-specific mini-barcode for freshwater fishes by successful PCR amplification and sequencing of the motif (154 bp) using the designed primers. We anticipate that use of such motifs will enhance the diagnostic power of DNA barcode, and the mini-barcode approach will greatly benefit the field-based system of rapid species identification. © 2017 John Wiley & Sons Ltd.

Expression of ayu (Plecoglossus altivelis) Pit-1 in Escherichia coli: its purification and immunohistochemical detection using monoclonal antibody.

PubMed

Chiu, Chi-Chien; John, Joseph Abraham Christopher; Hseu, Tzong-Hsiung; Chang, Chi-Yao

2002-03-01

The pituitary-specific transcription factor Pit-1 belongs to the family of POU-domain proteins and is known to play an important role in the differentiation of pituitary cells. Here we report the complete nucleotide sequence of cDNA encoding Pit-1 from the brackish water fish, ayu (Plecoglossus altivelis). Nucleotide sequence analysis of 1910 bp of ayu Pit-1 cDNA revealed an open reading frame of 1074 bp that encodes a protein of 358 amino acids containing a POU-specific domain, POU homeodomain, and an STA (Ser/Thr-rich activation) transactivation domain. We inserted the coding region of Pit-1 cDNA, obtained by PCR, into a pET-20b(+) plasmid to produce recombinant Pit-1 in Escherichia coli BL21 (DE3) pLysS cells. Upon induction with isopropyl beta-D-thiogalactopyranoside, Pit-1 was expressed and accumulated as inclusion bodies in E. coli. The protein was then purified in one step by affinity chromatography on a nickel-nitrilotriacetic acid agarose column under denaturing conditions. This method yielded 0.7 mg of highly pure and stable protein per 200 ml of bacterial culture. A band of 40 kDa, resolved as recombinant ayu Pit-1 by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, agrees well with the molecular mass calculated from the translated cDNA sequence. The purified recombinant Pit-1 was confirmed in vitro through Western blot analysis, using its monoclonal antibody. This monoclonal antibody detected Pit-1 in the nuclei of ayu developing pituitary by immunohistochemical reaction. It serves as a good reagent for the detection of ayu Pit-1 in situ. Copyright 2002 Elsevier Science (USA).

Molecular identification of the ompL1 gene within Leptospira interrogans standard serovars.

PubMed

Dezhbord, Mehrangiz; Esmaelizad, Majid; Khaki, Pejvak; Fotohi, Fariba; Zarehparvar Moghaddam, Athena

2014-06-11

Leptospirosis, caused by infection with pathogenic Leptospira species, is one of the most prevalent zoonotic diseases in the world. Current leptospiral vaccines are mainly multivalent dead whole-cell mixtures made of several local dominant serovars. Therefore, design and construction of an efficient recombinant vaccine for leptospirosis control is very important. OmpL1 is an immunogenic porin protein that could be of special significance in vaccination and serodiagnosis for leptospirosis. Three strains belonging to pathogenic L. interrogans were analyzed. The specific primers for proliferation of the ompL1 gene were designed. The amplified gene was cloned. In order to investigate the ompL1 nucleotide sequence and homological analysis of this gene, ompL1 genes cloned from standard vaccinal Leptospira serovars prevalent in Iran were sequenced and cloned. PCR amplification of the ompL1 gene using the designed primers resulted in a 963 bp ompL1 gene product. The PCR based on the ompL1 gene detected all pathogenic reference serovars of Leptospira spp. tested. Based on alignment and phylogenetic analysis, although the ompL1 nucleotide sequence was slightly different within three vaccinal serovars (100%-85% identity), amino acid alignment of the OmpL1 proteins revealed that there would be inconsiderable difference among them. The ompL1 gene of the three isolates was well conserved, differing only by a total of 6 bp and the proteins by 2 amino acids. The cloned gene could be further used for expression and recombinant OmpL1 as an efficient and conserved antigen, and may be a useful vaccine candidate against leptospirosis in our region.

Mitochondrial genome of the freshwater jellyfish Craspedacusta sowerbyi and phylogenetics of Medusozoa.

PubMed

Zou, Hong; Zhang, Jin; Li, Wenxiang; Wu, Shangong; Wang, Guitang

2012-01-01

The 17,922 base pairs (bp) nucleotide sequence of the linear mitochondrial DNA (mtDNA) molecule of the freshwater jellyfish Craspedacusta sowerbyi (Hydrozoa, Trachylina, Limnomedusae) has been determined. This sequence exhibits surprisingly low A+T content (57.1%), containing genes for 13 energy pathway proteins, a small and a large subunit rRNAs, and methionine and tryptophan tRNAs. Mitochondrial ancestral medusozoan gene order (AMGO) was found in the C. sowerbyi, as those found in Cubaia aphrodite (Hydrozoa, Trachylina, Limnomedusae), discomedusan Scyphozoa and Staurozoa. The genes of C. sowerbyi mtDNA are arranged in two clusters with opposite transcriptional polarities, whereby transcription proceeds toward the ends of the DNA molecule. Identical inverted terminal repeats (ITRs) flank the ends of the mitochondrial DNA molecule, a characteristic typical of medusozoans. In addition, two open reading frames (ORFs) of 354 and 1611 bp in length were found downstream of the large subunit rRNA gene, similar to the two ORFs of ORF314 and polB discovered in the linear mtDNA of C. aphrodite, discomedusan Scyphozoa and Staurozoa. Phylogenetic analyses of C. sowerbyi and other cnidarians were carried out based on both nucleotide and inferred amino acid sequences of the 13 mitochondrial energy pathway genes. Our working hypothesis supports the monophyletic Medusozoa being a sister group to Octocorallia (Cnidaria, Anthozoa). Within Medusozoa, the phylogenetic analysis suggests that Staurozoa may be the earliest diverging class and the sister group of all other medusozoans. Cubozoa and coronate Scyphozoa form a clade that is the sister group of Hydrozoa plus discomedusan Scyphozoa. Hydrozoa is the sister group of discomedusan Scyphozoa. Semaeostomeae is a paraphyletic clade with Rhizostomeae, while Limnomedusae (Trachylina) is the sister group of hydroidolinans and may be the earliest diverging lineage among Hydrozoa.

Mitochondrial Genome of the Freshwater Jellyfish Craspedacusta sowerbyi and Phylogenetics of Medusozoa

PubMed Central

Zou, Hong; Zhang, Jin; Li, Wenxiang; Wu, Shangong; Wang, Guitang

2012-01-01

The 17,922 base pairs (bp) nucleotide sequence of the linear mitochondrial DNA (mtDNA) molecule of the freshwater jellyfish Craspedacusta sowerbyi (Hydrozoa,Trachylina, Limnomedusae) has been determined. This sequence exhibits surprisingly low A+T content (57.1%), containing genes for 13 energy pathway proteins, a small and a large subunit rRNAs, and methionine and tryptophan tRNAs. Mitochondrial ancestral medusozoan gene order (AMGO) was found in the C. sowerbyi, as those found in Cubaia aphrodite (Hydrozoa, Trachylina, Limnomedusae), discomedusan Scyphozoa and Staurozoa. The genes of C. sowerbyi mtDNA are arranged in two clusters with opposite transcriptional polarities, whereby transcription proceeds toward the ends of the DNA molecule. Identical inverted terminal repeats (ITRs) flank the ends of the mitochondrial DNA molecule, a characteristic typical of medusozoans. In addition, two open reading frames (ORFs) of 354 and 1611 bp in length were found downstream of the large subunit rRNA gene, similar to the two ORFs of ORF314 and polB discovered in the linear mtDNA of C. aphrodite, discomedusan Scyphozoa and Staurozoa. Phylogenetic analyses of C. sowerbyi and other cnidarians were carried out based on both nucleotide and inferred amino acid sequences of the 13 mitochondrial energy pathway genes. Our working hypothesis supports the monophyletic Medusozoa being a sister group to Octocorallia (Cnidaria, Anthozoa). Within Medusozoa, the phylogenetic analysis suggests that Staurozoa may be the earliest diverging class and the sister group of all other medusozoans. Cubozoa and coronate Scyphozoa form a clade that is the sister group of Hydrozoa plus discomedusan Scyphozoa. Hydrozoa is the sister group of discomedusan Scyphozoa. Semaeostomeae is a paraphyletic clade with Rhizostomeae, while Limnomedusae (Trachylina) is the sister group of hydroidolinans and may be the earliest diverging lineage among Hydrozoa. PMID:23240028

Population genetic structure and phylogeographical pattern of a relict tree fern, Alsophila spinulosa (Cyatheaceae), inferred from cpDNA atpB- rbcL intergenic spacers.

PubMed

Su, Yingjuan; Wang, Ting; Zheng, Bo; Jiang, Yu; Chen, Guopei; Gu, Hongya

2004-11-01

Sequences of chloroplast DNA (cpDNA) atpB- rbcL intergenic spacers of individuals of a tree fern species, Alsophila spinulosa, collected from ten relict populations distributed in the Hainan and Guangdong provinces, and the Guangxi Zhuang region in southern China, were determined. Sequence length varied from 724 bp to 731 bp, showing length polymorphism, and base composition was with high A+T content between 63.17% and 63.95%. Sequences were neutral in terms of evolution (Tajima's criterion D=-1.01899, P>0.10 and Fu and Li's test D*=-1.39008, P>0.10; F*=-1.49775, P>0.10). A total of 19 haplotypes were identified based on nucleotide variation. High levels of haplotype diversity (h=0.744) and nucleotide diversity (Dij=0.01130) were detected in A. spinulosa, probably associated with its long evolutionary history, which has allowed the accumulation of genetic variation within lineages. Both the minimum spanning network and neighbor-joining trees generated for haplotypes demonstrated that current populations of A. spinulosa existing in Hainan, Guangdong, and Guangxi were subdivided into two geographical groups. An analysis of molecular variance indicated that most of the genetic variation (93.49%, P<0.001) was partitioned among regions. Wright's isolation by distance model was not supported across extant populations. Reduced gene flow by the Qiongzhou Strait and inbreeding may result in the geographical subdivision between the Hainan and Guangdong + Guangxi populations (FST=0.95, Nm=0.03). Within each region, the star-like pattern of phylogeography of haplotypes implied a population expansion process during evolutionary history. Gene genealogies together with coalescent theory provided significant information for uncovering phylogeography of A. spinulosa.

Pestoides F, an atypical Yersinia pestis strain from the former Soviet Union.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia, Emilio; Worsham, Patricia; Bearden, S.

2007-01-01

Unlike the classical Yersinia pestis strains, members of an atypical group of Y. pestis from Central Asia, denominated Y. pestis subspecies caucasica (also known as one of several pestoides types), are distinguished by a number of characteristics including their ability to ferment rhamnose and melibiose, their lack of the small plasmid encoding the plasminogen activator (pla) and pesticin, and their exceptionally large variants of the virulence plasmid pMT (encoding murine toxin and capsular antigen). We have obtained the entire genome sequence of Y. pestis Pestoides F, an isolate from the former Soviet Union that has enabled us to carryout amore » comprehensive genome-wide comparison of this organism's genomic content against the six published sequences of Y. pestis and their Y. pseudotuberculosis ancestor. Based on classical glycerol fermentation (+ve) and nitrate reduction (+ve) Y. pestis Pestoides F is an isolate that belongs to the biovar antiqua. This strain is unusual in other characteristics such as the fact that it carries a non-consensus V antigen (lcrV) sequence, and that unlike other Pla(-) strains, Pestoides F retains virulence by the parenteral and aerosol routes. The chromosome of Pestoides F is 4,517,345 bp in size comprising some 3,936 predicted coding sequences, while its pCD and pMT plasmids are 71,507 bp and 137,010 bp in size respectively. Comparison of chromosome-associated genes in Pestoides F with those in the other sequenced Y. pestis strains reveals differences ranging from strain-specific rearrangements, insertions, deletions, single nucleotide polymorphisms, and a unique distribution of insertion sequences. There is a single approximately 7 kb unique region in the chromosome not found in any of the completed Y. pestis strains sequenced to date, but which is present in the Y. pseudotuberculosis ancestor. Taken together, these findings are consistent with Pestoides F being derived from the most ancient lineage of Y. pestis yet sequenced.« less

Pestoides F, and Atypical Yersinia pestis Strain from the Former Soviet Union

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia, E; Worsham, P; Bearden, S

2007-01-05

Unlike the classical Yersinia pestis strains, members of an atypical group of Y. pestis from Central Asia, denominated Y. pestis subspecies caucasica (also known as one of several pestoides types), are distinguished by a number of characteristics including their ability to ferment rhamnose and melibiose, their lacking the small plasmid encoding the plasminogen activator (pla) and pesticin, and their exceptionally large variants of the virulence plasmid pMT (encoding murine toxin and capsular antigen). We have obtained the entire genome sequence of Y. pestis Pestoides F, an isolate from the former Soviet Union that has enabled us to carryout a comprehensivemore » genome-wide comparison of this organism's genomic content against the six published sequences of Y. pestis and their Y. pseudotuberculosis ancestor. Based on classical glycerol fermentation (+ve) and nitrate reduction (+ve) Y. pestis Pestoides F is an isolate that belongs to the biovar antiqua. This strain is unusual in other characteristics such as the fact that it carries a non-consensus V antigen (lcrV) sequence, and that unlike other Pla{sup -} strains, Pestoides F retains virulence by the parenteral and aerosol routes. The chromosome of Pestoides F is 4,517,345 bp in size comprising some 3,936 predicted coding sequences, while its pCD and pMT plasmids are 71,507 bp and 137,010 bp in size respectively. Comparison of chromosome-associated genes in Pestoides F with those in the other sequenced Y. pestis strains, reveals a series of differences ranging from strain-specific rearrangements, insertions, deletions, single nucleotide polymorphisms, and a unique distribution of insertion sequences. There is a single {approx}7 kb unique region in the chromosome not found in any of the completed Y. pestis strains sequenced to date, but which is present in the Y. pseudotuberculosis ancestor. Taken together, these findings are consistent with Pestoides F being derived from the most ancient lineage of Y. pestis yet sequenced.« less

Comparative Transcriptome Analysis of the Accessory Sex Gland and Testis from the Chinese Mitten Crab (Eriocheir sinensis)

PubMed Central

He, Lin; Jiang, Hui; Cao, Dandan; Liu, Lihua; Hu, Songnian; Wang, Qun

2013-01-01

The accessory sex gland (ASG) is an important component of the male reproductive system, which functions to enhance the fertility of spermatozoa during male reproduction. Certain proteins secreted by the ASG are known to bind to the spermatozoa membrane and affect its function. The ASG gene expression profile in Chinese mitten crab (Eriocheir sinensis) has not been extensively studied, and limited genetic research has been conducted on this species. The advent of high-throughput sequencing technologies enables the generation of genomic resources within a short period of time and at minimal cost. In the present study, we performed de novo transcriptome sequencing to produce a comprehensive transcript dataset for the ASG of E. sinensis using Illumina sequencing technology. This analysis yielded a total of 33,221,284 sequencing reads, including 2.6 Gb of total nucleotides. Reads were assembled into 85,913 contigs (average 218 bp), or 58,567 scaffold sequences (average 292 bp), that identified 37,955 unigenes (average 385 bp). We assembled all unigenes and compared them with the published testis transcriptome from E. sinensis. In order to identify which genes may be involved in ASG function, as it pertains to modification of spermatozoa, we compared the ASG and testis transcriptome of E. sinensis. Our analysis identified specific genes with both higher and lower tissue expression levels in the two tissues, and the functions of these genes were analyzed to elucidate their potential roles during maturation of spermatozoa. Availability of detailed transcriptome data from ASG and testis in E. sinensis can assist our understanding of the molecular mechanisms involved with spermatozoa conservation, transport, maturation and capacitation and potentially acrosome activation. PMID:23342039

Effective de novo assembly of fish genome using haploid larvae.

PubMed

Iwasaki, Yuki; Nishiki, Issei; Nakamura, Yoji; Yasuike, Motoshige; Kai, Wataru; Nomura, Kazuharu; Yoshida, Kazunori; Nomura, Yousuke; Fujiwara, Atushi; Kobayashi, Takanori; Ototake, Mitsuru

2016-02-01

Recent improvements in next-generation sequencing technology have made it possible to do whole genome sequencing, on even non-model eukaryote species with no available reference genomes. However, de novo assembly of diploid genomes is still a big challenge because of allelic variation. The aim of this study was to determine the feasibility of utilizing the genome of haploid fish larvae for de novo assembly of whole-genome sequences. We compared the efficiency of assembly using the haploid genome of yellowtail (Seriola quinqueradiata) with that using the diploid genome obtained from the dam. De novo assembly from the haploid and the diploid sequence reads (100 million reads per each datasets) generated by the Ion Proton sequencer (200 bp) was done under two different assembly algorithms, namely overlap-layout-consensus (OLC) and de Bruijn graph (DBG). This revealed that the assembly of the haploid genome significantly reduced (approximately 22% for OLC, 9% for DBG) the total number of contigs (with longer average and N50 contig lengths) when compared to the diploid genome assembly. The haploid assembly also improved the quality of the scaffolds by reducing the number of regions with unassigned nucleotides (Ns) (total length of Ns; 45,331,916 bp for haploids and 67,724,360 bp for diploids) in OLC-based assemblies. It appears clear that the haploid genome assembly is better because the allelic variation in the diploid genome disrupts the extension of contigs during the assembly process. Our results indicate that utilizing the genome of haploid larvae leads to a significant improvement in the de novo assembly process, thus providing a novel strategy for the construction of reference genomes from non-model diploid organisms such as fish. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

PubMed

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

Optimizing de novo transcriptome assembly and extending genomic resources for striped catfish (Pangasianodon hypophthalmus).

PubMed

Thanh, Nguyen Minh; Jung, Hyungtaek; Lyons, Russell E; Njaci, Isaac; Yoon, Byoung-Ha; Chand, Vincent; Tuan, Nguyen Viet; Thu, Vo Thi Minh; Mather, Peter

2015-10-01

Striped catfish (Pangasianodon hypophthalmus) is a commercially important freshwater fish used in inland aquaculture in the Mekong Delta, Vietnam. The culture industry is facing a significant challenge however from saltwater intrusion into many low topographical coastal provinces across the Mekong Delta as a result of predicted climate change impacts. Developing genomic resources for this species can facilitate the production of improved culture lines that can withstand raised salinity conditions, and so we have applied high-throughput Ion Torrent sequencing of transcriptome libraries from six target osmoregulatory organs from striped catfish as a genomic resource for use in future selection strategies. We obtained 12,177,770 reads after trimming and processing with an average length of 97bp. De novo assemblies were generated using CLC Genomic Workbench, Trinity and Velvet/Oases with the best overall contig performance resulting from the CLC assembly. De novo assembly using CLC yielded 66,451 contigs with an average length of 478bp and N50 length of 506bp. A total of 37,969 contigs (57%) possessed significant similarity with proteins in the non-redundant database. Comparative analyses revealed that a significant number of contigs matched sequences reported in other teleost fishes, ranging in similarity from 45.2% with Atlantic cod to 52% with zebrafish. In addition, 28,879 simple sequence repeats (SSRs) and 55,721 single nucleotide polymorphisms (SNPs) were detected in the striped catfish transcriptome. The sequence collection generated in the current study represents the most comprehensive genomic resource for P. hypophthalmus available to date. Our results illustrate the utility of next-generation sequencing as an efficient tool for constructing a large genomic database for marker development in non-model species. Copyright © 2015 Elsevier B.V. All rights reserved.

Analyses of Mitogenome Sequences Revealed that Asian Citrus Psyllids (Diaphorina citri) from California Were Related to Those from Florida.

PubMed

Wu, Fengnian; Kumagai, Luci; Cen, Yijing; Chen, Jianchi; Wallis, Christopher M; Polek, MaryLou; Jiang, Hongyan; Zheng, Zheng; Liang, Guangwen; Deng, Xiaoling

2017-08-31

Asian citrus psyllid (ACP, Diaphorina citri Kuwayama) transmits "Candidatus Liberibacter asiaticus" (CLas), an unculturable alpha-proteobacterium associated with citrus Huanglongbing (HLB). CLas has recently been found in California. Understanding ACP population diversity is necessary for HLB regulatory practices aimed at reducing CLas spread. In this study, two circular ACP mitogenome sequences from California (mt-CApsy, ~15,027 bp) and Florida (mt-FLpsy, ~15,012 bp), USA, were acquired. Each mitogenome contained 13 protein coding genes, 2 ribosomal RNA and 22 transfer RNA genes, and a control region varying in sizes. The Californian mt-CApsy was identical to the Floridian mt-FLpsy, but different from the mitogenome (mt-GDpsy) of Guangdong, China, in 50 single nucleotide polymorphisms (SNPs). Further analyses were performed on sequences in cox1 and trnAsn regions with 100 ACPs, SNPs in nad1-nad4-nad5 locus through PCR with 252 ACP samples. All results showed the presence of a Chinese ACP cluster (CAC) and an American ACP cluster (AAC). We proposed that ACP in California was likely not introduced from China based on our current ACP collection but somewhere in America. However, more studies with ACP samples from around the world are needed. ACP mitogenome sequence analyses will facilitate ACP population research.

Complement component 3: characterization and association with mastitis resistance in Egyptian water buffalo and cattle.

PubMed

El-Halawany, Nermin; Abd-El-Monsif, Shawky A; Al-Tohamy Ahmed, F M; Hegazy, Lamees; Abdel-Shafy, Hamdy; Abdel-Latif, Magdy A; Ghazi, Yasser A; Neuhoff, Christiane; Salilew-Wondim, Dessie; Schellander, Karl

2017-03-01

Mastitis is an infectious disease of the mammary gland that leads to reduced milk production and change in milk composition. Complement component C3 plays a major role as a central molecule of the complement cascade involving in killing of microorganisms, either directly or in cooperation with phagocytic cells. C3 cDNA were isolated, from Egyptian buffalo and cattle, sequenced and characterized. The C3 cDNA sequences of buffalo and cattle consist of 5025 and 5019 bp, respectively. Buffalo and cattle C3 cDNAs share 99% of sequence identity with each other. The 4986 bp open reading frame in buffalo encodes a putative protein of 1661 amino acids-as in cattle-and includes all the functional domains. Further, analysis of the C3 cDNA sequences detected six novel single-nucleotide polymorphisms (SNPs) in buffalo and three novel SNPs in cattle. The association analysis of the detected SNPs with milk somatic cell score as an indicator of mastitis revealed that the most significant association in buffalo was found in the C>A substitution (ss: 1752816097) in exon 27, whereas in cattle it was in the C>T substitution (ss: 1752816085) in exon 12. Our findings provide preliminary information about the contribution of C3 polymorphisms to mastitis resistance in buffalo and cattle.

Detection and analysis of hemolysin genes in Aeromonas hydrophila isolated from Gouramy (Osphronemus gouramy) by polymerase chain reaction (PCR)

NASA Astrophysics Data System (ADS)

Rozi; Rahayu, K.; Daruti, D. N.

2018-04-01

The goal of this study was to detect of Aeromonas hydrophila carrying the hlyA gene in guramy by PCR assay. A total of 5 A. hydrophila strains were isolated from gouramy with different location and furthermore genotypic of all A. hydrophila strains havedetected by PCR assay for 16S rRNA gene. The primers used in the PCR targeted a 592-bp fragment of the hlyA gene coding for the hemolysin gene. Particularly hlyA genes are responsible for haemolysin toxins production in this genus. After gel electrophoresis, the amplicons from representative strains of the A. hydrophila were purified using extraction kit and were subjected to the DNA sequencing analysis. The results showed that: (i) the 592bp amplicon of the hlyA gene was detected in 5/6 of the A. hydrophila; (ii) the nucleotide blast results of hemolysin gene sequences of the strains of A. hydrophila revealed a high homology of 90-97 % with published sequences, and;(iii) the protein blast showed 95-98 % homology when compared to the published sequences. The PCR clearly identified the haemolysin-producing strains of A. hydrophila by detection in hlyA genes and may have application as a rapid species-specific virulence test.

The complete sequence of the mitochondrial genome of Arctic fox (Alopex lagopus).

PubMed

Yan, Shou-Qing; Guo, Peng-Cheng; Yue, Yuan; Li, Wan-Hong; Bai, Chun-Yan; Li, Yu-Mei; Sun, Jin-Hai; Zhao, Zhi-Hui

2016-11-01

In the present study, the complete mitochondrial genome sequence of Arctic fox (Alopex lagopus) was determined for the first time. It has a total length of 16,656 bp, and contains 13 protein-coding genes, 22 tRNA genes, 2 ribosome RNA genes and 1 control region. The nucleotide composition is 31.3% for A, 26.2% for C, 14.8% for G and 27.7% for T, respectively. The D-loop region located between tRNA Pro and tRNA Phe contains a (ACACGTACACGCAT) 18 tandem repeat array. The data will be useful for the investigation of the genetic structure and diversity in the natural and farmed population of Arctic foxes.

Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solera, J.; Magallon, M.; Martin-Villar, J.

1992-02-01

DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less

DNA barcoding commercially important aquatic invertebrates of Turkey.

PubMed

Keskin, Emre; Atar, Hasan Hüseyin

2013-08-01

DNA barcoding was used in order to identify aquatic invertebrates sampled from fisheries bycatch and discards. A total of 440 unique cytochrome c oxidase sub unit I (COI) barcodes were generated for 22 species from three important phyla (Arthropoda, Cnidaria, and Mollusca). All the species were sequenced and submitted to GenBank and Barcode of Life Database (BOLD) databases using 654 bp-long fragment of mitochondrial COI gene. Two of them (Pontastacus leptodactylus and Rapana bezoar) were first records of the species for the BOLD database and six of them (Carcinus aestuarii, Loligo vulgaris, Melicertus kerathurus, Nephrops norvegicus, Scyllarides latus, and Scyllarus arctus) were first standard (>648 bp) COI barcode records for the GenBank database. COI barcodes were analyzed for nucleotide composition, nucleotide pair frequencies, and Kimura's two-parameter genetic distance. Mean genetic distance among species was found increasing at higher taxonomic levels. Neighbor-joining trees generated were congruent with morphometric-based taxonomic classification. Findings of this study clearly demonstrate that DNA barcodes could be used as an efficient molecular tool in identification of not only target species from fisheries but also bycatch and discard species, and so it could provide us leverage for a better understanding in monitoring and management of fisheries and biodiversity.

The complete sequences and gene organisation of the mitochondrial genomes of the heterodont bivalves Acanthocardia tuberculata and Hiatella arctica – and the first record for a putative Atpase subunit 8 gene in marine bivalves

PubMed Central

Dreyer, Hermann; Steiner, Gerhard

2006-01-01

Background Mitochondrial (mt) gene arrangement is highly variable among molluscs and especially among bivalves. Of the 30 complete molluscan mt-genomes published to date, only one is of a heterodont bivalve, although this is the most diverse taxon in terms of species numbers. We determined the complete sequence of the mitochondrial genomes of Acanthocardia tuberculata and Hiatella arctica, (Mollusca, Bivalvia, Heterodonta) and describe their gene contents and genome organisations to assess the variability of these features among the Bivalvia and their value for phylogenetic inference. Results The size of the mt-genome in Acanthocardia tuberculata is 16.104 basepairs (bp), and in Hiatella arctica 18.244 bp. The Acanthocardia mt-genome contains 12 of the typical protein coding genes, lacking the Atpase subunit 8 (atp8) gene, as all published marine bivalves. In contrast, a complete atp8 gene is present in Hiatella arctica. In addition, we found a putative truncated atp8 gene when re-annotating the mt-genome of Venerupis philippinarum. Both mt-genomes reported here encode all genes on the same strand and have an additional trnM. In Acanthocardia several large non-coding regions are present. One of these contains 3.5 nearly identical copies of a 167 bp motive. In Hiatella, the 3' end of the NADH dehydrogenase subunit (nad)6 gene is duplicated together with the adjacent non-coding region. The gene arrangement of Hiatella is markedly different from all other known molluscan mt-genomes, that of Acanthocardia shows few identities with the Venerupis philippinarum. Phylogenetic analyses on amino acid and nucleotide levels robustly support the Heterodonta and the sister group relationship of Acanthocardia and Venerupis. Monophyletic Bivalvia are resolved only by a Bayesian inference of the nucleotide data set. In all other analyses the two unionid species, being to only ones with genes located on both strands, do not group with the remaining bivalves. Conclusion The two mt-genomes reported here add to and underline the high variability of gene order and presence of duplications in bivalve and molluscan taxa. Some genomic traits like the loss of the atp8 gene or the encoding of all genes on the same strand are homoplastic among the Bivalvia. These characters, gene order, and the nucleotide sequence data show considerable potential of resolving phylogenetic patterns at lower taxonomic levels. PMID:16948842

[Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

PubMed

Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

2002-06-01

Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

The complete chloroplast genome sequence of Mahonia bealei (Berberidaceae) reveals a significant expansion of the inverted repeat and phylogenetic relationship with other angiosperms.

PubMed

Ma, Ji; Yang, Bingxian; Zhu, Wei; Sun, Lianli; Tian, Jingkui; Wang, Xumin

2013-10-10

Mahonia bealei (Berberidaceae) is a frequently-used traditional Chinese medicinal plant with efficient anti-inflammatory ability. This plant is one of the sources of berberine, a new cholesterol-lowering drug with anti-diabetic activity. We have sequenced the complete nucleotide sequence of the chloroplast (cp) genome of M. bealei. The complete cp genome of M. bealei is 164,792 bp in length, and has a typical structure with large (LSC 73,052 bp) and small (SSC 18,591 bp) single-copy regions separated by a pair of inverted repeats (IRs 36,501 bp) of large size. The Mahonia cp genome contains 111 unique genes and 39 genes are duplicated in the IR regions. The gene order and content of M. bealei are almost unarranged which is consistent with the hypothesis that large IRs stabilize cp genome and reduce gene loss-and-gain probabilities during evolutionary process. A large IR expansion of over 12 kb has occurred in M. bealei, 15 genes (rps19, rpl22, rps3, rpl16, rpl14, rps8, infA, rpl36, rps11, petD, petB, psbH, psbN, psbT and psbB) have expanded to have an additional copy in the IRs. The IR expansion rearrangement occurred via a double-strand DNA break and subsequence repair, which is different from the ordinary gene conversion mechanism. Repeat analysis identified 39 direct/inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Analysis also revealed 75 simple sequence repeat (SSR) loci and almost all are composed of A or T, contributing to a distinct bias in base composition. Comparison of protein-coding sequences with ESTs reveals 9 putative RNA edits and 5 of them resulted in non-synonymous modifications in rpoC1, rps2, rps19 and ycf1. Phylogenetic analysis using maximum parsimony (MP) and maximum likelihood (ML) was performed on a dataset composed of 65 protein-coding genes from 25 taxa, which yields an identical tree topology as previous plastid-based trees, and provides strong support for the sister relationship between Ranunculaceae and Berberidaceae. Molecular dating analyses suggest that Ranunculaceae and Berberidaceae diverged between 90 and 84 mya, which is congruent with the fossil records and with recent estimates of the divergence time of these two taxa. © 2013.

Characterization of Toll-like receptor 3 gene in large yellow croaker, Pseudosciaena crocea.

PubMed

Huang, Xue-Na; Wang, Zhi-Yong; Yao, Cui-Luan

2011-07-01

Toll-like receptor 3 (TLR3) plays an important role in innate immune responses. In this report, the full-length cDNA sequence and genomic structure of Pseudosciaena crocea TLR3 (PcTLR3) were identified and characterized. The full-length cDNA of PcTLR3 was of 3384 bp, including a 5'-terminal untranslated region (UTR) of 65 bp, a 3'-terminal UTR of 589 bp and an open reading frame (ORF) of 2730 bp encoding a polypeptide of 909 amino acid residues. The full-length genome sequence of PcTLR3 was composed of 5721 nucleotides, including five exons and four introns. The putative PcTLR3 protein contained a signal peptide sequence, 16 leucine-rich repeat (LRR) motifs, a transmembrane region and a Toll/interleukin-1 receptor (TIR) domain. Quantitative real-time reverse transcription PCR analysis revealed a broad expression of PcTLR3 in most tissues, with the predominant expression in liver, then intestine, and the weakest expression in blood cells. The expression of PcTLR3 after injection with poly inosinic:cytidylic (I:C) and Vibrio parahemolyticus was tested in spleen, blood cells and liver. The results indicated that PcTLR3 transcripts could be induced in the three tissues by injection with poly I:C. The highest expression was in the blood cells with 43.5 times (at 6h) greater expression than in the control (p<0.05). In addition, after V. parahemolyticus challenge, a moderate up-regulation and down-regulation of PcTLR3 was found in blood cells and liver, respectively. Our results suggested that PcTLR3 might play an important role in fish's defense against both viral and bacterial infection. Copyright © 2011 Elsevier Ltd. All rights reserved.

The Complete Mitochondrial Genome of Corizus tetraspilus (Hemiptera: Rhopalidae) and Phylogenetic Analysis of Pentatomomorpha

PubMed Central

Guo, Zhong-Long; Wang, Juan; Shen, Yu-Ying

2015-01-01

Insect mitochondrial genome (mitogenome) are the most extensively used genetic information for molecular evolution, phylogenetics and population genetics. Pentatomomorpha (>14,000 species) is the second largest infraorder of Heteroptera and of great economic importance. To better understand the diversity and phylogeny within Pentatomomorpha, we sequenced and annotated the complete mitogenome of Corizus tetraspilus (Hemiptera: Rhopalidae), an important pest of alfalfa in China. We analyzed the main features of the C. tetraspilus mitogenome, and provided a comparative analysis with four other Coreoidea species. Our results reveal that gene content, gene arrangement, nucleotide composition, codon usage, rRNA structures and sequences of mitochondrial transcription termination factor are conserved in Coreoidea. Comparative analysis shows that different protein-coding genes have been subject to different evolutionary rates correlated with the G+C content. All the transfer RNA genes found in Coreoidea have the typical clover leaf secondary structure, except for trnS1 (AGN) which lacks the dihydrouridine (DHU) arm and possesses a unusual anticodon stem (9 bp vs. the normal 5 bp). The control regions (CRs) among Coreoidea are highly variable in size, of which the CR of C. tetraspilus is the smallest (440 bp), making the C. tetraspilus mitogenome the smallest (14,989 bp) within all completely sequenced Coreoidea mitogenomes. No conserved motifs are found in the CRs of Coreoidea. In addition, the A+T content (60.68%) of the CR of C. tetraspilus is much lower than that of the entire mitogenome (74.88%), and is lowest among Coreoidea. Phylogenetic analyses based on mitogenomic data support the monophyly of each superfamily within Pentatomomorpha, and recognize a phylogenetic relationship of (Aradoidea + (Pentatomoidea + (Lygaeoidea + (Pyrrhocoroidea + Coreoidea)))). PMID:26042898

Isolation of an invertebrate-type lysozyme from the nephridia of the echiura, Urechis unicinctus, and its recombinant production and activities.

PubMed

Oh, Hye Young; Kim, Chan-Hee; Go, Hye-Jin; Park, Nam Gyu

2018-05-09

Invertebrates, unlike vertebrates which have adaptive immune system, rely heavily on the innate immune system for the defense against pathogenic bacteria. Lysozymes, along with other immune effectors, are regarded as an important group in this defense. An invertebrate-type (i-type) lysozyme, designated Urechis unicinctus invertebrate-type lysozyme, Uu-ilys, has been isolated from nephridia of Urechis unicinctus using a series of high performance liquid chromatography (HPLC), and ultrasensitive radial diffusion assay (URDA) as a bioassay system. Analyses of the primary structure and cDNA cloning revealed that Uu-ilys was approximately 14 kDa and composed of 122 amino acids (AAs) of which the precursor had a total of 160 AAs containing a signal peptide of 18 AAs and a pro-sequence of 20 AAs encoded by the nucleotide sequence of 714 bp that comprises a 5' untranslated region (UTR) of 42 bp, an open reading frame (ORF) of 483 bp, and a 3' UTR of 189 bp. Multiple sequence alignment showed Uu-ilys has high homology to i-type lysozymes from several annelids. Relatively high transcriptional expression levels of Uu-ilys was detected in nephridia, anal vesicle, and intestine. The native Uu-ilys exhibited comparable lysozyme enzymatic and antibacterial activities to hen egg white lysozyme. Collectively, these data suggest that Uu-ilys, the isolated antibacterial protein, plays a role in the immune defense mechanism of U. unicinctus. Recombinant Uu-ilys (rUu-ilys) produced in a bacterial expression system showed significantly decreased lysozyme lytic activity from that of the native while its potency on radial diffusion assay detecting antibacterial activity was retained, which may indicate the non-enzymatic antibacterial capacity of Uu-ilys. Copyright © 2018. Published by Elsevier Ltd.

Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA.

PubMed

Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod

2016-02-01

Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.

Rapid Identification and Differentiation of Trichophyton Species, Based on Sequence Polymorphisms of the Ribosomal Internal Transcribed Spacer Regions, by Rolling-Circle Amplification▿

PubMed Central

Kong, Fanrong; Tong, Zhongsheng; Chen, Xiaoyou; Sorrell, Tania; Wang, Bin; Wu, Qixuan; Ellis, David; Chen, Sharon

2008-01-01

DNA sequencing analyses have demonstrated relatively limited polymorphisms within the fungal internal transcribed spacer (ITS) regions among Trichophyton spp. We sequenced the ITS region (ITS1, 5.8S, and ITS2) for 42 dermatophytes belonging to seven species (Trichophyton rubrum, T. mentagrophytes, T. soudanense, T. tonsurans, Epidermophyton floccosum, Microsporum canis, and M. gypseum) and developed a novel padlock probe and rolling-circle amplification (RCA)-based method for identification of single nucleotide polymorphisms (SNPs) that could be exploited to differentiate between Trichophyton spp. Sequencing results demonstrated intraspecies genetic variation for T. tonsurans, T. mentagrophytes, and T. soudanense but not T. rubrum. Signature sets of SNPs between T. rubrum and T. soudanense (4-bp difference) and T. violaceum and T. soudanense (3-bp difference) were identified. The RCA assay correctly identified five Trichophyton species. Although the use of two “group-specific” probes targeting both the ITS1 and the ITS2 regions were required to identify T. soudanense, the other species were identified by single ITS1- or ITS2-targeted species-specific probes. There was good agreement between ITS sequencing and the RCA assay. Despite limited genetic variation between Trichophyton spp., the sensitive, specific RCA-based SNP detection assay showed potential as a simple, reproducible method for the rapid (2-h) identification of Trichophyton spp. PMID:18234865

Definition of Eight Mulberry Species in the Genus Morus by Internal Transcribed Spacer-Based Phylogeny

PubMed Central

Zeng, Qiwei; Chen, Hongyu; Zhang, Chao; Han, Minjing; Li, Tian; Qi, Xiwu; Xiang, Zhonghuai; He, Ningjia

2015-01-01

Mulberry, belonging to the order Rosales, family Moraceae, and genus Morus, has received attention because of both its economic and medicinal value, as well as for its important ecological function. The genus Morus has a worldwide distribution, however, its taxonomy remains complex and disputed. Many studies have attempted to classify Morus species, resulting in varied numbers of designated Morus spp. To address this issue, we used information from internal transcribed spacer (ITS) genetic sequences to study the taxonomy of all the members of generally accepted genus Morus. We found that intraspecific 5.8S rRNA sequences were identical but that interspecific 5.8S sequences were diverse. M. alba and M. notabilis showed the shortest (215 bp) and the longest (233 bp) ITS1 sequence length, respectively. With the completion of the mulberry genome, we could identify single nucleotide polymorphisms within the ITS locus in the M. notabilis genome. From reconstruction of a phylogenetic tree based on the complete ITS data, we propose that the Morus genus should be classified into eight species, including M. alba, M. nigra, M. notabilis, M. serrata, M. celtidifolia, M. insignis, M. rubra, and M. mesozygia. Furthermore, the classification of the ITS sequences of known interspecific hybrid clones into both paternal and maternal clades indicated that ITS variation was sufficient to distinguish interspecific hybrids in the genus Morus. PMID:26266951

Differentiation of highly virulent strains of Streptococcus suis serotype 2 according to glutamate dehydrogenase electrophoretic and sequence type.

PubMed

Kutz, Russell; Okwumabua, Ogi

2008-10-01

The glutamate dehydrogenase (GDH) enzymes of 19 Streptococcus suis serotype 2 strains, consisting of 18 swine isolates and 1 human clinical isolate from a geographically varied collection, were analyzed by activity staining on a nondenaturing gel. All seven (100%) of the highly virulent strains tested produced an electrophoretic type (ET) distinct from those of moderately virulent and nonvirulent strains. By PCR and nucleotide sequence determination, the gdh genes of the 19 strains and of 2 highly virulent strains involved in recent Chinese outbreaks yielded a 1,820-bp fragment containing an open reading frame of 1,344 nucleotides, which encodes a protein of 448 amino acid residues with a calculated molecular mass of approximately 49 kDa. The nucleotide sequences contained base pair differences, but most were silent. Cluster analysis of the deduced amino acid sequences separated the isolates into three groups. Group I (ETI) consisted of the seven highly virulent isolates and the two Chinese outbreak strains, containing Ala(299)-to-Ser, Glu(305)-to-Lys, and Glu(330)-to-Lys amino acid substitutions compared with groups II and III (ETII). Groups II and III consisted of moderately virulent and nonvirulent strains, which are separated from each other by Tyr(72)-to-Asp and Thr(296)-to-Ala substitutions. Gene exchange studies resulted in the change of ETI to ETII and vice versa. A spectrophotometric activity assay for GDH did not show significant differences between the groups. These results suggest that the GDH ETs and sequence types may serve as useful markers in predicting the pathogenic behavior of strains of this serotype and that the molecular basis for the observed differences in the ETs was amino acid substitutions and not deletion, insertion, or processing uniqueness.

Expansion of the Preimmune Antibody Repertoire by Junctional Diversity in Bos taurus

PubMed Central

Liljavirta, Jenni; Niku, Mikael; Pessa-Morikawa, Tiina; Ekman, Anna; Iivanainen, Antti

2014-01-01

Cattle have a limited range of immunoglobulin genes which are further diversified by antigen independent somatic hypermutation in fetuses. Junctional diversity generated during somatic recombination contributes to antibody diversity but its relative significance has not been comprehensively studied. We have investigated the importance of terminal deoxynucleotidyl transferase (TdT) -mediated junctional diversity to the bovine immunoglobulin repertoire. We also searched for new bovine heavy chain diversity (IGHD) genes as the information of the germline sequences is essential to define the junctional boundaries between gene segments. New heavy chain variable genes (IGHV) were explored to address the gene usage in the fetal recombinations. Our bioinformatics search revealed five new IGHD genes, which included the longest IGHD reported so far, 154 bp. By genomic sequencing we found 26 new IGHV sequences that represent potentially new IGHV genes or allelic variants. Sequence analysis of immunoglobulin heavy chain cDNA libraries of fetal bone marrow, ileum and spleen showed 0 to 36 nontemplated N-nucleotide additions between variable, diversity and joining genes. A maximum of 8 N nucleotides were also identified in the light chains. The junctional base profile was biased towards A and T nucleotide additions (64% in heavy chain VD, 52% in heavy chain DJ and 61% in light chain VJ junctions) in contrast to the high G/C content which is usually observed in mice. Sequence analysis also revealed extensive exonuclease activity, providing additional diversity. B-lymphocyte specific TdT expression was detected in bovine fetal bone marrow by reverse transcription-qPCR and immunofluorescence. These results suggest that TdT-mediated junctional diversity and exonuclease activity contribute significantly to the size of the cattle preimmune antibody repertoire already in the fetal period. PMID:24926997

Skipping of Exons by Premature Termination of Transcription and Alternative Splicing within Intron-5 of the Sheep SCF Gene: A Novel Splice Variant

PubMed Central

Saravanaperumal, Siva Arumugam; Pediconi, Dario; Renieri, Carlo; La Terza, Antonietta

2012-01-01

Stem cell factor (SCF) is a growth factor, essential for haemopoiesis, mast cell development and melanogenesis. In the hematopoietic microenvironment (HM), SCF is produced either as a membrane-bound (−) or soluble (+) forms. Skin expression of SCF stimulates melanocyte migration, proliferation, differentiation, and survival. We report for the first time, a novel mRNA splice variant of SCF from the skin of white merino sheep via cloning and sequencing. Reverse transcriptase (RT)-PCR and molecular prediction revealed two different cDNA products of SCF. Full-length cDNA libraries were enriched by the method of rapid amplification of cDNA ends (RACE-PCR). Nucleotide sequencing and molecular prediction revealed that the primary 1519 base pair (bp) cDNA encodes a precursor protein of 274 amino acids (aa), commonly known as ‘soluble’ isoform. In contrast, the shorter (835 and/or 725 bp) cDNA was found to be a ‘novel’ mRNA splice variant. It contains an open reading frame (ORF) corresponding to a truncated protein of 181 aa (vs 245 aa) with an unique C-terminus lacking the primary proteolytic segment (28 aa) right after the D175G site which is necessary to produce ‘soluble’ form of SCF. This alternative splice (AS) variant was explained by the complete nucleotide sequencing of splice junction covering exon 5-intron (5)-exon 6 (948 bp) with a premature termination codon (PTC) whereby exons 6 to 9/10 are skipped (Cassette Exon, CE 6–9/10). We also demonstrated that the Northern blot analysis at transcript level is mediated via an intron-5 splicing event. Our data refine the structure of SCF gene; clarify the presence (+) and/or absence (−) of primary proteolytic-cleavage site specific SCF splice variants. This work provides a basis for understanding the functional role and regulation of SCF in hair follicle melanogenesis in sheep beyond what was known in mice, humans and other mammals. PMID:22719917

Sequence and genetic organization of a Zymomonas mobilis gene cluster that encodes several enzymes of glucose metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barnell, W.O.; Kyung Cheol Yi; Conway, T.

1990-12-01

The Zymomonas mobilis genes that encode glucose-6-phosphate dehydrogenase (zwf), 6-phosphogluconate dehydratase (edd), and glucokinase (glk) were cloned independently by genetic complementation of specific defects in Escherichia coli metabolism. The identify of these cloned genes was confirmed by various biochemical means. Nucleotide sequence analysis established that these three genes are clustered on the genome and revealed an additional open reading frame in this region that has significant amino acid identity to the E.coli xylose-proton symporter and the human glucose transporter. On the basis of this evidence and structural analysis of the deduced primary amino acid sequence, this gene is believed tomore » encode the Z. mobilis glucose-facilitated diffusion protein, glf. The four genes in the 6-kb cluster are organized in the order glf, zwf, edd, glk. The glf and zwf genes are separated by 146 bp. The zwf and edd genes overlap by 8 bp, and their expression may be translationally coupled. The edd and glk genes are separated by 203 bp. The glk gene is followed by tandem transcriptional terminators. The four genes appear to be organized in an operon. Such an arrangement of the genes that govern glucose uptake and the first three steps of the Entner-Doudoroff glycolytic pathway provides the organism with a mechanism for carefully regulating the levels of the enzymes that control carbon flux into the pathway.« less

A reference human genome dataset of the BGISEQ-500 sequencer.

PubMed

Huang, Jie; Liang, Xinming; Xuan, Yuankai; Geng, Chunyu; Li, Yuxiang; Lu, Haorong; Qu, Shoufang; Mei, Xianglin; Chen, Hongbo; Yu, Ting; Sun, Nan; Rao, Junhua; Wang, Jiahao; Zhang, Wenwei; Chen, Ying; Liao, Sha; Jiang, Hui; Liu, Xin; Yang, Zhaopeng; Mu, Feng; Gao, Shangxian

2017-05-01

BGISEQ-500 is a new desktop sequencer developed by BGI. Using DNA nanoball and combinational probe anchor synthesis developed from Complete Genomics™ sequencing technologies, it generates short reads at a large scale. Here, we present the first human whole-genome sequencing dataset of BGISEQ-500. The dataset was generated by sequencing the widely used cell line HG001 (NA12878) in two sequencing runs of paired-end 50 bp (PE50) and two sequencing runs of paired-end 100 bp (PE100). We also include examples of the raw images from the sequencer for reference. Finally, we identified variations using this dataset, estimated the accuracy of the variations, and compared to that of the variations identified from similar amounts of publicly available HiSeq2500 data. We found similar single nucleotide polymorphism (SNP) detection accuracy for the BGISEQ-500 PE100 data (false positive rate [FPR] = 0.00020%, sensitivity = 96.20%) compared to the PE150 HiSeq2500 data (FPR = 0.00017%, sensitivity = 96.60%) better SNP detection accuracy than the PE50 data (FPR = 0.0006%, sensitivity = 94.15%). But for insertions and deletions (indels), we found lower accuracy for BGISEQ-500 data (FPR = 0.00069% and 0.00067% for PE100 and PE50 respectively, sensitivity = 88.52% and 70.93%) than the HiSeq2500 data (FPR = 0.00032%, sensitivity = 96.28%). Our dataset can serve as the reference dataset, providing basic information not just for future development, but also for all research and applications based on the new sequencing platform. © The Authors 2017. Published by Oxford University Press.

Identification of a Novel Human Papillomavirus, Type HPV199, Isolated from a Nasopharynx and Anal Canal, and Complete Genomic Characterization of Papillomavirus Species Gamma-12

PubMed Central

Oštrbenk, Anja; Kocjan, Boštjan J.; Hošnjak, Lea; Li, Jingjing; Deng, Qiuju; Šterbenc, Anja; Poljak, Mario

2015-01-01

The novel human papillomavirus type 199 (HPV199) was initially identified in a nasopharyngeal swab sample obtained from a 25 year-old immunocompetent male. The complete genome of HPV199 is 7,184 bp in length with a GC content of 36.5%. Comparative genomic characterization of HPV199 and its closest relatives showed the classical genomic organization of Gammapapillomaviruses (Gamma-PVs). HPV199 has seven major open reading frames (ORFs), encoding five early (E1, E2, E4, E6, and E7) and two late (L1 and L2) proteins, while lacking the E5 ORF. The long control region (LCR) of 513 bp is located between the L1 and E6 ORFs. Phylogenetic analysis additionally confirmed that HPV-199 clusters into the Gamma-PV genus, species Gamma-12, additionally containing HPV127, HV132, HPV148, HPV165, and three putative HPV types: KC5, CG2 and CG3. HPV199 is most closely related to HPV127 (nucleotide identity 77%). The complete viral genome sequence of additional HPV199 isolate was determined from anal canal swab sample. Two HPV199 complete viral sequences exhibit 99.4% nucleotide identity. To the best of our knowledge, this is the first member of Gamma-PV with complete nucleotide sequences determined from two independent clinical samples. To evaluate the tissue tropism of the novel HPV type, 916 clinical samples were tested using HPV199 type-specific real-time PCR: HPV199 was detected in 2/76 tissue samples of histologically confirmed common warts, 2/108 samples of eyebrow hair follicles, 2/137 anal canal swabs obtained from individuals with clinically evident anal pathology, 4/184 nasopharyngeal swabs and 3/411 cervical swabs obtained from women with normal cervical cytology. Although HPV199 was found in 1.4% of cutaneous and mucosal samples only, it exhibits dual tissue tropism. According to the results of our study and literature data, dual tropism of all Gamma-12 members is highly possible. PMID:26375679

Concholepas concholepas Ferritin H-like subunit (CcFer): Molecular characterization and single nucleotide polymorphism associated to innate immune response.

PubMed

Chávez-Mardones, Jacqueline; Valenzuela-Muñoz, Valentina; Núñez-Acuña, Gustavo; Maldonado-Aguayo, Waleska; Gallardo-Escárate, Cristian

2013-09-01

Ferritin has been identified as the principal protein of iron storage and iron detoxification, playing a pivotal role for the cellular homeostasis in living organisms. However, recent studies in marine invertebrates have suggested its association with innate immune system. In the present study, one Ferritin subunit was identified from the gastropod Concholepas concholepas (CcFer), which was fully characterized by Rapid Amplification of cDNA Ends technique. Simultaneously, a challenge test was performed to evaluate the immune response against Vibrio anguillarum. The full length of cDNA Ccfer was 1030 bp, containing 513 bp of open reading frame that encodes to 170 amino acid peptide, which was similar to the Ferritin H subunit described in vertebrates. Untranslated Regions (UTRs) were identified with a 5'UTR of 244 bp that contains iron responsive element (IRE), and a 3'UTR of 273 bp. The predicted molecular mass of deduced amino acid of CcFer was 19.66 kDa and isoelectric point of 4.92. Gene transcription analysis revealed that CcFer increases against infections with V. anguillarum, showing a peak expression at 6 h post-infection. Moreover, a single nucleotide polymorphism was detected at -64 downstream 5'UTR sequence (SNP-64). Quantitative real time analysis showed that homozygous mutant allele (TT) was significantly associated with higher expression levels of the challenged group compared to wild (CC) and heterozygous (CT) variants. Our findings suggest that CcFer is associated to innate immune response in C. concholepas and that the presence of SNPs may involve differential transcriptional expression of CcFer. Copyright © 2013 Elsevier Ltd. All rights reserved.

Molecular cloning, expression profile, polymorphism and the genetic effects of the dopamine D1 receptor gene on duck reproductive traits.

PubMed

Wang, Cui; Li, Shijun; Li, Chuang; Feng, Yanping; Peng, Xiuli; Gong, Yanzhang

2012-09-01

The dopamine D1 receptor (DRD1), a member of the dopamine receptor (DR) gene family, participates in the regulation of reproductive behaviors in birds. In this study, a 1,390 bp fragment covering the complete coding region (CDS) of duck DRD1 gene was obtained. The cDNA (GenBank: JQ346726) contains a 1,353 bp CDS and a 37 bp 3'- UTR including a TGA termination codon (nucleotides 1,354-1,356 bp). The duck DRD1 shares about 76-96 % nucleic acid identity and 82-98 % amino acid identity with their counterparts in other species. A phylogenetic tree based on amino acid sequences displays that duck DRD1 protein is closely related with those of chicken and zebra finch. The quantitative real-time PCR analysis indicates that the DRD1 mRNA is widely expressed in all examined tissues. Five single nucleotide polymorphisms (SNPs) (c.189A > T, c.507C > T, c.681C > T, c.765A > T, c.1044A > G) in the CDS of duck DRD1 gene were indentified, c.681C > T and c.765A > T were genotyped and analyzed in a two generations duck population by using of PCR-RFLP. Association analysis demonstrated that the c.681C > T genotypes were significantly associated with body weight at sexual maturity (when laying their first egg) (P < 0.01), egg production within 360 days (P < 0.05) and 420 days (P < 0.01); the c.765A > T genotypes were significantly associated with egg shape index and egg shell strength (P < 0.05). Those results suggest that the DRD1 gene may be a potential genetic marker to improve some reproductive traits in ducks.

Genetic characterization of the oxytocin-neurophysin I gene (OXT) and its regulatory regions analysis in domestic Old and New World camelids

PubMed Central

Ogah, Danlami Moses; Iannaccone, Marco; Erhardt, Georg; Di Stasio, Liliana; Cosenza, Gianfranco

2018-01-01

Oxytocin is a neurohypophysial peptide linked to a wide range of biological functions, including milk ejection, temperament and reproduction. Aims of the present study were a) the characterization of the OXT (Oxytocin-neurophysin I) gene and its regulatory regions in Old and New world camelids; b) the investigation of the genetic diversity and the discovery of markers potentially affecting the gene regulation. On average, the gene extends over 814 bp, ranging between 825 bp in dromedary, 811 bp in Bactrian and 810 bp in llama and alpaca. Such difference in size is due to a duplication event of 21 bp in dromedary. The main regulatory elements, including the composite hormone response elements (CHREs), were identified in the promoter, whereas the presence of mature microRNAs binding sequences in the 3’UTR improves the knowledge on the factors putatively involved in the OXT gene regulation, although their specific biological effect needs to be still elucidated. The sequencing of genomic DNA allowed the identification of 17 intraspecific polymorphisms and 69 nucleotide differences among the four species. One of these (MF464535:g.622C>G) is responsible, in alpaca, for the loss of a consensus sequence for the transcription factor SP1. Furthermore, the same SNP falls within a CpG island and it creates a new methylation site, thus opening future possibilities of investigation to verify the influence of the novel allelic variant in the OXT gene regulation. A PCR-RFLP method was setup for the genotyping and the frequency of the allele C was 0.93 in a population of 71 alpacas. The obtained data clarify the structure of OXT gene in domestic camelids and add knowledge to the genetic variability of a genomic region, which has received little investigation so far. These findings open the opportunity for new investigations, including association studies with productive and reproductive traits. PMID:29608621

Genetic characterization of the oxytocin-neurophysin I gene (OXT) and its regulatory regions analysis in domestic Old and New World camelids.

PubMed

Pauciullo, Alfredo; Ogah, Danlami Moses; Iannaccone, Marco; Erhardt, Georg; Di Stasio, Liliana; Cosenza, Gianfranco

2018-01-01

Oxytocin is a neurohypophysial peptide linked to a wide range of biological functions, including milk ejection, temperament and reproduction. Aims of the present study were a) the characterization of the OXT (Oxytocin-neurophysin I) gene and its regulatory regions in Old and New world camelids; b) the investigation of the genetic diversity and the discovery of markers potentially affecting the gene regulation. On average, the gene extends over 814 bp, ranging between 825 bp in dromedary, 811 bp in Bactrian and 810 bp in llama and alpaca. Such difference in size is due to a duplication event of 21 bp in dromedary. The main regulatory elements, including the composite hormone response elements (CHREs), were identified in the promoter, whereas the presence of mature microRNAs binding sequences in the 3'UTR improves the knowledge on the factors putatively involved in the OXT gene regulation, although their specific biological effect needs to be still elucidated. The sequencing of genomic DNA allowed the identification of 17 intraspecific polymorphisms and 69 nucleotide differences among the four species. One of these (MF464535:g.622C>G) is responsible, in alpaca, for the loss of a consensus sequence for the transcription factor SP1. Furthermore, the same SNP falls within a CpG island and it creates a new methylation site, thus opening future possibilities of investigation to verify the influence of the novel allelic variant in the OXT gene regulation. A PCR-RFLP method was setup for the genotyping and the frequency of the allele C was 0.93 in a population of 71 alpacas. The obtained data clarify the structure of OXT gene in domestic camelids and add knowledge to the genetic variability of a genomic region, which has received little investigation so far. These findings open the opportunity for new investigations, including association studies with productive and reproductive traits.

Functional Genomics Analysis of Singapore Grouper Iridovirus: Complete Sequence Determination and Proteomic Analysis

PubMed Central

Song, Wen Jun; Qin, Qi Wei; Qiu, Jin; Huang, Can Hua; Wang, Fan; Hew, Choy Leong

2004-01-01

Here we report the complete genome sequence of Singapore grouper iridovirus (SGIV). Sequencing of the random shotgun and restriction endonuclease genomic libraries showed that the entire SGIV genome consists of 140,131 nucleotide bp. One hundred sixty-two open reading frames (ORFs) from the sense and antisense DNA strands, coding for lengths varying from 41 to 1,268 amino acids, were identified. Computer-assisted analyses of the deduced amino acid sequences revealed that 77 of the ORFs exhibited homologies to known virus genes, 23 of which matched functional iridovirus proteins. Forty-two putative conserved domains or signatures were detected in the National Center for Biotechnology Information CD-Search database and PROSITE database. An assortment of enzyme activities involved in DNA replication, transcription, nucleotide metabolism, cell signaling, etc., were identified. Viruses were cultured on a cell line derived from the embryonated egg of the grouper Epinephelus tauvina, isolated, and purified by sucrose gradient ultracentrifugation. The protein extract from the purified virions was analyzed by polyacrylamide gel electrophoresis followed by in-gel digestion of protein bands. Matrix-assisted laser desorption ionization-time of flight mass spectrometry and database searching led to identification of 26 proteins. Twenty of these represented novel or previously unidentified genes, which were further confirmed by reverse transcription-PCR (RT-PCR) and DNA sequencing of their respective RT-PCR products. PMID:15507645

The complete mitochondrial genome of the common sea slater, Ligia oceanica (Crustacea, Isopoda) bears a novel gene order and unusual control region features

PubMed Central

Kilpert, Fabian; Podsiadlowski, Lars

2006-01-01

Background Sequence data and other characters from mitochondrial genomes (gene translocations, secondary structure of RNA molecules) are useful in phylogenetic studies among metazoan animals from population to phylum level. Moreover, the comparison of complete mitochondrial sequences gives valuable information about the evolution of small genomes, e.g. about different mechanisms of gene translocation, gene duplication and gene loss, or concerning nucleotide frequency biases. The Peracarida (gammarids, isopods, etc.) comprise about 21,000 species of crustaceans, living in many environments from deep sea floor to arid terrestrial habitats. Ligia oceanica is a terrestrial isopod living at rocky seashores of the european North Sea and Atlantic coastlines. Results The study reveals the first complete mitochondrial DNA sequence from a peracarid crustacean. The mitochondrial genome of Ligia oceanica is a circular double-stranded DNA molecule, with a size of 15,289 bp. It shows several changes in mitochondrial gene order compared to other crustacean species. An overview about mitochondrial gene order of all crustacean taxa yet sequenced is also presented. The largest non-coding part (the putative mitochondrial control region) of the mitochondrial genome of Ligia oceanica is unexpectedly not AT-rich compared to the remainder of the genome. It bears two repeat regions (4× 10 bp and 3× 64 bp), and a GC-rich hairpin-like secondary structure. Some of the transfer RNAs show secondary structures which derive from the usual cloverleaf pattern. While some tRNA genes are putative targets for RNA editing, trnR could not be localized at all. Conclusion Gene order is not conserved among Peracarida, not even among isopods. The two isopod species Ligia oceanica and Idotea baltica show a similarly derived gene order, compared to the arthropod ground pattern and to the amphipod Parhyale hawaiiensis, suggesting that most of the translocation events were already present the last common ancestor of these isopods. Beyond that, the positions of three tRNA genes differ in the two isopod species. Strand bias in nucleotide frequency is reversed in both isopod species compared to other Malacostraca. This is probably due to a reversal of the replication origin, which is further supported by the fact that the hairpin structure typically found in the control region shows a reversed orientation in the isopod species, compared to other crustaceans. PMID:16987408

Phylogeny and polymorphism in the long control regions E6, E7, and L1 of HPV Type 56 in women from southwest China

PubMed Central

Jing, Yaling; Wang, Tao; Chen, Zuyi; Ding, Xianping; Xu, Jianju; Mu, Xuemei; Cao, Man; Chen, Honghan

2018-01-01

Globally, human papillomavirus (HPV)-56 accounts for a small proportion of all high-risk HPV types; however, HPV-56 is detected at a higher rate in Asia, particularly in southwest China. The present study analyzed polymorphisms, intratypic variants, and genetic variability in the long control regions (LCR), E6, E7, and L1 of HPV-56 (n=75). The LCRs, E6, E7 and L1 were sequenced using a polymerase chain reaction and the sequences were submitted to GenBank. Maximum-likelihood trees were constructed using Kimura's two-parameter model, followed by secondary structure analysis and protein damaging prediction. Additionally, in order to assess the effect of variations in the LCR on putative binding sites for cellular proteins, MATCH server was used. Finally, the selection pressures of the E6-E7 and L1 genes were estimated. A total of 18 point substitutions, a 42-bp deletion and a 19-bp deletion of LCR were identified. Some of those mutations are embedded in the putative binding sites for transcription factors. 18 single nucleotide changes occurred in the E6-E7 sequence, 11/18 were non-synonymous substitutions and 7/18 were synonymous mutations. A total 24 single nucleotide changes were identified in the L1 sequence, 6/24 being non-synonymous mutations and 18/24 synonymous mutations. Selective pressure analysis predicted that the majority of mutations of HPV-56 E6, E7 and L1 were of positive selection. The phylogenetic tree demonstrated that the isolates distributed in two lineages. Data on the prevalence and genetic variation of HPV-56 types in southwest China may aid future studies on viral molecular mechanisms and contribute to future investigations of diagnostic probes and therapeutic vaccines. PMID:29568922

Identification of Genes Encoding Conjugated Bile Salt Hydrolase and Transport in Lactobacillus johnsonii 100-100

PubMed Central

Elkins, Christopher A.; Savage, Dwayne C.

1998-01-01

Cytosolic extracts of Lactobacillus johnsonii 100-100 (previously reported as Lactobacillus sp. strain 100-100) contain four heterotrimeric isozymes composed of two peptides, α and β, with conjugated bile salt hydrolase (BSH) activity. We now report cloning, from the genome of strain 100-100, a 2,977-bp DNA segment that expresses BSH activity in Escherichia coli. The sequencing of this segment showed that it contained one complete and two partial open reading frames (ORFs). The 3′ partial ORF (927 nucleotides) was predicted by BLAST and confirmed with 5′ and 3′ deletions to be a BSH gene. Thermal asymmetric interlaced PCR was used to extend and complete the 948-nucleotide sequence of the BSH gene 3′ of the cloned segment. The predicted amino acid sequence of the 5′ partial ORF (651 nucleotides) was about 80% similar to the C-terminal half of the largest, complete ORF (1,353 nucleotides), and these two putative proteins were similar to several amine, multidrug resistance, and sugar transport proteins of the major facilitator superfamily. E. coli DH5α cells transformed with a construct containing these ORFs, in concert with an extracellular factor produced by strain 100-100, demonstrated levels of uptake of [14C]taurocholic acid that were increased as much as threefold over control levels. [14C]Cholic acid was taken up in similar amounts by strain DH5α pSportI (control) and DH5α p2000 (transport clones). These findings support a hypothesis that the ORFs are conjugated bile salt transport genes which may be arranged in an operon with BSH genes. PMID:9721268

The Linum usitatissimum L. plastome reveals atypical structural evolution, new editing sites, and the phylogenetic position of Linaceae within Malpighiales.

PubMed

de Santana Lopes, Amanda; Pacheco, Túlio Gomes; Santos, Karla Gasparini Dos; Vieira, Leila do Nascimento; Guerra, Miguel Pedro; Nodari, Rubens Onofre; de Souza, Emanuel Maltempi; de Oliveira Pedrosa, Fábio; Rogalski, Marcelo

2018-02-01

The plastome of Linum usitatissimum was completely sequenced allowing analyses of evolution of genome structure, RNA editing sites, molecular markers, and indicating the position of Linaceae within Malpighiales. Flax (Linum usitatissimum L.) is an economically important crop used as food, feed, and industrial feedstock. It belongs to the Linaceae family, which is noted by high morphological and ecological diversity. Here, we reported the complete sequence of flax plastome, the first species within Linaceae family to have the plastome sequenced, assembled and characterized in detail. The plastome of flax is a circular DNA molecule of 156,721 bp with a typical quadripartite structure including two IRs of 31,990 bp separating the LSC of 81,767 bp and the SSC of 10,974 bp. It shows two expansion events from IRB to LSC and from IRB to SSC, and a contraction event in the IRA-LSC junction, which changed significantly the size and the gene content of LSC, SSC and IRs. We identified 109 unique genes and 2 pseudogenes (rpl23 and ndhF). The plastome lost the conserved introns of clpP gene and the complete sequence of rps16 gene. The clpP, ycf1, and ycf2 genes show high nucleotide and aminoacid divergence, but they still possibly retain the functionality. Moreover, we also identified 176 SSRs, 20 tandem repeats, and 39 dispersed repeats. We predicted in 18 genes a total of 53 RNA editing sites of which 32 were not found before in other species. The phylogenetic inference based on 63 plastid protein-coding genes of 38 taxa supports three major clades within Malpighiales order. One of these clades has flax (Linaceae) sister to Chrysobalanaceae family, differing from earlier studies that included Linaceae into the euphorbioid clade.

The complete mitochondrial genome of the fall webworm, Hyphantria cunea (Lepidoptera: Arctiidae)

PubMed Central

Liao, Fang; Wang, Lin; Wu, Song; Li, Yu-Ping; Zhao, Lei; Huang, Guo-Ming; Niu, Chun-Jing; Liu, Yan-Qun; Li, Ming-Gang

2010-01-01

The complete mitochondrial genome (mitogenome) of the fall webworm, Hyphantria cunea (Lepidoptera: Arctiidae) was determined. The genome is a circular molecule 15 481 bp long. It presents a typical gene organization and order for completely sequenced lepidopteran mitogenomes, but differs from the insect ancestral type for the placement of tRNAMet. The nucleotide composition of the genome is also highly A + T biased, accounting for 80.38%, with a slightly positive AT skewness (0.010), indicating the occurrence of more As than Ts, as found in the Noctuoidea species. All protein-coding genes (PCGs) are initiated by ATN codons, except for COI, which is tentatively designated by the CGA codon as observed in other lepidopterans. Four of 13 PCGs harbor the incomplete termination codon, T or TA. All tRNAs have a typical clover-leaf structure of mitochondrial tRNAs, except for tRNASer(AGN), the DHU arm of which could not form a stable stem-loop structure. The intergenic spacer sequence between tRNASer(AGN) and ND1 also contains the ATACTAA motif, which is conserved across the Lepidoptera order. The H. cunea A+T-rich region of 357 bp is comprised of non-repetitive sequences, but harbors several features common to the Lepidoptera insects, including the motif ATAGA followed by an 18 bp poly-T stretch, a microsatellite-like (AT)8 element preceded by the ATTTA motif, an 11 bp poly-A present immediately upstream tRNAMet. The phylogenetic analyses support the view that the H. cunea is closerly related to the Lymantria dispar than Ochrogaster lunifer, and support the hypothesis that Noctuoidea (H. cunea, L. dispar, and O. lunifer) and Geometroidea (Phthonandria atrilineata) are monophyletic. However, in the phylogenetic trees based on mitogenome sequences among the lepidopteran superfamilies, Papillonoidea (Artogeia melete, Acraea issoria, and Coreana raphaelis) joined basally within the monophyly of Lepidoptera, which is different to the traditional classification. PMID:20376208

Enhanced Gene Expression Rather than Natural Polymorphism in Coding Sequence of the OsbZIP23 Determines Drought Tolerance and Yield Improvement in Rice Genotypes

PubMed Central

Dey, Avishek; Samanta, Milan Kumar; Gayen, Srimonta; Sen, Soumitra K.; Maiti, Mrinal K.

2016-01-01

Drought is one of the major limiting factors for productivity of crops including rice (Oryza sativa L.). Understanding the role of allelic variations of key regulatory genes involved in stress-tolerance is essential for developing an effective strategy to combat drought. The bZIP transcription factors play a crucial role in abiotic-stress adaptation in plants via abscisic acid (ABA) signaling pathway. The present study aimed to search for allelic polymorphism in the OsbZIP23 gene across selected drought-tolerant and drought-sensitive rice genotypes, and to characterize the new allele through overexpression (OE) and gene-silencing (RNAi). Analyses of the coding DNA sequence (CDS) of the cloned OsbZIP23 gene revealed single nucleotide polymorphism at four places and a 15-nucleotide deletion at one place. The single-copy OsbZIP23 gene is expressed at relatively higher level in leaf tissues of drought-tolerant genotypes, and its abundance is more in reproductive stage. Cloning and sequence analyses of the OsbZIP23-promoter from drought-tolerant O. rufipogon and drought-sensitive IR20 cultivar showed variation in the number of stress-responsive cis-elements and a 35-nucleotide deletion at 5’-UTR in IR20. Analysis of the GFP reporter gene function revealed that the promoter activity of O. rufipogon is comparatively higher than that of IR20. The overexpression of any of the two polymorphic forms (1083 bp and 1068 bp CDS) of OsbZIP23 improved drought tolerance and yield-related traits significantly by retaining higher content of cellular water, soluble sugar and proline; and exhibited decrease in membrane lipid peroxidation in comparison to RNAi lines and non-transgenic plants. The OE lines showed higher expression of target genes-OsRab16B, OsRab21 and OsLEA3-1 and increased ABA sensitivity; indicating that OsbZIP23 is a positive transcriptional-regulator of the ABA-signaling pathway. Taken together, the present study concludes that the enhanced gene expression rather than natural polymorphism in coding sequence of OsbZIP23 is accountable for improved drought tolerance and yield performance in rice genotypes. PMID:26959651

Nucleotide Diversity and Selection Signature in the Domesticated Silkworm, Bombyx mori, and Wild Silkworm, Bombyx mandarina

PubMed Central

Guo, Yi; Shen, Yi-Hong; Sun, Wei; Kishino, Hirohisa; Xiang, Zhong-Huai; Zhang, Ze

2011-01-01

To investigate the patterns of nucleotide diversity in domesticated silkworm, Bombyx mori L. (Lepidoptera: Bombycidae) and its wild relative, Chinese wild silkworm, Bombyx mandarina Moore, we sequenced nine nuclear genes. Neutrality test and coalescent simulation for these genes were performed to look at bottleneck intensity and selection signature; linkage disequilibrium (LD) within and between loci was employed to investigate allele association. As a result, B. mori lost 33–49% of nucleotide diversity relative to wild silkworm, which is similar to the loss levels found in major cultivated crops. Diversity of B. mori is significantly lower than that of B. mandarina measured as πtotal (0.01166 vs. 0.1741) or θW(0.01124 vs. 0.02206). Bottleneck intensity of domesticated silkworm is 1.5 (in terms of k = Nb/d, Nb-bottleneck population size; d-bottleneck duration) with different durations. Gene DefA showed signature of artificial selection by all analysis methods and might experience strong artificial selection in B. mori during domestication. For nine loci, both curves of LD decay rapidly within 200 bp and drop slowly when distance is > 200 bp, although that of B. mori decays slower than B. mandarina at loci investigated. However, LD could not be estimated at DefA in B. mori and at ER in both silkworms. Elevated LD observed in B. mori may be indicator of selection and demographic events. PMID:22239062

The complete mitogenome of Ginkgo-toothed beaked whale (Mesoplodon ginkgodens) (Chordata: Ziphiidae).

PubMed

Yao, Chiou-Ju; Chen, Ching-Hung; Hsiao, Chung-Der

2016-07-01

In this study, we used the next-generation sequencing method to deduce the complete mitogenome of Ginkgo-toothed beaked whale (Mesoplodon ginkgodens) for the first time. The nucleotide composition was asymmetric (33.3% A, 25.3% C, 12.6% G, and 28.7% T) with an overall GC content of 37.9%. The length of the assembled mitogenome was 16,339 bp and follows the typical vertebrate arrangement, including 13 protein coding genes, 22 transfer RNAs, 2 ribosomal RNAs genes, and a non-coding control region of D-loop. The D-loop contains 870 bp and is located between tRNA-Pro and tRNA-Phe. The complete mitogenome of Ginkgo-toothed beaked whale deduced in this study provides essential and important DNA molecular data for further phylogenetic and evolutionary analysis for cetaceans.

Identification of Sinorhizobium (Ensifer) medicae based on a specific genomic sequence unveiled by M13-PCR fingerprinting.

PubMed

Dourado, Ana Catarina; Alves, Paula I L; Tenreiro, Tania; Ferreira, Eugénio M; Tenreiro, Rogério; Fareleira, Paula; Crespo, M Teresa Barreto

2009-12-01

A collection of nodule isolates from Medicago polymorpha obtained from southern and central Portugal was evaluated by M13-PCR fingerprinting and hierarchical cluster analysis. Several genomic clusters were obtained which, by 16S rRNA gene sequencing of selected representatives, were shown to be associated with particular taxonomic groups of rhizobia and other soil bacteria. The method provided a clear separation between rhizobia and co-isolated non-symbiotic soil contaminants. Ten M13-PCR groups were assigned to Sinorhizobium (Ensifer) medicae and included all isolates responsible for the formation of nitrogen-fixing nodules upon re-inoculation of M. polymorpha test-plants. In addition, enterobacterial repetitive intergenic consensus (ERIC)-PCR fingerprinting indicated a high genomic heterogeneity within the major M13- PCR clusters of S. medicae isolates. Based on nucleotide sequence data of an M13-PCR amplicon of ca. 1500 bp, observed only in S. medicae isolates and spanning locus Smed_3707 to Smed_3709 from the pSMED01 plasmid sequence of S. medicae WSM419 genome's sequence, a pair of PCR primers was designed and used for direct PCR amplification of a 1399-bp sequence within this fragment. Additional in silico and in vitro experiments, as well as phylogenetic analysis, confirmed the specificity of this primer combination and therefore the reliability of this approach in the prompt identification of S. medicae isolates and their distinction from other soil bacteria.

Partial bisulfite conversion for unique template sequencing

PubMed Central

Kumar, Vijay; Rosenbaum, Julie; Wang, Zihua; Forcier, Talitha; Ronemus, Michael; Wigler, Michael

2018-01-01

Abstract We introduce a new protocol, mutational sequencing or muSeq, which uses sodium bisulfite to randomly deaminate unmethylated cytosines at a fixed and tunable rate. The muSeq protocol marks each initial template molecule with a unique mutation signature that is present in every copy of the template, and in every fragmented copy of a copy. In the sequenced read data, this signature is observed as a unique pattern of C-to-T or G-to-A nucleotide conversions. Clustering reads with the same conversion pattern enables accurate count and long-range assembly of initial template molecules from short-read sequence data. We explore count and low-error sequencing by profiling 135 000 restriction fragments in a PstI representation, demonstrating that muSeq improves copy number inference and significantly reduces sporadic sequencer error. We explore long-range assembly in the context of cDNA, generating contiguous transcript clusters greater than 3,000 bp in length. The muSeq assemblies reveal transcriptional diversity not observable from short-read data alone. PMID:29161423

A SINE in the genome of the cephalochordate amphioxus is an Alu element

PubMed Central

Holland, Linda Z.

2006-01-01

Transposable elements of about 300 bp, termed “short interspersed nucleotide elements or SINEs are common in eukaryotes. However, Alu elements, SINEs containing restriction sites for the AluI enzyme, have been known only from primates. Here I report the first SINE found in the genome of the cephalochordate, amphioxus. It is an Alu element of 375 bp that does not share substantial identity with any genomic sequences in vertebrates. It was identified because it was located in the FoxD regulatory region in a cosmid derived from one individual, but absent from the two FoxD alleles of BACs from a second individual. However, searches of sequences of BACs and genomic traces from this second individual gave an estimate of 50-100 copies in the amphioxus genome. The finding of an Alu element in amphioxus raises the question of whether Alu elements in amphioxus and primates arose by convergent evolution or by inheritance from a common ancestor. Genome-wide analyses of transposable elements in amphioxus and other chordates such as tunicates, agnathans and cartilaginous fishes could well provide the answer. PMID:16733535

Rabies among African wild dogs (Lycaon pictus) in the Masai Mara, Kenya.

PubMed

Kat, P W; Alexander, K A; Smith, J S; Richardson, J D; Munson, L

1996-10-01

A pack of African wild dogs (Lycaon pictus) ranging to the north of the Masai Mara National Reserve in southwestern Kenya was monitored from 1988 to 1989. During a 6-week period (August 1-September 13, 1989), 21 of 23 members of this pack died. Seven carcasses were retrieved, of which 4 were suitable for necropsy and histopathologic examination. Gross findings varied among individuals and included multiple bite wounds, synovitis, lymphadenopathy, submandibular, cervical, and vocal cord edema, blood in bronchi, bronchioles, stomach, and intestine, and interioventral lung lobe consolidation. Histologic examination of 2 available brain samples revealed nonsuppurative encephalitis with eosinophilic intracytoplasmic inclusions (Negri bodies). An additional brain sample tested positive for rabies via a fluorescent antibody test. Other histologic features included severe suppurative bronchopneumonia, myocarditis, and lymphoid depletion of the lymph nodes, tonsils, and spleen. A 304-base pair (bp) nucleotide sequence from the N gene and a 310-bp sequence from the G gene from rabies isolates of 4 wild dogs indicated that infection was with a rabies variant common among domestic dogs in Kenya and Tanzania.

Complete genome sequences of Geobacillus sp. Y412MC52, a xylan-degrading strain isolated from obsidian hot spring in Yellowstone National Park.

PubMed

Brumm, Phillip; Land, Miriam L; Hauser, Loren J; Jeffries, Cynthia D; Chang, Yun-Juan; Mead, David A

2015-01-01

Geobacillus sp. Y412MC52 was isolated from Obsidian Hot Spring, Yellowstone National Park, Montana, USA under permit from the National Park Service. The genome was sequenced, assembled, and annotated by the DOE Joint Genome Institute and deposited at the NCBI in December 2011 (CP002835). Based on 16S rRNA genes and average nucleotide identity, Geobacillus sp. Y412MC52 and the related Geobacillus sp. Y412MC61 appear to be members of a new species of Geobacillus. The genome of Geobacillus sp. Y412MC52 consists of one circular chromosome of 3,628,883 bp, an average G + C content of 52 % and one circular plasmid of 45,057 bp and an average G + C content of 45 %. Y412MC52 possesses arabinan, arabinoglucuronoxylan, and aromatic acid degradation clusters for degradation of hemicellulose from biomass. Transport and utilization clusters are also present for other carbohydrates including starch, cellobiose, and α- and β-galactooligosaccharides.

Complete genome sequences of Geobacillus sp. Y412MC52, a xylan-degrading strain isolated from obsidian hot spring in Yellowstone National Park

DOE PAGES

Brumm, Phillip; Land, Miriam L.; Hauser, Loren J.; ...

2015-10-19

We isolated geobacillus sp. Y412MC52 from Obsidian Hot Spring, Yellowstone National Park, Montana, USA under permit from the National Park Service. The genome was sequenced, assembled, and annotated by the DOE Joint Genome Institute and deposited at the NCBI in December 2011 (CP002835). Based on 16S rRNA genes and average nucleotide identity, Geobacillus sp. Y412MC52 and the related Geobacillus sp. Y412MC61 appear to be members of a new species of Geobacillus. Moreover, te genome of Geobacillus sp. Y412MC52 consists of one circular chromosome of 3,628,883 bp, an average G + C content of 52 % and one circular plasmid ofmore » 45,057 bp and an average G + C content of 45 %. Y412MC52 possesses arabinan, arabinoglucuronoxylan, and aromatic acid degradation clusters for degradation of hemicellulose from biomass. Finally, we present transport and utilization clusters for other carbohydrates including starch, cellobiose, and - and -galactooligosaccharides.« less

Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

PubMed

Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

2015-10-01

Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

Complete genome sequences of Geobacillus sp. Y412MC52, a xylan-degrading strain isolated from obsidian hot spring in Yellowstone National Park

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brumm, Phillip; Land, Miriam L.; Hauser, Loren J.

We isolated geobacillus sp. Y412MC52 from Obsidian Hot Spring, Yellowstone National Park, Montana, USA under permit from the National Park Service. The genome was sequenced, assembled, and annotated by the DOE Joint Genome Institute and deposited at the NCBI in December 2011 (CP002835). Based on 16S rRNA genes and average nucleotide identity, Geobacillus sp. Y412MC52 and the related Geobacillus sp. Y412MC61 appear to be members of a new species of Geobacillus. Moreover, te genome of Geobacillus sp. Y412MC52 consists of one circular chromosome of 3,628,883 bp, an average G + C content of 52 % and one circular plasmid ofmore » 45,057 bp and an average G + C content of 45 %. Y412MC52 possesses arabinan, arabinoglucuronoxylan, and aromatic acid degradation clusters for degradation of hemicellulose from biomass. Finally, we present transport and utilization clusters for other carbohydrates including starch, cellobiose, and - and -galactooligosaccharides.« less

The complete mitochondrial genomes of the Fenton′s wood white, Leptidea morsei, and the lemon emigrant, Catopsilia pomona

PubMed Central

Hao, Juan-Juan; Hao, Jia-Sheng; Sun, Xiao-Yan; Zhang, Lan-Lan; Yang, Qun

2014-01-01

Abstract The complete mitochondrial genomes of Leptidea morsei Fenton (Lepidoptera: Pieridae: Dis-morphiinae) and Catopsilia pomona (F.) (Lepidoptera: Pieridae: Coliadinae) were determined to be 15,122 and 15,142 bp in length, respectively, with that of L . morsei being the smallest among all known butterflies. Both mitogenomes contained 37 genes and an A+T-rich region, with the gene order identical to those of other butterflies, except for the presence of a tRNA-like insertion, tRNA Leu (UUR), in C . pomona . The nucleotide compositions of both genomes were higher in A and T (80.2% for L . morsei and 81.3% for C . pomona ) than C and G; the A+T bias had a significant effect on the codon usage and the amino acid composition. The protein-coding genes utilized the standard mitochondrial start codon ATN, except the COI gene using CGA as the initiation codon, as reported in other butterflies. The intergenic spacer sequence between the tRNA Ser (UCN) and ND1 genes contained the ATACTAA motif. The A+T-rich region harbored a poly-T stretch and a conserved ATAGA motif located at the end of the region. In addition, there was a triplicated 23 bp repeat and a microsatellite-like (TA) 9 (AT) 3 element in the A+T-rich region of the L. morsei mitogenome , while in C . pomona, there was a duplicated 24 bp repeat element and a microsatellite-like (TA) 9 element. The phylogenetic trees of the main butterfly lineages (Hesperiidae, Papilionidae, Pieridae, Nymphalidae, Lycaenidae, and Riodinidae) were reconstructed with maximum likelihood and Bayesian inference methods based on the 13 concatenated nucleotide sequences of protein-coding genes, and both trees showed that the Pieridae family is sister to Lycaenidae. Although this result contradicts the traditional morphologically based views, it agrees with other recent studies based on mitochondrial genomic data. PMID:25368074

Accurate and exact CNV identification from targeted high-throughput sequence data.

PubMed

Nord, Alex S; Lee, Ming; King, Mary-Claire; Walsh, Tom

2011-04-12

Massively parallel sequencing of barcoded DNA samples significantly increases screening efficiency for clinically important genes. Short read aligners are well suited to single nucleotide and indel detection. However, methods for CNV detection from targeted enrichment are lacking. We present a method combining coverage with map information for the identification of deletions and duplications in targeted sequence data. Sequencing data is first scanned for gains and losses using a comparison of normalized coverage data between samples. CNV calls are confirmed by testing for a signature of sequences that span the CNV breakpoint. With our method, CNVs can be identified regardless of whether breakpoints are within regions targeted for sequencing. For CNVs where at least one breakpoint is within targeted sequence, exact CNV breakpoints can be identified. In a test data set of 96 subjects sequenced across ~1 Mb genomic sequence using multiplexing technology, our method detected mutations as small as 31 bp, predicted quantitative copy count, and had a low false-positive rate. Application of this method allows for identification of gains and losses in targeted sequence data, providing comprehensive mutation screening when combined with a short read aligner.

Complete nucleotide sequence of the freshwater unicellular cyanobacterium Synechococcus elongatus PCC 6301 chromosome: gene content and organization.

PubMed

Sugita, Chieko; Ogata, Koretsugu; Shikata, Masamitsu; Jikuya, Hiroyuki; Takano, Jun; Furumichi, Miho; Kanehisa, Minoru; Omata, Tatsuo; Sugiura, Masahiro; Sugita, Mamoru

2007-01-01

The entire genome of the unicellular cyanobacterium Synechococcus elongatus PCC 6301 (formerly Anacystis nidulans Berkeley strain 6301) was sequenced. The genome consisted of a circular chromosome 2,696,255 bp long. A total of 2,525 potential protein-coding genes, two sets of rRNA genes, 45 tRNA genes representing 42 tRNA species, and several genes for small stable RNAs were assigned to the chromosome by similarity searches and computer predictions. The translated products of 56% of the potential protein-coding genes showed sequence similarities to experimentally identified and predicted proteins of known function, and the products of 35% of the genes showed sequence similarities to the translated products of hypothetical genes. The remaining 9% of genes lacked significant similarities to genes for predicted proteins in the public DNA databases. Some 139 genes coding for photosynthesis-related components were identified. Thirty-seven genes for two-component signal transduction systems were also identified. This is the smallest number of such genes identified in cyanobacteria, except for marine cyanobacteria, suggesting that only simple signal transduction systems are found in this strain. The gene arrangement and nucleotide sequence of Synechococcus elongatus PCC 6301 were nearly identical to those of a closely related strain Synechococcus elongatus PCC 7942, except for the presence of a 188.6 kb inversion. The sequences as well as the gene information shown in this paper are available in the Web database, CYORF (http://www.cyano.genome.jp/).

The complete mitochondrial genome of the medicinal fungus Ganoderma applanatum (Polyporales, Basidiomycota).

PubMed

Wang, Xin-Cun; Shao, Junjie; Liu, Chang

2016-07-01

We have determined the complete nucleotide sequence of the mitochondrial genome of the medicinal fungus Ganoderma applanatum (Pers.) Pat. using the next-generation sequencing technology. The circular molecule is 119,803 bp long with a GC content of 26.66%. Gene prediction revealed genes encoding 15 conserved proteins, 25 tRNAs, the large and small ribosomal RNAs, all genes are located on the same strand except trnW-CCA. Compared with previously sequenced genomes of G. lucidum, G. meredithiae and G. sinense, the order of the protein and rRNA genes is highly conserved; however, the types of tRNA genes are slightly different. The mitochondrial genome of G. applanatum will contribute to the understanding of the phylogeny and evolution of Ganoderma and Ganodermataceae, the group containing many species with high medicinal values.

Structural analysis of the rDNA intergenic spacer of Brassica nigra: evolutionary divergence of the spacers of the three diploid Brassica species.

PubMed

Bhatia, S; Singh Negi, M; Lakshmikumaran, M

1996-11-01

EcoRI restriction of the B. nigra rDNA recombinants, isolated from a lambda genomic library, showed that the 3.9-kb fragment corresponded to the Intergenic Spacer (IGS), which was sequenced and found to be 3,928 bp in size. Sequence and dot-matrix analyses showed that the organization of the B. nigra rDNA IGS was typical of most rDNA spacers, consisting of a central repetitive region and flanking unique sequences on either side. The repetitive region was composed of two repeat families-RF 'A' and RF 'B.' The B. nigra RF 'A' consisted of a tandem array of three full-length copies of a 106-bp sequence element. RF 'B' was composed of 66 tandemly repeated elements. Each 'B' element was only 21-bp in size and this is the smallest repeat unit identified in plant rDNA to date. The putative transcription initiation site (TIS) was identified as nucleotide position 3,110. Based on the sequence analysis it was suggested that the present organization of the repeat families was generated by successive cycles of deletions and amplifications and was being maintained by homogenization processes such as gene conversion and crossing-over.A detailed comparison of the rDNA IGS sequences of the three diploid Brassica species-namely, B. nigra, B. campestris, and B. oleracea-was carried out. First, comparisons revealed that B. campestris and B. oleracea were close to each other as the repeat families in both showed high sequence homology between each other. Second, the repeat elements in both the species were organized in an interspersed manner. Third, a 52-bp sequence, present just downstream of the repeats in B. campestris, was found to be identical to the B. oleracea repeats, thereby suggesting a common progenitor. On the other hand, in B. nigra no interspersion pattern of organization of repeats was observed. Further, the B. nigra RF 'A' was identified as distinct from the repeat families of B. campestris and B. oleracea. Based on this analysis, it was suggested that during speciation B. campestris and B. oleracea evolved in one lineage whereas B. nigra diverged into a separate lineage. The comparative analysis of the IGS helped in identifying not only conserved ancestral sequence motifs of possible functional significance such as promoters and enhancers, but also sequences which showed variation between the three diploid species and were therefore identified as species-specific sequences.

High occurrence of mitochondrial heteroplasmy in nepalese indigenous sheep (Ovis aries) compared to chinese sheep.

PubMed

Gorkhali, Neena Amatya; Jiang, Lin; Shrestha, Bhola Shankar; He, Xiao-Hong; Junzhao, Qian; Han, Jian-Lin; Ma, Yue-Hui

2016-07-01

Heteroplasmy due to length polymorphism with tandem repeats in mtDNAs within individual was hardly studied in domestic animals. In the present study, we identified intra-individual length variation in the control region of mtDNAs in Nepalese sheep by molecular cloning and sequencing techniques. We observed one to four tandem repeats of a 75-bp nucleotide sequences in the mtDNA control region in 45% of the total Nepalese sheep sampled in contrast to the Chinese sheep, indicating that the heteroplasmy is specific to Nepalese sheep. The high rate of heteroplasmy in Nepalese sheep could be a resultant of the mtDNA mutation and independent segregation at intra-individual level or a strand slippage and mispairing during the replication.

Mitochondrial genome of the tomato clownfish Amphiprion frenatus (Pomacentridae, Amphiprioninae).

PubMed

Ye, Le; Hu, Jing; Wu, Kaichang; Wang, Yu; Li, Jianlong

2016-01-01

The complete mitochondrial (mt) genome of the tomato clownfish Amphiprion frenatus was obtained in this study. The circular mtDNA molecule was 16,774 bp in size and the overall nucleotide composition of the H-strand was 29.72% A, 25.81% T, 15.38% G and 29.09% C, with an A + T bias. The complete mitogenome encoded 13 protein-coding genes, 2 rRNAs, 22 tRNAs and a control region (D-loop), with the gene arrangement and translation direction basically identical to other typical vertebrate mitogenomes. The D-loop included termination associated sequence (TAS), central conserved domain (CCD) and conserved sequence block (CSB), and was composed of 6 complete continuity tandem repeat units and an imperfect tandem repeat unit.

Entire nucleotide sequences of Gossypium raimondii and G. arboreum mitochondrial genomes revealed A-genome species as cytoplasmic donor of the allotetraploid species.

PubMed

Chen, Z; Nie, H; Grover, C E; Wang, Y; Li, P; Wang, M; Pei, H; Zhao, Y; Li, S; Wendel, J F; Hua, J

2017-05-01

Cotton (Gossypium spp.) is commonly grouped into eight diploid genomic groups, designated A-G and K, and an allotetraploid genomic group, AD. Gossypium raimondii (D 5 ) and G. arboreum (A 2 ) are the putative contributors to the progenitor of G. hirsutum (AD 1 ), the economically important fibre-producing cotton species. Mitochondrial DNA from week-old etiolated seedlings was extracted from isolated organelles using discontinuous sucrose density gradient method. Mitochondrial genomes were sequenced, assembled, annotated and analysed in orderly. Gossypium raimondii (D 5 ) and G. arboreum (A 2 ) mitochondrial genomes were provided in this study. The mitochondrial genomes of two diploid species harboured circular genome of 643,914 bp (D 5 ) and 687,482 bp (A 2 ), respectively. They differ in size and number of repeat sequences, both contain illuminating triplicate sequences with 7317 and 10,246 bp, respectively, demonstrating dynamic difference and rearranged genome organisations. Comparing the D 5 and A 2 mitogenomes with mitogenomes of tetraploid Gossypium species (AD 1 , G. hirsutum; AD 2 , G. barbadense), a shared 11 kbp fragment loss was detected in allotetraploid species, three regions shared by G. arboreum (A 2 ), G. hirsutum (AD 1 ) and G. barbadense (AD 2 ), while eight regions were specific to G. raimondii (D 5 ). The presence/absence variations and gene-based phylogeny supported that A-genome is a cytoplasmic donor to the progenitor of allotetraploid species G. hirsutum and G. barbadense. The results present structure variations and phylogeny of Gossypium mitochondrial genome evolution. © 2017 The Authors. Plant Biology published by John Wiley & Sons Ltd on behalf of German Botanical Society, Royal Dutch Botanical Society.

Chloroplast genome resources and molecular markers differentiate rubber dandelion species from weedy relatives.

PubMed

Zhang, Yingxiao; Iaffaldano, Brian J; Zhuang, Xiaofeng; Cardina, John; Cornish, Katrina

2017-02-02

Rubber dandelion (Taraxacum kok-saghyz, TK) is being developed as a domestic source of natural rubber to meet increasing global demand. However, the domestication of TK is complicated by its colocation with two weedy dandelion species, Taraxacum brevicorniculatum (TB) and the common dandelion (Taraxacum officinale, TO). TB is often present as a seed contaminant within TK accessions, while TO is a pandemic weed, which may have the potential to hybridize with TK. To discriminate these species at the molecular level, and facilitate gene flow studies between the potential rubber crop, TK, and its weedy relatives, we generated genomic and marker resources for these three dandelion species. Complete chloroplast genome sequences of TK (151,338 bp), TO (151,299 bp), and TB (151,282 bp) were obtained using the Illumina GAII and MiSeq platforms. Chloroplast sequences were analyzed and annotated for all the three species. Phylogenetic analysis within Asteraceae showed that TK has a closer genetic distance to TB than to TO and Taraxacum species were most closely related to lettuce (Lactuca sativa). By sequencing multiple genotypes for each species and testing variants using gel-based methods, four chloroplast Single Nucleotide Polymorphism (SNP) variants were found to be fixed between TK and TO in large populations, and between TB and TO. Additionally, Expressed Sequence Tag (EST) resources developed for TO and TK permitted the identification of five nuclear species-specific SNP markers. The availability of chloroplast genomes of these three dandelion species, as well as chloroplast and nuclear molecular markers, will provide a powerful genetic resource for germplasm differentiation and purification, and the study of potential gene flow among Taraxacum species.

Cloning and sequence analysis of a full-length cDNA of SmPP1cb encoding turbot protein phosphatase 1 beta catalytic subunit

NASA Astrophysics Data System (ADS)

Qi, Fei; Guo, Huarong; Wang, Jian

2008-02-01

Reversible protein phosphorylation, catalyzed by protein kinases and phosphatases, is an important and versatile mechanism by which eukaryotic cells regulate almost all the signaling processes. Protein phosphatase 1 (PP1) is the first and well-characterized member of the protein serine/threonine phosphatase family. In the present study, a full-length cDNA encoding the beta isoform of the catalytic subunit of protein phosphatase 1(PP1cb), was for the first time isolated and sequenced from the skin tissue of flatfish turbot Scophthalmus maximus, designated SmPP1cb, by the rapid amplification of cDNA ends (RACE) technique. The cDNA sequence of SmPP1cb we obtained contains a 984 bp open reading frame (ORF), flanked by a complete 39 bp 5' untranslated region and 462 bp 3' untranslated region. The ORF encodes a putative 327 amino acid protein, and the N-terminal section of this protein is highly acidic, Met-Ala-Glu-Gly-Glu-Leu-Asp-Val-Asp, a common feature for PP1 catalytic subunit but absent in protein phosphatase 2B (PP2B). And its calculated molecular mass is 37 193 Da and pI 5.8. Sequence analysis indicated that, SmPP1cb is extremely conserved in both amino acid and nucleotide acid levels compared with the PP1cb of other vertebrates and invertebrates, and its Kozak motif contained in the 5'UTR around ATG start codon is GXXAXXGXX ATGG, which is different from mammalian in two positions A-6 and G-3, indicating the possibility of different initiation of translation in turbot, and also the 3'UTR of SmPP1cb is highly diverse in the sequence similarity and length compared with other animals, especially zebrafish. The cloning and sequencing of SmPP1cb gene lays a good foundation for the future work on the biological functions of PP1 in the flatfish turbot.

Sequence characterization of cDNA sequence of encoding of an antimicrobial Peptide with no disulfide bridge from the Iranian mesobuthus eupeus venomous glands.

PubMed

Farajzadeh-Sheikh, Ahmad; Jolodar, Abbas; Ghaemmaghami, Shamsedin

2013-01-01

Scorpion venom glands produce some antimicrobial peptides (AMP) that can rapidly kill a broad range of microbes and have additional activities that impact on the quality and effectiveness of innate responses and inflammation. In this study, we reported the identification of a cDNA sequence encoding cysteine-free antimicrobial peptides isolated from venomous glands of this species. Total RNA was extracted from the Iranian mesobuthus eupeus venom glands, and cDNA was synthesized by using the modified oligo (dT). The cDNA was used as the template for applying Semi-nested RT- PCR technique. PCR Products were used for direct nucleotide sequencing and the results were compared with Gen Bank database. A 213 BP cDNA fragment encoding the entire coding region of an antimicrobial toxin from the Iranian scorpion M. Eupeus venom glands were isolated. The full-length sequence of the coding region was 210 BP contained an open reading frame of 70 amino with a predicted molecular mass of 7970.48 Da and theoretical Pi of 9.10. The open reading frame consists of 210 BP encoding a precursor of 70 amino acid residues, including a signal peptide of 23 residues a propertied of 7 residues, and a mature peptide of 34 residues with no disulfide bridge. The peptide has detectable sequence identity to the Lesser Asian mesobuthus eupeus MeVAMP-2 (98%), MeVAMP-9 (60%) and several previously described AMPs from other scorpion venoms including mesobuthus martensii (94%) and buthus occitanus Israelis (82%). The secondary structure of the peptide mainly consisted of α-helical structure which was generally conserved by previously reported scorpion counterparts. The phylogenetic analysis showed that the Iranian MeAMP-like toxin was similar but not identical with that of venom antimicrobial peptides from lesser Asian scorpion mesobuthus eupeus.

Characterization of the complete mitochondrial genome of Chilo auricilius and comparison with three other rice stem borers.

PubMed

Cao, Shuang-Shuang; Du, Yu-Zhou

2014-09-15

The mitogenome of Chilo auricilius (Lepidoptera: Pyraloidea: Crambidae) was a circular molecule made up of 15,367 bp. Sesamia inferens, Chilo suppressalis, Tryporyza incertulas, and C. auricilius, are closely related, well known rice stem borers that are widely distributed in the main rice-growing regions of China. The gene order and orientation of all four stem borers were similar to that of other insect mitogenomes. Among the four stem borers, all AT contents were below 83%, while all AT contents of tRNA genes were above 80%. The genomes were compact, with only 121-257 bp of non-coding intergenic spacer. There are 56 or 62-bp overlapping nucleotides in Crambidae moths, but were only 25-bp overlapping nucleotides in the noctuid moth S. inferens. There was a conserved motif 'ATACTAAA' between trnS2 (UCN) and nad1 in Crambidae moths, but this same region was 'ATCATA' in the noctuid S. inferens. And there was a 6-bp motif 'ATGATAA' of overlapping nucleotides, which was conserved in Lepidoptera, and a 14-bp motif 'TAAGCTATTTAAAT' conserved in the three Crambidae moths (C. suppressalis, C. auricilius and T. incertulas), but not in the noctuid. Finally, there were no stem-and-loop structures in the two Chilo moths. Copyright © 2014 Elsevier B.V. All rights reserved.

Use of tuf Sequences for Genus-Specific PCR Detection and Phylogenetic Analysis of 28 Streptococcal Species

PubMed Central

Picard, François J.; Ke, Danbing; Boudreau, Dominique K.; Boissinot, Maurice; Huletsky, Ann; Richard, Dave; Ouellette, Marc; Roy, Paul H.; Bergeron, Michel G.

2004-01-01

A 761-bp portion of the tuf gene (encoding the elongation factor Tu) from 28 clinically relevant streptococcal species was obtained by sequencing amplicons generated using broad-range PCR primers. These tuf sequences were used to select Streptococcus-specific PCR primers and to perform phylogenetic analysis. The specificity of the PCR assay was verified using 102 different bacterial species, including the 28 streptococcal species. Genomic DNA purified from all streptococcal species was efficiently detected, whereas there was no amplification with DNA from 72 of the 74 nonstreptococcal bacterial species tested. There was cross-amplification with DNAs from Enterococcus durans and Lactococcus lactis. However, the 15 to 31% nucleotide sequence divergence in the 761-bp tuf portion of these two species compared to any streptococcal tuf sequence provides ample sequence divergence to allow the development of internal probes specific to streptococci. The Streptococcus-specific assay was highly sensitive for all 28 streptococcal species tested (i.e., detection limit of 1 to 10 genome copies per PCR). The tuf sequence data was also used to perform extensive phylogenetic analysis, which was generally in agreement with phylogeny determined on the basis of 16S rRNA gene data. However, the tuf gene provided a better discrimination at the streptococcal species level that should be particularly useful for the identification of very closely related species. In conclusion, tuf appears more suitable than the 16S ribosomal RNA gene for the development of diagnostic assays for the detection and identification of streptococcal species because of its higher level of species-specific genetic divergence. PMID:15297518

Identification of Splice Variants, Targeted MicroRNAs and Functional Single Nucleotide Polymorphisms of the BOLA-DQA2 Gene in Dairy Cattle

PubMed Central

Hou, Qinlei; Huang, Jinming; Ju, Zhihua; Li, Qiuling; Li, Liming; Wang, Changfa; Sun, Tao; Wang, Lingling; Hou, Minghai

2012-01-01

Major histocompatibility complex, class II, DQ alpha 2, also named BOLA-DQA2, belongs to the Bovine Leukocyte Antigen (BOLA) class II genes which are involved in the immune response. To explore the variability of the BOLA-DQA2 gene and resistance to mastitis in cows, the splice variants (SV), targeted microRNAs (miRNAs), and single nucleotide polymorphisms (SNPs) were identified in this study. A new SV (BOLA-DQA2-SV1) lacking part of exon 3 (195 bp) and two 3′-untranslated regions (UTR) (52 bp+167 bp) of the BOLA-DQA2 gene was found in the healthy and mastitis-infected mammary gland tissues. Four of 13 new SNPs and multiple nucleotide polymorphisms resulted in amino acid changes in the protein and SNP (c. +1283 C>T) may affect the binding to the seed sequence of bta-miR-2318. Further, we detected the relative expressions of two BOLA-DQA2 transcripts and five candidated microRNAs binding to the 3′-UTR of two transcripts in the mammary gland tissues in dairy cattle by using the quantitative real-time polymerase chain reaction. The result showed that expression of the BOLA-DQA2-SV1 mRNA was significantly upregulated 2.67-fold (p<0.05) in mastitis-infected mammary tissues (n=5) compared with the healthy mammary gland mammary tissues (n=5). Except for bta-miR-1777a, miRNA expression (bta-miR-296, miR-2430, and miR-671) was upregulated 1.75 to 2.59-fold (p<0.05), whereas miR-2318 was downregulated in the mastitis cows. Our findings reveal that BOLA-DQA2-SV1 may play an important role in the mastitis resistance in dairy cattle. Whether the SNPs affect the structure of the BOLA-DQA2 gene or association with mastitis resistance is unknown and warrants further investigation. PMID:22084936

The complete chloroplast genome sequence of strawberry (Fragaria  × ananassa Duch.) and comparison with related species of Rosaceae

PubMed Central

Cheng, Hui; Li, Jinfeng; Zhang, Hong; Cai, Binhua; Gao, Zhihong

2017-01-01

Compared with other members of the family Rosaceae, the chloroplast genomes of Fragaria species exhibit low variation, and this situation has limited phylogenetic analyses; thus, complete chloroplast genome sequencing of Fragaria species is needed. In this study, we sequenced the complete chloroplast genome of F. × ananassa ‘Benihoppe’ using the Illumina HiSeq 2500-PE150 platform and then performed a combination of de novo assembly and reference-guided mapping of contigs to generate complete chloroplast genome sequences. The chloroplast genome exhibits a typical quadripartite structure with a pair of inverted repeats (IRs, 25,936 bp) separated by large (LSC, 85,531 bp) and small (SSC, 18,146 bp) single-copy (SC) regions. The length of the F. × ananassa ‘Benihoppe’ chloroplast genome is 155,549 bp, representing the smallest Fragaria chloroplast genome observed to date. The genome encodes 112 unique genes, comprising 78 protein-coding genes, 30 tRNA genes and four rRNA genes. Comparative analysis of the overall nucleotide sequence identity among ten complete chloroplast genomes confirmed that for both coding and non-coding regions in Rosaceae, SC regions exhibit higher sequence variation than IRs. The Ka/Ks ratio of most genes was less than 1, suggesting that most genes are under purifying selection. Moreover, the mVISTA results also showed a high degree of conservation in genome structure, gene order and gene content in Fragaria, particularly among three octoploid strawberries which were F. × ananassa ‘Benihoppe’, F. chiloensis (GP33) and F. virginiana (O477). However, when the sequences of the coding and non-coding regions of F. × ananassa ‘Benihoppe’ were compared in detail with those of F. chiloensis (GP33) and F. virginiana (O477), a number of SNPs and InDels were revealed by MEGA 7. Six non-coding regions (trnK-matK, trnS-trnG, atpF-atpH, trnC-petN, trnT-psbD and trnP-psaJ) with a percentage of variable sites greater than 1% and no less than five parsimony-informative sites were identified and may be useful for phylogenetic analysis of the genus Fragaria. PMID:29038765

[Sequencing and analysis of the complete genome of a rabies virus isolate from Sika deer].

PubMed

Zhao, Yun-Jiao; Guo, Li; Huang, Ying; Zhang, Li-Shi; Qian, Ai-Dong

2008-05-01

One DRV strain was isolated from Sika Deer brain and sequenced. Nine overlapped gene fragments were amplified by RT-PCR through 3'-RACE and 5'-RACE method, and the complete DRV genome sequence was assembled. The length of the complete genome is 11863bp. The DRV genome organization was similar to other rabies viruses which were composed of five genes and the initiation sites and termination sites were highly conservative. There were mutated amino acids in important antigen sites of nucleoprotein and glycoprotein. The nucleotide and amino acid homologies of gene N, P, M, G, L in strains with completed genomie sequencing were compared. Compared with N gene sequence of other typical rabies viruses, a phylogenetic tree was established . These results indicated that DRV belonged to gene type 1. The highest homology compared with Chinese vaccine strain 3aG was 94%, and the lowest was 71% compared with WCBV. These findings provided theoretical reference for further research in rabies virus.

Genetic diversity of the captive Asian tapir population in Thailand, based on mitochondrial control region sequence data and the comparison of its nucleotide structure with Brazilian tapir.

PubMed

Muangkram, Yuttamol; Amano, Akira; Wajjwalku, Worawidh; Pinyopummintr, Tanu; Thongtip, Nikorn; Kaolim, Nongnid; Sukmak, Manakorn; Kamolnorranath, Sumate; Siriaroonrat, Boripat; Tipkantha, Wanlaya; Maikaew, Umaporn; Thomas, Warisara; Polsrila, Kanda; Dongsaard, Kwanreaun; Sanannu, Saowaphang; Wattananorrasate, Anuwat

2017-07-01

The Asian tapir (Tapirus indicus) has been classified as Endangered on the IUCN Red List of Threatened Species (2008). Genetic diversity data provide important information for the management of captive breeding and conservation of this species. We analyzed mitochondrial control region (CR) sequences from 37 captive Asian tapirs in Thailand. Multiple alignments of the full-length CR sequences sized 1268 bp comprised three domains as described in other mammal species. Analysis of 16 parsimony-informative variable sites revealed 11 haplotypes. Furthermore, the phylogenetic analysis using median-joining network clearly showed three clades correlated with our earlier cytochrome b gene study in this endangered species. The repetitive motif is located between first and second conserved sequence blocks, similar to the Brazilian tapir. The highest polymorphic site was located in the extended termination associated sequences domain. The results could be applied for future genetic management based in captivity and wild that shows stable populations.

New partial sequences of phosphoenolpyruvate carboxylase as molecular phylogenetic markers.

PubMed

Gehrig, H; Heute, V; Kluge, M

2001-08-01

To better understand the evolution of the enzyme phosphoenolpyruvate carboxylase (PEPC) and to test its versatility as a molecular character in phylogenetic and taxonomic studies, we have characterized and compared 70 new partial PEPC nucleotide and amino acid sequences (about 1100 bp of the 3' side of the gene) from 50 plant species (24 species of Bryophyta, 1 of Pteridophyta, and 25 of Spermatophyta). Together with previously published data, the new set of sequences allowed us to construct the up to now most complete phylogenetic tree of PEPC, where the PEPC sequences cluster according to both the taxonomic positions of the donor plants and the assumed specific function of the PEPC isoforms. Altogether, the study further strengthens the view that PEPC sequences can provide interesting information for the reconstruction of phylogenetic relations between organisms and metabolic pathways. To avoid confusion in future discussion, we propose a new nomenclature for the denotation of PEPC isoforms. Copyright 2001 Academic Press.

Genetic Diversity and Phylogenetic Evolution of Tibetan Sheep Based on mtDNA D-Loop Sequences

PubMed Central

Yue, Yaojing; Guo, Xian; Guo, Tingting; Chu, Min; Wang, Fan; Han, Jilong; Feng, Ruilin; Sun, Xiaoping; Niu, Chune; Yang, Bohui; Guo, Jian; Yuan, Chao

2016-01-01

The molecular and population genetic evidence of the phylogenetic status of the Tibetan sheep (Ovis aries) is not well understood, and little is known about this species’ genetic diversity. This knowledge gap is partly due to the difficulty of sample collection. This is the first work to address this question. Here, the genetic diversity and phylogenetic relationship of 636 individual Tibetan sheep from fifteen populations were assessed using 642 complete sequences of the mitochondrial DNA D-loop. Samples were collected from the Qinghai-Tibetan Plateau area in China, and reference data were obtained from the six reference breed sequences available in GenBank. The length of the sequences varied considerably, between 1031 and 1259 bp. The haplotype diversity and nucleotide diversity were 0.992±0.010 and 0.019±0.001, respectively. The average number of nucleotide differences was 19.635. The mean nucleotide composition of the 350 haplotypes was 32.961% A, 29.708% T, 22.892% C, 14.439% G, 62.669% A+T, and 37.331% G+C. Phylogenetic analysis showed that all four previously defined haplogroups (A, B, C, and D) were found in the 636 individuals of the fifteen Tibetan sheep populations but that only the D haplogroup was found in Linzhou sheep. Further, the clustering analysis divided the fifteen Tibetan sheep populations into at least two clusters. The estimation of the demographic parameters from the mismatch analyses showed that haplogroups A, B, and C had at least one demographic expansion in Tibetan sheep. These results contribute to the knowledge of Tibetan sheep populations and will help inform future conservation programs about the Tibetan sheep native to the Qinghai-Tibetan Plateau. PMID:27463976

A Molecular Method for the Identification of Honey Bee Subspecies Used by Beekeepers in Russia

PubMed Central

Syromyatnikov, Mikhail Y.; Borodachev, Anatoly V.; Kokina, Anastasia V.; Popov, Vasily N.

2018-01-01

Apis mellifera L. includes several recognized subspecies that differ in their biological properties and agricultural characteristics. Distinguishing between honey bee subspecies is complicated. We analyzed the Folmer region of the COX1 gene in honey bee subspecies cultivated at bee farms in Russia and identified subspecies-specific SNPs. DNA analysis revealed two clearly distinct haplogroups in A. mellifera mellifera. The first one was characterized by multiple cytosine-thymine (thymine–cytosine) transitions, one adenine-guanine substitution, and one thymine–adenine substitution. The nucleotide sequence of the second haplogroup coincided with sequences from other subspecies, except the unique C/A SNP at position 421 of the 658-bp Folmer region. A. mellifera carnica and A. mellifera carpatica could be distinguished from A. mellifera mellifera and A. mellifera caucasica by the presence of the A/G SNP at position 99 of the 658-bp Folmer region. The G/A SNP at position 448 was typical for A. mellifera carnica. A. mellifera caucasica COX1 sequence lacked all the above-mentioned sites. We developed a procedure for rapid identification of honey bee subspecies by PCR with restriction fragment length polymorphism (RFLP) using mutagenic primers. The developed molecular method for honey bee subspecies identification is fast and inexpensive. PMID:29382048

Elongation Factor-1α Accurately Reconstructs Relationships Amongst Psyllid Families (Hemiptera: Psylloidea), with Possible Diagnostic Implications.

PubMed

Martoni, Francesco; Bulman, Simon R; Pitman, Andrew; Armstrong, Karen F

2017-12-05

The superfamily Psylloidea (Hemiptera: Sternorrhyncha) lacks a robust multigene phylogeny. This impedes our understanding of the evolution of this group of insects and, consequently, an accurate identification of individuals, of their plant host associations, and their roles as vectors of economically important plant pathogens. The conserved nuclear gene elongation factor-1 alpha (EF-1α) has been valuable as a higher-level phylogenetic marker in insects and it has also been widely used to investigate the evolution of intron/exon structure. To explore evolutionary relationships among Psylloidea, polymerase chain reaction amplification and nucleotide sequencing of a 250-bp EF-1α gene fragment was applied to psyllids belonging to five different families. Introns were detected in three individuals belonging to two families. The nine genera belonging to the family Aphalaridae all lacked introns, highlighting the possibility of using intron presence/absence as a diagnostic tool at a family level. When paired with cytochrome oxidase I gene sequences, the 250 bp EF-1α sequence appeared to be a very promising higher-level phylogenetic marker for psyllids. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

cDNA nucleotide sequence coding for stearoyl-CoA desaturase and its expression in the zebrafish (Danio rerio) embryo.

PubMed

Hsieh, S L; Liu, R W; Wu, C H; Cheng, W T; Kuo, Ching-Ming

2003-12-01

A cDNA sequence of stearoyl-CoA desaturase (SCD) was determined from zebrafish (Danio rerio) and compared to the corresponding genes in several teleosts. Zebrafish SCD cDNA has a size of 1,061 bp, encodes a polypeptide of 325 amino acids, and shares 88, 85, 84, and 83% similarities with tilapia (Oreochromis mossambicus), grass carp (Ctenopharyngodon idella), common carp (Cyprinus carpio), and milkfish (Chanos chanos), respectively. This 1,061 bp sequence specifies a protein that, in common with other fatty acid desaturases, contains three histidine boxes, believed to be involved in catalysis. These observations suggested that SCD genes are highly conserved. In addition, an oligonucleotide probe complementary to zebrafish SCD mRNA was hybridized to mRNA of approximately 396 bases with Northern blot analysis. The Northern blot and RT-PCR analyses showed that the SCD mRNA was expressed predominantly in the liver, intestine, gill, and muscle, while a lower level was found in the brain. Furthermore, we utilized whole-mount in situ hybridization and real-time quantitative RT-PCR to identify expression of the zebrafish SCD gene at five different stages of development. This revealed that very high levels of transcripts were found in zebrafish at all stages during embryogenesis and early development. Copyright 2003 Wiley-Liss, Inc.

Complete mitochondrial genome of Porzana fusca and Porzana pusilla and phylogenetic relationship of 16 Rallidae species.

PubMed

Chen, Peng; Han, Yuqing; Zhu, Chaoying; Gao, Bin; Ruan, Luzhang

2017-12-01

The complete mitochondrial genome sequences of Porzana fusca and Porzana pusilla were determined. The two avian species share a high degree of homology in terms of mitochondrial genome organization and gene arrangement. Their corresponding mitochondrial genomes are 16,935 and 16,978 bp and consist of 37 genes and a control region. Their PCGs were both 11,365 bp long and have similar structure. Their tRNA gene sequences could be folded into canonical cloverleaf secondary structure, except for tRNA Ser (AGY) , which lost its "DHU" arm. Based on the concatenated nucleotide sequences of the complete mitochondrial DNA genes of 16 Rallidae species, reconstruction of phylogenetic trees and analysis of the molecular clock of P. fusca and P. pusilla indicated that these species from a sister group, which in turn are sister group to Rallina eurizonoides. The genus Gallirallus is a sister group to genus Lewinia, and these groups in turn are sister groups to genus Porphyrio. Moreover, molecular clock analyses suggested that the basal divergence of Rallidae could be traced back to 40.47 (41.46‒39.45) million years ago (Mya), and the divergence of Porzana occurred approximately 5.80 (15.16‒0.79) Mya.

Targeted 'next-generation' sequencing in anophthalmia and microphthalmia patients confirms SOX2, OTX2 and FOXE3 mutations.

PubMed

Jimenez, Nelson Lopez; Flannick, Jason; Yahyavi, Mani; Li, Jiang; Bardakjian, Tanya; Tonkin, Leath; Schneider, Adele; Sherr, Elliott H; Slavotinek, Anne M

2011-12-28

Anophthalmia/microphthalmia (A/M) is caused by mutations in several different transcription factors, but mutations in each causative gene are relatively rare, emphasizing the need for a testing approach that screens multiple genes simultaneously. We used next-generation sequencing to screen 15 A/M patients for mutations in 9 pathogenic genes to evaluate this technology for screening in A/M. We used a pooled sequencing design, together with custom single nucleotide polymorphism (SNP) calling software. We verified predicted sequence alterations using Sanger sequencing. We verified three mutations - c.542delC in SOX2, resulting in p.Pro181Argfs*22, p.Glu105X in OTX2 and p.Cys240X in FOXE3. We found several novel sequence alterations and SNPs that were likely to be non-pathogenic - p.Glu42Lys in CRYBA4, p.Val201Met in FOXE3 and p.Asp291Asn in VSX2. Our analysis methodology gave one false positive result comprising a mutation in PAX6 (c.1268A > T, predicting p.X423LeuextX*15) that was not verified by Sanger sequencing. We also failed to detect one 20 base pair (bp) deletion and one 3 bp duplication in SOX2. Our results demonstrated the power of next-generation sequencing with pooled sample groups for the rapid screening of candidate genes for A/M as we were correctly able to identify disease-causing mutations. However, next-generation sequencing was less useful for small, intragenic deletions and duplications. We did not find mutations in 10/15 patients and conclude that there is a need for further gene discovery in A/M.

Targeted 'Next-Generation' sequencing in anophthalmia and microphthalmia patients confirms SOX2, OTX2 and FOXE3 mutations

PubMed Central

2011-01-01

Background Anophthalmia/microphthalmia (A/M) is caused by mutations in several different transcription factors, but mutations in each causative gene are relatively rare, emphasizing the need for a testing approach that screens multiple genes simultaneously. We used next-generation sequencing to screen 15 A/M patients for mutations in 9 pathogenic genes to evaluate this technology for screening in A/M. Methods We used a pooled sequencing design, together with custom single nucleotide polymorphism (SNP) calling software. We verified predicted sequence alterations using Sanger sequencing. Results We verified three mutations - c.542delC in SOX2, resulting in p.Pro181Argfs*22, p.Glu105X in OTX2 and p.Cys240X in FOXE3. We found several novel sequence alterations and SNPs that were likely to be non-pathogenic - p.Glu42Lys in CRYBA4, p.Val201Met in FOXE3 and p.Asp291Asn in VSX2. Our analysis methodology gave one false positive result comprising a mutation in PAX6 (c.1268A > T, predicting p.X423LeuextX*15) that was not verified by Sanger sequencing. We also failed to detect one 20 base pair (bp) deletion and one 3 bp duplication in SOX2. Conclusions Our results demonstrated the power of next-generation sequencing with pooled sample groups for the rapid screening of candidate genes for A/M as we were correctly able to identify disease-causing mutations. However, next-generation sequencing was less useful for small, intragenic deletions and duplications. We did not find mutations in 10/15 patients and conclude that there is a need for further gene discovery in A/M. PMID:22204637

Genomic characterization of two large Alu-mediated rearrangements of the BRCA1 gene.

PubMed

Peixoto, Ana; Pinheiro, Manuela; Massena, Lígia; Santos, Catarina; Pinto, Pedro; Rocha, Patrícia; Pinto, Carla; Teixeira, Manuel R

2013-02-01

To determine whether a large genomic rearrangement is actually novel and to gain insight about the mutational mechanism responsible for its occurrence, molecular characterization with breakpoint identification is mandatory. We here report the characterization of two large deletions involving the BRCA1 gene. The first rearrangement harbored a 89,664-bp deletion comprising exon 7 of the BRCA1 gene to exon 11 of the NBR1 gene (c.441+1724_oNBR1:c.1073+480del). Two highly homologous Alu elements were found in the genomic sequences flanking the deletion breakpoints. Furthermore, a 20-bp overlapping sequence at the breakpoint junction was observed, suggesting that the most likely mechanism for the occurrence of this rearrangement was nonallelic homologous recombination. The second rearrangement fully characterized at the nucleotide level was a BRCA1 exons 11-15 deletion (c.671-319_4677-578delinsAlu). The case harbored a 23,363-bp deletion with an Alu element inserted at the breakpoints of the deleted region. As the Alu element inserted belongs to a still active AluY family, the observed rearrangement could be due to an insertion-mediated deletion mechanism caused by Alu retrotransposition. To conclude, we describe the breakpoints of two novel large deletions involving the BRCA1 gene and analysis of their genomic context allowed us to gain insight about the respective mutational mechanism.

Complete Mitochondrial Genome Sequence of Acrida cinerea (Acrididae: Orthoptera) and Comparative Analysis of Mitochondrial Genomes in Orthoptera

PubMed Central

Liu, Nian; Huang, Yuan

2010-01-01

The complete 15,599-bp mitogenome of Acrida cinerea was determined and compared with that of the other 20 orthopterans. It displays characteristic gene content, genome organization, nucleotide composition, and codon usage found in other Caelifera mitogenomes. Comparison of 21 orthopteran sequences revealed that the tRNAs encoded by the H-strand appear more conserved than those by the L-stand. All tRNAs form the typical clover-leaf structure except trnS (agn), and most of the size variation among tRNAs stemmed from the length variation in the arm and loop of TΨC and the loop of DHU. The derived secondary structure models of the rrnS and rrnL from 21 orthoptera species closely resemble those from other insects on CRW except a considerably enlarged loop of helix 1399 of rrnS in Caelifera, which is a potentially autapomorphy of Caelifera. In the A+T-rich region, tandem repeats are not only conserved in the closely related mitogenome but also share some conserved motifs in the same subfamily. A stem-loop structure, 16 bp or longer, is likely to be involved in replication initiation in Caelifera and Grylloidea. A long T-stretch (>17 bp) with conserved stem-loop structure next to rrnS on the H-strand, bounded by a purine at either end, exists in the three species from Tettigoniidae. PMID:21197069

Sequence Variation of the tRNALeu Intron as a Marker for Genetic Diversity and Specificity of Symbiotic Cyanobacteria in Some Lichens

PubMed Central

Paulsrud, Per; Lindblad, Peter

1998-01-01

We examined the genetic diversity of Nostoc symbionts in some lichens by using the tRNALeu (UAA) intron as a genetic marker. The nucleotide sequence was analyzed in the context of the secondary structure of the transcribed intron. Cyanobacterial tRNALeu (UAA) introns were specifically amplified from freshly collected lichen samples without previous DNA extraction. The lichen species used in the present study were Nephroma arcticum, Peltigera aphthosa, P. membranacea, and P. canina. Introns with different sizes around 300 bp were consistently obtained. Multiple clones from single PCRs were screened by using their single-stranded conformational polymorphism pattern, and the nucleotide sequence was determined. No evidence for sample heterogenity was found. This implies that the symbiont in situ is not a diverse community of cyanobionts but, rather, one Nostoc strain. Furthermore, each lichen thallus contained only one intron type, indicating that each thallus is colonized only once or that there is a high degree of specificity. The same cyanobacterial intron sequence was also found in samples of one lichen species from different localities. In a phylogenetic analysis, the cyanobacterial lichen sequences grouped together with the sequences from two free-living Nostoc strains. The size differences in the intron were due to insertions and deletions in highly variable regions. The sequence data were used in discussions concerning specificity and biology of the lichen symbiosis. It is concluded that the tRNALeu (UAA) intron can be of great value when examining cyanobacterial diversity. PMID:9435083

Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

PubMed

Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

2015-02-01

There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

Precise determination, cross-recognition, and functional analysis of the double-strand origins of the rolling-circle replication plasmids in haloarchaea.

PubMed

Zhou, Ligang; Zhou, Meixian; Sun, Chaomin; Han, Jing; Lu, Qiuhe; Zhou, Jian; Xiang, Hua

2008-08-01

The precise nick site in the double-strand origin (DSO) of pZMX201, a 1,668-bp rolling-circle replication (RCR) plasmid from the haloarchaeon Natrinema sp. CX2021, was determined by electron microscopy and DSO mapping. In this plasmid, DSO nicking occurred between residues C404 and G405 within a heptanucleotide sequence (TCTC/GGC) located in the stem region of an imperfect hairpin structure. This nick site sequence was conserved among the haloarchaeal RCR plasmids, including pNB101, suggesting that the DSO nick site might be the same for all members of this plasmid family. Interestingly, the DSOs of pZMX201 and pNB101 were found to be cross-recognized in RCR initiation and termination in a hybrid plasmid system. Mutation analysis of the DSO from pZMX201 (DSO(Z)) in this hybrid plasmid system revealed that: (i) the nucleotides in the middle of the conserved TCTCGGC sequence play more-important roles in the initiation and termination process; (ii) the left half of the hairpin structure is required for initiation but not for termination; and (iii) a 36-bp sequence containing TCTCGGC and the downstream sequence is essential and sufficient for termination. In conclusion, these haloarchaeal plasmids, with novel features that are different from the characteristics of both single-stranded DNA phages and bacterial RCR plasmids, might serve as a good model for studying the evolution of RCR replicons.

Phylogenetic analyses indicate little variation among reticuloendotheliosis viruses infecting avian species, including the endangered Attwater's prairie chicken.

PubMed

Bohls, Ryan L; Linares, Jose A; Gross, Shannon L; Ferro, Pam J; Silvy, Nova J; Collisson, Ellen W

2006-08-01

Reticuloendotheliosis virus infection, which typically causes systemic lymphomas and high mortality in the endangered Attwater's prairie chicken, has been described as a major obstacle in repopulation efforts of captive breeding facilities in Texas. Although antigenic relationships among reticuloendotheliosis virus (REV) strains have been previously determined, phylogenetic relationships have not been reported. The pol and env of REV proviral DNA from prairie chickens (PC-R92 and PC-2404), from poxvirus lesions in domestic chickens, the prototype poultry derived REV-A and chick syncytial virus (CSV), and duck derived spleen necrosis virus (SNV) were PCR amplified and sequenced. The 5032bp, that included the pol and most of env genes, of the PC-R92 and REV-A were 98% identical, and nucleotide sequence identities of smaller regions within the pol and env from REV strains examined ranged from 95 to 99% and 93 to 99%, respectively. The putative amino acid sequences were 97-99% identical in the polymerase and 90-98% in the envelope. Phylogenetic analyses of the nucleotide and amino acid sequences indicated the closest relationship among the recent fowl pox-associated chicken isolates, the prairie chicken isolates and the prototype CSV while only the SNV appeared to be distinctly divergent. While the origin of the naturally occurring viruses is not known, the avian poxvirus may be a critical component of transmission of these ubiquitous oncogenic viruses.

Cloning and sequence analysis of the Antheraea pernyi nucleopolyhedrovirus gp64 gene.

PubMed

Wang, Wenbing; Zhu, Shanying; Wang, Liqun; Yu, Feng; Shen, Weide

2005-12-01

Frequent outbreaks of the purulence disease of Chinese oak silkworm are reported in Middle and Northeast China. The disease is produced by the pathogen Antheraea pernyi nucleopolyhedrovirus (AnpeNPV). To obtain molecular information of the virus, the polyhedra of AnpeNPV were purified and characterized. The genomic DNA of AnpeNPV was extracted and digested with HindIII. The genome size of AnpeNPV is estimated at 128 kb. Based on the analysis of DNA fragments digested with HindIII, 23 fragments were bigger than 564 bp. A genomic library was generated using HindIII and the positive clones were sequenced and analysed. The gp64 gene, encoding the baculovirus envelope protein GP64, was found in an insert. The nucleotide sequence analysis indicated that the AnpeNPV gp64 gene consists of a 1,530 nucleotide open reading frame (ORF), encoding a protein of 509 amino acids. Of the eight gp64 homologues, the AnpeNPV gp64 ORF shared the most sequence similarity with the gp64 gene of Anticarsia gemmatalis NPV, but not Bombyx mori NPV. The upstream region of the AnpeNPV gp64 ORF encoded the conserved transcriptional elements for early and late stage of the viral infection cycle. These results indicated that AnpeNPV belongs to group I NPV and was far removed in molecular phylogeny from the BmNPV.

Complete nucleotide sequence of the gene for human heparin cofactor II and mapping to chromosomal band 22q11

DOE Office of Scientific and Technical Information (OSTI.GOV)

Herzog, R.; Lutz, S.; Blin, N.

1991-02-05

Heparin cofactor II (HCII) is a 66-kDa plasma glycoprotein that inhibits thrombin rapidly in the presence of dermatan sulfate or heparin. Clones comprising the entire HCII gene were isolated from a human leukocyte genomic library in EMBL-3 {lambda} phage. The sequence of the gene was determined on both strands of DNA (15,849 bp) and included 1,749 bp of 5{prime}-flanking sequence, five exons, four introns, and 476 bp of DNA 3{prime} to the polyadenylation site. Ten complete and one partial Alu repeats were identified in the introns and 5{prime}-flanking region. The HCII gene was regionally mapped on chromosome 22 using rodent-humanmore » somatic cell hybrids, carrying only parts of human chromosome 22, and the chronic myelogenous leukemia cell line K562. With the cDNA probe HCII7.2, containing the entire coding region of the gene, the HCII gene was shown to be amplified 10-20-fold in K562 cells by Southern analysis and in situ hybridization. From these data, the authors concluded that the HCII gene is localized on the chromosomal band 22q11 proximal to the breakpoint cluster region (BCR). Analysis by pulsed-field gel electrophoresis indicated that the amplified HCII gene in K562 cells maps at least 2 Mbp proximal to BCR-1. Furthermore, the HCII7.2 cDNA probe detected two frequent restriction fragment length polymorphisms with the restriction enzymes BamHI and Hind III.« less

Transcriptome analysis of the couch potato (CPO) protein reveals an expression pattern associated with early development in the salmon louse Caligus rogercresseyi.

PubMed

Gallardo-Escárate, Cristian; Valenzuela-Muñoz, Valentina; Nuñez-Acuña, Gustavo; Chávez-Mardones, Jacqueline; Maldonado-Aguayo, Waleska

2014-02-15

The couch potato (CPO) protein is a key biomolecule involved in regulating diapause through the RNA-binding process of the peripheral and central nervous systems in insects and also recently discovered in a few crustacean species. As such, ectoparasitic copepods are interesting model species that have no evidence of developmental arrest. The present study is the first to report on the cloning of a putative CPO gene from the salmon louse Caligus rogercresseyi (CrCPO), as identified by high-throughput transcriptome sequencing. In addition, the transcription expression in larvae and adults was evaluated using quantitative real-time PCR. The CrCPO cDNA sequence showed 3261 base pairs (bp), consisting of 713bp of 5' UTR, 1741bp of 3' UTR, and an open reading frame of 807bp encoding for 268 amino acids. The highly conserved RNA binding regions RNP2 (LFVSGL) and RNP1 (SPVGFVTF), as well the dimerization site (LEF), were also found. Furthermore, eight single nucleotide polymorphisms located in the untranslated regions and one located in the coding region were detected. Gene transcription analysis revealed that CrCPO has ubiquitous expression across larval stages and in adult individuals, with the highest expression from nauplius to copepodid stages. The present study suggests a putative biological function of CrCPO associated with the development of the nervous system in salmon lice and contributes molecular evidence for candidate genes related to host-parasite interactions. Copyright © 2013 Elsevier B.V. All rights reserved.

Determination of the melon chloroplast and mitochondrial genome sequences reveals that the largest reported mitochondrial genome in plants contains a significant amount of DNA having a nuclear origin

PubMed Central

2011-01-01

Background The melon belongs to the Cucurbitaceae family, whose economic importance among vegetable crops is second only to Solanaceae. The melon has a small genome size (454 Mb), which makes it suitable for molecular and genetic studies. Despite similar nuclear and chloroplast genome sizes, cucurbits show great variation when their mitochondrial genomes are compared. The melon possesses the largest plant mitochondrial genome, as much as eight times larger than that of other cucurbits. Results The nucleotide sequences of the melon chloroplast and mitochondrial genomes were determined. The chloroplast genome (156,017 bp) included 132 genes, with 98 single-copy genes dispersed between the small (SSC) and large (LSC) single-copy regions and 17 duplicated genes in the inverted repeat regions (IRa and IRb). A comparison of the cucumber and melon chloroplast genomes showed differences in only approximately 5% of nucleotides, mainly due to short indels and SNPs. Additionally, 2.74 Mb of mitochondrial sequence, accounting for 95% of the estimated mitochondrial genome size, were assembled into five scaffolds and four additional unscaffolded contigs. An 84% of the mitochondrial genome is contained in a single scaffold. The gene-coding region accounted for 1.7% (45,926 bp) of the total sequence, including 51 protein-coding genes, 4 conserved ORFs, 3 rRNA genes and 24 tRNA genes. Despite the differences observed in the mitochondrial genome sizes of cucurbit species, Citrullus lanatus (379 kb), Cucurbita pepo (983 kb) and Cucumis melo (2,740 kb) share 120 kb of sequence, including the predicted protein-coding regions. Nevertheless, melon contained a high number of repetitive sequences and a high content of DNA of nuclear origin, which represented 42% and 47% of the total sequence, respectively. Conclusions Whereas the size and gene organisation of chloroplast genomes are similar among the cucurbit species, mitochondrial genomes show a wide variety of sizes, with a non-conserved structure both in gene number and organisation, as well as in the features of the noncoding DNA. The transfer of nuclear DNA to the melon mitochondrial genome and the high proportion of repetitive DNA appear to explain the size of the largest mitochondrial genome reported so far. PMID:21854637

Coordinating Environmental Genomics and Geochemistry Reveals Metabolic Transitions in a Hot Spring Ecosystem

PubMed Central

Swingley, Wesley D.; Meyer-Dombard, D’Arcy R.; Shock, Everett L.; Alsop, Eric B.; Falenski, Heinz D.; Havig, Jeff R.; Raymond, Jason

2012-01-01

We have constructed a conceptual model of biogeochemical cycles and metabolic and microbial community shifts within a hot spring ecosystem via coordinated analysis of the “Bison Pool” (BP) Environmental Genome and a complementary contextual geochemical dataset of ∼75 geochemical parameters. 2,321 16S rRNA clones and 470 megabases of environmental sequence data were produced from biofilms at five sites along the outflow of BP, an alkaline hot spring in Sentinel Meadow (Lower Geyser Basin) of Yellowstone National Park. This channel acts as a >22 m gradient of decreasing temperature, increasing dissolved oxygen, and changing availability of biologically important chemical species, such as those containing nitrogen and sulfur. Microbial life at BP transitions from a 92°C chemotrophic streamer biofilm community in the BP source pool to a 56°C phototrophic mat community. We improved automated annotation of the BP environmental genomes using BLAST-based Markov clustering. We have also assigned environmental genome sequences to individual microbial community members by complementing traditional homology-based assignment with nucleotide word-usage algorithms, allowing more than 70% of all reads to be assigned to source organisms. This assignment yields high genome coverage in dominant community members, facilitating reconstruction of nearly complete metabolic profiles and in-depth analysis of the relation between geochemical and metabolic changes along the outflow. We show that changes in environmental conditions and energy availability are associated with dramatic shifts in microbial communities and metabolic function. We have also identified an organism constituting a novel phylum in a metabolic “transition” community, located physically between the chemotroph- and phototroph-dominated sites. The complementary analysis of biogeochemical and environmental genomic data from BP has allowed us to build ecosystem-based conceptual models for this hot spring, reconstructing whole metabolic networks in order to illuminate community roles in shaping and responding to geochemical variability. PMID:22675512

Mitochondrial DNA variation in natural populations of endangered Indian feather-back fish, Chitala chitala.

PubMed

Mandal, Anup; Mohindra, Vindhya; Singh, Rajeev Kumar; Punia, Peyush; Singh, Ajay Kumar; Lal, Kuldeep Kumar

2012-02-01

Genetic variation at mitochondrial cytochrome b (cyt b) and D-loop region reveals the evidence of population sub-structuring in Indian populations of highly endangered primitive feather-back fish Chitala chitala. Samples collected through commercial catches from eight riverine populations from different geographical locations of India were analyzed for cyt b region (307 bp) and D-loop region (636-716 bp). The sequences of the both the mitochondrial regions revealed high haplotype diversity and low nucleotide diversity. The patterns of genetic diversity, haplotypes networks clearly indicated two distinct mitochondrial lineages and mismatch distribution strongly suggest a historical influence on the genetic structure of C. chitala populations. The baseline information on genetic variation and the evidence of population sub-structuring generated from this study would be useful for planning effective strategies for conservation and rehabilitation of this highly endangered species.

Solution structure of conserved AGNN tetraloops: insights into Rnt1p RNA processing

PubMed Central

Lebars, Isabelle; Lamontagne, Bruno; Yoshizawa, Satoko; Abou Elela, Sherif; Fourmy, Dominique

2001-01-01

Rnt1p, the yeast orthologue of RNase III, cleaves rRNAs, snRNAs and snoRNAs at a stem capped with conserved AGNN tetraloop. Here we show that 9 bp long stems ending with AGAA or AGUC tetraloops bind to Rnt1p and direct specific but sequence-independent RNA cleavage when provided with stems longer than 13 bp. The solution structures of these two tetraloops reveal a common fold for the terminal loop stabilized by non-canonical A–A or A–C pairs and extensive base stacking. The conserved nucleotides are stacked at the 5′ side of the loop, exposing their Watson–Crick and Hoogsteen faces for recognition by Rnt1p. These results indicate that yeast RNase III recognizes the fold of a conserved single-stranded tetraloop to direct specific dsRNA cleavage. PMID:11743001

[Genetic characterization of different populations of Rhopilema esculentum based on the mitochondrial COI sequence.

PubMed

Li, Yu Long; Dong, Jing; Wang, Bin; Li, Yi Ping; Yu, Xu Guang; Fu, Jie; Wang, Wen Bo

2016-07-01

To investigate the genetic characterization and population genetic structure of Rhopilema esculentum, we sequenced the mtDNA COI gene (624 bp) in 56 individuals collected from Liaodong Bay and the Ganghwado Island in the estuarine waters of the Han River. In addition, the homologous sequences of other 15 individuals which were sampled from the Bohai and Yellow seas and Sea of Japan were analyzed. A total of 28 polymorphic nucleotide sites were detected among the 71 individuals, which defined 32 haplotypes. Haplotype diversity levels were high (0.91±0.06-0.94±0.01) in R. esculentum populations, whereas those of nucleotide diversity were moderate to low [(0.60±0.34)%-(0.68±0.40)%]. Compared with several other giant jellyfish species, the variation level of R. esculentum was high. Phylogeographic analysis of the COI region revealed two lineages. The pairwise F ST comparison and hierarchical molecular variance analysis (AMOVA) showed that significant population structure existed throughout the range of R. esculentum. The results of this study indicated that the life-cycle characteristics, together with possible anthropogenic introduction such as stock enhancement and the prevailing ocean currents in this region, were proposed as the main factors that determined the genetic patterns of R. esculentum.

Crystal structure of importin-α3 bound to the nuclear localization signal of Ran-binding protein 3.

PubMed

Koyama, Masako; Matsuura, Yoshiyuki

2017-09-23

Ran-binding protein 3 (RanBP3) is a primarily nuclear Ran-binding protein that functions as an accessory factor in the Ran GTPase system. RanBP3 associates with Ran-specific nucleotide exchange factor RCC1 and enhances its catalytic activity towards Ran. RanBP3 also promotes CRM1-mediated nuclear export as well as CRM1-independent nuclear export of β-catenin, Smad2, and Smad3. Nuclear import of RanBP3 is dependent on the nuclear import adaptor protein importin-α and, RanBP3 is imported more efficiently by importin-α3 than by other members of the importin-α family. Protein kinase signaling pathways control nucleocytoplasmic transport through phosphorylation of RanBP3 at Ser58, immediately C-terminal to the nuclear localization signal (NLS) in the N-terminal region of RanBP3. Here we report the crystal structure of human importin-α3 bound to an N-terminal fragment of human RanBP3 containing the NLS sequence that is necessary and sufficient for nuclear import. The structure reveals that RanBP3 binds to importin-α3 residues that are strictly conserved in all seven isoforms of human importin-α at the major NLS-binding site, indicating that the region of importin-α outside the NLS-binding site, possibly the autoinhibotory importin-β1-binding domain, may be the key determinant for the preferential binding of RanBP3 to importin-α3. Computational docking simulation indicates that phosphorylation of RanBP3 at Ser58 could potentially stabilize the association of RanBP3 with importin-α through interactions between the phosphate moiety of phospho-Ser58 of RanBP3 and a cluster of basic residues (Arg96 and Lys97 in importin-α3) on armadillo repeat 1 of importin-α. Copyright © 2017 Elsevier Inc. All rights reserved.

Population genetic implications from sequence variation in four Y chromosome genes.

PubMed

Shen, P; Wang, F; Underhill, P A; Franco, C; Yang, W H; Roxas, A; Sung, R; Lin, A A; Hyman, R W; Vollrath, D; Davis, R W; Cavalli-Sforza, L L; Oefner, P J

2000-06-20

Some insight into human evolution has been gained from the sequencing of four Y chromosome genes. Primary genomic sequencing determined gene SMCY to be composed of 27 exons that comprise 4,620 bp of coding sequence. The unfinished sequencing of the 5' portion of gene UTY1 was completed by primer walking, and a total of 20 exons were found. By using denaturing HPLC, these two genes, as well as DBY and DFFRY, were screened for polymorphic sites in 53-72 representatives of the five continents. A total of 98 variants were found, yielding nucleotide diversity estimates of 2.45 x 10(-5), 5. 07 x 10(-5), and 8.54 x 10(-5) for the coding regions of SMCY, DFFRY, and UTY1, respectively, with no variant having been observed in DBY. In agreement with most autosomal genes, diversity estimates for the noncoding regions were about 2- to 3-fold higher and ranged from 9. 16 x 10(-5) to 14.2 x 10(-5) for the four genes. Analysis of the frequencies of derived alleles for all four genes showed that they more closely fit the expectation of a Luria-Delbrück distribution than a distribution expected under a constant population size model, providing evidence for exponential population growth. Pairwise nucleotide mismatch distributions date the occurrence of population expansion to approximately 28,000 years ago. This estimate is in accord with the spread of Aurignacian technology and the disappearance of the Neanderthals.

The complete nucleotide sequence of the domestic dog (Canis familiaris) mitochondrial genome.

PubMed

Kim, K S; Lee, S E; Jeong, H W; Ha, J H

1998-10-01

The complete nucleotide sequence of the mitochondrial genome of the domestic dog, Canis familiaris, was determined. The length of the sequence was 16,728 bp; however, the length was not absolute due to the variation (heteroplasmy) caused by differing numbers of the repetitive motif, 5'-GTACACGT(A/G)C-3', in the control region. The genome organization, gene contents, and codon usage conformed to those of other mammalian mitochondrial genomes. Although its features were unknown, the "CTAGA" duplication event which followed the translational stop codon of the COII gene was not observed in other mammalian mitochondrial genomes. In order to determine the possible differences between mtDNAs in carnivores, two rRNA and 13 protein-coding genes from the cat, dog, and seal were compared. The combined molecular differences, in two rRNA genes as well as in the inferred amino acid sequences of the mitochondrial 13 protein-coding genes, suggested that there is a closer relationship between the dog and the seal than there is between either of these species and the cat. Based on the molecular differences of the mtDNA, the evolutionary divergence between the cat, the dog, and the seal was dated to approximately 50 +/- 4 million years ago. The degree of difference between carnivore mtDNAs varied according to the individual protein-coding gene applied, showing that the evolutionary relationships of distantly related species should be presented in an extended study based on ample sequence data like complete mtDNA molecules. Copyright 1998 Academic Press.

Characterization of the complete mitochondrial genome of the hybrid Epinephelus moara♀ × Epinephelus lanceolatus♂, and phylogenetic analysis in subfamily epinephelinae

NASA Astrophysics Data System (ADS)

Gao, Fengtao; Wei, Min; Zhu, Ying; Guo, Hua; Chen, Songlin; Yang, Guanpin

2017-06-01

This study presents the complete mitochondrial genome of the hybrid Epinephelus moara♀× Epinephelus lanceolatus♂. The genome is 16886 bp in length, and contains 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes, a light-strand replication origin and a control region. Additionally, phylogenetic analysis based on the nucleotide sequences of 13 conserved protein-coding genes using the maximum likelihood method indicated that the mitochondrial genome is maternally inherited. This study presents genomic data for studying phylogenetic relationships and breeding of hybrid Epinephelinae.

Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

PubMed

Dunham, S P; Onions, D E

2001-06-21

A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

Characterization of a variant strain of Norwalk virus from a food-borne outbreak of gastroenteritis on a cruise ship in Hawaii.

PubMed Central

Herwaldt, B L; Lew, J F; Moe, C L; Lewis, D C; Humphrey, C D; Monroe, S S; Pon, E W; Glass, R I

1994-01-01

A gastroenteritis outbreak affecting at least 217 (41%) of 527 passengers on a cruise ship was caused by a variant strain of Norwalk virus (NV) that is related to but distinct from the prototype NV strain. Consumption of fresh-cut fruit served at two buffets was significantly associated with illness (P < or = 0.01), and a significant dose-response relationship was evident between illness and the number of various fresh-cut fruit items eaten. Seven (58%) of 12 paired serum specimens from ill persons demonstrated at least fourfold rises in antibody response to recombinant NV capsid antigen. A 32-nm small round-structured virus was visualized by electron microscopy in 4 (29%) of 14 fecal specimens, but none of the 8 specimens that were examined by an enzyme immunoassay for NV antigen demonstrated antigen. Four (40%) of 10 fecal specimens were positive by reverse transcriptase-PCR by using primer pairs selected from the polymerase region of NV. In a 145-bp region, the PCR product shared only 72% nucleotide sequence identity with the reference NV strain and 77% nucleotide sequence identity with Southampton virus but shared 95% nucleotide sequence identity with UK2 virus, a United Kingdom reference virus strain. In addition, the outbreak virus was serotyped as UK2 virus by solid-phase immune electron microscopy. The genetic and antigenic divergence of the outbreak strain from the reference NV strain highlights the need for more broadly reactive diagnostic assays and for improved understanding of the relatedness of the NV group of agents. Images PMID:8027335

[Cloning of new acylamidase gene from Rhodococcus erythropolis and its expression in Escherichia coli].

PubMed

Lavrov, K V; Ianenko, A S

2013-10-01

The gene for new Rhodococcus erythropolis TA37 acylamidase, which possesses unique substrate specificity, has been cloned and expressed in E. coli. Substrates for this enzyme are not only simple amides, such as acetamide and propionamide, but also N-substituted amides, such as 4'-nitroacetanilide. The 1431-bp gene was expressed in E. coli BL21 (DE3) cells on pET16b plasmid under the control of a promoter of the φ 10 gene from the T7 phage. The molecular mass of recombinant acylamidase in E. coli was 55 kDa, which corresponded to that of native acylamidase from Rhodococcus erythropolis TA37. Recombinant acylamidase was able to hydrolize N-substituted amides. A search of a nucleotide database and multiple alignment revealed that acylamidase belonged to the Amidase protein family PF01425, but its nucleotide and amino acid sequences differed significantly from those of the described amidases.

Discovery and Complete Genome Sequence of a Bacteriophage from an Obligate Intracellular Symbiont of a Cellulolytic Protist in the Termite Gut

PubMed Central

Pramono, Ajeng K.; Kuwahara, Hirokazu; Itoh, Takehiko; Toyoda, Atsushi; Yamada, Akinori; Hongoh, Yuichi

2017-01-01

Termites depend nutritionally on their gut microbes, and protistan, bacterial, and archaeal gut communities have been extensively studied. However, limited information is available on viruses in the termite gut. We herein report the complete genome sequence (99,517 bp) of a phage obtained during a genome analysis of “Candidatus Azobacteroides pseudotrichonymphae” phylotype ProJPt-1, which is an obligate intracellular symbiont of the cellulolytic protist Pseudotrichonympha sp. in the gut of the termite Prorhinotermes japonicus. The genome of the phage, designated ProJPt-Bp1, was circular or circularly permuted, and was not integrated into the two circular chromosomes or five circular plasmids composing the host ProJPt-1 genome. The phage was putatively affiliated with the order Caudovirales based on sequence similarities with several phage-related genes; however, most of the 52 protein-coding sequences had no significant homology to sequences in the databases. The phage genome contained a tRNA-Gln (CAG) gene, which showed the highest sequence similarity to the tRNA-Gln (CAA) gene of the host “Ca. A. pseudotrichonymphae” phylotype ProJPt-1. Since the host genome lacked a tRNA-Gln (CAG) gene, the phage tRNA gene may compensate for differences in codon usage bias between the phage and host genomes. The phage genome also contained a non-coding region with high nucleotide sequence similarity to a region in one of the host plasmids. No other phage-related sequences were found in the host ProJPt-1 genome. To the best of our knowledge, this is the first report of a phage from an obligate, mutualistic endosymbiont permanently associated with eukaryotic cells. PMID:28321010

Isolation and sequence characterization of DNA-A genome of a new begomovirus strain associated with severe leaf curling symptoms of Jatropha curcas L.

PubMed

Chauhan, Sushma; Rahman, Hifzur; Mastan, Shaik G; Pamidimarri, D V N Sudheer; Reddy, Muppala P

2018-07-20

Begomoviruses belong to the family Geminiviridae are associated with several disease symptoms, such as mosaic and leaf curling in Jatropha curcas. The molecular characterization of these viral strains will help in developing management strategies to control the disease. In this study, J. curcas that was infected with begomovirus and showed acute leaf curling symptoms were identified. DNA-A segment from pathogenic viral strain was isolated and sequenced. The sequenced genome was assembled and characterized in detail. The full-length DNA-A sequence was covered by primer walking. The genome sequence showed the general organization of DNA-A from begomovirus by the distribution of ORFs in both viral and anti-viral strands. The genome size ranged from 2844 bp-2852 bp. Three strains with minor nucleotide variations were identified, and a phylogenetic analysis was performed by comparing the DNA-A segments from other reported begomovirus isolates. The maximum sequence similarity was observed with Euphorbia yellow mosaic virus (FN435995). In the phylogenetic tree, no clustering was observed with previously reported begomovirus strains isolated from J. curcas host. The strains isolated in this study belong to new begomoviral strain that elicits symptoms of leaf curling in J. curcas. The results indicate that the probable origin of the strains is from Jatropha mosaic virus infecting J. gassypifolia. The strains isolated in this study are referred as Jatropha curcas leaf curl India virus (JCLCIV) based on the major symptoms exhibited by host J. curcas. Copyright © 2018 Elsevier B.V. All rights reserved.

Forensic strategy to ensure the quality of sequencing data of mitochondrial DNA in highly degraded samples.

PubMed

Adachi, Noboru; Umetsu, Kazuo; Shojo, Hideki

2014-01-01

Mitochondrial DNA (mtDNA) is widely used for DNA analysis of highly degraded samples because of its polymorphic nature and high number of copies in a cell. However, as endogenous mtDNA in deteriorated samples is scarce and highly fragmented, it is not easy to obtain reliable data. In the current study, we report the risks of direct sequencing mtDNA in highly degraded material, and suggest a strategy to ensure the quality of sequencing data. It was observed that direct sequencing data of the hypervariable segment (HVS) 1 by using primer sets that generate an amplicon of 407 bp (long-primer sets) was different from results obtained by using newly designed primer sets that produce an amplicon of 120-139 bp (mini-primer sets). The data aligned with the results of mini-primer sets analysis in an amplicon length-dependent manner; the shorter the amplicon, the more evident the endogenous sequence became. Coding region analysis using multiplex amplified product-length polymorphisms revealed the incongruence of single nucleotide polymorphisms between the coding region and HVS 1 caused by contamination with exogenous mtDNA. Although the sequencing data obtained using long-primer sets turned out to be erroneous, it was unambiguous and reproducible. These findings suggest that PCR primers that produce amplicons shorter than those currently recognized should be used for mtDNA analysis in highly degraded samples. Haplogroup motif analysis of the coding region and HVS should also be performed to improve the reliability of forensic mtDNA data. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Sequence of interleukin-2 isolated from human placental poly A+ RNA: possible role in maintenance of fetal allograft.

PubMed

Chernicky, C L; Tan, H; Burfeind, P; Ilan, J; Ilan, J

1996-02-01

There are several cell types within the placenta that produce cytokines which can contribute to the regulatory mechanisms that ensure normal pregnancy. The immunological milieu at the maternofetal interface is considered to be crucial for survival of the fetus. Interleukin-2 (IL-2) is expressed by the syncytiotrophoblast, the cell layer between the mother and the fetus. IL-2 appears to be a key factor in maintenance of pregnancy. Therefore, it was important to determine the sequence of human placental interleukin-2. Direct sequencing of human placental IL-2 cDNA was determined for the coding region. Subclone sequencing was carried out for the 5'- and 3'-untranslated regions (5'-UTR and 3'-UTR). The 5'-UTR for human placental IL-2 cDNA is 294 bp, which is 247 nucleotides longer than that reported for cDNA IL-2 derived from T cells. The sequence of the coding region is identical to that reported for T cell IL-2, while sequence analysis of the polymerase chain reaction (PCR) product showed that the cDNA from the 3' end was the same as that reported for cDNA from T cells. Human placental IL-2 cDNA is 1,028 base pairs (excluding the poly A tail), which is 247 bp longer at the 5' end than that reported for IL-2 T cell cDNA. Therefore, the extended 5'-UTR of the placental IL-2 cDNA may be a consequence of alternative promoter utilization in the placenta.

A comparison of chloroplast genome sequences in Aconitum (Ranunculaceae): a traditional herbal medicinal genus

PubMed Central

Yao, Gang

2017-01-01

The herbal medicinal genus Aconitum L., belonging to the Ranunculaceae family, represents the earliest diverging lineage within the eudicots. It currently comprises of two subgenera, A. subgenus Lycoctonum and A. subg. Aconitum. The complete chloroplast (cp) genome sequences were characterized in three species: A. angustius, A. finetianum, and A. sinomontanum in subg. Lycoctonum and compared to other Aconitum species to clarify their phylogenetic relationship and provide molecular information for utilization of Aconitum species particularly in Eastern Asia. The length of the chloroplast genome sequences were 156,109 bp in A. angustius, 155,625 bp in A. finetianum and 157,215 bp in A. sinomontanum, with each species possessing 126 genes with 84 protein coding genes (PCGs). While genomic rearrangements were absent, structural variation was detected in the LSC/IR/SSC boundaries. Five pseudogenes were identified, among which Ψrps19 and Ψycf1 were in the LSC/IR/SSC boundaries, Ψrps16 and ΨinfA in the LSC region, and Ψycf15 in the IRb region. The nucleotide variability (Pi) of Aconitum was estimated to be 0.00549, with comparably higher variations in the LSC and SSC than the IR regions. Eight intergenic regions were revealed to be highly variable and a total of 58–62 simple sequence repeats (SSRs) were detected in all three species. More than 80% of SSRs were present in the LSC region. Altogether, 64.41% and 46.81% of SSRs are mononucleotides in subg. Lycoctonum and subg. Aconitum, respectively, while a higher percentage of di-, tri-, tetra-, and penta- SSRs were present in subg. Aconitum. Most species of subg. Aconitum in Eastern Asia were first used for phylogenetic analyses. The availability of the complete cp genome sequences of these species in subg. Lycoctonum will benefit future phylogenetic analyses and aid in germplasm utilization in Aconitum species. PMID:29134154

A comparison of chloroplast genome sequences in Aconitum (Ranunculaceae): a traditional herbal medicinal genus.

PubMed

Kong, Hanghui; Liu, Wanzhen; Yao, Gang; Gong, Wei

2017-01-01

The herbal medicinal genus Aconitum L., belonging to the Ranunculaceae family, represents the earliest diverging lineage within the eudicots. It currently comprises of two subgenera, A . subgenus Lycoctonum and A . subg. Aconitum . The complete chloroplast (cp) genome sequences were characterized in three species: A. angustius , A. finetianum , and A. sinomontanum in subg. Lycoctonum and compared to other Aconitum species to clarify their phylogenetic relationship and provide molecular information for utilization of Aconitum species particularly in Eastern Asia. The length of the chloroplast genome sequences were 156,109 bp in A. angustius , 155,625 bp in A. finetianum and 157,215 bp in A. sinomontanum , with each species possessing 126 genes with 84 protein coding genes (PCGs). While genomic rearrangements were absent, structural variation was detected in the LSC/IR/SSC boundaries. Five pseudogenes were identified, among which Ψ rps 19 and Ψ ycf 1 were in the LSC/IR/SSC boundaries, Ψ rps 16 and Ψ inf A in the LSC region, and Ψ ycf 15 in the IRb region. The nucleotide variability ( Pi ) of Aconitum was estimated to be 0.00549, with comparably higher variations in the LSC and SSC than the IR regions. Eight intergenic regions were revealed to be highly variable and a total of 58-62 simple sequence repeats (SSRs) were detected in all three species. More than 80% of SSRs were present in the LSC region. Altogether, 64.41% and 46.81% of SSRs are mononucleotides in subg. Lycoctonum and subg. Aconitum , respectively, while a higher percentage of di-, tri-, tetra-, and penta- SSRs were present in subg. Aconitum . Most species of subg. Aconitum in Eastern Asia were first used for phylogenetic analyses. The availability of the complete cp genome sequences of these species in subg. Lycoctonum will benefit future phylogenetic analyses and aid in germplasm utilization in Aconitum species.

Molecular detection and characterization of Hepatozoon spp. in dogs from the central part of Turkey.

PubMed

Aydin, Mehmet Fatih; Sevinc, Ferda; Sevinc, Mutlu

2015-04-01

Canine hepatozoonosis is a tick-borne protozoal disease caused by Hepatozoon spp. Two species of Hepatozoon are currently known to infect dogs as Hepatozoon canis and H. americanum. Although H. canis generally causes a chronic infection with relatively mild clinical alterations compared to H. americanum, infection by H. canis can be life-threatening. The disease is widespread in USA, Africa, Europe, South America, and Asia. To determine the frequency of infection with Hepatozoon spp. in stray dogs from Central Anatolia Region of Turkey, a total of 221 blood samples collected over a three-year period were evaluated by using genus specific Polymerase Chain Reaction (PCR) designed to amplify a fragment of 666bp located in 18 S rRNA gene of Hepatozoon spp. Eight (3.61%) blood samples were positive for Hepatozoon spp. For the classification of species, all positive PCR products were purified with a PCR purification kit and sequenced. Sequencing results of eight representative amplicons indicated that 6 were 98-99% identical to the sequence of H. canis and the other 2 sequences were 95-97% identical to the sequence of Hepatozoon spp. So it was named Hepatozoon sp. MF. A phylogenetic tree was constructed from the sequences of the tick-borne agents identified previously and in this study using the neighbor-joining method. The nucleotide sequences were compared to the H. canis sequences reported in Turkey using the nucleotide Basic Local Alignment Search Tool (BLAST) program. The results of this study are significant in terms of the presence of a novel canine Hepatozoon genotype. Copyright © 2015 Elsevier GmbH. All rights reserved.

Genetic differentiation of Artyfechinostomum malayanum and A. sufrartyfex (Trematoda: Echinostomatidae) based on internal transcribed spacer sequences.

PubMed

Tantrawatpan, Chairat; Saijuntha, Weerachai; Sithithaworn, Paiboon; Andrews, Ross H; Petney, Trevor N

2013-01-01

Genetic differentiation between two synonymous echinostomes species, Artyfechinostomum malayanum and Artyfechinostomum sufrartyfex was determined by using the first and second internal transcribed spacers (ITS1 and ITS2), the non-coding region of rDNA as genetic makers. Of the 699 bp of combined ITS1 and ITS2 sequences examined, 18 variable nucleotide positions (2.58 %) were observed. Of these, 17 positions could be used as diagnostic position between these two sibling species, whereas the other one variation was intraspecific variation of A. malayanum. A clade of A. malayanum was closely aligned with A. sufrartyfex and clearly distance from the cluster of other echinostomes. Our results may sufficiently suggest that the current synonymy of these species is not valid.

Description of the mitochondrial genome of the tree coral Dendrophyllia arbuscula (Anthozoa, Scleractinia).

PubMed

Luz, Bruna Louise Pereira; Capel, Kátia Cristina Cruz; Stampar, Sérgio Nascimento; Kitahara, Marcelo Visentini

2016-07-01

Dendrophylliidae is one of the few monophyletic families within the Scleractinia that embraces zooxanthellate and azooxanthellate species represented by both solitary and colonial forms. Among the exclusively azooxanthellate genera, Dendrophyllia is reported worldwide from 1 to 1200 m deep. To date, although three complete mitochondrial (mt) genomes from representatives of the family are available, only that from Turbinaria peltata has been formally published. Here we describe the complete nucleotide sequence of the mt genome from Dendrophyllia arbuscula that is 19 069 bp in length and comprises two rDNAs, two tRNAs, and 13 protein-coding genes arranged in the canonical scleractinian mt gene order. No genes overlap, resulting in the presence of 18 intergenic spacers and one of the longest scleractinian mt genome sequenced to date.

The complete mitochondrial genome of domestic sheep, Ovis aries.

PubMed

Hu, Xiao-di; Gao, Li-zhi

2016-01-01

In this study, we report a complete mitochondrial (mt) genome sequence of the Texel ewe, Ovis aries. The total genome is 16,615 bp in length and its overall base composition was estimated to be 33.68% for A, 27.36% for T, 25.86% for C, and 13.10% for G indicating an AT-rich (61.04%) feature in the O. aries mtgenome. It contains a total of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes and a control region (D-loop region). Comparisons with other publicly available sheep mitogenomes revealed a bunch of nucleotide diversity. This complete mitgenome sequence would enlarge useful genomic information for further studies on sheep evolution and domestication that will enhance germplasm conservation and breeding programs of O. aries.

Stability of Tandem Repeats in the Drosophila Melanogaster HSR-Omega Nuclear RNA

PubMed Central

Hogan, N. C.; Slot, F.; Traverse, K. L.; Garbe, J. C.; Bendena, W. G.; Pardue, M. L.

1995-01-01

The Drosophila melanogaster Hsr-omega locus produces a nuclear RNA containing >5 kb of tandem repeat sequences. These repeats are unique to Hsr-omega and show concerted evolution similar to that seen with classical satellite DNAs. In D. melanogaster the monomer is ~280 bp. Sequences of 191/2 monomers differ by 8 +/- 5% (mean +/- SD), when all pairwise comparisons are considered. Differences are single nucleotide substitutions and 1-3 nucleotide deletions/insertions. Changes appear to be randomly distributed over the repeat unit. Outer repeats do not show the decrease in monomer homogeneity that might be expected if homogeneity is maintained by recombination. However, just outside the last complete repeat at each end, there are a few fragments of sequence similar to the monomer. The sequences in these flanking regions are not those predicted for sequences decaying in the absence of recombination. Instead, the fragmentation of the sequence homology suggests that flanking regions have undergone more severe disruptions, possibly during an insertion or amplification event. Hsr-omega alleles differing in the number of repeats are detected and appear to be stable over a few thousand generations; however, both increases and decreases in repeat numbers have been observed. The new alleles appear to be as stable as their predecessors. No alleles of less than ~5 kb nor more than ~16 kb of repeats were seen in any stocks examined. The evidence that there is a limit on the minimum number of repeats is consistent with the suggestion that these repeats are important in the function of the unusual Hsr-omega nuclear RNA. PMID:7540581

Genetic structure of the Caribbean giant barrel sponge Xestospongia muta using the I3-M11 partition of COI

NASA Astrophysics Data System (ADS)

López-Legentil, S.; Pawlik, J. R.

2009-03-01

In recent years, reports of sponge bleaching, disease, and subsequent mortality have increased alarmingly. Population recovery may depend strongly on colonization capabilities of the affected species. The giant barrel sponge Xestospongia muta is a dominant reef constituent in the Caribbean. However, little is known about its population structure and gene flow. The 5'-end fragment of the mitochondrial gene cytochrome oxidase subunit I is often used to address these kinds of questions, but it presents very low intraspecific nucleotide variability in sponges. In this study, the usefulness of the I3-M11 partition of COI to determine the genetic structure of X. muta was tested for seven populations from Florida, the Bahamas and Belize. A total of 116 sequences of 544 bp were obtained for the I3-M11 partition corresponding to four haplotypes. In order to make a comparison with the 5'-end partition, 10 sequences per haplotype were analyzed for this fragment. The 40 resulting sequences were of 569 bp and corresponded to two haplotypes. The nucleotide diversity of the I3-M11 partition (π = 0.00386) was higher than that of the 5'-end partition (π = 0.00058), indicating better resolution at the intraspecific level. Sponges with the most divergent external morphologies (smooth vs. digitate surface) had different haplotypes, while those with the most common external morphology (rough surface) presented a mixture of haplotypes. Pairwise tests for genetic differentiation among geographic locations based on F ST values showed significant genetic divergence between most populations, but this genetic differentiation was not due to isolation by distance. While limited larval dispersal may have led to differentiation among some of the populations, the patterns of genetic structure appear to be most strongly related to patterns of ocean currents. Therefore, hydrological features may play a major role in sponge colonization and need to be considered in future plans for management and conservation of these important components of coral reef ecosystems.

Nucleotide sequence of the COX1 gene in Kluyveromyces lactis mitochondrial DNA: evidence for recent horizontal transfer of a group II intron.

PubMed

Hardy, C M; Clark-Walker, G D

1991-07-01

The cytochrome oxidase subunit 1 gene (COX1) in K. lactis K8 mtDNA spans 8,826 bp and contains five exons (termed E1-E5) totalling 1,602 bp that show 88% nucleotide base matching and 91% amino acid homology to the equivalent gene in S. cerevisiae. The four introns (termed K1 cox1.1-1.4) contain open reading frames encoding proteins of 786, 333, 319 and 395 amino acids respectively that potentially encode maturase enzymes. The first intron belongs to group II whereas the remaining three are group I type B. Introns K1 cox1.1, 1.3, and 1.4 are found at identical locations to introns Sc cox1.2, 1.5 a, and 1.5 b respectively from S. cerevisiae. Horizontal transfer of an intron between recent progenitors of K. lactis and S. cerevisiae is suggested by the observation that K1 cox1.1 and Sc cox1.2 show 96% base matching. Sequence comparisons between K1 cox1.3/Sc cox1.5 a and K1 cox1.4/Sc cox1.5 b suggest that these introns are likely to have been present in the ancestral COX1 gene of these yeasts. Intron K1 cox1.2 is not found in S. cerevisiae and appears at an unique location in K. lactis. A feature of the DNA sequences of the group I introns K1 cox1.2, 1.3, and 1.4 is the presence of 11 GC-rich clusters inserted into both coding and noncoding regions. Immediately downstream of the COX1 gene is the ATPase subunit 8 gene (A8) that shows 82.6% base matching to its counterpart in S. cerevisiae mtDNA.

Polynesian genetic affinities with Southeast Asian populations as identified by mtDNA analysis.

PubMed Central

Melton, T; Peterson, R; Redd, A J; Saha, N; Sofro, A S; Martinson, J; Stoneking, M

1995-01-01

Polynesian genetic affinities to populations of Asia were studied using mtDNA markers. A total of 1,037 individuals from 12 populations were screened for a 9-bp deletion in the intergenic region between the COII and tRNA(Lys) genes that approaches fixation in Polynesians. Sequence-specific oligonucleotide probes that identify specific mtDNA control region nucleotide substitutions were used to describe variation in individuals with the 9-bp deletion. The 9-bp deletion was not observed in northern Indians, Bangladeshis, or Pakistanis but was seen at low to moderate frequencies in the nine other Southeast Asian populations. Three substitutions in the control region at positions 16217, 16247, and 16261 have previously been observed at high frequency in Polynesian mtDNAs; this "Polynesian motif" was observed in 20% of east Indonesians with the 9-bp deletion but was observed in only one additional individual. mtDNA types related to the Polynesian motif are highest in frequency in the corridor from Taiwan south through the Philippines and east Indonesia, and the highest diversity for these types is in Taiwan. These results are consistent with linguistic evidence of a Taiwanese origin for the proto-Polynesian expansion, which spread throughout Oceania by way of Indonesia. PMID:7668267

Na+/K+-ATPase α-subunit in swimming crab Portunus trituberculatus: molecular cloning, characterization, and expression under low salinity stress

NASA Astrophysics Data System (ADS)

Han, Xiaolin; Liu, Ping; Gao, Baoquan; Wang, Haofeng; Duan, Yafei; Xu, Wenfei; Chen, Ping

2015-07-01

Na+/K+-ATPases are membrane-associated enzymes responsible for the active transport of Na+ and K+ ions across cell membranes, generating chemical and electrical gradients. These enzymes' α-subunit provides catalytic function, binding and hydrolyzing ATP, and itself becoming phosphorylated during the transport cycle. In this study, Na+/K+-ATPase α-subunit cDNA was cloned from gill tissue of the swimming crab Portunus trituberculatus by reverse-transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end methods. Analysis of the nucleotide sequence revealed that the cDNA had a full-length of 3 833 base pairs (bp), with an open reading frame of 3 120 bp, 5' untranslated region (UTR) of 317 bp, and 3' UTR of 396 bp. The sequence encoded a 1 039 amino acid protein with a predicted molecular weight of 115.57 kDa and with estimated pI of 5.21. It was predicted here to possess all expected features of Na+/K+-ATPase members, including eight transmembrane domains, putative ATP-binding site, and phosphorylation site. Comparison of amino acid sequences showed that the P. trituberculatus α-subunit possessed an overall identity of 75%-99% to that of other organisms. Phylogenetic analysis revealed that this α-subunit was in the same category as those of crustaceans. Quantitative real-time RT-PCR analysis indicated that this α-subunit's transcript were most highly expressed in gill and lowest in muscle. RT-PCR analysis also revealed that α-subunit expression in crab gill decreased after 2 and 6 h, but increased after 12, 24, 48, and 72 h. In addition, α-subunit expression in hepatopancreas of crab decreased after 2-72 h. These facts indicated that the crab's Na+/K+-ATPase α-subunit was potentially involved in the observed acute response to low salinity stress.

Characterization of mitochondrial genome of sea cucumber Stichopus horrens: a novel gene arrangement in Holothuroidea.

PubMed

Fan, SiGang; Hu, ChaoQun; Wen, Jing; Zhang, LvPing

2011-05-01

The complete mitochondrial DNA sequence contains useful information for phylogenetic analyses of metazoa. In this study, the complete mitochondrial DNA sequence of sea cucumber Stichopus horrens (Holothuroidea: Stichopodidae: Stichopus) is presented. The complete sequence was determined using normal and long PCRs. The mitochondrial genome of Stichopus horrens is a circular molecule 16257 bps long, composed of 13 protein-coding genes, two ribosomal RNA genes and 22 transfer RNA genes. Most of these genes are coded on the heavy strand except for one protein-coding gene (nad6) and five tRNA genes (tRNA ( Ser(UCN) ), tRNA ( Gln ), tRNA ( Ala ), tRNA ( Val ), tRNA ( Asp )) which are coded on the light strand. The composition of the heavy strand is 30.8% A, 23.7% C, 16.2% G, and 29.3% T bases (AT skew=0.025; GC skew=-0.188). A non-coding region of 675 bp was identified as a putative control region because of its location and AT richness. The intergenic spacers range from 1 to 50 bp in size, totaling 227 bp. A total of 25 overlapping nucleotides, ranging from 1 to 10 bp in size, exist among 11 genes. All 13 protein-coding genes are initiated with an ATG. The TAA codon is used as the stop codon in all the protein coding genes except nad3 and nad4 that use TAG as their termination codon. The most frequently used amino acids are Leu (16.29%), Ser (10.34%) and Phe (8.37%). All of the tRNA genes have the potential to fold into typical cloverleaf secondary structures. We also compared the order of the genes in the mitochondrial DNA from the five holothurians that are now available and found a novel gene arrangement in the mitochondrial DNA of Stichopus horrens.

Insertion of a solo LTR retrotransposon associates with spur mutations in 'Red Delicious' apple (Malus × domestica).

PubMed

Han, Mengxue; Sun, Qibao; Zhou, Junyong; Qiu, Huarong; Guo, Jing; Lu, Lijuan; Mu, Wenlei; Sun, Jun

2017-09-01

Insertion of a solo LTR, which possesses strong bidirectional, stem-specific promoter activities, is associated with the evolution of a dwarfing apple spur mutation. Spur mutations in apple scions revolutionized global apple production. Since long terminal repeat (LTR) retrotransposons are tightly related to natural mutations, inter-retrotransposon-amplified polymorphism technique and genome walking were used to find sequences in the apple genome based on these LTRs. In 'Red Delicious' spur mutants, a novel, 2190-bp insertion was identified as a spur-specific, solo LTR (sLTR) located at the 1038th nucleotide of another sLTR, which was 1536 bp in length. This insertion-within-an-insertion was localized within a preexisting Gypsy-50 retrotransposon at position 3,762,767 on chromosome 4. The analysis of transcriptional activity of the two sLTRs (the 2190- and 1536-bp inserts) indicated that the 2190-bp sLTR is a promoter, capable of bidirectional transcription. GUS expression in the 2190-bp-sense and 2190-bp-antisense transgenic lines was prominent in stems. In contrast, no promoter activity from either the sense or the antisense strand of the 1536-bp sLTR was detected. From ~150 kb of DNA on each side of the 2190 bp, sLTR insertion site, corresponding to 300 kb of the 'Golden Delicious' genome, 23 genes were predicted. Ten genes had predicted functions that could affect shoot development. This first report, of a sLTR insertion associated with the evolution of apple spur mutation, will facilitate apple breeding, cloning of spur-related genes, and discovery of mechanisms behind dwarf habit.

Partial bisulfite conversion for unique template sequencing.

PubMed

Kumar, Vijay; Rosenbaum, Julie; Wang, Zihua; Forcier, Talitha; Ronemus, Michael; Wigler, Michael; Levy, Dan

2018-01-25

We introduce a new protocol, mutational sequencing or muSeq, which uses sodium bisulfite to randomly deaminate unmethylated cytosines at a fixed and tunable rate. The muSeq protocol marks each initial template molecule with a unique mutation signature that is present in every copy of the template, and in every fragmented copy of a copy. In the sequenced read data, this signature is observed as a unique pattern of C-to-T or G-to-A nucleotide conversions. Clustering reads with the same conversion pattern enables accurate count and long-range assembly of initial template molecules from short-read sequence data. We explore count and low-error sequencing by profiling 135 000 restriction fragments in a PstI representation, demonstrating that muSeq improves copy number inference and significantly reduces sporadic sequencer error. We explore long-range assembly in the context of cDNA, generating contiguous transcript clusters greater than 3,000 bp in length. The muSeq assemblies reveal transcriptional diversity not observable from short-read data alone. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

An Efficient Strategy of Screening for Pathogens in Wild-Caught Ticks and Mosquitoes by Reusing Small RNA Deep Sequencing Data

PubMed Central

An, Xiaoping; Fan, Hang; Ma, Maijuan; Anderson, Benjamin D.; Jiang, Jiafu; Liu, Wei; Cao, Wuchun; Tong, Yigang

2014-01-01

This paper explored our hypothesis that sRNA (18∼30 bp) deep sequencing technique can be used as an efficient strategy to identify microorganisms other than viruses, such as prokaryotic and eukaryotic pathogens. In the study, the clean reads derived from the sRNA deep sequencing data of wild-caught ticks and mosquitoes were compared against the NCBI nucleotide collection (non-redundant nt database) using Blastn. The blast results were then analyzed with in-house Python scripts. An empirical formula was proposed to identify the putative pathogens. Results showed that not only viruses but also prokaryotic and eukaryotic species of interest can be screened out and were subsequently confirmed with experiments. Specially, a novel Rickettsia spp. was indicated to exist in Haemaphysalis longicornis ticks collected in Beijing. Our study demonstrated the reuse of sRNA deep sequencing data would have the potential to trace the origin of pathogens or discover novel agents of emerging/re-emerging infectious diseases. PMID:24618575

Molecular phylogeny for marine turtles based on sequences of the ND4-leucine tRNA and control regions of mitochondrial DNA.

PubMed

Dutton, P H; Davis, S K; Guerra, T; Owens, D

1996-06-01

Marine turtles are divided into two families, the Dermochelyidae and the Cheloniidae. The majority of species are currently placed within the two tribes of the Cheloniidae, the Chelonini and the Carettini, but debate continues over generic and tribal affinities as well as species boundaries. We used nucleotide sequences (907 bp) from the ND4-LEU tRNA region and the control region (526 bp) of mitochondrial DNA to resolve areas of uncertainty in marine turtle (Chelonioidae) systematics. The ND4-LEU tRNA fragment was more conserved than the fragment from the control region, with sequence divergences ranging from 0.026 to 0.148 and 0.067 to 0.267, respectively. Parsimony analysis based only on the ND4-LEU tRNA data suggests that the hawksbill, Eretmochelys imbricata, lies within the tribe Carettni and is closely related to the genus Caretta, but could not resolve the position of the flatback, Natator depressus. A similar analysis based only on the control region sequence data suggested that N. depressus is affiliated with the Chelonini, but failed to resolve the position of E. imbricata and the loggerhead, Caretta caretta. In contrast to these results, the combination of both data sets with published cytochrome b data produced a phylogeny based on 1924 bp of sequence data which resolves the position of E. imbricata relative to Caretta and Lepidochelys and joins N. depressus as sister to the Carettini. Based on the molecular data, the Chelonini contains the Chelonia species, while the Carettini contains the remaining species of Cheloniidae. The control region sequence divergence between Pacific and Atlantic populations of the leatherback, Dermochelys coriacea, was relatively low (0.0081) when compared with the green turtle, Chelonia mydas (0.071-0.074). Atlantic and Pacific populations of Ch. mydas were found to be paraphyletic with respect to the black turtle, Ch. agassizi, suggesting that the current taxonomic designations within the Pacific Chelonia are questionable. This analysis shows the utility of combining sequence data for different regions of mtDNA that by themselves are insufficient to obtain robust phylogenies.

Two different size classes of 5S rDNA units coexisting in the same tandem array in the razor clam Ensis macha: is this region suitable for phylogeographic studies?

PubMed

Fernández-Tajes, Juan; Méndez, Josefina

2009-12-01

For a study of 5S ribosomal genes (rDNA) in the razor clam Ensis macha, the 5S rDNA region was amplified and sequenced. Two variants, so-called type I or short repeat (approximately 430 bp) and type II or long repeat (approximately 735 bp), appeared to be the main components of the 5S rDNA of this species. Their spacers differed markedly, both in length and nucleotide composition. The organization of the two variants was investigated by amplifying the genomic DNA with primers based on the sequence of the type I and type II spacers. PCR amplification products with primers EMLbF and EMSbR showed that the long and short repeats are associated within the same tandem array, suggesting an intermixed arrangement of both spacers. Nevertheless, amplifications carried out with inverse primers EMSinvF/R and EMLinvF/R revealed that some short and long repeats are contiguous in the same tandem array. This is the first report of the coexistence of two variable spacers in the same tandem array in bivalve mollusks.

Genetic and Biochemical Characterization of Monokaryotic Progeny Strains of Button Mushroom (Agaricus bisporus)

PubMed Central

Kwon, Hyuk Woo; Choi, Min Ah; Yun, Yeo Hong; Oh, Youn-Lee; Kong, Won-Sik

2015-01-01

To promote the selection of promising monokaryotic strains of button mushroom (Agaricus bisporus) during breeding, 61 progeny strains derived from basidiospores of two different lines of dikaryotic parental strains, ASI1038 and ASI1346, were analyzed by nucleotide sequencing of the intergenic spacer I (IGS I) region in their rDNA and by extracellular enzyme assays. Nineteen different sizes of IGS I, which ranged from 1,301 to 1,348 bp, were present among twenty ASI1346-derived progeny strains, while 15 different sizes of IGS I, which ranged from 700 to 1,347 bp, were present among twenty ASI1038-derived progeny strains. Phylogenetic analysis of the IGS sequences revealed that different clades were present in both the ASI10388- and ASI1346-derived progeny strains. Plating assays of seven kinds of extracellular enzymes (β-glucosidase, avicelase, CM-cellulase, amylase, pectinase, xylanase, and protease) also revealed apparent variation in the ability to produce extracellular enzymes among the 40 tested progeny strains from both parental A. bisporus strains. Overall, this study demonstrates that characterization of IGS I regions and extracellular enzymes is useful for the assessment of the substrate-degrading ability and heterogenicity of A. bisporus monokaryotic strains. PMID:25892920

Lack of genetic structure in the jellyfish Pelagia noctiluca (Cnidaria: Scyphozoa: Semaeostomeae) across European seas.

PubMed

Stopar, Katja; Ramsak, Andreja; Trontelj, Peter; Malej, Alenka

2010-10-01

The genetic structure of the holopelagic scyphozoan Pelagia noctiluca was inferred based on the study of 144 adult medusae. The areas of study were five geographic regions in two European seas (Eastern Atlantic and Mediterranean Sea). A 655-bp sequence of mitochondrial cytochrome c oxidase subunit I (COI), and a 645-bp sequence of two nuclear internal transcribed spacers (ITS1 and ITS2) were analyzed. The protein coding COI gene showed a higher level of divergence than the combined nuclear ITS fragment (haplotype diversity 0.962 vs. 0.723, nucleotide diversity 1.16% vs. 0.31%). Phylogeographic analysis on COI gene revealed two clades, the larger consisting of specimens from all sampling sites, and the smaller mostly formed of specimens from the Mediterranean Sea. Haplotype diversity was very high throughout the sampled area, and within sample diversity was higher than diversity among geographical regions. No strongly supported genetically or geographically distinct groups of P. noctiluca were found. The results - long distance dispersal, insignificant F(ST) values, lack of isolation by distance - pointed toward an admixture among Mediterranean and East Atlantic populations. Copyright 2010 Elsevier Inc. All rights reserved.

Two haplotype clusters of Echinococcus granulosus sensu stricto in northern Iraq (Kurdistan region) support the hypothesis of a parasite cradle in the Middle East.

PubMed

Hassan, Zuber Ismael; Meerkhan, Azad Abdullah; Boufana, Belgees; Hama, Abdullah A; Ahmed, Bayram Dawod; Mero, Wijdan Mohammed Salih; Orsten, Serra; Interisano, Maria; Pozio, Edoardo; Casulli, Adriano

2017-08-01

Human cystic echinococcosis (CE) caused by Echinococcus granulosus s.s. is a major public health problem in Iraqi Kurdistan with a reported surgical incidence of 6.3 per 100,000 Arbil inhabitants. A total of 125 Echinococcus isolates retrieved from sheep, goats and cattle were used in this study. Our aim was to determine species/genotypes infecting livestock in Iraqi Kurdistan and examine intraspecific variation and population structure of Echinococcus granulosus s.s. in this region and relate it to that of other regions worldwide. Using nucleotide sequences of the mitochondrial cytochrome c oxidase subunit 1 (cox 1) we identified E. granulosus s.s. as the cause of hydatidosis in all examined animals. The haplotype network displayed a double-clustered topology with two main E. granulosus s.s. haplotypes, (KU05) and (KU33). The 'founder' haplotype (KU05) confirmed the presence of a common lineage of non-genetically differentiated populations as inferred by the low non-significant fixation index values. Overall diversity and neutrality indices indicated demographic expansion. We used E. granulosus s.s. nucleotide sequences from GenBank to draw haplotype networks for the Middle East (Iran, Jordan and Turkey), Europe (Albania, Greece, Italy, Romania and Spain), China, Mongolia, Russia, South America (Argentina, Brazil, Chile and Mexico) and Tunisia. Networks with two haplotype clusters like that reported here for Iraqi Kurdistan were seen for the Middle East, Europe, Mongolia, Russia and Tunisia using both 827bp and 1609bp cox1 nucleotide sequences, whereas a star-like network was observed for China and South America. We hypothesize that the double clustering seen at what is generally assumed to be the cradle of domestication may have emerged independently and dispersed from the Middle East to other regions and that haplotype (KU33) may be the main haplotype within a second cluster in the Middle East from where it has spread into Europe, Mongolia, Russia and North Africa. Further studies using metacestodes of human origin are required to investigate the biological importance of E. granulosus s.s. haplotypes/clusters and their association, if any with clinical manifestations of CE infection. Copyright © 2017 Elsevier B.V. All rights reserved.

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam

2014-08-05

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam Huu

2015-11-24

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

Nucleotide sequence analysis reveals linked N-acetyl hydrolase, thioesterase, transport, and regulatory genes encoded by the bialaphos biosynthetic gene cluster of Streptomyces hygroscopicus.

PubMed Central

Raibaud, A; Zalacain, M; Holt, T G; Tizard, R; Thompson, C J

1991-01-01

Nucleotide sequence analysis of a 5,000-bp region of the bialaphos antibiotic production (bap) gene cluster defined five open reading frames (ORFs) which predicted structural genes in the order bah, ORF1, ORF2, and ORF3 followed by the regulatory gene, brpA (H. Anzai, T. Murakami, S. Imai, A. Satoh, K. Nagaoka, and C.J. Thompson, J. Bacteriol. 169:3482-3488, 1987). The four structural genes were translationally coupled and apparently cotranscribed from an undefined promoter(s) under the positive control of the brpA gene product. S1 mapping experiments indicated that brpA was transcribed by two promoters (brpAp1 and brpAp2) which initiate transcription 150 and 157 bp upstream of brp A within an intergenic region and at least one promoter further upstream within the bap gene cluster (brpAp3). All three transcripts were present at low levels during exponential growth and increased just before the stationary phase. The levels of the brpAp3 band continued to increase at the onset of stationary phase, whereas brpAp1-and brpAp2-protected fragments showed no further change. BrpA contained a possible helix-turn-helix motif at its C terminus which was similar to the C-terminal regulatory motif found in the receiver component of a family of two-component transcriptional activator proteins. This motif was not associated with the N-terminal domain conserved in other members of the family. The structural gene cluster sequenced began with bah, encoding a bialaphos acetylhydrolase which removes the N-acetyl group from bialaphos as one of the final steps in the biosynthetic pathway. The observation that Bah was similar to a rat and to a bacterial (Acinetobacter calcoaceticus) lipase probably reflects the fact that the ester bonds of triglycerides and the amide bond linking acetate to phosphinothricin are similar and hydrolysis is catalyzed by structurally related enzymes. This was followed by two regions encoding ORF1 and ORF2 which were similar to each other (48% nucleotide identity, 31% amino acid identity), as well as to GrsT, a protein encoded by a gene located adjacent to gramicidin S synthetase in Bacillus brevis, and to vertebrate (mallard duck and rat) thioesterases. The amino acid sequence and hydrophobicity profile of ORF3 indicated that it was related to a family of membrane transport proteins. It was strikingly similar to the citrate uptake protein encoded by the transposon Tn3411. Images PMID:2066341

Disease surveillance of Atlantic herring: molecular characterization of hepatic coccidiosis and a morphological report of a novel intestinal coccidian

USGS Publications Warehouse

Friend, Sarah E; Lovey, J; Hershberger, Paul

2016-01-01

Surveillance for pathogens of Atlantic herring, including viral hemorrhagic septicemia virus (VHSV),Ichthyophonus hoferi, and hepatic and intestinal coccidians, was conducted from 2012 to 2016 in the NW Atlantic Ocean, New Jersey, USA. Neither VHSV nor I. hoferi was detected in any sample. Goussia clupearum was found in the livers of 40 to 78% of adult herring in varying parasite loads; however, associated pathological changes were negligible. Phylogenetic analysis based on small subunit 18S rRNA gene sequences placed G. clupearum most closely with other extraintestinal liver coccidia from the genus Calyptospora, though the G. clupearum isolates had a unique nucleotide insertion between 604 and 729 bp that did not occur in any other coccidian species. G. clupearum oocysts from Atlantic and Pacific herring were morphologically similar, though differences occurred in oocyst dimensions. Comparison of G. clupearum genetic sequences from Atlantic and Pacific herring revealed 4 nucleotide substitutions and 2 gaps in a 1749 bp region, indicating some divergence in the geographically separate populations. Pacific G. clupearum oocysts were not directly infective, suggesting that a heteroxenous life cycle is likely. Intestinal coccidiosis was described for the first time from juvenile and adult Atlantic herring. A novel intestinal coccidian species was detected based on morphological characteristics of exogenously sporulated oocysts. A unique feature in these oocysts was the presence of 3 long (15.1 ± 5.1 µm, mean ±SD) spiny projections on both ends of the oocyst. The novel morphology of this coccidian led us to tentatively name this parasite G. echinata n. sp.

Detection of Strand Cleavage And Oxidation Damage Using Model DNA Molecules Captured in a Nanoscale Pore

NASA Technical Reports Server (NTRS)

Vercoutere, W.; Solbrig, A.; DeGuzman, V.; Deamer, D.; Akeson, M.

2003-01-01

We use a biological nano-scale pore to distinguish among individual DNA hairpins that differ by a single site of oxidation or a nick in the sugar-phosphate backbone. In earlier work we showed that the protein ion channel alpha-hemolysin can be used as a detector to distinguish single-stranded from double-stranded DNA, single base pair and single nucleotide differences. This resolution is in part a result of sensitivity to structural changes that influence the molecular dynamics of nucleotides within DNA. The strand cleavage products we examined here included a 5-base-pair (5-bp) hairpin with a 5-prime five-nucleotide overhang, and a complementary five-nucleotide oligomer. These produced predictable shoulder-spike and rapid near-full blockade signatures, respectively. When combined, strand annealing was monitored in real time. The residual current level dropped to a lower discrete level in the shoulder-spike blockade signatures, and the duration lengthened. However, these blockade signatures had a shorter duration than the unmodified l0bp hairpin. To test the pore sensitivity to nucleotide oxidation, we examined a 9-bp hairpin with a terminal 8-oxo-deoxyguanosine (8-oxo-dG), or a penultimate 8-oxo-dG. Each produced blockade signatures that differed from the otherwise identical control 9bp hairpins. This study showed that DNA structure is modified sufficiently by strand cleavage or oxidation damage at a single site to alter in a predictable manner the ionic current blockade signatures produced. This technique improves the ability to assess damage to DNA, and can provide a simple means to help characterize the risks of radiation exposure. It may also provide a method to test radiation protection.

Genetic and morphological characterization of Cladobotryum species causing cobweb disease of mushrooms.

PubMed

McKay, G J; Egan, D; Morris, E; Scott, C; Brown, A E

1999-02-01

Cladobotryum dendroides (= Dactylium dendroides) has hitherto been regarded as the major causal agent of cobweb disease of the cultivated mushroom, Agaricus bisporus. Nucleotide sequence data for the internal transcribed spacer (ITS) regions of four Cladobotryum/Hypomyces species reported to be associated with cobweb disease, however, indicate that the most common pathogen is now C. mycophilum. This cobweb pathogen varies somewhat in conidial septation from published descriptions of C. mycophilum and lacks the distinctive colony odor. ITS sequencing revealed minor nucleotide variation which split isolates of the pathogen into three subgroups, two comprising isolates that were sensitive to methylbenzimidazole carbamate (MBC) fungicides and one comprising MBC-resistant isolates. The MBC-resistant isolates, which were only obtained from Ireland and Great Britain, clustered together strongly in randomly amplified polymorphic DNA (RAPD) PCR analysis, suggesting that they may be clonal. The MBC-sensitive isolates were more diverse. A RAPD fragment of 800 to 900 bp, containing a microsatellite and found in the MBC-resistant isolates, also indicated their clonal nature; the microsatellites of these isolates contained the same number of GA repeats. Smaller, polymorphic microsatellites, similarly comprising GA repeats, in the MBC-sensitive isolates in general correlated with their geographic origin.

Genetic and Morphological Characterization of Cladobotryum Species Causing Cobweb Disease of Mushrooms

PubMed Central

McKay, Gareth J.; Egan, Damian; Morris, Elizabeth; Scott, Carol; Brown, Averil E.

1999-01-01

Cladobotryum dendroides (= Dactylium dendroides) has hitherto been regarded as the major causal agent of cobweb disease of the cultivated mushroom, Agaricus bisporus. Nucleotide sequence data for the internal transcribed spacer (ITS) regions of four Cladobotryum/Hypomyces species reported to be associated with cobweb disease, however, indicate that the most common pathogen is now C. mycophilum. This cobweb pathogen varies somewhat in conidial septation from published descriptions of C. mycophilum and lacks the distinctive colony odor. ITS sequencing revealed minor nucleotide variation which split isolates of the pathogen into three subgroups, two comprising isolates that were sensitive to methylbenzimidazole carbamate (MBC) fungicides and one comprising MBC-resistant isolates. The MBC-resistant isolates, which were only obtained from Ireland and Great Britain, clustered together strongly in randomly amplified polymorphic DNA (RAPD) PCR analysis, suggesting that they may be clonal. The MBC-sensitive isolates were more diverse. A RAPD fragment of 800 to 900 bp, containing a microsatellite and found in the MBC-resistant isolates, also indicated their clonal nature; the microsatellites of these isolates contained the same number of GA repeats. Smaller, polymorphic microsatellites, similarly comprising GA repeats, in the MBC-sensitive isolates in general correlated with their geographic origin. PMID:9925589

Genomics and introgression: discovery and mapping of thousands of species-diagnostic SNPs using RAD sequencing

USGS Publications Warehouse

Hand, Brian K.; Hether, Tyler D; Kovach, Ryan P.; Muhlfeld, Clint C.; Amish, Stephen J.; Boyer, Matthew C.; O’Rourke, Sean M.; Miller, Michael R.; Lowe, Winsor H.; Hohenlohe, Paul A.; Luikart, Gordon

2015-01-01

Invasive hybridization and introgression pose a serious threat to the persistence of many native species. Understanding the effects of hybridization on native populations (e.g., fitness consequences) requires numerous species-diagnostic loci distributed genome-wide. Here we used RAD sequencing to discover thousands of single-nucleotide polymorphisms (SNPs) that are diagnostic between rainbow trout (RBT, Oncorhynchus mykiss), the world’s most widely introduced fish, and native westslope cutthroat trout (WCT, O. clarkii lewisi) in the northern Rocky Mountains, USA. We advanced previous work that identified 4,914 species-diagnostic loci by using longer sequence reads (100 bp vs. 60 bp) and a larger set of individuals (n = 84). We sequenced RAD libraries for individuals from diverse sampling sources, including native populations of WCT and hatchery broodstocks of WCT and RBT. We also took advantage of a newly released reference genome assembly for RBT to align our RAD loci. In total, we discovered 16,788 putatively diagnostic SNPs, 10,267 of which we mapped to anchored chromosome locations on the RBT genome. A small portion of previously discovered putative diagnostic loci (325 of 4,914) were no longer diagnostic (i.e., fixed between species) based on our wider survey of non-hybridized RBT and WCT individuals. Our study suggests that RAD loci mapped to a draft genome assembly could provide the marker density required to identify genes and chromosomal regions influencing selection in admixed populations of conservation concern and evolutionary interest.

[Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

PubMed

Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

2011-03-01

To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.

Population Genetic Analyses of the Fungal Pathogen Colletotrichum fructicola on Tea-Oil Trees in China

PubMed Central

Li, He; Zhou, Guo-Ying; Liu, Jun-Ang; Xu, Jianping

2016-01-01

The filamentous fungus Colletotrichum fructicola is found in all five continents and is capable of causing severe diseases in a number of economically important plants such as avocado, fig, cocoa, pear, and tea-oil trees. However, almost nothing is known about its patterns of genetic variation and epidemiology on any of its host plant species. Here we analyzed 167 isolates of C. fructicola obtained from the leaves of tea-oil tree Camellia oleifera at 15 plantations in seven Chinese provinces. Multilocus sequence typing was conducted for all isolates based on DNA sequences at fragments of four genes: the internal transcribed spacers of the nuclear ribosomal RNA gene cluster (539 bp), calmodulin (633 bp), glutamine synthetase (711 bp), and glyceraldehyde-3-phosphate dehydrogenase (190 bp), yielding 3.52%, 0.63%, 8.44%, and 7.89% of single nucleotide polymorphic sites and resulting in 15, 5, 12 and 11 alleles respectively at the four gene fragments in the total sample. The combined allelic information from all four loci identified 53 multilocus genotypes with the most frequent represented by 21 isolates distributed in eight tea-oil plantations in three provinces, consistent with long-distance clonal dispersal. However, despite evidence for clonal dispersal, statistically significant genetic differentiation among geographic populations was detected. In addition, while no evidence of recombination was found within any of the four gene fragments, signatures of recombination were found among the four gene fragments in most geographic populations, consistent with sexual mating of this species in nature. Our study provides the first insights into the population genetics and epidemiology of the important plant fungal pathogen C. fructicola. PMID:27299731

Single nucleotide polymorphism (SNP) discovery in duplicated genomes: intron-primed exon-crossing (IPEC) as a strategy for avoiding amplification of duplicated loci in Atlantic salmon (Salmo salar) and other salmonid fishes

PubMed Central

Ryynänen, Heikki J; Primmer, Craig R

2006-01-01

Background Single nucleotide polymorphisms (SNPs) represent the most abundant type of DNA variation in the vertebrate genome, and their applications as genetic markers in numerous studies of molecular ecology and conservation of natural populations are emerging. Recent large-scale sequencing projects in several fish species have provided a vast amount of data in public databases, which can be utilized in novel SNP discovery in salmonids. However, the suggested duplicated nature of the salmonid genome may hamper SNP characterization if the primers designed in conserved gene regions amplify multiple loci. Results Here we introduce a new intron-primed exon-crossing (IPEC) method in an attempt to overcome this duplication problem, and also evaluate different priming methods for SNP discovery in Atlantic salmon (Salmo salar) and other salmonids. A total of 69 loci with differing priming strategies were screened in S. salar, and 27 of these produced ~13 kb of high-quality sequence data consisting of 19 SNPs or indels (one per 680 bp). The SNP frequency and the overall nucleotide diversity (3.99 × 10-4) in S. salar was lower than reported in a majority of other organisms, which may suggest a relative young population history for Atlantic salmon. A subset of primers used in cross-species analyses revealed considerable variation in the SNP frequencies and nucleotide diversities in other salmonids. Conclusion Sequencing success was significantly higher with the new IPEC primers; thus the total number of loci to screen in order to identify one potential polymorphic site was six times less with this new strategy. Given that duplication may hamper SNP discovery in some species, the IPEC method reported here is an alternative way of identifying novel polymorphisms in such cases. PMID:16872523

A locally funded Puerto Rican parrot (Amazona vittata) genome sequencing project increases avian data and advances young researcher education

PubMed Central

2012-01-01

Background Amazona vittata is a critically endangered Puerto Rican endemic bird, the only surviving native parrot species in the United States territory, and the first parrot in the large Neotropical genus Amazona, to be studied on a genomic scale. Findings In a unique community-based funded project, DNA from an A. vittata female was sequenced using a HiSeq Illumina platform, resulting in a total of ~42.5 billion nucleotide bases. This provided approximately 26.89x average coverage depth at the completion of this funding phase. Filtering followed by assembly resulted in 259,423 contigs (N50 = 6,983 bp, longest = 75,003 bp), which was further scaffolded into 148,255 fragments (N50 = 19,470, longest = 206,462 bp). This provided ~76% coverage of the genome based on an estimated size of 1.58 Gb. The assembled scaffolds allowed basic genomic annotation and comparative analyses with other available avian whole-genome sequences. Conclusions The current data represents the first genomic information from and work carried out with a unique source of funding. This analysis further provides a means for directed training of young researchers in genetic and bioinformatics analyses and will facilitate progress towards a full assembly and annotation of the Puerto Rican parrot genome. It also adds extensive genomic data to a new branch of the avian tree, making it useful for comparative analyses with other avian species. Ultimately, the knowledge acquired from these data will contribute to an improved understanding of the overall population health of this species and aid in ongoing and future conservation efforts. PMID:23587420

Candidate gene association mapping of Sclerotinia stalk rot resistance in sunflower (Helianthus annuus L.) uncovers the importance of COI1 homologs.

PubMed

Talukder, Zahirul I; Hulke, Brent S; Qi, Lili; Scheffler, Brian E; Pegadaraju, Venkatramana; McPhee, Kevin; Gulya, Thomas J

2014-01-01

Functional markers for Sclerotinia basal stalk rot resistance in sunflower were obtained using gene-level information from the model species Arabidopsis thaliana. Sclerotinia stalk rot, caused by Sclerotinia sclerotiorum, is one of the most destructive diseases of sunflower (Helianthus annuus L.) worldwide. Markers for genes controlling resistance to S. sclerotiorum will enable efficient marker-assisted selection (MAS). We sequenced eight candidate genes homologous to Arabidopsis thaliana defense genes known to be associated with Sclerotinia disease resistance in a sunflower association mapping population evaluated for Sclerotinia stalk rot resistance. The total candidate gene sequence regions covered a concatenated length of 3,791 bp per individual. A total of 187 polymorphic sites were detected for all candidate gene sequences, 149 of which were single nucleotide polymorphisms (SNPs) and 38 were insertions/deletions. Eight SNPs in the coding regions led to changes in amino acid codons. Linkage disequilibrium decay throughout the candidate gene regions declined on average to an r (2) = 0.2 for genetic intervals of 120 bp, but extended up to 350 bp with r (2) = 0.1. A general linear model with modification to account for population structure was found the best fitting model for this population and was used for association mapping. Both HaCOI1-1 and HaCOI1-2 were found to be strongly associated with Sclerotinia stalk rot resistance and explained 7.4 % of phenotypic variation in this population. These SNP markers associated with Sclerotinia stalk rot resistance can potentially be applied to the selection of favorable genotypes, which will significantly improve the efficiency of MAS during the development of stalk rot resistant cultivars.

Molecular Cloning of an Immunogenic Protein of Baylisascaris procyonis and Expression in Escherichia coli for Use in Developing Improved Serodiagnostic Assays▿

PubMed Central

Dangoudoubiyam, Sriveny; Vemulapalli, Ramesh; Hancock, Kathy; Kazacos, Kevin R.

2010-01-01

Larva migrans caused by Baylisascaris procyonis is an important zoonotic disease. Current serological diagnostic assays for this disease depend on the use of the parasite's larval excretory-secretory (ES) antigens. In order to identify genes encoding ES antigens and to generate recombinant antigens for use in diagnostic assays, construction and immunoscreening of a B. procyonis third-stage larva cDNA expression library was performed and resulted in identification of a partial-length cDNA clone encoding an ES antigen, designated repeat antigen 1 (RAG1). The full-length rag1 cDNA contained a 753-bp open reading frame that encoded a protein of 250 amino acids with 12 tandem repeats of a 12-amino-acid long sequence. The rag1 genomic DNA revealed a single intron of 837 bp that separated the 753-bp coding sequence into two exons delimited by canonical splice sites. No nucleotide or amino acid sequences present in the GenBank databases had significant similarity with those of RAG1. We have cloned, expressed, and purified the recombinant RAG1 (rRAG1) and analyzed its diagnostic potential by enzyme-linked immunosorbent assay. Anti-Baylisascaris species-specific rabbit serum showed strong reactivity to rRAG1, while only minimal to no reactivity was observed with sera against the related ascarids Toxocara canis and Ascaris suum, strongly suggesting the specificity of rRAG1. On the basis of these results, the identified RAG1 appears to be a promising diagnostic antigen for the development of serological assays for specific detection of B. procyonis larva migrans. PMID:20926699

High Resolution Size Analysis of Fetal DNA in the Urine of Pregnant Women by Paired-End Massively Parallel Sequencing

PubMed Central

Tsui, Nancy B. Y.; Jiang, Peiyong; Chow, Katherine C. K.; Su, Xiaoxi; Leung, Tak Y.; Sun, Hao; Chan, K. C. Allen; Chiu, Rossa W. K.; Lo, Y. M. Dennis

2012-01-01

Background Fetal DNA in maternal urine, if present, would be a valuable source of fetal genetic material for noninvasive prenatal diagnosis. However, the existence of fetal DNA in maternal urine has remained controversial. The issue is due to the lack of appropriate technology to robustly detect the potentially highly degraded fetal DNA in maternal urine. Methodology We have used massively parallel paired-end sequencing to investigate cell-free DNA molecules in maternal urine. Catheterized urine samples were collected from seven pregnant women during the third trimester of pregnancies. We detected fetal DNA by identifying sequenced reads that contained fetal-specific alleles of the single nucleotide polymorphisms. The sizes of individual urinary DNA fragments were deduced from the alignment positions of the paired reads. We measured the fractional fetal DNA concentration as well as the size distributions of fetal and maternal DNA in maternal urine. Principal Findings Cell-free fetal DNA was detected in five of the seven maternal urine samples, with the fractional fetal DNA concentrations ranged from 1.92% to 4.73%. Fetal DNA became undetectable in maternal urine after delivery. The total urinary cell-free DNA molecules were less intact when compared with plasma DNA. Urinary fetal DNA fragments were very short, and the most dominant fetal sequences were between 29 bp and 45 bp in length. Conclusions With the use of massively parallel sequencing, we have confirmed the existence of transrenal fetal DNA in maternal urine, and have shown that urinary fetal DNA was heavily degraded. PMID:23118982

Structural analysis of two length variants of the rDNA intergenic spacer from Eruca sativa.

PubMed

Lakshmikumaran, M; Negi, M S

1994-03-01

Restriction enzyme analysis of the rRNA genes of Eruca sativa indicated the presence of many length variants within a single plant and also between different cultivars which is unusual for most crucifers studied so far. Two length variants of the rDNA intergenic spacer (IGS) from a single individual E. sativa (cv. Itsa) plant were cloned and characterized. The complete nucleotide sequences of both the variants (3 kb and 4 kb) were determined. The intergenic spacer contains three families of tandemly repeated DNA sequences denoted as A, B and C. However, the long (4 kb) variant shows the presence of an additional repeat, denoted as D, which is a duplication of a 224 bp sequence just upstream of the putative transcription initiation site. Repeat units belonging to the three different families (A, B and C) were in the size range of 22 to 30 bp. Such short repeat elements are present in the IGS of most of the crucifers analysed so far. Sequence analysis of the variants (3 kb and 4 kb) revealed that the length heterogeneity of the spacer is located at three different regions and is due to the varying copy numbers of repeat units belonging to families A and B. Length variation of the spacer is also due to the presence of a large duplication (D repeats) in the 4 kb variant which is absent in the 3 kb variant. The putative transcription initiation site was identified by comparisons with the rDNA sequences from other plant species.

A complete mitochondrial genome of wheat (Triticum aestivum cv. Chinese Yumai), and fast evolving mitochondrial genes in higher plants.

PubMed

Cui, Peng; Liu, Huitao; Lin, Qiang; Ding, Feng; Zhuo, Guoyin; Hu, Songnian; Liu, Dongcheng; Yang, Wenlong; Zhan, Kehui; Zhang, Aimin; Yu, Jun

2009-12-01

Plant mitochondrial genomes, encoding necessary proteins involved in the system of energy production, play an important role in the development and reproduction of the plant. They occupy a specific evolutionary pattern relative to their nuclear counterparts. Here, we determined the winter wheat (Triticum aestivum cv. Chinese Yumai) mitochondrial genome in a length of 452 and 526 bp by shotgun sequencing its BAC library. It contains 202 genes, including 35 known protein-coding genes, three rRNA and 17 tRNA genes, as well as 149 open reading frames (ORFs; greater than 300 bp in length). The sequence is almost identical to the previously reported sequence of the spring wheat (T. aestivum cv. Chinese Spring); we only identified seven SNPs (three transitions and four transversions) and 10 indels (insertions and deletions) between the two independently acquired sequences, and all variations were found in non-coding regions. This result confirmed the accuracy of the previously reported mitochondrial sequence of the Chinese Spring wheat. The nucleotide frequency and codon usage of wheat are common among the lineage of higher plant with a high AT-content of 58%. Molecular evolutionary analysis demonstrated that plant mitochondrial genomes evolved at different rates, which may correlate with substantial variations in metabolic rate and generation time among plant lineages. In addition, through the estimation of the ratio of non-synonymous to synonymous substitution rates between orthologous mitochondrion-encoded genes of higher plants, we found an accelerated evolutionary rate that seems to be the result of relaxed selection.

pSLA2-M of Streptomyces rochei is a composite linear plasmid characterized by self-defense genes and homology with pSLA2-L.

PubMed

Yang, Yingjie; Kurokawa, Toru; Takahama, Yoshifumi; Nindita, Yosi; Mochizuki, Susumu; Arakawa, Kenji; Endo, Satoru; Kinashi, Haruyasu

2011-01-01

The 113,463-bp nucleotide sequence of the linear plasmid pSLA2-M of Streptomyces rochei 7434AN4 was determined. pSLA2-M had a 69.7% overall GC content, 352-bp terminal inverted repeats with 91% (321/352) identity at both ends, and 121 open reading frames. The rightmost 14.6-kb sequence was almost (14,550/14,555) identical to that of the coexisting 211-kb linear plasmid pSLA2-L. Adjacent to this homologous region an 11.8-kb CRISPR cluster was identified, which is known to function against phage infection in prokaryotes. This cluster region as well as another one containing two large membrane protein genes (orf78 and orf79) were flanked by direct repeats of 194 and 566 bp respectively. Hence the insertion of circular DNAs containing each cluster by homologous recombination was suggested. In addition, the orf71 encoded a Ku70/Ku80-like protein, known to function in the repair of double-strand DNA breaks in eukaryotes, but disruption of it did not affect the radiation sensitivity of the mutant. A pair of replication initiation genes (orf1-orf2) were identified at the extreme left end. Thus, pSLA2-M proved to be a composite linear plasmid characterized by self-defense genes and homology with pSLA2-L that might have been generated by multiple recombination events.

ICAM-1-related long non-coding RNA: promoter analysis and expression in human retinal endothelial cells.

PubMed

Lumsden, Amanda L; Ma, Yuefang; Ashander, Liam M; Stempel, Andrew J; Keating, Damien J; Smith, Justine R; Appukuttan, Binoy

2018-05-09

Regulation of intercellular adhesion molecule (ICAM)-1 in retinal endothelial cells is a promising druggable target for retinal vascular diseases. The ICAM-1-related (ICR) long non-coding RNA stabilizes ICAM-1 transcript, increasing protein expression. However, studies of ICR involvement in disease have been limited as the promoter is uncharacterized. To address this issue, we undertook a comprehensive in silico analysis of the human ICR gene promoter region. We used genomic evolutionary rate profiling to identify a 115 base pair (bp) sequence within 500 bp upstream of the transcription start site of the annotated human ICR gene that was conserved across 25 eutherian genomes. A second constrained sequence upstream of the orthologous mouse gene (68 bp; conserved across 27 Eutherian genomes including human) was also discovered. Searching these elements identified 33 matrices predictive of binding sites for transcription factors known to be responsive to a broad range of pathological stimuli, including hypoxia, and metabolic and inflammatory proteins. Five phenotype-associated single nucleotide polymorphisms (SNPs) in the immediate vicinity of these elements included four SNPs (i.e. rs2569693, rs281439, rs281440 and rs11575074) predicted to impact binding motifs of transcription factors, and thus the expression of ICR and ICAM-1 genes, with potential to influence disease susceptibility. We verified that human retinal endothelial cells expressed ICR, and observed induction of expression by tumor necrosis factor-α.

Purification, developmental expression, and in silico characterization of α-amylase inhibitor from Echinochloa frumentacea.

PubMed

Panwar, Priyankar; Verma, A K; Dubey, Ashutosh

2018-05-01

Barnyard ( Echinochloa frumentacea ) and finger ( Eleusine coracana ) millet growing at northwestern Himalaya were explored for the α-amylase inhibitor (α-AI). The mature seeds of barnyard millet variety PRJ1 had maximum α-AI activity which increases in different developmental stage. α-AI was purified up to 22.25-fold from barnyard millet variety PRJ1. Semi-quantitative PCR of different developmental stages of barnyard millet seeds showed increased levels of the transcript from 7 to 28 days. Sequence analysis revealed that it contained 315 bp nucleotide which encodes 104 amino acid sequence with molecular weight 10.72 kDa. The predicted 3D structure of α-AI was 86.73% similar to a bifunctional inhibitor of ragi. In silico analysis of 71 α-AI protein sequences were carried out for biochemical features, homology search, multiple sequence alignment, phylogenetic tree construction, motif, and superfamily distribution of protein sequences. Analysis of multiple sequence alignment revealed the existence of conserved regions NPLP[S/G]CRWYVV[S/Q][Q/R]TCG[V/I] throughout sequences. Superfam analysis revealed that α-AI protein sequences were distributed among seven different superfamilies.

Cloning and sequencing of the pheP gene, which encodes the phenylalanine-specific transport system of Escherichia coli.

PubMed Central

Pi, J; Wookey, P J; Pittard, A J

1991-01-01

The phenylalanine-specific permease gene (pheP) of Escherichia coli has been cloned and sequenced. The gene was isolated on a 6-kb Sau3AI fragment from a chromosomal library, and its presence was verified by complementation of a mutant lacking the functional phenylalanine-specific permease. Subcloning from this fragment localized the pheP gene on a 2.7-kb HindIII-HindII fragment. The nucleotide sequence of this 2.7-kb region was determined. An open reading frame was identified which extends from a putative start point of translation (GTG at position 636) to a termination signal (TAA at position 2010). The assignment of the GTG as the initiation codon was verified by site-directed mutagenesis of the initiation codon and by introducing a chain termination mutation into the pheP-lacZ fusion construct. A single initiation site of transcription 30 bp upstream of the start point of translation was identified by the primer extension analysis. The pheP structural gene consists of 1,374 nucleotides specifying a protein of 458 amino acid residues. The PheP protein is very hydrophobic (71% nonpolar residues). A topological model predicted from the sequence analysis defines 12 transmembrane segments. This protein is highly homologous with the AroP (general aromatic transport) system of E. coli (59.6% identity) and to a lesser extent with the yeast permeases CAN1 (arginine), PUT4 (proline), and HIP1 (histidine) of Saccharomyces cerevisiae. Images PMID:1711024

Grizzly bear corticosteroid binding globulin: Cloning and serum protein expression.

PubMed

Chow, Brian A; Hamilton, Jason; Alsop, Derek; Cattet, Marc R L; Stenhouse, Gordon; Vijayan, Mathilakath M

2010-06-01

Serum corticosteroid levels are routinely measured as markers of stress in wild animals. However, corticosteroid levels rise rapidly in response to the acute stress of capture and restraint for sampling, limiting its use as an indicator of chronic stress. We hypothesized that serum corticosteroid binding globulin (CBG), the primary transport protein for corticosteroids in circulation, may be a better marker of the stress status prior to capture in grizzly bears (Ursus arctos). To test this, a full-length CBG cDNA was cloned and sequenced from grizzly bear testis and polyclonal antibodies were generated for detection of this protein in bear sera. The deduced nucleotide and protein sequences were 1218 bp and 405 amino acids, respectively. Multiple sequence alignments showed that grizzly bear CBG (gbCBG) was 90% and 83% identical to the dog CBG nucleotide and amino acid sequences, respectively. The affinity purified rabbit gbCBG antiserum detected grizzly bear but not human CBG. There were no sex differences in serum total cortisol concentration, while CBG expression was significantly higher in adult females compared to males. Serum cortisol levels were significantly higher in bears captured by leg-hold snare compared to those captured by remote drug delivery from helicopter. However, serum CBG expression between these two groups did not differ significantly. Overall, serum CBG levels may be a better marker of chronic stress, especially because this protein is not modulated by the stress of capture and restraint in grizzly bears. Copyright 2010 Elsevier Inc. All rights reserved.

Production of recombinant streptokinase from Streptococcus pyogenes isolate and its potential for thrombolytic therapy.

PubMed

Assiri, Abdullah S; El-Gamal, Basiouny A; Hafez, Elsayed E; Haidara, Mohamed A

2014-12-01

To produce an effective recombinant streptokinase (rSK) from pathogenic Streptococcus pyogenes isolate in yeast, and evaluate its potential for thrombolytic therapy. This study was conducted from November 2012 to December 2013 at King Khalid University, Abha, Kingdom of Saudi Arabia (KSA). Throat swabs collected from 45 pharyngitis patients in Asser Central Hospital, Abha, KSA were used to isolate Streptococcus pyogenes. The bacterial DNA was used for amplification of the streptokinase gene (1200 bp). The gene was cloned and in vitro transcribed in an eukaryotic expression vector that was transformed into yeast Pichia pastoris SMD1168, and the rSK protein was purified and tested for its thrombolytic activity. The Streptococcus pyogenes strain was isolated and its DNA nucleotide sequence revealed similarity to other Streptococcus pyogenes in the Gene bank. Sequencing of the amplified gene based on DNA nucleotide sequence revealed a SK gene closely related to other SK genes in the Gene bank. However, based on deduced amino acids sequence, the gene formed a separate cluster different from clusters formed by other examined genes, suggesting a new bacterial isolate and accordingly a new gene. The purified protein showed 82% clot lysis compared to a commercial SK (81%) at an enzyme concentration of 2000 U/ml. The present yeast rSK showed similar thrombolytic activity in vitro as that of a commercial SK, suggesting its potential for thrombolytic therapy and large scale production. 

A 2,4-dichlorophenoxyacetic acid degradation plasmid pM7012 discloses distribution of an unclassified megaplasmid group across bacterial species.

PubMed

Sakai, Yoriko; Ogawa, Naoto; Shimomura, Yumi; Fujii, Takeshi

2014-03-01

Analysis of the complete nucleotide sequence of plasmid pM7012 from 2,4-dichlorophenoxyacetic-acid (2,4-D)-degrading bacterium Burkholderia sp. M701 revealed that the plasmid had 582 142 bp, with 541 putative protein-coding sequences and 39 putative tRNA genes for the transport of the standard 20 aa. pM7012 contains sequences homologous to the regions involved in conjugal transfer and plasmid maintenance found in plasmids byi_2p from Burkholderia sp. YI23 and pBVIE01 from Burkholderia sp. G4. No relaxase gene was found in any of these plasmids, although genes for a type IV secretion system and type IV coupling proteins were identified. Plasmids with no relaxase gene have been classified as non-mobile plasmids. However, nucleotide sequences with a high level of similarity to the genes for plasmid transfer, plasmid maintenance, 2,4-D degradation and arsenic resistance contained on pM7012 were also detected in eight other megaplasmids (~600 or 900 kb) found in seven Burkholderia strains and a strain of Cupriavidus, which were isolated as 2,4-D-degrading bacteria in Japan and the United States. These results suggested that the 2,4-D degradation megaplasmids related to pM7012 are mobile and distributed across various bacterial species worldwide, and that the plasmid group could be distinguished from known mobile plasmid groups.

A novel RNA species from the turtle mitochondrial genome: induction and regulation of transcription and processing under anoxic and freezing stresses.

PubMed

Cai, Q; Storey, K B

1997-08-01

The present study identifies a previously cloned cDNA, pBTaR914, as homologous to the mitochondrial WANCY (tryptophan, alanine, asparagine, cysteine, and tyrosine) tRNA gene cluster. This cDNA clone has a 304-bp sequence and its homologue, pBTaR09, has a 158-bp sequence with a long poly(A)+ tail (more than 60 adenosines). RNA blotting analysis using pBTaR914 probe against the total RNA from the tissues of adult and hatchling turtles revealed five bands: 540, 1800, 2200, 3200, and 3900 nucleotides (nt). The 540-nt transcript is considered to be an intact mtRNA unit from a novel mtDNA gene designated WANCYHP that overlaps the WANCY tRNA gene cluster region. This transcript was highly induced by both anoxic and freezing stresses in turtle heart. The other transcripts are considered to be the processed intermediates of mtRNA transcripts with WANCYHP sequence. All these transcripts were differentially regulated by anoxia and freezing in different organs. The data suggest that mtRNA processing is sensitive to regulation by external stresses, oxygen deprivation, and freezing. Furthermore, the fact that the WANCYHP transcript is highly induced during anoxic exposure suggests that it may play an important role in the regulation of mitochondrial activities to coordinate the physiological adaptation to anoxia.

Reconstruction of the ancestral plastid genome in Geraniaceae reveals a correlation between genome rearrangements, repeats, and nucleotide substitution rates.

PubMed

Weng, Mao-Lun; Blazier, John C; Govindu, Madhumita; Jansen, Robert K

2014-03-01

Geraniaceae plastid genomes are highly rearranged, and each of the four genera already sequenced in the family has a distinct genome organization. This study reports plastid genome sequences of six additional species, Francoa sonchifolia, Melianthus villosus, and Viviania marifolia from Geraniales, and Pelargonium alternans, California macrophylla, and Hypseocharis bilobata from Geraniaceae. These genome sequences, combined with previously published species, provide sufficient taxon sampling to reconstruct the ancestral plastid genome organization of Geraniaceae and the rearrangements unique to each genus. The ancestral plastid genome of Geraniaceae has a 4 kb inversion and a reduced, Pelargonium-like small single copy region. Our ancestral genome reconstruction suggests that a few minor rearrangements occurred in the stem branch of Geraniaceae followed by independent rearrangements in each genus. The genomic comparison demonstrates that a series of inverted repeat boundary shifts and inversions played a major role in shaping genome organization in the family. The distribution of repeats is strongly associated with breakpoints in the rearranged genomes, and the proportion and the number of large repeats (>20 bp and >60 bp) are significantly correlated with the degree of genome rearrangements. Increases in the degree of plastid genome rearrangements are correlated with the acceleration in nonsynonymous substitution rates (dN) but not with synonymous substitution rates (dS). Possible mechanisms that might contribute to this correlation, including DNA repair system and selection, are discussed.

Isolation of a gene (pbsC) required for siderophore biosynthesis in fluorescent Pseudomonas sp. strain M114.

PubMed

Adams, C; Dowling, D N; O'Sullivan, D J; O'Gara, F

1994-06-03

An iron-regulated gene, pbsC, required for siderophore production in fluorescent Pseudomonas sp. strain M114 has been identified. A kanamycin-resistance cassette was inserted at specific restriction sites within a 7 kb genomic fragment of M114 DNA and by marker exchange two siderophore-negative mutants, designated M1 and M2, were isolated. The nucleotide sequence of approximately 4 kb of the region flanking the insertion sites was determined and a large open reading frame (ORF) extending for 2409 bp was identified. This gene was designated pbsC (pseudobactin synthesis C) and its putative protein product termed PbsC. PbsC was found to be homologous to a family of enzymes involved in the biosynthesis of secondary metabolites, including EntF of Escherichia coli. These enzymes are believed to act via ATP-dependent binding of AMP to their substrate. Several areas of high sequence homology between these proteins and PbsC were observed, including a conserved AMP-binding domain. The expression of pbsC is iron-regulated as revealed when a DNA fragment containing the upstream region was cloned in a promoter probe vector and conjugated into the wild-type strain, M114. The nucleotide sequence upstream of the putative translational start site contains a region homologous to previously defined -16 to -25 sequences of iron-regulated genes but did not contain an iron-box consensus sequence. It was noted that inactivation of the pbsC gene also affected other iron-regulated phenotypes of Pseudomonas M114.

Complete Mitochondrial Genome of Echinostoma hortense (Digenea: Echinostomatidae).

PubMed

Liu, Ze-Xuan; Zhang, Yan; Liu, Yu-Ting; Chang, Qiao-Cheng; Su, Xin; Fu, Xue; Yue, Dong-Mei; Gao, Yuan; Wang, Chun-Ren

2016-04-01

Echinostoma hortense (Digenea: Echinostomatidae) is one of the intestinal flukes with medical importance in humans. However, the mitochondrial (mt) genome of this fluke has not been known yet. The present study has determined the complete mt genome sequences of E. hortense and assessed the phylogenetic relationships with other digenean species for which the complete mt genome sequences are available in GenBank using concatenated amino acid sequences inferred from 12 protein-coding genes. The mt genome of E. hortense contained 12 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 1 non-coding region. The length of the mt genome of E. hortense was 14,994 bp, which was somewhat smaller than those of other trematode species. Phylogenetic analyses based on concatenated nucleotide sequence datasets for all 12 protein-coding genes using maximum parsimony (MP) method showed that E. hortense and Hypoderaeum conoideum gathered together, and they were closer to each other than to Fasciolidae and other echinostomatid trematodes. The availability of the complete mt genome sequences of E. hortense provides important genetic markers for diagnostics, population genetics, and evolutionary studies of digeneans.

Complete Mitochondrial Genome of Echinostoma hortense (Digenea: Echinostomatidae)

PubMed Central

Liu, Ze-Xuan; Zhang, Yan; Liu, Yu-Ting; Chang, Qiao-Cheng; Su, Xin; Fu, Xue; Yue, Dong-Mei; Gao, Yuan; Wang, Chun-Ren

2016-01-01

Echinostoma hortense (Digenea: Echinostomatidae) is one of the intestinal flukes with medical importance in humans. However, the mitochondrial (mt) genome of this fluke has not been known yet. The present study has determined the complete mt genome sequences of E. hortense and assessed the phylogenetic relationships with other digenean species for which the complete mt genome sequences are available in GenBank using concatenated amino acid sequences inferred from 12 protein-coding genes. The mt genome of E. hortense contained 12 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 1 non-coding region. The length of the mt genome of E. hortense was 14,994 bp, which was somewhat smaller than those of other trematode species. Phylogenetic analyses based on concatenated nucleotide sequence datasets for all 12 protein-coding genes using maximum parsimony (MP) method showed that E. hortense and Hypoderaeum conoideum gathered together, and they were closer to each other than to Fasciolidae and other echinostomatid trematodes. The availability of the complete mt genome sequences of E. hortense provides important genetic markers for diagnostics, population genetics, and evolutionary studies of digeneans. PMID:27180575

The complete DNA sequence of lymphocystis disease virus.

PubMed

Tidona, C A; Darai, G

1997-04-14

Lymphocystis disease virus (LCDV) is the causative agent of lymphocystis disease, which has been reported to occur in over 100 different fish species worldwide. LCDV is a member of the family Iridoviridae and the type species of the genus Lymphocystivirus. The virions contain a single linear double-stranded DNA molecule, which is circularly permuted, terminally redundant, and heavily methylated at cytosines in CpG sequences. The complete nucleotide sequence of LCDV-1 (flounder isolate) was determined by automated cycle sequencing and primer walking. The genome of LCDV-1 is 102.653 bp in length and contains 195 open reading frames with coding capacities ranging from 40 to 1199 amino acids. Computer-assisted analyses of the deduced amino acid sequences led to the identification of several putative gene products with significant homologies to entries in protein data banks, such as the two major subunits of the viral DNA-dependent RNA polymerase, DNA polymerase, several protein kinases, two subunits of the ribonucleoside diphosphate reductase, DNA methyltransferase, the viral major capsid protein, insulin-like growth factor, and tumor necrosis factor receptor homolog.

Target capture enrichment of nuclear SNP markers for massively parallel sequencing of degraded and mixed samples.

PubMed

Bose, Nikhil; Carlberg, Katie; Sensabaugh, George; Erlich, Henry; Calloway, Cassandra

2018-05-01

DNA from biological forensic samples can be highly fragmented and present in limited quantity. When DNA is highly fragmented, conventional PCR based Short Tandem Repeat (STR) analysis may fail as primer binding sites may not be present on a single template molecule. Single Nucleotide Polymorphisms (SNPs) can serve as an alternative type of genetic marker for analysis of degraded samples because the targeted variation is a single base. However, conventional PCR based SNP analysis methods still require intact primer binding sites for target amplification. Recently, probe capture methods for targeted enrichment have shown success in recovering degraded DNA as well as DNA from ancient bone samples using next-generation sequencing (NGS) technologies. The goal of this study was to design and test a probe capture assay targeting forensically relevant nuclear SNP markers for clonal and massively parallel sequencing (MPS) of degraded and limited DNA samples as well as mixtures. A set of 411 polymorphic markers totaling 451 nuclear SNPs (375 SNPs and 36 microhaplotype markers) was selected for the custom probe capture panel. The SNP markers were selected for a broad range of forensic applications including human individual identification, kinship, and lineage analysis as well as for mixture analysis. Performance of the custom SNP probe capture NGS assay was characterized by analyzing read depth and heterozygote allele balance across 15 samples at 25 ng input DNA. Performance thresholds were established based on read depth ≥500X and heterozygote allele balance within ±10% deviation from 50:50, which was observed for 426 out of 451 SNPs. These 426 SNPs were analyzed in size selected samples (at ≤75 bp, ≤100 bp, ≤150 bp, ≤200 bp, and ≤250 bp) as well as mock degraded samples fragmented to an average of 150 bp. Samples selected for ≤75 bp exhibited 99-100% reportable SNPs across varied DNA amounts and as low as 0.5 ng. Mock degraded samples at 1 ng and 10 ng exhibited >90% reportable SNPs. Finally, two-person male-male mixtures were tested at 10 ng in contributor varying ratios. Overall, 85-100% of alleles unique to the minor contributor were observed at all mixture ratios. Results from these studies using the SNP probe capture NGS system demonstrates proof of concept for application to forensically relevant degraded and mixed DNA samples. Copyright © 2018 Elsevier B.V. All rights reserved.

Isolation and characterisation of mRNA encoding the salmon- and chicken-II type gonadotrophin-releasing hormones in the teleost fish Rutilus rutilus (Cyprinidae).

PubMed

Penlington, M C; Williams, M A; Sumpter, J P; Rand-Weaver, M; Hoole, D; Arme, C

1997-12-01

The complementary DNAs (cDNA) encoding the [Trp7,Leu8]-gonadotrophin-releasing hormone (salmon-type GnRH; sGnRH:GeneBank accession no. u60667) and the [His5,Trp7,Tyr8]-GnRH (chicken-II-type GnRH; cGnRH-II: GeneBank accession no. u60668) precursor in the roach (Rutilus rutilus) were isolated and sequenced following reverse transcription and rapid amplification of cDNA ends (RACE). The sGnRH and cGnRH-II precursor cDNAs consisted of 439 and 628 bp, and included open reading frames of 282 and 255 bp respectively. The structures of the encoded peptides were the same as GnRHs previously identified in other vertebrates. The sGnRH and cGnRH-II precursor cDNAs, including the non-coding regions, had 88.6 and 79.9% identity respectively, to those identified in goldfish (Carassius auratus). However, significant similarity was not observed between the non-coding regions of the GnRH cDNAs of Cyprinidae and other fish. The presumed third exon, encoding partial sGnRH associated peptide (GAP) of roach, demonstrated significant nucleotide and amino acid similarity with the appropriate regions in the goldfish, but not with other species, and this may indicate functional differences of GAP between different families of fish. cGnRH-II precursor cDNAs from roach had relatively high nucleotide similarity across this GnRH variant. Cladistic analysis classified the sGnRH and cGnRH-II precursor cDNAs into three and two groups respectively. However, the divergence between nucleotide sequences within the sGnRH variant was greater than those encoding the cGnRH-II precursors. Consistent with the consensus developed from previous studies, Northern blot analysis demonstrated that expression of sGnRH and cGnRH-II was restricted to the olfactory bulbs and midbrain of roach respectively. This work forms the basis for further study on the mechanisms by which the tapeworm, Ligula intestinalis, interacts with the pituitary-gonadal axis of its fish host.

Spiking of contemporary human template DNA with ancient DNA extracts induces mutations under PCR and generates nonauthentic mitochondrial sequences.

PubMed

Pusch, Carsten M; Bachmann, Lutz

2004-05-01

Proof of authenticity is the greatest challenge in palaeogenetic research, and many safeguards have become standard routine in laboratories specialized on ancient DNA research. Here we describe an as-yet unknown source of artifacts that will require special attention in the future. We show that ancient DNA extracts on their own can have an inhibitory and mutagenic effect under PCR. We have spiked PCR reactions including known human test DNA with 14 selected ancient DNA extracts from human and nonhuman sources. We find that the ancient DNA extracts inhibit the amplification of large fragments to different degrees, suggesting that the usual control against contaminations, i.e., the absence of long amplifiable fragments, is not sufficient. But even more important, we find that the extracts induce mutations in a nonrandom fashion. We have amplified a 148-bp stretch of the mitochondrial HVRI from contemporary human template DNA in spiked PCR reactions. Subsequent analysis of 547 sequences from cloned amplicons revealed that the vast majority (76.97%) differed from the correct sequence by single nucleotide substitutions and/or indels. In total, 34 positions of a 103-bp alignment are affected, and most mutations occur repeatedly in independent PCR amplifications. Several of the induced mutations occur at positions that have previously been detected in studies of ancient hominid sequences, including the Neandertal sequences. Our data imply that PCR-induced mutations are likely to be an intrinsic and general problem of PCR amplifications of ancient templates. Therefore, ancient DNA sequences should be considered with caution, at least as long as the molecular basis for the extract-induced mutations is not understood.

[A new herbs traceability method based on DNA barcoding-origin-morphology analysis--an example from an adulterant of 'Heiguogouqi'].

PubMed

Gu, Xuan; Zhang, Xiao-qin; Song, Xiao-na; Zang, Yi-mei; Li Yan-peng; Ma, Chang-hua; Zhao, Bai-xiao; Liu, Chun-sheng

2014-12-01

The fruit of Lycium ruthenicum is a common folk medicine in China. Now it is popular for its antioxidative effect and other medical functions. The adulterants of the herb confuse consumers. In order to identify a new adulterant of L. ruthenicum, a research was performed based on NCBI Nucleotide Database ITS Sequence, combined analysis of the origin and morphology of the adulterant to traceable varieties. Total genomic DNA was isolated from the materials, and nuclear DNA ITS sequences were amplified and sequenced; DNA fragments were collated and matched by using ContingExpress. Similarity identification of BLAST analysis was performed. Besides, the distribution of plant origin and morphology were considered to further identification and verification. Families and genera were identified by molecular identification method. The adulterant was identified as plant belonging to Berberis. Origin analysis narrowed the range of sample identification. Seven different kinds of plants in Berberis were potential sources of the sample. Adulterants variety was traced by morphological analysis. The united molecular identification-origin-morphology research proves to be a preceding way to medical herbs traceability with time-saving and economic advantages and the results showed the new adulterant of L. ruthenicum was B. kaschgarica. The main differences between B. kaschgarica and L. ruthenicum are as follows: in terms of the traits, the surface of B. kaschgarica is smooth and crispy, and that of L. ruthenicum is shrinkage, solid and hard. In microscopic characteristics, epicarp cells of B. aschgarica thickening like a string of beads, stone cells as the rectangle, and the stone cell walls of L. ruthenicum is wavy, obvious grain layer. In molecular sequences, the length of ITS sequence of B. kaschgarica is 606 bp, L. ruthenicum is 654 bp, the similarity of the two sequences is 53.32%.

Development of a PCR-based marker utilizing a deletion mutation in the dihydroflavonol 4-reductase (DFR) gene responsible for the lack of anthocyanin production in yellow onions (Allium cepa).

PubMed

Kim, Sunggil; Yoo, Kil Sun; Pike, Leonard M

2005-02-01

Bulb color in onions (Allium cepa) is an important trait, but the mechanism of color inheritance is poorly understood at the molecular level. A previous study showed that inactivation of the dihydroflavonol 4-reductase (DFR) gene at the transcriptional level resulted in a lack of anthocyanin production in yellow onions. The objectives of the present study were the identification of the critical mutations in the DFR gene (DFR-A) and the development of a PCR-based marker for allelic selection. We report the isolation of two additional DFR homologs (DFR-B and DFR-C). No unique sequences were identified in either DFR homolog, even in the untranslated region (UTR). Both genes shared more than 95% nucleotide sequence identity with the DFR-A gene. To obtain a unique sequence from each gene, we isolated the promoter regions. Sequences of the DFR-A and DFR-B promoters differed completely from one another, except for an approximately 100-bp sequence adjacent to the 5'UTR. It was possible to specifically amplify only the DFR-A gene using primers designed to anneal to the unique promoter region. The sequences of yellow and red DFR-A alleles were the same except for a single base-pair change in the promoter and an approximately 800-bp deletion within the 3' region of the yellow DFR-A allele. This deletion was used to develop a co-dominant PCR-based marker that segregated perfectly with color phenotypes in the F2 population. These results indicate that a deletion mutation in the yellow DFR-A gene results in the lack of anthocyanin production in yellow onions.

Isolation of a complementary DNA clone for thyroid microsomal antigen. Homology with the gene for thyroid peroxidase.

PubMed Central

Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B

1987-01-01

The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979

Development of a tetra-primer ARMS-PCR for detecting the E198A SNP in the isotype-1 β-tubulin gene of Haemonchus contortus populations in China.

PubMed

Zongze, Zhang; Xin, Yang; Awais, Ali Ahmad; Weiqiang, Lei; Chunqun, Wang; Di, Wenda; Yanqin, Zhou; Junlong, Zhao; Rui, Fang; Min, Hu

2018-03-15

The tetra-primer ARMS-PCR is a rapid, simple and low cost method for single nucleotide polymorphism (SNP) genotyping and has been used to detect SNPs associated with diseases and drug resistance. E198A in the isotype-1 β-tubulin gene is one of the three SNPs associated with benzimidazole resistance in parasitic nematode Haemonchus contortus. However, up to now, only PCR-RFLP method was used to test E198A in H. contortus. In the present study, we developed a tetra-primer ARMS-PCR to detect E198A in H. contortus and the accuracy of the results was compared with that of PCR-coupled sequencing. The results showed that optimization of PCR reaction system, especially the proportion of the amount of inner and outer primers, could achieve desirable amplification effect. Three different profiles displaying three distinct genotypes could be identified clearly and intuitively on the agarose gel where the samples with amplified PCR products containing two bands of 433 bp and 200 bp in size indicated susceptible homozygous (SS), those with PCR products containing two bands of 433 bp and 284 bp in length indicated resistant homozygous (RR) and the samples with amplified PCR products containing three bands of 433 bp, 284 bp and 200 bp in size indicated heterozygous (RS). The results showed that the established method can be successfully applied to the detection of E198A in H. contortus, which has high accuracy and is easy to perform. Copyright © 2018 Elsevier B.V. All rights reserved.

Complete nucleotide sequence of the Oenothera elata plastid chromosome, representing plastome I of the five distinguishable euoenothera plastomes.

PubMed

Hupfer, H; Swiatek, M; Hornung, S; Herrmann, R G; Maier, R M; Chiu, W L; Sears, B

2000-05-01

We describe the 159,443-bp [corrected] sequence of the plastid chromosome of Oenothera elata (evening primrose). The Oe. elata plastid chromosome represents type I of the five genetically distinguishable basic plastomes found in the subsection Euoenothera. The genus Oenothera provides an ideal system in which to address fundamental questions regarding the functional integration of the compartmentalised genetic system characteristic of the eukaryotic cell. Its highly developed taxonomy and genetics, together with a favourable combination of features in its genetic structure (interspecific fertility, stable heterozygous progeny, biparental transmission of organelles, and the phenomenon of complex heterozygosity), allow facile exchanges of nuclei, plastids and mitochondria, as well as individual chromosome pairs, between species. The resulting hybrids or cybrids are usually viable and fertile, but can display various forms of developmental disturbance.

Development of the polymerase chain reaction for diagnosis of chancroid.

PubMed Central

Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

1993-01-01

The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

Evaluation of full S1 gene sequencing of classical and variant infectious bronchitis viruses extracted from allantoic fluid and FTA cards.

PubMed

Manswr, Basim; Ball, Christopher; Forrester, Anne; Chantrey, Julian; Ganapathy, Kannan

2018-08-01

Sequence variability in the S1 gene determines the genotype of infectious bronchitis virus (IBV) strains. A single RT-PCR assay was developed to amplify and sequence the full S1 gene for six classical and variant IBVs (M41, D274, 793B, IS/885/00, IS/1494/06 and Q1) enriched in allantoic fluid (AF) or the same AF inoculated onto Flinders Technology Association (FTA) cards. Representative strains from each genotype were grown in specific-pathogen-free eggs and RNA was extracted from AF. Full S1 gene amplification was achieved using primer A and primer 22.51. Products were sequenced using primers A, 1050+, 1380+ and SX3+ to obtain short sequences covering the full gene. Following serial dilutions of AF, detection limits of the partial assay were higher than those of the full S1 gene. Partial S1 sequences exhibited higher-than-average nucleotide similarity percentages (79%; 352 bp) compared to full S1 sequences (77%; 1756 bp), suggesting that full S1 analysis allows greater strain differentiation. For IBV detection from AF-inoculated FTA cards, four serotypes were incubated for up to 21 days at three temperatures, 4°C, room temperature (approximately 24°C) and 40°C. RNA was extracted and tested with partial and full S1 protocols. Through partial sequencing, all IBVs were successfully detected at all sampling points and storage temperatures. In contrast, using full S1 sequencing it was not possible to amplify the gene beyond 14 days or when stored at 40°C. Data presented show that for full S1 sequencing, a substantial amount of RNA is needed. Field samples collected onto FTA cards are unlikely to yield such quantity or quality. AF: allantoic fluid; CD50: ciliostatic dose 50; FTA: Flinders Technology Association; IB: infectious bronchitis; IBV: infectious bronchitis virus.

Polymerase chain reaction for detection of invasive Shigella flexneri in food.

PubMed

Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

1990-06-01

The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.

Analysis of the global transcriptome of longan (Dimocarpus longan Lour.) embryogenic callus using Illumina paired-end sequencing

PubMed Central

2013-01-01

Background Longan is a tropical/subtropical fruit tree of great economic importance in Southeast Asia. Progress in understanding molecular mechanisms of longan embryogenesis, which is the primary influence on fruit quality and yield, is slowed by lack of transcriptomic and genomic information. Illumina second generation sequencing, which is suitable for generating enormous numbers of transcript sequences that can be used for functional genomic analysis of longan. Results In this study, a longan embryogenic callus (EC) cDNA library was sequenced using an Illumina HiSeq 2000 system. A total of 64,876,258 clean reads comprising 5.84 Gb of nucleotides were assembled into 68,925 unigenes of 448-bp mean length, with unigenes ≥1000 bp accounting for 8.26% of the total. Using BLASTx, 40,634 unigenes were found to have significant similarity with accessions in Nr and Swiss- Prot databases. Of these, 38,845 unigenes were assigned to 43 GO sub-categories and 17,118 unigenes were classified into 25 COG sub-groups. In addition, 17,306 unigenes mapped to 199 KEGG pathways, with the categories of Metabolic pathways, Plant-pathogen interaction, Biosynthesis of secondary metabolites, and Genetic information processing being well represented. Analyses of unigenes ≥1000 bp revealed 328 embryogenesis-related unigenes as well as numerous unigenes expressed in EC associated with functions of reproductive growth, such as flowering, gametophytogenesis, and fertility, and vegetative growth, such as root and shoot growth. Furthermore, 23 unigenes related to embryogenesis and reproductive and vegetative growth were validated by quantitative real time PCR (qPCR) in samples from different stages of longan somatic embryogenesis (SE); their differentially expressions in the various embryogenic cultures indicated their possible roles in longan SE. Conclusions The quantity and variety of expressed EC genes identified in this study is sufficient to serve as a global transcriptome dataset for longan EC and to provide more molecular resources for longan functional genomics. PMID:23957614

Insights from the complete chloroplast genome into the evolution of Sesamum indicum L.

PubMed

Zhang, Haiyang; Li, Chun; Miao, Hongmei; Xiong, Songjin

2013-01-01

Sesame (Sesamum indicum L.) is one of the oldest oilseed crops. In order to investigate the evolutionary characters according to the Sesame Genome Project, apart from sequencing its nuclear genome, we sequenced the complete chloroplast genome of S. indicum cv. Yuzhi 11 (white seeded) using Illumina and 454 sequencing. Comparisons of chloroplast genomes between S. indicum and the 18 other higher plants were then analyzed. The chloroplast genome of cv. Yuzhi 11 contains 153,338 bp and a total of 114 unique genes (KC569603). The number of chloroplast genes in sesame is the same as that in Nicotiana tabacum, Vitis vinifera and Platanus occidentalis. The variation in the length of the large single-copy (LSC) regions and inverted repeats (IR) in sesame compared to 18 other higher plant species was the main contributor to size variation in the cp genome in these species. The 77 functional chloroplast genes, except for ycf1 and ycf2, were highly conserved. The deletion of the cp ycf1 gene sequence in cp genomes may be due either to its transfer to the nuclear genome, as has occurred in sesame, or direct deletion, as has occurred in Panax ginseng and Cucumis sativus. The sesame ycf2 gene is only 5,721 bp in length and has lost about 1,179 bp. Nucleotides 1-585 of ycf2 when queried in BLAST had hits in the sesame draft genome. Five repeats (R10, R12, R13, R14 and R17) were unique to the sesame chloroplast genome. We also found that IR contraction/expansion in the cp genome alters its rate of evolution. Chloroplast genes and repeats display the signature of convergent evolution in sesame and other species. These findings provide a foundation for further investigation of cp genome evolution in Sesamum and other higher plants.

Molecular characterization of nucleopolyhedrovirus of three lepidopteran pests using late expression factor-8 gene.

PubMed

Jose, Jency; Jalali, S K; Shivalingaswamy, T M; Kumar, N K Krishna; Bhatnagar, R; Bandyopadhyay, A

2013-06-01

A PCR based method for detection of viral DNA in nucleopolyhedrovirus of three lepidopterans, Spodoptera litura, Amsacta albistriga and Helicoverpa armigera, was developed by employing the late expression factor-8 (lef-8) gene of three NPV using specific primers. The amplicons of 689, 699 and 665 bp were amplified, respectively, and the nucleotide sequences were submitted to GenBank and the accession numbers were obtained. The sequences of lef-8 gene of S. litura NPV and H. armigera NPV matched with those of their respective references in the GenBank database, thereby confirming their identity, however, the sequence of A. albistriga NPV was the first sequence submitted to the GenBank database. The sequence similarity analysis between the three lef-8 gene of NPV sequenced in the present study revealed that there was no significant similarity between them, however A. albistriga NPV and S. litura NPV were found to be closely related. CLUSTAL alignment of the sequences generated revealed general relatedness among NPVs lef-8 gene. The study confirmed that lef-8 gene can be used for quick and correct discriminatory identification of insect viruses.

Molecular characterization and combined genotype association study of bovine cluster of differentiation 14 gene with clinical mastitis in crossbred dairy cattle

PubMed Central

Selvan, A. Sakthivel; Gupta, I. D.; Verma, A.; Chaudhari, M. V.; Magotra, A.

2016-01-01

Aim: The present study was undertaken with the objectives to characterize and to analyze combined genotypes of cluster of differentiation 14 (CD14) gene to explore its association with clinical mastitis in Karan Fries (KF) cows maintained in the National Dairy Research Institute herd, Karnal. Materials and Methods: Genomic DNA was extracted using blood of randomly selected 94 KF lactating cattle by phenol-chloroform method. After checking its quality and quantity, polymerase chain reaction (PCR) was carried out using six sets of reported gene-specific primers to amplify complete KF CD14 gene. The forward and reverse sequences for each PCR fragments were assembled to form complete sequence for the respective region of KF CD14 gene. The multiple sequence alignments of the edited sequence with the corresponding reference with reported Bos taurus sequence (EU148610.1) were performed with ClustalW software to identify single nucleotide polymorphisms (SNPs). Basic Local Alignment Search Tool analysis was performed to compare the sequence identity of KF CD14 gene with other species. The restriction fragment length polymorphism (RFLP) analysis was carried out in all KF cows using Helicobacter pylori 188I (Hpy188I) (contig 2) and Haemophilus influenzae I (HinfI) (contig 4) restriction enzyme (RE). Cows were assigned genotypes obtained by PCR-RFLP analysis, and association study was done using Chi-square (χ2) test. The genotypes of both contigs (loci) number 2 and 4 were combined with respect to each animal to construct combined genotype patterns. Results: Two types of sequences of KF were obtained: One with 2630 bp having one insertion at 616 nucleotide (nt) position and one deletion at 1117 nt position, and the another sequence was of 2629 bp having only one deletion at 615 nt position. ClustalW, multiple alignments of KF CD14 gene sequence with B. taurus cattle sequence (EU148610.1), revealed 24 nt changes (SNPs). Cows were also screened using PCR-RFLP with Hpy188I (contig 2) and HinfI (contig 4) RE, which revealed three genotypes each that differed significantly regarding mastitis incidence. The maximum possible combination of these two loci shown nine combined genotype patterns and it was observed only eight combined genotypes out of nine: AACC, AACD, AADD, ABCD, ABDD, BBCC, BBCD, and BBDD. The combined genotype ABCC was not observed in the studied population of KF cows. Out of 94 animals, AACD combined genotype animals (10.63%) were found to be not affected with mastitis, and ABDD combined genotyped animals was observed having the highest mastitis incidence of 15.96%. Conclusion: AACD typed cows were found to be least susceptible to mastitis incidence as compared to other combined genotypes. PMID:27536026

Molecular characterization and combined genotype association study of bovine cluster of differentiation 14 gene with clinical mastitis in crossbred dairy cattle.

PubMed

Selvan, A Sakthivel; Gupta, I D; Verma, A; Chaudhari, M V; Magotra, A

2016-07-01

The present study was undertaken with the objectives to characterize and to analyze combined genotypes of cluster of differentiation 14 (CD14) gene to explore its association with clinical mastitis in Karan Fries (KF) cows maintained in the National Dairy Research Institute herd, Karnal. Genomic DNA was extracted using blood of randomly selected 94 KF lactating cattle by phenol-chloroform method. After checking its quality and quantity, polymerase chain reaction (PCR) was carried out using six sets of reported gene-specific primers to amplify complete KF CD14 gene. The forward and reverse sequences for each PCR fragments were assembled to form complete sequence for the respective region of KF CD14 gene. The multiple sequence alignments of the edited sequence with the corresponding reference with reported Bos taurus sequence (EU148610.1) were performed with ClustalW software to identify single nucleotide polymorphisms (SNPs). Basic Local Alignment Search Tool analysis was performed to compare the sequence identity of KF CD14 gene with other species. The restriction fragment length polymorphism (RFLP) analysis was carried out in all KF cows using Helicobacter pylori 188I (Hpy188I) (contig 2) and Haemophilus influenzae I (HinfI) (contig 4) restriction enzyme (RE). Cows were assigned genotypes obtained by PCR-RFLP analysis, and association study was done using Chi-square (χ (2)) test. The genotypes of both contigs (loci) number 2 and 4 were combined with respect to each animal to construct combined genotype patterns. Two types of sequences of KF were obtained: One with 2630 bp having one insertion at 616 nucleotide (nt) position and one deletion at 1117 nt position, and the another sequence was of 2629 bp having only one deletion at 615 nt position. ClustalW, multiple alignments of KF CD14 gene sequence with B. taurus cattle sequence (EU148610.1), revealed 24 nt changes (SNPs). Cows were also screened using PCR-RFLP with Hpy188I (contig 2) and HinfI (contig 4) RE, which revealed three genotypes each that differed significantly regarding mastitis incidence. The maximum possible combination of these two loci shown nine combined genotype patterns and it was observed only eight combined genotypes out of nine: AACC, AACD, AADD, ABCD, ABDD, BBCC, BBCD, and BBDD. The combined genotype ABCC was not observed in the studied population of KF cows. Out of 94 animals, AACD combined genotype animals (10.63%) were found to be not affected with mastitis, and ABDD combined genotyped animals was observed having the highest mastitis incidence of 15.96%. AACD typed cows were found to be least susceptible to mastitis incidence as compared to other combined genotypes.

Genetic diversity of Plasmodium Vivax revealed by the merozoite surface protein-1 icb5-6 fragment.

PubMed

Ruan, Wei; Zhang, Ling-Ling; Feng, Yan; Zhang, Xuan; Chen, Hua-Liang; Lu, Qiao-Yi; Yao, Li-Nong; Hu, Wei

2017-06-05

Plasmodium vivax remains a potential cause of morbidity and mortality for people living in its endemic areas. Understanding the genetic diversity of P. vivax from different regions is valuable for studying population dynamics and tracing the origins of parasites. The PvMSP-1 gene is highly polymorphic and has been used as a marker in many P. vivax population studies. The aim of this study was to investigate the genetic diversity of the PvMSP-1 gene icb5-6 fragment and to provide more genetic polymorphism data for further studies on P. vivax population structure and tracking of the origin of clinical cases. Nested PCR and sequencing of the PvMSP-1 icb5-6 marker were performed to obtain the nucleotide sequences of 95 P. vivax isolates collected from Zhejiang province, China. To investigate the genetic diversity of PvMSP-1, the 95 nucleotide sequences of the PvMSP-1 icb5-6 fragment were genotyped and analyzed using DnaSP v5, MEGA software. The 95 P. vivax isolates collected from Zhejiang province were either indigenous cases or imported cases from different regions around the world. A total of 95 sequences ranging from 390 to 460 bp were obtained. The 95 sequences were genotyped into four allele-types (Sal I, Belem, R-III and R-IV) and 17 unique haplotypes. R-III and Sal I were the predominant allele-types. The haplotype diversity (Hd) and nucleotide diversity (Pi) were estimated to be 0.729 and 0.062, indicating that the PvMSP-1 icb5-6 fragment had the highest level of polymorphism due to frequent recombination processes and single nucleotide polymorphism. The values of dN/dS and Tajima's D both suggested neutral selection for the PvMSP-1icb5-6 fragment. In addition, a rare recombinant style of R-IV type was identified. This study presented high genetic diversity in the PvMSP-1 marker among P. vivax strains from around the world. The genetic data is valuable for expanding the polymorphism information on P. vivax, which could be helpful for further study on population dynamics and tracking the origin of P. vivax.

A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

PubMed

Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

2009-11-01

Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

The complete mitochondrial genome of the diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae).

PubMed

Dai, Li-Shang; Zhu, Bao-Jian; Qian, Cen; Zhang, Cong-Fen; Li, Jun; Wang, Lei; Wei, Guo-Qing; Liu, Chao-Liang

2016-01-01

The complete mitochondrial genome (mitogenome) of Plutella xylostella (Lepidoptera: Plutellidae) was determined (GenBank accession No. KM023645). The length of this mitogenome is 16,014 bp with 13 protein-coding genes (PCGs), 2 rRNA genes, 22 tRNA genes and an A + T-rich region. It presents the typical gene organization and order for completely sequenced lepidopteran mitogenomes. The nucleotide composition of the genome is highly A + T biased, accounting for 81.48%, with a slightly positive AT skewness (0.005). All PCGs are initiated by typical ATN codons, except for the gene cox1, which uses CGA as its start codon. Some PCGs harbor TA (nad5) or incomplete termination codon T (cox1, cox2, nad2 and nad4), while others use TAA as their termination codons. The A + T-rich region is located between rrnS and trnM with a length of 888 bp.

Construction of Pseudomolecule Sequences of the aus Rice Cultivar Kasalath for Comparative Genomics of Asian Cultivated Rice

PubMed Central

Sakai, Hiroaki; Kanamori, Hiroyuki; Arai-Kichise, Yuko; Shibata-Hatta, Mari; Ebana, Kaworu; Oono, Youko; Kurita, Kanako; Fujisawa, Hiroko; Katagiri, Satoshi; Mukai, Yoshiyuki; Hamada, Masao; Itoh, Takeshi; Matsumoto, Takashi; Katayose, Yuichi; Wakasa, Kyo; Yano, Masahiro; Wu, Jianzhong

2014-01-01

Having a deep genetic structure evolved during its domestication and adaptation, the Asian cultivated rice (Oryza sativa) displays considerable physiological and morphological variations. Here, we describe deep whole-genome sequencing of the aus rice cultivar Kasalath by using the advanced next-generation sequencing (NGS) technologies to gain a better understanding of the sequence and structural changes among highly differentiated cultivars. The de novo assembled Kasalath sequences represented 91.1% (330.55 Mb) of the genome and contained 35 139 expressed loci annotated by RNA-Seq analysis. We detected 2 787 250 single-nucleotide polymorphisms (SNPs) and 7393 large insertion/deletion (indel) sites (>100 bp) between Kasalath and Nipponbare, and 2 216 251 SNPs and 3780 large indels between Kasalath and 93-11. Extensive comparison of the gene contents among these cultivars revealed similar rates of gene gain and loss. We detected at least 7.39 Mb of inserted sequences and 40.75 Mb of unmapped sequences in the Kasalath genome in comparison with the Nipponbare reference genome. Mapping of the publicly available NGS short reads from 50 rice accessions proved the necessity and the value of using the Kasalath whole-genome sequence as an additional reference to capture the sequence polymorphisms that cannot be discovered by using the Nipponbare sequence alone. PMID:24578372

Draft Sequences of the Radish (Raphanus sativus L.) Genome

PubMed Central

Kitashiba, Hiroyasu; Li, Feng; Hirakawa, Hideki; Kawanabe, Takahiro; Zou, Zhongwei; Hasegawa, Yoichi; Tonosaki, Kaoru; Shirasawa, Sachiko; Fukushima, Aki; Yokoi, Shuji; Takahata, Yoshihito; Kakizaki, Tomohiro; Ishida, Masahiko; Okamoto, Shunsuke; Sakamoto, Koji; Shirasawa, Kenta; Tabata, Satoshi; Nishio, Takeshi

2014-01-01

Radish (Raphanus sativus L., n = 9) is one of the major vegetables in Asia. Since the genomes of Brassica and related species including radish underwent genome rearrangement, it is quite difficult to perform functional analysis based on the reported genomic sequence of Brassica rapa. Therefore, we performed genome sequencing of radish. Short reads of genomic sequences of 191.1 Gb were obtained by next-generation sequencing (NGS) for a radish inbred line, and 76,592 scaffolds of ≥300 bp were constructed along with the bacterial artificial chromosome-end sequences. Finally, the whole draft genomic sequence of 402 Mb spanning 75.9% of the estimated genomic size and containing 61,572 predicted genes was obtained. Subsequently, 221 single nucleotide polymorphism markers and 768 PCR-RFLP markers were used together with the 746 markers produced in our previous study for the construction of a linkage map. The map was combined further with another radish linkage map constructed mainly with expressed sequence tag-simple sequence repeat markers into a high-density integrated map of 1,166 cM with 2,553 DNA markers. A total of 1,345 scaffolds were assigned to the linkage map, spanning 116.0 Mb. Bulked PCR products amplified by 2,880 primer pairs were sequenced by NGS, and SNPs in eight inbred lines were identified. PMID:24848699

Sequence diversity and differential expression of major phenylpropanoid-flavonoid biosynthetic genes among three mango varieties.

PubMed

Hoang, Van L T; Innes, David J; Shaw, P Nicholas; Monteith, Gregory R; Gidley, Michael J; Dietzgen, Ralf G

2015-07-30

Mango fruits contain a broad spectrum of phenolic compounds which impart potential health benefits; their biosynthesis is catalysed by enzymes in the phenylpropanoid-flavonoid (PF) pathway. The aim of this study was to reveal the variability in genes involved in the PF pathway in three different mango varieties Mangifera indica L., a member of the family Anacardiaceae: Kensington Pride (KP), Irwin (IW) and Nam Doc Mai (NDM) and to determine associations with gene expression and mango flavonoid profiles. A close evolutionary relationship between mango genes and those from the woody species poplar of the Salicaceae family (Populus trichocarpa) and grape of the Vitaceae family (Vitis vinifera), was revealed through phylogenetic analysis of PF pathway genes. We discovered 145 SNPs in total within coding sequences with an average frequency of one SNP every 316 bp. Variety IW had the highest SNP frequency (one SNP every 258 bp) while KP and NDM had similar frequencies (one SNP every 369 bp and 360 bp, respectively). The position in the PF pathway appeared to influence the extent of genetic diversity of the encoded enzymes. The entry point enzymes phenylalanine lyase (PAL), cinnamate 4-mono-oxygenase (C4H) and chalcone synthase (CHS) had low levels of SNP diversity in their coding sequences, whereas anthocyanidin reductase (ANR) showed the highest SNP frequency followed by flavonoid 3'-hydroxylase (F3'H). Quantitative PCR revealed characteristic patterns of gene expression that differed between mango peel and flesh, and between varieties. The combination of mango expressed sequence tags and availability of well-established reference PF biosynthetic genes from other plant species allowed the identification of coding sequences of genes that may lead to the formation of important flavonoid compounds in mango fruits and facilitated characterisation of single nucleotide polymorphisms between varieties. We discovered an association between the extent of sequence variation and position in the pathway for up-stream genes. The high expression of PAL, C4H and CHS genes in mango peel compared to flesh is associated with high amounts of total phenolic contents in peels, which suggest that these genes have an influence on total flavonoid levels in mango fruit peel and flesh. In addition, the particularly high expression levels of ANR in KP and NDM peels compared to IW peel and the significant accumulation of its product epicatechin gallate (ECG) in those extracts reflects the rate-limiting role of ANR on ECG biosynthesis in mango.

Cloning, molecular characterization and heterologous expression of AMY1, an alpha-amylase gene from Cryptococcus flavus.

PubMed

Galdino, Alexsandro S; Ulhoa, Cirano J; Moraes, Lídia Maria P; Prates, Maura V; Bloch, Carlos; Torres, Fernando A G

2008-03-01

A Cryptococcus flavus gene (AMY1) encoding an extracellular alpha-amylase has been cloned. The nucleotide sequence of the cDNA revealed an ORF of 1896 bp encoding for a 631 amino acid polypeptide with high sequence identity with a homologous protein isolated from Cryptococcus sp. S-2. The presence of four conserved signature regions, (I) (144)DVVVNH(149), (II) (235)GLRIDSLQQ(243), (III) (263)GEVFN(267), (IV) (327)FLENQD(332), placed the enzyme in the GH13 alpha-amylase family. Furthermore, sequence comparison suggests that the C. flavusalpha-amylase has a C-terminal starch-binding domain characteristic of the CBM20 family. AMY1 was successfully expressed in Saccharomyces cerevisiae. The time course of amylase secretion in S. cerevisiae resulted in a maximal extracellular amylolytic activity (3.93 U mL(-1)) at 60 h of incubation. The recombinant protein had an apparent molecular mass similar to the native enzyme (c. 67 kDa), part of which was due to N-glycosylation.

Diversity of partial RNA-dependent RNA polymerase gene sequences of soybean blotchy mosaic virus isolates from different host-, geographical- and temporal origins.

PubMed

Strydom, Elrea; Pietersen, Gerhard

2018-05-01

Infection of soybean by the plant cytorhabdovirus soybean blotchy mosaic virus (SbBMV) results in significant yield losses in the temperate, lower-lying soybean production regions of South Africa. A 277 bp portion of the RNA-dependent RNA polymerase gene of 66 SbBMV isolates from different: hosts, geographical locations in South Africa, and times of collection (spanning 16 years) were amplified by RT-PCR and sequenced to investigate the genetic diversity of isolates. Phylogenetic reconstruction revealed three main lineages, designated Groups A, B and C, with isolates grouping primarily according to geographic origin. Pairwise nucleotide identities ranged between 85.7% and 100% among all isolates, with isolates in Group A exhibiting the highest degree of sequence identity, and isolates of Groups A and B being more closely related to each other than to those in Group C. This is the first study investigating the genetic diversity of SbBMV.

Cloning and characterization of the ddc homolog encoding L-2,4-diaminobutyrate decarboxylase in Enterobacter aerogenes.

PubMed

Yamamoto, S; Mutoh, N; Tsuzuki, D; Ikai, H; Nakao, H; Shinoda, S; Narimatsu, S; Miyoshi, S I

2000-05-01

L-2,4-diaminobutyrate decarboxylase (DABA DC) catalyzes the formation of 1,3-diaminopropane (DAP) from DABA. In the present study, the ddc gene encoding DABA DC from Enterobacter aerogenes ATCC 13048 was cloned and characterized. Determination of the nucleotide sequence revealed an open reading frame of 1470 bp encoding a 53659-Da protein of 490 amino acids, whose deduced NH2-terminal sequence was identical to that of purified DABA DC from E. aerogenes. The deduced amino acid sequence was highly similar to those of Acinetobacter baumannii and Haemophilus influenzae DABA DCs encoded by the ddc genes. The lysine-307 of the E. aerogenes DABA DC was identified as the pyridoxal 5'-phosphate binding residue by site-directed mutagenesis. Furthermore, PCR analysis revealed the distribution of E. aerogenes ddc homologs in some other species of Enterobacteriaceae. Such a relatively wide occurrence of the ddc homologs implies biological significance of DABA DC and its product DAP.

A gene variation of 14-3-3 zeta isoform in rat hippocampus.

PubMed

Murakami, K; Situ, S Y; Eshete, F

1996-11-14

A variant form of 14-3-3 zeta was isolated from the rat hippocampal cDNA library. The cloned cDNA is 1687 bp in length and it contains an entire ORF (nt = 63-797) with 245 amino acids that is characteristic to 14-3-3 zeta subtype. By comparing with reported sequences of 14-3-3 zeta, we found three nucleotide substitutions within the coding sequence in our clone; C<-->T transition at nt = 325 and G<-->C transversions at nt = 387 and 388. Both are missense mutations, leading ACG (Thr) to ATG (Met) and CGT (Arg) to GCT (Ala) conversions at residue 88 and 109, respectively. Our results show that at least three different genetic variants of 14-3-3 zeta are present in rat species which results in protein variations. Such mutation in the amino acid sequence is an important indication of the diverse functions of this protein and may also contribute to the recent contradictory observations regarding the role of the 14-3-3 zeta subtype.

Enterobacter cloacae with a novel variant of ACT AmpC beta-lactamase originating from glaucous gull (Larus hyperboreus) in Svalbard.

PubMed

Literak, Ivan; Manga, Ivan; Wojczulanis-Jakubas, Katarzyna; Chroma, Magdalena; Jamborova, Ivana; Dobiasova, Hana; Sedlakova, Miroslava Htoutou; Cizek, Alois

2014-07-16

We aimed at Escherichia coli and Enterobacter cloacae isolates resistant to cephalosporins and fluoroquinolones and Salmonella isolates in wild birds in Arctic Svalbard, Norway. Cloacal swabs of little auks (Alle alle, n=215) and samples of faeces of glaucous gulls (Larus hyperboreus, n=15) were examined. Inducible production of AmpC enzyme was detected in E. cloacae KW218 isolate. Sequence analysis of the 1146 bp PCR product of the ampC gene from this isolate revealed 99% sequence homology with the blaACT-14 and blaACT-5 AmpC beta-lactamase genes. Four, respectively six of the identified single nucleotide polymorphisms generated amino acid substitutions in the amino acid chain. As the ampC sequence polymorphism in the investigated E. cloacae strain was identified as unique, we revealed a novel variant of the ampC beta-lactamase gene blaACT-23. Copyright © 2014 Elsevier B.V. All rights reserved.

Metastasizing patent claims on BRCA1.

PubMed

Kepler, Thomas B; Crossman, Colin; Cook-Deegan, Robert

2010-05-01

Many patents make claims on DNA sequences; some include claims on oligonucleotides related to the primary patented gene. We used bioinformatics to quantify the reach of one such claim from patent 4,747,282 on BRCA1. We find that human chromosome 1 (which does not contain BRCA1) contains over 300,000 oligonucleotides covered by this claim, and that 80% of cDNA and mRNA sequences contributed to GenBank before the patent application was filed also contain at least one claimed oligonucleotide. Any "isolated" DNA molecules that include such 15 bp nucleotide sequences would fall under the claim as granted by the US Patent and Trademark Office. Anyone making, using, selling, or importing such a molecule for any purpose within the United States would thus be infringing the claim. This claim and others like it turn out, on examination, to be surprisingly broad, and if enforced would have substantial implications for medical practice and scientific research. Copyright 2010 Elsevier Inc. All rights reserved.

Single nucleotide polymorphism of FSHβ gene associated with reproductive traits in Japanese flounder ( Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

He, Feng; Wen, Haishen; Yu, Dahui; Li, Jifang; Shi, Bao; Chen, Caifang; Zhang, Jiaren; Jin, Guoxiong; Chen, Xiaoyan; Shi, Dan; Yang, Yanping

2010-12-01

Follicle stimulating hormone β (FSHβ) of Japanese flounder ( Paralichthys olivaceus) plays a key role in the regulation of gonadal development. This study aimed to investigate molecular genetic characteristics of the FSHβ gene and elucidate the effects of single nucleotide polymorphisms (SNPs) of FSHβ on reproductive traits in Japanese flounder. We used polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) and sequencing of the FSHβ gene in 60 individuals. We identified only an SNP (T/C) in the coding region of exon3 of FSHβ. The SNP (T/C) did not lead to amino acid changes at the position 340 bp of FSHβ gene. Statistical analysis showed that the SNP was significantly associated with testosterone (T) level and gonadosomatic index (GSI) ( P < 0.05). Individuals with genotype TC of the SNP had significantly higher serum T levels and GSI ( P < 0.05) than that of genotype CC. Therefore, FSHβ gene could be a useful molecular marker in selection for prominent reproductive trait in Japanese Flounder.

Heterogeneity of 3’-Untraslated Region of Genome RNA of the Tick-Borne Encephalitis Virus (TBEV) Strains Isolated from Ticks in the Western Siberia, Russia

PubMed Central

Morozova, Olga V.; Bakhvalova, Valentina N.; Morozov, Igor V.

2007-01-01

The tick-borne encephalitis virus (TBEV) strains have been isolated from unfed adult ticks Ixodes persulcatus Schulze in Novosibirsk region (South-Western Siberia, Russia) beginning from 1980 till 2006. The TBEV 3’-untraslated region (3’UTR) variable fragment was amplified with primers corresponding to conserved flanking areas. The RT-PCR product lengths varied in range from 100 to 400 bp. Comparative analysis of 3’UTR nucleotide sequences revealed a few groups of the TBEV strains within Siberian genetic subtype with significant intra-group homology and essential differences between groups. Correlation between lengths of the 3’UTR fragments and hemagglutination (HA) titers for subsequent passages of the TBEV strains was not found. However, for the viral strains with shorter 3’UTR (less than 200 nucleotides) incubation period for suckling mice was longer than 5 days. It might be resulted from decreased RNA synthesis or reduced neuroinvasiveness. PMID:23675045

Complete mitochondrial genome of the Yellownose skate: Zearaja chilensis (Rajiformes, Rajidae).

PubMed

Jeong, Dageum; Lee, Youn-Ho

2016-01-01

The complete sequence of mitochondrial DNA of a Yellownose skate, Zearaja chilensis was determined for the first time. It is 16,909 bp in length covering 2 rRNA, 22 tRNA and 13 protein coding genes with the identical gene order and structure as those of other Rajidae species. The nucleotide of L-strand is composed of low G (14.3%), and slightly high A + T (58.9%) nucleotides. The strong codon usage bias against the use of G (6.0%) is found at the third codon positions. Twelve of the 13 protein coding genes use ATG as the start codon while COX1 starts with GTG. As for the stop codon, only ND4 shows an incomplete stop codon TA. This is the first report of the mitogenome for a species in the genus Zearaja, providing a valuable source of genetic information on the evolution of the family Rajidae and the genus Zearaja as well as for establishment of a sustainble fishery management plan of the species.

Helicase Stepping Investigated with One-Nucleotide Resolution Fluorescence Resonance Energy Transfer

NASA Astrophysics Data System (ADS)

Lin, Wenxia; Ma, Jianbing; Nong, Daguan; Xu, Chunhua; Zhang, Bo; Li, Jinghua; Jia, Qi; Dou, Shuoxing; Ye, Fangfu; Xi, Xuguang; Lu, Ying; Li, Ming

2017-09-01

Single-molecule Förster resonance energy transfer is widely applied to study helicases by detecting distance changes between a pair of dyes anchored to overhangs of a forked DNA. However, it has been lacking single-base pair (1-bp) resolution required for revealing stepping kinetics of helicases. We designed a nanotensioner in which a short DNA is bent to exert force on the overhangs, just as in optical or magnetic tweezers. The strategy improved the resolution of Förster resonance energy transfer to 0.5 bp, high enough to uncover differences in DNA unwinding by yeast Pif1 and E. coli RecQ whose unwinding behaviors cannot be differentiated by currently practiced methods. We found that Pif1 exhibits 1-bp-stepping kinetics, while RecQ breaks 1 bp at a time but sequesters the nascent nucleotides and releases them randomly. The high-resolution data allowed us to propose a three-parameter model to quantitatively interpret the apparently different unwinding behaviors of the two helicases which belong to two superfamilies.

37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

Code of Federal Regulations, 2011 CFR

2011-07-01

... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

Molecular characterization of a distinct begomovirus species from Vernonia cinerea and its associated DNA-beta using the bacteriophage Phi 29 DNA polymerase.

PubMed

Packialakshmi, R M; Srivastava, N; Girish, K R; Usha, R

2010-08-01

Vernonia cinerea plants with yellow vein symptoms were collected around crop fields in Madurai. A portion (550 bp) of the AV1 gene amplified using degenerate primers from the total DNA purified from diseased leaf sample was cloned and sequenced. Specific primers derived from the above sequence were used to amplify 2,745 nucleotides with the typical genome organization of begomoviral DNA A (EMBL Accession No. AM182232). Sequence comparison with other begomoviruses revealed the greatest identity (82.4%) with Emilia yellow vein virus (EmYVV-[Fz1]) from China and less than 80% with all other known begomoviruses. The International Committee on Taxonomy of Viruses (ICTV) has therefore recognized Vernonia yellow vein virus (VeYVV) as a distinct begomovirus species. Conventional PCR could not amplify the DNA B or DNA beta from the diseased tissue. However, the beta DNA (1364 bp) associated with the disease was obtained (Accession No. FN435836) by the rolling circle amplification-restriction fragment length polymorphism method (RCA-RFLP) using Phi 29 DNA polymerase. Sequence analysis shows that DNA beta of VeYVV has the highest identity (56.8%) with DNA beta of Sigesbeckia yellow vein Guangxi betasatellite (SibYVGxB-[CN: Gx111:05]) and 56-53% with DNA beta associated with other begomoviruses. This is the first report of the molecular characterization of VeYVV from V. cinerea in India. The complete molecular characterization, phylogenetic analysis, and putative recombination events in VeYVV are reported.

Report on the development of putative functional SSR and SNP markers in passion fruits.

PubMed

da Costa, Zirlane Portugal; Munhoz, Carla de Freitas; Vieira, Maria Lucia Carneiro

2017-09-06

Passionflowers Passiflora edulis and Passiflora alata are diploid, outcrossing and understudied fruit bearing species. In Brazil, passion fruit cultivation began relatively recently and has earned the country an outstanding position as the world's top producer of passion fruit. The fruit's main economic value lies in the production of juice, an essential exotic ingredient in juice blends. Currently, crop improvement strategies, including those for underexploited tropical species, tend to incorporate molecular genetic approaches. In this study, we examined a set of P. edulis transcripts expressed in response to infection by Xanthomonas axonopodis, (the passion fruit's main bacterial pathogen that attacks the vines), aiming at the development of putative functional markers, i.e. SSRs (simple sequence repeats) and SNPs (single nucleotide polymorphisms). A total of 210 microsatellites were found in 998 sequences, and trinucleotide repeats were found to be the most frequent (31.4%). Of the sequences selected for designing primers, 80.9% could be used to develop SSR markers, and 60.6% SNP markers for P. alata. SNPs were all biallelic and found within 15 gene fragments of P. alata. Overall, gene fragments generated 10,003 bp. SNP frequency was estimated as one SNP every 294 bp. Polymorphism rates revealed by SSR and SNP loci were 29.4 and 53.6%, respectively. Passiflora edulis transcripts were useful for the development of putative functional markers for P. alata, suggesting a certain level of sequence conservation between these cultivated species. The markers developed herein could be used for genetic mapping purposes and also in diversity studies.

Cloning and characterization of the gene encoding the endopolygalacturonase-inhibiting protein (PGIP) of Phaseolus vulgaris L.

PubMed

Toubart, P; Desiderio, A; Salvi, G; Cervone, F; Daroda, L; De Lorenzo, G

1992-05-01

Polygalacturonase-inhibiting protein (PGIP) is a cell wall protein purified from hypocotyls of true bean (Phaseolus vulgaris L.). PGIP inhibits fungal endopolygalacturonases and is considered to be an important factor for plant resistance to phytopathogenic fungi (Albersheim and Anderson, 1971; Cervone et al., 1987). The amino acid sequences of the N-terminus and one internal tryptic peptide of the PGIP purified from P. vulgaris cv. Pinto were used to design redundant oligonucleotides that were successfully utilized as primers in a polymerase chain reaction (PCR) with total DNA of P. vulgaris as a template. A DNA band of 758 bp (a specific PCR amplification product of part of the gene coding for PGIP) was isolated and cloned. By using the 758-bp DNA as a hybridization probe, a lambda clone containing the PGIP gene was isolated from a genomic library of P. vulgaris cv. Saxa. The coding and immediate flanking regions of the PGIP gene, contained on a subcloned 3.3 kb SalI-SalI DNA fragment, were sequenced. A single, continuous ORF of 1026 nt (342 amino acids) was present in the genomic clone. The nucleotide and deduced amino acid sequences of the PGIP gene showed no significant similarity with any known databank sequence. Northern blotting analysis of poly(A)+ RNAs, isolated from various tissues of bean seedlings or from suspension-cultured bean cells, were also performed using the cloned PCR-generated DNA as a probe. A 1.2 kb transcript was detected in suspension-cultured cells and, to a lesser extent, in leaves, hypocotyls, and flowers.(ABSTRACT TRUNCATED AT 250 WORDS)

Mycobacterium smegmatis strain for detection of Mycobacterium tuberculosis by PCR used as internal control for inhibition of amplification and for quantification of bacteria.

PubMed Central

Kolk, A H; Noordhoek, G T; de Leeuw, O; Kuijper, S; van Embden, J D

1994-01-01

For the detection of Mycobacterium tuberculosis by PCR, the IS6110 sequence was used. A modified target was constructed by insertion of 56 nucleotides in the IS6110 insertion element of Mycobacterium bovis BCG. This modified insertion sequence was integrated into the genome of Mycobacterium smegmatis, a mycobacterium species which does not contain the IS6110 element. When DNA from the modified M. smegmatis 1008 strain was amplified with IS6110-specific primers INS1 and INS2, a band of 301 bp was seen on agarose gel, whereas the PCR product of M. tuberculosis complex DNA was a 245-bp fragment with these primers. The addition of a small number of M. smegmatis 1008 cells to clinical samples before DNA purification enables the detection of problems which may be due to the loss of DNA in the isolation procedure or to the presence of inhibitors. The presence of inhibitors of the amplification reaction can be confirmed by the addition of M. smegmatis 1008 DNA after the DNA isolation procedure. Furthermore, competition between the different target DNAs of M. smegmatis 1008 DNA and M. tuberculosis complex DNA enables the estimation of the number of IS6110 elements in the clinical sample. Images PMID:8051267

Identification and molecular characterization of 48 kDa calcium binding protein as calreticulin from finger millet (Eleusine coracana) using peptide mass fingerprinting and transcript profiling.

PubMed

Singh, Manoj; Metwal, Mamta; Kumar, Vandana A; Kumar, Anil

2016-01-30

Attempts were made to identify and characterize the calcium binding proteins (CaBPs) in grain filling stages of finger millet using proteomics, bioinformatics and molecular approaches. A distinctly observed blue color band of 48 kDa stained by Stains-all was eluted and analyzed as calreticulin (CRT) using nano liquid chromatography-tandem mass spectrometry (nano LC-MS). Based on the top hits of peptide mass fingerprinting results, conserved primers were designed for isolation of the CRT gene from finger millet using calreticulin sequences of different cereals. The deduced nucleotide sequence analysis of 600 bp amplicon showed up to 91% similarity with CRT gene(s) of rice and other plant species and designated as EcCRT1. Transcript profiling of EcCRT1 showed different levels of relative expression at different stages of developing spikes. The higher expression of EcCRT1 transcripts and protein were observed in later stages of developing spikes which might be due to greater translational synthesis of EcCRT1 protein during seed maturation in finger millet. Preferentially higher synthesis of this CaBP during later stages of grain filling may be responsible for the sequestration of calcium in endoplasmic reticulum of finger millet grains. © 2015 Society of Chemical Industry.

Development of a polymerase chain reaction to distinguish monocellate cobra (Naja khouthia) bites from other common Thai snake species, using both venom extracts and bite-site swabs.

PubMed

Suntrarachun, S; Pakmanee, N; Tirawatnapong, T; Chanhome, L; Sitprija, V

2001-07-01

A PCR technique was used in this study to identify and distinguish monocellate cobra snake bites using snake venoms and swab specimens from snake bite-sites in mice from bites by other common Thai snakes. The sequences of nucleotide primers were selected for the cobrotoxin-encoding gene from the Chinese cobra (Naja atra) since the sequences of monocellate cobra (Naja kaouthia) venom are still unknown. However, the 113-bp fragment of cDNA of the cobrotoxin-encoding gene was detected in the monocellate cobra venom using RT-PCR. This gene was not found in the venoms of Ophiophagus hannah (king cobra), Bungarus fasciatus (banded krait), Daboia russelii siamensis (Siamese Russell's Viper, and Calloselasma rhodostoma (Malayan pit viper). Moreover, direct PCR could detect a 665-bp fragment of the cobrotoxin-encoding gene in the monocellate cobra venom but not the other snake venoms. Likewise, this gene was only observed in swab specimens from cobra snake bite-sites in mice. This is the first report demonstrating the ability of PCR to detect the cobrotoxin-encoding gene from snake venoms and swab specimens. Further studies are required for identification of this and other snakes from the bite-sites on human skin.

Prohibitin-2 gene reveals sex-related differences in the salmon louse Caligus rogercresseyi.

PubMed

Farlora, Rodolfo; Nuñez-Acuña, Gustavo; Gallardo-Escárate, Cristian

2015-06-10

Prohibitins are evolutionarily conserved proteins present in multiple cellular compartments, and are involved in diverse cellular processes, including steroid hormone transcription and gametogenesis. In the present study, we report for the first time the characterization of the prohibitin-2 (Phb2) gene in the sea lice Caligus rogercresseyi. The CrPhb2 cDNA showed a total length of 1406 bp, which contained a predicted open reading frame (ORF) of 894 base pairs (bp) encoding for 298 amino acids. Multiple sequence alignments of prohibitin proteins from other arthropods revealed a high degree of amino acid sequence conservation. In silico Illumina read counts and RT-qPCR analyses showed a sex-dependent differential expression, with mRNA levels exhibiting a 1.7-fold (RT-qPCR) increase in adult females compared with adult males. A total of nine single nucleotide polymorphisms (SNPs) were identified, three were located in the 5' UTR of the Phb2 messenger and six in the ORF, but no mutations associated with sex were found. These results contribute to expand the present knowledge of the reproduction-related genes in C. rogercresseyi, and may be useful in future experiments aimed at controlling the impacts of sea lice in fish farming. Copyright © 2015 Elsevier B.V. All rights reserved.

Novel large deletion in AVPR2 gene causing copy number variation in a patient with X-linked nephrogenic diabetes insipidus.

PubMed

Cho, Sun Young; Law, Chun Yiu; Ng, Kwok Leung; Lam, Ching Wan

2016-04-01

The diagnosis of cranial and nephrogenic diabetes insipidus (DI) can be clinically challenging. The application of molecular genetic analysis can help in resolving diagnostic difficulties. A 3 month-old boy presented with recurrent polyuria was admitted to Intensive Care Unit and was treated as DI. The patient also had a strong family history of polyuria affecting his maternal uncles. Molecular genetic analysis using Single Nucleotide Polymorphism (SNP) array detected a large deletion located at Xq28 region and the breakpoint was identified using PCR and Sanger sequencing. An 11,535 bp novel deletion affecting the entire APVR2 gene and the last intron and exon of the ARHGAP4 gene was confirmed. This large deletion is likely due to the 7-bp microhomology sequence at the junctions of both 5' and 3' breakpoints. No disease-causing mutation was identified for AQP2. We report a novel deletion in a Chinese patient with congenital nephrogenic DI. We suggested that patients with suspected congenital DI should undergo genetic analysis of AVPR2 and AQP2 genes. A definitive diagnosis can benefit patient by treatment of hydrochlorothiazide and amiloride and avoiding unnecessary investigations. Copyright © 2016 Elsevier B.V. All rights reserved.

Evidence from mitochondrial DNA that head lice and body lice of humans (Phthiraptera: Pediculidae) are conspecific.

PubMed

Leo, N P; Campbell, N J H; Yang, X; Mumcuoglu, K; Barker, S C

2002-07-01

The specific status of the head and body lice of humans has been debated for more than 200 yr. To clarify the specific status of head and body lice, we sequenced 524 base pairs (bp) of the cytochrome oxidase I (COI) gene of 28 head and 28 body lice from nine countries. Ten haplotypes that differed by 1-5 bp at 11 nucleotide positions were identified. A phylogeny of these sequences indicates that these head and body lice are not from reciprocally monophyletic lineages. Indeed, head and body lice share three of the 10 haplotypes we found. F(ST) values and exact tests of haplotype frequencies showed significant differences between head and body lice. However, the same tests also showed significant differences among lice from different countries. Indeed, more of the variation in haplotype frequencies was explained by differences among lice from different countries than by differences between head and body lice. Our results indicate the following: (1) head and body lice do not represent reciprocally monophyletic lineages and are conspecific; (2) gene flow among populations of lice from different countries is limited; and (3) frequencies of COI haplotypes can be used to study maternal gene flow among populations of head and body lice and thus transmission of lice among their human hosts.

The Organelle Genomes of Hassawi Rice (Oryza sativa L.) and Its Hybrid in Saudi Arabia: Genome Variation, Rearrangement, and Origins

PubMed Central

Zhang, Tongwu; Hu, Songnian; Zhang, Guangyu; Pan, Linlin; Zhang, Xiaowei; Al-Mssallem, Ibrahim S.; Yu, Jun

2012-01-01

Hassawi rice (Oryza sativa L.) is a landrace adapted to the climate of Saudi Arabia, characterized by its strong resistance to soil salinity and drought. Using high quality sequencing reads extracted from raw data of a whole genome sequencing project, we assembled both chloroplast (cp) and mitochondrial (mt) genomes of the wild-type Hassawi rice (Hassawi-1) and its dwarf hybrid (Hassawi-2). We discovered 16 InDels (insertions and deletions) but no SNP (single nucleotide polymorphism) is present between the two Hassawi cp genomes. We identified 48 InDels and 26 SNPs in the two Hassawi mt genomes and a new type of sequence variation, termed reverse complementary variation (RCV) in the rice cp genomes. There are two and four RCVs identified in Hassawi-1 when compared to 93–11 (indica) and Nipponbare (japonica), respectively. Microsatellite sequence analysis showed there are more SSRs in the genic regions of both cp and mt genomes in the Hassawi rice than in the other rice varieties. There are also large repeats in the Hassawi mt genomes, with the longest length of 96,168 bp and 96,165 bp in Hassawi-1 and Hassawi-2, respectively. We believe that frequent DNA rearrangement in the Hassawi mt and cp genomes indicate ongoing dynamic processes to reach genetic stability under strong environmental pressures. Based on sequence variation analysis and the breeding history, we suggest that both Hassawi-1 and Hassawi-2 originated from the Indonesian variety Peta since genetic diversity between the two Hassawi cultivars is very low albeit an unknown historic origin of the wild-type Hassawi rice. PMID:22870184

High-coverage sequencing and annotated assembly of the genome of the Australian dragon lizard Pogona vitticeps.

PubMed

Georges, Arthur; Li, Qiye; Lian, Jinmin; O'Meally, Denis; Deakin, Janine; Wang, Zongji; Zhang, Pei; Fujita, Matthew; Patel, Hardip R; Holleley, Clare E; Zhou, Yang; Zhang, Xiuwen; Matsubara, Kazumi; Waters, Paul; Graves, Jennifer A Marshall; Sarre, Stephen D; Zhang, Guojie

2015-01-01

The lizards of the family Agamidae are one of the most prominent elements of the Australian reptile fauna. Here, we present a genomic resource built on the basis of a wild-caught male ZZ central bearded dragon Pogona vitticeps. The genomic sequence for P. vitticeps, generated on the Illumina HiSeq 2000 platform, comprised 317 Gbp (179X raw read depth) from 13 insert libraries ranging from 250 bp to 40 kbp. After filtering for low-quality and duplicated reads, 146 Gbp of data (83X) was available for assembly. Exceptionally high levels of heterozygosity (0.85 % of single nucleotide polymorphisms plus sequence insertions or deletions) complicated assembly; nevertheless, 96.4 % of reads mapped back to the assembled scaffolds, indicating that the assembly included most of the sequenced genome. Length of the assembly was 1.8 Gbp in 545,310 scaffolds (69,852 longer than 300 bp), the longest being 14.68 Mbp. N50 was 2.29 Mbp. Genes were annotated on the basis of de novo prediction, similarity to the green anole Anolis carolinensis, Gallus gallus and Homo sapiens proteins, and P. vitticeps transcriptome sequence assemblies, to yield 19,406 protein-coding genes in the assembly, 63 % of which had intact open reading frames. Our assembly captured 99 % (246 of 248) of core CEGMA genes, with 93 % (231) being complete. The quality of the P. vitticeps assembly is comparable or superior to that of other published squamate genomes, and the annotated P. vitticeps genome can be accessed through a genome browser available at https://genomics.canberra.edu.au.

Draft genome sequence of non-shiga toxin-producing Escherichia coli O157 NCCP15738.

PubMed

Kwon, Taesoo; Kim, Jung-Beom; Bak, Young-Seok; Yu, Young-Bin; Kwon, Ki Sung; Kim, Won; Cho, Seung-Hak

2016-01-01

The non-shiga toxin-producing Escherichia coli (non-STEC) O157 is a pathogenic strain that cause diarrhea but does not cause hemolytic-uremic syndrome, or hemorrhagic colitis. Here, we present the 5-Mb draft genome sequence of non-STEC O157 NCCP15738, which was isolated from the feces of a Korean patient with diarrhea, and describe its features and the structural basis for its genome evolution. A total of 565-Mbp paired-end reads were generated using the Illumina-HiSeq 2000 platform. The reads were assembled into 135 scaffolds throughout the de novo assembly. The assembled genome size of NCCP15738 was 5,005,278 bp with an N50 value of 142,450 bp and 50.65 % G+C content. Using Rapid Annotation using Subsystem Technology analysis, we predicted 4780 ORFs and 31 RNA genes. The evolutionary tree was inferred from multiple sequence alignment of 45 E. coli species. The most closely related neighbor of NCCP15738 indicated by whole-genome phylogeny was E. coli UMNK88, but that indicated by multilocus sequence analysis was E. coli DH1(ME8569). A comparison between the NCCP15738 genome and those of reference strains, E. coli K-12 substr. MG1655 and EHEC O157:H7 EDL933 by bioinformatics analyses revealed unique genes in NCCP15738 associated with lysis protein S, two-component signal transduction system, conjugation, the flagellum, nucleotide-binding proteins, and metal-ion binding proteins. Notably, NCCP15738 has a dual flagella system like that in Vibrio parahaemolyticus, Aeromonas spp., and Rhodospirillum centenum. The draft genome sequence and the results of bioinformatics analysis of NCCP15738 provide the basis for understanding the genomic evolution of this strain.

Transcriptome Analysis of the Chrysanthemum Foliar Nematode, Aphelenchoides ritzemabosi (Aphelenchida: Aphelenchoididae)

PubMed Central

Li, Jun-Yi; Xie, Hui; Xu, Chun-Ling; Li, Yu

2016-01-01

The chrysanthemum foliar nematode (CFN), Aphelenchoides ritzemabosi, is a plant parasitic nematode that attacks many plants. In this study, a transcriptomes of mixed-stage population of CFN was sequenced on the Illumina HiSeq 2000 platform. 68.10 million Illumina high quality paired end reads were obtained which generated 26,817 transcripts with a mean length of 1,032 bp and an N50 of 1,672 bp, of which 16,467 transcripts were annotated against six databases. In total, 20,311 coding region sequences (CDS), 495 simple sequence repeats (SSRs) and 8,353 single-nucleotide polymorphisms (SNPs) were predicted, respectively. The CFN with the most shared sequences was B. xylophilus with 16,846 (62.82%) common transcripts and 10,543 (39.31%) CFN transcripts matched sequences of all of four plant parasitic nematodes compared. A total of 111 CFN transcripts were predicted as homologues of 7 types of carbohydrate-active enzymes (CAZymes) with plant/fungal cell wall-degrading activities, fewer transcripts were predicted as homologues of plant cell wall-degrading enzymes than fungal cell wall-degrading enzymes. The phylogenetic analysis of GH5, GH16, GH43 and GH45 proteins between CFN and other organisms showed CFN and other nematodes have a closer phylogenetic relationship. In the CFN transcriptome, sixteen types of genes orthologues with seven classes of protein families involved in the RNAi pathway in C. elegans were predicted. This research provides comprehensive gene expression information at the transcriptional level, which will facilitate the elucidation of the molecular mechanisms of CFN and the distribution of gene functions at the macro level, potentially revealing improved methods for controlling CFN. PMID:27875578

Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis.

PubMed

Nath, B Surendra; Gupta, S K; Bajpai, A K

2012-12-01

The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.

Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

PubMed

Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

2015-01-01

In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

PubMed Central

Rehm, Charlotte; Wurmthaler, Lena A.; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S.

2015-01-01

In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1–5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6–9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria. PMID:26695179

Comparison and phylogenetic analysis of the ISS gene in two predominant avian pathogenic E. coli serogroups isolated from avian colibacillosis in Iran.

PubMed

Zahraei Salehi, Taghi; Derakhshandeh, Abdollah; Tadjbakhsh, Hasan; Karimi, Vahid

2013-02-01

The ISS (increased serum survival) gene and its protein product (ISS) of avian pathogenic Escherichia coli (APEC) are important characteristics of resistance to the complement system. The aims of this study were to clone, sequence and characterize sequence diversity of the ISS gene between two predominant serogroups in Iran and among those previously deposited in Genbank. The ISS gene of 309 bp from the APEC χ1390 strain was amplified by PCR, cloned and sequenced using pTZ57R/T vector. The ISS gene from the χ1390 strain has 100% identity among different serogroups of APEC in different geographical regions throughout the world. Phylogenetic analysis shows two different phylogenic groups among the different strains. Strong association of nucleotide sequences among different E. coli strains suggests that it may be a conserved gene and could be a suitable antigen to control and detect avian pathogenic E. coli, at least in our region. Currently, our group is working on the ISS protein as candidate vaccine in SPF poultry. Copyright © 2012 Elsevier Ltd. All rights reserved.

[The primary structure of a vaccine strain of tobacco mosaic virus V-69].

PubMed

Shiian, A N; Mil'shina, N V; Snegireva, P B; Pukhal'skiĭ, V A

1994-12-01

A random set of cDNA fragments were synthesized on genomic RNA of TMV vaccine strain V-69, using random primers and reverse transcriptase. Following synthesis of double-stranded cDNA, they were cloned into the pUC-19 plasmid; and 28 clones were sequenced (insert size 100-500 bp). High nucleotide sequence homology of V-69 (more than 95%) was shown only with tomato strain TMV-L [1]. Sequenced clones represent 54% of the genome (50% of the replicase gene, 98% of the transport protein gene, and 60% of the coat protein gene). In this genome region, 24 base substitutions were revealed, as compared to the wild-type TMV-L sequence. Six base substitutions resulted in changes in corresponding amino acid codons. No substitutions coincided with those discovered in the related TMV vaccine strain L11A [2], while two substitutions in the replicase gene were identical to those found in TMV strain Lta1 [3], which is capable of overcoming protection in tomatoes with the resistance gene Tm-1.

A segment of rbcL gene as a potential tool for forensic discrimination of Cannabis sativa seized at Rio de Janeiro, Brazil.

PubMed

Mello, I C T; Ribeiro, A S D; Dias, V H G; Silva, R; Sabino, B D; Garrido, R G; Seldin, L; de Moura Neto, Rodrigo Soares

2016-03-01

Cannabis sativa, known by the common name marijuana, is the psychoactive drug most widely distributed in the world. Identification of Cannabis cultivars may be useful for association to illegal crops, which may reveal trafficking routes and related criminal groups. This study provides evidence for the performance of a segment of the rbcL gene, through genetic signature, as a tool for identification for C. sativa samples apprehended by the Rio de Janeiro Police, Brazil. The PCR amplified and further sequenced the fragment of approximately 561 bp of 24 samples of C. sativa rbcL gene and showed the same nucleotide sequences, suggesting a possible genetic similarity or identical varieties. Comparing with other Cannabaceae family sequences, we have found 99% of similarity between the Rio de Janeiro sequence and three other C. sativa rbcL genes. These findings suggest that the fragment utilized at this study is efficient in identifying C. sativa samples, therefore, useful in genetic discrimination of samples seized in forensic cases.

Molecular cloning of a putative gene encoding isopentenyltransferase from pingyitiancha (Malus hupehensis) and characterization of its response to nitrate.

PubMed

Peng, Jing; Peng, Futian; Zhu, Chunfu; Wei, Shaochong

2008-06-01

A putative isopentenyltransferase (IPT) encoding gene was identified from a pingyitiancha (Malus hupehensis Rehd.) expressed sequence tag database, and the full-length gene was cloned by RACE. Based on expression profile and sequence alignment, the nucleotide sequence of the clone, named MhIPT3, was most similar to AtIPT3, an IPT gene in Arabidopsis. The full-length cDNA contained a 963-bp open reading frame encoding a protein of 321 amino acids with a molecular mass of 37.3 kDa. Sequence analysis of genomic DNA revealed the absence of introns in the frame. Quantitative real-time PCR analysis demonstrated that the gene was expressed in roots, stems and leaves. Application of nitrate to roots of nitrogen-deprived seedlings strongly induced expression of MhIPT3 and was accompanied by the accumulation of cytokinins, whereas MhIPT3 expression was little affected by ammonium application to roots of nitrogen-deprived seedlings. Application of nitrate to leaves also up-regulated the expression of MhIPT3 and corresponded closely with the accumulation of isopentyladenine and isopentyladenosine in leaves.

The maize stripe virus major noncapsid protein messenger RNA transcripts contain heterogeneous leader sequences at their 5' termini.

PubMed

Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W

1993-12-01

Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

Molecular Cloning, Characterization, and Expression of a Catalase Gene in the Japanese Scallop Mizuhopecten yessoensis Induced in the Presence of Cadmium

NASA Astrophysics Data System (ADS)

Gao, Jialong; Ishizaki, Shoichiro; Nagashima, Yuji

2016-03-01

Cadmium (Cd) is known to influence the oxidative status of marine organisms and can induce the formation of reactive oxygen species (ROS). Catalase (CAT) is one of the important enzymes involved in scavenging high levels of ROS. In present study, we cloned CAT cDNA and investigated the response of this enzyme at the transcriptional level in the Japanese scallop Mizuhopecten yessoensis exposed to Cd. The full-length CAT cDNA (MyCAT) of 1,870 nucleotides including a 57 bp 5'-UTR, a coding sequence of 1,500 bp and a 313 bp 3'-UTR were identified from the scallop. The deduced amino acid sequence of MyCAT corresponds to 499 amino acids with predicted molecular weight of 56.48 kDa and contains highly conserved motifs of the proximal heme-binding site RLFSYSTH, proximal active signature FNRERIPERVVHAKGGG and three catalytic amino acid residues His72, Asn145, and Tyr355. Its significant homology to CATs from multiple alignments revealed that MyCAT had a high identity with CATs from other mollusks. CAT mRNA expression analysis revealed that expression level was highest in the digestive gland ( p < 0.01) but weak in muscle. Following exposure to 200 and 400 µg/l of Cd, a high amount of Cd was found to have accumulated in the digestive gland and CAT mRNA expression had significantly increased in this organ among 7-day exposed scallops ( p < 0.001). The result demonstrated that antioxidant enzymes such as CAT play important roles in counteracting Cd stress in M. yessoensis.

Identification of RAPD and SCAR markers associated with yield traits in the Indian tropical tasar silkworm Antheraea mylitta drury

PubMed Central

Dutta, Suhrid R.; Kar, Prasanta K.; Srivastava, Ashok K.; Sinha, Manoj K.; Shankar, Jai; Ghosh, Ananta K.

2012-01-01

The tropical tasar silkworm, Antheraea mylitta, is a semi-domesticated vanya silk-producing insect of high economic importance. To date, no molecular marker associated with cocoon and shell weights has been identified in this species. In this report, we identified a randomly amplified polymorphic DNA (RAPD) marker and examined its inheritance, and also developed a stable diagnostic sequence-characterized amplified region (SCAR) marker. Silkworms were divided into groups with high (HCSW) and low (LCSW) cocoon and shell weights, and the F2 progeny of a cross between these two groups were obtained. DNA from these silkworms was screened by PCR using 34 random primers and the resulting RAPD fragments were used for cluster analysis and discriminant function analysis (DFA). The clustering pattern in a UPGMA-based dendogram and DFA clearly distinguished the HCSW and LCSW groups. Multiple regression analysis identified five markers associated with cocoon and shell weights. The marker OPW16905 bp showed the most significant association with cocoon and shell weights, and its inheritance was confirmed in F2 progeny. Cloning and sequencing of this 905 bp fragment showed 88% identity between its 134 nucleotides and the Bmc-1/Yamato-like retroposon of A. mylitta. This marker was further converted into a diagnostic SCAR marker (SCOPW 16826 bp). The SCAR marker developed here may be useful in identifying the right parental stock of tasar silk-worms for high cocoon and shell weights in breeding programs designed to enhance the productivity of tasar silk. PMID:23271934

Bov-tA short interspersed nucleotide element sequences in circulating nucleic acids from sera of cattle with bovine spongiform encephalopathy (BSE) and sera of cattle exposed to BSE.

PubMed

Schütz, Ekkehard; Urnovitz, Howard B; Iakoubov, Leonid; Schulz-Schaeffer, Walter; Wemheuer, Wilhelm; Brenig, Bertram

2005-07-01

Circulating nucleic acids (CNA) are known to be enriched in repetitive DNA sequences in humans. Here, bovine sera CNA were analyzed to determine if cell stress-related short interspersed nucleotide elements (SINEs) could be detected in sera from cattle associated with bovine spongiform encephalopathy (BSE). Nucleic acids were extracted, amplified, cloned, and sequenced from the sera of protease-resistant prion protein (PrP(res))-positive cattle (n = 2) and sera from BSE-cohort cows (n = 6); 150 out of 163 clones revealed the presence of, on average, an 80-bp sequence from the 3' region of Bov-tA SINE. A PCR protocol was developed that differentially identified SINE-associated CNA in BSE-exposed versus normal cattle. CNA were extracted from a serum vesicular fraction after controlled blood collection and processing procedures. Sera from four confirmed cases of BSE, 137 BSE-exposed cohort animals associated with eight confirmed BSE cases, and 845 healthy, PrP(res)-negative control cows were tested. All four sera from confirmed BSE cases were repeatedly reactive in the assay. BSE-exposed cohorts had a 100-fold higher occurrence of repeatedly reactive individuals per cohort (average = 63%; range = 33% to 91%), compared to healthy controls (average = 0.6%; P < 0.001). This study shows that BSE-confirmed and cohort animals possess a unique profile of SINE-associated serum CNA that can be utilized as a marker that highly correlates to BSE exposure.

Bov-tA Short Interspersed Nucleotide Element Sequences in Circulating Nucleic Acids from Sera of Cattle with Bovine Spongiform Encephalopathy (BSE) and Sera of Cattle Exposed to BSE

PubMed Central

Schütz, Ekkehard; Urnovitz, Howard B.; Iakoubov, Leonid; Schulz-Schaeffer, Walter; Wemheuer, Wilhelm; Brenig, Bertram

2005-01-01

Circulating nucleic acids (CNA) are known to be enriched in repetitive DNA sequences in humans. Here, bovine sera CNA were analyzed to determine if cell stress-related short interspersed nucleotide elements (SINEs) could be detected in sera from cattle associated with bovine spongiform encephalopathy (BSE). Nucleic acids were extracted, amplified, cloned, and sequenced from the sera of protease-resistant prion protein (PrPres)-positive cattle (n = 2) and sera from BSE-cohort cows (n = 6); 150 out of 163 clones revealed the presence of, on average, an 80-bp sequence from the 3′ region of Bov-tA SINE. A PCR protocol was developed that differentially identified SINE-associated CNA in BSE-exposed versus normal cattle. CNA were extracted from a serum vesicular fraction after controlled blood collection and processing procedures. Sera from four confirmed cases of BSE, 137 BSE-exposed cohort animals associated with eight confirmed BSE cases, and 845 healthy, PrPres-negative control cows were tested. All four sera from confirmed BSE cases were repeatedly reactive in the assay. BSE-exposed cohorts had a 100-fold higher occurrence of repeatedly reactive individuals per cohort (average = 63%; range = 33% to 91%), compared to healthy controls (average = 0.6%; P < 0.001). This study shows that BSE-confirmed and cohort animals possess a unique profile of SINE-associated serum CNA that can be utilized as a marker that highly correlates to BSE exposure. PMID:16002628

The comparative chloroplast genomic analysis of photosynthetic orchids and developing DNA markers to distinguish Phalaenopsis orchids.

PubMed

Jheng, Cheng-Fong; Chen, Tien-Chih; Lin, Jhong-Yi; Chen, Ting-Chieh; Wu, Wen-Luan; Chang, Ching-Chun

2012-07-01

The chloroplast genome of Phalaenopsis equestris was determined and compared to those of Phalaenopsis aphrodite and Oncidium Gower Ramsey in Orchidaceae. The chloroplast genome of P. equestris is 148,959 bp, and a pair of inverted repeats (25,846 bp) separates the genome into large single-copy (85,967 bp) and small single-copy (11,300 bp) regions. The genome encodes 109 genes, including 4 rRNA, 30 tRNA and 75 protein-coding genes, but loses four ndh genes (ndhA, E, F and H) and seven other ndh genes are pseudogenes. The rate of inter-species variation between the two moth orchids was 0.74% (1107 sites) for single nucleotide substitution and 0.24% for insertions (161 sites; 1388 bp) and deletions (189 sites; 1393 bp). The IR regions have a lower rate of nucleotide substitution (3.5-5.8-fold) and indels (4.3-7.1-fold) than single-copy regions. The intergenic spacers are the most divergent, and based on the length variation of the three intergenic spacers, 11 native Phalaenopsis orchids could be successfully distinguished. The coding genes, IR junction and RNA editing sites are relatively more conserved between the two moth orchids than between those of Phalaenopsis and Oncidium spp. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Sequencing, Analysis, and Annotation of Expressed Sequence Tags for Camelus dromedarius

PubMed Central

Al-Swailem, Abdulaziz M.; Shehata, Maher M.; Abu-Duhier, Faisel M.; Al-Yamani, Essam J.; Al-Busadah, Khalid A.; Al-Arawi, Mohammed S.; Al-Khider, Ali Y.; Al-Muhaimeed, Abdullah N.; Al-Qahtani, Fahad H.; Manee, Manee M.; Al-Shomrani, Badr M.; Al-Qhtani, Saad M.; Al-Harthi, Amer S.; Akdemir, Kadir C.; Otu, Hasan H.

2010-01-01

Despite its economical, cultural, and biological importance, there has not been a large scale sequencing project to date for Camelus dromedarius. With the goal of sequencing complete DNA of the organism, we first established and sequenced camel EST libraries, generating 70,272 reads. Following trimming, chimera check, repeat masking, cluster and assembly, we obtained 23,602 putative gene sequences, out of which over 4,500 potentially novel or fast evolving gene sequences do not carry any homology to other available genomes. Functional annotation of sequences with similarities in nucleotide and protein databases has been obtained using Gene Ontology classification. Comparison to available full length cDNA sequences and Open Reading Frame (ORF) analysis of camel sequences that exhibit homology to known genes show more than 80% of the contigs with an ORF>300 bp and ∼40% hits extending to the start codons of full length cDNAs suggesting successful characterization of camel genes. Similarity analyses are done separately for different organisms including human, mouse, bovine, and rat. Accompanying web portal, CAGBASE (http://camel.kacst.edu.sa/), hosts a relational database containing annotated EST sequences and analysis tools with possibility to add sequences from public domain. We anticipate our results to provide a home base for genomic studies of camel and other comparative studies enabling a starting point for whole genome sequencing of the organism. PMID:20502665

Comparative analysis of mitochondrial genomes between a wheat K-type cytoplasmic male sterility (CMS) line and its maintainer line.

PubMed

Liu, Huitao; Cui, Peng; Zhan, Kehui; Lin, Qiang; Zhuo, Guoyin; Guo, Xiaoli; Ding, Feng; Yang, Wenlong; Liu, Dongcheng; Hu, Songnian; Yu, Jun; Zhang, Aimin

2011-03-29

Plant mitochondria, semiautonomous organelles that function as manufacturers of cellular ATP, have their own genome that has a slow rate of evolution and rapid rearrangement. Cytoplasmic male sterility (CMS), a common phenotype in higher plants, is closely associated with rearrangements in mitochondrial DNA (mtDNA), and is widely used to produce F1 hybrid seeds in a variety of valuable crop species. Novel chimeric genes deduced from mtDNA rearrangements causing CMS have been identified in several plants, such as rice, sunflower, pepper, and rapeseed, but there are very few reports about mtDNA rearrangements in wheat. In the present work, we describe the mitochondrial genome of a wheat K-type CMS line and compare it with its maintainer line. The complete mtDNA sequence of a wheat K-type (with cytoplasm of Aegilops kotschyi) CMS line, Ks3, was assembled into a master circle (MC) molecule of 647,559 bp and found to harbor 34 known protein-coding genes, three rRNAs (18 S, 26 S, and 5 S rRNAs), and 16 different tRNAs. Compared to our previously published sequence of a K-type maintainer line, Km3, we detected Ks3-specific mtDNA (> 100 bp, 11.38%) and repeats (> 100 bp, 29 units) as well as genes that are unique to each line: rpl5 was missing in Ks3 and trnH was absent from Km3. We also defined 32 single nucleotide polymorphisms (SNPs) in 13 protein-coding, albeit functionally irrelevant, genes, and predicted 22 unique ORFs in Ks3, representing potential candidates for K-type CMS. All these sequence variations are candidates for involvement in CMS. A comparative analysis of the mtDNA of several angiosperms, including those from Ks3, Km3, rice, maize, Arabidopsis thaliana, and rapeseed, showed that non-coding sequences of higher plants had mostly divergent multiple reorganizations during the mtDNA evolution of higher plants. The complete mitochondrial genome of the wheat K-type CMS line Ks3 is very different from that of its maintainer line Km3, especially in non-coding sequences. Sequence rearrangement has produced novel chimeric ORFs, which may be candidate genes for CMS. Comparative analysis of several angiosperm mtDNAs indicated that non-coding sequences are the most frequently reorganized during mtDNA evolution in higher plants.

Genetic heterogeneity of the dnaK gene locus including transcription terminator region (TTR) in Campylobacter lari.

PubMed

Shitara, M; Tsuboi, Y; Sekizuka, T; Tazumi, A; Moorei, J E; Millar, B C; Taneike, I; Matsuda, M

2008-01-01

Nucleotide sequences of approximately 3.1 kbp consisting of the full-length open reading frame (ORF) for grpE, a non-coding (NC) region and a putative ORF for the full-length dnaK gene (1860 bp) were identified from a urease-positive thermophilic Campylobacter (UPTC) CF89-12 isolate. Then, following the construction of a new degenerate polymerase chain reaction (PCR) primer pair for amplification of the dnaK structural gene, including the transcription terminator region of C. lari isolates, the dnaK region was amplified successfully, TA-cloned and sequenced in nine C. lari isolates. The dnaK gene sequences commenced with an ATG and terminated with a TAA in all 10 isolates, including CF89-12. In addition, the putative ORFs for the dnaK gene locus from seven UPTC isolates consisted of 1860 bases, and the four urease-negative (UN) C. lari isolates included C. lari RM2100 reference strain 1866. Interestingly, different probable ribosome binding sites and hypothetically intrinsic p-independent terminator structures were identified between the seven UPTC and four UN C. lari isolates, respectively. Moreover, it is interesting to note that 20 out of a total of 28 polymorphic sites occurred among amino acid sequences of the dnaK ORF from 11 C. lari isolates, identified to be alternatively UPTC-specific or UN C. lari-specific. In the neighbour-joining tree based on the nucleotide sequence information of the dnaK gene, C. lari forms two major distinct clusters consisting of UPTC and UN C. lari isolates, respectively, with UN C. lari being more closely related to other thermophilic campylobacters than to UPTC.

Multilocus sequence analysis of Thermoanaerobacter isolates reveals recombining, but differentiated, populations from geothermal springs of the Uzon Caldera, Kamchatka, Russia

PubMed Central

Wagner, Isaac D.; Varghese, Litty B.; Hemme, Christopher L.; Wiegel, Juergen

2013-01-01

Thermal environments have island-like characteristics and provide a unique opportunity to study population structure and diversity patterns of microbial taxa inhabiting these sites. Strains having ≥98% 16S rRNA gene sequence similarity to the obligately anaerobic Firmicutes Thermoanaerobacter uzonensis were isolated from seven geothermal springs, separated by up to 1600 m, within the Uzon Caldera (Kamchatka, Russian Far East). The intraspecies variation and spatial patterns of diversity for this taxon were assessed by multilocus sequence analysis (MLSA) of 106 strains. Analysis of eight protein-coding loci (gyrB, lepA, leuS, pyrG, recA, recG, rplB, and rpoB) revealed that all loci were polymorphic and that nucleotide substitutions were mostly synonymous. There were 148 variable nucleotide sites across 8003 bp concatenates of the protein-coding loci. While pairwise FST values indicated a small but significant level of genetic differentiation between most subpopulations, there was a negligible relationship between genetic divergence and spatial separation. Strains with the same allelic profile were only isolated from the same hot spring, occasionally from consecutive years, and single locus variant (SLV) sequence types were usually derived from the same spring. While recombination occurred, there was an “epidemic” population structure in which a particular T. uzonensis sequence type rose in frequency relative to the rest of the population. These results demonstrate spatial diversity patterns for an anaerobic bacterial species in a relative small geographic location and reinforce the view that terrestrial geothermal springs are excellent places to look for biogeographic diversity patterns regardless of the involved distances. PMID:23801987

A rapid, one step molecular identification of Trichoderma citrinoviride and Trichoderma reesei.

PubMed

Saroj, Dina B; Dengeti, Shrinivas N; Aher, Supriya; Gupta, Anil K

2015-06-01

Trichoderma species are widely used as production hosts for industrial enzymes. Identification of Trichoderma species requires a complex molecular biology based identification involving amplification and sequencing of multiple genes. Industrial laboratories are required to run identification tests repeatedly in cell banking procedures and also to prove absence of production host in the product. Such demands can be fulfilled by a brief method which enables confirmation of strain identity. This communication describes one step identification method for two common Trichoderma species; T. citrinoviride and T. reesei, based on identification of polymorphic region in the nucleotide sequence of translation elongation factor 1 alpha. A unique forward primer and common reverse primer resulted in 153 and 139 bp amplicon for T. citrinoviride and T. reesei, respectively. Simplification was further introduced by using mycelium as template for PCR amplification. Method described in this communication allows rapid, one step identification of two Trichoderma species.

The complete mitochondrial genome of Cricetulus kamensis (Rodentia: Cricetidae).

PubMed

Kang, Chunlan; Yue, Hao; Liu, Mengyao; Huang, Ting; Liu, Yang; Zhang, Xiuyue; Yue, Bisong; Zeng, Tao; Liu, Shaoying

2016-01-01

The Cricetulus kamensis is endemic to China and is popular as pet. In the present study, the complete mitogenome of C. kamensis was first determined. It was 16,270 bp in length and the composition and arrangement of its genes are analogous to most other mammals. The overall base composition of heavy strand is 33.2% A, 26.8% T, 27.2% C and 12.7% G. The sequence is highly G-C poor (∼40%) and A is the most numerous nucleotide followed by T >C >G, which is similar to other mammalian mitochondrial genomes. It is notable that three extra bases "CAT" were inserted in cytb at the 3' end position and no stop codon was found for this coding region. The mitogenome sequence of C. kamensis could contribute to a better solution of its phylogenetic position and phylogenetic relationship within Cricetinae in the future.

Quantitative Analysis of Single-Nucleotide Polymorphism for Rapid Detection of TR34/L98H- and TR46/Y121F/T289A-Positive Aspergillus fumigatus Isolates Obtained from Patients in Iran from 2010 to 2014

PubMed Central

Mohammadi, Faezeh; Hashemi, Seyed Jamal; Zoll, Jan; Melchers, Willem J. G.; Rafati, Haleh; Dehghan, Parvin; Rezaie, Sasan; Tolooe, Ali; Tamadon, Yalda; van der Lee, Henrich A.; Verweij, Paul E.

2015-01-01

We employed an endpoint genotyping method to update the prevalence rate of positivity for the TR34/L98H mutation (a 34-bp tandem repeat mutation in the promoter region of the cyp51A gene in combination with a substitution at codon L98) and the TR46/Y121F/T289A mutation (a 46-bp tandem repeat mutation in the promoter region of the cyp51A gene in combination with substitutions at codons Y121 and T289) among clinical Aspergillus fumigatus isolates obtained from different regions of Iran over a recent 5-year period (2010 to 2014). The antifungal activities of itraconazole, voriconazole, and posaconazole against 172 clinical A. fumigatus isolates were investigated using the European Committee on Antimicrobial Susceptibility Testing (EUCAST) broth microdilution method. For the isolates with an azole resistance phenotype, the cyp51A gene and its promoter were amplified and sequenced. In addition, using a LightCycler 480 real-time PCR system, a novel endpoint genotyping analysis method targeting single-nucleotide polymorphisms was evaluated to detect the L98H and Y121F mutations in the cyp51A gene of all isolates. Of the 172 A. fumigatus isolates tested, the MIC values of itraconazole (≥16 mg/liter) and voriconazole (>4 mg/liter) were high for 6 (3.5%). Quantitative analysis of single-nucleotide polymorphisms showed the TR34/L98H mutation in the cyp51A genes of six isolates. No isolates harboring the TR46/Y121F/T289A mutation were detected. DNA sequencing of the cyp51A gene confirmed the results of the novel endpoint genotyping method. By microsatellite typing, all of the azole-resistant isolates had genotypes different from those previously recovered from Iran and from the Dutch TR34/L98H controls. In conclusion, there was not a significant increase in the prevalence of azole-resistant A. fumigatus isolates harboring the TR34/L98H resistance mechanism among isolates recovered over a recent 5-year period (2010 to 2014) in Iran. A quantitative assay detecting a single-nucleotide polymorphism in the cyp51A gene of A. fumigatus is a reliable tool for the rapid screening and monitoring of TR34/L98H- and TR46/Y121F/T289A-positive isolates and can easily be incorporated into clinical mycology algorithms. PMID:26525787

Phylogenetic Analysis and Pathogenicity Assessment of the Emerging Recombinant Subgroup K of Avian Leukosis Virus in South China

PubMed Central

Zhao, Zijun; Rao, Mingzhang; Liao, Ming; Cao, Weisheng

2018-01-01

In recent years, cases of avian leukosis virus (ALV) infection have become more frequent in China. We isolated 6 ALV strains from yellow feather broiler breeders in south China from 2014 to 2016. Their full genomes were sequenced, compared, and analyzed with other reference strains of ALV. The complete genomic nucleotide sequences of GD150509, GD160403, GD160607, GDFX0601, and GDFX0602 were 7482 bp in length, whereas GDFX0603 was 7480 bp. They shared 99.7% to 99.8% identity with each other. Homology analysis showed that the gag, pol, long terminal repeats (LTRs), and the transmembrane region (gp37) of the env genes of the 6 viruses were well conserved to endogenous counterpart sequences (>97.8%). However, the gp85 genes displayed high variability with any known chicken ALV strains. Growth kinetics of DF-1 cells infected with the isolated ALV showed viral titers that were lower than those infected with the GD13 (ALV-A), CD08 (ALV-B), and CHN06 (ALV-J) on day 7 post-infection. The infected Specific-pathogen-free (SPF) chickens could produce continuous viremia, atrophy of immune organs, growth retardation and no tumors were observed. These subgroup ALVs are unique and may be common in south China. The results suggested that updating the control and eradication program of exogenous ALV for yellow feather broiler breeders in south China needs to be considered because of the emergence of the new subgroup viruses. PMID:29652854

Genetic variability and haplotypes of Echinococcus isolates from Tunisia.

PubMed

Boufana, Belgees; Lahmar, Samia; Rebaï, Waël; Ben Safta, Zoubeir; Jebabli, Leïla; Ammar, Adel; Kachti, Mahmoud; Aouadi, Soufia; Craig, Philip S

2014-11-01

The species/genotypes of Echinococcus infecting a range of intermediate, canid and human hosts were examined as well as the intraspecific variation and population structure of Echinococcus granulosus sensu lato (s.l.) within these hosts. A total of 174 Echinococcus isolates from humans and ungulate intermediate hosts and adult tapeworms from dogs and jackals were used. Genomic DNA was used to amplify a fragment within a mitochondrial gene and a nuclear gene, coding for cytochrome c oxidase subunit 1 (cox1; 828 bp) and elongation factor 1-alpha (ef1a; 656 bp), respectively. E. granulosus sensu stricto was identified from all host species examined, E. canadensis (G6) in a camel and, for the first time, fertile cysts of E. granulosus (s.s.) and E. equinus in equids (donkeys) and E. granulosus (s.s.) from wild boars and goats. Considerable genetic variation was seen only for the cox1 sequences of E. granulosus (s.s.). The pairwise fixation index (Fst) for cox1 E. granulosus (s.s.) sequences from donkeys was high and was statistically significant compared with that of E. granulosus populations from other intermediate hosts. A single haplotype (EqTu01) was identified for the cox1 nucleotide sequences of E. equinus. The role of donkeys in the epidemiology of echinococcosis in Tunisia requires further investigation. © The Author 2014. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomkinson, B.; Jonsson, A-K

1991-01-01

Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less

NcoI and TaqI RFLPs for human M creatine kinase (CKM)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Perryman, M.B.; Hejtmancik, J.F.; Ashizawa, Tetsuo

1988-09-12

Probe pHMCKUT contains a 135 bp cDNA fragment inserted into pGEM 3. The probe corresponds to nucleotides 1,201 to 1,336 located in the 3{prime} untranslated region of human M creatine kinase. The probe is specific for human M creatine kinase and does not hybridize to human B cretine kinase sequences. NcoI identifies a two allele polymorphism of a band at either 2.5 kb or 3.6 kb. TaqI identifies a two allele polymorphism at either 3.8 kb or 4.5 kb. Human M creatine has been localized to chromosome 19q. Autosomal co-dominant inheritance was shown in six informative Caucasian families.

The complete mitochondrial genome of the sandbar shark Carcharhinus plumbeus.

PubMed

Blower, Dean C; Ovenden, Jennifer R

2016-01-01

The sandbar shark, Carcharhinus plumbeus, a major representative species in shark fisheries worldwide is now considered vulnerable to overfishing. A pool of 774,234 Roche 454 shotgun sequences from one individual were assembled into a 16,706 bp mitogenome with 33× average coverage depth. It comprised 13 protein coding genes, 22 transfer RNA's, 2 ribosomal genes and 2 non-coding regions, typical of a vertebrate mitogenome. As expected for sharks, an A-T nucleotide bias was evident. This adds to rapidly growing number of mitogenome assemblies for the economically important Carcharhinidae family. The C. plumbeus mitogenome will assist researchers, fisheries and conservation managers interested in shark molecular systematics, phylogeography, conservation genetics, population and stock structure.

Transcriptional Regulation of Aggregatibacter actinomycetemcomitans lsrACDBFG and lsrRK Operons and Their Role in Biofilm Formation

PubMed Central

Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Lamont, Richard J.

2013-01-01

Autoinducer-2 (AI-2) is required for biofilm formation and virulence of the oral pathogen Aggregatibacter actinomycetemcomitans, and we previously showed that lsrB codes for a receptor for AI-2. The lsrB gene is expressed as part of the lsrACDBFG operon, which is divergently transcribed from an adjacent lsrRK operon. In Escherichia coli, lsrRK encodes a repressor and AI-2 kinase that function to regulate lsrACDBFG. To determine if lsrRK controls lsrACDBFG expression and influences biofilm growth of A. actinomycetemcomitans, we first defined the promoters for each operon. Transcriptional reporter plasmids containing the 255-bp lsrACDBFG-lsrRK intergenic region (IGR) fused to lacZ showed that essential elements of lsrR promoter reside 89 to 255 bp upstream from the lsrR start codon. Two inverted repeat sequences that represent potential binding sites for LsrR and two sequences resembling the consensus cyclic AMP receptor protein (CRP) binding site were identified in this region. Using electrophoretic mobility shift assay (EMSA), purified LsrR and CRP proteins were shown to bind probes containing these sequences. Surprisingly, the 255-bp IGR did not contain the lsrA promoter. Instead, a fragment encompassing nucleotides +1 to +159 of lsrA together with the 255-bp IGR was required to promote lsrA transcription. This suggests that a region within the lsrA coding sequence influences transcription, or alternatively that the start codon of A. actinomycetemcomitans lsrA has been incorrectly annotated. Transformation of ΔlsrR, ΔlsrK, ΔlsrRK, and Δcrp deletion mutants with lacZ reporters containing the lsrA or lsrR promoter showed that LsrR negatively regulates and CRP positively regulates both lsrACDBFG and lsrRK. However, in contrast to what occurs in E. coli, deletion of lsrK had no effect on the transcriptional activity of the lsrA or lsrR promoters, suggesting that another kinase may be capable of phosphorylating AI-2 in A. actinomycetemcomitans. Finally, biofilm formation of the ΔlsrR, ΔlsrRK, and Δcrp mutants was significantly reduced relative to that of the wild type, indicating that proper regulation of the lsr locus is required for optimal biofilm growth by A. actinomycetemcomitans. PMID:23104800

Single Nucleotide Polymorphisms in IL8 and TLR4 Genes as Candidates for Digital Dermatitis Resistance/Susceptibility in Holstein Cattle.

PubMed

El-Shafaey, El-Sayed; Ateya, Ahmed; Ramadan, Hazem; Saleh, Rasha; Elseady, Yousef; Abo El Fadl, Eman; El-Khodery, Sabry

2017-04-03

Relatedness between single nucleotide polymorphisms in IL8 and TLR4 genes and digital dermatitis resistance/susceptibility was investigated in seventy Holstein dairy cows. Animals were assigned into two groups, affected group (n = 35) and resistant group (n = 35) based on clinical signs and previous history of farm clinical records. Blood samples were collected for DNA extraction to ampliy fragments of 267-bp and 382-bp for IL8 and TLR4 genes, respectively. PCR-DNA sequencing revealed three SNPs in each of IL8 and TLR4 genes. The identified SNPs associated with digital dermatitis resistance were C94T, A220G, and T262A for IL8 and C118T for TLR4. However, the G349C and C355A SNPs in TLR4 gene were associated with digital dermatitis susceptibility. Chi-square analysis for comparison the distribution of all identified SNPs in both IL8 and TLR4 genes between resistant and affected animals showed no significant variation among the identified SNPs in IL8 gene. Meanwhile, there was a significant variation in case of TLR4 gene. As a pilot study, the present results revealed that identified SNPs in IL8 and TLR4 genes can be used as a genetic marker and predisposing factor for resistance/susceptibility to digital dermatitis in dairy cows. However, TLR4 gene may be a potential candidate for such disease.

Two Novel HOGA1 Splicing Mutations Identified in a Chinese Patient with Primary Hyperoxaluria Type 3.

PubMed

Wang, Xinsheng; Zhao, Xiangzhong; Wang, Xiaoling; Yao, Jian; Zhang, Feifei; Lang, Yanhua; Tuffery-Giraud, Sylvie; Bottillo, Irene; Shao, Leping

2015-01-01

Twenty-six HOGA1 mutations have been reported in primary hyperoxaluria (PH) type 3 (PH3) patients with c.700 + 5G>T accounting for about 50% of the total alleles. However, PH3 has never been described in Asians. A Chinese child with early-onset nephrolithiasis was suspected of having PH. We searched for AGXT, GRHPR and HOGA1 gene mutations in this patient and his parents. All coding regions, including intron-exon boundaries, were analyzed using PCR followed by direct sequence analysis. Two heterozygous mutations not previously described in the literature about HOGA1 were identified (compound heterozygous). One mutation was a successive 2 bp substitution at the last nucleotide of exon 6 and at the first nucleotide of intron 6, respectively (c.834_834 + 1GG>TT), while the other one was a guanine to adenine substitution of the last nucleotide of exon 6 (c.834G>A). Direct sequencing analysis failed to find these mutations in 100 unrelated healthy subjects and the functional role on splicing of both variants found in this study was confirmed by a minigene assay based on the pSPL3 exon trapping vector. In addition, we found a SNP in this family (c.715G>A, p.V239I). There were no mutations detected in AGXT and GRHPR. Two novel HOGA1 mutations were identified in association with PH3. This is the first description and investigation on mutant gene analysis of PH3 in an Asian. © 2015 S. Karger AG, Basel

Exploring the sequence-function relationship in transcriptional regulation by the lac O1 operator.

PubMed

Maity, Tuhin S; Jha, Ramesh K; Strauss, Charlie E M; Dunbar, John

2012-07-01

Understanding how binding of a transcription factor to an operator is influenced by the operator sequence is an ongoing quest. It facilitates discovery of alternative binding sites as well as tuning of transcriptional regulation. We investigated the behavior of the Escherichia coli Lac repressor (LacI) protein with a large set of lac O(1) operator variants. The 114 variants examined contained a mean of 2.9 (range 0-4) mutations at positions -4, -2, +2 and +4 in the minimally required 17 bp operator. The relative affinity of LacI for the operators was examined by quantifying expression of a GFP reporter gene and Rosetta structural modeling. The combinations of mutations in the operator sequence created a wide range of regulatory behaviors. We observed variations in the GFP fluorescent signal among the operator variants of more than an order of magnitude under both uninduced and induced conditions. We found that a single nucleotide change may result in changes of up to six- and 12-fold in uninduced and induced GFP signals, respectively. Among the four positions mutated, we found that nucleotide G at position -4 is strongly correlated with strong repression. By Rosetta modeling, we found a significant correlation between the calculated binding energy and the experimentally observed transcriptional repression strength for many operators. However, exceptions were also observed, underscoring the necessity for further improvement in biophysical models of protein-DNA interactions. © 2012 The Authors Journal compilation © 2012 FEBS.

Structural organization of the porcine and human genes coding for a leydig cell-specific insulin-like peptide (LEY I-L) and chromosomal localization of the human gene (INSL3)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burkhardt E.; Adham, I.M.; Brosig, B.

1994-03-01

Leydig insulin-like protein (LEY I-L) is a member of the insulin-like hormone superfamily. The LEY I-L gene (designated INSL3) is expressed exclusively in prenatal and postnatal Leydig cells. The authors report here the cloning and nucleotide sequence of porcine and human LEY I-L genes including the 5[prime] regions. Both genes consist of two exons and one intron. The organization of the LEY I-L gene is similar to that of insulin and relaxin. The transcription start site in the porcine and human LEY I-L gene is localized 13 and 14 bp upstream of the translation start site, respectively. Alignment of themore » 5[prime] flanking regions of both genes reveals that the first 107 nucleotides upstream of the transcription start site exhibit an overall sequence similarity of 80%. This conserved region contains a consensus TATAA box, a CAAT-like element (GAAT), and a consensus SP1 sequence (GGGCGG) at equivalent positions in both genes and therefore may play a role in regulation of expression of the LEY I-L gene. The porcine and human genome contains a single copy of the LEY I-L gene. By in situ hybridization, the human gene was assigned to bands p13.2-p12 of the short arm of chromosome 19. 25 refs., 6 figs.« less

Structure and antigenicity analysis of the IgG gene for Nyctereutes procyonoides.

PubMed

Zhao, Cui; Guo, Shuyuan; Pang, Xiaoru; Song, Daozhen; Fu, Shijun; Chang, Weishan

2015-01-01

Nyctereutes procyonoides immunoglobulin G (IgG) gene is partially cloned. In order to obtain a certain length (966bp) of Nyctereutes procyonoides immunoglobulin G (IgG), two pairs of primers are designed according to the conserved nucleotide sequence of canine (GenBank:AF354265, AF354265, AF354266, AF354267) and mink (GenBank: L07789). Using Bioinformatics technology and Western-blot to analyze antigenicity of Nyctereutes procyonoides IgG-B gene. The homology for nucleotide sequence of IgG between Nyctereutes procyonoides and canine (IgG A, IgG B, IgG C, IgG D), mink, Homo sapiens, Oryctolagus cuniculus, Mus musculus, Anas platyrhynchos and gallus were respectively (88.1%, 93.6%, 85.4%, 87.2%), 83.7%, 74.8%, 71.8%, 69.2%, 51.6%, 48.4%. It can be seen that there was high homology of aminoacid sequence between IgG of Nyctereutes procyonoides and IgG (A, B, C, D) of canine. And the serum antibody of Nyctereutes procyonoides had obviously cross-reaction with HRP conjugated rabbit anti-dog IgG, compared with those of canine, oryctolagus cuniculus, mus musculus, mink, gallus. We successfully got Nyctereutes procyonoides immuneglobulin G (IgG) gene (Gen- Bank: KM010191). There is the closest ties of consanguinity of IgG exist between Nyctereutes procyonoides and canine among the mammal through the genetic evolution. The detection and treament of canine distemper can be used on Nyctereutes procyonoides.

PSSRdb: a relational database of polymorphic simple sequence repeats extracted from prokaryotic genomes.

PubMed

Kumar, Pankaj; Chaitanya, Pasumarthy S; Nagarajaram, Hampapathalu A

2011-01-01

PSSRdb (Polymorphic Simple Sequence Repeats database) (http://www.cdfd.org.in/PSSRdb/) is a relational database of polymorphic simple sequence repeats (PSSRs) extracted from 85 different species of prokaryotes. Simple sequence repeats (SSRs) are the tandem repeats of nucleotide motifs of the sizes 1-6 bp and are highly polymorphic. SSR mutations in and around coding regions affect transcription and translation of genes. Such changes underpin phase variations and antigenic variations seen in some bacteria. Although SSR-mediated phase variation and antigenic variations have been well-studied in some bacteria there seems a lot of other species of prokaryotes yet to be investigated for SSR mediated adaptive and other evolutionary advantages. As a part of our on-going studies on SSR polymorphism in prokaryotes we compared the genome sequences of various strains and isolates available for 85 different species of prokaryotes and extracted a number of SSRs showing length variations and created a relational database called PSSRdb. This database gives useful information such as location of PSSRs in genomes, length variation across genomes, the regions harboring PSSRs, etc. The information provided in this database is very useful for further research and analysis of SSRs in prokaryotes.

Combined proteomic and molecular approaches for cloning and characterization of copper-zinc superoxide dismutase (Cu, Zn-SOD2) from garlic (Allium sativum).

PubMed

Hadji Sfaxi, Imen; Ezzine, Aymen; Coquet, Laurent; Cosette, Pascal; Jouenne, Thierry; Marzouki, M Nejib

2012-09-01

Superoxide dismutases (SODs; EC 1.15.1.1) are key enzymes in the cells protection against oxidant agents. Thus, SODs play a major role in the protection of aerobic organisms against oxygen-mediated damages. Three SOD isoforms were previously identified by zymogram staining from Allium sativum bulbs. The purified Cu, Zn-SOD2 shows an antagonist effect to an anticancer drug and alleviate cytotoxicity inside tumor cells lines B16F0 (mouse melanoma cells) and PAE (porcine aortic endothelial cells). To extend the characterization of Allium SODs and their corresponding genes, a proteomic approach was applied involving two-dimensional gel electrophoresis and LC-MS/MS analyses. From peptide sequence data obtained by mass spectrometry and sequences homologies, primers were defined and a cDNA fragment of 456 bp was amplified by RT-PCR. The cDNA nucleotide sequence analysis revealed an open reading frame coding for 152 residues. The deduced amino acid sequence showed high identity (82-87%) with sequences of Cu, Zn-SODs from other plant species. Molecular analysis was achieved by a protein 3D structural model.

Genetic diversity analysis of Leuconostoc mesenteroides from Korean vegetables and food products by multilocus sequence typing.

PubMed

Sharma, Anshul; Kaur, Jasmine; Lee, Sulhee; Park, Young-Seo

2018-06-01

In the present study, 35 Leuconostoc mesenteroides strains isolated from vegetables and food products from South Korea were studied by multilocus sequence typing (MLST) of seven housekeeping genes (atpA, groEL, gyrB, pheS, pyrG, rpoA, and uvrC). The fragment sizes of the seven amplified housekeeping genes ranged in length from 366 to 1414 bp. Sequence analysis indicated 27 different sequence types (STs) with 25 of them being represented by a single strain indicating high genetic diversity, whereas the remaining 2 were characterized by five strains each. In total, 220 polymorphic nucleotide sites were detected among seven housekeeping genes. The phylogenetic analysis based on the STs of the seven loci indicated that the 35 strains belonged to two major groups, A (28 strains) and B (7 strains). Split decomposition analysis showed that intraspecies recombination played a role in generating diversity among strains. The minimum spanning tree showed that the evolution of the STs was not correlated with food source. This study signifies that the multilocus sequence typing is a valuable tool to access the genetic diversity among L. mesenteroides strains from South Korea and can be used further to monitor the evolutionary changes.

Molecular characterizations of somatic hybrids developed between Pleurotus florida and Lentinus squarrosulus through inter-simple sequence repeat markers and sequencing of ribosomal RNA-ITS gene.

PubMed

Mallick, Pijush; Chattaraj, Shruti; Sikdar, Samir Ranjan

2017-10-01

The 12 pfls somatic hybrids and 2 parents of Pleurotus florida and Lentinus s quarrosulus were characterized by ISSR and sequencing of rRNA-ITS genes. Five ISSR primers were used and amplified a total of 54 reproducible fragments with 98.14% polymorphism among all the pfls hybrid populations and parental strains. UPGMA-based cluster exhibited a dendrogram with three major groups between the parents and pfls hybrids. Parent P . florida and L . squarrosulus showed different degrees of genetic distance with all the hybrid lines and they showed closeness to hybrid pfls 1m and pfls 1h , respectively. ITS1(F) and ITS4(R) amplified the rRNA-ITS gene with 611-867 bp sequence length. The nucleotide polymorphisms were found in the ITS1, ITS2 and 5.8S rRNA region with different number of bases. Based on rRNA-ITS sequence, UPGMA cluster exhibited three distinct groups between L. squarrosulus and pfls 1p , pfls 1m and pfls 1s , and pfls 1e and P. florida .

Recent advances in rice genome and chromosome structure research by fluorescence in situ hybridization (FISH).

PubMed

Ohmido, Nobuko; Fukui, Kiichi; Kinoshita, Toshiro

2010-01-01

Fluorescence in situ hybridization (FISH) is an effective method for the physical mapping of genes and repetitive DNA sequences on chromosomes. Physical mapping of unique nucleotide sequences on specific rice chromosome regions was performed using a combination of chromosome identification and highly sensitive FISH. Increases in the detection sensitivity of smaller DNA sequences and improvements in spatial resolution have ushered in a new phase in FISH technology. Thus, it is now possible to perform in situ hybridization on somatic chromosomes, pachytene chromosomes, and even on extended DNA fibers (EDFs). Pachytene-FISH allows the integration of genetic linkage maps and quantitative chromosome maps. Visualization methods using FISH can reveal the spatial organization of the centromere, heterochromatin/euchromatin, and the terminal structures of rice chromosomes. Furthermore, EDF-FISH and the DNA combing technique can resolve a spatial distance of 1 kb between adjacent DNA sequences, and the detection of even a 300-bp target is now feasible. The copy numbers of various repetitive sequences and the sizes of various DNA molecules were quantitatively measured using the molecular combing technique. This review describes the significance of these advances in molecular cytology in rice and discusses future applications in plant studies using visualization techniques.

Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

PubMed Central

Hunt, C; Morimoto, R I

1985-01-01

We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-29

... DEPARTMENT OF COMMERCE Patent and Trademark Office Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request... Patent applications that contain nucleotide and/or amino acid sequence disclosures must include a copy of...

Characterisation of pks15/1 in clinical isolates of Mycobacterium tuberculosis from Mexico

PubMed Central

Zenteno-Cuevas, Roberto; Silva-Hernández, Francisco X; Mendoza-Damián, Fabiola; Ramírez-Hernández, Maria Dolores; Vázquez-Medina, Karen; Widrobo-García, Lorena; Cuellar-Sanchez, Aremy; Muñíz-Salazar, Raquel; Enciso-Moreno, Leonor; Pérez-Navarro, Lucia Monserrat; Enciso-Moreno, José Antonio

2013-01-01

Tuberculosis (TB) is an infectocontagious respiratory disease caused by members of the Mycobacterium tuberculosis complex. A 7 base pair (bp) deletion in the locus polyketide synthase (pks)15/1 is described as polymorphic among members of the M. tuberculosis complex, enabling the identification of Euro-American, Indo-Oceanic and Asian lineages. The aim of this study was to characterise this locus in TB isolates from Mexico. One hundred twenty clinical isolates were recovered from the states of Veracruz and Estado de Mexico. We determined the nucleotide sequence of a ± 400 bp fragment of the locus pks15/1, while genotypic characterisation was performed by spoligotyping. One hundred and fifty isolates contained the 7 bp deletion, while five had the wild type locus. Lineages X (22%), LAM (18%) and T (17%) were the most frequent; only three (2%) of the isolates were identified as Beijing and two (1%) EAI-Manila. The wild type pks15/1 locus was observed in all Asian lineage isolates tested. Our results confirm the utility of locus pks15/1 as a molecular marker for identifying Asian lineages of the M. tuberculosis complex. This marker could be of great value in the epidemiological surveillance of TB, especially in countries like Mexico, where the prevalence of such lineages is unknown. PMID:24037193

Structural polymorphism exhibited by a quasipalindrome present in the locus control region (LCR) of the human beta-globin gene cluster.

PubMed

Kaushik, Mahima; Kukreti, Shrikant

2006-01-01

Structural polymorphism of DNA is a widely accepted property. A simple addition to this perception has been our recent finding, where a single nucleotide polymorphism (SNP) site present in a quasipalindromic sequence of beta-globin LCR exhibited a hairpin-duplex equilibrium. Our current studies explore that secondary structures adopted by individual complementary strands compete with formation of a perfect duplex. Using gel-electrophoresis, ultraviolet (UV)-thermal denaturation, circular dichroism (CD) techniques, we have demonstrated the structural transitions within a perfect duplex containing 11 bp quasipalindromic stretch (TGGGG(G/C)CCCCA), to hairpins and bulge duplex forms. The extended version of the 11 bp duplex, flanked by 5 bp on both sides also demonstrated conformational equilibrium between duplex and hairpin species. Gel-electrophoresis confirms that the duplex coexists with hairpin and bulge duplex/cruciform species. Further, in CD spectra of duplexes, presence of two overlapping positive peaks at 265 and 285 nm suggest the features of A- as well as B-type DNA conformation and show oligomer concentration dependence, manifested in A --> B transition. This indicates the possibility of an architectural switching at quasipalindromic region between linear duplex to a cruciform structure. Such DNA structural variations are likely to be found in the mechanics of molecular recognition and manipulation by proteins.