Sample records for breast stem cell

  1. JMJD3 suppresses stem cell-like characteristics in breast cancer cells by downregulation of Oct4 independently of its demethylase activity.

    PubMed

    Xun, Jing; Wang, Dekun; Shen, Long; Gong, Junbo; Gao, Ruifang; Du, Lingfang; Chang, Antao; Song, Xiangrong; Xiang, Rong; Tan, Xiaoyue

    2017-03-28

    Epigenetic regulator JMJD3 plays an important role in both tumor progression and somatic cell reprogramming. Here, we explored the effect of JMJD3 on the stem cell-like characteristics of breast cancer and its underlying mechanism involving stemness-related transcription factor Oct4. Our data revealed that, in breast cancer cells lines and an orthotopic xenograph mouse model of breast cancer, ectopic overexpression of JMJD3 suppressed stem cell-like characteristics of breast cancer cells, whereas knockdown of JMJD3 promoted these characteristics. Oct4 mediated the suppressive effects of JMJD3 on the stemness of breast cancer cells. The inhibitory effect of JMJD3 on Oct4 was independent of demethylase activity, but mediated via degradation of PHF20. Furthermore, we applied an agonist of the vitamin D receptor, paricalcitol, and found that it induced JMJD3 in breast cancer cells. Our data showed that administration of paricalcitol suppressed stem cell-like characteristics and Oct4 expression. Taken together, JMJD3 inhibits the stem cell-like characteristics in breast cancer by suppression of stemness factor Oct4 in a PHF20-dependent manner. Administration of paricalcitol leads to upregulation of JMJD3 that suppresses Oct4 expression and the stem cell-like characteristics in breast cancer.

  2. Transcriptomic profiling of curcumin treated human breast stem cells identifies a role for stearoyl coa-desaturase in breast cancer prevention

    PubMed Central

    Colacino, Justin A.; McDermott, Sean P.; Sartor, Maureen A.; Wicha, Max S.; Rozek, Laura S.

    2017-01-01

    Curcumin is a potential agent for both the prevention and treatment of cancers. Curcumin treatment alone, or in combination with piperine, limits breast stem cell self-renewal while remaining non-toxic to normal differentiated cells. We paired fluorescence activated cell sorting with RNA sequencing to characterize the genome-wide changes induced specifically in normal breast stem cells following treatment with these compounds. We generated genome-wide maps of the transcriptional changes that occur in epithelial-like (ALDH+) and mesenchymal-like (ALDH−/CD44+/CD24−) normal breast stem/progenitor cells following treatment with curcumin and piperine. We show that curcumin targets both stem cell populations by down-regulating expression of breast stem cell genes including ALDH1A3, CD49f, PROM1, and TP63. We also identified novel genes and pathways targeted by curcumin, including downregulation of SCD. Transient siRNA knockdown of SCD in MCF10A cells significantly inhibited mammosphere formation and the mean proportion of CD44+/CD24− cells, suggesting that SCD is a regulator of breast stemness and a target of curcumin in breast stem cells. These findings extend previous reports of curcumin targeting stem cells, here in two phenotypically distinct stem/progenitor populations isolated from normal human breast tissue. We identified novel mechanisms by which curcumin and piperine target breast stem cell self-renewal, such as by targeting lipid metabolism, providing a mechanistic link between curcumin treatment and stem cell self renewal. These results elucidate the mechanisms by which curcumin may act as a cancer preventive compound and provide novel targets for cancer prevention and treatment. PMID:27306423

  3. Transcriptomic profiling of curcumin-treated human breast stem cells identifies a role for stearoyl-coa desaturase in breast cancer prevention.

    PubMed

    Colacino, Justin A; McDermott, Sean P; Sartor, Maureen A; Wicha, Max S; Rozek, Laura S

    2016-07-01

    Curcumin is a potential agent for both the prevention and treatment of cancers. Curcumin treatment alone, or in combination with piperine, limits breast stem cell self-renewal, while remaining non-toxic to normal differentiated cells. We paired fluorescence-activated cell sorting with RNA sequencing to characterize the genome-wide changes induced specifically in normal breast stem cells following treatment with these compounds. We generated genome-wide maps of the transcriptional changes that occur in epithelial-like (ALDH+) and mesenchymal-like (ALDH-/CD44+/CD24-) normal breast stem/progenitor cells following treatment with curcumin and piperine. We show that curcumin targets both stem cell populations by down-regulating expression of breast stem cell genes including ALDH1A3, CD49f, PROM1, and TP63. We also identified novel genes and pathways targeted by curcumin, including downregulation of SCD. Transient siRNA knockdown of SCD in MCF10A cells significantly inhibited mammosphere formation and the mean proportion of CD44+/CD24- cells, suggesting that SCD is a regulator of breast stemness and a target of curcumin in breast stem cells. These findings extend previous reports of curcumin targeting stem cells, here in two phenotypically distinct stem/progenitor populations isolated from normal human breast tissue. We identified novel mechanisms by which curcumin and piperine target breast stem cell self-renewal, such as by targeting lipid metabolism, providing a mechanistic link between curcumin treatment and stem cell self-renewal. These results elucidate the mechanisms by which curcumin may act as a cancer-preventive compound and provide novel targets for cancer prevention and treatment.

  4. Breast Stem Cell Markers and Tumor Stem Cells in BRCA1, BRCA2 and Non-BRCA 1/2 Women

    DTIC Science & Technology

    2006-08-01

    gene mutation often exhibit a basal phenotype that may reflect their origin in the breast stem cell . We therefore hypothesized that the breast stem ...expression of putative stem cell markers and investigated means to derive short-term in vitro cultures. Our preliminary findings indicate that it is... cell pool is aberrant in breast tissue of BRCA1 (or BRCA2)carriers versus noncarriers and that it becomes progressively and distinctively expanded in

  5. Stem-Like Cell Characteristics from Breast Milk of Mothers with Preterm Infants as Compared to Mothers with Term Infants.

    PubMed

    Briere, Carrie-Ellen; Jensen, Todd; McGrath, Jacqueline M; Young, Erin E; Finck, Christine

    2017-04-01

    Breast milk stem cells are hypothesized to be involved in infant health and development. Our research team is the first known team to enroll mothers of hospitalized preterm infants during the first few weeks of lactation and compare stem cell phenotypes and gene expression to mothers of healthy full-term infants. Participants were recruited from a Level IV Neonatal Intensive Care Unit (preterm dyads) and the community (full-term dyads) in the northeastern United States. Mothers of hospitalized preterm infants (<37 weeks gestational age at birth) and mothers of healthy full-term infants (>39 weeks gestational age at birth). Breast milk stem-like cell populations were identified in both preterm and full-term breast milk samples. The data suggest variability in the proportion of stem cell phenotypes present, as well as statistically significant differential expression (both over- and underexpression) of stem cell-specific genetic markers when comparing mothers' milk for preterm and full-term births. Our findings indicate that (1) stem cells are present in preterm breast milk; (2) differential expression of stem cell-specific markers can be detected in preterm and full-term breast milk samples; and (3) the percentage of cells expressing the various stem cell-specific markers differs when preterm and full-term breast milk samples are compared.

  6. Leptin and Adiponectin Modulate the Self-renewal of Normal Human Breast Epithelial Stem Cells.

    PubMed

    Esper, Raymond M; Dame, Michael; McClintock, Shannon; Holt, Peter R; Dannenberg, Andrew J; Wicha, Max S; Brenner, Dean E

    2015-12-01

    Multiple mechanisms are likely to account for the link between obesity and increased risk of postmenopausal breast cancer. Two adipokines, leptin and adiponectin, are of particular interest due to their opposing biologic functions and associations with breast cancer risk. In the current study, we investigated the effects of leptin and adiponectin on normal breast epithelial stem cells. Levels of leptin in human adipose explant-derived conditioned media positively correlated with the size of the normal breast stem cell pool. In contrast, an inverse relationship was found for adiponectin. Moreover, a strong linear relationship was observed between the leptin/adiponectin ratio in adipose conditioned media and breast stem cell self-renewal. Consistent with these findings, exogenous leptin stimulated whereas adiponectin suppressed breast stem cell self-renewal. In addition to local in-breast effects, circulating factors, including leptin and adiponectin, may contribute to the link between obesity and breast cancer. Increased levels of leptin and reduced amounts of adiponectin were found in serum from obese compared with age-matched lean postmenopausal women. Interestingly, serum from obese women increased stem cell self-renewal by 30% compared with only 7% for lean control serum. Taken together, these data suggest a plausible explanation for the obesity-driven increase in postmenopausal breast cancer risk. Leptin and adiponectin may function as both endocrine and paracrine/juxtacrine factors to modulate the size of the normal stem cell pool. Interventions that disrupt this axis and thereby normalize breast stem cell self-renewal could reduce the risk of breast cancer. ©2015 American Association for Cancer Research.

  7. Canonical Wnt Signaling as a Specific Mark of Normal and Tumorigenic Mammary Stem Cells

    DTIC Science & Technology

    2011-02-01

    aggressive mammary tumors. 15. SUBJECT TERMS Breast cancer stem cells, Wnt signaling, canonical Wnt signaling, B-catenin, normal stem cells, adult stem...Wnt pathway is associated with abnormal mouse mammary development, tumorigenesis, and human breast cancer. In addition, increasing evidence suggests...activation occurs in human breast cancer and is required for proliferation of various other stem cell compartments, addressing how Wnt signaling promotes

  8. Mammary Stem Cells and Breast Cancer Stem Cells: Molecular Connections and Clinical Implications.

    PubMed

    Celià-Terrassa, Toni

    2018-05-04

    Cancer arises from subpopulations of transformed cells with high tumor initiation and repopulation ability, known as cancer stem cells (CSCs), which share many similarities with their normal counterparts. In the mammary gland, several studies have shown common molecular regulators between adult mammary stem cells (MaSCs) and breast cancer stem cells (bCSCs). Cell plasticity and self-renewal are essential abilities for MaSCs to maintain tissue homeostasis and regenerate the gland after pregnancy. Intriguingly, these properties are similarly executed in breast cancer stem cells to drive tumor initiation, tumor heterogeneity and recurrence after chemotherapy. In addition, both stem cell phenotypes are strongly influenced by external signals from the microenvironment, immune cells and supportive specific niches. This review focuses on the intrinsic and extrinsic connections of MaSC and bCSCs with clinical implications for breast cancer progression and their possible therapeutic applications.

  9. Generation of Breast Cancer Stem Cells by the EMT

    DTIC Science & Technology

    2009-10-01

    shift in the type of human breast cancer cells. We began to use experimentally immortalized HMLE cells that were then transformed through...Generation of Breast Cancer Stem Cells by the EMT PRINCIPAL INVESTIGATOR: Robert A. Weinberg, Ph.D. CONTRACTING...Generation of Breast Cancer Stem Cells by the EMT 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-08-1-0464 5c. PROGRAM ELEMENT NUMBER 6

  10. [Role of let-7 in maintaining characteristics of breast cancer stem cells].

    PubMed

    Sun, Xin; Fan, Chong; Hu, Li-juan; Du, Ning; Xu, Chong-wen; Ren, Hong

    2012-08-01

    To observe the expression of let-7 in breast cancer stem cells and explore the role of let-7 in maintaining the characteristics of breast cancer stem cells. We separated breast cancer stem cells (SP and NSP) from MCF-7 cell line using SP sorting, and observed the expression of let-7a/b/c on SP and NSP cells using quantitative real-time PCR and the expressions of Ras and ERK using Western blotting to study the mechanism by which let-7 maintains the characteristics of breast cancer stem cells. The SP cells accounted for 3.3% in MCF-7 cells, however, the rate dropped to 0.4% when verapamil was added into the process of seperation. The level of Let-7a/b/c in SP cells were lower than that in NSP cells, and among let-7 miRNAs, let-7b/c showed the most obvious difference. The expressions of t-Ras and t-ERK showed no difference between SP and NSP cells, nevertheless, the expressions of p-Ras, p-ERK were higher in SP cells than in NSP cells. SP sorting is an effective method to separate cancer stem cells. There do exist cancer stem cells in MCF-7 breast cancer cell line. Let-7 is down-regulated in SP cells, and the down-regulation makes let-7 lose the opportunity to restrain Ras mRNA, finally, p-Ras and p-ERK are activated. They play an important role in maintaining the characteristics of breast cancer stem cells.

  11. A differential role for CXCR4 in the regulation of normal versus malignant breast stem cell activity.

    PubMed

    Ablett, Matthew P; O'Brien, Ciara S; Sims, Andrew H; Farnie, Gillian; Clarke, Robert B

    2014-02-15

    C-X-C chemokine receptor type 4 (CXCR4) is known to regulate lung, pancreatic and prostate cancer stem cells. In breast cancer, CXCR4 signalling has been reported to be a mediator of metastasis, and is linked to poor prognosis. However its role in normal and malignant breast stem cell function has not been investigated. Anoikis resistant (AR) cells were collected from immortalised (MCF10A, 226L) and malignant (MCF7, T47D, SKBR3) breast cell lines and assessed for stem cell enrichment versus unsorted cells. AR cells had significantly higher mammosphere forming efficiency (MFE) than unsorted cells. The AR normal cells demonstrated increased formation of 3D structures in Matrigel compared to unsorted cells. In vivo, SKBR3 and T47D AR cells had 7- and 130-fold enrichments for tumour formationrespectively, compared with unsorted cells. AR cells contained significantly elevated CXCR4 transcript and protein levels compared to unsorted cells. Importantly, CXCR4 mRNA was higher in stem cell-enriched CD44+/CD24- patient-derived breast cancer cells compared to non-enriched cells. CXCR4 stimulation by its ligand SDF-1 reduced MFE of the normal breast cells lines but increased the MFE in T47D and patient-derived breast cancer cells. CXCR4 inhibition by AMD3100 increased stem cell activity but reduced the self-renewal capacity of the malignant breast cell line T47D. CXCR4+ FACS sorted MCF7 cells demonstrated a significantly increased MFE compared with CXCR4- cells. This significant increase in MFE was further demonstrated in CXCR4 over-expressing MCF7 cells which also had an increase in self-renewal compared to parental cells. A greater reduction in self-renewal following CXCR4 inhibition in the CXCR4 over-expressing cells compared with parental cells was also observed. Our data establish for the first time that CXCR4 signalling has contrasting effects on normal and malignant breast stem cell activity. Here, we demonstrate that CXCR4 signalling specifically regulates breast cancer stem cell activities and may therefore be important in tumour formation at the sites of metastases.

  12. [Tricostantin A inhibits self-renewal of breast cancer stem cells in vitro].

    PubMed

    Peng, Li; Li, Fu-Xi; Shao, Wen-Feng; Xiong, Jing-Bo

    2013-10-01

    To investigate the effect of tricostantin A (TSA) on self-renewal of breast cancer stem cells and explore the mechanisms. Breast cancer cell lines MDA-MB-468, MDA-MB-231, MCF-7 and SKBR3 were cultured in suspension and treated with different concentrations of TSA for 7 days, using 0.1% DMSO as the control. Secondary mammosphere formation efficiency and percentage of CD44(+)/CD24(-) sub-population in the primary mammospheres were used to evaluate the effects of TSA on self-renewal of breast cancer stem cells. The breast cancer stem cell surface marker CD44(+)/CD24(-) and the percentage of apoptosis in the primary mammospheres were assayed using flow cytometry. The mRNA expressions of Nanog, Sox2 and Oct4 in the primary mammospheres were assayed with quantitative PCR. TSA at both 100 and 500 nmol/L, but not at 10 nmol/L, partially inhibited the self-renewal of breast cancer stem cells from the 4 cell lines. TSA at 500 nmol/L induced cell apoptosis in the primary mammospheres. TSA down-regulated the mRNA expression of Nanog and Sox2 in the primary mammospheres. TSA can partially inhibit the self-renewal of breast cancer stem cells through a mechanism involving the down-regulation of Nanog and Sox2 expression, indicating the value of combined treatments with low-dose TSA and other anticancer drugs to achieve maximum inhibition of breast cancer stem cell self-renewal. The core transcriptional factor of embryonic stem cells Nanog and Sox2 can be potential targets of anticancer therapy.

  13. Of mice and women: a comparative tissue biology perspective of breast stem cells and differentiation.

    PubMed

    Dontu, Gabriela; Ince, Tan A

    2015-06-01

    Tissue based research requires a background in human and veterinary pathology, developmental biology, anatomy, as well as molecular and cellular biology. This type of comparative tissue biology (CTB) expertise is necessary to tackle some of the conceptual challenges in human breast stem cell research. It is our opinion that the scarcity of CTB expertise contributed to some erroneous interpretations in tissue based research, some of which are reviewed here in the context of breast stem cells. In this article we examine the dissimilarities between mouse and human mammary tissue and suggest how these may impact stem cell studies. In addition, we consider the differences between breast ducts vs. lobules and clarify how these affect the interpretation of results in stem cell research. Lastly, we introduce a new elaboration of normal epithelial cell types in human breast and discuss how this provides a clinically useful basis for breast cancer classification.

  14. Canonical Wnt Signaling as a Specific Marker of Normal and Tumorigenic Mammary Stem Cells

    DTIC Science & Technology

    2010-02-01

    for mammary stem cells and be a target for transformation that results in the formation of aggressive mammary tumors. Breast cancer stem cells, Wnt...tumorigenesis, and human breast cancer. In addition, increasing evidence suggests that tumors arise from either normal stem or progenitor cells...population of mammary tumor cells that are CD24+/CD49++. Since Wnt pathway activation occurs in human breast cancer and is required for

  15. Glioma-Associated Oncogene Homolog Inhibitors Have the Potential of Suppressing Cancer Stem Cells of Breast Cancer.

    PubMed

    Jeng, Kuo-Shyang; Jeng, Chi-Juei; Sheen, I-Shyan; Wu, Szu-Hua; Lu, Ssu-Jung; Wang, Chih-Hsuan; Chang, Chiung-Fang

    2018-05-05

    Overexpression of Sonic Hedgehog signaling (Shh) pathway molecules is associated with invasiveness and recurrence in breast carcinoma. Therefore, inhibition of the Shh pathway downstream molecule Glioma-associated Oncogene Homolog (Gli) was investigated for its ability to reduce progression and invasiveness of patient-derived breast cancer cells and cell lines. Human primary breast cancer T2 cells with high expression of Shh signaling pathway molecules were compared with breast cancer line MDA-MB-231 cells. The therapeutic effects of Gli inhibitors were examined in terms of the cell proliferation, apoptosis, cancer stem cells, cell migration and gene expression. Blockade of the Shh signaling pathway could reduce cell proliferation and migration only in MDA-MB-231 cells. Hh pathway inhibitor-1 (HPI-1) increased the percentages of late apoptotic cells in MDA-MB-231 cells and early apoptotic cells in T2 cells. It reduced Bcl2 expression for cell proliferation and increased Bim expression for apoptosis. In addition, Gli inhibitor HPI-1 decreased significantly the percentages of cancer stem cells in T2 cells. HPI-1 worked more effectively than GANT-58 against breast carcinoma cells. In conclusion, HPI-1 could inhibit cell proliferation, reduce cell invasion and decrease cancer stem cell population in breast cancer cells. To target Gli-1 could be a potential strategy to suppress breast cancer stem cells.

  16. Vitamin D compounds inhibit cancer stem-like cells and induce differentiation in triple negative breast cancer.

    PubMed

    Shan, Naing Lin; Wahler, Joseph; Lee, Hong Jin; Bak, Min Ji; Gupta, Soumyasri Das; Maehr, Hubert; Suh, Nanjoo

    2017-10-01

    Triple-negative breast cancer is one of the least responsive breast cancer subtypes to available targeted therapies due to the absence of hormonal receptors, aggressive phenotypes, and the high rate of relapse. Early breast cancer prevention may therefore play an important role in delaying the progression of triple-negative breast cancer. Cancer stem cells are a subset of cancer cells that are thought to be responsible for tumor progression, treatment resistance, and metastasis. We have previously shown that vitamin D compounds, including a Gemini vitamin D analog BXL0124, suppress progression of ductal carcinoma in situ in vivo and inhibit cancer stem-like cells in MCF10DCIS mammosphere cultures. In the present study, the effects of vitamin D compounds in regulating breast cancer stem-like cells and differentiation in triple-negative breast cancer were assessed. Mammosphere cultures, which enriches for breast cancer cells with stem-like properties, were used to assess the effects of 1α,25(OH) 2 D 3 and BXL0124 on cancer stem cell markers in the triple-negative breast cancer cell line, SUM159. Vitamin D compounds significantly reduced the mammosphere forming efficiency in primary, secondary and tertiary passages of mammospheres compared to control groups. Key markers of cancer stem-like phenotype and pluripotency were analyzed in mammospheres treated with 1α,25(OH) 2 D 3 and BXL0124. As a result, OCT4, CD44 and LAMA5 levels were decreased. The vitamin D compounds also down-regulated the Notch signaling molecules, Notch1, Notch2, Notch3, JAG1, JAG2, HES1 and NFκB, which are involved in breast cancer stem cell maintenance. In addition, the vitamin D compounds up-regulated myoepithelial differentiating markers, cytokeratin 14 and smooth muscle actin, and down-regulated the luminal marker, cytokeratin 18. Cytokeratin 5, a biomarker associated with basal-like breast cancer, was found to be significantly down-regulated by the vitamin D compounds. These results suggest that vitamin D compounds may serve as potential preventive agents to inhibit triple negative breast cancer by regulating cancer stem cells and differentiation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Doxycycline inhibits the cancer stem cell phenotype and epithelial-to-mesenchymal transition in breast cancer.

    PubMed

    Zhang, Le; Xu, Liang; Zhang, Fengchun; Vlashi, Erina

    2017-04-18

    Experimental evidence suggest that breast tumors originate from breast cancer stem cells (BCSCs), and that mitochondrial biogenesis is essential for the anchorage-independent clonal expansion and survival of CSCs, thus rendering mitochondria a significant target for novel treatment approaches. One of the recognized side effects of the FDA-approved drug, doxycycline is the inhibition of mitochondrial biogenesis. Here we investigate the mechanism by which doxycycline exerts its inhibitory effects on the properties of breast cancer cells and BCSCs, such as mammosphere forming efficiency, invasion, migration, apoptosis, the expression of stem cell markers and epithelial-to-mesenchymal transition (EMT) related markers of breast cancer cells. In addition, we explored whether autophagy plays a role in the inhibitory effect of doxycycline on breast cancer cells. We find that doxycyline can inhibit the viability and proliferation of breast cancer cells and BCSCs, decrease mammosphere forming efficiency, migration and invasion, and EMT of breast cancer cells. Expression of stem cell factors Oct4, Sox2, Nanog and CD44 were also significantly downregulated after doxycycline treatment. Moreover, doxycycline could down-regulate the expression of the autophagy marker LC-3BI and LC-3BII, suggesting that inhibiting autophagy may be responsible in part for the observed effects on proliferation, EMT and stem cell markers. The potent inhibition of EMT and cancer stem-like characteristics in breast cancer cells by doxycycline treatment suggests that this drug can be repurposed as an anti-cancer drug in the treatment of breast cancer patients in the clinic.

  18. Doxycycline inhibits the cancer stem cell phenotype and epithelial-to-mesenchymal transition in breast cancer

    PubMed Central

    Xu, Liang; Zhang, Fengchun; Vlashi, Erina

    2017-01-01

    ABSTRACT Experimental evidence suggest that breast tumors originate from breast cancer stem cells (BCSCs), and that mitochondrial biogenesis is essential for the anchorage-independent clonal expansion and survival of CSCs, thus rendering mitochondria a significant target for novel treatment approaches. One of the recognized side effects of the FDA-approved drug, doxycycline is the inhibition of mitochondrial biogenesis. Here we investigate the mechanism by which doxycycline exerts its inhibitory effects on the properties of breast cancer cells and BCSCs, such as mammosphere forming efficiency, invasion, migration, apoptosis, the expression of stem cell markers and epithelial-to-mesenchymal transition (EMT) related markers of breast cancer cells. In addition, we explored whether autophagy plays a role in the inhibitory effect of doxycycline on breast cancer cells. We find that doxycyline can inhibit the viability and proliferation of breast cancer cells and BCSCs, decrease mammosphere forming efficiency, migration and invasion, and EMT of breast cancer cells. Expression of stem cell factors Oct4, Sox2, Nanog and CD44 were also significantly downregulated after doxycycline treatment. Moreover, doxycycline could down-regulate the expression of the autophagy marker LC-3BI and LC-3BII, suggesting that inhibiting autophagy may be responsible in part for the observed effects on proliferation, EMT and stem cell markers. The potent inhibition of EMT and cancer stem-like characteristics in breast cancer cells by doxycycline treatment suggests that this drug can be repurposed as an anti-cancer drug in the treatment of breast cancer patients in the clinic. PMID:27753527

  19. Midbody Accumulation in Breast Cancer Stem Cells

    DTIC Science & Technology

    2011-08-01

    transit amplifying or differentiating cells. These results suggest that MBds are in almost exclusively in stem cells and putative breast cancer stem...confer tumor-like properties to these cells. We were unable to establish GFP-MKLP1 breast cancer cell lines for this analysis for some reason that we...and nonpolarized cells (Fig. 1c, d). Immuno- electron microscopy confirmed this localization and revealed ultrastructural features characteristic of

  20. Application of stem cells in targeted therapy of breast cancer: a systematic review.

    PubMed

    Madjd, Zahra; Gheytanchi, Elmira; Erfani, Elham; Asadi-Lari, Mohsen

    2013-01-01

    The aim of this systematic review was to investigate whether stem cells could be effectively applied in targeted therapy of breast cancer. A systematic literature search was performed for original articles published from January 2007 until May 2012. Nine studies met the inclusion criteria for phase I or II clinical trials, of which three used stem cells as vehicles, two trials used autologous hematopoetic stem cells and in four trials cancer stem cells were targeted. Mesenchymal stem cells (MSCs) were applied as cellular vehicles to transfer therapeutic agents. Cell therapy with MSC can successfully target resistant cancers. Cancer stem cells were selectively targeted via a proteasome-dependent suicide gene leading to tumor regression. Wnt/β-catenin signaling pathway has been also evidenced to be an attractive CSC-target. This systematic review focused on two different concepts of stem cells and breast cancer marking a turning point in the trials that applied stem cells as cellular vehicles for targeted delivery therapy as well as CSC-targeted therapies. Applying stem cells as targeted therapy could be an effective therapeutic approach for treatment of breast cancer in the clinic and in therapeutic marketing; however this needs to be confirmed with further clinical investigations.

  1. Role of microRNA221 in regulating normal mammary epithelial hierarchy and breast cancer stem-like cells.

    PubMed

    Ke, Jia; Zhao, Zhiju; Hong, Su-Hyung; Bai, Shoumin; He, Zhen; Malik, Fayaz; Xu, Jiahui; Zhou, Lei; Chen, Weilong; Martin-Trevino, Rachel; Wu, Xiaojian; Lan, Ping; Yi, Yongju; Ginestier, Christophe; Ibarra, Ingrid; Shang, Li; McDermott, Sean; Luther, Tahra; Clouthier, Shawn G; Wicha, Max S; Liu, Suling

    2015-02-28

    Increasing evidence suggests that lineage specific subpopulations and stem-like cells exist in normal and malignant breast tissues. Epigenetic mechanisms maintaining this hierarchical homeostasis remain to be investigated. In this study, we found the level of microRNA221 (miR-221) was higher in stem-like and myoepithelial cells than in luminal cells isolated from normal and malignant breast tissue. In normal breast cells, over-expression of miR-221 generated more myoepithelial cells whereas knock-down of miR-221 increased luminal cells. Over-expression of miR-221 stimulated stem-like cells in luminal type of cancer and the miR-221 level was correlated with clinical outcome in breast cancer patients. Epithelial-mesenchymal transition (EMT) was induced by overexpression of miR-221 in normal and breast cancer cells. The EMT related gene ATXN1 was found to be a miR-221 target gene regulating breast cell hierarchy. In conclusion, we propose that miR-221 contributes to lineage homeostasis of normal and malignant breast epithelium.

  2. Ell3 stimulates proliferation, drug resistance, and cancer stem cell properties of breast cancer cells via a MEK/ERK-dependent signaling pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahn, Hee-Jin; Kim, Gwangil; Park, Kyung-Soon, E-mail: kspark@cha.ac.kr

    2013-08-09

    Highlights: •Ell3 enhances proliferation and drug resistance of breast cancer cell lines. •Ell3 is related to the cancer stem cell characteristics of breast cancer cell lines. •Ell3 enhances oncogenicity of breast cancer through the ERK1/2 signaling pathway. -- Abstract: Ell3 is a RNA polymerase II transcription elongation factor that is enriched in testis. The C-terminal domain of Ell3 shows strong similarities to that of Ell (eleven−nineteen lysine-rich leukemia gene), which acts as a negative regulator of p53 and regulates cell proliferation and survival. Recent studies in our laboratory showed that Ell3 induces the differentiation of mouse embryonic stem cells bymore » protecting differentiating cells from apoptosis via the promotion of p53 degradation. In this study, we evaluated the function of Ell3 in breast cancer cell lines. MCF-7 cell lines overexpressing Ell3 were used to examine cell proliferation and cancer stem cell properties. Ectopic expression of Ell3 in breast cancer cell lines induces proliferation and 5-FU resistance. In addition, Ell3 expression increases the cancer stem cell population, which is characterized by CD44 (+) or ALDH1 (+) cells. Mammosphere-forming potential and migration ability were also increased upon Ell3 expression in breast cancer cell lines. Through biochemical and molecular biological analyses, we showed that Ell3 regulates proliferation, cancer stem cell properties and drug resistance in breast cancer cell lines partly through the MEK−extracellular signal-regulated kinase signaling pathway. Murine xenograft experiments showed that Ell3 expression promotes tumorigenesis in vivo. These results suggest that Ell3 may play a critical role in promoting oncogenesis in breast cancer by regulating cell proliferation and cancer stem cell properties via the ERK1/2 signaling pathway.« less

  3. Evaluation of Melatonin Effect on Human Breast Cancer Stem Cells Using a Threedimensional Growth Method of Mammospheres.

    PubMed

    Lopes, Juliana Ramos; da Silva Kavagutti, Mayume; de Medeiros, Felipe Arthur Faustino; de Campos Zuccari, Debora Aparecida Pires

    2017-01-01

    The high rates of women&#039;s death from breast cancer occur due to acquired resistance by patients to certain treatments, enabling the recurrence and/or tumor growth, invasion and metastasis. It has been demonstrated that the presence of cancer stem cells in human tumors, as responsible for recurrence and resistance to therapy. Studies have identified OCT4 as responsible for self-renewal and maintenance of pluripotency of stem cells. Thus, it is interesting to study potential drugs that target this specific population in breast cancer. Melatonin, appears to have oncostatic effects on cancer cells, however, little is known about its therapeutic effect on cancer stem cells. Evaluate the viability and the expression of OCT4 in breast cancer stem cells, MCF-7 and MDA-MB- 231, after melatonin treatment. The cells were grown in a 3-dimensional model of mammospheres, representing the breast cancer stem cell population and treated or not with melatonin. The cell viability of mammospheres were evaluated by MTT assay and the OCT4 expression, a cancer stem cells marker, was verified by immunocitochemistry. Our results demonstrated that the melatonin treatment decreased the cell viability of MCF-7 and MDAMB- 231 mammospheres. Furthermore, it was observed that in both cell lines, the expression of OCT4 was decreased in melatonin-treated cells compared to the control group. This fact suggests that melatonin is effective against breast cancer stem cells inhibiting the cell viability via OCT 4. Based on that, we believe that melatonin has a high potential to be used as an alternative treatment for breast cancer. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  4. Curcumin targets breast cancer stem-like cells with microtentacles that persist in mammospheres and promote reattachment

    PubMed Central

    Charpentier, Monica S.; Whipple, Rebecca A.; Vitolo, Michele I.; Boggs, Amanda E.; Slovic, Jana; Thompson, Keyata N.; Bhandary, Lekhana; Martin, Stuart S.

    2014-01-01

    Cancer stem-like cells (CSC) and circulating tumor cells (CTCs) have related properties associated with distant metastasis, but the mechanisms through which CSCs promote metastasis are unclear. In this study, we report that breast cancer cell lines with more stem-like properties display higher levels of microtentacles (McTNs), a type of tubulin-based protrusion of the plasma cell membrane which forms on detached or suspended cells and aid in cell reattachment. We hypothesized that CSCs with large numbers of McTNs would more efficiently attach to distant tissues, promoting metastatic efficiency. The naturally occurring stem-like subpopulation of the HMLE breast cell line presents increased McTNs compared to its isogenic non-stem-like subpopulation. This increase was supported by elevated α-tubulin detyrosination and vimentin protein levels and organization. Increased McTNs in stem-like HMLEs promoted a faster initial reattachment of suspended cells that was inhibited by the tubulin-directed drug, colchicine, confirming a functional role for McTN in stem cell reattachment. Moreover, live cell confocal microscopy showed that McTN persist in breast stem cell mammospheres as flexible, motile protrusions on the surface of the mammosphere. While exposed to the environment, they also function as extensions between adjacent cells along cell-cell junctions. We found that treatment with the breast CSC-targeting compound curcumin rapidly extinguished McTN in breast CSC, preventing reattachment from suspension. Together, our results support a model in which breast CSCs with cytoskeletal alterations that promote McTN can mediate attachment and metastasis but might be targeted by curcumin as an anti-metastatic strategy. PMID:24371229

  5. Breast cancer subtypes: two decades of journey from cell culture to patients.

    PubMed

    Zhao, Xiangshan; Gurumurthy, Channabasavaiah Basavaraju; Malhotra, Gautam; Mirza, Sameer; Mohibi, Shakur; Bele, Aditya; Quinn, Meghan G; Band, Hamid; Band, Vimla

    2011-01-01

    Recent molecular profiling has identified six major subtypes of breast cancers that exhibit different survival outcomes for patients. To address the origin of different subtypes of breast cancers, we have now identified, isolated, and immortalized (using hTERT) mammary stem/progenitor cells which maintain their stem/progenitor properties even after immortalization. Our decade long research has shown that these stem/progenitor cells are highly susceptible to oncogenesis. Given the emerging evidence that stem/progenitor cells are precursors of cancers and that distinct subtypes of breast cancer have different survival outcome, these cellular models provide novel tools to understand the oncogenic process leading to various subtypes of breast cancers and for future development of novel therapeutic strategies to treat different subtypes of breast cancers.

  6. Identification of Metastatic Tumor Stem Cell

    DTIC Science & Technology

    2010-09-01

    addition to a tumor stem cell , an existence of a metastatic stem cell is predicted. Despite the critical importance of the concept, this idea has not been...isolating stem cell population from a unique set of breast tumor cell lines and by examining their metastatic behavior in an animal model. The overall...will (i) isolate stem - cell population from non-metastatic and metastatic cells of a pair of syngenic breast tumor cell lines, and test their metastatic

  7. A Unique Opportunity To Test Whether Cell Fusion Is a Mechanism of Breast Cancer Metastasis

    DTIC Science & Technology

    2016-08-01

    mesenchymal stem cells are a potent fusion partner for breast cancer cells ...and hematopoietic stem cells were enriched. In addition, human mesenchymal stem cells were obtained from bone marrow. 2   Table 1...adherent cell types – mesenchymal stem cells and epithelial cell types. Thus, MSCs were mixed with each epithelial cell type  (i.e. MSCs with

  8. Drug Screening Identifies Niclosamide as an Inhibitor of Breast Cancer Stem-Like Cells

    PubMed Central

    Wang, Yu-Chi; Chao, Tai-Kuang; Chang, Cheng-Chang; Yo, Yi-Te; Yu, Mu-Hsien; Lai, Hung-Cheng

    2013-01-01

    The primary cause of death from breast cancer is the progressive growth of tumors and resistance to conventional therapies. It is currently believed that recurrent cancer is repopulated according to a recently proposed cancer stem cell hypothesis. New therapeutic strategies that specifically target cancer stem-like cells may represent a new avenue of cancer therapy. We aimed to discover novel compounds that target breast cancer stem-like cells. We used a dye-exclusion method to isolate side population (SP) cancer cells and, subsequently, subjected these SP cells to a sphere formation assay to generate SP spheres (SPS) from breast cancer cell lines. Surface markers, stemness genes, and tumorigenicity were used to test stem properties. We performed a high-throughput drug screening using these SPS. The effects of candidate compounds were assessed in vitro and in vivo. We successfully generated breast cancer SPS with stem-like properties. These SPS were enriched for CD44high (2.8-fold) and CD24low (4-fold) cells. OCT4 and ABCG2 were overexpressed in SPS. Moreover, SPS grew tumors at a density of 103, whereas an equivalent number of parental cells did not initiate tumor formation. A clinically approved drug, niclosamide, was identified from the LOPAC chemical library of 1,258 compounds. Niclosamide downregulated stem pathways, inhibited the formation of spheroids, and induced apoptosis in breast cancer SPS. Animal studies also confirmed this therapeutic effect. The results of this proof-of-principle study may facilitate the development of new breast cancer therapies in the near future. The extension of niclosamide clinical trials is warranted. PMID:24058587

  9. Breast Cancer Subtypes: Two decades of Journey from Cell Culture to Patients

    PubMed Central

    Zhao, Xiangshan; Gurumurthy, Channabasavaiah Basavaraju; Malhotra, Gautam; Mirza, Sameer; Mohibi, Shakur; Bele, Aditya; Quinn, Meghan G; Band, Hamid; Band, Vimla

    2014-01-01

    Breast cancer remains the second leading cause of cancer-related deaths among women. Clinically breast cancer patients present with distinct diseases with vastly different outcomes. Recent molecular profiling has identified five major subtypes of breast cancers. Importantly, survival analyses have shown significantly different outcomes for patients belonging to various subgroups. These studies strongly support the idea that breast tumor subtypes may represent malignancies of biologically distinct cell types producing distinct disease entities that may also require different treatment strategies. Alternatively, different types of breast cancers may arise from a common precursor based on oncogene-driven reprogramming. Experimental systems that clearly define cancer cell heterogeneity and link this process to cancer stem/progenitor cells have not been developed. It is also unclear if oncogenic transformation of committed progenitors drives them along their committed pathway, and hence the cell of origin determines the histological features of breast cancer, or if different oncogenic pathways can transform the same precursor along distinct phenotypes. One major hurdle to addressing these fundamental questions about the origin and heterogeneity of human breast cancer is the lack of immortal human stem/progenitor cells that could be interrogated with breast cancer-relevant oncogenesis protocols. We have now identified, isolated and immortalized (using hTERT) such mammary stem/progenitor cells that are immortal and still maintain their progenitor/stem cell properties (self-renewal and differentiation into myoepithelial and luminal cells). Our research using these progenitor/stem cells that are highly susceptible to oncogenesis and various models of mammary cell immortalization has allowed us to define several novel cellular pathways and demonstration of their involvement in oncogenesis and breast cancer progression. Given the emerging evidence that stem/progenitor cells are precursors of cancers and distinct subtypes of breast cancer have different survival outcome, these studies are timely and carry the potential of developing novel therapeutics in the future as well as provide potentially novel markers for diagnostic/prognostic use in breast cancer. PMID:21901624

  10. Targeting Cell Polarity Machinery to Exhaust Breast Cancer Stem Cells

    DTIC Science & Technology

    2016-10-01

    AWARD NUMBER: W81XWH-15-1-0644 TITLE: Targeting Cell Polarity Machinery to Exhaust Breast Cancer Stem Cells PRINCIPAL INVESTIGATOR: Chun-Ju...U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland 21702-5012 DISTRIBUTION STATEMENT: Approved for Public Release...Targeting Cell Polarity Machinery to Exhaust Breast Cancer Stem Cells 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-15-1-0644 5c. PROGRAM ELEMENT

  11. Endothelial induced EMT in breast epithelial cells with stem cell properties.

    PubMed

    Sigurdsson, Valgardur; Hilmarsdottir, Bylgja; Sigmundsdottir, Hekla; Fridriksdottir, Agla J R; Ringnér, Markus; Villadsen, Rene; Borg, Ake; Agnarsson, Bjarni A; Petersen, Ole William; Magnusson, Magnus K; Gudjonsson, Thorarinn

    2011-01-01

    Epithelial to mesenchymal transition (EMT) is a critical event in cancer progression and is closely linked to the breast epithelial cancer stem cell phenotype. Given the close interaction between the vascular endothelium and cancer cells, especially at the invasive front, we asked whether endothelial cells might play a role in EMT. Using a 3D culture model we demonstrate that endothelial cells are potent inducers of EMT in D492 an immortalized breast epithelial cell line with stem cell properties. Endothelial induced mesenchymal-like cells (D492M) derived from D492, show reduced expression of keratins, a switch from E-Cadherin (E-Cad) to N-Cadherin (N-Cad) and enhanced migration. Acquisition of cancer stem cell associated characteristics like increased CD44(high)/CD24(low) ratio, resistance to apoptosis and anchorage independent growth was also seen in D492M cells. Endothelial induced EMT in D492 was partially blocked by inhibition of HGF signaling. Basal-like breast cancer, a vascular rich cancer with stem cell properties and adverse prognosis has been linked with EMT. We immunostained several basal-like breast cancer samples for endothelial and EMT markers. Cancer cells close to the vascular rich areas show no or decreased expression of E-Cad and increased N-Cad expression suggesting EMT. Collectively, we have shown in a 3D culture model that endothelial cells are potent inducers of EMT in breast epithelial cells with stem cell properties. Furthermore, we demonstrate that basal-like breast cancer contains cells with an EMT phenotype, most prominently close to vascular rich areas of these tumors. We conclude that endothelial cells are potent inducers of EMT and may play a role in progression of basal-like breast cancer.

  12. Endothelial Induced EMT in Breast Epithelial Cells with Stem Cell Properties

    PubMed Central

    Sigurdsson, Valgardur; Hilmarsdottir, Bylgja; Sigmundsdottir, Hekla; Fridriksdottir, Agla J. R.; Ringnér, Markus; Villadsen, Rene; Borg, Ake; Agnarsson, Bjarni A.; Petersen, Ole William; Magnusson, Magnus K.; Gudjonsson, Thorarinn

    2011-01-01

    Epithelial to mesenchymal transition (EMT) is a critical event in cancer progression and is closely linked to the breast epithelial cancer stem cell phenotype. Given the close interaction between the vascular endothelium and cancer cells, especially at the invasive front, we asked whether endothelial cells might play a role in EMT. Using a 3D culture model we demonstrate that endothelial cells are potent inducers of EMT in D492 an immortalized breast epithelial cell line with stem cell properties. Endothelial induced mesenchymal-like cells (D492M) derived from D492, show reduced expression of keratins, a switch from E-Cadherin (E-Cad) to N-Cadherin (N-Cad) and enhanced migration. Acquisition of cancer stem cell associated characteristics like increased CD44high/CD24low ratio, resistance to apoptosis and anchorage independent growth was also seen in D492M cells. Endothelial induced EMT in D492 was partially blocked by inhibition of HGF signaling. Basal-like breast cancer, a vascular rich cancer with stem cell properties and adverse prognosis has been linked with EMT. We immunostained several basal-like breast cancer samples for endothelial and EMT markers. Cancer cells close to the vascular rich areas show no or decreased expression of E-Cad and increased N-Cad expression suggesting EMT. Collectively, we have shown in a 3D culture model that endothelial cells are potent inducers of EMT in breast epithelial cells with stem cell properties. Furthermore, we demonstrate that basal-like breast cancer contains cells with an EMT phenotype, most prominently close to vascular rich areas of these tumors. We conclude that endothelial cells are potent inducers of EMT and may play a role in progression of basal-like breast cancer. PMID:21915264

  13. Sensitivity of Breast Cancer Stem Cells to TRA-8 Anti-DR5 Monoclonal Antibody

    DTIC Science & Technology

    2013-02-01

    1 AD_________________ Award Number: W81XWH-11-1-0151 TITLE: Sensitivity of Breast Cancer Stem Cells to TRA-8 Anti-DR5...Annual Summary 3. DATES COVERED 15-January-2012 – 14-January-2013 4. TITLE AND SUBTITLE Sensitivity of Breast Cancer Stem Cells to TRA-8 Anti-DR5...release; distribution unlimited 13. SUPPLEMENTARY NOTES 14. ABSTRACT Basal-like breast cancers (BLBCs) generally become resistant to

  14. Promotion of Tumor-Initiating Cells in Primary and Recurrent Breast Tumors

    DTIC Science & Technology

    2014-10-01

    confer stemness . We hypothesize that inhibition of IKK/NF-κB will reduce or eliminate breast camcer TICs, blocking tumorigenesis. Furthermore, we...Korkaya H, Liu S, Wicha MS. Breast cancer stem cells, cytokine networks, and the tumor microenvironment. J Clin Invest. 2011 Oct;121(10):3804-9. Review...cells and sub- population of cells termed cancer stem cells or tumor-initiating cells (TICs).1 The primary characteristic of TICs is their ability to

  15. Curcumin targets breast cancer stem-like cells with microtentacles that persist in mammospheres and promote reattachment.

    PubMed

    Charpentier, Monica S; Whipple, Rebecca A; Vitolo, Michele I; Boggs, Amanda E; Slovic, Jana; Thompson, Keyata N; Bhandary, Lekhana; Martin, Stuart S

    2014-02-15

    Cancer stem-like cells (CSC) and circulating tumor cells (CTC) have related properties associated with distant metastasis, but the mechanisms through which CSCs promote metastasis are unclear. In this study, we report that breast cancer cell lines with more stem-like properties display higher levels of microtentacles (McTN), a type of tubulin-based protrusion of the plasma cell membrane that forms on detached or suspended cells and aid in cell reattachment. We hypothesized that CSCs with large numbers of McTNs would more efficiently attach to distant tissues, promoting metastatic efficiency. The naturally occurring stem-like subpopulation of the human mammary epithelial (HMLE) cell line presents increased McTNs compared with its isogenic non-stem-like subpopulation. This increase was supported by elevated α-tubulin detyrosination and vimentin protein levels and organization. Increased McTNs in stem-like HMLEs promoted a faster initial reattachment of suspended cells that was inhibited by the tubulin-directed drug, colchicine, confirming a functional role for McTNs in stem cell reattachment. Moreover, live-cell confocal microscopy showed that McTNs persist in breast stem cell mammospheres as flexible, motile protrusions on the surface of the mammosphere. Although exposed to the environment, they also function as extensions between adjacent cells along cell-cell junctions. We found that treatment with the breast CSC-targeting compound curcumin rapidly extinguished McTN in breast CSC, preventing reattachment from suspension. Together, our results support a model in which breast CSCs with cytoskeletal alterations that promote McTNs can mediate attachment and metastasis but might be targeted by curcumin as an antimetastatic strategy. ©2013 AACR.

  16. The Role of SIRT1 in Breast Cancer Stem Cells

    DTIC Science & Technology

    2014-07-01

    Stem cell markers, SOX-2 and Nanog, are significantly decreased in SIRT1 inhibitor treated cancer cells by qRT-PCR and western blot in T47D cell line...cells. Immunohistochemistry performed on breast cancer specimens shows the correlation between cancer stem cell markers and SIRT1 overexpression. SIRT1

  17. Molecular biology of breast cancer stem cells: potential clinical applications.

    PubMed

    Nguyen, Nam P; Almeida, Fabio S; Chi, Alex; Nguyen, Ly M; Cohen, Deirdre; Karlsson, Ulf; Vinh-Hung, Vincent

    2010-10-01

    Breast cancer stem cells (CSC) have been postulated recently as responsible for failure of breast cancer treatment. The purpose of this study is to review breast CSCs molecular biology with respect to their mechanism of resistance to conventional therapy, and to develop treatment strategies that may improve survival of breast cancer patients. A literature search has identified in vitro and in vivo studies of breast CSCs. Breast CSCs overexpress breast cancer resistance protein (BCRP) which allows cancer cells to transport actively chemotherapy agents out of the cells. Radioresistance is modulated through activation of Wnt signaling pathway and overexpression of genes coding for glutathione. Lapatinib can selectively target HER-2 positive breast CSCs and improves disease-free survival in these patients. Metformin may target basal type breast CSCs. Parthenolide and oncolytic viruses are promising targeting agents for breast CSCs. Future clinical trials for breast cancer should include anti-cancer stem cells targeting agents in addition to conventional chemotherapy. Hypofractionation radiotherapy may be indicated for residual disease post chemotherapy. 2010 Elsevier Ltd. All rights reserved.

  18. Peroxisome Proliferator Activated Receptor-α/Hypoxia Inducible Factor-1α Interplay Sustains Carbonic Anhydrase IX and Apoliprotein E Expression in Breast Cancer Stem Cells

    PubMed Central

    Papi, Alessio; Storci, Gianluca; Guarnieri, Tiziana; De Carolis, Sabrina; Bertoni, Sara; Avenia, Nicola; Sanguinetti, Alessandro; Sidoni, Angelo; Santini, Donatella; Ceccarelli, Claudio; Taffurelli, Mario; Orlandi, Marina; Bonafé, Massimiliano

    2013-01-01

    Aims Cancer stem cell biology is tightly connected to the regulation of the pro-inflammatory cytokine network. The concept of cancer stem cells “inflammatory addiction” leads to envisage the potential role of anti-inflammatory molecules as new anti-cancer targets. Here we report on the relationship between nuclear receptors activity and the modulation of the pro-inflammatory phenotype in breast cancer stem cells. Methods Breast cancer stem cells were expanded as mammospheres from normal and tumor human breast tissues and from tumorigenic (MCF7) and non tumorigenic (MCF10) human breast cell lines. Mammospheres were exposed to the supernatant of breast tumor and normal mammary gland tissue fibroblasts. Results In mammospheres exposed to the breast tumor fibroblasts supernatant, autocrine tumor necrosis factor-α signalling engenders the functional interplay between peroxisome proliferator activated receptor-α and hypoxia inducible factor-1α (PPARα/HIF1α). The two proteins promote mammospheres formation and enhance each other expression via miRNA130b/miRNA17-5p-dependent mechanism which is antagonized by PPARγ. Further, the PPARα/HIF1α interplay regulates the expression of the pro-inflammatory cytokine interleukin-6, the hypoxia survival factor carbonic anhydrase IX and the plasma lipid carrier apolipoprotein E. Conclusion Our data demonstrate the importance of exploring the role of nuclear receptors (PPARα/PPARγ) in the regulation of pro-inflammatory pathways, with the aim to thwart breast cancer stem cells functioning. PMID:23372804

  19. Unravelling the mystery of stem/progenitor cells in human breast milk.

    PubMed

    Fan, Yiping; Chong, Yap Seng; Choolani, Mahesh A; Cregan, Mark D; Chan, Jerry K Y

    2010-12-28

    Mammary stem cells have been extensively studied as a system to delineate the pathogenesis and treatment of breast cancer. However, research on mammary stem cells requires tissue biopsies which limit the quantity of samples available. We have previously identified putative mammary stem cells in human breast milk, and here, we further characterised the cellular component of human breast milk. We identified markers associated with haemopoietic, mesenchymal and neuro-epithelial lineages in the cellular component of human breast milk. We found 2.6 ± 0.8% (mean ± SEM) and 0.7 ± 0.2% of the whole cell population (WCP) were found to be CD133+ and CD34+ respectively, 27.8 ± 9.1% of the WCP to be positive for Stro-1 through flow-cytometry. Expressions of neuro-ectodermal stem cell markers such as nestin and cytokeratin 5 were found through reverse-transcription polymerase chain reaction (RT-PCR), and in 4.17 ± 0.2% and 0.9 ± 0.2% of the WCP on flow-cytometry. We also established the presence of a side-population (SP) (1.8 ± 0.4% of WCP) as well as CD133+ cells (1.7 ± 0.5% of the WCP). Characterisation of the sorted SP and non-SP, CD133+ and CD133- cells carried out showed enrichment of CD326 (EPCAM) in the SP cells (50.6 ± 8.6 vs 18.1 ± 6.0, P-value  = 0.02). However, culture in a wide range of in vitro conditions revealed the atypical behaviour of stem/progenitor cells in human breast milk; in that if they are present, they do not respond to established culture protocols of stem/progenitor cells. The identification of primitive cell types within human breast milk may provide a non-invasive source of relevant mammary cells for a wide-range of applications; even the possibility of banking one's own stem cell for every breastfeeding woman.

  20. Unravelling the Mystery of Stem/Progenitor Cells in Human Breast Milk

    PubMed Central

    Fan, Yiping; Chong, Yap Seng; Choolani, Mahesh A.; Cregan, Mark D.; Chan, Jerry K. Y.

    2010-01-01

    Background Mammary stem cells have been extensively studied as a system to delineate the pathogenesis and treatment of breast cancer. However, research on mammary stem cells requires tissue biopsies which limit the quantity of samples available. We have previously identified putative mammary stem cells in human breast milk, and here, we further characterised the cellular component of human breast milk. Methodology/Principal Findings We identified markers associated with haemopoietic, mesenchymal and neuro-epithelial lineages in the cellular component of human breast milk. We found 2.6±0.8% (mean±SEM) and 0.7±0.2% of the whole cell population (WCP) were found to be CD133+ and CD34+ respectively, 27.8±9.1% of the WCP to be positive for Stro-1 through flow-cytometry. Expressions of neuro-ectodermal stem cell markers such as nestin and cytokeratin 5 were found through reverse-transcription polymerase chain reaction (RT-PCR), and in 4.17±0.2% and 0.9±0.2% of the WCP on flow-cytometry. We also established the presence of a side-population (SP) (1.8±0.4% of WCP) as well as CD133+ cells (1.7±0.5% of the WCP). Characterisation of the sorted SP and non-SP, CD133+ and CD133- cells carried out showed enrichment of CD326 (EPCAM) in the SP cells (50.6±8.6 vs 18.1±6.0, P-value  = 0.02). However, culture in a wide range of in vitro conditions revealed the atypical behaviour of stem/progenitor cells in human breast milk; in that if they are present, they do not respond to established culture protocols of stem/progenitor cells. Conclusions/Significance The identification of primitive cell types within human breast milk may provide a non-invasive source of relevant mammary cells for a wide-range of applications; even the possibility of banking one's own stem cell for every breastfeeding woman. PMID:21203434

  1. A Synthetic Triterpenoid CDDO-Im Inhibits Tumorsphere Formation by Regulating Stem Cell Signaling Pathways in Triple-Negative Breast Cancer

    PubMed Central

    Wahler, Joseph; Liby, Karen T.; Sporn, Michael B.; Suh, Nanjoo

    2014-01-01

    Triple-negative breast cancer is associated with poor prognosis because of a high rate of tumor recurrence and metastasis. Previous studies demonstrated that the synthetic triterpenoid, CDDO-Imidazolide (CDDO-Im) induced cell cycle arrest and apoptosis in triple-negative breast cancer. Since a small subpopulation of cancer stem cells has been suggested to be responsible for drug resistance and metastasis of tumors, our present study determined whether the effects of CDDO-Im in triple-negative breast cancer are due to the inhibition of a cancer stem cell subpopulation. CDDO-Im treatment markedly induced cell cycle arrest at G2/M-phase and apoptosis in the triple-negative breast cancer cell lines, SUM159 and MDA-MB-231. Because SUM159 cells were more sensitive to CDDO-Im than MDA-MB-231 cells, the effects of CDDO-Im on the cancer stem cell subpopulation were further investigated in SUM159 cells. SUM159 cells formed tumorspheres in culture, and the cancer stem cell subpopulation, CD24−/EpCAM+ cells, was markedly enriched in SUM159 tumorspheres. The CD24−/EpCAM+ cells in SUM159 tumorspheres were significantly inhibited by CDDO-Im treatment. CDDO-Im also significantly decreased sphere forming efficiency and tumorsphere size in both primary and secondary sphere cultures. PCR array of stem cell signaling genes showed that expression levels of many key molecules in the stem cell signaling pathways, such as Notch, TGF-β/Smad, Hedgehog and Wnt, were significantly down-regulated by CDDO-Im in SUM159 tumorspheres. Protein levels of Notch receptors (c-Notch1, Notch1 and Notch3), TGF-β/Smad (pSmad2/3) and Hedgehog downstream effectors (GLI1) also were markedly reduced by CDDO-Im. In conclusion, the present study demonstrates that the synthetic triterpenoid, CDDO-Im, is a potent anti-cancer agent against triple-negative breast cancer cells by targeting the cancer stem cell subpopulation. PMID:25229616

  2. Mammary stem cells: angels or demons in mammary gland?

    PubMed

    Chen, Xueman; Liu, Qiang; Song, Erwei

    2017-01-01

    A highly dynamic development process exits within the epithelia of mammary gland, featuring morphogenetic variation during puberty, pregnancy, lactation, and regression. The identification of mammary stem cells (MaSCs) via lineage-tracing studies has substantiated a hierarchical organization of the mammary epithelia. A single MaSC is capable of reconstituting the entirely functional mammary gland upon orthotopic transplantation. Although different mammary cell subpopulations can be candidate cells-of-origin for distinct breast tumor subtypes, it still lacks experimental proofs whether MaSCs, the most primitive cells, are the 'seeds' of malignant transformation during most, if not all, tumorigenesis in the breast. Here, we review current knowledge of mammary epithelial hierarchy, highlighting the roles of mammary stem/progenitor cells and breast cancer stem cells (BCSCs) along with their key molecular regulators in organ development and cancer evolution. Clarifying these issues will pave the way for developing novel interventions toward stem/progenitor cells in either prevention or treatment of breast cancer (BrCa).

  3. Mammary stem cells: angels or demons in mammary gland?

    PubMed Central

    Chen, Xueman; Liu, Qiang; Song, Erwei

    2017-01-01

    A highly dynamic development process exits within the epithelia of mammary gland, featuring morphogenetic variation during puberty, pregnancy, lactation, and regression. The identification of mammary stem cells (MaSCs) via lineage-tracing studies has substantiated a hierarchical organization of the mammary epithelia. A single MaSC is capable of reconstituting the entirely functional mammary gland upon orthotopic transplantation. Although different mammary cell subpopulations can be candidate cells-of-origin for distinct breast tumor subtypes, it still lacks experimental proofs whether MaSCs, the most primitive cells, are the ‘seeds’ of malignant transformation during most, if not all, tumorigenesis in the breast. Here, we review current knowledge of mammary epithelial hierarchy, highlighting the roles of mammary stem/progenitor cells and breast cancer stem cells (BCSCs) along with their key molecular regulators in organ development and cancer evolution. Clarifying these issues will pave the way for developing novel interventions toward stem/progenitor cells in either prevention or treatment of breast cancer (BrCa). PMID:29263909

  4. Breast tumor heterogeneity: cancer stem cells or clonal evolution?

    PubMed

    Campbell, Lauren L; Polyak, Kornelia

    2007-10-01

    Breast tumors are composed of a variety of cell types with distinct morphologies and behaviors. It is not clear how this tumor heterogeneity comes about. Two popular concepts that attempt to explain this are the cancer stem cell hypothesis and the clonal evolution model. Each of these ideas has been investigated for some time, leading to the accumulation of numerous findings that are used to support one or the other. Although the two views share some similarities, they are fundamentally different notions with very different clinical implications. Analysis of the research backing each concept, along with a review of the results of our recent study investigating putative breast cancer stem cells, suggests how the cancer stem cell hypothesis and the clonal evolution model may be involved in generating breast tumor heterogeneity. An understanding of this process will allow the development of more effective ways to treat and prevent breast cancer.

  5. Cytokeratin 19 (KRT19) has a Role in the Reprogramming of Cancer Stem Cell-Like Cells to Less Aggressive and More Drug-Sensitive Cells.

    PubMed

    Saha, Subbroto Kumar; Kim, Kyeongseok; Yang, Gwang-Mo; Choi, Hye Yeon; Cho, Ssang-Goo

    2018-05-09

    Cytokeratin 19 ( KRT19 ) is a cytoplasmic intermediate filament protein, which is responsible for structural rigidity and multipurpose scaffolds. In several cancers, KRT19 is overexpressed and may play a crucial role in tumorigenic transformation. In our previous study, we revealed the role of KRT19 as signaling component which mediated Wnt/NOTCH crosstalk through NUMB transcription in breast cancer. Here, we investigated the function of KRT19 in cancer reprogramming and drug resistance in breast cancer cells. We found that expression of KRT19 was attenuated in several patients-derived breast cancer tissues and patients with a low expression of KRT19 were significantly correlated with poor prognosis in breast cancer patients. Consistently, highly aggressive and drug-resistant breast cancer patient-derived cancer stem cell-like cells (konkuk university-cancer stem cell-like cell (KU-CSLCs)) displayed higher expression of cancer stem cell (CSC) markers, including ALDH1 , CXCR4 , and CD133 , but a much lower expression of KRT19 than that is seen in highly aggressive triple negative breast cancer MDA-MB231 cells. Moreover, we revealed that the knockdown of KRT19 in MDA-MB231 cells led to an enhancement of cancer properties, such as cell proliferation, sphere formation, migration, and drug resistance, while the overexpression of KRT19 in KU-CSLCs resulted in the significant attenuation of cancer properties. KRT19 regulated cancer stem cell reprogramming by modulating the expression of cancer stem cell markers ( ALDH1 , CXCR4 , and CD133 ), as well as the phosphorylation of Src and GSK3β (Tyr216). Therefore, our data may imply that the modulation of KRT19 expression could be involved in cancer stem cell reprogramming and drug sensitivity, which might have clinical implications for cancer or cancer stem cell treatment.

  6. Cytokeratin 19 (KRT19) has a Role in the Reprogramming of Cancer Stem Cell-Like Cells to Less Aggressive and More Drug-Sensitive Cells

    PubMed Central

    Kim, Kyeongseok; Yang, Gwang-Mo; Choi, Hye Yeon

    2018-01-01

    Cytokeratin 19 (KRT19) is a cytoplasmic intermediate filament protein, which is responsible for structural rigidity and multipurpose scaffolds. In several cancers, KRT19 is overexpressed and may play a crucial role in tumorigenic transformation. In our previous study, we revealed the role of KRT19 as signaling component which mediated Wnt/NOTCH crosstalk through NUMB transcription in breast cancer. Here, we investigated the function of KRT19 in cancer reprogramming and drug resistance in breast cancer cells. We found that expression of KRT19 was attenuated in several patients-derived breast cancer tissues and patients with a low expression of KRT19 were significantly correlated with poor prognosis in breast cancer patients. Consistently, highly aggressive and drug-resistant breast cancer patient-derived cancer stem cell-like cells (konkuk university-cancer stem cell-like cell (KU-CSLCs)) displayed higher expression of cancer stem cell (CSC) markers, including ALDH1, CXCR4, and CD133, but a much lower expression of KRT19 than that is seen in highly aggressive triple negative breast cancer MDA-MB231 cells. Moreover, we revealed that the knockdown of KRT19 in MDA-MB231 cells led to an enhancement of cancer properties, such as cell proliferation, sphere formation, migration, and drug resistance, while the overexpression of KRT19 in KU-CSLCs resulted in the significant attenuation of cancer properties. KRT19 regulated cancer stem cell reprogramming by modulating the expression of cancer stem cell markers (ALDH1, CXCR4, and CD133), as well as the phosphorylation of Src and GSK3β (Tyr216). Therefore, our data may imply that the modulation of KRT19 expression could be involved in cancer stem cell reprogramming and drug sensitivity, which might have clinical implications for cancer or cancer stem cell treatment. PMID:29747452

  7. Epigenetic Regulation of miRNAs and Breast Cancer Stem Cells

    PubMed Central

    Duru, Nadire; Gernapudi, Ramkishore; Eades, Gabriel; Eckert, Richard; Zhou, Qun

    2015-01-01

    MicroRNAs have emerged as important targets of chemopreventive strategies in breast cancer. We have found that miRNAs are dysregulated at an early stage in breast cancer, in non-malignant Ductal Carcinoma In Situ. Many dietary chemoprevention agents can act by epigenetically activating miRNA-signaling pathways involved in tumor cell proliferation and invasive progression. In addition, many miRNAs activated via chemopreventive strategies target cancer stem cell signaling and prevent tumor progression or relapse. Specifically, we have found that miRNAs regulate DCIS stem cells, which may play important roles in breast cancer progression to invasive disease. We have shown that chemopreventive agents can directly inhibit DCIS stem cells and block tumor formation in vivo, via activation of tumor suppressor miRNAs. PMID:26052481

  8. Metformin synergizes 5-fluorouracil, epirubicin, and cyclophosphamide (FEC) combination therapy through impairing intracellular ATP production and DNA repair in breast cancer stem cells.

    PubMed

    Soo, Jaslyn Sian-Siu; Ng, Char-Hong; Tan, Si Hoey; Malik, Rozita Abdul; Teh, Yew-Ching; Tan, Boon-Shing; Ho, Gwo-Fuang; See, Mee-Hoong; Taib, Nur Aishah Mohd; Yip, Cheng-Har; Chung, Felicia Fei-Lei; Hii, Ling-Wei; Teo, Soo-Hwang; Leong, Chee-Onn

    2015-10-01

    Metformin, an AMPK activator, has been reported to improve pathological response to chemotherapy in diabetic breast cancer patients. To date, its mechanism of action in cancer, especially in cancer stem cells (CSCs) have not been fully elucidated. In this study, we demonstrated that metformin, but not other AMPK activators (e.g. AICAR and A-769662), synergizes 5-fluouracil, epirubicin, and cyclophosphamide (FEC) combination chemotherapy in non-stem breast cancer cells and breast cancer stem cells. We show that this occurs through an AMPK-dependent mechanism in parental breast cancer cell lines. In contrast, the synergistic effects of metformin and FEC occurred in an AMPK-independent mechanism in breast CSCs. Further analyses revealed that metformin accelerated glucose consumption and lactate production more severely in the breast CSCs but the production of intracellular ATP was severely hampered, leading to a severe energy crisis and impairs the ability of CSCs to repair FEC-induced DNA damage. Indeed, addition of extracellular ATP completely abrogated the synergistic effects of metformin on FEC sensitivity in breast CSCs. In conclusion, our results suggest that metformin synergizes FEC sensitivity through distinct mechanism in parental breast cancer cell lines and CSCs, thus providing further evidence for the clinical relevance of metformin for the treatment of cancers.

  9. Exosomes enriched in stemness/metastatic-related mRNAS promote oncogenic potential in breast cancer.

    PubMed

    Rodríguez, Marta; Silva, Javier; Herrera, Alberto; Herrera, Mercedes; Peña, Cristina; Martín, Paloma; Gil-Calderón, Beatriz; Larriba, María Jesús; Coronado, M Josés; Soldevilla, Beatriz; Turrión, Víctor S; Provencio, Mariano; Sánchez, Antonio; Bonilla, Félix; García-Barberán, Vanesa

    2015-12-01

    Cancer cells efficiently transfer exosome contents (essentially mRNAs and microRNAs) to other cell types, modifying immune responses, cell growth, angiogenesis and metastasis. Here we analyzed the exosomes release by breast tumor cells with different capacities of stemness/metastasis based on CXCR4 expression, and evaluated their capacity to generate oncogenic features in recipient cells. Breast cancer cells overexpressing CXCR4 showed an increase in stemness-related markers, and in proliferation, migration and invasion capacities. Furthermore, recipient cells treated with exosomes from CXCR4-cells showed increased in the same abilities. Moreover, inoculation of CXCR4-cell-derived exosomes in immunocompromised mice stimulated primary tumor growth and metastatic potential. Comparison of nucleic acids contained into exosomes isolated from patients revealed a "stemness and metastatic" signature in exosomes of patients with worse prognosis. Finally, our data supported the view that cancer cells with stem-like properties show concomitant metastatic behavior, and their exosomes stimulate tumor progression and metastasis. Exosomes-derived nucleic acids from plasma of breast cancer patients are suitable markers in the prognosis of such patients.

  10. Promotion of Tumor-Initiating Cells in Primary and Recurrent Breast Tumors

    DTIC Science & Technology

    2013-07-01

    regulation of expression of genes which confer stemness . We hypothesize that inhibition of IKK/NF-κB will reduce or eliminate breast camcer TICs...Merkhofer et al., 2010). Baldwin, Albert S. W81XWH-12-1-0176 8 --Demonstrated that NF-κB is preferentially activated in breast cancer stem ...Breast cancer stem cells, cytokine networks, and the tumor microenvironment. J Clin Invest. 2011 Oct;121(10):3804-9. doi: 10.1172/JCI57099. Epub

  11. Mechanisms of Invariant Natural Killer T Cell-Mediated Immunoregulation in Cancer

    DTIC Science & Technology

    2012-05-01

    by mesenchymal stem cells . Intriguingly, the increased metastatic ability was dependent on the production of CCL5 by mesenchymal stem cells , which...Tubo, R., &Weinberg, R.A.(2007) Mesenchymal stem cells within tumour stroma promote breast cancer metastasis. Nature. Vol. 449:pp557-563. Breast...can induce preferential secretion of immunosuppressive cytokines ; 2) iNKT cells inhibit effector T cell priming by killing dendritic cells that

  12. Breast Cancer Stem Cell Therapeutics, Multiple Strategies Versus Using Engineered Mesenchymal Stem Cells With Notch Inhibitory Properties: Possibilities and Perspectives.

    PubMed

    Bose, Bipasha; Sen, Utsav; Shenoy P, Sudheer

    2018-01-01

    Relapse cases of cancers are more vigorous and difficult to control due to the preponderance of cancer stem cells (CSCs). Such CSCs that had been otherwise dormant during the first incidence of cancer gradually appear as radiochemoresistant cancer cells. Hence, cancer therapeutics aimed at CSCs would be an effective strategy for mitigating the cancers during relapse. Alternatively, CSC therapy can also be proposed as an adjuvant therapy, along-with the conventional therapies. As regenerative stem cells (RSCs) are known for their trophic effects, anti-tumorogenicity, and better migration toward an injury site, this review aims to address the use of adult stem cells such as dental pulp derived; cord blood derived pure populations of regenerative stem cells for targeting CSCs. Indeed, pro-tumorogenicity of RSCs is of concern and hence has also been dealt with in relation to breast CSC therapeutics. Furthermore, as notch signaling pathways are upregulated in breast cancers, and anti-notch antibody based and sh-RNA based therapies are already in the market, this review focuses the possibilities of engineering RSCs to express notch inhibitory proteins for breast CSC therapeutics. Also, we have drawn a comparison among various possibilities of breast CSC therapeutics, about, notch1 inhibition. J. Cell. Biochem. 119: 141-149, 2018. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  13. Novel anticancer activity of phloroglucinol against breast cancer stem-like cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Rae-Kwon; Uddin, Nizam; Hyun, Jin-Won

    Poor prognosis of breast cancer patients is closely associated with metastasis and relapse. There is substantial evidence supporting that cancer stem-like cells (CSCs) are primarily responsible for relapse in breast cancer after anticancer treatment. However, there is a lack of suitable drugs that target breast cancer stem-like cells (BCSCs). Here, we report that phloroglucinol (PG), a natural phlorotannin component of brown algae, suppresses sphere formation, anchorage-independent colony formation and in vivo tumorigenicity. In line with these observations, treatment with PG also decreased CD44{sup +} cancer cell population as well as expression of CSC regulators such as Sox2, CD44, Oct4, Notch2more » and β-catenin. Also, treatment with PG sensitized breast cancer cells to anticancer drugs such as cisplatin, etoposide, and taxol as well as to ionizing radiation. Importantly, PG inhibited KRAS and its downstream PI3K/AKT and RAF-1/ERK signaling pathways that regulate the maintenance of CSCs. Taken together, our findings implicate PG as a good candidate to target BCSCs and to prevent the disease relapse. - Highlights: • Phloroglucinol suppresses in vivo tumor formation. • Phloroglucinol sensitizes breast cancer cells to anticancer agents. • Phloroglucinol inhibits breast cancer stem-like cells. • Phloroglucinol inhibits PI3K/AKT and KRAS/RAF/ERK signaling pathways.« less

  14. The effects and mechanisms of SLC34A2 on maintaining stem cell-like phenotypes in CD147+ breast cancer stem cells.

    PubMed

    Lv, Yonggang; Wang, Ting; Fan, Jing; Zhang, Zhenzhen; Zhang, Juliang; Xu, Cheng; Li, Yongping; Zhao, Ge; He, Chenyang; Meng, Huimin; Yang, Hua; Wang, Zhen; Liu, Jiayun; Chen, Jianghao; Wang, Ling

    2017-04-01

    The cancer stem cell (CSC) hypothesis has gained significant recognition in describing tumorigenesis. Identification of the factors critical to development of breast cancer stem cells (BCSCs) may provide insight into the improvement of effective therapies against breast cancer. In this study, we aim to investigate the biological function of SLC34A2 in affecting the stem cell-like phenotypes in BCSCs and its underlying mechanisms. We demonstrated that CD147 + cells from breast cancer tissue samples and cell lines possessed BCSC-like features, including the ability of self-renewal in vitro, differentiation, and tumorigenic potential in vivo. Flow cytometry analysis showed the presence of a variable fraction of CD147 + cells in 9 of 10 tumor samples. Significantly, SLC34A2 expression in CD147 + BCSCs was enhanced compared with that in differentiated adherent progeny of CD147 + BCSCs and adherently cultured cell line cells. In breast cancer patient cohorts, SLC34A2 expression was found increased in 9 of 10 tumor samples. By using lentiviral-based approach, si-SLC34A2-transduced CD147 + BCSCs showed decreased ability of sphere formation, cell viability in vitro, and tumorigenicity in vivo, which suggested the essential role of SLC34A2 in CD147 + BCSCs. Furthermore, PI3K/AKT pathway and SOX2 were found necessary to maintain the stemness of CD147 + BCSCs by using LY294002 or lentiviral-si-SOX2. Finally, we indicated that SLC34A2 could regulate SOX2 to maintain the stem cell-like features in CD147 + BCSCs through PI3K/AKT pathway. Therefore, our report identifies a novel role of SLC34A2 in BCSCs' state regulation and establishes a rationale for targeting the SLC34A2/PI3K/AKT/SOX2 signaling pathway for breast cancer therapy.

  15. Human amniotic membrane-derived epithelial stem cells display anticancer activity in BALB/c female nude mice bearing disseminated breast cancer xenografts.

    PubMed

    Kang, Nam-Hee; Yi, Bo-Rim; Lim, So Yoon; Hwang, Kyung-A; Baek, Young Seok; Kang, Kyung-Sun; Choi, Kyung-Chul

    2012-06-01

    Breast cancer is one of the most common malignant tumors and the leading cause of mortality among women. In this study, we propose a human stem cell transplantation strategy, an important method for treating various cancers, as a potential breast cancer therapy. To this end, we used human amniotic membrane-derived epithelial stem cells (hAECs) as a cell source for performing human stem cell transplantation. hAECs have multipotent differentiation abilities and possess high proliferative potential. We transplanted hAECs into female BALB/c nude mice bearing tumors originating from MDA-MB-231 breast cancer cells. Co-culturred hAECs and MDA-MB-231 cells at a ratio of 1:4 or 1:8 (tumor cells to stem cells) inhibited breast cancer cell growth by 67.29 and 67.33%, respectively. In the xenograft mouse model, tumor volumes were significantly decreased by 5-flurouracil (5-FU) treatment and two different ratios of hAECs (1:4 and 1:8) by 84.33, 73.88 and 56.89%, respectively. Treatment of nude mice with hAECs (1:4) produced remarkable antitumor effects without any side-effects (e.g., weight loss, death and bruising) compared to the mice that received only 5-FU treatment. Tumor progression was significantly reduced by hAEC treatment compared to the xenograft model. On the other hand, breast tissues (e.g., the epidermis, dermis and reticular layer) appeared to be well-maintained following treatment with hAECs. Taken together, these results provide strong evidence that hAECs can be used as a safe and effective cancer-targeting cytotherapy for treating breast cancer.

  16. Epigenetic modulation of the miR-200 family is associated with transition to a breast cancer stem-cell-like state.

    PubMed

    Lim, Yat-Yuen; Wright, Josephine A; Attema, Joanne L; Gregory, Philip A; Bert, Andrew G; Smith, Eric; Thomas, Daniel; Lopez, Angel F; Drew, Paul A; Khew-Goodall, Yeesim; Goodall, Gregory J

    2013-05-15

    The miR-200 family is a key regulator of the epithelial-mesenchymal transition, however, its role in controlling the transition between cancer stem-cell-like and non-stem-cell-like phenotypes is not well understood. We utilized immortalized human mammary epithelial (HMLE) cells to investigate the regulation of the miR-200 family during their conversion to a stem-like phenotype. HMLE cells were found to be capable of spontaneous conversion from a non-stem to a stem-like phenotype and this conversion was accompanied by the loss of miR-200 expression. Stem-like cell fractions isolated from metastatic breast cancers also displayed loss of miR-200 indicating similar molecular changes may occur during breast cancer progression. The phenotypic change observed in HMLE cells was directly controlled by miR-200 because restoration of its expression decreased stem-like properties while promoting a transition to an epithelial phenotype. Investigation of the mechanisms controlling miR-200 expression revealed both DNA methylation and histone modifications were significantly altered in the stem-like and non-stem phenotypes. In particular, in the stem-like phenotype, the miR-200b-200a-429 cluster was silenced primarily through polycomb group-mediated histone modifications whereas the miR-200c-141 cluster was repressed by DNA methylation. These results indicate that the miR-200 family plays a crucial role in the transition between stem-like and non-stem phenotypes and that distinct epigenetic-based mechanisms regulate each miR-200 gene in this process. Therapy targeted against miR-200 family members and epigenetic modifications might therefore be applicable to breast cancer.

  17. The response of breast cancer cells to mesenchymal stem cells: a possible role of inflammation by breast implants.

    PubMed

    Orciani, Monia; Lazzarini, Raffaella; Scartozzi, Mario; Bolletta, Elisa; Mattioli-Belmonte, Monica; Scalise, Alessandro; Di Benedetto, Giovanni; Di Primio, Roberto

    2013-12-01

    Breast implants are widely used and at times might cause inflammation as a foreign body, followed by fibrous capsule formation around the implant. In cancer, the inflamed stroma is essential for preservation of the tumor. Mesenchymal stem cells can be recruited to sites of inflammation, and their role in cancer development is debated. The authors assessed the effects of inflammation caused by breast implants' effects on tumor. Mesenchymal stem cells were isolated from the fibrous capsules of women who underwent a second operation after 1 year (presenting inflammation) or after 20 years (not presenting inflammation) since initial surgery. After characterization, cells were co-cultured with MCF7, a breast cancer cell line. The expression of genes involved in oncogenesis, proliferation, and epithelial-to-mesenchymal transition was investigated, followed by Western blot analyses. After co-culture with mesenchymal stem cells from the inflamed capsule, MCF7 induced a dose- and time-dependent increase in proliferation. Polymerase chain reaction analyses revealed a dysregulation of genes involved in oncogenesis, proliferation, and epithelial-to-mesenchymal transition. The subsequent evaluation by Western blot did not confirm these results, showing only a modest decrease in the expression of E-cadherin after co-culture with mesenchymal stem cells (both derived from inflamed or control capsules). These data indicate that inflammation caused by breast implants partially affects proliferation of MCF7 but does not influence key mechanisms of tumor development.

  18. RUNX1 and RUNX3 protect against YAP-mediated EMT, stem-ness and shorter survival outcomes in breast cancer

    PubMed Central

    Kulkarni, Madhura; Tan, Tuan Zea; Syed Sulaiman, Nurfarhanah Bte; Lamar, John M.; Bansal, Prashali; Cui, Jianzhou; Qiao, Yiting; Ito, Yoshiaki

    2018-01-01

    Hippo pathway target, YAP has emerged as an important player in solid tumor progression. Here, we identify RUNX1 and RUNX3 as novel negative regulators of oncogenic function of YAP in the context of breast cancer. RUNX proteins are one of the first transcription factors identified to interact with YAP. RUNX1 or RUNX3 expression abrogates YAP-mediated pro-tumorigenic properties of mammary epithelial cell lines in an interaction dependent manner. RUNX1 and RUNX3 inhibit YAP-mediated migration and stem-ness properties of mammary epithelial cell lines by co-regulating YAP-mediated gene expression. Analysis of whole genome expression profiles of breast cancer samples revealed significant co-relation between YAP–RUNX1/RUNX3 expression levels and survival outcomes of breast cancer patients. High RUNX1/RUNX3 expression proved protective towards YAP-dependent patient survival outcomes. High YAP in breast cancer patients’ expression profiles co-related with EMT and stem-ness gene signature enrichment. High RUNX1/RUNX3 expression along with high YAP reflected lower enrichment of EMT and stem-ness signatures. This antagonistic activity of RUNX1 and RUNX3 towards oncogenic function of YAP identified in mammary epithelial cells as well as in breast cancer expression profiles gives a novel mechanistic insight into oncogene–tumor suppressor interplay in the context of breast cancer progression. The novel interplay between YAP, RUNX1 and RUNX3 and its significance in breast cancer progression can serve as a prognostic tool to predict cancer recurrence. PMID:29581836

  19. MicroRNA100 Inhibits Self-Renewal of Breast Cancer Stem–like Cells and Breast Tumor Development

    PubMed Central

    Deng, Lu; Shang, Li; Bai, Shoumin; Chen, Ji; He, Xueyan; Martin-Trevino, Rachel; Chen, Shanshan; Li, Xiao-yan; Meng, Xiaojie; Yu, Bin; Wang, Xiaolin; Liu, Yajing; McDermott, Sean P.; Ariazi, Alexa E.; Ginestier, Christophe; Ibarra, Ingrid; Ke, Jia; Luther, Tahra; Clouthier, Shawn G.; Xu, Liang; Shan, Ge; Song, Erwei; Yao, Herui; Hannon, Gregory J.; Weiss, Stephen J.; Wicha, Max S.; Liu, Suling

    2015-01-01

    miRNAs are essential for self-renewal and differentiation of normal and malignant stem cells by regulating the expression of key stem cell regulatory genes. Here, we report evidence implicating the miR100 in self-renewal of cancer stem-like cells (CSC). We found that miR100 expression levels relate to the cellular differentiation state, with lowest expression in cells displaying stem cell markers. Utilizing a tetracycline-inducible lentivirus to elevate expression of miR100 in human cells, we found that increasing miR100 levels decreased the production of breast CSCs. This effect was correlated with an inhibition of cancer cell proliferation in vitro and in mouse tumor xenografts due to attenuated expression of the CSC regulatory genes SMARCA5, SMARCD1, and BMPR2. Furthermore, miR100 induction in breast CSCs immediately upon their orthotopic implantation or intracardiac injection completely blocked tumor growth and metastasis formation. Clinically, we observed a significant association between miR100 expression in breast cancer specimens and patient survival. Our results suggest that miR100 is required to direct CSC self-renewal and differentiation. PMID:25217527

  20. ΔNp63 promotes stem cell activity in mammary gland development and basal-like breast cancer by enhancing Fzd7 expression and Wnt signaling

    PubMed Central

    Chakrabarti, Rumela; Wei, Yong; Hwang, Julie; Hang, Xiang; Blanco, Mario Andres; Choudhury, Abrar; Tiede, Benjamin; Romano, Rose-Anne; DeCoste, Christina; Mercatali, Laura; Ibrahim, Toni; Amadori, Dino; Kannan, Nagarajan; Eaves, Connie J; Sinha, Satrajit; Kang, Yibin

    2014-01-01

    Emerging evidence suggests that cancer is populated and maintained by tumor initiating cells (TICs) with stem-like properties similar to that of adult tissue stem cells. Despite recent advances, the molecular regulatory mechanisms that may be shared between normal and malignant stem cells remain poorly understood. Here we show that the ΔNp63 isoform of the Trp63 transcription factor promotes normal mammary stem cell (MaSC) activity by increasing the expression of the Wnt receptor Fzd7, thereby enhancing Wnt signaling. Importantly, Fzd7-dependent enhancement of Wnt signaling by ΔNp63 also governs tumor initiating activity of the basal subtype of breast cancer. These findings establish ΔNp63 as a key regulator of stem cells in both normal and malignant mammary tissues and provide direct evidence that breast cancer TICs and normal MaSCs share common regulatory mechanisms. PMID:25241036

  1. Targeting Breast Cancer Recurrence via Hedgehog-mediated Sensitization of Breast Cancer Stem Cells

    DTIC Science & Technology

    2011-07-01

    Hedgehog -mediated Sensitization of Breast Cancer Stem Cells PRINCIPAL INVESTIGATOR: David J. Robbins, Ph.D...June 2010 – 14 June 2011 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Targeting Breast Cancer Recurrence via Hedgehog -mediated Sensitization of...this award. Introduction The purpose of the research supported by this award is to determine if targeting the hedgehog signaling pathway in

  2. Overexpression of molecular chaperons GRP78 and GRP94 in CD44(hi)/CD24(lo) breast cancer stem cells.

    PubMed

    Nami, Babak; Ghasemi-Dizgah, Armin; Vaseghi, Akbar

    2016-01-01

    Breast cancer stem cell with CD44(hi)/CD24(lo) phonotype is described having stem cell properties and represented as the main driving factor in breast cancer initiation, growth, metastasis and low response to anti-cancer agents. Glucoseregulated proteins (GRPs) are heat shock protein family chaperons that are charged with regulation of protein machinery and modulation of endoplasmic reticulum homeostasis whose important roles in stem cell development and invasion of various cancers have been demonstrated. Here, we investigated the expression levels of GRP78 and GRP94 in CD44(hi)/CD24(lo) phenotype breast cancer stem cells (BCSCs). MCF7, T-47D and MDA-MB-231 breast cancer cell lines were used. CD44(hi)/CD24(lo) phenotype cell population were analyzed and sorted by fluorescence-activated cell sorting (FACS). Transcriptional and translational expression of GRP78 and GRP94 were investigated by western blotting and quantitative real time PCR. RESULTS showed different proportion of CD44(hi)/CD24(lo) phenotype cell population in their original bulk cells. The ranking of the cell lines in terms of CD44(hi)/CD24(lo) phenotype cell population was as MCF7

  3. Reprogramming of non-genomic estrogen signaling by the stemness factor SOX2 enhances the tumor-initiating capacity of breast cancer cells.

    PubMed

    Vazquez-Martin, Alejandro; Cufí, Sílvia; López-Bonet, Eugeni; Corominas-Faja, Bruna; Cuyàs, Elisabet; Vellon, Luciano; Iglesias, Juan Manuel; Leis, Olatz; Martín, Angel G; Menendez, Javier A

    2013-11-15

    The restoration of pluripotency circuits by the reactivation of endogenous stemness factors, such as SOX2, may provide a new paradigm in cancer development. The tumoral stem cell reprogramming hypothesis, i.e., the ability of stemness factors to redirect normal and differentiated tumor cells toward a less-differentiated and stem-like state, adds new layers of complexity to cancer biology, because the effects of such reprogramming may remain dormant until engaged later in response to (epi)genetic and/or (micro)environmental events. To test this hypothesis, we utilized an in vitro model of a SOX2-overexpressing cancer stem cell (CSC)-like cellular state that was recently developed in our laboratory by employing Yamanaka's nuclear reprogramming technology in the estrogen receptor α (ERα)-positive MCF-7 breast cancer cell line. Despite the acquisition of distinct molecular features that were compatible with a breast CSC-like cellular state, such as strong aldehyde dehydrogenase activity, as detected by ALDEFLUOR, and overexpression of the SSEA-4 and CD44 breast CSC markers, the tumor growth-initiating ability of SOX2-overexpressing CSC-like MCF-7 cells solely occurred in female nude mice supplemented with estradiol when compared with MCF-7 parental cells. Ser118 phosphorylation of estrogen receptor α (ERα), which is a pivotal integrator of the genomic and nongenomic E 2/ERα signaling pathways, drastically accumulated in nuclear speckles in the interphase nuclei of SOX2-driven CSC-like cell populations. Moreover, SOX2-positive CSC-like cells accumulated significantly higher numbers of actively dividing cells, and the highest levels of phospho-Ser118-ERα occurred when chromosomes lined up on a metaphase plate. The previously unrecognized link between E 2/ERα signaling and SOX2-driven stem cell circuitry may significantly impact our current understanding of breast cancer initiation and progression, i.e., SOX2 can promote non-genomic E 2 signaling that leads to nuclear phospho-Ser118-ERα, which ultimately exacerbates genomic ER signaling in response to E 2. Because E 2 stimulation has been recently shown to enhance breast tumor-initiating cell survival by downregulating miR-140, which targets SOX2, the establishment of a bidirectional cross-talk interaction between the stem cell self-renewal regulator, SOX2, and the local and systemic ability of E 2 to increase breast CSC activity may have profound implications for the development of new CSC-directed strategies for breast cancer prevention and therapy.

  4. A Unique Opportunity to Test Whether Cell Fusion is a Mechanism of Breast Cancer Metastasis

    DTIC Science & Technology

    2015-06-01

    conditions for T47D and human mesenchymal stem cell populations. As a result we have been able to conduct our first co-culture experiments to determine...spontaneously and reliably with mesenchymal stem cells . We found that fusion occurs more frequently with hypoxia and that one means by which...in hypoxic conditions, we decided to investigate whether the mechanism of breast cancer cell fusion with mesenchymal stem /multipotent stromal cells

  5. Profiling of normal and malignant breast tissue show CD44high/CD24low phenotype as a predominant stem/progenitor marker when used in combination with Ep-CAM/CD49f markers

    PubMed Central

    2013-01-01

    Background Accumulating evidence supports cancer to initiate and develop from a small population of stem-like cells termed as cancer stem cells (CSC). The exact phenotype of CSC and their counterparts in normal mammary gland is not well characterized. In this study our aim was to evaluate the phenotype and function of stem/progenitor cells in normal mammary epithelial cell populations and their malignant counterparts. Methods Freshly isolated cells from both normal and malignant human breasts were sorted using 13 widely used stem/progenitor cell markers individually or in combination by multi-parametric (up to 9 colors) cell sorting. The sorted populations were functionally evaluated by their ability to form colonies and mammospheres, in vitro. Results We have compared, for the first time, the stem/progenitor markers of normal and malignant breasts side-by-side. Amongst all markers tested, we found CD44high/CD24low cell surface marker combination to be the most efficient at selecting normal epithelial progenitors. Further fractionation of CD44high/CD24low positive cells showed that this phenotype selects for luminal progenitors within Ep-CAMhigh/CD49f + cells, and enriches for basal progenitors within Ep-CAM-/low/CD49f + cells. On the other hand, primary breast cancer samples, which were mainly luminal Ep-CAMhigh, had CD44high/CD24low cells among both CD49fneg and CD49f + cancer cell fractions. However, functionally, CSC were predominantly CD49f + proposing the use of CD44high/CD24low in combination with Ep-CAM/CD49f cell surface markers to further enrich for CSC. Conclusion Our study clearly demonstrates that both normal and malignant breast cells with the CD44high/CD24low phenotype have the highest stem/progenitor cell ability when used in combination with Ep-CAM/CD49f reference markers. We believe that this extensive characterization study will help in understanding breast cancer carcinogenesis, heterogeneity and drug resistance. PMID:23768049

  6. Gene Therapy of Breast Cancer: Studies of Selection Promoter/Enhancer-Modified Vectors to Deliver Suicide Genes.

    DTIC Science & Technology

    1996-09-01

    bone marrow (BM) or peripheral blood (PB) as sources of hematopoietic stem cells is being used as a treatment option for patients with breast cancer 1...peripheral blood (PB) may affect the outcome of patients receiving high dose chemotherapy with autologous transplantation of hematopoietic stem cell ...cancer cell contamination to relapse remains unclear, tumor-free hematopoietic stem cell products for autologous transplantation are nonetheless desirable

  7. Targeting Common but Complex Proteoglycans on Breast Cancer Cells and Stem Cells Using Evolutionary Refined Malaria Proteins

    DTIC Science & Technology

    2015-11-01

    AWARD NUMBER: W81XWH-13-1-0139 TITLE: Targeting Common but Complex Proteoglycans on Breast Cancer Cells and Stem Cells Using Evolutionary Refined...DATES COVERED 15Aug2013 - 14Aug2015 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER W81XWH-13-1-0139 Targeting Common but Complex Proteoglycans on...outbreaks in epidemic regions of the world. Prior to this application we discovered that human breast cancer cells express this same carbohydrate

  8. Detection of Ultra-Rare Mitochondrial Mutations in Breast Stem Cells by Duplex Sequencing.

    PubMed

    Ahn, Eun Hyun; Hirohata, Kensen; Kohrn, Brendan F; Fox, Edward J; Chang, Chia-Cheng; Loeb, Lawrence A

    2015-01-01

    Long-lived adult stem cells could accumulate non-repaired DNA damage or mutations that increase the risk of tumor formation. To date, studies on mutations in stem cells have concentrated on clonal (homoplasmic) mutations and have not focused on rarely occurring stochastic mutations that may accumulate during stem cell dormancy. A major challenge in investigating these rare mutations is that conventional next generation sequencing (NGS) methods have high error rates. We have established a new method termed Duplex Sequencing (DS), which detects mutations with unprecedented accuracy. We present a comprehensive analysis of mitochondrial DNA mutations in human breast normal stem cells and non-stem cells using DS. The vast majority of mutations occur at low frequency and are not detectable by NGS. The most prevalent point mutation types are the C>T/G>A and A>G/T>C transitions. The mutations exhibit a strand bias with higher prevalence of G>A, T>C, and A>C mutations on the light strand of the mitochondrial genome. The overall rare mutation frequency is significantly lower in stem cells than in the corresponding non-stem cells. We have identified common and unique non-homoplasmic mutations between non-stem and stem cells that include new mutations which have not been reported previously. Four mutations found within the MT-ND5 gene (m.12684G>A, m.12705C>T, m.13095T>C, m.13105A>G) are present in all groups of stem and non-stem cells. Two mutations (m.8567T>C, m.10547C>G) are found only in non-stem cells. This first genome-wide analysis of mitochondrial DNA mutations may aid in characterizing human breast normal epithelial cells and serve as a reference for cancer stem cell mutation profiles.

  9. Normal and cancer mammary stem cells evade interferon-induced constraint through the miR-199a-LCOR Axis

    PubMed Central

    Celià-Terrassa, Toni; Liu, Daniel; Choudhury, Abrar; Hang, Xiang; Wei, Yong; Zamalloa, Jose; Alfaro-Aco, Raymundo; Chakrabarti, Rumela; Jiang, Yi-Zhou; Koh, Bong Ihn; Smith, Heath; DeCoste, Christina; Li, Jun-Jing; Shao, Zhi-Ming; Kang, Yibin

    2017-01-01

    Tumor-initiating cells (TICs), or cancer stem cells (CSC), possess stem cell-like properties observed in normal adult tissue stem cells. Normal and cancerous stem cells may therefore share regulatory mechanisms for maintaining self-renewing capacity and resisting differentiation elicited by cell-intrinsic or microenvironmental cues. Here, we show that miR-199a promotes stem cell properties in mammary stem cells (MaSCs) and breast CSCs by directly repressing nuclear receptor corepressor LCOR, which primes interferon (IFN) responses. Elevated miR-199a expression in stem cell-enriched populations protects normal and malignant stem-like cells from differentiation and senescence induced by IFNs that are produced by epithelial and immune cells in the mammary gland. Importantly, the miR-199a-LCOR-IFN axis is activated in poorly differentiated ER− breast tumors, functionally promotes tumor initiation and metastasis, and is associated with poor clinical outcome. Our study therefore reveals a common mechanism shared by normal and malignant stem cells to protect them from suppressive immune cytokine signaling. PMID:28530657

  10. Xenografts in zebrafish embryos as a rapid functional assay for breast cancer stem-like cell identification.

    PubMed

    Eguiara, Arrate; Holgado, Olaia; Beloqui, Izaskun; Abalde, Leire; Sanchez, Yolanda; Callol, Carles; Martin, Angel G

    2011-11-01

    The cancer stem cell is defined by its capacity to self-renew, the potential to differentiate into all cells of the tumor and the ability to proliferate and drive the expansion of the tumor. Thus, targeting these cells may provide novel anti-cancer treatment strategies. Breast cancer stem cells have been isolated according to surface marker expression, ability to efflux fluorescent dyes, increased activity of aldehyde dehydrogenase or the capacity to form spheres in non-adherent culture conditions. In order to test novel drugs directed towards modulating self-renewal of cancer stem cells, rapid, easy and inexpensive assays must be developed. Using 2 days-post-fertilization (dpf) zebrafish embryos as transplant recipients, we show that cells grown in mammospheres from breast carcinoma cell lines migrate to the tail of the embryo and form masses with a significantly higher frequency than parental monolayer populations. When stem-like self-renewal was targeted in the parental population by the use of the dietary supplement curcumin, cell migration and mass formation were reduced, indicating that these effects were associated with stem-like cell content. This is a proof of principle report that proposes a rapid and inexpensive assay to target in vivo cancer stem-like cells, which may be used to unravel basic cancer stem cell biology and for drug screening.

  11. Fascin Is Critical for the Maintenance of Breast Cancer Stem Cell Pool Predominantly via the Activation of the Notch Self-Renewal Pathway.

    PubMed

    Barnawi, Rayanah; Al-Khaldi, Samiyah; Majed Sleiman, Ghida; Sarkar, Abdullah; Al-Dhfyan, Abdullah; Al-Mohanna, Falah; Ghebeh, Hazem; Al-Alwan, Monther

    2016-12-01

    An emerging dogma shows that tumors are initiated and maintained by a subpopulation of cancer cells that hijack some stem cell features and thus referred to as "cancer stem cells" (CSCs). The exact mechanism that regulates the maintenance of CSC pool remains largely unknown. Fascin is an actin-bundling protein that we have previously demonstrated to be a major regulator of breast cancer chemoresistance and metastasis, two cardinal features of CSCs. Here, we manipulated fascin expression in breast cancer cell lines and used several in vitro and in vivo approaches to examine the relationship between fascin expression and breast CSCs. Fascin knockdown significantly reduced stem cell-like phenotype (CD44 hi /CD24 lo and ALDH + ) and reversal of epithelial to mesenchymal transition. Interestingly, expression of the embryonic stem cell transcriptional factors (Oct4, Nanog, Sox2, and Klf4) was significantly reduced when fascin expression was down-regulated. Functionally, fascin-knockdown cells were less competent in forming colonies and tumorspheres, consistent with lower basal self-renewal activity and higher susceptibility to chemotherapy. Fascin effect on CSC chemoresistance and self-renewability was associated with Notch signaling. Activation of Notch induced the relevant downstream targets predominantly in the fascin-positive cells. Limiting-dilution xenotransplantation assay showed higher frequency of tumor-initiating cells in the fascin-positive group. Collectively, our data demonstrated fascin as a critical regulator of breast CSC pool at least partially via activation of the Notch self-renewal signaling pathway and modification of the expression embryonic transcriptional factors. Targeting fascin may halt CSCs and thus presents a novel therapeutic approach for effective treatment of breast cancer. Stem Cells 2016;34:2799-2813 Video Highlight: https://youtu.be/GxS4fJ_Ow-o. © 2016 AlphaMed Press.

  12. Nucleolin overexpression in breast cancer cell sub-populations with different stem-like phenotype enables targeted intracellular delivery of synergistic drug combination.

    PubMed

    Fonseca, Nuno A; Rodrigues, Ana S; Rodrigues-Santos, Paulo; Alves, Vera; Gregório, Ana C; Valério-Fernandes, Ângela; Gomes-da-Silva, Lígia C; Rosa, Manuel Santos; Moura, Vera; Ramalho-Santos, João; Simões, Sérgio; Moreira, João Nuno

    2015-11-01

    Breast cancer stem cells (CSC) are thought responsible for tumor growth and relapse, metastization and active evasion to standard chemotherapy. The recognition that CSC may originate from non-stem cancer cells (non-SCC) through plastic epithelial-to-mesenchymal transition turned these into relevant cell targets. Of crucial importance for successful therapeutic intervention is the identification of surface receptors overexpressed in both CSC and non-SCC. Cell surface nucleolin has been described as overexpressed in cancer cells as well as a tumor angiogenic marker. Herein we have addressed the questions on whether nucleolin was a common receptor among breast CSC and non-SCC and whether it could be exploited for targeting purposes. Liposomes functionalized with the nucleolin-binding F3 peptide, targeted simultaneously, nucleolin-overexpressing putative breast CSC and non-SCC, which was paralleled by OCT4 and NANOG mRNA levels in cells from triple negative breast cancer (TNBC) origin. In murine embryonic stem cells, both nucleolin mRNA levels and F3 peptide-targeted liposomes cellular association were dependent on the stemness status. An in vivo tumorigenic assay suggested that surface nucleolin overexpression per se, could be associated with the identification of highly tumorigenic TNBC cells. This proposed link between nucleolin expression and the stem-like phenotype in TNBC, enabled 100% cell death mediated by F3 peptide-targeted synergistic drug combination, suggesting the potential to abrogate the plasticity and adaptability associated with CSC and non-SCC. Ultimately, nucleolin-specific therapeutic tools capable of simultaneous debulk multiple cellular compartments of the tumor microenvironment may pave the way towards a specific treatment for TNBC patient care. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Pharmacological targets of breast cancer stem cells: a review.

    PubMed

    Pindiprolu, Sai Kiran S S; Krishnamurthy, Praveen T; Chintamaneni, Pavan Kumar

    2018-05-01

    Breast cancers contain small population of tumor-initiating cells called breast cancer stem cells (BCSCs), which are spared even after chemotherapy. Recently, BCSCs are implicated to be a cause of metastasis, tumor relapse, and therapy resistance in breast cancer. BCSCs have unique molecular mechanisms, which can be targeted to eliminate them. These include surface biomarkers, proteins involved in self-renewal pathways, drug efflux transporters, apoptotic/antiapoptotic proteins, autophagy, metabolism, and microenvironment regulation. The complex molecular mechanisms behind the survival of BCSCs and pharmacological targets for elimination of BCSCs are described in this review.

  14. Differential Radiosensitizing Effect of Valproic Acid in Differentiation Versus Self-Renewal Promoting Culture Conditions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Debeb, Bisrat G.; Xu Wei; Mok, Henry

    2010-03-01

    Purpose: It has been shown that valproic acid (VA) enhances the proliferation and self-renewal of normal hematopoietic stem cells and that breast cancer stem/progenitor cells can be resistant to radiation. From these data, we hypothesized that VA would fail to radiosensitize breast cancer stem/progenitor cells grown to three-dimensional (3D) mammospheres. Methods and Materials: We used the MCF7 breast cancer cell line grown under stem cell-promoting culture conditions (3D mammosphere) and standard nonstem cell monolayer culture conditions (two-dimensional) to examine the effect of pretreatment with VA on radiation sensitivity in clonogenic survival assays and on the expression of embryonic stem cellmore » transcription factors. Results: 3D-cultured MCF-7 cells expressed higher levels of Oct4, Nanog, and Sox2. The 3D passage enriched self-renewal and increased radioresistance in the 3D mammosphere formation assays. VA radiosensitized adherent cells but radioprotected 3D cells in single-fraction clonogenic assays. Moreover, fractionated radiation sensitized VA-treated adherent MCF7 cells but did not have a significant effect on VA-treated single cells grown to mammospheres. Conclusion: We have concluded that VA might preferentially radiosensitize differentiated cells compared with those expressing stem cell surrogates and that stem cell-promoting culture is a useful tool for in vitro evaluation of novel cancer therapeutic agents and radiosensitizers.« less

  15. LGR4 modulates breast cancer initiation, metastasis, and cancer stem cells.

    PubMed

    Yue, Zhiying; Yuan, Zengjin; Zeng, Li; Wang, Ying; Lai, Li; Li, Jing; Sun, Peng; Xue, Xiwen; Qi, Junyi; Yang, Zhengfeng; Zheng, Yansen; Fang, Yuanzhang; Li, Dali; Siwko, Stefan; Li, Yi; Luo, Jian; Liu, Mingyao

    2018-05-01

    The fourth member of the leucine-rich repeat-containing GPCR family (LGR4, frequently referred to as GPR48) and its cognate ligands, R-spondins (RSPOs) play crucial roles in the development of multiple organs as well as the survival of adult stem cells by activation of canonical Wnt signaling. Wnt/β-catenin signaling acts to regulate breast cancer; however, the molecular mechanisms determining its spatiotemporal regulation are largely unknown. In this study, we identified LGR4 as a master controller of Wnt/β-catenin signaling-mediated breast cancer tumorigenesis, metastasis, and cancer stem cell (CSC) maintenance. LGR4 expression in breast tumors correlated with poor prognosis. Either Lgr4 haploinsufficiency or mammary-specific deletion inhibited mouse mammary tumor virus (MMTV)- PyMT- and MMTV- Wnt1-driven mammary tumorigenesis and metastasis. Moreover, LGR4 down-regulation decreased in vitro migration and in vivo xenograft tumor growth and lung metastasis. Furthermore, Lgr4 deletion in MMTV- Wnt1 tumor cells or knockdown in human breast cancer cells decreased the number of functional CSCs by ∼90%. Canonical Wnt signaling was impaired in LGR4-deficient breast cancer cells, and LGR4 knockdown resulted in increased E-cadherin and decreased expression of N-cadherin and snail transcription factor -2 ( SNAI2) (also called SLUG), implicating LGR4 in regulation of epithelial-mesenchymal transition. Our findings support a crucial role of the Wnt signaling component LGR4 in breast cancer initiation, metastasis, and breast CSCs.-Yue, Z., Yuan, Z., Zeng, L., Wang, Y., Lai, L., Li, J., Sun, P., Xue, X., Qi, J., Yang, Z., Zheng, Y., Fang, Y., Li, D., Siwko, S., Li, Y., Luo, J., Liu, M. LGR4 modulates breast cancer initiation, metastasis, and cancer stem cells.

  16. Investigating the Regulation and Potential Role of Nonhypoxic Hypoxia Inducible Factor 1 (HIF 1) in Aromatase Inhibitor Resistant Breast Cancer

    DTIC Science & Technology

    2015-12-01

    resistance include: 1) cancer stem cell maintenance markers (Oct-4, kit ligand, JARID1B); 2) epithelial- mesenchymal -transition (EMT) markers (Snail...target proteins, such as BCRP andvimentin. BCRP and vimentin contribute to letrozole resistance through their effects on maintaining cacer stem cell ...treatment of acquired AI resistance. 15. SUBJECT TERMS Breast cancer, aromatase inhibitors (ex. letrozole), drug resistance, cancer stem cells ,nonhypoxic

  17. A possible usage of a CDK4 inhibitor for breast cancer stem cell-targeted therapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Han, Yu Kyeong; Lee, Jae Ho; Park, Ga-Young

    2013-01-25

    Highlights: ► A CDK4 inhibitor may be used for breast cancer stem cell-targeted therapy. ► The CDK4 inhibitor differentiated the cancer stem cell population (CD24{sup −}/CD44{sup +}) of MDA-MB-231. ► The differentiation of the cancer stem cells by the CDK4 inhibitor radiosensitized MDA-MB-231. -- Abstract: Cancer stem cells (CSCs) are one of the main reasons behind cancer recurrence due to their resistance to conventional anti-cancer therapies. Thus, many efforts are being devoted to developing CSC-targeted therapies to overcome the resistance of CSCs to conventional anti-cancer therapies and decrease cancer recurrence. Differentiation therapy is one potential approach to achieve CSC-targeted therapies.more » This method involves inducing immature cancer cells with stem cell characteristics into more mature or differentiated cancer cells. In this study, we found that a CDK4 inhibitor sensitized MDA-MB-231 cells but not MCF7 cells to irradiation. This difference appeared to be associated with the relative percentage of CSC-population between the two breast cancer cells. The CDK4 inhibitor induced differentiation and reduced the cancer stem cell activity of MDA-MB-231 cells, which are shown by multiple marker or phenotypes of CSCs. Thus, these results suggest that radiosensitization effects may be caused by reducing the CSC-population of MDA-MB-231 through the use of the CDK4 inhibitor. Thus, further investigations into the possible application of the CDK4 inhibitor for CSC-targeted therapy should be performed to enhance the efficacy of radiotherapy for breast cancer.« less

  18. ERK/p38 MAPK inhibition reduces radio-resistance to a pulsed proton beam in breast cancer stem cells

    NASA Astrophysics Data System (ADS)

    Jung, Myung-Hwan; Park, Jeong Chan

    2015-10-01

    Recent studies have identified highly tumorigenic cells with stem cell-like characteristics, termed cancer stem cells (CSCs) in human cancers. CSCs are resistant to conventional radiotherapy and chemotherapy owing to their high DNA repair ability and oncogene overexpression. However, the mechanisms regulating CSC radio-resistance, particularly proton beam resistance, remain unclear. We isolated CSCs from the breast cancer cell lines MCF-7 and MDA-MB-231, which expressed the characteristic breast CSC membrane protein markers CD44+/CD24-/ low , and irradiated the CSCs with pulsed proton beams. We confirmed that CSCs were resistant to pulsed proton beams and showed that treatment with p38 and ERK inhibitors reduced CSC radio-resistance. Based on these results, BCSC radio-resistance can be reduced during proton beam therapy by co-treatment with ERK1/2 or p38 inhibitors, a novel approach to breast cancer therapy.

  19. Repression of mammosphere formation of human breast cancer cells by soy isoflavone genistein and blueberry polyphenolic acids suggests diet-mediated targeting of cancer stem-like/progenitor cells

    USDA-ARS?s Scientific Manuscript database

    Mammary stem cells are undifferentiated epithelial cells which initiate mammary tumors and render them resistant to anticancer therapies, when deregulated. Diets rich in fruits and vegetables are implicated in breast cancer risk reduction, yet underlying mechanisms are poorly understood. Here, we ad...

  20. Long non-coding RNA FEZF1-AS1 promotes breast cancer stemness and tumorigenesis via targeting miR-30a/Nanog axis.

    PubMed

    Zhang, Zhi; Sun, Liwei; Zhang, Yixuan; Lu, Guanming; Li, Yongqiang; Wei, Zhongheng

    2018-05-24

    Long non-coding RNAs (lncRNAs) have been verified to modulate the tumorigenesis of breast cancer at multiple levels. In present study, we aim to investigate the role of lncRNA FEZF1-AS1 on breast cancer-stem like cells (BCSC) and the potential regulatory mechanism. In breast cancer tissue, lncRNA FEZF1-AS1 was up-regulated compared with controls and indicated poor prognosis of breast cancer patients. In vitro experiments, FEZF1-AS1 was significantly over-expressed in breast cancer cells, especially in sphere subpopulation compared with parental subpopulation. Loss-of-functional indicated that, in BCSC cells (MDA-MB-231 CSC, MCF-7 CSC), FEZF1-AS1 knockdown reduced the CD44 + /CD24 - rate, the mammosphere-forming ability, stem factors (Nanog, Oct4, SOX2), and inhibited the proliferation, migration and invasion. In vivo, FEZF1-AS1 knockdown inhibited the breast cancer cells growth. Bioinformatics analysis tools and series of validation experiments confirmed that FEZF1-AS1 modulated BCSC and Nanog expression through sponging miR-30a, suggesting the regulation of FEZF1-AS1/miR-30a/Nanog. In summary, our study validate the important role of FEZF1-AS1/miR-30a/Nanog in breast cancer stemness and tumorigenesis, providing a novel insight and treatment strategy for breast cancer. © 2018 The Authors. Journal of Cellular Physiology Published by Wiley Periodicals Inc.

  1. Asymmetric segregation of template DNA strands in basal-like human breast cancer cell lines

    PubMed Central

    2013-01-01

    Background and methods Stem or progenitor cells from healthy tissues have the capacity to co-segregate their template DNA strands during mitosis. Here, we set out to test whether breast cancer cell lines also possess the ability to asymmetrically segregate their template DNA strands via non-random chromosome co-segregation, and whether this ability correlates with certain properties attributed to breast cancer stem cells (CSCs). We quantified the frequency of asymmetric segregation of template DNA strands in 12 human breast cancer cell lines, and correlated the frequency to molecular subtype, CD44+/CD24-/lo phenotype, and invasion/migration ability. We tested if co-culture with human mesenchymal stem cells, which are known to increase self-renewal, can alter the frequency of asymmetric segregation of template DNA in breast cancer. Results We found a positive correlation between asymmetric segregation of template DNA and the breast cancer basal-like and claudin-low subtypes. There was an inverse correlation between asymmetric segregation of template DNA and Her2 expression. Breast cancer samples with evidence of asymmetric segregation of template DNA had significantly increased invasion and borderline significantly increased migration abilities. Samples with high CD44+/CD24-/lo surface expression were more likely to harbor a consistent population of cells that asymmetrically segregated its template DNA; however, symmetric self-renewal was enriched in the CD44+/CD24-/lo population. Co-culturing breast cancer cells with human mesenchymal stem cells expanded the breast CSC pool and decreased the frequency of asymmetric segregation of template DNA. Conclusions Breast cancer cells within the basal-like subtype can asymmetrically segregate their template DNA strands through non-random chromosome segregation. The frequency of asymmetric segregation of template DNA can be modulated by external factors that influence expansion or self-renewal of CSC populations. Future studies to uncover the underlying mechanisms driving asymmetric segregation of template DNA and dictating cell fate at the time of cell division may explain how CSCs are maintained in tumors. PMID:24238140

  2. Adipose derived stem cells (ASCs) isolated from breast cancer tissue express IL-4, IL-10 and TGF-β1 and upregulate expression of regulatory molecules on T cells: do they protect breast cancer cells from the immune response?

    PubMed

    Razmkhah, Mahboobeh; Jaberipour, Mansooreh; Erfani, Nasrollah; Habibagahi, Mojtaba; Talei, Abdol-rasoul; Ghaderi, Abbas

    2011-01-01

    Immunomodulatory function of bone marrow derived mesenchymal stem cells in cancer has recently been investigated. But the resident mesenchymal stem cells as whole in cancer and in the breast cancer tissue have not been studied well. In the present work we isolated adipose derived stem cells (ASCs) from breast cancer and normal breast tissues to investigate the expressions of IL-4, IL-10 and transforming growth factor (TGF)-β1 in ASCs and to see if ASCs isolated from patients can modulate the regulatory molecules on peripheral blood lymphocytes. Our results showed that IL-10 and TGF-β1 have significantly higher mRNA expressions in ASCs isolated from breast cancer patients than those from normal individuals (P value <0.05). The culture supernatant of ASCs isolated from breast cancer patients with pathological stage III induced upregulation of the mRNA expression levels of IL-4, TGF-β1, IL-10, CCR4 and CD25 in PBLs. In addition, the percentage of CD4+CD25(high)Foxp3(+) T regulatory cells was increased in vitro. When the same culture supernatant was added to ASCs isolated from normal subjects augmentation of the mRNA expressions of IL-4, IL-10, IL-8, MMP2, VEGF and SDF-1 in normal ASCs was also observed. These data collectively conclude that resident ASCs in breast cancer tissue may have crucial roles in breast tumor growth and progression by inducing regulatory molecules and promoting anti-inflammatory reaction within the tumor microenvironment. Further investigation is required to see if the immune suppression induced by ASCs is an independent property from tumor cells or ASCs gain their immunosuppressive potential from malignant cells. Copyright © 2010 Elsevier Inc. All rights reserved.

  3. Tamoxifen enhances stemness and promotes metastasis of ERα36+ breast cancer by upregulating ALDH1A1 in cancer cells

    PubMed Central

    Wang, Qiang; Jiang, Jun; Ying, Guoguang; Xie, Xiao-Qing; Zhang, Xia; Xu, Wei; Zhang, Xuemin; Song, Erwei; Bu, Hong; Ping, Yi-Fang; Yao, Xiao-Hong; Wang, Bin; Xu, Shilei; Yan, Ze-Xuan; Tai, Yanhong; Hu, Baoquan; Qi, Xiaowei; Wang, Yan-Xia; He, Zhi-Cheng; Wang, Yan; Wang, Ji Ming; Cui, You-Hong; Chen, Feng; Meng, Kun; Wang, Zhaoyi; Bian, Xiu-Wu

    2018-01-01

    The 66 kDa estrogen receptor alpha (ERα66) is the main molecular target for endocrine therapy such as tamoxifen treatment. However, many patients develop resistance with unclear mechanisms. In a large cohort study of breast cancer patients who underwent surgery followed by tamoxifen treatment, we demonstrate that ERα36, a variant of ERα66, correlates with poor prognosis. Mechanistically, tamoxifen directly binds and activates ERα36 to enhance the stemness and metastasis of breast cancer cells via transcriptional stimulation of aldehyde dehydrogenase 1A1 (ALDH1A1). Consistently, the tamoxifen-induced stemness and metastasis can be attenuated by either ALDH1 inhibitors or a specific ERα36 antibody. Thus, tamoxifen acts as an agonist on ERα36 in breast cancer cells, which accounts for hormone therapy resistance and metastasis of breast cancer. Our study not only reveals ERα36 as a stratifying marker for endocrine therapy but also provides a promising therapeutic avenue for tamoxifen-resistant breast cancer. PMID:29393296

  4. The Role of Epithelial-Mesenchymal Transition in the Formation of Normal and Neoplastic Mammary Epithelial Stem Cells

    DTIC Science & Technology

    2011-09-01

    separating stem cell and non- stem cell populations of normal and breast cancer cells and identified EMT transcription factors most likely involved in... stem cell biology. Preliminary results directly demonstrate that transient induction of EMT increases the number of mammary epithelial stem cells...EMT and entrance into a stem - cell state. The outcome of these experiments holds important implications for the mechanisms controlling the formation of

  5. Breast cancer stem-like cells are sensitized to tamoxifen induction of self-renewal inhibition with enforced Let-7c dependent on Wnt blocking

    PubMed Central

    Meng, Jinying; Wang, Jichang; Tang, Shou-Ching; Qin, Sida; Du, Ning; Li, Gang

    2018-01-01

    Let-7 microRNAs have been reported to have tumor suppressive functions; however, the effect of Let-7 when used in combination with chemotherapies is uncertain, but may have potential for use in clinical practice. In this study, we used RT-qPCR, western blot analysis, cell proliferation assay, flow cytometry analysis, immunohistochemistry (IHC) staining, luciferase assays, cell sorting analysis and xenografted tumor model to explore the role of Let-7 in the chemotherapy sensitivity of breast cancer stem cells. The findings of the current study indicated that Let-7 enhances the effects of endocrine therapy potentially by regulating the self-renewal of cancer stem cells. Let-7c increased the anticancer functions of tamoxifen and reduced the ratio of cancer stem-like cells (CSCs), sensitizing cells to therapy-induced repression in an estrogen receptor (ER)-dependent manner. Notably, Let-7 decreased the tumor formation ability of estrogen-treated breast CSCs in vivo and suppressed Wnt signaling, which further consolidated the previously hypothesis that Let-7 decreases the self-renewal ability, contributing to reduced tumor formation ability of stem cells. The suppressive effects exerted by Let-7 on stem-like cells involved Let-7c/ER/Wnt signaling, and the functions of Let-7c exerted with tamoxifen were dependent on ER. Taken together, the findings identified a biochemical and functional link between Let-7 and endocrine therapy in breast CSCs, which may facilitate clinical treatment in the future using delivery of suppressive Let-7. PMID:29336465

  6. Adipose-Derived Stem Cells in Novel Approaches to Breast Reconstruction: Their Suitability for Tissue Engineering and Oncological Safety.

    PubMed

    O'Halloran, Niamh; Courtney, Donald; Kerin, Michael J; Lowery, Aoife J

    2017-01-01

    Adipose-derived stem cells (ADSCs) are rapidly becoming the gold standard cell source for tissue engineering strategies and hold great potential for novel breast reconstruction strategies. However, their use in patients with breast cancer is controversial and their oncological safety, particularly in relation to local disease recurrence, has been questioned. In vitro, in vivo, and clinical studies using ADSCs report conflicting data on their suitability for adipose tissue regeneration in patients with cancer. This review aims to provide an overview of the potential role for ADSCs in breast reconstruction and to examine the evidence relating to the oncologic safety of their use in patients with breast cancer.

  7. Promoting effects of adipose-derived stem cells on breast cancer cells are reversed by radiation therapy.

    PubMed

    Baaße, Annemarie; Juerß, Dajana; Reape, Elaine; Manda, Katrin; Hildebrandt, Guido

    2018-04-01

    Partial breast irradiation of early breast cancer patients after lumpectomy and the use of endogenous adipose tissue (AT) for breast reconstruction are promising applications to reduce the side effects of breast cancer therapy. This study tries to investigate the possible risks associated with these therapeutic approaches. It also examines the influence of adipose derived stem cells (ADSCs) as part of the breast cancer microenvironment, and endogenous AT on breast cancer cells following radiation therapy. ADSCs, isolated from human reduction mammoplasties of healthy female donors, exhibited multilineage capacity and specific surface markers. The promoting effects of ADSCs on the growth and survival fraction of breast cancer cells were reversed by treatment with high (8 Gy) or medium (2 Gy) radiation doses. In addition, a suppressing influence on breast cancer growth could be detected by co-culturing with irradiated ADSCs (8 Gy). Furthermore the clonogenic survival of unirradiated tumor cells was reduced by medium of irradiated ADSCs. In conclusion, radiation therapy changed the interactions of ADSCs and breast cancer cells. On the basis of our work, the importance of further studies to exclude potential risks of ADSCs in regenerative applications and radiotherapy has been emphasized.

  8. Sulforaphane, a dietary component of broccoli/broccoli sprouts, inhibits breast cancer stem cells.

    PubMed

    Li, Yanyan; Zhang, Tao; Korkaya, Hasan; Liu, Suling; Lee, Hsiu-Fang; Newman, Bryan; Yu, Yanke; Clouthier, Shawn G; Schwartz, Steven J; Wicha, Max S; Sun, Duxin

    2010-05-01

    The existence of cancer stem cells (CSCs) in breast cancer has profound implications for cancer prevention. In this study, we evaluated sulforaphane, a natural compound derived from broccoli/broccoli sprouts, for its efficacy to inhibit breast CSCs and its potential mechanism. Aldefluor assay and mammosphere formation assay were used to evaluate the effect of sulforaphane on breast CSCs in vitro. A nonobese diabetic/severe combined immunodeficient xenograft model was used to determine whether sulforaphane could target breast CSCs in vivo, as assessed by Aldefluor assay, and tumor growth upon cell reimplantation in secondary mice. The potential mechanism was investigated using Western blotting analysis and beta-catenin reporter assay. Sulforaphane (1-5 micromol/L) decreased aldehyde dehydrogenase-positive cell population by 65% to 80% in human breast cancer cells (P < 0.01) and reduced the size and number of primary mammospheres by 8- to 125-fold and 45% to 75% (P < 0.01), respectively. Daily injection with 50 mg/kg sulforaphane for 2 weeks reduced aldehyde dehydrogenase-positive cells by >50% in nonobese diabetic/severe combined immunodeficient xenograft tumors (P = 0.003). Sulforaphane eliminated breast CSCs in vivo, thereby abrogating tumor growth after the reimplantation of primary tumor cells into the secondary mice (P < 0.01). Western blotting analysis and beta-catenin reporter assay showed that sulforaphane downregulated the Wnt/beta-catenin self-renewal pathway. Sulforaphane inhibits breast CSCs and downregulates the Wnt/beta-catenin self-renewal pathway. These findings support the use of sulforaphane for the chemoprevention of breast cancer stem cells and warrant further clinical evaluation. Copyright 2010 AACR.

  9. Enhanced anti-tumor activity and cytotoxic effect on cancer stem cell population of metformin-butyrate compared with metformin HCl in breast cancer.

    PubMed

    Lee, Kyung-Min; Lee, Minju; Lee, Jiwoo; Kim, Sung Wuk; Moon, Hyeong-Gon; Noh, Dong-Young; Han, Wonshik

    2016-06-21

    Metformin, which is a drug commonly used to treat type 2 diabetes, has shown anti-tumor effects in numerous experimental, epidemiologic, observational, and clinical studies. Here, we report a new metformin derivative, metformin-butyrate (MFB). Compared to metformin-HCl, it more potently activates AMPK, inhibits mTOR, and impairs cell cycle progression at S and G2/M phases. Moreover, MFB inhibits the mammosphere formation of breast cancer cells and shows cytotoxic effects against CD44+CD24-/low populations in vitro and in vivo, indicating that it might have preferential effects on the cancer stem cell population. MFB showed synergistic cytotoxicity with docetaxel and cisplatin, and MFB pretreatment of breast cancer cells prior to their injection into the mammary fat pads of mice significantly decreased the obtained xenograft tumor volumes, compared with untreated or metformin-pretreated cells. Overall, MFB showed greater anti-neoplastic activity and greater efficacies in targeting the G2/M phase and breast cancer stem cell population, compared to metformin-HCl. This suggests that MFB may be a promising therapeutic agent against aggressive and resistant breast cancers.

  10. Evodiamine selectively targets cancer stem-like cells through the p53-p21-Rb pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Han, Seula; Woo, Jong Kyu; Jung, Yuchae

    In spite of the recent improvements, the resistance to chemotherapy/radiotherapy followed by relapse is the main hurdle for the successful treatment of breast cancer, a leading cause of death in women. A small population of breast cancer cells that have stem-like characteristics (cancer stem-like cells; CSLC) may contribute to this resistance and relapse. Here, we report on a component of a traditional Chinese medicine, evodiamine, which selectively targets CSLC of breast cancer cell lines MCF7 and MDAMB 231 at a concentration that does show a little or no cytotoxic effect on bulk cancer cells. While evodiamine caused the accumulation of bulkmore » cancer cells at the G2/M phase, it did not hold CSLC in a specific cell cycle phase but instead, selectively killed CSLC. This was not due to the culture of CSLC in suspension or without FBS. A proteomic analysis and western blotting revealed that evodiamine changed the expression of cell cycle regulating molecules more efficiently in CSLC cells than in bulk cancer cells. Surprisingly, evodiamine selectively activated p53 and p21 and decreased inactive Rb, the master molecules in G1/S checkpoint. These data collectively suggest a novel mechanism involving CSLC-specific targeting by evodiamine and its possible use to the therapy of breast cancer. - Highlights: • Evodiamine selectively kills breast cancer stem like cells at G1 phase. • Evodiamine utilizes different mechanism of cell cycle modulation in CSLC and in bulk cancer cells. • Evodiamine activate the p53, p21 and Rb pathway.« less

  11. Long noncoding RNA linc00617 exhibits oncogenic activity in breast cancer.

    PubMed

    Li, Hengyu; Zhu, Li; Xu, Lu; Qin, Keyu; Liu, Chaoqian; Yu, Yue; Su, Dongwei; Wu, Kainan; Sheng, Yuan

    2017-01-01

    Protein-coding genes account for only 2% of the human genome, whereas the vast majority of transcripts are noncoding RNAs including long noncoding RNAs. LncRNAs are involved in the regulation of a diverse array of biological processes, including cancer progression. An evolutionarily conserved lncRNA TUNA, was found to be required for pluripotency of mouse embryonic stem cells. In this study, we found the human ortholog of TUNA, linc00617, was upregulated in breast cancer samples. Linc00617 promoted motility and invasion of breast cancer cells and induced epithelial-mesenchymal-transition (EMT), which was accompanied by generation of stem cell properties. Moreover, knockdown of linc00617 repressed lung metastasis in vivo. We demonstrated that linc00617 upregulated the expression of stemness factor Sox2 in breast cancer cells, which was shown to promote the oncogenic activity of breast cancer cells by stimulating epithelial-to-mesenchymal transition and enhancing the tumor-initiating capacity. Thus, our data indicate that linc00617 functions as an important regulator of EMT and promotes breast cancer progression and metastasis via activating the transcription of Sox2. Together, it suggests that linc00617 may be a potential therapeutic target for aggressive breast cancer. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  12. Histone Deacetylase Inhibitors Enhance Cytotoxicity Towards Breast Tumors While Preserving the Wound-Healing Function of Adipose-Derived Stem Cells.

    PubMed

    Koko, Kiavash R; Chang, Shaohua; Hagaman, Ashleigh L; Fromer, Marc W; Nolan, Ryan S; Gaughan, John P; Zhang, Ping; Carpenter, Jeffrey P; Brown, Spencer A; Matthews, Martha; Bird, Dorothy

    2017-06-01

    Paclitaxel improves the oncologic response of breast cancer resections; however, it may negatively affect the wound-healing potential of human adipose-derived stem cells (hASCs) for fat grafting and reconstructive surgery. Histone deacetylase inhibitors (HDACis) modify the epigenetic regulation of gene expression and stabilize microtubules similarly to paclitaxel, thus, creating a synergistic mechanism of cell cycle arrest. We aim to combine these drugs to enhance cytotoxicity towards breast cancer cells, while preserving the wound-healing function of hASCs for downstream reconstructive applications. Triple negative breast cancer cells (MBA-MB-231) and hASCs (institutional review board-approved clinical isolates) were treated with a standard therapeutic dose of paclitaxel (1.0 μM) or with low-dose paclitaxel (0.1 μM) combined with the HDACi suberoylanilide hydroxamic acid or trichostatin A. Cell viability, gene expression, apoptosis, and wound-healing/migration were measured via methylthiazol tetrazolium assay, quantitative real-time polymerase chain reaction, annexin V assay, and fibroblast scratch assay, respectively. Combined HDACi and low-dose paclitaxel therapy maintained cytotoxicity towards breast cancer cells and preserved adipose-derived stem cell viability. Histone deacetylase inhibitor demonstrated selective anti-inflammatory effects on adipose-derived stem cell gene expression and decreased expression of the proapoptotic gene FAS. Furthermore, HDACi therapy did not increase relative apoptosis within hASCs. A scratch assay demonstrated enhanced wound healing among injured fibroblasts indirectly co-cultured with HDACi-treated hASCs. Combining HDACi with low-dose paclitaxel improved cytotoxicity towards breast cancer cells and preserved hASC viability. Furthermore, enhanced wound healing was observed by improved migration in a fibroblast scratch assay. These results suggest that the addition of HDACi to taxane chemotherapy regimens may improve oncologic results and wound-healing outcomes after reconstructive surgery.

  13. The Removal of Human Breast Cancer Cells from Hematopoietic CD34+ Stem Cells by Dielectrophoretic Field-Flow-Fractionation

    PubMed Central

    HUANG, YING; YANG, JUN; WANG, XIAO-BO; BECKER, FREDERICK F.; GASCOYNE, PETER R.C.

    2009-01-01

    Dielectrophoretic field-flow-fractionation (DEP-FFF) was used to purge human breast cancer MDA-435 cells from hematopoietic CD34+ stem cells. An array of interdigitated microelectrodes lining the bottom surface of a thin chamber was used to generate dielectrophoretic forces that levitated the cell mixture in a fluid flow profile. CD34+ stem cells were levitated higher, were carried faster by the fluid flow, and exited the separation chamber earlier than the cancer cells. Using on-line flow cytometry, efficient separation of the cell mixture was observed in less than 12 min, and CD34+ stem cell fractions with a purity >99.2% were obtained. The method of DEP-FFF is potentially applicable to many biomedical cell separation problems, including microfluidic-scale diagnosis and preparative-scale purification of cell subpopulations. PMID:10791899

  14. Posttranslationally modified progesterone receptors direct ligand-specific expression of breast cancer stem cell-associated gene programs.

    PubMed

    Knutson, Todd P; Truong, Thu H; Ma, Shihong; Brady, Nicholas J; Sullivan, Megan E; Raj, Ganesh; Schwertfeger, Kathryn L; Lange, Carol A

    2017-04-17

    Estrogen and progesterone are potent breast mitogens. In addition to steroid hormones, multiple signaling pathways input to estrogen receptor (ER) and progesterone receptor (PR) actions via posttranslational events. Protein kinases commonly activated in breast cancers phosphorylate steroid hormone receptors (SRs) and profoundly impact their activities. To better understand the role of modified PRs in breast cancer, we measured total and phospho-Ser294 PRs in 209 human breast tumors represented on 2754 individual tissue spots within a tissue microarray and assayed the regulation of this site in human tumor explants cultured ex vivo. To complement this analysis, we assayed PR target gene regulation in T47D luminal breast cancer models following treatment with progestin (promegestone; R5020) and antiprogestins (mifepristone, onapristone, or aglepristone) in conditions under which the receptor is regulated by Lys388 SUMOylation (K388 intact) or is SUMO-deficient (via K388R mutation to mimic persistent Ser294 phosphorylation). Selected phospho-PR-driven target genes were validated by qRT-PCR and following RUNX2 shRNA knockdown in breast cancer cell lines. Primary and secondary mammosphere assays were performed to implicate phospho-Ser294 PRs, epidermal growth factor signaling, and RUNX2 in breast cancer stem cell biology. Phospho-Ser294 PR species were abundant in a majority (54%) of luminal breast tumors, and PR promoter selectivity was exquisitely sensitive to posttranslational modifications. Phospho-PR expression and target gene programs were significantly associated with invasive lobular carcinoma (ILC). Consistent with our finding that activated phospho-PRs undergo rapid ligand-dependent turnover, unique phospho-PR gene signatures were most prevalent in breast tumors clinically designated as PR-low to PR-null (luminal B) and included gene sets associated with cancer stem cell biology (HER2, PAX2, AHR, AR, RUNX). Validation studies demonstrated a requirement for RUNX2 in the regulation of selected phospho-PR target genes (SLC37A2). In vitro mammosphere formation assays support a role for phospho-Ser294-PRs via growth factor (EGF) signaling as well as RUNX2 as potent drivers of breast cancer stem cell fate. We conclude that PR Ser294 phosphorylation is a common event in breast cancer progression that is required to maintain breast cancer stem cell fate, in part via cooperation with growth factor-initiated signaling pathways and key phospho-PR target genes including SLC37A2 and RUNX2. Clinical measurement of phosphorylated PRs should be considered a useful marker of breast tumor stem cell potential. Alternatively, unique phospho-PR target gene sets may provide useful tools with which to identify patients likely to respond to selective PR modulators that block PR Ser294 phosphorylation as part of rational combination (i.e., with antiestrogens) endocrine therapies designed to durably block breast cancer recurrence.

  15. Histone Deacetylase Inhibitors Stimulate Dedifferentiation of Human Breast Cancer Cells through WNT/β-catenin Signaling

    PubMed Central

    Debeb, Bisrat G; Lacerda, Lara; Xu, Wei; Larson, Richard; Solley, Travis; Atkinson, Rachel; Sulman, Erik P.; Ueno, Naoto T; Krishnamurthy, Savitri; Reuben, James M; Buchholz, Thomas A; Woodward, Wendy A

    2015-01-01

    Recent studies have shown that differentiated cancer cells can de-differentiate into cancer stem cells (CSCs) although to date no studies have reported whether this transition is influenced by systemic anti-cancer agents. Valproic acid (VA) is a histone deacetylase (HDAC) inhibitor that promotes self renewal and expansion of hematopietic stem cells and facilitates the generation of induced pluripotent stem cells from somatic cells and is currently being investigated in breast cancer clinical trials. We hypothesized that HDAC inhibitors reprogram differentiated cancer cells towards the more resistant stem cell-like state. Two highly aggressive breast cancer cell lines, SUM159 and MDA-231, were FACS-sorted based on ALDH activity and subsequently ALDH-negative and ALDH-positive cells were treated with one of two known HDAC inhibitors, VA or SAHA (suberoylanilide hydroxamic acid). In addition, primary tumor cells from patients with metastatic breast cancer were evaluated for ALDH activity following treatment with HDAC inhibitors. We demonstrate that single cell sorted ALDH- negative cells spontaneously generated ALDH-positive cells in vitro. Treatment of ALDH-negative cells with HDAC inhibitors promoted the expansion of ALDH-positive cells and increased mammosphere forming efficiency. Most importantly, it significantly increased the tumor-initiating capacity of ALDH- negative cells in limiting dilution outgrowth assays. Moreover, while HDAC inhibitors upregulated β-catenin expression and significantly increased WNT reporter activity, a TCF4 dominant negative construct abolished HDAC-inhibitor induced expansion of CSCs. These results demonstrate that HDAC inhibitors promote the expansion of breast CSCs through dedifferentiation and have important clinical implications for the use of HDAC inhibitors in the treatment of cancer. PMID:22961641

  16. Hybrid clone cells derived from human breast epithelial cells and human breast cancer cells exhibit properties of cancer stem/initiating cells.

    PubMed

    Gauck, Daria; Keil, Silvia; Niggemann, Bernd; Zänker, Kurt S; Dittmar, Thomas

    2017-08-02

    The biological phenomenon of cell fusion has been associated with cancer progression since it was determined that normal cell × tumor cell fusion-derived hybrid cells could exhibit novel properties, such as enhanced metastatogenic capacity or increased drug resistance, and even as a mechanism that could give rise to cancer stem/initiating cells (CS/ICs). CS/ICs have been proposed as cancer cells that exhibit stem cell properties, including the ability to (re)initiate tumor growth. Five M13HS hybrid clone cells, which originated from spontaneous cell fusion events between M13SV1-EGFP-Neo human breast epithelial cells and HS578T-Hyg human breast cancer cells, and their parental cells were analyzed for expression of stemness and EMT-related marker proteins by Western blot analysis and confocal laser scanning microscopy. The frequency of ALDH1-positive cells was determined by flow cytometry using AldeRed fluorescent dye. Concurrently, the cells' colony forming capabilities as well as the cells' abilities to form mammospheres were investigated. The migratory activity of the cells was analyzed using a 3D collagen matrix migration assay. M13HS hybrid clone cells co-expressed SOX9, SLUG, CK8 and CK14, which were differently expressed in parental cells. A variation in the ALDH1-positive putative stem cell population was observed among the five hybrids ranging from 1.44% (M13HS-7) to 13.68% (M13HS-2). In comparison to the parental cells, all five hybrid clone cells possessed increased but also unique colony formation and mammosphere formation capabilities. M13HS-4 hybrid clone cells exhibited the highest colony formation capacity and second highest mammosphere formation capacity of all hybrids, whereby the mean diameter of the mammospheres was comparable to the parental cells. In contrast, the largest mammospheres originated from the M13HS-2 hybrid clone cells, whereas these cells' mammosphere formation capacity was comparable to the parental breast cancer cells. All M13HS hybrid clones exhibited a mesenchymal phenotype and, with the exception of one hybrid clone, responded to EGF with an increased migratory activity. Fusion of human breast epithelial cells and human breast cancer cells can give rise to hybrid clone cells that possess certain CS/IC properties, suggesting that cell fusion might be a mechanism underlying how tumor cells exhibiting a CS/IC phenotype could originate.

  17. Circulating cancer stem cell markers in breast carcinomas: a systematic review protocol.

    PubMed

    Mansoori, Maryam; Madjd, Zahra; Janani, Leila; Rasti, Arezoo

    2017-12-19

    Breast cancer is one of the most common types of cancer in women worldwide. Recent studies have provided strong support for the cancer stem cell (CSC) hypothesis, which suggests that many cancers, including breast cancer, are driven by a subpopulation of cells that display stem cell-like properties. The hypothesis that a subpopulation of circulating tumor cells (CTCs) possesses many CSC-like hallmarks is reinforced by the expression of related molecular markers between these two cell populations. The aim of this study is to systematically review primary studies and identify circulating CSC markers in breast cancer patients. Relevant observational studies evaluating the expression of circulating breast cancer stem cell markers through October 31, 2016, will be searched in PubMed, SCOPUS, Embase, ISI Web of Science, and Google Scholar with no restriction on language. Full copies of articles identified by the search and considered to meet the inclusion criteria will be obtained for data extraction and synthesis. Two quality assessment tools will be used for evaluating observational studies like case control, which are the Hoy et al. suggested tool and Newcastle-Ottawa Scale (NOS), respectively. Publication bias will be assessed by funnel plots or Egger's test (i.e., plots of study results against precision), and data synthesis will be performed using Stata software (Stata Corp V.12, TX, USA).This systematic review will be reported according to the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA). Detecting cancer stem cells in blood will help clinicians to monitor cancer patients by obtaining as many samples as needed with a non-invasive method and in any stages; it is not possible to repeat sampling on working on tissue samples. By identifying cancer stem cells early in blood, it will be possible to distinguish metastasis in early stages. CRD42016043810.

  18. Targeting Breast Cancer Recurrence via Hedgehog-Mediated Sensitization of Breast Cancer Stem Cells

    DTIC Science & Technology

    2011-07-01

    identification of Notch3 as a transcriptional target of ΔNp63α and a mediator of cellular quiescence in mammary stem cells. 2. Presentation of a poster...enhanced expression of Notch3 in HC11s and breast cancer cell lines, and ectopic expression of the Notch3 intracellular domain (N3ICD) was sufficient to...signaling or shRNA-mediated suppression of Notch3 were sufficient to bypass quiescence induced by ΔNp63α and other quiescence-inducing stimuli. these

  19. The Mammary Stem Cell Hierarchy: A Looking Glass into Heterogeneous Breast Cancer Landscapes

    PubMed Central

    Sreekumar, Amulya; Roarty, Kevin; Rosen, Jeffrey M.

    2015-01-01

    The mammary gland is a dynamic organ that undergoes extensive morphogenesis during the different stages of embryonic development, puberty, estrus, pregnancy, lactation and involution. Systemic and local cues underlie this constant tissue remodeling and act by eliciting an intricate pattern of responses in the mammary epithelial and stromal cells. Decades of studies utilizing methods such as transplantation and lineage tracing have identified a complex hierarchy of mammary stem cells, progenitors and differentiated epithelial cells that fuel mammary epithelial development. Importantly, these studies have extended our understanding of the molecular crosstalk between cell types, and signaling pathways maintaining normal homeostasis that often are deregulated during tumorigenesis. While several questions remain, this research has many implications for breast cancer. Fundamental among these are the identification of the cells of origin for the multiple subtypes of breast cancer and the understanding of tumor heterogeneity. A deeper understanding of these critical questions will unveil novel breast cancer drug targets and treatment paradigms. In this review, we provide a current overview of normal mammary development and tumorigenesis from a stem cell perspective. PMID:26206777

  20. Targeting Midbodies in Ovarian Cancer Stem Cells as a Therapeutic Strategy

    DTIC Science & Technology

    2014-12-01

    BRCA1, BRCA1, breast cancer 1 gene. MT, microtubules. 3. OVERALL PROJECT SUMMARY: Summarize the progress during appropriate reporting period...Biological and molecular heterogeneity of breast cancers correlates with their cancer stem cell content. Cell. 2010; 140:62–73. [PubMed: 20074520] 40. Pardal...cells and contributes to the tolerance to nutrient deprivation. Cancer Res. 2007; 67:9677–84. [PubMed: 17942897] 47. Sarkar S, et al. A rational

  1. JAK/STAT3-Regulated Fatty Acid β-Oxidation Is Critical for Breast Cancer Stem Cell Self-Renewal and Chemoresistance.

    PubMed

    Wang, Tianyi; Fahrmann, Johannes Francois; Lee, Heehyoung; Li, Yi-Jia; Tripathi, Satyendra C; Yue, Chanyu; Zhang, Chunyan; Lifshitz, Veronica; Song, Jieun; Yuan, Yuan; Somlo, George; Jandial, Rahul; Ann, David; Hanash, Samir; Jove, Richard; Yu, Hua

    2018-01-09

    Cancer stem cells (CSCs) are critical for cancer progression and chemoresistance. How lipid metabolism regulates CSCs and chemoresistance remains elusive. Here, we demonstrate that JAK/STAT3 regulates lipid metabolism, which promotes breast CSCs (BCSCs) and cancer chemoresistance. Inhibiting JAK/STAT3 blocks BCSC self-renewal and expression of diverse lipid metabolic genes, including carnitine palmitoyltransferase 1B (CPT1B), which encodes the critical enzyme for fatty acid β-oxidation (FAO). Moreover, mammary-adipocyte-derived leptin upregulates STAT3-induced CPT1B expression and FAO activity in BCSCs. Human breast-cancer-derived data suggest that the STAT3-CPT1B-FAO pathway promotes cancer cell stemness and chemoresistance. Blocking FAO and/or leptin re-sensitizes them to chemotherapy and inhibits BCSCs in mouse breast tumors in vivo. We identify a critical pathway for BCSC maintenance and breast cancer chemoresistance. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Progesterone regulation of stem and progenitor cells in normal and malignant breast

    PubMed Central

    Axlund, Sunshine Daddario; Sartorius, Carol A.

    2011-01-01

    Progesterone plays an important, if not controversial, role in mammary epithelial cell proliferation and differentiation. Evidence supports that progesterone promotes rodent mammary carcinogenesis under some conditions, progesterone receptors (PR) are necessary for murine mammary gland tumorigenesis, and exogenous progestin use in post-menopausal women increases breast cancer risk. Thus, the progesterone/PR signaling axis can promote mammary tumorigenesis, albeit in a context dependent manner. A mechanistic basis for the tumor promoting actions of progesterone has thus far remained unknown. Recent studies, however, have identified a novel role for progesterone in controlling the number and function of stem and progenitor cell populations in the normal human and mouse mammary glands, and in human breast cancers. These discoveries promise to reshape our perception of progesterone function in the mammary gland, and have spawned new hypotheses for how progestins may increase the risk of breast cancer. Here we review studies on progesterone regulation of mammary stem cells in normal and malignant tissue, and their implications for breast cancer risk, tumorigenesis, and tumor behavior. PMID:21945473

  3. Ethnicity-Dependent and -Independent Heterogeneity in Healthy Normal Breast Hierarchy Impacts Tumor Characterization

    PubMed Central

    Nakshatri, Harikrishna; Anjanappa, Manjushree; Bhat-Nakshatri, Poornima

    2015-01-01

    Recent reports of widespread genetic variation affecting regulation of gene expression raise the possibility of significant inter-individual differences in stem-progenitor-mature cell hierarchy in adult organs. This has not been explored because of paucity of methods to quantitatively assess subpopulation of normal epithelial cells on individual basis. We report the remarkable inter-individual differences in differentiation capabilities as documented by phenotypic heterogeneity in stem-progenitor-mature cell hierarchy of the normal breast. Ethnicity and genetic predisposition are partly responsible for this heterogeneity, evidenced by the finding that CD44+/CD24- and PROCR+/EpCAM- multi-potent stem cells were elevated significantly in African American women compared with Caucasians. ALDEFLUOR+ luminal stem/progenitor cells were lower in BRCA1-mutation carriers compared with cells from healthy donors (p = 0.0014). Moreover, tumor and adjoining-normal breast cells of the same patients showed distinct CD49f+/EpCAM+ progenitor, CD271+/EpCAM- basal, and ALDEFLUOR+ cell profiles. These inter-individual differences in the rate of differentiation in the normal breast may contribute to a substantial proportion of transcriptome, epigenome, and signaling pathway alterations and consequently has the potential to spuriously magnify the extent of documented tumor-specific gene expression. Therefore, comparative analysis of phenotypically defined subpopulations of normal and tumor cells on an individual basis may be required to identify cancer-specific aberrations. PMID:26311223

  4. Ethnicity-Dependent and -Independent Heterogeneity in Healthy Normal Breast Hierarchy Impacts Tumor Characterization.

    PubMed

    Nakshatri, Harikrishna; Anjanappa, Manjushree; Bhat-Nakshatri, Poornima

    2015-08-27

    Recent reports of widespread genetic variation affecting regulation of gene expression raise the possibility of significant inter-individual differences in stem-progenitor-mature cell hierarchy in adult organs. This has not been explored because of paucity of methods to quantitatively assess subpopulation of normal epithelial cells on individual basis. We report the remarkable inter-individual differences in differentiation capabilities as documented by phenotypic heterogeneity in stem-progenitor-mature cell hierarchy of the normal breast. Ethnicity and genetic predisposition are partly responsible for this heterogeneity, evidenced by the finding that CD44+/CD24- and PROCR+/EpCAM- multi-potent stem cells were elevated significantly in African American women compared with Caucasians. ALDEFLUOR+ luminal stem/progenitor cells were lower in BRCA1-mutation carriers compared with cells from healthy donors (p = 0.0014). Moreover, tumor and adjoining-normal breast cells of the same patients showed distinct CD49f+/EpCAM+ progenitor, CD271+/EpCAM- basal, and ALDEFLUOR+ cell profiles. These inter-individual differences in the rate of differentiation in the normal breast may contribute to a substantial proportion of transcriptome, epigenome, and signaling pathway alterations and consequently has the potential to spuriously magnify the extent of documented tumor-specific gene expression. Therefore, comparative analysis of phenotypically defined subpopulations of normal and tumor cells on an individual basis may be required to identify cancer-specific aberrations.

  5. The Role of Tumor Associated Macrophage in Recurrent Growth of Tumor Stem Cell

    DTIC Science & Technology

    2011-09-01

    recent cancer stem cell (CSC) theory, recurrent tumor must arise from a dormant tumor stem cell whose re-growth is triggered by shifting of...microenvironment. This project aims at clarifying the roles of TAM in recurrent growth of dormant stem cell in breast cancer. We hypothesize that the balance of...dormancy and recurrence is determined by the ability of the tumor stem cells to recruit TAM which in turn promotes self-renewal of the stem cell . We

  6. 6-Shogaol Inhibits Breast Cancer Cells and Stem Cell-Like Spheroids by Modulation of Notch Signaling Pathway and Induction of Autophagic Cell Death

    PubMed Central

    Ray, Anasuya; Vasudevan, Smreti; Sengupta, Suparna

    2015-01-01

    Cancer stem cells (CSCs) pose a serious obstacle to cancer therapy as they can be responsible for poor prognosis and tumour relapse. In this study, we have investigated inhibitory activity of the ginger-derived compound 6-shogaol against breast cancer cells both in monolayer and in cancer-stem cell-like spheroid culture. The spheroids were generated from adherent breast cancer cells. 6-shogaol was effective in killing both breast cancer monolayer cells and spheroids at doses that were not toxic to noncancerous cells. The percentages of CD44+CD24-/low cells and the secondary sphere content were reduced drastically upon treatment with 6-shogaol confirming its action on CSCs. Treatment with 6-shogaol caused cytoplasmic vacuole formation and cleavage of microtubule associated protein Light Chain3 (LC3) in both monolayer and spheroid culture indicating that it induced autophagy. Kinetic analysis of the LC3 expression and a combination treatment with chloroquine revealed that the autophagic flux instigated cell death in 6-shogaol treated breast cancer cells in contrast to the autophagy inhibitor chloroquine. Furthermore, 6-shogaol-induced cell death got suppressed in the presence of chloroquine and a very low level of apoptosis was exhibited even after prolonged treatment of the compound, suggesting that autophagy is the major mode of cell death induced by 6-shogaol in breast cancer cells. 6-shogaol reduced the expression levels of Cleaved Notch1 and its target proteins Hes1 and Cyclin D1 in spheroids, and the reduction was further pronounced in the presence of a γ-secretase inhibitor. Secondary sphere formation in the presence of the inhibitor was also further reduced by 6-shogaol. Together, these results indicate that the inhibitory action of 6-shogaol on spheroid growth and sustainability is conferred through γ-secretase mediated down-regulation of Notch signaling. The efficacy of 6-shogaol in monolayer and cancer stem cell-like spheroids raise hope for its therapeutic benefit in breast cancer treatment. PMID:26355461

  7. 6-Shogaol Inhibits Breast Cancer Cells and Stem Cell-Like Spheroids by Modulation of Notch Signaling Pathway and Induction of Autophagic Cell Death.

    PubMed

    Ray, Anasuya; Vasudevan, Smreti; Sengupta, Suparna

    2015-01-01

    Cancer stem cells (CSCs) pose a serious obstacle to cancer therapy as they can be responsible for poor prognosis and tumour relapse. In this study, we have investigated inhibitory activity of the ginger-derived compound 6-shogaol against breast cancer cells both in monolayer and in cancer-stem cell-like spheroid culture. The spheroids were generated from adherent breast cancer cells. 6-shogaol was effective in killing both breast cancer monolayer cells and spheroids at doses that were not toxic to noncancerous cells. The percentages of CD44+CD24-/low cells and the secondary sphere content were reduced drastically upon treatment with 6-shogaol confirming its action on CSCs. Treatment with 6-shogaol caused cytoplasmic vacuole formation and cleavage of microtubule associated protein Light Chain3 (LC3) in both monolayer and spheroid culture indicating that it induced autophagy. Kinetic analysis of the LC3 expression and a combination treatment with chloroquine revealed that the autophagic flux instigated cell death in 6-shogaol treated breast cancer cells in contrast to the autophagy inhibitor chloroquine. Furthermore, 6-shogaol-induced cell death got suppressed in the presence of chloroquine and a very low level of apoptosis was exhibited even after prolonged treatment of the compound, suggesting that autophagy is the major mode of cell death induced by 6-shogaol in breast cancer cells. 6-shogaol reduced the expression levels of Cleaved Notch1 and its target proteins Hes1 and Cyclin D1 in spheroids, and the reduction was further pronounced in the presence of a γ-secretase inhibitor. Secondary sphere formation in the presence of the inhibitor was also further reduced by 6-shogaol. Together, these results indicate that the inhibitory action of 6-shogaol on spheroid growth and sustainability is conferred through γ-secretase mediated down-regulation of Notch signaling. The efficacy of 6-shogaol in monolayer and cancer stem cell-like spheroids raise hope for its therapeutic benefit in breast cancer treatment.

  8. WE-E-BRE-10: Level of Breast Cancer Stem Cell Correlated with Tumor Radioresistence: An Indication for Individualized Breast Cancer Therapy Adapted to Cancer Stem Cell Fractions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qi, S; Pajonk, F; McCloskey, S

    2014-06-15

    Purposes: The presence of cancer stem cells (CSCs) in a solid tumor could result in poor tumor control probability. The purposes are to study CSC radiosensitivity parameters α and β and their correlation to CSC levels to understand the underlying radioresistance mechanisms and enable individualized treatment design. Methods: Four established breast cancer cell lines (MCF-7, T47D, MDA-MB-231, and SUM159PT) were irradiated in vitro using single radiation doses of 0, 2, 4, 6, 8 or 10 Gy. The fractions of CSCs in each cell lines were determined using cancer stem cell markers. Mammosphere assays were also performed to better estimate themore » number of CSCs and represent the CSC repopulation in a human solid tumor. The measured cell surviving fractions were fitted using the Linear-quadratic (LQ) model with independent fitting parameters: α-TC, β-TC (TCs), α-CSC, β-CSC (CSCs), and fs (the percentage of CSCs in each sample). Results: The measured fs increased following the irradiation by MCF-7 (0.1%), T47D (0.9%), MDA-MB-231 (1.18%) and SUM159T (2.46%), while decreasing surviving curve slopes were observed, indicating greater radioresistance, in the opposite order. The fitting yielded the radiosensitive parameters for the MCF-7: α-TC=0.1±0.2Gy{sup −1}, β-TC= 0.08 ±0.14Gy{sup −2}, α-CSC=0.04±0.07Gy{sup −1}, β-CSC =0.02±0.3Gy{sup −2}; for the SUM159PT, α-TC=0.08±0.25 Gy{sup −1}, β-TC=0.02±0.02Gy{sup −2}, α-CSC=0.04±0.18Gy{sup −1}, β-CSC =0.004±0.24Gy{sup −2}. In the mammosphere assay, where fs were higher than the corresponding cell line assays, there was almost no shoulder found in the surviving curves (more radioresistant in mammosphere assays) yielding β-CSC of approximately 0. Conclusion: Breast cancer stem cells were more radioresistant characterized by smaller α and β values compared to differentiated breast cancer cells. Percentage of breast cancer stem cells strongly correlated to overall tumor radioresistance. This observation suggested the feasibility of individualized radiotherapy prescription based on the fractions of cancer stem cells found in biopsy.« less

  9. Mammary stem cell and macrophage markers are enriched in normal tissue adjacent to inflammatory breast cancer.

    PubMed

    Reddy, Jay P; Atkinson, Rachel L; Larson, Richard; Burks, Jared K; Smith, Daniel; Debeb, Bisrat G; Ruffell, Brian; Creighton, Chad J; Bambhroliya, Arvind; Reuben, James M; Van Laere, Steven J; Krishnamurthy, Savitri; Symmans, William F; Brewster, Abenaa M; Woodward, Wendy A

    2018-06-01

    We hypothesized that breast tissue not involved by tumor in inflammatory breast cancer (IBC) patients contains intrinsic differences, including increased mammary stem cells and macrophage infiltration, which may promote the IBC phenotype. Normal breast parenchyma ≥ 5 cm away from primary tumors was obtained from mastectomy specimens. This included an initial cohort of 8 IBC patients and 60 non-IBC patients followed by a validation cohort of 19 IBC patients and 25 non-IBC patients. Samples were immunostained for either CD44 + CD49f + CD133/2 + mammary stem cell markers or the CD68 macrophage marker and correlated with IBC status. Quantitation of positive cells was determined using inForm software from PerkinElmer. We also examined the association between IBC status and previously published tumorigenic stem cell and IBC tumor signatures in the validation cohort samples. 8 of 8 IBC samples expressed isolated CD44 + CD49f + CD133/2 + stem cell marked cells in the initial cohort as opposed to 0/60 non-IBC samples (p = 0.001). Similarly, the median number of CD44 + CD49f + CD133/2 + cells was significantly higher in the IBC validation cohort as opposed to the non-IBC validation cohort (25.7 vs. 14.2, p = 0.007). 7 of 8 IBC samples expressed CD68 + histologically confirmed macrophages in initial cohort as opposed to 12/48 non-IBC samples (p = 0.001). In the validation cohort, the median number of CD68 + cells in IBC was 3.7 versus 1.0 in the non-IBC cohort (p = 0.06). IBC normal tissue was positively associated with a tumorigenic stem cell signature (p = 0.02) and with a 79-gene IBC signature (p < 0.001). Normal tissue from IBC patients is enriched for both mammary stem cells and macrophages and has higher association with both a tumorigenic stem cell signature and IBC-specific tumor signature. Collectively, these data suggest that IBC normal tissue differs from non-IBC tissue. Whether these changes occur before the tumor develops or is induced by tumor warrants further investigation.

  10. Limited utility of tissue micro-arrays in detecting intra-tumoral heterogeneity in stem cell characteristics and tumor progression markers in breast cancer.

    PubMed

    Kündig, Pascale; Giesen, Charlotte; Jackson, Hartland; Bodenmiller, Bernd; Papassotirolopus, Bärbel; Freiberger, Sandra Nicole; Aquino, Catharine; Opitz, Lennart; Varga, Zsuzsanna

    2018-05-08

    Intra-tumoral heterogeneity has been recently addressed in different types of cancer, including breast cancer. A concept describing the origin of intra-tumoral heterogeneity is the cancer stem-cell hypothesis, proposing the existence of cancer stem cells that can self-renew limitlessly and therefore lead to tumor progression. Clonal evolution in accumulated single cell genomic alterations is a further possible explanation in carcinogenesis. In this study, we addressed the question whether intra-tumoral heterogeneity can be reliably detected in tissue-micro-arrays in breast cancer by comparing expression levels of conventional predictive/prognostic tumor markers, tumor progression markers and stem cell markers between central and peripheral tumor areas. We analyzed immunohistochemical expression and/or gene amplification status of conventional prognostic tumor markers (ER, PR, HER2, CK5/6), tumor progression markers (PTEN, PIK3CA, p53, Ki-67) and stem cell markers (mTOR, SOX2, SOX9, SOX10, SLUG, CD44, CD24, TWIST) in 372 tissue-micro-array samples from 72 breast cancer patients. Expression levels were compared between central and peripheral tumor tissue areas and were correlated to histopathological grading. 15 selected cases additionally underwent RNA sequencing for transcriptome analysis. No significant difference in any of the analyzed between central and peripheral tumor areas was seen with any of the analyzed methods/or results that showed difference. Except mTOR, PIK3CA and SOX9 (nuclear) protein expression, all markers correlated significantly (p < 0.05) with histopathological grading both in central and peripheral areas. Our results suggest that intra-tumoral heterogeneity of stem-cell and tumor-progression markers cannot be reliably addressed in tissue-micro-array samples in breast cancer. However, most markers correlated strongly with histopathological grading confirming prognostic information as expression profiles were independent on the site of the biopsy was taken.

  11. Silencing PRDM14 expression by an innovative RNAi therapy inhibits stemness, tumorigenicity, and metastasis of breast cancer

    PubMed Central

    Taniguchi, Hiroaki; Hoshino, Daisuke; Moriya, Chiharu; Zembutsu, Hitoshi; Nishiyama, Nobuhiro; Yamamoto, Hiroyuki; Kataoka, Kazunori; Imai, Kohzoh

    2017-01-01

    PR domain zinc finger protein 14 (PRDM14) maintains stemness in embryonic stem cells via epigenetic mechanisms. Although PRDM14 is elevated in several cancers, it is unclear if and how PRDM14 confers stem cell-like properties and epigenetic changes to cancer cells. Here, we examined the phenotypic characteristics and epigenetic and gene expression profiles of cancer cells that differentially express PRDM14, and assessed the potential of PRDM14-targeted cancer therapy. PRDM14 expression was markedly increased in many different cancer types and correlated with poor survival of breast cancer patients. PRDM14 conferred stem cell-like phenotypes to cancer cells and regulated the expression of genes involved in cancer stemness, metastasis, and chemoresistance. PRDM14 also reduced the methylation of proto-oncogene and stemness gene promoters and PRDM14-binding regions were primarily occupied by histone H3 Lys-4 trimethylation (H3K4me3), both of which are positively correlated with gene expression. Moreover, strong PRDM14 binding sites coincided with promoters containing both H3K4me3 and H3K27me3 histone marks. Using calcium phosphate hybrid micelles as an RNAi delivery system, silencing of PRDM14 expression by chimera RNAi reduced tumor size and metastasis in vivo without causing adverse effects. Conditional loss of PRDM14 function also improved survival of MMTV-Wnt-1 transgenic mice, a spontaneous model of murine breast cancer. Our findings suggest that PRDM14 inhibition may be an effective and novel therapy for cancer stem cells. PMID:28423353

  12. Elucidating the Tumor Suppressive Role of SLITs in Maintaining the Basal Cell Niche

    DTIC Science & Technology

    2009-07-01

    deregulated upon cancerous transformation. 15. SUBJECT TERMS breast , Slit2, Robo1, basal cell 16. SECURITY CLASSIFICATION OF: 17. LIMITATION...natural
tumor
suppressor”
of
the
 breast 
because
they
 maintain
 breast 
tissue
integrity
by
organizing
the
cells
in
contact
with
them, including cells in...the breast stem cell niche, located between the myoepithelial and luminal epithelial cell layers.
SLITs
are
a
family
of
 secreted
proteins
that
were

  13. The Role of Tumor Associated Macrophage in Recurrent Growth of Tumor Stem Cell

    DTIC Science & Technology

    2012-09-01

    According to the recent cancer stem cell (CSC) theory, recurrent tumor must arise from a dormant tumor stem cell whose re- growth is triggered by...shifting of microenvironment. This project aims at clarifying the roles of TAM in recurrent growth of dormant stem cell in breast cancer. We hypothesize...the stem cell . We have established necessary mouse colonies and also developed the method to generate TAM. We have also shown that TAM indeed

  14. miR-142 regulates the tumorigenicity of human breast cancer stem cells through the canonical WNT signaling pathway

    PubMed Central

    Isobe, Taichi; Hisamori, Shigeo; Hogan, Daniel J; Zabala, Maider; Hendrickson, David G; Dalerba, Piero; Cai, Shang; Scheeren, Ferenc; Kuo, Angera H; Sikandar, Shaheen S; Lam, Jessica S; Qian, Dalong; Dirbas, Frederick M; Somlo, George; Lao, Kaiqin; Brown, Patrick O; Clarke, Michael F; Shimono, Yohei

    2014-01-01

    MicroRNAs (miRNAs) are important regulators of stem and progenitor cell functions. We previously reported that miR-142 and miR-150 are upregulated in human breast cancer stem cells (BCSCs) as compared to the non-tumorigenic breast cancer cells. In this study, we report that miR-142 efficiently recruits the APC mRNA to an RNA-induced silencing complex, activates the canonical WNT signaling pathway in an APC-suppression dependent manner, and activates the expression of miR-150. Enforced expression of miR-142 or miR-150 in normal mouse mammary stem cells resulted in the regeneration of hyperproliferative mammary glands in vivo. Knockdown of endogenous miR-142 effectively suppressed organoid formation by BCSCs and slowed tumor growth initiated by human BCSCs in vivo. These results suggest that in some tumors, miR-142 regulates the properties of BCSCs at least in part by activating the WNT signaling pathway and miR-150 expression. DOI: http://dx.doi.org/10.7554/eLife.01977.001 PMID:25406066

  15. Low adherent cancer cell subpopulations are enriched in tumorigenic and metastatic epithelial-to-mesenchymal transition-induced cancer stem-like cells.

    PubMed

    Morata-Tarifa, Cynthia; Jiménez, Gema; García, María A; Entrena, José M; Griñán-Lisón, Carmen; Aguilera, Margarita; Picon-Ruiz, Manuel; Marchal, Juan A

    2016-01-11

    Cancer stem cells are responsible for tumor progression, metastasis, therapy resistance and cancer recurrence, doing their identification and isolation of special relevance. Here we show that low adherent breast and colon cancer cells subpopulations have stem-like properties. Our results demonstrate that trypsin-sensitive (TS) breast and colon cancer cells subpopulations show increased ALDH activity, higher ability to exclude Hoechst 33342, enlarged proportion of cells with a cancer stem-like cell phenotype and are enriched in sphere- and colony-forming cells in vitro. Further studies in MDA-MB-231 breast cancer cells reveal that TS subpopulation expresses higher levels of SLUG, SNAIL, VIMENTIN and N-CADHERIN while show a lack of expression of E-CADHERIN and CLAUDIN, being this profile characteristic of the epithelial-to-mesenchymal transition (EMT). The TS subpopulation shows CXCL10, BMI-1 and OCT4 upregulation, differing also in the expression of several miRNAs involved in EMT and/or cell self-renewal such as miR-34a-5p, miR-34c-5p, miR-21-5p, miR-93-5p and miR-100-5p. Furthermore, in vivo studies in immunocompromised mice demonstrate that MDA-MB-231 TS cells form more and bigger xenograft tumors with shorter latency and have higher metastatic potential. In conclusion, this work presents a new, non-aggressive, easy, inexpensive and reproducible methodology to isolate prospectively cancer stem-like cells for subsequent biological and preclinical studies.

  16. H19/let-7/LIN28 reciprocal negative regulatory circuit promotes breast cancer stem cell maintenance

    PubMed Central

    Peng, Fei; Li, Ting-Ting; Wang, Kai-Li; Xiao, Guo-Qing; Wang, Ju-Hong; Zhao, Hai-Dong; Kang, Zhi-Jie; Fan, Wen-Jun; Zhu, Li-Li; Li, Mei; Cui, Bai; Zheng, Fei-Meng; Wang, Hong-Jiang; Lam, Eric W-F; Wang, Bo; Xu, Jie; Liu, Quentin

    2017-01-01

    Long noncoding RNA-H19 (H19), an imprinted oncofetal gene, has a central role in carcinogenesis. Hitherto, the mechanism by which H19 regulates cancer stem cells, remains elusive. Here we show that breast cancer stem cells (BCSCs) express high levels of H19, and ectopic overexpression of H19 significantly promotes breast cancer cell clonogenicity, migration and mammosphere-forming ability. Conversely, silencing of H19 represses these BCSC properties. In concordance, knockdown of H19 markedly inhibits tumor growth and suppresses tumorigenesis in nude mice. Mechanistically, we found that H19 functions as a competing endogenous RNA to sponge miRNA let-7, leading to an increase in expression of a let-7 target, the core pluripotency factor LIN28, which is enriched in BCSC populations and breast patient samples. Intriguingly, this gain of LIN28 expression can also feedback to reverse the H19 loss-mediated suppression of BCSC properties. Our data also reveal that LIN28 blocks mature let-7 production and, thereby, de-represses H19 expression in breast cancer cells. Appropriately, H19 and LIN28 expression exhibits strong correlations in primary breast carcinomas. Collectively, these findings reveal that lncRNA H19, miRNA let-7 and transcriptional factor LIN28 form a double-negative feedback loop, which has a critical role in the maintenance of BCSCs. Consequently, disrupting this pathway provides a novel therapeutic strategy for breast cancer. PMID:28102845

  17. Glycophenotype of breast and prostate cancer stem cells treated with thieno[2,3-b]pyridine anticancer compound.

    PubMed

    Mastelić, Angela; Čikeš Čulić, Vedrana; Režić Mužinić, Nikolina; Vuica-Ross, Milena; Barker, David; Leung, Euphemia Y; Reynisson, Jóhannes; Markotić, Anita

    2017-01-01

    Tumor progression may be driven by a small subpopulation of cancer stem cells (CSCs characterized by CD44 + /CD24 - phenotype). We investigated the influence of a newly developed thienopyridine anticancer compound (3-amino-5-oxo- N -naphthyl-5,6,7, 8-tetrahydrothieno[2,3- b ]quinoline-2-carboxamide, 1 ) on the growth, survival and glycophenotype (CD15s and GM3 containing neuraminic acid substituted with acetyl residue, NeuAc) of breast and prostate cancer stem/progenitor-like cell population. MDA-MB-231 and Du-145 cells were incubated with compound 1 alone or in combination with paclitaxel. The cellular metabolic activity was determined by the 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide (MTT) assay. The type of cell death induced by 48-h treatment was assessed using a combination of Annexin-V-FITC and propidium iodide staining. Flow cytometric analysis was performed to detect the percentage of CD44 + /CD24 - cells, and GM3 and CD15s positive CSCs, as well as the expression of GM3 and CD15s per one CSC, in both cell lines. Compound 1 produces a dose- and time-dependent cytotoxicity, mediated mainly by apoptosis in breast cancer cells, and slightly (2.3%) but statistically significant lowering breast CSC subpopulation. GM3 expression per one breast CSC was increased, and the percentage of prostate GM3 + CSC subpopulation was decreased in cells treated with compound 1 compared with non-treated cells. The percentage of CD15s + CSCs was lower in both cell lines after treatment with compound 1 . Considering that triple-negative breast cancers are characterized by an increased percentage of breast CSCs and knowing their association with an increased risk of metastasis and mortality, compound 1 is a potentially effective drug for triple-negative breast cancer treatment.

  18. Analysis of the Contribution of Stem Cells to Breast Cancer Using Microchimerism-Based Y-Chromosome Stains and Histopathology

    DTIC Science & Technology

    2005-07-01

    stroma), if any, have originated from the body’s circulating stem cell pool, using the Y- chromosome in micro-chimeric mothers . Such a cell may present... Transplanted or chimeric Y chromosome-bearing stem cells behave as do the mothers own: proliferating, differentiating and incorporating into... Transplanted or chimeric Y chromosome-bearing stem cells behave as do the mothers own: aggregating, proliferating, and differentiating(Petersen

  19. Intra-Tumour Signalling Entropy Determines Clinical Outcome in Breast and Lung Cancer

    PubMed Central

    Banerji, Christopher R. S.; Severini, Simone; Caldas, Carlos; Teschendorff, Andrew E.

    2015-01-01

    The cancer stem cell hypothesis, that a small population of tumour cells are responsible for tumorigenesis and cancer progression, is becoming widely accepted and recent evidence has suggested a prognostic and predictive role for such cells. Intra-tumour heterogeneity, the diversity of the cancer cell population within the tumour of an individual patient, is related to cancer stem cells and is also considered a potential prognostic indicator in oncology. The measurement of cancer stem cell abundance and intra-tumour heterogeneity in a clinically relevant manner however, currently presents a challenge. Here we propose signalling entropy, a measure of signalling pathway promiscuity derived from a sample’s genome-wide gene expression profile, as an estimate of the stemness of a tumour sample. By considering over 500 mixtures of diverse cellular expression profiles, we reveal that signalling entropy also associates with intra-tumour heterogeneity. By analysing 3668 breast cancer and 1692 lung adenocarcinoma samples, we further demonstrate that signalling entropy correlates negatively with survival, outperforming leading clinical gene expression based prognostic tools. Signalling entropy is found to be a general prognostic measure, valid in different breast cancer clinical subgroups, as well as within stage I lung adenocarcinoma. We find that its prognostic power is driven by genes involved in cancer stem cells and treatment resistance. In summary, by approximating both stemness and intra-tumour heterogeneity, signalling entropy provides a powerful prognostic measure across different epithelial cancers. PMID:25793737

  20. Identification of a selective small molecule inhibitor of breast cancer stem cells.

    PubMed

    Germain, Andrew R; Carmody, Leigh C; Morgan, Barbara; Fernandez, Cristina; Forbeck, Erin; Lewis, Timothy A; Nag, Partha P; Ting, Amal; VerPlank, Lynn; Feng, Yuxiong; Perez, Jose R; Dandapani, Sivaraman; Palmer, Michelle; Lander, Eric S; Gupta, Piyush B; Schreiber, Stuart L; Munoz, Benito

    2012-05-15

    A high-throughput screen (HTS) with the National Institute of Health-Molecular Libraries Small Molecule Repository (NIH-MLSMR) compound collection identified a class of acyl hydrazones to be selectively lethal to breast cancer stem cell (CSC) enriched populations. Medicinal chemistry efforts were undertaken to optimize potency and selectivity of this class of compounds. The optimized compound was declared as a probe (ML239) with the NIH Molecular Libraries Program and displayed greater than 20-fold selective inhibition of the breast CSC-like cell line (HMLE_sh_Ecad) over the isogenic control line (HMLE_sh_GFP). Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Gene expression profiles of breast biopsies from healthy women identify a group with claudin-low features.

    PubMed

    Haakensen, Vilde D; Lingjaerde, Ole Christian; Lüders, Torben; Riis, Margit; Prat, Aleix; Troester, Melissa A; Holmen, Marit M; Frantzen, Jan Ole; Romundstad, Linda; Navjord, Dina; Bukholm, Ida K; Johannesen, Tom B; Perou, Charles M; Ursin, Giske; Kristensen, Vessela N; Børresen-Dale, Anne-Lise; Helland, Aslaug

    2011-11-01

    Increased understanding of the variability in normal breast biology will enable us to identify mechanisms of breast cancer initiation and the origin of different subtypes, and to better predict breast cancer risk. Gene expression patterns in breast biopsies from 79 healthy women referred to breast diagnostic centers in Norway were explored by unsupervised hierarchical clustering and supervised analyses, such as gene set enrichment analysis and gene ontology analysis and comparison with previously published genelists and independent datasets. Unsupervised hierarchical clustering identified two separate clusters of normal breast tissue based on gene-expression profiling, regardless of clustering algorithm and gene filtering used. Comparison of the expression profile of the two clusters with several published gene lists describing breast cells revealed that the samples in cluster 1 share characteristics with stromal cells and stem cells, and to a certain degree with mesenchymal cells and myoepithelial cells. The samples in cluster 1 also share many features with the newly identified claudin-low breast cancer intrinsic subtype, which also shows characteristics of stromal and stem cells. More women belonging to cluster 1 have a family history of breast cancer and there is a slight overrepresentation of nulliparous women in cluster 1. Similar findings were seen in a separate dataset consisting of histologically normal tissue from both breasts harboring breast cancer and from mammoplasty reductions. This is the first study to explore the variability of gene expression patterns in whole biopsies from normal breasts and identified distinct subtypes of normal breast tissue. Further studies are needed to determine the specific cell contribution to the variation in the biology of normal breasts, how the clusters identified relate to breast cancer risk and their possible link to the origin of the different molecular subtypes of breast cancer.

  2. Implications of Cancer Stem Cell Theory for Cancer Chemoprevention by Natural Dietary Compounds

    PubMed Central

    Li, Yanyan; Wicha, Max S.; Schwartz, Steven J.; Sun, Duxin

    2011-01-01

    The emergence of cancer stem cell theory has profound implications for cancer chemoprevention and therapy. Cancer stem cells give rise to the tumor bulk through continuous self-renewal and differentiation. Understanding the mechanisms that regulate self-renewal is of greatest importance for discovery of anti-cancer drugs targeting cancer stem cells. Naturally-occurring dietary compounds have received increasing attention in cancer chemoprevention. The anti-cancer effects of many dietary components have been reported for both in vitro and in vivo studies. Recently, a number of studies have found that several dietary compounds can directly or indirectly affect cancer stem cell self-renewal pathways. Herein we review the current knowledge of most common natural dietary compounds for their impact on self-renewal pathways and potential effect against cancer stem cells. Three pathways (Wnt/β-catenin, Hedgehog, and Notch) are summarized for their functions in self-renewal of cancer stem cells. The dietary compounds, including curcumin, sulforaphane, soy isoflavone, epigallocatechin-3-gallate, resveratrol, lycopene, piperine, and vitamin D3, are discussed for their direct or indirect effect on these self-renewal pathways. Curcumin and piperine have been demonstrated to target breast cancer stem cells. Sulforaphane has been reported to inhibit pancreatic tumor initiating cells and breast cancer stem cells. These studies provide a basis for preclinical and clinical evaluation of dietary compounds for chemoprevention of cancer stem cells. This may enable us to discover more preventive strategies for cancer management by reducing cancer resistance and recurrence and improving patient survival. PMID:21295962

  3. Analysis of clonal expansions through the normal and premalignant human breast epithelium reveals the presence of luminal stem cells.

    PubMed

    Cereser, Biancastella; Jansen, Marnix; Austin, Emily; Elia, George; McFarlane, Taneisha; van Deurzen, Carolien Hm; Sieuwerts, Anieta M; Daidone, Maria G; Tadrous, Paul J; Wright, Nicholas A; Jones, Louise; McDonald, Stuart Ac

    2018-01-01

    It is widely accepted that the cell of origin of breast cancer is the adult mammary epithelial stem cell; however, demonstrating the presence and location of tissue stem cells in the human breast has proved difficult. Furthermore, we do not know the clonal architecture of the normal and premalignant mammary epithelium or its cellular hierarchy. Here, we use deficiency in the mitochondrial enzyme cytochrome c oxidase (CCO), typically caused by somatic mutations in the mitochondrial genome, as a means to perform lineage tracing in the human mammary epithelium. PCR sequencing of laser-capture microdissected cells in combination with immunohistochemistry for markers of lineage differentiation was performed to determine the clonal nature of the mammary epithelium. We have shown that in the normal human breast, clonal expansions (defined here by areas of CCO deficiency) are typically uncommon and of limited size, but can occur at any site within the adult mammary epithelium. The presence of a stem cell population was shown by demonstrating multi-lineage differentiation within CCO-deficient areas. Interestingly, we observed infrequent CCO deficiency that was restricted to luminal cells, suggesting that niche succession, and by inference stem cell location, is located within the luminal layer. CCO-deficient areas appeared large within areas of ductal carcinoma in situ, suggesting that the rate of clonal expansion was altered in the premalignant lesion. © 2017 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great Britain and Ireland. © 2017 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great Britain and Ireland.

  4. Breast Cancer Training Program

    DTIC Science & Technology

    2005-08-01

    trainee support in year 05 Dr. Matulka studies the biology and stem cell features of parity- induced mammary epithelial cells (PI- MECs). In particular...cancer- from discovery to application February 10, 2005 Dr. James Trosko Michigan State University Role of Human Adult Stem Cells and Cell - Cell ...cancer epidemiology September 6, 2001 Dr. Gilbert Smith NCI Mammary stem cells May 24, 2001 Dr. V. Craig Jordan Northwestern University School Henry

  5. ATM kinase sustains breast cancer stem-like cells by promoting ATG4C expression and autophagy.

    PubMed

    Antonelli, Martina; Strappazzon, Flavie; Arisi, Ivan; Brandi, Rossella; D'Onofrio, Mara; Sambucci, Manolo; Manic, Gwenola; Vitale, Ilio; Barilà, Daniela; Stagni, Venturina

    2017-03-28

    The efficacy of Ataxia-Telangiectasia Mutated (ATM) kinase signalling inhibition in cancer therapy is tempered by the identification of new emerging functions of ATM, which suggests that the role of this protein in cancer progression is complex. We recently demonstrated that this tumor suppressor gene could act as tumor promoting factor in HER2 (Human Epidermal Growth Factor Receptor 2) positive breast cancer. Herein we put in evidence that ATM expression sustains the proportion of cells with a stem-like phenotype, measured as the capability to form mammospheres, independently of HER2 expression levels. Transcriptomic analyses revealed that, in mammospheres, ATM modulates the expression of cell cycle-, DNA repair- and autophagy-related genes. Among these, the silencing of the autophagic gene, autophagy related 4C cysteine peptidase (ATG4C), impairs mammosphere formation similarly to ATM depletion. Conversely, ATG4C ectopic expression in cells silenced for ATM expression, rescues mammospheres growth. Finally, tumor array analyses, performed using public data, identify a significant correlation between ATM and ATG4C expression levels in all human breast cancer subtypes, except for the basal-like one.Overall, we uncover a new connection between ATM kinase and autophagy regulation in breast cancer. We demonstrate that, in breast cancer cells, ATM and ATG4C are essential drivers of mammosphere formation, suggesting that their targeting may improve current approaches to eradicate breast cancer cells with a stem-like phenotype.

  6. Prolyl isomerase Pin1 acts downstream of miR-200 to promote cancer stem-like cell traits in breast cancer

    PubMed Central

    Luo, Man-Li; Gong, Chang; Chen, Chun-Hau; Lee, Daniel Y.; Hu, Hai; Huang, Pengyu; Yao, Yandan; Guo, Wenjun; Reinhardt, Ferenc; Wulf, Gerburg; Lieberman, Judy; Zhou, Xiao Zhen; Song, Erwei; Lu, Kun Ping

    2014-01-01

    Breast cancer stem-like cells (BCSC) have been implicated in tumor growth, metastasis, drug resistance and relapse but druggable targets in appropriate subsets of this cell population have yet to be identified. Here we identify a fundamental role for the prolyl isomerase Pin1 in driving BCSC expansion, invasiveness and tumorigenicity, defining it as a key target of miR-200c which is known to be a critical regluator in BSCS. Pin1 overexpression expanded the growth and tumorigenicity of BCSC and triggered epithelial-mesenchymal transition (EMT). Conversely, genetic or pharmaacological inhibition of Pin1 reduced the abundance and self-renewal activity of BCSC. Moreover, moderate overexpression of miR-200c-resistant Pin1 rescued the BCSC defect in miR-200c-expressing cells. Genetic deletion of Pin1 also decreased the abundance and repopulating capability of normal mouse mammary stem cells. In human cells freshly isolated from reduction mammoplasty tissues, Pin1 overexpression endowed BCSC traits to normal breast epithelial cells, expanding both luminal and basal/myoepithelial lineages in these cells. In contrast, Pin1 silencing in primary breast cancer cells isolated from clinical samples inhibited the expansion, self-renewal activity and tumorigenesis of BCSC in vitro and in vivo. Overall, our work demonstrated that Pin1 is a pivotal regulator acting downstream of miR-200c to drive BCSC and breast tumorigenicity, highlighting a new therapeutic target to eradicate BCSC. PMID:24786790

  7. p62/SQSTM1 enhances breast cancer stem-like properties by stabilizing MYC mRNA

    PubMed Central

    Xu, L-Z; Li, S-S; Zhou, W; Kang, Z-J; Zhang, Q-X; Kamran, M; Xu, J; Liang, D-P; Wang, C-L; Hou, Z-J; Wan, X-B; Wang, H-J; Lam, E W-F; Zhao, Z-W; Liu, Q

    2017-01-01

    Aberrant p62 overexpression has been implicated in breast cancer development. Here, we found that p62 expression was elevated in breast cancer stem cells (BCSCs), including CD44+CD24− fractions, mammospheres, ALDH1+ populations and side population cells. Indeed, short-hairpin RNA (shRNA)-mediated knockdown of p62 impaired breast cancer cells from self-renewing under anchorage-independent conditions, whereas ectopic overexpression of p62 enhanced the self-renewal ability of breast cancer cells in vitro. Genetic depletion of p62 robustly inhibited tumor-initiating frequencies, as well as growth rates of BCSC-derived tumor xenografts in immunodeficient mice. Consistently, immunohistochemical analysis of clinical breast tumor tissues showed that high p62 expression levels were linked to poorer clinical outcome. Further gene expression profiling analysis revealed that p62 was positively correlated with MYC expression level, which mediated the function of p62 in promoting breast cancer stem-like properties. MYC mRNA level was reduced upon p62 deletion by siRNA and increased with p62 overexpression in breast cancer cells, suggesting that p62 positively regulated MYC mRNA. Interestingly, p62 did not transactivate MYC promoter. Instead, p62 delayed the degradation of MYC mRNA by repressing the expression of let-7a and let-7b, thus promoting MYC mRNA stabilization at the post-transcriptional level. Consistently, let-7a and let-7b mimics attenuated p62-mediated MYC mRNA stabilization. Together, these findings unveiled a previously unappreciated role of p62 in the regulation of BCSCs, assigning p62 as a promising therapeutic target for breast cancer treatments. PMID:27345399

  8. Role of the Drug Transporter ABCC3 in Breast Cancer Chemoresistance

    PubMed Central

    Balaji, Sai A.; Udupa, Nayanabhirama; Chamallamudi, Mallikarjuna Rao; Gupta, Vaijayanti; Rangarajan, Annapoorni

    2016-01-01

    Increased expression of ABC-family of transporters is associated with chemotherapy failure. Although the drug transporters ABCG2, ABCB1 and ABCC1 have been majorly implicated in cancer drug resistance, recent studies have associated ABCC3 with multi drug resistance and poor clinical response. In this study, we have examined the expression of ABCC3 in breast cancers and studied its role in drug resistance and stemness of breast cancer cells in comparison with the more studied ABCC1. We observed that similar to ABCC1, the transcripts levels of ABCC3 was significantly high in breast cancers compared to adjacent normal tissue. Importantly, expression of both transporters was further increased in chemotherapy treated patient samples. Consistent with this, we observed that treatment of breast cancer cell lines with anti-cancer agents increased their mRNA levels of both ABCC1 and ABCC3. Further, similar to knockdown of ABCC1, knockdown of ABCC3 also significantly increased the retention of chemotherapeutic drugs in breast cancer cells and rendered them more chemo-sensitive. Interestingly, ABCC1 and ABCC3 knockdown cells also showed reduction in the expression of stemness genes, while ABCC3 knockdown additionally led to a reduction in the CD44high/CD24low breast cancer stem-like subpopulation. Consistent with this, their ability to form primary tumours was compromised. Importantly, down-modulation of ABCC3 rendered these cells increasingly susceptible to doxorubicin in xenograft mice models in vivo. Thus, our study highlights the importance of ABCC3 transporters in drug resistance to chemotherapy in the context of breast cancer. Further, these results suggest that combinatorial inhibition of these transporters together with standard chemotherapy can reduce therapy-induced resistance in breast cancer. PMID:27171227

  9. Mammary molecular portraits reveal lineage-specific features and progenitor cell vulnerabilities.

    PubMed

    Casey, Alison E; Sinha, Ankit; Singhania, Rajat; Livingstone, Julie; Waterhouse, Paul; Tharmapalan, Pirashaanthy; Cruickshank, Jennifer; Shehata, Mona; Drysdale, Erik; Fang, Hui; Kim, Hyeyeon; Isserlin, Ruth; Bailey, Swneke; Medina, Tiago; Deblois, Genevieve; Shiah, Yu-Jia; Barsyte-Lovejoy, Dalia; Hofer, Stefan; Bader, Gary; Lupien, Mathieu; Arrowsmith, Cheryl; Knapp, Stefan; De Carvalho, Daniel; Berman, Hal; Boutros, Paul C; Kislinger, Thomas; Khokha, Rama

    2018-06-19

    The mammary epithelium depends on specific lineages and their stem and progenitor function to accommodate hormone-triggered physiological demands in the adult female. Perturbations of these lineages underpin breast cancer risk, yet our understanding of normal mammary cell composition is incomplete. Here, we build a multimodal resource for the adult gland through comprehensive profiling of primary cell epigenomes, transcriptomes, and proteomes. We define systems-level relationships between chromatin-DNA-RNA-protein states, identify lineage-specific DNA methylation of transcription factor binding sites, and pinpoint proteins underlying progesterone responsiveness. Comparative proteomics of estrogen and progesterone receptor-positive and -negative cell populations, extensive target validation, and drug testing lead to discovery of stem and progenitor cell vulnerabilities. Top epigenetic drugs exert cytostatic effects; prevent adult mammary cell expansion, clonogenicity, and mammopoiesis; and deplete stem cell frequency. Select drugs also abrogate human breast progenitor cell activity in normal and high-risk patient samples. This integrative computational and functional study provides fundamental insight into mammary lineage and stem cell biology. © 2018 Casey et al.

  10. Sox2 promotes tamoxifen resistance in breast cancer cells

    PubMed Central

    Piva, Marco; Domenici, Giacomo; Iriondo, Oihana; Rábano, Miriam; Simões, Bruno M; Comaills, Valentine; Barredo, Inmaculada; López-Ruiz, Jose A; Zabalza, Ignacio; Kypta, Robert; Vivanco, Maria d M

    2014-01-01

    Development of resistance to therapy continues to be a serious clinical problem in breast cancer management. Cancer stem/progenitor cells have been shown to play roles in resistance to chemo- and radiotherapy. Here, we examined their role in the development of resistance to the oestrogen receptor antagonist tamoxifen. Tamoxifen-resistant cells were enriched for stem/progenitors and expressed high levels of the stem cell marker Sox2. Silencing of the SOX2 gene reduced the size of the stem/progenitor cell population and restored sensitivity to tamoxifen. Conversely, ectopic expression of Sox2 reduced tamoxifen sensitivity in vitro and in vivo. Gene expression profiling revealed activation of the Wnt signalling pathway in Sox2-expressing cells, and inhibition of Wnt signalling sensitized resistant cells to tamoxifen. Examination of patient tumours indicated that Sox2 levels are higher in patients after endocrine therapy failure, and also in the primary tumours of these patients, compared to those of responders. Together, these results suggest that development of tamoxifen resistance is driven by Sox2-dependent activation of Wnt signalling in cancer stem/progenitor cells. PMID:24178749

  11. Meta-Analysis of Tumor Stem-Like Breast Cancer Cells Using Gene Set and Network Analysis

    PubMed Central

    Lee, Won Jun; Kim, Sang Cheol; Yoon, Jung-Ho; Yoon, Sang Jun; Lim, Johan; Kim, You-Sun; Kwon, Sung Won; Park, Jeong Hill

    2016-01-01

    Generally, cancer stem cells have epithelial-to-mesenchymal-transition characteristics and other aggressive properties that cause metastasis. However, there have been no confident markers for the identification of cancer stem cells and comparative methods examining adherent and sphere cells are widely used to investigate mechanism underlying cancer stem cells, because sphere cells have been known to maintain cancer stem cell characteristics. In this study, we conducted a meta-analysis that combined gene expression profiles from several studies that utilized tumorsphere technology to investigate tumor stem-like breast cancer cells. We used our own gene expression profiles along with the three different gene expression profiles from the Gene Expression Omnibus, which we combined using the ComBat method, and obtained significant gene sets using the gene set analysis of our datasets and the combined dataset. This experiment focused on four gene sets such as cytokine-cytokine receptor interaction that demonstrated significance in both datasets. Our observations demonstrated that among the genes of four significant gene sets, six genes were consistently up-regulated and satisfied the p-value of < 0.05, and our network analysis showed high connectivity in five genes. From these results, we established CXCR4, CXCL1 and HMGCS1, the intersecting genes of the datasets with high connectivity and p-value of < 0.05, as significant genes in the identification of cancer stem cells. Additional experiment using quantitative reverse transcription-polymerase chain reaction showed significant up-regulation in MCF-7 derived sphere cells and confirmed the importance of these three genes. Taken together, using meta-analysis that combines gene set and network analysis, we suggested CXCR4, CXCL1 and HMGCS1 as candidates involved in tumor stem-like breast cancer cells. Distinct from other meta-analysis, by using gene set analysis, we selected possible markers which can explain the biological mechanisms and suggested network analysis as an additional criterion for selecting candidates. PMID:26870956

  12. miRNA-regulated cancer stem cells: understanding the property and the role of miRNA in carcinogenesis.

    PubMed

    Chakraborty, Chiranjib; Chin, Kok-Yong; Das, Srijit

    2016-10-01

    Over the last few years, microRNAs (miRNA)-controlled cancer stem cells have drawn enormous attention. Cancer stem cells are a small population of tumor cells that possess the stem cell property of self-renewal. Recent data shows that miRNA regulates this small population of stem cells. In the present review, we explained different characteristics of cancer stem cells as well as miRNA regulation of self-renewal and differentiation in cancer stem cells. We also described the migration and tumor formation. Finally, we described the different miRNAs that regulate various types of cancer stem cells, such as prostate cancer stem cells, head and neck cancer stem cells, breast cancer stem cells, colorectal cancer stem cells, lung cancer stem cells, gastric cancer stem cells, pancreatic cancer stem cells, etc. Extensive research is needed in order to employ miRNA-based therapeutics to control cancer stem cell population in various cancers in the future.

  13. MiRNA Transcriptome Profiling of Spheroid-Enriched Cells with Cancer Stem Cell Properties in Human Breast MCF-7 Cell Line.

    PubMed

    Boo, Lily; Ho, Wan Yong; Ali, Norlaily Mohd; Yeap, Swee Keong; Ky, Huynh; Chan, Kok Gan; Yin, Wai Fong; Satharasinghe, Dilan Amila; Liew, Woan Charn; Tan, Sheau Wei; Ong, Han Kiat; Cheong, Soon Keng

    2016-01-01

    Breast cancer is the second leading cause of cancer-related mortality worldwide as most patients often suffer cancer relapse. The reason is often attributed to the presence of cancer stem cells (CSCs). Recent studies revealed that dysregulation of microRNA (miRNA) are closely linked to breast cancer recurrence and metastasis. However, no specific study has comprehensively characterised the CSC characteristic and miRNA transcriptome in spheroid-enriched breast cells. This study described the generation of spheroid MCF-7 cell in serum-free condition and the comprehensive characterisation for their CSC properties. Subsequently, miRNA expression differences between the spheroid-enriched CSC cells and their parental cells were evaluated using next generation sequencing (NGS). Our results showed that the MCF-7 spheroid cells were enriched with CSCs properties, indicated by the ability to self-renew, increased expression of CSCs markers, and increased resistance to chemotherapeutic drugs. Additionally, spheroid-enriched CSCs possessed greater cell proliferation, migration, invasion, and wound healing ability. A total of 134 significantly (p<0.05) differentially expressed miRNAs were identified between spheroids and parental cells using miRNA-NGS. MiRNA-NGS analysis revealed 25 up-regulated and 109 down-regulated miRNAs which includes some miRNAs previously reported in the regulation of breast CSCs. A number of miRNAs (miR-4492, miR-4532, miR-381, miR-4508, miR-4448, miR-1296, and miR-365a) which have not been previously reported in breast cancer were found to show potential association with breast cancer chemoresistance and self-renewal capability. The gene ontology (GO) analysis showed that the predicted genes were enriched in the regulation of metabolic processes, gene expression, DNA binding, and hormone receptor binding. The corresponding pathway analyses inferred from the GO results were closely related to the function of signalling pathway, self-renewability, chemoresistance, tumorigenesis, cytoskeletal proteins, and metastasis in breast cancer. Based on these results, we proposed that certain miRNAs identified in this study could be used as new potential biomarkers for breast cancer stem cell diagnosis and targeted therapy.

  14. Enhanced metastatic capacity of breast cancer cells after interaction and hybrid formation with mesenchymal stroma/stem cells (MSC).

    PubMed

    Melzer, Catharina; von der Ohe, Juliane; Hass, Ralf

    2018-01-05

    Fusion of breast cancer cells with tumor-associated populations of the microenvironment including mesenchymal stroma/stem-like cells (MSC) represents a rare event in cell communication whereby the metastatic capacity of those hybrid cells remains unclear. Functional changes were investigated in vitro and in vivo following spontaneous fusion and hybrid cell formation between primary human MSC and human MDA-MB-231 breast cancer cells. Thus, lentiviral eGFP-labeled MSC and breast cancer cells labeled with mcherry resulted in dual-fluorescing hybrid cells after co-culture. Double FACS sorting and single cell cloning revealed two different aneuploid male hybrid populations (MDA-hyb1 and MDA-hyb2) with different STR profiles, pronounced telomerase activities, and enhanced proliferative capacities as compared to the parental cells. Microarray-based mRNA profiling demonstrated marked regulation of genes involved in epithelial-mesenchymal transition and increased expression of metastasis-associated genes including S100A4. In vivo studies following subcutaneous injection of the breast cancer and the two hybrid populations substantiated the in vitro findings by a significantly elevated tumor growth of the hybrid cells. Moreover, both hybrid populations developed various distant organ metastases in a much shorter period of time than the parental breast cancer cells. Together, these data demonstrate spontaneous development of new tumor cell populations exhibiting different parental properties after close interaction and subsequent fusion of MSC with breast cancer cells. This formation of tumor hybrids contributes to continuously increasing tumor heterogeneity and elevated metastatic capacities.

  15. Defining High-Risk Precursor Signaling to Advance Breast Cancer Risk Assessment and Prevention

    DTIC Science & Technology

    2017-03-01

    KEYWORDS: 3. ACCOMPLISHMENTS: Aim 1: Functional analysis of progenitor and stem cells in high-risk tissues. Major Task 1Functional...and stem cells in high-risk tissues. Major Task 1: Quantitation of LP (Luminal Progenitor) and basal stem cell (MASC) populations A. Quantitation of...LP and basal stem cell (MASC) populations We have continued to add patients to the cohorts between months 12 and 24. (This reporting period

  16. Anticarcinogenic activity of polyphenolic extracts from grape stems against breast, colon, renal and thyroid cancer cells.

    PubMed

    Sahpazidou, Despina; Geromichalos, George D; Stagos, Dimitrios; Apostolou, Anna; Haroutounian, Serkos A; Tsatsakis, Aristidis M; Tzanakakis, George N; Hayes, A Wallace; Kouretas, Dimitrios

    2014-10-15

    A major part of the wineries' wastes is composed of grape stems which are discarded mainly in open fields and cause environmental problems due mainly to their high polyphenolic content. The grape stem extracts' use as a source of high added value polyphenols presents great interest because this combines a profitable venture with environmental protection close to wine-producing zones. In the present study, at first, the Total Polyphenolic Content (TPC) and the polyphenolic composition of grape stem extracts from four different Greek Vitis vinifera varieties were determined by HPLC methods. Afterwards, the grape stem extracts were examined for their ability to inhibit growth of colon (HT29), breast (MCF-7 and MDA-MB-23), renal (786-0 and Caki-1) and thyroid (K1) cancer cells. The cancer cells were exposed to the extracts for 72 h and the effects on cell growth were evaluated using the SRB assay. The results indicated that all extracts inhibited cell proliferation, with IC₅₀ values of 121-230 μg/ml (MCF-7), 121-184 μg/ml (MDA-MD-23), 175-309 μg/ml (HT29), 159-314 μg/ml (K1), 180-225 μg/ml (786-0) and 134->400 μg/ml (Caki-1). This is the first study presenting the inhibitory activity of grape stem extracts against growth of colon, breast, renal and thyroid cancer cells. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  17. Triple negative breast cancer initiating cell subsets differ in functional and molecular characteristics and in γ-secretase inhibitor drug responses

    PubMed Central

    Azzam, Diana J; Zhao, Dekuang; Sun, Jun; Minn, Andy J; Ranganathan, Prathibha; Drews-Elger, Katherine; Han, Xiaoqing; Picon-Ruiz, Manuel; Gilbert, Candace A; Wander, Seth A; Capobianco, Anthony J; El-Ashry, Dorraya; Slingerland, Joyce M

    2013-01-01

    Increasing evidence suggests that stem-like cells mediate cancer therapy resistance and metastasis. Breast tumour-initiating stem cells (T-ISC) are known to be enriched in CD44+CD24neg/low cells. Here, we identify two T-ISC subsets within this population in triple negative breast cancer (TNBC) lines and dissociated primary breast cancer cultures: CD44+CD24low+ subpopulation generates CD44+CD24neg progeny with reduced sphere formation and tumourigenicity. CD44+CD24low+ populations contain subsets of ALDH1+ and ESA+ cells, yield more frequent spheres and/or T-ISC in limiting dilution assays, preferentially express metastatic gene signatures and show greater motility, invasion and, in the MDA-MB-231 model, metastatic potential. CD44+CD24low+ but not CD44+CD24neg express activated Notch1 intracellular domain (N1-ICD) and Notch target genes. We show N1-ICD transactivates SOX2 to increase sphere formation, ALDH1+ and CD44+CD24low+cells. Gamma secretase inhibitors (GSI) reduced sphere formation and xenograft growth from CD44+CD24low+ cells, but CD44+CD24neg were resistant. While GSI hold promise for targeting T-ISC, stem cell heterogeneity as observed herein, could limit GSI efficacy. These data suggest a breast T-ISC hierarchy in which distinct pathways drive developmentally related subpopulations with different anti-cancer drug responsiveness. PMID:23982961

  18. Targeting breast to brain metastatic tumours with death receptor ligand expressing therapeutic stem cells

    PubMed Central

    Bagci-Onder, Tugba; Du, Wanlu; Figueiredo, Jose-Luiz; Martinez-Quintanilla, Jordi

    2015-01-01

    Characterizing clinically relevant brain metastasis models and assessing the therapeutic efficacy in such models are fundamental for the development of novel therapies for metastatic brain cancers. In this study, we have developed an in vivo imageable breast-to-brain metastasis mouse model. Using real time in vivo imaging and subsequent composite fluorescence imaging, we show a widespread distribution of micro- and macro-metastasis in different stages of metastatic progression. We also show extravasation of tumour cells and the close association of tumour cells with blood vessels in the brain thus mimicking the multi-foci metastases observed in the clinics. Next, we explored the ability of engineered adult stem cells to track metastatic deposits in this model and show that engineered stem cells either implanted or injected via circulation efficiently home to metastatic tumour deposits in the brain. Based on the recent findings that metastatic tumour cells adopt unique mechanisms of evading apoptosis to successfully colonize in the brain, we reasoned that TNF receptor superfamily member 10A/10B apoptosis-inducing ligand (TRAIL) based pro-apoptotic therapies that induce death receptor signalling within the metastatic tumour cells might be a favourable therapeutic approach. We engineered stem cells to express a tumour selective, potent and secretable variant of a TRAIL, S-TRAIL, and show that these cells significantly suppressed metastatic tumour growth and prolonged the survival of mice bearing metastatic breast tumours. Furthermore, the incorporation of pro-drug converting enzyme, herpes simplex virus thymidine kinase, into therapeutic S-TRAIL secreting stem cells allowed their eradication post-tumour treatment. These studies are the first of their kind that provide insight into targeting brain metastasis with stem-cell mediated delivery of pro-apoptotic ligands and have important clinical implications. PMID:25910782

  19. miR-206 Inhibits Stemness and Metastasis of Breast Cancer by Targeting MKL1/IL11 Pathway.

    PubMed

    Samaeekia, Ravand; Adorno-Cruz, Valery; Bockhorn, Jessica; Chang, Ya-Fang; Huang, Simo; Prat, Aleix; Ha, Nahun; Kibria, Golam; Huo, Dezheng; Zheng, Hui; Dalton, Rachel; Wang, Yuhao; Moskalenko, Grigoriy Y; Liu, Huiping

    2017-02-15

    Purpose: Effective targeting of cancer stem cells is necessary and important for eradicating cancer and reducing metastasis-related mortality. Understanding of cancer stemness-related signaling pathways at the molecular level will help control cancer and stop metastasis in the clinic. Experimental Design: By analyzing miRNA profiles and functions in cancer development, we aimed to identify regulators of breast tumor stemness and metastasis in human xenograft models in vivo and examined their effects on self-renewal and invasion of breast cancer cells in vitro To discover the direct targets and essential signaling pathways responsible for miRNA functions in breast cancer progression, we performed microarray analysis and target gene prediction in combination with functional studies on candidate genes (overexpression rescues and pheno-copying knockdowns). Results: In this study, we report that hsa-miR-206 suppresses breast tumor stemness and metastasis by inhibiting both self-renewal and invasion. We identified that among the candidate targets, twinfilin ( TWF1 ) rescues the miR-206 phenotype in invasion by enhancing the actin cytoskeleton dynamics and the activity of the mesenchymal lineage transcription factors, megakaryoblastic leukemia (translocation) 1 (MKL1), and serum response factor (SRF). MKL1 and SRF were further demonstrated to promote the expression of IL11 , which is essential for miR-206's function in inhibiting both invasion and stemness of breast cancer. Conclusions: The identification of the miR-206/TWF1/MKL1-SRF/IL11 signaling pathway sheds lights on the understanding of breast cancer initiation and progression, unveils new therapeutic targets, and facilitates innovative drug development to control cancer and block metastasis. Clin Cancer Res; 23(4); 1091-103. ©2016 AACR . ©2016 American Association for Cancer Research.

  20. The Role of Cancer Stem Cells in the Organ Tropism of Breast Cancer Metastasis: A Mechanistic Balance between the “Seed” and the “Soil”?

    PubMed Central

    Chu, Jenny E.; Allan, Alison L.

    2012-01-01

    Breast cancer is a prevalent disease worldwide, and the majority of deaths occur due to metastatic disease. Clinical studies have identified a specific pattern for the metastatic spread of breast cancer, termed organ tropism; where preferential secondary sites include lymph node, bone, brain, lung, and liver. A rare subpopulation of tumor cells, the cancer stem cells (CSCs), has been hypothesized to be responsible for metastatic disease and therapy resistance. Current treatments are highly ineffective against metastatic breast cancer, likely due to the innate therapy resistance of CSCs and the complex interactions that occur between cancer cells and their metastatic microenvironments. A better understanding of these interactions is essential for the development of novel therapeutic targets for metastatic disease. This paper summarizes the characteristics of breast CSCs and their potential metastatic microenvironments. Furthermore, it raises the question of the existence of a CSC niche and highlights areas for future investigation. PMID:22295241

  1. Differential MDR in Breast Cancer Stem Cells

    DTIC Science & Technology

    2006-05-01

    Source: Sanofi -Aventis Grant Title: CMDRP Era of Hope Scholar Award BC044784 Breast Cancer Stem Cells: A Novel Therapeutic Target Role in Project Co...E.M. and Whiteside, T.L. “Processing of Tumors for Vaccine and/or Tumor Infiltrating Lymphocytes”, p. 817-819 in Rose, N.R., Conway de Macario, E...Counterparts, Ernst Schering Res Foundation Workshop, In Press. [14] E.M. Elder, T.L. Whiteside, Processing of tumors for vaccine and/or tumor

  2. Hyaluronan Production Regulates Metabolic and Cancer Stem-like Properties of Breast Cancer Cells via Hexosamine Biosynthetic Pathway-coupled HIF-1 Signaling*

    PubMed Central

    Chanmee, Theerawut; Ontong, Pawared; Izumikawa, Tomomi; Higashide, Miho; Mochizuki, Nobutoshi; Chokchaitaweesuk, Chatchadawalai; Khansai, Manatsanan; Nakajima, Kazuki; Kakizaki, Ikuko; Kongtawelert, Prachya; Taniguchi, Naoyuki; Itano, Naoki

    2016-01-01

    Cancer stem cells (CSCs) represent a small subpopulation of self-renewing oncogenic cells. As in many other stem cells, metabolic reprogramming has been implicated to be a key characteristic of CSCs. However, little is known about how the metabolic features of cancer cells are controlled to orchestrate their CSC-like properties. We recently demonstrated that hyaluronan (HA) overproduction allowed plastic cancer cells to revert to stem cell states. Here, we adopted stable isotope-assisted tracing and mass spectrometry profiling to elucidate the metabolic features of HA-overproducing breast cancer cells. These integrated approaches disclosed an acceleration of metabolic flux in the hexosamine biosynthetic pathway (HBP). A metabolic shift toward glycolysis was also evident by quantitative targeted metabolomics, which was validated by the expression profiles of key glycolytic enzymes. Forced expression of glutamine:fructose-6-phosphate amidotransferase 1 (GFAT1), an HBP rate-limiting enzyme, resembled the results of HA overproduction with regard to HIF-1α accumulation and glycolytic program, whereas GFAT1 inhibition significantly decreased HIF-1α protein level in HA-overproducing cancer cells. Moreover, inhibition of the HBP-HIF-1 axis abrogated HA-driven glycolytic enhancement and reduced the CSC-like subpopulation. Taken together, our results provide compelling evidence that HA production regulates the metabolic and CSC-like properties of breast cancer cells via HBP-coupled HIF-1 signaling. PMID:27758869

  3. Use of a Novel Embryonic Mammary Stem Cell Gene Signature to Improve Human Breast Cancer Diagnostics and Therapeutic Decision Making

    DTIC Science & Technology

    2015-12-01

    Our major goals are to determine whether Fetal Mammary Stem Cell (fMaSC) signatures correlate with response to chemotherapy and metastasis in...these aims will enable us to: 1) better categorize distinct cell types within the fMaSC population, 2) identify biomarkers for prospective stem cell purification...and in situ localization, and 3) identify candidate stem cell regulatory pathways that should reveal therapeutic targets and improved

  4. Use of a Novel Embryonic Mammary Stem Cell Gene Signature to Improve Human Breast Cancer Diagnostics and Therapeutic Decision Making

    DTIC Science & Technology

    2014-10-01

    Our major goals are to determine whether Fetal Mammary Stem Cell (fMaSC) signatures correlate with response to chemotherapy and metastasis in...these aims will enable us to: 1) better categorize distinct cell types within the fMaSC population, 2) identify biomarkers for prospective stem cell purification...and in situ localization, and 3) identify candidate stem cell regulatory pathways that should reveal therapeutic targets and improved

  5. Implications of cancer stem cell theory for cancer chemoprevention by natural dietary compounds.

    PubMed

    Li, Yanyan; Wicha, Max S; Schwartz, Steven J; Sun, Duxin

    2011-09-01

    The emergence of cancer stem cell theory has profound implications for cancer chemoprevention and therapy. Cancer stem cells give rise to the tumor bulk through continuous self-renewal and differentiation. Understanding the mechanisms that regulate self-renewal is of greatest importance for discovery of anticancer drugs targeting cancer stem cells. Naturally occurring dietary compounds have received increasing attention in cancer chemoprevention. The anticancer effects of many dietary components have been reported for both in vitro and in vivo studies. Recently, a number of studies have found that several dietary compounds can directly or indirectly affect cancer stem cell self-renewal pathways. Herein we review the current knowledge of most common natural dietary compounds for their impact on self-renewal pathways and potential effect against cancer stem cells. Three pathways (Wnt/β-catenin, Hedgehog and Notch) are summarized for their functions in self-renewal of cancer stem cells. The dietary compounds, including curcumin, sulforaphane, soy isoflavone, epigallocatechin-3-gallate, resveratrol, lycopene, piperine and vitamin D(3), are discussed for their direct or indirect effect on these self-renewal pathways. Curcumin and piperine have been demonstrated to target breast cancer stem cells. Sulforaphane has been reported to inhibit pancreatic tumor-initiating cells and breast cancer stem cells. These studies provide a basis for preclinical and clinical evaluation of dietary compounds for chemoprevention of cancer stem cells. This may enable us to discover more preventive strategies for cancer management by reducing cancer resistance and recurrence and improving patient survival. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. TAZ is required for metastatic activity and chemoresistance of breast cancer stem cells.

    PubMed

    Bartucci, M; Dattilo, R; Moriconi, C; Pagliuca, A; Mottolese, M; Federici, G; Benedetto, A Di; Todaro, M; Stassi, G; Sperati, F; Amabile, M I; Pilozzi, E; Patrizii, M; Biffoni, M; Maugeri-Saccà, M; Piccolo, S; De Maria, R

    2015-02-05

    Metastatic growth in breast cancer (BC) has been proposed as an exclusive property of cancer stem cells (CSCs). However, formal proof of their identity as cells of origin of recurrences at distant sites and the molecular events that may contribute to tumor cell dissemination and metastasis development are yet to be elucidated. In this study, we analyzed a set of patient-derived breast cancer stem cell (BCSC) lines. We found that in vitro BCSCs exhibit a higher chemoresistance and migratory potential when compared with differentiated, nontumorigenic, breast cancer cells (dBCCs). By developing an in vivo metastatic model simulating the disease of patients with early BC, we observed that BCSCs is the only cell population endowed with metastatic potential. Gene-expression profile studies comparing metastagenic and non-metastagenic cells identified TAZ, a transducer of the Hippo pathway and biomechanical cues, as a central mediator of BCSCs metastatic ability involved in their chemoresistance and tumorigenic potential. Overexpression of TAZ in low-expressing dBCCs induced cell transformation and conferred tumorigenicity and migratory activity. Conversely, loss of TAZ in BCSCs severely impaired metastatic colonization and chemoresistance. In clinical data from 99 BC patients, high expression levels of TAZ were associated with shorter disease-free survival in multivariate analysis, thus indicating that TAZ may represent a novel independent negative prognostic factor. Overall, this study designates TAZ as a novel biomarker and a possible therapeutic target for BC.

  7. Studying Cancer Stem Cell Dynamics on PDMS Surfaces for Microfluidics Device Design

    PubMed Central

    Zhang, Weijia; Choi, Dong Soon; Nguyen, Yen H.; Chang, Jenny; Qin, Lidong

    2013-01-01

    This systematic study clarified a few interfacial aspects of cancer cell phenotypes on polydimethylsiloxane (PDMS) substrates and indicated that the cell phenotypic equilibrium greatly responds to cell-to-surface interactions. We demonstrated that coatings of fibronectin, bovine serum albumin (BSA), or collagen with or without oxygen-plasma treatments of the PDMS surfaces dramatically impacted the phenotypic equilibrium of breast cancer stem cells, while the variations of the PDMS elastic stiffness had much less such effects. Our results showed that the surface coatings of collagen and fibronectin on PDMS maintained breast cancer cell phenotypes to be nearly identical to the cultures on commercial polystyrene Petri dishes. The surface coating of BSA provided a weak cell-substrate adhesion that stimulated the increase in stem-cell-like subpopulation. Our observations may potentially guide surface modification approaches to obtain specific cell phenotypes. PMID:23900274

  8. Integrated Immunotherapy for Breast Cancer

    DTIC Science & Technology

    2015-09-01

    patterns in these reconstructed co-cultured cancer cell /stromal cell 3D organoids (Figure 2). The role of mesenchymal stem cells in cancer Bone...marrow-derived mesenchymal stem cells (MSC) have been the subject of interest in solid tumor. Because of their ability to migrate to sites of inflammation...10 Figure 3. Characterization of ex-vivo expanded C57 B6 derived bone marrow mesenchymal stem cells . The cells are positive for CD44, CD140β

  9. Anti-protozoal and anti-bacterial antibiotics that inhibit protein synthesis kill cancer subtypes enriched for stem cell-like properties.

    PubMed

    Cuyàs, Elisabet; Martin-Castillo, Begoña; Corominas-Faja, Bruna; Massaguer, Anna; Bosch-Barrera, Joaquim; Menendez, Javier A

    2015-01-01

    Key players in translational regulation such as ribosomes might represent powerful, but hitherto largely unexplored, targets to eliminate drug-refractory cancer stem cells (CSCs). A recent study by the Lisanti group has documented how puromycin, an old antibiotic derived from Streptomyces alboniger that inhibits ribosomal protein translation, can efficiently suppress CSC states in tumorspheres and monolayer cultures. We have used a closely related approach based on Biolog Phenotype Microarrays (PM), which contain tens of lyophilized antimicrobial drugs, to assess the chemosensitivity profiles of breast cancer cell lines enriched for stem cell-like properties. Antibiotics directly targeting active sites of the ribosome including emetine, puromycin and cycloheximide, inhibitors of ribosome biogenesis such as dactinomycin, ribotoxic stress agents such as daunorubicin, and indirect inhibitors of protein synthesis such as acriflavine, had the largest cytotoxic impact against claudin-low and basal-like breast cancer cells. Thus, biologically aggressive, treatment-resistant breast cancer subtypes enriched for stem cell-like properties exhibit exacerbated chemosensitivities to anti-protozoal and anti-bacterial antibiotics targeting protein synthesis. These results suggest that old/existing microbicides might be repurposed not only as new cancer therapeutics, but also might provide the tools and molecular understanding needed to develop second-generation inhibitors of ribosomal translation to eradicate CSC traits in tumor tissues.

  10. Anti-protozoal and anti-bacterial antibiotics that inhibit protein synthesis kill cancer subtypes enriched for stem cell-like properties

    PubMed Central

    Cuyàs, Elisabet; Martin-Castillo, Begoña; Corominas-Faja, Bruna; Massaguer, Anna; Bosch-Barrera, Joaquim; Menendez, Javier A

    2015-01-01

    Key players in translational regulation such as ribosomes might represent powerful, but hitherto largely unexplored, targets to eliminate drug-refractory cancer stem cells (CSCs). A recent study by the Lisanti group has documented how puromycin, an old antibiotic derived from Streptomyces alboniger that inhibits ribosomal protein translation, can efficiently suppress CSC states in tumorspheres and monolayer cultures. We have used a closely related approach based on Biolog Phenotype Microarrays (PM), which contain tens of lyophilized antimicrobial drugs, to assess the chemosensitivity profiles of breast cancer cell lines enriched for stem cell-like properties. Antibiotics directly targeting active sites of the ribosome including emetine, puromycin and cycloheximide, inhibitors of ribosome biogenesis such as dactinomycin, ribotoxic stress agents such as daunorubicin, and indirect inhibitors of protein synthesis such as acriflavine, had the largest cytotoxic impact against claudin-low and basal-like breast cancer cells. Thus, biologically aggressive, treatment-resistant breast cancer subtypes enriched for stem cell-like properties exhibit exacerbated chemosensitivities to anti-protozoal and anti-bacterial antibiotics targeting protein synthesis. These results suggest that old/existing microbicides might be repurposed not only as new cancer therapeutics, but also might provide the tools and molecular understanding needed to develop second-generation inhibitors of ribosomal translation to eradicate CSC traits in tumor tissues. PMID:25970790

  11. Notch-1-PTEN-ERK1/2 signaling axis promotes HER2+ breast cancer cell proliferation and stem cell survival.

    PubMed

    Baker, Andrew; Wyatt, Debra; Bocchetta, Maurizio; Li, Jun; Filipovic, Aleksandra; Green, Andrew; Peiffer, Daniel S; Fuqua, Suzanne; Miele, Lucio; Albain, Kathy S; Osipo, Clodia

    2018-05-10

    Trastuzumab targets the HER2 receptor on breast cancer cells to attenuate HER2-driven tumor growth. However, resistance to trastuzumab-based therapy remains a major clinical problem for women with HER2+ breast cancer. Breast cancer stem cells (BCSCs) are suggested to be responsible for drug resistance and tumor recurrence. Notch signaling has been shown to promote BCSC survival and self-renewal. Trastuzumab-resistant cells have increased Notch-1 expression. Notch signaling drives cell proliferation in vitro and is required for tumor recurrence in vivo. We demonstrate herein a mechanism by which Notch-1 is required for trastuzumab resistance by repressing PTEN expression to contribute to activation of ERK1/2 signaling. Furthermore, Notch-1-mediated inhibition of PTEN is necessary for BCSC survival in vitro and in vivo. Inhibition of MEK1/2-ERK1/2 signaling in trastuzumab-resistant breast cancer cells mimics effects of Notch-1 knockdown on bulk cell proliferation and BCSC survival. These findings suggest that Notch-1 contributes to trastuzumab resistance by repressing PTEN and this may lead to hyperactivation of ERK1/2 signaling. Furthermore, high Notch-1 and low PTEN mRNA expression may predict poorer overall survival in women with breast cancer. Notch-1 protein expression predicts poorer survival in women with HER2+ breast cancer. These results support a potential future clinical trial combining anti-Notch-1 and anti-MEK/ERK therapy for trastuzumab-resistant breast cancer.

  12. Distinct Effects of Adipose-Derived Stem Cells and Adipocytes on Normal and Cancer Cell Hierarchy.

    PubMed

    Anjanappa, Manjushree; Burnett, Riesa; Zieger, Michael A; Merfeld-Clauss, Stephanie; Wooden, William; March, Keith; Tholpady, Sunil; Nakshatri, Harikrishna

    2016-07-01

    Adipose-derived stem cells (ASC) have received considerable attention in oncology because of the known direct link between obesity and cancer as well as the use of ASCs in reconstructive surgery after tumor ablation. Previous studies have documented how cancer cells commandeer ASCs to support their survival by altering extracellular matrix composition and stiffness, migration, and metastasis. This study focused on delineating the effects of ASCs and adipocytes on the self-renewal of stem/progenitor cells and hierarchy of breast epithelial cells. The immortalized breast epithelial cell line MCF10A, ductal carcinoma in situ (DCIS) cell lines MCF10DCIS.com and SUM225, and MCF10A-overexpressing SRC oncogene were examined using a mammosphere assay and flow cytometry for the effects of ASCs on their self-renewal and stem-luminal progenitor-differentiated cell surface marker profiles. Interestingly, ASCs promoted the self-renewal of all cell types except SUM225. ASC coculture or treatment with ASC conditioned media altered the number of CD49f(high)/EpCAM(low) basal/stem-like and CD49f(medium)/EpCAM(medium) luminal progenitor cells. Among multiple factors secreted by ASCs, IFNγ and hepatocyte growth factor (HGF) displayed unique actions on epithelial cell hierarchy. IFNγ increased stem/progenitor-like cells while simultaneously reducing the size of mammospheres, whereas HGF increased the size of mammospheres with an accompanying increase in luminal progenitor cells. ASCs expressed higher levels of HGF, whereas adipocytes expressed higher levels of IFNγ. As luminal progenitor cells are believed to be prone for transformation, IFNγ and HGF expression status of ASCs may influence susceptibility for developing breast cancer as well as on outcomes of autologous fat transplantation on residual/dormant tumor cells. This study suggests that the ratio of ASCs to adipocytes influences cancer cell hierarchy, which may impact incidence and progression. Mol Cancer Res; 14(7); 660-71. ©2016 AACR. ©2016 American Association for Cancer Research.

  13. Cinnamides as selective small-molecule inhibitors of a cellular model of breast cancer stem cells.

    PubMed

    Germain, Andrew R; Carmody, Leigh C; Nag, Partha P; Morgan, Barbara; Verplank, Lynn; Fernandez, Cristina; Donckele, Etienne; Feng, Yuxiong; Perez, Jose R; Dandapani, Sivaraman; Palmer, Michelle; Lander, Eric S; Gupta, Piyush B; Schreiber, Stuart L; Munoz, Benito

    2013-03-15

    A high-throughput screen (HTS) was conducted against stably propagated cancer stem cell (CSC)-enriched populations using a library of 300,718 compounds from the National Institutes of Health (NIH) Molecular Libraries Small Molecule Repository (MLSMR). A cinnamide analog displayed greater than 20-fold selective inhibition of the breast CSC-like cell line (HMLE_sh_Ecad) over the isogenic control cell line (HMLE_sh_eGFP). Herein, we report structure-activity relationships of this class of cinnamides for selective lethality towards CSC-enriched populations. Copyright © 2013. Published by Elsevier Ltd.

  14. Rewriting the Histone Code of Breast Cancer Stem Cells

    DTIC Science & Technology

    2012-05-01

    possibly as natural mechanism of stem cells to protect the integrity of their long-life genomes (6-7). Because of their ability to initiate a tumor...tumor growth in xenograft mouse models. Furthermore, we fused ZF DNA-binding domains to the DNA- methyltransferase DNMT3a and engeneered catalytic...R, Liang J, Yu W, Sun L, Yang X, Wang Y, Zhang Y, Shang Y. The molecular mechanism governing the oncogenic potential of SOX2 in breast cancer. J

  15. Translational Significance of p53 Loss of Heterozygosity in Breast Cancer

    DTIC Science & Technology

    2017-09-01

    LOH), radiation , chemotherapy, Her2 positive breast cancer. 3. ACCOMPLISHMENTS: The major goals of the project. Major Task 1. Determine the...Intestinal Stem Cell-Derived Lineage Following  Radiation -Induced Gut Injury in Mice. Stem Cell Reorts. 6(6):815-24. 5. Snider AJ, Bialkowska AB, Ghaleb...and Amr M. Ghaleb. 2015. Krüppel-like factor 4 is a radioprotective factor for the intestine following γ- radiation - induced gut injury in mice. Am. J

  16. Spatially correlated phenotyping reveals K5-positive luminal progenitor cells and p63-K5/14-positive stem cell-like cells in human breast epithelium.

    PubMed

    Boecker, Werner; van Horn, Laura; Stenman, Göran; Stürken, Christine; Schumacher, Udo; Loening, Thomas; Liesenfeld, Lukas; Korsching, Eberhard; Gläser, Doreen; Tiemann, Katharina; Buchwalow, Igor

    2018-05-09

    Understanding the mechanisms regulating human mammary epithelium requires knowledge of the cellular constituents of this tissue. Different and partially contradictory definitions and concepts describing the cellular hierarchy of mammary epithelium have been proposed, including our studies of keratins K5 and/or K14 as markers of progenitor cells. Furthermore, we and others have suggested that the p53 homolog p63 is a marker of human breast epithelial stem cells. In this investigation, we expand our previous studies by testing whether immunohistochemical staining with monospecific anti-keratin antibodies in combination with an antibody against the stem cell marker p63 might help refine the different morphologic phenotypes in normal breast epithelium. We used in situ multilabel staining for p63, different keratins, the myoepithelial marker smooth muscle actin (SMA), the estrogen receptor (ER), and Ki67 to dissect and quantify the cellular components of 16 normal pre- and postmenopausal human breast epithelial tissue samples at the single-cell level. Importantly, we confirm the existence of K5+ only cells and suggest that they, in contrast to the current view, are key luminal precursor cells from which K8/18+ progeny cells evolve. These cells are further modified by the expression of ER and Ki67. We have also identified a population of p63+K5+ cells that are only found in nipple ducts. Based on our findings, we propose a new concept of the cellular hierarchy of human breast epithelium, including K5 luminal lineage progenitors throughout the ductal-lobular axis and p63+K5+ progenitors confined to the nipple ducts.

  17. Mutations in the estrogen receptor alpha hormone binding domain promote stem cell phenotype through notch activation in breast cancer cell lines.

    PubMed

    Gelsomino, L; Panza, S; Giordano, C; Barone, I; Gu, G; Spina, E; Catalano, S; Fuqua, S; Andò, S

    2018-04-24

    The detection of recurrent mutations affecting the hormone binding domain (HBD) of estrogen receptor alpha (ERα/ESR1) in endocrine therapy-resistant and metastatic breast cancers has prompted interest in functional characterization of these genetic alterations. Here, we explored the role of HBD-ESR1 mutations in influencing the behavior of breast cancer stem cells (BCSCs), using various BC cell lines stably expressing wild-type or mutant (Y537 N, Y537S, D538G) ERα. Compared to WT-ERα clones, mutant cells showed increased CD44 + /CD24 - ratio, mRNA levels of stemness genes, Mammosphere Forming Efficiency (MFE), Self-Renewal and migratory capabilities. Mutant clones exhibited high expression of NOTCH receptors/ligands/target genes and blockade of NOTCH signaling reduced MFE and migratory potential. Mutant BCSC activity was dependent on ERα phosphorylation at serine 118, since its inhibition decreased MFE and NOTCH4 activation only in mutant cells. Collectively, we demonstrate that the expression of HBD-ESR1 mutations may drive BC cells to acquire stem cell traits through ER/NOTCH4 interplay. We propose the early detection of HBD-ESR1 mutations as a challenge in precision medicine strategy, suggesting the development of tailored-approaches (i.e. NOTCH inhibitors) to prevent disease development and metastatic spread in BC mutant-positive patients. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Breast cancer stem cells in HER2-negative breast cancer cells contribute to HER2-mediated radioresistance and molecular subtype conversion: clinical implications for serum HER2 in recurrent HER2-negative breast cancer.

    PubMed

    Kim, Yun Gyoung; Yoon, Yi Na; Choi, Hyang Suk; Kim, Ji-Hyun; Seol, Hyesil; Lee, Jin Kyung; Seong, Min-Ki; Park, In Chul; Kim, Kwang Il; Kim, Hyun-Ah; Kim, Jae-Sung; Noh, Woo Chul

    2018-01-19

    Although it has been proposed that the beneficial effect of HER2-targeted therapy in HER2-negative breast cancer is associated with the molecular subtype conversion, the underlying mechanism and the clinical biomarkers are unclear. Our study showed that breast cancer stem cells (BCSCs) mediated HER2 subtype conversion and radioresistance in HER2-negative breast cancer cells and evaluated serum HER2 as a clinical biomarker for HER2 subtype conversion. We found that the CD44 + /CD24 -/low BCSCs from HER2-negative breast cancer MCF7 cells overexpressed HER2 and EGFR and showed the radioresistant phenotype. In addition, we showed that trastuzumab treatment sensitized the radioresistant phenotype of the CD44 + /CD24 -/low cells with decreased levels of HER2 and EGFR, which suggested that HER2-targeted therapy in HER2-negative breast cancer could be useful for targeting BCSCs that overexpress HER2/EGFR. Importantly, our clinical data showed that serial serum HER2 measurement synchronously reflected the disease relapse and the change in tumor burden in some patients who were initially diagnosed as HER2-negative breast cancer, which indicated that serum HER2 could be a clinical biomarker for the evaluation of HER2 subtype conversion in patients with recurrent HER2-negative breast cancer. Therefore, our data have provided in vitro and in vivo evidence for the molecular subtype conversion of HER2-negative breast cancer.

  19. Enhancing the Breadth and Efficacy of Therapeutic Vaccines for Breast Cancer

    DTIC Science & Technology

    2015-10-01

    including antigens preferentially expressed by breast cancer stem cells. We will identify both MHC-I- and MHC-II- restricted antigens driving both CD8...even two of them were exclusively targeted by T cells in chronic lymphocytic leukemia ( CLL ) patients (3). This analysis demonstrated both that...lymphocytic leukemia ( CLL ) 7 positive CLLs (23%) 3 Table 1. Immunogenic peptides that have been eluted from the cell surface of breast carcinoma cells

  20. Molecular Determinants and Clinical Implications of Breast Cancer Dormancy

    DTIC Science & Technology

    2014-12-01

    repair mediates resistance of hair follicle bulge stem cells to DNA-damage- induced cell death. Nat Cell Biol 2010; 12: 572–582. 7. Chiruvella KK1...on the role of cellular dormancy in promoting cancer aggressiveness and drug resistance in recurred breast cancer. We aimed to determine the impact...period, we have successfully established a reliable in vitro breast cancer dormancy cell model. Using this model, we tested and confirmed the

  1. Do myoepithelial cells hold the key for breast tumorprogression?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Polyak, Kornelia; Hu, Min

    2005-11-18

    Mammary myoepithelial cells have been the foster child of breast cancer biology and have been largely ignored since they were considered to be less important for tumorigenesis than luminal epithelial cells from which most of breast carcinomas are thought to arise. In recent years as our knowledge in stem cell biology and the cellular microenvironment has been increasing myoepithelial cells are slowly starting to gain more attention. Emerging data raise the hypothesis if myoepithelial cells play a key role in breast tumor progression by regulating the in situ to invasive carcinoma transition and if myoepithelial cells are part of themore » mammary stem cell niche. Paracrine interactions between myoepithelial and luminal epithelial cells are known to be important for cell cycle arrest, establishing epithelial cell polarity, and inhibiting migration and invasion. Based on these functions normal mammary myoepithelial cells have been called ''natural tumor suppressors''. However, during tumor progression myoepithelial cells seem to loose these properties and eventually they themselves diminish as tumors become invasive. Better understanding of myoepithelial cell function and their role in tumor progression may lead to their exploitation for cancer therapeutic and preventative measures.« less

  2. A Partnership Training Program: Studying Targeted Drug Delivery Using Nanoparticles in Breast Cancer Diagnosis and Therapy

    DTIC Science & Technology

    2013-10-01

    labeling and tracking of mesenchymal stem cells (MSCs). MSCs are a heterogeneous group of pluripotent stromal cells that can be isolated from... mesenchymal stem cell labelling by using polyhedral superparamagnetic iron oxide nanoparticles. Chemistry 2009;15:12417-25. Wang and Shan. MRI cell ...and Differentiation of Mesenchymal Stem Cells by Carboxylated Carbon Nanotubes. ACS Nano 2010, 4, 2185–2195. 15. Bertoncini, P.; Chauvet, O

  3. Gene expression profiles of breast biopsies from healthy women identify a group with claudin-low features

    PubMed Central

    2011-01-01

    Background Increased understanding of the variability in normal breast biology will enable us to identify mechanisms of breast cancer initiation and the origin of different subtypes, and to better predict breast cancer risk. Methods Gene expression patterns in breast biopsies from 79 healthy women referred to breast diagnostic centers in Norway were explored by unsupervised hierarchical clustering and supervised analyses, such as gene set enrichment analysis and gene ontology analysis and comparison with previously published genelists and independent datasets. Results Unsupervised hierarchical clustering identified two separate clusters of normal breast tissue based on gene-expression profiling, regardless of clustering algorithm and gene filtering used. Comparison of the expression profile of the two clusters with several published gene lists describing breast cells revealed that the samples in cluster 1 share characteristics with stromal cells and stem cells, and to a certain degree with mesenchymal cells and myoepithelial cells. The samples in cluster 1 also share many features with the newly identified claudin-low breast cancer intrinsic subtype, which also shows characteristics of stromal and stem cells. More women belonging to cluster 1 have a family history of breast cancer and there is a slight overrepresentation of nulliparous women in cluster 1. Similar findings were seen in a separate dataset consisting of histologically normal tissue from both breasts harboring breast cancer and from mammoplasty reductions. Conclusion This is the first study to explore the variability of gene expression patterns in whole biopsies from normal breasts and identified distinct subtypes of normal breast tissue. Further studies are needed to determine the specific cell contribution to the variation in the biology of normal breasts, how the clusters identified relate to breast cancer risk and their possible link to the origin of the different molecular subtypes of breast cancer. PMID:22044755

  4. Repression of mammosphere formation in breast cancer cells by soy isoflavone genistein and blueberry polyphenols

    USDA-ARS?s Scientific Manuscript database

    Epidemiological evidence implicates diets rich in fruits and vegetables in breast cancer prevention due to their phytochemical components, yet mechanisms for their anti-tumor activities are not well-understood. A small population of mammary epithelial cells, termed cancer stem cells (CSC), may be re...

  5. Dual-targeting Wnt and uPA receptors using peptide conjugated ultra-small nanoparticle drug carriers inhibited cancer stem-cell phenotype in chemo-resistant breast cancer.

    PubMed

    Miller-Kleinhenz, Jasmine; Guo, Xiangxue; Qian, Weiping; Zhou, Hongyu; Bozeman, Erica N; Zhu, Lei; Ji, Xin; Wang, Y Andrew; Styblo, Toncred; O'Regan, Ruth; Mao, Hui; Yang, Lily

    2018-01-01

    Heterogeneous tumor cells, high incidence of tumor recurrence, and decrease in overall survival are the major challenges for the treatment of chemo-resistant breast cancer. Results of our study showed differential chemotherapeutic responses among breast cancer patient derived xenograft (PDX) tumors established from the same patients. All doxorubicin (Dox)-resistant tumors expressed higher levels of cancer stem-like cell biomarkers, including CD44, Wnt and its receptor LRP5/6, relative to Dox-sensitive tumors. To effectively treat resistant tumors, we developed an ultra-small magnetic iron oxide nanoparticle (IONP) drug carrier conjugated with peptides that are dually targeted to Wnt/LRP5/6 and urokinase plasminogen activator receptor (uPAR). Our results showed that simultaneous binding to LRP5/6 and uPAR by the dual receptor targeted IONPs was required to inhibit breast cancer cell invasion. Molecular analysis revealed that the dual receptor targeted IONPs significantly inhibited Wnt/β-catenin signaling and cancer stem-like phenotype of tumor cells, with marked reduction of Wnt ligand, CD44 and uPAR. Systemic administration of the dual targeted IONPs led to nanoparticle-drug delivery into PDX tumors, resulting in stronger tumor growth inhibition compared to non-targeted or single-targeted IONP-Dox in a human breast cancer PDX model. Therefore, co-targeting Wnt/LRP and uPAR using IONP drug carriers is a promising therapeutic approach for effective drug delivery to chemo-resistant breast cancer. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Addiction to the IGF2-ID1-IGF2 circuit for maintenance of the breast cancer stem-like cells

    PubMed Central

    Tominaga, K; Shimamura, T; Kimura, N; Murayama, T; Matsubara, D; Kanauchi, H; Niida, A; Shimizu, S; Nishioka, K; Tsuji, E-i; Yano, M; Sugano, S; Shimono, Y; Ishii, H; Saya, H; Mori, M; Akashi, K; Tada, K-i; Ogawa, T; Tojo, A; Miyano, S; Gotoh, N

    2017-01-01

    The transcription factor nuclear factor-κB (NF-κB) has important roles for tumorigenesis, but how it regulates cancer stem cells (CSCs) remains largely unclear. We identified insulin-like growth factor 2 (IGF2) is a key target of NF-κB activated by HER2/HER3 signaling to form tumor spheres in breast cancer cells. The IGF2 receptor, IGF1 R, was expressed at high levels in CSC-enriched populations in primary breast cancer cells. Moreover, IGF2-PI3K (IGF2-phosphatidyl inositol 3 kinase) signaling induced expression of a stemness transcription factor, inhibitor of DNA-binding 1 (ID1), and IGF2 itself. ID1 knockdown greatly reduced IGF2 expression, and tumor sphere formation. Finally, treatment with anti-IGF1/2 antibodies blocked tumorigenesis derived from the IGF1Rhigh CSC-enriched population in a patient-derived xenograft model. Thus, NF-κB may trigger IGF2-ID1-IGF2-positive feedback circuits that allow cancer stem-like cells to appear. Then, they may become addicted to the circuits. As the circuits are the Achilles' heels of CSCs, it will be critical to break them for eradication of CSCs. PMID:27546618

  7. In Vitro Analysis of Breast Cancer Cell Line Tumourspheres and Primary Human Breast Epithelia Mammospheres Demonstrates Inter- and Intrasphere Heterogeneity

    PubMed Central

    Vargas, Ana Cristina; Keith, Patricia; Reid, Lynne; Wockner, Leesa; Amiri, Marjan Askarian; Sarkar, Debina; Simpson, Peter T.; Clarke, Catherine; Schmidt, Chris W.; Reynolds, Brent A.

    2013-01-01

    Mammosphere and breast tumoursphere culture have gained popularity as in vitro assays for propagating and analysing normal and cancer stem cells. Whether the spheres derived from different sources or parent cultures themselves are indeed single entities enriched in stem/progenitor cells compared to other culture formats has not been fully determined. We surveyed sphere-forming capacity across 26 breast cell lines, immunophenotyped spheres from six luminal- and basal-like lines by immunohistochemistry and flow cytometry and compared clonogenicity between sphere, adherent and matrigel culture formats using in vitro functional assays. Analyses revealed morphological and molecular intra- and inter-sphere heterogeneity, consistent with adherent parental cell line phenotypes. Flow cytometry showed sphere culture does not universally enrich for markers previously associated with stem cell phenotypes, although we found some cell-line specific changes between sphere and adherent formats. Sphere-forming efficiency was significantly lower than adherent or matrigel clonogenicity and constant over serial passage. Surprisingly, self-renewal capacity of sphere-derived cells was similar/lower than other culture formats. We observed significant correlation between long-term-proliferating-cell symmetric division rates in sphere and adherent cultures, suggesting functional overlap between the compartments sustaining them. Experiments with normal primary human mammary epithelia, including sorted luminal (MUC1+) and basal/myoepithelial (CD10+) cells revealed distinct luminal-like, basal-like and mesenchymal entities amongst primary mammospheres. Morphological and colony-forming-cell assay data suggested mammosphere culture may enrich for a luminal progenitor phenotype, or induce reversion/relaxation of the basal/mesenchymal in vitro selection occurring with adherent culture. Overall, cell line tumourspheres and primary mammospheres are not homogenous entities enriched for stem cells, suggesting a more cautious approach to interpreting data from these assays and careful consideration of its limitations. Sphere culture may represent an alternative 3-dimensional culture system which rather than universally ‘enriching’ for stem cells, has utility as one of a suite of functional assays that provide a read-out of progenitor activity. PMID:23750209

  8. DNMT1 is essential for mammary and cancer stem cell maintenance and tumorigenesis.

    PubMed

    Pathania, Rajneesh; Ramachandran, Sabarish; Elangovan, Selvakumar; Padia, Ravi; Yang, Pengyi; Cinghu, Senthilkumar; Veeranan-Karmegam, Rajalakshmi; Arjunan, Pachiappan; Gnana-Prakasam, Jaya P; Sadanand, Fulzele; Pei, Lirong; Chang, Chang-Sheng; Choi, Jeong-Hyeon; Shi, Huidong; Manicassamy, Santhakumar; Prasad, Puttur D; Sharma, Suash; Ganapathy, Vadivel; Jothi, Raja; Thangaraju, Muthusamy

    2015-04-24

    Mammary stem/progenitor cells (MaSCs) maintain self-renewal of the mammary epithelium during puberty and pregnancy. DNA methylation provides a potential epigenetic mechanism for maintaining cellular memory during self-renewal. Although DNA methyltransferases (DNMTs) are dispensable for embryonic stem cell maintenance, their role in maintaining MaSCs and cancer stem cells (CSCs) in constantly replenishing mammary epithelium is unclear. Here we show that DNMT1 is indispensable for MaSC maintenance. Furthermore, we find that DNMT1 expression is elevated in mammary tumours, and mammary gland-specific DNMT1 deletion protects mice from mammary tumorigenesis by limiting the CSC pool. Through genome-scale methylation studies, we identify ISL1 as a direct DNMT1 target, hypermethylated and downregulated in mammary tumours and CSCs. DNMT inhibition or ISL1 expression in breast cancer cells limits CSC population. Altogether, our studies uncover an essential role for DNMT1 in MaSC and CSC maintenance and identify DNMT1-ISL1 axis as a potential therapeutic target for breast cancer treatment.

  9. Reproductive history and breast cancer prevention.

    PubMed

    Russo, Jose

    2016-07-01

    The hormonal milieu of an early full-term pregnancy induces lobular development, completing the cycle of differentiation of the breast. This process induces a specific genomic signature in the mammary gland that is represented by the stem cell containing a heterochomatin condensed nucleus (HTN). Even though differentiation significantly reduces cell proliferation in the mammary gland, the mammary epithelium remains capable of responding with proliferation to given stimuli, such as a new pregnancy. The stem cell HTN is able to metabolize the carcinogen and repair the induced DNA damage more efficiently than the stem cell containing an euchromatinic structure (EUN), as it has been demonstrated in the rodent experimental system. The basic biological concept is that pregnancy shifts the stem cell EUN to the stem cell HTN that is refractory to carcinogenesis. Data generated by the use of cDNA micro array techniques have allowed to demonstrate that while lobular development regressed after pregnancy and lactation, programmed cell death genes, DNA repair genes, chromatin remodeling, transcription factors and immune-surveillance gene transcripts all of these genes are upregulated and are part of the genomic signature of pregnancy that is associated with the preventive effect of this physiological process.

  10. Oct4 suppresses IR‑induced premature senescence in breast cancer cells through STAT3- and NF‑κB-mediated IL‑24 production.

    PubMed

    Kim, Jeong-Yub; Kim, Jeong-Chul; Lee, Ji-Yun; Park, Myung-Jin

    2018-07-01

    Breast cancer stem cells (BCSCs) are a small subpopulation of breast cancer cells that have been proposed to be a primary cause of failure of therapies, including ionizing radiation (IR). Their embryonic stem-like signature is associated with poor clinical outcome. In the present study, the function of octamer-binding transcription factor 4 (Oct4), an embryonic stem cell factor, in the resistance of BCSCs to IR was investigated. Mammosphere cells exhibited increased expression of stemness-associated genes, including Oct4 and sex‑determining region Y‑box 2 (Sox2), and were more resistant to IR compared with serum-cultured monolayer cells. IR‑resistant MCF7 cells also exhibited significantly increased expression of Oct4. To investigate the possible involvement of Oct4 in IR resistance of breast cancer cells, cells were transfected with Oct4. Ectopic expression of Oct4 increased the clonogenic survival of MCF7 cells following IR, which was reversed by treatment with small interfering RNA (siRNA) targeting Oct4. Oct4 expression decreased phosphorylated histone H2AX (γ-H2AX) focus formation and suppressed IR‑induced premature senescence in these cells. Mammosphere, IR‑resistant and Oct4‑overexpressing MCF7 cells exhibited enhanced phosphorylation of signal transducer and activation of transcription 3 (STAT3) (Tyr705) and inhibitor of nuclear factor κB (NF‑κB), and blockade of these pathways with siRNA against STAT3 and/or specific inhibitors of STAT3 and NF‑κB significantly increased IR‑induced senescence. Secretome analysis revealed that Oct4 upregulated interleukin 24 (IL‑24) expression through STAT3 and NF‑κB signaling, and siRNA against IL‑24 increased IR‑induced senescence, whereas recombinant human IL‑24 suppressed it. The results of the present study indicated that Oct4 confers IR resistance on breast cancer cells by suppressing IR‑induced premature senescence through STAT3- and NF‑κB-mediated IL‑24 production.

  11. Anti-miR-203 suppresses ER-positive breast cancer growth and stemness by targeting SOCS3.

    PubMed

    Muhammad, Naoshad; Bhattacharya, Sourav; Steele, Robert; Ray, Ratna B

    2016-09-06

    Breast cancer is a major public health problem worldwide in women and existing treatments are not adequately effective for this deadly disease. microRNAs (miRNAs) regulate the expression of many target genes and play pivotal roles in the development, as well as in the suppression of many cancers including breast cancer. We previously observed that miR-203 was highly upregulated in breast cancer tissues and in ER-positive breast cancer cell lines. In our present study, we observed that anti-miR-203 suppresses breast cancer cell proliferation in vitro. Orthotopic implantation of miR-203 depleted MCF-7 cells into nude mice displays smaller tumor growth as compared to control MCF-7 cells. Furthermore, miR-203 expression is significantly higher in ER-positive breast cancer patients as compared to ER-negative patients. We identified suppressor of cytokine signaling 3 (SOCS3) as a direct target of miR-203. Here we observed that miR-203 expression is inversely correlated with SOCS3 expression in ER-positive breast cancer samples. Additionally, we found that anti-miR-203 suppressed the expression of pStat3, pERK and c-Myc in MCF-7 and ZR-75-1 cells. We also demonstrated that anti-miR-203 decreased mammospheres formation and expression of stem cell markers in MCF-7 and ZR-75-1 cells. Taken together, our data suggest that anti-miR-203 has potential as a novel therapeutic strategy in ER-positive breast cancer treatment.

  12. Genome-wide profiles of CtBP link metabolism with genome stability and epithelial reprogramming in breast cancer.

    PubMed

    Di, Li-Jun; Byun, Jung S; Wong, Madeline M; Wakano, Clay; Taylor, Tara; Bilke, Sven; Baek, Songjoon; Hunter, Kent; Yang, Howard; Lee, Maxwell; Zvosec, Cecilia; Khramtsova, Galina; Cheng, Fan; Perou, Charles M; Miller, C Ryan; Raab, Rachel; Olopade, Olufunmilayo I; Gardner, Kevin

    2013-01-01

    The C-terminal binding protein (CtBP) is a NADH-dependent transcriptional repressor that links carbohydrate metabolism to epigenetic regulation by recruiting diverse histone-modifying complexes to chromatin. Here global profiling of CtBP in breast cancer cells reveals that it drives epithelial-to-mesenchymal transition, stem cell pathways and genome instability. CtBP expression induces mesenchymal and stem cell-like features, whereas CtBP depletion or caloric restriction reverses gene repression and increases DNA repair. Multiple members of the CtBP-targeted gene network are selectively downregulated in aggressive breast cancer subtypes. Differential expression of CtBP-targeted genes predicts poor clinical outcome in breast cancer patients, and elevated levels of CtBP in patient tumours predict shorter median survival. Finally, both CtBP promoter targeting and gene repression can be reversed by small molecule inhibition. These findings define broad roles for CtBP in breast cancer biology and suggest novel chromatin-based strategies for pharmacologic and metabolic intervention in cancer.

  13. Cancer-selective death of human breast cancer cells by leelamine is mediated by bax and bak activation.

    PubMed

    Sehrawat, Anuradha; Kim, Su-Hyeong; Hahm, Eun-Ryeong; Arlotti, Julie A; Eiseman, Julie; Shiva, Sruti S; Rigatti, Lora H; Singh, Shivendra V

    2017-02-01

    The present study is the first to report inhibition of breast cancer cell growth in vitro and in vivo and suppression of self-renewal of breast cancer stem cells (bCSC) by a pine bark component (leelamine). Except for a few recent publications in melanoma, anticancer pharmacology of this interesting phytochemical is largely elusive. Leelamine (LLM) dose-dependently inhibited viability of MDA-MB-231 (triple-negative), MCF-7 (estrogen receptor-positive), and SUM159 (triple-negative) human breast cancer cells in association with apoptotic cell death induction. To the contrary, a normal mammary epithelial cell line derived from fibrocystic breast disease and spontaneously immortalized (MCF-10A) was fully resistant to LLM-mediated cell growth inhibition and apoptosis induction. LLM also inhibited self-renewal of breast cancer stem cells. Apoptosis induction by LLM in breast cancer cells was accompanied by a modest increase in reactive oxygen species production, which was not due to inhibition of mitochondrial electron transport chain complexes. Nevertheless, ectopic expression of manganese superoxide dismutase conferred partial protection against LLM-induced cell death but only at a lower yet pharmacologically relevant concentration. Exposure of breast cancer cells to LLM resulted in (a) induction and/or activation of multidomain proapoptotic proteins Bax and Bak, (b) caspase-9 activation, and (c) cytosolic release of cytochrome c. Bax and Bak deficiency in immortalized fibroblasts conferred significant protection against cell death by LLM. Intraperitoneal administration of LLM (7.5 mg/kg; 5 times/wk) suppressed the growth of orthotopic SUM159 xenografts in mice without any toxicity. In conclusion, the present study provides critical preclinical data to warrant further investigation of LLM. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  14. Distinctive expression pattern of OCT4 variants in different types of breast cancer.

    PubMed

    Soheili, Saamaaneh; Asadi, Malek Hossein; Farsinejad, Alireza

    2017-01-01

    OCT4 is a key regulator of self-renewal and pluripotency in embryonic stem cells which can potentially encode three spliced variants designated OCT4A, OCT4B and OCT4B1. Based on cancer stem cell concept, it is suggested that the stemness factors misexpressed in cancer cells and potentially is involved in tumorigenesis. Accordingly, in this study, we investigated the potential expression of OCT4 variants in breast cancer tissues. A total of 94 tumoral and peritumoral breast specimens were evaluated with respect to the expression of OCT4 variants using quantitative RT-PCR and immunohistochemical (IHC) analysis. We detected the expression of OCT4 variants in breast tumor tissues with no or very low levels of expression in peritumoral samples of the same patients. While OCT4B was highly expressed in lobular type of breast cancer, OCT4A and OCTB1 variants are highly expressed in low grade (I and II) ductal tumors. Furthermore, the results of this study revealed a considerable association between the expression level of OCT4 variants and the expression of ER, PR, Her2 and P53 factors. All data demonstrated a distinctive expression pattern of OCT4 spliced variants in different types of breast cancer and provide further evidence for the involvement of embryonic genes in carcinogenesis.

  15. miR-7 suppresses brain metastasis of breast cancer stem-like cells by modulating KLF4

    PubMed Central

    Okuda, Hiroshi; Xing, Fei; Pandey, Puspa R; Sharma, Sambad; Watabe, Misako; Pai, Sudha K.; Mo, Yin-Yuan; Iiizumi-Gairani, Megumi; Hirota, Shigeru; Liu, Yin; Wu, Kerui; Pochampally, Radhika; Watabe, Kounosuke

    2012-01-01

    Despite significant improvement in survival rates of breast cancer patients, prognosis of metastatic disease is still dismal. Cancer stem-like cells (CSCs) are considered to play a role in metastatic progression of breast cancer; however, the exact pathological role of CSCs is yet to be elucidated. In this report, we found that CSCs (CD24−/CD44+/ESA+) isolated from metastatic breast cell lines are significantly more metastatic than non-CSC populations in an organ specific manner. The results of our microRNA profile analysis for these cells revealed that CSCs that are highly metastatic to bone and brain expressed significantly lower level of miR-7 and that this microRNA was capable of modulating one of the essential genes for induced pluripotent stem cell, KLF4. Interestingly, high expression of KLF4 was significantly and inversely correlated to brain- but not bone-metastasis free survival of breast cancer patients, and we indeed found that the expression of miR-7 significantly suppressed the ability of CSCs to metastasize to brain but not to bone in our animal model. We also examined the expression of miR-7 and KLF4 in brain-metastatic lesions and found that these genes were significantly down- or up-regulated, respectively, in the tumor cells in brain. Furthermore, the results of our in vitro experiments indicate that miR-7 attenuates the abilities of invasion and self-renewal of CSCs by modulating KLF4 expression. These results suggest that miR-7 and KLF4 may serve as biomarkers or therapeutic targets for brain metastasis of breast cancer. PMID:23384942

  16. New use of an old drug: inhibition of breast cancer stem cells by benztropine mesylate.

    PubMed

    Cui, Jihong; Hollmén, Maija; Li, Lina; Chen, Yong; Proulx, Steven T; Reker, Daniel; Schneider, Gisbert; Detmar, Michael

    2017-01-03

    Cancer stem cells (CSCs) play major roles in cancer initiation, metastasis, recurrence and therapeutic resistance. Targeting CSCs represents a promising strategy for cancer treatment. The purpose of this study was to identify selective inhibitors of breast CSCs (BCSCs). We carried out a cell-based phenotypic screening with cell viability as a primary endpoint, using a collection of 2,546 FDA-approved drugs and drug-like molecules in spheres formed by malignant human breast gland-derived cells (HMLER-shEcad cells, representing BCSCs) and control immortalized non-tumorigenic human mammary cells (HMLE cells, representing normal stem cells). 19 compounds were identified from screening. The chemically related molecules benztropine mesylate and deptropine citrate were selected for further validation and both potently inhibited sphere formation and self-renewal of BCSCs in vitro. Benztropine mesylate treatment decreased cell subpopulations with high ALDH activity and with a CD44+/CD24- phenotype. In vivo, benztropine mesylate inhibited tumor-initiating potential in a 4T1 mouse model. Functional studies indicated that benztropine mesylate inhibits functions of CSCs via the acetylcholine receptors, dopamine transporters/receptors, and/or histamine receptors. In summary, our findings identify benztropine mesylate as an inhibitor of BCSCs in vitro and in vivo. This study also provides a screening platform for identification of additional anti-CSC agents.

  17. The Anti-Cancer Effect of Polyphenols against Breast Cancer and Cancer Stem Cells: Molecular Mechanisms

    PubMed Central

    Abdal Dayem, Ahmed; Choi, Hye Yeon; Yang, Gwang-Mo; Kim, Kyeongseok; Saha, Subbroto Kumar; Cho, Ssang-Goo

    2016-01-01

    The high incidence of breast cancer in developed and developing countries, and its correlation to cancer-related deaths, has prompted concerned scientists to discover novel alternatives to deal with this challenge. In this review, we will provide a brief overview of polyphenol structures and classifications, as well as on the carcinogenic process. The biology of breast cancer cells will also be discussed. The molecular mechanisms involved in the anti-cancer activities of numerous polyphenols, against a wide range of breast cancer cells, in vitro and in vivo, will be explained in detail. The interplay between autophagy and apoptosis in the anti-cancer activity of polyphenols will also be highlighted. In addition, the potential of polyphenols to target cancer stem cells (CSCs) via various mechanisms will be explained. Recently, the use of natural products as chemotherapeutics and chemopreventive drugs to overcome the side effects and resistance that arise from using chemical-based agents has garnered the attention of the scientific community. Polyphenol research is considered a promising field in the treatment and prevention of breast cancer. PMID:27657126

  18. Human Adipose-Derived Mesenchymal Stem Cell-Secreted CXCL1 and CXCL8 Facilitate Breast Tumor Growth By Promoting Angiogenesis.

    PubMed

    Wang, Yuan; Liu, Junli; Jiang, Qingyuan; Deng, Jie; Xu, Fen; Chen, Xiaolei; Cheng, Fuyi; Zhang, Yujing; Yao, Yunqi; Xia, Zhemin; Xu, Xia; Su, Xiaolan; Huang, Meijuan; Dai, Lei; Yang, Yang; Zhang, Shuang; Yu, Dechao; Zhao, Robert Chunhua; Wei, Yuquan; Deng, Hongxin

    2017-09-01

    Autologous adipose tissue or adipose tissue with additive adipose-derived mesenchymal stem cells (ADSCs) is used in the breast reconstruction of breast cancer patients who undergo mastectomy. ADSCs play an important role in the angiogenesis and adipogenesis, which make it much better than other materials. However, ADSCs may promote residual tumor cells to proliferate or metastasize, and the mechanism is still not fully understood. In this study, we demonstrated that human ADSCs (hADSCs) could facilitate tumor cells growth after co-injection with MCF7 and ZR-75-30 breast cancer cells (BCCs) by promoting angiogenesis, but hADSCs showed limited effect on the growth of MDA-MB-231 BCCs. Intriguingly, compared with ZR-75-30 tumor cells, MCF7 tumor cells were more potentially promoted by hADSCs in the aspects of angiogenesis and proliferation. Consistent with this, cytokine and angiogenesis array analyses showed that after co-injection with hADSCs, the CXCL1 and CXCL8 concentration were significantly increased in MCF7 tumor, but only moderately increased in ZR-75-30 tumor and did not increase in MDA-MB-231 tumor. Furthermore, we found that CXCL1/8 were mainly derived from hADSCs and could increase the migration and tube formation of human umbilical vein endothelial cells (HUVECs) by signaling via their receptors CXCR1 and CXCR2. A CXCR1/2-specific antagonist (SCH527123) attenuated the angiogenesis and tumor growth in vivo. Our findings suggest that CXCL1/8 secreted by hADSCs could promote breast cancer angiogenesis and therefore provide better understanding of safety concerns regarding the clinical application of hADSCs and suggestion in further novel therapeutic options. Stem Cells 2017;35:2060-2070. © 2017 AlphaMed Press.

  19. Epigenetic Silencing of TAP1 in Aldefluor+ Breast Cancer Stem Cells Contributes to Their Enhanced Immune Evasion.

    PubMed

    Sultan, Mohammad; Vidovic, Dejan; Paine, Arianne S; Huynh, Thomas T; Coyle, Krysta M; Thomas, Margaret L; Cruickshank, Brianne M; Dean, Cheryl A; Clements, Derek R; Kim, Youra; Lee, Kristen; Gujar, Shashi A; Weaver, Ian C G; Marcato, Paola

    2018-05-01

    Avoiding detection and destruction by immune cells is key for tumor initiation and progression. The important role of cancer stem cells (CSCs) in tumor initiation has been well established, yet their ability to evade immune detection and targeting is only partly understood. To investigate the ability of breast CSCs to evade immune detection, we identified a highly tumorigenic population in a spontaneous murine mammary tumor based on increased aldehyde dehydrogenase activity. We performed tumor growth studies in immunocompetent and immunocompromised mice. In immunocompetent mice, growth of the spontaneous mammary tumor was restricted; however, the Aldefluor + population was expanded, suggesting inherent resistance mechanisms. Gene expression analysis of the sorted tumor cells revealed that the Aldefluor + tumor cells has decreased expression of transporter associated with antigen processing (TAP) genes and co-stimulatory molecule CD80, which would decrease susceptibility to T cells. Similarly, the Aldefluor + population of patient tumors and 4T1 murine mammary cells had decreased expression of TAP and co-stimulatory molecule genes. In contrast, breast CSCs identified by CD44 + CD24 - do not have decreased expression of these genes, but do have increased expression of C-X-C chemokine receptor type 4. Decitabine treatment and bisulfite pyrosequencing suggests that DNA hypermethylation contributes to decreased TAP gene expression in Aldefluor + CSCs. TAP1 knockdown resulted in increased tumor growth of 4T1 cells in immunocompetent mice. Together, this suggests immune evasion mechanisms in breast CSCs are marker specific and epigenetic silencing of TAP1 in Aldefluor + breast CSCs contributes to their enhanced survival under immune pressure. Stem Cells 2018;36:641-654. © AlphaMed Press 2018.

  20. Heterogeneity of circulating epithelial tumour cells from individual patients with respect to expression profiles and clonal growth (sphere formation) in breast cancer.

    PubMed

    Pizon, M; Zimon, D; Carl, S; Pachmann, U; Pachmann, K; Camara, O

    2013-01-01

    The detection of tumour cells circulating in the peripheral blood of patients with breast cancer is a sign that cells have been able to leave the primary tumour and survive in the circulation. However, in order to form metastases, they require additional properties such as the ability to adhere, self-renew, and grow. Here we present data that a variable fraction among the circulating tumour cells detected by the Maintrac(®) approach expresses mRNA of the stem cell gene NANOG and of the adhesion molecule vimentin and is capable of forming tumour spheres, a property ascribed to tumour-initiating cells (TICs). Between ten and 50 circulating epithelial antigen-positive cells detected by the Maintrac approach were selected randomly from each of 20 patients with breast cancer before and after surgery and were isolated using automated capillary aspiration and deposited individually onto slides for expression profiling. In addition, the circulating tumour cells were cultured without isolation among the white blood cells from 39 patients with breast cancer in different stages of disease using culture methods favouring growth of epithelial cells. Although no epithelial cell adhesion molecule (EpCAM)-positive cells expressing stem cell genes or the adhesion molecule vimentin was detected before surgery, 10%-20% of the cells were found to be positive for mRNA of these genes after surgery. Tumour spheres from circulating cells of 39 patients with different stages of breast cancer were grown without previous isolation in a fraction increasing with the aggressivity of the tumour. Here we show that among the peripherally circulating tumour cells, a variable fraction is able to express stem cell and adhesion properties and can be grown into tumour spheres, a property ascribed to cells capable of initiating tumours and metastases.

  1. Aging is associated with an expansion of CD49fhi mammary stem cells that show a decline in function and increased transformation potential

    PubMed Central

    Dong, Qiaoxiang; Gao, Hui; Shi, Yuanshuo; Zhang, Fuchuang; Gu, Xiang; Wu, Anqi; Wang, Danhan; Chen, Yuanhong; Bandyopadhyay, Abhik; Yeh, I-Tien; Daniel, Benjamin J.; Chen, Yidong; Zou, Yi; Rebel, Vivienne L.; Walter, Christi A.; Lu, Jianxin; Huang, Changjiang; Sun, Lu-Zhe

    2016-01-01

    Breast cancer incidence increases during aging, yet the mechanism of age-associated mammary tumorigenesis is unclear. Mammary stem cells are believed to play an important role in breast tumorigenesis, but how their function changes with age is unknown. We compared mammary epithelial cells isolated from young and old mammary glands of different cohorts of C57BL6/J and BALB/c mice, and our findings revealed that old mammary glands were characterized by increased basal cell pool comprised of mostly CD49fhi cells, altered luminal-to-basal cell ratio, and irregular ductal morphology. More interestingly, basal stem cells in old mice were increased in frequency, but showed a functional decline of differentiation and increased neoplastic transformation potential. Gene signature enrichment analysis revealed a significant enrichment of a luminal cell gene expression signature in the basal stem cell-enriched population from old mice, suggesting some luminal cells were expressing basal markers. Immunofluorescence staining confirmed the presence of luminal cells with high CD49f expression in hyperplastic lesions implicating these cells as undergoing luminal to basal phenotypic changes during aging. Whole transcriptome analysis showed elevated immune and inflammatory responses in old basal stem cells and stromal cells, which may be the underlying cause for increased CD49fhi basal-like cells in aged glands. PMID:27852980

  2. Aging is associated with an expansion of CD49fhi mammary stem cells that show a decline in function and increased transformation potential.

    PubMed

    Dong, Qiaoxiang; Gao, Hui; Shi, Yuanshuo; Zhang, Fuchuang; Gu, Xiang; Wu, Anqi; Wang, Danhan; Chen, Yuanhong; Bandyopadhyay, Abhik; Yeh, I-Tien; Daniel, Benjamin J; Chen, Yidong; Zou, Yi; Rebel, Vivienne L; Walter, Christi A; Lu, Jianxin; Huang, Changjiang; Sun, Lu-Zhe

    2016-11-15

    Breast cancer incidence increases during aging, yet the mechanism of age-associated mammary tumorigenesis is unclear. Mammary stem cells are believed to play an important role in breast tumorigenesis, but how their function changes with age is unknown. We compared mammary epithelial cells isolated from young and old mammary glands of different cohorts of C57BL6/J and BALB/c mice, and our findings revealed that old mammary glands were characterized by increased basal cell pool comprised of mostly CD49f hi cells, altered luminal-to-basal cell ratio, and irregular ductal morphology. More interestingly, basal stem cells in old mice were increased in frequency, but showed a functional decline of differentiation and increased neoplastic transformation potential. Gene signature enrichment analysis revealed a significant enrichment of a luminal cell gene expression signature in the basal stem cell-enriched population from old mice, suggesting some luminal cells were expressing basal markers. Immunofluorescence staining confirmed the presence of luminal cells with high CD49f expression in hyperplastic lesions implicating these cells as undergoing luminal to basal phenotypic changes during aging. Whole transcriptome analysis showed elevated immune and inflammatory responses in old basal stem cells and stromal cells, which may be the underlying cause for increased CD49f hi basal-like cells in aged glands.

  3. Chemo Resistance of Breast Cancer Stem Cells

    DTIC Science & Technology

    2006-05-01

    for stem cell markers , including CD44+ CD24- lin- by flow cytometry following chemotherapy residual tumor is assayed. As shown in Figure 3 below...the tumor and thus may contribute to relapse following therapy. This was to be accomplished by utilizing mouse xenograft models as well as markers ...limitation of utilizing these markers is that they are not suitable for immunochemical detection of tumor stem cells since they require flow cytometric

  4. Estrogen Receptor β as a Therapeutic Target in Breast Cancer Stem Cells

    PubMed Central

    Ma, Ran; Karthik, Govindasamy-Muralidharan; Lövrot, John; Haglund, Felix; Rosin, Gustaf; Katchy, Anne; Zhang, Xiaonan; Viberg, Lisa; Frisell, Jan; Williams, Cecilia; Linder, Stig; Fredriksson, Irma

    2017-01-01

    Abstract Background: Breast cancer cells with tumor-initiating capabilities (BSCs) are considered to maintain tumor growth and govern metastasis. Hence, targeting BSCs will be crucial to achieve successful treatment of breast cancer. Methods: We characterized mammospheres derived from more than 40 cancer patients and two breast cancer cell lines for the expression of estrogen receptors (ERs) and stem cell markers. Mammosphere formation and proliferation assays were performed on cells from 19 cancer patients and five healthy individuals after incubation with ER-subtype selective ligands. Transcriptional analysis was performed to identify pathways activated in ERβ-stimulated mammospheres and verified using in vitro experiments. Xenograft models (n = 4 or 5 per group) were used to study the role of ERs during tumorigenesis. Results: We identified an absence of ERα but upregulation of ERβ in BSCs associated with phenotypic stem cell markers and responsible for the proliferative role of estrogens. Knockdown of ERβ caused a reduction of mammosphere formation in cell lines and in patient-derived cancer cells (40.7%, 26.8%, and 39.1%, respectively). Gene set enrichment analysis identified glycolysis-related pathways (false discovery rate < 0.001) upregulated in ERβ-activated mammospheres. We observed that tamoxifen or fulvestrant alone was insufficient to block proliferation of patient-derived BSCs while this could be accomplished by a selective inhibitor of ERβ (PHTPP; 53.7% in luminal and 45.5% in triple-negative breast cancers). Furthermore, PHTPP reduced tumor initiation in two patient-derived xenografts (75.9% and 59.1% reduction in tumor volume, respectively) and potentiated tamoxifen-mediated inhibition of tumor growth in MCF7 xenografts. Conclusion: We identify ERβ as a mediator of estrogen action in BSCs and a novel target for endocrine therapy. PMID:28376210

  5. Breast Milk Enhances Growth of Enteroids: An Ex Vivo Model of Cell Proliferation.

    PubMed

    Lanik, Wyatt E; Xu, Lily; Luke, Cliff J; Hu, Elise Z; Agrawal, Pranjal; Liu, Victoria S; Kumar, Rajesh; Bolock, Alexa M; Ma, Congrong; Good, Misty

    2018-02-15

    Human small intestinal enteroids are derived from the crypts and when grown in a stem cell niche contain all of the epithelial cell types. The ability to establish human enteroid ex vivo culture systems are important to model intestinal pathophysiology and to study the particular cellular responses involved. In recent years, enteroids from mice and humans are being cultured, passaged, and banked away for future use in several laboratories across the world. This enteroid platform can be used to test the effects of various treatments and drugs and what effects are exerted on different cell types in the intestine. Here, a protocol for establishing primary stem cell-derived small intestinal enteroids derived from neonatal mice and premature human intestine is provided. Moreover, this enteroid culture system was utilized to test the effects of species-specific breast milk. Mouse breast milk can be obtained efficiently using a modified human breast pump and expressed mouse milk can then be used for further research experiments. We now demonstrate the effects of expressed mouse, human, and donor breast milk on the growth and proliferation of enteroids derived from neonatal mice or premature human small intestine.

  6. Breast cancer stem cells, EMT and therapeutic targets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kotiyal, Srishti; Bhattacharya, Susinjan, E-mail: s.bhattacharya@jiit.ac.in

    Highlights: • Therapeutic targeting or inhibition of the key molecules of signaling pathways can control growth of breast cancer stem cells (BCSCs). • Development of BCSCs also involves miRNA interactions. • Therapeutic achievement can be done by targeting identified targets in the BCSC pathways. - Abstract: A small heterogeneous population of breast cancer cells acts as seeds to induce new tumor growth. These seeds or breast cancer stem cells (BCSCs) exhibit great phenotypical plasticity which allows them to undergo “epithelial to mesenchymal transition” (EMT) at the site of primary tumor and a future reverse transition. Apart from metastasis they aremore » also responsible for maintaining the tumor and conferring it with drug and radiation resistance and a tendency for post-treatment relapse. Many of the signaling pathways involved in induction of EMT are involved in CSC generation and regulation. Here we are briefly reviewing the mechanism of TGF-β, Wnt, Notch, TNF-α, NF-κB, RTK signalling pathways which are involved in EMT as well as BCSCs maintenance. Therapeutic targeting or inhibition of the key/accessory players of these pathways could control growth of BCSCs and hence malignant cancer. Additionally several miRNAs are dysregulated in cancer stem cells indicating their roles as oncogenes or tumor suppressors. This review also lists the miRNA interactions identified in BCSCs and discusses on some newly identified targets in the BCSC regulatory pathways like SHIP2, nicastrin, Pin 1, IGF-1R, pro-inflammatory cytokines and syndecan which can be targeted for therapeutic achievements.« less

  7. A high-content assay to identify small-molecule modulators of a cancer stem cell population in luminal breast cancer.

    PubMed

    Yoo, Byong Hoon; Axlund, Sunshine Daddario; Kabos, Peter; Reid, Brian G; Schaack, Jerome; Sartorius, Carol A; LaBarbera, Daniel V

    2012-10-01

    Breast cancers expressing hormone receptors for estrogen (ER) and progesterone (PR) represent ~70% of all cases and are treated with both ER-targeted and chemotherapies, with near 40% becoming resistant. We have previously described that in some ER(+) tumors, the resistant cells express cytokeratin 5 (CK5), a putative marker of breast stem and progenitor cells. CK5(+) cells have lost expression of ER and PR, express the tumor-initiating cell surface marker CD44, and are relatively quiescent. In addition, progestins, which increase breast cancer incidence, expand the CK5(+) subpopulation in ER(+)PR(+) breast cancer cell lines. We have developed models to induce and quantitate CK5(+)ER(-)PR(-) cells, using CK5 promoter-driven luciferase (Fluc) or green fluorescent protein (GFP) reporters stably transduced into T47D breast cancer cells (CK5Pro-GFP or CK5Pro-Luc). We validated the CK5Pro-GFP-T47D model for high-content screening in 96-well microplates and performed a pilot screen using a focused library of 280 compounds from the National Institutes of Health clinical collection. Four hits were obtained that significantly abrogated the progestin-induced CK5(+) cell population, three of which were members of the retinoid family. Hence, this approach will be useful in discovering small molecules that could potentially be developed as combination therapies, preventing the acquisition of a drug-resistant subpopulation.

  8. Parity induces differentiation and reduces Wnt/Notch signaling ratio and proliferation potential of basal stem/progenitor cells isolated from mouse mammary epithelium

    PubMed Central

    2013-01-01

    Introduction Early pregnancy has a strong protective effect against breast cancer in humans and rodents, but the underlying mechanism is unknown. Because breast cancers are thought to arise from specific cell subpopulations of mammary epithelia, we studied the effect of parity on the transcriptome and the differentiation/proliferation potential of specific luminal and basal mammary cells in mice. Methods Mammary epithelial cell subpopulations (luminal Sca1-, luminal Sca1+, basal stem/progenitor, and basal myoepithelial cells) were isolated by flow cytometry from parous and age-matched virgin mice and examined by using a combination of unbiased genomics, bioinformatics, in vitro colony formation, and in vivo limiting dilution transplantation assays. Specific findings were further investigated with immunohistochemistry in entire glands of parous and age-matched virgin mice. Results Transcriptome analysis revealed an upregulation of differentiation genes and a marked decrease in the Wnt/Notch signaling ratio in basal stem/progenitor cells of parous mice. Separate bioinformatics analyses showed reduced activity for the canonical Wnt transcription factor LEF1/TCF7 and increased activity for the Wnt repressor TCF3. This finding was specific for basal stem/progenitor cells and was associated with downregulation of potentially carcinogenic pathways and a reduction in the proliferation potential of this cell subpopulation in vitro and in vivo. As a possible mechanism for decreased Wnt signaling in basal stem/progenitor cells, we found a more than threefold reduction in the expression of the secreted Wnt ligand Wnt4 in total mammary cells from parous mice, which corresponded to a similar decrease in the proportion of Wnt4-secreting and estrogen/progesterone receptor-positive cells. Because recombinant Wnt4 rescued the proliferation defect of basal stem/progenitor cells in vitro, reduced Wnt4 secretion appears to be causally related to parity-induced alterations of basal stem/progenitor cell properties in mice. Conclusions By revealing that parity induces differentiation and downregulates the Wnt/Notch signaling ratio and the in vitro and in vivo proliferation potential of basal stem/progenitor cells in mice, our study sheds light on the long-term consequences of an early pregnancy. Furthermore, it opens the door to future studies assessing whether inhibitors of the Wnt pathway may be used to mimic the parity-induced protective effect against breast cancer. PMID:23621987

  9. Differential Expression Profile of ZFX Variants Discriminates Breast Cancer Subtypes

    PubMed

    Pourkeramati, Fatemeh; Asadi, Malek Hossein; Shakeri, Shahryar; Farsinejad, Alireza

    2018-05-13

    ZFX is a transcriptional regulator in embryonic stem cells that plays an important role in pluripotency and self-renewal. ZFX is widely expressed in pluripotent stem cells and is down-regulated during differentiation of embryonic stem cells. ZFX has five different variants that encode three different protein isoforms. While several reports have determined the overexpression of ZFX in a variety of somatic cancers, the expression of ZFX-spliced variants in cancer cells is not well-understood. We investigated the expression of ZFX variants in a series of breast cancer tissues and cell lines using quantitative PCR. The expression of ZFX variant 1/3 was higher in tumor tissue compared to marginal tissue. In contrast, the ZFX variant 5 was down-regulated in tumor tissues. While the ZFX variant 1/3 and ZFX variant 5 expression significantly increased in low-grade tumors, ZFX variant 4 was strongly expressed in high-grade tumors and demonstrating lymphatic invasion. In addition, our result revealed a significant association between the HER2 status and the expression of ZFX-spliced variants. Our data suggest that the expression of ZFX-spliced transcripts varies between different types of breast cancer and may contribute to their tumorigenesis process. Hence, ZFX-spliced transcripts could be considered as novel tumor markers with a probable value in diagnosis, prognosis, and therapy of breast cancer.

  10. The Anti-cancer Activity of Vernonia divaricata Sw against Leukaemia, Breast and Prostate Cancers In Vitro

    PubMed Central

    Lowe, HIC; Daley-Beckford, D; Toyang, NJ; Watson, C; Hartley, S; Bryant, J

    2014-01-01

    Background: Vernonia divaricata is one of five endemic Vernonia species of Jamaica. The ethnomedicinal uses of other species have been established, however, scientific validation of this species has not yet been done and as such this paper is aimed at identifying the anti-cancer activity of V divaricata against leukaemia, breast and prostate cancer cell lines. Methods: Leaves and stems of V divaricata were dried and milled into powder. The crude hexane and methanol extracts of the leaves and stems were obtained and bio-assayed using WST-1 cell proliferation assay against leukaemia, breast and prostate cancer cell lines. Results: The crude hexane and methanol extracts of V divaricata were able to significantly retard the growth of the MCF-7 (breast), HL-60 (leukaemia) and the PC-3 (prostate) cancer cell lines. The crude methanol extract of the stem was the strongest, exhibiting anti-proliferation activity with IC50 values of 10.14, 12.63 and 9.894 μg/ml for the HL-60, MCF-7 and PC-3 cancer cell lines, respectively, with the most potent toward prostate cancer. Conclusion: The medicinal use of V divaricata as an anti-cancer agent was corroborated as the crude hexane and methanol extracts demonstrated potent anti-proliferation activity and as such hold potential for further research and development into a drug to prevent or treat various cancers. PMID:25429469

  11. Targeting cancer stem cells and signaling pathways by phytochemicals: Novel approach for breast cancer therapy

    PubMed Central

    Dandawate, Prasad R.; Subramaniam, Dharmalingam; Jensen, Roy A.; Anant, Shrikant

    2017-01-01

    Breast cancer is the most common form of cancer diagnosed in women worldwide and the second leading cause of cancer-related deaths in the USA. Despite the development of newer diagnostic methods, selective as well as targeted chemotherapies and their combinations, surgery, hormonal therapy, radiotherapy, breast cancer recurrence, metastasis and drug resistance are still the major problems for breast cancer. Emerging evidence suggest the existence of cancer stem cells (CSCs), a population of cells with the capacity to self-renew, differentiate and be capable of initiating and sustaining tumor growth. In addition, CSCs are believed to be responsible for cancer recurrence, anticancer drug resistance, and metastasis. Hence, compounds targeting breast CSCs may be better therapeutic agents for treating breast cancer and control recurrence and metastasis. Naturally occurring compounds, mainly phytochemicals have gained immense attention in recent times because of their wide safety profile, ability to target heterogeneous populations of cancer cells as well as CSCs, and their key signaling pathways. Therefore, in the present review article, we summarize our current understanding of breast CSCs and their signaling pathways, and the phytochemicals that affect these cells including curcumin, resveratrol, tea polyphenols (epigallocatechin-3-gallate, epigallocatechin), sulforaphane, genistein, indole-3-carbinol, 3, 3′-di-indolylmethane, vitamin E, retinoic acid, quercetin, parthenolide, triptolide, 6-shogaol, pterostilbene, isoliquiritigenin, celastrol, and koenimbin. These phytochemicals may serve as novel therapeutic agents for breast cancer treatment and future leads for drug development. PMID:27609747

  12. Targeting cancer stem cells and signaling pathways by phytochemicals: Novel approach for breast cancer therapy.

    PubMed

    Dandawate, Prasad R; Subramaniam, Dharmalingam; Jensen, Roy A; Anant, Shrikant

    2016-10-01

    Breast cancer is the most common form of cancer diagnosed in women worldwide and the second leading cause of cancer-related deaths in the USA. Despite the development of newer diagnostic methods, selective as well as targeted chemotherapies and their combinations, surgery, hormonal therapy, radiotherapy, breast cancer recurrence, metastasis and drug resistance are still the major problems for breast cancer. Emerging evidence suggest the existence of cancer stem cells (CSCs), a population of cells with the capacity to self-renew, differentiate and be capable of initiating and sustaining tumor growth. In addition, CSCs are believed to be responsible for cancer recurrence, anticancer drug resistance, and metastasis. Hence, compounds targeting breast CSCs may be better therapeutic agents for treating breast cancer and control recurrence and metastasis. Naturally occurring compounds, mainly phytochemicals have gained immense attention in recent times because of their wide safety profile, ability to target heterogeneous populations of cancer cells as well as CSCs, and their key signaling pathways. Therefore, in the present review article, we summarize our current understanding of breast CSCs and their signaling pathways, and the phytochemicals that affect these cells including curcumin, resveratrol, tea polyphenols (epigallocatechin-3-gallate, epigallocatechin), sulforaphane, genistein, indole-3-carbinol, 3, 3'-di-indolylmethane, vitamin E, retinoic acid, quercetin, parthenolide, triptolide, 6-shogaol, pterostilbene, isoliquiritigenin, celastrol, and koenimbin. These phytochemicals may serve as novel therapeutic agents for breast cancer treatment and future leads for drug development. Copyright © 2016. Published by Elsevier Ltd.

  13. A block in lineage differentiation of immortal human mammary stem / progenitor cells by ectopically-expressed oncogenes

    PubMed Central

    Zhao, Xiangshan; Malhotra, Gautam K.; Band, Hamid; Band, Vimla

    2011-01-01

    Introduction: Emerging evidence suggests a direct role of cancer stem cells (CSCs) in the development of breast cancer. In vitro cellular models that recapitulate properties of CSCs are therefore highly desirable. We have previously shown that normal human mammary epithelial cells (hMECs) immortalized with human telomerase reverse transcriptase (hTERT) possess properties of mammary stem / progenitor cells. Materials and Methods: In the present study, we used this cell system to test the idea that other known hMEC-immortalizing oncogenes (RhoA, HPVE6, HPVE7, p53 mutant, and treatment with γ-radiation), share with hTERT, the ability to maintain mammary stem / progenitor cells. Results: The results presented here demonstrate that similar to hMECs immortalized with hTERT, all hMEC cell lines immortalized using various oncogenic strategies express stem / progenitor cell markers. Furthermore, analyses using 2D and 3D culture assays demonstrate that all the immortal cell lines retain their ability to self-renew and to differentiate along the luminal lineage. Remarkably, the stem / progenitor cell lines generated using various oncogenic strategies exhibit a block in differentiation along the myoepithelial lineage, a trait that is retained on hTERT-immortalized stem / progenitors. The inability to differentiate along the myoepithelial lineage could be induced by ectopic mutant p53 expression in hTERT-immortalized hMEC. Conclusions: Our studies demonstrate that stem / progenitor cell characteristics of hMECs are maintained upon immortalization by using various cancer-relevant oncogenic strategies. Oncogene-immortalized hMECs show a block in their ability to differentiate along the myoepithelial lineage. Abrogation of the myoepithelial differentiation potential by a number of distinct oncogenic insults suggests a potential explanation for the predominance of luminal and rarity of myoepithelial breast cancers. PMID:22279424

  14. A block in lineage differentiation of immortal human mammary stem / progenitor cells by ectopically-expressed oncogenes.

    PubMed

    Zhao, Xiangshan; Malhotra, Gautam K; Band, Hamid; Band, Vimla

    2011-01-01

    Emerging evidence suggests a direct role of cancer stem cells (CSCs) in the development of breast cancer. In vitro cellular models that recapitulate properties of CSCs are therefore highly desirable. We have previously shown that normal human mammary epithelial cells (hMECs) immortalized with human telomerase reverse transcriptase (hTERT) possess properties of mammary stem / progenitor cells. In the present study, we used this cell system to test the idea that other known hMEC-immortalizing oncogenes (RhoA, HPVE6, HPVE7, p53 mutant, and treatment with γ-radiation), share with hTERT, the ability to maintain mammary stem / progenitor cells. The results presented here demonstrate that similar to hMECs immortalized with hTERT, all hMEC cell lines immortalized using various oncogenic strategies express stem / progenitor cell markers. Furthermore, analyses using 2D and 3D culture assays demonstrate that all the immortal cell lines retain their ability to self-renew and to differentiate along the luminal lineage. Remarkably, the stem / progenitor cell lines generated using various oncogenic strategies exhibit a block in differentiation along the myoepithelial lineage, a trait that is retained on hTERT-immortalized stem / progenitors. The inability to differentiate along the myoepithelial lineage could be induced by ectopic mutant p53 expression in hTERT-immortalized hMEC. Our studies demonstrate that stem / progenitor cell characteristics of hMECs are maintained upon immortalization by using various cancer-relevant oncogenic strategies. Oncogene-immortalized hMECs show a block in their ability to differentiate along the myoepithelial lineage. Abrogation of the myoepithelial differentiation potential by a number of distinct oncogenic insults suggests a potential explanation for the predominance of luminal and rarity of myoepithelial breast cancers.

  15. Breast fibroblasts in both cancer and normal tissues induce phenotypic transformation of breast cancer stem cells: a preliminary study

    PubMed Central

    Xi, Chunfang; Liu, Mingwei; Sun, Haichen; Liu, Shuang; Song, Lei

    2018-01-01

    Background Breast cancer stem cells (BCSCs) are associated with the invasion of breast cancer. In recent years, studies have demonstrated different phenotypes among BCSCs. Furthermore, BCSCs of diverse phenotypes are present at different tumour sites and different histological stages. Fibroblasts are involved in the phenotypic transformation of BCSCs. Cancer-associated fibroblasts (CAFs) participate in the induction of epithelial–mesenchymal transition, thereby promoting the acquisition of stem cell characteristics, but little is known about the role of normal fibroblasts (NFs) in the phenotypic transformation of BCSCs or about the effect of CAFs and NFs on BCSC phenotypes. Methods A total of six pairs of primary CAFs and NFs were isolated from surgical samples of breast cancer patients and subjected to morphological, immunohistochemical, cell invasion and proteomics analyses. After establishing a cell culture system with conditioned medium from CAFs and NFs, we used the mammosphere formation assay to explore the effect of CAFs and NFs on the self-renewal ability of BCSCs. The effect of CAFs and NFs on the phenotypic differentiation of BCSCs was further analysed by flow cytometry and immunofluorescence. Results The isolated CAFs and NFs did not show significant differences in cell morphology or alpha-smooth muscle actin (α-SMA) expression, but cell invasion and proteomics analyses demonstrated heterogeneity among these fibroblasts. Both CAFs and NFs could promote the generation of BCSCs, but CAFs displayed a greater ability than NFs in promoting mammosphere formation. Conditioned medium from CAFs increased the proportion of aldehyde dehydrogenase-1 positive (ALDH1+) BCSCs, but conditioned medium from NFs was more likely to promote the generation of CD44+CD24− BCSCs from MCF-7 cells. Discussion This study validated the heterogeneity among CAFs and NFs and expanded on the conclusion that fibroblasts promote the generation of cancer stem cells. Our results particularly emphasized the effect of NFs on the phenotypic transformation of BCSCs. In addition, this study further highlighted the roles of CAFs and NFs in the induction of different phenotypes in BCSCs. PMID:29780673

  16. Breast fibroblasts in both cancer and normal tissues induce phenotypic transformation of breast cancer stem cells: a preliminary study.

    PubMed

    Wang, Bixiao; Xi, Chunfang; Liu, Mingwei; Sun, Haichen; Liu, Shuang; Song, Lei; Kang, Hua

    2018-01-01

    Breast cancer stem cells (BCSCs) are associated with the invasion of breast cancer. In recent years, studies have demonstrated different phenotypes among BCSCs. Furthermore, BCSCs of diverse phenotypes are present at different tumour sites and different histological stages. Fibroblasts are involved in the phenotypic transformation of BCSCs. Cancer-associated fibroblasts (CAFs) participate in the induction of epithelial-mesenchymal transition, thereby promoting the acquisition of stem cell characteristics, but little is known about the role of normal fibroblasts (NFs) in the phenotypic transformation of BCSCs or about the effect of CAFs and NFs on BCSC phenotypes. A total of six pairs of primary CAFs and NFs were isolated from surgical samples of breast cancer patients and subjected to morphological, immunohistochemical, cell invasion and proteomics analyses. After establishing a cell culture system with conditioned medium from CAFs and NFs, we used the mammosphere formation assay to explore the effect of CAFs and NFs on the self-renewal ability of BCSCs. The effect of CAFs and NFs on the phenotypic differentiation of BCSCs was further analysed by flow cytometry and immunofluorescence. The isolated CAFs and NFs did not show significant differences in cell morphology or alpha-smooth muscle actin (α-SMA) expression, but cell invasion and proteomics analyses demonstrated heterogeneity among these fibroblasts. Both CAFs and NFs could promote the generation of BCSCs, but CAFs displayed a greater ability than NFs in promoting mammosphere formation. Conditioned medium from CAFs increased the proportion of aldehyde dehydrogenase-1 positive (ALDH1 + ) BCSCs, but conditioned medium from NFs was more likely to promote the generation of CD44 + CD24 - BCSCs from MCF-7 cells. This study validated the heterogeneity among CAFs and NFs and expanded on the conclusion that fibroblasts promote the generation of cancer stem cells. Our results particularly emphasized the effect of NFs on the phenotypic transformation of BCSCs. In addition, this study further highlighted the roles of CAFs and NFs in the induction of different phenotypes in BCSCs.

  17. Targeting Unique Metabolic Properties of Breast Tumor Initiating Cells

    PubMed Central

    Feng, Weiguo; Gentles, Andrew; Nair, Ramesh V.; Huang, Min; Lin, Yuan; Lee, Cleo Y.; Cai, Shang; Scheeren, Ferenc A.; Kuo, Angera H.; Diehn, Maximilian

    2014-01-01

    Normal stem cells from a variety of tissues display unique metabolic properties compared to their more differentiated progeny. However, relatively little is known about heterogeneity of metabolic properties cancer stem cells, also called tumor initiating cells (TICs). In this study we show that, analogous to some normal stem cells, breast TICs have distinct metabolic properties compared to non-tumorigenic cancer cells (NTCs). Transcriptome profiling using RNA-Seq revealed TICs under-express genes involved in mitochondrial biology and mitochondrial oxidative phosphorylation and metabolic analyses revealed TICs preferentially perform glycolysis over oxidative phosphorylation compared to NTCs. Mechanistic analyses demonstrated that decreased expression and activity of pyruvate dehydrogenase (Pdh), a key regulator of oxidative phosphorylation, play a critical role in promoting the pro-glycolytic phenotype of TICs. Metabolic reprogramming via forced activation of Pdh preferentially eliminates TICs both in vitro and in vivo. Our findings reveal unique metabolic properties of TICs and demonstrate that metabolic reprogramming represents a promising strategy for targeting these cells. PMID:24497069

  18. Growth of human breast tissues from patient cells in 3D hydrogel scaffolds.

    PubMed

    Sokol, Ethan S; Miller, Daniel H; Breggia, Anne; Spencer, Kevin C; Arendt, Lisa M; Gupta, Piyush B

    2016-03-01

    Three-dimensional (3D) cultures have proven invaluable for expanding human tissues for basic research and clinical applications. In both contexts, 3D cultures are most useful when they (1) support the outgrowth of tissues from primary human cells that have not been immortalized through extensive culture or viral infection and (2) include defined, physiologically relevant components. Here we describe a 3D culture system with both of these properties that stimulates the outgrowth of morphologically complex and hormone-responsive mammary tissues from primary human breast epithelial cells. Primary human breast epithelial cells isolated from patient reduction mammoplasty tissues were seeded into 3D hydrogels. The hydrogel scaffolds were composed of extracellular proteins and carbohydrates present in human breast tissue and were cultured in serum-free medium containing only defined components. The physical properties of these hydrogels were determined using atomic force microscopy. Tissue growth was monitored over time using bright-field and fluorescence microscopy, and maturation was assessed using morphological metrics and by immunostaining for markers of stem cells and differentiated cell types. The hydrogel tissues were also studied by fabricating physical models from confocal images using a 3D printer. When seeded into these 3D hydrogels, primary human breast epithelial cells rapidly self-organized in the absence of stromal cells and within 2 weeks expanded to form mature mammary tissues. The mature tissues contained luminal, basal, and stem cells in the correct topological orientation and also exhibited the complex ductal and lobular morphologies observed in the human breast. The expanded tissues became hollow when treated with estrogen and progesterone, and with the further addition of prolactin produced lipid droplets, indicating that they were responding to hormones. Ductal branching was initiated by clusters of cells expressing putative mammary stem cell markers, which subsequently localized to the leading edges of the tissue outgrowths. Ductal elongation was preceded by leader cells that protruded from the tips of ducts and engaged with the extracellular matrix. These 3D hydrogel scaffolds support the growth of complex mammary tissues from primary patient-derived cells. We anticipate that this culture system will empower future studies of human mammary gland development and biology.

  19. HER2 in Breast Cancer Stemness: A Negative Feedback Loop towards Trastuzumab Resistance

    PubMed Central

    Nami, Babak; Wang, Zhixiang

    2017-01-01

    HER2 receptor tyrosine kinase that is overexpressed in approximately 20% of all breast cancers (BCs) is a poor prognosis factor and a precious target for BC therapy. Trastuzumab is approved by FDA to specifically target HER2 for treating HER2+ BC. However, about 60% of patients with HER2+ breast tumor develop de novo resistance to trastuzumab, partially due to the loss of expression of HER2 extracellular domain on their tumor cells. This is due to shedding/cleavage of HER2 by metalloproteinases (ADAMs and MMPs). HER2 shedding results in the accumulation of intracellular carboxyl-terminal HER2 (p95HER2), which is a common phenomenon in trastuzumab-resistant tumors and is suggested as a predictive marker for trastuzumab resistance. Up-regulation of the metalloproteinases is a poor prognosis factor and is commonly seen in mesenchymal-like cancer stem cells that are risen during epithelial to mesenchymal transition (EMT) of tumor cells. HER2 cleavage during EMT can explain why secondary metastatic tumors with high percentage of mesenchymal-like cancer stem cells are mostly resistant to trastuzumab but still sensitive to lapatinib. Importantly, many studies report HER2 interaction with oncogenic/stemness signaling pathways including TGF-β/Smad, Wnt/β-catenin, Notch, JAK/STAT and Hedgehog. HER2 overexpression promotes EMT and the emergence of cancer stem cell properties in BC. Increased expression and activation of metalloproteinases during EMT leads to proteolytic cleavage and shedding of HER2 receptor, which downregulates HER2 extracellular domain and eventually increases trastuzumab resistance. Here, we review the hypothesis that a negative feedback loop between HER2 and stemness signaling drives resistance of BC to trastuzumab. PMID:28445439

  20. New use of an old drug: inhibition of breast cancer stem cells by benztropine mesylate

    PubMed Central

    Cui, Jihong; Hollmén, Maija; Li, Lina; Chen, Yong; Proulx, Steven T.; Reker, Daniel; Schneider, Gisbert; Detmar, Michael

    2017-01-01

    Cancer stem cells (CSCs) play major roles in cancer initiation, metastasis, recurrence and therapeutic resistance. Targeting CSCs represents a promising strategy for cancer treatment. The purpose of this study was to identify selective inhibitors of breast CSCs (BCSCs). We carried out a cell-based phenotypic screening with cell viability as a primary endpoint, using a collection of 2,546 FDA-approved drugs and drug-like molecules in spheres formed by malignant human breast gland-derived cells (HMLER-shEcad cells, representing BCSCs) and control immortalized non-tumorigenic human mammary cells (HMLE cells, representing normal stem cells). 19 compounds were identified from screening. The chemically related molecules benztropine mesylate and deptropine citrate were selected for further validation and both potently inhibited sphere formation and self-renewal of BCSCs in vitro. Benztropine mesylate treatment decreased cell subpopulations with high ALDH activity and with a CD44+/CD24− phenotype. In vivo, benztropine mesylate inhibited tumor-initiating potential in a 4T1 mouse model. Functional studies indicated that benztropine mesylate inhibits functions of CSCs via the acetylcholine receptors, dopamine transporters/receptors, and/or histamine receptors. In summary, our findings identify benztropine mesylate as an inhibitor of BCSCs in vitro and in vivo. This study also provides a screening platform for identification of additional anti-CSC agents. PMID:27894093

  1. DNMT1 is essential for mammary and cancer stem cell maintenance and tumorigenesis

    PubMed Central

    Pathania, Rajneesh; Ramachandran, Sabarish; Elangovan, Selvakumar; Padia, Ravi; Yang, Pengyi; Cinghu, Senthilkumar; Veeranan-Karmegam, Rajalakshmi; Arjunan, Pachiappan; Gnana-Prakasam, Jaya P.; Fulzele, Sadanand; Pei, Lirong; Chang, Chang-Sheng; Choi, Hyeon; Shi, Huidong; Manicassamy, Santhakumar; Prasad, Puttur D.; Sharma, Suash; Ganapathy, Vadivel; Jothi, Raja; Thangaraju, Muthusamy

    2015-01-01

    Mammary stem/progenitor cells (MaSCs) maintain self-renewal of the mammary epithelium during puberty and pregnancy. DNA methylation provides a potential epigenetic mechanism for maintaining cellular memory during self-renewal. Although DNA methyltransferases (DNMTs) are dispensable for embryonic stem cell maintenance, their role in maintaining MaSCs and cancer stem cells (CSCs) in constantly replenishing mammary epithelium is unclear. Here we show that DNMT1 is indispensable for MaSC maintenance. Furthermore, we find that DNMT1 expression is elevated in mammary tumors, and mammary gland-specific DNMT1 deletion protects mice from mammary tumorigenesis by limiting the CSC pool. Through genome-scale methylation studies, we identify ISL1 as a direct DNMT1 target, hypermethylated and downregulated in mammary tumors and CSCs. DNMT inhibition or ISL1 expression in breast cancer cells limits CSC population. Altogether, our studies uncover an essential role for DNMT1 in MaSC and CSC maintenance and identify DNMT1-ISL1 axis as a potential therapeutic target for breast cancer treatment. PMID:25908435

  2. Protein kinase C α is a central signaling node and therapeutic target for breast cancer stem cells

    PubMed Central

    Tam, Wai Leong; Lu, Haihui; Buikhuisen, Joyce; Soh, Boon Seng; Lim, Elgene; Reinhardt, Ferenc; Wu, Zhenhua Jeremy; Krall, Jordan A.; Bierie, Brian; Guo, Wenjun; Chen, Xi; Liu, Xiaole Shirley; Brown, Myles; Lim, Bing; Weinberg, Robert A.

    2014-01-01

    SUMMARY The epithelial-mesenchymal transition program becomes activated during malignant progression and can enrich for cancer stem cells (CSCs). We report that inhibition of protein kinase C α (PKCα) specifically targets CSCs, but has little effect on non-CSCs. The formation of CSCs from non-stem cells involves a shift from EGFR to PDGFR signaling, and results in the PKCα-dependent activation of FRA1. We identified an AP-1 molecular switch in which c-FOS and FRA1 are preferentially utilized in non-CSCs and CSCs, respectively. PKCα and FRA1 expression is associated with the aggressive triple-negative breast cancers and the depletion of FRA1 results in a mesenchymal-epithelial transition. Hence, identifying molecular features that shift between cell states can be exploited to target signaling components critical to CSCs. PMID:24029232

  3. Protein kinase C α is a central signaling node and therapeutic target for breast cancer stem cells.

    PubMed

    Tam, Wai Leong; Lu, Haihui; Buikhuisen, Joyce; Soh, Boon Seng; Lim, Elgene; Reinhardt, Ferenc; Wu, Zhenhua Jeremy; Krall, Jordan A; Bierie, Brian; Guo, Wenjun; Chen, Xi; Liu, Xiaole Shirley; Brown, Myles; Lim, Bing; Weinberg, Robert A

    2013-09-09

    The epithelial-mesenchymal transition program becomes activated during malignant progression and can enrich for cancer stem cells (CSCs). We report that inhibition of protein kinase C α (PKCα) specifically targets CSCs but has little effect on non-CSCs. The formation of CSCs from non-stem cells involves a shift from EGFR to PDGFR signaling and results in the PKCα-dependent activation of FRA1. We identified an AP-1 molecular switch in which c-FOS and FRA1 are preferentially utilized in non-CSCs and CSCs, respectively. PKCα and FRA1 expression is associated with the aggressive triple-negative breast cancers, and the depletion of FRA1 results in a mesenchymal-epithelial transition. Hence, identifying molecular features that shift between cell states can be exploited to target signaling components critical to CSCs. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. [High dosage therapy and autologous peripheral stem cell transplantation in breast carcinoma].

    PubMed

    Kier, P; Ruckser, R; Buxhofer, V; Habertheuer, K H; Zelenka, P; Tatzreiter, G; Hübl, G; Kittl, E; Hauser, A; Sebesta, C; Hinterberger, W

    2000-01-01

    42 breast cancer patients were treated by high-dose chemotherapy (HDC) and autologous peripheral stem-cell transplantation (ASTx) in the Donauspital between 1992 and 1999. 24 patients had stage II/III breast cancer with high risk for relapse. The other 18 patients underwent HDC and ASTx in chemosensitive stage IV. After previous conventional chemotherapy peripheral stem-cells were harvested by one cycle of mobilisation chemotherapy (epirubicin/taxol, FEC 120 or cyclophosphamide) followed by cytokine stimulation. 16 patients were treated by a tandem transplantation (conditioning protocol for 1st ASTx was melphalan 200 mg/m2 and for 2nd transplant it was CTC: cyclophosphamide 6 g/m2; thiotepa 500 mg/m2; carboplatin 800 mg/m2). The other 26 patients received one HDC with CTC as conditioning protocol. The HDC was well tolerated by all patients, there was no transplant-related mortality. The median survival and the progression-free survival (PFS) after HDC and ASTx in stage IV breast cancer patients were 28 and 11 months, respectively. The median survival and PFS were not yet reached in stage II/III patients after 55 months. The actuarial survival and PFS in that patient group were 70% after 55 months. Our data confirm the low risk and good efficacy of HDC and ASTx in breast cancer patients. Nevertheless randomised studies are necessary to evaluate the importance of HDC compared to intensified conventional protocols without ASTx.

  5. BAG3 promotes stem cell-like phenotype in breast cancer by upregulation of CXCR4 via interaction with its transcript.

    PubMed

    Liu, Bao-Qin; Zhang, Song; Li, Si; An, Ming-Xin; Li, Chao; Yan, Jing; Wang, Jia-Mei; Wang, Hua-Qin

    2017-07-13

    BAG3 is an evolutionarily conserved co-chaperone expressed at high levels and has a prosurvival role in many tumor types. The current study reported that BAG3 was induced under specific floating culture conditions that enrich breast cancer stem cell (BCSC)-like cells in spheres. Ectopic BAG3 overexpression increased CD44 + /CD24 - CSC subpopulations, first-generation and second-generation mammosphere formation, indicating that BAG3 promotes CSC self-renewal and maintenance in breast cancer. We further demonstrated that mechanically, BAG3 upregulated CXCR4 expression at the post-transcriptional level. Further studies showed that BAG3 interacted with CXCR4 mRNA and promoted its expression via its coding and 3'-untranslational regions. BAG3 was also found to be positively correlated with CXCR4 expression and unfavorable prognosis in patients with breast cancer. Taken together, our data demonstrate that BAG3 promotes BCSC-like phenotype through CXCR4 via interaction with its transcript. Therefore, this study establishes BAG3 as a potential adverse prognostic factor and a therapeutic target of breast cancer.

  6. Sulforaphane enhances the anticancer activity of taxanes against triple negative breast cancer by killing cancer stem cells.

    PubMed

    Burnett, Joseph P; Lim, Gi; Li, Yanyan; Shah, Ronak B; Lim, Rebekah; Paholak, Hayley J; McDermott, Sean P; Sun, Lichao; Tsume, Yasuhiro; Bai, Shuhua; Wicha, Max S; Sun, Duxin; Zhang, Tao

    2017-05-28

    Triple negative breast cancer (TNBC) typically exhibits rapid progression, high mortality and faster relapse rates relative to other breast cancer subtypes. In this report we examine the combination of taxanes (paclitaxel or docetaxel) with a breast cancer stem cell (CSC)-targeting agent sulforaphane for use against TNBC. We demonstrate that paclitaxel or docetaxel treatment induces IL-6 secretion and results in expansion of CSCs in TNBC cell lines. Conversely, sulforaphane is capable of preferentially eliminating CSCs, by inhibiting NF-κB p65 subunit translocation, downregulating p52 and consequent downstream transcriptional activity. Sulforaphane also reverses taxane-induced aldehyde dehydrogenase-positive (ALDH+) cell enrichment, and dramatically reduces the size and number of primary and secondary mammospheres formed. In vivo in an advanced treatment orthotopic mouse xenograft model together with extreme limiting dilution analysis (ELDA), the combination of docetaxel and sulforaphane exhibits a greater reduction in primary tumor volume and significantly reduces secondary tumor formation relative to either treatment alone. These results suggest that treatment of TNBCs with cytotoxic chemotherapy would be greatly benefited by the addition of sulforaphane to prevent expansion of and eliminate breast CSCs. Published by Elsevier B.V.

  7. Tumor tropism of intravenously injected human-induced pluripotent stem cell-derived neural stem cells and their gene therapy application in a metastatic breast cancer model.

    PubMed

    Yang, Jing; Lam, Dang Hoang; Goh, Sally Sallee; Lee, Esther Xingwei; Zhao, Ying; Tay, Felix Chang; Chen, Can; Du, Shouhui; Balasundaram, Ghayathri; Shahbazi, Mohammad; Tham, Chee Kian; Ng, Wai Hoe; Toh, Han Chong; Wang, Shu

    2012-05-01

    Human pluripotent stem cells can serve as an accessible and reliable source for the generation of functional human cells for medical therapies. In this study, we used a conventional lentiviral transduction method to derive human-induced pluripotent stem (iPS) cells from primary human fibroblasts and then generated neural stem cells (NSCs) from the iPS cells. Using a dual-color whole-body imaging technology, we demonstrated that after tail vein injection, these human NSCs displayed a robust migratory capacity outside the central nervous system in both immunodeficient and immunocompetent mice and homed in on established orthotopic 4T1 mouse mammary tumors. To investigate whether the iPS cell-derived NSCs can be used as a cellular delivery vehicle for cancer gene therapy, the cells were transduced with a baculoviral vector containing the herpes simplex virus thymidine kinase suicide gene and injected through tail vein into 4T1 tumor-bearing mice. The transduced NSCs were effective in inhibiting the growth of the orthotopic 4T1 breast tumor and the metastatic spread of the cancer cells in the presence of ganciclovir, leading to prolonged survival of the tumor-bearing mice. The use of iPS cell-derived NSCs for cancer gene therapy bypasses the sensitive ethical issue surrounding the use of cells derived from human fetal tissues or human embryonic stem cells. This approach may also help to overcome problems associated with allogeneic transplantation of other types of human NSCs. Copyright © 2012 AlphaMed Press.

  8. Phytochemicals for breast cancer therapy: current status and future implications.

    PubMed

    Siddiqui, Jawed Akhtar; Singh, Aru; Chagtoo, Megha; Singh, Nidhi; Godbole, Madan Madhav; Chakravarti, Bandana

    2015-01-01

    Breast cancer is one of the most common malignancies among women, representing nearly 30% of newly diagnosed cancers every year. Till date, various therapeutic interventions, including surgery, chemotherapy, hormonal therapy, and radiotherapy are available and are known to cause a significant decline in the overall mortality rate. However, therapeutic resistance, recurrence and lack of treatment in metastasis are the major challenges that need to be addressed. Increasing evidence suggests the presence of cancer stem cells (CSCs) in heterogeneous population of breast tumors capable of selfrenewal and differentiation and is considered to be responsible for drug resistance and recurrence. Therefore, compound that can target both differentiated cancer cells, as well as CSCs, may provide a better treatment strategy. Due to safe nature of dietary agents and health products, investigators are introducing them into clinical trials in place of chemotherapeutic agents.This current review focuses on phytochemicals, mainly flavonoids that are in use for breast cancer therapy in preclinical phase. As phytochemicals have several advantages in breast cancer and cancer stem cells, new synthetic series for breast cancer therapy from analogues of most potent natural molecule can be developed via rational drug design approach.

  9. Targeting cancer stem cells in breast cancer: potential anticancer properties of 6-shogaol and pterostilbene.

    PubMed

    Wu, Chi-Hao; Hong, Bo-Han; Ho, Chi-Tang; Yen, Gow-Chin

    2015-03-11

    Breast cancer stem cells (BCSCs) constitute a small fraction of the primary tumor that can self-renew and become a drug-resistant cell population, thus limiting the treatment effects of chemotherapeutic drugs. The present study evaluated the cytotoxic effects of five phytochemicals including 6-gingerol (6-G), 6-shogaol (6-S), 5-hydroxy-3,6,7,8,3',4'-hexamethoxyflavone (5-HF), nobiletin (NOL), and pterostilbene (PTE) on MCF-7 breast cancer cells and BCSCs. The results showed that 6-G, 6-S, and PTE selectively killed BCSCs and had high sensitivity for BCSCs isolated from MCF-7 cells that expressed the surface antigen CD44(+)/CD24(-). 6-S and PTE induced cell necrosis phenomena such as membrane injury and bleb formation in BCSCs and inhibited mammosphere formation. In addition, 6-S and PTE increased the sensitivity of isolated BCSCs to chemotherapeutic drugs and significantly increased the anticancer activity of paclitaxel. Analysis of the underlying mechanism showed that 6-S and PTE decreased the expression of the surface antigen CD44 on BCSCs and promoted β-catenin phosphorylation through the inhibition of hedgehog/Akt/GSK3β signaling, thus decreasing the protein expression of downstream c-Myc and cyclin D1 and reducing BCSC stemness.

  10. Protein C receptor stimulates multiple signaling pathways in breast cancer cells.

    PubMed

    Wang, Daisong; Liu, Chunye; Wang, Jingqiang; Jia, Yingying; Hu, Xin; Jiang, Hai; Shao, Zhi-Ming; Zeng, Yi Arial

    2018-01-26

    The protein C receptor (PROCR) has emerged as a stem cell marker in several normal tissues and has also been implicated in tumor progression. However, the functional role of PROCR and the signaling mechanisms downstream of PROCR remain poorly understood. Here, we dissected the PROCR signaling pathways in breast cancer cells. Combining protein array, knockdown, and overexpression methods, we found that PROCR concomitantly activates multiple pathways. We also noted that PROCR-dependent ERK and PI3k-Akt-mTOR signaling pathways proceed through Src kinase and transactivation of insulin-like growth factor 1 receptor (IGF-1R). These pathway activities led to the accumulation of c-Myc and cyclin D1. On the other hand, PROCR-dependent RhoA-ROCK-p38 signaling relied on coagulation factor II thrombin receptor (F2R). We confirmed these findings in primary cells isolated from triple-negative breast cancer-derived xenografts (PDX) that have high expression of PROCR. To the best our knowledge, this is the first comprehensive study of PROCR signaling in breast cancer cells, and its findings also shed light on the molecular mechanisms of PROCR in stem cells in normal tissue. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Characterization of mammary epithelial stem/progenitor cells and their changes with aging in common marmosets.

    PubMed

    Wu, Anqi; Dong, Qiaoxiang; Gao, Hui; Shi, Yuanshuo; Chen, Yuanhong; Zhang, Fuchuang; Bandyopadhyay, Abhik; Wang, Danhan; Gorena, Karla M; Huang, Changjiang; Tardif, Suzette; Nathanielsz, Peter W; Sun, Lu-Zhe

    2016-08-25

    Age is the number one risk factor for breast cancer, yet the underlying mechanisms are unexplored. Age-associated mammary stem cell (MaSC) dysfunction is thought to play an important role in breast cancer carcinogenesis. Non-human primates with their close phylogenetic relationship to humans provide a powerful model system to study the effects of aging on human MaSC. In particular, the common marmoset monkey (Callithrix jacchus) with a relatively short life span is an ideal model for aging research. In the present study, we characterized for the first time the mammary epithelial stem/progenitor cells in the common marmoset. The MaSC-enriched cells formed four major types of morphologically distinct colonies when cultured on plates pre-seeded with irradiated NIH3T3 fibroblasts, and were also capable of forming mammospheres in suspension culture and subsequent formation of 3D organoids in Matrigel culture. Most importantly, these 3D organoids were found to contain stem/progenitor cells that can undergo self-renewal and multi-lineage differentiation both in vitro and in vivo. We also observed a significant decrease of luminal-restricted progenitors with age. Our findings demonstrate that common marmoset mammary stem/progenitor cells can be isolated and quantified with established in vitro and in vivo assays used for mouse and human studies.

  12. Breast Cancer Stem Cells in Antiestrogen Resistance

    DTIC Science & Technology

    2013-08-01

    several flavonoid derivatives purified from the bark of the Paper Mulberry tree (Broussonetia papyrifera) (L.) were able to down-regulate ER- α36...that a flavonoid derivative Broussoflavonol B, inhibited the expression of ER-α36 and EGFR, attenuated growth of ER-negative breast cancer stem...2.00+.40 Recently, we reported that several flavonoid derivatives purified from the bark of the Paper Mulberry tree (Broussonetia papyrifera) (L.) were

  13. Targeting Breast Cancer Stem Cells in Triple-Negative Breast Cancer

    DTIC Science & Technology

    2015-10-01

    an obligatory signaling cascade in the embryo-implantation process. Endocrinology 2005;146:694–701. 59. Wincewicz A, Koda M, Sulkowska M, Kanczuga... Koda L, Sulkowski S. Comparison of STAT3 with HIF-1alpha, Ob and ObR expressions in human endometrioid adenocarcinomas. Tissue Cell 2008;40:405–10

  14. Hinokitiol inhibits vasculogenic mimicry activity of breast cancer stem/progenitor cells through proteasome-mediated degradation of epidermal growth factor receptor

    PubMed Central

    TU, DOM-GENE; YU, YUN; LEE, CHE-HSIN; KUO, YU-LIANG; LU, YIN-CHE; TU, CHI-WEN; CHANG, WEN-WEI

    2016-01-01

    Hinokitiol, alternatively known as β-thujaplicin, is a tropolone-associated natural compound with antimicrobial, anti-inflammatory and antitumor activity. Breast cancer stem/progenitor cells (BCSCs) are a subpopulation of breast cancer cells associated with tumor initiation, chemoresistance and metastatic behavior, and may be enriched by mammosphere cultivation. Previous studies have demonstrated that BCSCs exhibit vasculogenic mimicry (VM) activity via the epidermal growth factor receptor (EGFR) signaling pathway. The present study investigated the anti-VM activity of hinokitiol in BCSCs. At a concentration below the half maximal inhibitory concentration, hinokitiol inhibited VM formation of mammosphere cells derived from two human breast cancer cell lines. Hinokitiol was additionally indicated to downregulate EGFR protein expression in mammosphere-forming BCSCs without affecting the expression of messenger RNA. The protein stability of EGFR in BCSCs was also decreased by hinokitiol. The EGFR protein expression and VM formation capability of hinokitiol-treated BCSCs were restored by co-treatment with MG132, a proteasome inhibitor. In conclusion, the present study indicated that hinokitiol may inhibit the VM activity of BCSCs through stimulating proteasome-mediated EGFR degradation. Hinokitiol may act as an anti-VM agent, and may be useful for the development of novel breast cancer therapeutic agents. PMID:27073579

  15. Melatonin decreases estrogen receptor binding to estrogen response elements sites on the OCT4 gene in human breast cancer stem cells

    PubMed Central

    Lopes, Juliana; Arnosti, David; Trosko, James E.; Tai, Mei-Hui; Zuccari, Debora

    2016-01-01

    Cancer stem cells (CSCs) pose a challenge in cancer treatment, as these cells can drive tumor growth and are resistant to chemotherapy. Melatonin exerts its oncostatic effects through the estrogen receptor (ER) pathway in cancer cells, however its action in CSCs is unclear. Here, we evaluated the effect of melatonin on the regulation of the transcription factor OCT4 (Octamer Binding 4) by estrogen receptor alpha (ERα) in breast cancer stem cells (BCSCs). The cells were grown as a cell suspension or as anchorage independent growth, for the mammospheres growth, representing the CSCs population and treated with 10 nM estrogen (E2) or 10 μM of the environmental estrogen Bisphenol A (BPA) and 1 mM of melatonin. At the end, the cell growth as well as OCT4 and ERα expression and the binding activity of ERα to the OCT4 was assessed. The increase in number and size of mammospheres induced by E2 or BPA was reduced by melatonin treatment. Furthermore, binding of the ERα to OCT4 was reduced, accompanied by a reduction of OCT4 and ERα expression. Thus, melatonin treatment is effective against proliferation of BCSCs in vitro and impacts the ER pathway, demonstrating its potential therapeutic use in breast cancer. PMID:27551335

  16. FOXC2 regulates the G2/M transition of stem cell-rich breast cancer cells and sensitizes them to PLK1 inhibition

    PubMed Central

    Pietilä, Mika; Vijay, Geraldine V.; Soundararajan, Rama; Yu, Xian; Symmans, William F.; Sphyris, Nathalie; Mani, Sendurai A.

    2016-01-01

    Cancer cells with stem cell properties (CSCs) underpin the chemotherapy resistance and high therapeutic failure of triple-negative breast cancers (TNBCs). Even though CSCs are known to proliferate more slowly, they are sensitive to inhibitors of G2/M kinases such as polo-like kinase 1 (PLK1). Understanding the cell cycle regulatory mechanisms of CSCs will help target these cells more efficiently. Herein, we identify a novel role for the transcription factor FOXC2, which is mostly expressed in CSCs, in the regulation of cell cycle of CSC-enriched breast cancer cells. We demonstrate that FOXC2 expression is regulated in a cell cycle-dependent manner, with FOXC2 protein levels accumulating in G2, and rapidly decreasing during mitosis. Knockdown of FOXC2 in CSC-enriched TNBC cells delays mitotic entry without significantly affecting the overall proliferation rate of these cells. Moreover, PLK1 activity is important for FOXC2 protein stability, since PLK1 inhibition reduces FOXC2 protein levels. Indeed, FOXC2 expressing CSC-enriched TNBC cells are sensitive to PLK1 inhibition. Collectively, our findings demonstrate a novel role for FOXC2 as a regulator of the G2/M transition and elucidate the reason for the observed sensitivity of CSC-enriched breast cancer cells to PLK1 inhibitor. PMID:27064522

  17. Tissue Factor promotes breast cancer stem cell activity in vitro.

    PubMed

    Shaker, Hudhaifah; Harrison, Hannah; Clarke, Robert; Landberg, Goran; Bundred, Nigel J; Versteeg, Henri H; Kirwan, Cliona C

    2017-04-18

    Cancer stem cells (CSCs) are a subpopulation of cells that can self-renew and initiate tumours. The clotting-initiating protein Tissue Factor (TF) promotes metastasis and may be overexpressed in cancer cells with increased CSC activity. We sought to determine whether TF promotes breast CSC activity in vitro using human breast cancer cell lines. TF expression was compared in anoikis-resistant (CSC-enriched) and unselected cells. In cells sorted into of TF-expressing and TF-negative (FACS), and in cells transfected to knockdown TF (siRNA) and overexpress TF (cDNA), CSC activity was compared by (i) mammosphere forming efficiency (MFE) (ii) holoclone colony formation (Hc) and (iii) ALDH1 activity. TF expression was increased in anoikis-resistant and high ALDH1-activity T47D cells compared to unselected cells. FACS sorted TF-expressing T47Ds and TF-overexpressing MCF7s had increased CSC activity compared to TF-low cells. TF siRNA cells (MDAMB231,T47D) had reduced CSC activity compared to control cells. FVIIa increased MFE and ALDH1 in a dose-dependent manner (MDAMB231, T47D). The effects of FVIIa on MFE were abrogated by TF siRNA (T47D). Breast CSCs (in vitro) demonstrate increased activity when selected for high TF expression, when induced to overexpress TF, and when stimulated (with FVIIa). Targeting the TF pathway in vivo may abrogate CSC activity.

  18. Mesenchymal Stem Cells in the Bone Marrow Provide a Supportive Niche for Early Disseminated Breast Tumor-Initiating Cells

    DTIC Science & Technology

    2011-04-01

    Differentiation of mouse embryonic stem cells Immunology: - Flow cytometry - Proliferation Assays - Chromium Release Assays - B...of metastatic cells in close proximation to hepatocytes in the liver. Additionally, re-expression of E-cadherin was observed in the membrane of the...profile CD44+/CD24low/ESA+ using fluorescence- activated cell sorting (FACS) [4]. Subcutaneous injection of low numbers of the sorted cell

  19. Transforming growth factor-β signaling: emerging stem cell target in metastatic breast cancer?

    PubMed Central

    Tan, Antoinette R.; Alexe, Gabriela; Reiss, Michael

    2009-01-01

    In most human breast cancers, lowering of TGFβ receptor- or Smad gene expression combined with increased levels of TGFβs in the tumor microenvironment is sufficient to abrogate TGFβs tumor suppressive effects and to induce a mesenchymal, motile and invasive phenotype. In genetic mouse models, TGFβ signaling suppresses de novo mammary cancer formation but promotes metastasis of tumors that have broken through TGFβ tumor suppression. In mouse models of “triple-negative” or basal-like breast cancer, treatment with TGFβ neutralizing anti-bodies or receptor kinase inhibitors strongly inhibits development of lung- and bone metastases. These TGFβ antagonists do not significantly affect tumor cell proliferation or apoptosis. Rather, they de-repress anti-tumor immunity, inhibit angiogenesis and reverse the mesenchymal, motile, invasive phenotype characteristic of basal-like and HER2-positive breast cancer cells. Patterns of TGFβ target genes upregulation in human breast cancers suggest that TGFβ may drive tumor progression in estrogen-independent cancer, while it mediates a suppressive host cell response in estrogen-dependent luminal cancers. In addition, TGFβ appears to play a key role in maintaining the mammary epithelial (cancer) stem cell pool, in part by inducing a mesenchymal phenotype, while differentiated, estrogen receptor-positive, luminal cells are unresponsive to TGFβ because the TGFBR2 receptor gene is transcriptionally silent. These same cells respond to estrogen by downregulating TGFβ, while antiestrogens act by upregulating TGFβ. This model predicts that inhibiting TGFβ signaling should drive the differentiation of mammary stem cells into ductal cells. Consequently, TGFβ antagonists may convert basal-like or HER2-positive cancers to a more epithelioid, non-proliferating (and, perhaps, non-metastatic) phenotype. Conversely, these agents might antagonize the therapeutic effects of anti-estrogens in estrogen-dependent luminal cancers. These predictions need to be addressed prospectively in clinical trials and should inform the selection of patient populations most likely to benefit from this novel anti-metastatic therapeutic approach. PMID:18841463

  20. Curcumin: a promising agent targeting cancer stem cells.

    PubMed

    Zang, Shufei; Liu, Tao; Shi, Junping; Qiao, Liang

    2014-01-01

    Cancer stem cells are a subset of cells that are responsible for cancer initiation and relapse. They are generally resistant to the current anticancer agents. Successful anticancer therapy must consist of approaches that can target not only the differentiated cancer cells, but also cancer stem cells. Emerging evidence suggested that the dietary agent curcumin exerted its anti-cancer activities via targeting cancer stem cells of various origins such as those of colorectal cancer, pancreatic cancer, breast cancer, brain cancer, and head and neck cancer. In order to enhance the therapeutic potential of curcumin, this agent has been modified or used in combination with other agents in the experimental therapy for many cancers. In this mini-review, we discussed the effect of curcumin and its derivatives in eliminating cancer stem cells and the possible underlying mechanisms.

  1. IL-1β produced by aggressive breast cancer cells is one of the factors that dictate their interactions with mesenchymal stem cells through chemokine production.

    PubMed

    Escobar, Pauline; Bouclier, Céline; Serret, Julien; Bièche, Ivan; Brigitte, Madly; Caicedo, Andres; Sanchez, Elodie; Vacher, Sophie; Vignais, Marie-Luce; Bourin, Philippe; Geneviève, David; Molina, Franck; Jorgensen, Christian; Lazennec, Gwendal

    2015-10-06

    The aim of this work was to understand whether the nature of breast cancer cells could modify the nature of the dialog of mesenchymal stem cells (MSCs) with cancer cells. By treating MSCs with the conditioned medium of metastatic Estrogen-receptor (ER)-negative MDA-MB-231, or non-metastatic ER-positive MCF-7 breast cancer cells, we observed that a number of chemokines were produced at higher levels by MSCs treated with MDA-MB-231 conditioned medium (CM). MDA-MB-231 cells were able to induce NF-κB signaling in MSC cells. This was shown by the use of a NF-kB chemical inhibitor or an IκB dominant negative mutant, nuclear translocation of p65 and induction of NF-κB signature. Our results suggest that MDA-MB-231 cells exert their effects on MSCs through the secretion of IL-1β, that activates MSCs and induces the same chemokines as the MDA-MB-231CM. In addition, inhibition of IL-1β secretion in the MDA-MB-231 cells reduces the induced production of a panel of chemokines by MSCs, as well the motility of MDA-MB-231 cells. Our data suggest that aggressive breast cancer cells secrete IL-1β, which increases the production of chemokines by MSCs.

  2. IL-1β produced by aggressive breast cancer cells is one of the factors that dictate their interactions with mesenchymal stem cells through chemokine production

    PubMed Central

    Serret, Julien; Bièche, Ivan; Brigitte, Madly; Caicedo, Andres; Sanchez, Elodie; Vacher, Sophie; Vignais, Marie-Luce; Bourin, Philippe; Geneviève, David; Molina, Franck; Jorgensen, Christian; Lazennec, Gwendal

    2015-01-01

    The aim of this work was to understand whether the nature of breast cancer cells could modify the nature of the dialog of mesenchymal stem cells (MSCs) with cancer cells. By treating MSCs with the conditioned medium of metastatic Estrogen-receptor (ER)-negative MDA-MB-231, or non-metastatic ER-positive MCF-7 breast cancer cells, we observed that a number of chemokines were produced at higher levels by MSCs treated with MDA-MB-231 conditioned medium (CM). MDA-MB-231 cells were able to induce NF-κB signaling in MSC cells. This was shown by the use of a NF-kB chemical inhibitor or an IκB dominant negative mutant, nuclear translocation of p65 and induction of NF-κB signature. Our results suggest that MDA-MB-231 cells exert their effects on MSCs through the secretion of IL-1β, that activates MSCs and induces the same chemokines as the MDA-MB-231CM. In addition, inhibition of IL-1β secretion in the MDA-MB-231 cells reduces the induced production of a panel of chemokines by MSCs, as well the motility of MDA-MB-231 cells. Our data suggest that aggressive breast cancer cells secrete IL-1β, which increases the production of chemokines by MSCs. PMID:26362269

  3. Patient-derived Mammosphere and Xenograft Tumour Initiation Correlates with Progression to Metastasis.

    PubMed

    Eyre, Rachel; Alférez, Denis G; Spence, Kath; Kamal, Mohamed; Shaw, Frances L; Simões, Bruno M; Santiago-Gómez, Angélica; Sarmiento-Castro, Aida; Bramley, Maria; Absar, Mohammed; Saad, Zahida; Chatterjee, Sumohan; Kirwan, Cliona; Gandhi, Ashu; Armstrong, Anne C; Wardley, Andrew M; O'Brien, Ciara S; Farnie, Gillian; Howell, Sacha J; Clarke, Robert B

    2016-12-01

    Breast cancer specific mortality results from tumour cell dissemination and metastatic colonisation. Identification of the cells and processes responsible for metastasis will enable better prevention and control of metastatic disease, thus reducing relapse and mortality. To better understand these processes, we prospectively collected 307 patient-derived breast cancer samples (n = 195 early breast cancers (EBC) and n = 112 metastatic samples (MBC)). We assessed colony-forming activity in vitro by growing isolated cells in both primary (formation) and secondary (self-renewal) mammosphere culture, and tumour initiating activity in vivo through subcutaneous transplantation of fragments or cells into mice. Metastatic samples formed primary mammosphere colonies significantly more frequently than early breast cancers and had significantly higher primary mammosphere colony formation efficiency (0.9 % vs. 0.6 %; p < 0.0001). Tumour initiation in vivo was significantly higher in metastatic than early breast cancer samples (63 % vs. 38 %, p = 0.04). Of 144 breast cancer samples implanted in vivo, we established 20 stable patient-derived xenograft (PDX) models at passage 2 or greater. Lung metastases were detected in mice from 14 PDX models. Mammosphere colony formation in vitro significantly correlated with the ability of a tumour to metastasise to the lungs in vivo (p = 0.05), but not with subcutaneous tumour initiation. In summary, the breast cancer stem cell activities of colony formation and tumour initiation are increased in metastatic compared to early samples, and predict metastasis in vivo. These results suggest that breast stem cell activity will predict for poor outcome tumours, and therapy targeting this activity will improve outcomes for patients with metastatic disease.

  4. Immunotherapy with dendritic cells and cytokine-induced killer cells for MDA-MB-231 breast cancer stem cells in nude mice

    PubMed Central

    Chen, Qiang; Cui, Xiao-Xu; Liang, Pei-Fen; Dou, Jin-Xia; Liu, Zi-Yan; Sun, Wen-Wen

    2016-01-01

    Objective: To compare the effects and safety of immunotherapy using different methods to load DC-CIK cells for MDA-MB-231 breast cancer stem cells. Methods: A breast cancer model was established in BALB/c nude mice using breast cancer stem cells. All mice were randomly divided into six groups, and each group had three nude mice: the blank control group, the DC-CIK group (group D), the MDA-MB-231 CSC whole-cell lysate DC-CIK group (group L-D), the MDA-MB-231 CSC RNA DC-CIK group (group R-D), the THP DC-CIK group (group T-D) and group THP. Nude mice in groups D, L-D, R-D and T-D were injected with CSCs; 4 days later, the mice were inoculated with 1 × 106 DC-CIK cells via the tail vein. This injection was repeated 2 times a week for three weeks. The mice in groups THP and T-D were injected with a 5 mg/Kg dose of THP chemotherapeutic agents via the tail vein the day before DC-CIK injection, which was repeated one time a week for three weeks. Nude mice in the blank control group were injected with normal saline. The weights and sizes of the tumors were measured after the mice were euthanized. The expression of c-Myc, a key proto-oncogene associated with the Akt signaling pathway, was detected with RT-PCR. Results: The tumor growth rates in each group were as follows: group L-D < group R-D < group D < group T-D < blank control group < group THP. The nude mice in groups L-D, R-D and D were normal, active and had a healthy appetite. The mice in groups T-D and THP were lethargic, less active and showed loss of appetite, and their caudal vein was easy to stimulate. The mice in the blank control group were sacrificed during the third week or when their tumors developed ulceration. Compared with the blank control group, c-Myc gene expression was reduced in the tumors of the five experimental groups. Conclusion: The results showed that DC-CIK cells stimulated by different methods were highly effect against MDA-MB-231 breast cancer stem cells in nude mice in all groups, especially in group L-D. DC-CIK immunotherapy may provide a new strategy for the clinical treatment of breast cancer. PMID:27508015

  5. Immunotherapy with dendritic cells and cytokine-induced killer cells for MDA-MB-231 breast cancer stem cells in nude mice.

    PubMed

    Chen, Qiang; Cui, Xiao-Xu; Liang, Pei-Fen; Dou, Jin-Xia; Liu, Zi-Yan; Sun, Wen-Wen

    2016-01-01

    To compare the effects and safety of immunotherapy using different methods to load DC-CIK cells for MDA-MB-231 breast cancer stem cells. A breast cancer model was established in BALB/c nude mice using breast cancer stem cells. All mice were randomly divided into six groups, and each group had three nude mice: the blank control group, the DC-CIK group (group D), the MDA-MB-231 CSC whole-cell lysate DC-CIK group (group L-D), the MDA-MB-231 CSC RNA DC-CIK group (group R-D), the THP DC-CIK group (group T-D) and group THP. Nude mice in groups D, L-D, R-D and T-D were injected with CSCs; 4 days later, the mice were inoculated with 1 × 10(6) DC-CIK cells via the tail vein. This injection was repeated 2 times a week for three weeks. The mice in groups THP and T-D were injected with a 5 mg/Kg dose of THP chemotherapeutic agents via the tail vein the day before DC-CIK injection, which was repeated one time a week for three weeks. Nude mice in the blank control group were injected with normal saline. The weights and sizes of the tumors were measured after the mice were euthanized. The expression of c-Myc, a key proto-oncogene associated with the Akt signaling pathway, was detected with RT-PCR. The tumor growth rates in each group were as follows: group L-D < group R-D < group D < group T-D < blank control group < group THP. The nude mice in groups L-D, R-D and D were normal, active and had a healthy appetite. The mice in groups T-D and THP were lethargic, less active and showed loss of appetite, and their caudal vein was easy to stimulate. The mice in the blank control group were sacrificed during the third week or when their tumors developed ulceration. Compared with the blank control group, c-Myc gene expression was reduced in the tumors of the five experimental groups. The results showed that DC-CIK cells stimulated by different methods were highly effect against MDA-MB-231 breast cancer stem cells in nude mice in all groups, especially in group L-D. DC-CIK immunotherapy may provide a new strategy for the clinical treatment of breast cancer.

  6. Anti-cell growth and anti-cancer stem cell activities of the non-canonical hedgehog inhibitor GANT61 in triple-negative breast cancer cells.

    PubMed

    Koike, Yoshikazu; Ohta, Yusuke; Saitoh, Wataru; Yamashita, Tetsumasa; Kanomata, Naoki; Moriya, Takuya; Kurebayashi, Junichi

    2017-09-01

    Triple-negative breast cancer (TNBC) exhibits biologically aggressive behavior and has a poor prognosis. Novel molecular targeting agents are needed to control TNBC. Recent studies revealed that the non-canonical hedgehog (Hh) signaling pathway plays important roles in the regulation of cancer stem cells (CSCs) in breast cancer. Therefore, the anti-cell growth and anti-CSC effects of the non-canonical Hh inhibitor GANT61 were investigated in TNBC cells. The effects of GANT61 on cell growth, cell cycle progression, apoptosis, and the proportion of CSCs were investigated in three TNBC cell lines. Four ER-positive breast cancer cell lines were also used for comparisons. The expression levels of effector molecules in the Hh pathway: glioma-associated oncogene (GLI) 1 and GLI2, were measured. The combined effects of GANT61 and paclitaxel on anti-cell growth and anti-CSC activities were also investigated. Basal expression levels of GLI1 and GLI2 were significantly higher in TNBC cells than in ER-positive breast cancer cells. GANT61 dose-dependently decreased cell growth in association with G1-S cell cycle retardation and increased apoptosis. GANT61 significantly decreased the CSC proportion in all TNBC cell lines. Paclitaxel decreased cell growth, but not the CSC proportion. Combined treatments of GANT61 and paclitaxel more than additively enhanced anti-cell growth and/or anti-CSC activities. The non-canonical Hh inhibitor GANT61 decreased not only cell growth, but also the CSC population in TNBC cells. GANT61 enhanced the anti-cell growth activity of paclitaxel in these cells. These results suggest for the first time that GANT61 has potential as a therapeutic agent in the treatment of patients with TNBC.

  7. The Role of Integrin α6 (CD49f) in Stem Cells: More than a Conserved Biomarker.

    PubMed

    Krebsbach, Paul H; Villa-Diaz, Luis G

    2017-08-01

    Stem cells have the capacity for self-renewal and differentiation into specialized cells that form and repopulated all tissues and organs, from conception to adult life. Depending on their capacity for differentiation, stem cells are classified as totipotent (ie, zygote), pluripotent (ie, embryonic stem cells), multipotent (ie, neuronal stem cells, hematopoietic stem cells, epithelial stem cells, etc.), and unipotent (ie, spermatogonial stem cells). Adult or tissue-specific stem cells reside in specific niches located in, or nearby, their organ or tissue of origin. There, they have microenvironmental support to remain quiescent, to proliferate as undifferentiated cells (self-renewal), and to differentiate into progenitors or terminally differentiated cells that migrate from the niche to perform specialized functions. The presence of proteins at the cell surface is often used to identify, classify, and isolate stem cells. Among the diverse groups of cell surface proteins used for these purposes, integrin α6, also known as CD49f, may be the only biomarker commonly found in more than 30 different populations of stem cells, including some cancer stem cells. This broad expression among stem cell populations indicates that integrin α6 may play an important and conserved role in stem cell biology, which is reaffirmed by recent demonstrations of its role maintaining self-renewal of pluripotent stem cells and breast and glioblastoma cancer stem cells. Therefore, this review intends to highlight and synthesize new findings on the importance of integrin α6 in stem cell biology.

  8. Induction of murine embryonic stem cell differentiation by medicinal plant extracts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reynertson, Kurt A.; Department of Pharmacology, Weill Cornell Medical College, 1300 York Avenue, New York, NY 10065; Charlson, Mary E.

    Epidemiological evidence indicates that diets high in fruits and vegetables provide a measure of cancer chemoprevention due to phytochemical constituents. Natural products are a rich source of cancer chemotherapy drugs, and primarily target rapidly cycling tumor cells. Increasing evidence indicates that many cancers contain small populations of resistant, stem-like cells that have the capacity to regenerate tumors following chemotherapy and radiation, and have been linked to the initiation of metastases. Our goal is to discover natural product-based clinical or dietary interventions that selectively target cancer stem cells, inducing differentiation. We adapted an alkaline phosphatase (AP) stain to assay plant extractsmore » for the capacity to induce differentiation in embryonic stem (ES) cells. AP is a characteristic marker of undifferentiated ES cells, and this represents a novel approach to screening medicinal plant extracts. Following a survey of approximately 100 fractions obtained from 12 species of ethnomedically utilized plants, we found fractions from 3 species that induced differentiation, decreasing AP and transcript levels of pluripotency markers (Nanog, Oct-4, Rex-1). These fractions affected proliferation of murine ES, and human embryonal, prostate, and breast carcinoma cells in a dose-dependent manner. Several phytochemical constituents were isolated; the antioxidant phytochemicals ellagic acid and gallic acid were shown to affect viability of cultured breast carcinoma cells.« less

  9. Induction of murine embryonic stem cell differentiation by medicinal plant extracts

    PubMed Central

    Reynertson, Kurt A.; Charlson, Mary E.; Gudas, Lorraine J.

    2010-01-01

    Epidemiological evidence indicates that diets high in fruits and vegetables provide a measure of cancer chemoprevention due to phytochemical constituents. Natural products are a rich source of cancer chemotherapy drugs, and primarily target rapidly-cycling tumor cells. Increasing evidence indicates that many cancers contain small populations of resistant, stem-like cells that have the capacity to regenerate tumors following chemotherapy and radiation, and have been linked to the initiation of metastases. Our goal is to discover natural product-based clinical or dietary interventions that selectively target cancer stem cells, inducing differentiation. We adapted an alkaline phosphatase (AP) stain to assay plant extracts for the capacity to induce differentiation in embryonic stem (ES) cells. AP is a characteristic marker of undifferentiated ES cells, and this represents a novel approach to screening medicinal plant extracts. Following a survey of approximately 100 fractions obtained from twelve species of ethnomedically utilized plants, we found fractions from three species that induced differentiation, decreasing AP and transcript levels of pluripotency markers (Nanog, Oct-4, Rex-1). These fractions affected proliferation of murine ES, and human embryonal, prostate, and breast carcinoma cells in a dose-dependent manner. Several phytochemical constituents were isolated; the antioxidant phytochemicals ellagic acid and gallic acid were shown to affect viability of cultured breast carcinoma cells. PMID:20955699

  10. Human Breast Cancer Cells Are Redirected to Mammary Epithelial Cells upon Interaction with the Regenerating Mammary Gland Microenvironment In-Vivo

    PubMed Central

    Bussard, Karen M.; Smith, Gilbert H.

    2012-01-01

    Breast cancer is the second leading cause of cancer deaths in the United States. At present, the etiology of breast cancer is unknown; however the possibility of a distinct cell of origin, i.e. a cancer stem cell, is a heavily investigated area of research. Influencing signals from the tissue niche are known to affect stem cells. Literature has shown that cancer cells lose their tumorigenic potential and display ‘normal’ behavior when placed into ‘normal’ ontogenic environments. Therefore, it may be the case that the tissue microenvironment is able to generate signals to redirect cancer cell fate. Previously, we showed that pluripotent human embryonal carcinoma cells could be redirected by the regenerating mammary gland microenvironment to contribute epithelial progeny for ‘normal’ gland development in-vivo. Here, we show that that human metastatic, non-metastatic, and metastasis-suppressed breast cancer cells proliferate and contribute to normal mammary gland development in-vivo without tumor formation. Immunochemistry for human-specific mitochondria, keratin 8 and 14, as well as human-specific milk proteins (alpha-lactalbumin, impregnated transplant hosts) confirmed the presence of human cell progeny. Features consistent with normal mammary gland development as seen in intact hosts (duct, lumen formation, development of secretory acini) were recapitulated in both primary and secondary outgrowths from chimeric implants. These results suggest the dominance of the tissue microenvironment over cancer cell fate. This work demonstrates that cultured human breast cancer cells (metastatic and non-metastatic) respond developmentally to signals generated by the mouse mammary gland microenvironment during gland regeneration in-vivo. PMID:23155468

  11. Niclosamide inhibits epithelial-mesenchymal transition and tumor growth in lapatinib-resistant human epidermal growth factor receptor 2-positive breast cancer.

    PubMed

    Liu, Junjun; Chen, Xiaosong; Ward, Toby; Mao, Yan; Bockhorn, Jessica; Liu, Xiaofei; Wang, Gen; Pegram, Mark; Shen, Kunwei

    2016-02-01

    Acquired resistance to lapatinib, a human epidermal growth factor receptor 2 kinase inhibitor, remains a clinical problem for women with human epidermal growth factor receptor 2-positive advanced breast cancer, as metastasis is commonly observed in these patients. Niclosamide, an anti-helminthic agent, has recently been shown to exhibit cytotoxicity to tumor cells with stem-like characteristics. This study was designed to identify the mechanisms underlying lapatinib resistance and to determine whether niclosamide inhibits lapatinib resistance by reversing epithelial-mesenchymal transition. Here, two human epidermal growth factor receptor 2-positive breast cancer cell lines, SKBR3 and BT474, were exposed to increasing concentrations of lapatinib to establish lapatinib-resistant cultures. Lapatinib-resistant SKBR3 and BT474 cells exhibited up-regulation of the phenotypic epithelial-mesenchymal transition markers Snail, vimentin and α-smooth muscle actin, accompanied by activation of nuclear factor-кB and Src and a concomitant increase in stem cell marker expression (CD44(high)/CD24(low)), compared to naive lapatinib-sensitive SKBR3 and BT474 cells, respectively. Interestingly, niclosamide reversed epithelial-mesenchymal transition, induced apoptosis and inhibited cell growth by perturbing aberrant signaling pathway activation in lapatinib-resistant human epidermal growth factor receptor 2-positive cells. The ability of niclosamide to alleviate stem-like phenotype development and invasion was confirmed. Collectively, our results demonstrate that lapatinib resistance correlates with epithelial-mesenchymal transition and that niclosamide inhibits lapatinib-resistant cell viability and epithelial-mesenchymal transition. These findings suggest a role of niclosamide or derivatives optimized for more favorable bioavailability not only in reversing lapatinib resistance but also in reducing metastatic potential during the treatment of human epidermal growth factor receptor 2-positive breast cancer. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Chronic exposure to combined carcinogens enhances breast cell carcinogenesis with mesenchymal and stem-like cell properties.

    PubMed

    Pluchino, Lenora Ann; Wang, Hwa-Chain Robert

    2014-01-01

    Breast cancer is the most common type of cancer affecting women in North America and Europe. More than 85% of breast cancers are sporadic and attributable to long-term exposure to small quantities of multiple carcinogens. To understand how multiple carcinogens act together to induce cellular carcinogenesis, we studied the activity of environmental carcinogens 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) and benzo[a]pyrene (B[a]P), and dietary carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) using our breast cell carcinogenesis model. Our study revealed, for the first time, that combined NNK and B[a]P enhanced breast cell carcinogenesis chronically induced by PhIP in both non-cancerous and cancerous breast cells. Co-exposure was more potent than sequential exposure to combined NNK and B[a]P followed by PhIP in inducing carcinogenesis. Initiation of carcinogenesis was measured by transient endpoints induced in a single exposure, while progression of carcinogenesis was measured by acquisition of constitutive endpoints in cumulative exposures. Transient endpoints included DNA damage, Ras-Erk-Nox pathway activation, reactive oxygen species elevation, and increased cellular proliferation. Constitutive endpoints included various cancer-associated properties and signaling modulators, as well as enrichment of cancer stem-like cell population and activation of the epithelial-to-mesenchymal transition program. Using transient and constitutive endpoints as targets, we detected that a combination of the green tea catechins ECG and EGCG, at non-cytotoxic levels, was more effective than individual agents in intervention of cellular carcinogenesis induced by combined NNK, B[a]P, and PhIP. Thus, use of combined ECG and EGCG should be seriously considered for early intervention of breast cell carcinogenesis associated with long-term exposure to environmental and dietary carcinogens.

  13. Chronic Exposure to Combined Carcinogens Enhances Breast Cell Carcinogenesis with Mesenchymal and Stem-Like Cell Properties

    PubMed Central

    Pluchino, Lenora Ann; Wang, Hwa-Chain Robert

    2014-01-01

    Breast cancer is the most common type of cancer affecting women in North America and Europe. More than 85% of breast cancers are sporadic and attributable to long-term exposure to small quantities of multiple carcinogens. To understand how multiple carcinogens act together to induce cellular carcinogenesis, we studied the activity of environmental carcinogens 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) and benzo[a]pyrene (B[a]P), and dietary carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) using our breast cell carcinogenesis model. Our study revealed, for the first time, that combined NNK and B[a]P enhanced breast cell carcinogenesis chronically induced by PhIP in both non-cancerous and cancerous breast cells. Co-exposure was more potent than sequential exposure to combined NNK and B[a]P followed by PhIP in inducing carcinogenesis. Initiation of carcinogenesis was measured by transient endpoints induced in a single exposure, while progression of carcinogenesis was measured by acquisition of constitutive endpoints in cumulative exposures. Transient endpoints included DNA damage, Ras-Erk-Nox pathway activation, reactive oxygen species elevation, and increased cellular proliferation. Constitutive endpoints included various cancer-associated properties and signaling modulators, as well as enrichment of cancer stem-like cell population and activation of the epithelial-to-mesenchymal transition program. Using transient and constitutive endpoints as targets, we detected that a combination of the green tea catechins ECG and EGCG, at non-cytotoxic levels, was more effective than individual agents in intervention of cellular carcinogenesis induced by combined NNK, B[a]P, and PhIP. Thus, use of combined ECG and EGCG should be seriously considered for early intervention of breast cell carcinogenesis associated with long-term exposure to environmental and dietary carcinogens. PMID:25372613

  14. Anti-cancer stem cell activity of a hedgehog inhibitor GANT61 in estrogen receptor-positive breast cancer cells.

    PubMed

    Kurebayashi, Junichi; Koike, Yoshikazu; Ohta, Yusuke; Saitoh, Wataru; Yamashita, Tetsumasa; Kanomata, Naoki; Moriya, Takuya

    2017-05-01

    Estradiol (E2) increases not only the cell growth but also the cancer stem cell (CSC) proportion in estrogen receptor (ER)-positive breast cancer cells. It has been suggested that the non-canonical hedgehog (Hh) pathway activated by E2 plays an important role in the regulation of CSC proportion in ER-positive breast cancer cells. We studied anti-CSC activity of a non-canonical Hh inhibitor GANT61 in ER-positive breast cancer cells. Effects of GANT61 on the cell growth, cell cycle progression, apoptosis and CSC proportion were investigated in four ER-positive breast cancer cell lines. CSC proportion was measured using either the mammosphere assay or CD44/CD24 assay. Expression levels of pivotal molecules in the Hh pathway were measured. Combined effects of GANT61 with antiestrogens on the anti-cell growth and anti-CSC activities were investigated. E2 significantly increased the cell growth and CSC proportion in all ER-positive cell lines. E2 increased the expression levels of glioma-associated oncogene (GLI) 1 and/or GLI2. GANT61 decreased the cell growth in association with a G1-S cell cycle retardation and increased apoptosis. GANT61 decreased the E2-induced CSC proportion measured by the mammosphere assay in all cell lines. Antiestrogens also decreased the E2-induced cell growth and CSC proportion. Combined treatments of GANT61 with antiestrogens additively enhanced anti-cell growth and/or anti-CSC activities in some ER-positive cell lines. In conclusion, the non-canonical Hh inhibitor GANT61 inhibited not only the cell growth but also the CSC proportion increased by E2 in ER-positive breast cancer cells. GANT61 enhanced anti-cell growth and/or anti-CSC activities of antiestrogens in ER-positive cell lines. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  15. Differential marker expression by cultures rich in mesenchymal stem cells

    PubMed Central

    2013-01-01

    Background Mesenchymal stem cells have properties that make them amenable to therapeutic use. However, the acceptance of mesenchymal stem cells in clinical practice requires standardized techniques for their specific isolation. To date, there are no conclusive marker (s) for the exclusive isolation of mesenchymal stem cells. Our aim was to identify markers differentially expressed between mesenchymal stem cell and non-stem cell mesenchymal cell cultures. We compared and contrasted the phenotype of tissue cultures in which mesenchymal stem cells are rich and rare. By initially assessing mesenchymal stem cell differentiation, we established that bone marrow and breast adipose cultures are rich in mesenchymal stem cells while, in our hands, foreskin fibroblast and olfactory tissue cultures contain rare mesenchymal stem cells. In particular, olfactory tissue cells represent non-stem cell mesenchymal cells. Subsequently, the phenotype of the tissue cultures were thoroughly assessed using immuno-fluorescence, flow-cytometry, proteomics, antibody arrays and qPCR. Results Our analysis revealed that all tissue cultures, regardless of differentiation potential, demonstrated remarkably similar phenotypes. Importantly, it was also observed that common mesenchymal stem cell markers, and fibroblast-associated markers, do not discriminate between mesenchymal stem cell and non-stem cell mesenchymal cell cultures. Examination and comparison of the phenotypes of mesenchymal stem cell and non-stem cell mesenchymal cell cultures revealed three differentially expressed markers – CD24, CD108 and CD40. Conclusion We indicate the importance of establishing differential marker expression between mesenchymal stem cells and non-stem cell mesenchymal cells in order to determine stem cell specific markers. PMID:24304471

  16. Selective androgen receptor modulators (SARMs) negatively regulate triple-negative breast cancer growth and epithelial:mesenchymal stem cell signaling.

    PubMed

    Narayanan, Ramesh; Ahn, Sunjoo; Cheney, Misty D; Yepuru, Muralimohan; Miller, Duane D; Steiner, Mitchell S; Dalton, James T

    2014-01-01

    The androgen receptor (AR) is the most highly expressed steroid receptor in breast cancer with 75-95% of estrogen receptor (ER)-positive and 40-70% of ER-negative breast cancers expressing AR. Though historically breast cancers were treated with steroidal androgens, their use fell from favor because of their virilizing side effects and the emergence of tamoxifen. Nonsteroidal, tissue selective androgen receptor modulators (SARMs) may provide a novel targeted approach to exploit the therapeutic benefits of androgen therapy in breast cancer. Since MDA-MB-453 triple-negative breast cancer cells express mutated AR, PTEN, and p53, MDA-MB-231 triple-negative breast cancer cells stably expressing wildtype AR (MDA-MB-231-AR) were used to evaluate the in vitro and in vivo anti-proliferative effects of SARMs. Microarray analysis and epithelial:mesenchymal stem cell (MSC) co-culture signaling studies were performed to understand the mechanisms of action. Dihydrotestosterone and SARMs, but not bicalutamide, inhibited the proliferation of MDA-MB-231-AR. The SARMs reduced the MDA-MB-231-AR tumor growth and tumor weight by greater than 90%, compared to vehicle-treated tumors. SARM treatment inhibited the intratumoral expression of genes and pathways that promote breast cancer development through its actions on the AR. SARM treatment also inhibited the metastasis-promoting paracrine factors, IL6 and MMP13, and subsequent migration and invasion of epithelial:MSC co-cultures. 1. AR stimulation inhibits paracrine factors that are important for MSC interactions and breast cancer invasion and metastasis. 2. SARMs may provide promise as novel targeted therapies to treat AR-positive triple-negative breast cancer.

  17. Selective Androgen Receptor Modulators (SARMs) Negatively Regulate Triple-Negative Breast Cancer Growth and Epithelial:Mesenchymal Stem Cell Signaling

    PubMed Central

    Narayanan, Ramesh; Ahn, Sunjoo; Cheney, Misty D.; Yepuru, Muralimohan; Miller, Duane D.; Steiner, Mitchell S.; Dalton, James T.

    2014-01-01

    Abstract Introduction The androgen receptor (AR) is the most highly expressed steroid receptor in breast cancer with 75–95% of estrogen receptor (ER)-positive and 40–70% of ER-negative breast cancers expressing AR. Though historically breast cancers were treated with steroidal androgens, their use fell from favor because of their virilizing side effects and the emergence of tamoxifen. Nonsteroidal, tissue selective androgen receptor modulators (SARMs) may provide a novel targeted approach to exploit the therapeutic benefits of androgen therapy in breast cancer. Materials and Methods Since MDA-MB-453 triple-negative breast cancer cells express mutated AR, PTEN, and p53, MDA-MB-231 triple-negative breast cancer cells stably expressing wildtype AR (MDA-MB-231-AR) were used to evaluate the in vitro and in vivo anti-proliferative effects of SARMs. Microarray analysis and epithelial:mesenchymal stem cell (MSC) co-culture signaling studies were performed to understand the mechanisms of action. Results Dihydrotestosterone and SARMs, but not bicalutamide, inhibited the proliferation of MDA-MB-231-AR. The SARMs reduced the MDA-MB-231-AR tumor growth and tumor weight by greater than 90%, compared to vehicle-treated tumors. SARM treatment inhibited the intratumoral expression of genes and pathways that promote breast cancer development through its actions on the AR. SARM treatment also inhibited the metastasis-promoting paracrine factors, IL6 and MMP13, and subsequent migration and invasion of epithelial:MSC co-cultures. Conclusion 1. AR stimulation inhibits paracrine factors that are important for MSC interactions and breast cancer invasion and metastasis. 2. SARMs may provide promise as novel targeted therapies to treat AR-positive triple-negative breast cancer. PMID:25072326

  18. Photobiomodulation of breast and cervical cancer stem cells using low-intensity laser irradiation.

    PubMed

    Kiro, N E; Hamblin, M R; Abrahamse, H

    2017-06-01

    Breast and cervical cancers are dangerous threats with regard to the health of women. The two malignancies have reached the highest record in terms of cancer-related deaths among women worldwide. Despite the use of novel strategies with the aim to treat and cure advanced stages of cancer, post-therapeutic relapse believed to be caused by cancer stem cells is one of the challenges encountered during tumor therapy. Therefore, further attention should be paid to cancer stem cells when developing novel anti-tumor therapeutic approaches. Low-intensity laser irradiation is a form of phototherapy making use of visible light in the wavelength range of 630-905 nm. Low-intensity laser irradiation has shown remarkable results in a wide range of medical applications due to its biphasic dose and wavelength effect at a cellular level. Overall, this article focuses on the cellular responses of healthy and cancer cells after treatment with low-intensity laser irradiation alone or in combination with a photosensitizer as photodynamic therapy and the influence that various wavelengths and fluencies could have on the therapeutic outcome. Attention will be paid to the biomodulative effect of low-intensity laser irradiation on cancer stem cells.

  19. Ravuconazole in Preventing Fungal Infections in Patients Undergoing Allogeneic Stem Cell Transplantation

    ClinicalTrials.gov

    2012-03-07

    Breast Cancer; Chronic Myeloproliferative Disorders; Gestational Trophoblastic Tumor; Infection; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Myelodysplastic Syndromes; Myelodysplastic/Myeloproliferative Neoplasms; Neuroblastoma; Ovarian Cancer; Testicular Germ Cell Tumor

  20. TGFβ-Id1 Signaling Opposes Twist1 and Promotes Metastatic Colonization Via a Mesenchymal-to-Epithelial Transition

    PubMed Central

    Stankic, Marko; Pavlovic, Svetlana; Chin, Yvette; Brogi, Edi; Padua, David; Norton, Larry; Massague, Joan; Benezra, Robert

    2014-01-01

    SUMMARY ID genes are required for breast cancer colonization of the lungs, but the mechanism remains poorly understood. Here, we show that Id1 expression induces a stem-like phenotype in breast cancer cells, while retaining epithelial properties, contrary to the notion that cancer stem-like properties are inextricably linked to the mesenchymal state. During metastatic colonization, Id1 induces a mesenchymal-to-epithelial transition (MET), specifically in cells whose mesenchymal state is dependent on the Id1 target protein Twist1 but not at the primary site, where this state is controlled by the zinc-finger protein Snail1. Knockdown of Id expression in metastasizing cells prevents MET and dramatically reduces lung colonization. Furthermore, Id1 is induced by TGFβ only in cells that have first undergone EMT, demonstrating that EMT is a pre-requisite for subsequent Id1-induced MET during lung colonization. Collectively, these studies underscore the importance of Id-mediated phenotypic switching during distinct stages of breast cancer metastasis. PMID:24332369

  1. BAG3 promotes stem cell-like phenotype in breast cancer by upregulation of CXCR4 via interaction with its transcript

    PubMed Central

    Liu, Bao-Qin; Zhang, Song; Li, Si; An, Ming-Xin; Li, Chao; Yan, Jing; Wang, Jia-Mei; Wang, Hua-Qin

    2017-01-01

    BAG3 is an evolutionarily conserved co-chaperone expressed at high levels and has a prosurvival role in many tumor types. The current study reported that BAG3 was induced under specific floating culture conditions that enrich breast cancer stem cell (BCSC)-like cells in spheres. Ectopic BAG3 overexpression increased CD44+/CD24− CSC subpopulations, first-generation and second-generation mammosphere formation, indicating that BAG3 promotes CSC self-renewal and maintenance in breast cancer. We further demonstrated that mechanically, BAG3 upregulated CXCR4 expression at the post-transcriptional level. Further studies showed that BAG3 interacted with CXCR4 mRNA and promoted its expression via its coding and 3′-untranslational regions. BAG3 was also found to be positively correlated with CXCR4 expression and unfavorable prognosis in patients with breast cancer. Taken together, our data demonstrate that BAG3 promotes BCSC-like phenotype through CXCR4 via interaction with its transcript. Therefore, this study establishes BAG3 as a potential adverse prognostic factor and a therapeutic target of breast cancer. PMID:28703799

  2. T Cells in Predicting Acute Graft-Versus-Host Disease in Patients Undergoing Donor Stem Cell Transplant

    ClinicalTrials.gov

    2017-06-26

    Breast Cancer; Chronic Myeloproliferative Disorders; Gestational Trophoblastic Tumor; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Myelodysplastic Syndromes; Myelodysplastic/Myeloproliferative Neoplasms; Neuroblastoma; Ovarian Cancer; Testicular Germ Cell Tumor

  3. Curcumin in VIP-targeted sterically stabilized phospholipid nanomicelles: a novel therapeutic approach for breast cancer and breast cancer stem cells

    PubMed Central

    Khaja, Fatima; Kuzmis, Antonina; Önyüksel, Hayat

    2013-01-01

    Breast cancer is a leading cause of cancer deaths among women in the US, with 40 % chance of relapse after treatment. Recent studies outline the role of cancer stem cells (CSCs) in tumor initiation, propagation, and regeneration of cancer. Moreover, it has been established that breast CSCs reside in a quiescent state that makes them more resistant to conventional cancer therapies than bulk cancer cells resulting in tumor relapse. In this study, we establish that CSCs are associated with the overexpression of vasoactive intestinal peptide (VIP) receptors which can be used to actively target these cells. We investigated the potential of using a novel curcumin nanomedicine (C-SSM) surface conjugated with VIP to target and hinder breast cancer with CSCs. Here, we formulated, characterized, and evaluated the feasibility of C-SSM nanomedicine in vitro. We investigated the cytotoxicity of C-SSM on breast cancer cells and CSCs by tumorsphere formation assay. Our results suggest that curcumin can be encapsulated in SSM up to 200 μg/ml with 1 mM lipid concentration. C-SSM nanomedicine is easy to prepare and maintains its original physicochemical properties after lyophilization, with an IC50 that is significantly improved from that of free curcumin (14.2±1.2 vs. 26.1±3.0 μM). Furthermore, C-SSM-VIP resulted in up to 20 % inhibition of tumorsphere formation at a dose of 5 μM. To this end, our findings demonstrate the feasibility of employing our actively targeted nanomedicine as a potential therapy for CSCs-enriched breast cancer. PMID:24363979

  4. Sirtuin 1-dependent resveratrol cytotoxicity and pro-differentiation activity on breast cancer cells.

    PubMed

    Deus, Cláudia M; Serafim, Teresa L; Magalhães-Novais, Silvia; Vilaça, Andreia; Moreira, Ana C; Sardão, Vilma A; Cardoso, Susana M; Oliveira, Paulo J

    2017-03-01

    Sirtuins regulate several processes associated with tumor development. Resveratrol was shown to stimulate sirtuin 1 and 3 (SIRT1/3) activities and to result in cytotoxicity for some tumor types. The relationship between modulation of sirtuin activities, cellular metabolic remodeling and resveratrol cytotoxicity mechanism on breast cancer cells is still an open question. Here, we evaluated whether sirtuin 1 and 3 are involved in resveratrol toxicity and whether resveratrol leads to a metabolic remodeling and cell differentiation. Results using the Extracellular Flux Analyzer indicated that resveratrol inhibits mitochondrial respiration in breast cancer cells. We also demonstrated here for the first time that resveratrol cytotoxic effects on breast cancer cells were modulated by SIRT1 and also involved mitochondrial complex I inhibition. Importantly, we also demonstrated that resveratrol reduced the pool of breast cancer cells with stemness markers through a SIRT1-dependent mechanism. Our data highlights the role of SIRT1 in regulating resveratrol induced differentiation and/or toxicity in breast cancer cells.

  5. Isolated post-transplantation lymphoproliferative disease involving the breast and axilla as peripheral T-cell lymphoma.

    PubMed

    Hwang, Ji-Young; Cha, Eun Suk; Lee, Jee Eun; Sung, Sun Hee

    2013-01-01

    Post-transplantation lymphoproliferative disorders (PTLDs) are a heterogeneous group of diseases that represent serious complications following immunosuppressive therapy for solid organ or hematopoietic-cell recipients. In contrast to B-cell PTLD, T-cell PTLD is less frequent and is not usually associated with Epstein Barr Virus infection. Moreover, to our knowledge, isolated T-cell PTLD involving the breast is extremely rare and this condition has never been reported previously in the literature. Herein, we report a rare case of isolated T-cell PTLD of the breast that occurred after a patient had been treated for allogeneic peripheral blood stem cell transplantation due to acute myeloblastic leukemia.

  6. The Role of Stem Cells in Aesthetic Surgery: Fact or Fiction?

    PubMed Central

    McArdle, Adrian; Senarath-Yapa, Kshemendra; Walmsley, Graham G.; Hu, Michael; Atashroo, David A.; Tevlin, Ruth; Zielins, Elizabeth; Gurtner, Geoffrey C.; Wan, Derrick C.; Longaker, Michael T.

    2014-01-01

    Stem cells are attractive candidates for the development of novel therapies, targeting indications that involve functional restoration of defective tissue. Although most stem cell therapies are new and highly experimental, there are clinics around the world that exploit vulnerable patients with the hope of offering supposed stem cell therapies, many of which operate without credible scientific merit, oversight, or other patient protection. We review the potential, as well as drawbacks, for incorporation of stem cells in cosmetic procedures. A review of FDA-approved indications and ongoing clinical trials with adipose stem cells is provided. Furthermore, a “snapshot” analysis of websites using the search terms “stem cell therapy” or “stem cell treatment” or “stem cell facelift” was performed. Despite the protective net cast by regulatory agencies such as the FDA and professional societies such as the American Society of Plastic Surgeons, we are witnessing worrying advertisements for procedures such as stem cell facelifts, stem cell breast augmentations, and even stem cell vaginal rejuvenation. The marketing and promotion of stem cell procedures in aesthetic surgery is not adequately supported by clinical evidence in the majority of cases. Stem cells offer tremendous potential, but the marketplace is saturated with unsubstantiated and sometimes fraudulent claims that may place patients at risk. With plastic surgeons at the forefront of stem cell-based regenerative medicine, it is critically important that we provide an example of a rigorous approach to research, data collection, and advertising of stem cell therapies. PMID:24732654

  7. Adrenomedullin is a key Protein Mediating Rotary Cell Culture System that Induces the Effects of Simulated Microgravity on Human Breast Cancer Cells

    NASA Astrophysics Data System (ADS)

    Chen, Li; Yang, Xi; Cui, Xiang; Jiang, Minmin; Gui, Yu; Zhang, Yanni; Luo, Xiangdong

    2015-11-01

    Microgravity or simulated microgravity promotes stem cell proliferation and inhibits differentiation. But, researchers have not yet been able to understand the underlying mechanism through which microgravity or simulated microgravity brings about stem cell proliferation and inhibition of differentiation. In this study, we investigated the effect of simulated microgravity (SMG) on MDA-MB-231 and MCF-7 human breast cancer cells using rotary cell culture system (RCCS). SMG induced a significant accumulation of these cancer cells in S phase of the cell cycle. But, compared with the static group, there was no effect on the overall growth rate of cells in the RCCS group. Furthermore, the expression of cyclin D1 was inhibited in the RCCS group, indicating that RCCS induced cell cycle arrest. In addition, RCCS also induced glycolytic metabolism by increasing the expression of adrenomedullin (ADM), but not HIF1 a. The addition of ADM further enhanced the effects of SMG, which was induced by RCCS. But, the addition of adrenomedullin antagonist (AMA) reversed these effects of SMG. Finally, our results proved that RCCS, which induced cells cycle arrest of breast cancer cells, enhanced glycolysis and upregulated the expression of ADM. But, this did not lead to an increase in hypoxia-inducible factor-1 a (HIF1 a) expression. Thus, we have uncovered a new mechanism for understanding the Warburg effect in breast cancer cells, this mechanism is not the same as hypoxia induced glycolysis.

  8. Lactobacillus in Preventing Infection in Patients Undergoing a Donor Stem Cell Transplant for Hematologic Cancer or Myelodysplastic Syndrome

    ClinicalTrials.gov

    2017-02-02

    Breast Cancer; Chronic Myeloproliferative Disorders; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Myelodysplastic Syndromes; Myelodysplastic/Myeloproliferative Neoplasms; Neuroblastoma; Ovarian Cancer; Testicular Germ Cell Tumor

  9. Moxifloxacin in Preventing Bacterial Infections in Patients Who Have Undergone Donor Stem Cell Transplant

    ClinicalTrials.gov

    2017-05-07

    Breast Cancer; Chronic Myeloproliferative Disorders; Gestational Trophoblastic Tumor; Infection; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Myelodysplastic Syndromes; Myelodysplastic/Myeloproliferative Neoplasms; Neuroblastoma; Ovarian Cancer; Testicular Germ Cell Tumor

  10. Biological Therapy Following Chemotherapy and Peripheral Stem Cell Transplantation in Treating Patients With Cancer

    ClinicalTrials.gov

    2013-03-25

    Breast Cancer; Chronic Myeloproliferative Disorders; Gestational Trophoblastic Tumor; Kidney Cancer; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Myelodysplastic Syndromes; Neuroblastoma; Ovarian Cancer; Sarcoma; Testicular Germ Cell Tumor

  11. The mammary cellular hierarchy and breast cancer.

    PubMed

    Oakes, Samantha R; Gallego-Ortega, David; Ormandy, Christopher J

    2014-11-01

    Advances in the study of hematopoietic cell maturation have paved the way to a deeper understanding the stem and progenitor cellular hierarchy in the mammary gland. The mammary epithelium, unlike the hematopoietic cellular hierarchy, sits in a complex niche where communication between epithelial cells and signals from the systemic hormonal milieu, as well as from extra-cellular matrix, influence cell fate decisions and contribute to tissue homeostasis. We review the discovery, definition and regulation of the mammary cellular hierarchy and we describe the development of the concepts that have guided our investigations. We outline recent advances in in vivo lineage tracing that is now challenging many of our assumptions regarding the behavior of mammary stem cells, and we show how understanding these cellular lineages has altered our view of breast cancer.

  12. T-Cell Gene Therapy to Eradicate Disseminated Breast Cancers

    DTIC Science & Technology

    2011-05-01

    CD27 Functional tests were stalled by mycoplasma contamination of one of the parental cell lines for making VPCs. During this reporting period, new ...Rathinam C. A new role for an old cytokine: M-CSF regulates functions of human hemetopoietic stem cells, YCEMH mini symposium, New Haven, CT, July 23rd...efficacy of 3rd gen designer T cells III. Clinical ( new agent) BODY Aim 1. To test 2nd gen designer T cells in metastatic breast cancer A

  13. Nanoparticles for imaging and treatment of metastatic breast cancer

    PubMed Central

    Mu, Qingxin; Wang, Hui; Zhang, Miqin

    2017-01-01

    Introduction Metastatic breast cancer is one of the most devastating cancers that have no cure. Many therapeutic and diagnostic strategies have been extensively studied in the past decade. Among these strategies, cancer nanotechnology has emerged as a promising strategy in preclinical studies by enabling early identification of primary tumors and metastases, and by effective killing of cancer cells. Areas covered This review covers the recent progress made in targeting and imaging of metastatic breast cancer with nanoparticles, and treatment using nanoparticle-enabled chemo-, gene, photothermal- and radio-therapies. This review also discusses recent developments of nanoparticle-enabled stem cell therapy and immunotherapy. Expert opinion Nanotechnology is expected to play important roles in modern therapy for cancers, including metastatic breast cancer. Nanoparticles are able to target and visualize metastasis in various organs, and deliver therapeutic agents. Through targeting cancer stem cells, nanoparticles are able to treat resistant tumors with minimal toxicity to healthy tissues/organs. Nanoparticles are also able to activate immune cells to eliminate tumors. Owing to their multifunctional, controllable and trackable features, nanotechnology-based imaging and therapy could be a highly potent approach for future cancer research and treatment. PMID:27401941

  14. Novel 3D Tissue Engineered Bone Model, Biomimetic Nanomaterials, and Cold Atmospheric Plasma Technique for Biomedical Applications

    NASA Astrophysics Data System (ADS)

    Wang, Mian

    This thesis research is consist of four chapters, including biomimetic three-dimensional tissue engineered nanostructured bone model for breast cancer bone metastasis study (Chapter one), cold atmospheric plasma for selectively ablating metastatic breast cancer (Chapter two), design of biomimetic and bioactive cold plasma modified nanostructured scaffolds for enhanced osteogenic differentiation of bone marrow derived mesenchymal stem cells (Chapter three), and enhanced osteoblast and mesenchymal stem cell functions on titanium with hydrothermally treated nanocrystalline hydroxyapatite/magnetically treated carbon nanotubes for orthopedic applications (Chapter four). All the thesis research is focused on nanomaterials and the use of cold plasma technique for various biomedical applications.

  15. Targeting Common but Complex Proteoglycans on Breast Cancer Cells and Stem Cells Using Evolutionary Refined Malaria Proteins

    DTIC Science & Technology

    2014-09-01

    chondroitin sulfate A proteoglycans present on all tested breast cancer cells and the vast majority of tested tissue biopsies. Using pull down assays...Invited, Daugaard. C) 2014. Gordon research conference, July 6-11; Targeting of cancer-specific chondroitin sulfate on circulating tumor cells using...now successfully identified a number of proteoglycans that interact with the recombinant malaria protein VAR2CSA when sulfated on carbon 4 of the CS

  16. Human bone perivascular niche-on-a-chip for studying metastatic colonization.

    PubMed

    Marturano-Kruik, Alessandro; Nava, Michele Maria; Yeager, Keith; Chramiec, Alan; Hao, Luke; Robinson, Samuel; Guo, Edward; Raimondi, Manuela Teresa; Vunjak-Novakovic, Gordana

    2018-02-06

    Eight out of 10 breast cancer patients die within 5 years after the primary tumor has spread to the bones. Tumor cells disseminated from the breast roam the vasculature, colonizing perivascular niches around blood capillaries. Slow flows support the niche maintenance by driving the oxygen, nutrients, and signaling factors from the blood into the interstitial tissue, while extracellular matrix, endothelial cells, and mesenchymal stem cells regulate metastatic homing. Here, we show the feasibility of developing a perfused bone perivascular niche-on-a-chip to investigate the progression and drug resistance of breast cancer cells colonizing the bone. The model is a functional human triculture with stable vascular networks within a 3D native bone matrix cultured on a microfluidic chip. Providing the niche-on-a-chip with controlled flow velocities, shear stresses, and oxygen gradients, we established a long-lasting, self-assembled vascular network without supplementation of angiogenic factors. We further show that human bone marrow-derived mesenchymal stem cells, which have undergone phenotypical transition toward perivascular cell lineages, support the formation of capillary-like structures lining the vascular lumen. Finally, breast cancer cells exposed to interstitial flow within the bone perivascular niche-on-a-chip persist in a slow-proliferative state associated with increased drug resistance. We propose that the bone perivascular niche-on-a-chip with interstitial flow promotes the formation of stable vasculature and mediates cancer cell colonization.

  17. Genetic profiling of putative breast cancer stem cells from malignant pleural effusions.

    PubMed

    Tiran, Verena; Stanzer, Stefanie; Heitzer, Ellen; Meilinger, Michael; Rossmann, Christopher; Lax, Sigurd; Tsybrovskyy, Oleksiy; Dandachi, Nadia; Balic, Marija

    2017-01-01

    A common symptom during late stage breast cancer disease is pleural effusion, which is related to poor prognosis. Malignant cells can be detected in pleural effusions indicating metastatic spread from the primary tumor site. Pleural effusions have been shown to be a useful source for studying metastasis and for isolating cells with putative cancer stem cell (CSC) properties. For the present study, pleural effusion aspirates from 17 metastatic breast cancer patients were processed to propagate CSCs in vitro. Patient-derived aspirates were cultured under sphere forming conditions and isolated primary cultures were further sorted for cancer stem cell subpopulations ALDH1+ and CD44+CD24-/low. Additionally, sphere forming efficiency of CSC and non-CSC subpopulations was determined. In order to genetically characterize the different tumor subpopulations, DNA was isolated from pleural effusions before and after cell sorting, and compared with corresponding DNA copy number profiles from primary tumors or bone metastasis using low-coverage whole genome sequencing (SCNA-seq). In general, unsorted cells had a higher potential to form spheres when compared to CSC subpopulations. In most cases, cell sorting did not yield sufficient cells for copy number analysis. A total of five from nine analyzed unsorted pleura samples (55%) showed aberrant copy number profiles similar to the respective primary tumor. However, most sorted subpopulations showed a balanced profile indicating an insufficient amount of tumor cells and low sensitivity of the sequencing method. Finally, we were able to establish a long term cell culture from one pleural effusion sample, which was characterized in detail. In conclusion, we confirm that pleural effusions are a suitable source for enrichment of putative CSC. However, sequencing based molecular characterization is impeded due to insufficient sensitivity along with a high number of normal contaminating cells, which are masking genetic alterations of rare cancer (stem) cells.

  18. Evidence of two distinct functionally specialized fibroblast lineages in breast stroma.

    PubMed

    Morsing, Mikkel; Klitgaard, Marie Christine; Jafari, Abbas; Villadsen, René; Kassem, Moustapha; Petersen, Ole William; Rønnov-Jessen, Lone

    2016-11-03

    The terminal duct lobular unit (TDLU) is the most dynamic structure in the human breast and the putative site of origin of human breast cancer. Although stromal cells contribute to a specialized microenvironment in many organs, this component remains largely understudied in the human breast. We here demonstrate the impact on epithelium of two lineages of breast stromal fibroblasts, one of which accumulates in the TDLU while the other resides outside the TDLU in the interlobular stroma. The two lineages are prospectively isolated by fluorescence activated cell sorting (FACS) based on different expression levels of CD105 and CD26. The characteristics of the two fibroblast lineages are assessed by immunocytochemical staining and gene expression analysis. The differentiation capacity of the two fibroblast populations is determined by exposure to specific differentiating conditions followed by analysis of adipogenic and osteogenic differentiation. To test whether the two fibroblast lineages are functionally imprinted by their site of origin, single cell sorted CD271 low /MUC1 high normal breast luminal epithelial cells are plated on fibroblast feeders for the observation of morphological development. Epithelial structure formation and polarization is shown by immunofluorescence and digitalized quantification of immunoperoxidase-stained cultures. Lobular fibroblasts are CD105 high /CD26 low while interlobular fibroblasts are CD105 low /CD26 high . Once isolated the two lineages remain phenotypically stable and functionally distinct in culture. Lobular fibroblasts have properties in common with bone marrow derived mesenchymal stem cells and they specifically convey growth and branching morphogenesis of epithelial progenitors. Two distinct functionally specialized fibroblast lineages exist in the normal human breast, of which the lobular fibroblasts have properties in common with mesenchymal stem cells and support epithelial growth and morphogenesis. We propose that lobular fibroblasts constitute a specialized microenvironment for human breast luminal epithelial progenitors, i.e. the putative precursors of breast cancer.

  19. Maternal Embryonic Leucine-zipper Kinase: Key Kinase for Stem Cell Phenotype in Glioma and Other Cancers

    PubMed Central

    Ganguly, Ranjit; Hong, Christopher; Smith, Luke; Kornblum, Harley I; Nakano, Ichiro

    2014-01-01

    Maternal embryonic leucine zipper kinase (MELK) is a member of the snf1/AMPK family of protein Serine/Threonine kinases that has recently gained significant attention in the stem cell and cancer biology field. Recent studies suggest that activation of this kinase is tightly associated with extended survival and accelerated proliferation of cancer stem cells (CSCs) in various organs. Overexpression of MELK has been noted in various cancers, including colon, breast, ovaries, pancreas, prostate, and brain, making the inhibition of MELK an attractive therapeutic strategy for a variety of cancers. In the experimental cancer models, depletion of MELK by RNA interference or small molecule inhibitors induces apoptotic cell death of cancer stem cells derived from glioblastoma and breast cancer, both in vitro and in vivo. Mechanism of action of MELK includes, yet may not be restricted to, direct binding and activation of the oncogenic transcription factors c-JUN and FOXM1 in cancer cells but not in the normal counterparts. Following these pre-clinical studies, the Phase I clinical trial for advanced cancers with OTS167 started in 2013, as the first-in-class MELK inhibitor. This review summarizes the current molecular understanding of MELK and the recent pre-clinical studies about MELK as a cancer therapeutic target. PMID:24795222

  20. Stem cell regenerative potential for plastic and reconstructive surgery.

    PubMed

    Boháč, Martin; Csöbönyeiová, Mária; Kupcová, Ida; Zamborský, Radoslav; Fedeleš, Jozef; Koller, Ján

    2016-12-01

    Stem cells represent heterogeneous population of undifferentiated cells with unique characteristics of long term self renewal and plasticity. Moreover, they are capable of active migration to diseased tissues, secretion of different bioactive molecules, and they have immunosuppressive potential as well. They occur in all tissues through life and are involved in process of embryogenesis and regeneration. During last decades stem cells attracted significant attention in each field of medicine, including plastic and reconstructive surgery. The main goal of the present review article is to present and discuss the potential of stem cells and to provide information about their safe utilization in chronic wounds and fistulae healing, scar management, breast reconstruction, as well as in bone, tendon and peripheral nerve regeneration.

  1. Ketones and lactate increase cancer cell “stemness”, driving recurrence, metastasis and poor clinical outcome in breast cancer

    PubMed Central

    Tsirigos, Aristotelis; Lin, Zhao; Pavlides, Stephanos; Wang, Chengwang; Flomenberg, Neal; Knudsen, Erik S; Howell, Anthony; Pestell, Richard G

    2011-01-01

    Previously, we showed that high-energy metabolites (lactate and ketones) “fuel” tumor growth and experimental metastasis in an in vivo xenograft model, most likely by driving oxidative mitochondrial metabolism in breast cancer cells. To mechanistically understand how these metabolites affect tumor cell behavior, here we used genome-wide transcriptional profiling. Human breast cancer cells (MCF7) were cultured with lactate or ketones, and then subjected to transcriptional analysis (exon-array). Interestingly, our results show that treatment with these high-energy metabolites increases the transcriptional expression of gene profiles normally associated with “stemness”, including genes upregulated in embryonic stem (ES) cells. Similarly, we observe that lactate and ketones promote the growth of bonafide ES cells, providing functional validation. The lactate- and ketone-induced “gene signatures” were able to predict poor clinical outcome (including recurrence and metastasis) in human breast cancer patients. Taken together, our results are consistent with the idea that lactate and ketone utilization in cancer cells promotes the “cancer stem cell” phenotype, resulting in significant decreases in patient survival. One possible mechanism by which high-energy metabolites might induce stemness is by increasing the pool of Acetyl-CoA, leading to increased histone acetylation and elevated gene expression. Thus, our results mechanistically imply that clinical outcome in breast cancer could simply be determined by epigenetics and energy metabolism, rather than by the accumulation of specific “classical” gene mutations. We also suggest that high-risk cancer patients (identified by the lactate/ketone gene signatures) could be treated with new therapeutics that target oxidative mitochondrial metabolism, such as the anti-oxidant and “mitochondrial poison” metformin. Finally, we propose that this new approach to personalized cancer medicine be termed “metabolo-genomics,” which incorporates features of both (1) cell metabolism and (2) gene transcriptional profiling. This powerful new approach directly links cancer cell metabolism with clinical outcome, and suggests new therapeutic strategies for inhibiting the TCA cycle and mitochondrial oxidative phosphorylation in cancer cells. PMID:21512313

  2. Lymphangioleiomyomatosis Biomarkers Linked to Lung Metastatic Potential and Cell Stemness

    PubMed Central

    Ruiz de Garibay, Gorka; Herranz, Carmen; Llorente, Alicia; Boni, Jacopo; Serra-Musach, Jordi; Mateo, Francesca; Aguilar, Helena; Gómez-Baldó, Laia; Petit, Anna; Vidal, August; Climent, Fina; Hernández-Losa, Javier; Cordero, Álex; González-Suárez, Eva; Sánchez-Mut, José Vicente; Esteller, Manel; Llatjós, Roger; Varela, Mar; López, José Ignacio; García, Nadia; Extremera, Ana I.; Gumà, Anna; Ortega, Raúl; Plà, María Jesús; Fernández, Adela; Pernas, Sònia; Falo, Catalina; Morilla, Idoia; Campos, Miriam; Gil, Miguel; Román, Antonio; Molina-Molina, María; Ussetti, Piedad; Laporta, Rosalía; Valenzuela, Claudia; Ancochea, Julio; Xaubet, Antoni; Casanova, Álvaro; Pujana, Miguel Angel

    2015-01-01

    Lymphangioleiomyomatosis (LAM) is a rare lung-metastasizing neoplasm caused by the proliferation of smooth muscle-like cells that commonly carry loss-of-function mutations in either the tuberous sclerosis complex 1 or 2 (TSC1 or TSC2) genes. While allosteric inhibition of the mechanistic target of rapamycin (mTOR) has shown substantial clinical benefit, complementary therapies are required to improve response and/or to treat specific patients. However, there is a lack of LAM biomarkers that could potentially be used to monitor the disease and to develop other targeted therapies. We hypothesized that the mediators of cancer metastasis to lung, particularly in breast cancer, also play a relevant role in LAM. Analyses across independent breast cancer datasets revealed associations between low TSC1/2 expression, altered mTOR complex 1 (mTORC1) pathway signaling, and metastasis to lung. Subsequently, immunohistochemical analyses of 23 LAM lesions revealed positivity in all cases for the lung metastasis mediators fascin 1 (FSCN1) and inhibitor of DNA binding 1 (ID1). Moreover, assessment of breast cancer stem or luminal progenitor cell biomarkers showed positivity in most LAM tissue for the aldehyde dehydrogenase 1 (ALDH1), integrin-ß3 (ITGB3/CD61), and/or the sex-determining region Y-box 9 (SOX9) proteins. The immunohistochemical analyses also provided evidence of heterogeneity between and within LAM cases. The analysis of Tsc2-deficient cells revealed relative over-expression of FSCN1 and ID1; however, Tsc2-deficient cells did not show higher sensitivity to ID1-based cancer inhibitors. Collectively, the results of this study reveal novel LAM biomarkers linked to breast cancer metastasis to lung and to cell stemness, which in turn might guide the assessment of additional or complementary therapeutic opportunities for LAM. PMID:26167915

  3. Cells in human milk: state of the science.

    PubMed

    Hassiotou, Foteini; Geddes, Donna T; Hartmann, Peter E

    2013-05-01

    Reflecting millions of years of adaptation and optimization, milk is unique to the species that produces it and for the young of which it is intended, with large variations in both lactation strategies and milk composition existing among different mammalian species. Despite this, milk has the consistent function of providing nourishment, protection, and developmental programming to the young, with short- and long-term effects. Among its components that confer these functions, breast milk contains maternal cells, from leukocytes to epithelial cells of various developmental stages that include stem cells, progenitor cells, lactocytes, and myoepithelial cells. Although in the first 150 years since their discovery, breast milk cells were mostly studied for their morphological traits, technological advances in the last decade have allowed characterization of breast milk cell types at the protein and messenger RNA levels. This is now paving the way for investigation of the functions of these cells in the breastfed infant and the use of breast milk as a tool to understand the normal biology of the breast and its pathologies. This review summarizes the current knowledge of breast milk cellular heterogeneity and discusses future prospects and potential applications.

  4. The p53 Isoform Δ133p53β Promotes Cancer Stem Cell Potential

    PubMed Central

    Arsic, Nikola; Gadea, Gilles; Lagerqvist, E. Louise; Busson, Muriel; Cahuzac, Nathalie; Brock, Carsten; Hollande, Frederic; Gire, Veronique; Pannequin, Julie; Roux, Pierre

    2015-01-01

    Summary Cancer stem cells (CSC) are responsible for cancer chemoresistance and metastasis formation. Here we report that Δ133p53β, a TP53 splice variant, enhanced cancer cell stemness in MCF-7 breast cancer cells, while its depletion reduced it. Δ133p53β stimulated the expression of the key pluripotency factors SOX2, OCT3/4, and NANOG. Similarly, in highly metastatic breast cancer cells, aggressiveness was coupled with enhanced CSC potential and Δ133p53β expression. Like in MCF-7 cells, SOX2, OCT3/4, and NANOG expression were positively regulated by Δ133p53β in these cells. Finally, treatment of MCF-7 cells with etoposide, a cytotoxic anti-cancer drug, increased CSC formation and SOX2, OCT3/4, and NANOG expression via Δ133p53, thus potentially increasing the risk of cancer recurrence. Our findings show that Δ133p53β supports CSC potential. Moreover, they indicate that the TP53 gene, which is considered a major tumor suppressor gene, also acts as an oncogene via the Δ133p53β isoform. PMID:25754205

  5. Molecular and functional interactions between AKT and SOX2 in breast carcinoma

    PubMed Central

    Mir, Perihan; Konantz, Martina; Pereboom, Tamara C.; Paczulla, Anna M.; Merz, Britta; Fehm, Tanja; Perner, Sven; Rothfuss, Oliver C.; Kanz, Lothar; Schulze-Osthoff, Klaus; Lengerke, Claudia

    2015-01-01

    The transcription factor SOX2 is a key regulator of pluripotency in embryonic stem cells and plays important roles in early organogenesis. Recently, SOX2 expression was documented in various cancers and suggested as a cancer stem cell (CSC) marker. Here we identify the Ser/Thr-kinase AKT as an upstream regulator of SOX2 protein turnover in breast carcinoma (BC). SOX2 and pAKT are co-expressed and co-regulated in breast CSCs and depletion of either reduces clonogenicity. Ectopic SOX2 expression restores clonogenicity and in vivo tumorigenicity of AKT-inhibited cells, suggesting that SOX2 acts as a functional downstream AKT target. Mechanistically, we show that AKT physically interacts with the SOX2 protein to modulate its subcellular distribution. AKT kinase inhibition results in enhanced cytoplasmic retention of SOX2, presumably via impaired nuclear import, and in successive cytoplasmic proteasomal degradation of the protein. In line, blockade of either nuclear transport or proteasomal degradation rescues SOX2 expression in AKT-inhibited BC cells. Finally, AKT inhibitors efficiently suppress the growth of SOX2-expressing putative cancer stem cells, whereas conventional chemotherapeutics select for this population. Together, our results suggest the AKT/SOX2 molecular axis as a regulator of BC clonogenicity and AKT inhibitors as promising drugs for the treatment of SOX2-positive BC. PMID:26498353

  6. Lymphocyte Infusion in Treating Patients With Relapsed Cancer After Bone Marrow or Peripheral Stem Cell Transplantation

    ClinicalTrials.gov

    2011-11-28

    Breast Cancer; Chronic Myeloproliferative Disorders; Gestational Trophoblastic Tumor; Kidney Cancer; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Myelodysplastic Syndromes; Neuroblastoma; Ovarian Cancer; Sarcoma; Testicular Germ Cell Tumor

  7. Palifermin in Preventing Oral Mucositis Caused by Chemotherapy and/or Radiation Therapy in Young Patients Undergoing Stem Cell Transplant

    ClinicalTrials.gov

    2013-05-30

    Breast Cancer; Graft Versus Host Disease; Kidney Cancer; Leukemia; Lymphoma; Mucositis; Multiple Myeloma; Plasma Cell Neoplasm; Myelodysplastic Syndromes; Neuroblastoma; Ovarian Cancer; Sarcoma; Testicular Germ Cell Tumor

  8. Salinomycin kills cancer stem cells by sequestering iron in lysosomes

    NASA Astrophysics Data System (ADS)

    Mai, Trang Thi; Hamaï, Ahmed; Hienzsch, Antje; Cañeque, Tatiana; Müller, Sebastian; Wicinski, Julien; Cabaud, Olivier; Leroy, Christine; David, Amandine; Acevedo, Verónica; Ryo, Akihide; Ginestier, Christophe; Birnbaum, Daniel; Charafe-Jauffret, Emmanuelle; Codogno, Patrice; Mehrpour, Maryam; Rodriguez, Raphaël

    2017-10-01

    Cancer stem cells (CSCs) represent a subset of cells within tumours that exhibit self-renewal properties and the capacity to seed tumours. CSCs are typically refractory to conventional treatments and have been associated to metastasis and relapse. Salinomycin operates as a selective agent against CSCs through mechanisms that remain elusive. Here, we provide evidence that a synthetic derivative of salinomycin, which we named ironomycin (AM5), exhibits a more potent and selective activity against breast CSCs in vitro and in vivo, by accumulating and sequestering iron in lysosomes. In response to the ensuing cytoplasmic depletion of iron, cells triggered the degradation of ferritin in lysosomes, leading to further iron loading in this organelle. Iron-mediated production of reactive oxygen species promoted lysosomal membrane permeabilization, activating a cell death pathway consistent with ferroptosis. These findings reveal the prevalence of iron homeostasis in breast CSCs, pointing towards iron and iron-mediated processes as potential targets against these cells.

  9. Expansion of stem cells counteracts age-related mammary regression in compound Timp1/Timp3 null mice.

    PubMed

    Jackson, Hartland W; Waterhouse, Paul; Sinha, Ankit; Kislinger, Thomas; Berman, Hal K; Khokha, Rama

    2015-03-01

    Age is the primary risk factor for breast cancer in women. Bipotent basal stem cells actively maintain the adult mammary ductal tree, but with age tissues atrophy. We show that cell-extrinsic factors maintain the adult stem cell pool during ageing and dictate tissue stoichiometry. Mammary stem cells spontaneously expand more than 11-fold in virgin adult female mice lacking specific genes for TIMPs, the natural metalloproteinase inhibitors. Compound Timp1/Timp3 null glands exhibit Notch activation and accelerated gestational differentiation. Proteomics of mutant basal cells uncover altered cytoskeletal and extracellular protein repertoires, and we identify aberrant mitotic spindle orientation in these glands, a process that instructs asymmetric cell division and fate. We find that progenitor activity normally declines with age, but enriched stem/progenitor pools prevent tissue regression in Timp mutant mammary glands without affecting carcinogen-induced cancer susceptibility. Thus, improved stem cell content can extend mouse mammary tissue lifespan without altering cancer risk in this mouse model.

  10. Induction of murine embryonic stem cell differentiation by medicinal plant extracts.

    PubMed

    Reynertson, Kurt A; Charlson, Mary E; Gudas, Lorraine J

    2011-01-01

    Epidemiological evidence indicates that diets high in fruits and vegetables provide a measure of cancer chemoprevention due to phytochemical constituents. Natural products are a rich source of cancer chemotherapy drugs, and primarily target rapidly cycling tumor cells. Increasing evidence indicates that many cancers contain small populations of resistant, stem-like cells that have the capacity to regenerate tumors following chemotherapy and radiation, and have been linked to the initiation of metastases. Our goal is to discover natural product-based clinical or dietary interventions that selectively target cancer stem cells, inducing differentiation. We adapted an alkaline phosphatase (AP) stain to assay plant extracts for the capacity to induce differentiation in embryonic stem (ES) cells. AP is a characteristic marker of undifferentiated ES cells, and this represents a novel approach to screening medicinal plant extracts. Following a survey of approximately 100 fractions obtained from 12 species of ethnomedically utilized plants, we found fractions from 3 species that induced differentiation, decreasing AP and transcript levels of pluripotency markers (Nanog, Oct-4, Rex-1). These fractions affected proliferation of murine ES, and human embryonal, prostate, and breast carcinoma cells in a dose-dependent manner. Several phytochemical constituents were isolated; the antioxidant phytochemicals ellagic acid and gallic acid were shown to affect viability of cultured breast carcinoma cells. Copyright © 2010 Elsevier Inc. All rights reserved.

  11. Basal/HER2 breast carcinomas

    PubMed Central

    Martin-Castillo, Begoña; Oliveras-Ferraros, Cristina; Vazquez-Martin, Alejandro; Cufí, Silvia; Moreno, José Manuel; Corominas-Faja, Bruna; Urruticoechea, Ander; Martín, Ángel G.; López-Bonet, Eugeni; Menendez, Javier A.

    2013-01-01

    High rates of inherent primary resistance to the humanized monoclonal antibody trastuzumab (Herceptin) are frequent among HER2 gene-amplified breast carcinomas in both metastatic and adjuvant settings. The clinical efficacy of trastuzumab is highly correlated with its ability to specifically and efficiently target HER2-driven populations of breast cancer stem cells (CSCs). Intriguingly, many of the possible mechanisms by which cancer cells escape trastuzumab involve many of the same biomarkers that have been implicated in the biology of CS-like tumor-initiating cells. In the traditional, one-way hierarchy of CSCs in which all cancer cells descend from special self-renewing CSCs, HER2-positive CSCs can occur solely by self-renewal. Therefore, by targeting CSC self-renewal and resistance, trastuzumab is expected to induce tumor shrinkage and further reduce breast cancer recurrence rates when used alongside traditional therapies. In a new, alternate model, more differentiated non-stem cancer cells can revert to trastuzumab-refractory, CS-like cells via the activation of intrinsic or microenvironmental paths-to-stemness, such as the epithelial-to-mesenchymal transition (EMT). Alternatively, stochastic transitions of trastuzumab-responsive CSCs might also give rise to non-CSC cellular states that lack major attributes of CSCs and, therefore, can remain “hidden” from trastuzumab activity. Here, we hypothesize that a better understanding of the CSC/non-CSC social structure within HER2-overexpressing breast carcinomas is critical for trastuzumab-based treatment decisions in the clinic. First, we decipher the biological significance of CSC features and the EMT on the molecular effects and efficacy of trastuzumab in HER2-positive breast cancer cells. Second, we reinterpret the genetic heterogeneity that differentiates trastuzumab-responders from non-responders in terms of CSC cellular states. Finally, we propose that novel predictive approaches aimed at better forecasting early tumor responses to trastuzumab should identify biological determinants that causally underlie the intrinsic flexibility of HER2-positive CSCs to “enter” into or “exit” from trastuzumab-sensitive states. An accurate integration of CSC cellular states and EMT-related biomarkers with the currently available breast cancer molecular taxonomy may significantly improve our ability to make a priori decisions about whether patients belonging to HER2 subtypes differentially enriched with a “mesenchymal transition signature” (e.g., luminal/HER2 vs. basal/HER2) would distinctly benefit from trastuzumab-based therapy ab initio. PMID:23255137

  12. Novel Approaches to Breast Cancer Prevention and Inhibition of Metastases

    DTIC Science & Technology

    2014-10-01

    functional characterization of candidate breast cancer genes. The transgenic RNAi library is covering the whole Drosophila genome , giving us an...cancer prevention trials in BRCA1 carriers using RANKL blockade. Using Drosophila modeling of Ras-driven transformation, we performed a near- genome ... Genome wide functional genetics, haploid stem cells, Drosophila cancer modeling, breast cancer prevention, BRCA1 carriers 16. SECURITY

  13. Isolation and functional interrogation of adult human prostate epithelial stem cells at single cell resolution.

    PubMed

    Hu, Wen-Yang; Hu, Dan-Ping; Xie, Lishi; Li, Ye; Majumdar, Shyama; Nonn, Larisa; Hu, Hong; Shioda, Toshi; Prins, Gail S

    2017-08-01

    Using primary cultures of normal human prostate epithelial cells, we developed a novel prostasphere-based, label-retention assay that permits identification and isolation of stem cells at a single cell level. Their bona fide stem cell nature was corroborated using in vitro and in vivo regenerative assays and documentation of symmetric/asymmetric division. Robust WNT10B and KRT13 levels without E-cadherin or KRT14 staining distinguished individual stem cells from daughter progenitors in spheroids. Following FACS to isolate label-retaining stem cells from label-free progenitors, RNA-seq identified unique gene signatures for the separate populations which may serve as useful biomarkers. Knockdown of KRT13 or PRAC1 reduced sphere formation and symmetric self-renewal highlighting their role in stem cell maintenance. Pathways analysis identified ribosome biogenesis and membrane estrogen-receptor signaling enriched in stem cells with NF-ĸB signaling enriched in progenitors; activities that were biologically confirmed. Further, bioassays identified heightened autophagy flux and reduced metabolism in stem cells relative to progenitors. These approaches similarly identified stem-like cells from prostate cancer specimens and prostate, breast and colon cancer cell lines suggesting wide applicability. Together, the present studies isolate and identify unique characteristics of normal human prostate stem cells and uncover processes that maintain stem cell homeostasis in the prostate gland. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  14. Opposite Effects of Coinjection and Distant Injection of Mesenchymal Stem Cells on Breast Tumor Cell Growth.

    PubMed

    Zheng, Huilin; Zou, Weibin; Shen, Jiaying; Xu, Liang; Wang, Shu; Fu, Yang-Xin; Fan, Weimin

    2016-09-01

    : Mesenchymal stem cells (MSCs) usually promote tumor growth and metastasis. By using a breast tumor 4T1 cell-based animal model, this study determined that coinjection and distant injection of allogeneic bone marrow-derived MSCs with tumor cells could exert different effects on tumor growth. Whereas the coinjection of MSCs with 4T1 cells promoted tumor growth, surprisingly, the injection of MSCs at a site distant from the 4T1 cell inoculation site suppressed tumor growth. We further observed that, in the distant injection model, MSCs decreased the accumulation of myeloid-derived suppressor cells and regulatory T cells in tumor tissues by enhancing proinflammatory factors such as interferon-γ, tumor necrosis factor-α, Toll-like receptor (TLR)-3, and TLR-4, promoting host antitumor immunity and inhibiting tumor growth. Unlike previous reports, this is the first study reporting that MSCs may exert opposite roles on tumor growth in the same animal model by modulating the host immune system, which may shed light on the potential application of MSCs as vehicles for tumor therapy and other clinical applications. Mesenchymal stem cells (MSCs) have been widely investigated for their potential roles in tissue engineering, autoimmune diseases, and tumor therapeutics. This study explored the impact of coinjection and distant injection of allogeneic bone marrow-derived MSCs on mouse 4T1 breast cancer cells. The results showed that the coinjection of MSCs and 4T1 cells promoted tumor growth. MSCs might act as the tumor stromal precursors and cause immunosuppression to protect tumor cells from immunosurveillance, which subsequently facilitated tumor metastasis. Interestingly, the distant injection of MSCs and 4T1 cells suppressed tumor growth. Together, the results of this study revealed the dual functions of MSCs in immunoregulation. ©AlphaMed Press.

  15. Stem Cells as a Tool for Breast Imaging

    PubMed Central

    Padín-Iruegas, Maria Elena; López López, Rafael

    2012-01-01

    Stem cells are a scientific field of interest due to their therapeutic potential. There are different groups, depending on the differentiation state. We can find lonely stem cells, but generally they distribute in niches. Stem cells don't survive forever. They are affected for senescence. Cancer stem cells are best defined functionally, as a subpopulation of tumor cells that can enrich for tumorigenic property and can regenerate heterogeneity of the original tumor. Circulating tumor cells are cells that have detached from a primary tumor and circulate in the bloodstream. They may constitute seeds for subsequent growth of additional tumors (metastasis) in different tissues. Advances in molecular imaging have allowed a deeper understanding of the in vivo behavior of stem cells and have proven to be indispensable in preclinical and clinical studies. One of the first imaging modalities for monitoring pluripotent stem cells in vivo, magnetic resonance imaging (MRI) offers high spatial and temporal resolution to obtain detailed morphological and functional information. Advantages of radioscintigraphic techniques include their picomolar sensitivity, good tissue penetration, and translation to clinical applications. Radionuclide imaging is the sole direct labeling technique used thus far in human studies, involving both autologous bone marrow derived and peripheral stem cells. PMID:22848220

  16. Targeting Common but Complex Proteoglycans on Breast Cancer Cells and Stem Cells Using Evolutionary Refined Malaria Proteins

    DTIC Science & Technology

    2014-09-01

    protein VAR2CSA. We have extensive data demonstrating that this protein specifically targets sulfated chondroitin sulfate A proteoglycans present on all... chondroitin sulfate A on circulating tumor cells using a evolutionary refined malaria protein B) National Annual PhD meeting in Oncology, March 26-27...malaria protein VAR2CSA when sulfated on carbon 4 of the CS backbone. We have identified CSPG4 as a major protein in breast cancer cells, but also a

  17. The role of stem cells in aesthetic surgery: fact or fiction?

    PubMed

    McArdle, Adrian; Senarath-Yapa, Kshemendra; Walmsley, Graham G; Hu, Michael; Atashroo, David A; Tevlin, Ruth; Zielins, Elizabeth; Gurtner, Geoffrey C; Wan, Derrick C; Longaker, Michael T

    2014-08-01

    Stem cells are attractive candidates for the development of novel therapies, targeting indications that involve functional restoration of defective tissue. Although most stem cell therapies are new and highly experimental, there are clinics around the world that exploit vulnerable patients with the hope of offering supposed stem cell therapies, many of which operate without credible scientific merit, oversight, or other patient protection. The authors review the potential and the drawbacks of incorporation of stem cells in cosmetic procedures. A review of U.S. Food and Drug Administration-approved indications and ongoing clinical trials with adipose stem cells is provided. Furthermore, a "snapshot" analysis of Web sites using the search terms "stem cell therapy" or "stem cell treatment" or "stem cell facelift" was performed. Despite the protective net cast by regulatory agencies such as the U.S. Food and Drug Administration and professional societies such as the American Society of Plastic Surgeons, the authors are witnessing worrying advertisements for procedures such as stem cell face lifts, stem cell breast augmentations, and even stem cell vaginal rejuvenation. The marketing and promotion of stem cell procedures in aesthetic surgery is not adequately supported by clinical evidence in the majority of cases. Stem cells offer tremendous potential, but the marketplace is saturated with unsubstantiated and sometimes fraudulent claims that may place patients at risk. With plastic surgeons at the forefront of stem cell-based regenerative medicine, it is critically important that they provide an example of a rigorous approach to research, data collection, and advertising of stem cell therapies.

  18. Mesenchymal stem cells expressing interleukin-18 inhibit breast cancer in a mouse model.

    PubMed

    Liu, Xiaoyi; Hu, Jianxia; Li, Yueyun; Cao, Weihong; Wang, Yu; Ma, Zhongliang; Li, Funian

    2018-05-01

    Development of an improved breast cancer therapy has been an elusive goal of cancer gene therapy for a long period of time. Human mesenchymal stem cells derived from umbilical cord (hUMSCs) genetically modified with the interleukin (IL)-18 gene (hUMSCs/IL-18) were previously demonstrated to be able to suppress the proliferation, migration and invasion of breast cancer cells in vitro . In the present study, the effect of hUMSCs/IL-18 on breast cancer in a mouse model was investigated. A total of 128 mice were divided into 2 studies (the early-effect study and the late-effect study), with 4 groups in each, including the PBS-, hUMSC-, hUMSC/vector- and hUMSC/IL-18-treated groups. All treatments were injected along with 200 µl PBS. Following therapy, the tumor size, histological examination, and expression of lymphocytes, Ki-67, cluster of differentiation 31 and cytokines [interleukin (IL)-18, IL-12, interferon (IFN)-γ and TNF-α] in each group were analyzed. Proliferation of cells (assessed by measuring tumor size and Ki-67 expression) and metastasis, (by determining pulmonary and hepatic metastasis) of breast cancer cells in the hUMSC/IL-18 group were significantly decreased compared with all other groups. hUMSCs/IL-18 suppressed tumor cell proliferation by activating immunocytes and immune cytokines, decreasing the proliferation index of proliferation marker protein Ki-67 of tumor cells and inhibiting tumor angiogenesis. Furthermore, hUMSCs/IL-18 were able to induce a more marked and improved therapeutic effect in the tumor sites, particularly in early tumors. The results of the present study indicate that hUMSCs/IL-18 were able to inhibit the proliferation and metastasis of breast cancer cells in vivo , possibly leading to an approach for a novel antitumor therapy in breast cancer.

  19. Exosomal microRNA Signatures in the Diagnosis and Prognosis of Ovarian Cancer

    DTIC Science & Technology

    2013-10-01

    including CLL ,41 breast cancer,42 glioblastoma,43 thyroid papillary carcinoma,44 hepatocellular carcinoma,45 ovarian cancer,46 colon...modify cancer cell gene expression. Extracellular vesicles derived from cancer stem cells were shown to contain pro-angiogenic RNAs able to induce a pre...content differs. Extracellular vesicles from cancer stem cells contained miR29a, miR650, and miR151, all associated with tumor invasion and

  20. Collecting and Storing Tissue and DNA Samples From Patients Undergoing a Donor Stem Cell Transplant

    ClinicalTrials.gov

    2012-11-04

    Breast Cancer; Chronic Myeloproliferative Disorders; Gestational Trophoblastic Tumor; Graft Versus Host Disease; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Myelodysplastic Syndromes; Myelodysplastic/Myeloproliferative Neoplasms; Neuroblastoma; Ovarian Cancer; Testicular Germ Cell Tumor

  1. Aprepitant, Granisetron, & Dexamethasone in Preventing Nausea & Vomiting in Pts. Receiving Cyclophosphamide Before a Stem Cell Transplant

    ClinicalTrials.gov

    2016-02-12

    Breast Cancer; Chronic Myeloproliferative Disorders; Gestational Trophoblastic Tumor; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Myelodysplastic Syndromes; Myelodysplastic/Myeloproliferative Neoplasms; Nausea and Vomiting; Neuroblastoma; Ovarian Cancer; Testicular Germ Cell Tumor

  2. Study of the Emotional Needs of Caregivers of Stem Cell Transplantation Patients

    ClinicalTrials.gov

    2010-09-17

    Breast Cancer; Chronic Myeloproliferative Disorders; Gestational Trophoblastic Tumor; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Myelodysplastic Syndromes; Myelodysplastic/Myeloproliferative Diseases; Neuroblastoma; Ovarian Cancer; Psychosocial Effects of Cancer and Its Treatment; Testicular Germ Cell Tumor

  3. Dietary compound isoliquiritigenin prevents mammary carcinogenesis by inhibiting breast cancer stem cells through WIF1 demethylation.

    PubMed

    Wang, Neng; Wang, Zhiyu; Wang, Yu; Xie, Xiaoming; Shen, Jiangang; Peng, Cheng; You, Jieshu; Peng, Fu; Tang, Hailin; Guan, Xinyuan; Chen, Jianping

    2015-01-01

    Breast cancer stem cells (CSCs) are considered as the root of mammary tumorigenesis. Previous studies have demonstrated that ISL efficiently limited the activities of breast CSCs. However, the cancer prevention activities of ISL and its precise molecular mechanisms remain largely unknown. Here, we report a novel function of ISL as a natural demethylation agent targeting WIF1 to prevent breast cancer. ISL administration suppressed in vivo breast cancer initiation and progression, accompanied by reduced CSC-like populations. A global gene expression profile assay further identified WIF1 as the main response gene of ISL treatment, accompanied by the simultaneous downregulation of β-catenin signaling and G0/G1 phase arrest in breast CSCs. In addition, WIF1 inhibition significantly relieved the CSC-limiting effects of ISL and methylation analysis further revealed that ISL enhanced WIF1 gene expression via promoting the demethylation of its promoter, which was closely correlated with the inhibition of DNMT1 methyltransferase. Molecular docking analysis finally revealed that ISL could stably dock into the catalytic domain of DNMT1. Taken together, our findings not only provide preclinical evidence to demonstrate the use of ISL as a dietary supplement to inhibit mammary carcinogenesis but also shed novel light on WIF1 as an epigenetic target for breast cancer prevention.

  4. Fluorescent CSC models evidence that targeted nanomedicines improve treatment sensitivity of breast and colon cancer stem cells.

    PubMed

    Gener, Petra; Gouveia, Luis Pleno; Sabat, Guillem Romero; de Sousa Rafael, Diana Fernandes; Fort, Núria Bergadà; Arranja, Alexandra; Fernández, Yolanda; Prieto, Rafael Miñana; Ortega, Joan Sayos; Arango, Diego; Abasolo, Ibane; Videira, Mafalda; Schwartz, Simo

    2015-11-01

    To be able to study the efficacy of targeted nanomedicines in marginal population of highly aggressive cancer stem cells (CSC), we have developed a novel in vitro fluorescent CSC model that allows us to visualize these cells in heterogeneous population and to monitor CSC biological performance after therapy. In this model tdTomato reporter gene is driven by CSC specific (ALDH1A1) promoter and contrary to other similar models, CSC differentiation and un-differentiation processes are not restrained and longitudinal studies are feasible. We used this model for preclinical validation of poly[(d,l-lactide-co-glycolide)-co-PEG] (PLGA-co-PEG) micelles loaded with paclitaxel. Further, active targeting against CD44 and EGFR receptors was validated in breast and colon cancer cell lines. Accordingly, specific active targeting toward surface receptors enhances the performance of nanomedicines and sensitizes CSC to paclitaxel based chemotherapy. Many current cancer therapies fail because of the failure to target cancer stem cells. This surviving population soon proliferates and differentiates into more cancer cells. In this interesting article, the authors designed an in vitro cancer stem cell model to study the effects of active targeting using antibody-labeled micelles containing chemotherapeutic agent. This new model should allow future testing of various drug/carrier platforms before the clinical phase. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Dissecting tumor metabolic heterogeneity: Telomerase and large cell size metabolically define a sub-population of stem-like, mitochondrial-rich, cancer cells

    PubMed Central

    Lamb, Rebecca; Ozsvari, Bela; Bonuccelli, Gloria; Smith, Duncan L.; Pestell, Richard G.; Martinez-Outschoorn, Ubaldo E.; Clarke, Robert B.; Sotgia, Federica; Lisanti, Michael P.

    2015-01-01

    Tumor cell metabolic heterogeneity is thought to contribute to tumor recurrence, distant metastasis and chemo-resistance in cancer patients, driving poor clinical outcome. To better understand tumor metabolic heterogeneity, here we used the MCF7 breast cancer line as a model system to metabolically fractionate a cancer cell population. First, MCF7 cells were stably transfected with an hTERT-promoter construct driving GFP expression, as a surrogate marker of telomerase transcriptional activity. To enrich for immortal stem-like cancer cells, MCF7 cells expressing the highest levels of GFP (top 5%) were then isolated by FACS analysis. Notably, hTERT-GFP(+) MCF7 cells were significantly more efficient at forming mammospheres (i.e., stem cell activity) and showed increased mitochondrial mass and mitochondrial functional activity, all relative to hTERT-GFP(−) cells. Unbiased proteomics analysis of hTERT-GFP(+) MCF7 cells directly demonstrated the over-expression of 33 key mitochondrial proteins, 17 glycolytic enzymes, 34 ribosome-related proteins and 17 EMT markers, consistent with an anabolic cancer stem-like phenotype. Interestingly, MT-CO2 (cytochrome c oxidase subunit 2; Complex IV) expression was increased by >20-fold. As MT-CO2 is encoded by mt-DNA, this finding is indicative of increased mitochondrial biogenesis in hTERT-GFP(+) MCF7 cells. Importantly, most of these candidate biomarkers were transcriptionally over-expressed in human breast cancer epithelial cells in vivo. Similar results were obtained using cell size (forward/side scatter) to fractionate MCF7 cells. Larger stem-like cells also showed increased hTERT-GFP levels, as well as increased mitochondrial mass and function. Thus, this simple and rapid approach for the enrichment of immortal anabolic stem-like cancer cells will allow us and others to develop new prognostic biomarkers and novel anti-cancer therapies, by specifically and selectively targeting this metabolic sub-population of aggressive cancer cells. Based on our proteomics and functional analysis, FDA-approved inhibitors of protein synthesis and/or mitochondrial biogenesis, may represent novel treatment options for targeting these anabolic stem-like cancer cells. PMID:26323205

  6. Targeting of CD151 in Breast Cancer and in Breast Cancer Stem Cells

    DTIC Science & Technology

    2007-04-01

    motility in several cancer types (e.g.16). Removal of CD151, either by antisense, siRNA-knockdown or knockout, may affect PI3K, Akt , and Rac1...hemidesmosome intermediate filaments) promotes mammary tumor cell motility and invasion by activating the phosphoinositide 3-kinase (PI3K)/ AKT pathway or...mammary tumor progression31 (Fig. 4B, lower panels). Rac and Akt signaling pathways exert major influence on cell morphology, motility, and

  7. Cadmium exposure inhibits branching morphogenesis and causes alterations consistent with HIF-1α inhibition in human primary breast organoids.

    PubMed

    Rocco, Sabrina A; Koneva, Lada; Middleton, Lauren Y M; Thong, Tasha; Solanki, Sumeet; Karram, Sarah; Nambunmee, Kowit; Harris, Craig; Rozek, Laura S; Sartor, Maureen A; Shah, Yatrik M; Colacino, Justin A

    2018-05-07

    Developmental cadmium exposure in vivo disrupts mammary gland differentiation, while exposure of breast cell lines to cadmium causes invasion consistent with the epithelial-mesenchymal transition (EMT). The effects of cadmium on normal human breast stem cells have not been measured. Here, we quantified the effects of cadmium exposure on reduction mammoplasty patient-derived breast stem cell proliferation and differentiation. Using the mammosphere assay and organoid formation in 3D hydrogels, we tested two physiologically relevant doses of cadmium, 0.25μM and 2.5μM, and tested for molecular alterations using RNA-seq. We functionally validated our RNA-seq findings with a HIF-1α activity reporter line and pharmaceutical inhibition of HIF-1α in organoid formation assays. 2.5μM cadmium reduced primary mammosphere formation and branching structure organoid formation rates by 33% and 87%, respectively. Despite no changes in mammosphere formation, 0.25μM cadmium inhibited branching organoid formation in hydrogels by 73%. RNA-seq revealed cadmium downregulated genes associated with extracellular matrix formation and EMT, while upregulating genes associated with metal response including metallothioneins and zinc transporters. In the RNA-seq data, cadmium downregulated HIF-1α target genes including LOXL2, ZEB1, and VIM. Cadmium significantly inhibited HIF-1α activity in a luciferase assay, and the HIF-1α inhibitor acriflavine ablated mammosphere and organoid formation. These findings show that cadmium, at doses relevant to human exposure, inhibited human mammary stem cell proliferation and differentiation, potentially through disruption of HIF-1α activity.

  8. Neural Stem Cells Secreting Anti-HER2 Antibody Improve Survival in a Preclinical Model of HER2 Overexpressing Breast Cancer Brain Metastases.

    PubMed

    Kanojia, Deepak; Balyasnikova, Irina V; Morshed, Ramin A; Frank, Richard T; Yu, Dou; Zhang, Lingjiao; Spencer, Drew A; Kim, Julius W; Han, Yu; Yu, Dihua; Ahmed, Atique U; Aboody, Karen S; Lesniak, Maciej S

    2015-10-01

    The treatment of human epidermal growth factor receptor 2 (HER2)-overexpressing breast cancer has been revolutionized by trastuzumab. However, longer survival of these patients now predisposes them to forming HER2 positive brain metastases, as the therapeutic antibodies cannot cross the blood brain barrier. The current oncologic repertoire does not offer a rational, nontoxic targeted therapy for brain metastases. In this study, we used an established human neural stem cell line, HB1.F3 NSCs and generated a stable pool of cells secreting a high amount of functional full-length anti-HER2 antibody, equivalent to trastuzumab. Anti-HER2Ab secreted by the NSCs (HER2Ab-NSCs) specifically binds to HER2 overexpressing human breast cancer cells and inhibits PI3K-Akt signaling. This translates to HER2Ab-NSC inhibition of breast cancer cell growth in vitro. Preclinical in vivo experiments using HER2Ab overexpressing NSCs in a breast cancer brain metastases (BCBM) mouse model demonstrate that intracranial injection of HER2Ab-NSCs significantly improves survival. In effect, these NSCs provide tumor localized production of HER2Ab, minimizing any potential off-target side effects. Our results establish HER2Ab-NSCs as a novel, nontoxic, and rational therapeutic approach for the successful treatment of HER2 overexpressing BCBM, which now warrants further preclinical and clinical investigation. © 2015 AlphaMed Press.

  9. Targeting Cell Polarity Machinery to Exhaust Breast Cancer Stem Cells

    DTIC Science & Technology

    2017-10-01

    resemble normal stem cells, specifically in the ability to infinitely give rise to the bulk of a tumor as the “seed” of the cancer, account for cancer...infinitely give rise to the bulk of a tumor as the “seed” of the cancer, account for cancer initiation, progression, recurrence, and chemo...cell population that can infinitely give rise to the bulk of a tumor as the “seed” of the cancer, account for cancer initiation, progression, radio

  10. Elimination of epithelial-like and mesenchymal-like breast cancer stem cells to inhibit metastasis following nanoparticle-mediated photothermal therapy.

    PubMed

    Paholak, Hayley J; Stevers, Nicholas O; Chen, Hongwei; Burnett, Joseph P; He, Miao; Korkaya, Hasan; McDermott, Sean P; Deol, Yadwinder; Clouthier, Shawn G; Luther, Tahra; Li, Qiao; Wicha, Max S; Sun, Duxin

    2016-10-01

    Increasing evidence suggesting breast cancer stem cells (BCSCs) drive metastasis and evade traditional therapies underscores a critical need to exploit the untapped potential of nanotechnology to develop innovative therapies that will significantly improve patient survival. Photothermal therapy (PTT) to induce localized hyperthermia is one of few nanoparticle-based treatments to enter clinical trials in human cancer patients, and has recently gained attention for its ability to induce a systemic immune response targeting distal cancer cells in mouse models. Here, we first conduct classic cancer stem cell (CSC) assays, both in vitro and in immune-compromised mice, to demonstrate that PTT mediated by highly crystallized iron oxide nanoparticles effectively eliminates BCSCs in translational models of triple negative breast cancer. PTT in vitro preferentially targets epithelial-like ALDH + BCSCs, followed by mesenchymal-like CD44+/CD24- BCSCs, compared to bulk cancer cells. PTT inhibits BCSC self-renewal through reduction of mammosphere formation in primary and secondary generations. Secondary implantation in NOD/SCID mice reveals the ability of PTT to impede BCSC-driven tumor formation. Next, we explore the translational potential of PTT using metastatic and immune-competent mouse models. PTT to inhibit BCSCs significantly reduces metastasis to the lung and lymph nodes. In immune-competent BALB/c mice, PTT effectively eliminates ALDH + BCSCs. These results suggest the feasibility of incorporating PTT into standard clinical treatments such as surgery to enhance BCSC destruction and inhibit metastasis, and the potential of such combination therapy to improve long-term survival in patients with metastatic breast cancer. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Regenerative Stem Cell Therapy for Breast Cancer Bone Metastasis

    DTIC Science & Technology

    2014-09-01

    13. SUPPLEMENTARY NOTES 14. ABSTRACT Bone is the most common site of metastasis for human breast cancer (BCa), which results in significant...to all major bones as in human patients. 15. SUBJECT TERMS Bone metastasis; osteolysis; osteoprotegerin 16. SECURITY CLASSIFICATION OF: 17...metastasis for human breast cancer (BCa), which results in significant morbidity and mortality in patients with advanced disease. A vicious cycle

  12. Combining targeted drugs to overcome and prevent resistance of solid cancers with some stem-like cell features

    PubMed Central

    Koivunen, Peppi; Koivunen, Jussi P.

    2014-01-01

    Treatment resistance significantly inhibits the efficiency of targeted cancer therapies in drug-sensitive genotypes. In the current work, we studied mechanisms for rapidly occurring, adaptive resistance in targeted therapy-sensitive lung, breast, and melanoma cancer cell lines. The results show that in ALK translocated lung cancer lines H3122 and H2228, cells with cancer stem-like cell features characterized by high expression of cancer stem cell markers and/or in vivo tumorigenesis can mediate adaptive resistance to oncogene ablative therapy. When pharmacological ablation of ALK oncogene was accompanied with PI3K inhibitor or salinomycin therapy, cancer stem-like cell features were reversed which was accompanied with decreased colony formation. Furthermore, co-targeting was able to block the formation of acquired resistance in H3122 line. The results suggest that cells with cancer stem-like cell features can mediate adaptive resistance to targeted therapies. Since these cells follow the stochastic model, concurrent therapy with an oncogene ablating agent and a stem-like cell-targeting drug is needed for maximal therapeutic efficiency. PMID:25238228

  13. [THE USE AND STORAGE OF STEM CELLS AND CORD BLOOD: FRENCH AND ENGLISH LAW COMPARATIVE APPROACH].

    PubMed

    Madanamoothoo, Allane

    2015-07-01

    Becoming parents is one of the greatest wishes of a lot of couples. When their dreams come true, prior to the birth of the child, parents have to face several points: the choice of the name, place of delivery, breast or bottle feeding, etc. Recently, they have to face the issues of cord blood stem cells. Researchers and cord blood banks are also interested in those cells. In many countries a lot of advertising is made around umbilical cord blood stem cells. In France as in England, the use and preservation of cord blood are regulated by the legislators without necessarily having the same approach. The objective of this paper is to present English and French law approaches' on cord blood stem cells.

  14. High-Dose Chemotherapy With Autologous Hematopoietic Stem-Cell Transplantation in Metastatic Breast Cancer: Overview of Six Randomized Trials

    PubMed Central

    Berry, Donald A.; Ueno, Naoto T.; Johnson, Marcella M.; Lei, Xiudong; Caputo, Jean; Smith, Dori A.; Yancey, Linda J.; Crump, Michael; Stadtmauer, Edward A.; Biron, Pierre; Crown, John P.; Schmid, Peter; Lotz, Jean-Pierre; Rosti, Giovanni; Bregni, Marco; Demirer, Taner

    2011-01-01

    Purpose High doses of effective chemotherapy are compelling if they can be delivered safely. Substantial interest in supporting high-dose chemotherapy with bone marrow or autologous hematopoietic stem-cell transplantation in the 1980s and 1990s led to the initiation of randomized trials to evaluate its effect in the treatment of metastatic breast cancer. Methods We identified six randomized trials in metastatic breast cancer that evaluated high doses of chemotherapy with transplant support versus a control regimen without stem-cell support. We assembled a single database containing individual patient information from these trials. The primary analysis of overall survival was a log-rank test comparing high dose versus control. We also used Cox proportional hazards regression, adjusting for known covariates. We addressed potential treatment differences within subsets of patients. Results The effect of high-dose chemotherapy on overall survival was not statistically different (median, 2.16 v 2.02 years; P = .08). A statistically significant advantage in progression-free survival (median, 0.91 v 0.69 years) did not translate into survival benefit. Subset analyses found little evidence that there are groups of patients who might benefit from high-dose chemotherapy with hematopoietic support. Conclusion Overall survival of patients with metastatic breast cancer in the six randomized trials was not significantly improved by high-dose chemotherapy; any benefit from high doses was small. No identifiable subset of patients seems to benefit from high-dose chemotherapy. PMID:21768454

  15. Diet, Stem Cells, and Breast Cancer Prevention

    DTIC Science & Technology

    2011-01-01

    pepper [39], flavonoids such as hesperetin and naringenin in citrus fruits and tomatoes [40], isoflavones (e.g., GEN, daidzein) from legumes and red...Inhibition of human breast cancer cell proliferation and delay of mammary tumorigenesis by flavonoids and citrus juices. Nutr Cancer 1996;26:167–81. [41...38], capsaicin from chili pepper [39], flavonoids such as hesperetin and naringenin in citrus fruits and tomatoes [40], isoflavones (e.g., GEN

  16. The metastasis suppressor RARRES3 as an endogenous inhibitor of the immunoproteasome expression in breast cancer cells

    NASA Astrophysics Data System (ADS)

    Anderson, Alison M.; Kalimutho, Murugan; Harten, Sarah; Nanayakkara, Devathri M.; Khanna, Kum Kum; Ragan, Mark A.

    2017-01-01

    In breast cancer metastasis, the dynamic continuum involving pro- and anti-inflammatory regulators can become compromised. Over 600 genes have been implicated in metastasis to bone, lung or brain but how these genes might contribute to perturbation of immune function is poorly understood. To gain insight, we adopted a gene co-expression network approach that draws on the functional parallels between naturally occurring bone marrow-derived mesenchymal stem cells (BM-MSCs) and cancer stem cells (CSCs). Our network analyses indicate a key role for metastasis suppressor RARRES3, including potential to regulate the immunoproteasome (IP), a specialized proteasome induced under inflammatory conditions. Knockdown of RARRES3 in near-normal mammary epithelial and breast cancer cell lines increases overall transcript and protein levels of the IP subunits, but not of their constitutively expressed counterparts. RARRES3 mRNA expression is controlled by interferon regulatory factor IRF1, an inducer of the IP, and is sensitive to depletion of the retinoid-related receptor RORA that regulates various physiological processes including immunity through modulation of gene expression. Collectively, these findings identify a novel regulatory role for RARRES3 as an endogenous inhibitor of IP expression, and contribute to our evolving understanding of potential pathways underlying breast cancer driven immune modulation.

  17. Reversal of Multidrug Resistance in Breast Cancer

    DTIC Science & Technology

    1994-08-23

    peripherally derived stem cells (72). Antman and others showed increased numbers of CFU-GM and BFU-E in peripheral blood in the majority of patients treated...original regimen as reported by Antman (45). Peripheral stem cells are not washed before reinfusion and the osmolality of the cell suspension requires the...dosE combination alkylating agents with autologous bone marrow support. A phase I trial. J Clin Oncol 4:646-654, 1986. 63. Eder JP, Antman K, Peters W

  18. Targeting Thromboxane A2 Receptor for Anti-Metastasis Therapy of Breast Cancer

    DTIC Science & Technology

    2011-09-01

    of cell function by Rho GTPases." Drug News Perspect 14(7): 389-95. Erickson, J. W., R. A. Cerione, et al. (1997). "Identification of an actin...Focusing Tumor Microenvironment, Stem Cells and Metastasis 570 (MTOC) and Golgi apparatus to the front of the nucleus, oriented toward the direction of...define the function of TP in tumor cell motility and to validate TP as a target for anti-metastasis therapy of breast cancer. In the first aim, the

  19. Hypoxia-inducible factors regulate pluripotency factor expression by ZNF217- and ALKBH5-mediated modulation of RNA methylation in breast cancer cells.

    PubMed

    Zhang, Chuanzhao; Zhi, Wanqing Iris; Lu, Haiquan; Samanta, Debangshu; Chen, Ivan; Gabrielson, Edward; Semenza, Gregg L

    2016-10-04

    Exposure of breast cancer cells to hypoxia increases the percentage of breast cancer stem cells (BCSCs), which are required for tumor initiation and metastasis, and this response is dependent on the activity of hypoxia-inducible factors (HIFs). We previously reported that exposure of breast cancer cells to hypoxia induces the ALKBH5-mediated demethylation of N6-methyladenosine (m6A) in NANOG mRNA leading to increased expression of NANOG, which is a pluripotency factor that promotes BCSC specification. Here we report that exposure of breast cancer cells to hypoxia also induces ZNF217-dependent inhibition of m6A methylation of mRNAs encoding NANOG and KLF4, which is another pluripotency factor that mediates BCSC specification. Although hypoxia induced the BCSC phenotype in all breast-cancer cell lines analyzed, it did so through variable induction of pluripotency factors and ALKBH5 or ZNF217. However, in every breast cancer line, the hypoxic induction of pluripotency factor and ALKBH5 or ZNF217 expression was HIF-dependent. Immunohistochemistry revealed that expression of HIF-1α and ALKBH5 was concordant in all human breast cancer biopsies analyzed. ALKBH5 knockdown in MDA-MB-231 breast cancer cells significantly decreased metastasis from breast to lungs in immunodeficient mice. Thus, HIFs stimulate pluripotency factor expression and BCSC specification by negative regulation of RNA methylation.

  20. Human bone marrow-derived MSCs can home to orthotopic breast cancer tumors and promote bone metastasis

    PubMed Central

    Goldstein, Robert H; Reagan, Michaela R; Anderson, Kristen; Kaplan, David L; Rosenblatt, Michael

    2010-01-01

    American women have a nearly 25% lifetime risk of developing breast cancer, with 20–40% of these patients developing life-threatening metastases. Over 70% of patients presenting with metastases have skeletal involvement, which signals progression to an incurable stage. Tumor-stroma cell interactions are only superficially understood, specifically regarding the ability of stromal cells to affect metastasis. In vivo models show that exogenously supplied hBMSCs (human bone-marrow derived stem cells) migrate to breast cancer tumors, but no reports have shown endogenous hBMSC migration from the bone to primary tumors. Here we present a model of in vivo hBMSC migration from a physiologic human bone environment to human breast tumors. Further, hBMSCs alter tumor growth and bone metastasis frequency. hBMSCs may home to certain breast tumors based on tumor-derived TGF-β1. Moreover, at the primary tumor IL-17B/IL-17BR signaling may mediate interactions between hBMSCs and breast cancer cells (BCCs). PMID:21159629

  1. High-Dose Chemotherapy, Total-Body Irradiation, and Autologous Stem Cell Transplantation or Bone Marrow Transplantation in Treating Patients With Hematologic Cancer or Solid Tumors

    ClinicalTrials.gov

    2013-05-07

    Breast Cancer; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Testicular Germ Cell Tumor; Unspecified Adult Solid Tumor, Protocol Specific; Unspecified Childhood Solid Tumor, Protocol Specific

  2. Therapeutic Potential, Challenges and Future Perspective of Cancer Stem Cells in Translational Oncology: A Critical Review.

    PubMed

    Shukla, Gaurav; Khera, Harvinder Kour; Srivastava, Amit Kumar; Khare, Piush; Patidar, Rahul; Saxena, Rajiv

    2017-01-01

    Stem cell research is a rapidly developing field that offers effective treatment for a variety of malignant and non-malignant diseases. Stem cell is a regenerative medicine associated with the replacement, repair, and restoration of injured tissue. Stem cell research is a promising field having maximum therapeutic potential. Cancer stem cells (CSCs) are the cells within the tumor that posses capacity of selfrenewal and have a root cause for the failure of traditional therapies leading to re-occurrence of cancer. CSCs have been identified in blood, breast, brain, and colon cancer. Traditional therapies target only fast growing tumor mass, but not slow-dividing cancer stem cells. It has been shown that embryonic pathways such as Wnt, Hedgehog and Notch, control self-renewal capacity and involved in cancer stem cell maintenance. Targeting of these pathways may be effective in eradicating cancer stem cells and preventing chemotherapy and radiotherapy resistance. Targeting CSCs has become one of the most effective approaches to improve the cancer survival by eradicating the main root cause of cancer. The present review will address, in brief, the importance of cancer stem cells in targeting cancer as better and effective treatment along with a concluding outlook on the scope and challenges in the implication of cancer stem cells in translational oncology. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  3. Adipose and mammary epithelial tissue engineering.

    PubMed

    Zhu, Wenting; Nelson, Celeste M

    2013-01-01

    Breast reconstruction is a type of surgery for women who have had a mastectomy, and involves using autologous tissue or prosthetic material to construct a natural-looking breast. Adipose tissue is the major contributor to the volume of the breast, whereas epithelial cells comprise the functional unit of the mammary gland. Adipose-derived stem cells (ASCs) can differentiate into both adipocytes and epithelial cells and can be acquired from autologous sources. ASCs are therefore an attractive candidate for clinical applications to repair or regenerate the breast. Here we review the current state of adipose tissue engineering methods, including the biomaterials used for adipose tissue engineering and the application of these techniques for mammary epithelial tissue engineering. Adipose tissue engineering combined with microfabrication approaches to engineer the epithelium represents a promising avenue to replicate the native structure of the breast.

  4. Adipose and mammary epithelial tissue engineering

    PubMed Central

    Zhu, Wenting; Nelson, Celeste M.

    2013-01-01

    Breast reconstruction is a type of surgery for women who have had a mastectomy, and involves using autologous tissue or prosthetic material to construct a natural-looking breast. Adipose tissue is the major contributor to the volume of the breast, whereas epithelial cells comprise the functional unit of the mammary gland. Adipose-derived stem cells (ASCs) can differentiate into both adipocytes and epithelial cells and can be acquired from autologous sources. ASCs are therefore an attractive candidate for clinical applications to repair or regenerate the breast. Here we review the current state of adipose tissue engineering methods, including the biomaterials used for adipose tissue engineering and the application of these techniques for mammary epithelial tissue engineering. Adipose tissue engineering combined with microfabrication approaches to engineer the epithelium represents a promising avenue to replicate the native structure of the breast. PMID:23628872

  5. Liquid-phase electron microscopy of molecular drug response in breast cancer cells reveals irresponsive cell subpopulations related to lack of HER2 homodimers.

    PubMed

    Peckys, Diana B; Korf, Ulrike; Wiemann, Stefan; de Jonge, Niels

    2017-08-09

    The development of drug resistance in cancer poses a major clinical problem. An example is human epidermal growth factor receptor 2 (HER2) overexpressing breast cancer often treated with anti-HER2 antibody therapies, such as trastuzumab. Since drug resistance is rooted mainly in tumor cell heterogeneity, we examined the drug effect in different subpopulations of SKBR3 breast cancer cells, and compared the results with a drug resistant cell line, HCC1954. Correlative light microscopy and liquid-phase scanning transmission electron microscopy (STEM) were used to quantitatively analyze HER2 responses upon drug binding, whereby many tens of whole cells were imaged. Trastuzumab was found to selectively cross-link and down regulate HER2 homodimers from the plasma membranes of bulk cancer cells. In contrast, HER2 resided mainly as monomers in rare subpopulations of resting- and cancer stem cells (CSCs), and these monomers were not internalized after drug binding. The HER2 distribution was hardly influenced by trastuzumab for the HCC1954 cells. These findings show that resting cells and CSCs are irresponsive to the drug, and thus point towards a molecular explanation behind the origin of drug resistance. This analytical method is broadly applicable to study membrane protein interactions in the intact plasma membrane, while accounting for cell heterogeneity. © 2017 by The American Society for Cell Biology.

  6. Potential therapeutic effect of the secretome from human uterine cervical stem cells against both cancer and stromal cells compared with adipose tissue stem cells.

    PubMed

    Eiró, Noemí; Sendon-Lago, Juan; Seoane, Samuel; Bermúdez, María A; Lamelas, Maria Luz; Garcia-Caballero, Tomás; Schneider, José; Perez-Fernandez, Roman; Vizoso, Francisco J

    2014-11-15

    Evidences indicate that tumor development and progression towards a malignant phenotype depend not only on cancer cells themselves, but are also deeply influenced by tumor stroma reactivity. The present study uses mesenchymal stem cells from normal human uterine cervix (hUCESCs), isolated by the minimally invasive method of routine Pap cervical smear, to study their effect on the three main cell types in a tumor: cancer cells, fibroblasts and macrophages. Administration of hUCESCs-conditioned medium (CM) to a highly invasive breast cancer MDA-MB-231 cell line and to human breast tumors with high cell proliferation rates had the effect of reducing cell proliferation, modifying the cell cycle, inducing apoptosis, and decreasing invasion. In a xenograft mouse tumor model, hUCESCs-CM reduced tumor growth and increased overall survival. In cancer-associated fibroblasts, administration of hUCESCs-CM resulted in reduced cell proliferation, greater apoptosis and decreased invasion. In addition, hUCESCs-CM inhibited and reverted macrophage differentiation. The analysis of hUCESCs-CM (fresh and lyophilized) suggests that a complex paracrine signaling network could be implicated in the anti-tumor potential of hUCESCs. In light of their anti-tumor potential, the easy cell isolation method, and the fact that lyophilization of their CM conserves original properties make hUCESCs good candidates for experimental or clinical applications in anticancer therapy.

  7. Effects of extracellular modulation through hypoxia on the glucose metabolism of human breast cancer stem cells

    NASA Astrophysics Data System (ADS)

    Yustisia, I.; Jusman, S. W. A.; Wanandi, S. I.

    2017-08-01

    Cancer stem cells have been reported to maintain stemness under certain extracellular changes. This study aimed to analyze the effect of extracellular O2 level modulation on the glucose metabolism of human CD24-/CD44+ breast cancer stem cells (BCSCs). The primary BCSCs (CD24-/CD44+ cells) were cultured under hypoxia (1% O2) for 0.5, 4, 6, 24 and 48 hours. After each incubation period, HIF1α, GLUT1 and CA9 expressions, as well as glucose metabolism status, including glucose consumption, lactate production, O2 consumption and extracellular pH (pHe) were analyzed using qRT-PCR, colorimetry, fluorometry, and enzymatic reactions, respectively. Hypoxia caused an increase in HIF1α mRNA expressions and protein levels and shifted the metabolic states to anaerobic glycolysis, as demonstrated by increased glucose consumption and lactate production, as well as decreased O2 consumption and pHe. Furthermore, we demonstrated that GLUT1 and CA9 mRNA expressions simultaneously increased, in line with HIF1α expression. In conclusion, modulation of the extracellular environment of human BCSCs through hypoxia shifedt the metabolic state of BCSCs to anaerobic glycolysis, which might be associated with GLUT1 and CA9 expressions regulated by HIFlα transcription factor.

  8. Novel Approaches to Breast Cancer Prevention and Inhibition of Metastases

    DTIC Science & Technology

    2013-10-01

    allow a functional characterization of human candidate breast cancer genes. The transgenic RNAi library is covering the whole Drosophila genome ...W81XWH-12-1-0093 / Penninger 15. SUBJECT TERMS Genome wide functional genetics, haploid stem cells, Drosophila cancer modeling...With the advent of modern genomics hundreds of candidate genes have been associated with breast cancer both in GWAS studies as well as by cancer genome

  9. Adipose-Derived Stromal Vascular Fraction Differentially Expands Breast Progenitors in Tissue Adjacent to Tumors Compared to Healthy Breast Tissue

    PubMed Central

    Chatterjee, Sumanta; Laliberte, Mike; Blelloch, Sarah; Ratanshi, Imran; Safneck, Janice; Buchel, Ed

    2015-01-01

    Background: Autologous fat grafts supplemented with adipose-derived stromal vascular fraction are used in reconstructive and cosmetic breast procedures. Stromal vascular fraction contains adipose-derived stem cells that are thought to encourage wound healing, tissue regeneration, and graft retention. Although use of stromal vascular fraction has provided exciting perspectives for aesthetic procedures, no studies have yet been conducted to determine whether its cells contribute to breast tissue regeneration. The authors examined the effect of these cells on the expansion of human breast epithelial progenitors. Methods: From patients undergoing reconstructive breast surgery following mastectomies, abdominal fat, matching tissue adjacent to breast tumors, and the contralateral non–tumor-containing breast tissue were obtained. Ex vivo co-cultures using breast epithelial cells and the stromal vascular fraction cells were used to study the expansion potential of breast progenitors. Breast reduction samples were collected as a source of healthy breast cells. Results: The authors observed that progenitors present in healthy breast tissue or contralateral non–tumor-containing breast tissue showed significant and robust expansion in the presence of stromal vascular fraction (5.2- and 4.8-fold, respectively). Whereas the healthy progenitors expanded up to 3-fold without the stromal vascular fraction cells, the expansion of tissue adjacent to breast tumor progenitors required the presence of stromal vascular fraction cells, leading to a 7-fold expansion, which was significantly higher than the expansion of healthy progenitors with stromal vascular fraction. Conclusions: The use of stromal vascular fraction might be more beneficial to reconstructive operations following mastectomies compared with cosmetic corrections of the healthy breast. Future studies are required to examine the potential risk factors associated with its use. CLINICAL QUESTION/LEVEL OF EVIDENCE: Therapeutic, V. PMID:26090768

  10. Luminal Progenitors Restrict Their Lineage Potential during Mammary Gland Development

    PubMed Central

    Rodilla, Veronica; Dasti, Alessandro; Huyghe, Mathilde; Lafkas, Daniel; Laurent, Cécile; Reyal, Fabien; Fre, Silvia

    2015-01-01

    The hierarchical relationships between stem cells and progenitors that guide mammary gland morphogenesis are still poorly defined. While multipotent basal stem cells have been found within the myoepithelial compartment, the in vivo lineage potential of luminal progenitors is unclear. Here we used the expression of the Notch1 receptor, previously implicated in mammary gland development and tumorigenesis, to elucidate the hierarchical organization of mammary stem/progenitor cells by lineage tracing. We found that Notch1 expression identifies multipotent stem cells in the embryonic mammary bud, which progressively restrict their lineage potential during mammary ductal morphogenesis to exclusively generate an ERαneg luminal lineage postnatally. Importantly, our results show that Notch1-labelled cells represent the alveolar progenitors that expand during pregnancy and survive multiple successive involutions. This study reveals that postnatal luminal epithelial cells derive from distinct self-sustained lineages that may represent the cells of origin of different breast cancer subtypes. PMID:25688859

  11. Luminal progenitors restrict their lineage potential during mammary gland development.

    PubMed

    Rodilla, Veronica; Dasti, Alessandro; Huyghe, Mathilde; Lafkas, Daniel; Laurent, Cécile; Reyal, Fabien; Fre, Silvia

    2015-02-01

    The hierarchical relationships between stem cells and progenitors that guide mammary gland morphogenesis are still poorly defined. While multipotent basal stem cells have been found within the myoepithelial compartment, the in vivo lineage potential of luminal progenitors is unclear. Here we used the expression of the Notch1 receptor, previously implicated in mammary gland development and tumorigenesis, to elucidate the hierarchical organization of mammary stem/progenitor cells by lineage tracing. We found that Notch1 expression identifies multipotent stem cells in the embryonic mammary bud, which progressively restrict their lineage potential during mammary ductal morphogenesis to exclusively generate an ERαneg luminal lineage postnatally. Importantly, our results show that Notch1-labelled cells represent the alveolar progenitors that expand during pregnancy and survive multiple successive involutions. This study reveals that postnatal luminal epithelial cells derive from distinct self-sustained lineages that may represent the cells of origin of different breast cancer subtypes.

  12. Defining the steps that lead to cancer: replicative telomere erosion, aneuploidy and an epigenetic maturation arrest of tissue stem cells.

    PubMed

    Stindl, Reinhard

    2008-01-01

    Recently, an influential sequencing study found that more than 1700 genes had non-silent mutations in either a breast or colorectal cancer, out of just 11 breast and 11 colorectal tumor samples. This is not surprising given the fact that genomic instability is the hallmark of cancer cells. The plethora of genomic alterations found in every carcinoma does not obey the 'law of genotype-phenotype correlation', since the same histological subtype of cancer harbors different gene mutations and chromosomal aberrations in every patient. In an attempt to make sense out of the observed genetic and chromosomal chaos in cancer, I propose a cascade model. According to this model, tissue regeneration depends on the proliferation and serial activation of stem cells. Replicative telomere erosion limits the proliferative life span of adult stem cells and results in the Hayflick limit (M1). However, local tissue exhaustion or old age might promote the activation of M1-deficient tissue stem cells. Extended proliferation of these cells leads to telomere-driven chromosomal instability and aneuploidy (abnormal balance of chromosomes and/or chromosome material). Several of the aforementioned steps have been already described in the literature. However, in contrast to common theories, it is proposed here that the genomic damage blocks the epigenetic differentiation switch. As a result of aneuploidy, differentiation-specific genes cannot be activated by modification of methylation patterns. Consequently, the phenotype of cancer tissue is largely determined by the epigenetic maturation arrest of tissue stem cells, which in addition enables a fraction of cancer cells to proliferate, invade and metastasize, as normal adult stem cells do. The new model combines genetic and epigenetic alterations of cancer cells in one causative cascade and offers an explanation for why identical histologic cancer types harbor a confusing variety of chromosomal and gene aberrations. The Viennese Cascade, as presented here, may end the debate on if and how 'tumor-unspecific' aneuploidy leads to cancer.

  13. Inhibition of Bone Marrow-Derived Mesenchymal Stem Cells Homing Towards Triple-Negative Breast Cancer Microenvironment Using an Anti-PDGFRβ Aptamer

    PubMed Central

    Camorani, Simona; Hill, Billy Samuel; Fontanella, Raffaela; Greco, Adelaide; Gramanzini, Matteo; Auletta, Luigi; Gargiulo, Sara; Albanese, Sandra; Lucarelli, Enrico; Cerchia, Laura; Zannetti, Antonella

    2017-01-01

    Bone marrow-derived mesenchymal stem cells (BM-MSCs) are shown to participate in tumor progression by establishing a favorable tumor microenvironment (TME) that promote metastasis through a cytokine networks. However, the mechanism of homing and recruitment of BM-MSCs into tumors and their potential role in malignant tissue progression is poorly understood and controversial. Here we show that BM-MSCs increase aggressiveness of triple-negative breast cancer (TNBC) cell lines evaluated as capability to migrate, invade and acquire stemness markers. Importantly, we demonstrate that the treatment of BM-MSCs with a nuclease-resistant RNA aptamer against platelet-derived growth factor receptor β (PDGFRβ) causes the inhibition of receptor-dependent signaling pathways thus drastically hampering BM-MSC recruitment towards TNBC cell lines and BM-MSCs trans-differentiation into carcinoma-associated fibroblast (CAF)-like cells. Moreover, in vivo molecular imaging analysis demonstrated the aptamer ability to prevent BM-MSCs homing to TNBC xenografts. Collectively, our results indicate the anti-PDGFRβ aptamer as a novel therapeutic tool to interfere with BM-MSCs attraction to TNBC providing the rationale to further explore the aptamer in more complex pre-clinical settings. PMID:28912898

  14. Epidermal growth factor/heat shock protein 27 pathway regulates vasculogenic mimicry activity of breast cancer stem/progenitor cells.

    PubMed

    Lee, Che-Hsin; Wu, Yu-Ting; Hsieh, Hung-Chun; Yu, Yun; Yu, Alice L; Chang, Wen-Wei

    2014-09-01

    Tumor vascularization, which is mainly contributed by angiogenesis and vascularization, is necessary for tumor maintenance and progression. Vasculogenic mimicry (VM), vascular-like channels which are lack of the involvement of endothelial cells, has been observed in aggressive cancers and also involves in tumor vascularization. Breast cancer stem/progenitor cells (BCSCs) have been identified as a subpopulation of breast cancer cells with markers of CD24(-)CD44(+), high aldehyde dehydrogenase activity (ALDH(+)) or could be enriched by mammosphere cultivation. These cells have been proven to be associated with tumor vascularization. Here we investigated the molecular mechanisms in VM activity of BCSCs. By periodic acid-Schiff or hematoxylin-eosin stain, we found that there were VM structures in two xenografted human breast cancer tissues established from CD24(-)CD44(+) or ALDH(+) cells. Only ALDH(+) or mammosphere-forming BCSCs could form tube structures on matrigel-coated surface as similar as microvascular endothelial cells. Inhibition of the phosphorylation of epidermal growth factor receptor (EGFR) by gefitinib or knockdown of EGFR by lentiviral shRNA abolished the in vitro VM activity of BCSCs. By quercetin treatment, a plant flavonoid compound which is known to suppress heat shock proteins, or siRNA-mediated gene silencing, both Hsp27 expression and VM capability of BCSCs were suppressed. Forced expression of phosphor-mimic form of Hsp27 in ALDH(+) BCSCs could overcome the inhibitory effect of gefitinib. In conclusion, our data demonstrate that VM activity of BCSCs is mediated by EGF/Hsp27 signaling and targeting this pathway may benefit to breast cancer therapy. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  15. Chemotherapy triggers HIF-1–dependent glutathione synthesis and copper chelation that induces the breast cancer stem cell phenotype

    PubMed Central

    Lu, Haiquan; Samanta, Debangshu; Xiang, Lisha; Zhang, Huimin; Hu, Hongxia; Chen, Ivan; Bullen, John W.; Semenza, Gregg L.

    2015-01-01

    Triple negative breast cancer (TNBC) accounts for 10–15% of all breast cancer but is responsible for a disproportionate share of morbidity and mortality because of its aggressive characteristics and lack of targeted therapies. Chemotherapy induces enrichment of breast cancer stem cells (BCSCs), which are responsible for tumor recurrence and metastasis. Here, we demonstrate that chemotherapy induces the expression of the cystine transporter xCT and the regulatory subunit of glutamate-cysteine ligase (GCLM) in a hypoxia-inducible factor (HIF)-1–dependent manner, leading to increased intracellular glutathione levels, which inhibit mitogen-activated protein kinase kinase (MEK) activity through copper chelation. Loss of MEK-ERK signaling causes FoxO3 nuclear translocation and transcriptional activation of the gene encoding the pluripotency factor Nanog, which is required for enrichment of BCSCs. Inhibition of xCT, GCLM, FoxO3, or Nanog blocks chemotherapy-induced enrichment of BCSCs and impairs tumor initiation. These results suggest that, in combination with chemotherapy, targeting BCSCs by inhibiting HIF-1–regulated glutathione synthesis may improve outcome in TNBC. PMID:26229077

  16. In Vivo Role of Six1 in Mammary Gland Tumorigenesis

    DTIC Science & Technology

    2009-04-01

    K.E., and Pirisi, L. 2008. Gene expression changes during HPV -mediated carcinogenesis: a comparison between an in vitro cell model and cervical ...cofactors in breast cancer initiation and progression. 15. SUBJECT TERMS Six1, PyMT, stem cells , Wnt signaling, epithelial to mesenchymal transitions (EMT...in tumors that overexpress the gene. Overexpression of Six1 is observed in numerous cancers , including breast (3-5), ovarian (6), cervical (7), and

  17. In vitro and in vivo antiproliferative activity of metformin on stem-like cells isolated from spontaneous canine mammary carcinomas: translational implications for human tumors.

    PubMed

    Barbieri, Federica; Thellung, Stefano; Ratto, Alessandra; Carra, Elisa; Marini, Valeria; Fucile, Carmen; Bajetto, Adriana; Pattarozzi, Alessandra; Würth, Roberto; Gatti, Monica; Campanella, Chiara; Vito, Guendalina; Mattioli, Francesca; Pagano, Aldo; Daga, Antonio; Ferrari, Angelo; Florio, Tullio

    2015-04-07

    Cancer stem cells (CSCs) are considered the cell subpopulation responsible for breast cancer (BC) initiation, growth, and relapse. CSCs are identified as self-renewing and tumor-initiating cells, conferring resistance to chemo- and radio-therapy to several neoplasias. Nowadays, th (about 10mM)e pharmacological targeting of CSCs is considered an ineludible therapeutic goal. The antidiabetic drug metformin was reported to suppress in vitro and in vivo CSC survival in different tumors and, in particular, in BC preclinical models. However, few studies are available on primary CSC cultures derived from human postsurgical BC samples, likely because of the limited amount of tissue available after surgery. In this context, comparative oncology is acquiring a relevant role in cancer research, allowing the analysis of larger samples from spontaneous pet tumors that represent optimal models for human cancer. Isolation of primary canine mammary carcinoma (CMC) cells and enrichment in stem-like cell was carried out from fresh tumor specimens by culturing cells in stem-permissive conditions. Phenotypic and functional characterization of CMC-derived stem cells was performed in vitro, by assessment of self-renewal, long-lasting proliferation, marker expression, and drug sensitivity, and in vivo, by tumorigenicity experiments. Corresponding cultures of differentiated CMC cells were used as internal reference. Metformin efficacy on CMC stem cell viability was analyzed both in vitro and in vivo. We identified a subpopulation of CMC cells showing human breast CSC features, including expression of specific markers (i.e. CD44, CXCR4), growth as mammospheres, and tumor-initiation in mice. These cells show resistance to doxorubicin but were highly sensitive to metformin in vitro. Finally, in vivo metformin administration significantly impaired CMC growth in NOD-SCID mice, associated with a significant depletion of CSCs. Similarly to the human counterpart, CMCs contain stem-like subpopulations representing, in a comparative oncology context, a valuable translational model for human BC, and, in particular, to predict the efficacy of antitumor drugs. Moreover, metformin represents a potential CSC-selective drug for BC, as effective (neo-)adjuvant therapy to eradicate CSC in mammary carcinomas of humans and animals.

  18. Aloe-emodin inhibits HER-2 expression through the downregulation of Y-box binding protein-1 in HER-2-overexpressing human breast cancer cells.

    PubMed

    Ma, Jui-Wen; Hung, Chao-Ming; Lin, Ying-Chao; Ho, Chi-Tang; Kao, Jung-Yie; Way, Tzong-Der

    2016-09-13

    Human epidermal growth factor receptor-2 (HER-2)-positive breast cancer tends to be aggressive, highly metastatic, and drug resistant and spreads rapidly. Studies have indicated that emodin inhibits HER-2 expression. This study compared the HER-2-inhibitory effects of two compounds extracted from rhubarb roots: aloe-emodin (AE) and rhein. Our results indicated that AE exerted the most potent inhibitory effect on HER-2 expression. Treatment of HER-2-overexpressing breast cancer cells with AE reduced tumor initiation, cell migration, and cell invasion. AE was able to suppress YB-1 expression, further suppressing downstream HER-2 expression. AE suppressed YB-1 expression through the inhibition of Twist in HER-2-overexpressing breast cancer cells. Our data also found that AE inhibited cancer metastasis and cancer stem cells through the inhibition of EMT. Interestingly, AE suppressed YB-1 expression through the downregulation of the intracellular integrin-linked kinase (ILK)/protein kinase B (Akt)/mTOR signaling pathway in HER-2-overexpressing breast cancer cells. In vivo study showed the positive result of antitumor activity of AE in nude mice injected with human HER-2-overexpressing breast cancer cells. These findings suggest the possible application of AE in the treatment of HER-2-positive breast cancer.

  19. Cargo-free nano-medicine with pH-sensitivity for co-delivery of DOX conjugated prodrug with SN38 to synergistically eradicate breast cancer stem cells.

    PubMed

    Sun, Na; Zhao, Chenyang; Cheng, Rui; Liu, Zerong; Li, Xian; Lu, Axin; Tian, Zhongmin; Yang, Zhe

    2018-06-20

    Due to their abilities of transforming into bulk cancer cells and resistance to radiotherapy and chemotherapy, cancer stem cells (CSCs) are currently considered as a major obstacle for cancer treatment. Application of multiple drugs using nano-carriers is a promising approach to simultaneously eliminate non-cancer stem cells (non-CSCs) and CSCs. Herein, to employ the advantages of nano-medicine while avoiding new excipients, pH-responsive pro-drug (PEG-CH=N-DOX) was employed as the surfactant to fabricate cargo-free nano-medicine for co-delivery of DOX conjugated prodrug with SN38 to synergistically eradicate breast cancer stem cells (bCSCs) and non-bCSCs. Through the intermolecular interaction between DOX and SN38, PEG-CH=N-DOX and SN38 were assembled together to form a stable nano-medicine. This nano-medicine not only dramatically enhanced drug accumulation efficiency at the tumor site, but also effectively eliminated bCSCs and non-bCSCs, which resulted in achieving a superior in vivo tumor inhibition activity. Additionally, the biosafety of this nano-medicine was systematically studied through immunohistochemistry, blood bio-chemistry assay, blood routine examination and metabolomics. The results revealed that this nano-medicine significantly reduced the adverse effects of DOX and SN38. Therefore, this simple yet efficient nano-medicine provided a promising strategy for future clinical applications.

  20. Breast cancer stem cell-like cells generated during TGFβ-induced EMT are radioresistant.

    PubMed

    Konge, Julie; Leteurtre, François; Goislard, Maud; Biard, Denis; Morel-Altmeyer, Sandrine; Vaurijoux, Aurélie; Gruel, Gaetan; Chevillard, Sylvie; Lebeau, Jérôme

    2018-05-04

    Failure of conventional antitumor therapy is commonly associated with cancer stem cells (CSCs), which are often defined as inherently resistant to radiation and chemotherapeutic agents. However, controversy about the mechanisms involved in the radiation response remains and the inherent intrinsic radioresistance of CSCs has also been questioned. These discrepancies observed in the literature are strongly associated with the cell models used. In order to clarify these contradictory observations, we studied the radiosensitivity of breast CSCs using purified CD24 -/low /CD44 + CSCs and their corresponding CD24 + /CD44 low non-stem cells. These cells were generated after induction of the epithelial-mesenchymal transition (EMT) by transforming growth factor β (TGFβ) in immortalized human mammary epithelial cells (HMLE). Consequently, these 2 cellular subpopulations have an identical genetic background, their differences being related exclusively to TGFβ-induced cell reprogramming. We showed that mesenchymal CD24 -/low /CD44 + CSCs are more resistant to radiation compared with CD24 + /CD44 low parental cells. Cell cycle distribution and free radical scavengers, but not DNA repair efficiency, appeared to be intrinsic determinants of cellular radiosensitivity. Finally, for the first time, we showed that reduced radiation-induced activation of the death receptor pathways (FasL, TRAIL and TNF-α) at the transcriptional level was a key causal event in the radioresistance of CD24 -/low / CD44+ cells acquired during EMT.

  1. PDGFRα and β Play Critical Roles in Mediating Foxq1-Driven Breast Cancer Stemness and Chemoresistance

    PubMed Central

    Meng, Fanyan; Speyer, Cecilia L.; Zhang, Bin; Zhao, Yongzhong; Chen, Wei; Gorski, David H.; Miller, Fred R.; Wu, Guojun

    2015-01-01

    Many epithelial—mesenchymal transition (EMT)-promoting transcription factors have been implicated in tumorigenesis and metastasis as well as chemoresistance of cancer. However, the underlying mechanisms mediating these processes are unclear. Here, we report that Foxq1, a forkhead box-containing transcription factor and EMT-inducing gene, promotes stemness traits and chemoresistance in mammary epithelial cells. Using an expression profiling assay, we identified Twist1, Zeb2, and PDGFRα and β as Foxq1 downstream targets. We further show that PDGFRα and β can be directly regulated by Foxq1 or indirectly regulated through the Foxq1/Twist1 axis. Knockdown of both PDGFRα and β results in more significant effects on reversing Foxq1-promoted oncogenesis in vitro and in vivo than knockdown of either PDGFRα or β alone. In addition, PDGFRβ is a more potent mediator of Foxq1-promoted stemness traits than PDGFRα. Finally, pharmacologic inhibition or gene silencing of PDGFRs sensitizes mammary epithelial cells to chemotherapeutic agents in vitro and in vivo. These findings collectively implicate PDGFRs as critical mediators of breast cancer oncogenesis and chemoresistance driven by Foxq1, with potential implications for developing novel therapeutic combinations to treat breast cancer. PMID:25502837

  2. Evaluation of aldehyde dehydrogenase 1 and transcription factors in both primary breast cancer and axillary lymph node metastases as a prognostic factor.

    PubMed

    Ito, Maiko; Shien, Tadahiko; Omori, Masako; Mizoo, Taeko; Iwamoto, Takayuki; Nogami, Tomohiro; Motoki, Takayuki; Taira, Naruto; Doihara, Hiroyoshi; Miyoshi, Shinichiro

    2016-05-01

    Aldehyde dehydrogenase 1 (ALDH1) is a marker of breast cancer stem cells, and the expression of ALDH1 may be a prognostic factor of poor clinical outcome. The epithelial-mesenchymal transition may produce cells with stem-cell-like properties promoted by transcription factors. We investigated the expression of ALDH1 and transcription factors in both primary and metastatic lesions, and prognostic value of them in breast cancer patients with axillary lymph node metastasis (ALNM). Forty-seven breast cancer patients with ALNM who underwent surgery at Okayama University Hospital from 2002 to 2008 were enrolled. We retrospectively evaluated the levels of ALDH1 and transcription factors, such as Snail, Slug and Twist, in both primary and metastatic lesions by immunohistochemistry. In primary lesions, the positive rate of ALDH1, Snail, Slug and Twist was 19, 49, 40 and 26%, respectively. In lymph nodes, that of ALDH1, Snail, Slug and Twist was 21, 32, 13 and 23%, respectively. The expression of ALDH1 or transcription factors alone was not significantly associated with a poor prognosis. However, co-expression of ALDH1 and Slug in primary lesions was associated with a shorter DFS (P = 0.009). The evaluation of the co-expression of ALDH1 and transcription factors in primary lesions may be useful in prognosis of node-positive breast cancers.

  3. Current Progresses of Single Cell DNA Sequencing in Breast Cancer Research.

    PubMed

    Liu, Jianlin; Adhav, Ragini; Xu, Xiaoling

    2017-01-01

    Breast cancers display striking genetic and phenotypic diversities. To date, several hypotheses are raised to explain and understand the heterogeneity, including theories for cancer stem cell (CSC) and clonal evolution. According to the CSC theory, the most tumorigenic cells, while maintaining themselves through symmetric division, divide asymmetrically to generate non-CSCs with less tumorigenic and metastatic potential, although they can also dedifferentiate back to CSCs. Clonal evolution theory recapitulates that a tumor initially arises from a single cell, which then undergoes clonal expansion to a population of cancer cells. During tumorigenesis and evolution process, cancer cells undergo different degrees of genetic instability and consequently obtain varied genetic aberrations. Yet the heterogeneity in breast cancers is very complex, poorly understood and subjected to further investigation. In recent years, single cell sequencing (SCS) technology developed rapidly, providing a powerful new way to better understand the heterogeneity, which may lay foundations to some new strategies for breast cancer therapies. In this review, we will summarize development of SCS technologies and recent advances of SCS in breast cancer.

  4. Raising an Antibody Specific to Breast Cancer Subpopulations Using Phage Display on Tissue Sections.

    PubMed

    Larsen, Simon Asbjørn; Meldgaard, Theresa; Fridriksdottir, Agla Jael Rubner; Lykkemark, Simon; Poulsen, Pi Camilla; Overgaard, Laura Falkensteen; Petersen, Helene Bundgaard; Petersen, Ole William; Kristensen, Peter

    2016-01-01

    Primary tumors display a great level of intra-tumor heterogeneity in breast cancer. The current lack of prognostic and predictive biomarkers limits accurate stratification and the ability to predict response to therapy. The aim of the present study was to select recombinant antibody fragments specific against breast cancer subpopulations, aiding the discovery of novel biomarkers. Recombinant antibody fragments were selected by phage display. A novel shadowstick technology enabled the direct selection using tissue sections of antibody fragments specific against small subpopulations of breast cancer cells. Selections were performed against a subpopulation of breast cancer cells expressing CD271+, as these previously have been indicated to be potential breast cancer stem cells. The selected antibody fragments were screened by phage ELISA on both breast cancer and myoepithelial cells. The antibody fragments were validated and evaluated by immunohistochemistry experiments. Our study revealed an antibody fragment, LH8, specific for breast cancer cells. Immunohistochemistry results indicate that this particular antibody fragment binds an antigen that exhibits differential expression in different breast cancer subpopulations. Further studies characterizing this antibody fragment, the subpopulation it binds and the cognate antigen may unearth novel biomarkers of clinical relevance. Copyright© 2016, International Institute of Anticancer Research (Dr. John G. Delinasios), All rights reserved.

  5. CDKL2 promotes epithelial-mesenchymal transition and breast cancer progression

    PubMed Central

    Li, Linna; Liu, Chunping; Amato, Robert J.; Chang, Jeffrey T.; Du, Guangwei; Li, Wenliang

    2014-01-01

    The epithelial–mesenchymal transition (EMT) confers mesenchymal properties on epithelial cells and has been closely associated with the acquisition of aggressive traits by epithelial cancer cells. To identify novel regulators of EMT, we carried out cDNA screens that covered 500 human kinases. Subsequent characterization of candidate kinases led us to uncover cyclin-dependent kinase-like 2 (CDKL2) as a novel potent promoter for EMT and breast cancer progression. CDKL2-expressing human mammary gland epithelial cells displayed enhanced mesenchymal traits and stem cell-like phenotypes, which was acquired through activating a ZEB1/E-cadherin/β-catenin positive feedback loop and regulating CD44 mRNA alternative splicing to promote conversion of CD24high cells to CD44high cells. Furthermore, CDKL2 enhanced primary tumor formation and metastasis in a breast cancer xenograft model. Notably, CDKL2 is expressed significantly higher in mesenchymal human breast cancer cell lines than in epithelial lines, and its over-expression/amplification in human breast cancers is associated with shorter disease-free survival. Taken together, our study uncovered a major role for CDKL2 in promoting EMT and breast cancer progression. PMID:25333262

  6. Antiproliferative Effect of Synadenium grantii Hook f. stems (Euphorbiaceae) and a Rare Phorbol Diterpene Ester.

    PubMed

    Campos, Adriana; Vendramini-Costa, Débora Barbosa; Longato, Giovanna Barbarini; Zermiani, Tailyn; Ruiz, Ana Lúcia Tasca Gois; de Carvalho, João Ernesto; Pandiella, Atanasio; Cechinel Filho, Valdir

    2016-11-01

    Synadenium grantii is frequently used for the treatment of various diseases such as allergies, gastric disorders, and especially cancer. The aim of this study was to evaluate the possible antiproliferative potential of the methanol extract, fractions, and pure compounds from the stems of S grantii Phytochemical analysis was carried out by conventional chromatographic techniques, and the antiproliferative activity was analyzed using the sulforhodamine B assay and an MTT-based assay. Nonpolar fraction and its subfractions from the stems of S grantii exhibited promising cytostatic effect against several human tumor cell lines (glioma, breast, kidney, and lung), with total grown inhibition values ranging from 0.37 to 2.9 μg/mL. One of the active principles of this plant was identified as a rare phorbol diterpene ester, denoted as 3,4,12,13-tetraacetylphorbol-20-phenylacetate. This compound demonstrated antiproliferative activity against glioma, kidney, lung, and triple-negative breast cancer cell lines. These results demonstrate that S grantii stems produce active principles with relevant antiproliferative potential. © The Author(s) 2016.

  7. Mitochondria as new therapeutic targets for eradicating cancer stem cells: Quantitative proteomics and functional validation via MCT1/2 inhibition.

    PubMed

    Lamb, Rebecca; Harrison, Hannah; Hulit, James; Smith, Duncan L; Lisanti, Michael P; Sotgia, Federica

    2014-11-30

    Here, we used quantitative proteomics analysis to identify novel therapeutic targets in cancer stem cells and/or progenitor cells. For this purpose, mammospheres from two ER-positive breast cancer cell lines (MCF7 and T47D) were grown in suspension using low-attachment plates and directly compared to attached monolayer cells grown in parallel. This allowed us to identify a subset of proteins that were selectively over-expressed in mammospheres, relative to epithelial monolayers. We focused on mitochondrial proteins, as they appeared to be highly upregulated in both MCF7 and T47D mammospheres. Key mitochondrial-related enzymes involved in beta-oxidation and ketone metabolism were significantly upregulated in mammospheres, as well as proteins involved in mitochondrial biogenesis, and specific protein inhibitors of autophagy/mitophagy. Overall, we identified >40 "metabolic targets" that were commonly upregulated in both MCF7 and T47D mammospheres. Most of these "metabolic targets" were also transcriptionally upregulated in human breast cancer cells in vivo, validating their clinical relevance. Based on this analysis, we propose that increased mitochondrial biogenesis and decreased mitochondrial degradation could provide a novel mechanism for the accumulation of mitochondrial mass in cancer stem cells. To functionally validate our observations, we utilized a specific MCT1/2 inhibitor (AR-C155858), which blocks the cellular uptake of two types of mitochondrial fuels, namely ketone bodies and L-lactate. Our results indicate that inhibition of MCT1/2 function effectively reduces mammosphere formation, with an IC-50 of ~1 µM, in both ER-positive and ER-negative breast cancer cell lines. Very similar results were obtained with oligomycin A, an inhibitor of the mitochondrial ATP synthase. Thus, the proliferative clonal expansion of cancer stem cells appears to require oxidative mitochondrial metabolism, related to the re-use of monocarboxylic acids, such as ketones or L-lactate. Our findings have important clinical implications for exploiting mitochondrial metabolism to eradicate cancer stem cells and to prevent recurrence, metastasis and drug resistance in cancer patients. Importantly, a related MCT1/2 inhibitor (AZD3965) is currently in phase I clinical trials in patients with advanced cancers: http://clinicaltrials.gov/show/NCT01791595.

  8. Alemtuzumab and Glucocorticoids in Treating Newly Diagnosed Acute Graft-Versus-Host Disease in Patients Who Have Undergone a Donor Stem Cell Transplant

    ClinicalTrials.gov

    2010-05-12

    Breast Cancer; Chronic Myeloproliferative Disorders; Gestational Trophoblastic Tumor; Graft Versus Host Disease; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Myelodysplastic Syndromes; Myelodysplastic/Myeloproliferative Diseases; Neuroblastoma; Ovarian Cancer; Testicular Germ Cell Tumor

  9. Dimethyl Fumarate Inhibits the Nuclear Factor κB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein.

    PubMed

    Kastrati, Irida; Siklos, Marton I; Calderon-Gierszal, Esther L; El-Shennawy, Lamiaa; Georgieva, Gergana; Thayer, Emily N; Thatcher, Gregory R J; Frasor, Jonna

    2016-02-12

    In breast tumors, activation of the nuclear factor κB (NFκB) pathway promotes survival, migration, invasion, angiogenesis, stem cell-like properties, and resistance to therapy--all phenotypes of aggressive disease where therapy options remain limited. Adding an anti-inflammatory/anti-NFκB agent to breast cancer treatment would be beneficial, but no such drug is approved as either a monotherapy or adjuvant therapy. To address this need, we examined whether dimethyl fumarate (DMF), an anti-inflammatory drug already in clinical use for multiple sclerosis, can inhibit the NFκB pathway. We found that DMF effectively blocks NFκB activity in multiple breast cancer cell lines and abrogates NFκB-dependent mammosphere formation, indicating that DMF has anti-cancer stem cell properties. In addition, DMF inhibits cell proliferation and significantly impairs xenograft tumor growth. Mechanistically, DMF prevents p65 nuclear translocation and attenuates its DNA binding activity but has no effect on upstream proteins in the NFκB pathway. Dimethyl succinate, the inactive analog of DMF that lacks the electrophilic double bond of fumarate, is unable to inhibit NFκB activity. Also, the cell-permeable thiol N-acetyl l-cysteine, reverses DMF inhibition of the NFκB pathway, supporting the notion that the electrophile, DMF, acts via covalent modification. To determine whether DMF interacts directly with p65, we synthesized and used a novel chemical probe of DMF by incorporating an alkyne functionality and found that DMF covalently modifies p65, with cysteine 38 being essential for the activity of DMF. These results establish DMF as an NFκB inhibitor with anti-tumor activity that may add therapeutic value in the treatment of aggressive breast cancers. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Clinically relevant morphological structures in breast cancer represent transcriptionally distinct tumor cell populations with varied degrees of epithelial-mesenchymal transition and CD44+CD24- stemness

    PubMed Central

    Denisov, Evgeny V.; Skryabin, Nikolay A.; Gerashchenko, Tatiana S.; Tashireva, Lubov A.; Wilhelm, Jochen; Buldakov, Mikhail A.; Sleptcov, Aleksei A.; Lebedev, Igor N.; Vtorushin, Sergey V.; Zavyalova, Marina V.; Cherdyntseva, Nadezhda V.; Perelmuter, Vladimir M.

    2017-01-01

    Intratumor morphological heterogeneity in breast cancer is represented by different morphological structures (tubular, alveolar, solid, trabecular, and discrete) and contributes to poor prognosis; however, the mechanisms involved remain unclear. In this study, we performed 3D imaging, laser microdissection-assisted array comparative genomic hybridization and gene expression microarray analysis of different morphological structures and examined their association with the standard immunohistochemistry scorings and CD44+CD24- cancer stem cells. We found that the intratumor morphological heterogeneity is not associated with chromosomal aberrations. By contrast, morphological structures were characterized by specific gene expression profiles and signaling pathways and significantly differed in progesterone receptor and Ki-67 expression. Most importantly, we observed significant differences between structures in the number of expressed genes of the epithelial and mesenchymal phenotypes and the association with cancer invasion pathways. Tubular (tube-shaped) and alveolar (spheroid-shaped) structures were transcriptionally similar and demonstrated co-expression of epithelial and mesenchymal markers. Solid (large shapeless) structures retained epithelial features but demonstrated an increase in mesenchymal traits and collective cell migration hallmarks. Mesenchymal genes and cancer invasion pathways, as well as Ki-67 expression, were enriched in trabecular (one/two rows of tumor cells) and discrete groups (single cells and/or arrangements of 2-5 cells). Surprisingly, the number of CD44+CD24- cells was found to be the lowest in discrete groups and the highest in alveolar and solid structures. Overall, our findings indicate the association of intratumor morphological heterogeneity in breast cancer with the epithelial-mesenchymal transition and CD44+CD24- stemness and the appeal of this heterogeneity as a model for the study of cancer invasion. PMID:28977854

  11. Role of Breast Cancer Resistance Protein (BCRP/ABCG2) in Cancer Drug Resistance

    PubMed Central

    Natarajan, Karthika; Xie, Yi; Baer, Maria R.; Ross, Douglas D.

    2012-01-01

    Since cloning of the ATP-binding cassette (ABC) family member breast cancer resistance protein (BCRP/ABCG2) and its characterization as a multidrug resistance efflux transporter in 1998, BCRP has been the subject of more than two thousand scholarly articles. In normal tissues, BCRP functions as a defense mechanism against toxins and xenobiotics, with expression in the gut, bile canaliculi, placenta, blood-testis and blood-brain barriers facilitating excretion and limiting absorption of potentially toxic substrate molecules, including many cancer chemotherapeutic drugs. BCRP also plays a key role in heme and folate homeostasis, which may help normal cells survive under conditions of hypoxia. BCRP expression appears to be a characteristic of certain normal tissue stem cells termed “side population cells,” which are identified on flow cytometric analysis by their ability to exclude Hoechst 33342, a BCRP substrate fluorescent dye. Hence, BCRP expression may contribute to the natural resistance and longevity of these normal stem cells. Malignant tissues can exploit the properties of BCRP to survive hypoxia and to evade exposure to chemotherapeutic drugs. Evidence is mounting that many cancers display subpopulations of stem cells that are responsible for tumor self-renewal. Such stem cells frequently manifest the “side population” phenotype characterized by expression of BCRP and other ABC transporters. Along with other factors, these transporters may contribute to the inherent resistance of these neoplasms and their failure to be cured. PMID:22248732

  12. Phenotypic high-throughput screening elucidates target pathway in breast cancer stem cell-like cells.

    PubMed

    Carmody, Leigh C; Germain, Andrew R; VerPlank, Lynn; Nag, Partha P; Muñoz, Benito; Perez, Jose R; Palmer, Michelle A J

    2012-10-01

    Cancer stem cells (CSCs) are resistant to standard cancer treatments and are likely responsible for cancer recurrence, but few therapies target this subpopulation. Due to the difficulty in propagating CSCs outside of the tumor environment, previous work identified CSC-like cells by inducing human breast epithelial cells into an epithelial-to-mesenchymal transdifferentiated state (HMLE_sh_ECad). A phenotypic screen was conducted against HMLE_sh_ECad with 300 718 compounds from the Molecular Libraries Small Molecule Repository to identify selective inhibitors of CSC growth. The screen yielded 2244 hits that were evaluated for toxicity and selectivity toward an isogenic control cell line. An acyl hydrazone scaffold emerged as a potent and selective scaffold targeting HMLE_sh_ECad. Fifty-three analogues were acquired and tested; compounds ranged in potency from 790 nM to inactive against HMLE_sh_ECad. Of the analogues, ML239 was best-in-class with an IC(50)= 1.18 µM against HMLE_sh_ECad, demonstrated a >23-fold selectivity over the control line, and was toxic to another CSC-like line, HMLE_shTwist, and a breast carcinoma cell line, MDA-MB-231. Gene expression studies conducted with ML239-treated cells showed altered gene expression in the NF-κB pathway in the HMLE_sh_ECad line but not in the isogenic control line. Future studies will be directed toward the identification of ML239 target(s).

  13. Zoledronic acid overcomes chemoresistance by sensitizing cancer stem cells to apoptosis.

    PubMed

    Rouhrazi, H; Turgan, N; Oktem, G

    2018-01-01

    Unlike low tumorigenic bulk tumor cells (non-CSCs), cancer stem cells (CSCs) are a subset of tumor cells that can self-renew and differentiate into different cancer subtypes. CSCs are considered responsible for tumor recurrence, distant metastasis, angiogenesis, and drug or radiation resistance. CSCs also are resistant to apoptosis. Zoledronic acid (ZA) is a third generation bisphosphonate that reduces cell proliferation and exhibits anti-tumor effects by inducing cell death in some malignancies; however, the effects of ZA on CSCs are unclear. We investigated the anti-cancer effects of ZA on two epithelial cancer cell lines, prostate DU-145 and breast MCF7, focusing primarily on induction and activation of apoptosis. Cluster of differentiation (CD) 133 + /CD44 + prostate CSCs and CD 44 + /CD24 breast CSCs were isolated from the DU-145 human prostate cancer and MCF-7 human breast cancer cell lines, respectively, using FACSAria flow cytometry cell sorting. CSCs and non-CSCs were exposed to increasing concentrations of ZA for 24, 48 and 72 h to determine the IC 50 dose. Annexin-V assay for detecting cell death and cell cycle was performed using the Muse™ Cell Analyzer. Prostate CSCs and non-CSCs were assayed by quantitative reverse transcription PCR (qRT-PCR) array for detecting 84 key apoptosis related genes. Gene regulation at the protein level was investigated by immunofluorescence. ZA caused a dose- and time-dependent decrease in cell viability. Treatment with ZA resulted in a concomitant increase in apoptosis and cell cycle arrest at S-phase in CSCs. Significant over/under-expressions were detected in seven of the genes of ZA-treated DU-145 CSCs cells. Expressions of CASP9, CASP4, BAX and BAD genes increased, while the expressions of BIRC3, BIRC2 and BCL2 genes decreased. In the DU-145 non-CSCs, five genes exhibited changes in gene expression after ZA treatment, two exhibited increased expression (CASP7 and BAD) and three exhibited decreased expression (BIRC3, BIRC2 and BCL2). ZA caused cell death of drug resistant breast MCF-7 and prostate DU-145 cancer stem cells by activating apoptosis. ZA can facilitate the intrinsic pathway of apoptosis in human prostate CSCs by down-regulating anti-apoptotic genes and up-regulating pro-apoptotic genes. ZA may be an effective therapeutic agent for targeting chemoresistance in CSCs.

  14. Hsp27 participates in the maintenance of breast cancer stem cells through regulation of epithelial-mesenchymal transition and nuclear factor-κB

    PubMed Central

    2011-01-01

    Introduction Heat shock proteins (HSPs) are normally induced under environmental stress to serve as chaperones for maintenance of correct protein folding but they are often overexpressed in many cancers, including breast cancer. The expression of Hsp27, an ATP-independent small HSP, is associated with cell migration and drug resistance of breast cancer cells. Breast cancer stem cells (BCSCs) have been identified as a subpopulation of breast cancer cells with markers of CD24-CD44+ or high intracellular aldehyde dehydrogenase activity (ALDH+) and proved to be associated with radiation resistance and metastasis. However, the involvement of Hsp27 in the maintenance of BCSC is largely unknown. Methods Mitogen-activated protein kinase antibody array and Western blot were used to discover the expression of Hsp27 and its phosphorylation in ALDH + BCSCs. To study the involvement of Hsp27 in BCSC biology, siRNA mediated gene silencing and quercetin treatment were used to inhibit Hsp27 expression and the characters of BCSCs, which include ALDH+ population, mammosphere formation and cell migration, were analyzed simultaneously. The tumorigenicity of breast cancer cells after knockdown of Hsp27 was analyzed by xenograftment assay in NOD/SCID mice. The epithelial-mesenchymal transition (EMT) of breast cancer cells was analyzed by wound-healing assay and Western blot of snail, vimentin and E-cadherin expression. The activation of nuclear factor kappa B (NF-κB) was analyzed by luciferase-based reporter assay and nuclear translocation. Results Hsp27 and its phosphorylation were increased in ALDH+ BCSCs in comparison with ALDH- non-BCSCs. Knockdown of Hsp27 in breast cancer cells decreased characters of BCSCs, such as ALDH+ population, mammosphere formation and cell migration. In addition, the in vivo CSC frequency could be diminished in Hsp27 knockdown breast cancer cells. The inhibitory effects could also be observed in cells treated with quercetin, a plant flavonoid inhibitor of Hsp27, and it could be reversed by overexpression of Hsp27. Knockdown of Hsp27 also suppressed EMT signatures, such as decreasing the expression of snail and vimentin and increasing the expression of E-cadherin. Furthermore, knockdown of Hsp27 decreased the nuclear translocation as well as the activity of NF-κB in ALDH + BCSCs, which resulted from increasing expression of IκBα. Restored activation of NF-κB by knockdown of IκBα could reverse the inhibitory effect of Hsp27 siRNA in suppression of ALDH+ cells. Conclusions Our data suggest that Hsp27 regulates the EMT process and NF-κB activity to contribute the maintenance of BCSCs. Targeting Hsp27 may be considered as a novel strategy in breast cancer therapy. PMID:22023707

  15. Salinomycin possesses anti-tumor activity and inhibits breast cancer stem-like cells via an apoptosis-independent pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    An, Hyunsook; Kim, Ji Young; Lee, Nahyun

    Cancer stem cells (CSCs) play important roles in the formation, growth and recurrence of tumors, particularly following therapeutic intervention. Salinomycin has received recent attention for its ability to target breast cancer stem cells (BCSCs), but the mechanisms of action involved are not fully understood. In the present study, we sought to investigate the mechanisms responsible for salinomycin's selective targeting of BCSCs and its anti-tumor activity. Salinomycin suppressed cell viability, concomitant with the downregulation of cyclin D1 and increased p27{sup kip1} nuclear accumulation. Mammosphere formation assays revealed that salinomycin suppresses self-renewal of ALDH1-positive BCSCs and downregulates the transcription factors Nanog, Oct4more » and Sox2. TUNEL analysis of MDA-MB-231-derived xenografts revealed that salinomycin administration elicited a significant reduction in tumor growth with a marked downregulation of ALDH1 and CD44 levels, but seemingly without the induction of apoptosis. Our findings shed further light on the mechanisms responsible for salinomycin's effects on BCSCs. - Highlights: • Salinomycin suppresses mammosphere formation. • Salinomycin reduces ALDH1 activity and downregulates Nanog, Oct4 and Sox2. • Salinomycin targets BCSCs via an apoptosis-independent pathway.« less

  16. Ginsenoside Rg1 and platelet-rich fibrin enhance human breast adipose-derived stem cells function for soft tissue regeneration

    PubMed Central

    Li, Hong-Mian; Peng, Qi-Liu; Huang, Min-Hong; Li, De-Quan; Liang, Yi-Dan; Chi, Gang-Yi; Li, De-Hui; Yu, Bing-Chao; Huang, Ji-Rong

    2016-01-01

    Adipose-derived stem cells (ASCs) can be used to repair soft tissue defects, wounds, burns, and scars and to regenerate various damaged tissues. The cell differentiation capacity of ASCs is crucial for engineered adipose tissue regeneration in reconstructive and plastic surgery. We previously reported that ginsenoside Rg1 (G-Rg1 or Rg1) promotes proliferation and differentiation of ASCs in vitro and in vivio. Here we show that both G-Rg1 and platelet-rich fibrin (PRF) improve the proliferation, differentiation, and soft tissue regeneration capacity of human breast adipose-derived stem cells (HBASCs) on collagen type I sponge scaffolds in vitro and in vivo. Three months after transplantation, tissue wet weight, adipocyte number, intracellular lipid, microvessel density, and gene and protein expression of VEGF, HIF-1α, and PPARγ were higher in both G-Rg1- and PRF-treated HBASCs than in control grafts. More extensive new adipose tissue formation was evident after treatment with G-Rg1 or PRF. In summary, G-Rg1 and/or PRF co-administration improves the function of HBASCs for soft tissue regeneration engineering. PMID:27191987

  17. Targeting CXCR1/2 Significantly Reduces Breast Cancer Stem Cell Activity and Increases the Efficacy of Inhibiting HER2 via HER2-dependent and -independent Mechanisms

    PubMed Central

    Singh, Jagdeep K.; Farnie, Gillian; Bundred, Nigel J.; Simões, Bruno M; Shergill, Amrita; Landberg, Göran; Howell, Sacha; Clarke, Robert B.

    2012-01-01

    Purpose Breast cancer stem-like cells (CSCs) are an important therapeutic target as they are predicted to be responsible for tumour initiation, maintenance and metastases. Interleukin-8 (IL-8) is upregulated in breast cancer and associated with poor prognosis. Breast cancer cell line studies indicate that IL-8 via its cognate receptors, CXCR1 and CXCR2, is important in regulating breast CSC activity. We investigated the role of IL-8 in the regulation of CSC activity using patient-derived breast cancers and determined the potential benefit of combining CXCR1/2 inhibition with HER2-targeted therapy. Experimental design CSC activity of metastatic and invasive human breast cancers (n=19) was assessed ex vivo using the mammosphere colony forming assay. Results Metastatic fluid IL-8 level correlated directly with mammosphere formation (r=0.652; P<0.05; n=10). Recombinant IL-8 directly increased mammosphere formation/self-renewal in metastatic and invasive breast cancers (n=17). IL-8 induced activation of EGFR/HER2 and downstream signalling pathways and effects were abrogated by inhibition of SRC, EGFR/HER2, PI3K or MEK. Furthermore, lapatinib inhibited the mammosphere-promoting effect of IL-8 in both HER2-positive and negative patient-derived cancers. CXCR1/2 inhibition also blocked the effect of IL-8 on mammosphere formation and added to the efficacy of lapatinib in HER2-positive cancers. Conclusions These studies establish a role for IL-8 in the regulation of patient-derived breast CSC activity and demonstrate that IL-8/CXCR1/2 signalling is partly mediated via a novel SRC and EGFR/HER2-dependent pathway. Combining CXCR1/2 inhibitors with current HER2-targeted therapies has potential as an effective therapeutic strategy to reduce CSC activity in breast cancer and improve the survival of HER2-positive patients. PMID:23149820

  18. GE132+Natural: Novel promising dietetic supplement with antiproliferative influence on prostate, colon, and breast cancer cells.

    PubMed

    Okic-Djordjevic, I; Trivanovic, D; Krstic, J; Jaukovic, A; Mojsilovic, S; Santibanez, J F; Terzic, M; Vesovic, D; Bugarski, D

    2013-01-01

    Natural products have been investigated for promising new leads in pharmaceutical development. The purpose of this study was to analyze the biological effect of GE132+Natural, a novel supplement consisting of 5 compounds: Resveratrol, Ganoderma lucidum, Sulforaphane, Lycopene and Royal jelly. The antiproliferative activity of GE132+Natural was tested on 3 different human cancer cell lines: MCF7 (breast cancer cells), PC3 (prostate cancer cells), and SW480 (colon cancer cells), as well as on EA.hy 926 (normal human endothelial cell line). In addition, the cytotoxicity of GE132+- Natural on the proliferation of primary human mesenchymal stem cells isolated from dental pulp (DP=MSC), along with its in vitro impact on different peripheral blood parameters, was determined. The results revealed high antiproliferative activity of GE132+Natural on all tested cancer cell lines (PC3, MCF7 and SW480), as well as on the EA.hy 926 endothelial cell line in a dose-dependent manner. However, applied in a wide range of concentrations GE132+Natural did not affect both the proliferation of primary mesenchymal stem cells and the peripheral blood cells counts. The data obtained demonstrated that GE132+Natural is effective in inhibiting cancer cell proliferation, indicating its potential beneficial health effects. In addition, the results pointed that adult mesenchymal stem cells might be valuable as a test system for evaluating the toxicity and efficacy of new medicines or chemicals.

  19. Potential therapeutic effect of the secretome from human uterine cervical stem cells against both cancer and stromal cells compared with adipose tissue stem cells

    PubMed Central

    Seoane, Samuel; Bermúdez, María A.; Lamelas, Maria Luz; Garcia-Caballero, Tomás; Schneider, José; Perez-Fernandez, Roman; Vizoso, Francisco J.

    2014-01-01

    Evidences indicate that tumor development and progression towards a malignant phenotype depend not only on cancer cells themselves, but are also deeply influenced by tumor stroma reactivity. The present study uses mesenchymal stem cells from normal human uterine cervix (hUCESCs), isolated by the minimally invasive method of routine Pap cervical smear, to study their effect on the three main cell types in a tumor: cancer cells, fibroblasts and macrophages. Administration of hUCESCs-conditioned medium (CM) to a highly invasive breast cancer MDA-MB-231 cell line and to human breast tumors with high cell proliferation rates had the effect of reducing cell proliferation, modifying the cell cycle, inducing apoptosis, and decreasing invasion. In a xenograft mouse tumor model, hUCESCs-CM reduced tumor growth and increased overall survival. In cancer-associated fibroblasts, administration of hUCESCs-CM resulted in reduced cell proliferation, greater apoptosis and decreased invasion. In addition, hUCESCs-CM inhibited and reverted macrophage differentiation. The analysis of hUCESCs-CM (fresh and lyophilized) suggests that a complex paracrine signaling network could be implicated in the anti-tumor potential of hUCESCs. In light of their anti-tumor potential, the easy cell isolation method, and the fact that lyophilization of their CM conserves original properties make hUCESCs good candidates for experimental or clinical applications in anticancer therapy. PMID:25296979

  20. Three-Dimensional Mechanical Loading Modulates the Osteogenic Response of Mesenchymal Stem Cells to Tumor-Derived Soluble Signals.

    PubMed

    Lynch, Maureen E; Chiou, Aaron E; Lee, Min Joon; Marcott, Stephen C; Polamraju, Praveen V; Lee, Yeonkyung; Fischbach, Claudia

    2016-08-01

    Dynamic mechanical loading is a strong anabolic signal in the skeleton, increasing osteogenic differentiation of bone marrow-derived mesenchymal stem cells (BM-MSCs) and increasing the bone-forming activity of osteoblasts, but its role in bone metastatic cancer is relatively unknown. In this study, we integrated a hydroxyapatite-containing three-dimensional (3D) scaffold platform with controlled mechanical stimulation to investigate the effects of cyclic compression on the interplay between breast cancer cells and BM-MSCs as it pertains to bone metastasis. BM-MSCs cultured within mineral-containing 3D poly(lactide-co-glycolide) (PLG) scaffolds differentiated into mature osteoblasts, and exposure to tumor-derived soluble factors promoted this process. When BM-MSCs undergoing osteogenic differentiation were exposed to conditioned media collected from mechanically loaded breast cancer cells, their gene expression of osteopontin was increased. This was further enhanced when mechanical compression was simultaneously applied to BM-MSCs, leading to more uniformly deposited osteopontin within scaffold pores. These results suggest that mechanical loading of 3D scaffold-based culture models may be utilized to evaluate the role of physiologically relevant physical cues on bone metastatic breast cancer. Furthermore, our data imply that cyclic mechanical stimuli within the bone microenvironment modulate interactions between tumor cells and BM-MSCs that are relevant to bone metastasis.

  1. Mammary Stem Cells: Premise, Properties, and Perspectives.

    PubMed

    Lloyd-Lewis, Bethan; Harris, Olivia B; Watson, Christine J; Davis, Felicity M

    2017-08-01

    Adult mammary stem cells (MaSCs) drive postnatal organogenesis and remodeling in the mammary gland, and their longevity and potential have important implications for breast cancer. However, despite intense investigation the identity, location, and differentiation potential of MaSCs remain subject to deliberation. The application of genetic lineage-tracing models, combined with quantitative 3D imaging and biophysical methods, has provided new insights into the mammary epithelial hierarchy that challenge classical definitions of MaSC potency and behaviors. We review here recent advances - discussing fundamental unresolved properties of MaSC potency, dynamics, and plasticity - and point to evolving technologies that promise to shed new light on this intractable debate. Elucidation of the physiological mammary differentiation hierarchy is paramount to understanding the complex heterogeneous breast cancer landscape. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Targeting Metabolic Plasticity in Breast Cancer Cells via Mitochondrial Complex I Modulation

    PubMed Central

    Xu, Qijin; Biener-Ramanujan, Eva; Yang, Wei; Ramanujan, V Krishnan

    2016-01-01

    Purpose Heterogeneity commonly observed in clinical tumors stems both from the genetic diversity as well as from the differential metabolic adaptation of multiple cancer types during their struggle to maintain uncontrolled proliferation and invasion in vivo. This study aims to identify a potential metabolic window of such adaptation in aggressive human breast cancer cell lines. Methods With a multidisciplinary approach using high resolution imaging, cell metabolism assays, proteomic profiling and animal models of human tumor xenografts and via clinically-relevant, pharmacological approach for modulating mitochondrial complex I function in human breast cancer cell lines, we report a novel route to target metabolic plasticity in human breast cancer cells. Results By a systematic modulation of mitochondrial function and by mitigating metabolic switch phenotype in aggressive human breast cancer cells, we demonstrate that the resulting metabolic adaptation signatures can predictably decrease tumorigenic potential in vivo. Proteomic profiling of the metabolic adaptation in these cells further revealed novel protein-pathway interactograms highlighting the importance of antioxidant machinery in the observed metabolic adaptation. Conclusions Improved metabolic adaptation potential in aggressive human breast cancer cells contribute to improving mitochondrial function and reducing metabolic switch phenotype –which may be vital for targeting primary tumor growth in vivo. PMID:25677747

  3. Genome-wide effects of MELK-inhibitor in triple-negative breast cancer cells indicate context-dependent response with p53 as a key determinant

    PubMed Central

    Simon, Marisa; Mesmar, Fahmi; Helguero, Luisa

    2017-01-01

    Triple-negative breast cancer (TNBC) is an aggressive, highly recurrent breast cancer subtype, affecting approximately one-fifth of all breast cancer patients. Subpopulations of treatment-resistant cancer stem cells within the tumors are considered to contribute to disease recurrence. A potential druggable target for such cells is the maternal embryonic leucine-zipper kinase (MELK). MELK expression is upregulated in mammary stem cells and in undifferentiated cancers, where it correlates with poor prognosis and potentially mediates treatment resistance. Several MELK inhibitors have been developed, of which one, OTSSP167, is currently in clinical trials. In order to better understand how MELK and its inhibition influence TNBC, we verified its anti-proliferative and apoptotic effects in claudin-low TNBC cell lines MDA-MB-231 and SUM-159 using MTS assays and/or trypan blue viability assays together with analysis of PARP cleavage. Then, using microarrays, we explored which genes were affected by OTSSP167. We demonstrate that different sets of genes are regulated in MDA-MB-231 and SUM-159, but in both cell lines genes involved in cell cycle, mitosis and protein metabolism and folding were regulated. We identified p53 (TP53) as a potential upstream regulator of the regulated genes. Using western blot we found that OTSSP167 downregulates mutant p53 in all tested TNBC cell lines (MDA-MB-231, SUM-159, and BT-549), but upregulates wild-type p53 in the luminal A subtype MCF-7 cell line. We propose that OTSSP167 might have context-dependent or off-target effects, but that one consistent mechanism of action could involve the destabilization of mutant p53. PMID:28235006

  4. Gamma-Secretase Inhibitor RO4929097 and Cediranib Maleate in Treating Patients With Advanced Solid Tumors

    ClinicalTrials.gov

    2014-12-22

    Adult Anaplastic Astrocytoma; Adult Anaplastic Ependymoma; Adult Anaplastic Oligodendroglioma; Adult Brain Stem Glioma; Adult Giant Cell Glioblastoma; Adult Glioblastoma; Adult Gliosarcoma; Adult Mixed Glioma; Adult Solid Neoplasm; Male Breast Carcinoma; Recurrent Adult Brain Neoplasm; Recurrent Breast Carcinoma; Recurrent Colon Carcinoma; Recurrent Melanoma; Recurrent Non-Small Cell Lung Carcinoma; Recurrent Ovarian Carcinoma; Recurrent Ovarian Germ Cell Tumor; Recurrent Pancreatic Carcinoma; Recurrent Rectal Carcinoma; Recurrent Renal Cell Carcinoma; Stage III Pancreatic Cancer; Stage III Renal Cell Cancer; Stage IIIA Colon Cancer; Stage IIIA Non-Small Cell Lung Cancer; Stage IIIA Ovarian Cancer; Stage IIIA Ovarian Germ Cell Tumor; Stage IIIA Rectal Cancer; Stage IIIA Skin Melanoma; Stage IIIB Breast Cancer; Stage IIIB Colon Cancer; Stage IIIB Non-Small Cell Lung Cancer; Stage IIIB Ovarian Cancer; Stage IIIB Ovarian Germ Cell Tumor; Stage IIIB Rectal Cancer; Stage IIIB Skin Melanoma; Stage IIIC Breast Cancer; Stage IIIC Colon Cancer; Stage IIIC Ovarian Cancer; Stage IIIC Ovarian Germ Cell Tumor; Stage IIIC Rectal Cancer; Stage IIIC Skin Melanoma; Stage IV Breast Cancer; Stage IV Non-Small Cell Lung Cancer; Stage IV Ovarian Cancer; Stage IV Ovarian Germ Cell Tumor; Stage IV Pancreatic Cancer; Stage IV Renal Cell Cancer; Stage IV Skin Melanoma; Stage IVA Colon Cancer; Stage IVA Rectal Cancer; Stage IVB Colon Cancer; Stage IVB Rectal Cancer

  5. Cisplatin-induced mesenchymal stromal cells-mediated mechanism contributing to decreased antitumor effect in breast cancer cells.

    PubMed

    Skolekova, Svetlana; Matuskova, Miroslava; Bohac, Martin; Toro, Lenka; Durinikova, Erika; Tyciakova, Silvia; Demkova, Lucia; Gursky, Jan; Kucerova, Lucia

    2016-01-12

    Cells of the tumor microenvironment are recognized as important determinants of the tumor biology. The adjacent non-malignant cells can regulate drug responses of the cancer cells by secreted paracrine factors and direct interactions with tumor cells. Human mesenchymal stromal cells (MSC) actively contribute to tumor microenvironment. Here we focused on their response to chemotherapy as during the treatment these cells become affected. We have shown that the secretory phenotype and behavior of mesenchymal stromal cells influenced by cisplatin differs from the naïve MSC. MSC were more resistant to the concentrations of cisplatin, which was cytotoxic for tumor cells. They did not undergo apoptosis, but a part of MSC population underwent senescence. However, MSC pretreatment with cisplatin led to changes in phosphorylation profiles of many kinases and also increased secretion of IL-6 and IL-8 cytokines. These changes in cytokine and phosphorylation profile of MSC led to increased chemoresistance and stemness of breast cancer cells. Taken together here we suggest that the exposure of the chemoresistant cells in the tumor microenvironment leads to substantial alterations and might lead to promotion of acquired microenvironment-mediated chemoresistance and stemness.

  6. Randomized Trial of Interleukin-2 (IL-2) as Early Consolidation Following Marrow Ablative Therapy with Stem Cell Rescue for Matastatic Breast Cancer

    DTIC Science & Technology

    2007-10-01

    survival, with minimal toxicity. Effectiveness of this approach may correlate with the effective induction of LAK precursor and effector cells, as...and safe after AC+T chemotherapy and is showing a promising effect on breast cancer relapses. This regimen should be further evaluated in high-risk...1337 Diarrhea, hypoglycemia, hypocalcemia , stomatitis, skin irritation (port), nasal congestion, chest pain fatigue, dyspnea S-W 40 T2 N1biv

  7. Regulation of Survival by IKK(epsilon) in Inflammatory Breast Cancer Involves EpCAM

    DTIC Science & Technology

    2013-12-01

    responses and normalizes inflammatory cytokines in murine myeloproliferative neoplasms . Blood 115, 5232-5240 (2010). 28. J. S. Duncan, M. C. Whittle, K...H. Chen, D. Morosini, K. Bell, M. Alimzhanov, S. Ioannidis, P. McCoon, Z. A. Cao, H. Yu, R. Jove, M. Zinda, The JAK2 inhibitor AZD1480 potently...Frank, K. Polyak, The JAK2 /STAT3 signaling pathway is required for growth of CD44CD24 stem cell-like breast cancer cells in human tumors. The Journal

  8. Using 3D Super-Resolution Microscopy to Probe Breast Cancer Stem Cells and Their Microenvironment

    DTIC Science & Technology

    2014-05-01

    cultured on gelatin substrates. This imaging was the first of its kind for breast cancer. We also small controllable microenvironments, in which we can...pyruvate at 37 °C and 5% CO2. Cleaned coverslips were coated with gelatin attachment factor from Invitrogen and incubated at room temperature for 2 hours...or 37C for 30-45 min, and washed with media. The MCF7 cells were dissociated from their culture plate using enzyme-free dissociation buffer from

  9. Optimized dosing schedule based on circadian dynamics of mouse breast cancer stem cells improves the anti-tumor effects of aldehyde dehydrogenase.

    PubMed

    Matsunaga, Naoya; Ogino, Takashi; Hara, Yukinori; Tanaka, Takahiro; Koyanagi, Satoru; Ohdo, Shigehiro

    2018-05-07

    Although malignant phenotypes of triple-negative breast cancer (TNBC) are subject to circadian alterations, the role of cancer stem cells (CSC) in defining this circadian change remains unclear. CSC are often characterized by high aldehyde dehydrogenase (ALDH) activity, which is associated with the malignancy of cancer cells and used for identification and isolation of CSC. Here we show that the popultation of ALDH-positive cells in a mouse 4T1 breast tumor model exhibits pronounced circadian alterations. Alterations in the number of ALDH-positive cells was generated by time-dependent increases and decreases in the expression of Aldh3a1. Importantly, circadian clock genes were rhythmically expressed in ALDH-negative cells, but not in ALDH-positive cells. Circadian expression of Aldh3a1 in ALDH-positive cells was dependent on the time-dependent release of Wingless-type mmtv integration site family 10a (WNT10a) from ALDH-negative cells. Furthermore, anti-tumor and anti-metastatic effects of ALDH inhibitor N,N-diethylaminobenzaldehyde were enhanced by administration at the time of day when ALDH activity was increased in 4T1 tumor cells. Our findings reveal a new role for the circadian clock within the tumor microenvironment in regulating the circadian dynamics of CSC. These results should enable the development of novel therapeutic strategies for treatment of TNBC with ALDH inhibitors. Copyright ©2018, American Association for Cancer Research.

  10. IL6 blockade potentiates the anti-tumor effects of γ-secretase inhibitors in Notch3-expressing breast cancer.

    PubMed

    Wang, Dong; Xu, Jiahui; Liu, Bingjie; He, Xueyan; Zhou, Lei; Hu, Xin; Qiao, Feng; Zhang, Anli; Xu, Xiaojun; Zhang, Huafeng; Wicha, Max S; Zhang, Lixing; Shao, Zhi-Ming; Liu, Suling

    2018-02-01

    Notch pathways have important roles in carcinogenesis including pathways involving the Notch1 and Notch2 oncogenes. Pan-Notch inhibitors, such as gamma secretase inhibitors (GSIs), have been used in the clinical trials, but the outcomes of these trials have been insufficient and have yielded unclear. In the present study, we demonstrated that GSIs, such as MK-0752 and RO4929097, inhibit breast tumor growth, but increase the breast cancer stem cell (BCSC) population in Notch3-expressing breast cancer cells, in a process that is coupled with IL6 induction and is blocked by the IL6R antagonist Tocilizumab (TCZ). IL6 induction results from inhibition of Notch3-Hey2 signaling through MK-0752. Furthermore, HIF1α upregulates Notch3 expression via direct binding to the Notch3 promoter and subsequently downregulates BCSCs by decreasing the IL6 levels in Notch3-expressing breast cancer cells. Utilizing both breast cancer cell line xenografts and patient-derived xenografts (PDX), we showed that the combination of MK-0752 and Tocilizumab significantly decreases BCSCs and inhibits tumor growth and thus might serve as a novel therapeutic strategy for treating women with Notch3-expressing breast cancers.

  11. Overexpression of syndecan-1, MUC-1, and putative stem cell markers in breast cancer leptomeningeal metastasis: a cerebrospinal fluid flow cytometry study.

    PubMed

    Cordone, Iole; Masi, Serena; Summa, Valentina; Carosi, Mariantonia; Vidiri, Antonello; Fabi, Alessandra; Pasquale, Alessia; Conti, Laura; Rosito, Immacolata; Carapella, Carmine Maria; Villani, Veronica; Pace, Andrea

    2017-04-11

    Cancer is a mosaic of tumor cell subpopulations, where only a minority is responsible for disease recurrence and cancer invasiveness. We focused on one of the most aggressive circulating tumor cells (CTCs) which, from the primitive tumor, spreads to the central nervous system (CNS), evaluating the expression of prognostic and putative cancer stem cell markers in breast cancer (BC) leptomeningeal metastasis (LM). Flow cytometry immunophenotypic analysis of cerebrospinal fluid (CSF) samples (4.5 ml) was performed in 13 consecutive cases of BCLM. Syndecan-1 (CD138), MUC-1 (CD227) CD45, CD34, and the putative cancer stem cell markers CD15, CD24, CD44, and CD133 surface expression were evaluated on CSF floating tumor cells. The tumor-associated leukocyte population was also characterized. Despite a low absolute cell number (8 cell/μl, range 1-86), the flow cytometry characterization was successfully conducted in all the samples. Syndecan-1 and MUC-1 overexpression was documented on BC cells in all the samples analyzed; CD44, CD24, CD15, and CD133 in 77%, 75%, 70%, and 45% of cases, respectively. A strong syndecan-1 and MUC-1 expression was also documented by immunohistochemistry on primary breast cancer tissues, performed in four patients. The CSF tumor population was flanked by T lymphocytes, with a different immunophenotype between the CSF and peripheral blood samples (P ≤ 0.02). Flow cytometry can be successfully employed for solid tumor LM characterization even in CSF samples with low cell count. This in vivo study documents that CSF floating BC cells overexpress prognostic and putative cancer stem cell biomarkers related to tumor invasiveness, potentially representing a molecular target for circulating tumor cell detection and LM treatment monitoring, as well as a primary target for innovative treatment strategies. The T lymphocyte infiltration, documented in all CSF samples, suggests a possible involvement of the CNS lymphatic system in both lymphoid and cancer cell migration into and out of the meninges, supporting the extension of a new form of cellular immunotherapy to LM. Due to the small number of cases, validation on large cohorts of patients are warranted to confirm these findings and to evaluate the impact and value of these results for diagnosis and management of LM.

  12. PKCλ/ι signaling-a common node for normal cellular development and breast oncogenesis.

    PubMed

    Paul, Arindam; Paul, Soumen

    2015-01-01

    We recently demonstrated that PKCλ/ι signaling is an important contributor to breast cancer development. Strikingly, PKCλ/ι signaling is also important to balance self-renewal versus differentiation in pluripotent stem cells and is essential for embryonic development. This commentary highlights some key functions of PKCλ/ι signaling that are integral to both normal development and cancer progression.

  13. HIF2α/EFEMP1 cascade mediates hypoxic effects on breast cancer stem cell hierarchy.

    PubMed

    Kwak, Ji-Hye; Lee, Na-Hee; Lee, Hwa-Yong; Hong, In-Sun; Nam, Jeong-Seok

    2016-07-12

    Breast cancer stem cells (BCSCs) have been shown to contribute to tumor growth, metastasis, and recurrence. They are also markedly resistant to conventional cancer treatments, such as chemotherapy and radiation. Recent studies have suggested that hypoxia is one of the prominent micro-environmental factors that increase the self-renewal ability of BCSCs, partially by enhancing CSC phenotypes. Thus, the identification and development of new therapeutic approaches based on targeting the hypoxia-dependent responses in BCSCs is urgent. Through various in vitro studies, we found that hypoxia specifically up-regulates BCSC sphere formation and a subset of CD44+/CD24-/low CSCs. Hypoxia inducible factors 2α (HIF2α) depletion suppressed CSC-like phenotypes and CSC-mediated drug resistance in breast cancer. Furthermore, the stimulatory effects of hypoxia-induced HIF2α on BCSC sphere formation were successfully attenuated by epidermal growth factor-containing fibulin-like extracellular matrix protein 1 (EFEMP1) knockdown. Taken together, these data suggest that HIF2α mediates hypoxia-induced cancer growth/metastasis and that EFEMP1 is a downstream effector of hypoxia-induced HIF2α during breast tumorigenesis.

  14. Constitutive NOTCH3 Signaling Promotes the Growth of Basal Breast Cancers.

    PubMed

    Choy, Lisa; Hagenbeek, Thijs J; Solon, Margaret; French, Dorothy; Finkle, David; Shelton, Amy; Venook, Rayna; Brauer, Matthew J; Siebel, Christian W

    2017-03-15

    Notch ligands signal through one of four receptors on neighboring cells to mediate cell-cell communication and control cell fate, proliferation, and survival. Although aberrant Notch activation has been implicated in numerous malignancies, including breast cancer, the importance of individual receptors in distinct breast cancer subtypes and the mechanisms of receptor activation remain unclear. Using a novel antibody to detect active NOTCH3, we report here that NOTCH3 signals constitutively in a panel of basal breast cancer cell lines and in more than one third of basal tumors. Selective inhibition of individual ligands revealed that this signal does not require canonical ligand induction. A NOTCH3 antagonist antibody inhibited growth of basal lines, whereas a NOTCH3 agonist antibody enhanced the transformed phenotype in vitro and in tumor xenografts. Transcriptomic analyses generated a Notch gene signature that included Notch pathway components, the oncogene c-Myc , and the mammary stem cell regulator Id4 This signature drove clustering of breast cancer cell lines and tumors into the common subtypes and correlated with the basal classification. Our results highlight an unexpected ligand-independent induction mechanism and suggest that constitutive NOTCH3 signaling can drive an oncogenic program in a subset of basal breast cancers. Cancer Res; 77(6); 1439-52. ©2017 AACR . ©2017 American Association for Cancer Research.

  15. The Role of Retinal Determination Gene Network (RDGN) in Hormone Signaling Transduction and Prostate Tumorigenes

    DTIC Science & Technology

    2014-10-01

    McCue P, Lisanti MP, Wang C, Davis RJ, Mardon G, Pestell RG. The Endogenous Cell-Fate Factor Dachshund Restrains Prostate Epithelial Cell Migration via...Loro E, Pestell RG. “Inhibition of Breast Tumor Stem Cells Expansion by the Endogenous Cell Fate Determination Factor Dachshund.” Chapter in Volume

  16. Why are breast cancer stem cells resistant to radiation?

    DTIC Science & Technology

    2013-03-01

    of Human Hsp27 in Rodent Cells: Absence of Compensatory Regulation between Small Heat Shock Proteins. J. Therm. Biol., 21, 365-372, 1996. 69...Corry, P.M., and Lee, Y.J. Comparison of Tumor Growth between Hsp25 and Hsp27 Transfected Murine L929 Cells in Nude Mice. Int. J. Cancer, 72, 871

  17. RNAi as a Routine Route Toward Breast Cancer Therapy

    DTIC Science & Technology

    2014-05-01

    hematopoietic stem/ progenitor cells (HSPCs) and mature cells from the myeloid and lymphoid lineages. Hypomethylated regions (HMRs) associated with...Hematopoietic Cells (A and B) Genome browser tracks depict methylation profiles across a lymphoid (A) and myeloid (B) specific locus in blood cells ...multipotent populations, and two derived, mature cell types from the lymphoid and myeloid lineages, respectively. For comparison, we generated methylomes

  18. Laser direct writing of combinatorial libraries of idealized cellular constructs: Biomedical applications

    NASA Astrophysics Data System (ADS)

    Schiele, Nathan R.; Koppes, Ryan A.; Corr, David T.; Ellison, Karen S.; Thompson, Deanna M.; Ligon, Lee A.; Lippert, Thomas K. M.; Chrisey, Douglas B.

    2009-03-01

    The ability to control cell placement and to produce idealized cellular constructs is essential for understanding and controlling intercellular processes and ultimately for producing engineered tissue replacements. We have utilized a novel intra-cavity variable aperture excimer laser operated at 193 nm to reproducibly direct write mammalian cells with micrometer resolution to form a combinatorial array of idealized cellular constructs. We deposited patterns of human dermal fibroblasts, mouse myoblasts, rat neural stem cells, human breast cancer cells, and bovine pulmonary artery endothelial cells to study aspects of collagen network formation, breast cancer progression, and neural stem cell proliferation, respectively. Mammalian cells were deposited by matrix assisted pulsed laser evaporation direct write from ribbons comprised of a UV transparent quartz coated with either a thin layer of extracellular matrix or triazene as a dynamic release layer using CAD/CAM control. We demonstrate that through optical imaging and incorporation of a machine vision algorithm, specific cells on the ribbon can be laser deposited in spatial coherence with respect to geometrical arrays and existing cells on the receiving substrate. Having the ability to direct write cells into idealized cellular constructs can help to answer many biomedical questions and advance tissue engineering and cancer research.

  19. Breast milk-derived exosomes promote intestinal epithelial cell growth.

    PubMed

    Hock, Alison; Miyake, Hiromu; Li, Bo; Lee, Carol; Ermini, Leonardo; Koike, Yuhki; Chen, Yong; Määttänen, Pekka; Zani, Augusto; Pierro, Agostino

    2017-05-01

    Breast milk administration prevents necrotizing enterocolitis (NEC). However, the mechanism remains unclear. Exosomes are cell-derived vesicles highly present in human milk and regulate intercellular signaling, inflammation, and immune response. We hypothesized that milk-derived exosomes beneficially affect intestinal epithelial cells. Rat milk was collected, and exosomes were isolated using ExoQuick reagent and visualized by Nanoparticle Tracking Analysis. Protein was extracted from encapsulating exosomes, and concentration was measured. 2×10 4 intestinal epithelial cells (IEC-18) were treated for five hours with 0.5-μg/μl exosomes, an equal volume of exosome-free milk, or control solution (PBS). IEC-18 viability was measured using a colorimetric assay (MTT), and gene expression was analyzed by qRT-PCR. Data were compared using one-way ANOVA with Bonferroni post-test. Rat milk was collected, and exosome isolation was confirmed. Compared to control, treatment with exosomes significantly increased IEC viability, proliferation, and stem cell activity (all p<0.05). However, administration of exosome-free milk had less significant effects. Rat milk-derived exosomes promote IEC viability, enhance proliferation, and stimulate intestinal stem cell activity. These findings provide insight into the mechanism of action of breast milk in the intestines. Exosome administration is a promising prevention method for infants at risk of developing NEC when breastfeeding is not tolerated. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Targeting tissue factor as a novel therapeutic oncotarget for eradication of cancer stem cells isolated from tumor cell lines, tumor xenografts and patients of breast, lung and ovarian cancer.

    PubMed

    Hu, Zhiwei; Xu, Jie; Cheng, Jijun; McMichael, Elizabeth; Yu, Lianbo; Carson, William E

    2017-01-03

    Targeting cancer stem cell (CSC) represents a promising therapeutic approach as it can potentially fight cancer at its root. The challenge is to identify a surface therapeutic oncotarget on CSC. Tissue factor (TF) is known as a common yet specific surface target for cancer cells and tumor neovasculature in several solid cancers. However, it is unknown if TF is expressed by CSCs. Here we demonstrate that TF is constitutively expressed on CD133 positive (CD133+) or CD24-CD44+ CSCs isolated from human cancer cell lines, tumor xenografts from mice and breast tumor tissues from patients. TF-targeted agents, i.e., a factor VII (fVII)-conjugated photosensitizer (fVII-PS for targeted photodynamic therapy) and fVII-IgG1Fc (Immunoconjugate or ICON for immunotherapy), can eradicate CSC via the induction of apoptosis and necrosis and via antibody-dependent cellular cytotoxicity and complement-dependent cytotoxicity, respectively. In conclusion, these results demonstrate that TF is a novel surface therapeutic oncotarget for CSC, in addition to cancer cell TF and tumor angiogenic vascular endothelial TF. Moreover, this research highlights that TF-targeting therapeutics can effectively eradicate CSCs, without drug resistance, isolated from breast, lung and ovarian cancer with potential to translate into other most commonly diagnosed solid cancer, in which TF is also highly expressed.

  1. In Utero Influences, Breast Stem Cells, and Breast Cancer Risk Factors

    DTIC Science & Technology

    2011-08-01

    predictor of human breast cancer risk. Our hypothesis is that the in utero levels of mitogens, such as insulin -like growth factor-1 (IGF-1), drive an...by histological assays and in vivo and explant imaging. Histologically, we stained mammary glands from virgin and pregnant C57BL/6J mice using whole...that of a E16 pregnant (right panel); both glands are from 8 week-old mice. Second, we performed preliminary studies to quantitate and validate

  2. Exosomal microRNA Signatures in the Diagnosis and Prognosis of Ovarian Cancer

    DTIC Science & Technology

    2013-04-01

    types, including CLL ,41 breast cancer,42 glioblastoma,43 thyroid papillary carcinoma,44 hepatocellular carcinoma,45 ovarian cancer,46 colon...vesicles derived from cancer stem cells were shown to contain pro-angiogenic RNAs able to induce a pre-metastatic niche in the lungs, whereas those...cancer stem cells contained miR29a, miR650, and miR151, all associated with tumor invasion and metastases, along with miR19b, miR29c, and miR151

  3. Use of a Novel Embryonic Mammary Stem Cell Gene Signature to Improve Human Breast Cancer Diagnostics and Therapeutic Decision Making

    DTIC Science & Technology

    2015-12-01

    and injected as xenografts into immune compromised mice. Tumor growth and metastasis will be evaluated in real time using luminescent imaging. W...subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1. Cancer Cell 17:98–110 34. Gallahan D, Jhappan C, Robinson G... xenograft assays. These properties are clearly independent of stemness measured by transcription profiling, and should not be used as surrogates for

  4. Nanoparticle Delivery of miR-34a Eradicates Long-term-cultured Breast Cancer Stem Cells via Targeting C22ORF28 Directly

    PubMed Central

    Lin, Xiaoti; Chen, Weiyu; Wei, Fengqin; Zhou, Binhua P.; Hung, Mien-Chie; Xie, Xiaoming

    2017-01-01

    Rationale: Cancer stem cells (CSCs) have been implicated as the seeds of therapeutic resistance and metastasis, due to their unique abilities of self-renew, wide differentiation potentials and resistance to most conventional therapies. It is a proactive strategy for cancer therapy to eradicate CSCs. Methods: Tumor tissue-derived breast CSCs (BCSC), including XM322 and XM607, were isolated by fluorescence-activated cell sorting (FACS); while cell line-derived BCSC, including MDA-MB-231.SC and MCF-7.SC, were purified by magnetic-activated cell sorting (MACS). Analyses of microRNA and mRNA expression array profiles were performed in multiple breast cell lines. The mentioned nanoparticles were constructed following the standard molecular cloning protocol. Tissue microarray analysis has been used to study 217 cases of clinical breast cancer specimens. Results: Here, we have successfully established four long-term maintenance BCSC that retain their tumor-initiating biological properties. Our analyses of microarray and qRT-PCR explored that miR-34a is the most pronounced microRNA for investigation of BCSC. We establish hTERT promoter-driven VISA delivery of miR-34a (TV-miR-34a) plasmid that can induce high throughput of miR-34a expression in BCSC. TV-miR-34a significantly inhibited the tumor-initiating properties of long-term-cultured BCSC in vitro and reduced the proliferation of BCSC in vivo by an efficient and safe way. TV-miR-34a synergizes with docetaxel, a standard therapy for invasive breast cancer, to act as a BCSC inhibitor. Further mechanistic investigation indicates that TV-miR-34a directly prevents C22ORF28 accumulation, which abrogates clonogenicity and tumor growth and correlates with low miR-34 and high C22ORF28 levels in breast cancer patients. Conclusion: Taken together, we generated four long-term maintenance BCSC derived from either clinical specimens or cell lines, which would be greatly beneficial to the research progress in breast cancer patients. We further developed the non-viral TV-miR-34a plasmid, which has a great potential to be applied as a clinical application for breast cancer therapy. PMID:29187905

  5. MicroRNA-224 inhibits proliferation and migration of breast cancer cells by down-regulating Fizzled 5 expression.

    PubMed

    Liu, Feng; Liu, Yang; Shen, Jingling; Zhang, Guoqiang; Han, Jiguang

    2016-08-02

    The Wnt/β-catenin signaling is crucial for the proliferation and migration of breast cancer cells. However, the expression of microRNA-224 (miR-224) in the different types of breast cancers and its role in the Wnt/β-catenin signaling and the proliferation and migration of breast cancer cells are poorly understood. In this study, the levels of miR-224 in different types of breast cancer tissues and cell lines were examined by quantitative RT-PCR and the potential targets of miR-224 in the Wnt/β-catenin signaling were investigated. The effects of altered miR-224 expression on the frequency of CD44+CD24- cancer stem-like cells (CSC), proliferation and migration of MCF-7 and MDA-MB-231 cells were examined by flow cytometry, MTT and transwell migration. We found that the levels of miR-224 expression in different types of breast cancer tissues and cell lines were associated inversely with aggressiveness of breast cancers. Enhanced miR-224 expression significantly reduced the fizzled 5-regulated luciferase activity in 293T cells, fizzled 5 expression in MCF-7 and MDA-MB-231 cells, the β-dependent luciferase activity in MCF-7 cells, and the nuclear translocation of β-catenin in MDA-MB-231 cells. miR-224 inhibition significantly increased the percentages of CSC in MCF-7 cells and enhanced proliferation and migration of MCF-7 cells. Enhanced miR-224 expression inhibited proliferation and migration of MDA-MB-231 cells, and the growth of implanted breast cancers in vivo. Induction of Frizzled 5 over-expression mitigated the miR-224-mediated inhibition of breast cancer cell proliferation. Collectively, these data indicated that miR-224 down-regulated the Wnt/β-catenin signaling possibly by binding to Frizzled 5 and inhibited proliferation and migration of breast cancer cells.

  6. Evolution of Cancer Stem-like Cells in Endocrine-Resistant Metastatic Breast Cancers Is Mediated by Stromal Microvesicles.

    PubMed

    Sansone, Pasquale; Berishaj, Marjan; Rajasekhar, Vinagolu K; Ceccarelli, Claudio; Chang, Qing; Strillacci, Antonio; Savini, Claudia; Shapiro, Lauren; Bowman, Robert L; Mastroleo, Chiara; De Carolis, Sabrina; Daly, Laura; Benito-Martin, Alberto; Perna, Fabiana; Fabbri, Nicola; Healey, John H; Spisni, Enzo; Cricca, Monica; Lyden, David; Bonafé, Massimiliano; Bromberg, Jacqueline

    2017-04-15

    The hypothesis that microvesicle-mediated miRNA transfer converts noncancer stem cells into cancer stem cells (CSC) leading to therapy resistance remains poorly investigated. Here we provide direct evidence supporting this hypothesis, by demonstrating how microvesicles derived from cancer-associated fibroblasts (CAF) transfer miR-221 to promote hormonal therapy resistance (HTR) in models of luminal breast cancer. We determined that CAF-derived microvesicles horizontally transferred miR-221 to tumor cells and, in combination with hormone therapy, activated an ER lo /Notch hi feed-forward loop responsible for the generation of CD133 hi CSCs. Importantly, microvesicles from patients with HTR metastatic disease expressed high levels of miR-221. We further determined that the IL6-pStat3 pathway promoted the biogenesis of onco-miR-221 hi CAF microvesicles and established stromal CSC niches in experimental and patient-derived breast cancer models. Coinjection of patient-derived CAFs from bone metastases led to de novo HTR tumors, which was reversed with IL6R blockade. Finally, we generated patient-derived xenograft (PDX) models from patient-derived HTR bone metastases and analyzed tumor cells, stroma, and microvesicles. Murine and human CAFs were enriched in HTR tumors expressing high levels of CD133 hi cells. Depletion of murine CAFs from PDX restored sensitivity to HT, with a concurrent reduction of CD133 hi CSCs. Conversely, in models of CD133 neg , HT-sensitive cancer cells, both murine and human CAFs promoted de novo HT resistance via the generation of CD133 hi CSCs that expressed low levels of estrogen receptor alpha. Overall, our results illuminate how microvesicle-mediated horizontal transfer of genetic material from host stromal cells to cancer cells triggers the evolution of therapy-resistant metastases, with potentially broad implications for their control. Cancer Res; 77(8); 1927-41. ©2017 AACR . ©2017 American Association for Cancer Research.

  7. Mesenchymal Stem Cell as Targeted-Delivery Vehicle in Breast Cancer

    DTIC Science & Technology

    2008-06-01

    Transplantability and therapeutic effects of bone marrow-derived mesenchymal cells in children with osteogenesis imperfecta . Nat Med. 1999;5:309-13. 3. Le...relevant because the beneficial effects of MSCs are being tested clinically in attempts to improve hematopoietic engraftment [1], to treat osteogenesis

  8. Metformin and phenformin deplete tricarboxylic acid cycle and glycolytic intermediates during cell transformation and NTPs in cancer stem cells

    PubMed Central

    Janzer, Andreas; German, Natalie J.; Gonzalez-Herrera, Karina N.; Asara, John M.; Haigis, Marcia C.; Struhl, Kevin

    2014-01-01

    Metformin, a first-line diabetes drug linked to cancer prevention in retrospective clinical analyses, inhibits cellular transformation and selectively kills breast cancer stem cells (CSCs). Although a few metabolic effects of metformin and the related biguanide phenformin have been investigated in established cancer cell lines, the global metabolic impact of biguanides during the process of neoplastic transformation and in CSCs is unknown. Here, we use LC/MS/MS metabolomics (>200 metabolites) to assess metabolic changes induced by metformin and phenformin in an Src-inducible model of cellular transformation and in mammosphere-derived breast CSCs. Although phenformin is the more potent biguanide in both systems, the metabolic profiles of these drugs are remarkably similar, although not identical. During the process of cellular transformation, biguanide treatment prevents the boost in glycolytic intermediates at a specific stage of the pathway and coordinately decreases tricarboxylic acid (TCA) cycle intermediates. In contrast, in breast CSCs, biguanides have a modest effect on glycolytic and TCA cycle intermediates, but they strongly deplete nucleotide triphosphates and may impede nucleotide synthesis. These metabolic profiles are consistent with the idea that biguanides inhibit mitochondrial complex 1, but they indicate that their metabolic effects differ depending on the stage of cellular transformation. PMID:25002509

  9. Metformin and phenformin deplete tricarboxylic acid cycle and glycolytic intermediates during cell transformation and NTPs in cancer stem cells.

    PubMed

    Janzer, Andreas; German, Natalie J; Gonzalez-Herrera, Karina N; Asara, John M; Haigis, Marcia C; Struhl, Kevin

    2014-07-22

    Metformin, a first-line diabetes drug linked to cancer prevention in retrospective clinical analyses, inhibits cellular transformation and selectively kills breast cancer stem cells (CSCs). Although a few metabolic effects of metformin and the related biguanide phenformin have been investigated in established cancer cell lines, the global metabolic impact of biguanides during the process of neoplastic transformation and in CSCs is unknown. Here, we use LC/MS/MS metabolomics (>200 metabolites) to assess metabolic changes induced by metformin and phenformin in an Src-inducible model of cellular transformation and in mammosphere-derived breast CSCs. Although phenformin is the more potent biguanide in both systems, the metabolic profiles of these drugs are remarkably similar, although not identical. During the process of cellular transformation, biguanide treatment prevents the boost in glycolytic intermediates at a specific stage of the pathway and coordinately decreases tricarboxylic acid (TCA) cycle intermediates. In contrast, in breast CSCs, biguanides have a modest effect on glycolytic and TCA cycle intermediates, but they strongly deplete nucleotide triphosphates and may impede nucleotide synthesis. These metabolic profiles are consistent with the idea that biguanides inhibit mitochondrial complex 1, but they indicate that their metabolic effects differ depending on the stage of cellular transformation.

  10. Using a Stem Cell-Based Signature to Guide Therapeutic Selection in Cancer

    PubMed Central

    Shats, Igor; Gatza, Michael L.; Chang, Jeffrey T.; Mori, Seiichi; Wang, Jialiang; Rich, Jeremy; Nevins, Joseph R.

    2010-01-01

    Given the very substantial heterogeneity of most human cancers, it is likely that most cancer therapeutics will be active in only a small fraction of any population of patients. As such, the development of new therapeutics, coupled with methods to match a therapy with the individual patient, will be critical to achieving significant gains in disease outcome. One such opportunity is the use of expression signatures to identify key oncogenic phenotypes that can serve not only as biomarkers but also as a means of identifying therapeutic compounds that might specifically target these phenotypes. Given the potential importance of targeting tumors exhibiting a stem-like phenotype, we have developed an expression signature that reflects common biological aspects of various stem-like characteristics. The Consensus Stemness Ranking (CSR) signature is upregulated in cancer stem cell enriched samples, at advanced tumor stages and is associated with poor prognosis in multiple cancer types. Using two independent computational approaches we utilized the CSR signature to identify clinically useful compounds that could target the CSR phenotype. In vitro assays confirmed selectivity of several predicted compounds including topoisomerase inhibitors and resveratrol towards breast cancer cell lines that exhibit a high-CSR phenotype. Importantly, the CSR signature could predict clinical response of breast cancer patients to a neoadjuvant regimen that included a CSR-specific agent. Collectively, these results suggest therapeutic opportunities to target the CSR phenotype in a relevant cohort of cancer patients. PMID:21169407

  11. Mammary stem cells and the differentiation hierarchy: current status and perspectives

    PubMed Central

    Visvader, Jane E.; Stingl, John

    2014-01-01

    The mammary epithelium is highly responsive to local and systemic signals, which orchestrate morphogenesis of the ductal tree during puberty and pregnancy. Based on transplantation and lineage tracing studies, a hierarchy of stem and progenitor cells has been shown to exist among the mammary epithelium. Lineage tracing has highlighted the existence of bipotent mammary stem cells (MaSCs) in situ as well as long-lived unipotent cells that drive morphogenesis and homeostasis of the ductal tree. Moreover, there is accumulating evidence for a heterogeneous MaSC compartment comprising fetal MaSCs, slow-cycling cells, and both long-term and short-term repopulating cells. In parallel, diverse luminal progenitor subtypes have been identified in mouse and human mammary tissue. Elucidation of the normal cellular hierarchy is an important step toward understanding the “cells of origin” and molecular perturbations that drive breast cancer. PMID:24888586

  12. High-dose chemotherapy with autologous hematopoietic stem cell support for solid tumors in adults.

    PubMed

    Pedrazzoli, Paolo; Rosti, Giovanni; Secondino, Simona; Carminati, Ornella; Demirer, Taner

    2007-10-01

    Supported by experimental evidence and convincing results of early phase II studies, since the 1980s high-dose chemotherapy (HDC) with autologous hematopoietic stem cell support (AHSCT) has been uncritically adopted by many oncologists as a potentially curative option for several solid tumors. As a result, the number (and size) of randomized trials comparing this approach with conventional chemotherapy initiated (and often abandoned before completion) in this setting was limited and the benefit of a greater escalation of dose of chemotherapy with stem cell transplantation in solid tumors remains, with the possible exception of breast carcinoma (BC) and germ cell tumors (GCT), largely unsettled. In this article, we review and comment on the data from studies to date of HDC for solid tumors in adults.

  13. Epithelial-Stromal Interaction 1 (EPSTI1) Substitutes for Peritumoral Fibroblasts in the Tumor Microenvironment

    PubMed Central

    de Neergaard, Michala; Kim, Jiyoung; Villadsen, René; Fridriksdottir, Agla J.; Rank, Fritz; Timmermans-Wielenga, Vera; Langerød, Anita; Børresen-Dale, Anne-Lise; Petersen, Ole W.; Rønnov-Jessen, Lone

    2010-01-01

    Tumor cells can activate stroma, yet the implication of this activation in terms of reciprocal induction of gene expression in tumor cells is poorly understood. Epithelial Stromal Interaction 1 (EPSTI1) is an interferon response gene originally isolated from heterotypic recombinant cultures of human breast cancer cells and activated breast myofibroblasts. Here we describe the first immunolocalization of EPSTI1 in normal and cancerous breast tissue, and we provide evidence for a role of this molecule in the regulation of tumor cell properties and epithelial-mesenchymal transition. In general, no EPSTI1 staining was observed in normal breast epithelial cells from reduction mammoplasties (n = 25). However, in carcinomas, staining was positive in 22 of 40 biopsies and inversely correlated with the level of differentiation. To address the function of EPSTI1, we expressed EPSTI1 ectopically in one cell line and silenced endogenous EPSTI1 by RNA interference in another. Irrespective of the experimental approach, EPSTI1 expression led to an increase in tumorsphere formation—a property associated with breast stem/progenitor cells. Most remarkably, we show that EPSTI1, by conveying spread of tumor cells, can replace peritumoral activated fibroblasts in a tumor environment assay. These observations implicate EPSTI1 as a hitherto unappreciated regulator of tumor cell properties. PMID:20133812

  14. Increased sensitivity of African American triple negative breast cancer cells to nitric oxide-induced mitochondria-mediated apoptosis.

    PubMed

    Martinez, Luis; Thames, Easter; Kim, Jinna; Chaudhuri, Gautam; Singh, Rajan; Pervin, Shehla

    2016-07-29

    Breast cancer is a complex heterogeneous disease where many distinct subtypes are found. Younger African American (AA) women often present themselves with aggressive form of breast cancer with unique biology which is very difficult to treat. Better understanding the biology of AA breast tumors could lead to development of effective treatment strategies. Our previous studies indicate that AA but not Caucasian (CA) triple negative (TN) breast cancer cells were sensitive to nitrosative stress-induced cell death. In this study, we elucidate possible mechanisms that contribute to nitric oxide (NO)-induced apoptosis in AA TN breast cancer cells. Breast cancer cells were treated with various concentrations of long-acting NO donor, DETA-NONOate and cell viability was determined by trypan blue exclusion assay. Apoptosis was determined by TUNEL and caspase 3 activity as well as changes in mitochondrial membrane potential. Caspase 3 and Bax cleavage, levels of Cu/Zn superoxide dismutase (SOD) and Mn SOD was assessed by immunoblot analysis. Inhibition of Bax cleavage by Calpain inhibitor, and levels of reactive oxygen species (ROS) as well as SOD activity was measured in NO-induced apoptosis. In vitro and in vivo effect of NO treatment on mammary cancer stem cells (MCSCs) was assessed. NO induced mitocondria-mediated apoptosis in all AA but not in CA TN breast cancer cells. We found significant TUNEL-positive cells, cleavage of Bax and caspase-3 activation as well as depolarization mitochondrial membrane potential only in AA TN breast cancer cells exposed to NO. Inhibition of Bax cleavage and quenching of ROS partially inhibited NO-induced apoptosis in AA TN cells. Increase in ROS coincided with reduction in SOD activity in AA TN breast cancer cells. Furthermore, NO treatment of AA TN breast cancer cells dramatically reduced aldehyde dehydrogenase1 (ALDH1) expressing MCSCs and xenograft formation but not in breast cancer cells from CA origin. Ethnic differences in breast tumors dictate a need for tailoring treatment options more suited to the unique biology of the disease.

  15. Marrow-derived mesenchymal stem cells: role in epithelial tumor cell determination.

    PubMed

    Fierro, Fernando A; Sierralta, Walter D; Epuñan, Maria J; Minguell, José J

    2004-01-01

    Marrow stroma represents an advantageous environment for development of micrometastatic cells. Within the cellular structure of marrow stroma, mesenchymal stem cells (MSC) have been postulated as an interacting target for disseminated cancer cells. The studies reported here were performed to gain more information on the interaction of the human breast cancer cell line MCF-7 with human bone marrow-derived MSC cells and to investigate whether this interaction affects tumor cell properties. The results showed that after co-culture with MSC, changes were detected in the morphology, proliferative capacity and aggregation pattern of MCF-7 cells, but these parameters were not affected after the co-culture of MSC cells with a non-tumorigenic breast epithelial cell line, MCF-10. Since the indirect culture of MCF-7 with MSC or its products also resulted in functional changes in the tumor cells, we evaluated whether these effects could be attributed to growth factors produced by MSC cells. It was found that VEGF and IL-6 mimic the effects produced by MSC or its products on the proliferation and aggregation properties of MCF-7, cells, respectively. Thus, it seems that after entry of disseminated tumor cells into the marrow space, their proliferative and morphogenetic organization patterns are modified after interaction with distinct stromal cells and/or with specific signals from the marrow microenvironment.

  16. Isolation of stem-like cells from spontaneous feline mammary carcinomas: phenotypic characterization and tumorigenic potential.

    PubMed

    Barbieri, Federica; Wurth, Roberto; Ratto, Alessandra; Campanella, Chiara; Vito, Guendalina; Thellung, Stefano; Daga, Antonio; Cilli, Michele; Ferrari, Angelo; Florio, Tullio

    2012-04-15

    Current carcinogenesis theory states that only a small subset of tumor cells, the cancer stem cells or tumor initiating cells (TICs), are responsible for tumor formation and progression. Human breast cancer-initiating cells have been identified as CD44-expressing cells, which retain tumorigenic activity and display stem cell-like properties. Spontaneous feline mammary carcinoma (FMC) is an aggressive cancer, which shows biological similarities to the human tumor counterpart. We report the isolation and phenotypic characterization of FMC-derived stem/progenitor cells, showing in vitro self-renewal, long-lasting proliferation and in vivo tumorigenicity. Twenty-one FMC samples were collected, histologically classified and characterized for the expression of Ki67, EGFR, ER-α and CD44, by immunohistochemistry. By culture in stem cell permissive conditions, we isolated, from 13 FMCs, a CD44-positive subpopulation able to survive and proliferate in vitro as mammospheres of different sizes and morphologies. When injected in NOD/SCID mice, FMC stem-like cells initiate tumors, generating cell heterogeneity and recapitulating the original histotype. In serum-containing medium, spheroid cells showed differentiation properties as shown by morphological changes, the loss of CD44 expression and tumorigenic potential. These data show that stem-defined culture of FMC enriches for TICs and validate the use of these cells as a suitable model for comparative oncology studies of mammary biology and testing therapeutic strategies aimed at eradicating TICs. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Mathematical modelling of phenotypic plasticity and conversion to a stem-cell state under hypoxia

    NASA Astrophysics Data System (ADS)

    Dhawan, Andrew; Madani Tonekaboni, Seyed Ali; Taube, Joseph H.; Hu, Stephen; Sphyris, Nathalie; Mani, Sendurai A.; Kohandel, Mohammad

    2016-02-01

    Hypoxia, or oxygen deficiency, is known to be associated with breast tumour progression, resistance to conventional therapies and poor clinical prognosis. The epithelial-mesenchymal transition (EMT) is a process that confers invasive and migratory capabilities as well as stem cell properties to carcinoma cells thus promoting metastatic progression. In this work, we examined the impact of hypoxia on EMT-associated cancer stem cell (CSC) properties, by culturing transformed human mammary epithelial cells under normoxic and hypoxic conditions, and applying in silico mathematical modelling to simulate the impact of hypoxia on the acquisition of CSC attributes and the transitions between differentiated and stem-like states. Our results indicate that both the heterogeneity and the plasticity of the transformed cell population are enhanced by exposure to hypoxia, resulting in a shift towards a more stem-like population with increased EMT features. Our findings are further reinforced by gene expression analyses demonstrating the upregulation of EMT-related genes, as well as genes associated with therapy resistance, in hypoxic cells compared to normoxic counterparts. In conclusion, we demonstrate that mathematical modelling can be used to simulate the role of hypoxia as a key contributor to the plasticity and heterogeneity of transformed human mammary epithelial cells.

  18. Anti-Ma2 antibody related paraneoplastic limbic/brain stem encephalitis associated with breast cancer expressing Ma1, Ma2, and Ma3 mRNAs.

    PubMed

    Sahashi, K; Sakai, K; Mano, K; Hirose, G

    2003-09-01

    A 69 year old woman presented with cognitive impairment and supranuclear gaze palsy caused by paraneoplastic limbic/brain stem encephalitis associated with atypical medullary breast carcinoma. The cerebrospinal fluid from the patient harboured an anti-neuronal cell antibody against Ma2 antigen, but not against Ma1 or Ma3 antigen. Despite the antibody being restricted to the Ma2 antigen, the patient's cancer tissue expressed Ma1, Ma2, and Ma3 mRNAs. These results, and the expression of Ma2 mRNA in an atypical medullar breast carcinoma in another patient without paraneoplastic encephalitis, indicate that the induction of anti-Ma2 antibody depends on host immunoreponsiveness and not on the presence of the antigen itself in the cancer.

  19. Wnt-Responsive Cancer Stem Cells Are Located Close to Distorted Blood Vessels and Not in Hypoxic Regions in a p53-Null Mouse Model of Human Breast Cancer

    PubMed Central

    Landua, John D.; Bu, Wen; Wei, Wei; Li, Fuhai; Wong, Stephen T.C.; Dickinson, Mary E.; Rosen, Jeffrey M.; Lewis, Michael T.

    2014-01-01

    Cancer stem cells (CSCs, or tumor-initiating cells) may be responsible for tumor formation in many types of cancer, including breast cancer. Using high-resolution imaging techniques, we analyzed the relationship between a Wnt-responsive, CSC-enriched population and the tumor vasculature using p53-null mouse mammary tumors transduced with a lentiviral Wnt signaling reporter. Consistent with their localization in the normal mammary gland, Wnt-responsive cells in tumors were enriched in the basal/myoepithelial population and generally located in close proximity to blood vessels. The Wnt-responsive CSCs did not colocalize with the hypoxia-inducible factor 1α-positive cells in these p53-null basal-like tumors. Average vessel diameter and vessel tortuosity were increased in p53-null mouse tumors, as well as in a human tumor xenograft as compared with the normal mammary gland. The combined strategy of monitoring the fluorescently labeled CSCs and vasculature using high-resolution imaging techniques provides a unique opportunity to study the CSC and its surrounding vasculature. PMID:24797826

  20. Neural Stem Cell Delivery of Therapeutic Antibodies to Treat Breast Cancer Brain Metastases

    DTIC Science & Technology

    2009-10-01

    brain tumors remains dismal. High-grade neoplasms , such as gliomas, are highly invasive and spawn widely disseminated microsatellites that have... myeloproliferative sarcoma virus long terminal repeat negative control region deleted (MND promoter), allows suffi- cient expression in some cell types at a level

  1. Changes in mast cell number and stem cell factor expression in human skin after radiotherapy for breast cancer.

    PubMed

    Westbury, Charlotte B; Freeman, Alex; Rashid, Mohammed; Pearson, Ann; Yarnold, John R; Short, Susan C

    2014-05-01

    Mast cells are involved in the pathogenesis of radiation fibrosis and may be a therapeutic target. The mechanism of increased mast cell number in relation to acute and late tissue responses in human skin was investigated. Punch biopsies of skin 1 and 15-18 months after breast radiotherapy and a contralateral control biopsy were collected. Mast cells were quantified by immunohistochemistry using the markers c-Kit and tryptase. Stem cell factor (SCF) and collagen-1 expression was analysed by qRT-PCR. Clinical photographic scores were performed at post-surgical baseline and 18 months and 5 years post-radiotherapy. Primary human dermal microvascular endothelial cell (HDMEC) cultures were exposed to 2Gy ionising radiation and p53 and SCF expression was analysed by Western blotting and ELISA. Dermal mast cell numbers were increased at 1 (p=0.047) and 18 months (p=0.040) using c-Kit, and at 18 months (p=0.024) using tryptase immunostaining. Collagen-1 mRNA in skin was increased at 1 month (p=0.047) and 18 months (p=0.032) and SCF mRNA increased at 1 month (p=0.003). None of 16 cases scored had a change in photographic appearance at 5 years, compared to baseline. SCF expression was not increased in HDMECs irradiated in vitro. Increased mast cell number was associated with up-regulated collagen-1 expression in human skin at early and late time points. This increase could be secondary to elevated SCF expression at 1 month after radiotherapy. Although mast cells accumulate around blood vessels, no endothelial cell secretion of SCF was seen after in vitro irradiation. Modification of mast cell number and collagen-1 expression may be observed in skin at 1 and 18 months after radiotherapy in breast cancer patients with no change in photographic breast appearance at 5 years. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  2. Interplay between BRCA1 and RHAMM regulates epithelial apicobasal polarization and may influence risk of breast cancer.

    PubMed

    Maxwell, Christopher A; Benítez, Javier; Gómez-Baldó, Laia; Osorio, Ana; Bonifaci, Núria; Fernández-Ramires, Ricardo; Costes, Sylvain V; Guinó, Elisabet; Chen, Helen; Evans, Gareth J R; Mohan, Pooja; Català, Isabel; Petit, Anna; Aguilar, Helena; Villanueva, Alberto; Aytes, Alvaro; Serra-Musach, Jordi; Rennert, Gad; Lejbkowicz, Flavio; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Ripamonti, Carla B; Bonanni, Bernardo; Viel, Alessandra; Allavena, Anna; Bernard, Loris; Radice, Paolo; Friedman, Eitan; Kaufman, Bella; Laitman, Yael; Dubrovsky, Maya; Milgrom, Roni; Jakubowska, Anna; Cybulski, Cezary; Gorski, Bohdan; Jaworska, Katarzyna; Durda, Katarzyna; Sukiennicki, Grzegorz; Lubiński, Jan; Shugart, Yin Yao; Domchek, Susan M; Letrero, Richard; Weber, Barbara L; Hogervorst, Frans B L; Rookus, Matti A; Collee, J Margriet; Devilee, Peter; Ligtenberg, Marjolijn J; Luijt, Rob B van der; Aalfs, Cora M; Waisfisz, Quinten; Wijnen, Juul; Roozendaal, Cornelis E P van; Easton, Douglas F; Peock, Susan; Cook, Margaret; Oliver, Clare; Frost, Debra; Harrington, Patricia; Evans, D Gareth; Lalloo, Fiona; Eeles, Rosalind; Izatt, Louise; Chu, Carol; Eccles, Diana; Douglas, Fiona; Brewer, Carole; Nevanlinna, Heli; Heikkinen, Tuomas; Couch, Fergus J; Lindor, Noralane M; Wang, Xianshu; Godwin, Andrew K; Caligo, Maria A; Lombardi, Grazia; Loman, Niklas; Karlsson, Per; Ehrencrona, Hans; Wachenfeldt, Anna von; Barkardottir, Rosa Bjork; Hamann, Ute; Rashid, Muhammad U; Lasa, Adriana; Caldés, Trinidad; Andrés, Raquel; Schmitt, Michael; Assmann, Volker; Stevens, Kristen; Offit, Kenneth; Curado, João; Tilgner, Hagen; Guigó, Roderic; Aiza, Gemma; Brunet, Joan; Castellsagué, Joan; Martrat, Griselda; Urruticoechea, Ander; Blanco, Ignacio; Tihomirova, Laima; Goldgar, David E; Buys, Saundra; John, Esther M; Miron, Alexander; Southey, Melissa; Daly, Mary B; Schmutzler, Rita K; Wappenschmidt, Barbara; Meindl, Alfons; Arnold, Norbert; Deissler, Helmut; Varon-Mateeva, Raymonda; Sutter, Christian; Niederacher, Dieter; Imyamitov, Evgeny; Sinilnikova, Olga M; Stoppa-Lyonne, Dominique; Mazoyer, Sylvie; Verny-Pierre, Carole; Castera, Laurent; de Pauw, Antoine; Bignon, Yves-Jean; Uhrhammer, Nancy; Peyrat, Jean-Philippe; Vennin, Philippe; Fert Ferrer, Sandra; Collonge-Rame, Marie-Agnès; Mortemousque, Isabelle; Spurdle, Amanda B; Beesley, Jonathan; Chen, Xiaoqing; Healey, Sue; Barcellos-Hoff, Mary Helen; Vidal, Marc; Gruber, Stephen B; Lázaro, Conxi; Capellá, Gabriel; McGuffog, Lesley; Nathanson, Katherine L; Antoniou, Antonis C; Chenevix-Trench, Georgia; Fleisch, Markus C; Moreno, Víctor; Pujana, Miguel Angel

    2011-11-01

    Differentiated mammary epithelium shows apicobasal polarity, and loss of tissue organization is an early hallmark of breast carcinogenesis. In BRCA1 mutation carriers, accumulation of stem and progenitor cells in normal breast tissue and increased risk of developing tumors of basal-like type suggest that BRCA1 regulates stem/progenitor cell proliferation and differentiation. However, the function of BRCA1 in this process and its link to carcinogenesis remain unknown. Here we depict a molecular mechanism involving BRCA1 and RHAMM that regulates apicobasal polarity and, when perturbed, may increase risk of breast cancer. Starting from complementary genetic analyses across families and populations, we identified common genetic variation at the low-penetrance susceptibility HMMR locus (encoding for RHAMM) that modifies breast cancer risk among BRCA1, but probably not BRCA2, mutation carriers: n = 7,584, weighted hazard ratio ((w)HR) = 1.09 (95% CI 1.02-1.16), p(trend) = 0.017; and n = 3,965, (w)HR = 1.04 (95% CI 0.94-1.16), p(trend) = 0.43; respectively. Subsequently, studies of MCF10A apicobasal polarization revealed a central role for BRCA1 and RHAMM, together with AURKA and TPX2, in essential reorganization of microtubules. Mechanistically, reorganization is facilitated by BRCA1 and impaired by AURKA, which is regulated by negative feedback involving RHAMM and TPX2. Taken together, our data provide fundamental insight into apicobasal polarization through BRCA1 function, which may explain the expanded cell subsets and characteristic tumor type accompanying BRCA1 mutation, while also linking this process to sporadic breast cancer through perturbation of HMMR/RHAMM.

  3. Interplay between BRCA1 and RHAMM Regulates Epithelial Apicobasal Polarization and May Influence Risk of Breast Cancer

    PubMed Central

    Maxwell, Christopher A.; Benítez, Javier; Gómez-Baldó, Laia; Osorio, Ana; Bonifaci, Núria; Fernández-Ramires, Ricardo; Costes, Sylvain V.; Guinó, Elisabet; Chen, Helen; Evans, Gareth J. R.; Mohan, Pooja; Català, Isabel; Petit, Anna; Aguilar, Helena; Villanueva, Alberto; Aytes, Alvaro; Serra-Musach, Jordi; Rennert, Gad; Lejbkowicz, Flavio; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Ripamonti, Carla B.; Bonanni, Bernardo; Viel, Alessandra; Allavena, Anna; Bernard, Loris; Radice, Paolo; Friedman, Eitan; Kaufman, Bella; Laitman, Yael; Dubrovsky, Maya; Milgrom, Roni; Jakubowska, Anna; Cybulski, Cezary; Gorski, Bohdan; Jaworska, Katarzyna; Durda, Katarzyna; Sukiennicki, Grzegorz; Lubiński, Jan; Shugart, Yin Yao; Domchek, Susan M.; Letrero, Richard; Weber, Barbara L.; Hogervorst, Frans B. L.; Rookus, Matti A.; Collee, J. Margriet; Devilee, Peter; Ligtenberg, Marjolijn J.; van der Luijt, Rob B.; Aalfs, Cora M.; Waisfisz, Quinten; Wijnen, Juul; van Roozendaal, Cornelis E. P.; Easton, Douglas F.; Peock, Susan; Cook, Margaret; Oliver, Clare; Frost, Debra; Harrington, Patricia; Evans, D. Gareth; Lalloo, Fiona; Eeles, Rosalind; Izatt, Louise; Chu, Carol; Eccles, Diana; Douglas, Fiona; Brewer, Carole; Nevanlinna, Heli; Heikkinen, Tuomas; Couch, Fergus J.; Lindor, Noralane M.; Wang, Xianshu; Godwin, Andrew K.; Caligo, Maria A.; Lombardi, Grazia; Loman, Niklas; Karlsson, Per; Ehrencrona, Hans; von Wachenfeldt, Anna; Bjork Barkardottir, Rosa; Hamann, Ute; Rashid, Muhammad U.; Lasa, Adriana; Caldés, Trinidad; Andrés, Raquel; Schmitt, Michael; Assmann, Volker; Stevens, Kristen; Offit, Kenneth; Curado, João; Tilgner, Hagen; Guigó, Roderic; Aiza, Gemma; Brunet, Joan; Castellsagué, Joan; Martrat, Griselda; Urruticoechea, Ander; Blanco, Ignacio; Tihomirova, Laima; Goldgar, David E.; Buys, Saundra; John, Esther M.; Miron, Alexander; Southey, Melissa; Daly, Mary B.; Schmutzler, Rita K.; Wappenschmidt, Barbara; Meindl, Alfons; Arnold, Norbert; Deissler, Helmut; Varon-Mateeva, Raymonda; Sutter, Christian; Niederacher, Dieter; Imyamitov, Evgeny; Sinilnikova, Olga M.; Stoppa-Lyonne, Dominique; Mazoyer, Sylvie; Verny-Pierre, Carole; Castera, Laurent; de Pauw, Antoine; Bignon, Yves-Jean; Uhrhammer, Nancy; Peyrat, Jean-Philippe; Vennin, Philippe; Fert Ferrer, Sandra; Collonge-Rame, Marie-Agnès; Mortemousque, Isabelle; Spurdle, Amanda B.; Beesley, Jonathan; Chen, Xiaoqing; Healey, Sue; Barcellos-Hoff, Mary Helen; Vidal, Marc; Gruber, Stephen B.; Lázaro, Conxi; Capellá, Gabriel; McGuffog, Lesley; Nathanson, Katherine L.; Antoniou, Antonis C.; Chenevix-Trench, Georgia; Fleisch, Markus C.; Moreno, Víctor; Pujana, Miguel Angel

    2011-01-01

    Differentiated mammary epithelium shows apicobasal polarity, and loss of tissue organization is an early hallmark of breast carcinogenesis. In BRCA1 mutation carriers, accumulation of stem and progenitor cells in normal breast tissue and increased risk of developing tumors of basal-like type suggest that BRCA1 regulates stem/progenitor cell proliferation and differentiation. However, the function of BRCA1 in this process and its link to carcinogenesis remain unknown. Here we depict a molecular mechanism involving BRCA1 and RHAMM that regulates apicobasal polarity and, when perturbed, may increase risk of breast cancer. Starting from complementary genetic analyses across families and populations, we identified common genetic variation at the low-penetrance susceptibility HMMR locus (encoding for RHAMM) that modifies breast cancer risk among BRCA1, but probably not BRCA2, mutation carriers: n = 7,584, weighted hazard ratio (wHR) = 1.09 (95% CI 1.02–1.16), ptrend = 0.017; and n = 3,965, wHR = 1.04 (95% CI 0.94–1.16), ptrend = 0.43; respectively. Subsequently, studies of MCF10A apicobasal polarization revealed a central role for BRCA1 and RHAMM, together with AURKA and TPX2, in essential reorganization of microtubules. Mechanistically, reorganization is facilitated by BRCA1 and impaired by AURKA, which is regulated by negative feedback involving RHAMM and TPX2. Taken together, our data provide fundamental insight into apicobasal polarization through BRCA1 function, which may explain the expanded cell subsets and characteristic tumor type accompanying BRCA1 mutation, while also linking this process to sporadic breast cancer through perturbation of HMMR/RHAMM. PMID:22110403

  4. Chronic ethanol exposure enhances the aggressiveness of breast cancer: the role of p38γ

    PubMed Central

    Xu, Mei; Wang, Siying; Ren, Zhenhua; Frank, Jacqueline A.; Yang, Xiuwei H.; Zhang, Zhuo; Ke, Zun-ji; Shi, Xianglin; Luo, Jia

    2016-01-01

    Both epidemiological and experimental studies suggest that ethanol may enhance aggressiveness of breast cancer. We have previously demonstrated that short term exposure to ethanol (12–48 hours) increased migration/invasion in breast cancer cells overexpressing ErbB2, but not in breast cancer cells with low expression of ErbB2, such as MCF7, BT20 and T47D breast cancer cells. In this study, we showed that chronic ethanol exposure transformed breast cancer cells that were not responsive to short term ethanol treatment to a more aggressive phenotype. Chronic ethanol exposure (10 days - 2 months) at 100 (22 mM) or 200 mg/dl (44 mM) caused the scattering of MCF7, BT20 and T47D cell colonies in a 3-dimension culture system. Chronic ethanol exposure also increased colony formation in an anchorage-independent condition and stimulated cell invasion/migration. Chronic ethanol exposure increased cancer stem-like cell (CSC) population by more than 20 folds. Breast cancer cells exposed to ethanol in vitro displayed a much higher growth rate and metastasis in mice. Ethanol selectively activated p38γ MAPK and RhoC but not p38α/β in a concentration-dependent manner. SP-MCF7 cells, a derivative of MCF7 cells which compose mainly CSC expressed high levels of phosphorylated p38γ MAPK. Knocking-down p38γ MAPK blocked ethanol-induced RhoC activation, cell scattering, invasion/migration and ethanol-increased CSC population. Furthermore, knocking-down p38γ MAPK mitigated ethanol-induced tumor growth and metastasis in mice. These results suggest that chronic ethanol exposure can enhance the aggressiveness of breast cancer by activating p38γ MAPK/RhoC pathway. PMID:26655092

  5. AKT2 siRNA delivery with amphiphilic-based polymeric micelles show efficacy against cancer stem cells.

    PubMed

    Rafael, Diana; Gener, Petra; Andrade, Fernanda; Seras-Franzoso, Joaquin; Montero, Sara; Fernández, Yolanda; Hidalgo, Manuel; Arango, Diego; Sayós, Joan; Florindo, Helena F; Abasolo, Ibane; Schwartz, Simó; Videira, Mafalda

    2018-11-01

    Development of RNA interference-based therapies with appropriate therapeutic window remains a challenge for advanced cancers. Because cancer stem cells (CSC) are responsible of sustaining the metastatic spread of the disease to distal organs and the progressive gain of resistance of advanced cancers, new anticancer therapies should be validated specifically for this subpopulation of cells. A new amphihilic-based gene delivery system that combines Pluronic ® F127 micelles with polyplexes spontaneously formed by electrostatic interaction between anionic siRNA and cationic polyethylenimine (PEI) 10K, was designed (PM). Resultant PM gather the requirements for an efficient and safe transport of siRNA in terms of its physicochemical characteristics, internalization capacity, toxicity profile and silencing efficacy. PM were loaded with a siRNA against AKT2, an important oncogene involved in breast cancer tumorigenesis, with a special role in CSC malignancy. Efficacy of siAKT2-PM was validated in CSC isolated from two breast cancer cell lines: MCF-7 and Triple Negative MDA-MB-231 corresponding to an aggressive subtype of breast cancer. In both cases, we observed significant reduction on cell invasion capacity and strong inhibition of mammosphere formation after treatment. These results prompt AKT2 inhibition as a powerful therapeutic target against CSC and pave the way to the appearance of more effective nanomedicine-based gene therapies aimed to prevent CSC-related tumor recurrence.

  6. Three-Dimensional Mechanical Loading Modulates the Osteogenic Response of Mesenchymal Stem Cells to Tumor-Derived Soluble Signals

    PubMed Central

    Lynch, Maureen E.; Chiou, Aaron E.; Lee, Min Joon; Marcott, Stephen C.; Polamraju, Praveen V.; Lee, Yeonkyung

    2016-01-01

    Dynamic mechanical loading is a strong anabolic signal in the skeleton, increasing osteogenic differentiation of bone marrow-derived mesenchymal stem cells (BM-MSCs) and increasing the bone-forming activity of osteoblasts, but its role in bone metastatic cancer is relatively unknown. In this study, we integrated a hydroxyapatite-containing three-dimensional (3D) scaffold platform with controlled mechanical stimulation to investigate the effects of cyclic compression on the interplay between breast cancer cells and BM-MSCs as it pertains to bone metastasis. BM-MSCs cultured within mineral-containing 3D poly(lactide-co-glycolide) (PLG) scaffolds differentiated into mature osteoblasts, and exposure to tumor-derived soluble factors promoted this process. When BM-MSCs undergoing osteogenic differentiation were exposed to conditioned media collected from mechanically loaded breast cancer cells, their gene expression of osteopontin was increased. This was further enhanced when mechanical compression was simultaneously applied to BM-MSCs, leading to more uniformly deposited osteopontin within scaffold pores. These results suggest that mechanical loading of 3D scaffold-based culture models may be utilized to evaluate the role of physiologically relevant physical cues on bone metastatic breast cancer. Furthermore, our data imply that cyclic mechanical stimuli within the bone microenvironment modulate interactions between tumor cells and BM-MSCs that are relevant to bone metastasis. PMID:27401765

  7. R-spondin3 is associated with basal-progenitor behavior in normal and tumor mammary cells.

    PubMed

    Tocci, Johanna Melisa; Felcher, Carla María; García Solá, Martín E; Goddio, María Victoria; Zimberlin, María Noel; Rubinstein, Natalia; Srebrow, Anabella; Coso, Omar Adrián; Abba, Martín C; Meiss, Roberto P; Kordon, Edith C

    2018-05-10

    R-spondin3 (RSPO3) is a member of a family of secreted proteins that enhance Wnt signaling pathways in diverse processes including cancer. However, the role of RSPO3 in mammary gland and breast cancer development remains unclear. In this study, we show that RSPO3 is expressed in the basal stem cell-enriched compartment of normal mouse mammary glands but is absent from committed mature luminal cells in which exogenous RSPO3 impairs lactogenic differentiation. RSPO3 knockdown in basal-like mouse mammary tumor cells reduced canonical Wnt signaling, epithelial-to-mesenchymal transition-like features, migration capacity, and tumor formation in vivo. Conversely, RSPO3 overexpression, which was associated with some LGR and RUNX factors, highly correlated with the basal-like subtype among breast cancer patients. Thus we identified RSPO3 as a novel key modulator of breast cancer development and a potential target for treatment of basal-like breast cancers. Copyright ©2018, American Association for Cancer Research.

  8. A time- and matrix-dependent TGFBR3–JUND–KRT5 regulatory circuit in single breast epithelial cells and basal-like premalignancies

    PubMed Central

    Wang, Chun-Chao; Bajikar, Sameer S.; Jamal, Leen; Atkins, Kristen A.; Janes, Kevin A.

    2014-01-01

    Basal-like breast carcinoma is characterized by poor prognosis and high intratumor heterogeneity. In an immortalized basal-like breast epithelial cell line, we identified two anti-correlated gene-expression programs that arise among single extracellular matrix (ECM)-attached cells during organotypic 3D culture. The first contains multiple TGFβ-related genes including TGFBR3, whereas the second contains JUND and the basal-like marker, KRT5. TGFBR3 and JUND interconnect through four negative-feedback loops to form a circuit that exhibits spontaneous damped oscillations in 3D culture. The TGFBR3–JUND circuit appears conserved in some premalignant lesions that heterogeneously express KRT5. The circuit depends on ECM engagement, as detachment causes a rewiring that is triggered by RPS6 dephosphorylation and maintained by juxtacrine tenascin C, which is critical for intraductal colonization of basal-like breast cancer cells in vivo. Intratumor heterogeneity need not stem from partial differentiation and could instead reflect dynamic toggling of cells between expression states that are not cell autonomous. PMID:24658685

  9. Keeping abreast of the mammary epithelial hierarchy and breast tumorigenesis.

    PubMed

    Visvader, Jane E

    2009-11-15

    The epithelium of the mammary gland exists in a highly dynamic state, undergoing dramatic morphogenetic changes during puberty, pregnancy, lactation, and regression. The recent identification of stem and progenitor populations in mouse and human mammary tissue has provided evidence that the mammary epithelium is organized in a hierarchical manner. Characterization of these normal epithelial subtypes is an important step toward understanding which cells are predisposed to oncogenesis. This review summarizes progress in the field toward defining constituent cells and key molecular regulators of the mammary epithelial hierarchy. Potential relationships between normal epithelial populations and breast tumor subtypes are discussed, with implications for understanding the cellular etiology underpinning breast tumor heterogeneity.

  10. The Effects of Hemodynamic Shear Stress on Stemness of Acute Myelogenous Leukemia (AML)

    NASA Astrophysics Data System (ADS)

    Raddatz, Andrew; Triantafillu, Ursula; Kim, Yonghyun (John)

    2015-11-01

    Cancer stem cells (CSCs) have recently been identified as the root cause of tumors generated from cancer cell populations. This is because these CSCs are drug-resistant and have the ability to self-renew and differentiate. Current methods of culturing CSCs require much time and money, so cancer cell culture protocols, which maximize yield of CSCs are needed. It was hypothesized that the quantity of Acute myelogenous leukemia stem cells (LSCs) would increase after applying shear stress to the leukemia cells based on previous studies with breast cancer in bioreactors. The shear stress was applied by pumping the cells through narrow tubing to mimic the in vivo bloodstream environment. In support of the hypothesis, shear stress was found to increase the amount of LSCs in a given leukemia population. This work was supported by NSF REU Site Award 1358991.

  11. Hyaluronic acid functional amphipathic and redox-responsive polymer particles for the co-delivery of doxorubicin and cyclopamine to eradicate breast cancer cells and cancer stem cells

    NASA Astrophysics Data System (ADS)

    Hu, Kelei; Zhou, Huige; Liu, Ying; Liu, Zhu; Liu, Jing; Tang, Jinglong; Li, Jiayang; Zhang, Jiakun; Sheng, Wang; Zhao, Yuliang; Wu, Yan; Chen, Chunying

    2015-04-01

    Cancer stem cells (CSCs) have the ability to transform into bulk cancer cells, to promote tumor growth and establish tumor metastasis. To effectively inhibit tumor growth and prevent metastasis, treatments with conventional chemotherapy drugs should be combined with CSC targeted drugs. In this study, we describe the synthesis and characterization of a new amphiphilic polymer, hyaluronic acid-cystamine-polylactic-co-glycolic acid (HA-SS-PLGA), composed of a hydrophobic PLGA head and a hydrophilic HA segment linked by a bioreducible disulfide bond. With a double emulsion method, a nano delivery system was constructed to deliver doxorubicin (DOX) and cyclopamine (CYC, a primary inhibitor of the hedgehog signaling pathway of CSCs) to both a CD44-overexpressing breast CSC subpopulation and bulk breast cancer cells and allow an on-demand release. The resulting drug-loaded NPs exhibited a redox-responsive drug release profile. Dual drug-loaded particles potently diminished the number and size of tumorspheres and HA showed a targeting effect towards breast CSCs. In vivo combination therapy further demonstrated a remarkable synergistic anti-tumor effect and prolonged survival compared to mono-therapy using the orthotopic mammary fat pad tumor growth model. The co-delivery of drug and the CSC specific inhibitor towards targeted cancer chemotherapeutics provides an insight into anticancer strategy with facile control and high efficacy.Cancer stem cells (CSCs) have the ability to transform into bulk cancer cells, to promote tumor growth and establish tumor metastasis. To effectively inhibit tumor growth and prevent metastasis, treatments with conventional chemotherapy drugs should be combined with CSC targeted drugs. In this study, we describe the synthesis and characterization of a new amphiphilic polymer, hyaluronic acid-cystamine-polylactic-co-glycolic acid (HA-SS-PLGA), composed of a hydrophobic PLGA head and a hydrophilic HA segment linked by a bioreducible disulfide bond. With a double emulsion method, a nano delivery system was constructed to deliver doxorubicin (DOX) and cyclopamine (CYC, a primary inhibitor of the hedgehog signaling pathway of CSCs) to both a CD44-overexpressing breast CSC subpopulation and bulk breast cancer cells and allow an on-demand release. The resulting drug-loaded NPs exhibited a redox-responsive drug release profile. Dual drug-loaded particles potently diminished the number and size of tumorspheres and HA showed a targeting effect towards breast CSCs. In vivo combination therapy further demonstrated a remarkable synergistic anti-tumor effect and prolonged survival compared to mono-therapy using the orthotopic mammary fat pad tumor growth model. The co-delivery of drug and the CSC specific inhibitor towards targeted cancer chemotherapeutics provides an insight into anticancer strategy with facile control and high efficacy. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr01084e

  12. A mathematical model of breast cancer development, local treatment and recurrence.

    PubMed

    Enderling, Heiko; Chaplain, Mark A J; Anderson, Alexander R A; Vaidya, Jayant S

    2007-05-21

    Cancer development is a stepwise process through which normal somatic cells acquire mutations which enable them to escape their normal function in the tissue and become self-sufficient in survival. The number of mutations depends on the patient's age, genetic susceptibility and on the exposure of the patient to carcinogens throughout their life. It is believed that in every malignancy 4-6 crucial similar mutations have to occur on cancer-related genes. These genes are classified as oncogenes and tumour suppressor genes (TSGs) which gain or lose their function respectively, after they have received one mutative hit or both of their alleles have been knocked out. With the acquisition of each of the necessary mutations the transformed cell gains a selective advantage over normal cells, and the mutation will spread throughout the tissue via clonal expansion. We present a simplified model of this mutation and expansion process, in which we assume that the loss of two TSGs is sufficient to give rise to a cancer. Our mathematical model of the stepwise development of breast cancer verifies the idea that the normal mutation rate in genes is only sufficient to give rise to a tumour within a clinically observable time if a high number of breast stem cells and TSGs exist or genetic instability is involved as a driving force of the mutation pathway. Furthermore, our model shows that if a mutation occurred in stem cells pre-puberty, and formed a field of cells with this mutation through clonal formation of the breast, it is most likely that a tumour will arise from within this area. We then apply different treatment strategies, namely surgery and adjuvant external beam radiotherapy and targeted intraoperative radiotherapy (TARGIT) and use the model to identify different sources of local recurrence and analyse their prevention.

  13. Epithelial-to-mesenchymal transition leads to loss of EpCAM and different physical properties in circulating tumor cells from metastatic breast cancer.

    PubMed

    Hyun, Kyung-A; Koo, Gi-Bang; Han, Hyunju; Sohn, Joohyuk; Choi, Wonshik; Kim, Seung-Il; Jung, Hyo-Il; Kim, You-Sun

    2016-04-26

    The dissemination of circulating tumor cells (CTCs) requires the Epithelial-to-Mesenchymal transition (EMT), in which cells lose their epithelial characteristics and acquire more mesenchymal-like phenotypes. Current isolation of CTCs relies on affinity-based approaches reliant on the expression of Epithelial Cell Adhesion Molecule (EpCAM). Here we show EMT-induced breast cancer cells maintained in prolonged mammosphere culture conditions possess increased EMT markers and cancer stem cell markers, as well as reduced cell mass and size by quantitative phase microscopy; however, EpCAM expression is dramatically decreased in these cells. Moreover, CTCs isolated from breast cancer patients using a label-free microfluidic flow fractionation device had differing expression patterns of EpCAM, indicating that affinity approaches reliant on EpCAM expression may underestimate CTC number and potentially miss critical subpopulations. Further characterization of CTCs, including low-EpCAM populations, using this technology may improve detection techniques and cancer diagnosis, ultimately improving cancer treatment.

  14. Human embryonic stem cell-derived endothelial cells as cellular delivery vehicles for treatment of metastatic breast cancer.

    PubMed

    Su, Weijun; Wang, Lina; Zhou, Manqian; Liu, Ze; Hu, Shijun; Tong, Lingling; Liu, Yanhua; Fan, Yan; Kong, Deling; Zheng, Yizhou; Han, Zhongchao; Wu, Joseph C; Xiang, Rong; Li, Zongjin

    2013-01-01

    Endothelial progenitor cells (EPCs) have shown tropism towards primary tumors or metastases and are thus potential vehicles for targeting tumor therapy. However, the source of adult EPCs is limited, which highlights the need for a consistent and renewable source of endothelial cells for clinical applications. Here, we investigated the potential of human embryonic stem cell-derived endothelial cells (hESC-ECs) as cellular delivery vehicles for therapy of metastatic breast cancer. In order to provide an initial assessment of the therapeutic potency of hESC-ECs, we treated human breast cancer MDA-MB-231 cells with hESC-EC conditioned medium (EC-CM) in vitro. The results showed that hESC-ECs could suppress the Wnt/β-catenin signaling pathway and thereby inhibit the proliferation and migration of MDA-MB-231 cells. To track and evaluate the possibility of hESC-EC-employed therapy, we employed the bioluminescence imaging (BLI) technology. To study the therapeutic potential of hESC-ECs, we established lung metastasis models by intravenous injection of MDA-MB-231 cells labeled with firefly luciferase (Fluc) and green fluorescent protein (GFP) to NOD/SCID mice. In mice with lung metastases, we injected hESC-ECs armed with herpes simplex virus truncated thymidine kinase (HSV-ttk) intravenously on days 11, 16, 21, and 26 after MDA-MB-231 cell injection. The NOD/SCID mice were subsequently treated with ganciclovir (GCV), and the growth status of tumor was monitored by Fluc imaging. We found that MDA-MB-231 tumors were significantly inhibited by intravenously injected hESC-ECs. The tumor-suppressive effects of the hESC-ECs, by inhibiting Wnt/β-catenin signaling pathway and inducing tumor cell death through bystander effect in human metastatic breast cancer model, provide previously unexplored therapeutic modalities for cancer treatment.

  15. Citral reduces breast tumor growth by inhibiting the cancer stem cell marker ALDH1A3.

    PubMed

    Thomas, Margaret Lois; de Antueno, Roberto; Coyle, Krysta Mila; Sultan, Mohammad; Cruickshank, Brianne Marie; Giacomantonio, Michael Anthony; Giacomantonio, Carman Anthony; Duncan, Roy; Marcato, Paola

    2016-11-01

    Breast cancer stem cells (CSCs) can be identified by increased Aldefluor fluorescence caused by increased expression of aldehyde dehydrogenase 1A3 (ALDH1A3), as well as ALDH1A1 and ALDH2. In addition to being a CSC marker, ALDH1A3 regulates gene expression via retinoic acid (RA) signaling and plays a key role in the progression and chemotherapy resistance of cancer. Therefore, ALDH1A3 represents a druggable anti-cancer target of interest. Since to date, there are no characterized ALDH1A3 isoform inhibitors, drugs that were previously described as inhibiting the activity of other ALDH isoforms were tested for anti-ALDH1A3 activity. Twelve drugs (3-hydroxy-dl-kynurenine, benomyl, citral, chloral hydrate, cyanamide, daidzin, DEAB, disulfiram, gossypol, kynurenic acid, molinate, and pargyline) were compared for their efficacy in inducing apoptosis and reducing ALDH1A3, ALDH1A1 and ALDH2-associated Aldefluor fluorescence in breast cancer cells. Citral was identified as the best inhibitor of ALDH1A3, reducing the Aldefluor fluorescence in breast cancer cell lines and in a patient-derived tumor xenograft. Nanoparticle encapsulated citral specifically reduced the enhanced tumor growth of MDA-MB-231 cells overexpressing ALDH1A3. To determine the potential mechanisms of citral-mediated tumor growth inhibition, we performed cell proliferation, clonogenic, and gene expression assays. Citral reduced ALDH1A3-mediated colony formation and expression of ALDH1A3-inducible genes. In conclusion, citral is an effective ALDH1A3 inhibitor and is able to block ALDH1A3-mediated breast tumor growth, potentially via blocking its colony forming and gene expression regulation activity. The promise of ALDH1A3 inhibitors as adjuvant therapies for patients with tumors that have a large population of high-ALDH1A3 CSCs is discussed. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  16. New Monoclonal Antibodies to Defined Cell Surface Proteins on Human Pluripotent Stem Cells.

    PubMed

    O'Brien, Carmel M; Chy, Hun S; Zhou, Qi; Blumenfeld, Shiri; Lambshead, Jack W; Liu, Xiaodong; Kie, Joshua; Capaldo, Bianca D; Chung, Tung-Liang; Adams, Timothy E; Phan, Tram; Bentley, John D; McKinstry, William J; Oliva, Karen; McMurrick, Paul J; Wang, Yu-Chieh; Rossello, Fernando J; Lindeman, Geoffrey J; Chen, Di; Jarde, Thierry; Clark, Amander T; Abud, Helen E; Visvader, Jane E; Nefzger, Christian M; Polo, Jose M; Loring, Jeanne F; Laslett, Andrew L

    2017-03-01

    The study and application of human pluripotent stem cells (hPSCs) will be enhanced by the availability of well-characterized monoclonal antibodies (mAbs) detecting cell-surface epitopes. Here, we report generation of seven new mAbs that detect cell surface proteins present on live and fixed human ES cells (hESCs) and human iPS cells (hiPSCs), confirming our previous prediction that these proteins were present on the cell surface of hPSCs. The mAbs all show a high correlation with POU5F1 (OCT4) expression and other hPSC surface markers (TRA-160 and SSEA-4) in hPSC cultures and detect rare OCT4 positive cells in differentiated cell cultures. These mAbs are immunoreactive to cell surface protein epitopes on both primed and naive state hPSCs, providing useful research tools to investigate the cellular mechanisms underlying human pluripotency and states of cellular reprogramming. In addition, we report that subsets of the seven new mAbs are also immunoreactive to human bone marrow-derived mesenchymal stem cells (MSCs), normal human breast subsets and both normal and tumorigenic colorectal cell populations. The mAbs reported here should accelerate the investigation of the nature of pluripotency, and enable development of robust cell separation and tracing technologies to enrich or deplete for hPSCs and other human stem and somatic cell types. Stem Cells 2017;35:626-640. © 2016 The Authors Stem Cells published by Wiley Periodicals, Inc. on behalf of AlphaMed Press.

  17. MicroRNA miR-30 family regulates non-attachment growth of breast cancer cells

    PubMed Central

    2013-01-01

    Background A subset of breast cancer cells displays increased ability to self-renew and reproduce breast cancer heterogeneity. The characterization of these so-called putative breast tumor-initiating cells (BT-ICs) may open the road for novel therapeutic strategies. As microRNAs (miRNAs) control developmental programs in stem cells, BT-ICs may also rely on specific miRNA profiles for their sustained activity. To explore the notion that miRNAs may have a role in sustaining BT-ICs, we performed a comprehensive profiling of miRNA expression in a model of putative BT-ICs enriched by non-attachment growth conditions. Results We found breast cancer cells grown under non-attachment conditions display a unique pattern of miRNA expression, highlighted by a marked low expression of miR-30 family members relative to parental cells. We further show that miR-30a regulates non-attachment growth. A target screening revealed that miR-30 family redundantly modulates the expression of apoptosis and proliferation-related genes. At least one of these targets, the anti-apoptotic protein AVEN, was able to partially revert the effect of miR-30a overexpression. Finally, overexpression of miR-30a in vivo was associated with reduced breast tumor progression. Conclusions miR30-family regulates the growth of breast cancer cells in non-attachment conditions. This is the first analysis of target prediction in a whole family of microRNAs potentially involved in survival of putative BT-ICs. PMID:23445407

  18. Selection of Brain Metastasis-Initiating Breast Cancer Cells Determined by Growth on Hard Agar

    PubMed Central

    Guo, Lixia; Fan, Dominic; Zhang, Fahao; Price, Janet E.; Lee, Ju-Seog; Marchetti, Dario; Fidler, Isaiah J.; Langley, Robert R.

    2011-01-01

    An approach that facilitates rapid isolation and characterization of tumor cells with enhanced metastatic potential is highly desirable. Here, we demonstrate that plating GI-101A human breast cancer cells on hard (0.9%) agar selects for the subpopulation of metastasis-initiating cells. The agar-selected cells, designated GI-AGR, were homogeneous for CD44+ and CD133+ and five times more invasive than the parental GI-101A cells. Moreover, mice injected with GI-AGR cells had significantly more experimental brain metastases and shorter overall survival than did mice injected with GI-101A cells. Comparative gene expression analysis revealed that GI-AGR cells were markedly distinct from the parental cells but shared an overlapping pattern of gene expression with the GI-101A subline GI-BRN, which was generated by repeated in vivo recycling of GI-101A cells in an experimental brain metastasis model. Data mining on 216 genes shared between GI-AGR and GI-BRN breast cancer cells suggested that the molecular phenotype of these cells is consistent with that of cancer stem cells and the aggressive basal subtype of breast cancer. Collectively, these results demonstrate that analysis of cell growth in a hard agar assay is a powerful tool for selecting metastasis-initiating cells in a heterogeneous population of breast cancer cells, and that such selected cells have properties similar to those of tumor cells that are selected based on their potential to form metastases in mice. PMID:21514446

  19. Fusion of CCL21 non-migratory active breast epithelial and breast cancer cells give rise to CCL21 migratory active tumor hybrid cell lines.

    PubMed

    Berndt, Benjamin; Haverkampf, Sonja; Reith, Georg; Keil, Silvia; Niggemann, Bernd; Zänker, Kurt S; Dittmar, Thomas

    2013-01-01

    The biological phenomenon of cell fusion has been linked to tumor progression because several data provided evidence that fusion of tumor cells and normal cells gave rise to hybrid cell lines exhibiting novel properties, such as increased metastatogenic capacity and an enhanced drug resistance. Here we investigated M13HS hybrid cell lines, derived from spontaneous fusion events between M13SV1-EGFP-Neo breast epithelial cells exhibiting stem cell characteristics and HS578T-Hyg breast cancer cells, concerning CCL21/CCR7 signaling. Western Blot analysis showed that all cell lines varied in their CCR7 expression levels as well as differed in the induction and kinetics of CCR7 specific signal transduction cascades. Flow cytometry-based calcium measurements revealed that a CCL21 induced calcium influx was solely detected in M13HS hybrid cell lines. Cell migration demonstrated that only M13HS hybrid cell lines, but not parental derivatives, responded to CCL21 stimulation with an increased migratory activity. Knockdown of CCR7 expression by siRNA completely abrogated the CCL21 induced migration of hybrid cell lines indicating the necessity of CCL21/CCR7 signaling. Because the CCL21/CCR7 axis has been linked to metastatic spreading of breast cancer to lymph nodes we conclude from our data that cell fusion could be a mechanism explaining the origin of metastatic cancer (hybrid) cells.

  20. Fusion of CCL21 Non-Migratory Active Breast Epithelial and Breast Cancer Cells Give Rise to CCL21 Migratory Active Tumor Hybrid Cell Lines

    PubMed Central

    Reith, Georg; Keil, Silvia; Niggemann, Bernd; Zänker, Kurt S.; Dittmar, Thomas

    2013-01-01

    The biological phenomenon of cell fusion has been linked to tumor progression because several data provided evidence that fusion of tumor cells and normal cells gave rise to hybrid cell lines exhibiting novel properties, such as increased metastatogenic capacity and an enhanced drug resistance. Here we investigated M13HS hybrid cell lines, derived from spontaneous fusion events between M13SV1-EGFP-Neo breast epithelial cells exhibiting stem cell characteristics and HS578T-Hyg breast cancer cells, concerning CCL21/CCR7 signaling. Western Blot analysis showed that all cell lines varied in their CCR7 expression levels as well as differed in the induction and kinetics of CCR7 specific signal transduction cascades. Flow cytometry-based calcium measurements revealed that a CCL21 induced calcium influx was solely detected in M13HS hybrid cell lines. Cell migration demonstrated that only M13HS hybrid cell lines, but not parental derivatives, responded to CCL21 stimulation with an increased migratory activity. Knockdown of CCR7 expression by siRNA completely abrogated the CCL21 induced migration of hybrid cell lines indicating the necessity of CCL21/CCR7 signaling. Because the CCL21/CCR7 axis has been linked to metastatic spreading of breast cancer to lymph nodes we conclude from our data that cell fusion could be a mechanism explaining the origin of metastatic cancer (hybrid) cells. PMID:23667660

  1. Radiation-Induced Vaccination to Breast Cancer

    DTIC Science & Technology

    2015-10-01

    monocyte gating strategy. We have shown in animal models that myelopiesis has a profound effect on lymphocyte responses and bone marrow mobilization...responses using blood samples before, during and after treatment by multi-channel flow cytometry for immune monitoring, 3) to examine the effects of...longer than those getting the lower 1mg dose . 2.2 Effects of TGF-beta on breast cancer stem-cells Recent preclinical and clinical data

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barbieri, Federica; Wurth, Roberto; Ratto, Alessandra

    Current carcinogenesis theory states that only a small subset of tumor cells, the cancer stem cells or tumor initiating cells (TICs), are responsible for tumor formation and progression. Human breast cancer-initiating cells have been identified as CD44-expressing cells, which retain tumorigenic activity and display stem cell-like properties. Spontaneous feline mammary carcinoma (FMC) is an aggressive cancer, which shows biological similarities to the human tumor counterpart. We report the isolation and phenotypic characterization of FMC-derived stem/progenitor cells, showing in vitro self-renewal, long-lasting proliferation and in vivo tumorigenicity. Twenty-one FMC samples were collected, histologically classified and characterized for the expression of Ki67,more » EGFR, ER-{alpha} and CD44, by immunohistochemistry. By culture in stem cell permissive conditions, we isolated, from 13 FMCs, a CD44-positive subpopulation able to survive and proliferate in vitro as mammospheres of different sizes and morphologies. When injected in NOD/SCID mice, FMC stem-like cells initiate tumors, generating cell heterogeneity and recapitulating the original histotype. In serum-containing medium, spheroid cells showed differentiation properties as shown by morphological changes, the loss of CD44 expression and tumorigenic potential. These data show that stem-defined culture of FMC enriches for TICs and validate the use of these cells as a suitable model for comparative oncology studies of mammary biology and testing therapeutic strategies aimed at eradicating TICs. -- Highlights: Black-Right-Pointing-Pointer Feline mammary carcinoma contain a sub-population of stem-like cells expressing CD44 Black-Right-Pointing-Pointer These grow as spheres in serum-free medium and self-renew Black-Right-Pointing-Pointer Isolated stem-like cancer cells initiate tumor in immunodeficient mice Black-Right-Pointing-Pointer Xenografted tumors are phenotypically similar to the original tumor Black-Right-Pointing-Pointer Upon differentiation, cells grow as monolayers, loosing the tumorigenic potential.« less

  3. The H3K27me3-demethylase KDM6A is suppressed in breast cancer stem-like cells, and enables the resolution of bivalency during the mesenchymal-epithelial transition

    PubMed Central

    Taube, Joseph H.; Sphyris, Nathalie; Johnson, Kelsey S.; Reisenauer, Keighley N.; Nesbit, Taylor A.; Joseph, Robiya; Vijay, Geraldine V.; Sarkar, Tapasree R.; Bhangre, Neeraja A.; Song, Joon Jin; Chang, Jeffrey T.; Lee, Min Gyu; Soundararajan, Rama; Mani, Sendurai A.

    2017-01-01

    The deposition of the activating H3K4me3 and repressive H3K27me3 histone modifications within the same promoter, forming a so-called bivalent domain, maintains gene expression in a repressed but transcription-ready state. We recently reported a significantly increased incidence of bivalency following an epithelial-mesenchymal transition (EMT), a process associated with the initiation of the metastatic cascade. The reverse process, known as the mesenchymal-epithelial transition (MET), is necessary for efficient colonization. Here, we identify numerous genes associated with differentiation, proliferation and intercellular adhesion that are repressed through the acquisition of bivalency during EMT, and re-expressed following MET. The majority of EMT-associated bivalent domains arise through H3K27me3 deposition at H3K4me3-marked promoters. Accordingly, we show that the expression of the H3K27me3-demethylase KDM6A is reduced in cells that have undergone EMT, stem-like subpopulations of mammary cell lines and stem cell-enriched triple-negative breast cancers. Importantly, KDM6A levels are restored following MET, concomitant with CDH1/E-cadherin reactivation through H3K27me3 removal. Moreover, inhibition of KDM6A, using the H3K27me3-demethylase inhibitor GSK-J4, prevents the re-expression of bivalent genes during MET. Our findings implicate KDM6A in the resolution of bivalency accompanying MET, and suggest KDM6A inhibition as a viable strategy to suppress metastasis formation in breast cancer. PMID:29029452

  4. Isolation and characterization of a metastatic hybrid cell line generated by ER negative and ER positive breast cancer cells in mouse bone marrow.

    PubMed

    Mukhopadhyay, Keya De; Bandyopadhyay, Abhik; Chang, Ting-Tung A; Elkahloun, Abdel G; Cornell, John E; Yang, Junhua; Goins, Beth A; Yeh, I-Tien; Sun, Lu-Zhe

    2011-01-01

    The origin and the contribution of breast tumor heterogeneity to its progression are not clear. We investigated the effect of a growing orthotopic tumor formed by an aggressive estrogen receptor (ER)-negative breast cancer cell line on the metastatic potential of a less aggressive ER-positive breast cancer cell line for the elucidation of how the presence of heterogeneous cancer cells might affect each other's metastatic behavior. ER positive ZR-75-1/GFP/puro cells, resistant to puromycin and non-tumorigenic/non-metastatic without exogenous estrogen supplementation, were injected intracardiacally into mice bearing growing orthotopic tumors, formed by ER negative MDA-MB-231/GFP/Neo cells resistant to G418. A variant cell line B6, containing both estrogen-dependent and -independent cells, were isolated from GFP expressing cells in the bone marrow and re-inoculated in nude mice to generate an estrogen-independent cell line B6TC. The presence of ER negative orthotopic tumors resulted in bone metastasis of ZR-75-1 without estrogen supplementation. The newly established B6TC cell line was tumorigenic without estrogen supplementation and resistant to both puromycin and G418 suggesting its origin from the fusion of MDA-MB-231/GFP/Neo and ZR-75-1/GFP/puro in the mouse bone marrow. Compared to parental cells, B6TC cells were more metastatic to lung and bone after intracardiac inoculation. More significantly, B6TC mice also developed brain metastasis, which was not observed in the MDA-MB-231/GFP/Neo cell-inoculated mice. Low expression of ERα and CD24, and high expression of EMT-related markers such as Vimentin, CXCR4, and Integrin-β1 along with high CD44 and ALDH expression indicated stem cell-like characteristics of B6TC. Gene microarray analysis demonstrated a significantly different gene expression profile of B6TC in comparison to those of parental cell lines. Spontaneous generation of the novel hybrid cell line B6TC, in a metastatic site with stem cell-like properties and propensity to metastasize to brain, suggest that cell fusion can contribute to tumor heterogeneity.

  5. Breast carcinoma cells modulate the chemoattractive activity of human bone marrow-derived mesenchymal stromal cells by interfering with CXCL12.

    PubMed

    Wobus, Manja; List, Catrin; Dittrich, Tobias; Dhawan, Abhishek; Duryagina, Regina; Arabanian, Laleh S; Kast, Karin; Wimberger, Pauline; Stiehler, Maik; Hofbauer, Lorenz C; Jakob, Franz; Ehninger, Gerhard; Anastassiadis, Konstantinos; Bornhäuser, Martin

    2015-01-01

    We investigated whether breast tumor cells can modulate the function of mesenchymal stromal cells (MSCs) with a special emphasis on their chemoattractive activity towards hematopoietic stem and progenitor cells (HSPCs). Primary MSCs as well as a MSC line (SCP-1) were cocultured with primary breast cancer cells, MCF-7, MDA-MB231 breast carcinoma or MCF-10A non-malignant breast epithelial cells or their conditioned medium. In addition, the frequency of circulating clonogenic hematopoietic progenitors was determined in 78 patients with breast cancer and compared with healthy controls. Gene expression analysis of SCP-1 cells cultured with MCF-7 medium revealed CXCL12 (SDF-1) as one of the most significantly downregulated genes. Supernatant from both MCF-7 and MDA-MB231 reduced the CXCL12 promoter activity in SCP-1 cells to 77% and 47%, respectively. Moreover, the CXCL12 mRNA and protein levels were significantly reduced. As functional consequence of lower CXCL12 levels, we detected a decreased trans-well migration of HSPCs towards MSC/tumor cell cocultures or conditioned medium. The specificity of this effect was confirmed by blocking studies with the CXCR4 antagonist AMD3100. Downregulation of SP1 and increased miR-23a levels in MSCs after contact with tumor cell medium as well as enhanced TGFβ1 expression were identified as potential molecular regulators of CXCL12 activity in MSCs. Moreover, we observed a significantly higher frequency of circulating colony-forming hematopoietic progenitors in patients with breast cancer compared with healthy controls. Our in vitro results propose a potential new mechanism by which disseminated tumor cells in the bone marrow may interfere with hematopoiesis by modulating CXCL12 in protected niches. © 2014 UICC.

  6. Leptin produced by obese adipose stromal/stem cells enhances proliferation and metastasis of estrogen receptor positive breast cancers.

    PubMed

    Strong, Amy L; Ohlstein, Jason F; Biagas, Brandi A; Rhodes, Lyndsay V; Pei, Dorothy T; Tucker, H Alan; Llamas, Claire; Bowles, Annie C; Dutreil, Maria F; Zhang, Shijia; Gimble, Jeffrey M; Burow, Matthew E; Bunnell, Bruce A

    2015-08-19

    The steady increase in the incidence of obesity among adults has been paralleled with higher levels of obesity-associated breast cancer. While recent studies have suggested that adipose stromal/stem cells (ASCs) isolated from obese women enhance tumorigenicity, the mechanism(s) by which this occurs remains undefined. Evidence suggests that increased adiposity results in increased leptin secretion from adipose tissue, which has been shown to increased cancer cell proliferation. Previously, our group demonstrated that ASCs isolated from obese women (obASCs) also express higher levels of leptin relative to ASCs isolated from lean women (lnASCs) and that this obASC-derived leptin may account for enhanced breast cancer cell growth. The current study investigates the impact of inhibiting leptin expression in lnASCs and obASCs on breast cancer cell (BCC) growth and progression. Estrogen receptor positive (ER+) BCCs were co-cultured with leptin shRNA lnASCs or leptin shRNA obASCs and changes in the proliferation, migration, invasion, and gene expression of BCCs were investigated. To assess the direct impact of leptin inhibition in obASCs on BCC proliferation, MCF7 cells were injected alone or mixed with control shRNA obASCs or leptin shRNA obASCs into SCID/beige mice. ER+ BCCs were responsive to obASCs during direct co-culture, whereas lnASCs were unable to increase ER(+) BCC growth. shRNA silencing of leptin in obASCs negated the enhanced proliferative effects of obASC on BCCs following direct co-culture. BCCs co-cultured with obASCs demonstrated enhanced expression of epithelial-to-mesenchymal transition (EMT) and metastasis genes (SERPINE1, MMP-2, and IL-6), while BCCs co-cultured with leptin shRNA obASCs did not display similar levels of gene induction. Knockdown of leptin significantly reduced tumor volume and decreased the number of metastatic lesions to the lung and liver. These results correlated with reduced expression of both SERPINE1 and MMP-2 in tumors formed with MCF7 cells mixed with leptin shRNA obASCs, when compared to tumors formed with MCF7 cells mixed with control shRNA obASCs. This study provides mechanistic insight as to how obesity enhances the proliferation and metastasis of breast cancer cells; specifically, obASC-derived leptin contributes to the aggressiveness of breast cancer in obese women.

  7. Microfluidics separation reveals the stem-cell-like deformability of tumor-initiating cells.

    PubMed

    Zhang, Weijia; Kai, Kazuharu; Choi, Dong Soon; Iwamoto, Takayuki; Nguyen, Yen H; Wong, Helen; Landis, Melissa D; Ueno, Naoto T; Chang, Jenny; Qin, Lidong

    2012-11-13

    Here we report a microfluidics method to enrich physically deformable cells by mechanical manipulation through artificial microbarriers. Driven by hydrodynamic forces, flexible cells or cells with high metastatic propensity change shape to pass through the microbarriers and exit the separation device, whereas stiff cells remain trapped. We demonstrate the separation of (i) a mixture of two breast cancer cell types (MDA-MB-436 and MCF-7) with distinct deformabilities and metastatic potentials, and (ii) a heterogeneous breast cancer cell line (SUM149), into enriched flexible and stiff subpopulations. We show that the flexible phenotype is associated with overexpression of multiple genes involved in cancer cell motility and metastasis, and greater mammosphere formation efficiency. Our observations support the relationship between tumor-initiating capacity and cell deformability, and demonstrate that tumor-initiating cells are less differentiated in terms of cell biomechanics.

  8. Oncogenic role and therapeutic target of leptin signaling in breast cancer and cancer stem cells

    PubMed Central

    Guo, Shanchun; Liu, Mingli; Wang, Guangdi; Torroella-Kouri, Marta; Gonzalez-Perez, Ruben R.

    2012-01-01

    Significant correlations between obesity and incidence of various cancers have been reported. Obesity, considered a mild inflammatory process, is characterized by a high level of secretion of several cytokines from adipose tissue. These molecules have disparate effects, which could be relevant to cancer development. Among the inflammatory molecules, leptin, mainly produced by adipose tissue and overexpressed with its receptor (Ob-R) in cancer cells is the most studied adipokine. Mutations of leptin or Ob-R genes associated with obesity or cancer are rarely found. However, leptin is an anti-apoptotic molecule in many cell types, and its central roles in obesity-related cancers are based on its pro-angiogenic, pro-inflammatory and mitogenic actions. Notably, these leptin actions are commonly reinforced through entangled crosstalk with multiple oncogenes, cytokines and growth factors. Leptin-induced signals comprise several pathways commonly triggered by many cytokines (i.e, canonical: JAK2/STAT; MAPK/ERK1/2 and PI-3K/AKT1 and, non-canonical signaling pathways: PKC, JNK and p38 MAP kinase). Each of these leptin-induced signals is essential to its biological effects on food intake, energy balance, adiposity, immune and endocrine systems, as well as oncogenesis. This review is mainly focused on the current knowledge of the oncogenic role of leptin in breast cancer. Additionally, leptin pro-angiogenic molecular mechanisms and its potential role in breast cancer stem cells will be reviewed. Strict biunivocal binding-affinity and activation of leptin/Ob-R complex makes it a unique molecular target for prevention and treatment of breast cancer, particularly in obesity contexts. PMID:22289780

  9. The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells

    PubMed Central

    Pickard, Mark R.; Williams, Gwyn T.

    2016-01-01

    Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727

  10. Contrasting hypoxic effects on breast cancer stem cell hierarchy is dependent on ER-α status.

    PubMed

    Harrison, Hannah; Rogerson, Lynsey; Gregson, Hannah J; Brennan, Keith R; Clarke, Robert B; Landberg, Göran

    2013-02-15

    Tumor hypoxia is often linked to decreased survival in patients with breast cancer and current therapeutic strategies aim to target the hypoxic response. One way in which this is done is by blocking hypoxia-induced angiogenesis. Antiangiogenic therapies show some therapeutic potential with increased disease-free survival, but these initial promising results are short lived and followed by tumor progression. We hypothesized that this may be due to altered cancer stem cell (CSC) activity resulting from increased tumor hypoxia. We studied the effects of hypoxia on CSC activity, using in vitro mammosphere and holoclone assays as well as in vivo limiting dilution experiments, in 13 patient-derived samples and four cell lines. There was a HIF-1α-dependent CSC increase in ER-α-positive cancers following hypoxic exposure, which was blocked by inhibition of estrogen and Notch signaling. A contrasting decrease in CSC was seen in ER-α-negative cancers. We next developed a xenograft model of cell lines and patient-derived samples to assess the hypoxic CSC response. Varying sizes of xenografts were collected and analyzed for HIF1-α expression and CSC. The same ER-α-dependent contrasting hypoxic-CSC response was seen validating the initial observation. These data suggest that ER-α-positive and negative breast cancer subtypes respond differently to hypoxia and, as a consequence, antiangiogenic therapies will not be suitable for both subgroups.

  11. Bromelain-induced apoptosis in GI-101A breast cancer cells.

    PubMed

    Dhandayuthapani, Sivanesan; Perez, Honey Diaz; Paroulek, Alexandra; Chinnakkannu, Panneerselvam; Kandalam, Umadevi; Jaffe, Mark; Rathinavelu, Appu

    2012-04-01

    Bromelain is a proteolytic enzyme extracted from the stems and the immature fruits of pineapple that was found to be antitumorigenic in different in vitro models. Bromelain has been reported to promote apoptosis, particularly in breast cancer cells, with the up-regulation of c-Jun N-terminal kinase and p38 kinase. Our study was designed to determine if bromelain could induce apoptosis in GI-101A breast cancer cells. GI-101A cells were treated with increasing concentrations of bromelain for 24 hours. The effect of bromelain for inducing cell death via activation of the apoptosis mechanism in GI-101A cells was further determined by using caspase-9 and caspase-3 assays along with the M30-Apoptosense assay to measure cytokeratin 18 (CK18) levels in the cytoplasm of the cultured cancer cells. A dose-dependent increase in the activities of caspase-9 and caspase-3 coinciding with elevation of CK18 levels was found in bromelain-treated cells compared with control cells. Furthermore, the apoptosis induction by bromelain was confirmed by DNA fragmentation analysis and 4,6'-diamino-2-phenylindole dihydrochloride fluorescence staining of the nucleus. Our results indicate an increase in apoptosis-related cell death in breast cancer cells with increasing concentrations of bromelain.

  12. Metformin selectively affects human glioblastoma tumor-initiating cell viability

    PubMed Central

    Würth, Roberto; Pattarozzi, Alessandra; Gatti, Monica; Bajetto, Adirana; Corsaro, Alessandro; Parodi, Alessia; Sirito, Rodolfo; Massollo, Michela; Marini, Cecilia; Zona, Gianluigi; Fenoglio, Daniela; Sambuceti, Gianmario; Filaci, Gilberto; Daga, Antonio; Barbieri, Federica; Florio, Tullio

    2013-01-01

    Cancer stem cell theory postulates that a small population of tumor-initiating cells is responsible for the development, progression and recurrence of several malignancies, including glioblastoma. In this perspective, tumor-initiating cells represent the most relevant target to obtain effective cancer treatment. Metformin, a first-line drug for type II diabetes, was reported to possess anticancer properties affecting the survival of cancer stem cells in breast cancer models. We report that metformin treatment reduced the proliferation rate of tumor-initiating cell-enriched cultures isolated from four human glioblastomas. Metformin also impairs tumor-initiating cell spherogenesis, indicating a direct effect on self-renewal mechanisms. Interestingly, analyzing by FACS the antiproliferative effects of metformin on CD133-expressing subpopulation, a component of glioblastoma cancer stem cells, a higher reduction of proliferation was observed as compared with CD133-negative cells, suggesting a certain degree of cancer stem cell selectivity in its effects. In fact, glioblastoma cell differentiation strongly reduced sensitivity to metformin treatment. Metformin effects in tumor-initiating cell-enriched cultures were associated with a powerful inhibition of Akt-dependent cell survival pathway, while this pathway was not affected in differentiated cells. The specificity of metformin antiproliferative effects toward glioblastoma tumor-initiating cells was confirmed by the lack of significant inhibition of normal human stem cells (umbilical cord-derived mesenchymal stem cells) in vitro proliferation after metformin exposure. Altogether, these data clearly suggest that metformin exerts antiproliferative activity on glioblastoma cells, showing a higher specificity toward tumor-initiating cells, and that the inhibition of Akt pathway may represent a possible intracellular target of this effect. PMID:23255107

  13. Ultrastable Nontoxic RNA Nanoparticles for Targeting Triple-Negative Breast Cancer Stem Cells

    DTIC Science & Technology

    2016-04-01

    delivery system to meet the urgent need of efficient strategies for the treatment of breast cancer. 15. SUBJECT TERMS RNA nanotechnology ; three-way...construct a new generation of drugs composed purely of RNA (Nature Nanotechnology , 2011, 6: 658; Nano Today, 2012, 7: 245). Our goal is to apply our...anti-proliferative, anti-invasive and anti- metastasis properties. 2. KEYWORDS: RNA nanotechnology ; three-way junction; RNA aptamer; miRNA; triple

  14. Regulation of Breast Cancer Stem Cell by Tissue Rigidity

    DTIC Science & Technology

    2015-06-01

    analysis. The TCGA breast cancer gene expression data set (TCGA BRCA G4502A_07_3) was downloaded from the UCSC Cancer Genome Browser (https:// genome ...Public Release; Distribution Unlimited The views, opinions and/or findings contained in this report are those of the author(s) and should not be...construed as an official Department of the Army position, policy or decision unless so designated by other documentation. Report Documentation Page Form

  15. Notch1 inhibition alters the CD44hi/CD24lo population and reduces the formation of brain metastases from breast cancer.

    PubMed

    McGowan, Patricia M; Simedrea, Carmen; Ribot, Emeline J; Foster, Paula J; Palmieri, Diane; Steeg, Patricia S; Allan, Alison L; Chambers, Ann F

    2011-07-01

    Brain metastasis from breast cancer is an increasingly important clinical problem. Here we assessed the role of CD44(hi)/CD24(lo) cells and pathways that regulate them, in an experimental model of brain metastasis. Notch signaling (mediated by γ-secretase) has been shown to contribute to maintenance of the cancer stem cell (CSC) phenotype. Cells sorted for a reduced stem-like phenotype had a reduced ability to form brain metastases compared with unsorted or CD44(hi)/CD24(lo) cells (P < 0.05; Kruskal-Wallis). To assess the effect of γ-secretase inhibition, cells were cultured with DAPT and the CD44/CD24 phenotypes quantified. 231-BR cells with a CD44(hi)/CD24(lo) phenotype was reduced by about 15% in cells treated with DAPT compared with DMSO-treated or untreated cells (P = 0.001, ANOVA). In vivo, mice treated with DAPT developed significantly fewer micro- and macrometastases compared with vehicle treated or untreated mice (P = 0.011, Kruskal-Wallis). Notch1 knockdown reduced the expression of CD44(hi)/CD24(lo) phenotype by about 20%. In vitro, Notch1 shRNA resulted in a reduction in cellular growth at 24, 48, and 72 hours time points (P = 0.033, P = 0.002, and P = 0.009, ANOVA) and about 60% reduction in Matrigel invasion was observed (P < 0.001, ANOVA). Cells transfected with shNotch1 formed significantly fewer macrometastases and micrometastases compared with scrambled shRNA or untransfected cells (P < 0.001; Kruskal-Wallis). These data suggest that the CSC phenotype contributes to the development of brain metastases from breast cancer, and this may arise in part from increased Notch activity. ©2011 AACR.

  16. Cadherin-11 in poor prognosis malignancies and rheumatoid arthritis: common target, common therapies

    PubMed Central

    Hampel, Constanze; Anastasiadis, Panos Z.; Kallakury, Bhaskar; Uren, Aykut; Foley, David W; Brown, Milton L.; Shapiro, Lawrence; Brenner, Michael; Haigh, David; Byers, Stephen W.

    2014-01-01

    Cadherin-11 (CDH11), associated with epithelial to mesenchymal transformation in development, poor prognosis malignancies and cancer stem cells, is also a major therapeutic target in rheumatoid arthritis (RA). CDH11 expressing basal-like breast carcinomas and other CDH11 expressing malignancies exhibit poor prognosis. We show that CDH11 is increased early in breast cancer and ductal carcinoma in-situ. CDH11 knockdown and antibodies effective in RA slowed the growth of basal-like breast tumors and decreased proliferation and colony formation of breast, glioblastoma and prostate cancer cells. The repurposed arthritis drug celecoxib, which binds to CDH11, and other small molecules designed to bind CDH11 without inhibiting COX-2 preferentially affect the growth of CDH11 positive cancer cells in vitro and in animals. These data suggest that CDH11 is important for malignant progression, and is a therapeutic target in arthritis and cancer with the potential for rapid clinical translation PMID:24681547

  17. LRIG1 opposes epithelial to mesenchymal transition and inhibits invasion of basal-like breast cancer cells

    PubMed Central

    Yokdang, Nucharee; Hatakeyama, Jason; Wald, Jessica H.; Simion, Catalina; Tellez, Joseph D.; Chang, Dennis Z.; Swamynathan, Manojit Mosur; Chen, Mingyi; Murphy, William J.; Carraway, Kermit L.; Sweeney, Colleen

    2015-01-01

    LRIG1, a member of the LRIG family of transmembrane leucine rich repeat-containing proteins, is a negative regulator of receptor tyrosine kinase signaling and a tumor suppressor. LRIG1 expression is broadly decreased in human cancer and in breast cancer, low expression of LRIG1 has been linked to decreased relapse-free survival. Recently, low expression of LRIG1 was revealed to be an independent risk factor for breast cancer metastasis and death. These findings suggest that LRIG1 may oppose breast cancer cell motility and invasion, cellular processes which are fundamental to metastasis. However, very little is known of LRIG1 function in this regard. In this study, we demonstrate that LRIG1 is down-regulated during epithelial to mesenchymal transition (EMT) of human mammary epithelial cells, suggesting that LRIG1 expression may represent a barrier to EMT. Indeed, depletion of endogenous LRIG1 in human mammary epithelial cells expands the stem cell population, augments mammosphere formation and accelerates EMT. Conversely, expression of LRIG1 in highly invasive Basal B breast cancer cells provokes a mesenchymal to epithelial transition accompanied by a dramatic suppression of tumorsphere formation and a striking loss of invasive growth in three-dimensional culture. LRIG1 expression perturbs multiple signaling pathways and represses markers and effectors of the mesenchymal state. Furthermore, LRIG1 expression in MDA-MB-231 breast cancer cells significantly slows their growth as tumors, providing the first in vivo evidence that LRIG1 functions as a growth suppressor in breast cancer. PMID:26387542

  18. Overexpression of SDF-1 activates the NF-κB pathway to induce epithelial to mesenchymal transition and cancer stem cell-like phenotypes of breast cancer cells.

    PubMed

    Kong, Lingxin; Guo, Sufen; Liu, Chunfeng; Zhao, Yiling; Feng, Chong; Liu, Yunshuang; Wang, Tao; Li, Caijuan

    2016-03-01

    The formation of EMT and EMT-induced CSC-like phenotype is crucial for the metastasis of tumor cells. The stromal cell-derived factor-1 (SDF-1) is upregulated in various human carcinomas, which is closely associated with proliferation, migration, invasion and prognosis of malignancies. However, limited attention has been directed towards the effect of SDF-1 on epithelial to mesenchymal transition (EMT) or cancer stem cell (CSC)-like phenotype formation in breast cancer cells and the related mechanism. In the present study, we screened MCF-7 cells with low SDF-1 expression level for the purpose of evaluating whether SDF-1 is involved in EMT and CSC-like phenotype formation in MCF-7 cells. The pEGFP-N1-SDF-1 plasmid was transfected into MCF-7 cells, and the stably overexpressed SDF-1 in MCF-7 cells was confirmed by real-time PCR and western blot analysis. Colony formation assay, MTT, wound healing assay and Transwell invasion assay demonstrated that overexpression of SDF-1 significantly boosted the proliferation, migration and invasion of MCF-7 cells compared with parental (P<0.05). Flow cytometry analysis revealed a notable increase of CD44+/CD24- subpopulation in SDF-1 overexpressing MCF-7 cells (P<0.001), accompanied by the apparently elevated ALDH activity and the upregulation of the stem cell markers OCT-4, Nanog, and SOX2 compared with parental (P<0.01). Besides, western blot analysis and immunofluorescence assay observed the significant decreased expression of E-cadherin and enhanced expression of slug, fibronectin and vimentin in SDF-1 overexpressed MCF-7 cells in comparison with parental (P<0.01). Further study found that overexpression of SDF-1 induced the activation of NF-κB pathway in MCF-7 cells. Conversely, suppressing or silencing p65 expression by antagonist or RNA interference could remarkably increase the expression of E-cadherin in SDF-1 overexpressed MCF-7 cells (P<0.001). Overall, the above results indicated that overexpression of SDF-1 enhanced EMT by activating the NF-κB pathway of MCF-7 cells and further induced the formation of CSC-like phenotypes, ultimately promoting the proliferation and metastasis of MCF-7 cells. Therefore, SDF-1 may further be assessed as a potential target for gene therapy of breast cancer.

  19. High-Throughput Microfluidic Labyrinth for the Label-free Isolation of Circulating Tumor Cells.

    PubMed

    Lin, Eric; Rivera-Báez, Lianette; Fouladdel, Shamileh; Yoon, Hyeun Joong; Guthrie, Stephanie; Wieger, Jacob; Deol, Yadwinder; Keller, Evan; Sahai, Vaibhav; Simeone, Diane M; Burness, Monika L; Azizi, Ebrahim; Wicha, Max S; Nagrath, Sunitha

    2017-09-27

    We present "Labyrinth," a label-free microfluidic device to isolate circulating tumor cells (CTCs) using the combination of long loops and sharp corners to focus both CTCs and white blood cells (WBCs) at a high throughput of 2.5 mL/min. The high yield (>90%) and purity (600 WBCs/mL) of Labyrinth enabled us to profile gene expression in CTCs. As proof of principle, we used previously established cancer stem cell gene signatures to profile single cells isolated from the blood of breast cancer patients. We observed heterogeneous subpopulations of CTCs expressing genes for stem cells, epithelial cells, mesenchymal cells, and cells transitioning between epithelial and mesenchymal. Labyrinth offers a cell-surface marker-independent single-cell isolation platform to study heterogeneous CTC subpopulations. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Self-renewal of CD133(hi) cells by IL6/Notch3 signalling regulates endocrine resistance in metastatic breast cancer.

    PubMed

    Sansone, Pasquale; Ceccarelli, Claudio; Berishaj, Marjan; Chang, Qing; Rajasekhar, Vinagolu K; Perna, Fabiana; Bowman, Robert L; Vidone, Michele; Daly, Laura; Nnoli, Jennifer; Santini, Donatella; Taffurelli, Mario; Shih, Natalie N C; Feldman, Michael; Mao, Jun J; Colameco, Christopher; Chen, Jinbo; DeMichele, Angela; Fabbri, Nicola; Healey, John H; Cricca, Monica; Gasparre, Giuseppe; Lyden, David; Bonafé, Massimiliano; Bromberg, Jacqueline

    2016-02-09

    The mechanisms of metastatic progression from hormonal therapy (HT) are largely unknown in luminal breast cancer. Here we demonstrate the enrichment of CD133(hi)/ER(lo) cancer cells in clinical specimens following neoadjuvant endocrine therapy and in HT refractory metastatic disease. We develop experimental models of metastatic luminal breast cancer and demonstrate that HT can promote the generation of HT-resistant, self-renewing CD133(hi)/ER(lo)/IL6(hi) cancer stem cells (CSCs). HT initially abrogates oxidative phosphorylation (OXPHOS) generating self-renewal-deficient cancer cells, CD133(hi)/ER(lo)/OXPHOS(lo). These cells exit metabolic dormancy via an IL6-driven feed-forward ER(lo)-IL6(hi)-Notch(hi) loop, activating OXPHOS, in the absence of ER activity. The inhibition of IL6R/IL6-Notch pathways switches the self-renewal of CD133(hi) CSCs, from an IL6/Notch-dependent one to an ER-dependent one, through the re-expression of ER. Thus, HT induces an OXPHOS metabolic editing of luminal breast cancers, paradoxically establishing HT-driven self-renewal of dormant CD133(hi)/ER(lo) cells mediating metastatic progression, which is sensitive to dual targeted therapy.

  1. Protein Tyrosine Phosphatase 1B Inhibitors from the Stems of Akebia quinata.

    PubMed

    An, Jin-Pyo; Ha, Thi Kim Quy; Kim, Jinwoong; Cho, Tae Oh; Oh, Won Keun

    2016-08-19

    PTP1B deficiency in mouse mammary tumor virus (MMTV)-NeuNT transgenic mice inhibited the onset of MMTV-NeuNT-evoked breast cancer, while its overexpression was observed in breast cancer. Thus, PTP1B inhibitors are considered chemopreventative agents for breast cancer. As part of our program to find PTP1B inhibitors, one new diterpene glycoside (1) and 13 known compounds (2-14) were isolated from the methanol extract of the stems of Akebia quinata. All isolates were identified based on extensive spectroscopic data analysis, including UV, IR, NMR and MS. Compounds 2, 3, 6, 8 and 11 showed significant inhibitory effects on the PTP1B enzyme, with IC50 values ranging from 4.08 ± 1.09 to 21.80 ± 4.74 μM. PTP1B inhibitors also had concentration-dependent cytotoxic effects on breast cancer cell lines, such as MCF7, MDA-MB-231 and tamoxifen-resistant MCF7 (MCF7/TAMR) (IC50 values ranging from 0.84 ± 0.04 to 7.91 ± 0.39 μM). These results indicate that compounds 6 and 8 from Akebia quinata may be lead compounds acting as anti-breast cancer agents.

  2. The effects of restricted glycolysis on stem-cell like characteristics of breast cancer cells

    PubMed Central

    Banerjee, Arindam; Arvinrad, Pardis; Darley, Matthew; Laversin, Stéphanie A.; Parker, Rachel; Rose-Zerilli, Matthew J.J.; Townsend, Paul A.; Cutress, Ramsey I.; Beers, Stephen A.; Houghton, Franchesca D.; Birts, Charles N.; Blaydes, Jeremy P.

    2018-01-01

    Altered glycolysis is a characteristic of many cancers, and can also be associated with changes in stem cell-like cancer (SCLC) cell populations. We therefore set out to directly examine the effect of glycolysis on SCLC cell phenotype, using a model where glycolysis is stably reduced by adapting the cells to a sugar source other than glucose. Restricting glycolysis using this approach consistently resulted in cells with increased oncogenic potential; including an increase in SCLC cells, proliferation in 3D matrigel, invasiveness, chemoresistance, and altered global gene expression. Tumorigenicity in vivo was also markedly increased. SCLC cells exhibited increased dependence upon alternate metabolic pathways. They also became c-KIT dependent, indicating that their apparent state of maturation is regulated by glycolysis. Single-cell mRNA sequencing identified altered networks of metabolic-, stem- and signaling- gene expression within SCLC-enriched populations in response to glycolytic restriction. Therefore, reduced glycolysis, which may occur in niches within tumors where glucose availability is limiting, can promote tumor aggressiveness by increasing SCLC cell populations, but can also introduce novel, potentially exploitable, vulnerabilities in SCLC cells. PMID:29796188

  3. BMI-1 Promotes Self-Renewal of Radio- and Temozolomide (TMZ)-Resistant Breast Cancer Cells.

    PubMed

    Yan, Yanfang; Wang, Ying; Zhao, Pengxin; Ma, Weiyuan; Hu, Zhigang; Zhang, Kaili

    2017-12-01

    Breast cancer is a hormone-dependent malignancy and is the most prevalent cause of cancer-related mortality among females. Radiation therapy and chemotherapy are common treatments of breast cancer. However, tumor relapse and metastasis following therapy are major clinical challenges. The importance of B-lymphoma Moloney murine leukemia virus insertion region-1 (BMI-1) was implicated in cell proliferation, stem cell maintenance, and tumor initiation. We established radio- and temozolomide (TMZ)-resistant (IRC-R) MCF-7 and MDA-MB-231 cell lines to investigate the mechanism involved in therapeutic resistance. Cell proliferation and sphere number were dramatically elevated, and BMI-1 was remarkably upregulated, in IRC-R cells compared to parental cells. Silencing BMI-1 by RNA interference only affected the cell proliferation of IRC-R but not parental cells, suggesting the critical role of BMI-1 in radio- and TMZ resistance. We used a xenograft mice model to elucidate that BMI-1 was necessary in tumor development by assessing tumor volume and Ki67 expression. We found that Hedgehog (Hhg) signaling exerted synergized functions together with BMI-1, implicating the importance of BMI-1 in Hhg signaling. Downregulation of BMI-1 could be an effective strategy to suppress tumor growth, which supports the potential clinical use of targeting BMI-1 in breast cancer treatment.

  4. Evidence of a cellular immune response against sialyl-Tn in breast and ovarian cancer patients after high-dose chemotherapy, stem cell rescue, and immunization with Theratope STn-KLH cancer vaccine.

    PubMed

    Sandmaier, B M; Oparin, D V; Holmberg, L A; Reddish, M A; MacLean, G D; Longenecker, B M

    1999-01-01

    Seven ovarian and 33 breast high-risk stage II/III and stage IV cancer patients received high-dose chemotherapy followed by stem cell rescue. Thirty to 151 days after stem cell transplantation, the patients received their first immunotherapy treatment with Theratope STn-KLH cancer vaccine. Most patients developed increasing IgG anti-STn titers to a sustained peak after the fourth or fifth immunizations. Only one patient had elevated CA27.29 (MUC1 mucin) serum levels at trial entry. Five of the seven patients with preimmunotherapy elevated serum CA125 levels demonstrated decreasing CA125 levels during immunotherapy, consistent with an antitumor response. Evidence of STn antigen-specific T-cell proliferation was obtained from 17 of the 27 evaluable patients who received at least three immunotherapy treatments. Eleven of the 26 patients tested had evidence of an anti-STn TH1 antigen-specific T-cell response as determined by interferon-gamma, but not interleukin (IL)-4, production. After immunization, lytic activity of peripheral blood lymphocytes (PBLs) tested against a lymphokine activated killer (LAK)-sensitive cell line, a natural killer (NK)-sensitive cell line, and an STn-expressing cancer cell line (OVCAR) increased significantly. In vitro IL-2 treatment of the PBLs after vaccination greatly enhanced killing of the STn+ cancer cell line. Evidence of the development of OVCAR specific killing activity, over and above that seen due to LAK or NK killing, is presented. These studies provide the strongest evidence in humans of the development of an antitumor T-cell response after immunization with a cancer-associated carbohydrate antigen.

  5. Neural Stem Cell Delivery of Therapeutic Antibodies to Treat Breast Cancer Brain Metastases

    DTIC Science & Technology

    2010-10-01

    Barry AM, MacKenzie LT, Mikulis DJ, Palmieri D, Bronder JL, Steeg PS, Yoneda T, MacDonald IC, Chambers AF, Rutt BK, Foster PJ: In vivo MRI of cancer...Fransisco, CA). Caspase-3 was immunoprecipitated from cell lysates in the presence of protease inhibitors (Roche complete Mini tablet , EDTA-free and 2

  6. Mechanisms of Twist 1-Induced Invasion in Breast Cancer Metastasis

    DTIC Science & Technology

    2011-01-01

    with properties of stem cells. Cell 133, 704–715. Miller, L.D., Smeds , J., George, J., Vega, V.B., Vergara, L., Ploner, A., Pawitan, Y., Hall, P...Sotiriou, C., Wirapati, P., Loi, S., Harris, A., Fox, S., Smeds , J., Nordgren, H., Farmer, P., Praz, V., Haibe-Kains, B., et al. (2006). Gene expression

  7. A Phenotypic Cell-Binding Screen Identifies a Novel Compound Targeting Triple-Negative Breast Cancer.

    PubMed

    Chen, Luxi; Long, Chao; Youn, Jonghae; Lee, Jiyong

    2018-06-11

    We describe a "phenotypic cell-binding screen" by which therapeutic candidate targeting cancer cells of a particular phenotype can be isolated without knowledge of drug targets. Chemical library beads are incubated with cancer cells of the phenotype of interest in the presence of cancer cells lacking the phenotype of interest, and then the beads bound to only cancer cells of the phenotype of interest are selected as hits. We have applied this screening strategy in discovering a novel compound (LC129-8) targeting triple-negative breast cancer (TNBC). LC129-8 displayed highly specific binding to TNBC in cancer cell lines and patient-derived tumor tissues. LC129-8 exerted anti-TNBC activity by inducing apoptosis, inhibiting proliferation, reversing epithelial-mesenchymal transition, downregulating cancer stem cell activity and blocking in vivo tumor growth.

  8. The Role of Exosomes in Breast Cancer.

    PubMed

    Lowry, Michelle C; Gallagher, William M; O'Driscoll, Lorraine

    2015-12-01

    Although it has been long realized that eukaryotic cells release complex vesicular structures into their environment, only in recent years has it been established that these entities are not merely junk or debris, but that they are tailor-made specialized minimaps of their cell of origin and of both physiological and pathological relevance. These exosomes and microvesicles (ectosomes), collectively termed extracellular vesicles (EVs), are often defined and subgrouped first and foremost according to size and proposed origin (exosomes approximately 30-120 nm, endosomal origin; microvesicles 120-1000 nm, from the cell membrane). There is growing interest in elucidating the relevance and roles of EVs in cancer. Much of the pioneering work on EVs in cancer has focused on breast cancer, possibly because breast cancer is a leading cause of cancer-related deaths worldwide. This review provides an in-depth summary of such studies, supporting key roles for exosomes and other EVs in breast cancer cell invasion and metastasis, stem cell stimulation, apoptosis, immune system modulation, and anti-cancer drug resistance. Exosomes as diagnostic, prognostic, and/or predictive biomarkers and their potential use in the development of therapeutics are discussed. Although not fully elucidated, the involvement of exosomes in breast cancer development, progression, and resistance is becoming increasingly apparent from preclinical and clinical studies, with mounting interest in the potential exploitation of these vesicles for breast cancer biomarkers, as drug delivery systems, and in the development of future novel breast cancer therapies. © 2015 American Association for Clinical Chemistry.

  9. Down-regulation of vitamin D receptor in mammospheres: implications for vitamin D resistance in breast cancer and potential for combination therapy.

    PubMed

    Pervin, Shehla; Hewison, Martin; Braga, Melissa; Tran, Lac; Chun, Rene; Karam, Amer; Chaudhuri, Gautam; Norris, Keith; Singh, Rajan

    2013-01-01

    Vitamin D signaling in mammary cancer stem cells (MCSCs), which are implicated in the initiation and progression of breast cancer, is poorly understood. In this study, we examined vitamin D signaling in mammospheres which are enriched in MCSCs from established breast cancer cell lines. Breast cancer cells positive for aldehyde dehydrogenase (ALDH(+)) had increased ability to form mammospheres compared to ALDH(-) cells. These mammospheres expressed MCSC-specific markers and generated transplantable xenografts in nude mice. Vitamin D receptor (VDR) was significantly down-regulated in mammospheres, as well as in ALDH(+) breast cancer cells. TN aggressive human breast tumors as well as transplantable xenografts obtained from SKBR3 expressed significantly lower levels of VDR but higher levels of CD44 expression. Snail was up-regulated in mammospheres isolated from breast cancer cells. Inhibition of VDR expression by siRNA led to a significant change in key EMT-specific transcription factors and increased the ability of these cells to form mammospheres. On the other hand, over-expression of VDR led to a down-regulation of Snail but increased expression of E-cad and significantly compromised the ability of cells to form mammospheres. Mammospheres were relatively insensitive to treatment with 1,25-dihydroxyvitamin D (1,25D), the active form of vitamin D, compared to more differentiated cancer cells grown in presence of serum. Treatment of H-Ras transformed HMLE(HRas) cells with DETA NONOate, a nitric oxide (NO)-donor led to induction of MAP-kinase phosphatase -1 (MKP-1) and dephosphorylation of ERK1/2 in the mammospheres. Combined treatment of these cells with 1,25D and a low-concentration of DETA NONOate led to a significant decrease in the overall size of mammospheres and reduced tumor volume in nude mice. Our findings therefore, suggest that combination therapy using 1,25D with drugs specifically targeting key survival pathways in MCSCs warrant testing in prospective clinical trial for treatment of aggressive breast cancer.

  10. Selection of a Relevant In Vitro Blood-Brain Barrier Model to Investigate Pro-Metastatic Features of Human Breast Cancer Cell Lines.

    PubMed

    Drolez, Aurore; Vandenhaute, Elodie; Julien, Sylvain; Gosselet, Fabien; Burchell, Joy; Cecchelli, Roméo; Delannoy, Philippe; Dehouck, Marie-Pierre; Mysiorek, Caroline

    2016-01-01

    Around 7-17% of metastatic breast cancer patients will develop brain metastases, associated with a poor prognosis. To reach the brain parenchyma, cancer cells need to cross the highly restrictive endothelium of the Blood-Brain Barrier (BBB). As treatments for brain metastases are mostly inefficient, preventing cancer cells to reach the brain could provide a relevant and important strategy. For that purpose an in vitro approach is required to identify cellular and molecular interaction mechanisms between breast cancer cells and BBB endothelium, notably at the early steps of the interaction. However, while numerous studies are performed with in vitro models, the heterogeneity and the quality of BBB models used is a limitation to the extrapolation of the obtained results to in vivo context, showing that the choice of a model that fulfills the biological BBB characteristics is essential. Therefore, we compared pre-established and currently used in vitro models from different origins (bovine, mice, human) in order to define the most appropriate tool to study interactions between breast cancer cells and the BBB. On each model, the BBB properties and the adhesion capacities of breast cancer cell lines were evaluated. As endothelial cells represent the physical restriction site of the BBB, all the models consisted of endothelial cells from animal or human origins. Among these models, only the in vitro BBB model derived from human stem cells both displayed BBB properties and allowed measurement of meaningful different interaction capacities of the cancer cell lines. Importantly, the measured adhesion and transmigration were found to be in accordance with the cancer cell lines molecular subtypes. In addition, at a molecular level, the inhibition of ganglioside biosynthesis highlights the potential role of glycosylation in breast cancer cells adhesion capacities.

  11. Breast milk breaks new boundaries.

    PubMed

    Hilton, Sioned

    2012-01-01

    It is widely understood that breast milk is best for babies, but groundbreaking research continues to be conducted by the world's leading researchers to ensure we have the most recent knowledge to help breastfeeding mothers and give health professionals up to date guidance. This article provides a report from the recent International Breastfeeding and Lactation Symposium, hosted by Medela, touching on some of the key findings that were presented. This year's symposium revealed some exciting news for the breastfeeding world and here our reporter gives us a snap shot of the three most significant updates: further understanding of stem cells in breast milk, findings that have unlocked the power of human milk and insights into medication and breast milk.

  12. Metastatic breast carcinomas display genomic and transcriptomic heterogeneity

    PubMed Central

    Weigelt, Britta; Ng, Charlotte KY; Shen, Ronglai; Popova, Tatiana; Schizas, Michail; Natrajan, Rachael; Mariani, Odette; Stern, Marc-Henri; Norton, Larry; Vincent-Salomon, Anne; Reis-Filho, Jorge S

    2015-01-01

    Metaplastic breast carcinoma is a rare and aggressive histologic type of breast cancer, preferentially displaying a triple-negative phenotype. We sought to define the transcriptomic heterogeneity of metaplastic breast cancers on the basis of current gene expression microarray-based classifiers, and to determine whether these tumors display gene copy number profiles consistent with those of BRCA1-associated breast cancers. Twenty-eight consecutive triple-negative metaplastic breast carcinomas were reviewed, and the metaplastic component present in each frozen specimen was defined (ie, spindle cell, squamous, chondroid metaplasia). RNA and DNA extracted from frozen sections with tumor cell content >60% were subjected to gene expression (Illumina HumanHT-12 v4) and copy number profiling (Affymetrix SNP 6.0), respectively. Using the best practice PAM50/claudin-low microarray-based classifier, all metaplastic breast carcinomas with spindle cell metaplasia were of claudin-low subtype, whereas those with squamous or chondroid metaplasia were preferentially of basal-like subtype. Triple-negative breast cancer subtyping using a dedicated website (http://cbc.mc.vanderbilt.edu/tnbc/) revealed that all metaplastic breast carcinomas with chondroid metaplasia were of mesenchymal-like subtype, spindle cell carcinomas preferentially of unstable or mesenchymal stem-like subtype, and those with squamous metaplasia were of multiple subtypes. None of the cases was classified as immunomodulatory or luminal androgen receptor subtype. Integrative clustering, combining gene expression and gene copy number data, revealed that metaplastic breast carcinomas with spindle cell and chondroid metaplasia were preferentially classified as of integrative clusters 4 and 9, respectively, whereas those with squamous metaplasia were classified into six different clusters. Eight of the 26 metaplastic breast cancers subjected to SNP6 analysis were classified as BRCA1-like. The diversity of histologic features of metaplastic breast carcinomas is reflected at the transcriptomic level, and an association between molecular subtypes and histology was observed. BRCA1-like genomic profiles were found only in a subset (31%) of metaplastic breast cancers, and were not associated with a specific molecular or histologic subtype. PMID:25412848

  13. Sensitivity of Breast Cancer Stem Cells to TRA-8 Anti-DR5 Monoclonal Antibody

    DTIC Science & Technology

    2012-02-01

    cytotoxicity and reduction in BrCSC marker expression. A. 2LMP cells were sorted using flow cytometry for CD44+/CD24-/ALDHhigh. Cells were pre...cells were sorted using flow cytometry for ALDH? cells and allowed to form primary tumorspheres for 3 days. After tumorspheres were mechanically...n =5 ) Day Fig. 5 Effect of ex vivo treatment of BrCSC enriched cells on tumorgenicity in NOD/SCID mice. 2LMP cells were sorted using flow cytometry

  14. Engineering Breast Cancer Microenvironments and 3D Bioprinting

    PubMed Central

    Belgodere, Jorge A.; King, Connor T.; Bursavich, Jacob B.; Burow, Matthew E.; Martin, Elizabeth C.; Jung, Jangwook P.

    2018-01-01

    The extracellular matrix (ECM) is a critical cue to direct tumorigenesis and metastasis. Although two-dimensional (2D) culture models have been widely employed to understand breast cancer microenvironments over the past several decades, the 2D models still exhibit limited success. Overwhelming evidence supports that three dimensional (3D), physiologically relevant culture models are required to better understand cancer progression and develop more effective treatment. Such platforms should include cancer-specific architectures, relevant physicochemical signals, stromal–cancer cell interactions, immune components, vascular components, and cell-ECM interactions found in patient tumors. This review briefly summarizes how cancer microenvironments (stromal component, cell-ECM interactions, and molecular modulators) are defined and what emerging technologies (perfusable scaffold, tumor stiffness, supporting cells within tumors and complex patterning) can be utilized to better mimic native-like breast cancer microenvironments. Furthermore, this review emphasizes biophysical properties that differ between primary tumor ECM and tissue sites of metastatic lesions with a focus on matrix modulation of cancer stem cells, providing a rationale for investigation of underexplored ECM proteins that could alter patient prognosis. To engineer breast cancer microenvironments, we categorized technologies into two groups: (1) biochemical factors modulating breast cancer cell-ECM interactions and (2) 3D bioprinting methods and its applications to model breast cancer microenvironments. Biochemical factors include matrix-associated proteins, soluble factors, ECMs, and synthetic biomaterials. For the application of 3D bioprinting, we discuss the transition of 2D patterning to 3D scaffolding with various bioprinting technologies to implement biophysical cues to model breast cancer microenvironments. PMID:29881724

  15. Regulation of Breast Cancer Stem Cells by Tissue Rigidity

    DTIC Science & Technology

    2015-06-01

    investigated whether the TWIST1–G3BP2 mechanotrans- duction pathway has a significant role in human cancer progression. We first analysed The Cancer Genome ... the central conserved region. Proc. Natl Acad. Sci. USA 96, 9112–9117 (1999). 38. Singh, S. & Gramolini, A. O. Characterization of sequences in human...breast cancer gene expression data set (TCGA BRCA G4502A_07_3) was downloaded from the UCSC Cancer Genome Browser (https:// genome -cancer.ucsc.edu

  16. Six1 expands the mouse mammary epithelial stem/progenitor cell pool and induces mammary tumors that undergo epithelial-mesenchymal transition

    PubMed Central

    McCoy, Erica L.; Iwanaga, Ritsuko; Jedlicka, Paul; Abbey, Nee-Shamo; Chodosh, Lewis A.; Heichman, Karen A.; Welm, Alana L.; Ford, Heide L.

    2009-01-01

    Six1 is a developmentally regulated homeoprotein with limited expression in most normal adult tissues and frequent misexpression in a variety of malignancies. Here we demonstrate, using a bitransgenic mouse model, that misexpression of human Six1 in adult mouse mammary gland epithelium induces tumors of multiple histological subtypes in a dose-dependent manner. The neoplastic lesions induced by Six1 had an in situ origin, showed diverse differentiation, and exhibited progression to aggressive malignant neoplasms, as is often observed in human carcinoma of the breast. Strikingly, the vast majority of Six1-induced tumors underwent an epithelial-mesenchymal transition (EMT) and expressed multiple targets of activated Wnt signaling, including cyclin D1. Interestingly, Six1 and cyclin D1 coexpression was found to frequently occur in human breast cancers and was strongly predictive of poor prognosis. We further show that Six1 promoted a stem/progenitor cell phenotype in the mouse mammary gland and in Six1-driven mammary tumors. Our data thus provide genetic evidence for a potent oncogenic role for Six1 in mammary epithelial neoplasia, including promotion of EMT and stem cell–like features. PMID:19726883

  17. Salinomycin overcomes ABC transporter-mediated multidrug and apoptosis resistance in human leukemia stem cell-like KG-1a cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fuchs, Dominik; Institute of Immunology, University of Heidelberg, Im Neuenheimer Feld 305, D-69120 Heidelberg; Daniel, Volker

    2010-04-16

    Leukemia stem cells are known to exhibit multidrug resistance by expression of ATP-binding cassette (ABC) transporters which constitute transmembrane proteins capable of exporting a wide variety of chemotherapeutic drugs from the cytosol. We show here that human promyeloblastic leukemia KG-1a cells exposed to the histone deacetylase inhibitor phenylbutyrate resemble many characteristics of leukemia stem cells, including expression of functional ABC transporters such as P-glycoprotein, BCRP and MRP8. Consequently, KG-1a cells display resistance to the induction of apoptosis by various chemotherapeutic drugs. Resistance to apoptosis induction by chemotherapeutic drugs can be reversed by cyclosporine A, which effectively inhibits the activity ofmore » P-glycoprotein and BCRP, thus demonstrating ABC transporter-mediated drug resistance in KG-1a cells. However, KG-1a are highly sensitive to apoptosis induction by salinomycin, a polyether ionophore antibiotic that has recently been shown to kill human breast cancer stem cell-like cells and to induce apoptosis in human cancer cells displaying multiple mechanisms of drug and apoptosis resistance. Whereas KG-1a cells can be adapted to proliferate in the presence of apoptosis-inducing concentrations of bortezomib and doxorubicin, salinomycin does not permit long-term adaptation of the cells to apoptosis-inducing concentrations. Thus, salinomycin should be regarded as a novel and effective agent for the elimination of leukemia stem cells and other tumor cells exhibiting ABC transporter-mediated multidrug resistance.« less

  18. Awareness and current knowledge of breast cancer.

    PubMed

    Akram, Muhammad; Iqbal, Mehwish; Daniyal, Muhammad; Khan, Asmat Ullah

    2017-10-02

    Breast cancer remains a worldwide public health dilemma and is currently the most common tumour in the globe. Awareness of breast cancer, public attentiveness, and advancement in breast imaging has made a positive impact on recognition and screening of breast cancer. Breast cancer is life-threatening disease in females and the leading cause of mortality among women population. For the previous two decades, studies related to the breast cancer has guided to astonishing advancement in our understanding of the breast cancer, resulting in further proficient treatments. Amongst all the malignant diseases, breast cancer is considered as one of the leading cause of death in post menopausal women accounting for 23% of all cancer deaths. It is a global issue now, but still it is diagnosed in their advanced stages due to the negligence of women regarding the self inspection and clinical examination of the breast. This review addresses anatomy of the breast, risk factors, epidemiology of breast cancer, pathogenesis of breast cancer, stages of breast cancer, diagnostic investigations and treatment including chemotherapy, surgery, targeted therapies, hormone replacement therapy, radiation therapy, complementary therapies, gene therapy and stem-cell therapy etc for breast cancer.

  19. A Unique Opportunity to Test Whether Cell Fusion is a Mechanism of Breast Cancer Metastasis

    DTIC Science & Technology

    2013-07-01

    populations. Last cycle we optimized electroporation conditions for T47D and human mesenchymal stem cell populations and this cycle we have improved our...specific receptor-ligand interactions necessary for cell fusion, to produce a target for drug therapy. Post-fusion events might also be investigated...new tools for the study of the complex processes of cell fusion. The inducible bipartite nature of these strategies assures the accurate

  20. Cold Atmospheric Plasma for Selectively Ablating Metastatic Breast Cancer Cells

    PubMed Central

    Wang, Mian; Holmes, Benjamin; Cheng, Xiaoqian; Zhu, Wei; Keidar, Michael; Zhang, Lijie Grace

    2013-01-01

    Traditional breast cancer treatments such as surgery and radiotherapy contain many inherent limitations with regards to incomplete and nonselective tumor ablation. Cold atomospheric plasma (CAP) is an ionized gas where the ion temperature is close to room temperature. It contains electrons, charged particles, radicals, various excited molecules, UV photons and transient electric fields. These various compositional elements have the potential to either enhance and promote cellular activity, or disrupt and destroy them. In particular, based on this unique composition, CAP could offer a minimally-invasive surgical approach allowing for specific cancer cell or tumor tissue removal without influencing healthy cells. Thus, the objective of this research is to investigate a novel CAP-based therapy for selectively bone metastatic breast cancer treatment. For this purpose, human metastatic breast cancer (BrCa) cells and bone marrow derived human mesenchymal stem cells (MSCs) were separately treated with CAP, and behavioral changes were evaluated after 1, 3, and 5 days of culture. With different treatment times, different BrCa and MSC cell responses were observed. Our results showed that BrCa cells were more sensitive to these CAP treatments than MSCs under plasma dose conditions tested. It demonstrated that CAP can selectively ablate metastatic BrCa cells in vitro without damaging healthy MSCs at the metastatic bone site. In addition, our study showed that CAP treatment can significantly inhibit the migration and invasion of BrCa cells. The results suggest the great potential of CAP for breast cancer therapy. PMID:24040051

  1. Chemo Resistance of Breast Cancer Stem Cells

    DTIC Science & Technology

    2007-05-01

    Thus PTEN deficiency results in myeloproliferative disorders and eventually leukemia (112, 113). The most recent study by He et al, using...Gateff E. Malignant neoplasms of genetic origin in Drosophila melanogaster. Science. 1978 Jun 30;200(4349):1448-59. 48. Nusslein-Volhard C, Wieschaus

  2. Metformin selectively affects human glioblastoma tumor-initiating cell viability: A role for metformin-induced inhibition of Akt.

    PubMed

    Würth, Roberto; Pattarozzi, Alessandra; Gatti, Monica; Bajetto, Adirano; Corsaro, Alessandro; Parodi, Alessia; Sirito, Rodolfo; Massollo, Michela; Marini, Cecilia; Zona, Gianluigi; Fenoglio, Daniela; Sambuceti, Gianmario; Filaci, Gilberto; Daga, Antonio; Barbieri, Federica; Florio, Tullio

    2013-01-01

    Cancer stem cell theory postulates that a small population of tumor-initiating cells is responsible for the development, progression and recurrence of several malignancies, including glioblastoma. In this perspective, tumor-initiating cells represent the most relevant target to obtain effective cancer treatment. Metformin, a first-line drug for type II diabetes, was reported to possess anticancer properties affecting the survival of cancer stem cells in breast cancer models. We report that metformin treatment reduced the proliferation rate of tumor-initiating cell-enriched cultures isolated from four human glioblastomas. Metformin also impairs tumor-initiating cell spherogenesis, indicating a direct effect on self-renewal mechanisms. Interestingly, analyzing by FACS the antiproliferative effects of metformin on CD133-expressing subpopulation, a component of glioblastoma cancer stem cells, a higher reduction of proliferation was observed as compared with CD133-negative cells, suggesting a certain degree of cancer stem cell selectivity in its effects. In fact, glioblastoma cell differentiation strongly reduced sensitivity to metformin treatment. Metformin effects in tumor-initiating cell-enriched cultures were associated with a powerful inhibition of Akt-dependent cell survival pathway, while this pathway was not affected in differentiated cells. The specificity of metformin antiproliferative effects toward glioblastoma tumor-initiating cells was confirmed by the lack of significant inhibition of normal human stem cells (umbilical cord-derived mesenchymal stem cells) in vitro proliferation after metformin exposure. Altogether, these data clearly suggest that metformin exerts antiproliferative activity on glioblastoma cells, showing a higher specificity toward tumor-initiating cells, and that the inhibition of Akt pathway may represent a possible intracellular target of this effect.

  3. The Nuclear Receptor, RORγ, Regulates Pathways Necessary for Breast Cancer Metastasis

    PubMed Central

    Oh, Tae Gyu; Wang, Shu-Ching M.; Acharya, Bipul R.; Goode, Joel M.; Graham, J. Dinny; Clarke, Christine L.; Yap, Alpha S.; Muscat, George E.O.

    2016-01-01

    We have previously reported that RORγ expression was decreased in ER − ve breast cancer, and increased expression improves clinical outcomes. However, the underlying RORγ dependent mechanisms that repress breast carcinogenesis have not been elucidated. Here we report that RORγ negatively regulates the oncogenic TGF-β/EMT and mammary stem cell (MaSC) pathways, whereas RORγ positively regulates DNA-repair. We demonstrate that RORγ expression is: (i) decreased in basal-like subtype cancers, and (ii) inversely correlated with histological grade and drivers of carcinogenesis in breast cancer cohorts. Furthermore, integration of RNA-seq and ChIP-chip data reveals that RORγ regulates the expression of many genes involved in TGF-β/EMT-signaling, DNA-repair and MaSC pathways (including the non-coding RNA, LINC00511). In accordance, pharmacological studies demonstrate that an RORγ agonist suppresses breast cancer cell viability, migration, the EMT transition (microsphere outgrowth) and mammosphere-growth. In contrast, RNA-seq demonstrates an RORγ inverse agonist induces TGF-β/EMT-signaling. These findings suggest pharmacological modulation of RORγ activity may have utility in breast cancer. PMID:27211549

  4. The Critical, Clinical Role of Interferon-Beta in Regulating Cancer Stem Cell Properties in Triple-Negative Breast Cancer.

    PubMed

    Doherty, Mary R; Jackson, Mark W

    2018-05-11

    Triple-negative breast cancer (TNBC) the deadliest form of this disease currently lacks a targeted therapy and is characterized by increased risk of metastasis and presence of therapeutically resistant cancer stem cells (CSC). Recent evidence has demonstrated that the presence of an interferon (IFN)/signal transducer of activated transcription 1 (STAT1) gene signature correlates with improved therapeutic response and overall survival in TNBC patients. In agreement with these clinical observations, our recent work has demonstrated, in a cell model of TNBC that CSC have intrinsically repressed IFN signaling. Administration of IFN-β represses CSC properties, inducing a less aggressive non-CSC state. Moreover, an elevated IFN-β gene signature correlated with repressed CSC-related genes and an increased presence of tumor-infiltrating lymphocytes in TNBC specimens. We therefore propose that IFN-β be considered as a potential therapeutic option in the treatment of TNBC, to repress the CSC properties responsible for therapy failure. Future studies aim to improve methods to target delivery of IFN-β to tumors, to maximize therapeutic efficacy while minimizing systemic side effects.

  5. KAP1 promotes proliferation and metastatic progression of breast cancer cells.

    PubMed

    Addison, Joseph B; Koontz, Colton; Fugett, James H; Creighton, Chad J; Chen, Dongquan; Farrugia, Mark K; Padon, Renata R; Voronkova, Maria A; McLaughlin, Sarah L; Livengood, Ryan H; Lin, Chen-Chung; Ruppert, J Michael; Pugacheva, Elena N; Ivanov, Alexey V

    2015-01-15

    KAP1 (TRIM28) is a transcriptional regulator in embryonic development that controls stem cell self-renewal, chromatin organization, and the DNA damage response, acting as an essential corepressor for KRAB family zinc finger proteins (KRAB-ZNF). To gain insight into the function of this large gene family, we developed an antibody that recognizes the conserved zinc fingers linker region (ZnFL) in multiple KRAB-ZNF. Here, we report that the expression of many KRAB-ZNF along with active SUMOlyated KAP1 is elevated widely in human breast cancers. KAP1 silencing in breast cancer cells reduced proliferation and inhibited the growth and metastasis of tumor xenografts. Conversely, KAP1 overexpression stimulated cell proliferation and tumor growth. In cells where KAP1 was silenced, we identified multiple downregulated genes linked to tumor progression and metastasis, including EREG/epiregulin, PTGS2/COX2, MMP1, MMP2, and CD44, along with downregulation of multiple KRAB-ZNF proteins. KAP1-dependent stabilization of KRAB-ZNF required direct interactions with KAP1. Together, our results show that KAP1-mediated stimulation of multiple KRAB-ZNF contributes to the growth and metastasis of breast cancer. ©2014 American Association for Cancer Research.

  6. Modeling triple-negative breast cancer heterogeneity: effects of stromal macrophages, fibroblasts and tumor vasculature.

    PubMed

    Norton, Kerri-Ann; Jin, Kideok; Popel, Aleksander S

    2018-05-08

    A hallmark of breast tumors is its spatial heterogeneity that includes its distribution of cancer stem cells and progenitor cells, but also heterogeneity in the tumor microenvironment. In this study we focus on the contributions of stromal cells, specifically macrophages, fibroblasts, and endothelial cells on tumor progression. We develop a computational model of triple-negative breast cancer based on our previous work and expand it to include macrophage infiltration, fibroblasts, and angiogenesis. In vitro studies have shown that the secretomes of tumor-educated macrophages and fibroblasts increase both the migration and proliferation rates of triple-negative breast cancer cells. In vivo studies also demonstrated that blocking signaling of selected secreted factors inhibits tumor growth and metastasis in mouse xenograft models. We investigate the influences of increased migration and proliferation rates on tumor growth, the effect of the presence on fibroblasts or macrophages on growth and morphology, and the contributions of macrophage infiltration on tumor growth. We find that while the presence of macrophages increases overall tumor growth, the increase in macrophage infiltration does not substantially increase tumor growth and can even stifle tumor growth at excessive rates. Copyright © 2018. Published by Elsevier Ltd.

  7. SUPPRESSION OF THE EPITHELIAL-MESENCHYMAL TRANSITION BY GRAINYHEAD-LIKE-2

    PubMed Central

    Cieply, Benjamin; Riley, Philip; Pifer, Phillip M.; Widmeyer, Joseph; Addison, Joseph B.; Ivanov, Alexey V.; Denvir, James; Frisch, Steven M.

    2012-01-01

    Grainyhead genes are involved in wound healing and developmental neural tube closure. In light of the high degree of similarity between the epithelial-mesenchymal transitions (EMT) occurring in wound healing processes and the cancer stem cell-like compartment of tumors, including TGF-β-dependence, we investigated the role of the Grainyhead gene, Grainyhead-Like-2 (GRHL2) in oncogenic EMT. GRHL2 was down-regulated specifically in the claudin-low subclass breast tumors and in basal-B subclass breast cancer cell lines. GRHL2 suppressed TGF-β-induced, Twist-induced or spontaneous EMT, enhanced anoikis-sensitivity, and suppressed mammosphere generation in mammary epithelial cells. These effects were mediated in part by suppression of ZEB1 expression via direct repression of the ZEB1 promoter. GRHL2 also inhibited Smad-mediated transcription and it upregulated mir200b/c as well as the TGF-β receptor antagonist, BMP2. Lastly, ectopic expression of GRHL2 in MDA-MB-231 breast cancer cells triggered a mesenchymal-to-epithelial transition and restored sensitivity to anoikis. Taken together, our findings define a major role for GRHL2 in the suppression of oncogenic EMT in breast cancer cells. PMID:22379025

  8. PTP1B promotes aggressiveness of breast cancer cells by regulating PTEN but not EMT.

    PubMed

    Liu, Xue; Chen, Qian; Hu, Xu-Gang; Zhang, Xian-Chao; Fu, Ti-Wei; Liu, Qing; Liang, Yan; Zhao, Xi-Long; Zhang, Xia; Ping, Yi-Fang; Bian, Xiu-Wu

    2016-10-01

    Metastasis is a complicated, multistep process and remains the major cause of cancer-related mortality. Exploring the molecular mechanisms underlying tumor metastasis is crucial for development of new strategies for cancer prevention and treatment. In this study, we found that protein tyrosine phosphatase 1B (PTP1B) promoted breast cancer metastasis by regulating phosphatase and tensin homolog (PTEN) but not epithelial-mesenchymal transition (EMT). By detecting PTP1B expression of the specimens from 128 breast cancer cases, we found that the level of PTP1B was higher in breast cancer tissues than the corresponding adjacent normal tissues. Notably, PTP1B was positively associated with lymph node metastasis (LNM) and estrogen receptor (ER) status. In vitro, disturbing PTP1B expression obviously attenuated cell migration and invasion. On the contrary, PTP1B overexpression significantly increased migration and invasion of breast cancer cells. Mechanistically, PTP1B knockdown upregulated PTEN, accompanied with an abatement of AKT phosphorylation and the expression of matrix metalloproteinase 2 (MMP2) and MMP7. Conversely, forced expression of PTP1B reduced PTEN and increased AKT phosphorylation as well as the expression of MMP2 and MMP7. Notably, neither EMT nor stemness of breast cancer cells was regulated by PTP1B. We also found that PTP1B acted as an independent prognostic factor and predicted poor prognosis in ER-positive breast cancer patients. Taken together, our findings provide advantageous evidence for the development of PTP1B as a potential therapeutic target for breast cancer, especially for ER-positive breast cancer patients.

  9. Mesenchymal Stem Cells for Vascular Target Discovery in Breast Cancer-Associated Angiogenesis

    DTIC Science & Technology

    2004-09-01

    Matrigel plug and sorted by flow cytometry . Sorting of these retrieved cells based on co-expression of the GFP marker and cell- surface endothelial...express the green fluorescent protein (GFP) and clonal MSC populations can be isolated and phenotypically and genotypically analyzed by flow cytometry ...monoclonal populations of these GFP+ murine MSCs and conducted flow cytometry analysis to determine their phenotype. Specifically, we determined if

  10. Adipose progenitor cells increase fibronectin matrix strain and unfolding in breast tumors

    NASA Astrophysics Data System (ADS)

    Chandler, E. M.; Saunders, M. P.; Yoon, C. J.; Gourdon, D.; Fischbach, C.

    2011-02-01

    Increased stiffness represents a hallmark of breast cancer that has been attributed to the altered physicochemical properties of the extracellular matrix (ECM). However, the role of fibronectin (Fn) in modulating the composition and mechanical properties of the tumor-associated ECM remains unclear. We have utilized a combination of biochemical and physical science tools to evaluate whether paracrine signaling between breast cancer cells and adipose progenitor cells regulates Fn matrix assembly and stiffness enhancement in the tumor stroma. In particular, we utilized fluorescence resonance energy transfer imaging to map the molecular conformation and stiffness of Fn that has been assembled by 3T3-L1 preadipocytes in response to conditioned media from MDA-MB231 breast cancer cells. Our results reveal that soluble factors secreted by tumor cells promote Fn expression, unfolding, and stiffening by adipose progenitor cells and that transforming growth factor-β serves as a soluble cue underlying these changes. In vivo experiments using orthotopic co-transplantation of primary human adipose-derived stem cells and MDA-MB231 into SCID mice support the pathological relevance of our results. Insights gained by these studies advance our understanding of the role of Fn in mammary tumorigenesis and may ultimately lead to improved anti-cancer therapies.

  11. Antioxidant Activity and ROS-Dependent Apoptotic Effect of Scurrula ferruginea (Jack) Danser Methanol Extract in Human Breast Cancer Cell MDA-MB-231

    PubMed Central

    Marvibaigi, Mohsen; Amini, Neda; Supriyanto, Eko; Abdul Majid, Fadzilah Adibah; Kumar Jaganathan, Saravana; Jamil, Shajarahtunnur; Hamzehalipour Almaki, Javad; Nasiri, Rozita

    2016-01-01

    Scurrula ferruginea (Jack) Danser is one of the mistletoe species belonging to Loranthaceae family, which grows on the branches of many deciduous trees in tropical countries. This study evaluated the antioxidant activities of S. ferruginea extracts. The cytotoxic activity of the selected extracts, which showed potent antioxidant activities, and high phenolic and flavonoid contents, were investigated in human breast cancer cell line (MDA-MB-231) and non-cancer human skin fibroblast cells (HSF-1184). The activities and characteristics varied depending on the different parts of S. ferruginea, solvent polarity, and concentrations of extracts. The stem methanol extract showed the highest amount of both phenolic (273.51 ± 4.84 mg gallic acid/g extract) and flavonoid contents (163.41 ± 4.62 mg catechin/g extract) and strong DPPH• radical scavenging (IC50 = 27.81 μg/mL) and metal chelation activity (IC50 = 80.20 μg/mL). The stem aqueous extract showed the highest ABTS•+ scavenging ability. The stem methanol and aqueous extracts exhibited dose-dependent cytotoxic activity against MDA-MB-231 cells with IC50 of 19.27 and 50.35 μg/mL, respectively. Furthermore, the extracts inhibited the migration and colony formation of MDA-MB-231 cells in a concentration-dependent manner. Morphological observations revealed hallmark properties of apoptosis in treated cells. The methanol extract induced an increase in ROS generation and mitochondrial depolarization in MDA-MB-231 cells, suggesting its potent apoptotic activity. The present study demonstrated that the S. ferruginea methanol extract mediated MDA-MB-231 cell growth inhibition via induction of apoptosis which was confirmed by Western blot analysis. It may be a potential anticancer agent; however, its in vivo anticancer activity needs to be investigated. PMID:27410459

  12. Long Non-Coding RNA HOTAIR Regulates the Proliferation, Self-Renewal Capacity, Tumor Formation and Migration of the Cancer Stem-Like Cell (CSC) Subpopulation Enriched from Breast Cancer Cells.

    PubMed

    Deng, Jia; Yang, Mengchang; Jiang, Rong; An, Ning; Wang, Xiaoshan; Liu, Bin

    2017-01-01

    Long non-coding RNAs (lncRNAs) play important roles in the malignant behavior of cancer. HOTAIR, a well-studied lncRNA, contributes to breast cancer development, and overexpression of HOTAIR predicts a poor prognosis. However, the regulatory role of HOTAIR in the cancer stem-like cell (CSC) subpopulation remains largely unknown. Our goal was to determine the regulatory functions of HOTAIR in the processes of self-renewal capacity, tumor formation and proliferation of CSCs derived from breast cancer. We first enriched and incubated the CSC population derived from breast cancer cell line MCF7 (CSC-MCF7) or MDA-MB-231 (MB231, CSC-MB231). Self-renewal capacity and tumor formation were assessed in vitro and in vivo to determine the stemness of CSCs. We assessed the impact on ectopically upregulated or downregulated expression of HOTAIR in CSCs by soft agar, self-renewal capacity and CCK-8 assays. The functional domain of HOTAIR was determined by truncation. RT-qPCR and semiquantitative Western blotting were performed to detect the expression levels of genes of interest. Chromatin IP (ChIP) was employed to detect the transcriptional regulatory activity of p53 on its target gene. After the identification of CSC properties, RT-qPCR analysis revealed that HOTAIR, but not other cancer-associated lncRNAs, is highly upregulated in both CSC-MCF7 and CSC-MB231 populations compared with MCF7 and MB231 populations. By modulating the level of HOTAIR expression, we showed that HOTAIR tightly regulates the proliferation, colony formation, migration and self-renewal capacity of CSCs. Moreover, full-length HOTAIR transcriptionally inhibits miR-34a specifically, leading to upregulation of Sox2, which is targeted by miR-34a. Ectopic introduction of miR-34a mimics reverses the effects of HOTAIR on the physiological processes of CSCs, indicating that HOTAIR affects these processes, including self-renewal capacity; these effects are dependent on the regulation of Sox2 via miR-34a. Interestingly, tight transcriptional regulation of p53 by HOTAIR was found; accordingly, p21 is indirectly regulated by HOTAIR, resulting in cell cycle entry. These results suggest that HOTAIR is a key regulator of proliferation, colony formation, invasion and self-renewal capacity in breast CSCs, which occurs in part through regulation of Sox2 and p53.

  13. Established breast cancer stem cell markers do not correlate with in vivo tumorigenicity of tumor-initiating cells

    PubMed Central

    LEHMANN, CHRISTIAN; JOBS, GABRIELE; THOMAS, MARKUS; BURTSCHER, HELMUT; KUBBIES, MANFRED

    2012-01-01

    The tumor-initiating capacity of primary human breast cancer cells is maintained in vitro by culturing these cells as spheres/aggregates. Inoculation of small cell numbers derived from these non-adherent cultures leads to rapid xenograft tumor formation in mice. Accordingly, injection of more differentiated monolayer cells derived from spheres results in significantly decelerated tumor growth. For our study, two breast cancer cell lines were generated from primary tumors and cultured as mammospheres or as their adherent counterparts. We examined the in vivo tumorigenicity of these cells by injecting serial dilutions into immunodeficient mice. Inoculation of 106 cells per mouse led to rapid tumor formation, irrespective of cell line or culture conditions. However, after injection of only 103 cells, solely sphere cells were highly tumorigenic. In vitro, we investigated differentiation markers, established breast CSC markers and conducted mRNA profiling. Cytokeratin 5 and 18 were increased in both monolayer cell types, indicating a more differentiated phenotype. All cell lines were CD24−/CD44+ and did not express CD133, CD326 or E-cadherin. ALDH1 activity was not detectable in any cell line. A verapamil-sensitive Hoechst side population was present in sphere cells, but there was no correlation with tumorigenicity in vivo. mRNA profiling did not reveal upregulation of relevant transcription factors. In vitro cell cycle kinetics and in vivo tumor doubling times displayed no difference between sphere and monolayer cultures. Our data indicate that intrinsic genetic and functional markers investigated are not indicative of the in vivo tumori-genicity of putative breast tumor-initiating cells. PMID:23042145

  14. [Tandem transplantation with peripheral autologous hematopoietic blood stem cells in treatment of oncologic and hematologic malignancies. Initial results of the Donauspital, Vienna].

    PubMed

    Ruckser, R; Kier, P; Sebesta, C; Kittl, E; Kurz, M; Selleny, S; Höniger, S; Scherz, M; Habertheuer, K H; Zelenka, P

    1995-01-01

    10 patients were subjected to tandem transplantation for breast cancer (n = 3), ovarian cancer (n = 2) and multiple myeloma (n = 5), at the Second Department of Medicine, Donauspital, Vienna. The breast cancer patients were in stages 2 and 3, respectively, at diagnosis and entered complete remission thereafter. 2 of them developed lymph node metastasis and additional local recurrence, the 3rd patient presented with distant metastasis. The 2 patients with ovarian cancer were in stages Figo III and IV, respectively, at the time of diagnosis, and showed minimal residual disease at second-look-operation. 5 patients with multiple myeloma were in stage 3 pretransplant. Peripheral stem cells were obtained after either high-dose cyclophosphamide or FEC induction and application of cytokines. In 4 patients, tandem transplantation has been completed. 1 patient with multiple myeloma, who had received total body irradiation in combination with chemotherapy for the 2nd transplant, succumbed from idiopathic interstitial pneumonia. No severe clinical complications were observed in all other patients. All patients with solid tumors entered complete remission after the 1st transplantation. 3 of them completed tandem transplantation. Of these, 2 remain in continuous complete remission, the 3rd patient relapsed in lymph nodes day 485. In patients who received only 1 course of high dose chemotherapy with stem cell transplantation, relapses occurred on days 29 and 75, respectively. All patients with multiple myeloma entered only partial remission. We conclude that supralethal chemotherapy with peripheral blood stem cell support is a safe procedure that may at least induce prolonged remissions in solid tumors and hematologic malignancies.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. Curcumin: the spicy modulator of breast carcinogenesis.

    PubMed

    Banik, Urmila; Parasuraman, Subramani; Adhikary, Arun Kumar; Othman, Nor Hayati

    2017-07-19

    Worldwide breast cancer is the most common cancer in women. For many years clinicians and the researchers are examining and exploring various therapeutic modalities for breast cancer. Yet the disease has remained unconquered and the quest for cure is still going on. Present-day strategy of breast cancer therapy and prevention is either combination of a number of drugs or a drug that modulates multiple targets. In this regard natural products are now becoming significant options. Curcumin exemplifies a promising natural anticancer agent for this purpose. This review primarily underscores the modulatory effect of curcumin on the cancer hallmarks. The focus is its anticancer effect in the complex pathways of breast carcinogenesis. Curcumin modulates breast carcinogenesis through its effect on cell cycle and proliferation, apoptosis, senescence, cancer spread and angiogenesis. Largely the NFkB, PI3K/Akt/mTOR, MAPK and JAK/STAT are the key signaling pathways involved. The review also highlights the curcumin mediated modulation of tumor microenvironment, cancer immunity, breast cancer stem cells and cancer related miRNAs. Using curcumin as a therapeutic and preventive agent in breast cancer is perplexed by its diverse biological activity, much of which remains inexplicable. The information reviewed here should point toward potential scope of future curcumin research in breast cancer.

  16. The milk protein α-casein functions as a tumor suppressor via activation of STAT1 signaling, effectively preventing breast cancer tumor growth and metastasis

    PubMed Central

    Bonuccelli, Gloria; Castello-Cros, Remedios; Capozza, Franco; Martinez-Outschoorn, Ubaldo E.; Lin, Zhao; Tsirigos, Aristotelis; Xuanmao, Jiao; Whitaker-Menezes, Diana; Howell, Anthony; Lisanti, Michael P.; Sotgia, Federica

    2012-01-01

    Here, we identified the milk protein α-casein as a novel suppressor of tumor growth and metastasis. Briefly, Met-1 mammary tumor cells expressing α-casein showed a ~5-fold reduction in tumor growth and a near 10-fold decrease in experimental metastasis. To identify the molecular mechanism(s), we performed genome-wide transcriptional profiling. Interestingly, our results show that α-casein upregulates gene transcripts associated with interferon/STAT1 signaling and downregulates genes associated with “stemness.” These findings were validated by immunoblot and FACS analysis, which showed the upregulation and hyperactivation of STAT1 and a decrease in the number of CD44(+) “cancer stem cells.” These gene signatures were also able to predict clinical outcome in human breast cancer patients. Thus, we conclude that a lactation-based therapeutic strategy using recombinant α-casein would provide a more natural and non-toxic approach to the development of novel anticancer therapies. PMID:23047602

  17. Prolactin Alters the Mammary Epithelial Hierarchy, Increasing Progenitors and Facilitating Ovarian Steroid Action.

    PubMed

    O'Leary, Kathleen A; Shea, Michael P; Salituro, Stephanie; Blohm, Courtney E; Schuler, Linda A

    2017-10-10

    Hormones drive mammary development and function and play critical roles in breast cancer. Epidemiologic studies link prolactin (PRL) to increased risk for aggressive cancers that express estrogen receptor α (ERα). However, in contrast to ovarian steroids, PRL actions on the mammary gland outside of pregnancy are poorly understood. We employed the transgenic NRL-PRL model to examine the effects of PRL alone and with defined estrogen/progesterone exposure on stem/progenitor activity and regulatory networks that drive epithelial differentiation. PRL increased progenitors and modulated transcriptional programs, even without ovarian steroids, and with steroids further raised stem cell activity associated with elevated canonical Wnt signaling. However, despite facilitating some steroid actions, PRL opposed steroid-driven luminal maturation and increased CD61 + luminal cells. Our findings demonstrate that PRL can powerfully influence the epithelial hierarchy alone and temper the actions of ovarian steroids, which may underlie its role in the development of breast cancer. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  18. Resveratrol suppresses growth of cancer stem-like cells by inhibiting fatty acid synthase.

    PubMed

    Pandey, Puspa R; Okuda, Hiroshi; Watabe, Misako; Pai, Sudha K; Liu, Wen; Kobayashi, Aya; Xing, Fei; Fukuda, Koji; Hirota, Shigeru; Sugai, Tamotsu; Wakabayashi, Go; Koeda, Keisuke; Kashiwaba, Masahiro; Suzuki, Kazuyuki; Chiba, Toshimi; Endo, Masaki; Fujioka, Tomoaki; Tanji, Susumu; Mo, Yin-Yuan; Cao, Deliang; Wilber, Andrew C; Watabe, Kounosuke

    2011-11-01

    Resveratrol is a natural polyphenolic compound and has been shown to exhibit cardio-protective as well as anti-neoplastic effects on various types of cancers. However, the exact mechanism of its anti-tumor effect is not clearly defined. Resveratrol has been shown to have strong hypolipidemic effect on normal adipocytes and as hyper-lipogenesis is a hallmark of cancer cell physiology, the effect of resveratrol on lipid synthesis in cancer stem-like cells (CD24(-)/CD44(+)/ESA(+)) that were isolated from both ER+ and ER- breast cancer cell lines was examined. The authors found that resveratrol significantly reduced the cell viability and mammosphere formation followed by inducing apoptosis in cancer stem-like cells. This inhibitory effect of resveratrol is accompanied by a significant reduction in lipid synthesis which is caused by the down-regulation of the fatty acid synthase (FAS) gene followed by up-regulation of pro-apoptotic genes, DAPK2 and BNIP3. The activation of apoptotic pathway in the cancer stem-like cells was suppressed by TOFA and by Fumonisin B1, suggesting that resveratrol-induced apoptosis is indeed through the modulation of FAS-mediated cell survival signaling. Importantly, resveratrol was able to significantly suppress the growth of cancer stem-like cells in an animal model of xenograft without showing apparental toxicity. Taken together, the results of this study indicate that resveratrol is capable of inducing apoptosis in the cancer stem-like cells through suppression of lipogenesis by modulating FAS expression, which highlights a novel mechanism of anti-tumor effect of resveratrol.

  19. Resveratrol suppresses growth of cancer stem-like cells by inhibiting fatty acid synthase

    PubMed Central

    Pandey, Puspa R.; Okuda, Hiroshi; Watabe, Misako; Pai, Sudha K.; Liu, Wen; Kobayashi, Aya; Xing, Fei; Fukuda, Koji; Hirota, Shigeru; Sugai, Tamotsu; Wakabayashi, Go; Koeda, Keisuke; Kashiwaba, Masahiro; Suzuki, Kazuyuki; Chiba, Toshimi; Endo, Masaki; Fujioka, Tomoaki; Tanji, Susumu; Mo, Yin-Yuan; Cao, Deliang; Wilber, Andrew C.; Watabe, Kounosuke

    2012-01-01

    Resveratrol is a natural polyphenolic compound and has been shown to exhibit cardio-protective as well as anti-neoplastic effects on various types of cancers. However, the exact mechanism of its anti-tumor effect is not clearly defined. Resveratrol has been shown to have strong hypolipidemic effect on normal adipocytes and as hyper-lipogenesis is a hallmark of cancer cell physiology, we examined the effect of resveratrol on lipid synthesis in cancer stem-like cells (CD24−/CD44+/ESA+) that were isolated from both ER+ and ER− breast cancer cell lines. We found that resveratrol significantly reduced the cell viability and mammosphere formation followed by inducing apoptosis in cancer stem-like cells. This inhibitory effect of resveratrol is accompanied by a significant reduction in lipid synthesis which is caused by the down-regulation of the fatty acid synthase (FAS) gene followed by up-regulation of pro-apoptotic genes, DAPK2 and BNIP3. The activation of apoptotic pathway in the cancer stem-like cells was suppressed by TOFA and by Fumonisin B1, suggesting that resveratrol-induced apoptosis is indeed through the modulation of FAS-mediated cell survival signaling. Importantly, resveratrol was able to significantly suppress the growth of cancer stem-like cells in an animal model of xenograft without showing apparental toxicity. Taken together, our results indicate that resveratrol is capable of inducing apoptosis in the cancer stem-like cells through suppression of lipogenesis by modulating FAS expression, which highlights a novel mechanism of anti-tumor effect of resveratrol. PMID:21188630

  20. Mel-18 negatively regulates stem cell-like properties through downregulation of miR-21 in gastric cancer

    PubMed Central

    Hua, Rui-Xi; Du, Yi-Qun; Huang, Ming-Zhu; Liu, Yong; Cheng, Yu Fang; Guo, Wei-Jian

    2016-01-01

    Mel-18, a polycomb group protein, has been reported to act as a tumor suppressor and be down-regulated in several human cancers including gastric cancer. It was also found that Mel-18 negatively regulates self-renewal of hematopoietic stem cells and breast cancer stem cells (CSCs). This study aimed to clarify its role in gastric CSCs and explore the mechanisms. We found that low-expression of Mel-18 was correlated with poor prognosis and negatively correlated with overexpression of stem cell markers Oct4, Sox2, and Gli1 in 101 gastric cancer tissues. Mel-18 was down-regulated in cultured spheroid cells, which possess CSCs, and overexpression of Mel-18 inhibits cells sphere-forming ability and tumor growth in vivo. Besides, Mel-18 was lower-expressed in ovary metastatic lesions compared with that in primary lesions of gastric cancer, and Mel-18 overexpression inhibited the migration ability of gastric cancer cells. Interestingly, overexpression of Mel-18 resulted in down-regulation of miR-21 in gastric cancer cells and the expression of Mel-18 was negatively correlated with the expression of miR-21 in gastric cancer tissues. Furthermore, miR-21 overexpression partially restored sphere-forming ability, migration potential and chemo-resistance in Mel-18 overexpressing gastric cancer cells. These results suggests Mel-18 negatively regulates stem cell-like properties through downregulation of miR-21 in gastric cancer cells. PMID:27542229

  1. Extensive Determination of Glycan Heterogeneity Reveals an Unusual Abundance of High Mannose Glycans in Enriched Plasma Membranes of Human Embryonic Stem Cells*

    PubMed Central

    An, Hyun Joo; Gip, Phung; Kim, Jaehan; Wu, Shuai; Park, Kun Wook; McVaugh, Cheryl T.; Schaffer, David V.; Bertozzi, Carolyn R.; Lebrilla, Carlito B.

    2012-01-01

    Most cell membrane proteins are known or predicted to be glycosylated in eukaryotic organisms, where surface glycans are essential in many biological processes including cell development and differentiation. Nonetheless, the glycosylation on cell membranes remains not well characterized because of the lack of sensitive analytical methods. This study introduces a technique for the rapid profiling and quantitation of N- and O-glycans on cell membranes using membrane enrichment and nanoflow liquid chromatography/mass spectrometry of native structures. Using this new method, the glycome analysis of cell membranes isolated from human embryonic stem cells and somatic cell lines was performed. Human embryonic stem cells were found to have high levels of high mannose glycans, which contrasts with IMR-90 fibroblasts and a human normal breast cell line, where complex glycans are by far the most abundant and high mannose glycans are minor components. O-Glycosylation affects relatively minor components of cell surfaces. To verify the quantitation and localization of glycans on the human embryonic stem cell membranes, flow cytometry and immunocytochemistry were performed. Proteomics analyses were also performed and confirmed enrichment of plasma membrane proteins with some contamination from endoplasmic reticulum and other membranes. These findings suggest that high mannose glycans are the major component of cell surface glycosylation with even terminal glucoses. High mannose glycans are not commonly presented on the surfaces of mammalian cells or in serum yet may play important roles in stem cell biology. The results also mean that distinguishing stem cells from other mammalian cells may be facilitated by the major difference in the glycosylation of the cell membrane. The deep structural analysis enabled by this new method will enable future mechanistic studies on the biological significance of high mannose glycans on stem cell membranes and provide a general tool to examine cell surface glycosylation. PMID:22147732

  2. STAT3 as a promising chemoresistance biomarker associated with the CD44+/high/CD24-/low/ALDH+ BCSCs-like subset of the triple-negative breast cancer (TNBC) cell line.

    PubMed

    Moreira, Milene Pereira; da Conceição Braga, Letícia; Cassali, Geovanni Dantas; Silva, Luciana Maria

    2018-02-15

    The cancer stem cell (CSC) concept is currently employed to explain the mechanism of multidrug resistance that is implicated in the reduced efficacy of many chemotherapeutic agents, consequently leading to metastatic spread and disease relapse. We searched for potential predictive markers of doxorubicin (DOX) resistance in breast cancer stem cells (BCSCs) of the BT-549 human triple-negative breast cancer (TNBC) cell line classified as a claudin-low subtype. In this study, we show that BT-549 presents a BCSCs-like subset determined by a CD44 +/high /CD24 -/low /ALDH1 + phenotype. The CD44 +/high /CD24 -/low /ALDH + BCSCs-like subset presented the downregulation of a majority of the genes analyzed (64 genes), and only 3 genes were upregulated after DOX treatment. Among the upregulated genes, MAPK3, PRKCZ and STAT3, STAT3 presented a higher level of upregulation in the DOX-treated CD44 +/high /CD24 -/low /ALDH + BCSCs-like subset. The identification of biomarkers that predict antitumor responses is at the top of cancer research priorities. STAT3 was highlighted as a molecular signature in the CD44 +/high /CD24 -/low /ALDH1 + BCSCs-like subset obtained from the TNBC BT-549 cell line related to DOX resistance. A majority of the evaluated genes in the EGF pathway appear to be not associated with DOX resistance, as observed in the CD44 +/high /CD24 -/low /ALDH1 + BCSCs-like subset. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. RANKL/RANK: from bone loss to the prevention of breast cancer.

    PubMed

    Sigl, Verena; Jones, Laundette P; Penninger, Josef M

    2016-11-01

    RANK and RANKL, a receptor ligand pair belonging to the tumour necrosis factor family, are the critical regulators of osteoclast development and bone metabolism. Besides their essential function in bone, RANK and RANKL have also been identified as the key factors for the formation of a lactating mammary gland in pregnancy. Mechanistically, RANK and RANKL link the sex hormone progesterone with stem cell expansion and proliferation of mammary epithelial cells. Based on their normal physiology, RANKL/RANK control the onset of hormone-induced breast cancer through the expansion of mammary progenitor cells. Recently, we and others were able to show that RANK and RANKL are also critical regulators of BRCA1-mutation-driven breast cancer. Currently, the preventive strategy for BRCA1-mutation carriers includes preventive mastectomy, associated with wide-ranging risks and psychosocial effects. The search for an alternative non-invasive prevention strategy is therefore of paramount importance. As our work strongly implicates RANK and RANKL as key molecules involved in the initiation of BRCA1-associated breast cancer, we propose that anti-RANKL therapy could be a feasible preventive strategy for women carrying BRCA1 mutations, and by extension to other women with high risk of breast cancer. © 2016 The Authors.

  4. The Isolation and Characterization of Human Prostate Cancer Stem Cells

    DTIC Science & Technology

    2015-05-01

    GATGGAGTTGAAGGTAGTTTC GTG -30. Real time PCR was performed with iQ SYBR Green Supermix in an iCycler iQ System (Bio-Rad) using the SYBR Green Detection...initiate prostate tumorigenesis. Proc Natl Acad Sci USA 2005; 102(19):6942–6947. 16. Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer...receptor protein. Cancer Res. 1995; 55:3068–3072. [PubMed: 7541709] Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer resistance

  5. A Unique Opportunity to Test Whether Cell Fusion is a Mechanism of Breast Cancer Metastasis

    DTIC Science & Technology

    2012-07-01

    tetraploid with numerous structural rearrangements. The observations that a majority of cancer cell lines in the NCI-60 drug screening panel99 and...optimized electroporation conditions for T47D and human mesenchymal stem cell populations. As a result we have been able to conduct our first co...specific receptor-ligand interactions necessary for cell fusion, to produce a target for drug therapy. Post-fusion events might also be investigated

  6. [High-dose chemotherapy as a strategy to overcome drug resistance in solid tumors].

    PubMed

    Selle, Frédéric; Gligorov, Joseph; Soares, Daniele G; Lotz, Jean-Pierre

    2016-10-01

    The concept of high-doses chemotherapy was developed in the 1980s based on in vitro scientific observations. Exposure of tumor cells to increasing concentrations of alkylating agents resulted in increased cell death in a strong dose-response manner. Moreover, the acquired resistance of tumor cells could be overcome by dose intensification. In clinic, dose intensification of alkylating agents resulted in increased therapeutic responses, however associated with significant hematological toxicity. Following the development of autologous stem cells transplantation harvesting from peripheral blood, the high-doses of chemotherapy, initially associated with marked toxic effects, could be more easily tolerated. As a result, the approach was evaluated in different types of solid tumors, including breast, ovarian and germ cell tumors, small cell lung carcinoma, soft tissue sarcomas and Ewing sarcoma. To date, high-doses chemotherapy with hematopoietic stem cells support is only used as a salvage therapy to treat poor prognosis germ cell tumors patients with chemo-sensitive disease. Regarding breast and ovarian cancer, high-doses chemotherapy should be considered only in the context of clinical trials. However, intensive therapy as an approach to overcome resistance to standard treatments is still relevant. Numerous efforts are still ongoing to identify novel therapeutic combinations and active treatments to improve patients' responses. Copyright © 2016 Société Française du Cancer. Published by Elsevier Masson SAS. All rights reserved.

  7. Hypoxia-induced secretion of TGF-β1 in mesenchymal stem cell promotes breast cancer cell progression.

    PubMed

    Hung, Shun-Pei; Yang, Muh-Hwa; Tseng, Kuo-Fung; Lee, Oscar K

    2013-01-01

    In solid tumors, a decreased oxygen and nutrient supply creates a hypoxic microenvironment in the central region. This hypoxic condition induces molecular responses of normal and cancer cells in the local area, including angiogenesis, metabolic changes, and metastasis. In addition, other cells including mesenchymal stem cells (MSCs) have been reported to be recruited into the hypoxic area of solid tumors. In our previous study, we found that hypoxic condition induces the secretion of growth factors and cytokines in MSCs, and here we demonstrate that elevated secretion of transforming growth factor-β1 (TGF-β1) by MSCs under hypoxia promotes the growth, motility, and invasive ability of breast cancer cells. It was found that TGF-β1 promoter activity was regulated by hypoxia, and the major hypoxia-regulated element was located between bp -1030 to -666 in front of the TGF-β1 promoter region. In ChIP assay, the results revealed that HIF-1 was bound to the hypoxia response element (HRE) of TGF-β1 promoter. Collectively, the results indicate that hypoxia microenvironment can enhance cancer cell growth through the paracrine effects of the MSCs by driving their TGF-β1 gene expression and secretion. Therefore, extra caution has to be exercised when considering hypoxia pretreatment of MSCs before cell transplantation into patients for therapeutic purposes, particularly in patients susceptible to tumor growth.

  8. Economic analysis of conventional-dose chemotherapy compared with high-dose chemotherapy plus autologous hematopoietic stem-cell transplantation for metastatic breast cancer.

    PubMed

    Schulman, K A; Stadtmauer, E A; Reed, S D; Glick, H A; Goldstein, L J; Pines, J M; Jackman, J A; Suzuki, S; Styler, M J; Crilley, P A; Klumpp, T R; Mangan, K F; Glick, J H

    2003-02-01

    We performed an economic analysis of data from 180 women in a clinical trial of conventional-dose chemotherapy vs high-dose chemotherapy plus stem-cell transplantation for metastatic breast cancer responding to first-line chemotherapy. Data on resource use, including hospitalizations, medical procedures, medications, and diagnostic tests, were abstracted from subjects' clinical trial records. Resources were valued using the Medicare Fee Schedule for inpatient costs at one academic medical center and average wholesale prices for medications. Monthly costs were calculated and stratified by treatment group and clinical phase. Mean follow-up was 690 days in the transplantation group and 758 days in the conventional-dose chemotherapy group. Subjects in the transplantation group were hospitalized for more days (28.6 vs 17.8, P=0.0041) and incurred higher costs (US dollars 84055 vs US dollars 28169) than subjects receiving conventional-dose chemotherapy, with a mean difference of US dollars 55886 (95% CI, US dollars 47298-US dollars 63666). Sensitivity analyses resulted in cost differences between the treatment groups from US dollars 36528 to US dollars 75531. High-dose chemotherapy plus stem-cell transplantation resulted in substantial additional morbidity and costs at no improvement in survival. Neither the survival results nor the economic findings support the use of this procedure outside of the clinical trial setting.

  9. Graphene oxide selectively targets cancer stem cells, across multiple tumor types: Implications for non-toxic cancer treatment, via “differentiation-based nano-therapy”

    PubMed Central

    Fiorillo, Marco; Verre, Andrea F.; Iliut, Maria; Peiris-Pagés, Maria; Ozsvari, Bela; Gandara, Ricardo; Cappello, Anna Rita; Sotgia, Federica; Vijayaraghavan, Aravind; Lisanti, Michael P.

    2015-01-01

    Tumor-initiating cells (TICs), a.k.a. cancer stem cells (CSCs), are difficult to eradicate with conventional approaches to cancer treatment, such as chemo-therapy and radiation. As a consequence, the survival of residual CSCs is thought to drive the onset of tumor recurrence, distant metastasis, and drug-resistance, which is a significant clinical problem for the effective treatment of cancer. Thus, novel approaches to cancer therapy are needed urgently, to address this clinical need. Towards this end, here we have investigated the therapeutic potential of graphene oxide to target cancer stem cells. Graphene and its derivatives are well-known, relatively inert and potentially non-toxic nano-materials that form stable dispersions in a variety of solvents. Here, we show that graphene oxide (of both big and small flake sizes) can be used to selectively inhibit the proliferative expansion of cancer stem cells, across multiple tumor types. For this purpose, we employed the tumor-sphere assay, which functionally measures the clonal expansion of single cancer stem cells under anchorage-independent conditions. More specifically, we show that graphene oxide effectively inhibits tumor-sphere formation in multiple cell lines, across 6 different cancer types, including breast, ovarian, prostate, lung and pancreatic cancers, as well as glioblastoma (brain). In striking contrast, graphene oxide is non-toxic for “bulk” cancer cells (non-stem) and normal fibroblasts. Mechanistically, we present evidence that GO exerts its striking effects on CSCs by inhibiting several key signal transduction pathways (WNT, Notch and STAT-signaling) and thereby inducing CSC differentiation. Thus, graphene oxide may be an effective non-toxic therapeutic strategy for the eradication of cancer stem cells, via differentiation-based nano-therapy. PMID:25708684

  10. The Network of Epithelial-mesenchymal transition: potential new targets for tumor resistance

    PubMed Central

    Nantajit, Danupon; Lin, Dong; Li, Jian Jian

    2014-01-01

    Purpose In multiple cell metazoans, the ability of polarized epithelial cells to convert to motile mesenchymal cells in order to relocate to another location is governed by a unique process termed epithelial-mesenchymal transition (EMT). While being an essential process of cellular plasticity for normal tissue and organ developments, EMT is found to be involved in an array of malignant phenotypes of tumor cells including proliferation and invasion, angiogenesis, stemness of cancer cells and resistance to chemo-radiotherapy. Although EMT is being extensively studied and demonstrated to play a key role in tumor metastasis and in sustaining tumor hallmarks, there is a lack of clear picture of the overall EMT signaling network, wavering the potential clinical trials targeting EMT. Methods In this review, we highlight the potential key therapeutic targets of EMT linked with tumor aggressiveness, hypoxia, angiogenesis and cancer stem cells, emphasizing on an emerging EMT-associated NF-κB/HER2/STAT3 pathway in radioresistance of breast cancer stem cells. Results Further definition of cancer stem cell repopulation due to EMT-controlled tumor microenvironment will help to understand how tumors exploit the EMT mechanisms for their survival and expansion advantages. Conclusions The knowledge of EMT will offer more effective targets in clinical trials to treat therapy-resistant metastatic lesions. PMID:25270087

  11. Nuclear organization mediates cancer-compromised genetic and epigenetic control.

    PubMed

    Zaidi, Sayyed K; Fritz, Andrew; Tracy, Kirsten; Gordon, Jonathan; Tye, Coralee; Boyd, Joseph; Van Wijnen, Andre; Nickerson, Jeffrey; Imbalzano, Anthony; Lian, Jane; Stein, Janet; Stein, Gary

    2018-05-09

    Nuclear organization is functionally linked to genetic and epigenetic regulation of gene expression for biological control and is modified in cancer. Nuclear organization supports cell growth and phenotypic properties of normal and cancer cells by facilitating physiologically responsive interactions of chromosomes, genes and regulatory complexes at dynamic three-dimensional microenvironments. We will review nuclear structure/function relationships that include: 1. Epigenetic bookmarking of genes by phenotypic transcription factors to control fidelity and plasticity of gene expression as cells enter and exit mitosis; 2. Contributions of chromatin remodeling to breast cancer nuclear morphology, metabolism and effectiveness of chemotherapy; 3. Relationships between fidelity of nuclear organization and metastasis of breast cancer to bone; 4. Dynamic modifications of higher-order inter- and intra-chromosomal interactions in breast cancer cells; 5. Coordinate control of cell growth and phenotype by tissue-specific transcription factors; 6. Oncofetal epigenetic control by bivalent histone modifications that are functionally related to sustaining the stem cell phenotype; and 7. Noncoding RNA-mediated regulation in the onset and progression of breast cancer. The discovery of components to nuclear organization that are functionally related to cancer and compromise gene expression have the potential for translation to innovative cancer diagnosis and targeted therapy. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Rottlerin-induced autophagy leads to the apoptosis in breast cancer stem cells: molecular mechanisms.

    PubMed

    Kumar, Dhruv; Shankar, Sharmila; Srivastava, Rakesh K

    2013-12-23

    Autophagy is an indispensable lysosomal self-digestion process involved in the degradation of aggregated proteins and damaged organelles. Autophagy is associated with the several pathological processes, including cancer. Cancer stem cells (CSCs) play significant roles in cancer initiation, progression and drug resistance. Recent studies have demonstrated the antitumor activities of plant-derived chemopreventive agent rottlerin (Rott). However, the molecular mechanism by which Rott induces autophagy in breast CSCs has not been investigated. The objectives of this study were to examine the molecular mechanism by which Rott induces autophagy which leads to apoptosis in breast CSCs. Treatment of breast CSCs with Rott for 24 h resulted in a concentration dependent induction of autophagy, followed by apoptosis as measured by flow cytometry. Electron microscopy confirmed the presence of autophagosomes in Rott treated breast CSCs. Western blot analysis showed that Rott treatment increased the expression of LC3, Beclin-1 and Atg12 that are accumulated during autophagy. Prolonged exposure of breast CSCs to Rott caused apoptosis which was associated with the suppression of phosphorylated Akt and mTOR, upregulation of phosphorylated AMPK, and downregulation of anti-apoptosis Bcl-2, Bcl-X(L), XIAP and cIAP-1. Knock-down of Atg7 or Beclin-1 by shRNA inhibited Rott-induced autophagy at 24 h. Our study also demonstrates that pre-treatment of breast CSCs with autophagosome inhibitors 3-methyladenine and Bafilomycin, as well as protein synthesis inhibitor cycloheximide inhibited Rott-induced autophagy and apoptosis. Rott induces autophagy via extensive cytoplasmic vacuolization in breast CSCs. Molecular docking results between C2-domain of protein kinase C-delta and Rott indicated that both hydrogen bonding and hydrophobic interactions contributed significantly for ligand binding with minimum binding affinity of ≈ 7.5 Kcal/mol. Although, autophagy inhibitors suppress the formation of cytoplasmic vacuolization and autophagy in breast CSCs, the potency of Rott to induce autophagy and apoptosis might be based on its capability to activate several pathways such as AMPK and proteasome inhibition. A better understanding of the relationship between autophagy and apoptosis would eventually allow us to discover novel drugs for the treatment of breast cancer by eliminating CSCs.

  13. Early dissemination seeds metastasis in breast cancer

    PubMed Central

    Hosseini, Hedayatollah; Obradović, Milan M.S.; Hoffmann, Martin; Harper, Kathryn; Sosa, Maria Soledad; Werner-Klein, Melanie; Nanduri, Lahiri Kanth; Werno, Christian; Ehrl, Carolin; Maneck, Matthias; Patwary, Nina; Haunschild, Gundula; Gužvić, Miodrag; Reimelt, Christian; Grauvogl, Michael; Eichner, Norbert; Weber, Florian; Hartkopf, Andreas; Taran, Florin-Andrei; Brucker, Sara Y.; Fehm, Tanja; Rack, Brigitte; Buchholz, Stefan; Spang, Rainer; Meister, Gunter; Aguirre-Ghiso, Julio A.; Klein, Christoph A.

    2016-01-01

    Accumulating data suggest that metastatic dissemination often occurs early during tumour formation but the mechanisms of early metastatic spread have not yet been addressed. Here, we studied metastasis in a HER2-driven mouse breast cancer model and found that progesterone-induced signalling triggered migration of cancer cells from early lesions shortly after HER2 activation, but promoted proliferation in advanced primary tumour cells. The switch from migration to proliferation was regulated by elevated HER2 expression and increased tumour cell density involving miRNA-mediated progesterone receptor (PGR) down-regulation and was reversible. Cells from early, low-density lesions displayed more stemness features than cells from dense, advanced tumours, migrated more and founded more metastases. Strikingly, we found that at least 80% of metastases were derived from early disseminated cancer cells (DCC). Karyotypic and phenotypic analysis of human disseminated cancer cells and primary tumours corroborated the relevance of these findings for human metastatic dissemination. PMID:27974799

  14. Emerging role of brain metastases in the prognosis of breast cancer patients.

    PubMed

    Hambrecht, Amanda; Jandial, Rahul; Neman, Josh

    2011-08-10

    Cancer starts with one rogue cell. Through mutations and genomic alterations, the cell acquires specific and stem cell-like characteristics necessary for invasion of a distant organ and ultimately metastasis. Metastatic brain cancer is a particularly formidable disease because of its poor prognosis and the highly resistant nature of the tumor to chemotherapy. Although several types of primary tumors have a tendency to metastasize to the brain, the incidence of brain metastases has increased dramatically in some subsets of breast cancer patients. Several conventional treatments are available, but success is limited and often short-lived. Given that no standard treatment options exist, there is a significant need to investigate the biology of these clinically recalcitrant tumors.

  15. Emerging role of brain metastases in the prognosis of breast cancer patients

    PubMed Central

    Hambrecht, Amanda; Jandial, Rahul; Neman, Josh

    2011-01-01

    Cancer starts with one rogue cell. Through mutations and genomic alterations, the cell acquires specific and stem cell-like characteristics necessary for invasion of a distant organ and ultimately metastasis. Metastatic brain cancer is a particularly formidable disease because of its poor prognosis and the highly resistant nature of the tumor to chemotherapy. Although several types of primary tumors have a tendency to metastasize to the brain, the incidence of brain metastases has increased dramatically in some subsets of breast cancer patients. Several conventional treatments are available, but success is limited and often short-lived. Given that no standard treatment options exist, there is a significant need to investigate the biology of these clinically recalcitrant tumors. PMID:24367178

  16. STAT3/NF-κB-Regulated Lentiviral TK/GCV Suicide Gene Therapy for Cisplatin-Resistant Triple-Negative Breast Cancer

    PubMed Central

    Kuo, Wei-Ying; Hwu, Luen; Wu, Chun-Yi; Lee, Jhih-Shian; Chang, Chi-Wei; Liu, Ren-Shyan

    2017-01-01

    Triple-negative breast cancer (TNBC) represents approximately 20% of all breast cancers and appears resistance to conventional cytotoxic chemotherapy, demonstrating a particularly poor prognosis and a significantly worse clinical outcome than other types of cancer. Suicide gene therapy has been used for the in vivo treatment of various solid tumors in recent clinical trials. In tumor microenvironment, STAT3/NF-κB pathways are constitutively activated in stromal cells as well as in cancer stem cells (CSCs). In this study, we have cloned a novel STAT3/NF-κB-based reporter system to drive the expression of herpes simplex virus thymidine kinase (HSV-TK) against breast cancer. Lentiviral vector expressing HSV-TK under the regulation of STAT3/NF-κB fused response element was developed. In this setting, we exploited the constitutive STAT3/NF-κB activation in tumors to achieve higher transgene expression than that driven by a constitutively active CMV promotor in vivo. An orthotropic MDA-MB-231 triple negative breast cancer mouse model was used for evaluating the feasibility of STAT3-NF-κB-TK/GCV suicide gene therapy system. The basal promoter activity of Lenti-CMV-TK and Lenti-STAT3-NF-κB-TK in MDA-MB-231 cells was compared by 3H-FEAU uptake assay. The Lenti-CMV-TK showed ~5 fold higher 3H-FEAU uptake then Lenti -STAT3-NF-κB-TK. In clonogenic assay, cells expressing Lenti-CMV-TK were 2-fold more sensitive to GCV than Lenti-STAT3-NF-κB-TK transduced cells. In vitro effect of STAT3-NF-κB-induced transgene expression was determined by 10ng/mL TNF-α induction and confirmed by western blot analysis and DsRedm fluorescent microscopy. In vivo evaluation of therapeutic effect by bioluminescence and [18F]FHBG microPET imaging indicated that Lenti-STAT3-NF-κB-TK showed more tumor growth retardation than Lenti-CMV-TK when GCV (20 mg/kg) was administered. The invasiveness and expression of cancer stem cell markers were both decreased after STAT3/NF-κB-regulated HSV-TK/GCV therapy. Moreover, STAT3/NF-κB signaling targeting could further sensitize tumor cells to cisplatin. This study successfully established a theranositic approach to treat triple-negative breast cancer via STAT3-NF-κB responsive element-driven suicide gene therapy. This platform may also be an alternative strategy to handle with drug-resistant cancer cells. PMID:28255357

  17. Fas Protects Breast Cancer Stem Cells from Death

    DTIC Science & Technology

    2015-10-01

    proteins. B: All proteins from A that were deregulated at least 1.5 fold in the opposite direction in either analysis. Proteins in red have been...for Clinical Research (IZKF) at the University Hospital of the Friedrich- Alexander-University Erlangen-Nuremberg, in Germany , that I have

  18. Evaluation of a developmental hierarchy for breast cancer cells to assess risk-based patient selection for targeted treatment.

    PubMed

    Bliss, Sarah A; Paul, Sunirmal; Pobiarzyn, Piotr W; Ayer, Seda; Sinha, Garima; Pant, Saumya; Hilton, Holly; Sharma, Neha; Cunha, Maria F; Engelberth, Daniel J; Greco, Steven J; Bryan, Margarette; Kucia, Magdalena J; Kakar, Sham S; Ratajczak, Mariusz Z; Rameshwar, Pranela

    2018-01-10

    This study proposes that a novel developmental hierarchy of breast cancer (BC) cells (BCCs) could predict treatment response and outcome. The continued challenge to treat BC requires stratification of BCCs into distinct subsets. This would provide insights on how BCCs evade treatment and adapt dormancy for decades. We selected three subsets, based on the relative expression of octamer-binding transcription factor 4 A (Oct4A) and then analysed each with Affymetrix gene chip. Oct4A is a stem cell gene and would separate subsets based on maturation. Data analyses and gene validation identified three membrane proteins, TMEM98, GPR64 and FAT4. BCCs from cell lines and blood from BC patients were analysed for these three membrane proteins by flow cytometry, along with known markers of cancer stem cells (CSCs), CD44, CD24 and Oct4, aldehyde dehydrogenase 1 (ALDH1) activity and telomere length. A novel working hierarchy of BCCs was established with the most immature subset as CSCs. This group was further subdivided into long- and short-term CSCs. Analyses of 20 post-treatment blood indicated that circulating CSCs and early BC progenitors may be associated with recurrence or early death. These results suggest that the novel hierarchy may predict treatment response and prognosis.

  19. Protocol for Biomarker Ratio Imaging Microscopy with Specific Application to Ductal Carcinoma In situ of the Breast

    PubMed Central

    Clark, Andrea J.; Petty, Howard R.

    2016-01-01

    This protocol describes the methods and steps involved in performing biomarker ratio imaging microscopy (BRIM) using formalin fixed paraffin-embedded (FFPE) samples of human breast tissue. The technique is based on the acquisition of two fluorescence images of the same microscopic field using two biomarkers and immunohistochemical tools. The biomarkers are selected such that one biomarker correlates with breast cancer aggressiveness while the second biomarker anti-correlates with aggressiveness. When the former image is divided by the latter image, a computed ratio image is formed that reflects the aggressiveness of tumor cells while increasing contrast and eliminating path-length and other artifacts from the image. For example, the aggressiveness of epithelial cells may be assessed by computing ratio images of N-cadherin and E-cadherin images or CD44 and CD24 images, which specifically reflect the mesenchymal or stem cell nature of the constituent cells, respectively. This methodology is illustrated for tissue samples of ductal carcinoma in situ (DCIS) and invasive breast cancer. This tool should be useful in tissue studies of experimental cancer as well as the management of cancer patients. PMID:27857940

  20. Semisynthesis of SY-1 for investigation of breast cancer stem cell selectivity of C-ring-modified salinomycin analogues.

    PubMed

    Huang, Xiaoli; Borgström, Björn; Månsson, Linda; Persson, Lo; Oredsson, Stina; Hegardt, Cecilia; Strand, Daniel

    2014-07-18

    Salinomycin, a naturally occurring polyether ionophore was recently found to selectively reduce the proportion of CD44(+)/CD24(-) cells, a phenotype associated with breast cancer stem cells. Subsequent studies from our group showed that chemical modification of the allylic C20 hydroxyl of salinomycin, located at the C-ring, can enhance the activity of derivatives against breast cancer cells over 5-fold compared to the native structure. Access to C-ring-modified salinomycin analogues is thus of interest from both a mechanistic and a synthetic perspective. Here, we report efficient strategies for gram scale synthesis of the natural product SY-1 (20-deoxy salinomycin), and a saturated analogue, 18,19-dihydro SY-1, for a comparative in vitro investigation of the biological profiles of these compounds with that of salinomycin. Across several assays, the deoxygenated structures required higher concentrations to elicit similar cellular responses to that of salinomycin. Similarly to salinomycin, SY-1 or 18,19-dihydro SY-1 treatment was found to reduce the proportion of CD44(+)/CD24(-) cells with essentially complete selectivity up to ∼IC25. Importantly, the proportion of CD44(+)/CD24(-) cells showed a pronounced U-shaped dose response curve for salinomycin and its derivatives, but not for paclitaxel. The concentration for maximum response in this assay followed differences in IC50 for salinomycin and its analogues, which emphasizes the importance of taking concentration dependence into account when comparing effects on the CD44(+)/CD24(-) phenotype. Small differences in the global conformation within the triad of compounds investigated together with differences in activity across assays emphasize the importance of substitution at C20 for the activity of salinomycin and its derivatives.

  1. MUC1-C activates BMI1 in human cancer cells.

    PubMed

    Hiraki, M; Maeda, T; Bouillez, A; Alam, M; Tagde, A; Hinohara, K; Suzuki, Y; Markert, T; Miyo, M; Komura, K; Ahmad, R; Rajabi, H; Kufe, D

    2017-05-18

    B-cell-specific Moloney murine leukemia virus integration site 1 (BMI1) is a component of the polycomb repressive complex 1 (PRC1) complex that is overexpressed in breast and other cancers, and promotes self-renewal of cancer stem-like cells. The oncogenic mucin 1 (MUC1) C-terminal (MUC1-C) subunit is similarly overexpressed in human carcinoma cells and has been linked to their self-renewal. There is no known relationship between MUC1-C and BMI1 in cancer. The present studies demonstrate that MUC1-C drives BMI1 transcription by a MYC-dependent mechanism in breast and other cancer cells. In addition, we show that MUC1-C blocks miR-200c-mediated downregulation of BMI1 expression. The functional significance of this MUC1-C→︀BMI1 pathway is supported by the demonstration that targeting MUC1-C suppresses BMI1-induced ubiquitylation of H2A and thereby derepresses homeobox HOXC5 and HOXC13 gene expression. Notably, our results further show that MUC1-C binds directly to BMI1 and promotes occupancy of BMI1 on the CDKN2A promoter. In concert with BMI1-induced repression of the p16 INK4a tumor suppressor, we found that targeting MUC1-C is associated with induction of p16 INK4a expression. In support of these results, analysis of three gene expresssion data sets demonstrated highly significant correlations between MUC1-C and BMI1 in breast cancers. These findings uncover a previously unrecognized role for MUC1-C in driving BMI1 expression and in directly interacting with this stem cell factor, linking MUC1-C with function of the PRC1 in epigenetic gene silencing.

  2. Proteomic Profiling of β-hCG-Induced Spheres in BRCA1 Defective Triple Negative Breast Cancer Cells.

    PubMed

    Sengodan, Satheesh Kumar; Rajan, Arathi; Hemalatha, Sreelatha Krishnakumar; Nadhan, Revathy; Jaleel, Abdul; Srinivas, Priya

    2018-01-05

    Previously, we identified that β-hCG is expressed by BRCA1 mutated but not wild type breast cancers in vitro/in vivo and exhibited a novel event in β-hCG overexpressing BRCA1 mutated HCC1937 cells where the cells were able to form spheres (HCC1937 β spheres) in adherent cell culture plates even in the absence of any growth factors. These spheres express stem cell and EMT markers. In the present study, we carried out the total proteomic profiling of these HCC1937 β spheres obtained from BRCA1 defective β-hCG expressing stable breast cancer cells to analyze the cell signaling pathways that are active in these cells. Functional annotation revealed proteins (164 cellular and 97 secretory) predominantly involved in oxygen binding, nucleosome assembly, cytoskeleton organization, protein folding, etc. Many of the proteins identified from HCC1937 β spheres in this study are also up regulated in breast cancers, which are directly linked with poor prognosis in human cancer samples as analyzed using TCGA data set. Survival analysis shows that β-hCG expressing cancer patients are linked with poor survival rate. Interestingly, hemoglobins were identified at both cellular and secretory level in HCC1937 β spheres and experiments after treating with ROS inducers revealed that β-hCG induces hemoglobin and protects the cancer cells during oxidative stress. Our proteomic data strongly propose β-hCG as an oncogenic molecule associated with BRCA1 mutation, and hence, targeting β-hCG could be a strategy to treat BRCA1 defective breast cancers.

  3. Derailed Estrogen Signaling and Breast Cancer: An Authentic Couple

    PubMed Central

    Dey, Oindrilla; Gajulapalli, Vijay Narsihma Reddy; Bhatia, Raghavendra Singh; Bugide, Suresh; Kumar, Rakesh

    2013-01-01

    Estrogen or 17β-estradiol, a steroid hormone, plays a critical role in the development of mammary gland via acting through specific receptors. In particular, estrogen receptor-α (ERα) acts as a transcription factor and/or a signal transducer while participating in the development of mammary gland and breast cancer. Accumulating evidence suggests that the transcriptional activity of ERα is altered by the action of nuclear receptor coregulators and might be responsible, at least in part, for the development of breast cancer. In addition, this process is driven by various posttranslational modifications of ERα, implicating active participation of the upstream receptor modifying enzymes in breast cancer progression. Emerging studies suggest that the biological outcome of breast cancer cells is also influenced by the cross talk between microRNA and ERα signaling, as well as by breast cancer stem cells. Thus, multiple regulatory controls of ERα render mammary epithelium at risk for transformation upon deregulation of normal homeostasis. Given the importance that ERα signaling has in breast cancer development, here we will highlight how the activity of ERα is controlled by various regulators in a spatial and temporal manner, impacting the progression of the disease. We will also discuss the possible therapeutic value of ERα modulators as alternative drug targets to retard the progression of breast cancer. PMID:22947396

  4. Effects of Radiation on Proteasome Function in Prostate Cancer Cells

    DTIC Science & Technology

    2012-02-01

    California Breast Cancer Research Program Innovative Development and Exploratory Award (IDEA) Competitive Renewal Modulation of...Weissman IL. Establishment of a normal hemato- poietic and leukemia stem cell hierarchy. Cold Spring Harb Symp Quant Biol 2008;73:439–449. 9 Trott KR...existence of CSCs in solid cancer has been advocated by radiobiologists for decades [Withers et al., 1988; Trott , 1994]. However, until recently this

  5. Targeting CD81 to Prevent Metastases in Breast Cancer

    DTIC Science & Technology

    2015-10-01

    exosome uptake by mesenchymal stem cells (57). In view of these studies it is intriguing that while naïve CD81KO and WT Tregs suppressed T cell ...Kusmartsev S, Sotomayor E, et al. Mechanism regulating reactive oxygen species in tumor-induced myeloid-derived suppressor cells . J Immunol. 2009 May...KM, et al. The inhibitory cytokine IL-35 contributes to regulatory T- cell function. Nature. 2007 Nov 22;450(7169):566-9. 52. Yan Z, Garg SK, Banerjee

  6. A Novel Differentiation Therapy Approach to Reduce the Metastatic Potential of Basal, Highly Metastatic, Triple-Negative Breast Cancers

    DTIC Science & Technology

    2012-05-01

    subset enriched in epithelial-to- mesenchymal transition and stem cell characteristics. Cancer Res 69: 4116–4124. Hoenerhoff MJ, Chu I, Barkan D, Liu ZY...expression of epithelial markers and loss of mesenchymal markers in MB- 231 cells (Task1a) Our analyses of m icroarray data com paring 231-Empty cells ...is considered a hallmark of EMT (Yang and Weinberg 2008). MB-231 cells lack E-cadherin expression and exhibit a more mesenchymal phenotype

  7. Genistein-mediated inhibition of mammary stromal adipocyte differentiation limits expansion of mammary stem/progenitor cells by paracrine signaling

    USDA-ARS?s Scientific Manuscript database

    Mammary adiposity may contribute to breast cancer development and progression by releasing cytokines and other inflammatory mediators that promote mammary epithelial proliferation. We evaluated the effects of soy isoflavone genistein (GEN) on the adipogenic differentiation of a SV40-immortalized mou...

  8. 75 FR 20370 - National Cancer Institute; Notice of Closed Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-19

    ... Special Emphasis Panel, Breast Cancer Biology. Date: May 20, 2010. Time: 8 a.m. to 5 p.m. Agenda: To... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Cancer Institute... Cancer Institute Special Emphasis Panel, Assay Systems for Drug Efficacy in Cancer Stem Cells. Date...

  9. Cytotoxic effect of disulfiram/copper on human glioblastoma cell lines and ALDH-positive cancer-stem-like cells

    PubMed Central

    Liu, P; Brown, S; Goktug, T; Channathodiyil, P; Kannappan, V; Hugnot, J-P; Guichet, P-O; Bian, X; Armesilla, A L; Darling, J L; Wang, W

    2012-01-01

    Background: Glioblastoma multiforme (GBM) cells are resistant to anticancer drugs. Cancer stem cells (CSCs) are a key mediator of chemoresistance. We have reported that disulfiram (DS), an aldehyde dehydrogenase (ALDH) inhibitor, targets breast CSC-like cells. In this study, the effect of DS and combination of DS and gemcitabine (dFdC) on GBM cells and GBM stem-like cells was investigated. Methods: 1-(4,5-Dimethylthiazol-2-yl)-3,5-diphenylformazan (MTT), combination index (CI)-isobologram, western blot, luciferase reporter gene assay, electrophoretic mobility-shift assay and ALDH analysis were used in this study. Results: Disulfiram is cytotoxic in GBM cell lines in a copper (Cu)-dependent manner. Disulfiram/copper enhances the cytotoxicity of dFdC. Combination index-isobologram analysis indicates a synergistic effect between DS/Cu and dFdC. Disulfiram/copper induces reactive oxygen species (ROS), activates JNK and p38 pathways and inhibits nuclear factor-kappa B activity in GBM cell lines. Disulfiram/copper may trigger intrinsic apoptotic pathway via modulation of the Bcl2 family. Disulfiram/copper abolishes stem-like cell population in GBM cell lines. Conclusion: Our findings indicate that the cytotoxicity of DS/Cu and the enhancing effect of DS/Cu on the cytotoxicity of dFdC in GBM stem-like cells may be caused by induction of ROS and inhibition of both ALDH and the NFkB pathway. Both DS and dFdC can traverse the blood–brain barrier. Further study may lead them into GBM chemotherapy. PMID:23033007

  10. Down-Regulation of Vitamin D Receptor in Mammospheres: Implications for Vitamin D Resistance in Breast Cancer and Potential for Combination Therapy

    PubMed Central

    Pervin, Shehla; Hewison, Martin; Braga, Melissa; Tran, Lac; Chun, Rene; Karam, Amer; Chaudhuri, Gautam; Norris, Keith; Singh, Rajan

    2013-01-01

    Vitamin D signaling in mammary cancer stem cells (MCSCs), which are implicated in the initiation and progression of breast cancer, is poorly understood. In this study, we examined vitamin D signaling in mammospheres which are enriched in MCSCs from established breast cancer cell lines. Breast cancer cells positive for aldehyde dehydrogenase (ALDH+) had increased ability to form mammospheres compared to ALDH− cells. These mammospheres expressed MCSC-specific markers and generated transplantable xenografts in nude mice. Vitamin D receptor (VDR) was significantly down-regulated in mammospheres, as well as in ALDH+ breast cancer cells. TN aggressive human breast tumors as well as transplantable xenografts obtained from SKBR3 expressed significantly lower levels of VDR but higher levels of CD44 expression. Snail was up-regulated in mammospheres isolated from breast cancer cells. Inhibition of VDR expression by siRNA led to a significant change in key EMT-specific transcription factors and increased the ability of these cells to form mammospheres. On the other hand, over-expression of VDR led to a down-regulation of Snail but increased expression of E-cad and significantly compromised the ability of cells to form mammospheres. Mammospheres were relatively insensitive to treatment with 1,25-dihydroxyvitamin D (1,25D), the active form of vitamin D, compared to more differentiated cancer cells grown in presence of serum. Treatment of H-Ras transformed HMLEHRas cells with DETA NONOate, a nitric oxide (NO)-donor led to induction of MAP-kinase phosphatase -1 (MKP-1) and dephosphorylation of ERK1/2 in the mammospheres. Combined treatment of these cells with 1,25D and a low-concentration of DETA NONOate led to a significant decrease in the overall size of mammospheres and reduced tumor volume in nude mice. Our findings therefore, suggest that combination therapy using 1,25D with drugs specifically targeting key survival pathways in MCSCs warrant testing in prospective clinical trial for treatment of aggressive breast cancer. PMID:23341935

  11. PRDM14 directly interacts with heat shock proteins HSP90α and glucose-regulated protein 78.

    PubMed

    Moriya, Chiharu; Taniguchi, Hiroaki; Nagatoishi, Satoru; Igarashi, Hisayoshi; Tsumoto, Kouhei; Imai, Kohzoh

    2018-02-01

    PRDM14 is overexpressed in various cancers and can regulate cancer phenotype under certain conditions. Inhibiting PRDM14 expression in breast and pancreatic cancers has been reported to reduce cancer stem-like phenotypes, which are associated with aggressive tumor properties. Therefore, PRDM14 is considered a promising target for cancer therapy. To develop a pharmaceutical treatment, the mechanism and interacting partners of PRDM14 need to be clarified. Here, we identified the proteins interacting with PRDM14 in triple-negative breast cancer (TNBC) cells, which do not express the three most common types of receptor (estrogen receptors, progesterone receptors, and HER2). We obtained 13 candidates that were pulled down with PRDM14 in TNBC HCC1937 cells and identified them by mass spectrometry. Two candidates-glucose-regulated protein 78 (GRP78) and heat shock protein 90-α (HSP90α)-were confirmed in immunoprecipitation assay in two TNBC cell lines (HCC1937 and MDA-MB231). Surface plasmon resonance analysis using GST-PRDM14 showed that these two proteins directly interacted with PRDM14 and that the interactions required the C-terminal region of PRDM14, which includes zinc finger motifs. We also confirmed the interactions in living cells by NanoLuc luciferase-based bioluminescence resonance energy transfer (NanoBRET) assay. Moreover, HSP90 inhibitors (17DMAG and HSP990) significantly decreased breast cancer stem-like CD24 -  CD44 + and side population (SP) cells in HCC1937 cells, but not in PRDM14 knockdown HCC1937 cells. The combination of the GRP78 inhibitor HA15 and PRDM14 knockdown significantly decreased cell proliferation and SP cell number in HCC1937 cells. These results suggest that HSP90α and GRP78 interact with PRDM14 and participate in cancer regulation. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  12. Lgr6 labels a rare population of mammary gland progenitor cells that are able to originate luminal mammary tumours

    PubMed Central

    Messal, Hendrik A.; Andersson, Agneta B.; Ruiz, E. Josue; Gerling, Marco; Douagi, Iyadh; Spencer-Dene, Bradley; Musch, Alexandra; Mitter, Richard; Bhaw, Leena; Stone, Richard; Bornhorst, Dorothee; Sesay, Abdul K.; Jonkers, Jos; Stamp, Gordon; Malanchi, Ilaria; Toftgård, Rune; Behrens, Axel

    2018-01-01

    The mammary gland is composed of a complex cellular hierarchy with unusual postnatal plasticity. The identities of stem/progenitor cell populations, as well as tumour-initiating cells that give rise to breast cancer, are incompletely understood. Here we show that Lgr6 marks rare populations of cells in both basal and luminal mammary gland compartments in mice. Lineage tracing analysis showed that Lgr6+ cells are unipotent progenitors, which expand clonally during puberty but diminish in adulthood. In pregnancy or upon stimulation with ovarian hormones, adult Lgr6+ cells regained proliferative potency and their progeny formed alveoli over repeated pregnancies. Oncogenic mutations in Lgr6+ cells resulted in expansion of luminal cells, culminating in mammary gland tumours. Conversely, depletion of Lgr6+ cells in the MMTV-PyMT model of mammary tumourigenesis significantly impaired tumour growth. Thus, Lgr6 marks mammary gland progenitor cells that can initiate tumours, and cells of luminal breast tumours required for efficient tumour maintenance. PMID:27798604

  13. Eya2 Is Required to Mediate the Pro-Metastatic Functions of Six1 Via the Induction of TGF-β Signaling, Epithelial-Mesenchymal Transition, and Cancer Stem Cell Properties

    PubMed Central

    Farabaugh, Susan M.; Micalizzi, Douglas S.; Jedlicka, Paul; Zhao, Rui; Ford, Heide L.

    2011-01-01

    Six1 is a critical regulator of embryonic development that requires interaction with the Eya family of proteins (Eya1-4) to activate the transcription of genes involved in neurogenesis, myogenesis, and nephrogenesis. While expression of Six1 and Eya family members is predominantly observed in development, their overexpression is observed in numerous cancers. Importantly, both Six1 and Eya have independently been shown to mediate breast cancer metastasis, but whether they functionally interact during tumor progression has not been explored. Herein we demonstrate that knockdown of Eya2 in MCF7 mammary carcinoma cells reverses the ability of Six1 to induce TGF-β signaling, as well as to induce characteristics associated with epithelial-mesenchymal transition (EMT) and cancer stem cells (CSCs), suggesting that Six1 is dependent on Eya2 to mediate numerous pro-metastatic characteristics. The importance of the Six1/Eya interaction in human breast cancer is underscored by the finding that high levels of Six1 correlate with shortened time to relapse and metastasis as well as decreased survival only when co-expressed with high levels of Eya2. Overall, these data implicate Eya2 as a necessary cofactor for many of the metastasis promoting functions of Six1, suggesting that targeting the Six1/Eya interaction may inhibit breast cancer progression. Since Six1 and Eya2 are not highly expressed in most adult tissues, the Six1-Eya interaction may be a valuable future therapeutic target whose inhibition would be expected to impair breast cancer progression while conferring limited side effects. PMID:21706047

  14. The Nuclear Receptor, RORγ, Regulates Pathways Necessary for Breast Cancer Metastasis.

    PubMed

    Oh, Tae Gyu; Wang, Shu-Ching M; Acharya, Bipul R; Goode, Joel M; Graham, J Dinny; Clarke, Christine L; Yap, Alpha S; Muscat, George E O

    2016-04-01

    We have previously reported that RORγ expression was decreased in ER-ve breast cancer, and increased expression improves clinical outcomes. However, the underlying RORγ dependent mechanisms that repress breast carcinogenesis have not been elucidated. Here we report that RORγ negatively regulates the oncogenic TGF-β/EMT and mammary stem cell (MaSC) pathways, whereas RORγ positively regulates DNA-repair. We demonstrate that RORγ expression is: (i) decreased in basal-like subtype cancers, and (ii) inversely correlated with histological grade and drivers of carcinogenesis in breast cancer cohorts. Furthermore, integration of RNA-seq and ChIP-chip data reveals that RORγ regulates the expression of many genes involved in TGF-β/EMT-signaling, DNA-repair and MaSC pathways (including the non-coding RNA, LINC00511). In accordance, pharmacological studies demonstrate that an RORγ agonist suppresses breast cancer cell viability, migration, the EMT transition (microsphere outgrowth) and mammosphere-growth. In contrast, RNA-seq demonstrates an RORγ inverse agonist induces TGF-β/EMT-signaling. These findings suggest pharmacological modulation of RORγ activity may have utility in breast cancer. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  15. BRCA1 haploinsufficiency cell-autonomously activates RANKL expression and generates denosumab-responsive breast cancer-initiating cells.

    PubMed

    Cuyàs, Elisabet; Corominas-Faja, Bruna; Martín, María Muñoz-San; Martin-Castillo, Begoña; Lupu, Ruth; Brunet, Joan; Bosch-Barrera, Joaquim; Menendez, Javier A

    2017-05-23

    Denosumab, a monoclonal antibody to the receptor activator of nuclear factor-κB ligand (RANKL), might be a novel preventative therapy for BRCA1-mutation carriers at high risk of developing breast cancer. Beyond its well-recognized bone-targeted activity impeding osteoclastogenesis, denosumab has been proposed to interfere with the cross-talk between RANKL-producing sensor cells and cancer-initiating RANK+ responder cells that reside within premalignant tissues of BRCA1-mutation carriers. We herein tested the alternative but not mutually exclusive hypothesis that BRCA1 deficiency might cell-autonomously activate RANKL expression to generate cellular states with cancer stem cell (CSC)-like properties. Using isogenic pairs of normal-like human breast epithelial cells in which the inactivation of a single BRCA1 allele results in genomic instability, we assessed the impact of BRCA1 haploinsufficiency on the expression status of RANK and RANKL. RANK expression remained unaltered but RANKL was dramatically up-regulated in BRCA1mut/+ haploinsufficient cells relative to isogenic BRCA1+/+ parental cells. Neutralizing RANKL with denosumab significantly abrogated the ability of BRCA1 haploinsufficient cells to survive and proliferate as floating microtumors or "mammospheres" under non-adherent/non-differentiating conditions, an accepted surrogate of the relative proportion and survival of CSCs. Intriguingly, CSC-like states driven by epithelial-to-mesenchymal transition or HER2 overexpression traits responded to some extent to denosumab. We propose that breast epithelium-specific mono-allelic inactivation of BRCA1 might suffice to cell-autonomously generate RANKL-addicted, denosumab-responsive CSC-like states. The convergent addiction to a hyperactive RANKL/RANK axis of CSC-like states from genetically diverse breast cancer subtypes might inaugurate a new era of cancer prevention and treatment based on denosumab as a CSC-targeted agent.

  16. Conditionally reprogrammed cells (CRC) methodology does not allow the in vitro expansion of patient-derived primary and metastatic lung cancer cells.

    PubMed

    Sette, Giovanni; Salvati, Valentina; Giordani, Ilenia; Pilozzi, Emanuela; Quacquarini, Denise; Duranti, Enrico; De Nicola, Francesca; Pallocca, Matteo; Fanciulli, Maurizio; Falchi, Mario; Pallini, Roberto; De Maria, Ruggero; Eramo, Adriana

    2018-07-01

    Availability of tumor and non-tumor patient-derived models would promote the development of more effective therapeutics for non-small cell lung cancer (NSCLC). Recently, conditionally reprogrammed cells (CRC) methodology demonstrated exceptional potential for the expansion of epithelial cells from patient tissues. However, the possibility to expand patient-derived lung cancer cells using CRC protocols is controversial. Here, we used CRC approach to expand cells from non-tumoral and tumor biopsies of patients with primary or metastatic NSCLC as well as pulmonary metastases of colorectal or breast cancers. CRC cultures were obtained from both tumor and non-malignant tissues with extraordinary high efficiency. Tumor cells were tracked in vitro through tumorigenicity assay, monitoring of tumor-specific genetic alterations and marker expression. Cultures were composed of EpCAM+ lung epithelial cells lacking tumorigenic potential. NSCLC biopsies-derived cultures rapidly lost patient-specific genetic mutations or tumor antigens. Similarly, pulmonary metastases of colon or breast cancer generated CRC cultures of lung epithelial cells. All CRC cultures examined displayed epithelial lung stem cell phenotype and function. In contrast, brain metastatic lung cancer biopsies failed to generate CRC cultures. In conclusion, patient-derived primary and metastatic lung cancer cells were negatively selected under CRC conditions, limiting the expansion to non-malignant lung epithelial stem cells from either tumor or non-tumor tissue sources. Thus, CRC approach cannot be applied for direct therapeutic testing of patient lung tumor cells, as the tumor-derived CRC cultures are composed of (non-tumoral) airway basal cells. © 2018 UICC.

  17. Regulation of Breast Cancer Stem Cell by Tissue Rigidity

    DTIC Science & Technology

    2014-06-01

    pose the similar question as Paszek et al but in a more biomimetic niche: “Does the mature mammary acinar structure desensitize mammary epithelial...2728032. 6. Lucero HA, Kagan HM. Lysyl oxidase: an oxidative enzyme and effector of cell function. Cell Mol Life Sci. 2006;63(19-20):2304-16. 7. Levental...requirement of EMT and/or MET during the individual steps of tumor metastasis and discuss the potential of targeting this program when treating

  18. Pregnancy at early age is associated with a reduction of progesterone-responsive cells and epithelial Wnt signaling in human breast tissue.

    PubMed

    Muenst, Simone; Mechera, Robert; Däster, Silvio; Piscuoglio, Salvatore; Ng, Charlotte K Y; Meier-Abt, Fabienne; Weber, Walter P; Soysal, Savas D

    2017-04-04

    Pregnancy at early age is the most significant modifiable factor which consistently decreases lifetime breast cancer risk. However, the underlying mechanisms haven't been conclusively identified. Studies in mice suggest a reduction in progesterone-receptor (PR) sensitive epithelial cells as well as a downregulation of the Wnt signaling pathway as being one of the main mechanisms for the protective effect of early pregnancy. The aim of our study was to validate these findings in humans. We collected benign breast tissue of 125 women who had been stratified according to age at first pregnancy and the occurrence of subsequent breast cancer, and performed immunohistochemistry for PR, Wnt4 and the Wnt-target Versican. The number of PR positive epithelial cells was significantly lower in the group of women with early pregnancy and no subsequent breast cancer compared to the group of nulliparous women with subsequent invasive breast cancer (p = 0.0135). In women with early pregnancy, expression of Versican and Wnt4 was significantly lower compared to nulliparous women (p = 0.0036 and p = 0.0241 respectively), and Versican expression was also significant lower compared to women with late pregnancy (p < 0.0001). Our results confirm prior observations in mice and suggest a role of downregulation of epithelial Wnt signaling in the protective effect of early pregnancy in humans. This results in a decreased proliferation of stem/progenitor cells; therefore, the Wnt signaling pathway may represent a potential target for breast cancer prevention in humans.

  19. Treating cancer stem cells and cancer metastasis using glucose-coated gold nanoparticles

    PubMed Central

    Hu, Chenxia; Niestroj, Martin; Yuan, Daniel; Chang, Steven; Chen, Jie

    2015-01-01

    Cancer ranks among the leading causes of human mortality. Cancer becomes intractable when it spreads from the primary tumor site to various organs (such as bone, lung, liver, and then brain). Unlike solid tumor cells, cancer stem cells and metastatic cancer cells grow in a non-attached (suspension) form when moving from their source to other locations in the body. Due to the non-attached growth nature, metastasis is often first detected in the circulatory systems, for instance in a lymph node near the primary tumor. Cancer research over the past several decades has primarily focused on treating solid tumors, but targeted therapy to treat cancer stem cells and cancer metastasis has yet to be developed. Because cancers undergo faster metabolism and consume more glucose than normal cells, glucose was chosen in this study as a reagent to target cancer cells. In particular, by covalently binding gold nanoparticles (GNPs) with thio-PEG (polyethylene glycol) and thio-glucose, the resulting functionalized GNPs (Glu-GNPs) were created for targeted treatment of cancer metastasis and cancer stem cells. Suspension cancer cell THP-1 (human monocytic cell line derived from acute monocytic leukemia patients) was selected because it has properties similar to cancer stem cells and has been used as a metastatic cancer cell model for in vitro studies. To take advantage of cancer cells’ elevated glucose consumption over normal cells, different starvation periods were screened in order to achieve optimal treatment effects. Cancer cells were then fed using Glu-GNPs followed by X-ray irradiation treatment. For comparison, solid tumor MCF-7 cells (breast cancer cell line) were studied as well. Our irradiation experimental results show that Glu-GNPs are better irradiation sensitizers to treat THP-1 cells than MCF-7 cells, or Glu-GNPs enhance the cancer killing of THP-1 cells 20% more than X-ray irradiation alone and GNP treatment alone. This finding can help oncologists to design therapeutic strategies to target cancer stem cells and cancer metastasis. PMID:25844037

  20. Sequence-specific inhibition of microRNA-130a gene by CRISPR/Cas9 system in breast cancer cell line

    NASA Astrophysics Data System (ADS)

    Ainina Abdollah, Nur; Das Kumitaa, Theva; Yusof Narazah, Mohd; Razak, Siti Razila Abdul

    2017-05-01

    MicroRNAs (miRNAs) are short stranded noncoding RNA that play important roles in apoptosis, cell survival, development and cell proliferation. However, gene expression control via small regulatory RNA, particularly miRNA in breast cancer is still less explored. Therefore, this project aims to develop an approach to target microRNA-130a using the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system in MCF7, breast cancer cell line. The 20 bp sequences target at stem loop, 3ʹ and 5ʹ end of miR130a were cloned into pSpCas9(BB)-2A-GFP (PX458) plasmid, and the positive clones were confirmed by sequencing. A total of 5 μg of PX458-miR130a was transfected to MCF7 using Lipofectamine® 3000 according to manufacturer’s protocol. The transfected cells were maintained in the incubator at 37 °C under humidified 5% CO2. After 48 hours, cells were harvested and total RNA was extracted using miRNeasy Mini Kit (Qiagen). cDNAs were synthesised specific to miR-130a using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems). Then, qRT-PCR was carried out using TaqMan Universal Master Mix (Applied Biosystems) to quantify the knockdown level of mature miRNAs in the cells. Result showed that miR-130a-5p was significantly downregulated in MCF7 cell line. However, no significant changes were observed for sequences targeting miR-130a-3p and stem loop. Thus, this study showed that the expression of miR-130a-5p was successfully down-regulated using CRISPR silencing system. This technique may be useful to manipulate the level of miRNA in various cell types to answer clinical questions at the molecular level.

Top