Sample records for breast prostate thyroid

  1. Incidence of Breast, Prostate, Testicular, and Thyroid Cancer in Italian Contaminated Sites with Presence of Substances with Endocrine Disrupting Properties.

    PubMed

    Benedetti, Marta; Zona, Amerigo; Beccaloni, Eleonora; Carere, Mario; Comba, Pietro

    2017-03-29

    The aim of the present study was to investigate the incidence of breast (females), prostate, testicular, and thyroid cancer in the Italian National Priority Contaminated Sites (NPCSs), served by cancer registries, where the presence of endocrine disruptors (EDs), reported to be linked to these tumours, was documented. Evidence of carcinogenicity of EDs present in NPCSs was assessed based on evaluation by international scientific institutions and committees. Standardized Incidence Ratios (SIRs) were computed for each NPCS and cancer site between 1996 and 2005. Excess incidence of one or more cancer site studied was found in twelve out of fourteen NPCSs. Significantly increased SIRs were found for breast cancer in eight NPCSs, for prostate cancer in six, for thyroid cancer (both gender) in four, and for testicular cancer in two. Non-significantly increased SIRs were found in five NPCSs for testicular cancer and in two for thyroid cancer (males). In a small number of instances a significant deficit was reported, mainly for thyroid and prostate cancer. Although increased incidence of one or more cancer sites studied were found in several NPCSs, the ecological study design and the multifactorial aetiology of the considered tumours do not permit concluding causal links with environmental contamination. Regarding the observation of some excesses in SIRs, continuing epidemiological surveillance is warranted.

  2. High incidence of thyroid cancer among patients with acromegaly.

    PubMed

    Kaldrymidis, Dimitrios; Papadakis, Georgios; Tsakonas, Georgios; Kaldrymidis, Philippos; Flaskas, Theofanis; Seretis, Andreas; Pantazi, Eleni; Kostoglou-Athanassiou, Ifigenia; Peppa, Melpomeni; Roussou, Paraskevi; Diamanti-Kandarakis, Evanthia

    2016-01-01

    Several studies have suggested that patients with acromegaly have an increased risk of thyroid, colorectal, breast and prostate cancers. In this study we determined the prevalence of malignant neoplasms in patients with acromegaly. Cancer risk was evaluated in a cohort of 110 patients (M/F 48/62, age 58.63±13.8 years, range 30-86) with acromegaly. Mean age at diagnosis of acromegaly was 46.37±13.11 years. Mean period of time since diagnosis of acromegaly was 12.26+9.6 years. From 110 patients, cancer was diagnosed in 26 (23.6%) patients. Thyroid cancer was the most common cancer and was diagnosed in 13 patients (11.8%); other cancers encountered were gastric cancer (N=2), endometrial cancer (N-2), and breast cancer, colon cancer, prostate cancer (N-2), myelodysplastic syndrome, renal cell carcinoma, lung cancer and pancreatic carcinoma, one case each. Age, gender, age at the time of diagnosis of acromegaly, tumor size of pituitary adenoma and duration of disease were not associated with cancer development. This study suggests that patients with acromegaly have an increased risk of thyroid cancer and therefore they should undergo regular screening with hormonal and ultrasound evaluation of the thyroid and FNAB when required.

  3. CHEK2 mutations and the risk of papillary thyroid cancer.

    PubMed

    Siołek, Monika; Cybulski, Cezary; Gąsior-Perczak, Danuta; Kowalik, Artur; Kozak-Klonowska, Beata; Kowalska, Aldona; Chłopek, Małgorzata; Kluźniak, Wojciech; Wokołorczyk, Dominika; Pałyga, Iwona; Walczyk, Agnieszka; Lizis-Kolus, Katarzyna; Sun, Ping; Lubiński, Jan; Narod, Steven A; Góźdż, Stanisław

    2015-08-01

    Mutations in the cell cycle checkpoint kinase 2 (CHEK2) tumor suppressor gene are associated with multi-organ cancer susceptibility including cancers of the breast and prostate. A genetic association between thyroid and breast cancer has been suggested, however little is known about the determinants of this association. To characterize the association of CHEK2 mutations with thyroid cancer, we genotyped 468 unselected patients with papillary thyroid cancer and 468 (matched) cancer-free controls for four founder mutations of CHEK2 (1100delC, IVS2 + 1G>A, del5395 and I157T). We compared the family histories reported by patients with a CHEK2 mutation to those of non-carriers. A CHEK2 mutation was seen in 73 of 468 (15.6%) unselected patients with papillary thyroid cancer, compared to 28 of 460 (6.0%) age- and sex-matched controls (OR 3.3; p < 0.0001). A truncating mutation (IVS2 + 1G>A, 1100delC or del5395) was associated with a higher risk of thyroid cancer (OR = 5.7; p = 0.006), than was the missense mutation I157T (OR = 2.8; p = 0.0001). CHEK2 mutation carriers reported a family history of breast cancer 2.2 times more commonly than non-carriers (16.4% vs.8.1%; p = 0.05). A CHEK2 mutation was found in seven of 11 women (63%) with multiple primary cancers of the breast and thyroid (OR = 10; p = 0.0004). These results suggest that CHEK2 mutations predispose to thyroid cancer, familial aggregations of breast and thyroid cancer and to double primary cancers of the breast and thyroid. © 2015 UICC.

  4. A Continuation Study Using Sunitinib Malate For Patients Leaving Treatment On A Previous Sunitinib Study.

    ClinicalTrials.gov

    2015-10-07

    Metastatic Breast Cancer [F]; Advanced Breast Cancer; Metastatic Castration Resistant Prostate Cancer; Metastatic Renal Cell Cancer; Non-Small Cell Lung Cancer; Thyroid Cancer; Advanced/Metastatic Non-Small Cell Lung Cancer; Advanced Gastric Cancer; Gastrointestinal Stromal Tumor; Hepatocellular Carcinoma; Pancreatic Islet Cell Carcinoma; Pancreatic Neuroendocrine Tumor

  5. Targeted Therapy Directed by Genetic Testing in Treating Patients With Advanced Refractory Solid Tumors, Lymphomas, or Multiple Myeloma (The MATCH Screening Trial)

    ClinicalTrials.gov

    2018-06-25

    Advanced Malignant Solid Neoplasm; Bladder Carcinoma; Breast Carcinoma; Cervical Carcinoma; Colon Carcinoma; Colorectal Carcinoma; Endometrial Carcinoma; Esophageal Carcinoma; Gastric Carcinoma; Glioma; Head and Neck Carcinoma; Kidney Carcinoma; Liver and Intrahepatic Bile Duct Carcinoma; Lung Carcinoma; Lymphoma; Malignant Uterine Neoplasm; Melanoma; Ovarian Carcinoma; Pancreatic Carcinoma; Plasma Cell Myeloma; Prostate Carcinoma; Rectal Carcinoma; Recurrent Bladder Carcinoma; Recurrent Breast Carcinoma; Recurrent Cervical Carcinoma; Recurrent Colon Carcinoma; Recurrent Colorectal Carcinoma; Recurrent Esophageal Carcinoma; Recurrent Gastric Carcinoma; Recurrent Glioma; Recurrent Head and Neck Carcinoma; Recurrent Liver Carcinoma; Recurrent Lung Carcinoma; Recurrent Lymphoma; Recurrent Malignant Solid Neoplasm; Recurrent Melanoma; Recurrent Ovarian Carcinoma; Recurrent Pancreatic Carcinoma; Recurrent Plasma Cell Myeloma; Recurrent Prostate Carcinoma; Recurrent Rectal Carcinoma; Recurrent Skin Carcinoma; Recurrent Thyroid Gland Carcinoma; Recurrent Uterine Corpus Carcinoma; Refractory Lymphoma; Refractory Malignant Solid Neoplasm; Refractory Plasma Cell Myeloma; Skin Carcinoma; Thyroid Gland Carcinoma; Uterine Corpus Cancer

  6. Phase I/II Study of IMMU-132 in Patients With Epithelial Cancers

    ClinicalTrials.gov

    2018-04-23

    Colorectal Cancer; Gastric Adenocarcinoma; Esophageal Cancer; Hepatocellular Carcinoma; Non-small Cell Lung Cancer; Small Cell Lung Cancer; Ovarian Epithelial Cancer; Carcinoma Breast Stage IV; Hormone-refractory Prostate Cancer; Pancreatic Ductal Adenocarcinoma; Head and Neck Cancers- Squamous Cell; Renal Cell Cancer; Urinary Bladder Neoplasms; Cervical Cancer; Endometrial Cancer; Follicular Thyroid Cancer; Glioblastoma Multiforme; Triple Negative Breast Cancer

  7. Spectroscopy With Surface Coils and Decoupling

    ClinicalTrials.gov

    2015-12-23

    Adrenal Cortical Cancer; Brain Cancer; Breast Cancer; CNS Cancer; Colon Cancer; HEENT Cancer; Hodgkin's Disease; Kaposi's Sarcoma; Liver Cancer; Lung Cancer; Non-Hodgkin's Lymphoma; Ovarian Cancer; Pancreatic Cancer; Prostate Cancer; Rectal Cancer; Renal Cancer; Sarcoma; Squamous Cell Carcinoma; Thyroid Cancer

  8. Safety Study of MGD009 in B7-H3-expressing Tumors

    ClinicalTrials.gov

    2017-10-04

    Mesothelioma; Bladder Cancer; Melanoma; Squamous Cell Carcinoma of the Head and Neck; Non Small Cell Lung Cancer; Clear Cell Renal Cell Carcinoma; Ovarian Cancer; Thyroid Cancer; Breast Cancer; Pancreatic Cancer; Prostate Cancer; Colon Cancer; Soft Tissue Sarcoma

  9. Optional Sub-study to Intraoperative Imaging With ICG Registry

    ClinicalTrials.gov

    2016-07-19

    Lung, Prostate, Breast, Colon, Pancreatic, Renal, Bladder,Thyroid, Ovarian, Head and Neck,GI (Foregut - Esophagus),GI (Midgut) Cancer; Cancer of the Ovarian, Head and Neck,GI (Foregut - Esophagus),GI (Midgut), Sarcoma Cancer; Cancer of Neuro-onc, Parathyroid, Desmoid Tumors, Melanoma Cancer

  10. 77 FR 24969 - National Cancer Institute; Notice of Closed Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-26

    ... Special Emphasis Panel; SPORE in Breast, Prostate and Thyroid Cancers. Date: May 23-24, 2012. Time: 8 a.m... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Cancer Institute... clearly unwarranted invasion of personal privacy. Name of Committee: National Cancer Institute Special...

  11. Internal Radiation Therapy for Cancer

    Cancer.gov

    When getting internal radiation therapy, a source of radiation is put inside your body, in either liquid or solid form. It can be used treat different kinds of cancer, including thyroid, head and neck, breast, cervix, prostate, and eye. Learn more about how what to expect when getting internal radiation therapy.

  12. Temsirolimus and Vinorelbine Ditartrate in Treating Patients With Unresectable or Metastatic Solid Tumors

    ClinicalTrials.gov

    2016-06-09

    Extensive Stage Small Cell Lung Cancer; Hereditary Paraganglioma; Male Breast Cancer; Malignant Paraganglioma; Metastatic Gastrointestinal Carcinoid Tumor; Metastatic Pheochromocytoma; Pancreatic Polypeptide Tumor; Recurrent Breast Cancer; Recurrent Cervical Cancer; Recurrent Endometrial Carcinoma; Recurrent Gastrointestinal Carcinoid Tumor; Recurrent Islet Cell Carcinoma; Recurrent Neuroendocrine Carcinoma of the Skin; Recurrent Non-small Cell Lung Cancer; Recurrent Ovarian Epithelial Cancer; Recurrent Ovarian Germ Cell Tumor; Recurrent Pheochromocytoma; Recurrent Prostate Cancer; Recurrent Renal Cell Cancer; Recurrent Small Cell Lung Cancer; Recurrent Uterine Sarcoma; Regional Gastrointestinal Carcinoid Tumor; Regional Pheochromocytoma; Stage III Cervical Cancer; Stage III Endometrial Carcinoma; Stage III Neuroendocrine Carcinoma of the Skin; Stage III Ovarian Epithelial Cancer; Stage III Ovarian Germ Cell Tumor; Stage III Prostate Cancer; Stage III Renal Cell Cancer; Stage III Uterine Sarcoma; Stage IIIA Breast Cancer; Stage IIIA Non-small Cell Lung Cancer; Stage IIIB Breast Cancer; Stage IIIB Non-small Cell Lung Cancer; Stage IIIC Breast Cancer; Stage IV Breast Cancer; Stage IV Endometrial Carcinoma; Stage IV Neuroendocrine Carcinoma of the Skin; Stage IV Non-small Cell Lung Cancer; Stage IV Ovarian Epithelial Cancer; Stage IV Ovarian Germ Cell Tumor; Stage IV Prostate Cancer; Stage IV Renal Cell Cancer; Stage IV Uterine Sarcoma; Stage IVA Cervical Cancer; Stage IVB Cervical Cancer; Thyroid Gland Medullary Carcinoma

  13. Sudden loss of vision due to breast cancer metastasis to the eyeball.

    PubMed

    Antosz, Zbigniew S; Walocha, Jerzy; Poręba, Ryszard; Sioma-Markowska, Urszula

    2014-01-01

    Intraocular choroidal metastasis is a very rare cause of blindness. Carcinoma of breast is the most common primary malignancy the accounts for choroidal metastasis in females. Other primary neoplasms which can uncommonly metastasize to the choroid are gastrointestinal tract, thyroid, pancreas, prostate and testis. Metastatic neoplasm to the eye outnumbers the primary tumors such as retinoblastoma and malignant melanoma. We present a case of sudden loss of vision due to breast cancer metastasis to the eyeball. The interval between the diagnosis of the primary tumor and the choroidal metastasis was 4 years.

  14. The Risk and Clinical/Molecular Characteristics of Breast Cancer in Women with Neurofibromatosis Type 1

    DTIC Science & Technology

    2016-03-01

    pancreas, biliary tract, lung, skin, thyroid, ovarian, leukemia and lymphoma in people with NF1.[8] The spectrum of non-neoplastic clinical and physical...colorectal, 4 esophageal, 2 gastric , 6 head and neck, 3 cervical, 5 ovarian, 3 uterine, 3 bladder, 12 prostate, 3 renal, 9 skin or melanoma, 3

  15. Safety and Immune Response to a Multi-component Immune Based Therapy (MKC1106-PP) for Patients With Advanced Cancer.

    ClinicalTrials.gov

    2010-08-02

    Ovarian; Melanoma; Renal; Prostate; Colorectal; Endometrial Carcinoma; Cervical Carcinoma; Testicular Cancer; Thyroid Cancer; Small Cell Lung Carcinoma; Mesothelioma; Breast Carcinoma; Esophageal Carcinoma; Gastric Cancer; Pancreatic Carcinoma; Neuroendocrine Cancer; Liver Cancer; Gallbladder Cancer; Biliary Tract Cancer; Anal Carcinoma; Bone Sarcomas; Soft Tissue Sarcomas; Carcinoma of Unknown Origin, Primary

  16. Targeting the thyroid gland with thyroid-stimulating hormone (TSH)-nanoliposomes.

    PubMed

    Paolino, Donatella; Cosco, Donato; Gaspari, Marco; Celano, Marilena; Wolfram, Joy; Voce, Pasquale; Puxeddu, Efisio; Filetti, Sebastiano; Celia, Christian; Ferrari, Mauro; Russo, Diego; Fresta, Massimo

    2014-08-01

    Various tissue-specific antibodies have been attached to nanoparticles to obtain targeted delivery. In particular, nanodelivery systems with selectivity for breast, prostate and cancer tissue have been developed. Here, we have developed a nanodelivery system that targets the thyroid gland. Nanoliposomes have been conjugated to the thyroid-stimulating hormone (TSH), which binds to the TSH receptor (TSHr) on the surface of thyrocytes. The results indicate that the intracellular uptake of TSH-nanoliposomes is increased in cells expressing the TSHr. The accumulation of targeted nanoliposomes in the thyroid gland following intravenous injection was 3.5-fold higher in comparison to untargeted nanoliposomes. Furthermore, TSH-nanoliposomes encapsulated with gemcitabine showed improved anticancer efficacy in vitro and in a tumor model of follicular thyroid carcinoma. This drug delivery system could be used for the treatment of a broad spectrum of thyroid diseases to reduce side effects and improve therapeutic efficacy. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. Gynecomastia as the initial manifestation of hyperthyroidism.

    PubMed

    Gordon, D L; Brown, J L; Emanuele, N V; Hall, L

    1997-01-01

    To present two new cases of gynecomastia as the initial manifestation of hyperthyroidism. We describe detailed case reports of two men with breast enlargement who were found to have hyperthyroidism, and we review the related literature. Two men sought medical assistance because of unilateral tender gynecomastia. In one of these patients, thyroid, gonadal, and prostate examinations showed normal findings at the time of initial assessment, and symptoms of hyperthyroidism developed later. In our other patient with gynecomastia, other symptoms of hyperthyroidism--for example, nervousness, irritability, palpitations, and fatigue--had been present for a prolonged period but had been considered "normal" by the patient. In both patients, the hyperthyroidism was treated with radioiodine. Breast pain disappeared in both patients, and breast enlargement disappeared in one patient and was decreased in the other patient after euthyroidism was achieved. Review of the literature disclosed only two similar cases. Because of the rarity of gynecomastia as the initial symptom of hyperthyroidism, we believe that thyroid function tests are not indicated in the workup of patients whose major complaint is gynecomastia.

  18. Interleukin-12 and Trastuzumab in Treating Patients With Cancer That Has High Levels of HER2/Neu

    ClinicalTrials.gov

    2013-02-27

    Advanced Adult Primary Liver Cancer; Anaplastic Thyroid Cancer; Bone Metastases; Carcinoma of the Appendix; Distal Urethral Cancer; Fallopian Tube Cancer; Gastrinoma; Glucagonoma; Inflammatory Breast Cancer; Insulinoma; Liver Metastases; Localized Unresectable Adult Primary Liver Cancer; Lung Metastases; Male Breast Cancer; Malignant Pericardial Effusion; Malignant Pleural Effusion; Metastatic Gastrointestinal Carcinoid Tumor; Metastatic Parathyroid Cancer; Metastatic Transitional Cell Cancer of the Renal Pelvis and Ureter; Newly Diagnosed Carcinoma of Unknown Primary; Occult Non-small Cell Lung Cancer; Pancreatic Polypeptide Tumor; Primary Peritoneal Cavity Cancer; Proximal Urethral Cancer; Pulmonary Carcinoid Tumor; Recurrent Adenoid Cystic Carcinoma of the Oral Cavity; Recurrent Adrenocortical Carcinoma; Recurrent Adult Primary Liver Cancer; Recurrent Anal Cancer; Recurrent Bladder Cancer; Recurrent Breast Cancer; Recurrent Carcinoma of Unknown Primary; Recurrent Cervical Cancer; Recurrent Colon Cancer; Recurrent Endometrial Carcinoma; Recurrent Esophageal Cancer; Recurrent Extrahepatic Bile Duct Cancer; Recurrent Gallbladder Cancer; Recurrent Gastric Cancer; Recurrent Gastrointestinal Carcinoid Tumor; Recurrent Islet Cell Carcinoma; Recurrent Malignant Testicular Germ Cell Tumor; Recurrent Mucoepidermoid Carcinoma of the Oral Cavity; Recurrent Non-small Cell Lung Cancer; Recurrent Ovarian Epithelial Cancer; Recurrent Pancreatic Cancer; Recurrent Parathyroid Cancer; Recurrent Prostate Cancer; Recurrent Rectal Cancer; Recurrent Renal Cell Cancer; Recurrent Salivary Gland Cancer; Recurrent Small Intestine Cancer; Recurrent Squamous Cell Carcinoma of the Larynx; Recurrent Squamous Cell Carcinoma of the Lip and Oral Cavity; Recurrent Squamous Cell Carcinoma of the Nasopharynx; Recurrent Squamous Cell Carcinoma of the Oropharynx; Recurrent Thyroid Cancer; Recurrent Transitional Cell Cancer of the Renal Pelvis and Ureter; Recurrent Urethral Cancer; Recurrent Vaginal Cancer; Recurrent Vulvar Cancer; Skin Metastases; Small Intestine Adenocarcinoma; Somatostatinoma; Stage III Adenoid Cystic Carcinoma of the Oral Cavity; Stage III Adrenocortical Carcinoma; Stage III Bladder Cancer; Stage III Cervical Cancer; Stage III Colon Cancer; Stage III Endometrial Carcinoma; Stage III Esophageal Cancer; Stage III Follicular Thyroid Cancer; Stage III Gastric Cancer; Stage III Malignant Testicular Germ Cell Tumor; Stage III Mucoepidermoid Carcinoma of the Oral Cavity; Stage III Ovarian Epithelial Cancer; Stage III Pancreatic Cancer; Stage III Papillary Thyroid Cancer; Stage III Prostate Cancer; Stage III Rectal Cancer; Stage III Renal Cell Cancer; Stage III Salivary Gland Cancer; Stage III Squamous Cell Carcinoma of the Larynx; Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage III Squamous Cell Carcinoma of the Nasopharynx; Stage III Squamous Cell Carcinoma of the Oropharynx; Stage III Vaginal Cancer; Stage III Vulvar Cancer; Stage IIIA Anal Cancer; Stage IIIA Breast Cancer; Stage IIIA Non-small Cell Lung Cancer; Stage IIIB Anal Cancer; Stage IIIB Breast Cancer; Stage IIIB Non-small Cell Lung Cancer; Stage IV Adenoid Cystic Carcinoma of the Oral Cavity; Stage IV Adrenocortical Carcinoma; Stage IV Anal Cancer; Stage IV Bladder Cancer; Stage IV Breast Cancer; Stage IV Colon Cancer; Stage IV Endometrial Carcinoma; Stage IV Esophageal Cancer; Stage IV Follicular Thyroid Cancer; Stage IV Gastric Cancer; Stage IV Mucoepidermoid Carcinoma of the Oral Cavity; Stage IV Non-small Cell Lung Cancer; Stage IV Ovarian Epithelial Cancer; Stage IV Pancreatic Cancer; Stage IV Papillary Thyroid Cancer; Stage IV Prostate Cancer; Stage IV Rectal Cancer; Stage IV Renal Cell Cancer; Stage IV Salivary Gland Cancer; Stage IV Squamous Cell Carcinoma of the Larynx; Stage IV Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IV Squamous Cell Carcinoma of the Nasopharynx; Stage IV Squamous Cell Carcinoma of the Oropharynx; Stage IVA Cervical Cancer; Stage IVA Vaginal Cancer; Stage IVB Cervical Cancer; Stage IVB Vaginal Cancer; Stage IVB Vulvar Cancer; Thyroid Gland Medullary Carcinoma; Unresectable Extrahepatic Bile Duct Cancer; Unresectable Gallbladder Cancer; Urethral Cancer Associated With Invasive Bladder Cancer; WDHA Syndrome

  19. Basal cell skin cancer and the risk of second primary cancers: a cancer registry-based study in Lithuania.

    PubMed

    Krilaviciute, Agne; Vincerzevskiene, Ieva; Smailyte, Giedre

    2016-07-01

    The aim of this population-based cohort study was to determine the risk of second primary cancer in basal cell carcinoma (BCC) patients in Lithuania. This analysis was based on patients diagnosed with BCC in Lithuania between 1998 and 2007 and followed until 2011. Standardized incidence ratios for subsequent cancers as a ratio of observed number of cancer cases in people with previous BCC diagnosis to the expected number of cancer cases in the underlying general population were calculated. After diagnosis of BCC, 1442 new cases of selected cancers were diagnosed. Compared with the general population, the incidence of all new primaries combined after BCC was very close to expected. Statistically meaningful increase in developing subsequent cancer was obtained for Hodgkin's lymphoma, prostate cancer, and leukemia in men, and for cancers of the lip, lung, and breast in women. Risk of melanoma and thyroid cancer was significantly elevated in both sexes. Relative risk of cancer of the eye was increased although not significant. In our study, we found increased cancer risk for cancers related to sun exposure. In addition, increased risks were identified for Hodgkin's lymphoma, thyroid cancer, leukemia, prostate, and breast cancer in BCC patients. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Breast, prostate, and thyroid cancer screening tests and overdiagnosis.

    PubMed

    Jung, Minsoo

    The purpose of this study was to examine overdiagnosis and overtreatment related to cancer screening and to review relevant reports and studies. A comprehensive search of peer-reviewed and gray literature was conducted for relevant studies published between January 2000 and December 2015 reporting breast, prostate, and thyroid cancer screening tests and overdiagnosis. This study revealed no dichotomy on where screening would lower risk or cause overdiagnosis and overtreatment. Many screening tests did both, that is, at population level, there were both benefit (decreased disease-specific mortality) and harm (overdiagnosis and overtreatment). Therefore, we need to consider a balanced argument with citations for the potential benefits of screening along with the harms associated with screening. Although the benefits and harms can only be tested through randomized trials, important data from cohort studies, diagnostic accuracy studies, and modeling work can help define the extent of benefits and harms in the population. The health care cycle that prompt patients to undergo periodic screening tests is self-reinforcing. In most developed countries, screening test recommendations encourage periodic testing. Therefore, patients are continuing their screening. It is necessary for patients to become wise consumers of screening tests and make decisions with their physicians regarding further testing and treatments. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Romidepsin in Treating Patients With Lymphoma, Chronic Lymphocytic Leukemia, or Solid Tumors With Liver Dysfunction

    ClinicalTrials.gov

    2018-04-02

    Glioma; Lymphoma; Metastatic Malignant Solid Neoplasm; Neuroendocrine Neoplasm; Recurrent Adult Soft Tissue Sarcoma; Recurrent Bladder Carcinoma; Recurrent Breast Carcinoma; Recurrent Chronic Lymphocytic Leukemia; Recurrent Colorectal Carcinoma; Recurrent Head and Neck Carcinoma; Recurrent Lung Carcinoma; Recurrent Malignant Solid Neoplasm; Recurrent Melanoma; Recurrent Pancreatic Carcinoma; Recurrent Primary Cutaneous T-Cell Non-Hodgkin Lymphoma; Recurrent Prostate Carcinoma; Recurrent Renal Cell Carcinoma; Recurrent Thyroid Gland Carcinoma; Refractory Chronic Lymphocytic Leukemia; Refractory Mature T-Cell and NK-Cell Non-Hodgkin Lymphoma; Refractory Primary Cutaneous T-Cell Non-Hodgkin Lymphoma; Stage III Breast Cancer AJCC v7; Stage III Colorectal Cancer AJCC v7; Stage III Cutaneous Melanoma AJCC v7; Stage III Lung Cancer AJCC v7; Stage III Pancreatic Cancer AJCC v6 and v7; Stage III Prostate Cancer AJCC v7; Stage III Renal Cell Cancer AJCC v7; Stage III Soft Tissue Sarcoma AJCC v7; Stage IIIA Breast Cancer AJCC v7; Stage IIIA Colorectal Cancer AJCC v7; Stage IIIA Cutaneous Melanoma AJCC v7; Stage IIIB Breast Cancer AJCC v7; Stage IIIB Colorectal Cancer AJCC v7; Stage IIIB Cutaneous Melanoma AJCC v7; Stage IIIC Breast Cancer AJCC v7; Stage IIIC Colorectal Cancer AJCC v7; Stage IIIC Cutaneous Melanoma AJCC v7; Stage IV Breast Cancer AJCC v6 and v7; Stage IV Colorectal Cancer AJCC v7; Stage IV Cutaneous Melanoma AJCC v6 and v7; Stage IV Lung Cancer AJCC v7; Stage IV Pancreatic Cancer AJCC v6 and v7; Stage IV Prostate Cancer AJCC v7; Stage IV Renal Cell Cancer AJCC v7; Stage IV Soft Tissue Sarcoma AJCC v7; Stage IVA Colorectal Cancer AJCC v7; Stage IVB Colorectal Cancer AJCC v7; Unresectable Solid Neoplasm

  2. Facial paralysis caused by metastasis of breast carcinoma to the temporal bone.

    PubMed

    Lan, Ming-Ying; Shiao, An-Suey; Li, Wing-Yin

    2004-11-01

    Metastatic tumors to the temporal bone are very rare. The most common sites of origin of temporal bone metastases are breast, lung, kidney, gastrointestinal tract, larynx, prostate gland, and thyroid gland. The pathogenesis of spread to the temporal bone is most commonly by the hematogenous route. The common otologic symptoms that manifest with facial nerve paralysis are often thought to be due to a mastoid infection. Here is a report on a case of breast carcinoma presenting with otalgia, otorrhea, and facial paralysis for 2 months. The patient was initially diagnosed as mastoiditis, and later the clinical impression was revised to metastatic breast carcinoma to temporal bone, based on the pathologic findings. Metastatic disease should be considered as a possible etiology in patients with a clinical history of malignant neoplasms presenting with common otologic or vestibular symptoms, especially with facial nerve paralysis.

  3. HER2-positive male breast cancer with thyroid cancer: an institutional report and review of literature.

    PubMed

    Bardhan, Pooja; Bui, Marilyn M; Minton, Susan; Loftus, Loretta; Carter, W Bradford; Laronga, Christine; Ismail-Khan, Roohi

    2012-01-01

    We report a rare finding of two male breast cancer patients with HER2-positive breast cancer who also developed thyroid cancer. We reviewed 45 male breast cancer patients treated in our institution from 2003 to 2008. Only five male breast cancer patients were HER2-positive. In reviewing the published data, we found no cases of thyroid cancer and concurrent breast cancer in men. However, breast cancer and thyroid cancer have shown close association in women. This finding therefore provokes speculation as to whether we should investigate whether women with HER2-positive breast cancer are at a higher risk for thyroid cancer. Although this observation seems to be clinically prevalent, publications are sparse in clinical research areas linking thyroid cancer to breast cancer.

  4. The Breast-Thyroid Cancer Link: A Systematic Review and Meta-Analysis

    PubMed Central

    Nielsen, Sarah M.; White, Michael G.; Hong, Susan; Aschebrook-Kilfoy, Briseis; Kaplan, Edwin L.; Angelos, Peter; Kulkarni, Swati A.; Olopade, Olufunmilayo I.; Grogan, Raymon H.

    2015-01-01

    Rates of thyroid cancer in women with a history of breast cancer are higher than expected. Similarly, rates of breast cancer in those with a history of thyroid cancer are increased. Explanations for these associations include detection bias, shared hormonal risk factors, treatment effect, and genetic susceptibility. With increasing numbers of breast and thyroid cancer survivors clinicians should be particularly cognizant of this association. Here we perform a systematic review and meta-analysis of the literature utilizing PubMed and Scopus search engines to identify all publications studying the incidence of breast cancer as a secondary malignancy following a diagnosis of thyroid cancer or thyroid cancer following a diagnosis of breast cancer. This demonstrated an increased risk of thyroid cancer as a secondary malignancy following breast cancer (OR=1.55, 95% CI [1.44,1.67]) and an increased risk of breast cancer as a secondary malignancy following thyroid cancer (OR= 1.32, 95% CI [1.23,1.42]). There is a clear increase in the odds of developing either thyroid or breast cancer as a secondary malignancy after diagnosis with the other. Here we review this association and current hypothesis as to the cause of this correlation. PMID:26908594

  5. Neovascular PSMA expression is a common feature in malignant neoplasms of the thyroid

    PubMed Central

    Heitkötter, Birthe; Steinestel, Konrad; Trautmann, Marcel; Grünewald, Inga; Barth, Peter; Gevensleben, Heidrun; Bögemann, Martin; Wardelmann, Eva; Hartmann, Wolfgang; Rahbar, Kambiz; Huss, Sebastian

    2018-01-01

    Aim PSMA (prostate-specific membrane antigen) is physiologically expressed in normal prostate tissue and over expressed in prostate cancer cells, therefore constituting a potential target for antibody-based radioligand therapy. Very recent imaging findings reported PSMA-PET/CT uptake in various thyroid lesions. We were therefore encouraged to systematically analyse PSMA expression in different benign and malignant thyroid lesions. Methods Immunohistochemistry was used to detect PSMA expression in 101 thyroid lesions, while neovasculature was identified by CD34 immunostaining. Results PSMA expression in the neovasculature was significantly more frequent in malignant tumors (36/63; 57.1%) compared to benign diseases (5/38; 13.2%; p = 0.0001). In addition, PSMA expression levels in the neovasculature of poorly and undifferentiated thyroid cancers were significantly higher compared to differentiated thyroid tumors (p = 0.021). However, one case with a strong expression in follicular adenoma was identified. Conclusions We conclude that neovascular PSMA expression is common in thyroid cancer but may also rarely be found in benign thyroid diseases, such as follicular adenoma. High expression in the tumor-associated neovasculature is predominantly found in poorly differentiated and undifferentiated (anaplastic) thyroid cancer. This knowledge is highly relevant when interpreting PSMA/PET-CT scans from patients with prostate cancer. In addition, our findings might provide a rationale for further evaluation of PSMA-targeted anti-neovascular or radioligand therapy in metastatic dedifferentiated thyroid cancer. PMID:29515776

  6. B-Receptor Signaling in Cardiomyopathy

    ClinicalTrials.gov

    2015-11-16

    Carcinomas; Amyloidosis; Anal Cancer; Anemia; Cholangiocarcinoma of the Extrahepatic Bile Duct; Transitional Cell Carcinoma of Bladder; Bone Marrow Transplant Failure; Bone Cancer; Cancer of Brain and Nervous System; Breast Cancer; Carcinoma of the Large Intestine; Endocrine Cancer; Esophageal Cancer; Eye Cancer; Gall Bladder Cancer; Gastric (Stomach) Cancer; Gastrooesophageal Cancer; Gastrointestinal Stromal Tumor (GIST); Gynecologic Cancers; Head and Neck Cancers; Hepatobiliary Neoplasm; Kidney (Renal Cell) Cancer; Leukemia; Lung Cancer; Hodgkin Disease; Lymphoma, Non-Hodgkin; Mesothelioma; Multiple Myeloma; Myelodysplastic Syndromes (MDS); Neuroendocrine Tumors; Myeloproliferative Disorders; Pancreatic Cancer; Prostate Cancer; Skin Cancer; Soft Tissue Sarcoma; Testicular Cancer; Thymus Cancer; Thyroid Cancer

  7. Synchronous Detection of Male Breast Cancer and Prostatic Cancer in a Patient With Suspected Prostatic Carcinoma on 68Ga-PSMA PET/CT Imaging.

    PubMed

    Kumar, Rajender; Mittal, Bhagwant Rai; Bhattacharya, Anish; Singh, Harmandeep; Singh, Shrawan Kumar

    2018-06-01

    The male breast cancer is very less common as compared with the female breast cancer. We report a case of 64-year-old man who presented with the history of lower urinary tract symptoms. The digital rectal examination revealed hard and nodular prostate, and serum prostate-specific antigen level was 23.4 ng/mL. Ga-labeled prostate-specific membrane antigen PET/CT revealed prostate-specific membrane antigen-expressing lesions in the prostate, axillary tail of the right breast, and axillary lymph nodes. Histology from prostate revealed prostate carcinoma, whereas fine-needle aspiration from the breast revealed invasive ductal carcinoma of the breast.

  8. Cabozantinib-induced thyroid dysfunction: a review of two ongoing trials for metastatic bladder cancer and sarcoma.

    PubMed

    Yavuz, Sahzene; Apolo, Andrea B; Kummar, Shivaani; del Rivero, Jaydira; Madan, Ravi A; Shawker, Thomas; Reynolds, James; Celi, Francesco S

    2014-08-01

    Thyroid dysfunction is a common adverse event associated with tyrosine kinase inhibitors (TKI), but its underlying pathophysiology is unclear. Cabozantinib is a novel TKI currently Food and Drug Administration approved for advanced medullary thyroid cancer and tested in clinical trials on solid tumors including prostate, liver, bladder, breast, and ovarian cancer. We analyzed the thyroid function of patients enrolled in two phase 2 clinical trials using cabozantinib at the National Institutes of Health Clinical Center. Two cases of thyroiditis associated with cabozantinib therapy are presented in detail, and a systematic review of the literature on TKI-associated thyroid dysfunction is also discussed. Between September 2012 and September 2013, 33 patients were treated with cabozantinib, and follow-up thyroid function tests were available for 31 (20 males, 11 females; age 59±1 years). Thyroid dysfunction was recorded in the majority of patients (93.1%), with a predominance of subclinical hypothyroidism. Two cases showed a biphasic pattern of thyroid dysfunction characterized by a transient thyrotoxicosis followed by hypothyroidism. Color Doppler demonstrated an increase in vascularization during the thyrotoxic phase, but no uptake was visualized on nuclear medicine imaging. A systematic review of the literature resulted in the identification of 40 original manuscripts, of which 13 were case series and 6 were case reports describing TKI-associated thyroid dysfunction. TKI therapy often results in clinically significant thyroid dysfunction. Cabozantinib treatment commonly results in thyroid dysfunction varying from subclinical hypothyroidism to symptomatic thyrotoxicosis. Early detection and characterization of cabozantinib-associated thyroid dysfunction and close follow-up are essential to provide adequate management of this common adverse event.

  9. Cabozantinib-Induced Thyroid Dysfunction: A Review of Two Ongoing Trials for Metastatic Bladder Cancer and Sarcoma

    PubMed Central

    Yavuz, Sahzene; Apolo, Andrea B.; Kummar, Shivaani; del Rivero, Jaydira; Madan, Ravi A.; Shawker, Thomas; Reynolds, James

    2014-01-01

    Background: Thyroid dysfunction is a common adverse event associated with tyrosine kinase inhibitors (TKI), but its underlying pathophysiology is unclear. Cabozantinib is a novel TKI currently Food and Drug Administration approved for advanced medullary thyroid cancer and tested in clinical trials on solid tumors including prostate, liver, bladder, breast, and ovarian cancer. Methods: We analyzed the thyroid function of patients enrolled in two phase 2 clinical trials using cabozantinib at the National Institutes of Health Clinical Center. Two cases of thyroiditis associated with cabozantinib therapy are presented in detail, and a systematic review of the literature on TKI-associated thyroid dysfunction is also discussed. Results: Between September 2012 and September 2013, 33 patients were treated with cabozantinib, and follow-up thyroid function tests were available for 31 (20 males, 11 females; age 59±1 years). Thyroid dysfunction was recorded in the majority of patients (93.1%), with a predominance of subclinical hypothyroidism. Two cases showed a biphasic pattern of thyroid dysfunction characterized by a transient thyrotoxicosis followed by hypothyroidism. Color Doppler demonstrated an increase in vascularization during the thyrotoxic phase, but no uptake was visualized on nuclear medicine imaging. A systematic review of the literature resulted in the identification of 40 original manuscripts, of which 13 were case series and 6 were case reports describing TKI-associated thyroid dysfunction. Conclusion: TKI therapy often results in clinically significant thyroid dysfunction. Cabozantinib treatment commonly results in thyroid dysfunction varying from subclinical hypothyroidism to symptomatic thyrotoxicosis. Early detection and characterization of cabozantinib-associated thyroid dysfunction and close follow-up are essential to provide adequate management of this common adverse event. PMID:24724719

  10. Implication from thyroid function decreasing during chemotherapy in breast cancer patients: chemosensitization role of triiodothyronine

    PubMed Central

    2013-01-01

    Background Thyroid hormones have been shown to regulate breast cancer cells growth, the absence or reduction of thyroid hormones in cells could provoke a proliferation arrest in G0-G1 or weak mitochondrial activity, which makes cells insensitive to therapies for cancers through transforming into low metabolism status. This biological phenomenon may help explain why treatment efficacy and prognosis vary among breast cancer patients having hypothyroid, hyperthyroid and normal function. Nevertheless, the abnormal thyroid function in breast cancer patients has been considered being mainly caused by thyroid diseases, few studied influence of chemotherapy on thyroid function and whether its alteration during chemotherapy can influence the respose to chemotherapy is still unclear. So, we aimed to find the alterations of thyroid function and non-thyroidal illness syndrome (NTIS) prevalence druing chemotherapy in breast cancer patients, and investigate the influence of thyroid hormones on chemotherapeutic efficacy. Methods Thyroid hormones and NTIS prevalence at initial diagnosis and during chemotherapy were analyzed in 685 breast diseases patients (369 breast cancer, 316 breast benign lesions). The influence of thyroid hormones on chemotherapeutic efficacy was evaluated by chemosensitization test, to compare chemotherapeutic efficacy between breast cancer cells with chemotherapeutics plus triiodothyronine (T3) and chemotherapeutics only. Results In breast cancer, NTIS prevalence at the initial diagnosis was higher and increased during chemotherapy, but declined before the next chemotherapeutic course. Thyroid hormones decreased signigicantly during chemotherapy. T3 can enhance the chemosensitivity of MCF-7 to 5-Fu and taxol, with progression from G0-G1 phase to S phase. The similar chemosensitization role of T3 were found in MDA-MB-231. We compared chemotherapeutic efficacy among groups with different usage modes of T3, finding pretreatment with lower dose of T3, using higher dose of T3 together with 5-Fu or during chemotherapy with 5-Fu were all available to achieve chemosensitization, but pretreatment with lower dose of T3 until the end of chemotherapy may be a safer and more efficient therapy. Conclusions Taken together, thyroid hormones decreasing during chemotherapy was found in lots of breast cancer patients. On the other hand, thyroid hormones can enhance the chemotherapeutic efficacy through gatherring tumor cells in actively proliferating stage, which may provide a new adjuvant therapy for breast cancer in furture, especially for those have hypothyroidism during chemotherapy. PMID:23829347

  11. PI3Kbeta Inhibitor AZD8186 and Docetaxel in Treating Patients Advanced Solid Tumors With PTEN or PIK3CB Mutations That Are Metastatic or Cannot Be Removed by Surgery

    ClinicalTrials.gov

    2018-05-16

    Advanced Malignant Solid Neoplasm; Anatomic Stage III Breast Cancer AJCC v8; Anatomic Stage IIIA Breast Cancer AJCC v8; Anatomic Stage IIIB Breast Cancer AJCC v8; Anatomic Stage IIIC Breast Cancer AJCC v8; Anatomic Stage IV Breast Cancer AJCC v8; Castration-Resistant Prostate Carcinoma; Estrogen Receptor Negative; Estrogen Receptor Positive; HER2/Neu Negative; Metastatic Malignant Solid Neoplasm; Metastatic Prostate Carcinoma; PIK3CB Gene Mutation; Progesterone Receptor Negative; Prognostic Stage III Breast Cancer AJCC v8; Prognostic Stage IIIA Breast Cancer AJCC v8; Prognostic Stage IIIB Breast Cancer AJCC v8; Prognostic Stage IIIC Breast Cancer AJCC v8; Prognostic Stage IV Breast Cancer AJCC v8; PTEN Gene Mutation; PTEN Loss; Stage III Prostate Cancer AJCC v8; Stage IIIA Prostate Cancer AJCC v8; Stage IIIB Prostate Cancer AJCC v8; Stage IIIC Prostate Cancer AJCC v8; Stage IV Prostate Cancer AJCC v8; Stage IVA Prostate Cancer AJCC v8; Stage IVB Prostate Cancer AJCC v8; Triple-Negative Breast Carcinoma; Unresectable Solid Neoplasm

  12. Benign breast disease and risk of thyroid cancer.

    PubMed

    Luo, Juhua; Hendryx, Michael; Nassir, Rami; Cheng, Ting-Yuan David; Lane, Dorothy; Margolis, Karen L

    2017-09-01

    It has been suggested that breast and thyroid diseases may be linked. The aim of this study was to investigate the association between benign breast disease and subsequent risk of thyroid cancer. Postmenopausal women (n = 133,875) aged 50-79 years were followed up for a mean of 14 years. Benign breast disease was defined by history of biopsy. Incident thyroid cancer cases were confirmed by medical record review. Multivariable Cox proportional hazard modeling was used to estimate hazard ratios. There were 370 incident thyroid cancer cases during the follow-up period. Compared to women without BBD, women with BBD had a significant increased risk of thyroid cancer after adjusting for potential confounders (HR 1.38 95% CI 1.10-1.73), especially for women with more than two biopsies (HR 1.59 95% CI 1.10-2.26). There were no significant differences in thyroid tumor size, stage or histologic types between women with and without BBD. Our large prospective study observed that postmenopausal women with BBD had an increased risk for thyroid cancer compared with women without BBD. A more detailed investigation of thyroid cancer risk according to different subtypes of benign breast disease is needed to better understand the association observed between thyroid and benign breast diseases.

  13. Thyroid Hormone in the Clinic and Breast Cancer.

    PubMed

    Hercbergs, Aleck; Mousa, Shaker A; Leinung, Matthew; Lin, Hung-Yun; Davis, Paul J

    2018-06-01

    There is preclinical and recent epidemiological evidence that thyroid hormone supports breast cancer. These observations raise the issue of whether management of breast cancer in certain settings should include consideration of reducing the possible contribution of thyroid hormone to the advancement of the disease. In a preliminary experience, elimination of the clinical action of endogenous L-thyroxine (T 4 ) in patients with advanced solid tumors, including breast cancer, has favorably affected the course of the cancer, particularly when coupled with administration of exogenous 3,5,3'-triiodo-L-thyronine (T 3 ) (euthyroid hypothyroxinemia). We discuss in the current brief review the possible clinical settings in which to consider whether endogenous thyroid hormone-or exogenous thyroid hormone in the patient with hypothyroidism and coincident breast cancer-is significantly contributing to breast cancer outcome.

  14. Study on the status of thyroid function and thyroid nodules in chinese breast cancer patients

    PubMed Central

    Xu, Zhou; Zhao, Chunxia; Wu, Yutuan; Wu, He; Chen, Haoran; Li, Hong-Yuan; Wu, Kai-Nan; Kong, Ling-Quan

    2017-01-01

    We performed a study to investigate the status of thyroid nodules and thyroid functions in Chinese breast cancer women. The clinical data of female patients with breast cancer or benign breast diseases and normal populace were evaluated. The thyroxine(T4) level in initially diagnosed breast cancer patients were significantly higher than those in benign breast diseases patients (7.68±1.51 vs 7.29±1.52ug/dl, p<0.001), while the TSH levels were slightly lower than in benign breast diseases patients(3.23±4.59 vs 3.60±6.74uIU/ml, p=0.302). The overall incidence of hypothyroidism in initially diagnosed breast cancer and benign breast diseases patients were 28.65% and 32.74%(p=0.195). During chemotherapy, the T4(7.08±1.69ug/dl), fT3(2.87±0.48pg/ml) and fT4(0.83±0.15ng/dl) levels were significantly lower than in initially diagnosed breast cancer patients(7.68±1.51ug/dl, 3.07±0.50pg/ml, 0.88±0.20ng/dl, p<0.05). The incidence of thyroid nodules in initially diagnosed breast cancer patients, benign breast diseases patients and healthy population were 56.17%, 43.64%, 34.49%(p<0.001). The incidence of TI-RADS≥4 TN in initially diagnosed breast cancer patients and benign breast diseases patients were significantly higher than in normal population(7.27% vs 9.45% vs 2.87%, p<0.001). The incidence of TI-RADS≥4 thyroid nodules in breast cancer patients receiving chemotherapy was significantly higher than in initially diagnosed breast cancer patients(11.71% vs 7.27%, p<0.05). These data indicate that the incidence of thyroid disease in breast disease patients is higher than in normal population in China, and the breast diseases, especially breast cancer, might be related to the high incidence of thyroid nodules. PMID:29113346

  15. [Geomagnetic field variation in early ontogenesis as a risk factor for oncopathology].

    PubMed

    Iamshanov, V A

    2003-01-01

    The data on 534 cancer patients with tumors of 15 different sites were evaluated to elucidate the influence of geomagnetic field (GMF) in certain months of the pre- and early postnatal periods on future incidence of cancer. We identified neoplasms of the breast, lung, urinary bladder, hypophysis, ovary, prostate, liver, Hodgkin's disease, lymphoma and, possibly, gastric cancer as GMF-dependent. This relationship appeared to be idiosyncratic with every cancer variety. It was negligible in cases of esophagus, thyroid, uterine cervix and colorectal cancer. GMF variations as a carcinogenic factor in early ontogenesis can be assessed quantitatively.

  16. Incidence of breast carcinoma in women with thyroid carcinoma.

    PubMed

    Vassilopoulou-Sellin, R; Palmer, L; Taylor, S; Cooksley, C S

    1999-02-01

    Breast carcinoma and differentiated thyroid carcinoma(the most common endocrine malignancy) occur predominantly in women. An association between the two tumors has been suggested by some investigators, but the potential impact of treatment of one of these diseases on the development of the other remains unclear. The authors examined the relation between the occurrence of these two tumors. There were 41,686 patients with breast carcinoma and 3662 with thyroid carcinoma who registered at The University of Texas M. D. Anderson Cancer Center between March 1944 and April 1997. Women who received both diagnoses since 1976 were identified and incidence rates and relative risks of secondary tumor development were calculated. Surveillance, Epidemiology and End Results (SEER) program data on the age-adjusted incidences of these diseases during the same time period were used for the expected incidences in the same population. Among 18,931 women with a diagnosis of breast carcinoma since 1976, 11 developed differentiated thyroid carcinoma > or = 2 years after the diagnosis of breast carcinoma. These breast carcinoma patients contributed 129,336 person-years of follow-up; the observed incidence of thyroid carcinoma in this group was not different from that in a similar age group of women in the SEER database. Among 1013 women with a diagnosis of thyroid carcinoma since 1976, 24 developed breast carcinoma > or = 2 years after the diagnosis of thyroid carcinoma. These thyroid carcinoma patients contributed 8380 person-years of follow-up; the observed incidence of breast carcinoma in women ages 40-49 years was significantly higher than the expected incidence for women in the same age group in the SEER database. Breast carcinoma developing after thyroid carcinoma was diagnosed more frequently than expected in young adult women seen at the study institution since 1976. This potential association and plausible mechanisms of breast carcinoma development after thyroid carcinoma should be evaluated in larger cohorts of patients.

  17. Thyroid peroxidase (TPO) expressed in thyroid and breast tissues shows similar antigenic properties.

    PubMed

    Godlewska, Marlena; Arczewska, Katarzyna D; Rudzińska, Magdalena; Łyczkowska, Anna; Krasuska, Wanda; Hanusek, Karolina; Ruf, Jean; Kiedrowski, Mirosław; Czarnocka, Barbara

    2017-01-01

    Thyroid peroxidase (TPO) is essential for physiological function of the thyroid gland. The high prevalence of thyroid peroxidase antibodies (TPOAbs) in patients with breast cancer and their protective role had previously been demonstrated, indicating a link between breast cancer and thyroid autoimmunity. Recently, TPO was shown to be present in breast cancer tissue samples but its antigenicity has not been analyzed. In this study, we investigated TPO expression levels in a series of fifty-six breast cancer samples paired with normal (peri-tumoral) tissue and its antigenic activity using a panel of well-characterized murine anti-human TPOAbs. We have shown that TPO transcripts were present in both normal and cancer tissue samples, although the amounts in the latter were reduced. Additionally, we observed that TPO levels are lower in more advanced cancers. TPO protein expression was confirmed in all tissue samples, both normal and cancerous. We also found that the antigenicity of the immunodominant regions (IDRs) in breast TPO resembles that of thyroid TPO, which is crucial for effective interactions with human TPOAbs. Expression of TPO in breast cancer together with its antigenic activity may have beneficial effects in TPOAb-positive breast cancer patients. However, further studies are needed to confirm the beneficial role of TPOAbs and to better understand the underlying mechanism.

  18. The first report of a 5-year period cancer registry in Greece (2009-2013): a pathology-based cancer registry.

    PubMed

    Patsea, Eleni; Kaklamanis, Loukas; Batistatou, Anna

    2018-04-01

    Cancer registries are essential in health care, since they allow more accurate planning of necessary health services and evaluation of programs for cancer prevention and control. The Hellenic Society of Pathology (HSP) having recognized the lack of such information in Greece has undertaken the task of a 5-year pathology-based cancer registry in Greece (2009-2013). In this study, > 95% of all pathology laboratories in the national health system hospitals and 100% of pathology laboratories in private hospitals, as well as > 80% of private pathology laboratories have contributed their data. The most common cancer types overall were as follows: breast cancer (18.26%), colorectal cancer (15.49%), prostate cancer (13.49%), and lung cancer (10.24% of all registered cancers). In men, the most common neoplasms were as follows: prostate cancer, colorectal cancer, lung cancer, and gastric cancer. In women, the most common neoplasms were as follows: breast cancer, colorectal cancer, thyroid cancer, and lung cancer. The data on cancer burden in Greece, presented herein, fill the void of cancer information in Greece that affects health care not only nationally but Europe-wise.

  19. Differential action of glycoprotein hormones: significance in cancer progression.

    PubMed

    Govindaraj, Vijayakumar; Arya, Swathy V; Rao, A J

    2014-02-01

    Growth of multicellular organisms depends on maintenance of proper balance between proliferation and differentiation. Any disturbance in this balance in animal cells can lead to cancer. Experimental evidence is provided to conclude with special reference to the action of follicle-stimulating hormone (FSH) on Sertoli cells, and luteinizing hormone (LH) on Leydig cells that these hormones exert a differential action on their target cells, i.e., stimulate proliferation when the cells are in an undifferentiated state which is the situation with cancer cells and promote only functional parameters when the cell are fully differentiated. Hormones and growth factors play a key role in cell proliferation, differentiation, and apoptosis. There is a growing body of evidence that various tumors express some hormones at high levels as well as their cognate receptors indicating the possibility of a role in progression of cancer. Hormones such as LH, FSH, and thyroid-stimulating hormone have been reported to stimulate cell proliferation and act as tumor promoter in a variety of hormone-dependent cancers including gonads, lung, thyroid, uterus, breast, prostate, etc. This review summarizes evidence to conclude that these hormones are produced by some cancer tissues to promote their own growth. Also an attempt is made to explain the significance of the differential action of hormones in progression of cancer with special reference to prostate cancer.

  20. Thyroid peroxidase (TPO) expressed in thyroid and breast tissues shows similar antigenic properties

    PubMed Central

    Godlewska, Marlena; Arczewska, Katarzyna D.; Rudzińska, Magdalena; Łyczkowska, Anna; Krasuska, Wanda; Hanusek, Karolina; Ruf, Jean; Kiedrowski, Mirosław

    2017-01-01

    Background Thyroid peroxidase (TPO) is essential for physiological function of the thyroid gland. The high prevalence of thyroid peroxidase antibodies (TPOAbs) in patients with breast cancer and their protective role had previously been demonstrated, indicating a link between breast cancer and thyroid autoimmunity. Recently, TPO was shown to be present in breast cancer tissue samples but its antigenicity has not been analyzed. Methods In this study, we investigated TPO expression levels in a series of fifty-six breast cancer samples paired with normal (peri-tumoral) tissue and its antigenic activity using a panel of well-characterized murine anti-human TPOAbs. Results We have shown that TPO transcripts were present in both normal and cancer tissue samples, although the amounts in the latter were reduced. Additionally, we observed that TPO levels are lower in more advanced cancers. TPO protein expression was confirmed in all tissue samples, both normal and cancerous. We also found that the antigenicity of the immunodominant regions (IDRs) in breast TPO resembles that of thyroid TPO, which is crucial for effective interactions with human TPOAbs. Conclusions Expression of TPO in breast cancer together with its antigenic activity may have beneficial effects in TPOAb-positive breast cancer patients. However, further studies are needed to confirm the beneficial role of TPOAbs and to better understand the underlying mechanism. PMID:28575127

  1. Irradiation doses on thyroid gland during the postoperative irradiation for breast cancer.

    PubMed

    Akın, Mustafa; Ergen, Arzu; Unal, Aysegul; Bese, Nuran

    2014-01-01

    Thyroid gland is one of the radiosensitive endocrine organs in the body. It has been shown that direct irradiation of thyroid with total doses of 26 to 30 Gy can lead to functional abnormalities. In this study, irradiation doses on thyroid gland of the patients who received postoperative chest-wall/breast and regional nodal irradiation were assessed. Retrospective analyses of treatment plans from 122 breast cancer patients who were treated with 3D conformal radiotherapy (3D CRT) planning was performed. All patients received irradiation to supraclavicular/level III lymph nodes in addition to chest-wall/breast. A total dose of 46 Gy was delivered in 25 days to supraclavicular/level III lymph node region while a total dose of 50 Gy was delivered to whole breast/chest-wall. Thyroid gland was contoured on 2-5 mm thickness of computed tomography scans. Absolute thyroid volume, mean thyroid doses were calculated. The mean thyroid volume of all patients was 16.7 cc (min: 1.9 cc, max: 41.6 cc). The mean irradiation dose on was 22.5 Gy (0.32 Gy-46.5 Gy). The level of dose was higher than 26 Gy in 44% of the patients. In majority of the node-positive breast cancer patients treated with 3D CRT, the thyroid gland was exposed to considerable doses. On the other hand, for 44% of the patients are at risk for developing thyroid function abnormalities which should be considered during the routine follow-up.

  2. Biochemical properties of thyroid peroxidase (TPO) expressed in human breast and mammary-derived cell lines

    PubMed Central

    Godlewska, Marlena; Krasuska, Wanda

    2018-01-01

    Thyroid peroxidase (TPO) is an enzyme and autoantigen expressed in thyroid and breast tissues. Thyroid TPO undergoes a complex maturation process however, nothing is known about post-translational modifications of breast-expressed TPO. In this study, we have investigated the biochemical properties of TPO expressed in normal and cancerous human breast tissues, and the maturation process and antigenicity of TPO present in a panel of human breast tissue-derived cell lines. We found that the molecular weight of breast TPO was slightly lower than that of thyroid TPO due to decreased glycosylation and as suggest results of Western blot also shorter amino acid chain. Breast TPO exhibit enzymatic activity and isoelectric point comparable to that of thyroid TPO. The biochemical properties of TPO expressed in mammary cell lines and normal thyrocytes are similar regarding glycan content, molecular weight and isoelectric point. However, no peroxidase activity and dimer formation was detected in any of these cell lines since the majority of TPO protein was localized in the cytoplasmic compartment, and the TPO expression at the cell surface was too low to detect its enzymatic activity. Lactoperoxidase, a protein highly homologous to TPO expressed also in breast tissues, does not influence the obtained data. TPO expressed in the cell lines was recognized by a broad panel of TPO-specific antibodies. Although some differences in biochemical properties between thyroid and breast TPO were observed, they do not seem to be critical for the overall three-dimensional structure. This conclusion is supported by the fact that TPO expressed in breast tissues and cell lines reacts well with conformation-sensitive antibodies. Taking into account a close resemblance between both proteins, especially high antigenicity, future studies should investigate the potential immunotherapies directed against breast-expressed TPO and its specific epitopes. PMID:29513734

  3. Biochemical properties of thyroid peroxidase (TPO) expressed in human breast and mammary-derived cell lines.

    PubMed

    Godlewska, Marlena; Krasuska, Wanda; Czarnocka, Barbara

    2018-01-01

    Thyroid peroxidase (TPO) is an enzyme and autoantigen expressed in thyroid and breast tissues. Thyroid TPO undergoes a complex maturation process however, nothing is known about post-translational modifications of breast-expressed TPO. In this study, we have investigated the biochemical properties of TPO expressed in normal and cancerous human breast tissues, and the maturation process and antigenicity of TPO present in a panel of human breast tissue-derived cell lines. We found that the molecular weight of breast TPO was slightly lower than that of thyroid TPO due to decreased glycosylation and as suggest results of Western blot also shorter amino acid chain. Breast TPO exhibit enzymatic activity and isoelectric point comparable to that of thyroid TPO. The biochemical properties of TPO expressed in mammary cell lines and normal thyrocytes are similar regarding glycan content, molecular weight and isoelectric point. However, no peroxidase activity and dimer formation was detected in any of these cell lines since the majority of TPO protein was localized in the cytoplasmic compartment, and the TPO expression at the cell surface was too low to detect its enzymatic activity. Lactoperoxidase, a protein highly homologous to TPO expressed also in breast tissues, does not influence the obtained data. TPO expressed in the cell lines was recognized by a broad panel of TPO-specific antibodies. Although some differences in biochemical properties between thyroid and breast TPO were observed, they do not seem to be critical for the overall three-dimensional structure. This conclusion is supported by the fact that TPO expressed in breast tissues and cell lines reacts well with conformation-sensitive antibodies. Taking into account a close resemblance between both proteins, especially high antigenicity, future studies should investigate the potential immunotherapies directed against breast-expressed TPO and its specific epitopes.

  4. Extended Cancer Education for Longer-Term Survivors in Primary Care for Patients With Stage I-II Breast or Prostate Cancer or Stage I-III Colorectal Cancer

    ClinicalTrials.gov

    2017-11-15

    Stage I Breast Cancer; Stage I Colorectal Cancer AJCC v6 and v7; Stage I Prostate Cancer; Stage IA Breast Cancer; Stage IB Breast Cancer; Stage II Breast Cancer; Stage II Colorectal Cancer AJCC v7; Stage II Prostate Cancer; Stage IIA Breast Cancer; Stage IIA Colorectal Cancer AJCC v7; Stage IIA Prostate Cancer; Stage IIB Breast Cancer; Stage IIB Colorectal Cancer AJCC v7; Stage IIB Prostate Cancer; Stage IIC Colorectal Cancer AJCC v7; Stage III Colorectal Cancer AJCC v7; Stage IIIA Colorectal Cancer AJCC v7; Stage IIIB Colorectal Cancer AJCC v7; Stage IIIC Colorectal Cancer AJCC v7

  5. Recurrent Medullary Thyroid Carcinoma on 68Ga-Prostate-Specific Membrane Antigen PET/CT: Exploring New Theranostic Avenues.

    PubMed

    Arora, Saurabh; Damle, Nishikant Avinash; Parida, Girish Kumar; Singhal, Abhinav; Nalli, Harish; Dattagupta, Shreya; Bal, Chandrasekar

    2018-05-01

    The prostate-specific membrane antigen (PSMA) is highly expressed in prostate cancer cells. Few other malignancies have shown expression of PSMA. We present a case of 35-year-old man with medullary thyroid carcinoma, post total thyroidectomy and bilateral neck dissection, now presenting with rising calcitonin levels (doubling time 9 months) and local neck recurrence with negative I-MIBG scan. We decided to perform Ga-PSMA-HBED-CC PET/CT scan to assess PSMA expression and explore the therapeutic option in view of rising serum calcitonin. It revealed intense PSMA uptake in the soft tissue mass in left thyroid bed and cervical lymph nodes.

  6. Descriptive characteristics of prostate cancer in patients with a history of primary male breast cancer - a SEER analysis.

    PubMed

    Abhyankar, Nikita; Hoskins, Kent F; Abern, Michael R; Calip, Gregory S

    2017-09-25

    Current evidence on risk of prostate cancer following a diagnosis of male breast cancer is limited and guidance for screening in this potentially higher-risk population remainsunclear. Our objective was to quantify prostate cancer risk in men diagnosed with breast cancer. We identified men diagnosed with first primary breast cancer between 1988 and 2012 using the Surveillance, Epidemiology and End Results Program registry databases. Men were followed for occurrence of a second primary prostate cancer and secondary outcomes of cancer-specific and overall survival. Stratified analyses were performed by age, breast cancer stage, race, and breast cancer hormone receptor status. Excess risk per 10,000 person-years and standardized incidence ratios (SIR) with 95% confidence intervals (95% CI) were calculated. We used multivaraible Cox proportional hazard models to estimate hazard ratios (HR) and 95% CI for characteristics associated with secondary prostate cancer and survival. From a cohort of 5753 men with breast cancer with median follow up of 4.3 years, we identified 250 cases of second primary prostate cancer. Overall, the incidence of second primary prostate cancer was modestly greater than expected (SIR = 1.12, 95% CI 0.93-1.33), although not statistically significant. Stratified analyses demonstrated associations for men ages 65-74 at the time of breast cancer diagnosis (SIR = 1.34, 95%CI 1.01-1.73), hormone receptor-positive breast cancer (SIR = 1.23, 95%CI 1.11-1.39) or AJCC stage I breast cancer (SIR = 1.36, 95%CI 1.04-1.75) and second primary prostate cancer diagnosis. The incidence of prostate cancer in men with history of breast cancer is similar to the general population. Men with favorable characteristics of their breast cancer were more likely to develop prostate cancer, possibly due to a lower competing risk of breast cancer mortality.

  7. Bone sialoprotein and its transcriptional regulatory mechanism.

    PubMed

    Ogata, Y

    2008-04-01

    Bone sialoprotein is a mineralized tissue-specific noncollagenous protein that is glycosylated, phosphorylated and sulfated. The temporo-spatial deposition of bone sialoprotein into the extracellular matrix of bone, and the ability of bone sialoprotein to nucleate hydroxyapatite crystal formation, indicates a potential role for bone sialoprotein in the initial mineralization of bone, dentin and cementum. Bone sialoprotein is also expressed in breast, lung, thyroid and prostate cancers. We used osteoblast-like cells (rat osteosarcoma cell lines ROS17/2.8 and UMR106, rat stromal bone marrow RBMC-D8 cells and human osteosarcoma Saos2 cells), and breast and prostate cancer cells to investigate the transcriptional regulation of bone sialoprotein. To determine the molecular basis of the transcriptional regulation of the bone sialoprotein gene, we conducted northern hybridization, transient transfection analyses with chimeric constructs of the bone sialoprotein gene promoter linked to a luciferase reporter gene and gel mobility shift assays. Bone sialoprotein transcription is regulated by hormones, growth factors and cytokines through tyrosine kinase, mitogen-activated protein kinase and cAMP-dependent pathways. Microcalcifications are often associated with human mammary lesions, particularly with breast carcinomas. Expression of bone sialoprotein by cancer cells could play a major role in the mineral deposition and in preferred bone homing of breast cancer cells. Bone sialoprotein protects cells from complement-mediated cellular lysis, activates matrix metalloproteinase 2 and has an angiogenic capacity. Therefore, regulation of the bone sialoprotein gene is potentially important in the differentiation of osteoblasts, bone matrix mineralization and tumor metastasis. This review highlights the function and transcriptional regulation of bone sialoprotein.

  8. KT5823 Differentially Modulates Sodium Iodide Symporter Expression, Activity, and Glycosylation between Thyroid and Breast Cancer Cells

    PubMed Central

    Beyer, Sasha; Lakshmanan, Aparna; Liu, Yu-Yu; Zhang, Xiaoli; Wapnir, Irene; Smolenski, Albert

    2011-01-01

    Na+/I− symporter (NIS)-mediated iodide uptake into thyroid follicular cells serves as the basis of radioiodine therapy for thyroid cancer. NIS protein is also expressed in the majority of breast tumors, raising potential for radionuclide therapy of breast cancer. KT5823, a staurosporine-related protein kinase inhibitor, has been shown to increase thyroid-stimulating hormone-induced NIS expression, and thus iodide uptake, in thyroid cells. In this study, we found that KT5823 does not increase but decreases iodide uptake within 0.5 h of treatment in trans-retinoic acid and hydrocortisone-treated MCF-7 breast cancer cells. Moreover, KT5823 accumulates hypoglycosylated NIS, and this effect is much more evident in breast cancer cells than thyroid cells. The hypoglycosylated NIS is core glycosylated, has not been processed through the Golgi apparatus, but is capable of trafficking to the cell surface. KT5823 impedes complex NIS glycosylation at a regulatory point similar to brefeldin A along the N-linked glycosylation pathway, rather than targeting a specific N-glycosylated site of NIS. KT5823-mediated effects on NIS activity and glycosylation are also observed in other breast cancer cells as well as human embryonic kidney cells expressing exogenous NIS. Taken together, KT5823 will serve as a valuable pharmacological reagent to uncover mechanisms underlying differential NIS regulation between thyroid and breast cancer cells at multiple levels. PMID:21209020

  9. [Breast metastases from extramammary malignancies in men].

    PubMed

    Murakami, T; Hideura, S; Shimizu, R; Shimizu, T; Yano, K; Ishihara, T

    1985-12-01

    Metastases to the breast from extramammary carcinomas are rare. Carcinoma of the male breast is generally regarded as primary in origin and uncommon, accounting for less than 0.42% of all malignancies in men. Tow men who presented with breast malignancies in the course of their prostatic carcinoma are described. One was metastasis to the breast from prostatic cancer, the other from pancreatic cancer. The prostatic origin of these carcinomas, was confirmed by histological findings and immunocytochemical demonstration of prostatic acid phosphatase with the avidin-biotin-complex method.

  10. Breast and Prostate Cancer Cohort Consortium (BPC3)

    Cancer.gov

    Breast and Prostate Cancer Cohort Consortium collaborates with three genomic facilities, epidemiologists, population geneticists, and biostatisticians from multiple institutions to study hormone-related gene variants and environmental factors in breast and prostate cancers.

  11. Dosimetric study of a brachytherapy treatment of esophagus with Brazilian 192Ir sources using an anthropomorphic phantom

    NASA Astrophysics Data System (ADS)

    Neves, Lucio P.; Santos, William S.; Gorski, Ronan; Perini, Ana P.; Maia, Ana F.; Caldas, Linda V. E.; Orengo, Gilberto

    2014-11-01

    Several radioisotopes are produced at Instituto de Pesquisas Energéticas e Nucleares for the use in medical treatments, including the activation of 192Ir sources. These sources are suitable for brachytherapy treatments, due to their low or high activity, depending on the concentration of 192Ir, easiness to manufacture, small size, stable daughter products and the possibility of re-utilization. They may be used for the treatment of prostate, cervix, head and neck, skin, breast, gallbladder, uterus, vagina, lung, rectum, and eye cancer treatment. In this work, the use of some 192Ir sources was studied for the treatment of esophagus cancer, especially the dose determination of important structures, such as those on the mediastinum. This was carried out utilizing a FASH anthropomorphic phantom and the MCNP5 Monte Carlo code to transport the radiation through matter. It was possible to observe that the doses at lungs, breast, esophagus, thyroid and heart were the highest, which was expected due to their proximity to the source. Therefore, the data are useful to assess the representative dose specific to brachytherapy treatments on the esophagus for radiation protection purposes. The use of brachytherapy sources was studied for the treatment of esophagus cancer. FASH anthropomorphic phantom and MCNP5 Monte Carlo code were employed. The doses at lungs, breast, esophagus, thyroid and heart were the highest. The data is useful to assess the representative doses of treatments on the esophagus.

  12. Cohort study of risk factors for breast cancer in post menopausal women.

    PubMed

    Hartz, Arthur J; He, Tao

    2013-01-01

    The present study assessed more than 800 potential risk factors to identify new predictors of breast cancer and compare the independence and relative importance of established risk factors. Data were collected by the Women's Health Initiative and included 147,202 women ages 50 to 79 who were enrolled from 1993 to 1998 and followed for 8 years. Analyses performed in 2011 and 2012 used the Cox proportional hazard regression to test the association between more than 800 baseline risk factors and incident breast cancer. Baseline factors independently associated with subsequent breast cancer at the p<0.001 level (in decreasing order of statistical significance) were breast aspiration, family history, age, weight, history of breast biopsies, estrogen and progestin use, fewer live births, greater age at menopause, history of thyroid cancer, breast tenderness, digitalis use, alcohol intake, white race, not restless, no vaginal dryness, relative with prostate cancer, colon polyps, smoking, no breast augmentation, and no osteoporosis. Risk factors previously reported that were not independently associated with breast cancer in the present study included socioeconomic status, months of breast feeding, age at first birth, adiposity measures, adult weight gain, timing of initiation of hormone therapy, and several dietary, psychological, and exercise variables. Family history was not found to alter the risk associated with other factors. These results suggest that some risk factors not commonly studied may be important for breast cancer and some frequently cited risk factors may be relatively unimportant or secondary.

  13. Breast and Prostate Cancer and Hormone-Related Gene Variant Study

    Cancer.gov

    The Breast and Prostate Cancer and Hormone-Related Gene Variant Study allows large-scale analyses of breast and prostate cancer risk in relation to genetic polymorphisms and gene-environment interactions that affect hormone metabolism.

  14. Unusual Metastasis of Medullary Thyroid Carcinoma to the Breast: A Cytological and Histopathological Correlation

    PubMed Central

    Tanwar, Parul; Gandhi, Jatin S; Sharma, Anila; Gupta, Manoj; Choudhary, Partha S

    2018-01-01

    Breast metastases are a relatively rare condition and account for approximately 0.5–2% of all breast tumors. Recognition of metastatic tumors in the breast is important because it would prevent unnecessary mutilating surgery and would lead to appropriate treatment of the primary tumor. Breast metastases from medullary thyroid cancer (MTC) are very rare with only 21 reported cases in the literature. Some MTCs mimic primary invasive lobular carcinoma of the breast histopathologically and radiologically, making the distinction between the two diagnostically challenging. We present the case of a 45-year-old female presenting with a lump breast, which was later found out to be metastasis from medullary carcinoma thyroid. PMID:29643661

  15. Metastases of breast cancer to the thyroid gland in two patients - a case report.

    PubMed

    Skowrońska-Jóźwiak, Elżbieta; Krawczyk-Rusiecka, Kinga; Adamczewski, Zbigniew; Sporny, Stanisław; Zadrożny, Marek; Dedecjus, Marek; Brzeziński, Jan; Lewiński, Andrzej

    2010-01-01

    Metastatic cancer is rarely found in the thyroid (only 2-3% of malignant tumours found in that gland); primary sources usually including breast, kidney, and lung tumours. Two cases of advanced breast cancer with thyroid metastases in female patients are presented. The similarities between these two cases included: 1) postmenopausal age; 2) diagnosis based on result of FNAB (numerous groups of cells with epithelial phenotype strongly implying metastatic breast cancer); 3) thyroid function - overt hyperthyroidism in the first woman and subclinical hyperthyroidism in the second one; 4) the presence of nodular goitre in clinical examination, the occurrence of many nodular solid normoechogenic lesions with calcifications in both thyroid lobes in US; and 5) negative antithyroid antibodies. The main difference was the time of establishing diagnosis; in the first woman - before mammectomy, parallel to diagnostics of breast tumour, and in the second woman four years after mammectomy, during cancer dissemination (with right pleural effusion and lung metastasis). In the first case, mammectomy was followed two weeks later by thyroidectomy. The second patient was disqualified from thyroid surgery due to systemic metastatic disease. 1. Fine needle aspiration biopsy of the thyroid gland should obligatorily be performed in patients with breast cancer and nodular goitre, even without any clinical data of metastatic disease. 2. The clinical context of cytological findings is of critical value. 3. In patients with breast cancer accompanied by multinodular goitre, we recommend that more punctures be performed during FNAB than is routinely done. (

  16. Exercise in Targeting Metabolic Dysregulation in Stage I-III Breast or Prostate Cancer Survivors

    ClinicalTrials.gov

    2017-09-12

    Cancer Survivor; No Evidence of Disease; Obesity; Overweight; Prostate Carcinoma; Sedentary Lifestyle; Stage I Breast Cancer; Stage IA Breast Cancer; Stage IB Breast Cancer; Stage II Breast Cancer; Stage IIA Breast Cancer; Stage IIB Breast Cancer; Stage III Breast Cancer; Stage IIIA Breast Cancer; Stage IIIB Breast Cancer; Stage IIIC Breast Cancer

  17. Does Breast Feeding Protect the Hypothyroid Infant Diagnosed by Newborn Screening?

    ERIC Educational Resources Information Center

    Rovet, Joanne F.

    Because breast milk contains small quantities of thyroid hormones not found in commercial formula preparations, it was hypothesized that breast feeding may provide some protective benefit to the hypothyroid infant before medical treatment is begun. Of 108 children with congenital hypothyroidism, breast-fed children had higher thyroid hormone…

  18. Overexpression of peptide deformylase in breast, colon, and lung cancers.

    PubMed

    Randhawa, Harsharan; Chikara, Shireen; Gehring, Drew; Yildirim, Tuba; Menon, Jyotsana; Reindl, Katie M

    2013-07-01

    Human mitochondrial peptide deformylase (PDF) has been proposed as a novel cancer therapeutic target. However, very little is known about its expression and regulation in human tissues. The purpose of this study was to characterize the expression pattern of PDF in cancerous tissues and to identify mechanisms that regulate its expression. The mRNA expression levels of PDF and methionine aminopeptidase 1D (MAP1D), an enzyme involved in a related pathway with PDF, were determined using tissue panels containing cDNA from patients with various types of cancer (breast, colon, kidney, liver, lung, ovarian, prostate, or thyroid) and human cell lines. Protein levels of PDF were also determined in 2 colon cancer patients via western blotting. Colon cancer cells were treated with inhibitors of ERK, Akt, and mTOR signaling pathways and the resulting effects on PDF and MAP1D mRNA levels were determined by qPCR for colon and lung cancer cell lines. Finally, the effects of a PDF inhibitor, actinonin, on the proliferation of breast, colon, and prostate cell lines were determined using the CyQUANT assay. PDF and MAP1D mRNA levels were elevated in cancer cell lines compared to non-cancer lines. PDF mRNA levels were significantly increased in breast, colon, and lung cancer samples while MAP1D mRNA levels were increased in just colon cancers. The expression of PDF and MAP1D varied with stage in these cancers. Further, PDF protein expression was elevated in colon cancer tissue samples. Inhibition of the MEK/ERK, but not PI3K or mTOR, pathway reduced the expression of PDF and MAP1D in both colon and lung cancer cell lines. Further, inhibition of PDF with actinonin resulted in greater reduction of breast, colon, and prostate cancer cell proliferation than non-cancer cell lines. This is the first report showing that PDF is over-expressed in breast, colon, and lung cancers, and the first evidence that the MEK/ERK pathway plays a role in regulating the expression of PDF and MAP1D. The over-expression of PDF in several cancers and the inhibition of cancer cell growth by a PDF inhibitor suggest this enzyme may act as an oncogene to promote cancer cell proliferation.

  19. Overexpression of peptide deformylase in breast, colon, and lung cancers

    PubMed Central

    2013-01-01

    Background Human mitochondrial peptide deformylase (PDF) has been proposed as a novel cancer therapeutic target. However, very little is known about its expression and regulation in human tissues. The purpose of this study was to characterize the expression pattern of PDF in cancerous tissues and to identify mechanisms that regulate its expression. Methods The mRNA expression levels of PDF and methionine aminopeptidase 1D (MAP1D), an enzyme involved in a related pathway with PDF, were determined using tissue panels containing cDNA from patients with various types of cancer (breast, colon, kidney, liver, lung, ovarian, prostate, or thyroid) and human cell lines. Protein levels of PDF were also determined in 2 colon cancer patients via western blotting. Colon cancer cells were treated with inhibitors of ERK, Akt, and mTOR signaling pathways and the resulting effects on PDF and MAP1D mRNA levels were determined by qPCR for colon and lung cancer cell lines. Finally, the effects of a PDF inhibitor, actinonin, on the proliferation of breast, colon, and prostate cell lines were determined using the CyQUANT assay. Results PDF and MAP1D mRNA levels were elevated in cancer cell lines compared to non-cancer lines. PDF mRNA levels were significantly increased in breast, colon, and lung cancer samples while MAP1D mRNA levels were increased in just colon cancers. The expression of PDF and MAP1D varied with stage in these cancers. Further, PDF protein expression was elevated in colon cancer tissue samples. Inhibition of the MEK/ERK, but not PI3K or mTOR, pathway reduced the expression of PDF and MAP1D in both colon and lung cancer cell lines. Further, inhibition of PDF with actinonin resulted in greater reduction of breast, colon, and prostate cancer cell proliferation than non-cancer cell lines. Conclusions This is the first report showing that PDF is over-expressed in breast, colon, and lung cancers, and the first evidence that the MEK/ERK pathway plays a role in regulating the expression of PDF and MAP1D. The over-expression of PDF in several cancers and the inhibition of cancer cell growth by a PDF inhibitor suggest this enzyme may act as an oncogene to promote cancer cell proliferation. PMID:23815882

  20. Breast cancer metastases to the thyroid gland - an uncommon sentinel for diffuse metastatic disease: a case report and review of the literature.

    PubMed

    Plonczak, Agata M; DiMarco, Aimee N; Dina, Roberto; Gujral, Dorothy M; Palazzo, Fausto F

    2017-09-22

    Metastases to the thyroid are rare. The most common primary cancer to metastasize to the thyroid is renal cell carcinoma, followed by malignancies of the gastrointestinal tract, lungs, and skin, with breast cancer metastases to the thyroid being rare. Overall, the outcomes in malignancies that have metastasized to the thyroid are poor. There are no prospective studies addressing the role of surgery in metastatic disease of the thyroid. Isolated thyroidectomy has been proposed as a local disease control option to palliate and prevent the potential morbidity of tumor extension related to the airway. Here, we present a case of a patient with breast cancer metastases to the thyroid gland and discuss the role of thyroidectomy in the context of the current literature. A 62-year-old Afro-Caribbean woman was diagnosed as having bilateral breast carcinoma in 2004, for which she underwent bilateral mastectomy. The pathology revealed multifocal disease on the right, T2N0(0/20)M0 grade 1 and 2 invasive ductal carcinoma, and on the left side, T3N1(2/18)M0 grade 1 invasive ductal carcinoma. Surgery was followed by adjuvant chemotherapy and regional radiotherapy. The disease was under control on hormonal therapy until 2016, when she developed cervical lymphadenopathy. The fine-needle aspiration cytology of the thyroid was reported as papillary thyroid cancer; and the fine-needle biopsy of the left lateral nodal disease was more suggestive of breast malignancy. She underwent a total thyroidectomy and a clearance of the central compartment lymph nodes and a biopsy of the lateral nodal disease. The histopathological analysis was consistent with metastatic breast cancer in the thyroid and lymph nodes with no evidence of a primary thyroid malignancy. A past history of a malignancy elsewhere should raise the index of suspicion of metastatic disease in patients presenting with thyroid lumps with or without cervical lymphadenopathy. Detection of metastases to the thyroid generally indicates poor prognosis, obviating the need of surgery in an already compromised patient. An empirical thyroidectomy should be considered in select patients for local disease control.

  1. Choroidal metastasis from carcinoma of breast detected on F18-FDG PET CT scan: A case report and review of literature.

    PubMed

    Solav, Shrikant; Bhandari, Ritu; Sowani, Anuradha; Saxena, Sameer

    2010-10-01

    Intraocular choroidal metastasis is a very rare cause of blindness. Choroidal hemangioma and melanoma are other causes that may mimic the condition. Carcinoma of breast is the most common primary malignancy that accounts for choroidal metastasis in females and carcinoma of lung is the most common cause in males. Other primary neoplasms which can uncommonly metastasize to the choroid are testis, gastrointestinal tract, kidney, thyroid, pancreas, and prostate. Metastatic neoplasm to the eye outnumbers the primary tumors such as retinoblastomas and malignant melanoma. Sonography is usually the initial investigation after fundus examination to look for the architecture of the lesion. However, it lacks in specificity. We present a case of carcinoma of breast that had visual disturbances and wholebody F18-fluorodeoxyglucose, positron emission tomography-computerized tomography (FDG PET CT) revealed a choroidal lesion in addition to cerebral, pulmonary, and skeletal metastases. Choroidal metastasis from carcinoma of lung has been reported previously on FDG PET. To the best of our knowledge, this is the first case report of carcinoma of breast demonstrating choroid metastasis on F18-FDG PET CT scan.

  2. Increased Cancer Risks in Myotonic Dystrophy

    PubMed Central

    Win, Aung Ko; Perattur, Promilla G.; Pulido, Jose S.; Pulido, Christine M.; Lindor, Noralane M.

    2012-01-01

    Objective To estimate cancer risks for patients with myotonic dystrophy, given that increased risks for neoplasms in association with myotonic dystrophy type 1 and type 2 have been suggested in several studies but the risks of cancers have not been quantified. Patients and Methods A cohort of 307 patients with myotonic dystrophy identified from medical records of Mayo Clinic in Rochester, MN, from January 1, l993, through May 28, 2010, was retrospectively analyzed. We estimated standardized incidence ratios (SIRs) of specific cancers for patients with myotonic dystrophy compared with age- and sex-specific cancer incidences of the general population. Age-dependent cumulative risks were calculated using the Kaplan-Meier method. Results A total of 53 cancers were observed at a median age at diagnosis of 55 years. Patients with myotonic dystrophy had an increased risk of thyroid cancer (SIR, 5.54; 95% confidence interval [CI], 1.80-12.93; P=.001) and choroidal melanoma (SIR, 27.54; 95% CI, 3.34-99.49; P<.001). They may also have an increased risk of testicular cancer (SIR, 5.09; 95% CI, 0.62-18.38; P=.06) and prostate cancer (SIR, 2.21; 95% CI, 0.95-4.35; P=.05). The estimated cumulative risks at age 50 years were 1.72% (95% CI, 0.64%-4.55%) for thyroid cancer and 1.00% (95% CI, 0.25%-3.92%) for choroidal melanoma. There was no statistical evidence of an increased risk of brain, breast, colorectal, lung, renal, bladder, endometrial, or ovarian cancer; lymphoma; leukemia; or multiple myeloma. Conclusion Patients with myotonic dystrophy may have an increased risk of thyroid cancer and choroidal melanoma and, possibly, testicular and prostate cancers. PMID:22237010

  3. Soy foods and supplementation: a review of commonly perceived health benefits and risks.

    PubMed

    D'Adamo, Christopher R; Sahin, Azize

    2014-01-01

    In recent years, the impact of soy foods and supplements upon human health has become increasingly controversial among the general public. No one has conducted a broad evaluation of the scientific evidence supporting or refuting popular perceptions of the health effects of soy consumption. In this article, the authors have conducted a comprehensive assessment of the literature surrounding the health effects of soy consumption that are of greatest interest. This review has focused on 5 health benefits- relief of menopausal symptoms and prevention of heart disease, breast cancer, prostate cancer, and osteoporosis, and 5 health risks-increased risk of breast cancer, male hormonal and fertility problems, hypothyroidism, antinutrient content, and harmful processing by-products. Systematic reviews of human trials, prospective human trials, observational human studies, animal models, in vitro studies, and laboratory analyses of soy components were included for review. This literature review revealed that soy foods and isoflavones may provide relief from menopausal symptoms and protect against breast cancer and heart disease. Soy does not appear to offer protection against osteoporosis. The evidence on male fertility and reproductive hormones was conflicting; some studies demonstrated a deleterious impact caused by soy consumption and others showed no effect. Soy supplementation also appears to affect thyroid function in an inconsistent manner, as studies have shown both increases and decreases in the same parameters of thyroid activity. Soaking, fermentation, and heating may reduce problematic antinutrients contained in soy. The authors found that consuming moderate amounts of traditionally prepared and minimally processed soy foods may offer modest health benefits while minimizing potential for adverse health effects. However, additional studies are necessary to elucidate the variable thyroid response to soy supplementation, and more rigorous studies are required to assess dose-response relationships, the relationship between intestinal-flora composition and the response to soy, potential fertility issues among males, and the unknown long-term health effects of consuming highly processed modern soy foods.

  4. Acquired neonatal thyroid disease due to TSH receptor antibodies in breast milk.

    PubMed

    Törnhage, C J; Grankvist, K

    2006-06-01

    We investigated whether thyroid receptor antibodies (TRAb) could result in transient neonatal thyroid disease by transfer through milk from mothers treated for thyrotoxicosis. To analyse whether breast milk content of TRAb in euthyroid mothers with treated thyrotoxicosis resulted in neonatal thyroid disease and whether extended breastfeeding prolonged the neonatal disease. We tested three TRAb-positive mothers and the course, treatment and outcome for their offspring with neonatal thyrotoxicosis, and six healthy and two TRAb-negative euthyroid mothers with treated thyrotoxicosis during breastfeeding. TRAb was analysed in serum and breast milk by a radioreceptor assay. TRAb in serum was detectable in all treated mothers, in one mother during her four pregnancies, resulting in all neonates requiring treatment for thyrotoxicosis. Serum TRAb concentration in neonates decreased continuously with time after birth. Breast milk TRAb was detectable in all cases but not in the controls or in TRAb-negative mothers treated for thyrotoxicosis. The calculated half-life for offspring serum and breast milk TRAb was calculated as approx. 3 weeks and 2 months, respectively. Euthyroid TRAb-positive mothers may cause transient neonatal thyroid disease which seems to be worse and more prolonged during breastfeeding as a consequence of TRAb in breast milk.

  5. A Proposal to Unify the Classification of Breast and Prostate Cancers Based on the Anatomic Site of Cancer Origin and on Long-term Patient Outcome

    PubMed Central

    Tabár, László; Dean, Peter B.; Yen, Amy M.-F.; Tarján, Miklós; Chiu, Sherry Y.-H.; Chen, Sam L.-S.; Fann, Jean C.-Y.; Chen, Tony H.-H.

    2014-01-01

    The similarity between the structure and function of the breast and prostate has been known for a long time, but there are serious discrepancies in the terminology describing breast and prostate cancers. The use of the large, thick-section (3D) histology technique for both organs exposes the irrationality of the breast cancer terminology. Pathologists with expertise in diagnosing prostate cancer take the anatomic site of cancer origin into account when using the terms AAP (acinar adenocarcinoma of the prostate) and DAP (ductal adenocarcinoma of the prostate) to distinguish between the prostate cancers originating primarily from the fluid-producing acinar portion of the organ (AAP) and the tumors originating either purely from the larger ducts (DAP) or from both the acini and the main ducts combined (DAP and AAP). Long-term patient outcome is closely correlated with the terminology, because patients with DAP have a significantly poorer prognosis than patients with AAP. The current breast cancer terminology could be improved by modeling it after the method of classifying prostate cancer to reflect the anatomic site of breast cancer origin and the patient outcome. The long-term survival curves of our consecutive breast cancer cases collected since 1977 clearly show that the non-palpable, screen-detected breast cancers originating from the milk-producing acini have excellent prognosis, irrespective of their histologic malignancy grade or biomarkers. Correspondingly, the breast cancer subtypes of truly ductal origin have a significantly poorer outcome, despite recent improvements in diagnosis and therapy. The mammographic appearance of breast cancers reflects the underlying tissue structure. Addition of these “mammographic tumor features” to the currently used histologic phenotypes makes it possible to distinguish the breast cancer cases of ductal origin with a poor outcome, termed DAB (ductal adenocarcinoma of the breast), from the more easily managed breast cancers of acinar origin, termed AAB (acinar adenocarcinoma of the breast), which have a significantly better outcome. This simple and easily communicable terminology could lead to better communication between the diagnostic and therapeutic team members and result in more rational treatment planning for the benefit of their patients. PMID:24653647

  6. Cancer Incidence in First- and Second-Degree Relatives of BRCA1 and BRCA2 Mutation Carriers.

    PubMed

    Streff, Haley; Profato, Jessica; Ye, Yuanqing; Nebgen, Denise; Peterson, Susan K; Singletary, Claire; Arun, Banu K; Litton, Jennifer K

    2016-07-01

    Mutations in the BRCA1 and BRCA2 genes are associated with increased risk of breast, ovarian, and several other cancers. The purpose of the present study was to evaluate the incidence of cancer in first- and second-degree relatives of BRCA mutation carriers compared with the general population. A total of 1,086 pedigrees of BRCA mutation carriers was obtained from a prospectively maintained, internal review board-approved study of persons referred for clinical genetic counseling at the University of Texas MD Anderson Cancer Center. We identified 9,032 first- and second-degree relatives from 784 pedigrees that had demonstrated a clear indication of parental origin of mutation. Standardized incidence ratios (SIRs) were used to compare the observed incidence of 20 primary cancer sites to the expected incidence of each cancer based on the calculated risk estimates according to each subject's age, sex, and ethnicity. BRCA1 families had increased SIRs for breast and ovarian cancer (p < .001) and decreased SIRs for kidney, lung, prostate, and thyroid cancer and non-Hodgkin's lymphoma (p < .001). BRCA2 families had increased SIRs for breast, ovarian, and pancreatic cancer (p < .001) and decreased SIRs for kidney, lung, thyroid, and uterine cancer and non-Hodgkin's lymphoma (p < .0025). Analysis of only first-degree relatives (n = 4,099) identified no decreased SIRs and agreed with the increased SIRs observed in the overall study population. We have confirmed previous reports of an association between breast, ovarian, and pancreatic cancers with BRCA mutations. Additional research to quantify the relative risks of these cancers for BRCA mutation carriers can help tailor recommendations for risk reduction and enhance genetic counseling. BRCA gene mutations have been well described to carry an increased risk of both breast and ovarian cancer. However, the implications and risks of other cancers continues to be investigated. Evaluating the risks for other cancers further is key in identifying and managing risk reduction strategies. ©AlphaMed Press.

  7. New mutation in the PTEN gene in a Brazilian patient with Cowden's syndrome.

    PubMed

    Lima, Erika U de; Soares, Iberê C; Danilovic, Debora L S; Marui, Suemi

    2012-11-01

    Cowden syndrome is characterized by hamartomatous polyps, trichilemmomas, increased risk of developing neoplasms, and is associated with germline mutations in the PTEN gene. We searched for germline mutations in PTEN in a 49-year-old female patient who presented trichilemmoma with previous history of breast carcinoma, and thyroidectomy for a thyroid nodule. We also searched for somatic mutations in breast and thyroid tumoral tissues. DNA was extracted from peripheral leukocytes, paraffin samples of breast carcinoma, and cytological smears of thyroid nodule fine-needle aspiration biopsy, whose final histopathological diagnosis was adenomatous goiter. PTEN was amplified and sequenced. We identified a novel mutation, due to a T>A inversion at position 159 and A>T inversion at position 160, leading to valine-to-aspartic acid substitution at position 53. The p.Val53Asp was also found in homozygous state in samples obtained from adenocarcinoma breast and thyroid biopsy, denoting loss of heterozygosity. Here, we demonstrated a novel germline mutation in PTEN, as well as somatic loss of the wild-type PTEN allele in breast and thyroid tumors in a patient with Cowden syndrome.

  8. Prostate Cancer

    MedlinePlus

    ... breast cancer (BRCA1 or BRCA2) or a very strong family history of breast cancer, your risk of prostate cancer may be higher. Obesity. Obese men diagnosed with prostate cancer may be more likely ...

  9. Trends in use and cost of initial cancer treatment in Ontario: a population-based descriptive study.

    PubMed

    de Oliveira, Claire; Bremner, Karen E; Pataky, Reka; Gunraj, Nadia; Haq, Mahbubul; Chan, Kelvin; Cheung, Winson Y; Hoch, Jeffrey S; Peacock, Stuart; Krahn, Murray D

    2013-10-01

    Cancer incidence and treatment-related costs are rising in Canada. We estimated health care use and costs in the first year after diagnosis for patients with 7 common types of cancer in Ontario to examine temporal trends in patterns of care and costs. We selected patients aged 19-44 years who had received a diagnosis of melanoma, breast cancer (female only), testicular cancer or thyroid cancer, in addition to patients aged 45 years and older who had received a diagnosis of breast (female only), prostate, lung or colorectal cancer, between 1997 and 2007. Patients were identified from the Ontario Cancer Registry. Using linked administrative databases, we determined use and costs of chemotherapy, radiotherapy, cancer-related surgery, other admissions to hospital and home care. We adjusted all costs to 2009 Canadian dollars. We identified 20 821 patients aged 19-44 years and 178 797 patients aged 45 years and older. The greatest increases in costs during the study period were for melanoma, breast cancer, colorectal cancer, lung cancer and prostate cancer (p < 0.05). For prostate and lung cancers, mean costs increased 50% (from $11 490 and $22 037 to $15 170 and $34 473, respectively). Mean costs doubled for breast (from $15 460 and $12 909 to $35 977 and $29 362 for younger and older patients, respectively) and colorectal cancers (from $24 769 to $43 964), and nearly tripled for melanoma (from $3581 to $8934). Costs related to hospital admissions accounted for the largest portion of total costs. The use of chemotherapy, radiotherapy and home care generally increased for all cancers. The significant increase in mean costs of initial cancer treatment among the patients included in this study was primarily due to more patients receiving adjuvant therapy and home care, and to the increasing expenditures for these services and cancer-related surgeries. Understanding trends in health care use and costs can help policy-makers to take the necessary measures to achieve a more accountable, high-performing health care system.

  10. Associations of non-melanoma skin cancer and melanoma, extra-cutaneous cancers and smoking in adults: a US population-based study.

    PubMed

    Silverberg, J I; Ratner, D

    2015-07-01

    Non-melanoma skin cancer (NMSC) and melanoma are common malignancies in the US and may be associated with other types of cancer. We sought to determine whether NMSC and melanoma are associated with extra-cutaneous cancers and identify modifiable risk factors for such an association. We analysed data from 447,801 adult participants in the 1997-2011 National Health Interview Surveys. Survey logistic regression models were constructed that accounted for the complex sample weights. History of NMSC, melanoma and 27 primary extra-cutaneous cancers was assessed. NMSC was associated with increased odds of one (multinomial survey logistic regression, unadjusted odds ratio [95% CI]: 2.43 [2.20-2.68]) or multiple (2.94 [2.21-3.92]) extra-cutaneous malignancies. Melanoma was also associated with increased odds of one (3.25 [2.70-3.90]) or multiple (6.11 [4.34-8.61]) extra-cutaneous malignancies. Extra-cutaneous cancers were more common in younger patients (ages 18-39 and 40-49 years) and Caucasians with NMSC or melanoma (P < 0.0001). Smokers with a history of NMSC or melanoma had even higher odds of extra-cutaneous malignancy at ages 18-39 and 40-49 years compared to smokers without NMSC or melanoma (P < 0.0001). History of NMSC was associated with higher odds of malignancies of the bladder, brain, breast, colon, oesophagus, kidney, lung, lymphoma, melanoma, prostate, soft tissue, throat/pharynx, thyroid and uterus. Melanoma was associated with malignancies of the bladder, breast, colon, kidney, lung, pancreas, prostate, soft tissue, throat/pharynx, thyroid and uterus. The prevalence of extra-cutaneous cancers increased between 1997 and 2011 in all subjects (4.51% and 5.73%, P < 0.0001), with even higher rates of increase in those with history of NMSC or melanoma. Patients with history of NMSC and melanoma have increased odds of developing extra-cutaneous cancers, especially those with younger age and smoking history. © 2014 European Academy of Dermatology and Venereology.

  11. Thyroid and associated polyglandular neoplasms in patients who received head and neck irradiation during childhood

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Katz, A.D.

    One hundred fifty-one patients with a history of childhood irradiation to the head, neck, and thorax had neck explorations (142 for cold thyroid nodules and 9 for hypercalcemia). Fifty-nine of the patients had thyroid carcinoma, and associated glandular tumors were found in 20 others. In addition, 6 female patients developed breast carcinoma; 4 of these women also had thyroid carcinoma. In this series, 48.6% of the patients irradiated for acne and 36.4% with tonsil and adenoid irradiation developed thyroid carcinoma, but only 10.5% with thymic irradiation did so. It is suggested that the workup on these patients include not onlymore » complete thyroid and parathyroid testing, but also a careful examination of all salivary glands, both major and minor. Women should have thorough breast examinations and should perhaps be followed as if they were in the potentially high-risk breast group. When thyroid surgery is performed, a total thyroidectomy is recommended.« less

  12. Thyroid Autoimmunity: Role of Anti-thyroid Antibodies in Thyroid and Extra-Thyroidal Diseases

    PubMed Central

    Fröhlich, Eleonore; Wahl, Richard

    2017-01-01

    Autoimmune diseases have a high prevalence in the population, and autoimmune thyroid disease (AITD) is one of the most common representatives. Thyroid autoantibodies are not only frequently detected in patients with AITD but also in subjects without manifest thyroid dysfunction. The high prevalence raises questions regarding a potential role in extra-thyroidal diseases. This review summarizes the etiology and mechanism of AITD and addresses prevalence of antibodies against thyroid peroxidase, thyroid-stimulating hormone receptor (TSHR), and anti-thyroglobulin and their action outside the thyroid. The main issues limiting the reliability of the conclusions drawn here include problems with different specificities and sensitivities of the antibody detection assays employed, as well as potential confounding effects of altered thyroid hormone levels, and lack of prospective studies. In addition to the well-known effects of TSHR antibodies on fibroblasts in Graves’ disease (GD), studies speculate on a role of anti-thyroid antibodies in cancer. All antibodies may have a tumor-promoting role in breast cancer carcinogenesis despite anti-thyroid peroxidase antibodies having a positive prognostic effect in patients with overt disease. Cross-reactivity with lactoperoxidase leading to induction of chronic inflammation might promote breast cancer, while anti-thyroid antibodies in manifest breast cancer might be an indication for a more active immune system. A better general health condition in older women with anti-thyroid peroxidase antibodies might support this hypothesis. The different actions of the anti-thyroid antibodies correspond to differences in cellular location of the antigens, titers of the circulating antibodies, duration of antibody exposure, and immunological mechanisms in GD and Hashimoto’s thyroiditis. PMID:28536577

  13. Autoantibodies

    MedlinePlus

    ... 28 weeks to delivery) Primary Aldosteronism (Conn Syndrome) Prostate Cancer Protein in Urine (Proteinuria) Reactive Arthritis Rheumatoid Arthritis ... Thyroid Thyroid Autoantibodies (e.g., anti-TPO, TSH receptor antibodies) Liver Smooth Muscle Antibodies (SMA) Antimitochondrial Antibodies ( ...

  14. Familial transmission of prostate, breast and colorectal cancer in adoptees is related to cancer in biological but not in adoptive parents: a nationwide family study.

    PubMed

    Zöller, Bengt; Li, Xinjun; Sundquist, Jan; Sundquist, Kristina

    2014-09-01

    Familial clustering of prostate, breast and colorectal cancer is well established, but the familial risk of these cancers has not been determined among adoptees. The aim was to disentangle the contributions of genetic and environmental factors to the familial transmission of prostate, breast and colorectal cancer. The Swedish Multi-Generation Register was used to follow all adoptees born between 1932 and 1969 (n=70,965) for prostate, breast and colorectal cancer from January 1958 up to December 2010. The risk of prostate, breast and colorectal cancer was estimated in adoptees with at least one biological parent with the same cancer type compared with adoptees without a biological parent with the same cancer type. The risk of cancer was also determined in adoptees with at least one adoptive parent with cancer compared with adoptees with an adoptive parent without cancer. Adoptees with at least one biological parent with prostate, breast or colorectal cancer were more likely to have cancer of the same type than adoptees with biological parents not affected by these respective cancer types (standardised incidence ratio=SIR: 1.8 [95% confidence interval 1.2-2.7], 2.0 [1.6-2.5] and 1.9 [1.2-2.9], respectively). In contrast, adoptees with at least one adoptive parent with prostate, breast or colorectal cancer were not at an increased risk of these respective cancer types (SIR=1.2 [0.94-1.6], 0.97 [0.71-1.3], and 1.1 [0.71-1.5], respectively). The findings of the study support the importance of genetic/biological factors in the familial transmission of prostate, breast and colorectal cancer. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Does Breast or Ovarian Cancer Run in Your Family?

    MedlinePlus

    ... receptors, progesterone receptors and human epidermal growth factor receptor 2.) Cancer in both breasts Breast cancer in a male relative Ovarian, fallopian tube, or primary peritoneal cancer Pancreatic cancer or high grade prostate cancer Breast, ovarian, pancreatic, or high grade prostate ...

  16. Fatigue Interventions in Cancer (Exercise Intervention)

    ClinicalTrials.gov

    2018-01-29

    Sedentary Lifestyle; Stage III Breast Cancer AJCC v7; Stage III Prostate Cancer AJCC v7; Stage IIIA Breast Cancer AJCC v7; Stage IIIB Breast Cancer AJCC v7; Stage IIIC Breast Cancer AJCC v7; Stage IV Breast Cancer AJCC v6 and v7; Stage IV Prostate Cancer AJCC v7

  17. Apocrine sweat gland obstruction by antiperspirants allowing transdermal absorption of cutaneous generated hormones and pheromones as a link to the observed incidence rates of breast and prostate cancer in the 20th century.

    PubMed

    McGrath, Kris G

    2009-06-01

    Breast and prostate cancer share similarities and likely represent homologous cancers in females and males, respectively. The role of hormones such as testosterone and estrogen in carcinogenesis is well established. Despite worldwide research efforts, the pathogenesis of these diseases is largely not well understood. Personal care products containing estrogens or xenoestrogens have raised concern as a breast cancer risk, especially in young African-American women. In the United States (US) there is a parallel rise in the incidence in breast and prostate cancer compared to selected non-hormone dependent tumors. Observed US and global breast and prostate cancer incidence increases were occurring before exogenous hormone replacement and xenoestrogen exposure were commonplace. An unintentional, inadvertent, and long term hormone exposure may occur from transdermal absorption of sex hormones and pheromones (androgens) from axillary apocrine sweat gland obstruction by aluminum-based antiperspirants. The global rise in antiperspirant use parallels rises in breast and prostate cancer incidence and mortality rates. A multi-disciplinary literature based set of evidence is presented on how such a link is possible, to prompt confirmatory investigations in the pursuit of unmet needs in breast and prostate cancer etiology and prevention.

  18. Cancer incidence, trends, and survival among immigrants to Sweden: a population-based study.

    PubMed

    Mousavi, Seyed Mohsen; Hemminki, Kari

    2015-03-01

    This review aimed at covering cancer risk trends by site and histology in first-generation and second-generation immigrants in Sweden compared with natives. In addition, we reviewed data on cancer survival in immigrants to explore factors explaining cancer survival in the entire population. The Swedish Family-Cancer Database was used to calculate standardized incidence ratios and hazard ratios (HRs) of death from cancer in 77,360 and 993,824 cases among first-generation, and 4356 and 263,485 cases among second-generation immigrants and Swedes, respectively. Ordinal logistic regression analyses were used to calculate odds ratio. To obtain the maximum number of cases, we classified the immigrants according to geographical setting, population, and/or cancer risk. Compared with native Swedes, the highest risk of cancer was observed for nasopharyngeal carcinoma in Southeast Asian men (standardized incidence ratio=35.6) and women (24.6), for hypopharyngeal carcinoma in Indian men (5.4), for squamous-cell carcinoma of the esophagus in Iranian women (3.8), for cardia of the stomach in East Asian women (4.2), for signet-ring cell carcinoma of the stomach in Southeast Asian women (6.7), for the liver in East Asian men (6.8), for the gall bladder in Indian women (3.8), for the pancreas in North African men (2.2), for large cell carcinoma of the lung in former Yugoslavian men (4.2), for pleural mesothelioma in Turkish women (23.8), for the cervix in Danes (1.6), for seminoma in Chileans (2.1), for transitional-cell carcinoma of the bladder in Asian Arab men (2.3), for meningioma in former Yugoslavians (1.3), and for papillary carcinoma of the thyroid in East and Southeast Asian men (3.6). No immigrant groups had an increased risk of breast, uterus, ovary, and prostate cancers or nervous system tumors. The HRs for all breast cancers were between 1.0 in low-risk Europeans and 1.2 in lowest-risk non-Europeans. Low-risk non-Europeans had an HR of 2.9 for lobular carcinoma. Low-risk non-Europeans were diagnosed in a higher T-class (odds ratio=1.9) than Swedes. The HRs for prostate cancer were 0.6 in Turks, Middle Easterners, Asians, and Chileans. In conclusion, environmental and behavioral factors, early-childhood exposures, and infections may play a major role in the risk of esophageal, stomach, liver, nasopharyngeal and hypopharyngeal cancers, malignant pleural mesothelioma, breast, gynecological, testicular, urinary bladder, and thyroid cancers. Pancreatic cancer and nervous system tumors may have a major genetic component in the etiology. The ethnic differences in the risk of breast cancer by histology had no major influence on survival. Middle Easterners, Asians, and Chileans, with the lowest risk of prostate cancer, also had the most favorable survival, suggesting a biological mechanism for this finding.

  19. Antithyroid peroxidase antibody positivity is associated with lower incidence of metastasis in breast cancer.

    PubMed

    Kemal, Yasemin; Demirag, Guzin; Ekiz, Kubilay; Yucel, Idris

    2015-05-01

    Thyroid extracts were first used to treat patients with metastatic breast cancer over a century ago. Since then, a number of studies have investigated the association between thyroid disorders and breast cancer. The presence of antibodies to thyroid peroxidase (TPOab) was recently reported to be associated with improved outcome in these patients. The aim of the present study was to evaluate the association between TPOab positivity and clinicopathological characteristics in breast cancer patients. The study included 318 newly diagnosed cases of breast cancer treated at Ondokuz Mayis University Hospital, Samsun, Turkey, between 2008 and 2012. Serum thyroid-stimulating hormone, free triiodothyronine and free thyroxine levels were measured at the time of diagnosis. Of the 318 patients, 253 were considered to be TPOab-negative (TPOab ≤34 IU/ml) and 65 TPOab-positive (TPOab >34 IU/ml). No cases with distant metastases were found in the TPOab-positive group. However, 20 (7.9%) of the 253 patients displayed distant metastases in the TPOab-negative group (P=0.01). Therefore, TPOab positivity was found to be associated with a lower incidence of metastasis in breast cancer patients.

  20. Can selenium be a modifier of cancer risk in CHEK2 mutation carriers?

    PubMed

    Gupta, Satish; Jaworska-Bieniek, Katarzyna; Lubinski, Jan; Jakubowska, Anna

    2013-11-01

    Selenium is an essential trace element for humans, playing an important role in various major metabolic pathways. Selenium helps to protect the body from the poisonous effects of heavy metals and other harmful substances. Medical studies have provided evidence of selenium supplementation in preventing certain cancers. Low and too high selenium (Se) status correlates with increased risk of e.g. lung, larynx, colorectal and prostate cancers. A higher level of selenium and supplementation with selenium has been shown to be associated with substantially reduced cancer mortality. Selenium exerts its biological roles through selenoproteins, which are involved in oxidoreductions, redox signalling, antioxidant defence, thyroid hormone metabolism and immune responses. Checkpoint kinase 2 (CHEK2) is an important signal transducer of cellular responses to DNA damage and acts as a tumour suppressor gene. Mutations in the CHEK2 gene have been shown to be associated with increased risks of several cancers. Four common mutations in CHEK2 gene (1100delC, IVS2+1G>A, del5395 and I157T) have been identified in the Polish population. Studies have provided evidence that CHEK2-truncating and/or missense mutations are associated with increased risk of breast, prostate, thyroid, colon and kidney cancers. The variability in penetrance and cancer expression in CHEK2 mutation carriers can probably be explained by the influence of other genetic or environmental factors. One of the possible candidates is Se, which together with genetic variations in selenoprotein genes may influence susceptibility to cancer risk.

  1. Resveratrol as an anti-cancer agent: A review.

    PubMed

    Rauf, Abdur; Imran, Muhammad; Butt, Masood Sadiq; Nadeem, Muhammad; Peters, Dennis G; Mubarak, Mohammad S

    2018-06-13

    Owing to their antimicrobial, antioxidant, and anti-inflammatory activity, grapes (Vitis vinifera L.) are the archetypal paradigms of fruits used not only for nutritional purposes, but also for exclusive therapeutics. Grapes are a prominent and promising source of phytochemicals, especially resveratrol, a phytoalexin antioxidant found in red grapes which has both chemopreventive and therapeutic effects against various ailments. Resveratrol's role in reducing different human cancers, including breast, cervical, uterine, blood, kidney, liver, eye, bladder, thyroid, esophageal, prostate, brain, lung, skin, gastric, colon, head and neck, bone, ovarian, and cervical, has been reviewed. This review covers the literature that deals with the anti-cancer mechanism of resveratrol with special reference to antioxidant potential. Furthermore, this article summarizes the literature pertaining to resveratrol as an anti-cancer agent.

  2. A unifying biology of sex steroid-induced apoptosis in prostate and breast cancers

    PubMed Central

    Abderrahman, Balkees; Curpan, Ramona F; Hawsawi, Yousef M; Fan, Ping; Jordan, V Craig

    2018-01-01

    Prostate and breast cancer are the two cancers with the highest incidence in men and women, respectively. Here, we focus on the known biology of acquired resistance to antihormone therapy of prostate and breast cancer and compare laboratory and clinical similarities in the evolution of the disease. Laboratory studies and clinical observations in prostate and breast cancer demonstrate that cell selection pathways occur during acquired resistance to antihormonal therapy. Following sex steroid deprivation, both prostate and breast cancer models show an initial increased acquired sensitivity to the growth potential of sex steroids. Subsequently, prostate and breast cancer cells either become dependent upon the antihormone treatment or grow spontaneously in the absence of hormones. Paradoxically, the physiologic sex steroids now kill a proportion of selected, but vulnerable, resistant tumor cells. The sex steroid receptor complex triggers apoptosis. We draw parallels between acquired resistance in prostate and breast cancer to sex steroid deprivation. Clinical observations and patient trials confirm the veracity of the laboratory studies. We consider therapeutic strategies to increase response rates in clinical trials of metastatic disease that can subsequently be applied as a preemptive salvage adjuvant therapy. The goal of future advances is to enhance response rates and deploy a safe strategy earlier in the treatment plan to save lives. The introduction of a simple evidence-based enhanced adjuvant therapy as a global healthcare strategy has the potential to control recurrence, reduce hospitalization, reduce healthcare costs and maintain a healthier population that contributes to society. PMID:29162647

  3. Serum cholecystokinin and neurotensin during follow-up of pancreas, prostate and medullary thyroid tumors.

    PubMed

    Pichon, M F; Coquin, G; Fauveau, C; Rey, A

    1999-01-01

    Growth of pancreatic carcinoma cells is stimulated by cholecystokinin (CCK) and neurotensin (NT). Prostatic carcinoma cells can secrete neurotensin. The CCK gene has been described in thyroid medullary carcinomas (MCT). Serum CCK and NT were measured by RIAs during monitoring of 19 pancreas tumours, 10 prostate adenocarcinomas and 10 thyroid medullary cancers (MCT). No correlations were found between CCK and NT in the three tumour types, nor with CA 19.9, PSA, CEA or calcitonin. In pancreas adenocarcinomas (n = 12), initial median CCK was > 8pg/ml (non significant differences between stages T, N or M). Median NT was > 80 pg/ml in all but M0 and stage I-II cases, and significantly higher in M1 and stages IV (P = 0.002). Non significant differences were found for CCK and NT according to clinical stages. In prostate cancers, median CCK was significantly more elevated after relapse (P = 0.040). Median NT was significantly more elevated in disease-free patients (P = 0.04). In MCT, CCK and NT were not related to clinical stages. In pancreas and prostate cancers serum CCK may follow tumour load and disease progression. NT was lower in progressive disease. The contribution of these peptides in human tumour growth, since they may have therapeutic implication, warrants further investigation.

  4. Highly Increased 125I-JR11 Antagonist Binding In Vitro Reveals Novel Indications for sst2 Targeting in Human Cancers.

    PubMed

    Reubi, Jean Claude; Waser, Beatrice; Mäcke, Helmut; Rivier, Jean

    2017-02-01

    There is recent in vitro and in vivo evidence that somatostatin receptor subtype 2 (sst 2 ) antagonists are better tools to target neuroendocrine tumors (NETs) than sst 2 agonists. Indeed, antagonists bind to a greater number of sst 2 sites than agonists. Whether sst 2 antagonists could be used successfully to target non-NETs, expressing low sst 2 density, is unknown. Here, we compare quantitatively 125 I-JR11 sst 2 antagonist binding in vitro with that of the sst 2 agonist 125 I-Tyr 3 -octreotide in large varieties of non-NET and NET. In vitro receptor autoradiography was performed with 125 I-JR11 and 125 I-Tyr 3 -octreotide in cancers from prostate, breast, colon, kidney, thyroid, and lymphoid tissues as well as NETs as reference. In general, 125 I-JR11 binds to many more sst 2 sites than 125 I-Tyr 3 -octreotide. In 13 breast cancers, 8 had a low binding (mean density, 844 ± 168 dpm/mg of tissue) with the agonist whereas 12 had a high binding (mean density, 4,447 ± 1,128 dpm/mg of tissue) with the antagonist. All 12 renal cell cancers showed a low binding of sst 2 with the agonist (mean density, 348 ± 49 dpm/mg of tissue) whereas all cases had a high sst 2 binding with the antagonist (mean density, 3,777 ± 582 dpm/mg of tissue). One of 5 medullary thyroid cancers was positive with the agonist, whereas 5 of 5 were positive with the antagonist. In 15 non-Hodgkin lymphomas, many more sst 2 sites were labeled with the antagonist than with the agonist. In 14 prostate cancers, none had sst 2 binding with the agonist and only 4 had a weak binding with the antagonist. None of 17 colon cancers showed sst 2 sites with the agonist, and only 3 cases were weakly positive with the antagonist. In the various tumor types, adjacent sst 2 -expressing tissues such as vessels, lymphocytes, nerves, mucosa, or stroma were more strongly labeled with the antagonist than with the agonist. The reference NET cases, incubated with a smaller amount of tracer, were also found to have many more sst 2 sites measured with the antagonist. All renal cell cancers and most breast cancers, non-Hodgkin lymphomas, and medullary thyroid cancers represent novel indications for the in vivo radiopeptide targeting of sst 2 by sst 2 antagonists, comparable to NET radiotargeting with sst 2 agonists. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.

  5. Pyrrolidon carboxypeptidase activities in the hypothalamus-pituitary-thyroid and hypothalamus-pituitary-ovary axes of rats with mammary gland cancer induced by N-methyl nitrosourea.

    PubMed

    Carrera, M P; Ramírez-Expósito, M J; Valenzuela, M T; García, M J; Mayas, M D; Arias de Saavedra, J M; Sánchez, R; Pérez, M C; Martínez-Martos, J M

    2005-02-01

    Pyrrolidon carboxypeptidase is an omega-peptidase that hydrolyses N-terminal pyroglutamyl residues from biologically active peptides such as gonadotropin-releasing and thyrotrophin-releasing hormones. We previously described a decrease in both rat and human pyrrolidon carboxypeptidase activity with breast cancer, suggesting that gonadotropin-releasing hormone may be an important local intracrine, autocrine and/or paracrine hormonal factor in the pathogenesis of breast cancer while playing a role in the tumoral process. However, the other susceptible substrate of pyrrolidon carboxypeptidase, thyrotrophin-releasing hormone, may also be modified with breast cancer, supporting an association between breast cancer and thyroid disorders. The present work analyses soluble and membrane-bound pyrrolidon carboxypeptidase activities in the hypothalamus-pituitary-thyroid and hypothalamus-pituitary-ovary axes in N-methyl nitrosourea-induced breast cancer in rats. Our aim was to determine the possible relationship between gonadotropin-releasing hormone and thyrotrophin-releasing hormone regulation through pyrrolidon carboxypeptidase activity. We propose that pyrrolidon carboxypeptidase activity dysregulation at various local and systemic levels may participate in the initiation, promotion and progression of breast cancer induced in rat by N-methyl nitrosourea through the increase in gonadotropin-releasing hormone. Since pyrrolidon carboxypeptidase activity also acts on thyrotrophin-releasing hormone, the dysregulation of this enzyme's activity could indirectly affect hypothalamus-pituitary-thyroid axis function, and thus potentially represent a link between the diseases of thyroid and breast cancer.

  6. 68Ga-PSMA Expression in Pseudoangiomatous Stromal Hyperplasia of the Breast.

    PubMed

    Malik, Dharmender; Basher, Rajender K; Mittal, Bhagwant Rai; Jain, Tarun Kumar; Bal, Amanjit; Singh, Shrawan Kumar

    2017-01-01

    Ga-labeled prostate-specific membrane antigen ligand PET-CT has emerged as a promising technique to evaluate the extent of disease in patients with prostate carcinoma. We are reporting a 63-year-old man with prostatic carcinoma subjected to Ga-prostate-specific membrane antigen ligand PET-CT for initial staging. In addition to the radiotracer uptake in known primary site (prostate), focal increased radiotracer uptake was also noticed in the left breast. Subsequent biopsy of the breast lesion revealed PASH (pseudoangiomatous stromal hyperplasia), which is a benign mesenchymal proliferative lesion that may present clinically as palpable mass requiring further evaluation to rule out malignancy.

  7. Therapeutic efficacy and molecular mechanisms of snake (Walterinnesia aegyptia) venom-loaded silica nanoparticles in the treatment of breast cancer- and prostate cancer-bearing experimental mouse models.

    PubMed

    Badr, Gamal; Al-Sadoon, Mohamed K; Rabah, Danny M

    2013-12-01

    The treatment of drug-resistant cancer is a clinical challenge, and thus screening for novel anticancer drugs is critically important. We recently demonstrated a strong enhancement of the antitumor activity of snake (Walterinnesia aegyptia) venom (WEV) in vitro in breast carcinoma, prostate cancer, and multiple myeloma cell lines but not in normal cells when the venom was combined with silica nanoparticles (WEV+NP). In the present study, we investigated the in vivo therapeutic efficacy of WEV+NP in breast cancer- and prostate cancer-bearing experimental mouse models. Xenograft breast and prostate tumor mice models were randomized into 4 groups for each cancer model (10 mice per group) and were treated with vehicle (control), NP, WEV, or WEV+NP daily for 28 days post tumor inoculation. The tumor volumes were monitored throughout the experiment. On Day 28 post tumor inoculation, breast and prostate tumor cells were collected and either directly cultured for flow cytometry analysis or lysed for Western blot and ELISA analysis. Treatment with WEV+NP or WEV alone significantly reduced both breast and prostate tumor volumes compared to treatment with NP or vehicle alone. Compared to treatment with WEV alone, treatment of breast and prostate cancer cells with WEV+NP induced marked elevations in the levels of reactive oxygen species (ROS), hydroperoxides, and nitric oxide; robust reductions in the levels of the chemokines CXCL9, CXCL10, CXCL12, CXCL13, and CXCL16 and decreased surface expression of their cognate chemokine receptors CXCR3, CXCR4, CXCR5, and CXCR6; and subsequent reductions in the chemokine-dependent migration of both breast and prostate cancer cells. Furthermore, we found that WEV+NP strongly inhibited insulin-like growth factor 1 (IGF-1)- and epidermal growth factor (EGF)-mediated proliferation of breast and prostate cancer cells, respectively, and enhanced the induction of apoptosis by increasing the activity of caspase-3,-8, and -9 in both breast and prostate cancer cells. In addition, treatment of breast and prostate cancer cells with WEV+NP or WEV alone revealed that the combination of WEV with NP robustly decreased the phosphorylation of AKT, ERK, and IκBα; decreased the expression of cyclin D1, surviving, and the antiapoptotic Bcl-2 family members Bcl-2, Bcl-XL, and Mcl-1; markedly increased the expression of cyclin B1 and the proapoptotic Bcl-2 family members Bak, Bax, and Bim; altered the mitochondrial membrane potential; and subsequently sensitized tumor cells to growth arrest. Our data reveal the therapeutic potential of the nanoparticle-sustained delivery of snake venom against different cancer cell types. Crown Copyright © 2013. Published by Elsevier Inc. All rights reserved.

  8. Evaluation of thyroid gland as an organ at risk after breast cancer radiotherapy: a systematic review and meta-analysis.

    PubMed

    Darvish, L; Ghorbani, M; Teshnizi, S Hosseini; Roozbeh, N; Seif, F; Bayatiani, M Reza; Knaup, C; Amraee, A

    2018-05-14

    Radiotherapy can often lead to thyroid dysfunction. Some studies demonstrated that treatment of breast cancer by RT can expose thyroid gland to high doses of radiation. The aim of this systematic review is to evaluate consideration of thyroid gland as an organ at risk. In this systematic review and meta-analysis to select initial studies, a comprehensive search by two independent reviewers was performed. Electronical databases following: Web of Science, Google Scholar, Scopus, PubMed, Elsevier, Embase, ProQuest and Persian databases such as Iranmedex, Magiran, and SID were searched. All searches were restricted to English language between 1985 and 2017. A random effect meta-analysis is applied to estimate pooled effect size across initial studies. Funnel plot with Egger's test is used to assess potential publication bias. Totally, five studies (478 samples) were included in meta-analysis. The meta-analyses of result showed that thyroid gland is affected by radiotherapy significantly and the TSH increased after radiotherapy (z = 2.68, P = 0.007). The pooled estimate of difference mean for TSH was 0.90 (95% CI 0.24, 1.55). In studies among patients with breast cancer RT, hypothyroidism was reported more than other thyroid disorders. There was not showed possibility publication bias among studies (P > 0.05). This study demonstrated that thyroid gland is affected by radiotherapy significantly and the TSH increased after radiotherapy. Protecting thyroid gland during radiation and follow-up of patients with breast cancer RT are suggested for the assessment of thyroid gland dysfunction.

  9. Antithyroid peroxidase antibody positivity is associated with lower incidence of metastasis in breast cancer

    PubMed Central

    KEMAL, YASEMIN; DEMIRAG, GUZIN; EKIZ, KUBILAY; YUCEL, IDRIS

    2015-01-01

    Thyroid extracts were first used to treat patients with metastatic breast cancer over a century ago. Since then, a number of studies have investigated the association between thyroid disorders and breast cancer. The presence of antibodies to thyroid peroxidase (TPOab) was recently reported to be associated with improved outcome in these patients. The aim of the present study was to evaluate the association between TPOab positivity and clinicopathological characteristics in breast cancer patients. The study included 318 newly diagnosed cases of breast cancer treated at Ondokuz Mayis University Hospital, Samsun, Turkey, between 2008 and 2012. Serum thyroid-stimulating hormone, free triiodothyronine and free thyroxine levels were measured at the time of diagnosis. Of the 318 patients, 253 were considered to be TPOab-negative (TPOab ≤34 IU/ml) and 65 TPOab-positive (TPOab >34 IU/ml). No cases with distant metastases were found in the TPOab-positive group. However, 20 (7.9%) of the 253 patients displayed distant metastases in the TPOab-negative group (P=0.01). Therefore, TPOab positivity was found to be associated with a lower incidence of metastasis in breast cancer patients. PMID:26137279

  10. Clinical implications of prostate-specific antigen in men and women.

    PubMed

    Yu, H

    2000-01-01

    Prostate-specific antigen (PSA) is a valuable tumor marker for prostate cancer. Although it is indeed produced at an extremely high level by the prostate, PSA is also expressed in many female tissues, especially those regulated by sex steroid hormones. PSA is detected in both normal and abnormal breast tissue, as well as in various breast fluids, including milk, nipple aspirate, and cyst fluid. Clinical studies suggest that the presence of PSA in breast tissue may indicate a favorable prognosis for breast cancer patients. Levels of PSA in nipple aspirate fluid, however, may be indicative of breast cancer risk. Concentrations of PSA in serum are elevated in pregnant women as well as in women who have excess androgens. More studies are necessary to determine the clinical implications of the presence of PSA in amniotic fluid and female serum.

  11. Association of meat and coffee use with cancers of the large bowel, breast, and prostate among Seventh-Day Adventists: preliminary results.

    PubMed

    Phillips, R L; Snowdon, D A

    1983-05-01

    Deaths from cancers of the large bowel, breast, and prostate were ascertained over a 21-year period among 21,295 white California Adventists. Compared to non-Adventists, the age-sex-adjusted mortality for large bowel cancer was substantially reduced among Adventists. Adventists also showed a minimum reduction in mortality for breast and prostate cancer. Fatal large bowel cancer within the Adventist group was unrelated to meat use. However, coffee use showed a substantial positive association with fatal large bowel cancer. Although this association may be indirect or spurious, it deserves further investigation. Weak nonsignificant associations were observed between cancers of the breast and prostate and meat use.

  12. Germline PARP4 mutations in patients with primary thyroid and breast cancers.

    PubMed

    Ikeda, Yuji; Kiyotani, Kazuma; Yew, Poh Yin; Kato, Taigo; Tamura, Kenji; Yap, Kai Lee; Nielsen, Sarah M; Mester, Jessica L; Eng, Charis; Nakamura, Yusuke; Grogan, Raymon H

    2016-03-01

    Germline mutations in the PTEN gene, which cause Cowden syndrome, are known to be one of the genetic factors for primary thyroid and breast cancers; however, PTEN mutations are found in only a small subset of research participants with non-syndrome breast and thyroid cancers. In this study, we aimed to identify germline variants that may be related to genetic risk of primary thyroid and breast cancers. Genomic DNAs extracted from peripheral blood of 14 PTEN WT female research participants with primary thyroid and breast cancers were analyzed by whole-exome sequencing. Gene-based case-control association analysis using the information of 406 Europeans obtained from the 1000 Genomes Project database identified 34 genes possibly associated with the phenotype with P < 1.0 × 10(-3). Among them, rare variants in the PARP4 gene were detected at significant high frequency (odds ratio = 5.2; P = 1.0 × 10(-5)). The variants, G496V and T1170I, were found in six of the 14 study participants (43%) while their frequencies were only 0.5% in controls. Functional analysis using HCC1143 cell line showed that knockdown of PARP4 with siRNA significantly enhanced the cell proliferation, compared with the cells transfected with siControl (P = 0.02). Kaplan-Meier analysis using Gene Expression Omnibus (GEO), European Genome-phenome Archive (EGA) and The Cancer Genome Atlas (TCGA) datasets showed poor relapse-free survival (P < 0.001, Hazard ratio 1.27) and overall survival (P = 0.006, Hazard ratio 1.41) in a PARP4 low-expression group, suggesting that PARP4 may function as a tumor suppressor. In conclusion, we identified PARP4 as a possible susceptibility gene of primary thyroid and breast cancer. © 2016 Society for Endocrinology.

  13. Germline PARP4 mutations in patients with primary thyroid and breast cancers

    PubMed Central

    Ikeda, Yuji; Kiyotani, Kazuma; Yew, Poh Yin; Kato, Taigo; Tamura, Kenji; Yap, Kai-Lee; Nielsen, Sarah M.; Mester, Jessica L; Eng, Charis; Nakamura, Yusuke; Grogan, Raymon H.

    2016-01-01

    Germline mutations in the PTEN gene, which cause Cowden syndrome (CS), are known to be one of the genetic factors for primary thyroid and breast cancers, however, PTEN mutations are found in only a small subset of research participants with non-syndrome breast and thyroid cancers. In this study, we aimed to identify germline variants that may be related to genetic risk of primary thyroid and breast cancers. Genomic DNAs extracted from peripheral blood of 14 PTEN-wild-type female research participants with primary thyroid and breast cancers were analyzed by whole-exome sequencing. Gene-based case control association analysis using the information of 406 Europeans obtained from the 1000 Genomes Project database identified 34 genes possibly associated with the phenotype with P<1.0×10−3. Among them, rare variants in the PARP4 gene were detected at significant high frequency (odds ratio = 5.2, P = 1.0×10−5). The variants, G496V and T1170I, were found in 6 of the 14 study participants (43%) while their frequencies were only 0.5% in controls. Functional analysis using HCC1143 cell line showed that knockdown of PARP4 with siRNA significantly enhanced the cell proliferation, compared with the cells transfected with siControl (P = 0.02). Kaplan-Meier analysis using GEO, EGA and TCGA datasets showed poor progression-free survival (P = 0.006, Hazard ratio 0.71) and overall survival (P < 0.0001, Hazard ratio 0.79) in a PARP4 low-expression group, suggesting that PARP4 may function as a tumor suppression. In conclusion, we identified PARP4 as a possible susceptibility gene of primary thyroid and breast cancer. PMID:26699384

  14. Human Prostate Cancer Infiltrating Lymphocytes: Raft Microdomains, Signaling and Activation in Organ Cultures

    DTIC Science & Technology

    2006-06-01

    and cell growth and differentiation (14). Increased ARG activity has long been detected in pa- tients with colon, breast , lung, and prostate cancer ...activity has long been detected in patients with colon, breast , lung and prostate cancer [23] and it was advanced that this enzymatic activity...AD_________________ Award Number: DAMD 17-03-01-0032 TITLE: Human Prostate Cancer Infiltrating

  15. Differential Expression of Zinc Transporters in Prostate Epithelia of Racial Groups

    DTIC Science & Technology

    2010-09-01

    proteins in the prostate cancers taken from AAs versus those from European Americans (EAs)?” Because there is a well-documented depression in zinc...research ( breast cancer , diabetes and miRNA research connected to 14 prostate cancer ). Each of the undergraduate student presented their...Prostate and breast cancers and role of zinc transporters. Jessica Abercrombie: Miss Abercrombie is a junior undergraduate student, currently working

  16. Thyroid function in the etiology of fatigue in breast cancer.

    PubMed

    Kumar, Nagi B; Fink, Angelina; Levis, Silvina; Xu, Ping; Tamura, Roy; Krischer, Jeffrey

    2018-05-22

    Cancer related fatigue (CRF), reported in about 90% of breast cancer patients receiving chemotherapy, and has a profound impact on physical function, psychological distress and quality of life. Although several etiological factors such as anemia, depression, chronic inflammation, neurological pathology and alterations in metabolism have been proposed, the mechanisms of CRF are largely unknown. We conducted a pilot, prospective, case-control study to estimate the magnitude of change in thyroid function in breast cancer patients from baseline to 24 months, compared to cancer-free, age-matched controls. Secondary objectives were to correlate changes in thyroid function and obesity over time with fatigue symptoms scores in this patient population. The proportion of women with breast cancer who developed subclinical or overt hypothyroidism (TSH >4.0 mIU/L) from baseline to year 1 was significantly greater compared to controls (9.6% vs. 5%; p=0.02). Subjects with breast cancer reported significantly worse fatigue symptoms than age-matched controls, as indicated by higher disruption indices (p<0.001 at baseline, p=0.02 at year 1, p=0.09 at year 2). Additionally, a significant interaction effect on disruption index score (p=0.019), general level of activity over time (p=0.006) and normal work activity (p= 0.002) was observed in the subgroup of women with BMI>30. Screening breast cancer patients for thyroid function status at baseline and serially post-treatment to evaluate the need for thyroid hormone replacement may provide for a novel strategy for treating chemotherapy-induced fatigue.

  17. Targeting the androgen receptor in prostate and breast cancer – several new agents in development

    PubMed Central

    Proverbs-Singh, Tracy; Feldman, Jarett L.; Morris, Michael J.; Autio, Karen A.; Traina, Tiffany A.

    2016-01-01

    Prostate cancer and breast cancer share similarities as hormone-sensitive cancers with a wide heterogeneity of both phenotype and biology. The androgen receptor (AR) is a hormone receptor involved in both benign and malignant processes. Targeting androgen synthesis and the AR pathway has been and remains central to prostate cancer therapy. Recently, there is increased interest in the role of the AR in breast cancer development and growth, with data suggesting AR co-expression with estrogen, progesterone and human epidermal growth factor receptors, across all intrinsic subtypes of breast cancer. Targeting the AR axis is an evolving field with novel therapies in development which may ultimately be applicable for both tumor types. In this review, we offer an overview of available agents which target the AR axis in both prostate and breast cancer and provide insight into the novel drugs in development for targeting this signaling pathway. PMID:25722318

  18. Co-Operation Between FADD and Bin1 in Prostate Cancer Apoptosis

    DTIC Science & Technology

    2005-04-01

    an early step in prostate (and also breast ) cancer development, it may represent an early link between cell growth 9 DAMD17-03-1-0049 PI Andrew M...apoptosis is combined. TRAIL-induced autophagy occurs prostate cancer research programs grants DAMD17-02-1-0612 and DAMD17- during breast epithelial cell...Hahn, W. C., and Weinberg, R. A. (2001). Human breast are involved in mammalian cell immortalization, including cancer cells generated by oncogenic

  19. Incidence of cancer in Gulf Cooperation Council countries, 1998-2001.

    PubMed

    Al-Hamdan, N; Ravichandran, K; Al-Sayyad, J; Al-Lawati, J; Khazal, Z; Al-Khateeb, F; Abdulwahab, A; Al-Asfour, A

    2009-01-01

    We describe the patterns of cancer incidence for common cancers in Gulf Cooperation Council countries during 1998-2001. A total of 32,291 cases of cancer were diagnosed (16,342 in males; 15,949 in females). Male preponderance was observed only in Saudi Arabia and Oman. The age-standardized incidence of all malignancies per 100,000 in both sexes was highest in Qatar followed by Bahrain, Kuwait, Oman, UAE and Saudi Arabia. Paediatric cancer ranged from 9.5% of total cancers in Saudi Arabia and UAE to 4.0% in Bahrain. In all countries, the mean age at diagnosis was higher in males than females; cancer of the lung and prostate were commonest among males, and cancer of breast and thyroid among females. Lung cancer ranked second among Bahraini women.

  20. Implementation of the first wellness-fitness evaluation for the Dallas Fire-Rescue Department

    PubMed Central

    Seals, Norman; Martin, JoAnn; Russell, Bryan

    2010-01-01

    More than 100 firefighters lose their lives in the line of duty each year; many of these deaths are caused by cardiovascular events and underlying coronary heart disease. In addition, firefighters are at higher-than-normal risk of developing certain types of cancer. To improve health and fitness among its firefighters, the Dallas Fire-Rescue Department developed and implemented an annual wellness-fitness program in 2008. The program detected and addressed medical issues including coronary disease, hypertension, high triglyceride levels, high cholesterol, high blood glucose levels, and hematuria. Prostate, thyroid, breast, kidney, and bladder cancers were also detected. By identifying these issues, engaging the firefighters' personal physicians, and recommending individualized treatment plans, this program may have extended lives and improved the quality of life for the firefighters. PMID:20671818

  1. Implementation of the first wellness-fitness evaluation for the Dallas Fire-Rescue Department.

    PubMed

    Winter, F David; Seals, Norman; Martin, Joann; Russell, Bryan

    2010-07-01

    More than 100 firefighters lose their lives in the line of duty each year; many of these deaths are caused by cardiovascular events and underlying coronary heart disease. In addition, firefighters are at higher-than-normal risk of developing certain types of cancer. To improve health and fitness among its firefighters, the Dallas Fire-Rescue Department developed and implemented an annual wellness-fitness program in 2008. The program detected and addressed medical issues including coronary disease, hypertension, high triglyceride levels, high cholesterol, high blood glucose levels, and hematuria. Prostate, thyroid, breast, kidney, and bladder cancers were also detected. By identifying these issues, engaging the firefighters' personal physicians, and recommending individualized treatment plans, this program may have extended lives and improved the quality of life for the firefighters.

  2. Is thyroid gland an organ at risk in breast cancer patients treated with locoregional radiotherapy? Results of a pilot study.

    PubMed

    Tunio, Mutahir Ali; Al Asiri, Mushabbab; Bayoumi, Yasser; Stanciu, Laura G; Al Johani, Naji; Al Saeed, Eyad Fawzi

    2015-01-01

    Aim was to evaluate the dose distribution within the thyroid gland its association with hypothyroidism in breast cancer (BC) patients receiving supraclavicular (SC) radiation therapy (RT). Consecutive 40 BC patients with baseline normal thyroid function tests (TFTs), were randomized into two groups: (a) Adjuvant chest wall/breast with SC-RT (20 patients) and (b) control group (adjuvant chest wall/breast RT only); 20 patients. The thyroid gland was contoured for each patient. Each patient's dose volume histogram (DVH), mean thyroid volume, the volume percentages of the thyroid absorbing respectively 5, 10, 20, 30, 40, and 50 Gy (V5, V10, V20, V30, V40, and V50), and Dmean (average dose in whole volume of thyroid) were then estimated. TFTs were performed at the time of the last follow-up and compared. Mean thyroid volume of cohort was 19.6 cm(3) (4.02-93.52) and Dmean of thyroid gland in SC-RT and control group was 25.8 Gy (16.4-52.2) and 5.6 Gy (0.7-12.8), respectively. Median values of V5, V10, V20, V30, V40, and V50 were 54%, 51%, 42.8%, 30.8%, 27.8%, and 7.64%, respectively, in SC-RT as compared to control group (V5;4.9%, V10;2.4%, V20;1.75%, V301%, V40;0%, and V50;0%, respectively) with P < 0.0001. At 52 months, a majority of patients (90%) had a normal thyroid function whereas four patients (10%) had hypothyroidism; 3/20 (15%) patients in SC-RT and 1/20 (5%) in control group with P < 0.001. Significant prognostic factors were; SC-RT (P = 0.001), V30 above 50% (P = 0.001), and smaller thyroid volume (P = 0.03). The risk of hypothyroidism in BC patients after SC-RT depends on the thyroid gland volume and V30 >50% and the risk can be minimized by thyroid gland shielding during RT.

  3. Physical activity and natural anti-VIP antibodies: potential role in breast and prostate cancer therapy.

    PubMed

    Veljkovic, Milena; Dopsaj, Violeta; Dopsaj, Milivoj; Branch, Donald R; Veljkovic, Nevena; Sakarellos-Daitsiotis, Maria M; Veljkovic, Veljko; Glisic, Sanja; Colombatti, Alfonso

    2011-01-01

    There is convincing evidence from numerous clinical and epidemiological studies that physical activity can reduce the risk for breast and prostate cancer. The biological mechanisms underlying this phenomenon remain elusive. Herein we suggest a role for naturally produced antibodies reactive with the vasoactive intestinal peptide (VIP) in the suppression of breast and prostate cancer, which we believe could offer a possible molecular mechanism underlying control of these cancers by physical exercise. We found that sera from individuals having breast and prostate cancers have decreased titers of VIP natural antibodies as demonstrated by a lower reactivity against peptide NTM1, having similar informational and structural properties as VIP. In contrast, sera collected from elite athletes, exhibited titers of natural NTM1-reactive antibodies that are significantly increased, suggesting that physical activity boosts production of these antibodies. Presented results suggest that physical exercise stimulates production of natural anti-VIP antibodies and likely results in suppression of VIP. This, in turn, may play a protective role against breast and prostate cancers. Physical exercise should be further investigated as a potential tool in the treatment of these diseases.

  4. Thyroid Hormone Differentially Modulates Warburg Phenotype in Breast Cancer Cells

    PubMed Central

    Suhane, Sonal; Ramanujan, V Krishnan

    2011-01-01

    Sustenance of cancer cells in vivo critically depends on a variety of genetic and metabolic adaptations. Aerobic glycolysis or Warburg effect has been a defining biochemical hallmark of transformed cells for more than five decades although a clear molecular basis of this observation is emerging only in recent years. In this study, we present our findings that thyroid hormone exerts its non-genomic and genomic actions in two model human breast cancer cell lines differentially. By laying a clear foundation for experimentally monitoring the Warburg phenotype in living cancer cells, we demonstrate that thyroid hormone-induced modulation of bioenergetic profiles in these two model cell lines depends on the degree of Warburg phenotype that they display. Further we also show that thyroid hormone can sensitize mitochondria in aggressive, triple-negative breast cancer cells favorably to increase the chemotherapeutic efficacy in these cells. Even though the role of thyroid hormone in modulating mitochondrial metabolism has been known, the current study accentuates the critical role it plays in modulating Warburg phenotype in breast cancer cells. The clinical significance of this finding is the possibility to devise strategies for metabolically modulating aggressive triple-negative tumors so as to enhance their chemosensitivity in vivo. PMID:21945435

  5. Cancer incidence among Turkish, Chilean, and North African first-generation immigrants in Sweden compared with residents in the countries of origin and native Swedes.

    PubMed

    Mousavi, Seyed Mohsen; Sundquist, Jan; Hemminki, Kari

    2013-01-01

    We compared the incidence of cancer among Turkish, Chilean, and North African (NA) first-generation immigrants with residents in their countries of origin and native Swedes. The Swedish Family-Cancer Database was used to calculate age-standardized incidence rates. We compared the age-standardized incidence rates for immigrants with those in the Cancer Incidence in Five Continents report. All-cancer rates were decreased in Turks (men) and Chileans and increased in NAs compared with the residents in their countries of origin. The rates of stomach cancer in Chileans and lung cancer in Turkish men were decreased, whereas Turkish women had an increased rate of lung cancer. Furthermore, the rate of prostate cancer in Turks and NAs and nervous system tumors in NA men and Turkish women were increased. Chileans had higher rates of stomach and testicular cancers and lower rates of colon cancer, nervous system tumors, and non-Hodgkin's lymphoma compared with Swedes. Higher rates of male lung cancer and female thyroid cancer, and lower rates of male rectal and kidney cancers and nervous system tumors, and female stomach and colon cancers were observed among Turks compared with Swedes. The differences observed in all-cancer rates among immigrants were mostly attributable to decreased rates of stomach and lung cancers or an increased rate of prostate cancer after migration. We observed increased rates of colon, breast, and nervous system cancers after migration, whereas the rates of testicular, kidney and thyroid cancers, and non-Hodgkin's lymphoma remained unchanged.

  6. Spatial Autocorrelation of Cancer Incidence in Saudi Arabia

    PubMed Central

    Al-Ahmadi, Khalid; Al-Zahrani, Ali

    2013-01-01

    Little is known about the geographic distribution of common cancers in Saudi Arabia. We explored the spatial incidence patterns of common cancers in Saudi Arabia using spatial autocorrelation analyses, employing the global Moran’s I and Anselin’s local Moran’s I statistics to detect nonrandom incidence patterns. Global ordinary least squares (OLS) regression and local geographically-weighted regression (GWR) were applied to examine the spatial correlation of cancer incidences at the city level. Population-based records of cancers diagnosed between 1998 and 2004 were used. Male lung cancer and female breast cancer exhibited positive statistically significant global Moran’s I index values, indicating a tendency toward clustering. The Anselin’s local Moran’s I analyses revealed small significant clusters of lung cancer, prostate cancer and Hodgkin’s disease among males in the Eastern region and significant clusters of thyroid cancers in females in the Eastern and Riyadh regions. Additionally, both regression methods found significant associations among various cancers. For example, OLS and GWR revealed significant spatial associations among NHL, leukemia and Hodgkin’s disease (r² = 0.49–0.67 using OLS and r² = 0.52–0.68 using GWR) and between breast and prostate cancer (r² = 0.53 OLS and 0.57 GWR) in Saudi Arabian cities. These findings may help to generate etiologic hypotheses of cancer causation and identify spatial anomalies in cancer incidence in Saudi Arabia. Our findings should stimulate further research on the possible causes underlying these clusters and associations. PMID:24351742

  7. Prediction of Breast and Prostate Cancer Risks in Male BRCA1 and BRCA2 Mutation Carriers Using Polygenic Risk Scores

    PubMed Central

    Lecarpentier, Julie; Silvestri, Valentina; Kuchenbaecker, Karoline B.; Barrowdale, Daniel; Dennis, Joe; McGuffog, Lesley; Soucy, Penny; Leslie, Goska; Rizzolo, Piera; Navazio, Anna Sara; Valentini, Virginia; Zelli, Veronica; Lee, Andrew; Amin Al Olama, Ali; Tyrer, Jonathan P.; Southey, Melissa; John, Esther M.; Conner, Thomas A.; Goldgar, David E.; Buys, Saundra S.; Janavicius, Ramunas; Steele, Linda; Ding, Yuan Chun; Neuhausen, Susan L.; Hansen, Thomas V.O.; Osorio, Ana; Weitzel, Jeffrey N.; Toss, Angela; Medici, Veronica; Cortesi, Laura; Zanna, Ines; Palli, Domenico; Radice, Paolo; Manoukian, Siranoush; Peissel, Bernard; Azzollini, Jacopo; Viel, Alessandra; Cini, Giulia; Damante, Giuseppe; Tommasi, Stefania; Peterlongo, Paolo; Fostira, Florentia; Hamann, Ute; Evans, D. Gareth; Henderson, Alex; Brewer, Carole; Eccles, Diana; Cook, Jackie; Ong, Kai-ren; Walker, Lisa; Side, Lucy E.; Porteous, Mary E.; Davidson, Rosemarie; Hodgson, Shirley; Frost, Debra; Adlard, Julian; Izatt, Louise; Eeles, Ros; Ellis, Steve; Tischkowitz, Marc; Godwin, Andrew K.; Meindl, Alfons; Gehrig, Andrea; Dworniczak, Bernd; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Hahnen, Eric; Hauke, Jan; Rhiem, Kerstin; Kast, Karin; Arnold, Norbert; Ditsch, Nina; Wang-Gohrke, Shan; Wappenschmidt, Barbara; Wand, Dorothea; Lasset, Christine; Stoppa-Lyonnet, Dominique; Belotti, Muriel; Damiola, Francesca; Barjhoux, Laure; Mazoyer, Sylvie; Van Heetvelde, Mattias; Poppe, Bruce; De Leeneer, Kim; Claes, Kathleen B.M.; de la Hoya, Miguel; Garcia-Barberan, Vanesa; Caldes, Trinidad; Perez Segura, Pedro; Kiiski, Johanna I.; Aittomäki, Kristiina; Khan, Sofia; Nevanlinna, Heli; van Asperen, Christi J.; Vaszko, Tibor; Kasler, Miklos; Olah, Edith; Balmaña, Judith; Gutiérrez-Enríquez, Sara; Diez, Orland; Teulé, Alex; Izquierdo, Angel; Darder, Esther; Brunet, Joan; Del Valle, Jesús; Feliubadalo, Lidia; Pujana, Miquel Angel; Lazaro, Conxi; Arason, Adalgeir; Agnarsson, Bjarni A.; Johannsson, Oskar Th.; Barkardottir, Rosa B.; Alducci, Elisa; Tognazzo, Silvia; Montagna, Marco; Teixeira, Manuel R.; Pinto, Pedro; Spurdle, Amanda B.; Holland, Helene; Lee, Jong Won; Lee, Min Hyuk; Lee, Jihyoun; Kim, Sung-Won; Kang, Eunyoung; Kim, Zisun; Sharma, Priyanka; Rebbeck, Timothy R.; Vijai, Joseph; Robson, Mark; Lincoln, Anne; Musinsky, Jacob; Gaddam, Pragna; Tan, Yen Y.; Berger, Andreas; Singer, Christian F.; Loud, Jennifer T.; Greene, Mark H.; Mulligan, Anna Marie; Glendon, Gord; Andrulis, Irene L.; Toland, Amanda Ewart; Senter, Leigha; Bojesen, Anders; Nielsen, Henriette Roed; Skytte, Anne-Bine; Sunde, Lone; Jensen, Uffe Birk; Pedersen, Inge Sokilde; Krogh, Lotte; Kruse, Torben A.; Caligo, Maria A.; Yoon, Sook-Yee; Teo, Soo-Hwang; von Wachenfeldt, Anna; Huo, Dezheng; Nielsen, Sarah M.; Olopade, Olufunmilayo I.; Nathanson, Katherine L.; Domchek, Susan M.; Lorenchick, Christa; Jankowitz, Rachel C.; Campbell, Ian; James, Paul; Mitchell, Gillian; Orr, Nick; Park, Sue Kyung; Thomassen, Mads; Offit, Kenneth; Couch, Fergus J.; Simard, Jacques; Easton, Douglas F.; Chenevix-Trench, Georgia; Schmutzler, Rita K.; Antoniou, Antonis C.; Ottini, Laura

    2017-01-01

    Purpose BRCA1/2 mutations increase the risk of breast and prostate cancer in men. Common genetic variants modify cancer risks for female carriers of BRCA1/2 mutations. We investigated—for the first time to our knowledge—associations of common genetic variants with breast and prostate cancer risks for male carriers of BRCA1/2 mutations and implications for cancer risk prediction. Materials and Methods We genotyped 1,802 male carriers of BRCA1/2 mutations from the Consortium of Investigators of Modifiers of BRCA1/2 by using the custom Illumina OncoArray. We investigated the combined effects of established breast and prostate cancer susceptibility variants on cancer risks for male carriers of BRCA1/2 mutations by constructing weighted polygenic risk scores (PRSs) using published effect estimates as weights. Results In male carriers of BRCA1/2 mutations, PRS that was based on 88 female breast cancer susceptibility variants was associated with breast cancer risk (odds ratio per standard deviation of PRS, 1.36; 95% CI, 1.19 to 1.56; P = 8.6 × 10−6). Similarly, PRS that was based on 103 prostate cancer susceptibility variants was associated with prostate cancer risk (odds ratio per SD of PRS, 1.56; 95% CI, 1.35 to 1.81; P = 3.2 × 10−9). Large differences in absolute cancer risks were observed at the extremes of the PRS distribution. For example, prostate cancer risk by age 80 years at the 5th and 95th percentiles of the PRS varies from 7% to 26% for carriers of BRCA1 mutations and from 19% to 61% for carriers of BRCA2 mutations, respectively. Conclusion PRSs may provide informative cancer risk stratification for male carriers of BRCA1/2 mutations that might enable these men and their physicians to make informed decisions on the type and timing of breast and prostate cancer risk management. PMID:28448241

  8. Prediction of Breast and Prostate Cancer Risks in Male BRCA1 and BRCA2 Mutation Carriers Using Polygenic Risk Scores.

    PubMed

    Lecarpentier, Julie; Silvestri, Valentina; Kuchenbaecker, Karoline B; Barrowdale, Daniel; Dennis, Joe; McGuffog, Lesley; Soucy, Penny; Leslie, Goska; Rizzolo, Piera; Navazio, Anna Sara; Valentini, Virginia; Zelli, Veronica; Lee, Andrew; Amin Al Olama, Ali; Tyrer, Jonathan P; Southey, Melissa; John, Esther M; Conner, Thomas A; Goldgar, David E; Buys, Saundra S; Janavicius, Ramunas; Steele, Linda; Ding, Yuan Chun; Neuhausen, Susan L; Hansen, Thomas V O; Osorio, Ana; Weitzel, Jeffrey N; Toss, Angela; Medici, Veronica; Cortesi, Laura; Zanna, Ines; Palli, Domenico; Radice, Paolo; Manoukian, Siranoush; Peissel, Bernard; Azzollini, Jacopo; Viel, Alessandra; Cini, Giulia; Damante, Giuseppe; Tommasi, Stefania; Peterlongo, Paolo; Fostira, Florentia; Hamann, Ute; Evans, D Gareth; Henderson, Alex; Brewer, Carole; Eccles, Diana; Cook, Jackie; Ong, Kai-Ren; Walker, Lisa; Side, Lucy E; Porteous, Mary E; Davidson, Rosemarie; Hodgson, Shirley; Frost, Debra; Adlard, Julian; Izatt, Louise; Eeles, Ros; Ellis, Steve; Tischkowitz, Marc; Godwin, Andrew K; Meindl, Alfons; Gehrig, Andrea; Dworniczak, Bernd; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Hahnen, Eric; Hauke, Jan; Rhiem, Kerstin; Kast, Karin; Arnold, Norbert; Ditsch, Nina; Wang-Gohrke, Shan; Wappenschmidt, Barbara; Wand, Dorothea; Lasset, Christine; Stoppa-Lyonnet, Dominique; Belotti, Muriel; Damiola, Francesca; Barjhoux, Laure; Mazoyer, Sylvie; Van Heetvelde, Mattias; Poppe, Bruce; De Leeneer, Kim; Claes, Kathleen B M; de la Hoya, Miguel; Garcia-Barberan, Vanesa; Caldes, Trinidad; Perez Segura, Pedro; Kiiski, Johanna I; Aittomäki, Kristiina; Khan, Sofia; Nevanlinna, Heli; van Asperen, Christi J; Vaszko, Tibor; Kasler, Miklos; Olah, Edith; Balmaña, Judith; Gutiérrez-Enríquez, Sara; Diez, Orland; Teulé, Alex; Izquierdo, Angel; Darder, Esther; Brunet, Joan; Del Valle, Jesús; Feliubadalo, Lidia; Pujana, Miquel Angel; Lazaro, Conxi; Arason, Adalgeir; Agnarsson, Bjarni A; Johannsson, Oskar Th; Barkardottir, Rosa B; Alducci, Elisa; Tognazzo, Silvia; Montagna, Marco; Teixeira, Manuel R; Pinto, Pedro; Spurdle, Amanda B; Holland, Helene; Lee, Jong Won; Lee, Min Hyuk; Lee, Jihyoun; Kim, Sung-Won; Kang, Eunyoung; Kim, Zisun; Sharma, Priyanka; Rebbeck, Timothy R; Vijai, Joseph; Robson, Mark; Lincoln, Anne; Musinsky, Jacob; Gaddam, Pragna; Tan, Yen Y; Berger, Andreas; Singer, Christian F; Loud, Jennifer T; Greene, Mark H; Mulligan, Anna Marie; Glendon, Gord; Andrulis, Irene L; Toland, Amanda Ewart; Senter, Leigha; Bojesen, Anders; Nielsen, Henriette Roed; Skytte, Anne-Bine; Sunde, Lone; Jensen, Uffe Birk; Pedersen, Inge Sokilde; Krogh, Lotte; Kruse, Torben A; Caligo, Maria A; Yoon, Sook-Yee; Teo, Soo-Hwang; von Wachenfeldt, Anna; Huo, Dezheng; Nielsen, Sarah M; Olopade, Olufunmilayo I; Nathanson, Katherine L; Domchek, Susan M; Lorenchick, Christa; Jankowitz, Rachel C; Campbell, Ian; James, Paul; Mitchell, Gillian; Orr, Nick; Park, Sue Kyung; Thomassen, Mads; Offit, Kenneth; Couch, Fergus J; Simard, Jacques; Easton, Douglas F; Chenevix-Trench, Georgia; Schmutzler, Rita K; Antoniou, Antonis C; Ottini, Laura

    2017-07-10

    Purpose BRCA1/2 mutations increase the risk of breast and prostate cancer in men. Common genetic variants modify cancer risks for female carriers of BRCA1/2 mutations. We investigated-for the first time to our knowledge-associations of common genetic variants with breast and prostate cancer risks for male carriers of BRCA1/ 2 mutations and implications for cancer risk prediction. Materials and Methods We genotyped 1,802 male carriers of BRCA1/2 mutations from the Consortium of Investigators of Modifiers of BRCA1/2 by using the custom Illumina OncoArray. We investigated the combined effects of established breast and prostate cancer susceptibility variants on cancer risks for male carriers of BRCA1/2 mutations by constructing weighted polygenic risk scores (PRSs) using published effect estimates as weights. Results In male carriers of BRCA1/2 mutations, PRS that was based on 88 female breast cancer susceptibility variants was associated with breast cancer risk (odds ratio per standard deviation of PRS, 1.36; 95% CI, 1.19 to 1.56; P = 8.6 × 10 -6 ). Similarly, PRS that was based on 103 prostate cancer susceptibility variants was associated with prostate cancer risk (odds ratio per SD of PRS, 1.56; 95% CI, 1.35 to 1.81; P = 3.2 × 10 -9 ). Large differences in absolute cancer risks were observed at the extremes of the PRS distribution. For example, prostate cancer risk by age 80 years at the 5th and 95th percentiles of the PRS varies from 7% to 26% for carriers of BRCA1 mutations and from 19% to 61% for carriers of BRCA2 mutations, respectively. Conclusion PRSs may provide informative cancer risk stratification for male carriers of BRCA1/2 mutations that might enable these men and their physicians to make informed decisions on the type and timing of breast and prostate cancer risk management.

  9. Detection of Metastatic Breast and Thyroid Cancer in Lymph Nodes by Desorption Electrospray Ionization Mass Spectrometry Imaging

    NASA Astrophysics Data System (ADS)

    Zhang, Jialing; Feider, Clara L.; Nagi, Chandandeep; Yu, Wendong; Carter, Stacey A.; Suliburk, James; Cao, Hop S. Tran; Eberlin, Livia S.

    2017-06-01

    Ambient ionization mass spectrometry has been widely applied to image lipids and metabolites in primary cancer tissues with the purpose of detecting and understanding metabolic changes associated with cancer development and progression. Here, we report the use of desorption electrospray ionization mass spectrometry (DESI-MS) to image metastatic breast and thyroid cancer in human lymph node tissues. Our results show clear alterations in lipid and metabolite distributions detected in the mass spectra profiles from 42 samples of metastatic thyroid tumors, metastatic breast tumors, and normal lymph node tissues. 2D DESI-MS ion images of selected molecular species allowed discrimination and visualization of specific histologic features within tissue sections, including regions of metastatic cancer, adjacent normal lymph node, and fibrosis or adipose tissues, which strongly correlated with pathologic findings. In thyroid cancer metastasis, increased relative abundances of ceramides and glycerophosphoinisitols were observed. In breast cancer metastasis, increased relative abundances of various fatty acids and specific glycerophospholipids were seen. Trends in the alterations in fatty acyl chain composition of lipid species were also observed through detailed mass spectra evaluation and chemical identification of molecular species. The results obtained demonstrate DESI-MSI as a potential clinical tool for the detection of breast and thyroid cancer metastasis in lymph nodes, although further validation is needed. [Figure not available: see fulltext.

  10. Co-Operation Between FADD and Bin1 in Prostate Cancer Apoptosis

    DTIC Science & Technology

    2006-04-01

    manuscript. Research in our laboratory is supported bygrants from the National Institutes of Health, the US Army Breast Cancer and Prostate Cancer Research...Programs and the Susan G. Komen Breast Cancer Foundation.References [1] Wang X. Genes Dev 2001;15(22):2922–33. [2] Huang DS, Strasser A. Cell 2000;103...This work was supported by U.S. Army breast and prostate cancer research programs grants DAMD17-02-1-0612 and DAMD17- 03-1-0049. REFERENCES Ali, S

  11. Predictors of falls in older survivors of breast and prostate cancer: A retrospective cohort study of surveillance, epidemiology and end results-Medicare health outcomes survey linkage.

    PubMed

    Huang, Min H; Blackwood, Jennifer; Godoshian, Monica; Pfalzer, Lucinda

    2018-05-08

    To identify predictors of falls in older breast and prostate cancer survivors. This retrospective cohort study analyzed population-based Surveillance, Epidemiology and End Results-Medicare Health Outcomes Survey (SEER-MHOS) linkage. Inclusion criteria were age >65 years at cancer diagnosis, first primary female breast or prostate cancer, cancer staging information available, completion of baseline MHOS during years 2-3 and follow-up MHOS during years 4-5 post-diagnosis, and falls information available. Data from 437 breast and 660 prostate cancer survivors were analyzed. Multivariable logistic regression was constructed to evaluate variables from baseline MHOS with relation to falls from follow-up MHOS. Model accuracy was assessed using area under receiver-operating-characteristic curve (AUC). At follow-up MHOS, 26% of breast and 22% of prostate cancer survivors reported falls in the past 12 months. In breast cancer, a history of falls (odds ratio (OR) = 4.95, 95% confidence interval (CI) = 2.44-10.04) and sensory impairment in feet (OR = 3.33, 95%CI = 1.51-7.32) were significant predictors of falls. In prostate cancer, a history of falls (OR = 3.04, 95%CI = 1.79-5.15), unmarried (OR = 1.82, 95%CI = 1.12-2.95), lower physical summary score of quality-of-life(OR = 0.96, 95%CI = 0.94-0.98), urinary incontinence (OR = 1.69, 95%CI = 1.08-2.65), older age at diagnosis (OR = 1.05, 95%CI = 1.01-1.09), and shorter time post-diagnosis (OR = 0.96, 95%CI = 0.93-0.99) were significant predictors of falls. AUC was 0.67 and 0.77 for breast and prostate cancer, respectively, indicating moderate accuracy of models in detecting fallers. Asking older breast and prostate cancer survivors about falls in the past 12 months is imperative in fall prevention. Further examination of deficits specific to each cancer is necessary to assess fall risks. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Eph receptor A10 has a potential as a target for a prostate cancer therapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nagano, Kazuya; Yamashita, Takuya; Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871

    2014-07-18

    Highlights: • EphA10 mRNA is overexpressed in breast, prostate and colon cancer cell lines. • EphA10 is overexpressed in clinical prostate tumors at mRNA and protein levels. • Anti-EphA10 antibodies were cytotoxic on EphA10-positive prostate cancer cells. - Abstract: We recently identified Eph receptor A10 (EphA10) as a novel breast cancer-specific protein. Moreover, we also showed that an in-house developed anti-EphA10 monoclonal antibody (mAb) significantly inhibited proliferation of breast cancer cells, suggesting EphA10 as a promising target for breast cancer therapy. However, the only other known report for EphA10 was its expression in the testis at the mRNA level. Therefore,more » the potency of EphA10 as a drug target against cancers other than the breast is not known. The expression of EphA10 in a wide variety of cancer cells was studied and the potential of EphA10 as a drug target was evaluated. Screening of EphA10 mRNA expression showed that EphA10 was overexpressed in breast cancer cell lines as well as in prostate and colon cancer cell lines. Thus, we focused on prostate cancers in which EphA10 expression was equivalent to that in breast cancers. As a result, EphA10 expression was clearly shown in clinical prostate tumor tissues as well as in cell lines at the mRNA and protein levels. In order to evaluate the potential of EphA10 as a drug target, we analyzed complement-dependent cytotoxicity effects of anti-EphA10 mAb and found that significant cytotoxicity was mediated by the expression of EphA10. Therefore, the idea was conceived that the overexpression of EphA10 in prostate cancers might have a potential as a target for prostate cancer therapy, and formed the basis for the studies reported here.« less

  13. Original BPC3 Research Plan

    Cancer.gov

    The Breast and Prostate Cancer and Hormone-Related Gene Variant Study allows large-scale analyses of breast and prostate cancer risk in relation to genetic polymorphisms and gene-environment interactions that affect hormone metabolism.

  14. Nanoparticle Albumin-Bound Rapamycin in Treating Patients With Advanced Cancer With mTOR Mutations

    ClinicalTrials.gov

    2018-06-01

    Advanced Malignant Neoplasm; Cervical Squamous Cell Carcinoma; Endometrial Carcinoma; Malignant Uterine Neoplasm; Recurrent Bladder Carcinoma; Recurrent Breast Carcinoma; Recurrent Cervical Carcinoma; Recurrent Head and Neck Carcinoma; Recurrent Malignant Neoplasm; Recurrent Ovarian Carcinoma; Recurrent Prostate Carcinoma; Recurrent Renal Cell Carcinoma; Solid Neoplasm; Stage III Bladder Cancer; Stage III Prostate Cancer; Stage III Renal Cell Cancer; Stage IIIA Breast Cancer; Stage IIIA Cervical Cancer; Stage IIIA Ovarian Cancer; Stage IIIB Breast Cancer; Stage IIIB Cervical Cancer; Stage IIIB Ovarian Cancer; Stage IIIC Breast Cancer; Stage IIIC Ovarian Cancer; Stage IV Breast Cancer; Stage IV Ovarian Cancer; Stage IV Prostate Cancer; Stage IV Renal Cell Cancer; Stage IVA Bladder Cancer; Stage IVA Cervical Cancer; Stage IVB Bladder Cancer; Stage IVB Cervical Cancer

  15. Association of dipeptidyl peptidase 4 inhibitors with risk of metastases in patients with type 2 diabetes and breast, prostate or digestive system cancer.

    PubMed

    Rathmann, Wolfgang; Kostev, Karel

    2017-04-01

    Experimental and animal studies have supported the hypothesis that dipeptidyl peptidase-4 inhibitors (DPP-4i) may accelerate tumor metastasis. The aim was to analyze the relationships between DPP-4i therapy with risk of metastases in type 2 diabetes patients with breast, prostate and digestive organ cancers. Type 2 diabetes patients with first diagnoses of breast, prostate or digestive organ cancer were selected in general and internal medicine practices (Disease Analyzer Germany: 01/2008-12/2014). Propensity score matching between DPP-4i users and non-users was carried out for age, sex, diabetes duration, and metformin use. Time-dependent Cox regression models were used to estimate hazard ratios (HR) for metastases further adjusting for HbA1c, body mass index, comorbidity and co-therapy with glucose-lowering drugs (3-4years follow-up). 668 patients with newly diagnosed breast cancer, 906 with prostate cancer and 908 with digestive organ cancer were analyzed. In Cox regression, use of DPP-4i was not associated with an increased risk of metastases in patients with breast (adjusted HR, 95%CI: 1.00, 0.49-2.02), prostate (0.98, 0.54-1.77) or digestive organ cancers (0.97, 0.57-1.66). This first observational study in patients with type 2 diabetes and breast, prostate or digestive organ cancer found no increased risk of metastases in DPP-4i users. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Assessment of the contents related to screening on Portuguese language websites providing information on breast and prostate cancer.

    PubMed

    Ferreira, Daniel; Carreira, Helena; Silva, Susana; Lunet, Nuno

    2013-11-01

    The objective of this study was to assess the quality of the contents related to screening in a sample of websites providing information on breast and prostate cancer in the Portuguese language. The first 200 results of each cancer-specific Google search were considered. The accuracy of the screening contents was defined in accordance with the state of the art, and its readability was assessed. Most websites mentioned mammography as a method for breast cancer screening (80%), although only 28% referred to it as the only recommended method. Almost all websites mentioned PSA evaluation as a possible screening test, but correct information regarding its effectiveness was given in less than 10%. For both breast and prostate cancer screening contents, the potential for overdiagnosis and false positive results was seldom addressed, and the median readability index was approximately 70. There is ample margin for improving the quality of websites providing information on breast and prostate cancer in Portuguese.

  17. Determinants of Patient Activation in a Community Sample of Breast and Prostate Cancer Survivors

    PubMed Central

    O’Malley, Denalee; Dewan, Asa A.; Ohman-Strickland, Pamela; Gundersen, Daniel A.; Miller, Suzanne M.; Hudson, Shawna V.

    2017-01-01

    Background Patient activation—the knowledge, skills and confidence to manage one’s health—is associated with improved self-management behaviors for several chronic conditions. This study assesses rates of patient activation in breast and prostate cancer survivors and explores the characteristics associated with patient activation. Methods A cross-sectional study of survivors with localized (Stage I or II) breast and prostate cancers who are post-treatment (between 1–10+ years) were recruited from four community-hospital sites in New Jersey. Survey data on patient characteristics (demographic and psychosocial) and clinical factors were assessed to the explore relationships with patient activation using the Patient Activation Measure (PAM-13). Results Among 325 survivors (112 prostate; 213 breast) overall patient activation was high (M=3.25). Activation was significantly lower among prostate survivors when compared to breast cancer survivors (M=3.25 [SD 0.38] vs. M=3.34 [SD 0.37], p <0.05). For prostate survivors, race (p< 0.05), marital status (p<0.001), employment status (p<0.01), household income (p<0.05), and fear of recurrence (p<0.01) were significantly associated with patient activation. For both groups ease of access to oncology team and primary care physicians (PCPs) (all p-values < 0.001) and perceptions of time spent with oncologists team and PCPs (all P-values <.01) were positive predictors of activation. Conclusions In both breast and prostate survivors’ access to providers (both PCPs and oncologists) and perception that adequate time spent with providers were associated with activation. Therefore, clinical interventions maybe a promising avenue to improve patient activation. Research is needed to develop and test tailored patient activation interventions to improve self-management among cancer survivors. PMID:28133892

  18. Thyroid cancer in a patient with Lynch syndrome - case report and literature review.

    PubMed

    Fazekas-Lavu, Monika; Parker, Andrew; Spigelman, Allan D; Scott, Rodney J; Epstein, Richard J; Jensen, Michael; Samaras, Katherine

    2017-01-01

    Lynch syndrome describes a familial cancer syndrome comprising germline mutations in one of four DNA mismatch repair genes, MLH1 , MSH2 , MSH6 , and PMS2 and is characterized by colorectal, endometrial, and other epithelial malignancies. Thyroid cancer is not usually considered to be part of the constellation of Lynch syndrome cancers nor have Lynch syndrome tumor gene mutations been reported in thyroid malignancies. This study reports a woman with Lynch syndrome (colonic cancer and a DNA mismatch repair mutation in the MSH2 gene) with a synchronous papillary thyroid cancer. Six years later, she developed metachronous breast cancer. Metastatic bone disease developed after 3 years, and the disease burden was due to both breast and thyroid diseases. Despite multiple interventions for both metastatic breast and thyroid diseases, the patient's metastatic burden progressed and she died of leptomeningeal metastatic disease. Two prior case reports suggested thyroid cancer may be an extraintestinal malignancy of the Lynch syndrome cancer group. Hence, this study examined the genetic relationship between the patient's known Lynch syndrome and her thyroid cancer. The thyroid cancer tissue showed normal expression of MSH2 , suggesting that the tumor was not due to the oncogenic mutation of Lynch syndrome, and molecular analysis confirmed BRAF V600E mutation. Although in this case the thyroid cancer was sporadic, it raises the importance of considering cancer genetics in familial cancer syndromes when other cancers do not fit the criteria of the syndrome. Careful documentation of other malignancies in patients with thyroid cancer and their families would assist in better understanding of any potential association. Appropriate genetic testing will clarify whether a common pathogenic mechanism links seemingly unrelated cancers.

  19. A novel robotic surgical technique for thyroid surgery: bilateral axillary approach (BAA).

    PubMed

    Woo, Jung-Woo; Kim, Seo Ki; Park, Inhye; Choe, Jun Ho; Kim, Jung-Han; Kim, Jee Soo

    2017-02-01

    Bilateral axillo-breast approach (BABA) robotic thyroidectomy (RT) is proven to be a feasible method for the treatment of well-differentiated thyroid cancers in terms of oncology as well as cosmesis. However, BABA RT causes postoperative sternal discomfort and needs an incision over the nipple areolar area. Here, we suggest a novel robotic surgical technique for thyroid surgery that does not need a breast incision-bilateral axillary approach (BAA). We recruited 51 patients who were willing to undergo the novel BAA robotic thyroid surgery. We performed a propensity score-matched analysis to compare the BAA robotic thyroid surgery group (BAA group) with the conventional open thyroid surgery group (open group). Mean operation time in the BAA group (129.7 min) was significantly longer than that in the open group (103.1 min) (p < 0.001). However, no significant differences in the mean number of metastatic lymph nodes (LNs), mean number of retrieved LNs, vocal cord palsy, hypoparathyroidism, and mean stimulated thyroglobulin level were observed between the two groups. There was no case of postoperative bleeding or chyle leak. Of the 51 patients who had undergone the BAA procedure, 27 patients answered the questionnaire. The mean scale, ranging from 0 to 10, at postoperative 1 day/2 weeks was as follows: voice change score, 3.0/1.6; swallowing difficulty score, 4.0/2.0; anterior neck pain score, 4.6/3.6; anterior neck numbness score, 5.4/4.3; right chest pain score, 3.8/2.1; left chest pain score, 3.6/2.3; right chest numbness score, 3.2/2.8; left chest numbness score, 2.4/2.7; right breast pain score, 0.9/0; left breast pain score, 1.2/0; right breast numbness score, 1.7/0; and left breast numbness score, 2.6/0, respectively. BAA robotic thyroid surgery is a novel, safe, and feasible oncoplastic method, especially for patients who have fear of procedures around the nipple areolar complex.

  20. TGF-Beta Induction of PMEPA1: Role in Bone Metastasis Due to Prostate Cancer

    DTIC Science & Technology

    2009-01-01

    expresses renilla luciferase, in PC-3 (prostate cancer cells), and HepG2 ( hepatocarcinoma ) and A459 (lung cancer cells) known for their sensitivity to...bound PMEPA1 in prostate, breast, lung cancer cells and hepatocarcinoma cells. Prostate (PC-3, DU-145), breast (MDA-MB-231) and lung (A549) cancer...cells and hepatocarcinoma cells (HepG2) were grown until reaching cell layer reached near confluency. Cells were serum-starved for 4 hours and further

  1. An ecologic study of cancer mortality rates in Spain with respect to indices of solar UVB irradiance and smoking.

    PubMed

    Grant, William B

    2007-03-01

    There is increasing evidence that vitamin D reduces the risk of many types of cancer. Geographic variations in cancer mortality rates in Spain are apparently linked to variations in solar ultraviolet (UV) irradiances and other factors. Cancer mortality rates for 48 continental Spanish provinces for 1978-1992 were used in linear regression analyses with respect to mortality rates for latitude (an index of solar UVB levels), skin cancer (an index of high cumulative UVB irradiance), melanoma (an index related to solar UV irradiance and several other factors) and lung cancer (an index of cumulative effects of smoking). The 9 cancers with mortality rates significantly correlated with latitude for 1 or both sexes were brain, gastric, melanoma, nonmelanoma skin cancer (NMSC), non-Hodgkin's lymphoma (NHL), pancreatic, pleural, rectal and thyroid cancer. Inverse correlations with latitude were found for laryngeal, lung and uterine corpus cancer. The 17 cancers inversely correlated with NMSC are bladder, brain, breast, colon, esophageal, gallbladder, Hodgkin's lymphoma, lung, melanoma, multiple myeloma, NHL, ovarian, pancreatic, pleural, rectal, thyroid and uterine corpus cancer. The 16 correlated with melanoma are bladder, brain, breast, colon, gallbladder, leukemia, lung, multiple myeloma, NHL, ovarian, pancreatic, pleural, prostate, rectal, renal and uterine corpus cancer. The results for lung cancer were in accordance with the literature. These results provide more support for the UVB/vitamin D/cancer hypothesis and indicate a new way to investigate the role of solar UV irradiance on cancer risk. They also provide more evidence that melanoma and NMSC have different etiologies. Copyright 2006 Wiley-Liss, Inc.

  2. Scattered dose to radiosensitive organs and associated risk for cancer development from head and neck radiotherapy in pediatric patients.

    PubMed

    Kourinou, Kalliopi M; Mazonakis, Michalis; Lyraraki, Efrosini; Stratakis, John; Damilakis, John

    2013-11-01

    The purpose of this study was to measure the scattered dose to out-of-field organs from head and neck radiotherapy in pediatric patients and to estimate the risk for second cancer induction to individual organs. Radiotherapy for thalamic tumor, brain tumor, acute leukemia and Hodgkin's disease in the neck region was simulated on 5 and 10-year-old pediatric phantoms with a 6 MV photon beam. The radiation dose to thyroid, breast, lung, stomach, ovaries, bladder, liver, uterus, prostate and colon was measured using thermoluminescent dosimeters. The methodology, provided by the BEIR VII report was used for the second cancer risk estimations. Peripheral dose range for a simulated 5-year-old patient was 0.019%-1.572% of the given tumor dose. The corresponding range at the advanced patient age was reduced to 0.018%-1.468%. The second cancer risk per fraction for male patients varied from 3 to 215 per 1,000,000 patients depending upon the age at the time of exposure, primary cancer site and organ scattered dose. The corresponding risk for females was 1-1186 per 1,000,000 patients. The higher risk values were found for breast, thyroid and lung cancer development. The current data concerning the risk magnitude for developing subsequent neoplasms to various out-of-field organs may be of value for health care professionals in the follow-up studies of childhood cancer survivors. Copyright © 2012 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  3. Clopidogrel use and cancer-specific mortality: a population-based cohort study of colorectal, breast and prostate cancer patients.

    PubMed

    Hicks, Blánaid M; Murray, Liam J; Hughes, Carmel; Cardwell, Chris R

    2015-08-01

    Concerns were raised about the safety of antiplatelet thienopyridine derivatives after a randomized control trial reported increased risks of cancer and cancer deaths in prasugrel users. We investigate whether clopidogrel, a widely used thienopyridine derivative, was associated with increased risk of cancer-specific or all-cause mortality in cancer patients. Colorectal, breast and prostate cancer patients, newly diagnosed from 1998 to 2009, were identified from the National Cancer Data Repository. Cohorts were linked to the UK Clinical Practice Research Datalink, providing prescription records, and to the Office of National Statistics mortality data (up to 2012). Unadjusted and adjusted hazard ratios (HRs) for cancer-specific and all-cause mortality in post-diagnostic clopidogrel users were calculated using time-dependent Cox regression models. The analysis included 10 359 colorectal, 17 889 breast and 13 155 prostate cancer patients. There was no evidence of an increase in cancer-specific mortality in clopidogrel users with colorectal (HR = 0.98 95% confidence interval (CI) 0.77, 1.24) or prostate cancer (HR = 1.03 95%CI 0.82, 1.28). There was limited evidence of an increase in breast cancer patients (HR = 1.22 95%CI 0.90, 1.65); however, this was attenuated when removing prescriptions in the year prior to death. This novel study of large population-based cohorts of colorectal, breast and prostate cancer patients found no evidence of an increased risk of cancer-specific mortality among colorectal, breast and prostate cancer patients using clopidogrel. Copyright © 2015 John Wiley & Sons, Ltd.

  4. Annual Medical Expenditure and Productivity Loss Among Colorectal, Female Breast, and Prostate Cancer Survivors in the United States

    PubMed Central

    Yabroff, K. Robin; Guy, Gery P.; Han, Xuesong; Li, Chunyu; Banegas, Matthew P.; Ekwueme, Donatus U.; Jemal, Ahmedin

    2016-01-01

    Background: There are limited nationally representative estimates of the annual economic burden among survivors of the three most prevalent cancers (colorectal, female breast, and prostate) in both nonelderly and elderly populations in the United States. Methods: The 2008 to 2012 Medical Expenditure Panel Survey data were used to identify colorectal (n = 540), female breast (n = 1568), and prostate (n = 1170) cancer survivors and individuals without a cancer history (n = 109 423). Excess economic burden attributable to cancer included per-person excess annual medical expenditures and productivity losses (employment disability, missed work days, and days stayed in bed). All analyses were stratified by cancer site and age (nonelderly: 18–64 years vs elderly: ≥65 years). Multivariable analyses controlled for age, sex, race/ethnicity, marital status, education, number of comorbidities, and geographic region. All statistical tests were two-sided. Results: Compared with individuals without a cancer history, cancer survivors experienced annual excess medical expenditures (for the nonelderly population, colorectal: $8647, 95% confidence interval [CI] = $4932 to $13 974, P < .001; breast: $5119, 95% CI = $3439 to $7158, P < .001; prostate: $3586, 95% CI = $1792 to $6076, P < .001; for the elderly population, colorectal: $4913, 95% CI = $2768 to $7470, P < .001; breast: $2288, 95% CI = $814 to $3995, P = .002; prostate: $3524, 95% CI = $1539 to $5909, P < .001). Nonelderly colorectal and breast cancer survivors experienced statistically significant annual excess employment disability (13.6%, P < .001, and 4.8%, P = .001) and productivity loss at work (7.2 days, P < .001, and 3.3 days, P = .002) and at home (4.5 days, P < .001, and 3.3 days, P = .003). In contrast, elderly survivors of all three cancer sites had comparable productivity losses as those without a cancer history. Conclusions: Colorectal, breast, and prostate cancer survivors experienced statistically significantly higher economic burden compared with individuals without a cancer history; however, excess economic burden varies by cancer site and age. Targeted efforts will be important in reducing the economic burden of colorectal, breast, and prostate cancer. PMID:26705361

  5. Annual Medical Expenditure and Productivity Loss Among Colorectal, Female Breast, and Prostate Cancer Survivors in the United States.

    PubMed

    Zheng, Zhiyuan; Yabroff, K Robin; Guy, Gery P; Han, Xuesong; Li, Chunyu; Banegas, Matthew P; Ekwueme, Donatus U; Jemal, Ahmedin

    2016-05-01

    There are limited nationally representative estimates of the annual economic burden among survivors of the three most prevalent cancers (colorectal, female breast, and prostate) in both nonelderly and elderly populations in the United States. The 2008 to 2012 Medical Expenditure Panel Survey data were used to identify colorectal (n = 540), female breast (n = 1568), and prostate (n = 1170) cancer survivors and individuals without a cancer history (n = 109 423). Excess economic burden attributable to cancer included per-person excess annual medical expenditures and productivity losses (employment disability, missed work days, and days stayed in bed). All analyses were stratified by cancer site and age (nonelderly: 18-64 years vs elderly: ≥ 65 years). Multivariable analyses controlled for age, sex, race/ethnicity, marital status, education, number of comorbidities, and geographic region. All statistical tests were two-sided. Compared with individuals without a cancer history, cancer survivors experienced annual excess medical expenditures (for the nonelderly population, colorectal: $8647, 95% confidence interval [CI] = $4932 to $13 974, P < .001; breast: $5119, 95% CI = $3439 to $7158, P < .001; prostate: $3586, 95% CI = $1792 to $6076, P < .001; for the elderly population, colorectal: $4913, 95% CI = $2768 to $7470, P < .001; breast: $2288, 95% CI = $814 to $3995, P = .002; prostate: $3524, 95% CI = $1539 to $5909, P < .001). Nonelderly colorectal and breast cancer survivors experienced statistically significant annual excess employment disability (13.6%, P < .001, and 4.8%, P = .001) and productivity loss at work (7.2 days, P < .001, and 3.3 days, P = .002) and at home (4.5 days, P < .001, and 3.3 days, P = .003). In contrast, elderly survivors of all three cancer sites had comparable productivity losses as those without a cancer history. Colorectal, breast, and prostate cancer survivors experienced statistically significantly higher economic burden compared with individuals without a cancer history; however, excess economic burden varies by cancer site and age. Targeted efforts will be important in reducing the economic burden of colorectal, breast, and prostate cancer. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. 78 FR 8410 - Thiacloprid; Pesticide Tolerances

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-06

    ...) were noted in dog, rat, and mouse studies. Increased prostate weight and prostatic hypertrophy were... acetylcholine receptors. In the neurotoxicity studies in rats, there was a reduction in motor and locomotor... uterine tumors in rats, thyroid follicular adenomas in rat and ovarian tumors in mice. A cancer slope...

  7. 2002 Annual Report of the Korea Central Cancer Registry: Based on Registered Data from 139 Hospitals

    PubMed Central

    Shin, Hai-Rim; Jung, Kyu-Won; Won, Young-Joo

    2004-01-01

    Purpose To estimate the number of cancer cases during 2002 in Korea through a nationwide hospital based cancer registration by the Korea Central Cancer Registry (KCCR). Materials and Methods One hundred and thirty nine hospitals participated in the KCCR program in 2002. Cancer cases were coded and classified according to the International Classification of Diseases for Oncology 2nd edition (ICD-O-2). The software program "IARC Check" was used to evaluate the quality of registered cancer cases. Of the 122,770 malignancies registered, 11,732 (9.6%) duplicated malignancies were excluded. Among the remaining 102,677 malignancies, 3,652 (3.6%) cases with carcinoma in situ (Morphology code/2) were separated. Finally, 99,025 malignancies were analyzed. Results Of the total of 99,025 malignancies, 55,398 (55.9%) cases were males and 43,627 (44.1%) were females. More than one third of cases were from the elderly (65 years old and more). The six leading primary cancer sites in the order of their relative frequency, were stomach (24.0%), followed by the lung (16.0%), the liver (15.4%), the colorectum (11.6%), the bladder (3.2%), and the prostate (3.0%) among males. In females, the breast (16.8%) was the common cancer site, followed by the stomach (15.3%), the colorectum (10.7%), the thyroid gland (9.5%), the cervix uteri (9.1%), and the lung (6.6%). Conclusion With the continued increase in cancer cases especially prostate cancer among males and thyroid cancer among females, the total number of registered cancer cases in Korea continues to rapidly increase. PMID:20396549

  8. Health behaviour models and patient preferences regarding nutrition and physical activity after breast or prostate cancer diagnosis.

    PubMed

    Green, H J; Steinnagel, G; Morris, C; Laakso, E L

    2014-09-01

    This study aimed to improve understanding of prostate and breast cancer survivors' physical activity and nutrition and the association of these behaviours with two models. The first model, the Commonsense Self-Regulation Model (CSM), addresses cognitive and emotional perceptions of illness whereas the Transtheoretical Model (TTM) focuses on stage of readiness to engage in a behaviour. Participants who had been diagnosed with either breast (n = 145) or prostate cancer (n = 92) completed measures of demographic and health information, illness representations, stage of change, self-efficacy and preferences regarding health behaviour interventions. Health behaviours in the past seven days were measured via the International Physical Activity Questionnaire and concordance with national dietary guidelines. As hypothesised, TTM variables (stage of change and self-efficacy) demonstrated independent associations with physical activity and nutrition in regression analyses. CSM variables were not independently associated with absolute levels of health behaviours but both TTM and CSM variables were independently associated with self-reported changes in physical activity and nutrition following prostate or breast cancer diagnosis. Many participants reported high interest in receiving lifestyle interventions, particularly soon after diagnosis. Results supported application of the TTM and CSM models for strengthening behaviour change intentions and actions in breast and prostate cancer survivors. © 2014 John Wiley & Sons Ltd.

  9. Metallothionein - immunohistochemical cancer biomarker: a meta-analysis.

    PubMed

    Gumulec, Jaromir; Raudenska, Martina; Adam, Vojtech; Kizek, Rene; Masarik, Michal

    2014-01-01

    Metallothionein (MT) has been extensively investigated as a molecular marker of various types of cancer. In spite of the fact that numerous reviews have been published in this field, no meta-analytical approach has been performed. Therefore, results of to-date immunohistochemistry-based studies were summarized using meta-analysis in this review. Web of science, PubMed, Embase and CENTRAL databases were searched (up to April 30, 2013) and the eligibility of individual studies and heterogeneity among the studies was assessed. Random and fixed effects model meta-analysis was employed depending on the heterogeneity, and publication bias was evaluated using funnel plots and Egger's tests. A total of 77 studies were included with 8,015 tissue samples (4,631 cases and 3,384 controls). A significantly positive association between MT staining and tumors (vs. healthy tissues) was observed in head and neck (odds ratio, OR 9.95; 95% CI 5.82-17.03) and ovarian tumors (OR 7.83; 1.09-56.29), and a negative association was ascertained in liver tumors (OR 0.10; 0.03-0.30). No significant associations were identified in breast, colorectal, prostate, thyroid, stomach, bladder, kidney, gallbladder, and uterine cancers and in melanoma. While no associations were identified between MT and tumor staging, a positive association was identified with the tumor grade (OR 1.58; 1.08-2.30). In particular, strong associations were observed in breast, ovarian, uterine and prostate cancers. Borderline significant association of metastatic status and MT staining were determined (OR 1.59; 1.03-2.46), particularly in esophageal cancer. Additionally, a significant association between the patient prognosis and MT staining was also demonstrated (hazard ratio 2.04; 1.47-2.81). However, a high degree of inconsistence was observed in several tumor types, including colorectal, kidney and prostate cancer. Despite the ambiguity in some tumor types, conclusive results are provided in the tumors of head and neck, ovary and liver and in relation to the tumor grade and patient survival.

  10. Cross-cancer genome-wide analysis of lung, ovary, breast, prostate and colorectal cancer reveals novel pleiotropic associations

    PubMed Central

    Fehringer, Gordon; Kraft, Peter; Pharoah, Paul D.; Eeles, Rosalind A.; Chatterjee, Nilanjan; Schumacher, Fred; Schildkraut, Joellen; Lindström, Sara; Brennan, Paul; Bickeböller, Heike; Houlston, Richard S.; Landi, Maria Teresa; Caporaso, Neil; Risch, Angela; Olama, Ali Amin Al; Berndt, Sonja I; Giovannucci, Edward; Grönberg, Henrik; Kote-Jarai, Zsofia; Ma, Jing; Muir, Kenneth; Stampfer, Meir; Stevens, Victoria L.; Wiklund, Fredrik; Willett, Walter; Goode, Ellen L.; Permuth, Jennifer; Risch, Harvey A.; Reid, Brett M.; Bezieau, Stephane; Brenner, Hermann; Chan, Andrew T.; Chang-Claude, Jenny; Hudson, Thomas J.; Kocarnik, Jonathan K.; Newcomb, Polly A.; Schoen, Robert E.; Slattery, Martha L.; White, Emily; Adank, Muriel A.; Ahsan, Habibul; Aittomäki, Kristiina; Baglietto, Laura; Blomquist, Carl; Canzian, Federico; Czene, Kamila; dos-Santos-Silva, Isabel; Eliassen, A. Heather; Figueroa, Jonine; Flesch-Janys, Dieter; Fletcher, Olivia; Garcia-Closas, Montserrat; Gaudet, Mia M.; Johnson, Nichola; Hall, Per; Hazra, Aditi; Hein, Rebecca; Hofman, Albert; Hopper, John L.; Irwanto, Astrid; Johansson, Mattias; Kaaks, Rudolf; Kibriya, Muhammad G.; Lichtner, Peter; Liu, Jianjun; Lund, Eiliv; Makalic, Enes; Meindl, Alfons; Müller-Myhsok, Bertram; Muranen, Taru A.; Nevanlinna, Heli; Peeters, Petra H.; Peto, Julian; Prentice, Ross L.; Rahman, Nazneen; Sanchez, Maria Jose; Schmidt, Daniel F.; Schmutzler, Rita K.; Southey, Melissa C.; Tamimi, Rulla; Travis, Ruth C.; Turnbull, Clare; Uitterlinden, Andre G.; Wang, Zhaoming; Whittemore, Alice S.; Yang, Xiaohong R.; Zheng, Wei; Rafnar, Thorunn; Gudmundsson, Julius; Stacey, Simon N.; Stefansson, Kari; Sulem, Patrick; Chen, Y. Ann; Tyrer, Jonathan P.; Christiani, David C.; Wei, Yongyue; Shen, Hongbing; Hu, Zhibin; Shu, Xiao-Ou; Shiraishi, Kouya; Takahashi, Atsushi; Bossé, Yohan; Obeidat, Ma’en; Nickle, David; Timens, Wim; Freedman, Matthew L.; Li, Qiyuan; Seminara, Daniela; Chanock, Stephen J.; Gong, Jian; Peters, Ulrike; Gruber, Stephen B.; Amos, Christopher I.; Sellers, Thomas A.; Easton, Douglas F.; Hunter, David J.; Haiman, Christopher A.; Henderson, Brian E.; Hung, Rayjean J.

    2016-01-01

    Identifying genetic variants with pleiotropic associations can uncover common pathways influencing multiple cancers. We took a two-staged approach to conduct genome-wide association studies for lung, ovary, breast, prostate and colorectal cancer from the GAME-ON/GECCO Network (61,851 cases, 61,820 controls) to identify pleiotropic loci. Findings were replicated in independent association studies (55,789 cases, 330,490 controls). We identified a novel pleiotropic association at 1q22 involving breast and lung squamous cell carcinoma, with eQTL analysis showing an association with ADAM15/THBS3 gene expression in lung. We also identified a known breast cancer locus CASP8/ALS2CR12 associated with prostate cancer, a known cancer locus at CDKN2B-AS1 with different variants associated with lung adenocarcinoma and prostate cancer and confirmed the associations of a breast BRCA2 locus with lung and serous ovarian cancer. This is the largest study to date examining pleiotropy across multiple cancer-associated loci, identifying common mechanisms of cancer development and progression. PMID:27197191

  11. Oxidative stress and apoptosis induction in human thyroid carcinoma cells exposed to the essential oil from Pistacia lentiscus aerial parts.

    PubMed

    Catalani, Simona; Palma, Francesco; Battistelli, Serafina; Benedetti, Serena

    2017-01-01

    Essential oils from the aerial parts (leaves, twigs and berries) of Pistacia lentiscus (PLEO) have been well characterized for their antibacterial and anti-inflammatory properties; however, poor information exists on their potential anticancer activity. Increasing concentrations of PLEO (0.01-0.1% v/v, 80-800 μg/ml) were administered to a wide variety of cultured cancer cells from breast, cervix, colon, liver, lung, prostate, and thyroid carcinomas. Fibroblasts were also included as healthy control cells. Cell viability was monitored by WST-8 assay up to 72 hours after PLEO administration. The intracellular formation of reactive oxygen species (ROS), the induction of apoptosis, and the enhancement of chemotherapeutic drug cytotoxicity by PLEO were further investigated in the most responsive cancer cell line. A dose-dependent reduction of tumor cell viability was observed upon PLEO exposure; while no cytotoxic effect was revealed in healthy fibroblasts. FTC-133 thyroid cancer cells were found to be the most sensitive cells to PLEO treatment; accordingly, an intracellular accumulation of ROS and an activation of both the extrinsic and intrinsic apoptotic pathways were evidenced in FTC-133 cells after PLEO administration. Furthermore, the cytotoxic effect of the antineoplastic drugs cisplatin, 5-fluorouracil and etoposide was enhanced in PLEO-exposed FTC-133 cells. Taking into account its mode of action, PLEO might be considered as a promising source of natural antitumor agents which might have therapeutic potential in integrated oncology.

  12. Oxidative stress and apoptosis induction in human thyroid carcinoma cells exposed to the essential oil from Pistacia lentiscus aerial parts

    PubMed Central

    Catalani, Simona; Palma, Francesco; Battistelli, Serafina; Benedetti, Serena

    2017-01-01

    Background Essential oils from the aerial parts (leaves, twigs and berries) of Pistacia lentiscus (PLEO) have been well characterized for their antibacterial and anti-inflammatory properties; however, poor information exists on their potential anticancer activity. Methods Increasing concentrations of PLEO (0.01–0.1% v/v, 80–800 μg/ml) were administered to a wide variety of cultured cancer cells from breast, cervix, colon, liver, lung, prostate, and thyroid carcinomas. Fibroblasts were also included as healthy control cells. Cell viability was monitored by WST-8 assay up to 72 hours after PLEO administration. The intracellular formation of reactive oxygen species (ROS), the induction of apoptosis, and the enhancement of chemotherapeutic drug cytotoxicity by PLEO were further investigated in the most responsive cancer cell line. Results A dose-dependent reduction of tumor cell viability was observed upon PLEO exposure; while no cytotoxic effect was revealed in healthy fibroblasts. FTC-133 thyroid cancer cells were found to be the most sensitive cells to PLEO treatment; accordingly, an intracellular accumulation of ROS and an activation of both the extrinsic and intrinsic apoptotic pathways were evidenced in FTC-133 cells after PLEO administration. Furthermore, the cytotoxic effect of the antineoplastic drugs cisplatin, 5-fluorouracil and etoposide was enhanced in PLEO-exposed FTC-133 cells. Conclusion Taking into account its mode of action, PLEO might be considered as a promising source of natural antitumor agents which might have therapeutic potential in integrated oncology. PMID:28196126

  13. An analysis of discrepancies between United Kingdom cancer research funding and societal burden and a comparison to previous and United States values.

    PubMed

    Carter, Ashley J R; Delarosa, Beverly; Hur, Hannah

    2015-11-02

    Ideally, the allocation of research funding for each specific type of cancer should be proportional to its societal burden. This burden can be estimated with the metric 'years of life lost' (YLL), which combines overall mortality and age at death. Using United Kingdom data from 2010, we compared research funding from the National Cancer Research Institute to this YLL burden metric for 26 types of cancers in order to identify the discrepancies between cancer research funding allocation and societal burden. We also compared these values to United States data from 2010 and United Kingdom data published in 2005. Our study revealed a number of discrepancies between cancer research funding and burden. Some cancers are funded at levels far higher than their relative burden suggests (testicular, leukaemia, Hodgkin's lymphoma, breast, cervical, ovarian, prostate) while other cancers appear under-funded (gallbladder, lung, nasopharyngeal, intestine, stomach, pancreatic, thyroid, oesophageal, liver, kidney, bladder, and brain/central nervous system). United Kingdom funding patterns over the past decade have generally moved to increase funding to previously under-funded cancers with one notable exception showing a converse trend (breast cancer). The broad relationship between United Kingdom and United States funding patterns is similar with a few exceptions (e.g. leukaemia, Hodgkin's lymphoma, prostate, testicular cancer). There are discrepancies between cancer research funding allocation and societal burden in the United Kingdom. These discrepancies are broadly similar in both the United Kingdom and the United States and, while they appear to be improving, this is not consistent across all types of cancer.

  14. Mechanism and Regulation of Gene Expression by Androgen Receptor in Prostate Cancer

    DTIC Science & Technology

    2004-07-01

    the nature, regulation and mechanism of action of these factors can facilitate the development of anti-prostatic cancer therapy. The general objective...response to other signal transduction pathways) during prostate cancer development . This approach might provide new drug development insights into...G. Roeder. 2000. Involvement of the TRAP220 component of the TRAP/SMCC coactivator complex in embryonic development and thyroid hormone action. Mol

  15. Sheehan's Syndrome (Postpartum Hypopituitarism)

    MedlinePlus

    ... gland controls: thyroid, adrenal, breast milk production and menstrual function hormones. These include: Difficulty breast-feeding or an inability to breast-feed No menstrual periods (amenorrhea) or infrequent menstruation (oligomenorrhea) Inability to ...

  16. Evaluating the Association between Artificial Light-at-Night Exposure and Breast and Prostate Cancer Risk in Spain (MCC-Spain Study).

    PubMed

    Garcia-Saenz, Ariadna; Sánchez de Miguel, Alejandro; Espinosa, Ana; Valentin, Antonia; Aragonés, Núria; Llorca, Javier; Amiano, Pilar; Martín Sánchez, Vicente; Guevara, Marcela; Capelo, Rocío; Tardón, Adonina; Peiró-Perez, Rosana; Jiménez-Moleón, José Juan; Roca-Barceló, Aina; Pérez-Gómez, Beatriz; Dierssen-Sotos, Trinidad; Fernández-Villa, Tania; Moreno-Iribas, Conchi; Moreno, Victor; García-Pérez, Javier; Castaño-Vinyals, Gemma; Pollán, Marina; Aubé, Martin; Kogevinas, Manolis

    2018-04-23

    Night shift work, exposure to light at night (ALAN) and circadian disruption may increase the risk of hormone-dependent cancers. We evaluated the association of exposure to ALAN during sleeping time with breast and prostate cancer in a population based multicase-control study (MCC-Spain), among subjects who had never worked at night. We evaluated chronotype, a characteristic that may relate to adaptation to light at night. We enrolled 1,219 breast cancer cases, 1,385 female controls, 623 prostate cancer cases, and 879 male controls from 11 Spanish regions in 2008-2013. Indoor ALAN information was obtained through questionnaires. Outdoor ALAN was analyzed using images from the International Space Station (ISS) available for Barcelona and Madrid for 2012-2013, including data of remotely sensed upward light intensity and blue light spectrum information for each geocoded longest residence of each MCC-Spain subject. Among Barcelona and Madrid participants with information on both indoor and outdoor ALAN, exposure to outdoor ALAN in the blue light spectrum was associated with breast cancer [adjusted odds ratio (OR) for highest vs. lowest tertile, OR=1.47; 95% CI: 1.00, 2.17] and prostate cancer (OR=2.05; 95% CI: 1.38, 3.03). In contrast, those exposed to the highest versus lowest intensity of outdoor ALAN were more likely to be controls than cases, particularly for prostate cancer. Compared with those who reported sleeping in total darkness, men who slept in "quite illuminated" bedrooms had a higher risk of prostate cancer (OR=2.79; 95% CI: 1.55, 5.04), whereas women had a slightly lower risk of breast cancer (OR=0.77; 95% CI: 0.39, 1.51). Both prostate and breast cancer were associated with high estimated exposure to outdoor ALAN in the blue-enriched light spectrum. https://doi.org/10.1289/EHP1837.

  17. Alveolar soft part sarcoma presenting as a breast metastasis in a patient with a history of thyroid cancer: a case report

    PubMed Central

    Bychkov, Andrey; Sampatanukul, Pichet

    2015-01-01

    Metastases to the breast are uncommon, accounting for 0.5% of breast tumors, and most of them are originated from lymphoma, melanoma and carcinomas of various organs. Alveolar soft part sarcoma (ASPS) is a very rare neoplasm that is usually found in the lower extremities. Lungs are the common site of dissemination and may represent initial manifestation of disease. We report a clinically unsuspected case of ASPS presenting as a breast metastasis in a 25-year-old woman. The patient’s medical history was notable for a thyroid cancer treated by surgery and radioiodine ablation 2 years ago. Core needle biopsy of slowly growing breast mass yielded polygonal cells with abundant eosinophilic cytoplasm arranged into solid pattern. Differential diagnosis between apocrine cell carcinoma, paraganglioma, granular cell tumor, neuroendocrine carcinoma, ASPS and metastatic hepatocellular and renal cell carcinoma was rendered by immunohistochemistry. Strong nuclear TFE3 immunoreactivity confirmed a diagnosis of ASPS. Retrospectively a primary tumor was found in the thigh. Most likely, ASPS and thyroid cancer in the patient were growing synchronously and independently. PMID:26464747

  18. A DNA microarray-based methylation-sensitive (MS)-AFLP hybridization method for genetic and epigenetic analyses.

    PubMed

    Yamamoto, F; Yamamoto, M

    2004-07-01

    We previously developed a PCR-based DNA fingerprinting technique named the Methylation Sensitive (MS)-AFLP method, which permits comparative genome-wide scanning of methylation status with a manageable number of fingerprinting experiments. The technique uses the methylation sensitive restriction enzyme NotI in the context of the existing Amplified Fragment Length Polymorphism (AFLP) method. Here we report the successful conversion of this gel electrophoresis-based DNA fingerprinting technique into a DNA microarray hybridization technique (DNA Microarray MS-AFLP). By performing a total of 30 (15 x 2 reciprocal labeling) DNA Microarray MS-AFLP hybridization experiments on genomic DNA from two breast and three prostate cancer cell lines in all pairwise combinations, and Southern hybridization experiments using more than 100 different probes, we have demonstrated that the DNA Microarray MS-AFLP is a reliable method for genetic and epigenetic analyses. No statistically significant differences were observed in the number of differences between the breast-prostate hybridization experiments and the breast-breast or prostate-prostate comparisons.

  19. Prostate and Colon Cancer Screening Messages in Popular Magazines

    PubMed Central

    Katz, Mira L; Sheridan, Stacey; Pignone, Michael; Lewis, Carmen; Battle, Jamila; Gollop, Claudia; O'Malley, Michael

    2004-01-01

    OBJECTIVES To 1) compare the number of articles published about prostate, colon, and breast cancer in popular magazines during the past 2 decades, and 2) evaluate the content of in-depth prostate and colon cancer screening articles identified from 1996 to 2001. DESIGN We used a searchable database to identify the number of prostate, colon, and breast cancer articles published in three magazines with the highest circulation from six categories. In addition, we performed a systematic review on the in-depth (≥2 pages) articles on prostate and colon cancer screening that appeared from 1996 through 2001. RESULTS Although the number of magazine articles on prostate and colon cancer published in the 1990s increased compared to the 1980s, the number of articles is approximately one third of breast cancer articles. There were 36 in-depth articles from 1996 to 2001 in which prostate or colon cancer screening were mentioned. Over 90% of the articles recommended screening. However, of those articles, only 76% (25/33; 95% confidence interval [CI], 58% to 89%) cited screening guidelines. The benefits of screening were mentioned in 89% (32/36; 95% CI, 74% to 97%) but the harms were only found in 58% (21/36; 95% CI, 41% to 75%). Only 28% (10/36; 95% CI, 14% to 45%) of the articles provided all the necessary information needed for the reader to make an informed decision. CONCLUSIONS In-depth articles about prostate and colon cancer in popular magazines do not appear as frequently as articles about breast cancer. The available articles on prostate and colon cancer screening often do not provide the information necessary for the reader to make an informed decision about screening. PMID:15242469

  20. Positional Cloning of an Ashkenzai Jewish Hereditary Prostate Cancer

    DTIC Science & Technology

    2006-01-01

    prostate cancer risk. Cancer Res 65: 1213-1222. Friedrichsen DM, Malone KE, Doody DR, Daling JR, Ostrander EA. (2004) Frequency of CHEK2 mutations...Genetics, Salt Lake City, UT, 2005. * First author "Identification and characterization of novel SNPs in CHEK2 in Ashkenazi Jewish men with prostate...Frequency of CHEK2 mutations in a population based, case-control study of breast cancer in young women. Breast Cancer Res. 6:R629-35. 7

  1. 68Ga-Prostate-Specific Membrane Antigen PET/CT in Triple-Negative Breast Cancer.

    PubMed

    Passah, Averilicia; Arora, Saurabh; Damle, Nishikant Avinash; Tripathi, Madhavi; Bal, Chandrasekhar; Subudhi, T Kishan; Arora, Geetanjali

    2018-06-01

    The prostate-specific membrane antigen (PSMA) is a transmembrane protein with elevated expression in prostate cancer cells. Breast cancer also shows PSMA expression. We present the case of a 30-year-old woman with triple-negative bilateral breast carcinoma who underwent bilateral mastectomy, chemotherapy, and radiotherapy. She developed a left chest wall and liver recurrence after primary therapy. Her recurrent disease was also triple-negative. In view of the known poor prognosis and very limited therapeutic options, we performed Ga-PSMA PET/CT scan to explore the possibility of PSMA-based therapy as a future option after exhausting standard-of-care treatments.

  2. Vaccine Therapy With or Without Sirolimus in Treating Patients With NY-ESO-1 Expressing Solid Tumors

    ClinicalTrials.gov

    2016-10-03

    Anaplastic Astrocytoma; Anaplastic Oligoastrocytoma; Anaplastic Oligodendroglioma; Estrogen Receptor Negative; Estrogen Receptor Positive; Glioblastoma; Hormone-Resistant Prostate Cancer; Metastatic Prostate Carcinoma; Metastatic Renal Cell Cancer; Recurrent Adult Brain Neoplasm; Recurrent Bladder Carcinoma; Recurrent Breast Carcinoma; Recurrent Colorectal Carcinoma; Recurrent Esophageal Carcinoma; Recurrent Gastric Carcinoma; Recurrent Hepatocellular Carcinoma; Recurrent Lung Carcinoma; Recurrent Melanoma; Recurrent Ovarian Carcinoma; Recurrent Prostate Carcinoma; Recurrent Renal Cell Carcinoma; Recurrent Uterine Corpus Carcinoma; Resectable Hepatocellular Carcinoma; Sarcoma; Stage IA Breast Cancer; Stage IA Ovarian Cancer; Stage IA Uterine Corpus Cancer; Stage IB Breast Cancer; Stage IB Ovarian Cancer; Stage IB Uterine Corpus Cancer; Stage IC Ovarian Cancer; Stage II Uterine Corpus Cancer; Stage IIA Breast Cancer; Stage IIA Lung Carcinoma; Stage IIA Ovarian Cancer; Stage IIB Breast Cancer; Stage IIB Esophageal Cancer; Stage IIB Lung Carcinoma; Stage IIB Ovarian Cancer; Stage IIB Skin Melanoma; Stage IIC Ovarian Cancer; Stage IIC Skin Melanoma; Stage IIIA Breast Cancer; Stage IIIA Esophageal Cancer; Stage IIIA Lung Carcinoma; Stage IIIA Ovarian Cancer; Stage IIIA Skin Melanoma; Stage IIIA Uterine Corpus Cancer; Stage IIIB Breast Cancer; Stage IIIB Esophageal Cancer; Stage IIIB Ovarian Cancer; Stage IIIB Skin Melanoma; Stage IIIB Uterine Corpus Cancer; Stage IIIC Breast Cancer; Stage IIIC Esophageal Cancer; Stage IIIC Ovarian Cancer; Stage IIIC Skin Melanoma; Stage IIIC Uterine Corpus Cancer; Stage IV Bladder Urothelial Carcinoma; Stage IV Esophageal Cancer; Stage IV Ovarian Cancer; Stage IV Prostate Cancer; Stage IV Skin Melanoma; Stage IVA Uterine Corpus Cancer; Stage IVB Uterine Corpus Cancer

  3. Adherence to nutrition-based cancer prevention guidelines and breast, prostate and colorectal cancer risk in the MCC-Spain case-control study.

    PubMed

    Romaguera, Dora; Gracia-Lavedan, Esther; Molinuevo, Amaia; de Batlle, Jordi; Mendez, Michelle; Moreno, Victor; Vidal, Carmen; Castelló, Adela; Pérez-Gómez, Beatriz; Martín, Vicente; Molina, Antonio J; Dávila-Batista, Verónica; Dierssen-Sotos, Trinidad; Gómez-Acebo, Inés; Llorca, Javier; Guevara, Marcela; Castilla, Jesús; Urtiaga, Carmen; Llorens-Ivorra, Cristóbal; Fernández-Tardón, Guillermo; Tardón, Adonina; Lorca, José Andrés; Marcos-Gragera, Rafael; Huerta, José María; Olmedo-Requena, Rocío; Jimenez-Moleon, José Juan; Altzibar, Jone; de Sanjosé, Silvia; Pollán, Marina; Aragonés, Núria; Castaño-Vinyals, Gemma; Kogevinas, Manolis; Amiano, Pilar

    2017-07-01

    Prostate, breast and colorectal cancer are the most common tumours in Spain. The aim of the present study was to evaluate the association between adherence to nutrition-based guidelines for cancer prevention and prostate, breast and colorectal cancer, in the MCC-Spain case-control study. A total of 1,718 colorectal, 1,343 breast and 864 prostate cancer cases and 3,431 population-based controls recruited between 2007 and 2012, were included in the present study. The World Cancer Research Fund/American Institute for Cancer Research (WCRC/AICR) score based on six recommendations for cancer prevention (on body fatness, physical activity, foods and drinks that promote weight gain, plant foods, animal foods and alcoholic drinks; score range 0-6) was constructed. We used unconditional logistic regression analysis adjusting for potential confounders. One-point increment in the WCRF/AICR score was associated with 25% (95% CI 19-30%) lower risk of colorectal, and 15% (95% CI 7-22%) lower risk of breast cancer; no association with prostate cancer was detected, except for cases with a Gleason score ≥7 (poorly differentiated/undifferentiated tumours) (OR 0.87, 95% CI 0.76-0.99). These results add to the wealth of evidence indicating that a great proportion of common cancer cases could be avoided by adopting healthy lifestyle habits. © 2017 UICC.

  4. TOPICAL REVIEW: Human soft tissue analysis using x-ray or gamma-ray techniques

    NASA Astrophysics Data System (ADS)

    Theodorakou, C.; Farquharson, M. J.

    2008-06-01

    This topical review is intended to describe the x-ray techniques used for human soft tissue analysis. X-ray techniques have been applied to human soft tissue characterization and interesting results have been presented over the last few decades. The motivation behind such studies is to provide improved patient outcome by using the data obtained to better understand a disease process and improve diagnosis. An overview of theoretical background as well as a complete set of references is presented. For each study, a brief summary of the methodology and results is given. The x-ray techniques include x-ray diffraction, x-ray fluorescence, Compton scattering, Compton to coherent scattering ratio and attenuation measurements. The soft tissues that have been classified using x-rays or gamma rays include brain, breast, colon, fat, kidney, liver, lung, muscle, prostate, skin, thyroid and uterus.

  5. Incident diagnoses of cancers and cancer-related deaths, active component, U.S. Armed Forces, 2000-2011.

    PubMed

    2012-06-01

    In the United States, cancer is one of the five leading causes of death in all age groups among both men and women; overall, approximately one in four deaths is attributable to cancer. Compared to the general U.S. population, military members have been estimated to have lower incidence rates of several cancers including colorectal, lung, and cervical cancers and higher rates of prostate, breast, and thyroid cancer. Between 2000 and 2011 in active component members of the U.S. military, crude incidence rates of most cancer diagnoses have remained stable. 9,368 active component service members were diagnosed with one of the cancers of interest and no specific increasing or decreasing trends were observed. Cancer is an uncommon cause of death among service members on active duty and accounted for a total of 1,185 deaths during the 12-year surveillance period.

  6. Soy and Health Update: Evaluation of the Clinical and Epidemiologic Literature

    PubMed Central

    Messina, Mark

    2016-01-01

    Soyfoods have long been recognized as sources of high-quality protein and healthful fat, but over the past 25 years these foods have been rigorously investigated for their role in chronic disease prevention and treatment. There is evidence, for example, that they reduce risk of coronary heart disease and breast and prostate cancer. In addition, soy alleviates hot flashes and may favorably affect renal function, alleviate depressive symptoms and improve skin health. Much of the focus on soyfoods is because they are uniquely-rich sources of isoflavones. Isoflavones are classified as both phytoestrogens and selective estrogen receptor modulators. Despite the many proposed benefits, the presence of isoflavones has led to concerns that soy may exert untoward effects in some individuals. However, these concerns are based primarily on animal studies, whereas the human research supports the safety and benefits of soyfoods. In support of safety is the recent conclusion of the European Food Safety Authority that isoflavones do not adversely affect the breast, thyroid or uterus of postmenopausal women. This review covers each of the major research areas involving soy focusing primarily on the clinical and epidemiologic research. Background information on Asian soy intake, isoflavones, and nutrient content is also provided. PMID:27886135

  7. Detection of ATM germline variants by the p53 mitotic centrosomal localization test in BRCA1/2-negative patients with early-onset breast cancer.

    PubMed

    Prodosmo, Andrea; Buffone, Amelia; Mattioni, Manlio; Barnabei, Agnese; Persichetti, Agnese; De Leo, Aurora; Appetecchia, Marialuisa; Nicolussi, Arianna; Coppa, Anna; Sciacchitano, Salvatore; Giordano, Carolina; Pinnarò, Paola; Sanguineti, Giuseppe; Strigari, Lidia; Alessandrini, Gabriele; Facciolo, Francesco; Cosimelli, Maurizio; Grazi, Gian Luca; Corrado, Giacomo; Vizza, Enrico; Giannini, Giuseppe; Soddu, Silvia

    2016-09-06

    Variant ATM heterozygotes have an increased risk of developing cancer, cardiovascular diseases, and diabetes. Costs and time of sequencing and ATM variant complexity make large-scale, general population screenings not cost-effective yet. Recently, we developed a straightforward, rapid, and inexpensive test based on p53 mitotic centrosomal localization (p53-MCL) in peripheral blood mononuclear cells (PBMCs) that diagnoses mutant ATM zygosity and recognizes tumor-associated ATM polymorphisms. Fresh PBMCs from 496 cancer patients were analyzed by p53-MCL: 90 cases with familial BRCA1/2-positive and -negative breast and/or ovarian cancer, 337 with sporadic cancers (ovarian, lung, colon, and post-menopausal breast cancers), and 69 with breast/thyroid cancer. Variants were confirmed by ATM sequencing. A total of seven individuals with ATM variants were identified, 5/65 (7.7 %) in breast cancer cases of familial breast and/or ovarian cancer and 2/69 (2.9 %) in breast/thyroid cancer. No variant ATM carriers were found among the other cancer cases. Excluding a single case in which both BRCA1 and ATM were mutated, no p53-MCL alterations were observed in BRCA1/2-positive cases. These data validate p53-MCL as reliable and specific test for germline ATM variants, confirm ATM as breast cancer susceptibility gene, and highlight a possible association with breast/thyroid cancers.

  8. Cross-Cancer Genome-Wide Analysis of Lung, Ovary, Breast, Prostate, and Colorectal Cancer Reveals Novel Pleiotropic Associations.

    PubMed

    Fehringer, Gordon; Kraft, Peter; Pharoah, Paul D; Eeles, Rosalind A; Chatterjee, Nilanjan; Schumacher, Fredrick R; Schildkraut, Joellen M; Lindström, Sara; Brennan, Paul; Bickeböller, Heike; Houlston, Richard S; Landi, Maria Teresa; Caporaso, Neil; Risch, Angela; Amin Al Olama, Ali; Berndt, Sonja I; Giovannucci, Edward L; Grönberg, Henrik; Kote-Jarai, Zsofia; Ma, Jing; Muir, Kenneth; Stampfer, Meir J; Stevens, Victoria L; Wiklund, Fredrik; Willett, Walter C; Goode, Ellen L; Permuth, Jennifer B; Risch, Harvey A; Reid, Brett M; Bezieau, Stephane; Brenner, Hermann; Chan, Andrew T; Chang-Claude, Jenny; Hudson, Thomas J; Kocarnik, Jonathan K; Newcomb, Polly A; Schoen, Robert E; Slattery, Martha L; White, Emily; Adank, Muriel A; Ahsan, Habibul; Aittomäki, Kristiina; Baglietto, Laura; Blomquist, Carl; Canzian, Federico; Czene, Kamila; Dos-Santos-Silva, Isabel; Eliassen, A Heather; Figueroa, Jonine D; Flesch-Janys, Dieter; Fletcher, Olivia; Garcia-Closas, Montserrat; Gaudet, Mia M; Johnson, Nichola; Hall, Per; Hazra, Aditi; Hein, Rebecca; Hofman, Albert; Hopper, John L; Irwanto, Astrid; Johansson, Mattias; Kaaks, Rudolf; Kibriya, Muhammad G; Lichtner, Peter; Liu, Jianjun; Lund, Eiliv; Makalic, Enes; Meindl, Alfons; Müller-Myhsok, Bertram; Muranen, Taru A; Nevanlinna, Heli; Peeters, Petra H; Peto, Julian; Prentice, Ross L; Rahman, Nazneen; Sanchez, Maria Jose; Schmidt, Daniel F; Schmutzler, Rita K; Southey, Melissa C; Tamimi, Rulla; Travis, Ruth C; Turnbull, Clare; Uitterlinden, Andre G; Wang, Zhaoming; Whittemore, Alice S; Yang, Xiaohong R; Zheng, Wei; Buchanan, Daniel D; Casey, Graham; Conti, David V; Edlund, Christopher K; Gallinger, Steven; Haile, Robert W; Jenkins, Mark; Le Marchand, Loïc; Li, Li; Lindor, Noralene M; Schmit, Stephanie L; Thibodeau, Stephen N; Woods, Michael O; Rafnar, Thorunn; Gudmundsson, Julius; Stacey, Simon N; Stefansson, Kari; Sulem, Patrick; Chen, Y Ann; Tyrer, Jonathan P; Christiani, David C; Wei, Yongyue; Shen, Hongbing; Hu, Zhibin; Shu, Xiao-Ou; Shiraishi, Kouya; Takahashi, Atsushi; Bossé, Yohan; Obeidat, Ma'en; Nickle, David; Timens, Wim; Freedman, Matthew L; Li, Qiyuan; Seminara, Daniela; Chanock, Stephen J; Gong, Jian; Peters, Ulrike; Gruber, Stephen B; Amos, Christopher I; Sellers, Thomas A; Easton, Douglas F; Hunter, David J; Haiman, Christopher A; Henderson, Brian E; Hung, Rayjean J

    2016-09-01

    Identifying genetic variants with pleiotropic associations can uncover common pathways influencing multiple cancers. We took a two-stage approach to conduct genome-wide association studies for lung, ovary, breast, prostate, and colorectal cancer from the GAME-ON/GECCO Network (61,851 cases, 61,820 controls) to identify pleiotropic loci. Findings were replicated in independent association studies (55,789 cases, 330,490 controls). We identified a novel pleiotropic association at 1q22 involving breast and lung squamous cell carcinoma, with eQTL analysis showing an association with ADAM15/THBS3 gene expression in lung. We also identified a known breast cancer locus CASP8/ALS2CR12 associated with prostate cancer, a known cancer locus at CDKN2B-AS1 with different variants associated with lung adenocarcinoma and prostate cancer, and confirmed the associations of a breast BRCA2 locus with lung and serous ovarian cancer. This is the largest study to date examining pleiotropy across multiple cancer-associated loci, identifying common mechanisms of cancer development and progression. Cancer Res; 76(17); 5103-14. ©2016 AACR. ©2016 American Association for Cancer Research.

  9. Targeting Premalignant Lesions: Implications for Early Breast Cancer Detection and Intervention

    DTIC Science & Technology

    2016-04-01

    prostate, lung, colon and pancreas and have been also reported in the premalignant lesions. This peptide could provide us with an opportunity to...including those of the breast, prostate, lung, colon and pancreas and have been also reported in the premalignant lesions (Erez N, et. al Cancer Cell

  10. Polybrominated Diphenyl Ether (DE-71)Interferes with Thyroid Hormone Action Independent Of Effects On Circulating Levels of Thyroid Hormone in Male Rats

    EPA Science Inventory

    Polybrominated diphenyl ethers (PBDEs) are routinely found in human tissues including cord blood and breast milk. PBDEs may interfere with thyroid hormone (TH) during development, which could produce neurobehavioral deficits. An assumption in experimental and epidemiological stud...

  11. Do soy isoflavones lower cholesterol, inhibit atherosclerosis, and play a role in cancer prevention?

    PubMed

    Arliss, Rebecca M; Biermann, Carol A

    2002-10-01

    This article is designed to help nursing professionals advise patients about the role of soy in the prevention and treatment of heart disease, breast cancer, and prostate cancer. Soy protein lowers total cholesterol, low-density lipoprotein cholesterol, and triglycerides in humans and inhibits atherosclerosis in animals. In cell culture studies and animal research, the soy isoflavone genistein offers protection from breast cancer and prostate cancer because it prevents cancer initiation, slows promotion, and impedes cancer progression. This article synthesizes the current research concerning soy phytoestrogens and the prevention and treatment of heart disease, breast cancer, and prostate cancer. Nursing professionals may use this information when counseling patients.

  12. Implications of false-positive results for future cancer screenings.

    PubMed

    Taksler, Glen B; Keating, Nancy L; Rothberg, Michael B

    2018-06-01

    False-positive cancer screening results may affect a patient's willingness to obtain future screening. The authors conducted logistic regression analysis of 450,484 person-years of electronic medical records (2006-2015) in 92,405 individuals aged 50 to 75 years. Exposures were false-positive breast, prostate, or colorectal cancer screening test results (repeat breast imaging or negative breast biopsy ≤3 months after screening mammography, repeat prostate-specific antigen [PSA] test ≤3 months after PSA test result ≥4.0 ng/mL or negative prostate biopsy ≤3 months after any PSA result, or negative colonoscopy [without biopsy/polypectomy] ≤6 months after a positive fecal occult blood test). Outcomes were up-to-date status with breast or colorectal cancer screening. Covariates included prior screening history, clinical information (eg, family history, obesity, and smoking status), comorbidity, and demographics. Women were more likely to be up to date with breast cancer screening if they previously had false-positive mammography findings (adjusted odds ratio [AOR], 1.43 [95% confidence interval, 1.34-1.51] without breast biopsy and AOR, 2.02 [95% confidence interval, 1.56-2.62] with breast biopsy; both P<.001). The same women were more likely to be up to date with colorectal cancer screening (AOR range, 1.25-1.47 depending on breast biopsy; both P<.001). Men who previously had false-positive PSA testing were more likely to be up to date with colorectal cancer screening (AOR, 1.22 [P = .039] without prostate imaging/biopsy and AOR, 1.60 [P = .028] with imaging/biopsy). Results were stronger for individuals with more false-positive results (all P≤.005). However, women with previous false-positive colorectal cancer fecal occult blood test screening results were found to be less likely to be up to date with breast cancer screening (AOR, 0.73; P<.001). Patients who previously had a false-positive breast or prostate cancer screening test were more likely to engage in future screening. Cancer 2018;124:2390-8. © 2018 American Cancer Society. © 2018 American Cancer Society.

  13. Molecularly Targeted Dose-Enhancement Radiotherapy Using Gold and Luminescent Nanoparticles in an Orthotopic Human Prostate Cancer Rat Model

    DTIC Science & Technology

    2013-10-01

    cell lines, such as cervix cancer cell line (HeLa) and breast cancer cell line (MDA-MB-231), were also employed. The experiments with other cell lines...breast cancer cell line (MDA-MB- 231), and cervix cancer cell line (HeLa). Different from our hypothesis, prostate cancer cell lines did not present...Radiotherapy Using Gold and Luminescent Nanoparticles in an Orthotopic Human Prostate Cancer Rat Model PRINCIPAL INVESTIGATOR: Kwang Song

  14. Awareness, concern, and communication between physicians and patients on bone health in cancer.

    PubMed

    Tripathy, Debu; Durie, Brian G M; Mautner, Beatrice; Ferenz, Krag S; Moul, Judd W

    2014-06-01

    This study aims to explore physician-patient communications about bone metastases and cancer treatment-induced bone loss (CTIBL). The study utilizes online survey of patients with breast cancer, prostate cancer, and multiple myeloma, and the physicians who treat them. Even though 69 and 48 % of patients with nonmetastatic breast and prostate cancer aware of treatment-induced bone loss, only 39 and 23 %, respectively, were concerned about bone loss. Yet, 62 and 71 % of oncologists treating breast and prostate cancer felt that their patients were concerned. Among patients with metastatic breast and prostate cancer, two thirds had not discussed treatment for bone metastases with their doctor; when discussed, 88 and 91 % of discussions were initiated by the doctor, usually prior to initiating treatment. Most myeloma patients (77 %) had discussed treatment options with their physicians; 99 % of hematologists reported discussing treatment of bone disease with patients. Physicians are primary sources of information to patients regarding bone health. There is a gap between what physicians assume their patients know about bone health and the patients' perceptions, presenting a need for systematic awareness and education.

  15. Pizza consumption and the risk of breast, ovarian and prostate cancer.

    PubMed

    Gallus, Silvano; Talamini, Renato; Bosetti, Cristina; Negri, Eva; Montella, Maurizio; Franceschi, Silvia; Giacosa, Attilio; La Vecchia, Carlo

    2006-02-01

    Pizza has been favourably related to the risk of prostate cancer in North America. Scanty information, however, is available on sex hormone-related cancer sites. We therefore studied the role of pizza consumption on the risk of breast, ovarian and prostate cancers using data from three hospital-based case-control studies conducted in Italy between 1991 and 2002. These included 2569 women with breast cancer, 1031 with ovarian cancer, 1294 men with prostate cancer, and a total of 4864 controls. Compared with non-pizza eaters, the multivariate odds ratios for eaters were 0.97 (95% confidence interval (CI) 0.86-1.10) for breast, 1.06 (95% CI 0.89-1.26) for ovarian and 1.04 (95% CI 0.88-1.23) for prostate cancer. Corresponding estimates for regular eaters (i.e. > or =1 portion per week) were 0.92 (95% CI 0.78-1.08), 1.00 (95% CI 0.80-1.25) and 1.12 (95% CI 0.88-1.43), respectively. Our results do not show a relevant role of pizza on the risk of sex hormone-related cancers. The difference with selected studies from North America suggests that dietary and lifestyle correlates of pizza eating vary between different populations and social groups.

  16. Cancer Today

    MedlinePlus

    ... your doctor if you are considering having a prostate-specific antigen (PSA) test or digital rectal examination (DRE). Skin ... regular colonoscopy for cancer of the colon, serum prostatic-specific antigen (PSA) for prostate cancer, mammography for breast cancer, ...

  17. Sexual Health Concerns Among Cancer Survivors: Testing a Novel Information-Need Measure Among Breast and Prostate Cancer Patients.

    PubMed

    Crowley, Sheila A; Foley, Sallie M; Wittmann, Daniela; Jagielski, Christina H; Dunn, Rodney L; Clark, Patricia M; Griggs, Jennifer J; Peterson, Catherine; Leonard, Marcia; An, Lawrence C; Wei, John T; Montie, James E; Janz, Nancy K

    2016-09-01

    While it is recognized that cancer treatment can contribute to problems in sexual function, much less is currently known about the specific sexual health concerns and information needs of cancer survivors. This study tested a new instrument to measure cancer survivors' sexual health concerns and needs for sexual information after cancer treatment. The Information on Sexual Health: Your Needs after Cancer (InSYNC), developed by a multidisciplinary team of experts, is a novel 12-item questionnaire to measure sexual health concerns and information needs of cancer survivors. We tested the measure with a sample of breast and prostate cancer survivors. A convenience sample of 114 cancer survivors (58 breast, 56 prostate) was enrolled. Results of the InSYNC questionnaire showed high levels of sexual concern among cancer survivors. Areas of concern differed by cancer type. Prostate cancer survivors were most concerned about being able to satisfy their partners (57 %) while breast cancer survivors were most concerned with changes in how their bodies worked sexually (46 %). Approximately 35 % of all cancer survivors wanted more information about sexual health. Sexual health concerns and unmet information needs are common among breast and prostate cancer survivors, varying in some aspects by type of cancer. Routine screening for sexual health concerns should be included in comprehensive cancer survivorship care to appropriately address health care needs. The InSYNC questionnaire is one tool that may help clinicians identify concerns facing their patients.

  18. Antineoplastic Effects of PPARγ Agonists, with a Special Focus on Thyroid Cancer.

    PubMed

    Ferrari, Silvia Martina; Materazzi, Gabriele; Baldini, Enke; Ulisse, Salvatore; Miccoli, Paolo; Antonelli, Alessandro; Fallahi, Poupak

    2016-01-01

    Peroxisome Proliferator-Activated Receptor-γ (PPARγ) is a ligand-activated nuclear hormone receptor that functions as transcription factor and plays an important role in lipid metabolism and insulin sensitization. Recent studies have shown that PPARγ is overexpressed in many tumor types, including cancers of breast, lung, pancreas, colon, glioblastoma, prostate and thyroid differentiated/anaplastic cancers. These data suggest a role of PPARγ in tumor development and/or progression. PPARγ is emerging as a growth-limiting and differentiation-promoting factor, and it exerts a tumor suppressor role. Moreover, naturally-occurring and synthetic PPARγ agonists promote growth inhibition and apoptosis. Thiazolidinediones (TZDs) are synthetic agonists of PPARγ that were developed to treat type II diabetes. These compounds also display anticancer effects which appear mainly to be independent of their PPARγ agonist activity. Various preclinical and clinical studies strongly suggest a role for TZDs both alone and in combination with existing chemotherapeutic agents, for the treatment of cancer. Differentiation therapy involves the use of agents with the ability to induce differentiation in cells that have lost this ability, i.e. cancer cells, targeting pathways capable of re-activating blocked terminal differentiation programs. PPARγ agonists have been shown to induce differentiation in solid tumors such as thyroid differentiated/ anaplastic cancers and sarcomas. However, emerging data suggest that chronic use of TZDs is associated with increased risk of adverse cardiovascular events. The exploration of newer PPARγ agonists can help in unveiling the underlying mechanisms of these drugs, providing new molecules that are able to treat cancer, without increasing the cardiovascular risk of neoplastic patients.

  19. MEK Inhibition Leads To Lysosome-Mediated Na+/I- Symporter Protein Degradation In Human Breast Cancer Cells

    PubMed Central

    Zhang, Zhaoxia; Beyer, Sasha; Jhiang, Sissy M

    2013-01-01

    The Na+/I- symporter (NIS) is a transmembrane glycoprotein that mediates active iodide uptake into thyroid follicular cells. NIS-mediated iodide uptake in thyroid cells is the basis for targeted radionuclide imaging and treatment of differentiated thyroid carcinomas and their metastases. Furthermore, NIS is expressed in many human breast tumors but not in normal non-lactating breast tissue, suggesting that NIS-mediated radionuclide uptake may also allow the imaging and targeted therapy of breast cancer. However, functional cell surface NIS expression is often low in breast cancer, making it important to uncover signaling pathways that modulate NIS expression at multiple levels, from gene transcription to post-translational processing and cell surface trafficking. In this study, we investigated NIS regulation in breast cancer by MEK (MAPK/ERK kinase) signaling, an important cell signaling pathway involved in oncogenic transformation. We found that MEK inhibition decreased NIS protein levels in all-trans retinoic acid (tRA)/hydrocortisone treated MCF-7 cells as well as human breast cancer cells expressing exogenous NIS. The decrease in NIS protein levels by MEK inhibition was not accompanied by a decrease in NIS mRNA or a decrease in NIS mRNA export from the nucleus to the cytoplasm. NIS protein degradation upon MEK inhibition was prevented by lysosome inhibitors, but not by proteasome inhibitors. Interestingly, NIS protein level was correlated with MEK/ERK activation in human breast tumors from a tissue microarray. Taken together, MEK activation appears to play an important role in maintaining NIS protein stability in human breast cancers. PMID:23404856

  20. Effects of homeopathic preparations on human prostate cancer growth in cellular and animal models.

    PubMed

    MacLaughlin, Brian W; Gutsmuths, Babett; Pretner, Ewald; Jonas, Wayne B; Ives, John; Kulawardane, Don Victor; Amri, Hakima

    2006-12-01

    The use of dietary supplements for various ailments enjoys unprecedented popularity. As part of this trend, Sabal serrulata (saw palmetto) constitutes the complementary treatment of choice with regard to prostate health. In homeopathy, Sabal serrulata is commonly prescribed for prostate problems ranging from benign prostatic hyperplasia to prostate cancer. The authors' work assessed the antiproliferative effects of homeopathic preparations of Sabal serrulata, Thuja occidentalis, and Conium maculatum, in vivo, on nude mouse xenografts, and in vitro, on PC-3 and DU-145 human prostate cancer as well as MDA-MB-231 human breast cancer cell lines. Treatment with Sabal serrulata in vitro resulted in a 33% decrease of PC-3 cell proliferation at 72 hours and a 23% reduction of DU-145 cell proliferation at 24 hours (P<.01). The difference in reduction is likely due to the specific doubling time of each cell line. No effect was observed on MDA-MB-231 human breast cancer cells. Thuja occidentalis and Conium maculatum did not have any effect on human prostate cancer cell proliferation. In vivo, prostate tumor xenograft size was significantly reduced in Sabal serrulata-treated mice compared to untreated controls (P=.012). No effect was observed on breast tumor growth. Our study clearly demonstrates a biologic response to homeopathic treatment as manifested by cell proliferation and tumor growth. This biologic effect was (i)significantly stronger to Sabal serrulata than to controls and (ii)specific to human prostate cancer. Sabal serrulata should thus be further investigated as a specific homeopathic remedy for prostate pathology.

  1. Neighbourhoods matter too: the association between neighbourhood socioeconomic position, population density and breast, prostate and lung cancer incidence in Denmark between 2004 and 2008.

    PubMed

    Meijer, Mathias; Bloomfield, Kim; Engholm, Gerda

    2013-01-01

    Previous studies have shown that cancer incidence is related to a number of individual factors, including socioeconomic status. The aim of this study was to refine the current knowledge about indicators associated with cancer incidence by evaluating the influence of neighbourhood characteristics on breast, prostate and lung cancer incidence in Denmark. All women aged 30-83 years were followed for breast cancer between 2004 and 2008, men between 50 and 83 years were followed for prostate cancer and both sexes between ages 50 and 83 were followed for lung cancer. Registry data obtained from Statistics Denmark included age, sex, availability of breast cancer screening, marital status, education, disposable income and occupational socioeconomic status on the individual level and population density and neighbourhood socioeconomic status (the proportion of unemployed) on the parish level. Frailty modelling with individuals on the first level and parishes on the second level was conducted. A significantly lower HR of breast cancer was found in areas with low population density (HR=0.93; CI 0.88 to 0.99), while neighbourhood unemployment had no effect. Inhabitants of lower unemployment areas had a higher risk of prostate cancer (HR=1.14; CI 1.08 to 1.21) compared with those in higher unemployment areas, whereas population density had no effect. Risk of lung cancer was lower in areas with lowest population density (HR=0.80; CI 0.74 to 0.85) and lowest in areas with lowest unemployment (HR=0.88; CI 0.84 to 0.92). In addition to individual-level factors, characteristics on the neighbourhood level also have an influence on breast, prostate and lung cancer incidence.

  2. Disruptive mitochondrial DNA mutations in complex I subunits are markers of oncocytic phenotype in thyroid tumors.

    PubMed

    Gasparre, Giuseppe; Porcelli, Anna Maria; Bonora, Elena; Pennisi, Lucia Fiammetta; Toller, Matteo; Iommarini, Luisa; Ghelli, Anna; Moretti, Massimo; Betts, Christine M; Martinelli, Giuseppe Nicola; Ceroni, Alberto Rinaldi; Curcio, Francesco; Carelli, Valerio; Rugolo, Michela; Tallini, Giovanni; Romeo, Giovanni

    2007-05-22

    Oncocytic tumors are a distinctive class of proliferative lesions composed of cells with a striking degree of mitochondrial hyperplasia that are particularly frequent in the thyroid gland. To understand whether specific mitochondrial DNA (mtDNA) mutations are associated with the accumulation of mitochondria, we sequenced the entire mtDNA in 50 oncocytic lesions (45 thyroid tumors of epithelial cell derivation and 5 mitochondrion-rich breast tumors) and 52 control cases (21 nononcocytic thyroid tumors, 15 breast carcinomas, and 16 gliomas) by using recently developed technology that allows specific and reliable amplification of the whole mtDNA with quick mutation scanning. Thirteen oncocytic lesions (26%) presented disruptive mutations (nonsense or frameshift), whereas only two samples (3.8%) presented such mutations in the nononcocytic control group. In one case with multiple thyroid nodules analyzed separately, a disruptive mutation was found in the only nodule with oncocytic features. In one of the five mitochondrion-rich breast tumors, a disruptive mutation was identified. All disruptive mutations were found in complex I subunit genes, and the association between these mutations and the oncocytic phenotype was statistically significant (P=0.001). To study the pathogenicity of these mitochondrial mutations, primary cultures from oncocytic tumors and corresponding normal tissues were established. Electron microscopy and biochemical and molecular analyses showed that primary cultures derived from tumors bearing disruptive mutations failed to maintain the mutations and the oncocytic phenotype. We conclude that disruptive mutations in complex I subunits are markers of thyroid oncocytic tumors.

  3. Immunogenic Peptides (Vaccines) for the Treatment of Prostate and Breast Cancer | NCI Technology Transfer Center | TTC

    Cancer.gov

    Researchers at the NCI have developed a novel treatment for prostate and breast cancer using synthetic peptides derived from TARP, the T cell receptor gamma alternate reading frame protein. These immunogenic peptides from TARP elicit an immune response, triggering T cells to kill only the cancer cells within a patient.

  4. Perigastric lymph node metastasis from papillary thyroid carcinoma in a patient with early gastric cancer: the first case report.

    PubMed

    Jeong, Gui-Ae; Kim, Hyung-Chul; Kim, Hee-Kyung; Cho, Gyu-Seok

    2014-09-01

    Distant metastasis from papillary thyroid carcinoma (PTC), particularly from papillary thyroid microcarcinoma, is rare. We present a case of perigastric lymph node metastasis from PTC in a patient with early gastric cancer and breast cancer. During post-surgical follow-up for breast cancer, a 56-year-old woman was diagnosed incidentally with early gastric cancer and synchronous left thyroid cancer. Therefore, laparoscopic distal gastrectomy with lymph node dissection and left thyroidectomy were performed. On the basis of the pathologic findings of the surgical specimens, the patient was diagnosed to have papillary thyroid microcarcinoma with perigastric lymph node metastasis and early gastric cancer with mucosal invasion. Finally, on the basis of immunohistochemical staining with galectin-3, the diagnosis of perigastric lymph node metastasis from PTC was made. When a patient has multiple primary malignancies with lymph node metastasis, careful pathologic examination of the surgical specimen is necessary; immunohistochemical staining may be helpful in determining the primary origin of lymph node metastasis.

  5. TPOAb and Thyroid Function Are Not Associated with Breast Cancer Outcome: Evidence from a Large-Scale Study Using Data from the Taxotere as Adjuvant Chemotherapy Trial (TACT, CRUK01/001)

    PubMed Central

    Muller, Ilaria; Kilburn, Lucy S.; Taylor, Peter N.; Barrett-Lee, Peter J.; Bliss, Judith M.; Ellis, Paul; Ludgate, Marian E.; Dayan, Colin M.

    2017-01-01

    Background Small-scale studies correlated the presence of thyroid autoimmunity with both improved or worsened breast cancer outcome. Objectives We aimed to clarify this association in a large cohort using the phase III, randomized, controlled Taxotere as Adjuvant Chemotherapy Trial (TACT, CRUK01/001). Methods TACT women >18 years old with node-positive or high-risk node-negative early breast cancer (pT1–3a, pN0–1, M0), with stored plasma (n = 1,974), taken 15.5 (median; IQR 7.0–24.0) months after breast surgery were studied. Patients had also received chemotherapy (100%), radiotherapy (1,745/1,974; 88.4%), hormonal therapy (1,378/ 1,974; 69.8%), or trastuzumab (48/1,974; 2.4%). History of thyroid diseases and/or related treatments was not available. The prognostic significance of autoantibodies to thyroid peroxidase (TPOAb; positive ≥6 kIU/L), free-thyroxine and thyrotropin (combined: euthyroid, hypothyroid, hyperthyroid) was evaluated for disease-free survival (DFS), overall-survival (OS), and time-to-recurrence (TTR), with Cox regression models in univariate and multivariable analyses. The extended median follow-up was 97.5 months. Results No difference in DFS was found by TPOAb status (unadjusted hazard ratio [HR]: 0.97, 95%CI: 0.78–1.19; p = 0.75) and/or thyroid function (unadjusted HR [hypothyroid vs. euthyroid]: 1.15, 95% CI: 0.79–1.68; p = 0.46; unadjusted HR [hyperthyroid vs. euthyroid]: 1.14, 95% CI: 0.82–1.61; p = 0.44). Similar results were obtained for OS, TTR, multivariable analyses, when TPOAb titre by tertiles was considered, and in a subgroup of 123 patients with plasma collected before adjuvant treatments. Conclusions No evidence for a prognostic role of TPOAb and/or thyroid function in moderate-to-high-risk early breast cancer was found in the largest and longest observational study to date. PMID:28868260

  6. Genetic Variants in Epigenetic Pathways and Risks of Multiple Cancers in the GAME-ON Consortium.

    PubMed

    Toth, Reka; Scherer, Dominique; Kelemen, Linda E; Risch, Angela; Hazra, Aditi; Balavarca, Yesilda; Issa, Jean-Pierre J; Moreno, Victor; Eeles, Rosalind A; Ogino, Shuji; Wu, Xifeng; Ye, Yuanqing; Hung, Rayjean J; Goode, Ellen L; Ulrich, Cornelia M

    2017-06-01

    Background: Epigenetic disturbances are crucial in cancer initiation, potentially with pleiotropic effects, and may be influenced by the genetic background. Methods: In a subsets (ASSET) meta-analytic approach, we investigated associations of genetic variants related to epigenetic mechanisms with risks of breast, lung, colorectal, ovarian and prostate carcinomas using 51,724 cases and 52,001 controls. False discovery rate-corrected P values (q values < 0.05) were considered statistically significant. Results: Among 162,887 imputed or genotyped variants in 555 candidate genes, SNPs in eight genes were associated with risk of more than one cancer type. For example, variants in BABAM1 were confirmed as a susceptibility locus for squamous cell lung, overall breast, estrogen receptor (ER)-negative breast, and overall prostate, and overall serous ovarian cancer; the most significant variant was rs4808076 [OR = 1.14; 95% confidence interval (CI) = 1.10-1.19; q = 6.87 × 10 -5 ]. DPF1 rs12611084 was inversely associated with ER-negative breast, endometrioid ovarian, and overall and aggressive prostate cancer risk (OR = 0.93; 95% CI = 0.91-0.96; q = 0.005). Variants in L3MBTL3 were associated with colorectal, overall breast, ER-negative breast, clear cell ovarian, and overall and aggressive prostate cancer risk (e.g., rs9388766: OR = 1.06; 95% CI = 1.03-1.08; q = 0.02). Variants in TET2 were significantly associated with overall breast, overall prostate, overall ovarian, and endometrioid ovarian cancer risk, with rs62331150 showing bidirectional effects. Analyses of subpathways did not reveal gene subsets that contributed disproportionately to susceptibility. Conclusions: Functional and correlative studies are now needed to elucidate the potential links between germline genotype, epigenetic function, and cancer etiology. Impact: This approach provides novel insight into possible pleiotropic effects of genes involved in epigenetic processes. Cancer Epidemiol Biomarkers Prev; 26(6); 816-25. ©2017 AACR . ©2017 American Association for Cancer Research.

  7. Identification of a potential tumor differentiation factor receptor candidate in prostate cancer cells.

    PubMed

    Sokolowska, Izabela; Woods, Alisa G; Gawinowicz, Mary Ann; Roy, Urmi; Darie, Costel C

    2012-07-01

    Tumor differentiation factor (TDF) is a pituitary protein that is secreted into the bloodstream and has an endocrine function. TDF and TDF-P1, a 20-residue peptide selected from the ORF of TDF, induce differentiation in human breast and prostate cancer cells, but not in other cells. TDF has no known mechanism of action. In our recent study, we identified heat shock 70 kDa proteins (HSP70s) as TDF receptors (TDF-Rs) in breast cancer cells. Therefore, we sought to investigate whether TDF-R candidates from prostate cancer cells are the same as those identified in breast cancer cells. Here, we used TDF-P1 to purify the potential TDF-R candidates by affinity purification chromatography from DU145 and PC3 steroid-resistant prostate cancer cells, LNCaP steroid-responsive prostate cancer cells, and nonprostate NG108 neuroblastoma and BLK CL.4 fibroblast-like cells. We identified the purified proteins by MS, and validated them by western blotting, immunofluorescence microscopy, immunoaffinity purification chromatography, and structural biology. We identified seven candidate proteins, of which three were from the HSP70 family. These three proteins were validated as potential TDF-R candidates in LNCaP steroid-responsive and in DU145 and PC3 steroid-resistant prostate cancer cells, but not in NG108 neuroblastoma and BLK CL.4 fibroblast-like cells. Our previous study and the current study suggest that GRP78, and perhaps HSP70s, are strong TDF-R candidates, and further suggest that TDF interacts with its receptors exclusively in breast and prostate cells, inducing cell differentiation through a novel, steroid-independent pathway. © 2012 The Authors Journal compilation © 2012 FEBS.

  8. Status of oral ulcerative mucositis and biomarkers to monitor posttraumatic stress disorder effects in breast cancer patients.

    PubMed

    Loo, Wings T Y; Liu, Qing; Yip, Michael C W; Wang, Min; Chow, Louis W C; Cheung, Mary N B; Yip, Adrian Y S; Ng, Elizabeth L Y

    2013-06-28

    This study was designed to assess oral ulcerative mucositis, C-reactive protein, blood pressure, heart rate and thyroid function in breast cancer patients in relation to the occurrence of posttraumatic stress disorder 
(PTSD). A total of 120 female breast cancer patients and women 100 healthy subjects were enrolled in this study. PTSD status was assessed by questionnaire. Before and after treatment (modified radical mastectomy and chemotherapy), serum samples were collected and measured for levels of triiodothyronine (T3), thyroxine (T4), thyroid stimulating hormone (TSH) and high-sensitivity C-reactive protein (hs-CRP) by ELISA. Oral ulcerative mucositis was evaluated by the number and duration of oral ulcers and the degree of pain. Breast cancer patients experienced long-term PTSD and had elevated serum T3 and T4 levels. Patients experienced more severe pain and longer duration of oral ulcers compared with the healthy group. Oral ulcers were significantly associated with PTSD score in terms of the number of ulcers (p=0.0025), the degree of pain (p<0.0001) and the duration of ulcers (p<0.0001). These findings support that thyroid function is altered in breast cancer patients with PTSD. Elevation of T3 and T4 and oral ulcerative mucositis might be indicative of the emotional status of breast cancer patients.

  9. Immunohistochemical study of the neural development transcription factors (TTF1, ASCL1 and BRN2) in neuroendocrine prostate tumours.

    PubMed

    Rodríguez-Zarco, E; Vallejo-Benítez, A; Umbría-Jiménez, S; Pereira-Gallardo, S; Pabón-Carrasco, S; Azueta, A; González-Cámpora, R; Espinal, P S; García-Escudero, A

    2017-10-01

    Prostatic small-cell neuroendocrine carcinoma is an uncommon malignancy that constitutes 0.5-1% of all prostate malignancies. The median cancer-specific survival of patients with prostatic small-cell neuroendocrine carcinoma is 19 months, and 60.5% of the patients have metastatic disease. Neural development transcription factors are molecules involved in the organogenesis of the central nervous system and of neuroendocrine precursors of various tissues, including the suprarenal gland, thyroid glands, lungs and prostate. We present 3 cases of this uncommon condition, applying the new World Health Organisation criteria. We conducted studies through haematoxylin and eosin staining and analysed the expression of the neural development transcription factors achaete-scute homolog like 1, thyroid transcription factor 1 and the class III/IV POU transcription factors, as a new research line in the carcinogenesis of prostatic neuroendocrine tumours. In case 1, there was no TTF1 immunoexpression. Cases 2 and 3 had positive immunostaining for ASCL1, and Case 1 had negative immunostaining. BRN2 immunostaining was negative in case 1 and positive in cases 2 and 3. The World Health Organisation does not recognise any molecular or genetic marker with prognostic value. ASCL-1 is related to the NOTCH and WNT signalling pathways. ASCL-1, TTF1 and BRN2 could be used for early diagnosis and as prognostic factors and therapeutic targets. Copyright © 2017 AEU. All rights reserved.

  10. Dietary Iodine Sufficiency and Moderate Insufficiency in the Lactating Mother and Nursing Infant: A Computational Perspective

    PubMed Central

    Fisher, W.; Wang, Jian; George, Nysia I.; Gearhart, Jeffery M.; McLanahan, Eva D.

    2016-01-01

    The Institute of Medicine recommends that lactating women ingest 290 μg iodide/d and a nursing infant, less than two years of age, 110 μg/d. The World Health Organization, United Nations Children’s Fund, and International Council for the Control of Iodine Deficiency Disorders recommend population maternal and infant urinary iodide concentrations ≥ 100 μg/L to ensure iodide sufficiency. For breast milk, researchers have proposed an iodide concentration range of 150–180 μg/L indicates iodide sufficiency for the mother and infant, however no national or international guidelines exist for breast milk iodine concentration. For the first time, a lactating woman and nursing infant biologically based model, from delivery to 90 days postpartum, was constructed to predict maternal and infant urinary iodide concentration, breast milk iodide concentration, the amount of iodide transferred in breast milk to the nursing infant each day and maternal and infant serum thyroid hormone kinetics. The maternal and infant models each consisted of three sub-models, iodide, thyroxine (T4), and triiodothyronine (T3). Using our model to simulate a maternal intake of 290 μg iodide/d, the average daily amount of iodide ingested by the nursing infant, after 4 days of life, gradually increased from 50 to 101 μg/day over 90 days postpartum. The predicted average lactating mother and infant urinary iodide concentrations were both in excess of 100 μg/L and the predicted average breast milk iodide concentration, 157 μg/L. The predicted serum thyroid hormones (T4, free T4 (fT4), and T3) in both the nursing infant and lactating mother were indicative of euthyroidism. The model was calibrated using serum thyroid hormone concentrations for lactating women from the United States and was successful in predicting serum T4 and fT4 levels (within a factor of two) for lactating women in other countries. T3 levels were adequately predicted. Infant serum thyroid hormone levels were adequately predicted for most data. For moderate iodide deficient conditions, where dietary iodide intake may range from 50 to 150 μg/d for the lactating mother, the model satisfactorily described the iodide measurements, although with some variation, in urine and breast milk. Predictions of serum thyroid hormones in moderately iodide deficient lactating women (50 μg/d) and nursing infants did not closely agree with mean reported serum thyroid hormone levels, however, predictions were usually within a factor of two. Excellent agreement between prediction and observation was obtained for a recent moderate iodide deficiency study in lactating women. Measurements included iodide levels in urine of infant and mother, iodide in breast milk, and serum thyroid hormone levels in infant and mother. A maternal iodide intake of 50 μg/d resulted in a predicted 29–32% reduction in serum T4 and fT4 in nursing infants, however the reduced serum levels of T4 and fT4 were within most of the published reference intervals for infant. This biologically based model is an important first step at integrating the rapid changes that occur in the thyroid system of the nursing newborn in order to predict adverse outcomes from exposure to thyroid acting chemicals, drugs, radioactive materials or iodine deficiency. PMID:26930410

  11. Dietary Iodine Sufficiency and Moderate Insufficiency in the Lactating Mother and Nursing Infant: A Computational Perspective.

    PubMed

    Fisher, W; Wang, Jian; George, Nysia I; Gearhart, Jeffery M; McLanahan, Eva D

    2016-01-01

    The Institute of Medicine recommends that lactating women ingest 290 μg iodide/d and a nursing infant, less than two years of age, 110 μg/d. The World Health Organization, United Nations Children's Fund, and International Council for the Control of Iodine Deficiency Disorders recommend population maternal and infant urinary iodide concentrations ≥ 100 μg/L to ensure iodide sufficiency. For breast milk, researchers have proposed an iodide concentration range of 150-180 μg/L indicates iodide sufficiency for the mother and infant, however no national or international guidelines exist for breast milk iodine concentration. For the first time, a lactating woman and nursing infant biologically based model, from delivery to 90 days postpartum, was constructed to predict maternal and infant urinary iodide concentration, breast milk iodide concentration, the amount of iodide transferred in breast milk to the nursing infant each day and maternal and infant serum thyroid hormone kinetics. The maternal and infant models each consisted of three sub-models, iodide, thyroxine (T4), and triiodothyronine (T3). Using our model to simulate a maternal intake of 290 μg iodide/d, the average daily amount of iodide ingested by the nursing infant, after 4 days of life, gradually increased from 50 to 101 μg/day over 90 days postpartum. The predicted average lactating mother and infant urinary iodide concentrations were both in excess of 100 μg/L and the predicted average breast milk iodide concentration, 157 μg/L. The predicted serum thyroid hormones (T4, free T4 (fT4), and T3) in both the nursing infant and lactating mother were indicative of euthyroidism. The model was calibrated using serum thyroid hormone concentrations for lactating women from the United States and was successful in predicting serum T4 and fT4 levels (within a factor of two) for lactating women in other countries. T3 levels were adequately predicted. Infant serum thyroid hormone levels were adequately predicted for most data. For moderate iodide deficient conditions, where dietary iodide intake may range from 50 to 150 μg/d for the lactating mother, the model satisfactorily described the iodide measurements, although with some variation, in urine and breast milk. Predictions of serum thyroid hormones in moderately iodide deficient lactating women (50 μg/d) and nursing infants did not closely agree with mean reported serum thyroid hormone levels, however, predictions were usually within a factor of two. Excellent agreement between prediction and observation was obtained for a recent moderate iodide deficiency study in lactating women. Measurements included iodide levels in urine of infant and mother, iodide in breast milk, and serum thyroid hormone levels in infant and mother. A maternal iodide intake of 50 μg/d resulted in a predicted 29-32% reduction in serum T4 and fT4 in nursing infants, however the reduced serum levels of T4 and fT4 were within most of the published reference intervals for infant. This biologically based model is an important first step at integrating the rapid changes that occur in the thyroid system of the nursing newborn in order to predict adverse outcomes from exposure to thyroid acting chemicals, drugs, radioactive materials or iodine deficiency.

  12. Effect of Dietary Intake of Stable Iodine on Dose-per-unit-intake Factors for 99Tc

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strom, Daniel J.

    It is well-known that the human thyroid concentrates iodine more than 100 times the concentration in plasma. Also well-known is the fact that large amounts of stable iodine in the diet can limit thyroid uptake of total iodine; this is the basis for administering potassium iodide following a release of radioiodine from a nuclear reactor accident or nuclear weapon detonation. Many researchers have shown enhanced concentrations of both organic and inorganic iodine in saliva and breast milk. Technetium-99 is a long-lived (231,000 year half-life) radionuclide of concern in the management of high-level radioactive waste. There is no doubt that 99Tc,more » if it is in groundwater, will be found in the chemical form of pertechnetate, 99TcO4?. Pertechnetate is a large anion, almost identical in size to iodide, I?. The nuclear medicine literature shows that pertechnetate concentrates in the thyroid, salivary glands, and lactating breast in addition to the stomach, liver, and alimentary tract as currently recognized by the International Commission on Radiological Protection (ICRP). The fact that large intakes of stable iodine (127I) in the diet limit uptake of iodine by the thyroid leads one to generalize that stable iodine in the diet may also limit thyroid uptake of pertechnetate. While there is at least one report that iodine in the diet blocks uptake of 99mTcO4? by the thyroid and salivary glands (which have the same Na/I symporter, the biochemical concentration mechanism), the level of protective effect seen for blocking radioactive iodine is not expected for 99TcO4? because pertechnetate does not become organically bound in the thyroid and thus is not retained for months the way iodide is. While it does account for Tc concentration in the thyroid, the existing ICRP biokinetic model for technetium does not take enhanced concentrations in salivary gland and breast tissue into account. From the survey of the nuclear medicine literature, it is not possible to compute the effect of stable iodine in the diet on the dose per unit intake factors for 99Tc without developing an improved biokinetic model for technetium. Specific experiments should be designed to quantitatively evaluate 99TcO4? metabolism, excretion, and secretion, as well as to evaluate its chemical toxicity It is recommended that the ICRP reexamine its biokinetics models for Tc based on nuclear medicine data that have accumulated over the years. In particular, the ICRP ignores the lactation pathway, the enhanced concentration of Tc in breast and breast milk, and enhanced concentration of Tc (and I) in the salivary glands as well as in the thyroid. The ICRP should also explicitly incorporate the effect of stable iodine in the diet into both its models for iodine and technetium. The effect of concentration of Tc in breast milk needs further study for dosimetric implications to nursing infants whose mothers may ingest 99TcO4? from groundwater sources. The ICRP should also investigate the possibility of enhanced concentration of both I and Tc in the non-lactating female breast. To do these re-evaluations of biokinetic models, new experiments designed specifically to evaluate these questions concerning the biokinetics of Tc and I are needed.« less

  13. Effects of a psychosocial intervention on survival among patients with stage I breast and prostate cancer: a matched case-control study.

    PubMed

    Shrock, D; Palmer, R F; Taylor, B

    1999-05-01

    Psychosocial factors have been linked to the development and progression of cancer and shown to be relevant in cancer care. However, the evidence that psychosocial interventions affect cancer survival is less conclusive. Few methodologically sound studies have addressed this issue. To investigate the effects of a 6-week psychosocial intervention on survival among patients with stage I breast and prostate cancer. Matched case-control. 3 rural hospitals or cancer centers in central Pennsylvania. 21 breast and 29 prostate stage I cancer patients (treatment group) matched with 74 breast and 65 prostate stage I cancer patients from the same hospitals who did not receive the intervention (control group). Six 2-hour health psychology classes conducted by a licensed staff psychologist. Survival time was compared between the 2 groups and with national norms. The intervention group lived significantly longer than did matched controls. At 4- to 7-year follow-up (median = 4.2 years), none of the breast cancer patients in the intervention group died, whereas 12% of those in the control group died. Twice as many matched-control prostate cancer patients died compared with those in the intervention group (28% vs 14%). Control group survival was similar to national norms. These results are consistent with prior clinical trials and suggest that short-term psychosocial interventions that encourage the expression of emotions, provide social support, and teach coping skills can influence survival among cancer patients. However, self-selection bias cannot be ruled out as an alternative explanation for the results. These interventions merit further consideration and research.

  14. Health Screening: What Tests You Need and When

    MedlinePlus

    ... cancer screening if you are considering having a prostate-specific antigen (PSA) test or digital rectal examination (DRE). Sexually ... regular colonoscopy for cancer of the colon, serum prostatic-specific antigen (PSA) for prostate cancer, mammography for breast cancer, ...

  15. The Anti-cancer Activity of Vernonia divaricata Sw against Leukaemia, Breast and Prostate Cancers In Vitro

    PubMed Central

    Lowe, HIC; Daley-Beckford, D; Toyang, NJ; Watson, C; Hartley, S; Bryant, J

    2014-01-01

    Background: Vernonia divaricata is one of five endemic Vernonia species of Jamaica. The ethnomedicinal uses of other species have been established, however, scientific validation of this species has not yet been done and as such this paper is aimed at identifying the anti-cancer activity of V divaricata against leukaemia, breast and prostate cancer cell lines. Methods: Leaves and stems of V divaricata were dried and milled into powder. The crude hexane and methanol extracts of the leaves and stems were obtained and bio-assayed using WST-1 cell proliferation assay against leukaemia, breast and prostate cancer cell lines. Results: The crude hexane and methanol extracts of V divaricata were able to significantly retard the growth of the MCF-7 (breast), HL-60 (leukaemia) and the PC-3 (prostate) cancer cell lines. The crude methanol extract of the stem was the strongest, exhibiting anti-proliferation activity with IC50 values of 10.14, 12.63 and 9.894 μg/ml for the HL-60, MCF-7 and PC-3 cancer cell lines, respectively, with the most potent toward prostate cancer. Conclusion: The medicinal use of V divaricata as an anti-cancer agent was corroborated as the crude hexane and methanol extracts demonstrated potent anti-proliferation activity and as such hold potential for further research and development into a drug to prevent or treat various cancers. PMID:25429469

  16. Invasive cancer incidence - Puerto Rico, 2007-2011.

    PubMed

    O'Neil, Mary Elizabeth; Henley, S Jane; Singh, Simple D; Wilson, Reda J; Ortiz-Ortiz, Karen J; Ríos, Naydi Pérez; Torres Cintrón, Carlos R; Luna, Guillermo Tortolero; Zavala Zegarra, Diego E; Ryerson, A Blythe

    2015-04-17

    Cancer is a leading cause of morbidity and death in Puerto Rico. To set a baseline for identifying new trends and patterns of cancer incidence, Puerto Rico Central Cancer Registry staff and CDC analyzed data from Puerto Rico included in U.S. Cancer Statistics (USCS) for 2007-2011, the most recent data available. This is the first report of invasive cancer incidence rates for 2007-2011 among Puerto Rican residents by sex, age, cancer site, and municipality. Cancer incidence rates in Puerto Rico were compared with those in the U.S. population for 2011. A total of 68,312 invasive cancers were diagnosed and reported in Puerto Rico during 2007-2011. The average annual incidence rate was 330 cases per 100,000 persons. The cancer sites with the highest cancer incidence rates included prostate (152), female breast (84), and colon and rectum (43). Cancer incidence rates varied by municipality, particularly for prostate, lung and bronchus, and colon and rectum cancers. In 2011, cancer incidence rates in Puerto Rico were lower for all cancer sites and lung and bronchus, but higher for prostate and thyroid cancers, compared with rates within the U.S. Identifying these variations can aid evaluation of factors associated with high incidence, such as cancer screening practices, and development of targeted cancer prevention and control efforts. Public health professionals can monitor cancer incidence trends and use these findings to evaluate the impact of prevention efforts, such as legislation prohibiting tobacco use in the workplace and public places and the Puerto Rico Cessation Quitline in decreasing lung and other tobacco-related cancers.

  17. Gender as a Context for Interpreting the Self-Directed Learning Experiences of Prostate and Breast Cancer Patients

    ERIC Educational Resources Information Center

    Rager, Kathleen B.

    2007-01-01

    This article reports the findings from a secondary analysis of the data from two qualitative studies conducted by the researcher regarding the self-directed learning experiences of prostate and breast cancer patients. Of interest were possible differences in the descriptions of the participants' experiences that appear to relate to gender.…

  18. Homeopathic medicines do not alter growth and gene expression in prostate and breast cancer cells in vitro.

    PubMed

    Thangapazham, Rajesh L; Gaddipati, Jaya P; Rajeshkumar, N V; Sharma, Anuj; Singh, Anoop K; Ives, John A; Maheshwari, Radha K; Jonas, Wayne B

    2006-12-01

    Homeopathy is an alternative medical system practiced in all parts of the world. Although several theories are proposed to explain the mechanisms of action, none are scientifically verified. In this study, the authors investigate the effect of selected homeopathic remedies often used to treat prostate and breast cancer. The authors investigated the effect of the homeopathic medicines Conium maculatum, Sabal serrulata, Thuja occidentalis, Asterias, Phytolacca, and Carcinosin on prostate and breast cancer cell (DU-145, LNCaP, MAT-LyLu, MDA-MB-231) growth and on gene expression that regulates apoptosis, using MTT and multiprobe ribonuclease protection assay. None of the homeopathic remedies tested in different potencies produced significant inhibitory or growth-promoting activity in either prostate or breast cancer cells. Also, gene expression studies by ribonuclease protection assay produced no significant changes in mRNA levels of bax, bcl-2, bcl-x, caspase-1, caspase-2, caspase-3, Fas, or FasL after treatment with homeopathic medicines. The results demonstrate that the highly diluted homeopathic remedies used by homeopathic practitioners for cancer show no measurable effects on cell growth or gene expression in vitro using currently available methodologies.

  19. Hypothyroidism and hyperthyroidism and breast cancer risk: a nationwide cohort study.

    PubMed

    Søgaard, Mette; Farkas, Dóra Körmendiné; Ehrenstein, Vera; Jørgensen, Jens Otto Lunde; Dekkers, Olaf M; Sørensen, Henrik Toft

    2016-04-01

    The association between thyroid disease and breast cancer risk remains unclear. We, therefore examined the association between hypothyroidism, hyperthyroidism and breast cancer risk. This was a population-based cohort study. Using nationwide registries, we identified all women in Denmark with a first-time hospital diagnosis of hypothyroidism or hyperthyroidism, 1978-2013. We estimated the excess risk of breast cancer among patients with hypothyroidism or hyperthyroidism compared with the expected risk in the general population, using standardized incidence ratios (SIRs) as a measure of risk ratio. Breast cancer diagnoses in the first 12 months following diagnosis of thyroid disease were excluded from the calculations to avoid diagnostic work-up bias. We included 61, 873 women diagnosed with hypothyroidism and 80, 343 women diagnosed with hyperthyroidism. Median follow-up time was 4.9 years (interquartile range (IQR): 1.8-9.5 years) for hypothyroidism and 7.4 years (IQR: 3.1-13.5 years) for hyperthyroidism. Hyperthyroidism was associated with a slightly increased breast cancer risk compared with the general population (SIR: 1.11, 95% CI: 1.07-1.16), which persisted beyond 5 years of follow-up (SIR: 1.13, 95% CI: 1.08-1.19). In comparison, hypothyroidism was associated with a slightly lower risk of breast cancer (SIR: 0.94, 95% CI: 0.88-1.00). Stratification by cancer stage at diagnosis, estrogen receptor status, age, comorbidity, history of alcohol-related disease and clinical diagnoses of obesity produced little change in cancer risk. We found an increased risk of breast cancer in women with hyperthyroidism and a slightly decreased risk in women with hypothyroidism indicating an association between thyroid function level and breast cancer risk. © 2016 European Society of Endocrinology.

  20. Telomere structure and maintenance gene variants and risk of five cancer types.

    PubMed

    Karami, Sara; Han, Younghun; Pande, Mala; Cheng, Iona; Rudd, James; Pierce, Brandon L; Nutter, Ellen L; Schumacher, Fredrick R; Kote-Jarai, Zsofia; Lindstrom, Sara; Witte, John S; Fang, Shenying; Han, Jiali; Kraft, Peter; Hunter, David J; Song, Fengju; Hung, Rayjean J; McKay, James; Gruber, Stephen B; Chanock, Stephen J; Risch, Angela; Shen, Hongbing; Haiman, Christopher A; Boardman, Lisa; Ulrich, Cornelia M; Casey, Graham; Peters, Ulrike; Amin Al Olama, Ali; Berchuck, Andrew; Berndt, Sonja I; Bezieau, Stephane; Brennan, Paul; Brenner, Hermann; Brinton, Louise; Caporaso, Neil; Chan, Andrew T; Chang-Claude, Jenny; Christiani, David C; Cunningham, Julie M; Easton, Douglas; Eeles, Rosalind A; Eisen, Timothy; Gala, Manish; Gallinger, Steven J; Gayther, Simon A; Goode, Ellen L; Grönberg, Henrik; Henderson, Brian E; Houlston, Richard; Joshi, Amit D; Küry, Sébastien; Landi, Mari T; Le Marchand, Loic; Muir, Kenneth; Newcomb, Polly A; Permuth-Wey, Jenny; Pharoah, Paul; Phelan, Catherine; Potter, John D; Ramus, Susan J; Risch, Harvey; Schildkraut, Joellen; Slattery, Martha L; Song, Honglin; Wentzensen, Nicolas; White, Emily; Wiklund, Fredrik; Zanke, Brent W; Sellers, Thomas A; Zheng, Wei; Chatterjee, Nilanjan; Amos, Christopher I; Doherty, Jennifer A

    2016-12-15

    Telomeres cap chromosome ends, protecting them from degradation, double-strand breaks, and end-to-end fusions. Telomeres are maintained by telomerase, a reverse transcriptase encoded by TERT, and an RNA template encoded by TERC. Loci in the TERT and adjoining CLPTM1L region are associated with risk of multiple cancers. We therefore investigated associations between variants in 22 telomere structure and maintenance gene regions and colorectal, breast, prostate, ovarian, and lung cancer risk. We performed subset-based meta-analyses of 204,993 directly-measured and imputed SNPs among 61,851 cancer cases and 74,457 controls of European descent. Independent associations for SNP minor alleles were identified using sequential conditional analysis (with gene-level p value cutoffs ≤3.08 × 10 -5 ). Of the thirteen independent SNPs observed to be associated with cancer risk, novel findings were observed for seven loci. Across the DCLRE1B region, rs974494 and rs12144215 were inversely associated with prostate and lung cancers, and colorectal, breast, and prostate cancers, respectively. Across the TERC region, rs75316749 was positively associated with colorectal, breast, ovarian, and lung cancers. Across the DCLRE1B region, rs974404 and rs12144215 were inversely associated with prostate and lung cancers, and colorectal, breast, and prostate cancers, respectively. Near POT1, rs116895242 was inversely associated with colorectal, ovarian, and lung cancers, and RTEL1 rs34978822 was inversely associated with prostate and lung cancers. The complex association patterns in telomere-related genes across cancer types may provide insight into mechanisms through which telomere dysfunction in different tissues influences cancer risk. © 2016 UICC.

  1. Predicted Risk of Radiation-Induced Cancers After Involved Field and Involved Node Radiotherapy With or Without Intensity Modulation for Early-Stage Hodgkin Lymphoma in Female Patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weber, Damien C., E-mail: damien.weber@unige.ch; Johanson, Safora; Peguret, Nicolas

    2011-10-01

    Purpose: To assess the excess relative risk (ERR) of radiation-induced cancers (RIC) in female patients with Hodgkin lymphoma (HL) female patients treated with conformal (3DCRT), intensity modulated (IMRT), or volumetric modulated arc (RA) radiation therapy. Methods and Materials: Plans for 10 early-stage HL female patients were computed for 3DCRT, IMRT, and RA with involved field RT (IFRT) and involvednode RT (INRT) radiation fields. Organs at risk dose--volume histograms were computed and inter-compared for IFRT vs. INRT and 3DCRT vs. IMRT/RA, respectively. The ERR for cancer induction in breasts, lungs, and thyroid was estimated using both linear and nonlinear models. Results:more » The mean estimated ERR for breast, lung, and thyroid were significantly lower (p < 0.01) with INRT than with IFRT planning, regardless of the radiation delivery technique used, assuming a linear dose-risk relationship. We found that using the nonlinear model, the mean ERR values were significantly (p < 0.01) increased with IMRT or RA compared to those with 3DCRT planning for the breast, lung, and thyroid, using an IFRT paradigm. After INRT planning, IMRT or RA increased the risk of RIC for lung and thyroid only. Conclusions: In this comparative planning study, using a nonlinear dose--risk model, IMRT or RA increased the estimated risk of RIC for breast, lung, and thyroid for HL female patients. This study also suggests that INRT planning, compared to IFRT planning, may reduce the ERR of RIC when risk is predicted using a linear model. Observing the opposite effect, with a nonlinear model, however, questions the validity of these biologically parameterized models.« less

  2. Older cancer patients in cancer clinical trials are underrepresented. Systematic literature review of almost 5000 meta- and pooled analyses of phase III randomized trials of survival from breast, prostate and lung cancer.

    PubMed

    Dunn, Cita; Wilson, Andrew; Sitas, Freddy

    2017-12-01

    Older people represent increasing proportions of the population with cancer. To understand the representivity of cancer treatments in older people, we performed a systematic literature review using PRISMA guidelines of the age distribution of clinical trial participants for three leading cancer types, namely breast, prostate, and lung. We used PubMed to identify articles detailing meta or pooled-analyses of phase III, randomised controlled trials (RCTs) of survival for breast, prostate and lung cancer, published ≤5 years from 2016. We compared the age distribution of participants to that of these cancers for "More developed regions". 4993 potential papers were identified, but only three papers on breast cancer, three on lung cancer, and none on prostate cancer presented the age distribution of their participants. Except for one paper of breast cancer, participants ≥70 years in all other papers were underrepresented. We recommend the age distribution of patients be clearly reported in all clinical trials, as per guidelines. Clinical trials ought to be more representative of the populations most affected by the disease for which treatments are being tested. This should lead to better knowledge of effectiveness of treatments and better translation of trial results to optimal care of older cancer patients. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Carcinoma showing thymus-like elements of the thyroid gland: report of three cases including one case with breast cancer history.

    PubMed

    Zhang, Guanjun; Liu, Xi; Huang, Wei; Li, Xiaofeng; Johnstone, Marianne; Deng, Yuan; Ke, Yongqiang; Nunes, Quentin M; Wang, Hongyan; Wang, Yili; Zhang, Xuebin

    2015-01-01

    Carcinoma showing thymus-like elements (CASTLE) is a rare malignant tumor of the thyroid or adjacent neck soft tissues, whose histogenesis is still debated. It may resemble other primary or metastatic poorly differentiated tumors histologically and the differential diagnosis is crucial for CASTLE has a better prognosis. However, CASTLE as a second primary tumor has not been reported in the literature. We report three cases of thyroid CASTLE, including a unique tumor following breast-conserving surgery for early-stage breast invasive carcinoma. There were two female and one male. All three tumors were located in the right lobe of the thyroid, and one tumor showed extension into the surrounding soft tissue. Histologically, all tumors showed expansive growth and consisted of cords, nests or sheets of epithelial cells divided into irregularly shaped lobules by fibrous connective tissue with lymphoplasmacytic infiltration. Focal squamous differentiation resembling Hassall's corpuscles were observed. All cases stained positively for CD5, CD117, high molecular weight cytokeratin, cytokeratin, P63, carcinoembryonic antigen and epithelial membrane antigen. Positive staining for Bcl-2 in two cases and chromogranin A in one case was noted. Ki-67 expression ranged from 15 to 25%. Thyroid transcription factor and CD3 were negative. There was no evidence of recurrent or metastatic disease at following surgery. These features demonstrated CASTLE may arise from branchial pouch remnants, the thyroid solid cell nests. CASTLE is a rare entity, awareness of its occurrence as a second primary tumor is important to avoid overtreatment because it is associated with a favorable prognosis.

  4. Oleuropein and hydroxytyrosol protect rats' pups against bisphenol A induced hypothyroidism.

    PubMed

    Mahmoudi, Asma; Ghorbel, Hèla; Feki, Ines; Bouallagui, Zouhaier; Guermazi, Fadhel; Ayadi, Lobna; Sayadi, Sami

    2018-04-27

    Bisphenol A (BPA) can disturb the endocrine system and the organs that respond to endocrine signals in organisms, indirectly exposed during prenatal and/or early postnatal life. The present study was designed to assess the protective effect of phenolic compounds from olive leaves against BPA induced thyroid dysfunction and growth perturbation in young rats during lactation. The BPA disrupting effect on thyroid function was investigated by measuring changes in plasma levels of thyroid hormones. Free triiodothyronine (FT3) and thyroxine (FT4) were decreased in young rats breast-fed from mothers treated with bisphenol A. This effect was associated with an increase in the plasma level of thyroid-stimulating hormone (TSH). The histological and immunohistochemical study of the thyroid gland revealed a disturbance in morphological structure and thyroid cells function. Thyroid dysfunction led to a disruption in the skeletal bone growth of young rats. In fact, the infrared microspectroscopic analysis and histological examination of femoral bone showed significant changes in their histoarchitecture associated with a perturbation in the mechanism of bone tissue mineralization. The administration of oleuropein or hydroxytyrosol in BPA treated lactating mothers improved the thyroid cells function by enhancing thyroid hormone levels. Moreover, these phenolics increased the body growth characterized by an amelioration in the structure and the microstructure of femoral bone tissue. HPLC analysis of rats-breast milk indicated the presence of oleuropein and hydroxytyrosol, which could contribute to the protective effect against bisphenol A induced hypothyroidism in pups rats. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  5. Cancer incidence in the Middle Eastern population of California, 1988-2004.

    PubMed

    Nasseri, Kiumarss; Mills, Paul K; Allan, Mark

    2007-01-01

    International statistics suggest lower cancer incidence in the Middle East and Middle Eastern (ME) immigrants in Europe, Australia, and Canada, but little is known from the United States. This study compares cancer rates in ME population with other race/ethnic groups in California from 1988 through 2004. ME cases in California cancer registry were identified by surname and ME population was estimated from U.S. Census data. Cancer rates for ME countries was obtained from Globocan. The ME incidence rate ratios for all sites combined in male and female were 0.77 and 0.82, respectively and were statistically significant. ME rates were significantly lower for cancers of the colon, lung, skin melanoma, female breast and prostate, and were significantly higher for cancers of the stomach, liver, thyroid, leukemia, and male breast. Cancer incidence in ME population in California was 2.4 times higher than rates in home countries. Incidence trends in ME males remained fairly stable but in females shows a slight decline in recent years. Cancer incidence in ME population is lower than non-Hispanic white and non-Hispanic Black, but is higher than rates for Hispanics and Asians, and ME countries. Improved data quality, chronic infections, acculturation, and access to screening services are some of the factors responsible for the observed pattern.

  6. Cancer Incidence in the Middle Eastern Population of California, 1988–2004

    PubMed Central

    Nasseri, Kiumarss; Mills, Paul K; Allan, Mark

    2008-01-01

    International statistics suggest lower cancer incidence in the Middle East and Middle Eastern (ME) immigrants in Europe, Australia, and Canada, but little is known from the United States. This study compares cancer rates in ME population with other race/ethnic groups in California from 1988 through 2004. ME cases in California cancer registry were identified by surname and ME population was estimated from U.S. Census data. Cancer rates for ME countries was obtained from Globocan. The ME incidence rate ratios for all sites combined in male and female were 0.77 and 0.82, respectively and were statistically significant. ME rates were significantly lower for cancers of the colon, lung, skin melanoma, female breast and prostate, and were significantly higher for cancers of the stomach, liver, thyroid, leukemia, and male breast. Cancer incidence in ME population in California was 2.4 times higher than rates in home countries. Incidence trends in ME males remained fairly stable but in females shows a slight decline in recent years. Cancer incidence in ME population is lower than non-Hispanic white and non-Hispanic Black, but is higher than rates for Hispanics and Asians, and ME countries. Improved data quality, chronic infections, acculturation, and access to screening services are some of the factors responsible for the observed patterns. PMID:18159978

  7. Cancer risk factors in Korean news media: a content analysis.

    PubMed

    Kye, Su Yeon; Kwon, Jeong Hyun; Kim, Yong-Chan; Shim, Minsun; Kim, Jee Hyun; Cho, Hyunsoon; Jung, Kyu Won; Park, Keeho

    2015-01-01

    Little is known about the news coverage of cancer risk factors in Korea. This study aimed to examine how the news media encompasses a wide array of content regarding cancer risk factors and related cancer sites, and investigate whether news coverage of cancer risk factors is congruent with the actual prevalence of the disease. A content analysis was conducted on 1,138 news stories covered during a 5-year period between 2008 and 2012. The news stories were selected from nationally representative media in Korea. Information was collected about cancer risk factors and cancer sites. Of various cancer risk factors, occupational and environmental exposures appeared most frequently in the news. Breast cancer was mentioned the most in relation to cancer sites. Breast, cervical, prostate, and skin cancer were overrepresented in the media in comparison to incidence and mortality cases, whereas lung, thyroid, liver, and stomach cancer were underrepresented. To our knowledge, this research is the first investigation dealing with news coverage about cancer risk factors in Korea. The study findings show occupational and environmental exposures are emphasized more than personal lifestyle factors; further, more prevalent cancers in developed countries have greater media coverage, not reflecting the realities of the disease. The findings may help health journalists and other health storytellers to develop effective ways to communicate cancer risk factors.

  8. Multivalent Immunogenic Vaccines for Treating Prostate and Breast Cancer | NCI Technology Transfer Center | TTC

    Cancer.gov

    Researchers at the NCI have developed a treatment for prostate and breast cancer using multivalent peptides derived from TARP, the T cell receptor gamma alternate reading frame protein. These immunogenic peptides from TARP elicit an immune response, triggering T cells to kill only the cancer cells within a patient. NCI seeks licensees or co-development partners to commercialize this invention.

  9. Impact of general practitioners' sex and age on systematic recommendation for cancer screening.

    PubMed

    Eisinger, François; Pivot, Xavier; Coscas, Yvan; Viguier, Jérôme; Calazel-Benque, Anne; Blay, Jean-Yves; Roussel, Claire; Morère, Jean-François

    2011-01-01

    Characteristics of primary-care providers have been associated with their patients' participation in breast cancer screening. A nationwide observational survey, 'EDIFICE', was conducted by telephone from December 2007 to January 2008 on a representative sample of 600 general practitioners (GPs) working in France, to investigate how a GP's characteristics may influence patient participation in screening for breast, colorectal and prostate cancer. For breast cancer screening, systematic recommendation was associated with female physicians [odds ratio (OR) =1.9; 95% confidence interval (CI) 1.2-3.1]. This systematic recommendation was also correlated with systematic referral for colorectal cancer (OR=1.5; 95% CI=1.0-2.5) and prostate cancer screening (OR=2.7; 95% CI=1.8-4.1). For colorectal cancer screening, the sex of the GP had no significant impact. However, systematic recommendation for both breast and prostate cancer screening was shown to be associated with systematic recommendation for colorectal cancer screening (OR=2.7; 95% CI=1.6-4.7 and OR=1.8; 95% CI=1.1-3.0, respectively). For prostate cancer screening, there was no significant sex specificity. However, systematic recommendation for both breast and colorectal cancer screening was associated with an advice on prostate cancer screening (OR=2.9; 95% CI=2.0-4.4 and OR=2.0; 95% CI=1.3-3.2, respectively). The age of the GP was not associated with a higher rate of systematic recommendation for screening for the three types of cancer. Male GPs were more likely than female GPs to perform digital rectal examinations on male patients (69 vs. 54%; OR=1.86; 95% CI=1.31-2.63). There is a global pattern of physicians being screening-prone (as suggested by the cross impact of recommendations from one cancer type to another). Although the frequency of systematic recommendation for breast cancer screening is higher with female GPs, systematic recommendation for prostate cancer is not higher among male GPs. The factors associated with systematic recommendation for screening are both a matter of concern and a target for action, to improve adherence of individuals through GP commitment.

  10. Higher thyrotropin concentration is associated with increased incidence of colorectal cancer in older men.

    PubMed

    Chan, Yi X; Alfonso, Helman; Chubb, Stephen Anthony Paul; Fegan, Peter Gerard; Hankey, Graeme J; Golledge, Jonathan; Flicker, Leon; Yeap, Bu B

    2017-02-01

    Thyroid hormones regulate cellular survival and metabolism; however, their association with cancer incidence and death has not been well explored. Our aim was to examine the relationship between thyrotropin (TSH) and free thyroxine (FT4) with cancer incidence (all cancers, prostate, colorectal and lung cancer). Associations with cancer-related deaths were also explored. A prospective cohort study involving community-dwelling men aged 70-89 years. Thyroid hormones were measured in 3836 men between 2001 and 2004. Competing risks analyses were used to perform longitudinal analyses with results expressed as subhazard ratios (SHR). Outcomes were ascertained through electronic linkage until 20 June 2013. Mean age was 77·0 ± 3·6 years. A total of 864 men developed cancers, and 506 experienced cancer-related deaths. A total of 340, 136 and 119 men developed prostate, colorectal and lung cancers, respectively. After adjustments, there were no associations between TSH and incidence of all cancers, prostate or lung cancer. Higher TSH was associated with increased colorectal cancer incidence (SHR = 1·19, 95% CI 1·00-1·42; P = 0·048 for every 1 SD increase in log TSH). This association was strengthened after excluding the first year of follow-up (SHR = 1·23, 95% CI 1·02-1·48, P = 0·028). FT4 was not associated with incidence of all cancers, prostate, colorectal or lung cancer. Thyroid hormones were not associated with cancer-related deaths. In community-dwelling older men, FT4 was not associated with cancer incidence. Higher TSH is independently associated with increased incidence of colorectal cancer. Further investigation is warranted to determine whether a causal relationship exists. © 2016 John Wiley & Sons Ltd.

  11. ANX7 as a Bio-Marker in Prostate and Breast Cancer Progression

    PubMed Central

    Srivastava, Meera; Bubendorf, Lukas; Nolan, Lisa; Glasman, Mirta; Leighton, Ximena; Miller, Georgina; Fehrle, Wilfred; Raffeld, Mark; Eidelman, Ofer; Kallioniemi, Olli P.; Srivastava, Shiv; Pollard, Harvey B.

    2001-01-01

    The ANX7 gene codes for a Ca2+-activated GTPase, which has been implicated in both exocytotic secretion in cells and control of growth. In this review, we summarize information regarding increased tumor frequency in the Anx7 knockout mice, ANX7 growth suppression of human cancer cell lines, and ANX7 expression in human tumor tissue micro-arrays. The loss of ANX7 is significant in metastatic and hormone refractory prostate cancer compared to benign prostatic hyperplasia. In addition, ANX7 expression has prognostic value for predicting survival of breast cancer patients. PMID:11673658

  12. Endocrine-Disrupting Chemicals: An Endocrine Society Scientific Statement

    PubMed Central

    Diamanti-Kandarakis, Evanthia; Bourguignon, Jean-Pierre; Giudice, Linda C.; Hauser, Russ; Prins, Gail S.; Soto, Ana M.; Zoeller, R. Thomas; Gore, Andrea C.

    2009-01-01

    There is growing interest in the possible health threat posed by endocrine-disrupting chemicals (EDCs), which are substances in our environment, food, and consumer products that interfere with hormone biosynthesis, metabolism, or action resulting in a deviation from normal homeostatic control or reproduction. In this first Scientific Statement of The Endocrine Society, we present the evidence that endocrine disruptors have effects on male and female reproduction, breast development and cancer, prostate cancer, neuroendocrinology, thyroid, metabolism and obesity, and cardiovascular endocrinology. Results from animal models, human clinical observations, and epidemiological studies converge to implicate EDCs as a significant concern to public health. The mechanisms of EDCs involve divergent pathways including (but not limited to) estrogenic, antiandrogenic, thyroid, peroxisome proliferator-activated receptor γ, retinoid, and actions through other nuclear receptors; steroidogenic enzymes; neurotransmitter receptors and systems; and many other pathways that are highly conserved in wildlife and humans, and which can be modeled in laboratory in vitro and in vivo models. Furthermore, EDCs represent a broad class of molecules such as organochlorinated pesticides and industrial chemicals, plastics and plasticizers, fuels, and many other chemicals that are present in the environment or are in widespread use. We make a number of recommendations to increase understanding of effects of EDCs, including enhancing increased basic and clinical research, invoking the precautionary principle, and advocating involvement of individual and scientific society stakeholders in communicating and implementing changes in public policy and awareness. PMID:19502515

  13. Geographical Variations and Trends in Major Cancer Incidences throughout Korea during 1999-2013.

    PubMed

    Won, Young-Joo; Jung, Kyu-Won; Oh, Chang-Mo; Park, Eun-Hye; Kong, Hyun-Joo; Lee, Duk Hyoung; Lee, Kang Hyun

    2018-01-04

    We aimed to describe the temporal trends and district-level geographical variations in cancer incidences throughout Korea during 1999-2013. Data were obtained from the Korean National Cancer Incidence Database. We calculated the age-standardized cumulative cancer incidences according to sex and geographical region (metropolitan cities, provinces, and districts) for three 5-year periods (1999-2003, 2004-2008, and 2009-2013). Each quintile interval contained the same number of regions. Disease maps were created to visualize regional differences in the cancer incidences. Substantial differences in cancer incidences were observed according to district and cancer type. The largest variations between geographical regions were found for thyroid cancer among both men and women. There was little variation in the incidences of stomach, colorectal, and lung cancer according to geographical region. Substantially elevated incidences of specific cancers were observed in Jeollanam-do (thyroid); Daejeon (colorectum); Jeollanam-do, Gyeongsangbuk-do, and Chungcheongbuk-do (lung); Seocho-gu, Gangnam-gu, and Seongnam, Bundang-gu (breast and prostate); Chungcheong and Gyeongsang provinces (stomach); Ulleung-gun and the southern districts of Gyeongsangnam-do and Jeollanam-do (liver); and along the Nakdonggang River (gallbladder and biliary tract). Mapping regional cancer incidences in Korea allowed us to compare the results according to geographical region. Our results may facilitate the development of infrastructure for systematic cancer incidence monitoring, which could promote the planning and implementation of region-specific cancer management programs.

  14. Progress against cancer in the Netherlands since the late 1980s: an epidemiological evaluation.

    PubMed

    Karim-Kos, Henrike E; Kiemeney, Lambertus A L M; Louwman, Marieke W J; Coebergh, Jan Willem W; de Vries, Esther

    2012-06-15

    Progress against cancer through prevention and treatment is often measured by survival statistics only instead of analyzing trends in incidence, survival and mortality simultaneously because of interactive influences. This study combines these parameters of major cancers to provide an overview of the progress achieved in the Netherlands since 1989 and to establish in which areas action is needed. The population-based Netherlands Cancer Registry and Statistics Netherlands provided incidence, 5-year relative survival and mortality of 23 major cancer types. Incidence, survival and mortality changes were calculated as the estimated annual percentage change. Optimal progress was defined as decreasing incidence and/or improving survival accompanied by declining mortality, and deterioration as increasing incidence and/or deteriorating survival accompanied by increasing mortality rates. Optimal progress was observed in 12 of 19 cancer types among males: laryngeal, lung, stomach, gallbladder, colon, rectal, bladder, prostate and thyroid cancer, leukemia, Hodgkin and non-Hodgkin lymphoma. Among females, optimal progress was observed in 12 of 21 cancers: stomach, gallbladder, colon, rectal, breast, cervical, uterus, ovarian and thyroid cancer, leukemia, Hodgkin and non-Hodgkin lymphoma. Deterioration occurred in three cancer types among males: skin melanoma, esophageal and kidney cancer, and among females six cancer types: skin melanoma, oral cavity, pharyngeal, esophageal, pancreatic and lung cancer. Our conceptual framework limits misinterpretations from separate trends and generates a more balanced discussion on progress. Copyright © 2011 UICC.

  15. Breast and prostate cancer productivity costs: a comparison of the human capital approach and the friction cost approach.

    PubMed

    Hanly, Paul; Timmons, Aileen; Walsh, Paul M; Sharp, Linda

    2012-05-01

    Productivity costs constitute a substantial proportion of the total societal costs associated with cancer. We compared the results of applying two different analytical methods--the traditional human capital approach (HCA) and the emerging friction cost approach (FCA)--to estimate breast and prostate cancer productivity costs in Ireland in 2008. Data from a survey of breast and prostate cancer patients were combined with population-level survival estimates and a national wage data set to calculate costs of temporary disability (cancer-related work absence), permanent disability (workforce departure, reduced working hours), and premature mortality. For breast cancer, productivity costs per person using the HCA were € 193,425 and those per person using the FCA were € 8,103; for prostate cancer, the comparable estimates were € 109,154 and € 8,205, respectively. The HCA generated higher costs for younger patients (breast cancer) because of greater lifetime earning potential. In contrast, the FCA resulted in higher productivity costs for older male patients (prostate cancer) commensurate with higher earning capacity over a shorter time period. Reduced working hours postcancer was a key driver of total HCA productivity costs. HCA costs were sensitive to assumptions about discount and growth rates. FCA costs were sensitive to assumptions about the friction period. The magnitude of the estimates obtained in this study illustrates the importance of including productivity costs when considering the economic impact of illness. Vastly different results emerge from the application of the HCA and the FCA, and this finding emphasizes the importance of choosing the study perspective carefully and being explicit about assumptions that underpin the methods. Copyright © 2012 International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier Inc. All rights reserved.

  16. Predictors of Medicare costs in elderly beneficiaries with breast, colorectal, lung, or prostate cancer.

    PubMed

    Penberthy, L; Retchin, S M; McDonald, M K; McClish, D K; Desch, C E; Riley, G F; Smith, T J; Hillner, B E; Newschaffer, C J

    1999-07-01

    Determining the apportionment of costs of cancer care and identifying factors that predict costs are important for planning ethical resource allocation for cancer care, especially in markets where managed care has grown. This study linked tumor registry data with Medicare administrative claims to determine the costs of care for breast, colorectal, lung and prostate cancers during the initial year subsequent to diagnosis, and to develop models to identify factors predicting costs. Patients with a diagnosis of breast (n = 1,952), colorectal (n = 2,563), lung (n = 3,331) or prostate cancer (n = 3,179) diagnosed from 1985 through 1988. The average costs during the initial treatment period were $12,141 (s.d. = $10,434) for breast cancer, $24,910 (s.d. = $14,870) for colorectal cancer, $21,351 (s.d. = $14,813) for lung cancer, and $14,361 (s.d. = $11,216) for prostate cancer. Using least squares regression analysis, factors significantly associated with cost included comorbidity, hospital length of stay, type of therapy, and ZIP level income for all four cancer sites. Access to health care resources was variably associated with costs of care. Total R2 ranged from 38% (prostate) to 49% (breast). The prediction error for the regression models ranged from < 1% to 4%, by cancer site. Linking administrative claims with state tumor registry data can accurately predict costs of cancer care during the first year subsequent to diagnosis for cancer patients. Regression models using both data sources may be useful to health plans and providers and in determining appropriate prospective reimbursement for cancer, particularly with increasing HMO penetration and decreased ability to capture complete and accurate utilization and cost data on this population.

  17. Development, implementation, and compliance of treatment pathways in radiation medicine.

    PubMed

    Potters, Louis; Raince, Jadeep; Chou, Henry; Kapur, Ajay; Bulanowski, Daniel; Stanzione, Regina; Lee, Lucille

    2013-01-01

    While much emphasis on safety in the radiation oncology clinic is placed on process, there remains considerable opportunity to increase safety, enhance outcomes, and avoid ad hoc care by instituting detailed treatment pathways. The purpose of this study was to review the process of developing evidence and consensus-based, outcomes-oriented treatment pathways that standardize treatment and patient management in a large multi-center radiation oncology practice. Further, we reviewed our compliance in incorporating these directives into our day-to-day clinical practice. Using the Institute of Medicine guideline for developing treatment pathways, 87 disease specific pathways were developed and incorporated into the electronic medical system in our multi-facility radiation oncology department. Compliance in incorporating treatment pathways was assessed by mining our electronic medical records (EMR) data from January 1, 2010 through February 2012 for patients with breast and prostate cancer. This retrospective analysis of data from EMR found overall compliance to breast and prostate cancer treatment pathways to be 97 and 99%, respectively. The reason for non-compliance proved to be either a failure to complete the prescribed care based on grade II or III toxicity (n = 1 breast, 3 prostate) or patient elected discontinuance of care (n = 1 prostate) or the physician chose a higher dose for positive/close margins (n = 3 breast). This study demonstrates that consensus and evidence-based treatment pathways can be developed and implemented in a multi-center department of radiation oncology. And that for prostate and breast cancer there was a high degree of compliance using these directives. The development and implementation of these pathways serve as a key component of our safety program, most notably in our effort to facilitate consistent decision-making and reducing variation between physicians.

  18. Cancer survival in Cali, Colombia: A population-based study, 1995-2004

    PubMed Central

    García, Luz Stella; Collazos, Paola Andrea

    2014-01-01

    Background: There is limited information on population-based cancer survival data in Latin America. Objetive: To obtain estimates of survival for some cancers recognized as a public health priority in Colombia using data from the Cancer Registry of Cali for 1995-2004. Methods: All cancer cases for residents of Cali were included for the following sites: breast (3,984), cervix uteri (2,469), prostate (3,999), stomach (3,442) and lung (2,170). Five-year relative survival estimates were calculated using the approach described by Estève. Results: Five-year relative survival was 79% in patients with prostate cancer and 68% and 60% in women with breast or cervix uteri cancer, respectively. The cure fraction was close to zero in subjects with lung cancer and less than 10% in those with stomach cancer. The probability of dying from breast or prostate cancer in people in the lower socio-economic strata (SES) was 1.8 and 2.6 times, respectively, when compared to upper SES, p <0.001. Excess mortality associated with cancer was independent of age in prostate or breast cancer. After adjusting for age, sex and SES, the risk of dying from breast, cervix uteri, prostate and lung cancer during the 2000-2004 period decreased 19%, 13%, 48% and 16%, respectively, when compared with the period of 1995-1999. There was no change in the prognosis for patients with stomach cancer. Conclusions: Survival for some kinds of cancer improved through the 1995-2004 period, however health care programs for cancer patients in Cali are inequitable. People from lower SES are the most vulnerable and the least likely to survive. PMID:25386036

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tyldesley, Scott, E-mail: styldesl@bccancer.bc.c; Delaney, Geoff; Foroudi, Farshad

    Purpose: Estimates of the need for radiotherapy (RT) using different methods (criterion based benchmarking [CBB]and the Canadian [C-EBEST]and Australian [A-EBEST]epidemiologically based estimates) exist for various cancer sites. We compared these model estimates to actual RT rates for lung, breast, and prostate cancers in British Columbia (BC). Methods and Materials: All cases of lung, breast, and prostate cancers in BC from 1997 to 2004 and all patients receiving RT within 1 year (RT{sub 1Y}) and within 5 years (RT{sub 5Y}) of diagnosis were identified. The RT{sub 1Y} and RT{sub 5Y} proportions in health regions with a cancer center for the mostmore » recent year were then calculated. RT rates were compared with CBB and EBEST estimates of RT needs. Variation was assessed by time and region. Results: The RT{sub 1Y} in regions with a cancer center for lung, breast, and prostate cancers were 51%, 58%, and 33% compared with 45%, 57%, and 32% for C-EBEST and 41%, 61%, and 37% for CBB models. The RT{sub 5Y} rates in regions with a cancer center for lung, breast, and prostate cancers were 59%, 61%, and 40% compared with 61%, 66%, and 61% for C-EBEST and 75%, 83%, and 60% for A-EBEST models. The RT{sub 1Y} rates increased for breast and prostate cancers. Conclusions: C-EBEST and CBB model estimates are closer to the actual RT rates than the A-EBEST estimates. Application of these model estimates by health care decision makers should be undertaken with an understanding of the methods used and the assumptions on which they were based.« less

  20. Thyroid disorders and breast cancer risk in Asian population: a nationwide population-based case-control study in Taiwan.

    PubMed

    Weng, Chien-Hsiang; Chen, Yi-Huei; Lin, Ching-Heng; Luo, Xun; Lin, Tseng-Hsi

    2018-03-30

    To evaluate whether hyperthyroidism or hypothyroidism increases the risk of subsequent breast cancer in an Asian population. Nationwide population-based case-control study. All healthcare facilities in Taiwan. A total of 103 466 women (mean age 53.3 years) were enrolled. 51 733 adult women with newly diagnosed primary breast cancer without a previous cancer history between 2006 and 2011 were identified and included in our study. 51 733 women with no cancer diagnosis prior to the index date were age matched as controls. Diagnosis of hyperthyroidism or hypothyroidism prior to the diagnosis of breast cancer or the same index date was identified, age, histories of thyroid disease treatment, oestrogen use and radioactive iodine treatment were adjusted. To identify risk differences in developing breast cancer among patients with a medical history of hyperthyroidism or hypothyroidism. There was a significantly increased risk of breast cancer in women with hyperthyroidism under the age of 55 years (age <45: OR 1.16, P=0.049; age 45-55: OR 1.15, P=0.019). Patients with hypothyroidism also showed an increased risk of breast cancer (OR 1.19, P=0.029) without statistical significance after stratification by age group (age <45, 45-55, >55 years). Treatment for thyroid disorders did not alter the association in subgroup analyses (P=0.857; 0.262, respectively). Asian women under 55 years of age with history of hyperthyroidism have a significantly increased risk of breast cancer regardless of treatment. Women with history of hypothyroidism may also have an increased risk. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  1. Angiogenesis Inhibitors

    MedlinePlus

    ... Leukemia Liver Cancer Lung Cancer Lymphoma Pancreatic Cancer Prostate Cancer Skin Cancer Thyroid Cancer Uterine Cancer All Cancer ... as vascular endothelial growth factor (VEGF) , bind to receptors on the surface of normal endothelial cells. When ...

  2. Radiotherapy wait times for patients with a diagnosis of invasive cancer, 1992-2000.

    PubMed

    Johnston, Grace M; MacGarvie, Vicki L; Elliott, David; Dewar, Ron A D; MacIntyre, Maureen M; Nolan, Maureen C

    2004-06-01

    To study the wait times for cancer patients from the time of diagnosis to consultation with a radiation oncologist (T1), from consultation to radiotherapy (T2) and from diagnosis to radiotherapy (T3) in the context of treatment practices and measurement issues. From 1992 to 2000, we studied 6585 Nova Scotian patients over the age of 24 years with a diagnosis of breast, lung, colorectal or prostate cancer who received radiotherapy within 1 year of diagnosis. Multivariate analyses examined associations between wait time and diagnosis year, age, sex, median household income (MHI), distance to the cancer centre and extent of disease. Univariate findings reported are median times and interquartile ranges. The T3 was 16 weeks for breast and colorectal cancer, 6 weeks for lung cancer and 18 weeks for prostate cancer. The greatest T1 decrease over time was for prostate cancer: 13-8 weeks (hazards ratio [HR] = 1.07, 95% confidence interval [CI] = 1.05-1.10). The T2 increased for all cancers, and the T3 increased from 5 to 7 weeks for lung cancer, from 17 to 22 weeks for prostate cancer and from 10 to 18 weeks for breast cancer, with no change for colorectal cancer. The T3 decreased by age for breast cancer (HR = 1.12, CI = 1.10-1.14) and prostate cancer (HR = 1.07, CI = 1.02-1.11), showed no consistent association with distance to a cancer centre and varied by extent of disease. Patients with localized lung disease had a longer T3 than those with distant disease, but the opposite results were noted for patients with breast cancer. The T3 was greater for regional than distant disease in lung and breast cancers. Sex and MHI had no effect. Wait times reflected clinical practice, and there were no adverse patterns related to age, sex, income or distance from a cancer centre.

  3. Medicare Spending for Breast, Prostate, Lung, and Colorectal Cancer Patients in the Year of Diagnosis and Year of Death.

    PubMed

    Chen, Christopher T; Li, Ling; Brooks, Gabriel; Hassett, Michael; Schrag, Deborah

    2017-07-26

    To characterize spending patterns for Medicare patients with incident breast, prostate, lung, and colorectal cancer. 2007-2012 data from the Surveillance, Epidemiology, and End Results Program linked with Medicare fee-for-service claims. We calculate per-patient monthly and yearly mean and median expenditures, by cancer type, stage at diagnosis, and spending category, over the years of diagnosis and death. Over the year of diagnosis, mean spending was $35,849, $26,295, $55,597, and $63,063 for breast, prostate, lung, and colorectal cancer, respectively. Over the year of death, spending was similar across different cancer types and stage at diagnosis. Characterization of Medicare spending according to clinically meaningful categories may assist development of oncology alternative payment models and cost-effectiveness models. © Health Research and Educational Trust.

  4. Nanoparticles as Theranostic Vehicles in Experimental and Clinical Applications—Focus on Prostate and Breast Cancer

    PubMed Central

    Elgqvist, Jörgen

    2017-01-01

    Prostate and breast cancer are the second most and most commonly diagnosed cancer in men and women worldwide, respectively. The American Cancer Society estimates that during 2016 in the USA around 430,000 individuals were diagnosed with one of these two types of cancers, and approximately 15% of them will die from the disease. In Europe, the rate of incidences and deaths are similar to those in the USA. Several different more or less successful diagnostic and therapeutic approaches have been developed and evaluated in order to tackle this issue and thereby decrease the death rates. By using nanoparticles as vehicles carrying both diagnostic and therapeutic molecular entities, individualized targeted theranostic nanomedicine has emerged as a promising option to increase the sensitivity and the specificity during diagnosis, as well as the likelihood of survival or prolonged survival after therapy. This article presents and discusses important and promising different kinds of nanoparticles, as well as imaging and therapy options, suitable for theranostic applications. The presentation of different nanoparticles and theranostic applications is quite general, but there is a special focus on prostate cancer. Some references and aspects regarding breast cancer are however also presented and discussed. Finally, the prostate cancer case is presented in more detail regarding diagnosis, staging, recurrence, metastases, and treatment options available today, followed by possible ways to move forward applying theranostics for both prostate and breast cancer based on promising experiments performed until today. PMID:28531102

  5. Ultrasound elastographic techniques in focal liver lesions

    PubMed Central

    Conti, Clara Benedetta; Cavalcoli, Federica; Fraquelli, Mirella; Conte, Dario; Massironi, Sara

    2016-01-01

    Elastographic techniques are new ultrasound-based imaging techniques developed to estimate tissue deformability/stiffness. Several ultrasound elastographic approaches have been developed, such as static elastography, transient elastography and acoustic radiation force imaging methods, which include point shear wave and shear wave imaging elastography. The application of these methods in clinical practice aims at estimating the mechanical tissues properties. One of the main settings for the application of these tools has been liver stiffness assessment in chronic liver disease, which has been studied mainly using transient elastography. Another field of application for these techniques is the assessment of focal lesions, detected by ultrasound in organs such as pancreas, prostate, breast, thyroid, lymph nodes. Considering the frequency and importance of the detection of focal liver lesions through routine ultrasound, some studies have also aimed to assess the role that elestography can play in studying the stiffness of different types of liver lesions, in order to predict their nature and thus offer valuable non-invasive methods for the diagnosis of liver masses. PMID:26973405

  6. Ultrasound elastographic techniques in focal liver lesions.

    PubMed

    Conti, Clara Benedetta; Cavalcoli, Federica; Fraquelli, Mirella; Conte, Dario; Massironi, Sara

    2016-03-07

    Elastographic techniques are new ultrasound-based imaging techniques developed to estimate tissue deformability/stiffness. Several ultrasound elastographic approaches have been developed, such as static elastography, transient elastography and acoustic radiation force imaging methods, which include point shear wave and shear wave imaging elastography. The application of these methods in clinical practice aims at estimating the mechanical tissues properties. One of the main settings for the application of these tools has been liver stiffness assessment in chronic liver disease, which has been studied mainly using transient elastography. Another field of application for these techniques is the assessment of focal lesions, detected by ultrasound in organs such as pancreas, prostate, breast, thyroid, lymph nodes. Considering the frequency and importance of the detection of focal liver lesions through routine ultrasound, some studies have also aimed to assess the role that elestography can play in studying the stiffness of different types of liver lesions, in order to predict their nature and thus offer valuable non-invasive methods for the diagnosis of liver masses.

  7. Public health implications from COGS and potential for risk stratification and screening.

    PubMed

    Burton, Hilary; Chowdhury, Susmita; Dent, Tom; Hall, Alison; Pashayan, Nora; Pharoah, Paul

    2013-04-01

    The PHG Foundation led a multidisciplinary program, which used results from COGS research identifying genetic variants associated with breast, ovarian and prostate cancers to model risk-stratified prevention for breast and prostate cancers. Implementing such strategies would require attention to the use and storage of genetic information, the development of risk assessment tools, new protocols for consent and programs of professional education and public engagement.

  8. Multiple Loci With Different Cancer Specificities Within the 8q24 Gene Desert

    PubMed Central

    Song, Honglin; Koessler, Thibaud; Al Olama, Ali Amin; Kote-Jarai, Zsofia; Driver, Kristy E.; Pooley, Karen A.; Ramus, Susan J.; Kjaer, Susanne Krüger; Hogdall, Estrid; DiCioccio, Richard A.; Whittemore, Alice S.; Gayther, Simon A.; Giles, Graham G.; Guy, Michelle; Edwards, Stephen M.; Morrison, Jonathan; Donovan, Jenny L.; Hamdy, Freddie C.; Dearnaley, David P.; Ardern-Jones, Audrey T.; Hall, Amanda L.; O'Brien, Lynne T.; Gehr-Swain, Beatrice N.; Wilkinson, Rosemary A.; Brown, Paul M.; Hopper, John L.; Neal, David E.; Pharoah, Paul D. P.; Ponder, Bruce A. J.; Eeles, Rosalind A.; Easton, Douglas F.; Dunning, Alison M.

    2008-01-01

    Recent studies based on genome-wide association, linkage, and admixture scan analysis have reported associations of various genetic variants in 8q24 with susceptibility to breast, prostate, and colorectal cancer. This locus lies within a 1.18-Mb region that contains no known genes but is bounded at its centromeric end by FAM84B and at its telomeric end by c-MYC, two candidate cancer susceptibility genes. To investigate the associations of specific loci within 8q24 with specific cancers, we genotyped the nine previously reported cancer-associated single-nucleotide polymorphisms across the region in four case–control sets of prostate (1854 case subjects and 1894 control subjects), breast (2270 case subjects and 2280 control subjects), colorectal (2299 case subjects and 2284 control subjects), and ovarian (1975 case subjects and 3411 control subjects) cancer. Five different haplotype blocks within this gene desert were specifically associated with risks of different cancers. One block was solely associated with risk of breast cancer, three others were associated solely with the risk of prostate cancer, and a fifth was associated with the risk of prostate, colorectal, and ovarian cancer, but not breast cancer. We conclude that there are at least five separate functional variants in this region. PMID:18577746

  9. Do cancer-specific websites meet patient's information needs?

    PubMed

    Warren, Emily; Footman, Katharine; Tinelli, Michela; McKee, Martin; Knai, Cécile

    2014-04-01

    To evaluate commonly used cancer websites' information provision, we developed and applied an Information Comprehensiveness Tool to breast and prostate cancer websites. We first collated questions from a systematic literature review on patient information needs. We then classified the questions in terms of spectrum of care, theme, and nature of question. "Breast cancer" and "prostate cancer" were typed into Google, and websites listed on the first page of results were selected. Two researchers, blind to each others' scores, assessed the same websites using the coding system. Each question was scored on a 3-point scale as not (0%), partially (50%) and fully (100%) answered by two researchers. Average scores were calculated across all questions. Inter-rater reliability was assessed. We identified 79 general, 5 breast, and 5 prostate cancer questions. Inter-rater reliability was good, with an intraclass coefficient of 0.756 (95% CIs 0.729-0.781). 17 questions were not answered thoroughly by any website. Questions about "future planning", "monitoring", and "decision-making" were discussed least. Biomedical questions scored highest. More comprehensive information needs to be provided on breast and prostate cancer websites. This ICT can improve cancer information online and enable patients to engage more actively regarding their information needs. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  10. Prevention of Gynecomastia and Breast Pain Caused by Androgen Deprivation Therapy in Prostate Cancer: Tamoxifen or Radiotherapy?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arruda Viani, Gustavo, E-mail: gusviani@gmail.com; Bernardes da Silva, Lucas Godoi; Stefano, Eduardo Jose

    Purpose: To determine, in a meta-analysis, whether gynecomastia and breast pain rates in men with prostate cancer treated with androgen deprivation therapy (ADT) are reduced if treated with prophylactic radiotherapy (RT) or tamoxifen (TMX). Methods and Materials: The MEDLINE, EMBASE, CANCERLIT, and Cochrane Library databases, as well as proceedings of annual meetings, were systematically searched to identify randomized, controlled studies comparing RT or TMX with observation for men with prostate cancer using ADT. Results: Six RCTs (three RT trials and three TMX trials, N = 777 patients total) were identified that met the study criteria. Pooled results from these RCTsmore » comparing RT vs. observation showed a significant reduction in the incidence of gynecomastia and breast pain rates in patients treated with RT (odds ratio [OR] = 0.21, 95% confidence interval [CI] = 0.12-0.37, p < 0.0001, and OR = 0.34, 95% CI 0.20-0.57, p < 0.0001, respectively). Use of RT resulted in an absolute risk reduction (ARR) of 29.4% and 19.9%, with a number needed to treat (NNT) of 3.4 and 5 to avoid one case of gynecomastia and breast pain, respectively. Pooled results from trials comparing TMX vs. observation showed a statistical benefit for breast pain and gynecomastia in favor of TMX arms (OR = 0.04, 95% CI = 0.02-0.08, p < 0.0001 and OR = 0.07, 95% CI = 0.0-0.14, p < 0.00001). TMX resulted in an ARR = 64.1% and 47.6%, with an NNT of 1.56 and 2.1 to avoid one case of gynecomastia and breast pain, respectively. Considering adverse effects, TMX was 6 times more adverse effects than RT. Conclusions: Our data have shown that both TMX and RT prevented gynecomastia and breast pain in patients with prostate cancer receiving ADT for prostate cancer. Although TMX was two times more effective in preventing gynecomastia, RT should represent an effective and safe treatment option, to take into account mainly in patients with cardiovascular risk factors or thrombotic diathesis.« less

  11. Coffee, tea, caffeine intake, and the risk of cancer in the PLCO cohort.

    PubMed

    Hashibe, Mia; Galeone, Carlotta; Buys, Saundra S; Gren, Lisa; Boffetta, Paolo; Zhang, Zuo-Feng; La Vecchia, Carlo

    2015-09-01

    The association between coffee intake, tea intake and cancer has been extensively studied, but associations are not established for many cancers. Previous studies are not consistent on whether caffeine may be the source of possible associations between coffee and cancer risk. In the Prostate, Lung, Colorectal, and Ovarian cancer screening trial, of the 97,334 eligible individuals, 10,399 developed cancer. Cancers included were 145 head and neck, 99 oesophageal, 136 stomach, 1137 lung, 1703 breast, 257 endometrial, 162 ovarian, 3037 prostate, 318 kidney, 398 bladder, 103 gliomas, and 106 thyroid. Mean coffee intake was higher in lower education groups, among current smokers, among heavier and longer duration smokers, and among heavier alcohol drinkers. Coffee intake was not associated with the risk of all cancers combined (RR=1.00, 95% confidence interval (CI)=0.96-1.05), whereas tea drinking was associated with a decreased risk of cancer overall (RR=0.95, 95% CI=0.94-0.96 for 1+ cups per day vs <1 cup per day). For endometrial cancer, a decreased risk was observed for coffee intake (RR=0.69, 95% CI=0,52-0.91 for ⩾2 cups per day). Caffeine intake was not associated with cancer risk in a dose-response manner. We observed a decreased risk of endometrial cancer for coffee intake, and a decreased risk of cancer overall with tea intake.

  12. Sex hormone-dependent tRNA halves enhance cell proliferation in breast and prostate cancers.

    PubMed

    Honda, Shozo; Loher, Phillipe; Shigematsu, Megumi; Palazzo, Juan P; Suzuki, Ryusuke; Imoto, Issei; Rigoutsos, Isidore; Kirino, Yohei

    2015-07-21

    Sex hormones and their receptors play critical roles in the development and progression of the breast and prostate cancers. Here we report that a novel type of transfer RNA (tRNA)-derived small RNA, termed Sex HOrmone-dependent TRNA-derived RNAs (SHOT-RNAs), are specifically and abundantly expressed in estrogen receptor (ER)-positive breast cancer and androgen receptor (AR)-positive prostate cancer cell lines. SHOT-RNAs are not abundantly present in ER(-) breast cancer, AR(-) prostate cancer, or other examined cancer cell lines from other tissues. ER-dependent accumulation of SHOT-RNAs is not limited to a cell culture system, but it also occurs in luminal-type breast cancer patient tissues. SHOT-RNAs are produced from aminoacylated mature tRNAs by angiogenin-mediated anticodon cleavage, which is promoted by sex hormones and their receptors. Resultant 5'- and 3'-SHOT-RNAs, corresponding to 5'- and 3'-tRNA halves, bear a cyclic phosphate (cP) and an amino acid at the 3'-end, respectively. By devising a "cP-RNA-seq" method that is able to exclusively amplify and sequence cP-containing RNAs, we identified the complete repertoire of 5'-SHOT-RNAs. Furthermore, 5'-SHOT-RNA, but not 3'-SHOT-RNA, has significant functional involvement in cell proliferation. These results have unveiled a novel tRNA-engaged pathway in tumorigenesis of hormone-dependent cancers and implicate SHOT-RNAs as potential candidates for biomarkers and therapeutic targets.

  13. Sex hormone-dependent tRNA halves enhance cell proliferation in breast and prostate cancers

    PubMed Central

    Honda, Shozo; Loher, Phillipe; Shigematsu, Megumi; Palazzo, Juan P.; Suzuki, Ryusuke; Imoto, Issei; Rigoutsos, Isidore; Kirino, Yohei

    2015-01-01

    Sex hormones and their receptors play critical roles in the development and progression of the breast and prostate cancers. Here we report that a novel type of transfer RNA (tRNA)-derived small RNA, termed Sex HOrmone-dependent TRNA-derived RNAs (SHOT-RNAs), are specifically and abundantly expressed in estrogen receptor (ER)-positive breast cancer and androgen receptor (AR)-positive prostate cancer cell lines. SHOT-RNAs are not abundantly present in ER− breast cancer, AR− prostate cancer, or other examined cancer cell lines from other tissues. ER-dependent accumulation of SHOT-RNAs is not limited to a cell culture system, but it also occurs in luminal-type breast cancer patient tissues. SHOT-RNAs are produced from aminoacylated mature tRNAs by angiogenin-mediated anticodon cleavage, which is promoted by sex hormones and their receptors. Resultant 5′- and 3′-SHOT-RNAs, corresponding to 5′- and 3′-tRNA halves, bear a cyclic phosphate (cP) and an amino acid at the 3′-end, respectively. By devising a “cP-RNA-seq” method that is able to exclusively amplify and sequence cP-containing RNAs, we identified the complete repertoire of 5′-SHOT-RNAs. Furthermore, 5′-SHOT-RNA, but not 3′-SHOT-RNA, has significant functional involvement in cell proliferation. These results have unveiled a novel tRNA-engaged pathway in tumorigenesis of hormone-dependent cancers and implicate SHOT-RNAs as potential candidates for biomarkers and therapeutic targets. PMID:26124144

  14. Stages of Pancreatic Neuroendocrine Tumors

    MedlinePlus

    ... Leukemia Liver Cancer Lung Cancer Lymphoma Pancreatic Cancer Prostate Cancer Skin Cancer Thyroid Cancer Uterine Cancer All Cancer ... also called nuclear magnetic resonance imaging (NMRI). Somatostatin receptor scintigraphy : A type of radionuclide scan that may ...

  15. Treatment Options for Pancreatic Neuroendocrine Tumors

    MedlinePlus

    ... Leukemia Liver Cancer Lung Cancer Lymphoma Pancreatic Cancer Prostate Cancer Skin Cancer Thyroid Cancer Uterine Cancer All Cancer ... also called nuclear magnetic resonance imaging (NMRI). Somatostatin receptor scintigraphy : A type of radionuclide scan that may ...

  16. Dose distribution in the thyroid gland following radiation therapy of breast cancer--a retrospective study.

    PubMed

    Johansen, S; Reinertsen, K V; Knutstad, K; Olsen, D R; Fosså, S D

    2011-06-09

    To relate the development of post-treatment hypothyroidism with the dose distribution within the thyroid gland in breast cancer (BC) patients treated with loco-regional radiotherapy (RT). In two groups of BC patients postoperatively irradiated by computer tomography (CT)-based RT, the individual dose distributions in the thyroid gland were compared with each other; Cases developed post-treatment hypothyroidism after multimodal treatment including 4-field RT technique. Matched patients in Controls remained free for hypothyroidism. Based on each patient's dose volume histogram (DVH) the volume percentages of the thyroid absorbing respectively 20, 30, 40 and 50 Gy were then estimated (V20, V30, V40 and V50) together with the individual mean thyroid dose over the whole gland (MeanTotGy). The mean and median thyroid dose for the included patients was about 30 Gy, subsequently the total volume of the thyroid gland (VolTotGy) and the absolute volumes (cm3) receiving respectively <30 Gy and ≥30 Gy were calculated (Vol<30 and Vol≥30) and analyzed. No statistically significant inter-group differences were found between V20, V30, V40 and V50Gy or the median of MeanTotGy. The median VolTotGy in Controls was 2.3 times above VolTotGy in Cases (ρ=0.003), with large inter-individual variations in both groups. The volume of the thyroid gland receiving<30 Gy in Controls was almost 2.5 times greater than the comparable figure in Cases. We concluded that in patients with small thyroid glands after loco-radiotherapy of BC, the risk of post-treatment hypothyroidism depends on the volume of the thyroid gland.

  17. Iodine stimulates estrogen receptor singling and its systemic level is increased in surgical patients due to topical absorption.

    PubMed

    He, Shaohua; Wang, Bingchan; Lu, Xiyi; Miao, Suyu; Yang, Fengming; Zava, Theodore; Ding, Qiang; Zhang, Shijiang; Liu, Jiayin; Zava, David; Shi, Yuenian Eric

    2018-01-02

    Iodine is crucial for thyroid hormone production. However, recent epidemiologic studies have shown that breast cancer patients have an elevated risk of developing thyroid cancer and vice versa. A notable finding in this study is that iodine stimulated the transcriptional activity of estrogen receptor-α (ER-α) in breast cancer cells. Iodine stimulated expression of several ER-α regulated gene including PS2 , Cathepsin D , CyclinD1 , and PR both in vitro and in nude mice, which is consistent with its stimulation of both anchorage-dependent and -independent growth of ER-α positive breast cancer cells and the effect to dampen tumor shrinkage of MCF-7 xenograft in ovariectomized nude mice. Analyses of clinical urine samples from breast cancer patients undergoing surgery demonstrated that urinary iodine levels were significantly higher than that in controls; and this increased level is due to the antiseptic use of iodine during breast surgery. The present study indicates that excess iodine intake may be an unfavorable factor in breast cancer by stimulation of ER-α transcriptional activity.

  18. The Estrogen Receptor and Its Variants as Risk Factors in Breast Cancer

    DTIC Science & Technology

    2000-11-01

    34Materials and Methods." observation that the ratio of SRA:AIB I is also significantly increased PCR products were separated on 6% acrylamide gels. which...prostate cancer Gerry Coetzee: Androgen receptor CAG repeat length and breast and prostate cancer risk 1030 COFFEE 1100 Session 2 - Receptor structure...Parker: Role of p160 coactivators in transcriptional activation by estrogen receptors and cross-coupling to other signalling pathways 1550 COFFEE 1615

  19. [Lymph node and distant metastases of thyroid gland cancer. Metastases in the thyroid glands].

    PubMed

    Schmid, K W

    2015-11-01

    The different biological features of the various major entities of thyroid cancer, e.g. papillary, follicular, poorly differentiated, anaplastic and medullary, depend to a large extent on their different metastatic spread. Papillary thyroid cancer (PTC) has a propensity for cervical lymphatic spread that occurs in 20-50 % of patients whereas distant metastasis occurs in < 5 % of cases. Cervical lymphadenopathy may be the first symptom particularly of (micro) PTC. In contrast follicular thyroid cancer (FTC) has a marked propensity for vascular but not lymphatic invasion and 10-20 % of FTC develop distant metastases. At the time of diagnosis approximately one third of medullary thyroid cancer (MTC) cases show lymph node metastases, in 10-15 % distant metastases and 25 % develop metastases during the course of the disease. Poorly differentiated (PDTC) and anaplastic thyroid cancer (ATC) spread via both lymphatic and vascular invasion. Thus distant metastases are relatively uncommon in DTC and when they occur, long-term stable disease is the typical clinical course. The major sites of distant metastases are the lungs and bone. Metastases to the brain, breasts, liver, kidneys, muscle and skin are relatively rare or even rare. The thyroid gland itself can be a site of metastases from a variety of other tumors. In autopsy series of patients with disseminated cancer disease, metastases to the thyroid gland were found in up to 10 % of cases. Metastases from other primary tumors to the thyroid gland have been reported in 1.4-3 % of patients who have surgery for suspected cancer of the thyroid gland. The most common primary cancers that metastasize to the thyroid gland are renal cell (48.1 %), colorectal (10.4 %), lung (8.3 %) and breast cancer (7.8 %) and surprisingly often sarcomas (4.0 %).

  20. Efficacy of tamoxifen and radiotherapy for prevention and treatment of gynaecomastia and breast pain caused by bicalutamide in prostate cancer: a randomised controlled trial.

    PubMed

    Perdonà, Sisto; Autorino, Riccardo; De Placido, Sabino; D'Armiento, Massimo; Gallo, Antonio; Damiano, Rocco; Pingitore, Domenico; Gallo, Luigi; De Sio, Marco; Bianco, Angelo Raffaele; Di Lorenzo, Giuseppe

    2005-05-01

    Gynaecomastia and breast pain are frequent adverse events with bicalutamide monotherapy, and might cause some patients to withdraw from treatment. We aimed to compare tamoxifen with radiotherapy for prevention and treatment of gynaecomastia, breast pain, or both during bicalutamide monotherapy for prostate cancer. 51 patients were randomly assigned to 150 mg bicalutamide per day, 50 patients to 150 mg bicalutamide per day and to 10 mg tamoxifen per day for 24 weeks, and 50 patients to 150 mg bicalutamide per day and radiotherapy (one 12-Gy fraction on the day of starting bicalutamide). 35 of the 51 patients allocated bicalutamide alone developed gynaecomastia or breast pain and were subsequently randomly allocated to tamoxifen (n=17) or radiotherapy (n=18) soon after symptoms started (median 180 days, range 160-195). Gynaecomastia and breast pain were assessed once a month. Severity of gynaecomastia was scored on the basis of the largest diameter. Breast pain was scored as none, mild, moderate, or severe. The primary outcome was frequency of gynaecomastia or breast pain; secondary outcomes were safety and tolerability, relapse-free survival, as assessed by concentration of prostate specific antigen, and quality of life. Analyses were by intention to treat. 35 of 51 patients assigned bicalutamide alone developed gynaecomastia, compared with four of 50 assigned bicalutamide and tamoxifen (odds ratio [OR] 0.1 [95% CI 0.08-0.12], p=0.0009), and with 17 of 50 assigned bicalutamide and radiotherapy (0.51 [0.47-0.54], p=0.008). Breast pain was seen in 29 of 51 patients allocated bicalutamide alone, compared with three allocated bicalutamide and tamoxifen (0.1 [0.07-0.11], p=0.009), and with 15 allocated bicalutamide and radiotherapy (0.43 [0.40-0.45], p=0.02) In 35 patients assigned bicalutamide alone who subsequently developed gynaecomastia, breast pain, or both, tamoxifen significantly reduced the frequency of gynaecomastia (0.2 [0.18-0.22], p=0.02). Antioestrogen treatment with tamoxifen could help patients with prostate cancer to tolerate the hypergonadotropic effects of bicalutamide monotherapy.

  1. Involved Node, Site, Field and Residual Volume Radiotherapy for Lymphoma: A Comparison of Organ at Risk Dosimetry and Second Malignancy Risks.

    PubMed

    Murray, L; Sethugavalar, B; Robertshaw, H; Bayman, E; Thomas, E; Gilson, D; Prestwich, R J D

    2015-07-01

    Recent radiotherapy guidelines for lymphoma have included involved site radiotherapy (ISRT), involved node radiotherapy (INRT) and irradiation of residual volume after full-course chemotherapy. In the absence of late toxicity data, we aim to compare organ at risk (OAR) dose-metrics and calculated second malignancy risks. Fifteen consecutive patients who had received mediastinal radiotherapy were included. Four radiotherapy plans were generated for each patient using a parallel pair photon technique: (i) involved field radiotherapy (IFRT), (ii) ISRT, (iii) INRT, (iv) residual post-chemotherapy volume. The radiotherapy dose was 30 Gy in 15 fractions. The OARs evaluated were: breasts, lungs, thyroid, heart, oesophagus. Relative and absolute second malignancy rates were estimated using the concept of organ equivalent dose. Significance was defined as P < 0.005. Compared with ISRT, IFRT significantly increased doses to lung, thyroid, heart and oesophagus, whereas INRT and residual volume techniques significantly reduced doses to all OARs. The relative risks of second cancers were significantly higher with IFRT compared with ISRT for lung, breast and thyroid; INRT and residual volume resulted in significantly lower relative risks compared with ISRT for lung, breast and thyroid. The median excess absolute risks of second cancers were consistently lowest for the residual technique and highest for IFRT in terms of thyroid, lung and breast cancers. The risk of oesophageal cancer was similar for all four techniques. Overall, the absolute risk of second cancers was very similar for ISRT and INRT. Decreasing treatment volumes from IFRT to ISRT, INRT or residual volume reduces radiation exposure to OARs. Second malignancy modelling suggests that this reduction in treatment volumes will lead to a reduction in absolute excess second malignancy. Little difference was observed in second malignancy risks between ISRT and INRT, supporting the use of ISRT in the absence of a pre-chemotherapy positron emission tomography scan in the radiotherapy treatment position. Copyright © 2015 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved.

  2. GATA-3 and FOXA1 expression is useful to differentiate breast carcinoma from other carcinomas.

    PubMed

    Davis, Drew G; Siddiqui, Momin T; Oprea-Ilies, Gabriela; Stevens, Keith; Osunkoya, Adeboye O; Cohen, Cynthia; Li, Xiaoxian Bill

    2016-01-01

    GATA-3, a member of the GATA family of zinc-finger DNA binding proteins, and FOXA1, a member of the forkhead transcription factor family, are both associated with estrogen receptor expression. Both GATA-3 and FOXA1 are useful markers for breast carcinoma, but their expression in the different breast cancer subtypes and other neoplasms has not been thoroughly evaluated. We examined the expression of GATA-3 and FOXA1 in estrogen receptor-positive, Her2/neu-positive, and triple-negative breast carcinomas as well as in 10 other common carcinomas, including hepatocellular, colonic, pancreatic, gastric, endometrial (endometrioid), lung, prostatic, renal cell, urothelial, and ovarian serous carcinomas. Primary and metastatic melanomas and mesotheliomas were also evaluated. GATA-3 and FOXA1 staining of estrogen receptor-positive breast carcinomas was seen in 96.6% and 96.2%, respectively. In triple-negative breast carcinomas, GATA-3 and FOXA1 staining was seen in 21.6% and 15.9%, respectively. Among the other tumors, GATA-3 staining was only seen in urothelial carcinoma (70.9%) and FOXA1 staining was only seen in prostatic (87.5%), urothelial (5.1%) carcinomas, and mesotheliomas (40.0%). In conclusion, GATA-3 and FOXA1 are excellent breast carcinoma markers; however, their utility is limited in the triple-negative subtype. The utility of FOXA1 in diagnosing prostatic carcinoma and mesothelioma warrants further investigation. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Study of Serum Total PSA and Free PSA as an Oncological Marker in Breast Tumour.

    PubMed

    Jahir, Elteza Tahjiba; Devi, Runi; Borthakur, Bibhuti Bhushan

    2017-03-01

    Breast Cancer (BC) cases are rising alarmingly all over the world and India is not an exception. This rising trend is due to an increased age at first child birth, decreased breast feeding, and the changing lifestyle mostly in urban India. With the advent of more sensitive methodologies and research works in this field, it has been suggested that Prostate Specific Antigen (PSA) plays an important role in the pathogenesis of breast cancer besides other established tumour markers. To study the molecular forms of PSA-total and free PSA in benign and malignant tumours and to analyse their association with the tumour burden. The present study was conducted in collaboration with Gauhati Medical College and Hospital and Dr B Borooah Cancer Institute, Guwahati, Assam, India. Women in the age group of 18-65 years with recently diagnosed tumour (benign/malignant) in the breast were included in the study. Women taking Oral Contraceptive Pill (OCP), hormone replacement therapy, with past/present history of gynaecological/other malignancy and chronic endocrine disease like diabetes, thyroid disorders were excluded. The case group comprised of 50 female subjects with newly diagnosed Benign Breast Disease (BBD) and 50 subjects with BC, while 50 age matched healthy females without any signs and symptoms of breast discomfort were included in the control group. Laboratory tests done were Serum Total PSA (TPSA), Free PSA (FPSA), Fasting Blood Glucose (FBS), serum urea, serum creatinine and fasting lipid profile. TPSA and FPSA was measured again in both the test groups after 10-14 days of surgery/therapy. A fall in postoperative value of total and free PSA in BC case group was noticed. In Grade I tumours the mean value of total PSA (1.813 ng/ml) and free PSA (1.149 ng/ml) were higher than those with Grade III tumours (TPSA-1.07 ng/ml and FPSA-1.002 ng/ml). Mean value of Fasting Blood Sugar (FBG), total cholesterol and Low Density Lipoprotein (LDL) in BC case group was higher than the control group. From the study, we can conclude PSA as a possible new marker for diagnosis and prognosis of BC.

  4. Prostate-derived Ets factor, an oncogenic driver in breast cancer.

    PubMed

    Sood, Ashwani K; Geradts, Joseph; Young, Jessica

    2017-05-01

    Prostate-derived Ets factor (PDEF), a member of the Ets family of transcription factors, differs from other family members in its restricted expression in normal tissues and its unique DNA-binding motif. These interesting attributes coupled with its aberrant expression in cancer have rendered PDEF a focus of increasing interest by tumor biologists. This review provides a current understanding of the characteristics of PDEF expression and its role in breast cancer. The bulk of the evidence is consistent with PDEF overexpression in most breast tumors and an oncogenic role for this transcription factor in breast cancer. In addition, high PDEF expression in estrogen receptor-positive breast tumors showed significant correlation with poor overall survival in several independent cohorts of breast cancer patients. Together, these findings demonstrate PDEF to be an oncogenic driver of breast cancer and a biomarker of poor prognosis in this cancer. Based on this understanding and the limited expression of PDEF in normal human tissues, the development of PDEF-based therapeutics for prevention and treatment of breast cancer is also discussed.

  5. Adjuvant Immunotherapy for Patients at High Risk of Recurrence Following Radiation Therapy for Prostate Cancer

    DTIC Science & Technology

    2005-08-01

    with breast cancer cells along with experiments conducted with cervical- HPV , lewis lung and avian influenza cells have shown the DEISSEROTH, Albert...vaccination strategies may be useful for the development of vaccines for cancers of the breast, lung, colon, ovary, prostate, endometrium, and cervix ... cancer cells bearing the TAA.7,16 We studied 2 types of TAA in this vector vaccination strategy: the human papillomavirus ( HPV ) E7 foreign antigen

  6. Skeletal effects of carcinoma of the breast and prostate.

    PubMed Central

    Percival, R. C.

    1986-01-01

    Recent research has led to improved understanding of the pathology of skeletal metastases in carcinoma of the breast and prostate. Several humoral mechanisms have been identified which have both primary and secondary consequences on skeletal metabolism and probably depend on the complex interplay of a number of factors derived from tumour tissues. An improved understanding of these interactions may lead to new approaches in the management of these common disorders. Images Fig. 1 PMID:3789624

  7. Characterization of tumor differentiation factor (TDF) and its receptor (TDF-R).

    PubMed

    Sokolowska, Izabela; Woods, Alisa G; Gawinowicz, Mary Ann; Roy, Urmi; Darie, Costel C

    2013-08-01

    Tumor differentiation factor (TDF) is an under-investigated protein produced by the pituitary with no definitive function. TDF is secreted into the bloodstream and targets the breast and prostate, suggesting that it has an endocrine function. Initially, TDF was indirectly discovered based on the differentiation effect of alkaline pituitary extracts of the mammosomatotropic tumor MtTWlO on MTW9/PI rat mammary tumor cells. Years later, the cDNA clone responsible for this differentiation activity was isolated from a human pituitary cDNA library using expression cloning. The cDNA encoded a 108-amino-acid polypeptide that had differentiation activity on MCF7 breast cancer cells and on DU145 prostate cancer cells in vitro and in vivo. Recently, our group focused on identification of the TDF receptor (TDF-R). As potential TDF-R candidates, we identified the members of the Heat Shock 70-kDa family of proteins (HSP70) in both MCF7 and BT-549 human breast cancer cells (HBCC) and PC3, DU145, and LNCaP human prostate cancer cells (HPCC), but not in HeLa cells, NG108 neuroblastoma, or HDF-a and BLK CL.4 cells fibroblasts or fibroblast-like cells. Here we review the current advances on TDF, with particular focus on the structural investigation of its receptor and on its functional effects on breast and prostate cells.

  8. Neurobehavioral and Thyroid Evaluations of Rats Developmentally Exposed to Tris(1,3-dichloro-2-propyl)phosphate(TDCPP)

    EPA Science Inventory

    TDCPP is an organophosphate flame retardant with widespread usage and documented human exposures through food, inhalation, dust ingestion, and breast milk. Findings of decreased neural proliferation in cell culture and abnormal development and altered thyroid hormones in larval z...

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aznar, Marianne C., E-mail: marianne.camille.aznar@regionh.dk; Faculty of Sciences, Niels Bohr Institute, and Faculty of Health Sciences, University of Copenhagen, Copenhagen; Maraldo, Maja V.

    Purpose: Hodgkin lymphoma (HL) survivors have an increased risk of cardiovascular disease (CD), lung cancer, and breast cancer. We investigated the risk for the development of CD and secondary lung, breast, and thyroid cancer after radiation therapy (RT) delivered with deep inspiration breath-hold (DIBH) compared with free-breathing (FB) using 3-dimensional conformal RT (3DCRT) and intensity modulated RT (IMRT). The aim of this study was to determine which treatment modality best reduced the combined risk of life-threatening late effects in patients with mediastinal HL. Methods and Materials: Twenty-two patients with early-stage mediastinal HL were eligible for the study. Treatment plans weremore » calculated with both 3DCRT and IMRT on both DIBH and FB planning computed tomographic scans. We reported the estimated dose to the heart, lung, female breasts, and thyroid and calculated the estimated life years lost attributable to CD and to lung, breast, and thyroid cancer. Results: DIBH lowered the estimated dose to heart and lung regardless of delivery technique (P<.001). There was no significant difference between IMRT-FB and 3DCRT-DIBH in mean heart dose, heart V20Gy, and lung V20Gy. The mean breast dose was increased with IMRT regardless of breathing technique. Life years lost was lowest with DIBH and highest with FB. Conclusions: In this cohort, 3DCRT-DIBH resulted in lower estimated doses and lower lifetime excess risks than did IMRT-FB. Combining IMRT and DIBH could be beneficial for a subgroup of patients.« less

  10. Dietary conjugated linoleic acid and long-chain n-3 fatty acids in mammary and prostate cancer protection: a review.

    PubMed

    Heinze, Verónica M; Actis, Adriana B

    2012-02-01

    The role of dietary fatty acids on cancer is still controversial. To examine the current literature on the protective role of conjugated linoleic acid (CLA) and marine long-chain fatty acids [eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA)] and the risk of breast and prostate cancer, data from 41 case-control and cohort studies and relevant in vitro and animal experiments were included in this 2000-2010 revision. Epidemiological studies on CLA intake or its tissue concentration related to breast and prostate tumorigenesis are not conclusive; EPA and DHA intake have shown important inverse associations just in some studies. Additional research on the analysed association is required.

  11. American Thyroid Association Statement on Remote-Access Thyroid Surgery

    PubMed Central

    Bernet, Victor; Fahey, Thomas J.; Kebebew, Electron; Shaha, Ashok; Stack, Brendan C.; Stang, Michael; Steward, David L.; Terris, David J.

    2016-01-01

    Background: Remote-access techniques have been described over the recent years as a method of removing the thyroid gland without an incision in the neck. However, there is confusion related to the number of techniques available and the ideal patient selection criteria for a given technique. The aims of this review were to develop a simple classification of these approaches, describe the optimal patient selection criteria, evaluate the outcomes objectively, and define the barriers to adoption. Methods: A review of the literature was performed to identify the described techniques. A simple classification was developed. Technical details, outcomes, and the learning curve were described. Expert opinion consensus was formulated regarding recommendations for patient selection and performance of remote-access thyroid surgery. Results: Remote-access thyroid procedures can be categorized into endoscopic or robotic breast, bilateral axillo-breast, axillary, and facelift approaches. The experience in the United States involves the latter two techniques. The limited data in the literature suggest long operative times, a steep learning curve, and higher costs with remote-access thyroid surgery compared with conventional thyroidectomy. Nevertheless, a consensus was reached that, in appropriate hands, it can be a viable option for patients with unilateral small nodules who wish to avoid a neck incision. Conclusions: Remote-access thyroidectomy has a role in a small group of patients who fit strict selection criteria. These approaches require an additional level of expertise, and therefore should be done by surgeons performing a high volume of thyroid and robotic surgery. PMID:26858014

  12. American Thyroid Association Statement on Remote-Access Thyroid Surgery.

    PubMed

    Berber, Eren; Bernet, Victor; Fahey, Thomas J; Kebebew, Electron; Shaha, Ashok; Stack, Brendan C; Stang, Michael; Steward, David L; Terris, David J

    2016-03-01

    Remote-access techniques have been described over the recent years as a method of removing the thyroid gland without an incision in the neck. However, there is confusion related to the number of techniques available and the ideal patient selection criteria for a given technique. The aims of this review were to develop a simple classification of these approaches, describe the optimal patient selection criteria, evaluate the outcomes objectively, and define the barriers to adoption. A review of the literature was performed to identify the described techniques. A simple classification was developed. Technical details, outcomes, and the learning curve were described. Expert opinion consensus was formulated regarding recommendations for patient selection and performance of remote-access thyroid surgery. Remote-access thyroid procedures can be categorized into endoscopic or robotic breast, bilateral axillo-breast, axillary, and facelift approaches. The experience in the United States involves the latter two techniques. The limited data in the literature suggest long operative times, a steep learning curve, and higher costs with remote-access thyroid surgery compared with conventional thyroidectomy. Nevertheless, a consensus was reached that, in appropriate hands, it can be a viable option for patients with unilateral small nodules who wish to avoid a neck incision. Remote-access thyroidectomy has a role in a small group of patients who fit strict selection criteria. These approaches require an additional level of expertise, and therefore should be done by surgeons performing a high volume of thyroid and robotic surgery.

  13. Treatment Option Overview (Pancreatic Neuroendocrine Tumors / Islet Cell Tumors)

    MedlinePlus

    ... Leukemia Liver Cancer Lung Cancer Lymphoma Pancreatic Cancer Prostate Cancer Skin Cancer Thyroid Cancer Uterine Cancer All Cancer ... also called nuclear magnetic resonance imaging (NMRI). Somatostatin receptor scintigraphy : A type of radionuclide scan that may ...

  14. Assessment of guilt and shame in patients with non-small-cell lung cancer compared with patients with breast and prostate cancer.

    PubMed

    LoConte, Noelle K; Else-Quest, Nicole M; Eickhoff, Jens; Hyde, Janet; Schiller, Joan H

    2008-05-01

    Patients with lung cancer might feel more guilt and shame resulting from previous smoking. This study was designed to determine the levels of guilt and shame among patients with non-small-cell lung cancer (NSCLC) compared with breast and prostate cancer. Surveys were sent to participants 3 times (at enrollment, 2 months, and 6 months). Patients were eligible if they had stage IV NSCLC, breast cancer, or prostate cancer. The survey included tests of generalized guilt, shame, depression, and anxiety as well as guilt, shame, and embarrassment related to one's cancer. One hundred seventy-two participants completed >or= 1 questionnaire: 96 patients with NSCLC, 30 patients with breast cancer, and 46 patients with prostate cancer. Of the patients with NSCLC, 91.7% were current or former smokers versus 67.1% of the comparison patients. A composite score of embarrassment related to one's cancer (perceived cancer-related stigma; PCRS) was higher in patients with NSCLC (P < .01). Mean baseline generalized guilt and shame scores were not different among groups and did not change over time. A history of smoking correlated with increased levels of guilt and shame, regardless of tumor type. A personal identification of past behaviors as contributing to cancer correlated with higher levels of guilt, shame, anxiety, and depression. Of the patients with NSCLC, 29.5% felt that their behaviors contributed to their cancer compared with 10.5% of the comparison patients. Patients with NSCLC had higher levels of PCRS than patients with prostate cancer or breast cancer but not higher baseline levels of shame and guilt. Smoking is correlated with higher levels of guilt and shame. A belief that one caused one's own cancer is correlated with higher levels of guilt, shame, anxiety, and depression. These findings could be translated into an increased need for open communication among patients and their providers surrounding issues of cancer causation, guilt, shame, depression, and anxiety.

  15. Cancer incidence in Rabat, Morocco: 2006–2008

    PubMed Central

    Tazi, Mohammed Adnane; Er-Raki, Abdelouahed; Benjaafar, Noureddine

    2013-01-01

    Introduction No population-based data of cancer incidence from Morocco have been published before. This is the first report of cancer incidence in Rabat from a population-based cancer registry for the period 2006–2008. Materials and methods The cancer registry collects data on all new cases of cancer diagnosed in the resident population of the Rabat area. Data collection is an active process involving visits by registry staff to all data sources, essentially hospitals, pathological laboratories, and private clinics in Rabat. Results A total of 2,473 new cases of cancer were registered among residents in Rabat during the period 2006–2008. The overall world age-standardised rate (ASR) for all sites combined was 136.6/100,000 for men and 114.5/100,000 for women. The most frequently diagnosed malignancies in males were lung cancer (19.0%, ASR 24.8/105), followed by prostate cancer (15.5%, ASR 22.9/105), colorectal cancer (8.8%, ASR 12.0/105), bladder cancer (6.9%, ASR 9.7/105), and non-Hodgkin’s lymphoma (NHL) (6.0%, ASR 8.2/105). In females, the most frequently reported malignancies were breast cancer (39.9%, ASR 43.4/105), followed by cervix uteri cancer (11.4%, ASR 13.0/105), colorectal cancer (7.5%, ASR 9.0/105), NHL (3.4, ASR 4.2/105), and thyroid cancer (3.4%, ASR 3.9/105). Of all cancers, 2% are observed in childhood (0–14 years), and ~43% of them are malignant haemopathies. Conclusion The data reported by Rabat Cancer Registry indicate that cancers of the breast, cervix, uteri, and colon and rectum in females and the lung, prostate, and colon and rectum in men are major cancers in the population of Rabat. The Incidences observed are sometimes different from those observed in the neighbouring North African countries. PMID:23940493

  16. Investments in cancer research awarded to UK institutions and the global burden of cancer 2000–2013: a systematic analysis

    PubMed Central

    Maruthappu, Mahiben; Head, Michael G; Zhou, Charlie D; Gilbert, Barnabas J; El-Harasis, Majd A; Raine, Rosalind; Fitchett, Joseph R; Atun, Rifat

    2017-01-01

    Objectives To systematically categorise cancer research investment awarded to United Kingdom (UK) institutions in the period 2000–2013 and to estimate research investment relative to disease burden as measured by mortality, disability-adjusted life years (DALYs) and years lived with disability (YLDs). Design Systematic analysis of all open-access data. Setting and participants Public and philanthropic funding to all UK cancer research institutions, 2000–2013. Main outcome measures Number and financial value of cancer research investments reported in 2013 UK pounds (UK£). Mortality, DALYs and YLDs data were acquired from the Global Burden of Disease Study. A compound metric was adapted to estimate research investment relative to disease burden as measured by mortality, DALYs and YLDs. Results We identified 4299 funded studies with a total research investment of £2.4 billion. The highest fundings by anatomical sites were haematological, breast, prostate, colorectal and ovarian cancers. Relative to disease burden as determined by a compound metric combining mortality, DALYs and YLDs, gender-specific cancers were found to be highest funded—the five sites that received the most funding were prostate, ovarian, breast, mesothelioma and testicular cancer; the least well-funded sites were liver, thyroid, lung, upper gastrointestinal (GI) and bladder. Preclinical science accounted for 66.2% of award numbers and 62.2% of all funding. The top five areas of primary research focus by funding were pathogenesis, drug therapy, diagnostic, screening and monitoring, women's health and immunology. The largest individual funder was the Medical Research Council. In combination, the five lowest funded site-specific cancers relative to disease burden account for 47.9%, 44.3% and 20.4% of worldwide cancer mortality, DALYs and YLDs. Conclusions Research funding for cancer is not allocated according to relative disease burden. These findings are in line with earlier published studies. Funding agencies and industry should openly document their research investments to improve better targeting of research investment. PMID:28428185

  17. [Geomagnetic field variations in the human prenatal period and cancer in adults].

    PubMed

    Iamshanov, V A

    2007-01-01

    Our earlier evidence pointed to a relationship between geomagnetic field (GMF) variations in pre- and early postnatal periods and appearance in the future of oncopathology in these patients. It appears to contribute to risk for such malignancies in adults as breast, lung, liver, bladder, kidney, prostate, hypophysis cancer, ovarian carcinoma, skin melanoma, Hodgkin's disease, lymphoma, and probably stomach cancer. No link was detected between esophageal, thyroid, colorectal cancer or cervical carcinoma, on the one hand, and GMF variations in prenatal period, on the other. It is suggested that low intensity of GMF is associated with increased death of macrophages and other granulocytes as well as nitric oxide formation both in fetal and maternal organism. The latter factor induces genes responsible for detoxication. In adults, under normal or disturbed GMF conditions, detoxication processes take care of excessive blood-nitric oxide. Both in fetus and mother, due to high GMF intensity, granulocyte decay is inhibited thus causing nitric oxide levels to fall. As a consequence, detoxication fails. That accounts for excessive blood-nitric oxide formation at adult stage when GMF intensity is low or normal. Nitric oxide causes certain nitrosamines to form, which are tissue-specific carcinogens. Therefore, the lower level of GMF oscillations was in pre- and early postnatal periods than in more late terms tumors appeared (for example, the negative correlation for breast cancer took place).

  18. The Isolation and Characterization of Human Prostate Cancer Stem Cells

    DTIC Science & Technology

    2015-05-01

    GATGGAGTTGAAGGTAGTTTC GTG -30. Real time PCR was performed with iQ SYBR Green Supermix in an iCycler iQ System (Bio-Rad) using the SYBR Green Detection...initiate prostate tumorigenesis. Proc Natl Acad Sci USA 2005; 102(19):6942–6947. 16. Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer...receptor protein. Cancer Res. 1995; 55:3068–3072. [PubMed: 7541709] Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer resistance

  19. A Study of the Frequency and Social Determinants of Exposure to Cancer-Related Direct-to-Consumer Advertising Among Breast, Prostate, and Colorectal Cancer Patients

    PubMed Central

    Tan, Andy SL

    2014-01-01

    Cancer-related direct-to-consumer advertising (DTCA) is controversial because cancer treatment is complex and entails more risks and costs than typical treatments that are advertised for other conditions. Drawing from the Structural Influence Model of Communication, this study explores communication inequalities in DTCA exposure across social determinants among a population-based sample of 2013 patients diagnosed with breast, prostate, or colorectal cancers. Three survey items assessed patients' frequency of encountering ads concerning treatment alternatives for cancer, dealing with side effects of treatment, and doctors or hospitals offering services for cancer following their diagnosis. The analysis showed that overall exposure to DTCA in this study population was modest (median was once per week). Breast cancer patients reported significantly higher exposure to all three ad categories and overall DTCA exposure than prostate and colorectal cancer patients. Older patients consistently reported lower overall exposure to DTCA across the three cancer types. Other significant correlates included ethnicity (higher exposures among African-American prostate cancer patients vs. white; lower exposures in Hispanic colorectal cancer patients vs. white), and cancer stage (higher exposures in stage IV prostate cancer patients vs. stages 0-II). Education level did not predict patients' DTCA exposure. The implications of these observed inequalities in DTCA exposure on cancer outcomes are discussed. PMID:25357119

  20. A Study of the Frequency and Social Determinants of Exposure to Cancer-Related Direct-to-Consumer Advertising Among Breast, Prostate, and Colorectal Cancer Patients.

    PubMed

    Tan, Andy S L

    2015-01-01

    Cancer-related direct-to-consumer advertising (DTCA) is controversial because cancer treatment is complex and entails more risks and costs than typical treatments that are advertised for other conditions. Drawing from the Structural Influence Model of Communication, this study explores communication inequalities in DTCA exposure across social determinants among a population-based sample of 2013 patients diagnosed with breast, prostate, or colorectal cancers. Three survey items assessed patients' frequency of encountering ads concerning treatment alternatives for cancer, dealing with side effects of treatment, and doctors or hospitals offering services for cancer following their diagnosis. The analysis showed that overall exposure to DTCA in this study population was modest (median was once per week). Breast cancer patients reported significantly higher exposure to all three ad categories and overall DTCA exposure than prostate and colorectal cancer patients. Older patients consistently reported lower overall exposure to DTCA across the three cancer types. Other significant correlates included ethnicity (higher exposures among African American prostate cancer patients vs. White; lower exposures in Hispanic colorectal cancer patients vs. White) and cancer stage (higher exposures in Stage IV prostate cancer patients vs. Stages 0-II). Education level did not predict patients' DTCA exposure. The implications of these observed inequalities in DTCA exposure on cancer outcomes are discussed.

  1. 28 CFR 79.21 - Definitions.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... lymphocytic leukemia, multiple myeloma, lymphomas, Hodgkin's disease, primary cancer of the thyroid, primary cancer of the male breast, primary cancer of the female breast, primary cancer of the esophagus, primary cancer of the stomach, primary cancer of the pharynx, primary cancer of the small intestine, primary...

  2. 28 CFR 79.21 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... lymphocytic leukemia, multiple myeloma, lymphomas, Hodgkin's disease, primary cancer of the thyroid, primary cancer of the male breast, primary cancer of the female breast, primary cancer of the esophagus, primary cancer of the stomach, primary cancer of the pharynx, primary cancer of the small intestine, primary...

  3. 28 CFR 79.21 - Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... lymphocytic leukemia, multiple myeloma, lymphomas, Hodgkin's disease, primary cancer of the thyroid, primary cancer of the male breast, primary cancer of the female breast, primary cancer of the esophagus, primary cancer of the stomach, primary cancer of the pharynx, primary cancer of the small intestine, primary...

  4. 28 CFR 79.21 - Definitions.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... lymphocytic leukemia, multiple myeloma, lymphomas, Hodgkin's disease, primary cancer of the thyroid, primary cancer of the male breast, primary cancer of the female breast, primary cancer of the esophagus, primary cancer of the stomach, primary cancer of the pharynx, primary cancer of the small intestine, primary...

  5. 28 CFR 79.21 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... lymphocytic leukemia, multiple myeloma, lymphomas, Hodgkin's disease, primary cancer of the thyroid, primary cancer of the male breast, primary cancer of the female breast, primary cancer of the esophagus, primary cancer of the stomach, primary cancer of the pharynx, primary cancer of the small intestine, primary...

  6. Proteolytic Processing of Laminin-332 by Hepsin and Matriptase and Its Role in Prostate Cancer Progression

    DTIC Science & Technology

    2011-09-01

    epithelial tumors, including breast, cervix , esophagus, liver, mesothelium, prostate, and colorectal cancers [36,38,61–69]. Interestingly, in the case of...Proteolytic Processing of Laminin-332 by Hepsin and Matriptase and Its Role in Prostate Cancer Progression Manisha Tripathi The Vanderbilt University...Nashville, TN 37203 Laminin-332 is lost in prostate cancer progression. Laminin-332 is known to be cleaved by various cell surface proteases

  7. Identification of activated enhancers and linked transcription factors in breast, prostate, and kidney tumors by tracing enhancer networks using epigenetic traits.

    PubMed

    Rhie, Suhn Kyong; Guo, Yu; Tak, Yu Gyoung; Yao, Lijing; Shen, Hui; Coetzee, Gerhard A; Laird, Peter W; Farnham, Peggy J

    2016-01-01

    Although technological advances now allow increased tumor profiling, a detailed understanding of the mechanisms leading to the development of different cancers remains elusive. Our approach toward understanding the molecular events that lead to cancer is to characterize changes in transcriptional regulatory networks between normal and tumor tissue. Because enhancer activity is thought to be critical in regulating cell fate decisions, we have focused our studies on distal regulatory elements and transcription factors that bind to these elements. Using DNA methylation data, we identified more than 25,000 enhancers that are differentially activated in breast, prostate, and kidney tumor tissues, as compared to normal tissues. We then developed an analytical approach called Tracing Enhancer Networks using Epigenetic Traits that correlates DNA methylation levels at enhancers with gene expression to identify more than 800,000 genome-wide links from enhancers to genes and from genes to enhancers. We found more than 1200 transcription factors to be involved in these tumor-specific enhancer networks. We further characterized several transcription factors linked to a large number of enhancers in each tumor type, including GATA3 in non-basal breast tumors, HOXC6 and DLX1 in prostate tumors, and ZNF395 in kidney tumors. We showed that HOXC6 and DLX1 are associated with different clusters of prostate tumor-specific enhancers and confer distinct transcriptomic changes upon knockdown in C42B prostate cancer cells. We also discovered de novo motifs enriched in enhancers linked to ZNF395 in kidney tumors. Our studies characterized tumor-specific enhancers and revealed key transcription factors involved in enhancer networks for specific tumor types and subgroups. Our findings, which include a large set of identified enhancers and transcription factors linked to those enhancers in breast, prostate, and kidney cancers, will facilitate understanding of enhancer networks and mechanisms leading to the development of these cancers.

  8. Mobile Phone Apps for Quality of Life and Well-Being Assessment in Breast and Prostate Cancer Patients: Systematic Review

    PubMed Central

    Rivera-Romero, Octavio; Dorronzoro-Zubiete, Enrique; Sanchez-Bocanegra, Carlos Luis; Gabarron, Elia

    2017-01-01

    Background Mobile phone health apps are increasingly gaining attention in oncological care as potential tools for supporting cancer patients. Although the number of publications and health apps focusing on cancer is increasing, there are still few specifically designed for the most prevalent cancers diagnosed: breast and prostate cancers. There is a need to review the effect of these apps on breast and prostate cancer patients’ quality of life (QoL) and well-being. Objective The purposes of this study were to review the scientific literature on mobile phone apps targeting breast or prostate cancer patients and involving QoL and well-being (anxiety and depression symptoms) and analyze the clinical and technological characteristics, strengths, and weaknesses of these apps, as well as patients’ user experience with them. Methods We conducted a systematic review of peer-reviewed literature from The Cochrane Library, Excerpta Medica Database, PsycINFO, PubMed, Scopus, and MEDLINE to identify studies involving apps focused on breast and/or prostate cancer patients and QoL and/or well-being published between January 1, 2000, and July 12, 2017. Only trial studies which met the inclusion criteria were selected. The systematic review was completed with a critical analysis of the apps previously identified in the health literature research that were available from the official app stores. Results The systematic review of the literature yielded 3862 articles. After removal of duplicates, 3229 remained and were evaluated on the basis of title and abstract. Of these, 3211 were discarded as not meeting the inclusion criteria, and 18 records were selected for full text screening. Finally, 5 citations were included in this review, with a total of 644 patients, mean age 52.16 years. Four studies targeted breast cancer patients and 1 focused on prostate cancer patients. Four studies referred to apps that assessed QoL. Only 1 among the 5 analyzed apps was available from the official app store. In 3 studies, an app-related intervention was carried out, and 2 of them reported an improvement on QoL. The lengths of the app-related interventions varied from 4 to 12 weeks. Because 2 of the studies only tracked use of the app, no effect on QoL or well-being was found. Conclusions Despite the existence of hundreds of studies involving cancer-focused mobile phone apps, there is a lack of rigorous trials regarding the QoL and/or well-being assessment in breast and/or prostate cancer patients. A strong and collective effort should be made by all health care providers to determine those cancer-focused apps that effectively represent useful, accurate, and reliable tools for cancer patients’ disease management. Trial Registration PROSPERO CRD42017073069; https://www.crd.york.ac.uk/PROSPERO/display_record.asp?ID= CRD42017073069 (Archived by WebCite at http://www.webcitation.org/6v38Clb9T) PMID:29203459

  9. What You Need to Know about Cancer of the Pancreas

    MedlinePlus

    ... Cell) Cancer Leukemia Liver Cancer Lung Cancer Lymphoma Pancreatic Cancer Prostate Cancer Skin Cancer Thyroid Cancer Uterine Cancer ... is about cancer of the pancreas, also called pancreatic cancer. There are two main types of pancreatic cancer. ...

  10. Deep learning as a tool for increased accuracy and efficiency of histopathological diagnosis

    NASA Astrophysics Data System (ADS)

    Litjens, Geert; Sánchez, Clara I.; Timofeeva, Nadya; Hermsen, Meyke; Nagtegaal, Iris; Kovacs, Iringo; Hulsbergen-van de Kaa, Christina; Bult, Peter; van Ginneken, Bram; van der Laak, Jeroen

    2016-05-01

    Pathologists face a substantial increase in workload and complexity of histopathologic cancer diagnosis due to the advent of personalized medicine. Therefore, diagnostic protocols have to focus equally on efficiency and accuracy. In this paper we introduce ‘deep learning’ as a technique to improve the objectivity and efficiency of histopathologic slide analysis. Through two examples, prostate cancer identification in biopsy specimens and breast cancer metastasis detection in sentinel lymph nodes, we show the potential of this new methodology to reduce the workload for pathologists, while at the same time increasing objectivity of diagnoses. We found that all slides containing prostate cancer and micro- and macro-metastases of breast cancer could be identified automatically while 30-40% of the slides containing benign and normal tissue could be excluded without the use of any additional immunohistochemical markers or human intervention. We conclude that ‘deep learning’ holds great promise to improve the efficacy of prostate cancer diagnosis and breast cancer staging.

  11. Health-related quality of life in rehabilitants with different cancer entities.

    PubMed

    Lamprecht, J; Thyrolf, A; Mau, W

    2017-09-01

    The focus of the study is the analysis of changes in health-related quality of life in various cancer entities during and after an inpatient rehabilitation programme. In a multicentre longitudinal study, a total of 211 cancer patients (breast cancer: N = 84; prostate cancer: N = 90; colon cancer: N = 37) were asked about their quality of life (EORTC QLQ-C30; HADS) at the beginning, the end and 3 months after the end of the rehabilitation programme. In different domains of quality of life significant and mostly clinically relevant improvements were found during rehabilitation. The breast and prostate cancer patients improved most in emotional functioning, colon cancer patients in global quality of life. With regard to the severity of symptoms, the fatigue burden improved in breast and colon cancer patients, nausea in the prostate cancer patients. However, they are increases 3 months after rehabilitation. Functional burdens improved 3 months after the end of rehabilitation in the physical domain for all cancer patients. For breast cancer patients, emotional functioning decreased significantly 3 months after rehabilitation. An inpatient oncological rehabilitation programme can lead to an improvement in quality of life. © 2016 John Wiley & Sons Ltd.

  12. Quality of life research in neuro-oncology: a quantitative comparison.

    PubMed

    Klein, Elizabeth; Altshuler, David; Hallock, Abhirami; Szerlip, Nicholas

    2014-01-01

    Our understanding of the biology of neuro-oncologic disease has improved vastly over time, however overall patient survival remains relatively poor. Our goal as clinicians, therefore, should be to ensure that the quality of life (QOL) in that survival time is optimized. Here we review neuro-oncology QOL abstracts presented at major oncology conferences and the published literature to make a quantitative comparison to other common cancer subtypes. First, all abstracts presented at major oncology meetings from 2008 to 2012 were reviewed and filtered to find those related to QOL in CNS, breast, lung, and prostate cancer. Next, a Medline search was performed to identify all QOL papers published from 2003 to 2012 for the same cancer subtypes. The results were compared as absolute values and percentages. The average percentage of CNS QOL-related abstracts presented at ASCO and ASTRO over the last 5 years was 4.9 %, compared to 6.4 % for breast, 4.4 % for lung, and 6.1 % for prostate. There is a significant difference in total percentage of QOL abstracts over the time period when comparing CNS to breast and prostate, but not lung (p < 0.05). The Medline search revealed an average of 25.2 publications per year for CNS cancer, compared to 146.2 for breast, 39.3 for lung, and 64.2 for prostate. When looking at trends over time, publications in CNS cancer have not been as prolific and have not increased as rapidly as publications in breast and lung cancer, indicating that QOL is underrepresented in neuro-oncology research. We need to improve this by standardizing QOL measures and including them in every outcome study.

  13. Association Study of Prostate Cancer Susceptibility Variants with Risks of Invasive Ovarian, Breast, and Colorectal Cancer

    PubMed Central

    Song, Honglin; Koessler, Thibaud; Ahmed, Shahana; Ramus, Susan J.; Kjaer, Susanne Krüger; DiCioccio, Richard A.; Wozniak, Eva; Hogdall, Estrid; Whittemore, Alice S.; McGuire, Valerie; Ponder, Bruce A.J.; Turnbull, Clare; Hines, Sarah; Rahman, Nazneen; Eeles, Rosalind A.; Easton, Douglas F.; Gayther, Simon A.; Dunning, Alison M.; Pharoah, Paul D.P.

    2009-01-01

    Several prostate cancer susceptibility loci have recently been identified by genome-wide association studies. These loci are candidates for susceptibility to other epithelial cancers. The aim of this study was to test these tag single nucleotide polymorphisms (SNP) for association with invasive ovarian, colorectal, and breast cancer. Twelve prostate cancer-associated tag SNPs were genotyped in ovarian (2,087 cases/3,491 controls), colorectal (2,148 cases/2,265 controls) and breast (first set, 4,339 cases/4,552controls; second set, 3,800 cases/3,995 controls) case-control studies. The primary test of association was a comparison of genotype frequencies between cases and controls, and a test for trend stratified by study where appropriate. Genotype-specific odds ratios (OR) were estimated by logistic regression. SNP rs2660753 (chromosome 3p12) showed evidence of association with ovarian cancer [per minor allele OR, 1.19; 95% confidence interval (95% CI), 1.04-1.37; Ptrend = 0.012]. This association was stronger for the serous histologic subtype (OR, 1.29; 95% CI, 1.09-1.53; P = 0.003). SNP rs7931342 (chromosome 11q13) showed some evidence of association with breast cancer (per minor allele OR, 0.95; 95% CI, 0.91-0.99; Ptrend = 0.028). This association was somewhat stronger for estrogen receptor-positive tumors (OR, 0.92; 95% CI, 0.87-0.98; P = 0.011). None of these tag SNPs were associated with risk of colorectal cancer. In conclusion, loci associated with risk of prostate cancer may also be associated with ovarian and breast cancer susceptibility. However, the effects are modest and warrant replication in larger studies. PMID:18974127

  14. Diagnosing cancer in the bush: a mixed-methods study of symptom appraisal and help-seeking behaviour in people with cancer from rural Western Australia.

    PubMed

    Emery, Jon D; Walter, Fiona M; Gray, Vicky; Sinclair, Craig; Howting, Denise; Bulsara, Max; Bulsara, Caroline; Webster, Andrew; Auret, Kirsten; Saunders, Christobel; Nowak, Anna; Holman, C D'Arcy

    2013-06-01

    Previous studies have focused on the treatment received by rural cancer patients and have not examined their diagnostic pathways as reasons for poorer outcomes in rural Australia. To compare and explore symptom appraisal and help-seeking behaviour in patients with breast, lung, prostate or colorectal cancer from rural Western Australia (WA). A mixed-methods study of people recently diagnosed with breast, lung, prostate or colorectal cancer from rural WA. The time from first symptom to diagnosis (i.e. total diagnostic interval, TDI) was calculated from interviews and medical records. Sixty-six participants were recruited (24 breast, 20 colorectal, 14 prostate and 8 lung cancer patients). There was a highly significant difference in time from symptom onset to seeking help between cancers (P = 0.006). Geometric mean symptom appraisal for colorectal cancer was significantly longer than that for breast and lung cancers [geometric mean differences: 2.58 (95% confidence interval, CI: 0.64-4.53), P = 0.01; 3.97 (1.63-6.30), P = 0.001, respectively]. There was a significant overall difference in arithmetic mean TDI (P = 0.046); breast cancer TDI was significantly shorter than colorectal or prostate cancer TDI [mean difference : 266.3 days (95% CI: 45.9-486.8), P = 0.019; 277.0 days, (32.1-521.9), P = 0.027, respectively]. These differences were explained by the nature and personal interpretation of symptoms, perceived as well as real problems of access to health care, optimism, stoicism, machismo, fear, embarrassment and competing demands. Longer symptom appraisal was observed for colorectal cancer. Participants defined core characteristics of rural Australians as optimism, stoicism and machismo. These features, as well as access to health care, contribute to later presentation of cancer.

  15. Locating a Prostate Cancer Susceptibility Gene on the X Chromosome by Linkage Disequilibrium Mapping Using Three Founder Populations in Quebec and Switzerland

    DTIC Science & Technology

    2005-03-01

    We also conducted the first phase of a SNP discovery project. We re- sequenced CHEK2 in 75 Ashkenazi Jewish individuals (25 prostate cancer, 25 breast...Aims for this reporting period: 1. To study CHEK2 and its contribution to prostate cancer in the AJ population. 2. To identify a prostate cancer genotype... CHEK2 in the Ashkenazi Jewish Population We have completed the first phase of this study. We sequenced 25 AJ prostate cancer cases and 25 controls. We

  16. Familial risks of breast and prostate cancers: does the definition of the at risk period matter?

    PubMed

    Brandt, Andreas; Bermejo, Justo Lorenzo; Sundquist, Jan; Hemminki, Kari

    2010-03-01

    'Being at familial risk' may have different connotations in studies on familial risk of cancer. The register-based definition of a family history considers individuals with an affected relative at familial risk independently of the family member's diagnostic time. Alternatively, the individuals are classified to be at familial risk only after the diagnosis date of their relative, relevant to clinical counselling and screening situations. The aim of this study was to compare familial breast and prostate cancer risks according to the two definitions. The nationwide Swedish Family-Cancer Database with information on cancers from 1958 to 2006 was used to calculate the hazard ratio of breast and prostate cancers according to family history using Cox regression. Family history was defined considering the number and type of affected relatives and the relative's diagnostic age, respectively. Individuals were considered at familial risk from their entry to the study or, alternatively, from the diagnostic time of the relative. Hazard ratios were equal whether individuals were considered at risk independent of the relative's diagnostic date or only after the relative's diagnostic date. These results indicate that studies on familial breast or prostate cancer risk which do not take the relative's diagnosis date into account are applicable to screening and clinical counselling situations. The estimates according to the register-based definition are based on larger numbers of patients, which may be crucial for analysis of small groups such as families of multiple cases. Copyright 2009 Elsevier Ltd. All rights reserved.

  17. Comparison of normal tissue pharmacokinetics with {sup 111}In/{sup 9}Y monoclonal antibody m170 for breast and prostate cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lehmann, Joerg; Department of Radiodiagnosis and Therapy, Division of Hematology/Oncology, University of California Davis School of Medicine, Sacramento, CA; DeNardo, Gerald L.

    Purpose: Radioactivity deposition in normal tissues limits the dose deliverable by radiopharmaceuticals (RP) in radioimmunotherapy (RIT). This study investigated the absorbed radiation dose in normal tissues for prostate cancer patients in comparison to breast cancer patients for 2 RPs using the monoclonal antibody (MAb) m170. Methods and Materials: {sup 111}In-DOTA-glycylglycylglycyl-L-p-isothiocyanatophenylalanine amide (GGGF)-m170 and {sup 111}In-1,4,7,10-tetraazacyclododecane-N,N',N'',N'''-tetraacetic acid (DOTA) 2-iminothiolane (2IT)-m170, representing the same MAb and chelate with and without a cleavable linkage, were studied in 13 breast cancer and 26 prostate cancer patients. Dosimetry for {sup 9}Y was calculated using {sup 111}In MAb pharmacokinetics from the initial imaging study for eachmore » patient, using reference man- and patient-specific masses. Results: The reference man-specific radiation doses (cGy/MBq) were not significantly different for the breast and the prostate cancer patients for both RPs in all but one tissue-RP combination (liver, DOTA-2IT). The patient-specific doses had differences between the groups most of which can be related to weight differences. Conclusions: Similar normal tissue doses were calculated for two groups of patients having different cancers and genders. This similarity combined with continued careful analysis of the imaging data might allow the use of higher starting doses in early phase RIT studies.« less

  18. Inflammatory biomarkers and fatigue during radiation therapy for breast and prostate cancer.

    PubMed

    Bower, Julienne E; Ganz, Patricia A; Tao, May Lin; Hu, Wenhua; Belin, Thomas R; Sepah, Saviz; Cole, Steve; Aziz, Najib

    2009-09-01

    Biomarkers of radiation-induced behavioral symptoms, such as fatigue, have not been identified. Studies linking inflammatory processes to fatigue in cancer survivors led us to test the hypothesis that activation of the proinflammatory cytokine network is associated with fatigue symptoms during radiation therapy for breast and prostate cancer. Individuals with early-stage breast (n = 28) and prostate cancer (n = 20) completed questionnaires and provided blood samples for determination of serum levels of interleukin 1beta (IL-1beta) and IL-6 at assessments conducted before, during, and after a course of radiation therapy. Serum markers of proinflammatory cytokine activity, including IL-1 receptor antagonist and C-reactive protein, were examined in a subset of participants. Random coefficient models were used to evaluate the association between changes in cytokine levels and fatigue. As expected, there was a significant increase in fatigue during radiation treatment. Changes in serum levels of inflammatory markers C-reactive protein and IL-1 receptor antagonist were positively associated with increases in fatigue symptoms (Ps < 0.05), although serum levels of IL-1beta and IL-6 were not associated with fatigue. These effects remained significant (Ps < 0.05) in analyses controlling for potential biobehavioral confounding factors, including age, body mass index, hormone therapy, depression, and sleep disturbance. Results suggest that activation of the proinflammatory cytokine network and associated increases in downstream biomarkers of proinflammatory cytokine activity are associated with fatigue during radiation therapy for breast and prostate cancer.

  19. Cancer survivors in the workplace: sleep disturbance mediates the impact of cancer on healthcare expenditures and work absenteeism.

    PubMed

    Gonzalez, Brian D; Grandner, Michael A; Caminiti, Courtney B; Hui, Siu-Kuen Azor

    2018-06-05

    History of cancer is significantly associated with increases in healthcare costs, worse work performance, and higher absenteeism in the workplace. This is particularly important as most cancer survivors return to employment. Sleep disturbance is a largely overlooked potential contributor to these changes. Data from 9488 state employees participating in the Kansas State employee wellness program were used to assess cancer history, sleep disturbance, healthcare expenditures, work performance ratings, and absenteeism. Participants were categorized as having had no history of breast or prostate cancer, a past history only with no current cancer treatment, or current treatment for breast or prostate cancer. Indirect mediation analyses determined whether sleep disturbance mediated the influence of cancer status on outcomes. Employees receiving treatment for breast or prostate cancer had significantly greater healthcare expenditures and absenteeism than those with a past history or no history of cancer (ps < .0001). Sleep disturbance significantly mediated the impact of cancer on healthcare expenditures and absenteeism (ps < .05), accounting for 2 and 8% of the impact of cancer on healthcare expenditure and missed full days of work, respectively. The worse outcomes observed among employees receiving treatment for breast and prostate cancer, the most common forms of cancer among women and men, were partially explained by the impacts of cancer and treatment for cancer on sleep disturbance. These findings suggest that preventing or addressing sleep disturbance may result in economic benefits in addition to improvements in health and quality of life.

  20. Vectors for Treatment of Metastatic Breast Cancer

    DTIC Science & Technology

    2005-08-01

    from human carcinomas of the breast, ovary and mouse breast cancer. In this study, in vitro cytotoxicity tests were carried out with the replication...injection of dendritic cells engineered to secrete interleukin-12 by recombinant adenovirus in patients with metastatic gastrointestinal carcinomas . J...see Figure IC) in carcinomas of the breast, lung, prostate, ovary, cervix, endometrium, esophagous, stomach and colon is associated with metastasis

  1. Radiation-Induce Immune Modulation in Prostate Cancer

    DTIC Science & Technology

    2005-01-01

    Prostate-specific antigen Prostate carcinoma Mammoglobin-A Breast carcinoma Overexpressed Alpha - fetoprotein Hepatocellular carcinoma and yolk-sac tumors...Interleukin-3 cooperates with tumor necrosis factor alpha for the development of human dendritic/Langerhans cells from cord blood CD34+ hematopoietic progenitor...additional subsets, e.g. Langerhans cells of the epidermis, and dermal or interstitial DC. PDC are the major interferon- alpha (IFNca) producing cells

  2. Radiation risk models for all solid cancers other than those types of cancer requiring individual assessments after a nuclear accident.

    PubMed

    Walsh, Linda; Zhang, Wei

    2016-03-01

    In the assessment of health risks after nuclear accidents, some health consequences require special attention. For example, in their 2013 report on health risk assessment after the Fukushima nuclear accident, the World Health Organisation (WHO) panel of experts considered risks of breast cancer, thyroid cancer and leukaemia. For these specific cancer types, use was made of already published excess relative risk (ERR) and excess absolute risk (EAR) models for radiation-related cancer incidence fitted to the epidemiological data from the Japanese A-bomb Life Span Study (LSS). However, it was also considered important to assess all other types of solid cancer together and the WHO, in their above-mentioned report, stated "No model to calculate the risk for all other solid cancer excluding breast and thyroid cancer risks is available from the LSS data". Applying the LSS models for all solid cancers along with the models for the specific sites means that some cancers have an overlap in the risk evaluations. Thus, calculating the total solid cancer risk plus the breast cancer risk plus the thyroid cancer risk can overestimate the total risk by several per cent. Therefore, the purpose of this paper was to publish the required models for all other solid cancers, i.e. all solid cancers other than those types of cancer requiring special attention after a nuclear accident. The new models presented here have been fitted to the same LSS data set from which the risks provided by the WHO were derived. Although it is known already that the EAR and ERR effect modifications by sex are statistically significant for the outcome "all solid cancer", it is shown here that sex modification is not statistically significant for the outcome "all solid cancer other than thyroid and breast cancer". It is also shown here that the sex-averaged solid cancer risks with and without the sex modification are very similar once breast and thyroid cancers are factored out. Some other notable model differences between those already published for all solid cancers and those presented here for all other solid cancers are also given here. The models presented here can be used to improve on the methodology adopted by WHO after Fukushima and could contribute to emergency preparedness for future nuclear accidents.

  3. Coffee, tea, caffeine intake, and the risk of cancer in the PLCO cohort

    PubMed Central

    Hashibe, Mia; Galeone, Carlotta; Buys, Saundra S; Gren, Lisa; Boffetta, Paolo; Zhang, Zuo-Feng; La Vecchia, Carlo

    2015-01-01

    Background: The association between coffee intake, tea intake and cancer has been extensively studied, but associations are not established for many cancers. Previous studies are not consistent on whether caffeine may be the source of possible associations between coffee and cancer risk. Methods: In the Prostate, Lung, Colorectal, and Ovarian cancer screening trial, of the 97 334 eligible individuals, 10 399 developed cancer. Cancers included were 145 head and neck, 99 oesophageal, 136 stomach, 1137 lung, 1703 breast, 257 endometrial, 162 ovarian, 3037 prostate, 318 kidney, 398 bladder, 103 gliomas, and 106 thyroid. Results: Mean coffee intake was higher in lower education groups, among current smokers, among heavier and longer duration smokers, and among heavier alcohol drinkers. Coffee intake was not associated with the risk of all cancers combined (RR=1.00, 95% confidence interval (CI)=0.96–1.05), whereas tea drinking was associated with a decreased risk of cancer overall (RR=0.95, 95% CI=0.94–0.96 for 1+ cups per day vs <1 cup per day). For endometrial cancer, a decreased risk was observed for coffee intake (RR=0.69, 95% CI=0,52–0.91 for ⩾2 cups per day). Caffeine intake was not associated with cancer risk in a dose–response manner. Conclusions: We observed a decreased risk of endometrial cancer for coffee intake, and a decreased risk of cancer overall with tea intake. PMID:26291054

  4. Adrenergic blockers and the risk for common solid cancers: a case-control study.

    PubMed

    Numbere, Beade; Fleming, Kate M; Walker, Alex; Card, Timothy R

    2017-01-01

    Laboratory studies have suggested that adrenergic blockers may inhibit the proliferation and migration of cancer cells, but epidemiological evidence of their effect on cancer incidence has proven inconsistent. We therefore conducted a case-control study using the Clinical Practice Research Datalink to assess the effect of adrenergic blockers on the incidence of prostate, lung, bowel and breast cancers. From among patients aged 18 years or older who contributed at least 2 years of prospectively gathered data between 1 January 1987 and 31 December 2012, we selected incident cases of relevant cancers and controls, frequency matched 10 : 1 by age. Logistic regression was used to adjust effect estimates for age, sex, smoking, alcohol use, and a number of potentially confounding comorbidities and coprescriptions. A total of 18 968 colorectal, 19 082 lung, 21 608 prostate and 29 109 breast cancers were identified. We found no evidence of a protective effect of adrenergic blockade in lung and prostate cancers and found a slightly increased risk for colorectal and breast cancers in users. This was largely explained by the effects of confounding in multivariate analyses, with final odds ratio estimates for lung, colorectal, breast and prostate cancers of 0.99 [95% confidence interval (0.96-1.04)], 1.14 (1.09-1.18), 1.10 (1.06-1.14), and 1.01 (0.98-1.05), respectively, for β-blocker exposure, and final odds ratio estimates for lung, colorectal and breast cancer of 1.03 (0.97-1.09), 1.13 (1.07-1.20), and 1.08 (1.00-1.17), respectively, for α-blocker exposure. We found no evidence to suggest that adrenergic blocker use prevents common cancers. Indeed, we found a slightly increased risk for colorectal and breast cancers, which may reflect residual confounding.

  5. [Thyroid and pregnancy].

    PubMed

    Iwen, K A; Lehnert, H

    2018-05-17

    During pregnancy thyroid hormones have profound effects on embryonal/fetal development and maternal health. Therefore, thyroid gland disorders should be immediately diagnosed and adequately treated. Pregnancy-specific physiological alterations during pregnancy cause changes in the reference interval for thyroid-stimulating hormone levels and trimester-specific thresholds must be taken into account. This article summarizes the most important diagnostic and therapeutic aspects before, during and after pregnancy. With reference to the period prior to pregnancy, the article discusses iodide supplementation, preconceptional examination of thyroid gland metabolism and the importance of thyroid gland functional disorders for fertility and fulfilling the desire to have children. With a view to the period during pregnancy, the effect of hypothyroxinemia, hypothyroidism, and hyperthyroidism as well as the effects of their treatment on the development of the child are explained. Finally, a description is given of what must be paid attention to in the breast-feeding period and in postpartum thyroiditis.

  6. Thyroid Gland Metastasis from Cancer of the Uterine Cervix: An Extremely Rare Case Report.

    PubMed

    Celik, Suleyman Utku; Besli, Dilara; Sak, Serpil Dizbay; Genc, Volkan

    The thyroid gland is a relatively uncommon site for a metastatic disease, although it is richly supplied with blood. The metastases may originate from various primary sites, mainly kidney, lung, head and neck, and breast. Thyroid metastasis from cervical carcinomas is extremely rare; and only a few cases have been previously reported in the literature. In patient with thyroid nodules and an oncological history, the possibility of thyroid metastasis should be seriously considered. Despite the rarity of the metastasis of cervical carcinoma to the thyroid, it is difficult to say appropriate treatment approach for these lesions. When managing such patients, decision-making should balance the possibility of gaining long-term survival against estimation of the aggressiveness of the disease and its possible complications. Here, a case of thyroid metastasis from a squamous cell carcinoma of the uterine cervix presenting with cervical mass and difficulty in swallowing and its treatment is reported.

  7. Bioequivalence & Food Effect Study in Patients With Solid Tumor or Hematologic Malignancies

    ClinicalTrials.gov

    2018-04-30

    Hematological Neoplasms; Non-Hodgkin's Lymphoma; Hodgkin's Lymphoma; Lymphoma; Multiple Myeloma; Acute Myeloid Leukemia; Leukemia; Myelodysplastic Syndromes; Neoplasms; Melanoma; Breast Cancer; Metastatic Breast Cancer; Non-Small Cell Lung Cancer; Small Cell Lung Cancer; Renal Cell Carcinoma; Glioblastoma Multiforme; Osteosarcoma; Sarcoma; Thyroid Cancer; Genitourinary

  8. Healthy Family 2009: Practicing Healthy Adult Living

    MedlinePlus

    ... doctor the pros and cons of having a prostate-specific antigen (PSA) test or digital rectal examination (DRE) to ... colonoscopies for cancer of the colon, serum prostatin-specific antigen (PSA) tests for prostate cancer, and mammograms for breast cancer. Work out ...

  9. Statistical process control analysis for patient quality assurance of intensity modulated radiation therapy

    NASA Astrophysics Data System (ADS)

    Lee, Rena; Kim, Kyubo; Cho, Samju; Lim, Sangwook; Lee, Suk; Shim, Jang Bo; Huh, Hyun Do; Lee, Sang Hoon; Ahn, Sohyun

    2017-11-01

    This study applied statistical process control to set and verify the quality assurances (QA) tolerance standard for our hospital's characteristics with the criteria standards that are applied to all the treatment sites with this analysis. Gamma test factor of delivery quality assurances (DQA) was based on 3%/3 mm. Head and neck, breast, prostate cases of intensity modulated radiation therapy (IMRT) or volumetric arc radiation therapy (VMAT) were selected for the analysis of the QA treatment sites. The numbers of data used in the analysis were 73 and 68 for head and neck patients. Prostate and breast were 49 and 152 by MapCHECK and ArcCHECK respectively. C p value of head and neck and prostate QA were above 1.0, C pml is 1.53 and 1.71 respectively, which is close to the target value of 100%. C pml value of breast (IMRT) was 1.67, data values are close to the target value of 95%. But value of was 0.90, which means that the data values are widely distributed. C p and C pml of breast VMAT QA were respectively 1.07 and 2.10. This suggests that the VMAT QA has better process capability than the IMRT QA. Consequently, we should pay more attention to planning and QA before treatment for breast Radiotherapy.

  10. Second Malignant Neoplasms in Patients With Cowden Syndrome With Underlying Germline PTEN Mutations

    PubMed Central

    Ngeow, Joanne; Stanuch, Kim; Mester, Jessica L.; Barnholtz-Sloan, Jill S.; Eng, Charis

    2014-01-01

    Purpose Patients with Cowden syndrome (CS) with underlying germline PTEN mutations are at increased risk of breast, thyroid, endometrial, and renal cancers. To our knowledge, risk of subsequent cancers in these patients has not been previously explored or quantified. Patients and Methods We conducted a 7-year multicenter prospective study (2005 to 2012) of patients with CS or CS-like disease, all of whom underwent comprehensive PTEN mutational analysis. Second malignant neoplasms (SMNs) were ascertained by medical records and confirmed by pathology reports. Standardized incidence ratios (SIRs) for all SMNs combined and for breast, thyroid, endometrial, and renal cancers were calculated. Results Of the 2,912 adult patients included in our analysis, 2,024 had an invasive cancer history. Germline pathogenic PTEN mutations (PTEN mutation positive) were identified in 114 patients (5.6%). Of these 114 patients, 46 (40%) had an SMN. Median age of SMN diagnosis was 50 years (range, 21 to 71 years). Median interval between primary cancer and SMN was 5 years (range, < 1 to 35 years). Of the 51 PTEN mutation–positive patients who presented with primary breast cancer, 11 (22%) had a subsequent new primary breast cancer and 10-year second breast cancer cumulative risk of 29% (95% CI, 15.3 to 43.7). Risk of SMNs compared with that of the general population was significantly elevated for all cancers (SIR, 7.74; 95% CI, 5.84 to 10.07), specifically for breast (SIR, 8.92; 95% CI, 5.85 to 13.07), thyroid (SIR, 5.83; 95% CI, 3.01 to 10.18), and endometrial SMNs (SIR, 14.08.07; 95% CI, 7.10 to 27.21). Conclusion Patients with CS with germline PTEN mutations are at higher risk for SMNs compared with the general population. Prophylactic mastectomy should be considered on an individual basis given the significant risk of subsequent breast cancer. PMID:24778394

  11. Acceptance and Commitment Therapy in Improving Well-Being in Patients With Stage III-IV Cancer and Their Partners

    ClinicalTrials.gov

    2018-02-06

    Malignant Female Reproductive System Neoplasm; Malignant Hepatobiliary Neoplasm; Partner; Stage III Breast Cancer; Stage III Cervical Cancer; Stage III Colorectal Cancer; Stage III Lung Cancer; Stage III Prostate Cancer; Stage III Skin Melanoma; Stage III Uterine Corpus Cancer; Stage IIIA Breast Cancer; Stage IIIA Cervical Cancer; Stage IIIA Colorectal Cancer; Stage IIIA Lung Carcinoma; Stage IIIA Skin Melanoma; Stage IIIA Uterine Corpus Cancer; Stage IIIB Breast Cancer; Stage IIIB Cervical Cancer; Stage IIIB Colorectal Cancer; Stage IIIB Lung Carcinoma; Stage IIIB Skin Melanoma; Stage IIIB Uterine Corpus Cancer; Stage IIIC Breast Cancer; Stage IIIC Colorectal Cancer; Stage IIIC Skin Melanoma; Stage IIIC Uterine Corpus Cancer; Stage IV Breast Cancer; Stage IV Cervical Cancer; Stage IV Colorectal Cancer; Stage IV Lung Cancer; Stage IV Prostate Cancer; Stage IV Skin Melanoma; Stage IV Uterine Corpus Cancer; Stage IVA Cervical Cancer; Stage IVA Colorectal Cancer; Stage IVA Uterine Corpus Cancer; Stage IVB Cervical Cancer; Stage IVB Colorectal Cancer; Stage IVB Uterine Corpus Cancer

  12. Ultrasound Elastography: Review of Techniques and Clinical Applications

    PubMed Central

    Sigrist, Rosa M.S.; Liau, Joy; Kaffas, Ahmed El; Chammas, Maria Cristina; Willmann, Juergen K.

    2017-01-01

    Elastography-based imaging techniques have received substantial attention in recent years for non-invasive assessment of tissue mechanical properties. These techniques take advantage of changed soft tissue elasticity in various pathologies to yield qualitative and quantitative information that can be used for diagnostic purposes. Measurements are acquired in specialized imaging modes that can detect tissue stiffness in response to an applied mechanical force (compression or shear wave). Ultrasound-based methods are of particular interest due to its many inherent advantages, such as wide availability including at the bedside and relatively low cost. Several ultrasound elastography techniques using different excitation methods have been developed. In general, these can be classified into strain imaging methods that use internal or external compression stimuli, and shear wave imaging that use ultrasound-generated traveling shear wave stimuli. While ultrasound elastography has shown promising results for non-invasive assessment of liver fibrosis, new applications in breast, thyroid, prostate, kidney and lymph node imaging are emerging. Here, we review the basic principles, foundation physics, and limitations of ultrasound elastography and summarize its current clinical use and ongoing developments in various clinical applications. PMID:28435467

  13. Determinants of Weight Gain in Women with Early-Stage Breast Cancer

    DTIC Science & Technology

    2010-04-01

    status, anthropometry, diet, physical activity, and psychological variables (fatigue, depression , social support) at baseline, 6, and 12 months. These...cytokine-driven symptoms experienced after breast cancer, including fatigue and depression . We highlight the similarity of some breast cancer-associated...Anti- depressants have been shown to help relieve hot flushes in male patients recovering from prostate cancer similarly as in women with breast cancer

  14. A pituitary gene encodes a protein that produces differentiation of breast and prostate cancer cells.

    PubMed

    Platica, Micsunica; Ivan, Elena; Holland, James F; Ionescu, Alin; Chen, Sheryl; Mandeli, John; Unger, Pamela D; Platica, Ovidiu

    2004-02-10

    A cDNA clone of 1.1 kb encoding a 108-aa polypeptide was isolated from a human pituitary cDNA library by expression cloning. This protein was named tumor differentiation factor (TDF). The recombinant TDF protein and a 20-aa peptide, P1, selected from the ORF of the gene, induced morphological and biochemical changes consistent with differentiation of human breast and prostate cancer cells. Fibroblast, kidney, hepatoma, and leukemic lymphocytic cell lines were unaffected. Breast and prostate cancer cells aggregated in spheroid-like structures within 24 h of exposure to TDF. This effect was abrogated by a specific affinity-purified rabbit polyclonal anti-P1 Ab. E-cadherin expression was increased in a dose-dependent manner by TDF. Treatment of MCF7 cells with TDF led to production of a lactalbumin-related protein. Peptide P1 significantly decreased the growth of androgen-independent DU145 prostate cancer in severe combined immunodeficient mice. The presence of TDF protein in human sera was detected by the anti-P1 Ab, suggesting a role of TDF in endocrine metabolism. The fact that all activities of TDF can be mimicked by a peptide derived from the encoding TDF sequence opens the possibility of therapeutic applications.

  15. Research Advances

    ERIC Educational Resources Information Center

    King, Angela G.

    2005-01-01

    Scientists at Texas Tech University measured perchlorate levels in breast milk and store-bought milk from across the US. Findings revealed that high levels of perchlorate might be correlated with low levels of iodide in breast milk, which can inhibit thyroid function in nursing women, an essential component for proper neural development of the…

  16. MSH3 rs26279 polymorphism increases cancer risk: a meta-analysis

    PubMed Central

    Miao, Hui-Kai; Chen, Li-Ping; Cai, Dong-Ping; Kong, Wei-Ju; Xiao, Li; Lin, Jie

    2015-01-01

    Previous studies have investigated the association of mutS homolog 3 (MSH3) rs26279 G > A polymorphism with the risk of different types of cancers including colorectal cancer, breast cancer, prostate cancer, bladder cancer, thyroid cancer, ovarian cancer and oesophageal cancer. However, its association with cancer remains conflicting. We performed a comprehensive meta-analysis to derive a more precise estimation of the relationship between MSH3 rs26279 G > A polymorphism and cancer susceptibility. Systematically searching the PubMed and EMBASE databases yielded 11 publications with 12 studies of 3282 cases and 6476 controls. The strength of the association was determined by crude odds ratios (OR) and 95% confidence intervals (CI). Overall, pooled risk estimates demonstrated that MSH3 rs26279 G > A was significantly associated with an increased overall cancer risk under all the genetic models (GG vs. AA: OR = 1.27, 95% CI = 1.09-1.48, P = 0.002; AG vs. AA: OR = 1.10, 95% CI = 1.00-1.21, P = 0.045; GG vs. AG + AA: OR = 1.23, 95% CI = 1.06-1.42, P = 0.005; AG + GG vs. AA: OR = 1.13, 95% CI = 1.04-1.24, P = 0.006; G vs. A: OR = 1.13, 95% CI = 1.05-1.20, P = 0.001). The association was more evident for colorectal cancer and breast cancer. Moreover, the significant association was also observed in the following subgroups: Europeans, Asians, population-based studies, hospital-based studies, and studies comprising relatively large sample size (≥ 200). Our meta-analysis results demonstrated that MSH3 rs26279 G > A polymorphism is associated with an increased risk of overall cancer, especially for the colorectal cancer and breast cancer. PMID:26617824

  17. MSH3 rs26279 polymorphism increases cancer risk: a meta-analysis.

    PubMed

    Miao, Hui-Kai; Chen, Li-Ping; Cai, Dong-Ping; Kong, Wei-Ju; Xiao, Li; Lin, Jie

    2015-01-01

    Previous studies have investigated the association of mutS homolog 3 (MSH3) rs26279 G > A polymorphism with the risk of different types of cancers including colorectal cancer, breast cancer, prostate cancer, bladder cancer, thyroid cancer, ovarian cancer and oesophageal cancer. However, its association with cancer remains conflicting. We performed a comprehensive meta-analysis to derive a more precise estimation of the relationship between MSH3 rs26279 G > A polymorphism and cancer susceptibility. Systematically searching the PubMed and EMBASE databases yielded 11 publications with 12 studies of 3282 cases and 6476 controls. The strength of the association was determined by crude odds ratios (OR) and 95% confidence intervals (CI). Overall, pooled risk estimates demonstrated that MSH3 rs26279 G > A was significantly associated with an increased overall cancer risk under all the genetic models (GG vs. AA: OR = 1.27, 95% CI = 1.09-1.48, P = 0.002; AG vs. AA: OR = 1.10, 95% CI = 1.00-1.21, P = 0.045; GG vs. AG + AA: OR = 1.23, 95% CI = 1.06-1.42, P = 0.005; AG + GG vs. AA: OR = 1.13, 95% CI = 1.04-1.24, P = 0.006; G vs. A: OR = 1.13, 95% CI = 1.05-1.20, P = 0.001). The association was more evident for colorectal cancer and breast cancer. Moreover, the significant association was also observed in the following subgroups: Europeans, Asians, population-based studies, hospital-based studies, and studies comprising relatively large sample size (≥ 200). Our meta-analysis results demonstrated that MSH3 rs26279 G > A polymorphism is associated with an increased risk of overall cancer, especially for the colorectal cancer and breast cancer.

  18. Molecular and cellular regulation of glucose transporter (GLUT) proteins in cancer.

    PubMed

    Macheda, Maria L; Rogers, Suzanne; Best, James D

    2005-03-01

    Malignant cells are known to have accelerated metabolism, high glucose requirements, and increased glucose uptake. Transport of glucose across the plasma membrane of mammalian cells is the first rate-limiting step for glucose metabolism and is mediated by facilitative glucose transporter (GLUT) proteins. Increased glucose transport in malignant cells has been associated with increased and deregulated expression of glucose transporter proteins, with overexpression of GLUT1 and/or GLUT3 a characteristic feature. Oncogenic transformation of cultured mammalian cells causes a rapid increase of glucose transport and GLUT1 expression via interaction with GLUT1 promoter enhancer elements. In human studies, high levels of GLUT1 expression in tumors have been associated with poor survival. Studies indicate that glucose transport in breast cancer is not fully explained by GLUT1 or GLUT3 expression, suggesting involvement of another glucose transporter. Recently, a novel glucose transporter protein, GLUT12, has been found in breast and prostate cancers. In human breast and prostate tumors and cultured cells, GLUT12 is located intracellularly and at the cell surface. Trafficking of GLUT12 to the plasma membrane could therefore contribute to glucose uptake. Several factors have been implicated in the regulation of glucose transporter expression in breast cancer. Hypoxia can increase GLUT1 levels and glucose uptake. Estradiol and epidermal growth factor, both of which can play a role in breast cancer cell growth, increase glucose consumption. Estradiol and epidermal growth factor also increase GLUT12 protein levels in cultured breast cancer cells. Targeting GLUT12 could provide novel methods for detection and treatment of breast and prostate cancer. 2004 Wiley-Liss, Inc.

  19. Circadian pathway genetic variation and cancer risk: evidence from genome-wide association studies.

    PubMed

    Mocellin, Simone; Tropea, Saveria; Benna, Clara; Rossi, Carlo Riccardo

    2018-02-19

    Dysfunction of the circadian clock and single polymorphisms of some circadian genes have been linked to cancer susceptibility, although data are scarce and findings inconsistent. We aimed to investigate the association between circadian pathway genetic variation and risk of developing common cancers based on the findings of genome-wide association studies (GWASs). Single nucleotide polymorphisms (SNPs) of 17 circadian genes reported by three GWAS meta-analyses dedicated to breast (Discovery, Biology, and Risk of Inherited Variants in Breast Cancer (DRIVE) Consortium; cases, n = 15,748; controls, n = 18,084), prostate (Elucidating Loci Involved in Prostate Cancer Susceptibility (ELLIPSE) Consortium; cases, n = 14,160; controls, n = 12,724) and lung carcinoma (Transdisciplinary Research In Cancer of the Lung (TRICL) Consortium; cases, n = 12,160; controls, n = 16,838) in patients of European ancestry were utilized to perform pathway analysis by means of the adaptive rank truncated product (ARTP) method. Data were also available for the following subgroups: estrogen receptor negative breast cancer, aggressive prostate cancer, squamous lung carcinoma and lung adenocarcinoma. We found a highly significant statistical association between circadian pathway genetic variation and the risk of breast (pathway P value = 1.9 × 10 -6 ; top gene RORA, gene P value = 0.0003), prostate (pathway P value = 4.1 × 10 -6 ; top gene ARNTL, gene P value = 0.0002) and lung cancer (pathway P value = 6.9 × 10 -7 ; top gene RORA, gene P value = 2.0 × 10 -6 ), as well as all their subgroups. Out of 17 genes investigated, 15 were found to be significantly associated with the risk of cancer: four genes were shared by all three malignancies (ARNTL, CLOCK, RORA and RORB), two by breast and lung cancer (CRY1 and CRY2) and three by prostate and lung cancer (NPAS2, NR1D1 and PER3), whereas four genes were specific for lung cancer (ARNTL2, CSNK1E, NR1D2 and PER2) and two for breast cancer (PER1, RORC). Our findings, based on the largest series ever utilized for ARTP-based gene and pathway analysis, support the hypothesis that circadian pathway genetic variation is involved in cancer predisposition.

  20. Is Serum Prostate-specific Antigen a Diagnostic Marker for Benign and Malignant Breast Tumors in Women.

    PubMed

    Razavi, Seyed Hasan Emami; Ghajarzadeh, Mahsa; Abdollahi, Alireza; Taran, Ludmila; Shoar, Saeed; Omranipour, Ramesh

    2015-06-01

    Breast cancer is the most common cancer in women. Prostrate-specific antigen (PSA) is a marker of prostate gland malignancy which has been considered in cases with breast cancer in recent years. The goal of this study was to determine total and free PSA levels in cases with malignant and benign breast lesions. Ninety women with histological proved malignant breast masses and 90 with benign breast masses were enrolled. Total and free PSA levels along with histological grade and conditions of vascular and perinural invasion, status of hormonal tumor receptors, immune-histo-chemistry markers recorded for all cases. Total and free PSA levels were assessed after treatment in cases with malignant masses. Total and free PSA levels were significantly higher in cases with malignant masses. The best cut off point for total PSA to differentiate benign and malignant masses was 0.31 and the best cut off point for free PSA to differentiate benign and malignant masses was 0.19. After treatment, mean free PSA level was significantly lower than free PSA before treatment (0.23 vs 0.3, p<0.001). Serum PSA level could be applied for differentiating benign and malignant breast masses.

  1. Mobile Phone Apps for Quality of Life and Well-Being Assessment in Breast and Prostate Cancer Patients: Systematic Review.

    PubMed

    Rincon, Esther; Monteiro-Guerra, Francisco; Rivera-Romero, Octavio; Dorronzoro-Zubiete, Enrique; Sanchez-Bocanegra, Carlos Luis; Gabarron, Elia

    2017-12-04

    Mobile phone health apps are increasingly gaining attention in oncological care as potential tools for supporting cancer patients. Although the number of publications and health apps focusing on cancer is increasing, there are still few specifically designed for the most prevalent cancers diagnosed: breast and prostate cancers. There is a need to review the effect of these apps on breast and prostate cancer patients' quality of life (QoL) and well-being. The purposes of this study were to review the scientific literature on mobile phone apps targeting breast or prostate cancer patients and involving QoL and well-being (anxiety and depression symptoms) and analyze the clinical and technological characteristics, strengths, and weaknesses of these apps, as well as patients' user experience with them. We conducted a systematic review of peer-reviewed literature from The Cochrane Library, Excerpta Medica Database, PsycINFO, PubMed, Scopus, and MEDLINE to identify studies involving apps focused on breast and/or prostate cancer patients and QoL and/or well-being published between January 1, 2000, and July 12, 2017. Only trial studies which met the inclusion criteria were selected. The systematic review was completed with a critical analysis of the apps previously identified in the health literature research that were available from the official app stores. The systematic review of the literature yielded 3862 articles. After removal of duplicates, 3229 remained and were evaluated on the basis of title and abstract. Of these, 3211 were discarded as not meeting the inclusion criteria, and 18 records were selected for full text screening. Finally, 5 citations were included in this review, with a total of 644 patients, mean age 52.16 years. Four studies targeted breast cancer patients and 1 focused on prostate cancer patients. Four studies referred to apps that assessed QoL. Only 1 among the 5 analyzed apps was available from the official app store. In 3 studies, an app-related intervention was carried out, and 2 of them reported an improvement on QoL. The lengths of the app-related interventions varied from 4 to 12 weeks. Because 2 of the studies only tracked use of the app, no effect on QoL or well-being was found. Despite the existence of hundreds of studies involving cancer-focused mobile phone apps, there is a lack of rigorous trials regarding the QoL and/or well-being assessment in breast and/or prostate cancer patients. A strong and collective effort should be made by all health care providers to determine those cancer-focused apps that effectively represent useful, accurate, and reliable tools for cancer patients' disease management. PROSPERO CRD42017073069; https://www.crd.york.ac.uk/PROSPERO/display_record.asp?ID= CRD42017073069 (Archived by WebCite at http://www.webcitation.org/6v38Clb9T). ©Esther Rincon, Francisco Monteiro-Guerra, Octavio Rivera-Romero, Enrique Dorronzoro-Zubiete, Carlos Luis Sanchez-Bocanegra, Elia Gabarron. Originally published in JMIR Mhealth and Uhealth (http://mhealth.jmir.org), 04.12.2017.

  2. Evidence of Prostate-Specific Membrane Antigen Expression in Metastatic Differentiated Thyroid Cancer Using 68Ga-PSMA-HBED-CC PET/CT.

    PubMed

    Verma, Priyanka; Malhotra, Gaurav; Agrawal, Ritesh; Sonavane, Sunita; Meshram, Vilas; Asopa, Ramesh V

    2018-06-12

    Prostate-specific membrane antigen (PSMA) overexpression is not restricted to prostate cancer, but it has also been demonstrated in gliomas, lung cancer, and in tumor neovasculature. Systematic studies exploring PSMA uptake in thyroid tumors are lacking. The aim of this pilot study was to assess PSMA expression in patients with metastatic differentiated thyroid cancer (mDTC). Ten patients of mDTC harboring 32 lesions (5 men; age range, 38-65 years; mean age, 50 years) underwent prospective evaluation with radioiodine (I), F-FDG PET, and Ga-PSMA-HBED-CC PET scans as per the institution protocol. PSMA expression (SUVmax) was compared with F-FDG and I scan findings in all patients. Lesions were radioiodine avid in 8 patients, whereas 2 were classified as thyroglobulin elevation with negative iodide scintigraphy (TENIS) patients. All patients with iodine-avid metastatic disease showed substantial PSMA uptake. PSMA PET detected 30/32 total lesions (93.75%; SUVmax ranging from 4.86 to 101.81 with median SUVmax of 31.35), whereas FDG PET/CT was positive in 23/32 lesions (81.85%). Twenty-one (70%) of 30 lesions that showed PSMA expression were localized to the bones. PSMA localized a lesion in each of the 2 TENIS patients similar to FDG PET scan. Ga-PSMA-HBED-CC PET/CT is a potentially useful imaging modality in patients of mDTC with most (70%) of PSMA expressing metastasis being localized to the bones. PSMA PET/CT could be useful for identifying patients with limited therapeutic options (eg, TENIS) who might benefit from PSMA-targeted radionuclide therapy.

  3. Egg intake and cancers of the breast, ovary and prostate: a dose-response meta-analysis of prospective observational studies.

    PubMed

    Keum, N; Lee, D H; Marchand, N; Oh, H; Liu, H; Aune, D; Greenwood, D C; Giovannucci, E L

    2015-10-14

    Evidence suggests that egg intake may be implicated in the aetiology of sex hormone-related cancers. However, dose-response relationships between egg intake and such cancers are unclear. Thus, we conducted a dose-response meta-analysis to summarise the dose-response relationships between egg consumption and the risk of breast, prostate and gynaecological cancers. A literature search was performed using PubMed and Embase up to April 2015 to identify relevant prospective observational studies. Summary relative risk (RR) and 95% CI were estimated using a random-effects model. For breast cancer, the linear dose-response meta-analysis found a non-significantly increased risk (RR for an increase of 5 eggs consumed/week: 1·05, 95% CI 0·99, 1·11, n 16,023 cases). Evidence for non-linearity was not statistically significant (P non-linearity= 0·50, n 15,415 cases) but consuming ≥ 5 eggs/week was significantly associated with an increased risk of breast cancer compared with no egg consumption, with the summary RR being 1·04 (95% CI 1·01, 1·07) for consuming 5 eggs/week and 1·09 (95% CI 1·03, 1·15) for consuming about 9 eggs/week. For other cancers investigated, the summary RR for an increase of 5 eggs consumed/week was 1·09 (95% CI 0·96, 1·24, n 2636 cases) for ovarian cancer; 1·47 (95% CI 1·01, 2·14, n 609 cases) for fatal prostate cancer, with evidence of small-study effects (P Egger= 0·04). No evidence was found for an association with the risk of total prostate cancer. While our conclusion was tempered by the potential for publication bias and confounding, high egg intake may be associated with a modestly elevated risk of breast cancer, and a positive association between egg intake and ovarian and fatal prostate cancers cannot be ruled out.

  4. The fibroblast surface markers FAP, anti-fibroblast, and FSP are expressed by cells of epithelial origin and may be altered during epithelial-to-mesenchymal transition.

    PubMed

    Kahounová, Zuzana; Kurfürstová, Daniela; Bouchal, Jan; Kharaishvili, Gvantsa; Navrátil, Jiří; Remšík, Ján; Šimečková, Šárka; Študent, Vladimír; Kozubík, Alois; Souček, Karel

    2017-04-06

    The identification of fibroblasts and cancer-associated fibroblasts from human cancer tissue using surface markers is difficult, especially because the markers used currently are usually not expressed solely by fibroblasts, and the identification of fibroblast-specific surface molecules is still under investigation. It was aimed to compare three commercially available antibodies in the detection of different surface epitopes of fibroblasts (anti-fibroblast, fibroblast activation protein α, and fibroblast surface protein). The specificity of their expression, employing fibroblast cell lines and tumor-derived fibroblasts from breast and prostate tissues was investigated. Both the established fibroblast cell line HFF-1 and ex vivo primary fibroblasts isolated from breast and prostate cancer tissues expressed the tested surface markers to different degrees. Surprisingly, those markers were expressed also by permanent cell lines of epithelial origin, both benign and cancer-derived (breast-cell lines MCF 10A, HMLE and prostate-cell lines BPH-1, DU 145, and PC-3). The expression of fibroblast activation protein α increased on the surface of previously described models of epithelial cells undergoing epithelial-to-mesenchymal transition in response to treatment with TGF-β1. To prove the co-expression of the fibroblast markers on cells of epithelial origin, we used freshly dissociated human prostate and breast cancer tissues. The results confirmed the co-expression of anti-fibroblast and fibroblast surface protein on CD31/CD45-negative/EpCAM-positive epithelial cells. In summary, our data support the findings that the tested fibroblast markers are not fibroblast specific and may be expressed also by cells of epithelial origin (e.g., cells undergoing EMT). Therefore, the expression of these markers should be interpreted with caution, and the combination of several epitopes for both positive (anti-fibroblast or fibroblast activation protein α) and negative (EpCAM) identification of fibroblasts from breast and prostate tumor tissues is advised. © 2017 International Society for Advancement of Cytometry. © 2017 International Society for Advancement of Cytometry.

  5. Do cell surface trafficking impairments account for variable cell surface sodium iodide symporter levels in breast cancer?

    PubMed Central

    Beyer, S.J.; Jimenez, R.E.; Shapiro, C.L.; Cho, J.Y.; Jhiang, S.M.

    2009-01-01

    The Na+/I- symporter (NIS) is a transmembrane glycoprotein that mediates iodide uptake into thyroid follicular cells and serves as the molecular basis of radioiodine imaging and therapy for thyroid cancer patients. The finding that NIS protein is present in 80-90% of breast tumors suggests that breast cancer patients may also benefit from NIS-mediated radionuclide imaging and targeted therapy. However, only 17-25% of NIS-positive breast tumors have detectable radionuclide uptake activity. The discrepancy between NIS expression and radionuclide uptake activity is most likely contributed by variable cell surface NIS protein levels. Apart from the prevalent view that NIS cell surface trafficking impairments account for the variability, our current study proposes that differential levels of NIS expression may also account for variable cell surface NIS levels among breast tumors. We address the need to confirm the identity of intracellular NIS staining to reveal the mechanisms underlying variable cell surface NIS levels. In addition, we warrant a quantitative correlation between cell surface NIS levels and radionuclide uptake activity in patients such that the cell surface NIS levels required for radionuclide imaging can be defined and the defects impairing NIS activity can be recognized. PMID:18500672

  6. [A patient with thyroid cancer evaluated according to Response Evaluation Criteria in Solid Tumors during treatment for breast cancer recurrence in hepatic and cervical lymph nodes].

    PubMed

    Hayashi, Keiko; Enomoto, Takumo; Oshida, Sayuri; Habiro, Takeyoshi; Hatate, Kazuhiko; Sengoku, Norihiko; Watanabe, Masahiko

    2013-11-01

    We describe a case of a 69-year-old woman who underwent left breast-preserving surgery and axillary dissection for left-sided breast cancer at 60 years of age. The histopathological diagnosis was papillotubular carcinoma, luminal A (pathological T1N0M0).In the eighth year after surgery, computed tomography (CT) revealed recurrence in the liver and cervical lymph node metastasis. The patient did not respond to 3 months of treatment with letrozole (progressive disease [PD]). Six courses of chemotherapy with epirubicin and cyclophosphamide (EC) were administered. Subsequently, the attending physician was replaced while the patient was receiving paclitaxel( PTX).After 4 courses of treatment with PTX, the liver metastasis disappeared (complete response [CR]).However, the cervical lymph nodes did not shrink (PD).The cytological diagnosis was papillary thyroid cancer with associated cervical lymph node metastasis. Total thyroidectomy and D3b cervical lymph node dissection were performed. The pathological diagnosis was pEx0T1bN1Mx, pStage IVA disease. Replacement of the attending physician is a critical turning point for patients. During chemotherapy or hormone therapy for breast cancer, each organ should be evaluated according to Response Evaluation Criteria in Solid Tumors (RECIST).In the case of our patient, thyroid cancer was diagnosed according to RECIST. Cancer specialists should bear in mind that the treatment policy may change dramatically depending on the results of RECIST assessment.

  7. A methylene chloride fraction of Saururus chinensis induces apoptosis through the activation of caspase-3 in prostate and breast cancer cells.

    PubMed

    Kim, Han-Young; Choi, Tae Won; Kim, Hyun Jung; Kim, Sung-Moo; Park, Kyung-Ran; Jang, Hyeung-Jin; Lee, Eun Ha; Kim, Chul Young; Jung, Sang Hoon; Shim, Bum Sang; Ahn, Kwang Seok

    2011-05-15

    The aerial parts of Saururus chinensis (SC) have been used for the treatment of edema, fever, jaundice, and inflammatory diseases in Korean folk medicine for centuries. However, the mechanism by which SC exerts these anti-tumorigenic activities in human prostate and breast cancer cells has not yet been fully understood. In this study, we report on the methylene chloride fraction from SC exerting cytotoxicity against prostate and breast cancer cells in a dose-dependent manner. Specifically, SC exerted the most potent cytotoxicity in LNCaP and MCF-7 cells. SC was shown to down-regulate various angiogenetic (VEGF), proliferative (Cyclin D₁, anti-apoptotic (Bcl-2) gene products in these cells. SC also increased the number of annexin V-positive apoptotic bodies and the sub-G1 DNA contents of the cell cycle undergoing apoptosis through caspase-3 activation in both LNCaP and MCF-7 cells. We further confirmed that caspase-3 plays an important role in SC-induced apoptosis in LNCaP and MCF-7 cells through the use of the caspase-3 inhibitor. Moreover, we observed that SC potentiated paclitaxel-induced apoptosis in MCF-7 cells and sauchinone is a major active constituent of SC, which could induce apoptosis in the cells. Taken together, our data provide the evidence that SC induces apoptosis depending on caspase-3 activation and overcomes the natural biological resistance to chemotherapy found in human prostate and breast cancer cells. Copyright © 2010 Elsevier GmbH. All rights reserved.

  8. Normal distribution pattern and physiological variants of 68Ga-PSMA-11 PET/CT imaging.

    PubMed

    Demirci, Emre; Sahin, Onur Erdem; Ocak, Meltem; Akovali, Burak; Nematyazar, Jamal; Kabasakal, Levent

    2016-11-01

    Ga-PSMA-11 is a novel PET tracer suggested to be used for imaging of advanced prostate cancer. In this study, we aimed to present a detailed biodistribution of Ga-PSMA-11, including physiological and benign variants of prostate-specific membrane antigen (PSMA) imaging. We carried out a retrospective analysis of 40 patients who underwent PSMA PET/computed tomography (CT) imaging and who had no evidence of residual or metastatic disease on the scans. In addition, 16 patients who underwent PSMA PET/CT imaging with any indication other than prostate cancer were included in the study to evaluate physiological uptake in the normal prostate gland. The median, minimum-maximum, and mean standardized uptake value (SUV) values were calculated for visceral organs, bone marrow and lymph nodes, and mucosal areas. Any physiological variants or benign lesions with Ga-PSMA-11 were also noted. Ga-PSMA-11 uptake was noted in the kidneys, parotid and submandibular glands, duodenum, small intestines, spleen, liver, and lacrimal glands, and mucosal uptake in the nasopharynx, vocal cords, pancreas, stomach, mediastinal blood pool, thyroid gland, adrenal gland, rectum, vertebral bone marrow, and testes. Celiac ganglia showed slight Ga-PSMA-11 uptake in 24 of 40 patients without the presence of any other pathologic lymph nodes in abdominal and pelvic areas. Variable uptake of Ga-PSMA-11 was observed in calcified choroid plexus, a thyroid nodule, an adrenal nodule, axillary lymph nodes and celiac ganglia, occasional osteophytes, and gallbladder. The patient group with PSMA PET/CT for indications other than prostate cancer (n=16) showed a slight radiotracer uptake in normal prostate gland (SUVmax: 5.5±1.6, range: 3.5-8.3). This study shows normal distribution pattern, range of SUVs, and physiological variants of Ga-PSMA-11. In addition, several potential pitfalls were documented to prevent misinterpretations of the scan.

  9. 9 CFR 318.1 - Products and other articles entering official establishments.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... substance shall be brought into or kept in an official establishment. (f) [Reserved] (g) Glands and organs, such as cotyledons, ovaries, prostate glands, tonsils, spinal cords, and detached lymphatic, pineal, pituitary, parathyroid, suprarenal, pancreatic and thyroid glands, used in preparing pharmaceutical...

  10. 9 CFR 318.1 - Products and other articles entering official establishments.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... substance shall be brought into or kept in an official establishment. (f) [Reserved] (g) Glands and organs, such as cotyledons, ovaries, prostate glands, tonsils, spinal cords, and detached lymphatic, pineal, pituitary, parathyroid, suprarenal, pancreatic and thyroid glands, used in preparing pharmaceutical...

  11. 9 CFR 318.1 - Products and other articles entering official establishments.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... substance shall be brought into or kept in an official establishment. (f) [Reserved] (g) Glands and organs, such as cotyledons, ovaries, prostate glands, tonsils, spinal cords, and detached lymphatic, pineal, pituitary, parathyroid, suprarenal, pancreatic and thyroid glands, used in preparing pharmaceutical...

  12. 9 CFR 318.1 - Products and other articles entering official establishments.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... substance shall be brought into or kept in an official establishment. (f) [Reserved] (g) Glands and organs, such as cotyledons, ovaries, prostate glands, tonsils, spinal cords, and detached lymphatic, pineal, pituitary, parathyroid, suprarenal, pancreatic and thyroid glands, used in preparing pharmaceutical...

  13. 9 CFR 318.1 - Products and other articles entering official establishments.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... substance shall be brought into or kept in an official establishment. (f) [Reserved] (g) Glands and organs, such as cotyledons, ovaries, prostate glands, tonsils, spinal cords, and detached lymphatic, pineal, pituitary, parathyroid, suprarenal, pancreatic and thyroid glands, used in preparing pharmaceutical...

  14. Cancer Incidence Trends Among Asian American Populations in the United States, 1990–2008

    PubMed Central

    2013-01-01

    Background National cancer incidence trends are presented for eight Asian American groups: Asian Indians/Pakistanis, Chinese, Filipinos, Japanese, Kampucheans, Koreans, Laotians, and Vietnamese. Methods Cancer incidence data from 1990 through 2008 were obtained from 13 Surveillance, Epidemiology, End Results (SEER) registries. Incidence rates from 1990 through 2008 and average percentage change were computed using SEER*Stat and Joinpoint software. The annual percentage change (APC) in incidence rates was estimated with 95% confidence intervals (95% CIs) calculated for both the rate and APC estimates. Rates for non-Hispanic whites are presented for comparison. Results Prostate cancer was the most common malignancy among most groups, followed by lung, colorectal, liver, and stomach cancers. Breast cancer was generally the most common cancer in women, followed by colorectal and lung cancers; liver, cervix, thyroid, and stomach cancers also ranked highly. Among men, increasing trends were observed for prostate (Asian Indians and Pakistanis: APC 1990–2003 = 2.2, 95% CI = 0.3 to 4.1; Filipinos: APC 1990–1994 = 19.0, 95% CI = 4.5 to 35.4; Koreans: APC 1990–2008 = 2.9, 95% CI = 1.8 to 4.0), colorectal (Koreans: APC 1990–2008 = 2.2, 95% CI = 0.9 to 3.5), and liver cancers (Filipinos: APC 1990–2008 = 1.6, 95% CI = 0.4 to 2.7; Koreans: APC 1990–2006 = 2.1, 95% CI = 0.4 to 3.7; Vietnamese: APC 1990–2008 = 1.6, 95% CI = 0.3 to 2.8), whereas lung and stomach cancers generally remained stable or decreased. Among women, increases were observed for uterine cancer (Asian Indians: APC 1990–2008 = 3.0, 95% CI = 0.3 to 5.8; Chinese: APC 2004–2008 = 7.0, 95% CI = 1.4 to 12.9; Filipina: APC 1990–2008 = 3.0, 95% CI = 2.4 to 3.7; Japanese: APC 1990–2008 = 1.1, 95% CI = 0.1 to 2.0), colorectal cancer (Koreans: APC 1990–2008 = 2.8, 95% CI = 1.7 to 3.9; Laotians: APC: 1990–2008 = 5.9, 95% CI = 4.0 to 7.7), lung cancer (Filipinas: APC 1990–2008 = 2.1, 95% CI = 1.4 to 2.8; Koreans: APC 1990–2008 = 2.1, 95% CI = 0.6 to 3.6), thyroid cancer (Filipinas: APC 1990–2008 = 2.5, 95% CI = 1.7 to 3.3), and breast cancer in most groups (APC 1990–2008 from 1.2 among Vietnamese and Chinese to 4.7 among Koreans). Decreases were observed for stomach (Chinese and Japanese), colorectal (Chinese), and cervical cancers (Laotians and Vietnamese). Conclusions These data fill a critical knowledge gap concerning the cancer experience of Asian American groups and highlight where increased preventive, screening, and surveillance efforts are needed—in particular, lung cancer among Filipina and Korean women and Asian Indian/Pakistani men, breast cancer among all women, and liver cancer among Vietnamese, Laotian, and Kampuchean women and Filipino, Kampuchean, and Vietnamese men. PMID:23878350

  15. Monitoring of PBDEs concentration in umbilical cord blood and breast milk from Korean population and estimating the effects of various parameters on accumulation in humans.

    PubMed

    Kim, Un-Jung; Lee, In-Seok; Kim, Hyung Sik; Oh, Jeong-Eun

    2011-10-01

    In this study, we investigated concentration, congener distribution pattern, and effects of potential environmental factors that affect PBDE accumulation. We also estimated correlation between PBDE concentration and health status or thyroid function by analyzing 90 cord blood and 21 breast milk samples obtained from Korean population. Seven from tri- to hepta-BDEs were analyzed by solid phase extraction-high-resolution gas chromatography/high-resolution mass spectrometry (SPE-HRGC/HRMS). The total concentration of 7 PBDEs in cord blood was 2.786-94.64 ng g(-1) lipid and that in breast milk was 1.076-8.664 ng g(-1) lipid. Tetra-BDE (#47) was the predominant type of PBDE and was present at concentrations of over 40% in both sample types. A weak correlation was observed between the concentration of BDE28 and 153 and thyroid hormone concentration only in the breast milk samples. In children, a weak negative correlation was observed between free thyroxine (FT4) concentration and BDE28 concentration (0.302, p<0.05), while in mothers, a weak positive correlation was observed between thyroid hormone concentration and BDE153 concentration (0.403, p<0.05). No significant correlations between PBDE concentration and work and residential environments were found in this study, but a weak correlation between BDE concentration in cord blood and potential PBDE sources was confirmed by investigating the frequency of oil paint usage (0.510, p<0.001). A weak correlation was also found between PBDE concentration in breast milk during pregnancy and dietary habits such as green tea drinking (0.541, p=0.025) and Trichiuridae intake (0.565, p=0.015). Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Anti-thyroid peroxidase antibodies are associated with the absence of distant metastases in patients with newly diagnosed breast cancer.

    PubMed

    Farahati, Jamshid; Roggenbuck, Dirk; Gilman, Elena; Schütte, Martin; Jagminaite, Elena; Seyed Zakavi, Rasoul; Löning, Thomas; Heissen, Eberhard

    2012-04-01

    The presence of thyroid peroxidase antibodies (TPOab) are reported to be associated with improved outcome among breast cancer patients. We evaluated the correlation between TPOab and diagnostic parameters among newly diagnosed breast cancer patients. Three hundred and fourteen newly diagnosed patients with breast cancer, diagnosed and treated in Bethesda Essen between January 2002 and June 2006, were included in this study; 258 (82.2%) without TPOab (≤100 IU/mL) and 56 (17.8%) with TPOab (>100 IU/mL). Blood analysis was performed to measure serum levels of carcinoembryonic antigen (CEA), cancer antigen 15-3 (CA-15-3), free triiodothyronine (fT3), free thyroxine (fT4), thyroid-stimulating hormone (TSH) and TPOab by radioimmunoassay. Data regarding age, tumor size, grading, TNM classification, receptor status, lymph node, and distant metastases were collected and analyzed from patient reports. Statistics were performed using Pearson’s χ2-test and logistic regression analysis. There were no incidences of distant metastasis among 56 patients with TPOab, whereas 17 (6.6%) of 258 cases without TPOab displayed distant metastases (p=0.04). Logistic regression showed an inverse association of TPOab with CA-15-3 and CEA levels (p<0.001, respectively). Both groups, with and without TPOab, revealed no significant differences with respect to age, tumor size, grading, TNM classification, fT3, fT4, and receptor status. TPOab positive patients had higher TSH levels (2.55±3.58), compared to TPOab negative cases (1.20±1.15) (p<0.001). TPOab occurrence is associated with significantly lower frequency of distant metastases in breast cancer. TPOab level inversely correlates with the conventional tumor markers CA-15-3 and CEA.

  17. Epigenetics in breast and prostate cancer.

    PubMed

    Wu, Yanyuan; Sarkissyan, Marianna; Vadgama, Jaydutt V

    2015-01-01

    Most recent investigations into cancer etiology have identified a key role played by epigenetics. Specifically, aberrant DNA and histone modifications which silence tumor suppressor genes or promote oncogenes have been demonstrated in multiple cancer models. While the role of epigenetics in several solid tumor cancers such as colorectal cancer are well established, there is emerging evidence that epigenetics also plays a critical role in breast and prostate cancer. In breast cancer, DNA methylation profiles have been linked to hormone receptor status and tumor progression. Similarly in prostate cancer, epigenetic patterns have been associated with androgen receptor status and response to therapy. The regulation of key receptor pathways and activities which affect clinical therapy treatment options by epigenetics renders this field high priority for elucidating mechanisms and potential targets. A new set of methylation arrays are now available to screen epigenetic changes and provide the cutting-edge tools needed to perform such investigations. The role of nutritional interventions affecting epigenetic changes particularly holds promise. Ultimately, determining the causes and outcomes from epigenetic changes will inform translational applications for utilization as biomarkers for risk and prognosis as well as candidates for therapy.

  18. Epigenetics in Breast and Prostate Cancer

    PubMed Central

    Wu, Yanyuan; Sarkissyan, Marianna; Vadgama, Jaydutt V.

    2015-01-01

    SUMMARY Most recent investigations into cancer etiology have identified a key role played by epigenetics. Specifically, aberrant DNA and histone modifications which silence tumor suppressor genes or promote oncogenes have been demonstrated in multiple cancer models. While the role of epigenetics in several solid tumor cancers such as colorectal cancer are well established, there is emerging evidence that epigenetics also plays a critical role in breast and prostate cancer. In breast cancer, DNA methylation profiles have been linked to hormone receptor status and tumor progression. Similarly in prostate cancer, epigenetic patterns have been associated with androgen receptor status and response to therapy. The regulation of key receptor pathways and activities which affect clinical therapy treatment options by epigenetics renders this field high priority for elucidating mechanisms and potential targets. A new set of methylation arrays are now available to screen epigenetic changes and provide the cuttingedge tools needed to perform such investigations. The role of nutritional interventions affecting epigenetic changes particularly holds promise. Ultimately, determining the causes and outcomes from epigenetic changes will inform translational applications for utilization as biomarkers for risk and prognosis as well as candidates for therapy. PMID:25421674

  19. Radiation exposure and breast cancer: lessons from Chernobyl.

    PubMed

    Ogrodnik, Aleksandra; Hudon, Tyler W; Nadkarni, Prakash M; Chandawarkar, Rajiv Y

    2013-04-01

    The lessons learned from the Chernobyl disaster have become increasingly important after the second anniversary of the Fukushima, Japan nuclear accident. Historically, data from the Chernobyl reactor accident 27 years ago demonstrated a strong correlation with thyroid cancer, but data on the radiation effects of Chernobyl on breast cancer incidence have remained inconclusive. We reviewed the published literature on the effects of the Chernobyl disaster on breast cancer incidence, using Medline and Scopus from the time of the accident to December of 2010. Our findings indicate limited data and statistical flaws. Other confounding factors, such as discrepancies in data collection, make interpretation of the results from the published literature difficult. Re-analyzing the data reveals that the incidence of breast cancer in Chernobyl-disaster-exposed women could be higher than previously thought. We have learned little of the consequences of radiation exposure at Chernobyl except for its effects on thyroid cancer incidence. Marking the 27th year after the Chernobyl event, this report sheds light on a specific, crucial and understudied aspect of the results of radiation from a gruesome nuclear power plant disaster.

  20. Fast patient-specific Monte Carlo brachytherapy dose calculations via the correlated sampling variance reduction technique

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sampson, Andrew; Le Yi; Williamson, Jeffrey F.

    2012-02-15

    Purpose: To demonstrate potential of correlated sampling Monte Carlo (CMC) simulation to improve the calculation efficiency for permanent seed brachytherapy (PSB) implants without loss of accuracy. Methods: CMC was implemented within an in-house MC code family (PTRAN) and used to compute 3D dose distributions for two patient cases: a clinical PSB postimplant prostate CT imaging study and a simulated post lumpectomy breast PSB implant planned on a screening dedicated breast cone-beam CT patient exam. CMC tallies the dose difference, {Delta}D, between highly correlated histories in homogeneous and heterogeneous geometries. The heterogeneous geometry histories were derived from photon collisions sampled inmore » a geometrically identical but purely homogeneous medium geometry, by altering their particle weights to correct for bias. The prostate case consisted of 78 Model-6711 {sup 125}I seeds. The breast case consisted of 87 Model-200 {sup 103}Pd seeds embedded around a simulated lumpectomy cavity. Systematic and random errors in CMC were unfolded using low-uncertainty uncorrelated MC (UMC) as the benchmark. CMC efficiency gains, relative to UMC, were computed for all voxels, and the mean was classified in regions that received minimum doses greater than 20%, 50%, and 90% of D{sub 90}, as well as for various anatomical regions. Results: Systematic errors in CMC relative to UMC were less than 0.6% for 99% of the voxels and 0.04% for 100% of the voxels for the prostate and breast cases, respectively. For a 1 x 1 x 1 mm{sup 3} dose grid, efficiency gains were realized in all structures with 38.1- and 59.8-fold average gains within the prostate and breast clinical target volumes (CTVs), respectively. Greater than 99% of the voxels within the prostate and breast CTVs experienced an efficiency gain. Additionally, it was shown that efficiency losses were confined to low dose regions while the largest gains were located where little difference exists between the homogeneous and heterogeneous doses. On an AMD 1090T processor, computing times of 38 and 21 sec were required to achieve an average statistical uncertainty of 2% within the prostate (1 x 1 x 1 mm{sup 3}) and breast (0.67 x 0.67 x 0.8 mm{sup 3}) CTVs, respectively. Conclusions: CMC supports an additional average 38-60 fold improvement in average efficiency relative to conventional uncorrelated MC techniques, although some voxels experience no gain or even efficiency losses. However, for the two investigated case studies, the maximum variance within clinically significant structures was always reduced (on average by a factor of 6) in the therapeutic dose range generally. CMC takes only seconds to produce an accurate, high-resolution, low-uncertainly dose distribution for the low-energy PSB implants investigated in this study.« less

  1. Scintillating fiber optic dosimeters for breast and prostate brachytherapy

    NASA Astrophysics Data System (ADS)

    Moutinho, L. M.; Castro, I. F.; Freitas, H.; Melo, J.; Silva, P.; Gonçalves, A.; Peralta, L.; Rachinhas, P. J.; Simões, P. C. P. S.; Pinto, S.; Pereira, A.; Santos, J. A. M.; Costa, M.; Veloso, J. F. C. A.

    2017-02-01

    Brachytherapy is a radiotherapy modality where the radioactive material is placed close to the tumor, being a common treatment for skin, breast, gynecological and prostate cancers. These treatments can be of low-dose-rate, using isotopes with mean energy of 30 keV, or high-dose-rate, using isotopes such as 192Ir with a mean energy of 380 keV. Currently these treatments are performed in most cases without in-vivo dosimetry for quality control and quality assurance. We developed a dosimeter using small diameter probes that can be inserted into the patient's body using standard brachytherapy needles. By performing real-time dosimetry in breast and prostate brachytherapy it will be possible to perform real-time dose correction when deviations from the treatment plan are observed. The dosimeter presented in this work was evaluated in-vitro. The studies consisted in the characterization of the dosimeter with 500 μm diameter sensitive probes (with a BCF-12 scintillating optical fiber) using an inhouse made gelatin breast phantom with a volume of 566 cm3. A breast brachytherapy treatment was simulated considering a tumor volume of 27 cm3 and a prescribed absolute dose of 5 Gy. The dose distribution was determined by the Inverse Planning Simulated Annealing (IPSA) optimization algorithm (ELEKTA). The dwell times estimated from the experimental measurements are in agreement with the prescribed dwell times, with relative error below 3%. The measured signal-to-noise ratio (SNR) including the stem-effect contribution is below 3%.

  2. Application of the BRAFO-tiered approach for benefit-risk assessment to case studies on natural foods.

    PubMed

    Watzl, Bernhard; Gelencsér, Eva; Hoekstra, Jeljer; Kulling, Sabine; Lydeking-Olsen, Eva; Rowland, Ian; Schilter, Benoît; van Klaveren, Jakob; Chiodini, Alessandro

    2012-11-01

    There is evidence that consumption of fish, especially oily fish, has substantial beneficial effects on health. In particular an inverse relationship of oily fish intake to coronary heart disease incidence has been established. These beneficial effects are ascribed to fish oil components including long chain ω-3 polyunsaturated fatty acids. On the other hand it should be noted that oily fish also contains hazardous substances such as dioxins, PCBs and methylmercury. Soy consumption has been associated with potential beneficial and adverse effects. The claimed benefits include reduced risk of cardiovascular disease; osteoporosis, breast and prostate cancer whereas potential adverse effects include impaired thyroid function, disruption of sex hormone levels, changes in reproductive function and increased breast cancer risk The two cases of natural foods highlight the need to consider both risks and benefits in order to establish the net health impact associated to the consumption of specific food products. Within the Sixth Framework programme of the European Commission, the BRAFO project was funded to develop a framework that allows for the quantitative comparison of human health risks and benefits in relation to foods and food compounds. This paper describes the application of the developed framework to two natural foods, farmed salmon and soy protein. We conclude that the BRAFO methodology is highly applicable to natural foods. It will help the benefit-risk managers in selecting the appropriate dietary recommendations for the population. Copyright © 2011 ILSI Europe. Published by Elsevier Ltd.. All rights reserved.

  3. A Spectrum of Monoclonal Antibodies Reactive with Human Mammary Tumor Cells

    NASA Astrophysics Data System (ADS)

    Colcher, D.; Horan Hand, P.; Nuti, M.; Schlom, J.

    1981-05-01

    Splenic lymphocytes of mice, immunized with membrane-enriched fractions of metastatic human mammary carcinoma tissues, were fused with the NS-1 non-immunoglobulin-secreting murine myeloma cell line. This resulted in the generation of hybridoma cultures secreting immunoglobulins reactive in solid-phase radioimmunoassays with extracts of metastatic mammary carcinoma cells from involved livers, but not with extracts of apparently normal human liver. As a result of further screening of immunoglobulin reactivities and double cloning of cultures, 11 monoclonal antibodies were chosen that demonstrated reactivities with human mammary tumor cells and not with apparently normal human tissues. These monoclonal antibodies could be placed into at least five major groups on the basis of their differential binding to the surface of various live human mammary tumor cells in culture, to extracts of mammary tumor tissues, or to tissue sections of mammary tumor cells studied by the immunoperoxidase technique. Whereas a spectrum of reactivities to mammary tumors was observed with the 11 monoclonal antibodies, no reactivity was observed to apparently normal cells of the following human tissues: breast, lymph node, lung, skin, testis, kidney, thymus, bone marrow, spleen, uterus, thyroid, intestine, liver, bladder, tonsils, stomach, prostate, and salivary gland. Several of the antibodies also demonstrated a ``pancarcinoma'' reactivity, showing binding to selected non-breast carcinomas. None of the monoclonal antibodies showed binding to purified ferritin or carcinoembryonic antigen. Monoclonal antibodies of all five major groups, however, demonstrated binding to human metastatic mammary carcinoma cells both in axillary lymph nodes and at distal sites.

  4. Influence of polyphenol extract from evening primrose (Oenothera paradoxa) seeds on human prostate and breast cancer cell lines.

    PubMed

    Lewandowska, Urszula; Owczarek, Katarzyna; Szewczyk, Karolina; Podsędek, Anna; Koziołkiewicz, Maria; Hrabec, Elżbieta

    2014-02-03

    There is growing interest in plant polyphenols which exhibit pleiotropic biological activities, including anti-inflammatory, antioxidant, and anticancer effects. The objective of our study was to evaluate the influence of an evening primrose extract (EPE) from defatted seeds on viability and invasiveness of three human cell lines: PNT1A (normal prostate cells), DU145 (prostate cancer cells) and MDA-MB-231 (breast cancer cells). The results revealed that after 72 h of incubation the tested extract reduced the viability of DU 145 and MDA-MB-231 with IC50 equal to 14.5 μg/mL for both cell lines. In contrast, EPE did not inhibit the viability of normal prostate cells. Furthermore, EPE reduced PNT1A and MDA-MB-231 cell invasiveness; at the concentration of 21.75 μg/mL the suppression of invasion reached 92% and 47%, respectively (versus control). Additionally, zymographic analysis revealed that after 48 h of incubation EPE inhibited metalloproteinase-2 (MMP-2) and metalloproteinase-9 (MMP-9) activities in a dose-dependent manner. For PNT1A the activities of MMP-2 and MMP-9 decreased 4- and 2-fold, respectively, at EPE concentration of 29 μg/mL. In the case of MDA-MB-231 and DU 145 the decrease in MMP-9 activity at EPE concentration of 29 μg/mL was 5.5-fold and almost 1.9-fold, respectively. In conclusion, this study suggests that EPE may exhibit antimigratory, anti-invasive and antimetastatic potential towards prostate and breast cancer cell lines.

  5. Glycophenotype of breast and prostate cancer stem cells treated with thieno[2,3-b]pyridine anticancer compound.

    PubMed

    Mastelić, Angela; Čikeš Čulić, Vedrana; Režić Mužinić, Nikolina; Vuica-Ross, Milena; Barker, David; Leung, Euphemia Y; Reynisson, Jóhannes; Markotić, Anita

    2017-01-01

    Tumor progression may be driven by a small subpopulation of cancer stem cells (CSCs characterized by CD44 + /CD24 - phenotype). We investigated the influence of a newly developed thienopyridine anticancer compound (3-amino-5-oxo- N -naphthyl-5,6,7, 8-tetrahydrothieno[2,3- b ]quinoline-2-carboxamide, 1 ) on the growth, survival and glycophenotype (CD15s and GM3 containing neuraminic acid substituted with acetyl residue, NeuAc) of breast and prostate cancer stem/progenitor-like cell population. MDA-MB-231 and Du-145 cells were incubated with compound 1 alone or in combination with paclitaxel. The cellular metabolic activity was determined by the 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide (MTT) assay. The type of cell death induced by 48-h treatment was assessed using a combination of Annexin-V-FITC and propidium iodide staining. Flow cytometric analysis was performed to detect the percentage of CD44 + /CD24 - cells, and GM3 and CD15s positive CSCs, as well as the expression of GM3 and CD15s per one CSC, in both cell lines. Compound 1 produces a dose- and time-dependent cytotoxicity, mediated mainly by apoptosis in breast cancer cells, and slightly (2.3%) but statistically significant lowering breast CSC subpopulation. GM3 expression per one breast CSC was increased, and the percentage of prostate GM3 + CSC subpopulation was decreased in cells treated with compound 1 compared with non-treated cells. The percentage of CD15s + CSCs was lower in both cell lines after treatment with compound 1 . Considering that triple-negative breast cancers are characterized by an increased percentage of breast CSCs and knowing their association with an increased risk of metastasis and mortality, compound 1 is a potentially effective drug for triple-negative breast cancer treatment.

  6. The Sodium Iodide Symporter (NIS) and Potential Regulators in Normal, Benign and Malignant Human Breast Tissue

    PubMed Central

    Ryan, James; Curran, Catherine E.; Hennessy, Emer; Newell, John; Morris, John C.; Kerin, Michael J.; Dwyer, Roisin M.

    2011-01-01

    Introduction The presence, relevance and regulation of the Sodium Iodide Symporter (NIS) in human mammary tissue remains poorly understood. This study aimed to quantify relative expression of NIS and putative regulators in human breast tissue, with relationships observed further investigated in vitro. Methods Human breast tissue specimens (malignant n = 75, normal n = 15, fibroadenoma n = 10) were analysed by RQ-PCR targeting NIS, receptors for retinoic acid (RARα, RARβ), oestrogen (ERα), thyroid hormones (THRα, THRβ), and also phosphoinositide-3-kinase (PI3K). Breast cancer cells were treated with Retinoic acid (ATRA), Estradiol and Thyroxine individually and in combination followed by analysis of changes in NIS expression. Results The lowest levels of NIS were detected in normal tissue (Mean(SEM) 0.70(0.12) Log10 Relative Quantity (RQ)) with significantly higher levels observed in fibroadenoma (1.69(0.21) Log10RQ, p<0.005) and malignant breast tissue (1.18(0.07) Log10RQ, p<0.05). Significant positive correlations were observed between human NIS and ERα (r = 0.22, p<0.05) and RARα (r = 0.29, p<0.005), with the strongest relationship observed between NIS and RARβ (r = 0.38, p<0.0001). An inverse relationship between NIS and PI3K expression was also observed (r = −0.21, p<0.05). In vitro, ATRA, Estradiol and Thyroxine individually stimulated significant increases in NIS expression (range 6–16 fold), while ATRA and Thyroxine combined caused the greatest increase (range 16–26 fold). Conclusion Although NIS expression is significantly higher in malignant compared to normal breast tissue, the highest level was detected in fibroadenoma. The data presented supports a role for retinoic acid and estradiol in mammary NIS regulation in vivo, and also highlights potential thyroidal regulation of mammary NIS mediated by thyroid hormones. PMID:21283523

  7. SU-E-T-59: A Novel Multi-Beam Dynamic IMRT with Fixed-Jaw Technique for Left Breast Cancer Patients with Regional Lymph Nodes Radiotherapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, J; Yang, Z; Hu, W

    2015-06-15

    Purpose: This study was to investigate the dosimetric benefit of a novel intensity modulated radiation therapy (IMRT) technique for irradiating the left breast and regional lymph node (RLN). Methods: The breast and RLN (internal mammary node and periclavicular node) and normal tissue were contoured for 16 consecutive left-sided breast cancer patients previously treated with RT after lumpectomy. Nine equi-spaced fields IMRT (9 -field IMRT), tangential multi-beam IMRT (tangential-IMRT) and IMRT with fixed-jaw technique (FJT-IMRT) were developed and compared with three-dimensional conformal RT (3DCRT). Prescribed dose was 50 Gy in 25 fractions. Dose distributions and dose volume histograms were used tomore » evaluate plans. Results: All IMRTs achieved similar target coverage and substantially reduced heart V30 and V20 compared to the 3DCRT. The average heart mean dose had different changes, which were 9.0Gy for 9-field IMRT, 5.7Gy for tangential-IMRT and 4.2Gy for FJT-IMRT. For the contralateral lung and breast, the 9-field IMRT has the highest mean dose; and the FJT-IMRT and tangential-IMRT had similar lower value. For the thyroid, both 9-field IMRT and FJT-IMRT had similar V30 (20% and 22%) and were significantly lower than that of 3DCRT (34%) and tangential-IMRT (46%). Moreover, the thyroid mean dose of FJT-IMRT is the lowest. For cervical esophagus and humeral head, the FJT-IMRT also had the best sparing. Conclusion: All 9-field IMRT, tangential-IMRT and FJT-IMRT had superiority for targets coverage and substantially reduced the heart volume of high dose irradiation. The FJT-IMRT showed advantages of avoiding the contralateral breast and lung irradiation and decreasing the thyroid, humeral head and cervical esophagus radiation dose at the expense of a slight monitor units (MUs) increasing.« less

  8. Intensity modulated radiotherapy with fixed collimator jaws for locoregional left-sided breast cancer irradiation.

    PubMed

    Wang, Juanqi; Yang, Zhaozhi; Hu, Weigang; Chen, Zhi; Yu, Xiaoli; Guo, Xiaomao

    2017-05-16

    The purpose of this study is to evaluate the intensity modulated radiotherapy (IMRT) with the fixed collimator jaws technique (FJT) for the left breast and regional lymph node. The targeted breast tissue and the lymph nodes, and the normal tissues were contoured for 16 left-sided breast cancer patients previously treated with radiotherapy after lumpectomy. For each patient, treatment plans using different planning techniques, i.e., volumetric modulated arc therapy (VMAT), tangential IMRT (tangential-IMRT), and IMRT with FJT (FJT-IMRT) were developed for dosimetric comparisons. A dose of 50Gy was prescribed to the planning target volume. The dose-volume histograms were generated, and the paired t-test was used to analyze the dose differences. FJT-IMRT had similar mean heart volume receiving 30Gy (V30 Gy) with tangential-IMRT (1.5% and 1.6%, p = 0.41), but inferior to the VMAT (0.8%, p < 0.001). In the average heart mean dose comparison, FJT-IMRT had the lowest value, and it was 0.6Gy lower than that for the VMAT plans (p < 0.01). A significant dose increase in the contralateral breast and lung was observed in VMAT plans. Compared with tangential-IMRT and VMAT plans, FJT-IMRT reduced the mean dose of thyroid, humeral head and cervical esophageal by 47.6% (p < 0.01) and 45.7% (p < 0.01), 74.3% (p =< 0.01) and 73% (p =< 0.01), and 26.7% (p =< 0.01) and 29.2% (p =< 0.01). In conclusion, compared with tangential-IMRT and VMAT, FJT-IMRT plan has the lowest thyroid, humeral head and cervical esophageal mean dose and it can be a reasonable treatment option for a certain subgroup of patients, such as young left-breast cancer patients and/or patients with previous thyroid disease.

  9. Development of Targeted Nanobubbles for Ultrasound Imaging and Ablation of Metastatic Prostate Cancer Lesions

    DTIC Science & Technology

    2014-08-01

    AD_________________ Award Number: W81XWH-12-1-0284 TITLE: Development of Targeted Nanobubbles for...matrix, optically transparent fibrin-based gel phantom embedded with a layer of PC-3 and C4-2B of human prostate cancer, and MDA-MB-231 of breast

  10. Identification of Androgen Receptor and Beta-Catenin Target Genes in Prostate and Prostate Cancer

    DTIC Science & Technology

    2013-10-01

    cervical cancer cells . iCRT-3 can also inhibit cell proliferation and survival in cervical cancer cells and can partially inhibit... cervical cancer cells lines (data not shown). In breast and neuronal cells , estrogen increases β-catenin expression, and activated estrogen receptor α...I3C can also degrade β- catenin in prostate cancer cells (27). Given these facts, I hypothesized that HPV infection leads to increased activity of

  11. Evaluation of polygenic risk scores for predicting breast and prostate cancer risk.

    PubMed

    Machiela, Mitchell J; Chen, Chia-Yen; Chen, Constance; Chanock, Stephen J; Hunter, David J; Kraft, Peter

    2011-09-01

    Recently, polygenic risk scores (PRS) have been shown to be associated with certain complex diseases. The approach has been based on the contribution of counting multiple alleles associated with disease across independent loci, without requiring compelling evidence that every locus had already achieved definitive genome-wide statistical significance. Whether PRS assist in the prediction of risk of common cancers is unknown. We built PRS from lists of genetic markers prioritized by their association with breast cancer (BCa) or prostate cancer (PCa) in a training data set and evaluated whether these scores could improve current genetic prediction of these specific cancers in independent test samples. We used genome-wide association data on 1,145 BCa cases and 1,142 controls from the Nurses' Health Study and 1,164 PCa cases and 1,113 controls from the Prostate Lung Colorectal and Ovarian Cancer Screening Trial. Ten-fold cross validation was used to build and evaluate PRS with 10 to 60,000 independent single nucleotide polymorphisms (SNPs). For both BCa and PCa, the models that included only published risk alleles maximized the cross-validation estimate of the area under the ROC curve (0.53 for breast and 0.57 for prostate). We found no significant evidence that PRS using common variants improved risk prediction for BCa and PCa over replicated SNP scores. © 2011 Wiley-Liss, Inc.

  12. Ultrasonographic patterns of reproductive organs in infants fed soy formula: Comparisons to infants fed breast milk and milk formula

    USDA-ARS?s Scientific Manuscript database

    Our objective was to determine if differences exist in hormone sensitive organ size between infants fed soy formula (SF), milk formula (MF), or breast milk (BF). Breast buds, uterus, ovaries, prostate, and testicular volumes were assessed by ultrasonography in 40 BF, 41 MF, and 39 SF infants at age ...

  13. Genome-Wide Meta-Analyses of Breast, Ovarian, and Prostate Cancer Association Studies Identify Multiple New Susceptibility Loci Shared by at Least Two Cancer Types.

    PubMed

    Kar, Siddhartha P; Beesley, Jonathan; Amin Al Olama, Ali; Michailidou, Kyriaki; Tyrer, Jonathan; Kote-Jarai, ZSofia; Lawrenson, Kate; Lindstrom, Sara; Ramus, Susan J; Thompson, Deborah J; Kibel, Adam S; Dansonka-Mieszkowska, Agnieszka; Michael, Agnieszka; Dieffenbach, Aida K; Gentry-Maharaj, Aleksandra; Whittemore, Alice S; Wolk, Alicja; Monteiro, Alvaro; Peixoto, Ana; Kierzek, Andrzej; Cox, Angela; Rudolph, Anja; Gonzalez-Neira, Anna; Wu, Anna H; Lindblom, Annika; Swerdlow, Anthony; Ziogas, Argyrios; Ekici, Arif B; Burwinkel, Barbara; Karlan, Beth Y; Nordestgaard, Børge G; Blomqvist, Carl; Phelan, Catherine; McLean, Catriona; Pearce, Celeste Leigh; Vachon, Celine; Cybulski, Cezary; Slavov, Chavdar; Stegmaier, Christa; Maier, Christiane; Ambrosone, Christine B; Høgdall, Claus K; Teerlink, Craig C; Kang, Daehee; Tessier, Daniel C; Schaid, Daniel J; Stram, Daniel O; Cramer, Daniel W; Neal, David E; Eccles, Diana; Flesch-Janys, Dieter; Edwards, Digna R Velez; Wokozorczyk, Dominika; Levine, Douglas A; Yannoukakos, Drakoulis; Sawyer, Elinor J; Bandera, Elisa V; Poole, Elizabeth M; Goode, Ellen L; Khusnutdinova, Elza; Høgdall, Estrid; Song, Fengju; Bruinsma, Fiona; Heitz, Florian; Modugno, Francesmary; Hamdy, Freddie C; Wiklund, Fredrik; Giles, Graham G; Olsson, Håkan; Wildiers, Hans; Ulmer, Hans-Ulrich; Pandha, Hardev; Risch, Harvey A; Darabi, Hatef; Salvesen, Helga B; Nevanlinna, Heli; Gronberg, Henrik; Brenner, Hermann; Brauch, Hiltrud; Anton-Culver, Hoda; Song, Honglin; Lim, Hui-Yi; McNeish, Iain; Campbell, Ian; Vergote, Ignace; Gronwald, Jacek; Lubiński, Jan; Stanford, Janet L; Benítez, Javier; Doherty, Jennifer A; Permuth, Jennifer B; Chang-Claude, Jenny; Donovan, Jenny L; Dennis, Joe; Schildkraut, Joellen M; Schleutker, Johanna; Hopper, John L; Kupryjanczyk, Jolanta; Park, Jong Y; Figueroa, Jonine; Clements, Judith A; Knight, Julia A; Peto, Julian; Cunningham, Julie M; Pow-Sang, Julio; Batra, Jyotsna; Czene, Kamila; Lu, Karen H; Herkommer, Kathleen; Khaw, Kay-Tee; Matsuo, Keitaro; Muir, Kenneth; Offitt, Kenneth; Chen, Kexin; Moysich, Kirsten B; Aittomäki, Kristiina; Odunsi, Kunle; Kiemeney, Lambertus A; Massuger, Leon F A G; Fitzgerald, Liesel M; Cook, Linda S; Cannon-Albright, Lisa; Hooning, Maartje J; Pike, Malcolm C; Bolla, Manjeet K; Luedeke, Manuel; Teixeira, Manuel R; Goodman, Marc T; Schmidt, Marjanka K; Riggan, Marjorie; Aly, Markus; Rossing, Mary Anne; Beckmann, Matthias W; Moisse, Matthieu; Sanderson, Maureen; Southey, Melissa C; Jones, Michael; Lush, Michael; Hildebrandt, Michelle A T; Hou, Ming-Feng; Schoemaker, Minouk J; Garcia-Closas, Montserrat; Bogdanova, Natalia; Rahman, Nazneen; Le, Nhu D; Orr, Nick; Wentzensen, Nicolas; Pashayan, Nora; Peterlongo, Paolo; Guénel, Pascal; Brennan, Paul; Paulo, Paula; Webb, Penelope M; Broberg, Per; Fasching, Peter A; Devilee, Peter; Wang, Qin; Cai, Qiuyin; Li, Qiyuan; Kaneva, Radka; Butzow, Ralf; Kopperud, Reidun Kristin; Schmutzler, Rita K; Stephenson, Robert A; MacInnis, Robert J; Hoover, Robert N; Winqvist, Robert; Ness, Roberta; Milne, Roger L; Travis, Ruth C; Benlloch, Sara; Olson, Sara H; McDonnell, Shannon K; Tworoger, Shelley S; Maia, Sofia; Berndt, Sonja; Lee, Soo Chin; Teo, Soo-Hwang; Thibodeau, Stephen N; Bojesen, Stig E; Gapstur, Susan M; Kjær, Susanne Krüger; Pejovic, Tanja; Tammela, Teuvo L J; Dörk, Thilo; Brüning, Thomas; Wahlfors, Tiina; Key, Tim J; Edwards, Todd L; Menon, Usha; Hamann, Ute; Mitev, Vanio; Kosma, Veli-Matti; Setiawan, Veronica Wendy; Kristensen, Vessela; Arndt, Volker; Vogel, Walther; Zheng, Wei; Sieh, Weiva; Blot, William J; Kluzniak, Wojciech; Shu, Xiao-Ou; Gao, Yu-Tang; Schumacher, Fredrick; Freedman, Matthew L; Berchuck, Andrew; Dunning, Alison M; Simard, Jacques; Haiman, Christopher A; Spurdle, Amanda; Sellers, Thomas A; Hunter, David J; Henderson, Brian E; Kraft, Peter; Chanock, Stephen J; Couch, Fergus J; Hall, Per; Gayther, Simon A; Easton, Douglas F; Chenevix-Trench, Georgia; Eeles, Rosalind; Pharoah, Paul D P; Lambrechts, Diether

    2016-09-01

    Breast, ovarian, and prostate cancers are hormone-related and may have a shared genetic basis, but this has not been investigated systematically by genome-wide association (GWA) studies. Meta-analyses combining the largest GWA meta-analysis data sets for these cancers totaling 112,349 cases and 116,421 controls of European ancestry, all together and in pairs, identified at P < 10(-8) seven new cross-cancer loci: three associated with susceptibility to all three cancers (rs17041869/2q13/BCL2L11; rs7937840/11q12/INCENP; rs1469713/19p13/GATAD2A), two breast and ovarian cancer risk loci (rs200182588/9q31/SMC2; rs8037137/15q26/RCCD1), and two breast and prostate cancer risk loci (rs5013329/1p34/NSUN4; rs9375701/6q23/L3MBTL3). Index variants in five additional regions previously associated with only one cancer also showed clear association with a second cancer type. Cell-type-specific expression quantitative trait locus and enhancer-gene interaction annotations suggested target genes with potential cross-cancer roles at the new loci. Pathway analysis revealed significant enrichment of death receptor signaling genes near loci with P < 10(-5) in the three-cancer meta-analysis. We demonstrate that combining large-scale GWA meta-analysis findings across cancer types can identify completely new risk loci common to breast, ovarian, and prostate cancers. We show that the identification of such cross-cancer risk loci has the potential to shed new light on the shared biology underlying these hormone-related cancers. Cancer Discov; 6(9); 1052-67. ©2016 AACR.This article is highlighted in the In This Issue feature, p. 932. ©2016 American Association for Cancer Research.

  14. Guideline-concordant cancer care and survival among American Indian/Alaskan Native patients.

    PubMed

    Javid, Sara H; Varghese, Thomas K; Morris, Arden M; Porter, Michael P; He, Hao; Buchwald, Dedra; Flum, David R

    2014-07-15

    American Indians/Alaskan Natives (AI/ANs) have the worst 5-year cancer survival of all racial/ethnic groups in the United States. Causes for this disparity are unknown. The authors of this report examined the receipt of cancer treatment among AI/AN patients compared with white patients. This was a retrospective cohort study of 338,204 patients who were diagnosed at age ≥65 years with breast, colon, lung, or prostate cancer between 1996 and 2005 in the Surveillance, Epidemiology, and End Results-Medicare database. Nationally accepted guidelines for surgical and adjuvant therapy and surveillance were selected as metrics of optimal, guideline-concordant care. Treatment analyses compared AI/ANs with matched whites. Across cancer types, AI/ANs were less likely to receive optimal cancer treatment and were less likely to undergo surgery (P ≤ .025 for all cancers). Adjuvant therapy rates were significantly lower for AI/AN patients with breast cancer (P < .001) and colon cancer (P = .001). Rates of post-treatment surveillance also were lower among AI/ANs and were statistically significantly lower for AI/AN patients with breast cancer (P = .002) and prostate cancer (P < .001). Nonreceipt of optimal cancer treatment was associated with significantly worse survival across cancer types. Disease-specific survival for those who did not undergo surgery was significantly lower for patients with breast cancer (hazard ratio [HR], 0.62), colon cancer (HR, 0.74), prostate cancer (HR, 0.52), and lung cancer (HR, 0.36). Survival rates also were significantly lower for those patients who did not receive adjuvant therapy for breast cancer (HR, 0.56), colon cancer (HR, 0.59), or prostate cancer (HR, 0.81; all 95% confidence intervals were <1.0). Fewer AI/AN patients than white patients received guideline-concordant cancer treatment across the 4 most common cancers. Efforts to explain these differences are critical to improving cancer care and survival for AI/AN patients. © 2014 American Cancer Society.

  15. Guideline-Concordant Cancer Care and Survival Among American Indian/Alaskan Native Patients

    PubMed Central

    Javid, Sara H.; Varghese, Thomas K.; Morris, Arden M.; Porter, Michael P.; He, Hao; Buchwald, Dedra; Flum, David R.

    2014-01-01

    BACKGROUND American Indians/Alaskan Natives (AI/ANs) have the worst 5-year cancer survival of all racial/ethnic groups in the United States. Causes for this disparity are unknown. The authors of this report examined the receipt of cancer treatment among AI/AN patients compared with white patients. METHODS This was a retrospective cohort study of 338,204 patients who were diagnosed at age ≥65 years with breast, colon, lung, or prostate cancer between 1996 and 2005 in the Surveillance, Epidemiology, and End Results-Medicare database. Nationally accepted guidelines for surgical and adjuvant therapy and surveillance were selected as metrics of optimal, guideline-concordant care. Treatment analyses compared AI/ANs with matched whites. RESULTS Across cancer types, AI/ANs were less likely to receive optimal cancer treatment and were less likely to undergo surgery (P ≤ .025 for all cancers). Adjuvant therapy rates were significantly lower for AI/AN patients with breast cancer (P <.001) and colon cancer (P = .001). Rates of post-treatment surveillance also were lower among AI/ANs and were statistically significantly lower for AI/AN patients with breast cancer (P = .002) and prostate cancer (P <.001). Nonreceipt of optimal cancer treatment was associated with significantly worse survival across cancer types. Disease-specific survival for those who did not undergo surgery was significantly lower for patients with breast cancer (hazard ratio [HR], 0.62), colon cancer (HR, 0.74), prostate cancer (HR, 0.52), and lung cancer (HR, 0.36). Survival rates also were significantly lower for those patients who did not receive adjuvant therapy for breast cancer (HR, 0.56), colon cancer (HR, 0.59), or prostate cancer (HR, 0.81; all 95% confidence intervals were <1.0). CONCLUSIONS Fewer AI/AN patients than white patients received guideline-concordant cancer treatment across the 4 most common cancers. Efforts to explain these differences are critical to improving cancer care and survival for AI/AN patients. PMID:24711210

  16. Red and processed meat intake and cancer risk: Results from the prospective NutriNet-Santé cohort study.

    PubMed

    Diallo, Abou; Deschasaux, Mélanie; Latino-Martel, Paule; Hercberg, Serge; Galan, Pilar; Fassier, Philippine; Allès, Benjamin; Guéraud, Françoise; Pierre, Fabrice H; Touvier, Mathilde

    2018-01-15

    The International Agency for Research on Cancer (WHO-IARC) classified red meat and processed meat as probably carcinogenic and carcinogenic for humans, respectively. These conclusions were mainly based on studies concerning colorectal cancer, but scientific evidence is still limited for other cancer locations. In this study, we investigated the prospective associations between red and processed meat intakes and overall, breast, and prostate cancer risk. This prospective study included 61,476 men and women of the French NutriNet-Santé cohort (2009-2015) aged ≥35 y and who completed at least three 24 hrs dietary records during the first year of follow-up. The risk of developing cancer was compared across sex-specific quintiles of red and processed meat intakes by multivariable Cox models. 1,609 first primary incident cancer cases were diagnosed during follow-up, among which 544 breast cancers and 222 prostate cancers. Red meat intake was associated with increased risk of overall cancers [HR Q5 vs. Q1 =1.31 (1.10-1.55), p trend  = 0.01) and breast cancer (HR Q5 vs. Q1  = 1.83 (1.33-2.51), p trend  = 0.002]. The latter association was observed in both premenopausal [HR Q5 vs. Q1 =2.04 (1.03-4.06)] and postmenopausal women [HR Q5 vs. Q1 =1.79 (1.26-2.55)]. No association was observed between red meat intake and prostate cancer risk. Processed meat intake was relatively low in this study (cut-offs for the 5th quintile = 46 g/d in men and 29 g/d in women) and was not associated with overall, breast or prostate cancer risk. This large cohort study suggested that red meat may be involved carcinogenesis at several cancer locations (other than colon-rectum), in particular breast cancer. These results are consistent with mechanistic evidence from experimental studies. © 2017 UICC.

  17. Breast-Milk Iodine Concentrations, Iodine Status, and Thyroid Function of Breastfed Infants Aged 2-4 Months and Their Mothers Residing in a South African Township.

    PubMed

    Osei, Jennifer; Andersson, Maria; Reijden, Olivia van der; Dold, Susanne; Smuts, Cornelius M; Baumgartner, Jeannine

    2016-12-01

    Lactating women and their infants are susceptible to iodine deficiency and iodine excess. In South Africa, no data exist on the iodine status and thyroid function of these vulnerable groups. In a cross-sectional study, urinary iodine concentrations (UIC), thyroid function, and breast-milk iodine concentrations (BMIC) were assessed in 100 lactating women from a South African township and their 2-4-month-old breastfed infants. Potential predictors of UIC, thyroid function, and BMIC, including household salt iodine concentrations (SIC) and maternal sodium excretion, were also investigated. The median (25th-75th percentile) UIC was 373 (202-627) μg/L in infants and 118 (67-179) μg/L in mothers. Median household SIC was 44 (27-63) ppm. Household SIC and maternal urinary sodium excretion predicted UIC of lactating mothers. Median BMIC was 179 (126-269) μg/L. Age of infants, SIC, and maternal UIC predicted BMIC. In turn, infant age and BMIC predicted UIC of infants. Forty-two percent of SIC values were within the South African recommended salt iodine fortification level at production of 35-65 ppm, whilst 21% of SIC were >65 ppm. Thyroid-stimulating hormone, total thyroxine, and thyroglobulin concentrations in the dried whole blood spot specimens from the infants were 1.3 (0.8-1.9) mU/L, 128±33 mmol/L, and 77.1 (56.3-105.7) μg/L, respectively, and did not correlate with infant UIC or BMIC. Our results suggest that the salt fortification program in South Africa provides adequate iodine to lactating women and indirectly to their infants via breast milk. However, monitoring of salt iodine content of the mandatory salt iodization program in South Africa is important to avoid over-iodization of salt.

  18. SASH1: a candidate tumor suppressor gene on chromosome 6q24.3 is downregulated in breast cancer.

    PubMed

    Zeller, Constanze; Hinzmann, Bernd; Seitz, Susanne; Prokoph, Helmuth; Burkhard-Goettges, Elke; Fischer, Jörg; Jandrig, Burkhard; Schwarz, Lope-Estevez; Rosenthal, André; Scherneck, Siegfried

    2003-05-15

    Loss of heterozygosity (LOH) and in silico expression analysis were applied to identify genes significantly downregulated in breast cancer within the genomic interval 6q23-25. Systematic comparison of candidate EST sequences with genomic sequences from this interval revealed the genomic structure of a potential target gene on 6q24.3, which we called SAM and SH3 domain containing 1 (SASH1). Loss of the gene-internal marker D6S311, found in 30% of primary breast cancer, was significantly correlated with poor survival and increase in tumor size. Two SASH1 transcripts of approximately 4.4 and 7.5 kb exist and are predominantly transcribed in the human breast, lung, thyroid, spleen, placenta and thymus. In breast cancer cell lines, SASH1 is only expressed at low levels. SASH1 is downregulated in the majority (74%) of breast tumors in comparison with corresponding normal breast epithelial tissues. In addition, SASH1 is also downregulated in tumors of the lung and thyroid. Analysis of the protein domain structure revealed that SASH1 is a member of a recently described family of SH3/SAM adapter molecules and thus suggests a role in signaling pathways. We assume that SASH1 is a new tumor suppressor gene possibly involved in tumorigenesis of breast and other solid cancers. We were unable to find mutations in the coding region of the gene in primary breast cancers showing LOH within the critical region. We therefore hypothesize that other mechanisms as for instance methylation of the promoter region of SASH1 are responsible for the loss of expression of SASH1 in primary and metastatic breast cancer.

  19. The French E3N Prospective Cohort Study

    ClinicalTrials.gov

    2017-09-18

    Breast Cancer; Colo-rectal Cancer; Parkinson Disease; Asthma; Diabetes; Inflammatory Bowel Diseases; Melanoma; Endometriosis; Thyroid Cancer; Hypertension; Endometrial Cancer; Crohn Disease; Depression; Cardiovascular Diseases

  20. Metformin Has a Positive Therapeutic Effect on Prostate Cancer in Diabetes Mellitus 2 Patients

    PubMed Central

    Chong, R. William; Vasudevan, Vijaya; Zuber, Jeffrey; Solomon, Solomon S.

    2016-01-01

    Objective Prostate cancer and type 2 diabetes mellitus are both common diseases found in the elderly male population. The diabetic drug, metformin, has been shown to have anti-neoplastic properties and demonstrated better treatment outcomes when used as adjuvant therapy in breast cancer patients. The hormonally-sensitive cancer analogous to breast in men is prostate. We investigated improved survival, lower risks of recurrences, and lower, more stable levels of prostate specific antigen (PSA) in DM2 patients with prostate cancer on metformin. Methods Prostate cancer patients with type 2 diabetes that remained on metformin were compared to controls not on metformin matched by age, weight, race, and Gleason score cancer staging. The endpoints of our study included final PSA values, number of recurrences, metastases and number living for each group. Results There were significantly fewer deaths (23% vs 10%), fewer recurrences (15% vs 8%), and fewer metastases (5% vs 0%), and fewer secondary cancers (17% vs 6%) in the metformin group (p<0.004). The final PSA value was lower in the metformin-treated group with a result approaching significance (p=0.067). The primary treatments for prostate cancer (i.e. surgery, radiation, androgen depletion) were found to be comparable in both groups. Conclusions Our retrospective study shows that adjuvant metformin therapy leads to a better prognosis in prostate cancer. Not only are PSA levels controlled for several years, but there are significantly fewer cancer recurrences in metformin treated patients. Overall, these results are promising and should be followed up with a prospective study to assess long-term survival. PMID:27079349

  1. The identification of incident cancers in UK primary care databases: a systematic review.

    PubMed

    Rañopa, Michael; Douglas, Ian; van Staa, Tjeerd; Smeeth, Liam; Klungel, Olaf; Reynolds, Robert; Bhaskaran, Krishnan

    2015-01-01

    UK primary care databases are frequently used in observational studies with cancer outcomes. We aimed to systematically review methods used by such studies to identify and validate incident cancers of the breast, colorectum, and prostate. Medline and Embase (1980-2013) were searched for UK primary care database studies with incident breast, colorectal, or prostate cancer outcomes. Data on the methods used for case ascertainment were extracted and summarised. Questionnaires were sent to corresponding authors to obtain details about case ascertainment. Eighty-four studies of breast (n = 51), colorectal (n = 54), and prostate cancer (n = 31) were identified; 30 examined >1 cancer type. Among the 84 studies, 57 defined cancers using only diagnosis codes, while 27 required further evidence such as chemotherapy. Few studies described methods used to create cancer code lists (n = 5); or made lists available directly (n = 5). Twenty-eight code lists were received on request from study authors. All included malignant neoplasm diagnosis codes, but there was considerable variation in the specific codes included which was not explained by coding dictionary changes. Code lists also varied in terms of other types of codes included, such as in-situ, cancer morphology, history of cancer, and secondary/suspected/borderline cancer codes. In UK primary care database studies, methods for identifying breast, colorectal, and prostate cancers were often unclear. Code lists were often unavailable, and where provided, we observed variation in the individual codes and types of codes included. Clearer reporting of methods and publication of code lists would improve transparency and reproducibility of studies. Copyright © 2014 John Wiley & Sons, Ltd.

  2. Vegetarianism and breast, colorectal and prostate cancer risk: an overview and meta-analysis of cohort studies.

    PubMed

    Godos, J; Bella, F; Sciacca, S; Galvano, F; Grosso, G

    2017-06-01

    Vegetarian diets may be associated with certain benefits toward human health, although current evidence is scarce and contrasting. In the present study, a systematic review and meta-analysis of prospective cohort studies was performed with respect to the association between vegetarian diets and breast, colorectal and prostate cancer risk. Studies were systematically searched in Pubmed and EMBASE electronic databases. Eligible studies had a prospective design and compared vegetarian, semi- and pesco-vegetarian diets with a non-vegetarian diet. Random-effects models were applied to calculate relative risks (RRs) of cancer between diets. Statistical heterogeneity and publication bias were explored. A total of nine studies were included in the meta-analysis. Studies were conducted on six cohorts accounting for 686 629 individuals, and 3441, 4062 and 1935 cases of breast, colorectal and prostate cancer, respectively. None of the analyses showed a significant association of vegetarian diet and a lower risk of either breast, colorectal, and prostate cancer compared to a non-vegetarian diet. By contrast, a lower risk of colorectal cancer was associated with a semi-vegetarian diet (RR = 0.86, 95% confidence interval = 0.79-0.94; I 2 = 0%, P heterogeneity = 0.82) and a pesco-vegetarian diet (RR = 0.67, 95% confidence interval = 0.53, 0.83; I 2 = 0%, P heterogeneity = 0.46) compared to a non-vegetarian diet. The subgroup analysis by cancer localisation showed no differences in summary risk estimates between colon and rectal cancer. A summary of the existing evidence from cohort studies on vegetarian diets showed that complete exclusion of any source of protein from the diet is not associated with further benefits for human health. © 2016 The British Dietetic Association Ltd.

  3. Targeting the Nuclear Cathepsin L CCAAT Displacement Protein/Cut Homeobox Transcription Factor-Epithelial Mesenchymal Transition Pathway in Prostate and Breast Cancer Cells with the Z-FY-CHO Inhibitor

    PubMed Central

    Burton, Liza J.; Dougan, Jodi; Jones, Jasmine; Smith, Bethany N.; Randle, Diandra; Henderson, Veronica

    2016-01-01

    ABSTRACT The epithelial mesenchymal transition (EMT) promotes tumor migration and invasion by downregulating epithelial markers such as E-cadherin and upregulating mesenchymal markers such as vimentin. Cathepsin L (Cat L) is a cysteine protease that can proteolytically activate CCAAT displacement protein/cut homeobox transcription factor (CUX1). We hypothesized that nuclear Cat L may promote EMT via CUX1 and that this could be antagonized with the Cat L-specific inhibitor Z-FY-CHO. Mesenchymal prostate (ARCaP-M and ARCaP-E overexpressing Snail) and breast (MDA-MB-468, MDA-MB-231, and MCF-7 overexpressing Snail) cancer cells expressed lower E-cadherin activity, higher Snail, vimentin, and Cat L activity, and a p110/p90 active CUX1 form, compared to epithelial prostate (ARCaP-E and ARCaP-Neo) and breast (MCF-7 and MCF-7 Neo) cancer cells. There was increased binding of CUX1 to Snail and the E-cadherin promoter in mesenchymal cells compared to epithelial prostate and breast cells. Treatment of mesenchymal cells with the Cat L inhibitor Z-FY-CHO led to nuclear-to-cytoplasmic relocalization of Cat L, decreased binding of CUX1 to Snail and the E-cadherin promoter, reversed EMT, and decreased cell migration/invasion. Overall, our novel data suggest that a positive feedback loop between Snail-nuclear Cat L-CUX1 drives EMT, which can be antagonized by Z-FY-CHO. Therefore, Z-FY-CHO may be an important therapeutic tool to antagonize EMT and cancer progression. PMID:27956696

  4. Targeting the Nuclear Cathepsin L CCAAT Displacement Protein/Cut Homeobox Transcription Factor-Epithelial Mesenchymal Transition Pathway in Prostate and Breast Cancer Cells with the Z-FY-CHO Inhibitor.

    PubMed

    Burton, Liza J; Dougan, Jodi; Jones, Jasmine; Smith, Bethany N; Randle, Diandra; Henderson, Veronica; Odero-Marah, Valerie A

    2017-03-01

    The epithelial mesenchymal transition (EMT) promotes tumor migration and invasion by downregulating epithelial markers such as E-cadherin and upregulating mesenchymal markers such as vimentin. Cathepsin L (Cat L) is a cysteine protease that can proteolytically activate CCAAT displacement protein/cut homeobox transcription factor (CUX1). We hypothesized that nuclear Cat L may promote EMT via CUX1 and that this could be antagonized with the Cat L-specific inhibitor Z-FY-CHO. Mesenchymal prostate (ARCaP-M and ARCaP-E overexpressing Snail) and breast (MDA-MB-468, MDA-MB-231, and MCF-7 overexpressing Snail) cancer cells expressed lower E-cadherin activity, higher Snail, vimentin, and Cat L activity, and a p110/p90 active CUX1 form, compared to epithelial prostate (ARCaP-E and ARCaP-Neo) and breast (MCF-7 and MCF-7 Neo) cancer cells. There was increased binding of CUX1 to Snail and the E-cadherin promoter in mesenchymal cells compared to epithelial prostate and breast cells. Treatment of mesenchymal cells with the Cat L inhibitor Z-FY-CHO led to nuclear-to-cytoplasmic relocalization of Cat L, decreased binding of CUX1 to Snail and the E-cadherin promoter, reversed EMT, and decreased cell migration/invasion. Overall, our novel data suggest that a positive feedback loop between Snail-nuclear Cat L-CUX1 drives EMT, which can be antagonized by Z-FY-CHO. Therefore, Z-FY-CHO may be an important therapeutic tool to antagonize EMT and cancer progression. Copyright © 2017 American Society for Microbiology.

  5. Disparities in Prostate, Lung, Breast, and Colorectal Cancer Survival and Comorbidity Status among Urban American Indians and Alaskan Natives.

    PubMed

    Emerson, Marc A; Banegas, Matthew P; Chawla, Neetu; Achacoso, Ninah; Alexeeff, Stacey E; Adams, Alyce S; Habel, Laurel A

    2017-12-01

    Cancer is the second leading cause of death among American Indians and Alaskan Natives (AIAN), although cancer survival information in this population is limited, particularly among urban AIAN. In this retrospective cohort study, we compared all-cause and prostate, breast, lung, and colorectal cancer-specific mortality among AIAN ( n = 582) and non-Hispanic white (NHW; n = 82,696) enrollees of Kaiser Permanente Northern California (KPNC) diagnosed with primary invasive breast, prostate, lung, or colorectal cancer from 1997 to 2015. Tumor registry and other electronic health records provided information on sociodemographic, comorbidity, tumor, clinical, and treatment characteristics. Cox regression models were used to estimate adjusted survival curves and hazard ratios (HR) with 95% confidence intervals (CI). AIAN had a significantly higher comorbidity burden compared with NHW ( P < 0.05). When adjusting for patient, disease characteristics, and Charlson comorbidity scores, all-cause mortality and cancer-specific mortality were significantly higher for AIAN than NHW patients with breast cancer (HR, 1.47; 95% CI, 1.13-1.92) or with prostate cancer (HR, 1.87; 95% CI, 1.14-3.06) but not for AIAN patients with lung and colorectal cancer. Despite approximately equal access to preventive services and cancer care in this setting, we found higher mortality for AIAN than NHW with some cancers, and a greater proportion of AIAN cancer patients with multiple comorbid conditions. This study provides severely needed information on the cancer experience of the 71% of AIANs who live in urban areas and access cancer care outside of the Indian Health Services, from which the vast majority of AIAN cancer information comes. Cancer Res; 77(23); 6770-6. ©2017 AACR . ©2017 American Association for Cancer Research.

  6. Oxidative stress in ventral prostate, ovary, and breast by 2,4-dichlorophenoxyacetic acid in pre- and postnatal exposed rats.

    PubMed

    Pochettino, Aristides A; Bongiovanni, Bettina; Duffard, Ricardo O; Evangelista de Duffard, Ana María

    2013-01-01

    The herbicide 2,4-dichlorophenoxyacetic acid (2,4-D) has been widely used in agriculture and forestry since the 1940s. 2,4-D has been shown to produce a wide range of adverse effects-from embryotoxicity and teratogenicity to neurotoxicity-on animal and human health. The purpose of this study was to determine the possible effects of pre- and postnatal exposure to 2,4-D on oxidative stress in ventral prostate, ovary and breast. Pregnant rats were daily exposed to oral doses of 70 mg/kg/day of 2,4-D from 16 days of gestation up to 23 days after delivery. Then, the pups were sacrificed by decapitation at postnatal day (PND) 45, 60, or 90. Antioxidant enzyme activities and some parameters of the oxidative stress were assessed in ventral prostate, breast, and ovary. Results show that 2,4-D produced three different effects. First, it increased the concentration of some radical oxygen species and the rates of lipid peroxidation and protein oxidation in ventral prostate, thereby causing oxidative stress at all ages studied. Although an increase in the activity of some antioxidant enzymes was detected, this seemed to have been not enough to counteract the oxidative stress. Second, 2,4-D promoted the oxidative stress in the breasts, mainly during puberty and adulthood, probably because the developing gland is more sensitive to xenobiotics than the adult organ. Third, 2,4-D altered the activity of some antioxidant enzymes and increased lipid peroxide concentration in the ovary. This effect could reflect the variety of ovarian cell types and their different responses to endocrine changes during development. Copyright © 2011 Wiley Periodicals, Inc.

  7. Carbohydrate nutrition and risk of adiposity-related cancers: results from the Framingham Offspring cohort (1991-2013).

    PubMed

    Makarem, Nour; Bandera, Elisa V; Lin, Yong; Jacques, Paul F; Hayes, Richard B; Parekh, Niyati

    2017-06-01

    Higher carbohydrate intake, glycaemic index (GI), and glycaemic load (GL) are hypothesised to increase cancer risk through metabolic dysregulation of the glucose-insulin axis and adiposity-related mechanisms, but epidemiological evidence is inconsistent. This prospective cohort study investigates carbohydrate quantity and quality in relation to risk of adiposity-related cancers, which represent the most commonly diagnosed preventable cancers in the USA. In exploratory analyses, associations with three site-specific cancers: breast, prostate and colorectal cancers were also examined. The study sample consisted of 3184 adults from the Framingham Offspring cohort. Dietary data were collected in 1991-1995 using a FFQ along with lifestyle and medical information. From 1991 to 2013, 565 incident adiposity-related cancers, including 124 breast, 157 prostate and sixty-eight colorectal cancers, were identified. Cox proportional hazards models were used to evaluate the role of carbohydrate nutrition in cancer risk. GI and GL were not associated with risk of adiposity-related cancers or any of the site-specific cancers. Total carbohydrate intake was not associated with risk of adiposity-related cancers combined or prostate and colorectal cancers. However, carbohydrate consumption in the highest v. lowest quintile was associated with 41 % lower breast cancer risk (hazard ratio (HR) 0·59; 95 % CI 0·36, 0·97). High-, medium- and low-GI foods were not associated with risk of adiposity-related cancers or prostate and colorectal cancers. In exploratory analyses, low-GI foods, were associated with 49 % lower breast cancer risk (HR 0·51; 95 % CI 0·32, 0·83). In this cohort of Caucasian American adults, associations between carbohydrate nutrition and cancer varied by cancer site. Healthier low-GI carbohydrate foods may prevent adiposity-related cancers among women, but these findings require confirmation in a larger sample.

  8. Trefoil factor 3 is required for differentiation of thyroid follicular cells and acts as a context-dependent tumor suppressor.

    PubMed

    Abols, A; Ducena, K; Andrejeva, D; Sadovska, L; Zandberga, E; Vilmanis, J; Narbuts, Z; Tars, J; Eglitis, J; Pirags, V; Line, A

    2015-01-01

    Trefoil factor 3 (TFF3) is overexpressed in a variety of solid epithelial cancers, where it has been shown to promote migration, invasion, proliferation, survival and angiogenesis. On the contrary, in the majority of thyroid tumors, it is downregulated, yet its role in the development of thyroid cancer remains unknown. Here we show that TFF3 exhibits strong cytoplasmic staining of normal thyroid follicular cells and colloid and the staining is increased in hyperfunctioning thyroid nodules, while it is decreased in all thyroid cancers of follicular cell origin. By meta-analysis of gene expression datasets, we found that in the thyroid cancer, conversely to the breast cancer, the expression of TFF3 mRNA was downregulated by estrogen signaling and confirmed this by treating thyroid cancer cells with estradiol. Forced expression of TFF3 in anaplastic thyroid cancer cells resulted in decreased cell proliferation, clonal spheroid formation and entry into the S phase. Furthermore, it induced acquisition of epithelial-like cell morphology and expression of the differentiation markers of thyroid follicular cells and transcription factors implicated in the thyroid morphogenesis and function. Taken together, this study provides the first evidence that TFF3 may act as a tumor suppressor or an oncogene depending on the cellular context.

  9. Prostate-specific membrane antigen in breast cancer: a comprehensive evaluation of expression and a case report of radionuclide therapy.

    PubMed

    Tolkach, Yuri; Gevensleben, Heidrun; Bundschuh, Ralph; Koyun, Aydan; Huber, Daniela; Kehrer, Christina; Hecking, Thomas; Keyver-Paik, Mignon-Denise; Kaiser, Christina; Ahmadzadehfar, Hojjat; Essler, Markus; Kuhn, Walther; Kristiansen, Glen

    2018-06-01

    Prostate-specific membrane antigen (PSMA), a protein product of the folate hydrolase 1 (FOLH1) gene, is gaining increasing acceptance as a target for positron emission tomography/computer tomography (PET/CT) imaging in patients with several cancer types, including breast cancer. So far, PSMA expression in breast cancer endothelia has not been sufficiently characterized. This study comprised 315 cases of invasive carcinoma of no special type (NST) and lobular breast cancer (median follow-up time 9.0 years). PSMA expression on tumor endothelia was detected by immunohistochemistry. Further, vascular mRNA expression of the FOLH1 gene (PSMA) was investigated in a cohort of patients with invasive breast cancer provided by The Cancer Genome Atlas (TCGA). Sixty percent of breast cancer cases exhibited PSMA-positive endothelia with higher expression rates in tumors of higher grade, NST subtype with Her2-positivity, and lack of hormone receptors. These findings were confirmed on mRNA expression levels. The highest PSMA rates were observed in triple-negative carcinomas (4.5 × higher than in other tumors). Further, a case of a patient with metastatic breast cancer showing PSMA expression in PET/CT imaging and undergoing PSMA radionuclide therapy is discussed in detail. This study provides a rationale for the further development of PSMA-targeted imaging in breast cancer, especially in triple-negative tumors.

  10. Perceived stigmatization and its impact on quality of life - results from a large register-based study including breast, colon, prostate and lung cancer patients.

    PubMed

    Ernst, J; Mehnert, A; Dietz, A; Hornemann, B; Esser, P

    2017-11-09

    To date, research on stigmatization among cancer patients and related psychosocial consequences has been scarce and mostly based on small and highly selected samples. We investigated stigmatization and its impact on quality of life among a large sample including four major tumor entities. We assessed 858 patients with breast, colon, lung or prostate cancer from two cancer registries. Stigmatization and quality of life (QoL) was assessed with the Social Impact Scale (SIS-D) and the EORTC Quality of Life Questionnaire (European Organization for Research and Treatment of Cancer), respectively. Group effects were analyzed via analyses of variance, relationships were investigated via Pearson's r and stepwise regression analyses. The mean age was 60.7 years, 54% were male. Across cancer sites, the dimensions of stigmatization (isolation, social rejection, financial insecurity and internalized shame) were in the lower and middle range, with the highest values found for isolation. Stigmatization was lowest among prostate cancer patients. Stigmatization predicted all five areas of QoL among breast cancer patients (p < .05), but only affected emotional functioning (p < .01) among lung cancer patients. We found an inverse relationship between perceived cancer-related stigmatization and various dimensions of QoL, with variation between cancer sites. Breast cancer patients should be focused in individual therapies regarding the negative consequences accompanied by perceived stigmatization.

  11. A comparison of breast, testicular and prostate cancer in mass print media (1996-2001).

    PubMed

    Clarke, Juanne Nancarrow

    2004-08-01

    This paper compares the portrayal of breast, testicular and prostate cancer in mass print English language magazines in the United States and Canada from 1996 to 2001. It is a follow-up of three papers that examined each of these three diseases separately in high circulating magazines up to 1995. It includes both quantitative and qualitative analyses of magazine stories and notes the continuing dominance of a medical perspective regarding disease as well as the association of each type of cancer examined with stereotypically individualized yet feminine and masculine characteristics and pursuits. It notes the conflation of breast cancer, since the discovery of BRCA1 and BRCA2, with the family. To be a 'feminine' woman is to be vulnerable to breast cancer and to be a 'masculine' man is to be vulnerable to testicular cancer when young and prostate cancer when older. The association of disease not just with personhood but also with the specifics of stereotyped masculinity and femininity may construct a more intimate, more personal link between disease and identity. This close attachment of gender and disease may shore up and exacerbate a fear reaction. It may also serve to diminish the awareness of other, more prevalent, causes of death for men and women. The social control consequences of potentially exacerbated disease-specific fear are discussed. Copyright 2003 Elsevier Ltd.

  12. Genome-wide Meta-analyses of Breast, Ovarian and Prostate Cancer Association Studies Identify Multiple New Susceptibility Loci Shared by At Least Two Cancer Types

    PubMed Central

    Kar, Siddhartha P.; Beesley, Jonathan; Al Olama, Ali Amin; Michailidou, Kyriaki; Tyrer, Jonathan; Kote-Jarai, ZSofia; Lawrenson, Kate; Lindstrom, Sara; Ramus, Susan J.; Thompson, Deborah J.; Kibel, Adam S.; Dansonka-Mieszkowska, Agnieszka; Michael, Agnieszka; Dieffenbach, Aida K.; Gentry-Maharaj, Aleksandra; Whittemore, Alice S.; Wolk, Alicja; Monteiro, Alvaro; Peixoto, Ana; Kierzek, Andrzej; Cox, Angela; Rudolph, Anja; Gonzalez-Neira, Anna; Wu, Anna H.; Lindblom, Annika; Swerdlow, Anthony; Ziogas, Argyrios; Ekici, Arif B.; Burwinkel, Barbara; Karlan, Beth Y.; Nordestgaard, Børge G.; Blomqvist, Carl; Phelan, Catherine; McLean, Catriona; Pearce, Celeste Leigh; Vachon, Celine; Cybulski, Cezary; Slavov, Chavdar; Stegmaier, Christa; Maier, Christiane; Ambrosone, Christine B.; Høgdall, Claus K.; Teerlink, Craig C.; Kang, Daehee; Tessier, Daniel C.; Schaid, Daniel J.; Stram, Daniel O.; Cramer, Daniel W.; Neal, David E.; Eccles, Diana; Flesch-Janys, Dieter; Velez Edwards, Digna R.; Wokozorczyk, Dominika; Levine, Douglas A.; Yannoukakos, Drakoulis; Sawyer, Elinor J.; Bandera, Elisa V.; Poole, Elizabeth M.; Goode, Ellen L.; Khusnutdinova, Elza; Høgdall, Estrid; Song, Fengju; Bruinsma, Fiona; Heitz, Florian; Modugno, Francesmary; Hamdy, Freddie C.; Wiklund, Fredrik; Giles, Graham G.; Olsson, Håkan; Wildiers, Hans; Ulmer, Hans-Ulrich; Pandha, Hardev; Risch, Harvey A.; Darabi, Hatef; Salvesen, Helga B.; Nevanlinna, Heli; Gronberg, Henrik; Brenner, Hermann; Brauch, Hiltrud; Anton-Culver, Hoda; Song, Honglin; Lim, Hui-Yi; McNeish, Iain; Campbell, Ian; Vergote, Ignace; Gronwald, Jacek; Lubiński, Jan; Stanford, Janet L.; Benítez, Javier; Doherty, Jennifer A.; Permuth, Jennifer B.; Chang-Claude, Jenny; Donovan, Jenny L.; Dennis, Joe; Schildkraut, Joellen M.; Schleutker, Johanna; Hopper, John L.; Kupryjanczyk, Jolanta; Park, Jong Y.; Figueroa, Jonine; Clements, Judith A.; Knight, Julia A.; Peto, Julian; Cunningham, Julie M.; Pow-Sang, Julio; Batra, Jyotsna; Czene, Kamila; Lu, Karen H.; Herkommer, Kathleen; Khaw, Kay-Tee; Matsuo, Keitaro; Muir, Kenneth; Offitt, Kenneth; Chen, Kexin; Moysich, Kirsten B.; Aittomäki, Kristiina; Odunsi, Kunle; Kiemeney, Lambertus A.; Massuger, Leon F.A.G.; Fitzgerald, Liesel M.; Cook, Linda S.; Cannon-Albright, Lisa; Hooning, Maartje J.; Pike, Malcolm C.; Bolla, Manjeet K.; Luedeke, Manuel; Teixeira, Manuel R.; Goodman, Marc T.; Schmidt, Marjanka K.; Riggan, Marjorie; Aly, Markus; Rossing, Mary Anne; Beckmann, Matthias W.; Moisse, Matthieu; Sanderson, Maureen; Southey, Melissa C.; Jones, Michael; Lush, Michael; Hildebrandt, Michelle A. T.; Hou, Ming-Feng; Schoemaker, Minouk J.; Garcia-Closas, Montserrat; Bogdanova, Natalia; Rahman, Nazneen; Le, Nhu D.; Orr, Nick; Wentzensen, Nicolas; Pashayan, Nora; Peterlongo, Paolo; Guénel, Pascal; Brennan, Paul; Paulo, Paula; Webb, Penelope M.; Broberg, Per; Fasching, Peter A.; Devilee, Peter; Wang, Qin; Cai, Qiuyin; Li, Qiyuan; Kaneva, Radka; Butzow, Ralf; Kopperud, Reidun Kristin; Schmutzler, Rita K.; Stephenson, Robert A.; MacInnis, Robert J.; Hoover, Robert N.; Winqvist, Robert; Ness, Roberta; Milne, Roger L.; Travis, Ruth C.; Benlloch, Sara; Olson, Sara H.; McDonnell, Shannon K.; Tworoger, Shelley S.; Maia, Sofia; Berndt, Sonja; Lee, Soo Chin; Teo, Soo-Hwang; Thibodeau, Stephen N.; Bojesen, Stig E.; Gapstur, Susan M.; Kjær, Susanne Krüger; Pejovic, Tanja; Tammela, Teuvo L.J.; Dörk, Thilo; Brüning, Thomas; Wahlfors, Tiina; Key, Tim J.; Edwards, Todd L.; Menon, Usha; Hamann, Ute; Mitev, Vanio; Kosma, Veli-Matti; Setiawan, Veronica Wendy; Kristensen, Vessela; Arndt, Volker; Vogel, Walther; Zheng, Wei; Sieh, Weiva; Blot, William J.; Kluzniak, Wojciech; Shu, Xiao-Ou; Gao, Yu-Tang; Schumacher, Fredrick; Freedman, Matthew L.; Berchuck, Andrew; Dunning, Alison M.; Simard, Jacques; Haiman, Christopher A.; Spurdle, Amanda; Sellers, Thomas A.; Hunter, David J.; Henderson, Brian E.; Kraft, Peter; Chanock, Stephen J.; Couch, Fergus J.; Hall, Per; Gayther, Simon A.; Easton, Douglas F.; Chenevix-Trench, Georgia; Eeles, Rosalind; Pharoah, Paul D.P.; Lambrechts, Diether

    2016-01-01

    Breast, ovarian, and prostate cancers are hormone-related and may have a shared genetic basis but this has not been investigated systematically by genome-wide association (GWA) studies. Meta-analyses combining the largest GWA meta-analysis data sets for these cancers totaling 112,349 cases and 116,421 controls of European ancestry, all together and in pairs, identified at P < 10−8 seven new cross-cancer loci: three associated with susceptibility to all three cancers (rs17041869/2q13/BCL2L11; rs7937840/11q12/INCENP; rs1469713/19p13/GATAD2A), two breast and ovarian cancer risk loci (rs200182588/9q31/SMC2; rs8037137/15q26/RCCD1), and two breast and prostate cancer risk loci (rs5013329/1p34/NSUN4; rs9375701/6q23/L3MBTL3). Index variants in five additional regions previously associated with only one cancer also showed clear association with a second cancer type. Cell-type specific expression quantitative trait locus and enhancer-gene interaction annotations suggested target genes with potential cross-cancer roles at the new loci. Pathway analysis revealed significant enrichment of death receptor signaling genes near loci with P < 10−5 in the three-cancer meta-analysis. PMID:27432226

  13. Cadmium effects on the thyroid gland.

    PubMed

    Jancic, Snezana A; Stosic, Bojan Z

    2014-01-01

    Cadmium has been listed as one of the 126 priority pollutants and a category I carcinogen. Carcinogenic effects of cadmium on the lungs, testicles, and prostate are widely recognized, but there has been insufficient research on the effect of cadmium on the thyroid gland. Cadmium has the affinity to accumulate not only in the liver, kidneys, and pancreas but also in the thyroid gland. It has been established that cadmium blood concentration correlates positively with its accumulation in the thyroid gland. Women of fertile age have higher cadmium blood and urine concentrations than men. In spite of its redox inertia, cadmium brings about oxidative stress and damage to the tissue by indirect mechanisms. Mitochondria are considered to be the main intracellular targets for cadmium. Colloid cystic goiter, adenomatoid follicular hyperplasia with low-grade dysplasia and thyroglobulin hypo- and asecretion, and parafollicular cell diffuse and nodular hyperplasia and hypertrophy are often found in chronic cadmium toxicity. © 2014 Elsevier Inc. All rights reserved.

  14. Effect of a HIF-1 Alpha Polymorphism on the Incidence and Prostate Cancer

    DTIC Science & Technology

    2007-02-01

    factor levels and risk of prostate cancer. Cancer Epidemiol Biomarkers Prev 2005;14(6):1557-1561. 34. Percy MJ, Mooney SM, McMullin MF, Flores A...vascular endothelial growth factor in pathological angiogenesis. Breast Cancer Research & Treatment 1995;36(2):127-137. 37. Jackson MW, Bentel JM, Tilley

  15. Immunoscore in Rectal Cancer

    ClinicalTrials.gov

    2017-06-13

    Cancer of the Rectum; Neoplasms, Rectal; Rectal Cancer; Rectal Tumors; Rectal Adenocarcinoma; Melanoma; Breast Cancer; Renal Cell Cancer; Lung Cancer; Bladder Cancer; Head and Neck Cancer; Ovarian Cancer; Thyroid Cancer

  16. Breast and Prostate Cancer Survivor Responses to Group Exercise and Supportive Group Psychotherapy.

    PubMed

    Martin, Eric; Bulsara, Caroline; Battaglini, Claudio; Hands, Beth; Naumann, Fiona L

    2015-01-01

    This study qualitatively examined an 8-week group exercise and counseling intervention for breast and prostate cancer survivors. Groups exercised 3 days per week, 50 minutes per session, performing moderate-intensity aerobic and resistance training. Groups also underwent 90-minute supportive group psychotherapy sessions once per week. Survivors discussed their experiences in focus groups post intervention. Transcripts were analyzed using interpretative phenomenological analysis. Survivors described how exercise facilitated counseling by creating mutual aid and trust, and counseling helped participants with self-identity, sexuality, and the return to normalcy. When possible, counselors and fitness professionals should create partnerships to optimally support cancer survivors.

  17. False Positive Uptake in Bilateral Gynecomastia on 68Ga-PSMA PET/CT Scan.

    PubMed

    Sasikumar, Arun; Joy, Ajith; Nair, Bindu P; Pillai, M R A; Madhavan, Jayaprakash

    2017-09-01

    A 66-year-old man on hormonal therapy with prostate cancer was referred for Ga-PSMA PET/CT scan for biochemical recurrence. Ga-PSMA PET/CT scan detected moderate heterogeneous tracer concentration in bilateral breast parenchyma, in addition to the abnormal tracer concentration in enlarged prostate gland, right external iliac lymph node, and sclerotic lesion in L4 vertebra. On clinical examination, he was found to have bilateral gynecomastia. Abnormal concentration of Ga-PSMA in breast cancer is now well known, and in this context, it is important to know that tracer localization can occur in gynecomastia as well, as evidenced in this case.

  18. Mutation analysis of aryl hydrocarbon receptor interacting protein (AIP) gene in colorectal, breast, and prostate cancers

    PubMed Central

    Georgitsi, M; Karhu, A; Winqvist, R; Visakorpi, T; Waltering, K; Vahteristo, P; Launonen, V; Aaltonen, L A

    2007-01-01

    Germline mutations in the aryl hydrocarbon receptor interacting protein (AIP) gene were recently identified in individuals with pituitary adenoma predisposition (PAP). These patients have prolactin (PRL) or growth hormone (GH) oversecreting pituitary adenomas, the latter exhibiting acromegaly or gigantism. Loss-of-heterozygosity (LOH) analysis revealed that AIP is lost in PAP tumours, suggesting that it acts as a tumour-suppressor gene. Aryl hydrocarbon receptor interacting protein is involved in several pathways, but it is best characterised as a cytoplasmic partner of the aryl hydrocarbon receptor (AHR). To examine the possible role of AIP in the genesis of common cancers, we performed somatic mutation screening in a series of 373 colorectal cancers (CRCs), 82 breast cancers, and 44 prostate tumour samples. A missense R16H (47G>A) change was identified in two CRC samples, as well as in the respective normal tissues, but was absent in 209 healthy controls. The remaining findings were silent, previously unreported, changes of the coding, non-coding, or untranslated regions of AIP. These results suggest that somatic AIP mutations are not common in CRC, breast, and prostate cancers. PMID:17242703

  19. Investments in cancer research awarded to UK institutions and the global burden of cancer 2000-2013: a systematic analysis.

    PubMed

    Maruthappu, Mahiben; Head, Michael G; Zhou, Charlie D; Gilbert, Barnabas J; El-Harasis, Majd A; Raine, Rosalind; Fitchett, Joseph R; Atun, Rifat

    2017-04-20

    To systematically categorise cancer research investment awarded to United Kingdom (UK) institutions in the period 2000-2013 and to estimate research investment relative to disease burden as measured by mortality, disability-adjusted life years (DALYs) and years lived with disability (YLDs). Systematic analysis of all open-access data. Public and philanthropic funding to all UK cancer research institutions, 2000-2013. Number and financial value of cancer research investments reported in 2013 UK pounds (UK£). Mortality, DALYs and YLDs data were acquired from the Global Burden of Disease Study. A compound metric was adapted to estimate research investment relative to disease burden as measured by mortality, DALYs and YLDs. We identified 4299 funded studies with a total research investment of £2.4 billion. The highest fundings by anatomical sites were haematological, breast, prostate, colorectal and ovarian cancers. Relative to disease burden as determined by a compound metric combining mortality, DALYs and YLDs, gender-specific cancers were found to be highest funded-the five sites that received the most funding were prostate, ovarian, breast, mesothelioma and testicular cancer; the least well-funded sites were liver, thyroid, lung, upper gastrointestinal (GI) and bladder. Preclinical science accounted for 66.2% of award numbers and 62.2% of all funding. The top five areas of primary research focus by funding were pathogenesis, drug therapy, diagnostic, screening and monitoring, women's health and immunology. The largest individual funder was the Medical Research Council. In combination, the five lowest funded site-specific cancers relative to disease burden account for 47.9%, 44.3% and 20.4% of worldwide cancer mortality, DALYs and YLDs. Research funding for cancer is not allocated according to relative disease burden. These findings are in line with earlier published studies. Funding agencies and industry should openly document their research investments to improve better targeting of research investment. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  20. Telomere structure and maintenance gene variants and risk of five cancer types

    PubMed Central

    Karami, Sara; Han, Younghun; Pande, Mala; Cheng, Iona; Rudd, James; Pierce, Brandon L.; Nutter, Ellen L.; Schumacher, Fredrick R.; Kote-Jarai, Zsofia; Lindstrom, Sara; Witte, John S.; Fang, Shenying; Han, Jiali; Kraft, Peter; Hunter, David; Song, Fengju; Hung, Rayjean J.; McKay, James; Gruber, Stephen B.; Chanock, Stephen J.; Risch, Angela; Shen, Hongbing; Haiman, Christopher A.; Boardman, Lisa; Ulrich, Cornelia M.; Casey, Graham; Peters, Ulrike; Al Olama, Ali Amin; Berchuck, Andrew; Berndt, Sonja I.; Bezieau, Stephane; Brennan, Paul; Brenner, Hermann; Brinton, Louise; Caporaso, Neil; Chan, Andrew T.; Chang-Claude, Jenny; Christiani, David C.; Cunningham, Julie M.; Easton, Douglas; Eeles, Rosalind A.; Eisen, Timothy; Gala, Manish; Gallinger, Steven J.; Gayther, Simon A.; Goode, Ellen L.; Grönberg, Henrik; Henderson, Brian E.; Houlston, Richard; Joshi, Amit D.; Küry, Sébastien; Landi, Mari T.; Le Marchand, Loic; Muir, Kenneth; Newcomb, Polly A.; Permuth-Wey, Jenny; Pharoah, Paul; Phelan, Catherine; Potter, John D.; Ramus, Susan J.; Risch, Harvey; Schildkraut, Joellen; Slattery, Martha L.; Song, Honglin; Wentzensen, Nicolas; White, Emily; Wiklund, Fredrik; Zanke, Brent W.; Sellers, Thomas A.; Zheng, Wei; Chatterjee, Nilanjan; Amos, Christopher I.; Doherty, Jennifer A.

    2016-01-01

    Telomeres cap chromosome ends, protecting them from degradation, double-strand breaks, and end-to-end fusions. Telomeres are maintained by telomerase, a reverse transcriptase encoded by TERT, and an RNA template encoded by TERC. Loci in the TERT and adjoining CLPTM1L region are associated with risk of multiple cancers. We therefore investigated associations between variants in 22 telomere structure and maintenance gene regions and colorectal, breast, prostate, ovarian, and lung cancer risk. We performed subset-based meta-analyses of 204,993 directly-measured and imputed SNPs among 61,851 cancer cases and 74,457 controls of European descent. Independent associations for SNP minor alleles were identified using sequential conditional analysis (with gene-level P-value cutoffs ≤3.08×10−5). Of the thirteen independent SNPs observed to be associated with cancer risk, novel findings were observed for seven loci. Across the TERT-CLPTML1 region, rs12655062 was associated positively with prostate cancer, and inversely with colorectal and ovarian cancers, and rs115960372 was associated positively with prostate cancer. Across the TERC region, rs75316749 was positively associated with colorectal, breast, ovarian, and lung cancers. Across the DCLRE1B region, rs974404 and rs12144215 were inversely associated with prostate and lung cancers, and colorectal, breast, and ovarian cancers, respectively. Near POT1, rs116895242 was inversely associated with colorectal, ovarian, and lung cancers, and RTEL1 rs34978822 was inversely associated with prostate and lung cancers. The complex association patterns in telomere-related genes across cancer types may provide insight into mechanisms through which telomere dysfunction in different tissues influences cancer risk. PMID:27459707

  1. Delivery of Cancer Screening

    PubMed Central

    Fenton, Joshua J.; Cai, Yong; Weiss, Noel S.; Elmore, Joann G.; Pardee, Roy E.; Reid, Robert J.; Baldwin, Laura-Mae

    2012-01-01

    Background Patients and physicians strongly endorse the importance of preventive or periodic health examinations (PHEs). However, the extent to which PHEs contribute to the delivery of cancer screening is uncertain. Methods In a retrospective cohort study, we determined the association between receipt of a PHE and cancer testing in a population-based sample of enrollees in a Washington State health plan who were aged 52 to 78 years and eligible for colorectal, breast, or prostate cancer screening in 2002–2003 (N = 64 288). Outcomes included completion of any colorectal cancer testing (fecal occult blood testing, sigmoidoscopy, colonoscopy, or barium enema), screening mammography, and prostate-specific antigen testing. Results More than half (52.4%) of the enrollees received a PHE during the study period. After adjusting for demographics, comorbidity, number of outpatient visits, and historical preventive service use before January 1, 2002, receipt of a PHE was significantly associated with completion of colorectal cancer testing (incidence difference, 40.4% [95% confidence interval (CI), 39.4%–41.3%]; relative incidence, 3.47 [95% CI, 3.34–3.59]), screening mammography [incidence difference, 14.2% [95% CI, 12.7%–15.7%]; relative incidence, 1.23 [95% CI, 1.20–1.25]), and prostate-specific antigen testing (incidence difference, 39.4% [95% CI, 38.3%–40.5%]; relative incidence, 3.06 [95% CI, 2.95–3.18]). Conclusions Among managed care enrollees eligible for cancer screening, PHE receipt is associated with completion of colorectal, breast, and prostate cancer testing. In similar populations, the PHE may serve as a clinically important forum for the promotion of evidence-based colorectal cancer and breast cancer screening and of screening with relatively less empirical support, such as prostate cancer screening. PMID:17389289

  2. Novel Nine-Exon AR Transcripts (Exon 1/Exon 1b/Exons 2-8) in Normal and Cancerous Breast and Prostate Cells.

    PubMed

    Hu, Dong Gui; McKinnon, Ross A; Hulin, Julie-Ann; Mackenzie, Peter I; Meech, Robyn

    2016-12-27

    Nearly 20 different transcripts of the human androgen receptor (AR) are reported with two currently listed as Refseq isoforms in the NCBI database. Isoform 1 encodes wild-type AR (type 1 AR) and isoform 2 encodes the variant AR45 (type 2 AR). Both variants contain eight exons: they share common exons 2-8 but differ in exon 1 with the canonical exon 1 in isoform 1 and the variant exon 1b in isoform 2. Splicing of exon 1 or exon 1b is reported to be mutually exclusive. In this study, we identified a novel exon 1b (1b/TAG) that contains an additional TAG trinucleotide upstream of exon 1b. Moreover, we identified AR transcripts in both normal and cancerous breast and prostate cells that contained either exon 1b or 1b/TAG spliced between the canonical exon 1 and exon 2, generating nine-exon AR transcripts that we have named isoforms 3a and 3b. The proteins encoded by these new AR variants could regulate androgen-responsive reporters in breast and prostate cancer cells under androgen-depleted conditions. Analysis of type 3 AR-GFP fusion proteins showed partial nuclear localization in PC3 cells under androgen-depleted conditions, supporting androgen-independent activation of the AR. Type 3 AR proteins inhibited androgen-induced growth of LNCaP cells. Microarray analysis identified a small set of type 3a AR target genes in LNCaP cells, including genes known to modulate growth and proliferation of prostate cancer ( PCGEM1 , PEG3 , EPHA3 , and EFNB2 ) or other types of human cancers ( TOX3 , ST8SIA4 , and SLITRK3 ), and genes that are diagnostic/prognostic biomarkers of prostate cancer ( GRINA3 , and BCHE ).

  3. "To be or not to be in a good shape": diagnostic and clinical value of nuclear shape irregularities in thyroid and breast cancer.

    PubMed

    Bussolati, Gianni; Maletta, Francesca; Asioli, Sofia; Annaratone, Laura; Sapino, Anna; Marchiò, Caterina

    2014-01-01

    Variation in both nuclear shape and size ("pleomorphism"), coupled with changes in chromatin amount and distribution, remains the basic criteria for microscopy in a cytologic diagnosis of cancer. The biological determinants of nuclear shape irregularities are not clarified, so, rather than on the genesis of nuclear irregularities, we here focus our attention on a descriptive analysis of nuclear pleomorphism. We keep in mind that evaluation of nuclear shape as currently practiced in routine preparations is improper because it is indirectly based on the distribution of DNA as revealed by the affinity for basic dyes. Therefore, over the last years we have been using as criteria morphological features of nuclei of thyroid and breast carcinomas as determined by immunofluorescence, in situ hybridization, and 3D reconstruction. We have translated this approach to routine diagnostic pathology on tissue sections by employing immunoperoxidase staining for emerin. Direct detection of nuclear envelope irregularities by tagging nuclear membrane proteins such as lamin B and emerin has resulted in a more objective definition of the shape of the nucleus. In this review we discuss in detail methodological issues as well as diagnostic and prognostic implications provided by decoration/staining of the nuclear envelope in both thyroid and breast cancer, thus demonstrating how much it matters "to be in the right shape" when dealing with pathological diagnosis of cancer.

  4. Selumetinib and Olaparib in Solid Tumors

    ClinicalTrials.gov

    2018-05-02

    Malignant Neoplasm of Breast; Malignant Neoplasms of Digestive Organs; Malignant Neoplasms of Female Genital Organs; Malignant Neoplasms of Male Genital Organs; Malignant Neoplasms of Thyroid and Other Endocrine Glands

  5. Small cell lung cancer with metastasis to the thyroid in a patient with toxic multinodular goiter.

    PubMed

    Ozgu, Eylem Sercan; Gen, Ramazan; Ilvan, Ahmet; Ozge, Cengiz; Polat, Ayşe; Vayisoglu, Yusuf

    2012-11-01

    Thyroid metastasis of lung cancer is rarely observed in clinical practice. The primary cancers which metastasize to the thyroid gland are mostly renal cell carcinoma, lung cancer, and breast cancer. Transient destructive thyrotoxicosis is caused by massive metastasis of extrathyroid tumors. We herein present a case report of a patient with small cell carcinoma of lung with metastasis to the thyroid and thyrotoxicosis due to toxic multinodular goiter. A 66-year-old man complained of swelling around the right side of the neck, dyspnea, progressive weight loss, and palpitation starting since 3 months before his admission. The patient was diagnosed with small cell carcinoma of lung with metastasis to the thyroid and thyrotoxicosis due to toxic multinodular goiter. The case report presented here illustrates the challenge of making a definitive and adequate diagnosis, particularly if the patient presents with 2 potential causes of thyrotoxicosis. Thyroid scintigraphy is an important tool for differential diagnosis of thyrotoxicosis.

  6. Zoledronic acid overcomes chemoresistance by sensitizing cancer stem cells to apoptosis.

    PubMed

    Rouhrazi, H; Turgan, N; Oktem, G

    2018-01-01

    Unlike low tumorigenic bulk tumor cells (non-CSCs), cancer stem cells (CSCs) are a subset of tumor cells that can self-renew and differentiate into different cancer subtypes. CSCs are considered responsible for tumor recurrence, distant metastasis, angiogenesis, and drug or radiation resistance. CSCs also are resistant to apoptosis. Zoledronic acid (ZA) is a third generation bisphosphonate that reduces cell proliferation and exhibits anti-tumor effects by inducing cell death in some malignancies; however, the effects of ZA on CSCs are unclear. We investigated the anti-cancer effects of ZA on two epithelial cancer cell lines, prostate DU-145 and breast MCF7, focusing primarily on induction and activation of apoptosis. Cluster of differentiation (CD) 133 + /CD44 + prostate CSCs and CD 44 + /CD24 breast CSCs were isolated from the DU-145 human prostate cancer and MCF-7 human breast cancer cell lines, respectively, using FACSAria flow cytometry cell sorting. CSCs and non-CSCs were exposed to increasing concentrations of ZA for 24, 48 and 72 h to determine the IC 50 dose. Annexin-V assay for detecting cell death and cell cycle was performed using the Muse™ Cell Analyzer. Prostate CSCs and non-CSCs were assayed by quantitative reverse transcription PCR (qRT-PCR) array for detecting 84 key apoptosis related genes. Gene regulation at the protein level was investigated by immunofluorescence. ZA caused a dose- and time-dependent decrease in cell viability. Treatment with ZA resulted in a concomitant increase in apoptosis and cell cycle arrest at S-phase in CSCs. Significant over/under-expressions were detected in seven of the genes of ZA-treated DU-145 CSCs cells. Expressions of CASP9, CASP4, BAX and BAD genes increased, while the expressions of BIRC3, BIRC2 and BCL2 genes decreased. In the DU-145 non-CSCs, five genes exhibited changes in gene expression after ZA treatment, two exhibited increased expression (CASP7 and BAD) and three exhibited decreased expression (BIRC3, BIRC2 and BCL2). ZA caused cell death of drug resistant breast MCF-7 and prostate DU-145 cancer stem cells by activating apoptosis. ZA can facilitate the intrinsic pathway of apoptosis in human prostate CSCs by down-regulating anti-apoptotic genes and up-regulating pro-apoptotic genes. ZA may be an effective therapeutic agent for targeting chemoresistance in CSCs.

  7. Continuing Development of Alternative High-Throughput Screens to Determine Endocrine Disruption, Focusing on Androgen Receptor, Steroidogenesis, and Thyroid Pathways

    EPA Science Inventory

    The focus of this meeting is the SAP's review and comment on the Agency's proposed high-throughput computational model of androgen receptor pathway activity as an alternative to the current Tier 1 androgen receptor assay (OCSPP 890.1150: Androgen Receptor Binding Rat Prostate Cyt...

  8. Phentermine

    MedlinePlus

    ... hyperthyroidism (overactive thyroid gland), diabetes, glaucoma, or a history of drug abuse.tell your doctor if you are pregnant, plan to become pregnant, or are breast-feeding. If you become pregnant while taking phentermine, call ...

  9. The p27Kip1 Tumor Suppressor and Multi-Step Tumorigenesis

    DTIC Science & Technology

    2001-08-01

    Breast Cancer , Cell cycle, tumor suppressor 33 16. PRICE CODE 17. SECURITY CLASSIFICATION 18. SECURITY CLASSIFICATION 19. SECURITY CLASSIFICATION 20...in many cancers , including carcinomas of the breast , colon, lung and prostate, and lymphoma. Although these studies of p27 expression in primary...of DMBA-induced pituitary tumors in p27-/- mice precluded determination of breast cancer risk in these mice. Nevertheless, the extensive mammary tissue

  10. Metallothionein-3 Increases Triple-Negative Breast Cancer Cell Invasiveness via Induction of Metalloproteinase Expression

    PubMed Central

    Suchanski, Jaroslaw; Olbromski, Mateusz; Gomulkiewicz, Agnieszka; Owczarek, Tomasz; Kruczak, Anna; Ambicka, Aleksandra; Rys, Janusz; Ugorski, Maciej; Podhorska-Okolow, Marzena; Dziegiel, Piotr

    2015-01-01

    It has been recently found that metallothionein-3 (MT3) enhances the invasiveness and tumorigenesis of prostate cancer cells. This finding is in contrast to those of earlier studies, which indicated that overexpression of MT3 in breast cancer and prostate cancer cell lines inhibits their growth in vitro. Therefore, to clarify the role of MT3 in breast cancer progression, we analyzed the effect of MT3-overexpression on proliferation, invasiveness, migration, and tumorigenesis of breast cancer MDA-MB-231/BO2 cells. It was found that MDA-MB-231/BO2 cells overexpressing MT3 were characterized by increased invasiveness in vitro, compared to the control cells. Interestingly, this increased invasiveness correlated with a highly increased concentration of MMP3 in the culture supernatants (p<0.0001). Our data suggest that MT3 may regulate breast cancer cell invasiveness by modulating the expression of MMP3. These experimental results, obtained using triple-negative MDA-MB-231/BO2 cells, were further supported by clinical data. It was found that, in triple-negative breast cancer (TNBC), nuclear MT3 immunoreactivity in cancer cells tended to be associated with patients’ shorter disease-specific survival, suggesting that nuclear MT3 expression may be a potential marker of poor prognosis of triple-negative TNBC cases. PMID:25933064

  11. Organ dose and risk assessment in paediatric radiography using the PCXMC 2.0

    NASA Astrophysics Data System (ADS)

    Ladia, A.; Messaris, G.; Delis, H.; Panayiotakis, G.

    2015-09-01

    Abdominal and chest radiographs are the most common examinations in paediatric radiology. X-ray examination of children attracts particular interest, mainly due to the increased risk for the expression of delayed radiogenic cancers as they have many years of expected life remaining. This study aims to calculate the organ dose and estimate the radiation Risk of Exposure Induced cancer Death (REID) to paediatric patients, using the PCXMC 2.0 Monte Carlo code.Patient data and exposure parameters were recorded during examinations of 240 patients, separated in four age groups undergoing chest or abdomen examinations.The organs received the highest dose in all patient groups were liver, lungs, stomach, thyroid, pancreas, breast, spleen in chest radiographs and liver, lungs, colon, stomach and ovaries, uterus (for girls) and prostate (for boys) in abdomen radiographs. The effective dosefor the chest was 0.49×10-2- 1.07×10-2 mSv, while for the abdomen 1.85×10-2- 3.02×10-2 mSv. The mean REID value was 1.254×10-5 for the abdomen and 0.645×10-5 for the chest.

  12. Ten-year cancer incidence in rescue/recovery workers and civilians exposed to the September 11, 2001 terrorist attacks on the World Trade Center.

    PubMed

    Li, Jiehui; Brackbill, Robert M; Liao, Tim S; Qiao, Baozhen; Cone, James E; Farfel, Mark R; Hadler, James L; Kahn, Amy R; Konty, Kevin J; Stayner, Leslie T; Stellman, Steven D

    2016-09-01

    Cancer incidence in exposed rescue/recovery workers (RRWs) and civilians (non-RRWs) was previously reported through 2008. We studied occurrence of first primary cancer among World Trade Center Health Registry enrollees through 2011 using adjusted standardized incidence ratios (SIRs), and the WTC-exposure-cancer association, using Cox proportional hazards models. All-cancer SIR was 1.11 (95% confidence interval (CI) 1.03-1.20) in RRWs, and 1.08 (95% CI 1.02-1.15) in non-RRWs. Prostate cancer and skin melanoma were significantly elevated in both populations. Thyroid cancer was significantly elevated only in RRWs while breast cancer and non-Hodgkin's lymphoma were significantly elevated only in non-RRWs. There was a significant exposure dose-response for bladder cancer among RRWs, and for skin melanoma among non-RRWs. We observed excesses of total and specific cancers in both populations, although the strength of the evidence for causal relationships to WTC exposures is somewhat limited. Continued monitoring of this population is indicated. Am. J. Ind. Med. 59:709-721, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  13. Prostate Cancer in African-American Men: Serum Biomarkers for Early Detection Using Nanoparticles

    DTIC Science & Technology

    2008-11-01

    breast cancer cells, Nanomedicine, (2008), 3(3), 283-292. 18 22. Shangguan, Dihua; Meng, Ling; Cao, Zehui Charles; Xiao, Zeyu; Fang, Xiaohong; Li...AD_________________ Award Number: W81XWH-06-1-0034 TITLE: Prostate Cancer in African-American Men...ORGANIZATION: Moffitt Cancer Center Tampa, FL 33612-9497 REPORT DATE: November 2008

  14. The Role of Retinal Determination Gene Network (RDGN) in Hormone Signaling Transduction and Prostate Tumorigenes

    DTIC Science & Technology

    2014-10-01

    McCue P, Lisanti MP, Wang C, Davis RJ, Mardon G, Pestell RG. The Endogenous Cell-Fate Factor Dachshund Restrains Prostate Epithelial Cell Migration via...Loro E, Pestell RG. “Inhibition of Breast Tumor Stem Cells Expansion by the Endogenous Cell Fate Determination Factor Dachshund.” Chapter in Volume

  15. Deregulated Wnt Signaling in Prostate Cancer

    DTIC Science & Technology

    2010-01-01

    cancer and has the highest mortality in American males (1). It is an increasing health problem in the US and results in many misdiagnoses and...Odero-Marah VA, Liu T, Kimbro KS, Sharma D, O’Regan RM., Breast Cancer Res Treat. 2009 Nov 18 13. Schmalhofer O, Brabletz S, Brabletz T., Cancer ...Prostate Cancer PRINCIPAL INVESTIGATOR: Robin Tharakan, Ph.D

  16. Fourier transform infrared attenuated total reflection analysis of human hair: comparison of hair from breast cancer patients with hair from healthy subjects.

    PubMed

    Lyman, Donald J; Murray-Wijelath, Jacqueline

    2005-01-01

    A comparative study of Fourier transform infrared attenuated total reflection (FTIR-ATR) spectra of 32 scalp and pubic hair samples from individuals diagnosed with breast cancer and those who were negative for breast cancer showed increases in the beta-sheet/disorder structures (relative to alpha-helix structures) and C-H lipid content of hair from breast cancer patients. Thus, the presence of breast cancer appears to alter the hair growth process, resulting in changes in the composition and conformation of cell membrane and matrix materials of hair fiber. These appear to be consistent with the changes observed in X-ray diffraction patterns for hair from breast cancer patients. A blind study of 12 additional hair samples using these FTIR-ATR spectral differences as markers correctly identified all four hair samples from cancer patients (100%). Two of these samples were from breast cancer patients. Of the remaining two samples analyzing positive for cancer, one was from a prostate cancer patient and one from a lung cancer patient. Thus, it appears that the mechanism that alters hair fiber synthesis in the three types of cancer may be similar. The blind study incorrectly identified as positive for cancer three hair samples from two apparently healthy individuals and one patient considered cured from prostate cancer.

  17. Alteration of the bioenergetic phenotype of mitochondria is a hallmark of breast, gastric, lung and oesophageal cancer.

    PubMed Central

    Isidoro, Antonio; Martínez, Marta; Fernández, Pedro L; Ortega, Alvaro D; Santamaría, Gema; Chamorro, Margarita; Reed, John C; Cuezva, José M

    2004-01-01

    Recent findings indicate that the expression of the beta-catalytic subunit of the mitochondrial H+-ATP synthase (beta-F1-ATPase) is depressed in liver, kidney and colon carcinomas, providing further a bioenergetic signature of cancer that is associated with patient survival. In the present study, we performed an analysis of mitochondrial and glycolytic protein markers in breast, gastric and prostate adenocarcinomas, and in squamous oesophageal and lung carcinomas. The expression of mitochondrial and glycolytic markers varied significantly in these carcinomas, when compared with paired normal tissues, with the exception of prostate cancer. Overall, the relative expression of beta-F1-ATPase was significantly reduced in breast and gastric adenocarcinomas, as well as in squamous oesophageal and lung carcinomas, strongly suggesting that alteration of the bioenergetic function of mitochondria is a hallmark of these types of cancer. PMID:14683524

  18. Transcription factor Brn-3α mRNA in cancers, relationship with AR, ER receptors and AKT/m-TOR pathway components

    NASA Astrophysics Data System (ADS)

    Spirina, L. V.; Gorbunov, A. K.; Chigevskaya, S. Y.; Usynin, Y. A.; Kondakova, I. V.; Slonimskaya, E. M.; Usynin, E. A.; Choinzonov, E. L.; Zaitseva, O. S.

    2017-09-01

    Transcription factors POU4F1 (neurogenic factor Brn-3α) play a pivotal role in cancers development. The aim of the study was to reveal the Brn-3α expression, AR, ER expression in cancers development, association with AKT/mTOR pathway activation. 30 patients with locally advanced prostate cancer, 20 patients with papillary thyroid cancer, T2-3N0-1M0 stages and 40 patients with renal cell cancer T2-3N0M0-1 were involved into the study. The expressions of Brn-3α, AR, ERα, components of AKT/m-TOR signaling pathway genes were performed by real-time PCR. The dependence of Brn-3α expression on mRNA levels of steroid hormone receptors and components of AKT/m-TOR signaling pathway in studied cancers were shown. High levels of mRNA of nuclear factor, steroid hormone receptors were found followed by the activation of this signaling pathway in prostate cancer tissue. The reduction of transcription factor Brn-3α was accompanied with tumor invasive growth with increasing rates of AR, ER and 4E-BP1 mRNA. Thyroid cancer development happened in a case of a Brn-3α and steroid hormone receptors decrease. The activation of AKT/m-TOR signaling pathway was established in the metastatic renal cancers, accompanied with the increase of ER mRNA. But there was no correlation between the steroid receptor and Brn-3α. One-direction changes of Brn-3α were observed in the development of prostate and thyroid cancer due to its effect on the steroid hormone receptors and the activation of AKT/m-TOR signaling pathway components. The influence of this factor on the development of the kidney cancer was mediated through m-TOR activity modifications, the key enzyme of oncogenesis.

  19. BRCA2 Polymorphic Stop Codon K3326X and the Risk of Breast, Prostate, and Ovarian Cancers

    PubMed Central

    Meeks, Huong D.; Song, Honglin; Michailidou, Kyriaki; Bolla, Manjeet K.; Dennis, Joe; Wang, Qin; Barrowdale, Daniel; Frost, Debra; McGuffog, Lesley; Ellis, Steve; Feng, Bingjian; Buys, Saundra S.; Hopper, John L.; Southey, Melissa C.; Tesoriero, Andrea; James, Paul A.; Bruinsma, Fiona; Campbell, Ian G.; Broeks, Annegien; Schmidt, Marjanka K.; Hogervorst, Frans B. L.; Beckman, Matthias W.; Fasching, Peter A.; Fletcher, Olivia; Johnson, Nichola; Sawyer, Elinor J.; Riboli, Elio; Banerjee, Susana; Menon, Usha; Tomlinson, Ian; Burwinkel, Barbara; Hamann, Ute; Marme, Frederik; Rudolph, Anja; Janavicius, Ramunas; Tihomirova, Laima; Tung, Nadine; Garber, Judy; Cramer, Daniel; Terry, Kathryn L.; Poole, Elizabeth M.; Tworoger, Shelley S.; Dorfling, Cecilia M.; van Rensburg, Elizabeth J.; Godwin, Andrew K.; Guénel, Pascal; Truong, Thérèse; Stoppa-Lyonnet, Dominique; Damiola, Francesca; Mazoyer, Sylvie; Sinilnikova, Olga M.; Isaacs, Claudine; Maugard, Christine; Bojesen, Stig E.; Flyger, Henrik; Gerdes, Anne-Marie; Hansen, Thomas V. O.; Jensen, Allen; Kjaer, Susanne K.; Hogdall, Claus; Hogdall, Estrid; Pedersen, Inge Sokilde; Thomassen, Mads; Benitez, Javier; González-Neira, Anna; Osorio, Ana; de la Hoya, Miguel; Segura, Pedro Perez; Diez, Orland; Lazaro, Conxi; Brunet, Joan; Anton-Culver, Hoda; Eunjung, Lee; John, Esther M.; Neuhausen, Susan L.; Ding, Yuan Chun; Castillo, Danielle; Weitzel, Jeffrey N.; Ganz, Patricia A.; Nussbaum, Robert L.; Chan, Salina B.; Karlan, Beth Y.; Lester, Jenny; Wu, Anna; Gayther, Simon; Ramus, Susan J.; Sieh, Weiva; Whittermore, Alice S.; Monteiro, Alvaro N. A.; Phelan, Catherine M.; Terry, Mary Beth; Piedmonte, Marion; Offit, Kenneth; Robson, Mark; Levine, Douglas; Moysich, Kirsten B.; Cannioto, Rikki; Olson, Sara H.; Daly, Mary B.; Nathanson, Katherine L.; Domchek, Susan M.; Lu, Karen H.; Liang, Dong; Hildebrant, Michelle A. T.; Ness, Roberta; Modugno, Francesmary; Pearce, Leigh; Goodman, Marc T.; Thompson, Pamela J.; Brenner, Hermann; Butterbach, Katja; Meindl, Alfons; Hahnen, Eric; Wappenschmidt, Barbara; Brauch, Hiltrud; Brüning, Thomas; Blomqvist, Carl; Khan, Sofia; Nevanlinna, Heli; Pelttari, Liisa M.; Aittomäki, Kristiina; Butzow, Ralf; Bogdanova, Natalia V.; Dörk, Thilo; Lindblom, Annika; Margolin, Sara; Rantala, Johanna; Kosma, Veli-Matti; Mannermaa, Arto; Lambrechts, Diether; Neven, Patrick; Claes, Kathleen B. M.; Maerken, Tom Van; Chang-Claude, Jenny; Flesch-Janys, Dieter; Heitz, Florian; Varon-Mateeva, Raymonda; Peterlongo, Paolo; Radice, Paolo; Viel, Alessandra; Barile, Monica; Peissel, Bernard; Manoukian, Siranoush; Montagna, Marco; Oliani, Cristina; Peixoto, Ana; Teixeira, Manuel R.; Collavoli, Anita; Hallberg, Emily; Olson, Janet E.; Goode, Ellen L.; Hart, Steven N.; Shimelis, Hermela; Cunningham, Julie M.; Giles, Graham G.; Milne, Roger L.; Healey, Sue; Tucker, Kathy; Haiman, Christopher A.; Henderson, Brian E.; Goldberg, Mark S.; Tischkowitz, Marc; Simard, Jacques; Soucy, Penny; Eccles, Diana M.; Le, Nhu; Borresen-Dale, Anne-Lise; Kristensen, Vessela; Salvesen, Helga B.; Bjorge, Line; Bandera, Elisa V.; Risch, Harvey; Zheng, Wei; Beeghly-Fadiel, Alicia; Cai, Hui; Pylkäs, Katri; Tollenaar, Robert A. E. M.; van der Ouweland, Ans M. W.; Andrulis, Irene L.; Knight, Julia A.; Narod, Steven; Devilee, Peter; Winqvist, Robert; Figueroa, Jonine; Greene, Mark H.; Mai, Phuong L.; Loud, Jennifer T.; García-Closas, Montserrat; Schoemaker, Minouk J.; Czene, Kamila; Darabi, Hatef; McNeish, Iain; Siddiquil, Nadeem; Glasspool, Rosalind; Kwong, Ava; Park, Sue K.; Teo, Soo Hwang; Yoon, Sook-Yee; Matsuo, Keitaro; Hosono, Satoyo; Woo, Yin Ling; Gao, Yu-Tang; Foretova, Lenka; Singer, Christian F.; Rappaport-Feurhauser, Christine; Friedman, Eitan; Laitman, Yael; Rennert, Gad; Imyanitov, Evgeny N.; Hulick, Peter J.; Olopade, Olufunmilayo I.; Senter, Leigha; Olah, Edith; Doherty, Jennifer A.; Schildkraut, Joellen; Koppert, Linetta B.; Kiemeney, Lambertus A.; Massuger, Leon F. A. G.; Cook, Linda S.; Pejovic, Tanja; Li, Jingmei; Borg, Ake; Öfverholm, Anna; Rossing, Mary Anne; Wentzensen, Nicolas; Henriksson, Karin; Cox, Angela; Cross, Simon S.; Pasini, Barbara J.; Shah, Mitul; Kabisch, Maria; Torres, Diana; Jakubowska, Anna; Lubinski, Jan; Gronwald, Jacek; Agnarsson, Bjarni A.; Kupryjanczyk, Jolanta; Moes-Sosnowska, Joanna; Fostira, Florentia; Konstantopoulou, Irene; Slager, Susan; Jones, Michael; Antoniou, Antonis C.; Berchuck, Andrew; Swerdlow, Anthony; Chenevix-Trench, Georgia; Dunning, Alison M.; Pharoah, Paul D. P.; Hall, Per; Easton, Douglas F.; Couch, Fergus J.; Spurdle, Amanda B.

    2016-01-01

    Background: The K3326X variant in BRCA2 (BRCA2*c.9976A>T; p.Lys3326*; rs11571833) has been found to be associated with small increased risks of breast cancer. However, it is not clear to what extent linkage disequilibrium with fully pathogenic mutations might account for this association. There is scant information about the effect of K3326X in other hormone-related cancers. Methods: Using weighted logistic regression, we analyzed data from the large iCOGS study including 76 637 cancer case patients and 83 796 control patients to estimate odds ratios (ORw) and 95% confidence intervals (CIs) for K3326X variant carriers in relation to breast, ovarian, and prostate cancer risks, with weights defined as probability of not having a pathogenic BRCA2 variant. Using Cox proportional hazards modeling, we also examined the associations of K3326X with breast and ovarian cancer risks among 7183 BRCA1 variant carriers. All statistical tests were two-sided. Results: The K3326X variant was associated with breast (ORw = 1.28, 95% CI = 1.17 to 1.40, P = 5.9x10- 6) and invasive ovarian cancer (ORw = 1.26, 95% CI = 1.10 to 1.43, P = 3.8x10-3). These associations were stronger for serous ovarian cancer and for estrogen receptor–negative breast cancer (ORw = 1.46, 95% CI = 1.2 to 1.70, P = 3.4x10-5 and ORw = 1.50, 95% CI = 1.28 to 1.76, P = 4.1x10-5, respectively). For BRCA1 mutation carriers, there was a statistically significant inverse association of the K3326X variant with risk of ovarian cancer (HR = 0.43, 95% CI = 0.22 to 0.84, P = .013) but no association with breast cancer. No association with prostate cancer was observed. Conclusions: Our study provides evidence that the K3326X variant is associated with risk of developing breast and ovarian cancers independent of other pathogenic variants in BRCA2. Further studies are needed to determine the biological mechanism of action responsible for these associations. PMID:26586665

  20. Prevalence of Types of Cancers in the Elderly Covered by Insurance of the Islamic Republic of Iran Broadcasting Company in 2015 - Comparison with Younger Groups.

    PubMed

    Roshani, Zahra; Akbari Kamrani, Ahmad Ali; Shati, Mohsen; Sahaf, Robab

    2016-01-01

    Presently, the world population of the elderly is growing. By improving health hygiene and welfare indicators, mortality and birth rates decrease and life expectancy increases, making the present century the century of elderly. Aging is one of the main risk factors for development of cancer, which itself is the second cause of death in old people. This study was conducted to assess the prevalence of cancer in the elderly covered by the Islamic Republic of Iran Broadcasting (IRIB) insurance program and to obtain suitable programs for cancer screening and early detection, increase patient survival, improve elderly care and to reclaim the cost of treatment in comparison to the national and international statistics. This is a cross-sectional study conducted on all elderly patients diagnosed with malignancy based on their pathology reports. In this study, of the total 75,500 patients covered by IRIB insurance, 17.2% belonged to the elderly group, males accounting for 53.3%. The most common cancers in old men were prostatic cancer (61.3%), colon cancer (10.3%) cancer of the hematologic system, bladder cancer (9.6%), lung cancer (9.1%), thyroid cancer (3.9%) and brain tumors (1.3%). In the elderly women, the most common cancers were breast cancer (80.1%), colon cancer (5.1%), thyroid cancers (4.4%), bladder and hematologic system malignancies (3.6), lung cancer (2.9%) and brain tumors (0.7%). In addition, the prevalence of cancer was almost the same as national and international statistics. With the exception of non-melanoma skin cancer no difference was shown in prevalence of cancer between IRIB elderly patients and the other groups of cancer patients in Iran.

  1. [The burden of disease from cancer in Cuba, 1990-2002].

    PubMed

    Alonso, Emma Domínguez; Jo, Armando H Seuc; Galán, Yaima

    2009-11-01

    To describe the burden of disease, using morbidity and mortality in Cuba from 1990-2002, by cancer type and location. A descriptive study of the disease burden in the years 1990, 1995, 2000, and 2002, by Cuba's most frequently associated cancer types and locations. Official Cuban sources were used to calculate years of potential life lost (YPLL) due to mortality (based on life expectancy) and morbidity (based on the incidence, average duration, and severity of the disease), as well as years of potential life lost per death (YPLL/D) and the disability-adjusted life years (DALY), for each cancer type and location, by sex and age group. The locations with higher YPLL were also those with the greatest total burden: lung, breast, prostate, colon and rectum, and cervix, and showed an upward trend for all cancer types and locations, except leukemia. The morbidity-related YPLL were concentrated in: breast, lung, prostate, colon and rectum, and cervix. In men, the highest mortality-related YPLL values were in the oral cavity and oropharynx, esophagus, stomach, lung, bladder, melanoma, lymphoma, and leukemia; women were more affected by cancer of the colon and rectum. The highest YPLL/D values were observed for cervix, breast, ovaries, leukemia, and lymphoma. The cancer types and locations with more DALYs were: lung, breast, prostate, colon and rectum, cervix, and endometrium. The burden of disease from cancer increased in Cuba from 1990-2002, mostly due to a rise in the mortality burden.

  2. Body-mass index and risk of 22 specific cancers: a population-based cohort study of 5·24 million UK adults.

    PubMed

    Bhaskaran, Krishnan; Douglas, Ian; Forbes, Harriet; dos-Santos-Silva, Isabel; Leon, David A; Smeeth, Liam

    2014-08-30

    High body-mass index (BMI) predisposes to several site-specific cancers, but a large-scale systematic and detailed characterisation of patterns of risk across all common cancers adjusted for potential confounders has not previously been undertaken. We aimed to investigate the links between BMI and the most common site-specific cancers. With primary care data from individuals in the Clinical Practice Research Datalink with BMI data, we fitted Cox models to investigate associations between BMI and 22 of the most common cancers, adjusting for potential confounders. We fitted linear then non-linear (spline) models; investigated effect modification by sex, menopausal status, smoking, and age; and calculated population effects. 5·24 million individuals were included; 166,955 developed cancers of interest. BMI was associated with 17 of 22 cancers, but effects varied substantially by site. Each 5 kg/m(2) increase in BMI was roughly linearly associated with cancers of the uterus (hazard ratio [HR] 1·62, 99% CI 1·56-1·69; p<0·0001), gallbladder (1·31, 1·12-1·52; p<0·0001), kidney (1·25, 1·17-1·33; p<0·0001), cervix (1·10, 1·03-1·17; p=0·00035), thyroid (1·09, 1·00-1·19; p=0·0088), and leukaemia (1·09, 1·05-1·13; p≤0·0001). BMI was positively associated with liver (1·19, 1·12-1·27), colon (1·10, 1·07-1·13), ovarian (1·09, 1.04-1.14), and postmenopausal breast cancers (1·05, 1·03-1·07) overall (all p<0·0001), but these effects varied by underlying BMI or individual-level characteristics. We estimated inverse associations with prostate and premenopausal breast cancer risk, both overall (prostate 0·98, 0·95-1·00; premenopausal breast cancer 0·89, 0·86-0·92) and in never-smokers (prostate 0·96, 0·93-0·99; premenopausal breast cancer 0·89, 0·85-0·94). By contrast, for lung and oral cavity cancer, we observed no association in never smokers (lung 0·99, 0·93-1·05; oral cavity 1·07, 0·91-1·26): inverse associations overall were driven by current smokers and ex-smokers, probably because of residual confounding by smoking amount. Assuming causality, 41% of uterine and 10% or more of gallbladder, kidney, liver, and colon cancers could be attributable to excess weight. We estimated that a 1 kg/m(2) population-wide increase in BMI would result in 3790 additional annual UK patients developing one of the ten cancers positively associated with BMI. BMI is associated with cancer risk, with substantial population-level effects. The heterogeneity in the effects suggests that different mechanisms are associated with different cancer sites and different patient subgroups. National Institute for Health Research, Wellcome Trust, and Medical Research Council. Copyright © 2014 Bhaskaran et al. Open Access article distributed under the terms of CC BY. Published by Elsevier Ltd. All rights reserved.

  3. Biomarker Detection Using NAPPA Tumor Antigen Arrays: EDRN Supplement — EDRN Public Portal

    Cancer.gov

    The overall goal of this project application for the EDRN set-aside funds is to focus our collaborative efforts to identify p53 mutation-specific antibody biomarkers in breast, prostate, and ovarian cancer. P53-specific gene mutations are frequent in multiple cancer types. Of the common solid tumors, p53 mutations have been identified in 50% of lung and ovarian cancers, 45% of colon cancers, 20% of breast cancers, and 10-30% of prostate cancers (The p53 Mutation Handbook, T. Soussi, http://p53/free/fr). The most common mutations vary from cancer to cancer, with 50 point mutations covering the 10 most common mutations for all major solid tumors

  4. Circulating testosterone and prostate-specific antigen in nipple aspirate fluid and tissue are associated with breast cancer.

    PubMed Central

    Sauter, Edward R; Tichansky, David S; Chervoneva, Inna; Diamandis, Eleftherios P

    2002-01-01

    Preliminary evidence has associated testosterone and prostate-specific antigen (PSA) with breast cancer. Our objective was to determine whether a) testosterone levels in nipple aspirate fluid (NAF), serum, or breast tissue are associated with breast cancer; b) testosterone levels in serum are associated with levels in NAF; c) PSA in NAF, serum, or breast tissue is associated with breast cancer; and d) serum PSA is associated with NAF PSA levels. We obtained 342 NAF specimens from 171 women by means of a modified breast pump. Additionally, we collected 201 blood samples from 99 women and 51 tissue samples from 41 subjects who underwent surgical resection for suspected disease. Women currently using birth control pills or hormone replacement therapy were excluded from the study. Controlling for age and menopausal status, serum testosterone was significantly increased in women with breast cancer (p = 0.002). NAF and serum testosterone levels were not associated. Neither NAF nor tissue testosterone was associated with breast cancer. Controlling for menopausal status and age, NAF PSA was significantly decreased in women with breast cancer (p < 0.001). We did not find serum PSA to be associated with breast cancer, although we found an indication that, in postmenopausal women, its levels were lower in women with cancer. Serum PSA was associated with NAF PSA in postmenopausal women (p < 0.001). PSA levels in cancerous tissue were significantly lower than in benign breast specimens from subjects without cancer (p = 0.011), whereas levels of PSA in histologically benign specimens from subjects with cancer were intermediate. Our results suggest that serum testosterone is increased and NAF PSA is decreased in women with breast cancer, with PSA expression being higher in normal than in cancerous breast tissues. NAF and serum PSA levels in postmenopausal women are correlated, suggesting that as laboratory assessment of PSA becomes more sensitive, serum PSA may become useful in identifying women with breast cancer. PMID:11882474

  5. The effect of chronic lymphocytic thyroiditis on patients with thyroid cancer.

    PubMed

    Zhang, Yi; Ma, Xiao-Peng; Deng, Fu-Sheng; Liu, Zheng-Rong; Wei, Hou-Qing; Wang, Xi-Hong; Chen, Hao

    2014-09-01

    The purpose of this study was to investigate the association between chronic lymphocytic thyroiditis (CLT) and malignant tumors of the thyroid. A retrospective review of 647 patients who underwent thyroid surgery at the Department of Breast and Thyroid Surgery in Anhui Provincial Hospital, China in 2012 was performed. The clinicopathological characteristics of patients with thyroid malignancies and CLT were collected. CLT was diagnosed by histopathological method. Among 647 patients, 144 patients had thyroid malignancies and 108 patients had been diagnosed with CLT. Moreover, in total, 44 patients had thyroid malignancies coexistent with CLT: forty-one (93.2%) patients had been diagnosed with the papillary thyroid cancer (PTC); two (4.5%) patients suffered from medullary carcinoma; and one (2.3%) patient suffered from lymphoma. The morbidity of thyroid malignancies in patients with CLT was significantly higher than that in patients without CLT (40.7% versus 18.6%; P <0.001). A female preponderance was observed in the patients with CLT compared with those without CLT (P <0.001). There was no statistically significant difference in the tumor size (P = 0.073), multifocality (P = 0.0871), neck lymph node metastasis (P = 0.350), age (P = 0.316), microcarcinoma (P = 0.983) and tumor-node-metastasis (TNM) stage (P = 0.949) between the patients of thyroid malignancies with CLT and without CLT. Female predominance was observed in patients with CLT. CLT may have no effect on the progression of thyroid malignant tumor. Nevertheless, the influences of CLT on the prognosis of the thyroid carcinoma still need to be investigated with a larger sample size.

  6. Microvascular Channel Device to Study Aggressiveness in Prostate Cancer Metastasis

    DTIC Science & Technology

    2012-06-01

    metastatic inefficiency. Breast Cancer Res 2000 2:400-407 8. Aigner S, Ramos CL, Hafezi- Moghadam A, Lawrence MB, Friederichs J, Altevogt P, Ley K...CD24 mediates rolling of breast carcinoma cells on P-selectin. 1998 FASEB J 12:1241-1251 9. Friederichs J, Zeller Y, Hafezi- Moghadam A, Grone HJ, Ley

  7. Breast Cancer Center Support Grant

    DTIC Science & Technology

    1999-09-01

    indicator for the disease. Am J Epidemiol 1980 ; 111:301-8. (42) Dupont WD, Page DL. Breast cancer risk associated with proliferative disease, age...1993;187:75-9. (52) Burhenne HJ, Burhenne LW, Goldberg F, Hislop TG, Worth AJ, Rebbeck PM, et al. Interval breast cancers in the Screening Mammography...Basier, Ian M. Thompson Until the mid- 1980s , early detection for prostate cancer had only one tool—digital rectal examination (DRE). The tool is

  8. Radiation-Related New Primary Solid Cancers in the Childhood Cancer Survivor Study: Comparative Radiation Dose Response and Modification of Treatment Effects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Inskip, Peter D., E-mail: inskippeter@gmail.com; Sigurdson, Alice J.; Veiga, Lene

    Objectives: The majority of childhood cancer patients now achieve long-term survival, but the treatments that cured their malignancy often put them at risk of adverse health outcomes years later. New cancers are among the most serious of these late effects. The aims of this review are to compare and contrast radiation dose–response relationships for new solid cancers in a large cohort of childhood cancer survivors and to discuss interactions among treatment and host factors. Methods: This review is based on previously published site-specific analyses for subsequent primary cancers of the brain, breast, thyroid gland, bone and soft tissue, salivary glands,more » and skin among 12,268 5-year childhood cancer survivors in the Childhood Cancer Survivor Study. Analyses included tumor site–specific, individual radiation dose reconstruction based on radiation therapy records. Radiation-related second cancer risks were estimated using conditional logistic or Poisson regression models for excess relative risk (ERR). Results: Linear dose–response relationships over a wide range of radiation dose (0-50 Gy) were seen for all cancer sites except the thyroid gland. The steepest slopes occurred for sarcoma, meningioma, and nonmelanoma skin cancer (ERR/Gy > 1.00), with glioma and cancers of the breast and salivary glands forming a second group (ERR/Gy = 0.27-0.36). The relative risk for thyroid cancer increased up to 15-20 Gy and then decreased with increasing dose. The risk of thyroid cancer also was positively associated with chemotherapy, but the chemotherapy effect was not seen among those who also received very high doses of radiation to the thyroid. The excess risk of radiation-related breast cancer was sharply reduced among women who received 5 Gy or more to the ovaries. Conclusions: The results suggest that the effect of high-dose irradiation is consistent with a linear dose–response for most organs, but they also reveal important organ-specific and host-specific differences in susceptibility and interactions between different aspects of treatment.« less

  9. Aided diagnosis methods of breast cancer based on machine learning

    NASA Astrophysics Data System (ADS)

    Zhao, Yue; Wang, Nian; Cui, Xiaoyu

    2017-08-01

    In the field of medicine, quickly and accurately determining whether the patient is malignant or benign is the key to treatment. In this paper, K-Nearest Neighbor, Linear Discriminant Analysis, Logistic Regression were applied to predict the classification of thyroid,Her-2,PR,ER,Ki67,metastasis and lymph nodes in breast cancer, in order to recognize the benign and malignant breast tumors and achieve the purpose of aided diagnosis of breast cancer. The results showed that the highest classification accuracy of LDA was 88.56%, while the classification effect of KNN and Logistic Regression were better than that of LDA, the best accuracy reached 96.30%.

  10. Long working hours and cancer risk: a multi-cohort study.

    PubMed

    Heikkila, Katriina; Nyberg, Solja T; Madsen, Ida E H; de Vroome, Ernest; Alfredsson, Lars; Bjorner, Jacob J; Borritz, Marianne; Burr, Hermann; Erbel, Raimund; Ferrie, Jane E; Fransson, Eleonor I; Geuskens, Goedele A; Hooftman, Wendela E; Houtman, Irene L; Jöckel, Karl-Heinz; Knutsson, Anders; Koskenvuo, Markku; Lunau, Thorsten; Nielsen, Martin L; Nordin, Maria; Oksanen, Tuula; Pejtersen, Jan H; Pentti, Jaana; Shipley, Martin J; Steptoe, Andrew; Suominen, Sakari B; Theorell, Töres; Vahtera, Jussi; Westerholm, Peter J M; Westerlund, Hugo; Dragano, Nico; Rugulies, Reiner; Kawachi, Ichiro; Batty, G David; Singh-Manoux, Archana; Virtanen, Marianna; Kivimäki, Mika

    2016-03-29

    Working longer than the maximum recommended hours is associated with an increased risk of cardiovascular disease, but the relationship of excess working hours with incident cancer is unclear. This multi-cohort study examined the association between working hours and cancer risk in 116 462 men and women who were free of cancer at baseline. Incident cancers were ascertained from national cancer, hospitalisation and death registers; weekly working hours were self-reported. During median follow-up of 10.8 years, 4371 participants developed cancer (n colorectal cancer: 393; n lung cancer: 247; n breast cancer: 833; and n prostate cancer: 534). We found no clear evidence for an association between working hours and the overall cancer risk. Working hours were also unrelated the risk of incident colorectal, lung or prostate cancers. Working ⩾55 h per week was associated with 1.60-fold (95% confidence interval 1.12-2.29) increase in female breast cancer risk independently of age, socioeconomic position, shift- and night-time work and lifestyle factors, but this observation may have been influenced by residual confounding from parity. Our findings suggest that working long hours is unrelated to the overall cancer risk or the risk of lung, colorectal or prostate cancers. The observed association with breast cancer would warrant further research.

  11. Skeletal-related events among breast and prostate cancer patients: towards new treatment initiation in Malaysia's hospital setting.

    PubMed

    Ezat, Sharifa Wan Puteh; Syed Junid, Syed Mohamed Aljunid; Noraziani, Khamis; Zafar, Ahmed; Saperi, Sulong; Nur, Amrizal Muhammad; Aizuddin, Azimatun Noor; Ismail, Fuad; Abdullah, Norlia; Zainuddin, Zulkifli Md; Mohd Kassim, Abdul Yazid; Haflah, Nor Hazla Mohamed

    2013-01-01

    The human skeleton is the most common organ to be affected by metastatic cancer and bone metastases are a major cause of cancer morbidity. The five most frequent cancers in Malaysia among males includes prostate whereas breast cancer is among those in females, both being associated with skeletal lesions. Bone metastases weaken bone structure, causing a range of symptoms and complications thus developing skeletal-related events (SRE). Patients with SRE may require palliative radiotherapy or surgery to bone for pain, having hypercalcaemia, pathologic fractures, and spinal cord compression. These complications contribute to a decline in patient health- related quality of life. The multidimensional assessment of health-related quality of life for those patients is important other than considering a beneficial treatment impact on patient survival, since the side effects of treatment and disease symptoms can significantly impact health-related quality of life. Cancer treatment could contribute to significant financial implications for the healthcare system. Therefore, it is essential to assess the health-related quality of life and treatment cost, among prostate and breast cancer patients in countries like Malaysia to rationalized cost-effective way for budget allocation or utilization of health care resources, hence helping in providing more personalized treatment for cancer patients.

  12. Icosapent Ethyl

    MedlinePlus

    ... doctor if you have or have ever had diabetes or liver, thyroid, or pancreatic disease.tell your doctor if you are pregnant, plan to become pregnant, or are breast-feeding. If you become pregnant while taking icosapent ethyl, ...

  13. Anticarcinogenic activity of polyphenolic extracts from grape stems against breast, colon, renal and thyroid cancer cells.

    PubMed

    Sahpazidou, Despina; Geromichalos, George D; Stagos, Dimitrios; Apostolou, Anna; Haroutounian, Serkos A; Tsatsakis, Aristidis M; Tzanakakis, George N; Hayes, A Wallace; Kouretas, Dimitrios

    2014-10-15

    A major part of the wineries' wastes is composed of grape stems which are discarded mainly in open fields and cause environmental problems due mainly to their high polyphenolic content. The grape stem extracts' use as a source of high added value polyphenols presents great interest because this combines a profitable venture with environmental protection close to wine-producing zones. In the present study, at first, the Total Polyphenolic Content (TPC) and the polyphenolic composition of grape stem extracts from four different Greek Vitis vinifera varieties were determined by HPLC methods. Afterwards, the grape stem extracts were examined for their ability to inhibit growth of colon (HT29), breast (MCF-7 and MDA-MB-23), renal (786-0 and Caki-1) and thyroid (K1) cancer cells. The cancer cells were exposed to the extracts for 72 h and the effects on cell growth were evaluated using the SRB assay. The results indicated that all extracts inhibited cell proliferation, with IC₅₀ values of 121-230 μg/ml (MCF-7), 121-184 μg/ml (MDA-MD-23), 175-309 μg/ml (HT29), 159-314 μg/ml (K1), 180-225 μg/ml (786-0) and 134->400 μg/ml (Caki-1). This is the first study presenting the inhibitory activity of grape stem extracts against growth of colon, breast, renal and thyroid cancer cells. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  14. Mortality among 24,865 workers exposed to polychlorinated biphenyls (PCBs) in three electrical capacitor manufacturing plants: a ten-year update.

    PubMed

    Ruder, Avima M; Hein, Misty J; Hopf, Nancy B; Waters, Martha A

    2014-03-01

    The objective of this analysis was to evaluate mortality among a cohort of 24,865 capacitor-manufacturing workers exposed to polychlorinated biphenyls (PCBs) at plants in Indiana, Massachusetts, and New York and followed for mortality through 2008. Cumulative PCB exposure was estimated using plant-specific job-exposure matrices. External comparisons to US and state-specific populations used standardized mortality ratios, adjusted for gender, race, age and calendar year. Among long-term workers employed 3 months or longer, within-cohort comparisons used standardized rate ratios and multivariable Poisson regression modeling. Through 2008, more than one million person-years at risk and 8749 deaths were accrued. Among long-term employees, all-cause and all-cancer mortality were not elevated; of the a priori outcomes assessed only melanoma mortality was elevated. Mortality was elevated for some outcomes of a priori interest among subgroups of long-term workers: all cancer, intestinal cancer and amyotrophic lateral sclerosis (women); melanoma (men); melanoma and brain and nervous system cancer (Indiana plant); and melanoma and multiple myeloma (New York plant). Standardized rates of stomach and uterine cancer and multiple myeloma mortality increased with estimated cumulative PCB exposure. Poisson regression modeling showed significant associations with estimated cumulative PCB exposure for prostate and stomach cancer mortality. For other outcomes of a priori interest--rectal, liver, ovarian, breast, and thyroid cancer, non-Hodgkin lymphoma, Alzheimer disease, and Parkinson disease--neither elevated mortality nor positive associations with PCB exposure were observed. Associations between estimated cumulative PCB exposure and stomach, uterine, and prostate cancer and myeloma mortality confirmed our previous positive findings. Published by Elsevier GmbH.

  15. Mortality among 24,865 workers exposed to polychlorinated biphenyls (PCBs) in three electrical capacitor manufacturing plants: A ten-year update

    PubMed Central

    Ruder, Avima M.; Hein, Misty J.; Hopf, Nancy B.; Waters, Martha A.

    2015-01-01

    The objective of this analysis was to evaluate mortality among a cohort of 24,865 capacitor-manufacturing workers exposed to polychlorinated biphenyls (PCBs) at plants in Indiana, Massachusetts, and New York and followed for mortality through 2008. Cumulative PCB exposure was estimated using plant-specific job-exposure matrices. External comparisons to US and state-specific populations used standardized mortality ratios, adjusted for gender, race, age and calendar year. Among long-term workers employed 3 months or longer, within-cohort comparisons used standardized rate ratios and multivariable Poisson regression modeling. Through 2008, more than one million person-years at risk and 8749 deaths were accrued. Among long-term employees, all-cause and all-cancer mortality were not elevated; of the a priori outcomes assessed only melanoma mortality was elevated. Mortality was elevated for some outcomes of a priori interest among subgroups of long-term workers: all cancer, intestinal cancer and amyotrophic lateral sclerosis (women); melanoma (men); melanoma and brain and nervous system cancer (Indiana plant); and melanoma and multiple myeloma (New York plant). Standardized rates of stomach and uterine cancer and multiple myeloma mortality increased with estimated cumulative PCB exposure. Poisson regression modeling showed significant associations with estimated cumulative PCB exposure for prostate and stomach cancer mortality. For other outcomes of a priori interest – rectal, liver, ovarian, breast, and thyroid cancer, non-Hodgkin lymphoma, Alzheimer disease, and Parkinson disease – neither elevated mortality nor positive associations with PCB exposure were observed. Associations between estimated cumulative PCB exposure and stomach, uterine, and prostate cancer and myeloma mortality confirmed our previous positive findings. PMID:23707056

  16. Patterns of care in palliative radiotherapy: a population-based study.

    PubMed

    Murphy, James D; Nelson, Lorene M; Chang, Daniel T; Mell, Loren K; Le, Quynh-Thu

    2013-09-01

    Approximately one half of the radiotherapy (RT) prescribed in the United States is delivered with palliative intent. The purpose of this study was to investigate the patterns of delivery of palliative RT across the United States. Using the Surveillance, Epidemiology, and End Results-Medicare linked database, 51,610 patients were identified with incident stage IV breast, prostate, lung, or colorectal cancer diagnosed between 2000 and 2007 and observed through 2009. Multivariate logistic regression determined predictors of palliative RT. Forty-one percent of the study population received palliative RT, including 53% of patients with lung cancer, followed by those with breast (42%), prostate (40%), and colorectal cancers (12%). Multivariate analysis revealed that older patients (P<.001) and those with higher Charlson comorbidity scores (P<.001) were less likely to receive palliative RT. Black patients with prostate cancer were 20% less likely (P<.001), and black patients with colorectal cancer were 28% less likely (P<.001), than white patients to receive palliative RT. Among those treated with RT, 23% of patients with lung cancer died within 2 weeks of completing treatment, followed by those with colorectal (12%), breast (11%), and prostate cancers (8%). In addition to tumor site, significant predictors (P<.05) of death within 2 weeks of receiving RT included increased age, increased comorbidity, and male sex. Inequality in the receipt of palliative RT exists among the elderly and patients with comorbid conditions and varies with race. In addition, a significant number of patients die shortly after receiving RT. Understanding these patterns of care, along with further research into the underlying causes, will improve access and quality of palliative RT.

  17. Cost-effectiveness of denosumab versus zoledronic acid for preventing skeletal-related events in the Czech Republic.

    PubMed

    Cristino, Joaquim; Finek, Jíndřich; Jandova, Petra; Kolek, Martin; Pásztor, Bálint; Giannopoulou, Christina; Qian, Yi; Brezina, Tomas; Lothgren, Mickael

    2017-08-01

    This study assessed the cost-effectiveness of the subcutaneous RANKL inhibitor, denosumab, vs the intravenous bisphosphonate, zoledronic acid, for the prevention of skeletal-related events (SREs) in patients with prostate cancer, breast cancer, and other solid tumors (OST) in the Czech Republic. A lifetime Markov model was developed to compare the effects of denosumab and zoledronic acid on costs (including drug costs and administration, patient management, SREs, and adverse events), quality-adjusted life-years (QALYs), and incremental cost-effectiveness ratios from a national payer perspective. Different discount rates, time horizons, SRE rates, distributions, and nature (asymptomatic vs all SREs), and the inclusion of treatment discontinuation were considered in scenario analyses. The robustness of the model was tested using deterministic and probabilistic sensitivity analyses. Across tumor types, denosumab was associated with fewer SREs, improved QALYs, and higher total costs over a lifetime. The incremental cost per QALY gained for denosumab vs zoledronic acid was 382,673 CZK for prostate cancer, 408,450 CZK for breast cancer, and 608,133 CZK for OST. Incremental costs per SRE avoided for the same tumor type were 54,007 CZK, 51,765 CZK, and 94,426 CZK, respectively. In scenario analyses, the results remained similar to baseline, when different discount rates and time horizons were considered. At a non-official willingness-to-pay threshold of 1.2 million CZK, the probabilities of denosumab being cost-effective vs zoledronic acid were 0.64, 0.67, and 0.49 for prostate cancer, breast cancer, and OST, respectively. The SRE rates used were obtained from clinical trials; studies suggest rates may be higher in clinical practice. Additional evidence on real-world SRE rates could further improve the accuracy of the modeling. Compared with zoledronic acid, denosumab provides a cost-effective treatment option for the prevention of SREs in patients with prostate cancer, breast cancer, and OST in the Czech Republic.

  18. Selection of tumor antigens as targets for immune attack using immunohistochemistry: protein antigens.

    PubMed

    Zhang, S; Zhang, H S; Cordon-Cardo, C; Ragupathi, G; Livingston, P O

    1998-11-01

    The relative expression of mucin antigens MUC1, MUC2, MUC3, MUC4, MUC5AC, MUC5B, and MUC7 and glycoprotein antigens KSA, carcinoembryonic antigen, prostate-specific membrane antigen (PSMA), HER-2/neu, and human chorionic gonadotropin-beta on different cancers and normal tissues is difficult to determine from available reports. We have compared the distribution of these antigens by immunohistology on a broad range of malignant and normal tissues. MUC1 expression was most intense in cancers of breast, lung, ovarian, and endometrial origin; MUC2 was most intense in cancers of colon and prostate origin; and MUC5AC was most intense in cancers of breast and gastric origin. MUC4 was intensely expressed in 50% of cancers of colon and pancreas origin, and MUC3, MUC5B, and MUC7 were expressed in a variety of epithelial cancers, but not so intensely. KSA was intensely and uniformly expressed on all epithelial cancers; carcinoembryonic antigen was expressed in most cancers of breast, lung, colon, pancreas, and gastric origin; and PSMA was expressed only in cancers of prostate origin. Human chorionic gonadotropin-beta was expressed on the majority of sarcomas and cancers of breast, lung, and pancreas origin, although intense staining was not seen. Staining on normal tissues was restricted to one or many normal epithelial tissues ranging from MUC3, MUC4, and PSMA, which were expressed only on epithelia of pancreas, stomach, and prostate origin, respectively, to MUC1 and KSA, which were expressed on most normal epithelia. Expression was restricted to the secretory borders of these epithelia while stroma and other normal tissues were completely negative. These results plus the results of the two previous papers (S. Zhang et al, Int. J. Cancer, 73: 42-49, 1997; S. Zhang et al., Int. J. Cancer, 73: 50-56, 1997) in this series provide the basis for selection of multiple cell surface antigens as targets for antibody-mediated attack against these cancers.

  19. Substantial Family History of Prostate Cancer in Black Men Recruited for Prostate Cancer Screening

    PubMed Central

    Mastalski, Kathleen; Coups, Elliot J.; Ruth, Karen; Raysor, Susan; Giri, Veda N.

    2008-01-01

    Background Black men are at increased risk for prostate cancer (PCA), particularly with a family history (FH) of the disease. Previous reports have raised concern for suboptimal screening of Black men with a FH of PCA. We report on the extent of FH of PCA from a prospective, longitudinal PCA screening program for high-risk men. Methods Black men ages 35-69 are eligible for PCA screening through the Prostate Cancer Risk Assessment Program (PRAP) regardless of FH. Rates of self-reported FH of PCA, breast, and colon cancer at baseline were compared with an age-matched sample of Black men from the 2005 National Health Interview Survey (NHIS) using standard statistical methods. Results As of January 2007, 332 Black men with pedigree information were enrolled in PRAP and FH of PCA was compared to 838 Black men from the 2005 NHIS. Black men in PRAP reported significantly more first-degree relatives with PCA compared to Black men in the 2005 NHIS (34.3%, 95% CI 29.2-39.7 vs. 5.7%, 95% CI 3.9-7.4). Black men in PRAP also had more FH of breast cancer compared to the 2005 NHIS (11.5%, 95% CI 8.2-15.4 vs 6.3%, 95% CI 4.6-8.0). Conclusions FH of PCA appears to be a motivating factor for Black men seeking PCA screening. Targeted recruitment and education among Black families should improve PCA screening rates. Efforts to recruit Black men without a FH of PCA are also needed. Condensed Abstract Black men seeking prostate cancer screening have a substantial burden of family history of prostate cancer. Targeted education and enhancing discussion in Black families should increase prostate cancer screening and adherence. PMID:18816608

  20. Prospective association between alcohol intake and hormone-dependent cancer risk: modulation by dietary fiber intake.

    PubMed

    Chhim, Anne-Sophie; Fassier, Philippine; Latino-Martel, Paule; Druesne-Pecollo, Nathalie; Zelek, Laurent; Duverger, Lucie; Hercberg, Serge; Galan, Pilar; Deschasaux, Mélanie; Touvier, Mathilde

    2015-07-01

    Alcohol intake is associated with increased circulating concentrations of sex hormones, which in turn may increase hormone-dependent cancer risk. This association may be modulated by dietary fiber intake, which has been shown to decrease steroid hormone bioavailability (decreased blood concentration and increased sex hormone-binding globulin concentration). However, this potential modulation has not been investigated in any prospective cohort. Our objectives were to study the relation between alcohol intake and the risk of hormone-dependent cancers (breast, prostate, ovarian, endometrial, and testicular) and to investigate whether dietary fiber intake modulated these associations. This prospective observational analysis included 3771 women and 2771 men who participated in the Supplémentation en Vitamines et Minéraux Antioxydants study (1994-2007) and completed at least 6 valid 24-h dietary records during the first 2 y of follow-up. After a median follow-up of 12.1 y, 297 incident hormone-dependent cancer cases, including 158 breast and 123 prostate cancers, were diagnosed. Associations were tested via multivariate Cox proportional hazards models. Overall, alcohol intake was directly associated with the risk of hormone-dependent cancers (tertile 3 vs. tertile 1: HR: 1.36; 95% CI: 1.00, 1.84; P-trend = 0.02) and breast cancer (HR: 1.70; 95% CI: 1.11, 2.61; P-trend = 0.04) but not prostate cancer (P-trend = 0.3). In stratified analyses (by sex-specific median of dietary fiber intake), alcohol intake was directly associated with hormone-dependent cancer (tertile 3 vs. tertile 1: HR: 1.76; 95% CI: 1.10, 2.82; P-trend = 0.002), breast cancer (HR: 2.53; 95% CI: 1.30, 4.95; P-trend = 0.02), and prostate cancer (HR: 1.37; 95% CI: 0.65, 2.89; P-trend = 0.02) risk among individuals with low dietary fiber intake but not among their counterparts with higher dietary fiber intake (P-trend = 0.9, 0.8, and 0.6, respectively). The P-interaction between alcohol and dietary fiber intake was statistically significant for prostate cancer (P = 0.01) but not for overall hormone-dependent (P = 0.2) or breast (P = 0.9) cancer. In line with mechanistic hypotheses and experimental data, this prospective study suggested that dietary fiber intake might modulate the association between alcohol intake and risk of hormone-dependent cancer. This trial was registered at clinicaltrials.gov as NCT00272428. © 2015 American Society for Nutrition.

  1. Cross-sectional analyses of participation in cancer screening and use of hormone replacement therapy and medications in meat eaters and vegetarians: the EPIC-Oxford study

    PubMed Central

    Appleby, Paul N; Bradbury, Kathryn E; Key, Timothy J

    2017-01-01

    Objectives To examine differences in health-related behaviours such as screening or testing for cancer, use of hormone replacement therapy (HRT) and use of other medications in different diet groups. Design We studied 31 260 participants across four diet groups (18 155 meat eaters, 5012 fish eaters, 7179 vegetarians, 914 vegans) in the UK EPIC-Oxford cohort. Information was collected in 5-year (around 2000–2003) or 10-year (around 2007) follow-up questionnaires regarding participation in breast screening, cervical screening, prostate-specific antigen (PSA) testing, use of HRT and use of medications for the past 4 weeks. Using Poisson regression, we estimated the prevalence ratios (PR) for each behaviour across people of different diet groups, using meat eaters as the reference group. Results Compared with meat eaters, vegetarian (PR: 0.94, 95% CI 0.89 to 0.98) and vegan (PR: 0.82, 95% CI 0.71 to 0.95) women reported lower participation in breast screening, and vegetarian men were less likely to report PSA testing (PR: 0.82, 95% CI 0.71 to 0.96). No differences were observed among women for cervical screening. In women, all non-meat-eating groups reported lower use of HRT compared with meat eaters (P heterogeneity <0.0001). Lower reported use of any medication was observed for participants in all non-meat-eating groups with no (P<0.0001) or one (P=0.0002) self-reported illness. No heterogeneity was observed across the diet groups for the reported use of specific medication for high blood pressure, high blood cholesterol, asthma, diabetes and thyroid disease. Conclusions Differences in self-reported breast screening, PSA testing, HRT use and overall medication use were observed across the diet groups. Whether such differences contribute to differential long-term disease risks requires further study. PMID:29284719

  2. Prostate derived Ets transcription factor and Carcinoembryonic antigen related cell adhesion molecule 6 constitute a highly active oncogenic axis in breast cancer

    PubMed Central

    Mukhopadhyay, Alka; Khoury, Thaer; Stein, Leighton; Shrikant, Protul; Sood, Ashwani K

    2013-01-01

    We previously reported overexpression of Prostate derived Ets transcriptionfactor (PDEF) in breast cancer and its role in breast cancer progression, supportingPDEF as an attractive target in this cancer. The goal of this research was to identifyspecific PDEF induced molecules that, like PDEF, show overexpression in breast tumorsand a role in breast tumor progression. PDEF expression was down regulated byshRNA in MCF-7 human breast tumor cell line, and probes from PDEF down-regulatedand control MCF-7 cells were used to screen the HG-U133A human gene chips. Theseanalyses identified 1318 genes that were induced two-fold or higher by PDEF in MCF-7 cells. Further analysis of three of these genes, namely CEACAM6, S100A7 and B7-H4, in relation to PDEF in primary breast tumors showed that in 82% of ER+, 67%of Her2 overexpressing and 24% of triple-negative breast tumors both PDEF andCEACAM6 expression was elevated 10-fold or higher in comparison to normal breasttissue. Overall, 72% (94 of 131) of the primary breast tumors showed 10-fold orhigher expression of both PDEF and CEACAM6. In contrast, S100A7 and B7-H4 failedto show concordant elevated expression with PDEF in primary tumors. To determinethe significance of elevated PDEF and CEACAM6 expression to tumor phenotype, theirexpression was down regulated by specific siRNAs in human breast tumor cell lines. This resulted in the loss of viability of tumor cells in vitro, supporting an oncogenicrole for both PDEF and CEACAM6 in breast cancer. Together, these findings show thatPDEF-CEACAM6 is a highly active oncogenic axis in breast cancer and suggest thattargeting of these molecules should provide novel treatments for most breast cancerpatients. PMID:23592399

  3. Iodine supplementation during pregnancy and lactation. Position statement of the working group on disorders related to iodine deficiency and thyroid dysfunction of the Spanish Society of Endocrinology and Nutrition.

    PubMed

    Donnay, Sergio; Arena, Jose; Lucas, Anna; Velasco, Inés; Ares, Susana

    2014-01-01

    Severe and mild iodine deficiency during pregnancy and lactation affects thyroid function of the mother and neonate as well as the infant's neuropsychological development. Studies performed in Spain confirm that most women are iodine deficient during pregnancy and lactation. Pregnant and breast feeding women and women planning to become pregnant should take iodine supplements. Copyright © 2013 SEEN. Published by Elsevier Espana. All rights reserved.

  4. Risk factors for the development of uterine cancer in breast cancer survivors: an army of women study.

    PubMed

    Torres, Diogo; Myers, John A; Eshraghi, Leah W; Riley, Elizabeth C; Soliman, Pamela T; Milam, Michael R

    2015-01-01

    Our study compares breast cancer survivors without a secondary diagnosis of uterine cancer (BC) to breast cancer survivors with a diagnosis of uterine cancer (BUC) to determine clinical characteristics that increase the odds of developing uterine cancer. A total of 7,228 breast cancer survivors were surveyed. A case-control study was performed with 173 BUC patients matched by age and race in a 1:5 ratio to 865 BC patients. Multivariable logistic regression examined which factors influence the odds of developing uterine cancer. A total of 5,980 (82.3 %) women did not have a previous hysterectomy at the time of breast cancer diagnosis, of which 173 (2.9 %) subsequently developed uterine cancer. There was no significant difference in body mass index (BMI) (34.4 vs. 34.1, p = 0.388) or age (52.3 vs. 52.3 years, p = 0.999) between the two groups. Increased odds for developing uterine cancer were found in patients with a personal history of hypertension [odds ratio (OR) = 1.62, 95 % confidence interval (CI) 1.45-2.70, p < 0.001], gallbladder disease (OR = 1.30, 95 % CI 1.14-1.55, p = 0.005), and thyroid disease (OR = 1.55, 95 % CI 1.37-1.69, p < 0.001). More than 80 % of women in both groups expressed a desire for a blood test to estimate the risk of uterine cancer (80.4 % BUC vs. 91.2 % BC, p < 0.001). Hypertension, gallbladder disease, and thyroid disease in breast cancer survivors increase the odds of developing uterine cancer. Breast cancer survivors also express significant interest in potential serum tests to assess the risk of developing uterine cancer.

  5. The Oncogenic Role of WWP1 E3 Ubiquitin Ligase in Prostate Cancer Development

    DTIC Science & Technology

    2011-05-01

    receptors are overexpressed and predict a low risk in human breast cancer. Cancer Res 1993;53:3736–40. 26. Koda M, Sulkowski S, Garofalo C, Kanczuga... Koda L, Sulkowska M, Surmacz E. Expression of the insulin-like growth factor-I recep- tor in primary breast cancer and lymph node metastases

  6. Targeting Alpha5 Beta1 Integrin to Prevent Metastatic Breast Cancer Cell Invasion: PhScN Target Site Definition and Plasma Stability

    DTIC Science & Technology

    2014-09-01

    Staszewski, et al., The PHSCN dendrimer as a more potent inhibitor of human breast cancer cell invasion, extravasation, and lung colony formation...the PHSCN dendrimer as an inhibitor of human prostate cancer cell invasion, extravasation, and lung colony formation. Clin Exp Metastasis, 2010. 27(3

  7. Angiostatic Therapy: A New Treatment Modality for Prostate Cancer

    DTIC Science & Technology

    2000-01-01

    ppendices .................................................................................................. 12 4 Per Borgstrbm INTRODUCTION The...human testing. It has low acute and chronic cvtological and thermographic examination of breast cancer toxicity and shows no clinically adverse reactions...reactions occurred during the 8, 1991. first 24 h or within 7 days. Acute toxicity assessments at 100 8 Hayes DF: Tumor markers for breast cancer. Ann

  8. Id-1 and Id-2 genes and products as therapeutic targets for treatment of breast cancer and other types of carcinoma

    DOEpatents

    Desprez, Pierre-Yves; Campisi, Judith

    2014-09-30

    A method for treatment and amelioration of breast, cervical, ovarian, endometrial, squamous cells, prostate cancer and melanoma in a patient comprising targeting Id-1 or Id-2 gene expression with a delivery vehicle comprising a product which modulates Id-1 or Id-2 expression.

  9. Endoscopic thyroidectomy with the da Vinci robot system using the bilateral axillary breast approach (BABA) technique: our initial experience.

    PubMed

    Lee, Kyu Eun; Rao, Jaideepraj; Youn, Yeo-Kyu

    2009-06-01

    Robotic surgery is useful in areas with difficult access like the pelvis. The ideal indications for robotic surgery are still to be established. The neck area, especially the thyroid gland poses a difficult challenge for many endoscopic surgeons. Robotic surgery is useful in this area due to its excellent magnification and endowrist function. We present our initial experience with robotic endoscopic thyroidectomy using the bilateral axillary breast approach (BABA). Between March and May 2008, 15 patients diagnosed with papillary thyroid cancer underwent robotic-assisted endoscopic thyroidectomy using the BABA technique. The mean operating time was 218 minutes. There was a steady decrease in operative time from the initial case to the 15th case. The blood loss was minimal. The recurrent laryngeal nerve and parathyroid glands were identified in great detail with ease and preserved in all cases. There were no postoperative complications in any case. Robotic endoscopic thyroidectomy using the BABA technique is a feasible procedure and can be performed safely. It provides an excellent operative field view enabling easy identification of vital structures. It also gives the desired cosmetic results and minimal postoperative pain similar to conventional endoscopic thyroid surgery using the BABA technique.

  10. Contralateral breast metastasis from pulmonary adenocarcinoma: two cases report and literature review

    PubMed Central

    Ji, Fang-Fang; Gao, Peng; Wang, Ji-Gang; Zhao, Jie

    2012-01-01

    Carcinoma metastatic to breast from extra-mammary malignancy is rare and only accounts for 0.4-1.3% of all breast cancer. Two rare cases of single breast metastasis from pulmonary adenocarcinoma were reported here with a brief review of the pertinent literature. The only complaint of the these two female patients was painless breast mass found recently. Most breast metastasis previously reported are present in the upper outer quadrant, however, in our study, one case was found to be located in the lower inner quadrant and the other in the upper inner quadrant. Tumor cells from breast biopsy were immune-positive for thyroid transcription factor-1. The two patients survived 5 and 8 months, respectively, following the diagnosis of both the primary lung tumor and the breast metastasis. Breast metastasis from lung adenocarcinoma is rare but does exist. The awareness of this possibility may help to differentiate the tumor from primary breast carcinoma. Clinical history and immunohistochemical studies are essential to reach the final diagnosis. PMID:22934141

  11. The Association of Digit Ratio (2D : 4D) with Cancer: A Systematic Review and Meta-Analysis.

    PubMed

    Bunevicius, Adomas

    2018-01-01

    Intrauterine sex hormone environment as indicated by the second to the fourth digit ratio (2D : 4D) can be associated with cancer risk. This systematic review and meta-analysis aimed to evaluate the association of 2D : 4D with cancer diagnosis, malignancy, and age at presentation. Studies that evaluated the association of 2D : 4D with cancer risk were collected from Pubmed/MEDLINE and Clarivate Analytics databases. Nineteen studies were included in the qualitative analysis. The 2D : 4D ratio was studied in prostate cancer, breast cancer, testicular cancer, gastric cancer, oral cancer, brain tumors, and cervical intraepithelial neoplasia. Low 2D : 4D was associated with prostate cancer, gastric cancer, and brain tumors, while high 2D : 4D, with breast cancer risk and cervical dysplasia. The 2D : 4D ratio was not associated with prostate, breast, and gastric cancer stage. Greater 2D : 4D ratio was associated with younger presentation of breast cancer and brain tumors. The meta-analyses demonstrated that testicular cancer was not associated with right-hand 2D : 4D ratio ( p = 0.74) and gastric cancer was not associated with right-hand ( p = 0.15) and left-hand ( p = 0.95) 2D : 4D ratio. Sex hormone environment during early development is associated with cancer risk later in life. Further studies exploring the link between intrauterine hormone environment and cancer risk are encouraged.

  12. Patient navigation improves cancer diagnostic resolution: an individually randomized clinical trial in an underserved population.

    PubMed

    Raich, Peter C; Whitley, Elizabeth M; Thorland, William; Valverde, Patricia; Fairclough, Diane

    2012-10-01

    Barriers to timely resolution of abnormal cancer screening tests add to cancer health disparities among low-income, uninsured, and minority populations. We conducted a randomized trial to evaluate the impact of lay patient navigators on time to resolution and completion of follow-up testing among patients with abnormal screening tests in a medically underserved patient population. Denver Health, the safety-net health care system serving Denver, is one of 10 performance sites participating in the Patient Navigation Research Program. Of 993 eligible subjects with abnormal screening tests randomized to navigation and no-navigation (control) arms and analyzed, 628 had abnormal breast screens (66 abnormal clinical breast examinations, 304 BIRADS 0, 200 BIRADS 3, 58 BIRADS 4 or 5) whereas 235 had abnormal colorectal and 130 had abnormal prostate screens. Time to resolution was significantly shorter in the navigated group (stratified log rank test, P < 0.001). Patient navigation improved diagnostic resolution for patients presenting with mammographic BIRADS 3 (P = 0.0003) and BIRADS 0 (P = 0.09), but not BIRADS 4/5 or abnormal breast examinations. Navigation shortened the time for both colorectal (P = 0.0017) and prostate screening resolution (P = 0.06). Participant demographics included 72% minority, 49% with annual household income less than $10,000, and 36% uninsured. Patient navigation positively impacts time to resolution of abnormal screening tests for breast, colorectal, and prostate cancers in a medically underserved population. By shortening the time to and increasing the proportion of patients with diagnostic resolution patient navigation could reduce disparities in stage at diagnosis and improve cancer outcomes. 2012 AACR

  13. The Effect of Area HMO Market Share on Cancer Screening

    PubMed Central

    Baker, Laurence C; Phillips, Kathryn A; Haas, Jennifer S; Liang, Su-Ying; Sonneborn, Dean

    2004-01-01

    Objective Managed care may have widespread impacts on health care delivery for all patients in the areas where they operate. We examine the relationship between area managed care activity and screening for breast, cervical, and prostate cancer among patients enrolled in more managed care plans and patients who are enrolled in less managed plans. Data and Methods Data on cancer screening from the 1996 Medical Expenditure Panel Survey (MEPS) were linked to data on health maintenance organization (HMO) and preferred provider organization (PPO) market share and HMO competition at the metropolitan statistical area (MSA) level. Logistic regression analysis was used to examine the relationship between area managed care prevalence and the use of mammography, clinical breast examination, Pap smear, and prostate cancer screening in the past two years, controlling for important covariates. Results Among all patients, increases in area-level HMO market share are associated with increases in the appropriate use of mammography, clinical breast exam, and Pap smear (OR for high relative to low managed care areas are 1.75, p<.01, for mammography, 1.58, p<.05, for clinical breast exam, and 1.71, p<.01, for Pap smear). In analyses of subgroups, the relationship is significant only for individuals who are enrolled in the nonmanaged plans; there is no relationship for individuals in more managed plans. No relationship is observed between area HMO market share and prostate cancer screening in any analysis. Neither the level of competition between area HMOs nor area PPO market share is associated with screening rates. Conclusions Area-level managed care activity can influence preventive care treatment patterns. PMID:15533185

  14. Novel Nine-Exon AR Transcripts (Exon 1/Exon 1b/Exons 2–8) in Normal and Cancerous Breast and Prostate Cells

    PubMed Central

    Hu, Dong Gui; McKinnon, Ross A.; Hulin, Julie-Ann; Mackenzie, Peter I.; Meech, Robyn

    2016-01-01

    Nearly 20 different transcripts of the human androgen receptor (AR) are reported with two currently listed as Refseq isoforms in the NCBI database. Isoform 1 encodes wild-type AR (type 1 AR) and isoform 2 encodes the variant AR45 (type 2 AR). Both variants contain eight exons: they share common exons 2–8 but differ in exon 1 with the canonical exon 1 in isoform 1 and the variant exon 1b in isoform 2. Splicing of exon 1 or exon 1b is reported to be mutually exclusive. In this study, we identified a novel exon 1b (1b/TAG) that contains an additional TAG trinucleotide upstream of exon 1b. Moreover, we identified AR transcripts in both normal and cancerous breast and prostate cells that contained either exon 1b or 1b/TAG spliced between the canonical exon 1 and exon 2, generating nine-exon AR transcripts that we have named isoforms 3a and 3b. The proteins encoded by these new AR variants could regulate androgen-responsive reporters in breast and prostate cancer cells under androgen-depleted conditions. Analysis of type 3 AR-GFP fusion proteins showed partial nuclear localization in PC3 cells under androgen-depleted conditions, supporting androgen-independent activation of the AR. Type 3 AR proteins inhibited androgen-induced growth of LNCaP cells. Microarray analysis identified a small set of type 3a AR target genes in LNCaP cells, including genes known to modulate growth and proliferation of prostate cancer (PCGEM1, PEG3, EPHA3, and EFNB2) or other types of human cancers (TOX3, ST8SIA4, and SLITRK3), and genes that are diagnostic/prognostic biomarkers of prostate cancer (GRINA3, and BCHE). PMID:28035996

  15. Effects of fertility drugs on cancers other than breast and gynecologic malignancies.

    PubMed

    Brinton, Louise A; Moghissi, Kamran S; Scoccia, Bert; Lamb, Emmet J; Trabert, Britton; Niwa, Shelley; Ruggieri, David; Westhoff, Carolyn L

    2015-10-01

    To examine the relationship of ovulation-stimulating drugs to risk of cancers other than breast and gynecologic malignancies. Retrospective cohort study, with additional follow-up since initial report. Reproductive endocrinology practices. Among a cohort of 12,193 women evaluated for infertility between 1965 and 1988, a total of 9,892 women (81.1% of the eligible population) were followed through 2010, via passive and active (questionnaire) approaches. None. Hazard ratios (HRs) and 95% confidence intervals (CIs) for various fertility treatment parameters for select cancers. During 30.0 median years of follow-up (285,332 person-years), 91 colorectal cancers, 84 lung cancers, 55 thyroid cancers, and 70 melanomas were diagnosed among study subjects. Clomiphene citrate (CC), used by 38.1% of patients, was not associated with colorectal or lung cancer risks, but was related significantly to melanoma (HR = 1.95; 95% CI: 1.18-3.22), and non-significantly to thyroid cancer risks (HR = 1.57; 95% CI: 0.89-2.75). The highest melanoma risks were seen among those with the lowest drug exposure levels, but thyroid cancer risk was greatest among the heavily exposed patients (HR = 1.96; 95% CI: 0.92-4.17 for those receiving >2,250 mg). Clomiphene citrate-associated risks for thyroid cancer were somewhat higher among nulligravid, compared with gravid, women, but did not differ according to distinct causes of infertility. Gonadotropins, used by only 9.7% of subjects, were not related to risk of any of the assessed cancers. Our results provide support for continued monitoring of both melanoma and thyroid cancer risk among patients receiving fertility drugs. Published by Elsevier Inc.

  16. Distribution of thyroid hormone and thyrotropin receptors in reproductive tissues of adult female rabbits.

    PubMed

    Rodríguez-Castelán, Julia; Anaya-Hernández, Arely; Méndez-Tepepa, Maribel; Martínez-Gómez, Margarita; Castelán, Francisco; Cuevas-Romero, Estela

    2017-02-01

    Thyroid dysfunctions are related to anovulation, miscarriages, and infertility in women and laboratory animals. Mechanisms associated with these effects are unknown, although indirect or direct actions of thyroid hormones and thyrotropin could be assumed. The present study aimed to identify the distribution of thyroid hormones (TRs) and thyrotropin (TSHR) receptors in reproductive organs of female rabbits. Ovary of virgin and pregnant rabbits, as well as the oviduct, uterus, and vagina of virgin rabbits were excised, histologically processed, and cut. Slices from these organs were used for immunohistochemical studies for TRα1-2, TRß1, and TSHR. The presence of TRs and TSHR was found in the primordial, primary, secondary, tertiary, and Graafian follicles of virgin rabbits, as well as in the corpora lutea, corpora albicans, and wall of hemorrhagic cysts of pregnant rabbits. Oviductal regions (fimbria-infundibulum, ampulla, isthmus, and utero-tubal junction), uterus (endometrium and myometrium), and vagina (abdominal, pelvic, and perineal portions) of virgin rabbits showed anti-TRs and anti-TSHR immunoreactivity. Additionally, the distal urethra, paravaginal ganglia, levator ani and iliococcygeus muscles, dorsal nerve and body of the clitoris, perigenital skin, and prostate had TRs and TSHR. The wide presence of TRs and TSHR in female reproductive organs suggests varied effects of thyroid hormones and thyrotropin in reproduction.

  17. Laboratory evaluations of erectile dysfunction: an evidence based approach.

    PubMed

    Bodie, Joshua; Lewis, Jean; Schow, Doug; Monga, Manoj

    2003-06-01

    We evaluate the prevalence of laboratory abnormalities in men presenting for initial evaluation and therapy of erectile dysfunction. The computerized charts of men receiving treatment for erectile dysfunction from 1987 to 2002 were retrospectively reviewed. We pooled laboratory data for 3,547 men with erectile dysfunction to assess the prevalence of laboratory abnormalities. Values of the common laboratory screening tests for erectile dysfunction were recorded for testosterone, prolactin, luteinizing hormone, thyroid-stimulating hormone, hemoglobin A(Ic), prostate specific antigen, hemoglobin, cholesterol and creatinine. Of those patients evaluated 18.7% had low testosterone, 4.6% had increased prolactin, 14.6% had abnormal luteinizing hormone, 4.0% had increased thyroid-stimulating hormone, 8.3% had increased prostate specific antigen, 26.5% had anemia and 11.9% tested had renal insufficiency. A high percentage of patients presenting with a primary complaint of erectile dysfunction had increased hemoglobin A(Ic) and total serum cholesterol levels (52.9% and 48.4%, respectively). An evidence based approach to standardization of laboratory evaluations for men presenting with erectile dysfunction is recommended. Laboratory screening should be directed to identify those risk factors that may benefit from lifestyle modification and pharmacological intervention.

  18. Chemotherapy in Treating Patients With Solid Tumors

    ClinicalTrials.gov

    2013-07-01

    Bladder Cancer; Breast Cancer; Colorectal Cancer; Esophageal Cancer; Head and Neck Cancer; Kidney Cancer; Lung Cancer; Ovarian Cancer; Prostate Cancer; Unspecified Adult Solid Tumor, Protocol Specific

  19. Emerging clinical importance of the cancer biomarkers kallikrein-related peptidases (KLK) in female and male reproductive organ malignancies

    PubMed Central

    Schmitt, Manfred; Magdolen, Viktor; Yang, Feng; Kiechle, Marion; Bayani, Jane; Yousef, George M.; Scorilas, Andreas; Diamandis, Eleftherios P.; Dorn, Julia

    2013-01-01

    Background Tumor tissue-associated KLKs (kallikrein-related peptidases) are clinically important biomarkers that may allow prognosis of the cancer disease and/or prediction of response/failure of cancer patients to cancer-directed drugs. Regarding the female/male reproductive tract, remarkably, all of the fifteen KLKs are expressed in the normal prostate, breast, cervix uteri, and the testis, whereas the uterus/endometrium and the ovary are expressing a limited number of KLKs only. Conclusions Most of the information regarding elevated expression of KLKs in tumor-affected organs is available for ovarian cancer; depicting them as valuable biomarkers in the cancerous phenotype. In contrast, for breast cancer, a series of KLKs was found to be downregulated. However, in breast cancer, KLK4 is elevated which is also true for ovarian and prostate cancer. In such cases, selective synthetic KLK inhibitors that aim at blocking the proteolytic activities of certain KLKs may serve as future candidate therapeutic drugs to interfere with tumor progression and metastasis. PMID:24294176

  20. Modulation of the Immune Response to Androgen Deprivation and Radiation Therapy for the Treatment of Prostate Cancer

    DTIC Science & Technology

    2014-04-01

    skin cancer model and the other in an implantable breast tumor model, depletion of CD20+ cells removed regulatory B cells, which could be...immunosuppressive (13, 14). Interestingly, a group recently studied the effect of B cell depletion using the same αCD20 antibody in a breast cancer model, a... breast cancer-specific immune responses and their correlation to prognosis. Cancer research 69, 8420-8428 (2009); published online EpubNov 1

  1. Keratin 13 expression reprograms bone and brain metastases of human prostate cancer cells.

    PubMed

    Li, Qinlong; Yin, Lijuan; Jones, Lawrence W; Chu, Gina C-Y; Wu, Jason B-Y; Huang, Jen-Ming; Li, Quanlin; You, Sungyong; Kim, Jayoung; Lu, Yi-Tsung; Mrdenovic, Stefan; Wang, Ruoxiang; Freeman, Michael R; Garraway, Isla; Lewis, Michael S; Chung, Leland W K; Zhau, Haiyen E

    2016-12-20

    Lethal progression of prostate cancer metastasis can be improved by developing animal models that recapitulate the clinical conditions. We report here that cytokeratin 13 (KRT13), an intermediate filament protein, plays a directive role in prostate cancer bone, brain, and soft tissue metastases. KRT13 expression was elevated in bone, brain, and soft tissue metastatic prostate cancer cell lines and in primary and metastatic clinical prostate, lung, and breast cancer specimens. When KRT13 expression was determined at a single cell level in primary tumor tissues of 44 prostate cancer cases, KRT13 level predicted bone metastasis and the overall survival of prostate cancer patients. Genetically enforced KRT13 expression in human prostate cancer cell lines drove metastases toward mouse bone, brain and soft tissues through a RANKL-independent mechanism, as KRT13 altered the expression of genes associated with EMT, stemness, neuroendocrine/neuromimicry, osteomimicry, development, and extracellular matrices, but not receptor activator NF-κB ligand (RANKL) signaling networks in prostate cancer cells. Our results suggest new inhibitors targeting RANKL-independent pathways should be developed for the treatment of prostate cancer bone and soft tissue metastases.

  2. BRCA2 Polymorphic Stop Codon K3326X and the Risk of Breast, Prostate, and Ovarian Cancers.

    PubMed

    Meeks, Huong D; Song, Honglin; Michailidou, Kyriaki; Bolla, Manjeet K; Dennis, Joe; Wang, Qin; Barrowdale, Daniel; Frost, Debra; McGuffog, Lesley; Ellis, Steve; Feng, Bingjian; Buys, Saundra S; Hopper, John L; Southey, Melissa C; Tesoriero, Andrea; James, Paul A; Bruinsma, Fiona; Campbell, Ian G; Broeks, Annegien; Schmidt, Marjanka K; Hogervorst, Frans B L; Beckman, Matthias W; Fasching, Peter A; Fletcher, Olivia; Johnson, Nichola; Sawyer, Elinor J; Riboli, Elio; Banerjee, Susana; Menon, Usha; Tomlinson, Ian; Burwinkel, Barbara; Hamann, Ute; Marme, Frederik; Rudolph, Anja; Janavicius, Ramunas; Tihomirova, Laima; Tung, Nadine; Garber, Judy; Cramer, Daniel; Terry, Kathryn L; Poole, Elizabeth M; Tworoger, Shelley S; Dorfling, Cecilia M; van Rensburg, Elizabeth J; Godwin, Andrew K; Guénel, Pascal; Truong, Thérèse; Stoppa-Lyonnet, Dominique; Damiola, Francesca; Mazoyer, Sylvie; Sinilnikova, Olga M; Isaacs, Claudine; Maugard, Christine; Bojesen, Stig E; Flyger, Henrik; Gerdes, Anne-Marie; Hansen, Thomas V O; Jensen, Allen; Kjaer, Susanne K; Hogdall, Claus; Hogdall, Estrid; Pedersen, Inge Sokilde; Thomassen, Mads; Benitez, Javier; González-Neira, Anna; Osorio, Ana; Hoya, Miguel de la; Segura, Pedro Perez; Diez, Orland; Lazaro, Conxi; Brunet, Joan; Anton-Culver, Hoda; Eunjung, Lee; John, Esther M; Neuhausen, Susan L; Ding, Yuan Chun; Castillo, Danielle; Weitzel, Jeffrey N; Ganz, Patricia A; Nussbaum, Robert L; Chan, Salina B; Karlan, Beth Y; Lester, Jenny; Wu, Anna; Gayther, Simon; Ramus, Susan J; Sieh, Weiva; Whittermore, Alice S; Monteiro, Alvaro N A; Phelan, Catherine M; Terry, Mary Beth; Piedmonte, Marion; Offit, Kenneth; Robson, Mark; Levine, Douglas; Moysich, Kirsten B; Cannioto, Rikki; Olson, Sara H; Daly, Mary B; Nathanson, Katherine L; Domchek, Susan M; Lu, Karen H; Liang, Dong; Hildebrant, Michelle A T; Ness, Roberta; Modugno, Francesmary; Pearce, Leigh; Goodman, Marc T; Thompson, Pamela J; Brenner, Hermann; Butterbach, Katja; Meindl, Alfons; Hahnen, Eric; Wappenschmidt, Barbara; Brauch, Hiltrud; Brüning, Thomas; Blomqvist, Carl; Khan, Sofia; Nevanlinna, Heli; Pelttari, Liisa M; Aittomäki, Kristiina; Butzow, Ralf; Bogdanova, Natalia V; Dörk, Thilo; Lindblom, Annika; Margolin, Sara; Rantala, Johanna; Kosma, Veli-Matti; Mannermaa, Arto; Lambrechts, Diether; Neven, Patrick; Claes, Kathleen B M; Maerken, Tom Van; Chang-Claude, Jenny; Flesch-Janys, Dieter; Heitz, Florian; Varon-Mateeva, Raymonda; Peterlongo, Paolo; Radice, Paolo; Viel, Alessandra; Barile, Monica; Peissel, Bernard; Manoukian, Siranoush; Montagna, Marco; Oliani, Cristina; Peixoto, Ana; Teixeira, Manuel R; Collavoli, Anita; Hallberg, Emily; Olson, Janet E; Goode, Ellen L; Hart, Steven N; Shimelis, Hermela; Cunningham, Julie M; Giles, Graham G; Milne, Roger L; Healey, Sue; Tucker, Kathy; Haiman, Christopher A; Henderson, Brian E; Goldberg, Mark S; Tischkowitz, Marc; Simard, Jacques; Soucy, Penny; Eccles, Diana M; Le, Nhu; Borresen-Dale, Anne-Lise; Kristensen, Vessela; Salvesen, Helga B; Bjorge, Line; Bandera, Elisa V; Risch, Harvey; Zheng, Wei; Beeghly-Fadiel, Alicia; Cai, Hui; Pylkäs, Katri; Tollenaar, Robert A E M; Ouweland, Ans M W van der; Andrulis, Irene L; Knight, Julia A; Narod, Steven; Devilee, Peter; Winqvist, Robert; Figueroa, Jonine; Greene, Mark H; Mai, Phuong L; Loud, Jennifer T; García-Closas, Montserrat; Schoemaker, Minouk J; Czene, Kamila; Darabi, Hatef; McNeish, Iain; Siddiquil, Nadeem; Glasspool, Rosalind; Kwong, Ava; Park, Sue K; Teo, Soo Hwang; Yoon, Sook-Yee; Matsuo, Keitaro; Hosono, Satoyo; Woo, Yin Ling; Gao, Yu-Tang; Foretova, Lenka; Singer, Christian F; Rappaport-Feurhauser, Christine; Friedman, Eitan; Laitman, Yael; Rennert, Gad; Imyanitov, Evgeny N; Hulick, Peter J; Olopade, Olufunmilayo I; Senter, Leigha; Olah, Edith; Doherty, Jennifer A; Schildkraut, Joellen; Koppert, Linetta B; Kiemeney, Lambertus A; Massuger, Leon F A G; Cook, Linda S; Pejovic, Tanja; Li, Jingmei; Borg, Ake; Öfverholm, Anna; Rossing, Mary Anne; Wentzensen, Nicolas; Henriksson, Karin; Cox, Angela; Cross, Simon S; Pasini, Barbara J; Shah, Mitul; Kabisch, Maria; Torres, Diana; Jakubowska, Anna; Lubinski, Jan; Gronwald, Jacek; Agnarsson, Bjarni A; Kupryjanczyk, Jolanta; Moes-Sosnowska, Joanna; Fostira, Florentia; Konstantopoulou, Irene; Slager, Susan; Jones, Michael; Antoniou, Antonis C; Berchuck, Andrew; Swerdlow, Anthony; Chenevix-Trench, Georgia; Dunning, Alison M; Pharoah, Paul D P; Hall, Per; Easton, Douglas F; Couch, Fergus J; Spurdle, Amanda B; Goldgar, David E

    2016-02-01

    The K3326X variant in BRCA2 (BRCA2*c.9976A>T; p.Lys3326*; rs11571833) has been found to be associated with small increased risks of breast cancer. However, it is not clear to what extent linkage disequilibrium with fully pathogenic mutations might account for this association. There is scant information about the effect of K3326X in other hormone-related cancers. Using weighted logistic regression, we analyzed data from the large iCOGS study including 76 637 cancer case patients and 83 796 control patients to estimate odds ratios (ORw) and 95% confidence intervals (CIs) for K3326X variant carriers in relation to breast, ovarian, and prostate cancer risks, with weights defined as probability of not having a pathogenic BRCA2 variant. Using Cox proportional hazards modeling, we also examined the associations of K3326X with breast and ovarian cancer risks among 7183 BRCA1 variant carriers. All statistical tests were two-sided. The K3326X variant was associated with breast (ORw = 1.28, 95% CI = 1.17 to 1.40, P = 5.9x10(-) (6)) and invasive ovarian cancer (ORw = 1.26, 95% CI = 1.10 to 1.43, P = 3.8x10(-3)). These associations were stronger for serous ovarian cancer and for estrogen receptor-negative breast cancer (ORw = 1.46, 95% CI = 1.2 to 1.70, P = 3.4x10(-5) and ORw = 1.50, 95% CI = 1.28 to 1.76, P = 4.1x10(-5), respectively). For BRCA1 mutation carriers, there was a statistically significant inverse association of the K3326X variant with risk of ovarian cancer (HR = 0.43, 95% CI = 0.22 to 0.84, P = .013) but no association with breast cancer. No association with prostate cancer was observed. Our study provides evidence that the K3326X variant is associated with risk of developing breast and ovarian cancers independent of other pathogenic variants in BRCA2. Further studies are needed to determine the biological mechanism of action responsible for these associations. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  3. [Definition of nodal volumes in breast cancer treatment and segmentation guidelines].

    PubMed

    Kirova, Y M; Castro Pena, P; Dendale, R; Campana, F; Bollet, M A; Fournier-Bidoz, N; Fourquet, A

    2009-06-01

    To assist in the determination of breast and nodal volumes in the setting of radiotherapy for breast cancer and establish segmentation guidelines. Materials and methods. Contrast metarial enhanced CT examinations were obtained in the treatment position in 25 patients to clearly define the target volumes. The clinical target volume (CTV) including the breast, internal mammary nodes, supraclavicular and subclavicular regions and axxilary region were segmented along with the brachial plexus and interpectoral nodes. The following critical organs were also segmented: heart, lungs, contralateral breast, thyroid, esophagus and humeral head. A correlation between clinical and imaging findings and meeting between radiation oncologists and breast specialists resulted in a better definition of irradiation volumes for breast and nodes with establishement of segmentation guidelines and creation of an anatomical atlas. A practical approach, based on anatomical criteria, is proposed to assist in the segmentation of breast and node volumes in the setting of breast cancer treatment along with a definition of irradiation volumes.

  4. Amyloidosis presented with whitening and loss of hair which improved after dimethylsulfoxide (DMSO) treatment.

    PubMed

    Hsieh, S D; Yamamoto, R; Saito, K; Iwamoto, Y; Kuzuya, T; Ohba, S; Kobori, S; Saito, K

    1987-08-01

    A 67-year-old male patient presented with rapid progression of whitening and loss of hair in past 2 months was consulted due to the suspicion of hypothyroidism. He had been told to have cardiomegaly for 3 years. Thyroid function was within normal limit. Prostate biopsy was performed because of prostatic hypertrophy and mild elevation of serum acid phosphatase. Amyloid accumulation was observed in the biopsy specimen. Subsequent skin biopsies revealed the same result. The scalp hair and beard grew and turned to black gradually several months after dimethyl sulfoxide (DMSO) treatment. These findings suggest that some of the manifestation of amyloidosis may respond to DMSO treatment.

  5. Possible association between hepatitis C virus and malignancies different from hepatocellular carcinoma: A systematic review

    PubMed Central

    Fiorino, Sirio; Bacchi-Reggiani, Letizia; de Biase, Dario; Fornelli, Adele; Masetti, Michele; Tura, Andrea; Grizzi, Fabio; Zanello, Matteo; Mastrangelo, Laura; Lombardi, Raffaele; Acquaviva, Giorgia; di Tommaso, Luca; Bondi, Arrigo; Visani, Michela; Sabbatani, Sergio; Pontoriero, Laura; Fabbri, Carlo; Cuppini, Andrea; Pession, Annalisa; Jovine, Elio

    2015-01-01

    AIM: To summarize the current knowledge about the potential relationship between hepatitis C virus (HCV) infection and the risk of several extra-liver cancers. METHODS: We performed a systematic review of the literature, according to the Preferred Reporting Items for Systematic reviews and Meta-Analysis (PRISMA) Statement. We extracted the pertinent articles, published in MEDLINE and the Cochrane Library, using the following search terms: neoplasm/cancer/malignancy/tumor/carcinoma/adeno-carcinoma and non-Hodgkin lymphomas, kidney/renal-, cholangio-, pancreatic-, thyroid-, breast-,oral-, skin-, prostate-, lung-, colon-, stomach-, haematologic. Case series, case-series with control-group, case-control, cohort-studies as well as meta-analyses, written in English were collected. Some of the main characteristics of retrieved trials, which were designed to investigate the prevalence of HCV infection in each type of the above-mentioned human malignancies were summarised. A main table was defined and included a short description in the text for each of these tumours, whether at least five studies about a specific neoplasm, meeting inclusion criteria, were available in literature. According to these criteria, we created the following sections and the corresponding tables and we indicated the number of included or excluded articles, as well as of meta-analyses and reviews: (1) HCV and haematopoietic malignancies; (2) HCV and cholangiocarcinoma; (3) HCV and pancreatic cancer; (4) HCV and breast cancer; (5) HCV and kidney cancer; (6) HCV and skin or oral cancer; and (7) HCV and thyroid cancer. RESULTS: According to available data, a clear correlation between regions of HCV prevalence and risk of extra-liver cancers has emerged only for a very small group of types and histological subtypes of malignancies. In particular, HCV infection has been associated with: (1) a higher incidence of some B-cell Non-Hodgkin-Lymphoma types, in countries, where an elevated prevalence of this pathogen is detectable, accounting to a percentage of about 10%; (2) an increased risk of intra-hepatic cholangiocarcinoma; and (3) a correlation between HCV prevalence and pancreatic cancer (PAC) incidence. CONCLUSION: To date no definitive conclusions may be obtained from the analysis of relationship between HCV and extra-hepatic cancers. Further studies, recruiting an adequate number of patients are required to confirm or deny this association. PMID:26668515

  6. Insertion of an SVA-E retrotransposon into the CASP8 gene is associated with protection against prostate cancer

    PubMed Central

    Stacey, Simon N.; Kehr, Birte; Gudmundsson, Julius; Zink, Florian; Jonasdottir, Aslaug; Gudjonsson, Sigurjon A.; Sigurdsson, Asgeir; Halldorsson, Bjarni V.; Agnarsson, Bjarni A.; Benediktsdottir, Kristrun R.; Aben, Katja K.H.; Vermeulen, Sita H.; Cremers, Ruben G.; Panadero, Angeles; Helfand, Brian T.; Cooper, Phillip R.; Donovan, Jenny L.; Hamdy, Freddie C.; Jinga, Viorel; Okamoto, Ichiro; Jonasson, Jon G.; Tryggvadottir, Laufey; Johannsdottir, Hrefna; Kristinsdottir, Anna M.; Masson, Gisli; Magnusson, Olafur T.; Iordache, Paul D.; Helgason, Agnar; Helgason, Hannes; Sulem, Patrick; Gudbjartsson, Daniel F.; Kong, Augustine; Jonsson, Eirikur; Barkardottir, Rosa B.; Einarsson, Gudmundur V.; Rafnar, Thorunn; Thorsteinsdottir, Unnur; Mates, Ioan N.; Neal, David E.; Catalona, William J.; Mayordomo, José I.; Kiemeney, Lambertus A.; Thorleifsson, Gudmar; Stefansson, Kari

    2016-01-01

    Transcriptional and splicing anomalies have been observed in intron 8 of the CASP8 gene (encoding procaspase-8) in association with cutaneous basal-cell carcinoma (BCC) and linked to a germline SNP rs700635. Here, we show that the rs700635[C] allele, which is associated with increased risk of BCC and breast cancer, is protective against prostate cancer [odds ratio (OR) = 0.91, P = 1.0 × 10−6]. rs700635[C] is also associated with failures to correctly splice out CASP8 intron 8 in breast and prostate tumours and in corresponding normal tissues. Investigation of rs700635[C] carriers revealed that they have a human-specific short interspersed element-variable number of tandem repeat-Alu (SINE-VNTR-Alu), subfamily-E retrotransposon (SVA-E) inserted into CASP8 intron 8. The SVA-E shows evidence of prior activity, because it has transduced some CASP8 sequences during subsequent retrotransposition events. Whole-genome sequence (WGS) data were used to tag the SVA-E with a surrogate SNP rs1035142[T] (r2 = 0.999), which showed associations with both the splicing anomalies (P = 6.5 × 10−32) and with protection against prostate cancer (OR = 0.91, P = 3.8 × 10−7). PMID:26740556

  7. Comparable amounts of sex steroids are made outside the gonads in men and women: strong lesson for hormone therapy of prostate and breast cancer.

    PubMed

    Labrie, Fernand; Cusan, Leonello; Gomez, José Luis; Martel, Céline; Bérubé, René; Bélanger, Patrick; Bélanger, Alain; Vandenput, Liesbeth; Mellström, Dan; Ohlsson, Claes

    2009-01-01

    The objective of this study was comparison of circulating androgens and their metabolites as well as estrogens measured for the first time by a validated mass spectrometry technology in 60-80-year-old men and women of comparable age. Castration in men (n=34) reduces the total androgen pool by only about 60% as indicated by the decrease in the serum levels of the glucuronide metabolites of androgens compared to intact men (n=1302). Such data are in agreement with the 50 to 75% decrease in intraprostatic dihydrotestosterone (DHT) concentration after castration. Most interestingly, the same amounts of androgens and estrogens are found in postmenopausal women (n=369) and castrated men of comparable age. The most significant therapeutic implication of these findings is the absolute need to add a pure (nonsteroidal) antiandrogen to castration in men with prostate cancer in order to block the action of the 25 to 50% DHT left in the prostate after castration. Not adding an antiandrogen to castration in men treated for prostate cancer is equivalent to not prescribing a blocker of estrogens in women suffering from breast cancer because they are postmenopausal and have low circulating estradiol.

  8. Dietary intake and development of a quantitative food-frequency questionnaire for the Barbados National Cancer Study.

    PubMed

    Sharma, Sangita; Cao, Xia; Harris, Rachel; Hennis, Anselm J M; Leske, M Cristina; Wu, Suh-Yuh

    2007-05-01

    To develop a quantitative food-frequency questionnaire (QFFQ) for the Barbados National Cancer Study (BNCS) that will permit examination of associations of diet with breast and prostate cancer. Population intake data from the year 2000 Barbados Food Consumption and Anthropometric Surveys (BFCAS 2000) were used to derive a list of foods consumed by the population. A 192-item draft QFFQ was developed from this list. Barbados, West Indies provides an ideal environment to understand cancer risk in African-origin populations, with high relevance to African-Americans. The BNCS is a population-based case-control study examining risk factors for breast and prostate cancer in such populations. A total of 1600 persons, 18 years and older, completed a 24-hour recall in the BFCAS 2000. Fifty of 63 randomly selected residents (79% response rate) gave additional updated information on foods consumed. The 50 participants provided a one-time 24-hour recall and completed the draft QFFQ. The final instrument contains 148 items: breads, cakes, cereals = 17; rice, pastas, noodles = 8; dairy = 10; meat, fish, poultry = 42; fruit = 16; vegetables = 26; soft drinks = 14; alcoholic beverages = 5; others = 10. Additional questions include supplement use and food preparation methods such as grilling. The final instrument is concise, complete and the most up-to-date for assessing the food and nutrient intake of African-origin Barbadians and the associations with breast and prostate cancer.

  9. Sleep quality, fatigue and physical activity following a cancer diagnosis.

    PubMed

    Humpel, N; Iverson, D C

    2010-11-01

    Research on physical activity for cancer survivors suggests a relationship with improved quality of life. The aim of this study was to explore if there was also a relationship of physical activity with sleep difficulties and fatigue, common effects of cancer and its treatments. Recruitment was by posters and flyers in medical waiting rooms and by letter of invitation. Thirty-two breast and 59 prostate cancer survivors completed the questionnaire. Poor sleep quality was reported by 57.8%. A greater proportion of breast cancer (36.7%) than prostate cancer survivors (15.5%) reported poor sleep latency, and sleep disturbance (48.4% vs. 17.2%). The mean minutes of moderate physical activity was lower among participants reporting poor sleep quality [F(1,89) = 11.36, P < 0.001]. A greater proportion of breast cancer (65.7%) than prostate cancer survivors (43.1%) reported high fatigue. Participants who reported no physical activity had significantly greater fatigue (M = 31) than those reporting high physical activity levels (M = 42). While at an early stage of research, results are suggestive of a relationship of physical activity with sleep problems among cancer survivors. Findings have implications for improving quality of life as poor sleep was associated with greater fatigue and regular physical activity shows promise as an aid to alleviating these problems. © 2009 The Authors. European Journal of Cancer Care © 2009 Blackwell Publishing Ltd.

  10. Long working hours and cancer risk: a multi-cohort study

    PubMed Central

    Heikkila, Katriina; Nyberg, Solja T; Madsen, Ida E H; de Vroome, Ernest; Alfredsson, Lars; Bjorner, Jacob J; Borritz, Marianne; Burr, Hermann; Erbel, Raimund; Ferrie, Jane E; Fransson, Eleonor I; Geuskens, Goedele A; Hooftman, Wendela E; Houtman, Irene L; Jöckel, Karl-Heinz; Knutsson, Anders; Koskenvuo, Markku; Lunau, Thorsten; Nielsen, Martin L; Nordin, Maria; Oksanen, Tuula; Pejtersen, Jan H; Pentti, Jaana; Shipley, Martin J; Steptoe, Andrew; Suominen, Sakari B; Theorell, Töres; Vahtera, Jussi; Westerholm, Peter J M; Westerlund, Hugo; Dragano, Nico; Rugulies, Reiner; Kawachi, Ichiro; Batty, G David; Singh-Manoux, Archana; Virtanen, Marianna; Kivimäki, Mika

    2016-01-01

    Background: Working longer than the maximum recommended hours is associated with an increased risk of cardiovascular disease, but the relationship of excess working hours with incident cancer is unclear. Methods: This multi-cohort study examined the association between working hours and cancer risk in 116 462 men and women who were free of cancer at baseline. Incident cancers were ascertained from national cancer, hospitalisation and death registers; weekly working hours were self-reported. Results: During median follow-up of 10.8 years, 4371 participants developed cancer (n colorectal cancer: 393; n lung cancer: 247; n breast cancer: 833; and n prostate cancer: 534). We found no clear evidence for an association between working hours and the overall cancer risk. Working hours were also unrelated the risk of incident colorectal, lung or prostate cancers. Working ⩾55 h per week was associated with 1.60-fold (95% confidence interval 1.12–2.29) increase in female breast cancer risk independently of age, socioeconomic position, shift- and night-time work and lifestyle factors, but this observation may have been influenced by residual confounding from parity. Conclusions: Our findings suggest that working long hours is unrelated to the overall cancer risk or the risk of lung, colorectal or prostate cancers. The observed association with breast cancer would warrant further research. PMID:26889978

  11. Decreased Cancer Mortality-to-Incidence Ratios with Increased Accessibility of Federally Qualified Health Centers

    PubMed Central

    Adams, Swann Arp; Choi, Seul Ki; Khang, Leepao; Campbell, Dayna A.; Friedman, Daniela B.; Eberth, Jan M.; Glasgow, Russell E.; Tucker-Seeley, Reginald; Xirasagar, Sudha; Yip, Mei Po; Young, Vicki M.; Hébert, James R.

    2015-01-01

    Federally qualified health centers (FQHCs) offer primary and preventive healthcare, including cancer screening, for the nation’s most vulnerable population. The purpose of this study was to explore the relationship between access to FQHCs and cancer mortality-to-incidence ratios (MIRs). One-way analysis of variance was conducted to compare the mean MIRs for breast, cervical, prostate, and colorectal cancers for each U.S. county for 2006–2010 by access to FQHCs (direct access, in-county FQHC; indirect access, adjacent-county FQHC; no access, no FQHC either in the county or in adjacent counties). ArcMap 10.1 software was used to map cancer MIRs and FQHC access levels. The mean MIRs for breast, cervical, and prostate cancer differed significantly across FQHC access levels (p < 0.05). In urban and healthcare professional shortage areas, mean MIRs decreased as FQHC access increased. A trend of lower breast and prostate cancer MIRs in direct access to FQHCs was found for all racial groups, but this trend was significant for whites only. States with a large proportion of rural and medically underserved areas had high mean MIRs, with correspondingly more direct FQHC access. Expanding FQHCs to more underserved areas and concentrations of disparity populations may have an important role in reducing cancer morbidity and mortality, as well as racial-ethnic disparities, in the United States. PMID:25634545

  12. Gynecomastia due to hormone therapy for advanced prostate cancer: a report of ten surgically treated cases and a review of treatment options.

    PubMed

    Prezioso, Domenico; Piccirillo, Giuseppe; Galasso, Raffaele; Altieri, Vincenzo; Mirone, Vincenzo; Lotti, Tullio

    2004-01-01

    Gynecomastia is an abnormal increase in the volume of the male breast that is generally considered to be due to an increased estrogen/androgen ratio. Pathological causes of gynecomastia include organic diseases and therapy, such as the administration of estrogens and antiandrogens, which alter the ratio of circulating hormones. Hormone therapy for prostate cancer is generally well tolerated but often accompanied by the occurrence of gynecomastia and breast pain or tenderness. The increased use of antiandrogens as monotherapy is leading to an increase in the number of patients affected by gynecomastia. Treatments are available to alleviate or prevent the development of gynecomastia, including medical treatment with antiestrogens and aromatase inhibitors. Alternatively, mastectomy with excision of the gland, liposuction or an association of the two techniques have proved to be effective. Radiation therapy may provide effective relief from the breast pain associated with gynecomastia. In this paper we show the good results of mastectomy performed with a lower semicircular periareolar incision in men suffering from gynecomastia due to antiandrogen therapy for inoperable prostate cancer. In addition, we present a review of the various techniques used for the treatment of gynecomastia. During the period from September 1998 to May 2001, 10 patients receiving hormone treatment for metastatic or inoperable prostatic cancer were selected for the study if they had breast pain and bilateral gynecomastia. Five of these patients had been offered prophylactic radiotherapy before treatment but refused, while the remaining five patients had refused radiotherapy after hormone treatment. These patients were therefore given the option of surgical treatment. Before surgery all patients underwent clinical and ultrasound examination of the breast. All surgical samples were examined histopathologically. During follow-up clinical examinations were carried out one week, one month, six months, one year and two years after surgery. The results were satisfactory in all patients especially from an aesthetic point of view. Moreover, breast pain disappeared about one week after surgery. After a follow-up of 6-36 months (average, 22.8 months) no recurrences were observed. Only a few immediate postoperative complications were recorded (hematoma in one case and seroma in another). Histological examination of the excised glands showed fibrosclerotic tissue and a small amount of fat. Surgical liposuction can be considered an effective treatment for gynecomastia, in particular in the very early stages because the breast becomes irreversibly fibrous as the disease progresses. This surgical technique is simple and effective and is therefore to be considered favorable, especially because of the very short hospitalization and the absence of complications.

  13. Bethanechol

    MedlinePlus

    ... or have ever had asthma, a bladder infection, epilepsy, high blood pressure, heart disease, Parkinson's disease, an overactive thyroid gland, or ulcers.tell your doctor if you are pregnant, plan to become pregnant, or are breast-feeding. If you become pregnant while taking bethanechol, call ...

  14. Intake of meat, meat mutagens, and iron and the risk of breast cancer in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial.

    PubMed

    Ferrucci, L M; Cross, A J; Graubard, B I; Brinton, L A; McCarty, C A; Ziegler, R G; Ma, X; Mayne, S T; Sinha, R

    2009-07-07

    Epidemiological evidence on meat intake and breast cancer is inconsistent, with little research on potentially carcinogenic meat-related exposures. We investigated meat subtypes, cooking practices, meat mutagens, iron, and subsequent breast cancer risk. Among 52 158 women (aged 55-74 years) in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial, who completed a food frequency questionnaire, 1205 invasive breast cancer cases were identified. We estimated meat mutagen and haem iron intake with databases accounting for cooking practices. Using Cox proportional hazards regression, we calculated hazard ratios (HRs) and 95% confidence intervals (CIs) within quintiles of intake. Comparing the fifth to the first quintile, red meat (HR=1.23; 95% CI=1.00-1.51, P trend=0.22), the heterocyclic amine (HCA), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), (HR=1.26; 95% CI=1.03-1.55; P trend=0.12), and dietary iron (HR=1.25; 95% CI=1.02-1.52; P trend=0.03) were positively associated with breast cancer. We observed elevated, though not statistically significant, risks with processed meat, the HCA 2-amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline (DiMeIQx), mutagenic activity, iron from meat, and haem iron from meat. In this prospective study, red meat, MeIQx, and dietary iron elevated the risk of invasive breast cancer, but there was no linear trend in the association except for dietary iron.

  15. Thyroid Hormone, Cancer, and Apoptosis.

    PubMed

    Lin, Hung-Yun; Chin, Yu-Tan; Yang, Yu-Chen S H; Lai, Husan-Yu; Wang-Peng, Jacqueline; Liu, Leory F; Tang, Heng-Yuan; Davis, Paul J

    2016-06-13

    Thyroid hormones play important roles in regulating normal metabolism, development, and growth. They also stimulate cancer cell proliferation. Their metabolic and developmental effects and growth effects in normal tissues are mediated primarily by nuclear hormone receptors. A cell surface receptor for the hormone on integrin [alpha]vβ3 is the initiation site for effects on tumor cells. Clinical hypothyroidism may retard cancer growth, and hyperthyroidism was recently linked to the prevalence of certain cancers. Local levels of thyroid hormones are controlled through activation and deactivation of iodothyronine deiodinases in different organs. The relative activities of different deiodinases that exist in tissues or organs also affect the progression and development of specific types of cancers. In this review, the effects of thyroid hormone on signaling pathways in breast, brain, liver, thyroid, and colon cancers are discussed. The importance of nuclear thyroid hormone receptor isoforms and of the hormone receptor on the extracellular domain of integrin [alpha]vβ3 as potential cancer risk factors and therapeutic targets are addressed. We analyze the intracellular signaling pathways activated by thyroid hormones in cancer progression in hyperthyroidism or at physiological concentrations in the euthyroid state. Determining how to utilize the deaminated thyroid hormone analog (tetrac), and its nanoparticulate derivative to reduce risks of cancer progression, enhance therapeutic outcomes, and prevent cancer recurrence is also deliberated. © 2016 American Physiological Society. Compr Physiol 6:1221-1237, 2016. Copyright © 2016 John Wiley & Sons, Inc.

  16. Solitary thyroid metastasis from colon cancer: fine-needle aspiration cytology and molecular biology approach.

    PubMed

    Onorati, M; Uboldi, P; Bianchi, C L; Nicola, M; Corradini, G M; Veronese, S; Fascì, A I; Di Nuovo, F

    2015-01-01

    Thyroid gland is one of the most vascularized organs of the body, nevertheless clinical and surgical series report an incidence of secondary malignancies in this gland of only 3%. Colorectal carcinoma metastatic to the thyroid gland is not as uncommon as previously believed, infact the number of cases seems to be increased in recent years due to the more frequent use of fine-needle aspiration cytology (FNAC) guided by ultrasonography. Although kidney, breast and lung metastases to the thyroid are frequent, metastasis from colon cancer is clinically rare with 52 cases reported in the literature in the last 5 decades and three cases described as solitary thyroid metastasis from the colon cancer without any other visceral metastases. To the best of our knowledge, we report the fourth case of solitary, asymptomatic thyroid metastasis from colon cancer without involvement of other organs. We discuss the importance of FNAC to detect metastatazing process as a compulsory step of the diagnostic and therapeutic management algorithm, combined with a molecular biology approach. A review of the last 5 decades literature, to update the number of cases described to date, is also included.

  17. Radiation therapy - what to ask your doctor

    MedlinePlus

    ... tumor Non-Hodgkin lymphoma Prostate cancer Testicular cancer Patient Instructions Abdominal radiation - discharge Bleeding during cancer treatment Brain radiation - discharge Breast radiation - discharge Chest radiation - discharge Dry mouth during ...

  18. The impact of transcription on metabolism in prostate and breast cancers.

    PubMed

    Poulose, Ninu; Mills, Ian G; Steele, Rebecca E

    2018-05-14

    Metabolic dysregulation is regarded as an important driver in cancer development and progression. The impact of transcriptional changes on metabolism have been intensively studied in hormone-dependent cancers, and in particular in prostate and breast cancer. These cancers have strong similarities in the function of important transcriptional drivers, such as the estrogen and androgen receptor, at the level of dietary risk and epidemiology, genetics and therapeutically. In this review we will focus on the function of these nuclear hormone receptors and their downstream impact on metabolism, with a particular focus on lipid metabolism. We go on to discuss how lipid metabolism remains dysregulated as the cancers progress. We conclude by discussing the opportunities that this presents for drug repurposing, imaging and the development and testing of new therapeutics and treatment combinations.

  19. Childhood and adult cancer in twins: evidence from the Utah genealogy.

    PubMed

    Neale, Rachel E; Mineau, Geraldine; Whiteman, David C; Brownbill, Pat A; Murphy, Michael F G

    2005-05-01

    Evidence suggests that the in utero environment may contribute to subsequent development of cancers in childhood and adulthood. Raised levels of estrogen during pregnancy may be the primary in utero etiologic factor. Mothers of twins have higher estrogen levels during pregnancy than mothers of singletons, therefore, assessment of cancer risk in twins may be informative. We conducted a retrospective cohort study of cancer among twin and singleton newborns selected from the Utah Population Database, matched on birth year and sex. Cancer diagnoses were determined by linkage with the Utah state cancer register. Relative rates of all cancers in childhood and in adulthood in twins compared with singletons, and for specific cancers including testicular, breast and melanoma, were calculated using Poisson regression. Twin (35,271) and singleton (74,199) births were identified, among whom there were 336 and 691 cancer diagnoses, respectively. The relative risk (RR) of childhood cancer in twins compared with singletons was 0.82 [95% confidence interval (CI) 0.55-1.24] and of adult cancer was 1.06 (0.92-1.22). We found nonsignificant increases in risk among adult twins for cancers of the breast, prostate, testis, lymphatic system, thyroid, and large bowel. The largest departures from unity were for testicular cancer (RR 1.47; 95% CI, 0.73-2.95) and melanoma (RR 0.67; 95% CI, 0.42-1.06). These results are consistent with the body of evidence suggesting that twins have a reduced risk of cancer in childhood. Although there is no overall differential in adult cancer risk, these data support the hypothesis that the in utero environment may play an important role in specific cancers.

  20. Cancer incidence and mortality in the Bucaramanga metropolitan area, 2003-2007.

    PubMed

    Uribe, Claudia; Osma, Sonia; Herrera, Víctor

    2012-10-01

    Cancer is an important cause of morbidity and mortality worldwide. Population-based cancer registries (PBCRs) make possible to estimate the burden of this condition. To estimate cancer incidence and mortality rates in the Bucaramanga Metropolitan Area (BMA) during 2003-2007. Incident cases of invasive cancer diagnosed during 2003-2007 were identified from the Bucaramanga Metropolitan Area PBCR (BMA-PBCR). Population counts and mortality were obtained from the Colombian National Administrative Department of Statistics (NADS). We estimated total and cancer-specific crude incidence and mortality rates by age group and sex, as well as age-standardized (Segi's world population) incidence (ASIR(W)) and mortality (ASMR(W)) rates. Statistical analyses were conducted using CanReg4 and Stata/IC 10.1. We identified 8,225 new cases of cancer excluding non-melanoma skin cancer (54.3% among women). Of all cases, 6,943 (84.4%) were verified by microscopy and 669 (8.1%) were detected only by death certificate. ASIR(W) for all invasive cancers was 162.8 per 100,000 women and 177.6 per 100,000 men. Breast, cervix, colorectal, stomach and thyroid were the most common types of cancer in women. In men, the corresponding malignancies were prostate, stomach, colorectal, lung and lymphoma. ASMR(W) was 84.5 per 100,000 person-years in women and 106.2 per 100,000 person-years in men. Breast and stomach cancer ranked first as causes of death in those groups, respectively. Overall, mortality rates in our region are higher than national estimates possibly due to limited effectiveness of secondary prevention strategies. Our work emphasizes the importance of maintaining high-quality, nationwide PBCRs.

  1. Cancer incidence in atomic bomb survivors. Part IV: Comparison of cancer incidence and mortality

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ron, E.; Preston, D.L.; Mabuchi, Kiyohiko

    1994-02-01

    This report compares cancer incidence and mortality among atomic bomb survivors in the Radiation Effects Research Foundation Life Span Study (LSS) cohort. Because the incidence data are derived from the Hiroshima and Nagasaki tumor registries, case ascertainment is limited to the time (1958-1987) and geographic restrictions (Hiroshima and Nagasaki) of the registries, whereas mortality data are available from 1950-1987 anywhere in Japan. With these conditions, there were 9,014 first primary incident cancer cases identified among LSS cohort members compared with 7,308 deaths for which cancer was listed as the underlying cause of death on death certificates. When deaths were limitedmore » to those occurring between 1958-1987 in Hiroshima or Nagasaki, there were 3,155 more incident cancer cases overall, and 1,262 more cancers of the digestive system. For cancers of the oral cavity and pharynx, skin, breast, female and male genital organs, urinary system and thyroid, the incidence series was at least twice as large as the comparable mortality series. Although the incidence and mortality data are dissimilar in many ways, the overall conclusions regarding which solid cancers provide evidence of a significant dose response generally confirm the mortality findings. When either incidence or mortality data are evaluated, significant excess risks are observed for all solid cancers, stomach, colon, liver (when it is defined as primary liver cancer or liver cancer not otherwise specified on the death certificate), lung, breast, ovary and urinary bladder. No significant radiation effect is seen for cancers of the pharynx, rectum, gallbladder, pancreas, nose, larynx, uterus, prostate or kidney in either series. There is evidence of a significant excess of nonmelanoma skin cancer in the incidence data, but not in the mortality series. 19 refs., 2 figs., 10 tabs.« less

  2. Cancer incidence and mortality in the Bucaramanga metropolitan area, 2003-2007

    PubMed Central

    Osma, Sonia; Herrera, Víctor

    2012-01-01

    Introduction: Cancer is an important cause of morbidity and mortality worldwide. Population-based cancer registries (PBCRs) make possible to estimate the burden of this condition. Aim: To estimate cancer incidence and mortality rates in the Bucaramanga Metropolitan Area (BMA) during 2003-2007. Methods: Incident cases of invasive cancer diagnosed during 2003-2007 were identified from the Bucaramanga Metropolitan Area PBCR (BMA-PBCR). Population counts and mortality were obtained from the Colombian National Administrative Department of Statistics (NADS). We estimated total and cancer-specific crude incidence and mortality rates by age group and sex, as well as age-standardized (Segi's world population) incidence (ASIR(W)) and mortality (ASMR(W)) rates. Statistical analyses were conducted using CanReg4 and Stata/IC 10.1. Results: We identified 8,225 new cases of cancer excluding non-melanoma skin cancer (54.3% among women). Of all cases, 6,943 (84.4%) were verified by microscopy and 669 (8.1%) were detected only by death certificate. ASIR(W) for all invasive cancers was 162.8 per 100,000 women and 177.6 per 100,000 men. Breast, cervix, colorectal, stomach and thyroid were the most common types of cancer in women. In men, the corresponding malignancies were prostate, stomach, colorectal, lung and lymphoma. ASMR(W) was 84.5 per 100,000 person-years in women and 106.2 per 100,000 person-years in men. Breast and stomach cancer ranked first as causes of death in those groups, respectively. Conclusion: Overall, mortality rates in our region are higher than national estimates possibly due to limited effectiveness of secondary prevention strategies. Our work emphasizes the importance of maintaining high-quality, nationwide PBCRs. PMID:24893302

  3. A French national breast and thyroid cancer screening programme for survivors of childhood, adolescent and young adult (CAYA) cancers - DeNaCaPST programme.

    PubMed

    Demoor-Goldschmidt, Charlotte; Drui, Delphine; Doutriaux, Isabelle; Michel, Gérard; Auquier, Pascal; Dumas, Agnès; Berger, Claire; Bernier, Valérie; Bohrer, Sandrine; Bondiau, Pierre-Yves; Filhon, Bruno; Fresneau, Brice; Freycon, Claire; Stefan, Dinu; Helfre, Sylvie; Jackson, Angela; Kerr, Christine; Laprie, Anne; Leseur, Julie; Mahé, Marc-André; Oudot, Caroline; Pluchard, Claire; Proust, Stéphanie; Sudour-Bonnange, Hélène; Vigneron, Céline; Lassau, Nathalie; Schlumberger, Martin; Conter, Cécile Faure; de Vathaire, Florent

    2017-05-12

    Survival of childhood, adolescent and young adult (CAYA) cancers has increased with progress in the management of the treatments and has reached more than 80% at 5 years. Nevertheless, these survivors are at great risk of second cancers and non-malignant co-morbidities in later life. DeNaCaPST is a non-interventional study whose aim is to organize a national screening for thyroid cancer and breast cancer in survivors of CAYA cancers. It will study the compliance with international recommendations, with the aim, regarding a breast screening programme, of offering for every woman living in France, at equal risk, an equal screening. DeNaCaPST trial is coordinated by the INSERM 1018 unit in cooperation with the LEA (French Childhood Cancer Survivor Study for Leukaemia) study's coordinators, the long term follow up committee and the paediatric radiation committee of the SFCE (French Society of Childhood Cancers). A total of 35 centres spread across metropolitan France and la Reunion will participate. FCCSS (French Childhood Cancer Survivor Study), LEA and central registry will be interrogated to identify eligible patients. To participate, centers agreed to perform a complete "long-term follow-up consultations" according to good clinical practice and the guidelines of the SFCE (French Society of Children Cancers). As survival has greatly improved in childhood cancers, detection of therapy-related malignancies has become a priority even if new radiation techniques will lead to better protection for organs at risk. International guidelines have been put in place because of the evidence for increased lifetime risk of breast and thyroid cancer. DeNaCaPST is based on these international recommendations but it is important to recognize that they are based on expert consensus opinion and are supported by neither nonrandomized observational studies nor prospective randomized trials in this specific population. Over-diagnosis is a phenomenon inherent in any screening program and therefore such programs must be evaluated.

  4. Cathepsin D in normal and neoplastic thyroid tissues.

    PubMed

    Kraimps, J L; Métayé, T; Millet, C; Margerit, D; Ingrand, P; Goujon, J M; Levillain, P; Babin, P; Begon, F; Barbier, J

    1995-12-01

    Cathepsin D is a widely distributed lysosomal acidic endopeptidase. It is an estrogen-regulated protein that is a prognostic factor in breast cancer. The aim of this study was to measure cathepsin D concentrations in thyroid tissues and to correlate these concentrations with clinical and pathologic parameters. Cathepsin D and thyroglobulin concentrations were measured in the cytosol of normal thyroid tissues (n = 14), benign nodules (n = 6), and thyroid carcinomas (n = 32) with an immunoradiometric assay. Statistical analysis was based on the Kruskal-Wallis and Wilcoxon tests and on the Spearman rank correlation coefficient. The mean level of cathepsin D, expressed as picomoles per milligram protein minus thyroglobulin, was higher in the 32 carcinomas, 29.1 +/- 15.5, than in the 14 normal thyroid tissues, 8.4 +/- 2.5 (p < 0.001) or in the 6 benign nodules, 11.2 +/- 7.3 (p = 0.003). Cathepsin D concentrations correlated with tumor size; Spearman rank correlation coefficient was rs = 0.44 (p = 0.012). No significant difference was found regarding histologic type. Cathepsin D concentrations were inversely correlated with the thyroglobulin level in the tumor; Spearman rank correlation coefficient was rs = -0.60 (p < 0.001). Cathepsin D concentration is higher in thyroid carcinoma than in normal thyroid tissue. Increased cathepsin D concentrations correlate with thyroid tumor size but not with histologic type. Further studies should be done to confirm the potential prognostic value of cathepsin D in patients with thyroid carcinomas.

  5. Synchronous diagnosis of metastatic cancer to the thyroid is associated with poor prognosis.

    PubMed

    Chen, Jeng-Yeou; Chen, I-Wen; Hsueh, Chuen; Chao, Tzu-Chieh; Gao, Bing-Ru; Lin, Jen-Der

    2015-03-01

    The incidence and histopathological characteristics of metastatic cancers to the thyroid (MCT) are different in various geographic areas. The aim of this study was to elucidate the clinical features of MCT, including histocytological diagnosis and therapeutic outcomes. A retrospective analysis of patients with thyroid cancer treated and followed up at the Chang Gung Medical Center in Linkou was performed. Among 3957 patients with thyroid cancer, a total of 56 patients with MCT were evaluated. Of them, 47 patients (83.9 %) were diagnosed with malignancy or suspected malignancy via fine needle aspiration cytology of the thyroid. Synchronous primary cancers were diagnosed in 44 of the patients with MCT. Of the MCT, metastasis of lung cancer to the thyroid was the leading category. Other primary sites of MCT were the head and neck, gastrointestinal tract, kidneys, breast, cervix, and unknown primary site. The mean 5-, 10-, 20-, and 60-month survival rates were 46.4, 32.1, 21.4, and 7.9 % for the patients. Patients with metachronous thyroid carcinoma had significantly better survival than patients with synchronous cancer. In conclusions, the incidence of MCT in patients with thyroid cancer is low; however, the prognosis of patients with MCT is poor, especially in patients diagnosed with synchronous primary tumors. In this study, MCT commonly originated in organs located near the thyroid, such as the lungs, head, and neck. Close monitoring of these malignancies may improve the prognosis of patients with MCT in the future.

  6. Prostate-specific antigen (PSA) as a possible biomarker in non-prostatic cancer: A review.

    PubMed

    Pérez-Ibave, Diana Cristina; Burciaga-Flores, Carlos Horacio; Elizondo-Riojas, Miguel-Ángel

    2018-06-01

    Prostate-specific antigen (PSA) is a serine protease produced by epithelial prostatic cells and its main function is to liquefy seminal coagulum. Currently, PSA is a biomarker for the diagnosis and screening of prostate cancer and it was the first cancer biomarker approved by the FDA. The quantity and serum isoforms of male PSA, allows distinguishing between carcinoma and benign inflammatory disease of the prostate. Initially, it was thought that PSA was produced only by the prostate, and thus, a protein that was expressed exclusively in men. However, several authors report that PSA is a protein that is expressed by multiple non-prostatic tissues not only in men but also in women. Some authors also report that in women, the expression of this protein is highly related to breast and colon cancer and therefore can act as a possible biomarker for early detection, diagnosis and prognosis of these cancers in women. In this review, we will focus on the characteristics of the PSA at a molecular level, its current clinical implications, the expression of this protein in non-prostatic tissues, and its relationship with cancer, especially in women. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Permanent scalp alopecia related to breast cancer chemotherapy by sequential fluorouracil/epirubicin/cyclophosphamide (FEC) and docetaxel: a prospective study of 20 patients.

    PubMed

    Kluger, N; Jacot, W; Frouin, E; Rigau, V; Poujol, S; Dereure, O; Guillot, B; Romieu, G; Bessis, D

    2012-11-01

    To analyze the clinical and histological features of permanent alopecia following a sequential fluorouracil/epirubicin/cyclophosphamide (FEC) and docetaxel regimen for adjuvant breast cancer treatment. Women treated for breast cancer by a sequential adjuvant FEC and docetaxel regimen who developed permanent alopecia diagnosed between 2007 and 2011 were identified from the Department of Dermatology (Saint-Eloi Hospital, Montpellier, France) and the Department of Medical Oncology (CRLC Val d'Aurelle, Montpellier, France). Data were collected regarding demographics, type of cancer, delay of onset after chemotherapy, Dermatology Life Quality Index (DLQI), clinical description of the lesions, scalp biopsies, laboratory explorations investigating steroid hormonal, iron, zinc and thyroid status, therapy and outcome. Twenty white Caucasian females were included. Hair loss presented with a moderate or intense androgenetic-like pattern of scalp alopecia. Biopsy specimen examinations were normal or displayed the androgenetic-like pattern. Laboratory explorations ruled out iron or zinc deficiency and thyroid disorders and confirmed hormonal menopause without hyperandrogenism. The overall mean DLQI score reflected the distressing psychological consequences in the patients' lives. No spontaneous regrowth of the scalp hair was noted. Treatment including vitamins, minoxidil, psoralen and ultraviolet A therapy and spironolactone proved to be ineffective. Permanent and severe alopecia is a newly reported complication of the FEC 100-docetaxel breast cancer regimen.

  8. Tackling cancer control in the Gulf Cooperation Council Countries.

    PubMed

    Al-Othman, Saleh; Haoudi, Abdelali; Alhomoud, Samar; Alkhenizan, Abdullah; Khoja, Tawfik; Al-Zahrani, Ali

    2015-05-01

    Cancer is a major health problem in both high income and middle-to-low income countries, and is the second leading cause of death in the world. Although more than a third of cancer could be prevented and another third could be cured if diagnosed early, it remains a huge challenge to health-care systems worldwide. Despite substantial improvements in health services some of the countries in the Gulf region, the burden of non-communicable diseases is a major threat, primarily due to the rapid socioeconomic shifts that have led to unfavourable changes in lifestyle such as increased tobacco use, decreased physical activity, and consumption of unhealthy food. In the Gulf Cooperation Council states (United Arab Emirates, Bahrain, Saudi Arabia, Oman, Qatar, and Kuwait), advanced breast cancer, colorectal cancer, leukaemia, thyroid cancer, and non-Hodgkin lymphomas are the most common cancers affecting younger populations compared with other countries. By contrast with cancer prevalence in developed countries, prostate, lung, and cervical cancers are not among the most common cancers in the Gulf region. In view of the increased cost of cancer management worldwide, integrated approaches between primary, secondary, and tertiary health-care systems with special focus on prevention and early detection is an essential step in the countries' efforts in the fight against cancer. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Search for familial clustering of multiple myeloma with any cancer.

    PubMed

    Frank, C; Fallah, M; Chen, T; Mai, E K; Sundquist, J; Försti, A; Hemminki, K

    2016-03-01

    Multiple myeloma (MM) is a disease of immunoglobulin-producing plasma cells, which reside mainly in the bone marrow. Family members of MM patients are at a risk of MM, but whether other malignancies are in excess in family members is not established and is the aim of this study. MM patients (24 137) were identified from the Swedish Cancer Registry from years 1958 to 2012. Relative risks (RRs) were calculated for MM defined by any cancer diagnosed in first-degree relatives and compared with individuals whose relatives had no cancer. MM was reliably associated with relative's colorectal, breast and prostate cancers, non-thyroid endocrine tumors, leukemia and cancer of unknown primary; in addition, MM was associated with subsites of bone and connective tissue tumors and of non-Hodgkin lymphoma, including lymphoplasmacytic lymphoma/Waldenström macroglobulinema (RR 3.47). MM showed a strong association (RR 1.91) in colorectal cancer families, possibly as part of an unidentified syndrome. All the associations of MM with discordant cancers are novel suggesting that MM shares genetic susceptibility with many cancers. The associations of MM bone and connective tissue tumors were supported by at least two independent results. Whether the results signal bone-related biology shared by MM and these tumors deserves further study.

  10. What is overdiagnosis and why should we take it seriously in cancer screening?

    PubMed

    Carter, Stacy M; Barratt, Alexandra

    2017-07-26

    Overdiagnosis occurs in a population when conditions are diagnosed correctly but the diagnosis produces an unfavourable balance between benefits and harms. In cancer screening, overdiagnosed cancers are those that did not need to be found because they would not have produced symptoms or led to premature death. These overdiagnosed cancers can be distinguished from false positives, which occur when an initial screening test suggests that a person is at high risk but follow-up testing shows them to be at normal risk. The cancers most likely to be overdiagnosed through screening are those of the prostate, thyroid, breast and lung. Overdiagnosis in cancer screening arises largely from the paradoxical problem that screening is most likely to find the slow-growing or dormant cancers that are least likely to harm us, and less likely to find the aggressive, fast-growing cancers that cause cancer mortality. This central paradox has become clearer over recent decades. The more overdiagnosis is produced by a screening program, the less likely the program is to serve its ultimate goal of reducing illness and premature death from cancer. Thus, it is vital that health professionals and researchers continue an open, scientific inquiry into the extent and consequences of overdiagnosis, and devise appropriate responses to it.

  11. Novel tumor necrosis factor-α induced protein eight (TNFAIP8/TIPE) family: Functions and downstream targets involved in cancer progression.

    PubMed

    Padmavathi, Ganesan; Banik, Kishore; Monisha, Javadi; Bordoloi, Devivasha; Bano, Shabnam; Arfuso, Frank; Sethi, Gautam; Lu, Fan; Kunnumakkara, Ajaikumar B

    2018-06-16

    The tumor necrosis factor (TNF)-α- induced protein 8 (TNFAIP8/TIPE) family is a death effector domain (DED)-containing protein family with four identified members: TNFAIP8 (TIPE), TNFAIP8L1 (TIPE1), TNFAIP8L2 (TIPE2), and TNFAIP8L3 (TIPE3). These proteins were found to play crucial roles in the regulation of immune homeostasis, inflammation, and cancer development. Intensive research in the past two decades revealed a strong correlation of TIPE proteins with development of various cancers including cancers of the bladder, blood, bone, breast, cervix, colon, esophagus, endometrium, stomach, liver, lung, ovary, pancreas, prostate, and thyroid gland. Also, deregulation of these proteins was found to promote the essential hallmarks of cancer such as survival, tumor growth, proliferation, inhibition of apoptosis, angiogenesis, invasion, migration, and metastasis. Further, differential expression of these proteins in normal and cancer tissues and their association with tumor progression and prognosis signifies the potential diagnostic and prognostic values of TIPE proteins and their importance in cancer therapy. The current review summarizes the literature available thus far on the expression, function, and role of TIPE proteins in the development and maintenance of various cancers. Copyright © 2018. Published by Elsevier B.V.

  12. Elastography: current status, future prospects, and making it work for you.

    PubMed

    Garra, Brian S

    2011-09-01

    Elastography has emerged as a useful adjunct tool for ultrasound diagnosis. Elastograms are images of tissue stiffness and may be in color, grayscale, or a combination of the two. The first and most common application of elastography is for the diagnosis of breast lesions where studies have shown an area under the receiver operating characteristic curve of 0.88 to 0.95 for distinguishing cancer from benign lesions. The technique is also useful for the diagnosis of complex cysts, although different scanners may vary in how they display such lesions. Recent advances in elastography include quantification using strain ratios, acoustic radiation force impulse imaging, and shear wave velocity estimation. These are useful not only for characterizing focal masses but also for diagnosing diffuse organ diseases such as liver cirrhosis. Other near term potential applications for elastography include characterization of thyroid nodules and lymph node evaluation for metastatic disease. Prostate cancer detection is also a potential application, but obtaining high-quality elastograms may be difficult. This area is evolving. Other promising applications include atheromatous plaque and arterial wall evaluation, venous thrombus evaluation, graft rejection, and monitoring of tumor ablation therapy. When contemplating the acquisition of a system with elastography in this rapidly evolving field, a clear picture of the manufacturer's plans for future upgrades (including quantification) should be obtained.

  13. Most cancer in firefighters is due to radio-frequency radiation exposure not inhaled carcinogens.

    PubMed

    Milham, S

    2009-11-01

    Recent reviews and reports of cancer incidence and mortality in firefighters conclude that they are at an increased risk of a number of cancers. These include leukemia, multiple myeloma, non-Hodgkin's lymphoma, male breast cancer, malignant melanoma, and cancers of the brain, stomach, colon, rectum, prostate, urinary bladder, testes, and thyroid. Firefighters are exposed to a long list of recognized or probable carcinogens in combustion products and the presumed route of exposure to these carcinogens is by inhalation. Curiously, respiratory system cancers and diseases are usually not increased in firefighters as they are in workers exposed to known inhaled carcinogens. The list of cancers with increased risk in firefighters strongly overlaps the list of cancers at increased risk in workers exposed to electromagnetic fields (EMF) and radiofrequency radiation (RFR). Firefighters have increased exposure to RFR in the course of their work, from the mobile two-way radio communications devices which they routinely use while fighting fires, and at times from firehouse and fire vehicle radio transmitters. I suggest that some of the increased cancer risk in firefighters is caused by RFR exposure, and is therefore preventable. The precautionary principle should be applied to reduce the risk of cancer in firefighters, and workman's compensation rules will necessarily need to be modified.

  14. Rationale for a 'Male Lumpectomy,' a Prostate Cancer Targeted Approach Using Cryoablation: Results in 21 Patients with at Least 2 Years of Follow-Up

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Onik, Gary

    2008-01-15

    Background. Prostate cancer in men raises many of the same issues that breast cancer does in women. Complications of prostate cancer treatment, including impotence and incontinence, affect the self-image and psyche of a man no less than does the loss of a breast in a woman. We present a pilot study in which 21 patients were treated with a focal cryoablation procedure. Methods. Focal cryoablation was performed using biplane transrectal ultrasound if the tumor was confined to only one prostate lobe. Preoperative PSA values were recorded. Cryoablation was planned to encompass the area of known tumor. PSA values were obtainedmore » every 3 months for 2 years and every 6 months thereafter. Potency and continence status was obtained at the same intervals. Routine biopsy was obtained at 1 year. Results. Twenty-one patients had focal cryoablation. Follow-up ranged from 24 to 105 months with a mean of 50 months. Twenty of 21 (95%) patients have stable PSA values with no evidence for cancer, despite 10 patients being at medium to high risk for recurrence. All patients biopsied (n = 19) were negative for tumor. Potency was maintained in 17 of 21 patients (80%). No other complications, including incontinence or fistula formation, were noted. Conclusion. These preliminary results indicate a 'male lumpectomy,' in which the prostate tumor region itself is destroyed, appears to preserve potency in a majority of patients and limits other complications, without compromising cancer control. If these results are confirmed by further studies and long-term follow-up, this treatment approach could have a profound effect on prostate cancer management.« less

  15. Pumpkin seed extract: Cell growth inhibition of hyperplastic and cancer cells, independent of steroid hormone receptors.

    PubMed

    Medjakovic, Svjetlana; Hobiger, Stefanie; Ardjomand-Woelkart, Karin; Bucar, Franz; Jungbauer, Alois

    2016-04-01

    Pumpkin seeds have been known in folk medicine as remedy for kidney, bladder and prostate disorders since centuries. Nevertheless, pumpkin research provides insufficient data to back up traditional beliefs of ethnomedical practice. The bioactivity of a hydro-ethanolic extract of pumpkin seeds from the Styrian pumpkin, Cucurbita pepo L. subsp. pepo var. styriaca, was investigated. As pumpkin seed extracts are standardized to cucurbitin, this compound was also tested. Transactivational activity was evaluated for human androgen receptor, estrogen receptor and progesterone receptor with in vitro yeast assays. Cell viability tests with prostate cancer cells, breast cancer cells, colorectal adenocarcinoma cells and a hyperplastic cell line from benign prostate hyperplasia tissue were performed. As model for non-hyperplastic cells, effects on cell viability were tested with a human dermal fibroblast cell line (HDF-5). No transactivational activity was found for human androgen receptor, estrogen receptor and progesterone receptor, for both, extract and cucurbitin. A cell growth inhibition of ~40-50% was observed for all cell lines, with the exception of HDF-5, which showed with ~20% much lower cell growth inhibition. Given the receptor status of some cell lines, a steroid-hormone receptor independent growth inhibiting effect can be assumed. The cell growth inhibition for fast growing cells together with the cell growth inhibition of prostate-, breast- and colon cancer cells corroborates the ethnomedical use of pumpkin seeds for a treatment of benign prostate hyperplasia. Moreover, due to the lack of androgenic activity, pumpkin seed applications can be regarded as safe for the prostate. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  16. Phase 1/2 Study of LOXO-195 in Patients With Previously Treated NTRK Fusion Cancers

    ClinicalTrials.gov

    2018-05-30

    Carcinoma, Non-Small-Cell Lung; Thyroid Neoplasms; Sarcoma; Colorectal Neoplasms; Salivary Gland Neoplasms; Biliary Tract Neoplasms; Brain Neoplasm, Primary; Melanoma; Glioblastoma; Bile Duct Neoplasms; Astrocytoma; Head and Neck Squamous Cell Carcinoma; Pontine Glioma; Pancreatic Neoplasms; Ovarian Neoplasms; Carcinoma, Renal Cell; Cholangiocarcinoma; Skin Carcinoma; Carcinoma, Bronchogenic; Bronchial Neoplasms; Lung Neoplasms; Respiratory Tract Neoplasms; Thoracic Neoplasms; Neoplasms, Nerve Tissue; Nevi and Melanomas; Intestinal Neoplasms; Thyroid Cancer; GIST; Malignant Peripheral Nerve Sheath Tumors; Breast Secretory Carcinoma; Uterine Neoplasms; Fibrosarcoma; Infantile Fibrosarcoma; Congenital Mesoblastic Nephroma; Central Nervous System Neoplasms

  17. Reduction of radiation exposure during radiography for scoliosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gray, J.E.; Hoffman, A.D.; Peterson, H.A.

    1983-01-01

    To reduce the radiation exposure received by young scoliosis patients during treatment, six changes in technique were instituted: (1) a posteroanterior projection, (2) specially designed leaded acrylic filters, (3) a high-speed screen-film system, (4) a specially designed cassette-holder and grid, (5) a breast-shield, and (6) additional filtration in the x-ray tube the thyroid, breast, and abdominal areas were made on an Alderson phantom. They revealed an eightfold reduction in abdominal exposure for both the posteroanterior and the lateral radiographys. There was a twentyfold reduction in exposure to the thyroid for the posteroanterior radiography from 100 to less than five milliroentgensmore » and for the lateral radiograph there was a 100-fold reduction from 618 to six milliroentgens. For the breasts there was a sixty-ninefold reduction from 344 to less than five milliroentgens for the posteroanterior radiography and a fifty-fivefold reduction from 277 to less than five milliroentgens for the lateral radiograph. These reductions in exposure were obtained without significant loss in the quality of the radiographs and in most instances with an improvement in the over-all quality of the radiograph due to the more uniform exposure.« less

  18. [Plastic surgery for the treatment of gynaecomastia following hormone therapy in prostate carcinoma].

    PubMed

    Ryssel, H; Germann, G; Köllensperger, E; Riedel, K

    2008-04-01

    Gynecomastia is a potential side effect of hormone therapy for prostate cancer. In large, randomized, placebo controlled studies approximately 50% or more of patients with prostate cancer experienced gynecomastia attributable to various mechanisms. Although it is mostly reported as mild to moderate, gynecomastia is one of the reasons most frequently cited for premature discontinuation of such treatment. Prophylactic radiotherapy and prophylactic tamoxifen have been shown to decrease the incidence of hormone-induced gynecomastia; nevertheless, there are still cases of refractory gynecomastia, and in these plastic surgery is needed for correction. Gynecomastia is a benign enlargement of the male breast, requiring no treatment unless it is a source of embarrassment and/or distress for the adolescent or man affected. The indications for surgical treatment of gynecomastia are founded on two main objectives: restoration of the male chest shape and diagnostic evaluation of suspected breast lesions. The authors believe that the complete circumareolar technique with no further scarring creates the best aesthetic results with fewer complications. When this is used in combination with liposuction very pleasing aesthetic results can be achieved.

  19. A novel minimally invasive dual-modality fiber optic probe for prostate cancer detection

    NASA Astrophysics Data System (ADS)

    Sharma, Vikrant

    Prostate cancer is the most common form of cancer in males, and is the second leading cause of cancer related deaths in United States. In prostate cancer diagnostics and therapy, there is a critical need for a minimally invasive tool for in vivo evaluation of prostate tissue. Such a tool finds its niche in improving TRUS (trans-rectal ultrasound) guided biopsy procedure, surgical margin assessment during radical prostatectomy, and active surveillance of patients with a certain risk levels. This work is focused on development of a fiber-based dual-modality optical device (dMOD), to differentiate prostate cancer from benign tissue, in vivo. dMOD utilizes two independent optical techniques, LRS (light reflectance spectroscopy) and AFLS (auto-fluorescence lifetime spectroscopy). LRS quantifies scattering coefficient of the tissue, as well as concentrations of major tissue chromophores like hemoglobin derivatives, β-carotene and melanin. AFLS was designed to target lifetime signatures of multiple endogenous fluorophores like flavins, porphyrins and lipo-pigments. Each of these methods was independently developed, and the two modalities were integrated using a thin (1-mm outer diameter) fiber-optic probe. Resulting dMOD probe was implemented and evaluated on animal models of prostate cancer, as well as on human prostate tissue. Application of dMOD to human breast cancer (invasive ductal carcinoma) identification was also evaluated. The results obtained reveal that both LRS and AFLS are excellent techniques to discriminate prostate cancer tissue from surrounding benign tissue in animal models. Each technique independently is capable of providing near absolute (100%) accuracy for cancer detection, indicating that either of them could be used independently without the need of implementing them together. Also, in case of human breast cancer, LRS and AFLS provided comparable accuracies to dMOD, LRS accuracy (96%) being the highest for the studied population. However, the dual-modality integration proved to be ideal for human prostate cancer detection, as dMOD provided much better accuracy i.e., 82.7% for cancer detection in intra-capsular prostatic tissues (ICT), and 92.4% for cancer detection in extra-capsular prostatic tissues (ECT), when compared with either LRS (74.7% ICT, 86.6% ECT) or AFLS(67.1% ICT, 82.1% ECT) alone. A classification algorithm was also developed to identify different grades of prostate cancers based on Gleason scores (GS). When stratified by grade, each high grade prostate cancer (GS 7, 8 and 9) was successfully identified using dMOD with excellent accuracy in ICT (88%, 90%, 85%), as well as ECT (91%, 92%, 94%).

  20. DESNT: A Poor Prognosis Category of Human Prostate Cancer.

    PubMed

    Luca, Bogdan-Alexandru; Brewer, Daniel S; Edwards, Dylan R; Edwards, Sandra; Whitaker, Hayley C; Merson, Sue; Dennis, Nening; Cooper, Rosalin A; Hazell, Steven; Warren, Anne Y; Eeles, Rosalind; Lynch, Andy G; Ross-Adams, Helen; Lamb, Alastair D; Neal, David E; Sethia, Krishna; Mills, Robert D; Ball, Richard Y; Curley, Helen; Clark, Jeremy; Moulton, Vincent; Cooper, Colin S

    2017-03-06

    A critical problem in the clinical management of prostate cancer is that it is highly heterogeneous. Accurate prediction of individual cancer behaviour is therefore not achievable at the time of diagnosis leading to substantial overtreatment. It remains an enigma that, in contrast to breast cancer, unsupervised analyses of global expression profiles have not currently defined robust categories of prostate cancer with distinct clinical outcomes. To devise a novel classification framework for human prostate cancer based on unsupervised mathematical approaches. Our analyses are based on the hypothesis that previous attempts to classify prostate cancer have been unsuccessful because individual samples of prostate cancer frequently have heterogeneous compositions. To address this issue, we applied an unsupervised Bayesian procedure called Latent Process Decomposition to four independent prostate cancer transcriptome datasets obtained using samples from prostatectomy patients and containing between 78 and 182 participants. Biochemical failure was assessed using log-rank analysis and Cox regression analysis. Application of Latent Process Decomposition identified a common process in all four independent datasets examined. Cancers assigned to this process (designated DESNT cancers) are characterized by low expression of a core set of 45 genes, many encoding proteins involved in the cytoskeleton machinery, ion transport, and cell adhesion. For the three datasets with linked prostate-specific antigen failure data following prostatectomy, patients with DESNT cancer exhibited poor outcome relative to other patients (p=2.65×10 -5 , p=4.28×10 -5 , and p=2.98×10 -8 ). When these three datasets were combined the independent predictive value of DESNT membership was p=1.61×10 -7 compared with p=1.00×10 -5 for Gleason sum. A limitation of the study is that only prediction of prostate-specific antigen failure was examined. Our results demonstrate the existence of a novel poor prognosis category of human prostate cancer and will assist in the targeting of therapy, helping avoid treatment-associated morbidity in men with indolent disease. Prostate cancer, unlike breast cancer, does not have a robust classification framework. We propose that this failure has occurred because prostate cancer samples selected for analysis frequently have heterozygous compositions (individual samples are made up of many different parts that each have different characteristics). Applying a mathematical approach that can overcome this problem we identify a novel poor prognosis category of human prostate cancer called DESNT. Copyright © 2017 European Association of Urology. Published by Elsevier B.V. All rights reserved.

  1. Iodine Symporter Targeting with 124I/131I Theranostics.

    PubMed

    Nagarajah, James; Janssen, Marcel; Hetkamp, Philipp; Jentzen, Walter

    2017-09-01

    Theranostics, a modern approach combining therapeutics and diagnostics, is among the most promising concepts in nuclear medicine for optimizing and individualizing treatments for many cancer entities. Theranostics has been used in clinical routines in nuclear medicine for more than 60 y-as 131 I for diagnostic and therapeutic purposes in thyroid diseases. In this minireview, we provide a survey of the use of 2 different radioiodine isotopes for targeting the sodium-iodine symporter in thyroid cancer and nonthyroidal neoplasms as well as a brief summary of theranostics for neuroendocrine neoplasms and metastatic castration-refractory prostate cancer. In particular, we discuss the role of 124 I-based dosimetry in targeting of the sodium-iodine symporter and describe the clinical application of 124 I dosimetry in a patient who had radioiodine-refractory thyroid cancer and who underwent a redifferentiation treatment with the mitogen-activated extracellular signal-related kinase kinase inhibitor trametinib. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.

  2. A diversity of cancer incidence and mortality in West Asian populations.

    PubMed

    Roshandel, Gholamreza; Boreiri, Majid; Sadjadi, Alireza; Malekzadeh, Reza

    2014-01-01

    Western Asia comprises a large proportion of the world population with different ethnicities and religions inhabiting areas of diverse geographic features. The countries of this region have experienced rapid economic growth over the latter half of the 20th century, which continues to this day, resulting in major changes in lifestyle of the population. The aim of this study was to compare the incidence and mortality of cancer in West Asia using the estimates reported by the International Agency for Research on Cancer (IARC) in Globocan-2012. Countries with high-quality data or national data (based on the definition of the Globocan-2012) were included in the analysis. These included Bahrain, Iran, Jordan, Kuwait, Lebanon, Oman, Qatar, Saudi Arabia, and Turkey. We also found high-quality cancer data from regional cancer registries in 3 Iranian and 3 Turkish provinces. Data on cancer incidence and mortality were collected and described in tables and graphs. Spearman's correlation test was used to assess the correlation between geographic coordinates and the incidence age-standardized rate (ASR; per 100,000 person-years) of cancers. Nine countries and 6 regional registries were included. Cancers of the lung (ASR, 33.3), prostate (24.9), bladder (19.1), stomach (16.5), and colorectal (15.9) were the most common malignancies in men. The most common cancers in women were those of the breast (35.4), colorectal (12.1), thyroid (10.3), stomach (9.2), and lung (6.7). The incidence rates of upper gastrointestinal and lung cancers were considerably higher in the northern part of this region, including Turkey and northern Iran compared with southern countries. High incidences of breast, colorectal, prostate, and bladder cancers were found in countries located in the northwest including Jordan, Lebanon, and Turkey. The most common cancers differed by country. Consequently, cancer control programs must be tailored to the most common types of cancers in each country. Lack of high-quality data for some West Asian countries was the major limitation of this study. Therefore, as the first step of cancer control programs, it is recommended that well-structured population-based cancer registries be established in all of these countries. Copyright © 2014 Icahn School of Medicine at Mount Sinai. Published by Elsevier Inc. All rights reserved.

  3. Comparison of anthropometric measures as predictors of cancer incidence: A pooled collaborative analysis of 11 Australian cohorts.

    PubMed

    Harding, Jessica L; Shaw, Jonathan E; Anstey, Kaarin J; Adams, Robert; Balkau, Beverley; Brennan-Olsen, Sharon L; Briffa, Tom; Davis, Timothy M E; Davis, Wendy A; Dobson, Annette; Flicker, Leon; Giles, Graham; Grant, Janet; Huxley, Rachel; Knuiman, Matthew; Luszcz, Mary; MacInnis, Robert J; Mitchell, Paul; Pasco, Julie A; Reid, Christopher; Simmons, David; Simons, Leon; Tonkin, Andrew; Woodward, Mark; Peeters, Anna; Magliano, Dianna J

    2015-10-01

    Obesity is a risk factor for cancer. However, it is not known if general adiposity, as measured by body mass index (BMI) or central adiposity [e.g., waist circumference (WC)] have stronger associations with cancer, or which anthropometric measure best predicts cancer risk. We included 79,458 men and women from the Australian and New Zealand Diabetes and Cancer Collaboration with complete data on anthropometry [BMI, WC, Hip Circumference (HC), WHR, waist to height ratio (WtHR), A Body Shape Index (ABSI)], linked to the Australian Cancer Database. Cox proportional hazards models assessed the association between each anthropometric marker, per standard deviation and the risk of overall, colorectal, post-menopausal (PM) breast, prostate and obesity-related cancers. We assessed the discriminative ability of models using Harrell's c-statistic. All anthropometric markers were associated with overall, colorectal and obesity-related cancers. BMI, WC and HC were associated with PM breast cancer and no significant associations were seen for prostate cancer. Strongest associations were observed for WC across all outcomes, excluding PM breast cancer for which HC was strongest. WC had greater discrimination compared to BMI for overall and colorectal cancer in men and women with c-statistics ranging from 0.70 to 0.71. We show all anthropometric measures are associated with the overall, colorectal, PM breast and obesity-related cancer in men and women, but not prostate cancer. WC discriminated marginally better than BMI. However, all anthropometric measures were similarly moderately predictive of cancer risk. We do not recommend one anthropometric marker over another for assessing an individuals' risk of cancer. © 2015 UICC.

  4. Cancer Stage at Diagnosis and Survival among Persons with Social Security Disability Insurance on Medicare

    PubMed Central

    McCarthy, Ellen P; Ngo, Long H; Chirikos, Thomas N; Roetzheim, Richard G; Li, Donglin; Drews, Reed E; Iezzoni, Lisa I

    2007-01-01

    Objective To examine stage at diagnosis and survival for disabled Medicare beneficiaries diagnosed with cancer under age 65 and compare their experiences with those of other persons diagnosed under age 65. Data Sources Surveillance, Epidemiology, and End Results (SEER) Program data and SEER-Medicare linked data for 1988–1999. SEER-11 Program includes 11 population-based tumor registries collecting information on all incident cancers in catchment areas. Tumor registry and Medicare data are linked for persons enrolled in Medicare. Study Design 307,595 incident cases of non-small cell lung (51,963), colorectal (52,092), breast (142,281), and prostate (61,259) cancer diagnosed in persons under age 65 from 1988 to 1999. Persons who qualified for Social Security Disability Insurance and had Medicare (SSDI/Medicare) were identified from Medicare enrollment files. Ordinal polychotomous logistic regression and Cox proportional hazards regression were used to estimate adjusted associations between disability status and later-stage diagnoses and mortality (all-cause and cancer-specific). Principal Findings Persons with SSDI/Medicare had lower rates of Stages III/IV diagnoses than others for lung (63.3 versus 69.5 percent) and prostate (25.5 versus 30.8 percent) cancers, but not for breast or colorectal cancers. After adjustment, they remained less likely to be diagnosed at later stages for lung and prostate cancers. Nevertheless, persons with SSDI/Medicare experienced higher all-cause mortality for each cancer. Cancer-specific mortality was higher among persons with SSDI/Medicare for breast and colorectal cancer patients. Conclusions Disabled Medicare beneficiaries are diagnosed with cancer at similar or earlier stages than others. However, they experience higher rates of cancer-related mortality when diagnosed at the same stage of breast and colorectal cancer. PMID:17362209

  5. Estimates of cancer burden in Lazio.

    PubMed

    Rashid, Ivan; Pannozzo, Fabio; Rossi, Silvia; Foschi, Roberto

    2013-01-01

    Since 1983 a population-based cancer registry has been operating in Lazio which provides incidence and survival data and covers the entire Latina province, amounting to 10% of the regional population. The aim of this paper is to provide estimates of the incidence, mortality and prevalence for seven major cancers in the Lazio region for the period 1970-2015. The estimates were obtained by applying the MIAMOD method, a statistical back-calculation approach to derive incidence and prevalence figures starting from mortality and relative survival data. Survival was modeled on the basis of published data from the Italian cancer registries. In 2012 the most frequent cancer sites were breast, colon-rectum and prostate with 5,529, 5,315 and 4,759 new diagnosed cases, respectively. The cancers with increasing incidence trends were breast cancer, lung cancer and skin melanoma in women, and prostate cancer, colorectal cancer and melanoma in men. The incidence rates of uterine cervix and stomach cancer decreased. The male lung cancer rates increased, reaching a peak in the late 1980s, and then decreased. Prevalence increased for all the considered cancers except cervix cancer. In 2012 breast, colorectal and prostate cancer had the highest prevalence, with 68,239, 36,617 and 33,934 prevalent cases, respectively. In the final period of the study the mortality declined for all cancers except female lung cancer. In 2012, the highest mortality rates were estimated for lung cancer in both men and women, with 89 and 40 deaths per 100,000, respectively. These estimates give a useful description of the present and future cancer patterns in the Lazio region. Incidence, mortality and prevalence projections provide new information for health resource planning. Furthermore, they point to the need to reinforce the organized screening programs, especially for breast and colorectal cancer.

  6. Prevalence of the CHEK2 R95* germline mutation.

    PubMed

    Knappskog, Stian; Leirvaag, Beryl; Gansmo, Liv B; Romundstad, Pål; Hveem, Kristian; Vatten, Lars; Lønning, Per E

    2016-01-01

    While germline CHEK2 mutations have been linked to a moderately elevated cancer risk, to date, a limited number of such mutations have been identified. Recently, we reported a germline nonsense mutation (C283T; R95*), introducing an early stop-codon, in two Norwegian patients diagnosed with locally advanced breast cancer. Both patients were resistant to anthracycline therapy, resembling what has been observed for TP53 mutations. In the present study, we screened a large population based sample, including 3748 non-cancer individuals and 7081 incident cancer cases (breast cancer, n  = 1717; prostate cancer n  = 2501, lung cancer n  = 1331 and colorectal cancer n  = 1532), for the distribution of CHEK2 R95*. We found that 12 individuals (0.11 %) carried the R95* variant: 4 non-cancer individuals (0.11 %), 4 breast cancer cases (0.23 %), and 4 prostate cancer cases (0.16 %). Although the low number of observations precluded formal statistical assessment, our data may indicate an elevated risk for breast (OR: 2.19, 95 % CI: 0.55-8.75) and prostate cancer (OR: 1.5, 95 % CI: 0.36-6.00) associated with CHEK2 R95*. By mining international databanks, we found no individuals carrying the R95* mutation, indicating it to be restricted to the Norwegian population. We provide proof-of-concept that previously unknown CHEK2 germline mutations may be present in certain populations. Notably, germline mutations in tumours are in general missed by contemporary massive parallel sequencing strategies, since tumour mutations are usually filtered against the germline. The fact that the CHEK2 R95* mutation may be associated with resistance to anthracyclines in cancer patients emphasizes its possible clinical importance.

  7. Cancer chemoprevention by dietary phytochemicals: Epidemiological evidence.

    PubMed

    Baena Ruiz, Raúl; Salinas Hernández, Pedro

    2016-12-01

    In recent years, natural compounds called "phytochemicals", which are present in fruits, vegetables, and plants, have received special attention due to their potential to interfere with tumour formation and development. Many of these phytochemicals are being used in chemoprevention strategies. However, the scientific evidence regarding the modification of cancer risk continues to be debated. The aim of this paper is to review the current scientific evidence and the most relevant epidemiological studies regarding the consumption or use of phytochemicals and their effects on the incidence of cancer. A search for relevant articles was conducted in EMBASE and PubMed-NCBI through to May 2016 to identify potential interactions between the consumption or use of phytochemicals and cancer risk. The use or consumption of carotenoids, such as lycopene, alpha-carotene, and betacarotene, leads to a reduction in the risk of cancer, such as breast and prostate tumours. For breast cancer, beta-carotene even reduces the risk of recurrence. The use or consumption of soybean isoflavones has led to a reduction in the risk of lung, prostate, colon (in women only), and breast cancers, although this has depended on menopausal and oestrogen receptor status. The use or consumption of isothiocyanates and indole-3-carbinol also seems to reduce the risk of cancer, such as breast, stomach, colorectal, or prostate tumours. The adoption of a diet rich in phytochemicals is associated with a modification of cancer risk. However, the scientific data supporting its use come mainly from in vitro and in vivo studies (especially in animal models). The epidemiological evidence is inconclusive for many of these phytochemicals, so further studies are needed. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. Cancer

    MedlinePlus

    ... cancer the three most common cancers are: Prostate cancer Lung cancer Colorectal cancer In US women, other than ... cancer the three most common cancers are: Breast cancer Lung cancer Colorectal cancer Some cancers are more common ...

  9. Did You Know? Video Series - SEER Cancer Statistics

    Cancer.gov

    Videos that explain cancer statistics. Choose from topics including survival, statistics overview, survivorship, disparities, and specific cancer types including breast, lung, colorectal, prostate, melanoma of the skin, and others.

  10. Targeting Alpha5 Beta1 Integrin to Prevent Metastatic Breast Cancer Cell Invasion: PhScN Target Site Definition and Plasma Stability

    DTIC Science & Technology

    2013-09-01

    12192595 12. Yao, H., D. Veine, K. Fay, E. Staszewski, et al., The PHSCN dendrimer as a more potent inhibitor of human breast cancer cell...Z.Z. Zeng, K.S. Fay, et al., Increased potency of the PHSCN dendrimer as an inhibitor of human prostate cancer cell invasion, extravasation, and lung

  11. Risk of gynecomastia and breast cancer associated with the use of 5-alpha reductase inhibitors for benign prostatic hyperplasia

    PubMed Central

    Hagberg, Katrina Wilcox; Divan, Hozefa A; Fang, Shona C; Nickel, J Curtis; Jick, Susan S

    2017-01-01

    Background Clinical trial results suggest that 5-alpha reductase inhibitors (5ARIs) for the treatment of benign prostatic hyperplasia (BPH) may increase the risk of gynecomastia and male breast cancer, but epidemiological studies have been limited. Patients and methods We conducted a cohort study with nested case–control analyses using the UK Clinical Practice Research Datalink. We identified men diagnosed with BPH who were free from Klinefelter syndrome, prostate, genital or urinary cancer, prostatectomy or orchiectomy, or evidence of gynecomastia or breast cancer. Patients entered the cohort at age ≥40 years and at least 3 years after the start of their electronic medical record. We classified exposure as 5ARIs (alone or in combination with alpha blockers [ABs]), AB only, or unexposed to 5ARIs and ABs. Cases were men who had a first-time diagnosis of gynecomastia or breast cancer. Incidence rates and incidence rate ratios (IRRs) with 95% confidence intervals (CIs) in the gynecomastia analysis and crude and adjusted odds ratios (ORs) with 95% CIs in both analyses were calculated. Results Compared to no exposure, gynecomastia risk was elevated for users of 5ARIs (alone or in combination with ABs) in both the cohort (IRR=3.55, 95% CI 3.05–4.14) and case–control analyses (OR=3.31, 95% CI 2.66–4.10), whereas the risk was null for users of AB only. The increased risk of gynecomastia with the use of 5ARIs persisted regardless of the number of prescriptions, exposure timing, and presence or absence of concomitant prescriptions for drugs known to be associated with gynecomastia. The risk was higher for dutasteride than for finasteride. 5ARI users did not have an increased risk of breast cancer compared to unexposed men (OR=1.52, 95% CI 0.61–3.80). Conclusion In men with BPH, 5ARIs significantly increased the risk of gynecomastia, but not breast cancer, compared to AB use and no exposure. PMID:28228662

  12. Inhibitory Ah Receptor-Androgen Receptor Crosstalk in Prostate Cancer

    DTIC Science & Technology

    2005-02-01

    Balk,S.P. Selection for androgen receptor mutations in prostate cancers treated with androgen antagonist. Cancer Res. 59:2511-2515, 1999. 5. Ris...expression, 24-hydroxylase activity, and inhibition of growth hydrocarbon receptor modulators ( SARMs ) for treatment of breast by lca,25-dihydroxyvitamin D3...Safe, A. McDougal, M.S. Gupta, K. Ramamoorthy, Selective Ah [20] D.M. Peehl, R.J. Skowronski, G.K. Leung, S.T. Wong, T.A. Stamey, receptor modulators

  13. IGF-1, IGFBP-1, and IGFBP-3 polymorphisms predict circulating IGF levels but not breast cancer risk: findings from the Breast and Prostate Cancer Cohort Consortium (BPC3).

    PubMed

    Patel, Alpa V; Cheng, Iona; Canzian, Federico; Le Marchand, Loïc; Thun, Michael J; Berg, Christine D; Buring, Julie; Calle, Eugenia E; Chanock, Stephen; Clavel-Chapelon, Francoise; Cox, David G; Dorronsoro, Miren; Dossus, Laure; Haiman, Christopher A; Hankinson, Susan E; Henderson, Brian E; Hoover, Robert; Hunter, David J; Kaaks, Rudolf; Kolonel, Laurence N; Kraft, Peter; Linseisen, Jakob; Lund, Eiliv; Manjer, Jonas; McCarty, Catherine; Peeters, Petra H M; Pike, Malcolm C; Pollak, Michael; Riboli, Elio; Stram, Daniel O; Tjonneland, Anne; Travis, Ruth C; Trichopoulos, Dimitrios; Tumino, Rosario; Yeager, Meredith; Ziegler, Regina G; Feigelson, Heather Spencer

    2008-07-02

    IGF-1 has been shown to promote proliferation of normal epithelial breast cells, and the IGF pathway has also been linked to mammary carcinogenesis in animal models. We comprehensively examined the association between common genetic variation in the IGF1, IGFBP1, and IGFBP3 genes in relation to circulating IGF-I and IGFBP-3 levels and breast cancer risk within the NCI Breast and Prostate Cancer Cohort Consortium (BPC3). This analysis included 6,912 breast cancer cases and 8,891 matched controls (n = 6,410 for circulating IGF-I and 6,275 for circulating IGFBP-3 analyses) comprised primarily of Caucasian women drawn from six large cohorts. Linkage disequilibrium and haplotype patterns were characterized in the regions surrounding IGF1 and the genes coding for two of its binding proteins, IGFBP1 and IGFBP3. In total, thirty haplotype-tagging single nucleotide polymorphisms (htSNP) were selected to provide high coverage of common haplotypes; the haplotype structure was defined across four haplotype blocks for IGF1 and three for IGFBP1 and IGFBP3. Specific IGF1 SNPs individually accounted for up to 5% change in circulating IGF-I levels and individual IGFBP3 SNPs were associated up to 12% change in circulating IGFBP-3 levels, but no associations were observed between these polymorphisms and breast cancer risk. Logistic regression analyses found no associations between breast cancer and any htSNPs or haplotypes in IGF1, IGFBP1, or IGFBP3. No effect modification was observed in analyses stratified by menopausal status, family history of breast cancer, body mass index, or postmenopausal hormone therapy, or for analyses stratified by stage at diagnosis or hormone receptor status. In summary, the impact of genetic variation in IGF1 and IGFBP3 on circulating IGF levels does not appear to substantially influence breast cancer risk substantially among primarily Caucasian postmenopausal women.

  14. Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.

    PubMed

    Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K

    2011-10-01

    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Epidermal Growth Factor Increases LRF/Pokemon Expression in Human Prostate Cancer Cells

    PubMed Central

    Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K.

    2011-01-01

    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. PMID:21640721

  16. A receptor tyrosine kinase, UFO/Axl, and other genes isolated by a modified differential display PCR are overexpressed in metastatic prostatic carcinoma cell line DU145.

    PubMed

    Jacob, A N; Kalapurakal, J; Davidson, W R; Kandpal, G; Dunson, N; Prashar, Y; Kandpal, R P

    1999-01-01

    We have used a modified differential display PCR protocol for isolating 3' restriction fragments of cDNAs specifically expressed or overexpressed in metastatic prostate carcinoma cell line DU145. Several cDNA fragments were identified that matched to milk fat globule protein, UFO/Axl, a receptor tyrosine kinase, human homologue of a Xenopus maternal transcript, laminin and laminin receptor, human carcinoma-associated antigen, and some expressed sequence tags. The transcript for milk fat globule protein, a marker protein shown to be overexpressed in breast tumors, was elevated in DU145 cells. The expression of UFO/Axl, a receptor tyrosine kinase, was considerably higher in DU145 cells as compared to normal prostate cells and prostatic carcinoma cell line PC-3. The overexpression of UFO oncogene in DU145 cells is discussed in the context of prostate cancer metastasis.

  17. Alcohol consumption and prostate cancer: a mini review.

    PubMed

    Rizos, Ch; Papassava, M; Golias, Ch; Charalabopoulos, K

    2010-07-01

    Prostate cancer has become a major public health problem worldwide although the etiology of prostate cancer remains largely unknown. Dietary factors, dietary supplements, and physical activity might be important in the prevention of the disease. In the majority of studies published, it was observed that high consumption of meat, alcohol and dairy products has been linked to a greater risk. Specifically, alcohol use, and particularly heavy use, may cause cancers of liver, esophagus, larynx, pharynx and oral cavity, with risks for the aero-digestive cancers. Moderate use among women has been related with increases in breast cancer. Alcohol consumption is a modifiable lifestyle factor that may affect prostate cancer risk. Alcohol alters the hormonal environment and in parallel, containing chemical substances such as flavonoids (red wine), may alter tumor cell growth. In this mini review, the relation between alcohol consumption and prostate cancer risk is analyzed.

  18. Prostate cancer and social media.

    PubMed

    Loeb, Stacy; Katz, Matthew S; Langford, Aisha; Byrne, Nataliya; Ciprut, Shannon

    2018-04-11

    The use of social media is increasing globally and is employed in a variety of ways in the prostate cancer community. In addition to their use in research, advocacy, and awareness campaigns, social media offer vast opportunities for education and networking for patients with prostate cancer and health-care professionals, and many educational resources and support networks are available to patients with prostate cancer and their caregivers. Despite the considerable potential for social media to be employed in the field of prostate cancer, concerns remain - particularly regarding the maintenance of patient confidentiality, variable information quality, and possible financial conflicts of interest. A number of professional societies have, therefore, issued guidance regarding social media use in medicine. Social media are used extensively in other cancer communities, particularly among patients with breast cancer, and both the quantity and type of information available are expected to grow in the future.

  19. AR Signaling in Human Malignancies: Prostate Cancer and Beyond.

    PubMed

    Antonarakis, Emmanuel S

    2018-01-18

    The notion that androgens and androgen receptor (AR) signaling are the hallmarks of prostate cancer oncogenesis and disease progression is generally well accepted. What is more poorly understood is the role of AR signaling in other human malignancies. This special issue of Cancers initially reviews the role of AR in advanced prostate cancer, and then explores the potential importance of AR signaling in other epithelial malignancies. The first few articles focus on the use of novel AR-targeting therapies in castration-resistant prostate cancer and the mechanisms of resistance to novel antiandrogens, and they also outline the interaction between AR and other cellular pathways, including PI3 kinase signaling, transcriptional regulation, angiogenesis, stromal factors, Wnt signaling, and epigenetic regulation in prostate cancer. The next several articles review the possible role of androgens and AR signaling in breast cancer, bladder cancer, salivary gland cancer, and hepatocellular carcinoma, as well as the potential treatment implications of using antiandrogen therapies in these non-prostatic malignancies.

  20. Assessment of Quality of Life in Patients With Symptomatic Chemotherapy-induced Anaemia

    ClinicalTrials.gov

    2017-02-07

    Anemia; Breast Cancer; Cancer; Colorectal Cancer; Lung Cancer; Ovarian Cancer; Prostate Cancer; Solid Tumors; Bladder Cancer; Endometrial Cancer; Renal Cancer; Pancreatic Cancer; Esophageal Cancer; Gastric Cancer

  1. Combination Chemotherapy Plus Filgrastim in Treating Patients With Advanced Solid Tumors

    ClinicalTrials.gov

    2013-08-27

    Bladder Cancer; Breast Cancer; Carcinoma of Unknown Primary; Esophageal Cancer; Gastric Cancer; Head and Neck Cancer; Lung Cancer; Melanoma (Skin); Ovarian Cancer; Pancreatic Cancer; Prostate Cancer; Sarcoma

  2. Nutrition and cancer prevention.

    PubMed

    Schapira, D V

    1992-09-01

    Of all cancers in the United States, 35% are estimated to be caused by dietary factors and may be preventable. Diets high in fat or calories, for example, are said to be associated with five of the six most common cancers: breast, colorectal, pancreatic, prostatic, and uterine. Conversely, some dietary components such as vitamin A, in fruits and vegetables, and fiber may help protect against certain cancers. Obesity may confer a small risk of breast cancer on a woman, but women with upper body fat localization are at significantly higher risk of developing breast cancer and endometrial cancer.

  3. Reduced expression of IQGAP2 and higher expression of IQGAP3 correlates with poor prognosis in cancers

    PubMed Central

    Kumar, Dinesh; Hassan, Md. Khurshidul; Pattnaik, Niharika; Mohapatra, Nachiketa

    2017-01-01

    IQGAPs is a family of proteins which comprises three members, in humans. The expression pattern and role of IQGAP1 has been well established in many cancers, whereas those of IQGAP2 and IQGAP3, have mostly remained unexplored. We used available large datasets, to explore the pan-cancer status of these two genes in-silico. Here we have analysed their mRNA expression and correlation with survivability in eight different cancers, including lung, breast, gastric, brain, colorectal, prostate, liver and kidney cancers and, their subtypes. The mRNA expression of IQGAP2 and IQGAP3 in individual cancers were analysed in two different publicly available databases viz. Oncomine and TCGA. The prognostic value of these genes in lung, breast and gastric cancer was analysed using Kaplan-Meier Plotter database, whereas for brain, colorectal, liver, prostate and kidney cancers, SurvExpress database was used. These results were validated by immunohistochemistry in cancer tissues (stomach, prostate, brain, colorectal). Moreover, we did IQGAP2 and IQGAP3 genomic alteration and, promoter methylation analysis using cBioportal and Wanderer web tool, respectively. Most of the cancer types (lung, breast, prostate, brain, gastric, liver, kidney and colorectal) showed increased IQGAP3 mRNA expression. In contrast, the IQGAP2 transcript levels were reduced across different cancers viz. lung, breast, gastric, liver, kidney and colorectal cancer. IQGAP2 expression correlated positively with survivability, on the contrary, IQGAP3 expression levels correlated inversely with survivability, in most of the cancers. Collectively, enhanced IQGAP3 and reduced IQGAP2 levels were frequently observed in multiple cancers with the former predicting poor survivability and the later opposite. Methylation pattern was significantly altered in most of the cancer types. We found copy no. variation and mutations in specific cancers, for IQGAP2 and IQGAP3. Our in-vivo (IHC) data confirmed the in-silico findings completely. Hence, IQGAP2 and IQGAP3 have potential to be used as prognostic markers or therapeutic targets in specific cancers. PMID:29073199

  4. Reduced expression of IQGAP2 and higher expression of IQGAP3 correlates with poor prognosis in cancers.

    PubMed

    Kumar, Dinesh; Hassan, Md Khurshidul; Pattnaik, Niharika; Mohapatra, Nachiketa; Dixit, Manjusha

    2017-01-01

    IQGAPs is a family of proteins which comprises three members, in humans. The expression pattern and role of IQGAP1 has been well established in many cancers, whereas those of IQGAP2 and IQGAP3, have mostly remained unexplored. We used available large datasets, to explore the pan-cancer status of these two genes in-silico. Here we have analysed their mRNA expression and correlation with survivability in eight different cancers, including lung, breast, gastric, brain, colorectal, prostate, liver and kidney cancers and, their subtypes. The mRNA expression of IQGAP2 and IQGAP3 in individual cancers were analysed in two different publicly available databases viz. Oncomine and TCGA. The prognostic value of these genes in lung, breast and gastric cancer was analysed using Kaplan-Meier Plotter database, whereas for brain, colorectal, liver, prostate and kidney cancers, SurvExpress database was used. These results were validated by immunohistochemistry in cancer tissues (stomach, prostate, brain, colorectal). Moreover, we did IQGAP2 and IQGAP3 genomic alteration and, promoter methylation analysis using cBioportal and Wanderer web tool, respectively. Most of the cancer types (lung, breast, prostate, brain, gastric, liver, kidney and colorectal) showed increased IQGAP3 mRNA expression. In contrast, the IQGAP2 transcript levels were reduced across different cancers viz. lung, breast, gastric, liver, kidney and colorectal cancer. IQGAP2 expression correlated positively with survivability, on the contrary, IQGAP3 expression levels correlated inversely with survivability, in most of the cancers. Collectively, enhanced IQGAP3 and reduced IQGAP2 levels were frequently observed in multiple cancers with the former predicting poor survivability and the later opposite. Methylation pattern was significantly altered in most of the cancer types. We found copy no. variation and mutations in specific cancers, for IQGAP2 and IQGAP3. Our in-vivo (IHC) data confirmed the in-silico findings completely. Hence, IQGAP2 and IQGAP3 have potential to be used as prognostic markers or therapeutic targets in specific cancers.

  5. Out of the black box: expansion of a theory-based intervention to self-manage the uncertainty associated with active surveillance (AS) for prostate cancer.

    PubMed

    Kazer, Meredith Wallace; Bailey, Donald E; Whittemore, Robin

    2010-01-01

    Active surveillance (AS) (sometimes referred to as watchful waiting) is an alternative approach to managing low-risk forms of prostate cancer. This management approach allows men to avoid expensive prostate cancer treatments and their well-documented adverse events of erectile dysfunction and incontinence. However, AS is associated with illness uncertainty and reduced quality of life (QOL; Wallace, 2003). An uncertainty management intervention (UMI) was developed by Mishel et al. (2002) to manage uncertainty in women treated for breast cancer and men treated for prostate cancer. However, the UMI was not developed for men undergoing AS for prostate cancer and has not been adequately tested in this population. This article reports on the expansion of a theory-based intervention to manage the uncertainty associated with AS for prostate cancer. Intervention Theory (Sidani & Braden, 1998) is discussed as a framework for revising the UMI intervention for men undergoing AS for prostate cancer (UMI-AS). The article concludes with plans for testing of the expanded intervention and implications for the extended theory.

  6. Thyroid Function in Women after Multimodal Treatment for Breast Cancer Stage II/III: Comparison With Controls From a Population Sample

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reinertsen, Kristin Valborg, E-mail: kvr@radiumhospitalet.n; Faculty Division the Norwegian Radium Hospital, University of Oslo, 0316 Oslo; Cancer Center, Ulleval University Hospital, Oslo

    Purpose: A possible association between thyroid diseases (TD) and breast cancer (BC) has been debated. We examined prevalence and development of TD in women after multimodal treatment for Stage II/III BC compared with women from a general population. Secondarily, we explored the impact of two different radiotherapy (RT) techniques (standardized field arrangements vs. computed tomography [CT]-based dose planning) on TD in BC patients examined 35-120 months after primary BC treatment. Methods and Materials: A total of 403 BC patients completed a questionnaire about TD and had blood samples taken for analyses of thyroid function. All had undergone postoperative RT withmore » or without (2%) adjuvant systemic treatment. The results in the BC patients were compared with a cancer-free, age-matched control group from a general population (CGr). Results: There was higher prevalence of self-reported hypothyroidism in the BC patients as compared with the CGr (18% vs. 6%, p < 0.001). The raised prevalence was predominantly due to a substantial increase in the development of hypothyroidism after BC diagnosis, whereas the prevalence of hypothyroidism before BC diagnosis was similar to that observed in the CGr. Patients treated with CT-based RT showed a trend for increased post-BC development of hypothyroidism as compared with those treated with standardized field arrangements (p = 0.08). Conclusions: Hypothyroidism is significantly increased in women after multimodal treatment for Stage II/III BC. Radiation to the thyroid gland may be a contributing factor. BC patients should be routinely screened for hypothyroidism.« less

  7. Lung Cancer Trends

    MedlinePlus

    ... the Biggest Cancer Killer in Both Men and Women” Stay Informed Trends for Other Kinds of Cancer Breast Cervical Colorectal (Colon) Ovarian Prostate Skin Cancer Home Lung Cancer Trends Language: English Español (Spanish) Recommend ...

  8. Physical Activity Assessment

    Cancer.gov

    Current evidence convincingly indicates that physical activity reduces the risk of colon and breast cancer. Physical activity may also reduce risk of prostate cancer. Scientists are also evaluating potential relationships between physical activity and other cancers.

  9. Breast Cancer with Synchronous Renal Cell Carcinoma: A Rare Presentation.

    PubMed

    Arjunan, Ravi; Kumar, Durgesh; Kumar, K V Veerendra; Premlatha, C S

    2016-10-01

    Primary cancer arising from multiple organs is a well known fact. Synchronous tumours have been most commonly associated with kidney cancer. Bladder, prostate, colorectal and lung cancer are the most common synchronous primaries with Renal Cell Carcinoma (RCC) identified till date. We found metachronous tumours of breast with RCC in literature search which included both metastatic tumours as well second primaries. Overall, 25 cases of metastatic breast tumours and eight cases of second primary in previously treated RCC have been reported in the literature. Here, we are reporting a case of synchronous presentation of carcinoma breast with RCC which is very rare because most of the multiple malignancies reported in the literature are metastatic tumours or metachronous breast malignancy with RCC.

  10. Breast Cancer with Synchronous Renal Cell Carcinoma: A Rare Presentation

    PubMed Central

    Arjunan, Ravi; Kumar, K V Veerendra; Premlatha, C S

    2016-01-01

    Primary cancer arising from multiple organs is a well known fact. Synchronous tumours have been most commonly associated with kidney cancer. Bladder, prostate, colorectal and lung cancer are the most common synchronous primaries with Renal Cell Carcinoma (RCC) identified till date. We found metachronous tumours of breast with RCC in literature search which included both metastatic tumours as well second primaries. Overall, 25 cases of metastatic breast tumours and eight cases of second primary in previously treated RCC have been reported in the literature. Here, we are reporting a case of synchronous presentation of carcinoma breast with RCC which is very rare because most of the multiple malignancies reported in the literature are metastatic tumours or metachronous breast malignancy with RCC. PMID:27891445

  11. Prostate Tumor Antigen Discovery: Development of a Novel Genetic Approach

    DTIC Science & Technology

    2001-12-01

    HIV infection and AIDS), 20 MUC-1 (associated with breast cancer), EBNA-1 (associated with Epstein Barr Virus infection), CA19.9 (associated with... developed with DCs transfected with RNA from LNCaP cell lines. These studies established the feasibility of using PSA as a vaccine for prostate cancer...effective as an adjunct therapy for this malignancy. There are several road blocks to developing a successful cancer vaccine . Products of tumor cells that are

  12. Prostate Cancer Aggressiveness Gene in Hereditary Prostate Cancer

    DTIC Science & Technology

    2007-03-01

    with REA, and estrogen receptor corepressor. Breast Canc Res Treat., in press (2007). This grant provided research support for Dr Veda Giri while...an estrogen receptor corepressor Clara Hwang Æ Veda N. Giri Æ John C. Wilkinson Æ Casey W. Wright Æ Amanda S. Wilkinson Æ Kathleen A. Cooney Æ Colin S...histone deacetylases (HDAC), and members of the polycomb group (PcG) of proteins. Clara Hwang and Veda N. Giri contributed equally to this work. C

  13. Markers of Ovarian Cancer Using a Glycoprotein/Antibody Array

    DTIC Science & Technology

    2013-05-01

    hepatocellular carcinoma based on altered profiles of alpha - fetoprotein . N. Engl. J. Med. 1993, 328 (25), 1802−6. (24) Hernandez, J.; Thompson, I. M...include HER2/NEU in breast cancer,22 α- fetoprotein (AFP) in hepatocellular carcinoma,23 prostate- specific antigen (PSA) in prostate cancer,24 and CA125...have already been found up- regulated in ovarian cancer, which include alpha -1-antitrypsin,36 haptoglobin,37 and alpha -1-proteinase inhibitor.38 In the

  14. The Genomic Evolution of Prostate Cancer

    DTIC Science & Technology

    2014-10-01

    Mutation characteristics. (a) Number of high-confidence somatic mutations across all foci. Non- silent , non- silent mutations; Unique, number of unique...genes harboring a non- silent mutation; Reported, gene reported to be mutated in references 9–12 and 14. (b) Spectrum of unique high confidence somatic...epigenetic and micr- oRNA-mediated inactivation of LRP1B, a modulator of the extracellular environment of thyroid cancer cells. Oncogene 2011; 30

  15. 3-D Ultrasound Vascularity Assessment for Breast Cancer Diagnosis

    DTIC Science & Technology

    2000-09-01

    circumscribed mass with no microcalcifications. Final pathologic studies revealed carcinosarcoma (half ductal, half chondrosarcoma ). (a) Lateral-axial...Prostate 2 0 0 2 Angiosarcoma 0 0 2 2 Chondrosarcoma 0 1 0 1 Nasopharyngeal tumor 0 0 1 1 Hemangioendothelioma 0 0 1 1 Renal tumor 1 0 2 3 Baseline...patient with metastatic rendered copper deficient. Table 2 summarizes the clinical chondrosarcoma secondary to radiation treatment for breast course of

  16. Physician-Initiated Stop-Smoking Program for Patients Receiving Treatment for Early-Stage Cancer

    ClinicalTrials.gov

    2015-10-06

    Bladder Cancer; Breast Cancer; Colorectal Cancer; Head and Neck Cancer; Lung Cancer; Lymphoma; Prostate Cancer; Testicular Germ Cell Tumor; Tobacco Use Disorder; Unspecified Adult Solid Tumor, Protocol Specific

  17. Chemotherapy in Treating Patients With Refractory Advanced Solid Tumors or Hematologic Cancer

    ClinicalTrials.gov

    2013-06-20

    Bladder Cancer; Breast Cancer; Colorectal Cancer; Gastric Cancer; Head and Neck Cancer; Kidney Cancer; Leukemia; Lung Cancer; Melanoma (Skin); Ovarian Cancer; Prostate Cancer; Unspecified Adult Solid Tumor, Protocol Specific

  18. Modeling of Radiotherapy Linac Source Terms Using ARCHER Monte Carlo Code: Performance Comparison for GPU and MIC Parallel Computing Devices

    NASA Astrophysics Data System (ADS)

    Lin, Hui; Liu, Tianyu; Su, Lin; Bednarz, Bryan; Caracappa, Peter; Xu, X. George

    2017-09-01

    Monte Carlo (MC) simulation is well recognized as the most accurate method for radiation dose calculations. For radiotherapy applications, accurate modelling of the source term, i.e. the clinical linear accelerator is critical to the simulation. The purpose of this paper is to perform source modelling and examine the accuracy and performance of the models on Intel Many Integrated Core coprocessors (aka Xeon Phi) and Nvidia GPU using ARCHER and explore the potential optimization methods. Phase Space-based source modelling for has been implemented. Good agreements were found in a tomotherapy prostate patient case and a TrueBeam breast case. From the aspect of performance, the whole simulation for prostate plan and breast plan cost about 173s and 73s with 1% statistical error.

  19. Obesity and cancer: mechanistic insights from transdisciplinary studies

    PubMed Central

    Allott, Emma H.; Hursting, Stephen D.

    2015-01-01

    Obesity is associated with a range of health outcomes that are of clinical and public health significance, including cancer. Herein, we summarize epidemiologic and preclinical evidence for an association between obesity and increased risk of breast and prostate cancer incidence and mortality. Moreover, we describe data from observational studies of weight change in humans and from calorie restriction studies in mouse models which support a potential role for weight loss in counteracting tumor-promoting properties of obesity in breast and prostate cancers. Given that weight loss is challenging to achieve and maintain, we also consider evidence linking treatments for obesity-associated co-morbidities, including metformin, statins and non-steroidal anti-inflammatory drugs, with reduced breast and prostate cancer incidence and mortality. Finally, we highlight several challenges that should be considered when conducting epidemiologic and preclinical research in the area of obesity and cancer, including the measurement of obesity in population-based studies, the timing of obesity and weight change in relation to tumor latency and cancer diagnosis, and the heterogeneous nature of obesity and its associated co-morbidities. Given that obesity is a complex trait, comprised of behavioral, epidemiologic and molecular/metabolic factors, we argue that a transdisciplinary approach is the key to understanding the mechanisms linking obesity and cancer. As such, this review highlights the critical need to integrate evidence from both epidemiologic and preclinical studies to gain insight into both biologic and non-biologic mechanisms contributing to the obesity-cancer link. PMID:26373570

  20. Travel Distance to Cancer Treatment Facilities in the Deep South.

    PubMed

    Wills, Mary J; Whitman, Marilyn V; English, Thomas M

    Despite ongoing efforts to improve rural healthcare, the health problems facing rural communities persist. The lack of healthcare providers and infrastructure in rural areas has been linked to a number of negative consequences. Among the elderly rural population, the lack of proximal access presents greater barriers because many elderly people are further limited in their ability to travel and pay for services. In the Deep South specifically, rural residents experience limited access to care and overall poor health outcomes. With cancer in particular, the Deep South has been dubbed the "cancer belt," faring far worse in prevalence and mortality rates than other areas of the country. The present study examines the average travel distance for rural elderly patients residing in the Deep South who are receiving treatment for prostate, breast, or colorectal cancer. We analyzed Medicare claims data of beneficiaries residing in the five Deep South states who had received a primary diagnosis of prostate, breast, or colorectal cancer, with a service date ranging from January 1, 2011, through December 31, 2014. The findings reveal that rural Medicare beneficiaries in the Deep South travel significantly greater distances than do their urban counterparts. In addition, travel distances to prostate cancer treatment facilities are significantly greater than those to breast or colorectal cancer treatment facilities. With cancer incidence predicted to increase, the need to reduce travel distances to treatment is vital in efforts to curb the mortality rate in the Deep South.

  1. Infective endocarditis and cancer in the elderly.

    PubMed

    García-Albéniz, Xabier; Hsu, John; Lipsitch, Marc; Logan, Roger W; Hernández-Díaz, Sonia; Hernán, Miguel A

    2016-01-01

    Little is known about the magnitude of the association between infective endocarditis and cancer, and about the natural history of cancer patients with concomitant diagnosis of infective endocarditis. We used the SEER-Medicare linked database to identify individuals aged 65 years or more diagnosed with colorectal, lung, breast, or prostate cancer, and without any cancer diagnosis (5% random Medicare sample from SEER areas) between 1992 and 2009. We identified infective endocarditis from the ICD-9 diagnosis of each admission recorded in the Medpar file and its incidence rate 90 days around cancer diagnosis. We also estimated the overall survival and CRC-specific survival after a concomitant diagnosis of infective endocarditis. The peri-diagnostic incidence of infective endocarditis was 19.8 cases per 100,000 person-months for CRC, 5.7 cases per 100,000 person-months for lung cancer, 1.9 cases per 100,000 person-months for breast cancer, 4.1 cases per 100,000 person-months for prostate cancer and 2.4 cases per 100,000 person-months for individuals without cancer. Two-year overall survival was 46.4% (95% CI 39.5, 54.5%) for stage I-III CRC patients with concomitant endocarditis and 73.1% (95 % CI 72.9, 73.3%) for those without it. In this elderly population, the incidence of infective endocarditis around CRC diagnosis was substantially higher than around the diagnosis of lung, breast and prostate cancers. A concomitant diagnosis of infective endocarditis in patients with CRC diagnosis is associated with shorter survival.

  2. A Randomized Controlled Trial for the Effectiveness of Progressive Muscle Relaxation and Guided Imagery as Anxiety Reducing Interventions in Breast and Prostate Cancer Patients Undergoing Chemotherapy

    PubMed Central

    Charalambous, Andreas; Giannakopoulou, Margarita; Bozas, Evangelos; Paikousis, Lefkios

    2015-01-01

    Objective. To test the effectiveness of guided imagery (GI) and progressive muscle relaxation (PMR) as stress reducing interventions in patients with prostate and breast cancer who undergo chemotherapy. Methods. Patients were randomly assigned to either the control group or the intervention group (PMR and GI). Patients were observed for a total duration of 3 weeks and assessed with the SAS and BECK-II questionnaires for anxiety and depression, respectively, in addiotion to two biological markers (saliva cortisol and saliva amylase) (trial registration number: NCT01275872). Results. 256 patients were registered and 236 were randomly assigned. In total 104 were randomised to the control group and 104 to the intervention group. Intervention's mean anxiety score and depression score changes were significantly different compared to the control's (b = −29.4, p < 0.001; b = −29.4, p < 0.001, resp.). Intervention group's cortisol levels before the intervention (0.30 ± 0.25) gradually decreased up to week 3 (0.16 ± 0.18), whilst the control group's cortisol levels before the intervention (0.21 ± 0.22) gradually increased up to week 3 (0.44 ± 0.35). The same interaction appears for the Amylase levels (p < 0.001). Conclusions. The findings showed that patients with prostate and breast cancer undergoing chemotherapy treatment can benefit from PMR and GI sessions to reduce their anxiety and depression. PMID:26347018

  3. Obesity and cancer: mechanistic insights from transdisciplinary studies.

    PubMed

    Allott, Emma H; Hursting, Stephen D

    2015-12-01

    Obesity is associated with a range of health outcomes that are of clinical and public health significance, including cancer. Herein, we summarize epidemiologic and preclinical evidence for an association between obesity and increased risk of breast and prostate cancer incidence and mortality. Moreover, we describe data from observational studies of weight change in humans and from calorie-restriction studies in mouse models that support a potential role for weight loss in counteracting tumor-promoting properties of obesity in breast and prostate cancers. Given that weight loss is challenging to achieve and maintain, we also consider evidence linking treatments for obesity-associated co-morbidities, including metformin, statins and non-steroidal anti-inflammatory drugs, with reduced breast and prostate cancer incidence and mortality. Finally, we highlight several challenges that should be considered when conducting epidemiologic and preclinical research in the area of obesity and cancer, including the measurement of obesity in population-based studies, the timing of obesity and weight change in relation to tumor latency and cancer diagnosis, and the heterogeneous nature of obesity and its associated co-morbidities. Given that obesity is a complex trait, comprised of behavioral, epidemiologic and molecular/metabolic factors, we argue that a transdisciplinary approach is the key to understanding the mechanisms linking obesity and cancer. As such, this review highlights the critical need to integrate evidence from both epidemiologic and preclinical studies to gain insight into both biologic and non-biologic mechanisms contributing to the obesity-cancer link. © 2015 Society for Endocrinology.

  4. Lycopene acts through inhibition of IκB kinase to suppress NF-κB signaling in human prostate and breast cancer cells.

    PubMed

    Assar, Emelia A; Vidalle, Magdalena Castellano; Chopra, Mridula; Hafizi, Sassan

    2016-07-01

    We studied the effect of the potent dietary antioxidant lycopene on multiple points along the nuclear factor kappa B (NF-κB) signaling pathway in prostate and breast cancer cells. Lycopene significantly inhibited prostate and breast cancer cell growth at physiologically relevant concentrations of ≥1.25 μM. Similar concentrations also caused a 30-40 % reduction in inhibitor of kappa B (IκB) phosphorylation in the cells, as determined by western blotting. Furthermore, the same degree of inhibition by lycopene was observed for NF-κB transcriptional activity, as determined by reporter gene assay. Concomitant with this, immunofluorescence staining of lycopene-treated cells showed a significant suppression (≥25 %) of TNF-induced NF-κB p65 subunit nuclear translocation. Further probing of lycopene's effects on upstream elements of the NF-κB pathway showed a 25 % inhibition of both activity of recombinant IκB kinase β (IKKβ) kinase in a cell-free in vitro assay, as well as activity of IKKβ immunoprecipitated from MDA-MB-231 cells treated with lycopene. In conclusion, the anticancer properties of lycopene may occur through inhibition of the NF-κB signaling pathway, beginning at the early stage of cytoplasmic IKK kinase activity, which then leads to reduced NF-κB-responsive gene regulation. Furthermore, these effects in cancer cells were observed at concentrations of lycopene that are relevant and achievable in vivo.

  5. Beyond the androgen receptor II: New approaches to understanding and treating metastatic prostate cancer; Report from the 2017 Coffey-Holden Prostate Cancer Academy Meeting.

    PubMed

    Miyahira, Andrea K; Cheng, Heather H; Abida, Wassim; Ellis, Leigh; Harshman, Lauren C; Spratt, Daniel E; Simons, Jonathan W; Pienta, Kenneth J; Soule, Howard R

    2017-11-01

    The 2017 Coffey-Holden Prostate Cancer Academy (CHPCA) Meeting, "Beyond the Androgen Receptor II: New Approaches to Understanding and Treating Metastatic Prostate Cancer," was held in Carlsbad, California from June 14-17, 2017. The CHPCA is an annual scientific conference hosted by the Prostate Cancer Foundation (PCF) that is uniquely designed to produce extensive and constructive discussions on the most urgent and impactful topics concerning research into the biology and treatment of metastatic prostate cancer. The 2017 CHPCA Meeting was the 5th meeting in this annual series and was attended by 71 investigators focused on prostate cancer and a variety of other fields including breast and ovarian cancer. The discussions at the meeting were concentrated on topics areas including: mechanisms and therapeutic approaches for molecular subclasses of castrate resistant prostate cancer (CRPC), the epigenetic landscape of prostate cancer, the role of DNA repair gene mutations, advancing the use of germline genetics in clinical practice, radionuclides for imaging and therapy, advances in molecular imaging, and therapeutic strategies for successful use of immunotherapy in advanced prostate cancer. This article reviews the presentations and discussions from the 2017 CHPCA Meeting in order to disseminate this knowledge and accelerate new biological understandings and advances in the treatment of patients with metastatic prostate cancer. © 2017 Wiley Periodicals, Inc.

  6. An inducible knockout mouse to model the cell-autonomous role of PTEN in initiating endometrial, prostate and thyroid neoplasias.

    PubMed

    Mirantes, Cristina; Eritja, Núria; Dosil, Maria Alba; Santacana, Maria; Pallares, Judit; Gatius, Sónia; Bergadà, Laura; Maiques, Oscar; Matias-Guiu, Xavier; Dolcet, Xavier

    2013-05-01

    PTEN is one of the most frequently mutated tumor suppressor genes in human cancers. The role of PTEN in carcinogenesis has been validated by knockout mouse models. PTEN heterozygous mice develop neoplasms in multiple organs. Unfortunately, the embryonic lethality of biallelic excision of PTEN has inhibited the study of complete PTEN deletion in the development and progression of cancer. By crossing PTEN conditional knockout mice with transgenic mice expressing a tamoxifen-inducible Cre-ER(T) under the control of a chicken actin promoter, we have generated a tamoxifen-inducible mouse model that allows temporal control of PTEN deletion. Interestingly, administration of a single dose of tamoxifen resulted in PTEN deletion mainly in epithelial cells, but not in stromal, mesenchymal or hematopoietic cells. Using the mT/mG double-fluorescent Cre reporter mice, we demonstrate that epithelial-specific PTEN excision was caused by differential Cre activity among tissues and cells types. Tamoxifen-induced deletion of PTEN resulted in extremely rapid and consistent formation of endometrial in situ adenocarcinoma, prostate intraepithelial neoplasia and thyroid hyperplasia. We also analyzed the role of PTEN ablation in other epithelial cells, such as the tubular cells of the kidney, hepatocytes, colonic epithelial cells or bronchiolar epithelium, but those tissues did not exhibit neoplastic growth. Finally, to validate this model as a tool to assay the efficacy of anti-tumor drugs in PTEN deficiency, we administered the mTOR inhibitor everolimus to mice with induced PTEN deletion. Everolimus dramatically reduced the progression of endometrial proliferations and significantly reduced thyroid hyperplasia. This model could be a valuable tool to study the cell-autonomous mechanisms involved in PTEN-loss-induced carcinogenesis and provides a good platform to study the effect of anti-neoplastic drugs on PTEN-negative tumors.

  7. An inducible knockout mouse to model the cell-autonomous role of PTEN in initiating endometrial, prostate and thyroid neoplasias

    PubMed Central

    Mirantes, Cristina; Eritja, Núria; Dosil, Maria Alba; Santacana, Maria; Pallares, Judit; Gatius, Sónia; Bergadà, Laura; Maiques, Oscar; Matias-Guiu, Xavier; Dolcet, Xavier

    2013-01-01

    SUMMARY PTEN is one of the most frequently mutated tumor suppressor genes in human cancers. The role of PTEN in carcinogenesis has been validated by knockout mouse models. PTEN heterozygous mice develop neoplasms in multiple organs. Unfortunately, the embryonic lethality of biallelic excision of PTEN has inhibited the study of complete PTEN deletion in the development and progression of cancer. By crossing PTEN conditional knockout mice with transgenic mice expressing a tamoxifen-inducible Cre-ERT under the control of a chicken actin promoter, we have generated a tamoxifen-inducible mouse model that allows temporal control of PTEN deletion. Interestingly, administration of a single dose of tamoxifen resulted in PTEN deletion mainly in epithelial cells, but not in stromal, mesenchymal or hematopoietic cells. Using the mT/mG double-fluorescent Cre reporter mice, we demonstrate that epithelial-specific PTEN excision was caused by differential Cre activity among tissues and cells types. Tamoxifen-induced deletion of PTEN resulted in extremely rapid and consistent formation of endometrial in situ adenocarcinoma, prostate intraepithelial neoplasia and thyroid hyperplasia. We also analyzed the role of PTEN ablation in other epithelial cells, such as the tubular cells of the kidney, hepatocytes, colonic epithelial cells or bronchiolar epithelium, but those tissues did not exhibit neoplastic growth. Finally, to validate this model as a tool to assay the efficacy of anti-tumor drugs in PTEN deficiency, we administered the mTOR inhibitor everolimus to mice with induced PTEN deletion. Everolimus dramatically reduced the progression of endometrial proliferations and significantly reduced thyroid hyperplasia. This model could be a valuable tool to study the cell-autonomous mechanisms involved in PTEN-loss-induced carcinogenesis and provides a good platform to study the effect of anti-neoplastic drugs on PTEN-negative tumors. PMID:23471917

  8. Primary hyperthyroidism--diagnosis and treatment. Indications and contraindications for radioiodine therapy.

    PubMed

    Gurgul, Edyta; Sowinski, Jerzy

    2011-01-01

    Isotope therapy is one of the methods used in primary hyperthyroidism. The therapy is based on short-range beta radiation emitted from radioactive iodine. Radioiodine administration must always be preceded by pharmacological normalization of thyroid function. Otherwise, post-radiation thyrocyte destruction and thyroid hormones release may lead to hyperthyroidism exacerbation. Indications for radioiodine therapy in Graves-Basedow disease include recurrent hyperthyroidism after thyrostatic treatment or thyroidectomy and side-effects observed during thyrostatic treatment. In toxic nodule, isotope therapy is the first choice therapy. Radioiodine is absorbed only in autonomous nodule. Therefore, it destroys only this area and does not damage the remaining thyroid tissue. In toxic goitre, radioiodine is used mostly in recurrent nodules. Absolute contraindications for radioiodine treatment are pregnancy and lactation. Relative contraindications are thyroid nodules suspected of malignancy and age under 15 years. In patients with thyroid nodules suspected of malignancy, radioiodine treatment may be applied as a preparation for surgery, if thyrostatic drugs are ineffective or contraindicated. In children, radioiodine therapy should be considered in recurrent toxic goitre and when thyrostatic drugs are ineffective. In patients with Graves-Basedow disease and thyroid-associated orbitopathy, radioiodine treatment may increase the inflammatory process and exacerbate the ophthalmological symptoms. However, thyroid-associated orbitopathy cannot be considered as a contraindication for isotope therapy. The potential carcinogenic properties of radioiodine, especially associated with tissues with high iodine uptake (thyroid, salivary glands, stomach, intestine, urinary tract, breast), have not been confirmed.

  9. Intake of meat, meat mutagens, and iron and the risk of breast cancer in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial

    PubMed Central

    Ferrucci, L M; Cross, A J; Graubard, B I; Brinton, L A; McCarty, C A; Ziegler, R G; Ma, X; Mayne, S T; Sinha, R

    2009-01-01

    Background: Epidemiological evidence on meat intake and breast cancer is inconsistent, with little research on potentially carcinogenic meat-related exposures. We investigated meat subtypes, cooking practices, meat mutagens, iron, and subsequent breast cancer risk. Methods: Among 52 158 women (aged 55–74 years) in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial, who completed a food frequency questionnaire, 1205 invasive breast cancer cases were identified. We estimated meat mutagen and haem iron intake with databases accounting for cooking practices. Using Cox proportional hazards regression, we calculated hazard ratios (HRs) and 95% confidence intervals (CIs) within quintiles of intake. Results: Comparing the fifth to the first quintile, red meat (HR=1.23; 95% CI=1.00–1.51, P trend=0.22), the heterocyclic amine (HCA), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), (HR=1.26; 95% CI=1.03–1.55; P trend=0.12), and dietary iron (HR=1.25; 95% CI=1.02–1.52; P trend=0.03) were positively associated with breast cancer. We observed elevated, though not statistically significant, risks with processed meat, the HCA 2-amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline (DiMeIQx), mutagenic activity, iron from meat, and haem iron from meat. Conclusion: In this prospective study, red meat, MeIQx, and dietary iron elevated the risk of invasive breast cancer, but there was no linear trend in the association except for dietary iron. PMID:19513076

  10. Paroxysmal atrial fibrillation during acute myocardial infarction associated with subclinical hyperthyroidism, severe three vessels coronary artery disease and elevation of prostate-specific antigen after TURP.

    PubMed

    Patanè, Salvatore; Marte, Filippo

    2010-01-21

    Subclinical hyperthyroidism is an increasingly recognized entity that is defined as a normal serum free thyroxine and free triiodothyronine levels with a thyroid-stimulating hormone level suppressed below the normal range and usually undetectable. Paroxysmal atrial fibrillation is a frequent complication of acute myocardial infarction. It has been reported that subclinical hyperthyroidism is not associated with CHD or mortality from cardiovascular causes but it is sufficient to induce an increase in atrial fibrillation rate and increased factor X activity in patients with subclinical hyperthyroidism represents a potential hypercoagulable state. It has also been reported that serum prostate-specific antigen (PSA) decreases drastically in patients who undergo transurethral resection of the prostate(TURP). We present a case of paroxysmal atrial fibrillation during acute myocardial infarction associated with subclinical hyperthyroidism, severe three vessels coronary artery disease and elevation of PSA after TURP in a 78-year-old Italian man. Copyright (c) 2008 Elsevier Ireland Ltd. All rights reserved.

  11. Unusual Cancers of Childhood Treatment (PDQ®)—Health Professional Version

    Cancer.gov

    Very rare cancers in children include nasopharyngeal, thyroid, oral, salivary, laryngeal, breast, lung, esophageal, cardiac, adrenocortical, gastric, pancreatic, GIST, carcinoid tumors, colorectal, bladder, and skin cancer. Get information about the diagnosis and treatment of these unusual childhood cancers in this summary for clinicians.

  12. Thyroid Function among Breastfed Children with Chronically Excessive Iodine Intakes

    PubMed Central

    Aakre, Inger; Strand, Tor A.; Bjøro, Trine; Norheim, Ingrid; Barikmo, Ingrid; Ares, Susana; Alcorta, Marta Duque; Henjum, Sigrun

    2016-01-01

    Iodine excess may impair thyroid function and trigger adverse health consequences for children. This study aims to describe iodine status among breastfed infants with high iodine exposure in the Saharawi refugee camps Algeria, and further assess thyroid function and iodine status among the children three years later. In 2010, a cross-sectional study among 111 breastfed children aged 0–6 months was performed (baseline study). In 2013, a second cross-sectional study (follow-up study) was conducted among 289 children; 213 newly selected and 76 children retrieved from baseline. Urinary iodine concentration (UIC) and breast milk iodine concentration (BMIC) were measured at baseline. UIC, thyroid hormones and serum thyroglobulin (Tg) were measured at follow-up. At baseline and follow-up, 88% and 72% had excessive iodine intakes (UIC ≥ 300 µg/L), respectively. At follow-up, 24% had a thyroid hormone disturbance and/or elevated serum Tg, including 9% with subclinical hypothyroidism (SCH), 4% with elevated fT3 and 14% with elevated Tg. Children with SCH had poorer linear growth and were more likely to be underweight than the children without SCH. Excessive iodine intakes and thyroid disturbances were common among children below four years of age in our study. Further, SCH seemed to be associated with poor growth and weight. PMID:27367720

  13. Hyperthyroidism, Hypothyroidism, and Cause-Specific Mortality in a Large Cohort of Women.

    PubMed

    Journy, Neige M Y; Bernier, Marie-Odile; Doody, Michele M; Alexander, Bruce H; Linet, Martha S; Kitahara, Cari M

    2017-08-01

    The prevalence of hyperthyroidism and hypothyroidism is 0.5-4% in iodine-replete communities, but it is 5-10 times higher in women than in men. Those conditions are associated with a broad range of metabolic disorders and cardiovascular diseases. Biological evidence of a role of thyroid hormones in carcinogenesis also exists. However, the association between thyroid dysfunction and cardiovascular disease or cancer mortality risk remains controversial. In a large cohort of women, the associations of hyperthyroidism and hypothyroidism with cause-specific mortality were evaluated after nearly 30 years of follow-up. The prospective study included 75,076 women aged 20-89 years who were certified as radiologic technologists in the United States in 1926-1982, completed baseline questionnaires in 1983-1998 from which medical history was ascertained, and reported no malignant disease or benign thyroid disease except thyroid dysfunction. A passive follow-up of this cohort was performed through the Social Security Administration database and the National Death Index-Plus. Cause-specific mortality risks were compared according to self-reported thyroid status, with proportional hazards models adjusted for baseline year and age, race/ethnicity, body mass index, family history of breast cancer, and life-style and reproductive factors. During a median follow-up of 28 years, 2609 cancer, 1789 cardiovascular or cerebrovascular, and 2442 other non-cancer deaths were recorded. Women with hyperthyroidism had an elevated risk of breast cancer mortality after 60 years of age (hazard ratio [HR] = 2.04 [confidence interval (CI) 1.16-3.60], 13 cases in hyperthyroid women) compared to women without thyroid disease. Hypothyroid women had increased mortality risks for diabetes mellitus (HR = 1.58 [CI 1.03-2.41], 27 cases in hypothyroid women), cardiovascular disease (HR = 1.20 [CI 1.01-1.42], 179 cases), and cerebrovascular disease (HR = 1.45 [CI 1.01-2.08], 35 cases, when restricting the follow-up to ≥10 years after baseline). Other causes of death were not associated with hyperthyroidism or hypothyroidism, though there was a suggestion of an elevated risk of ovarian cancer mortality in hyperthyroid women based on very few cases. The excess mortality risks observed in a large, prospective 30-year follow-up of patients with thyroid dysfunction require confirmation, and, if replicated, further investigation will be needed because of the clinical implications.

  14. Rare Case of Intratracheal Metastasis Detected on 68Ga-Prostate-Specific Membrane Antigen PET/CT Scan in a Case of Thyroglobulin Elevated Negative Iodine Scan Syndrome.

    PubMed

    Sasikumar, Arun; Joy, Ajith; Pillai, M R A; Oommen, Karuna Elza; Jayakumar, R

    2018-04-01

    A 64-year-old woman underwent completion thyroidectomy with upper tracheal ring resection and right-sided neck dissection for papillary carcinoma of the thyroid infiltrating the trachea and was given I radioiodine treatment. Three years later, she presented with hemoptysis. On evaluation, she had increased serum thyroglobulin and negative iodine scan (TENIS). F-FDG PET/CT scan did not identify any site of disease. One year later, Ga-PSMA scan done revealed a moderate focal tracer-avid intratracheal soft tissue; biopsy revealed it to be metastatic papillary carcinoma of the thyroid. This case kindles the possibility of using Ga-PSMA PET/CT to reveal occult disease in cases of TENIS.

  15. Risk factors for negative impacts on sexual activity and function in younger breast cancer survivors.

    PubMed

    Lee, Maria; Kim, Yun Hwan; Jeon, Myung Jae

    2015-09-01

    We aim to examine changes in sexual activity and function among younger breast cancer survivors who were sexually active before diagnosis and to investigate risk factors for negative impacts on them. An observational cohort study enrolled 304 premenopausal and sexually active women diagnosed with early stage breast cancer. Questionnaires were completed, and sexual activity was measured at two time points: after surgery, to assess sexual activity and function before diagnosis, and then at least 12 months after the completion of chemotherapy or endocrine therapy. For each domain of the Female Sexual Function Index, a score below 3 was classified as indicative of a sexual problem. Each sexual problem was considered to be dysfunctional if it was associated with distress. The median age at the last survey was 46.0 years (range: 23-57). Of the participants, 35 (11.5%) became sexually inactive after treatment. Among the 269 women who remained sexually active, 31.6% were currently experiencing sexual dysfunction, which was significantly higher compared with the frequency before diagnosis. In the multivariate logistic regression model, chemo-related menopause, thyroid dysfunction, and depression were independent risk factors for sexual inactivity. Chemo-related menopause was a significant risk factor for sexual dysfunction. Chemo-related menopause was significantly associated with both sexual inactivity and dysfunction after treatment. Thyroid dysfunction and depression were risk factors for sexual inactivity in younger breast cancer survivors. Copyright © 2015 John Wiley & Sons, Ltd.

  16. Lung cancer

    MedlinePlus

    Cancer - lung ... lung cancer than of breast, colon, and prostate cancers combined. Lung cancer is more common in older adults. It ... Horn L, Eisenberg R, Gius D, et al. Cancer of the lung: non-small cell lung cancer and small cell ...

  17. Denosumab Injection

    MedlinePlus

    ... to treat bone loss in men with prostate cancer and in women with breast cancer who are receiving certain treatments that increase their ... used to reduce fractures from certain types of cancer that began in another part of the body ...

  18. Patient identification error among prostate needle core biopsy specimens--are we ready for a DNA time-out?

    PubMed

    Suba, Eric J; Pfeifer, John D; Raab, Stephen S

    2007-10-01

    Patient identification errors in surgical pathology often involve switches of prostate or breast needle core biopsy specimens among patients. We assessed strategies for decreasing the occurrence of these uncommon and yet potentially catastrophic events. Root cause analyses were performed following 3 cases of patient identification error involving prostate needle core biopsy specimens. Patient identification errors in surgical pathology result from slips and lapses of automatic human action that may occur at numerous steps during pre-laboratory, laboratory and post-laboratory work flow processes. Patient identification errors among prostate needle biopsies may be difficult to entirely prevent through the optimization of work flow processes. A DNA time-out, whereby DNA polymorphic microsatellite analysis is used to confirm patient identification before radiation therapy or radical surgery, may eliminate patient identification errors among needle biopsies.

  19. Optical Strategies for Studying Metastatic Mechanisms, Tumor Cell Detection and Treatment of Prostate Cancer

    DTIC Science & Technology

    2006-10-01

    Treatment, Photodynamic Therapy, Biological Response 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18 . NUMBER OF PAGES 19a. NAME OF...photodynamic therapy in a rat prostate tumor model. Clin Cancer Res 2005;11:720-7. 18 . Fukumura D, Yuan F, Monsky WL, Chen Y, Jain RK. Effect of host...angiogenesis and microvascular functions in human breast cancer xenografts : Mammary fat pad versus cranial tumors. Clin Cancer Res 2002;8:1008-13. 20. Hasan T

  20. Therapeutic targeting of tumors with imageable GFP-expressing Salmonella typhimurium auxotrophic mutants

    NASA Astrophysics Data System (ADS)

    Hoffman, Robert M.; Hayashi, Katsuhiro; Zhao, Ming

    2008-02-01

    Tumor targeting Salmonella typhimurium has been developed. These bacteria were mutagenized and a strain auxotrophic for leucine and arguine was selected. This strain was also engineered to express GFP. This train, termed A1, could target prostate tumors in nude mouse models and inhibit their growth. A1 was passaged through a tumor and re-isolated and termed A1-R. A1-R had greater antitumor efficacy and could cure breast, prostate, pancreatic, and lung tumors in nude mouse models.

Top