Science.gov

Sample records for buffalo bubalus bubalus

  1. Water buffalo (Bubalus bubalis): complete nucleotide mitochondrial genome sequence.

    PubMed

    Parma, Pietro; Erra-Pujada, Marta; Feligini, Maria; Greppi, Gianfranco; Enne, Giuseppe

    2004-01-01

    In this work, we report the whole sequence of the water buffalo (Bubalus bubalis) mitochondrial genome. The water buffalo mt molecule is 16.355 base pair length and shows a genome organization similar to those reported for other mitochondrial genome. These new data provide an useful tool for many research area, i.e. evolutionary study and identification of food origin.

  2. Biochemical and histochemical studies of the sarcocyst of Sarcocystis fusiformis of buffalo Bubalus bubalis.

    PubMed

    Chaudhry, R K; Kushwah, H S; Shah, H L

    1986-10-01

    The glycogen content and activities of alkaline and acid phosphatases of sarcocysts of Sarcocystis fusiformis from naturally infected Indian water buffalo (Bubalus bubalis) were determined biochemically and histochemically.

  3. Fatal intestinal coccidiosis in a three week old buffalo calf (Bubalus bubalus).

    PubMed

    Dubey, J P; Wouda, W; Muskens, J

    2008-12-01

    The water buffalo (Bubalus bubalus) is important to the economy of several countries, especially in Asia and Brazil. Little is known of the impact of coccidiosis in buffaloes. Cattle and buffaloes are considered to have common species of Eimeria but critical cross transmissions have not been made because it is difficult to raise these hosts coccidian free. Clinical coccidiosis was confirmed post mortem in a 22-day old buffalo calf that died after a 3-4 day illness. Oocysts morphologically identical to Eimeria bareillyi were found in the feces and in sections of small intestine. Oocysts were often pyriform, sometimes with asymmetrical sides. The shorter end was flattened and approximately 5-6 microm wide. Unsporulated oocysts in feces were 23.2-29.5 x 16.5-22 microm in size with an average of 27.2 x 19.3 microm . Schizonts, gamonts, and oocysts were identified in sections of small intestine and they were located in entrocytes of jejunum and ileum. No coccidian stages were seen in sections of colon. This is one of the first confirmed cases of clinical coccidiosis in water buffalo.

  4. [The fertility of the water buffalo (Bubalus bubalus)].

    PubMed

    TerMeulen, U; Bode, E; Nothelle, G

    1995-12-01

    In the present study the conception- and calving-frequencies of Nili-Ravi milk buffaloes were calculated over a year's period in the Punjab region of Pakistan. The results show prominent fluctuations throughout the year with a minimum calving-frequency of 1.6% in March and a minimum conception-frequency of 1.8% in May and maximum calving frequencies of 15.2% in November. This distribution occurs in association with unsuitable and suitable climatic conditions respectively, and also in association with the feeding situation which is better in autumn than in spring (Nothelle, 1992). Thibault and Levasseur (1974) believe that there is an inborn seasonal nature of sexual activity for nearly all mammals. This principle surely applies to the milk buffaloes, although it is confirmed that the buffalo cow is a poly-oestrous animal with a regular sexual cycle all over the year. Through breeding-, feeding-, animal husbandry- and management practice it is possible to compensate the fluctuations of conception- and calving frequencies over the whole year.

  5. Isolation of Arcobacter species in water buffaloes (Bubalus bubalis).

    PubMed

    Piva, Silvia; Serraino, Andrea; Florio, Daniela; Giacometti, Federica; Pasquali, Frederique; Manfreda, Gerardo; Zanoni, Renato Giulio

    2013-05-01

    This is the first report of Arcobacter spp. in rectal fecal samples from healthy water buffaloes (Bubalus bubalis) reared on a dairy farm. Arcobacter species were isolated after enrichment, and isolates were identified at species level by multiplex-polymerase chain reaction assay. Thirty samples were examined and Arcobacter spp. were isolated from 96.7% of water buffaloes tested: 38 Arcobacter spp. isolates were obtained, with A. cryaerophilus as the dominant species followed by A. butzleri and A. skirrowii. Nine animals (31%) were colonized by more than one Arcobacter species. The present study indicates that water buffaloes can harbor a variety of Arcobacter spp. and that healthy buffaloes may act as hosts. Water buffalo fecal shedding of Arcobacter spp. may be of significance to human health, considering the potential fecal contamination during harvesting of raw milk and slaughtering.

  6. Experimental Sarcocystis hominis infection in a water buffalo (Bubalus bubalis).

    PubMed

    Chen, X W; Zuo, Y X; Hu, J J

    2003-04-01

    A water buffalo (Bubalus bubalis) was fed 5.0 x 10(5) Sarcocystis hominis sporocysts from a human volunteer who had ingested S. hominis cysts from naturally infected cattle. A necropsy was performed on the buffalo 119 days after inoculation, and a large number of microscopic sarcocysts (approximately 5,000/g) were found in skeletal muscles. Ultrastructurally, the sarcocyst wall from buffalo muscles has upright villar protrusions measuring about 5.6 x 0.8 microm with numerous microtubules that run from the base to the apex. Sarcocysts from this buffalo were infective to 2 human volunteers, confirming their identity as S. hominis. Therefore, we believe that buffaloes can act experimentally as the intermediate host for S. hominis.

  7. Sarcocystis levinei infection in Philippine water buffaloes (Bubalus bubalis).

    PubMed

    Claveria, F G; Cruz, M J

    2000-01-01

    Ultrastructural studies of sarcocysts obtained from Philippine water buffaloes revealed the presence of the commonly reported macroscopic species, Sarcocystis fusiformis, and the microscopic species Sarcocystis levinei (Dissanaike A, Kan S. Studies on Sarcocystis in Malaysia. I: Sarcocystis levinei n.sp. from the water buffalo Bubalus bubalis. Z Parasitenkd 1978;55:127-38), (Huong L, Dubey J, Uggla A. Redescription of Sarcocystis levinei Dissanaike and Kan, 1978 (Protozoa: Sarcocystidae) of the water buffalo (Bubalus bubalis). J Parasitol 1997;83:1148-52). The globular to oval microscopic cysts commonly observed in the muscles of the diaphragm and neck exhibit compartmentalized arrangement of zoites with septal partitions and measure 13-48 microns in diameter. The parasitophorous vacuolar membrane of sarcocyst bears minute and hair-like villar protrusions measuring 2.3-2.75 microns long emanating at certain distances from the primary cyst wall and lack microfilaments. Villar protrusions have expanded to dome-shaped base measuring 0.33-1.6 microns long by 0.22-1.0 micron wide, and intermediate and tapering distal segments bent approximately 90 degrees and run parallel to the cyst surface. The distal segments at some areas join to form conical tufts. The primary cyst wall bears numerous prominent undulations that are arranged in small clusters. The ground substance is 0.42-0.57 micron thick. This paper documents the first report of S. levinei in Philippine water buffaloes possessing the type 7 cyst wall.

  8. Fatal onion (Allium cepa) toxicosis in water buffalo (Bubalus bubalis).

    PubMed

    Borelli, Vanessa; Lucioli, Joelma; Furlan, Fernando Henrique; Hoepers, Patrícia Giovana; Roveda, Juliano Fleck; Traverso, Sandra Davi; Gava, Aldo

    2009-05-01

    Toxicosis caused by the ingestion of onion (Allium cepa) by 5 water buffalo (Bubalus bubalis) occurred in the district of Caçador, Santa Catarina, Brazil. The water buffalo died after ingestion of a large quantity of onion that had been left in the pasture. Clinical signs started 8 days postingestion and were characterized by pale mucous membranes, lethargy, and dark urine. At necropsy, pieces of onions were found in the rumen of 1 animal. The carcass smelled strongly of onion, and the kidneys and urine were dark brown. Microscopic renal lesions included tubular degeneration and necrosis with deposits of eosinophilic material in the cytoplasm of renal tubular epithelial cells and tubular lumina. These changes were consistent with hemoglobinuric nephrosis. Centrilobular coagulation necrosis was observed in the liver accompanied by hemorrhage and macrophages containing brown cytoplasmic pigment. A diagnosis of hemolytic anemia caused by onion toxicosis was based on the epidemiological data, clinical signs, macroscopic changes, and histological lesions.

  9. Fatal onion (Allium cepa) toxicosis in water buffalo (Bubalus bubalis).

    PubMed

    Borelli, Vanessa; Lucioli, Joelma; Furlan, Fernando Henrique; Hoepers, Patrícia Giovana; Roveda, Juliano Fleck; Traverso, Sandra Davi; Gava, Aldo

    2009-05-01

    Toxicosis caused by the ingestion of onion (Allium cepa) by 5 water buffalo (Bubalus bubalis) occurred in the district of Caçador, Santa Catarina, Brazil. The water buffalo died after ingestion of a large quantity of onion that had been left in the pasture. Clinical signs started 8 days postingestion and were characterized by pale mucous membranes, lethargy, and dark urine. At necropsy, pieces of onions were found in the rumen of 1 animal. The carcass smelled strongly of onion, and the kidneys and urine were dark brown. Microscopic renal lesions included tubular degeneration and necrosis with deposits of eosinophilic material in the cytoplasm of renal tubular epithelial cells and tubular lumina. These changes were consistent with hemoglobinuric nephrosis. Centrilobular coagulation necrosis was observed in the liver accompanied by hemorrhage and macrophages containing brown cytoplasmic pigment. A diagnosis of hemolytic anemia caused by onion toxicosis was based on the epidemiological data, clinical signs, macroscopic changes, and histological lesions. PMID:19407101

  10. Frequency of Toxoplasmosis in Water Buffalo (Bubalus bubalis) in Trinidad.

    PubMed

    Persad, Anil; Charles, Roxanne; Adesiyun, Abiodun A

    2011-01-01

    Toxoplasmosis has been reported to occur in several animals and humans causing different clinical manifestations. The study was conducted to determine the frequency of Toxoplasma gondii antibodies (IgG) in water buffalo (Bubalus bubalis) across farms in Trinidad using a latex agglutination test. Of a total of 333 water buffalo tested, 26 (7.8%) were seropositive for T. gondii antibodies. Seropositivity for toxoplasmosis was statistically significantly (P < 0.05; χ(2)) higher in adult water buffalo, 12.4% (14 of 113) compared with young water buffalo, 4.2% (6 of 143). Seropositivity for toxoplasmosis across the seven farms ranged from 0.0% (0 of 20) in Farm G compared with 20.0% (10 of 50) detected in Farm B. The differences in seropositivity by management system, free-ranging 6.7% (14 of 213) and semi-intensive 10.0% (12 of 120) and by sex, in male 6.7% (7 of 104) and female 8.3% (19 of 229) water buffalo, were not statistically significant (P > 0.05; χ(2)). This is the first documentation of toxoplasmosis in water buffalo in Trinidad.

  11. Embryo transfer in water buffalo (Bubalus bubalis).

    PubMed

    Drost, M; Wright, J M; Cripe, W S; Richter, A R

    1983-11-01

    A normal, live 35-kg water buffalo bull calf was born 300 days after it was nonsurgically collected as a 7-day blastocyst from a water buffalo donor and transferred nonsurgically to an unrelated water buffalo recipient. The development of estrus synchronization, superovulation and estrus detection methods in water buffalo are described.

  12. Baccharis megapotamica var. weirii poisoning in water buffalo (Bubalus bubalis).

    PubMed

    Oliveira-Filho, José C; Carmo, Priscila M S; Lucena, Ricardo B; Pierezan, Felipe; Barros, Claudio S L

    2011-05-01

    An outbreak of an acute disease in buffalo (Bubalus bubalis) caused by the ingestion of Baccharis megapotamica var. weirii occurred in the southern region of Brazil. Ten out of 50 buffalo died 24-48 hr after being introduced into a pasture containing abundant amounts of the plant. Factors influencing the ingestion of the plant and consequent toxicosis included hunger, stress caused by shipment, and unfamiliarity with the plant. Clinical signs included serous ocular discharge, incoordination, mild bloat, and muscle trembling. One buffalo was necropsied. Gross findings included dehydration, abundant liquid in the rumen, reddening of the mucosa of forestomachs, abomasum, and intestine, and edema of the wall of the rumen. The main histologic lesions were superficial to full thickness degeneration and necrosis of the stratified epithelium lining the forestomachs, necrosis of the intestinal mucosa, and widespread lymphoid necrosis. A calf (Bos taurus) was fed a single dose of 5 g/kg/body weight of B. megapotamica var. weirii harvested from the same site where the buffalo died. Twenty hours after the administration of the plant this calf died with clinical signs and lesions similar to those observed in the naturally poisoned buffalo.

  13. Water buffalo (Bubalus bubalis) hemoglobins: an electrophoretic and chromatographic study.

    PubMed

    Di Luccia, A; Iannibelli, L; Ferranti, P; Iorio, M; Annunziata, M; Ferrara, L

    1989-01-01

    1. Hemoglobins from three phenotypes of Italian water buffalo (Bubalus bubalis), named AA, AB and BB, were selected by starch gel electrophoresis at alkaline pH and analyzed using polyacrylamide gel isoelectric focusing and subsequent analysis of titration curves to reveal differences between two types of hemoglobin identified as Hb fast and Hb slow. 2. Globins from Hb fast and Hb slow were purified by fast protein liquid chromatography (FPLC). Electrophoretic differences were found in the respective alpha-chains using polyacrylamide gel disc-electrophoresis at acid pH, polyacrylamide gel isoelectric focusing and by subsequently analyzing titration curves. 3. The results suggest that the alpha chains of Hb fast and Hb slow, called I alpha and II alpha, respectively, differ in at least two aminoacid residues. Subsequently, these amino acids were identified as lysine and cysteine.

  14. A review of Neospora caninum in water buffalo (Bubalus bubalis).

    PubMed

    Reichel, Michael P; McAllister, Milton M; Nasir, Amar; Moore, Dadin P

    2015-09-15

    A number of countries in the world have reported infections with Neospora caninum in water buffalo (Bubalus bubalis), from Africa to Asia, Europe and South America and recently Australia. In general, clinical manifestations (such as abortion) seem rare, which has raised the prospect that buffalo may be inherently resistant to clinical effects of N. caninum infection. Worldwide, the seroprevalence of N. caninum infection (as a measure of exposure determined by the detection of antibody) in buffalo is high, at approximately 48%. This reported seroprevalence is three or four times higher than that reported from the world's cattle populations, which have collective seroprevalence rates of 16.1% for dairy cattle and 11.5% for beef cattle. However, there is a lack of standardisation in seroprevalence studies and some studies may well under-estimate the true level of infection. Epidemiologic evidence supports post-natal transmission, and in utero transmission has also been demonstrated. The causes for water buffalo to have markedly higher seroprevalence but apparently lower neosporosis abortion rates than cattle warrant further investigation. PMID:26298507

  15. A review of Neospora caninum in water buffalo (Bubalus bubalis).

    PubMed

    Reichel, Michael P; McAllister, Milton M; Nasir, Amar; Moore, Dadin P

    2015-09-15

    A number of countries in the world have reported infections with Neospora caninum in water buffalo (Bubalus bubalis), from Africa to Asia, Europe and South America and recently Australia. In general, clinical manifestations (such as abortion) seem rare, which has raised the prospect that buffalo may be inherently resistant to clinical effects of N. caninum infection. Worldwide, the seroprevalence of N. caninum infection (as a measure of exposure determined by the detection of antibody) in buffalo is high, at approximately 48%. This reported seroprevalence is three or four times higher than that reported from the world's cattle populations, which have collective seroprevalence rates of 16.1% for dairy cattle and 11.5% for beef cattle. However, there is a lack of standardisation in seroprevalence studies and some studies may well under-estimate the true level of infection. Epidemiologic evidence supports post-natal transmission, and in utero transmission has also been demonstrated. The causes for water buffalo to have markedly higher seroprevalence but apparently lower neosporosis abortion rates than cattle warrant further investigation.

  16. Intimal changes in the coronary arteries of Indian water buffaloes (Bubalus bubalis).

    PubMed

    Gupta, P P; Singh, B; Gill, B S

    1978-01-01

    Of 75 Indian water buffaloes (Bubalus bubalis) examined, 14 6-year-old or older buffaloes had early atherosclerotic lesions in the coronary arteries. These lesions resembled fatty streaks seen in man. Ageing changes and gross and microscopic features of the fatty streaks in the vessels resembled those described in the corresponding arteries of man.

  17. Monensin toxicosis in water buffaloes (Bubalus bubalis).

    PubMed

    Rozza, Daniela Bernadete; Vervuert, Ingrid; Kamphues, Josef; da Cruz, Cláudio Estêvão Farias; Driemeier, David

    2006-09-01

    The consumption of monensin-containing feed resulted in deaths of water buffaloes from a feedlot in which cattle and buffaloes were kept together. The monensin formulation was recommended only for use in cattle. Anorexia, muscular weakness, dyspnea, and recumbency were the major clinical findings. The most significant gross lesions were focal pale areas in semitendinosus and semimembranosus muscles, in which segmental necrosis of myofibers was seen microscopically. To compare susceptibilities of species to monensin, 3 bovine calves and 3 buffalo calves were orally dosed. At 5, 7.5, and 10 mg/kg of monensin, only the buffaloes became ill and died. Clinical signs initiated 18-20 h postdosing and were comparable to those from field cases. Gross changes consisted of ascites, hydrothorax, hydropericardium, hepatomegaly, and focal pale areas in the myocardium and to a lesser degree in semitendinosus and semimembranosus muscles. Histopathological changes also resembled those from the field cases, but were especially pronounced in the myocardial cells. The hypothesis that buffaloes could have a lower tolerance to monensin than cattle has been supported by experimental cases.

  18. Vitrification of buffalo (Bubalus bubalis) oocytes.

    PubMed

    Dhali, A; Manik, R S; Das, S K; Singla, S K; Palta, P

    2000-04-01

    The objective of the present study was to develop a method for the cryopreservation of buffalo oocytes by vitrification. Cumulus-oocyte complexes (COCs) were obtained from slaughterhouse ovaries. Prior to vitrification of COCs in the vitrification solution (VS) consisting of 4.5 M ethylene glycol, 3.4 M dimethyl sulfoxide, 5.56 mM glucose, 0.33 mM sodium pyruvate and 0.4% w/v bovine serum albumin in Dulbecco's phosphate buffered saline (DPBS), the COCs were exposed to the equilibration solution (50% VS v/v in DPBS) for 1 or 3 min at room temperature (25 to 30 degrees C). The COCs were then placed in 15-microL of VS and immediately loaded into 0.25-mL French straws, each containing 150 microL of 0.5 M sucrose in DPBS. The straws were placed in liquid nitrogen (LN2) vapor for 2 min, plunged and stored in LN2 for at least 7 d. The straws were thawed in warm water at 28 degrees C for 20 sec. For dilution, the COCs were equilibrated in 0.5 M sucrose in DPBS for 5 min and then washed 4 to 5 times in the washing medium (TCM-199+10% estrus buffalo serum). The proportion of oocytes recovered in a morphologically normal form was significantly higher (98 and 88%, respectively; P<0.05), and the proportion of oocytes recovered in a damaged form was significantly lower (2 and 12%, respectively; P<0.05) for the 3-min equilibration than for 1 min. For examining the in vitro developmental potential of vitrified-warmed oocytes, the oocytes were placed in 50-microL droplets (10 to 15 oocytes per droplet) of maturation medium (TCM-199+15% FBS+5 microg/mL FSH-P), covered with paraffin oil in a 35-mm Petri dish and cultured for 26 h in a CO2 incubator (5% CO2 in air) at 38.5 degrees C. Although the nuclear maturation rate did not differ between the 1- and 3-min equilibration periods (21.5+/-10.7 and 31.5+/-1.5%, respectively), the between-trial variation was very high for the 1-min period. This method of vitrification is simple and rapid, and can be useful for cryopreservation of

  19. Testicular cells in hybrid water buffaloes (Bubalus bubalis).

    PubMed

    Bongso, T A; Hilmi, M; Basrur, P K

    1983-11-01

    Meiotic chromosome behaviour and testicular histology were studied in water buffaloes (Bubalus bubalis) including two river (Murrah), two swamp and three F1 (Murrah cross swamp) hybrids aged between two and two and a half years, from testicular biopsies obtained by an open surgical method. Meiotic preparations revealed spermatogonial metaphases, pachytene, diplotene, diakinesis, first and second meiotic metaphases and spermatozoa in all three types of buffalo. Chromosome sets ranging from 22 to 26 (most frequent, 24 and 25) with many cells carrying univalent, bivalent and multivalent configurations were observed in hybrids, whereas the meiotic cells in the Murrah and swamp showed chromosome sets exclusively of 25 and 24 (bivalents) respectively. Histological examination of the hybrid testis revealed a large proportion of degenerating spermatocytes and abnormal spermatids in the process of spermiogenesis suggesting that the various synaptic associations leading to unbalanced gametes may be responsible for the degenerating germ cells in the hybrids. The unbalanced meiotic products will probably lead to selection against such spermatozoa or early embryos after fertilisation. Due to a large percentage of germinal epithelial cells in F1 hybrids being wasted, the fertility of backcross and F2 generations will be subnormal.

  20. Heterochromia iridis in water buffaloes (Bubalus bubalis).

    PubMed

    Misk, N.A.; Semieka, M.A.; Fathy, A.

    1998-01-01

    This study included 45 unaffected animals and 593 animals affected with heterochromia irides, and 85 enucleated eyeballs with heterochromia irides. The classification of heterochromia irides, morphology of normal and heterochromic irides, and the histology, ultrastructure, and scanning electron microscopy are presented. The incidence of heterochromia irides in water buffaloes was 7.62% affecting either one or both eyes. Both complete and partial heterochromia irides occurred. Complete heterochromia iridis is more frequent than the partial form in either bilateral or unilateral cases. The pupil has a dumb-bell-shape appearance. Granula iridica occurred at the upper (100%) and lower (30%) pupillary margins and originated from the posterior pigmented epithelium. In heterochromia irides, the melanocytes is absent in the anterior border and stromal layers, and iridal thickness appeared thinner than that of normal eyes.

  1. Prevalence and molecular characterization of Sarcocystis species in water buffaloes (Bubalus bubalus) in Egypt.

    PubMed

    Ashmawy, Karam I; Abu-Akkada, Somaia S; Ghashir, Mohamed Bn

    2014-12-01

    The present study was planned to investigate the prevalence of Sarcocystis spp. among slaughtered water buffaloes (Bubalus bubalis) at Alexandria province, Egypt. Three hundred blood samples were collected from slaughtered buffaloes (5-7 years old). Two techniques were used to evaluate the seroprevalence of Sarcocystis spp., enzyme-linked immunosorbent assay (ELISA) and indirect haemagglutination assay (IHA). It was revealed that 203 (67.6 %) and 191 (63.6 %) of the tested serum samples were seropositive to Sarcocystis spp. by ELISA and IHA, respectively. The results of sensitivity and specificity of IHA relative to ELISA were 94 and 100 %, respectively. For molecular characterization of inter- and intra-species genetic polymorphism within Egyptian isolates of Sarcocystis spp. of water buffaloes, polymerase chain reaction (PCR) and polymerase chain reaction-restriction length polymorphisms (PCR-RFLPs) were performed on four macroscopic isolates. The isolates represented two different geographical regions of Egypt, Alexandria and Assuit provinces. Alexandria isolates (large and small-sized cyst of the same host) and Assuit isolates (large and small-sized cyst of the same host) were used. The 18S rDNA of the macroscopic cysts were characterized, in tandem, by four restriction endonucleases, RsaI, MboI, SspI and DraI. RsaI and MboI enzymes did not show any restriction sites for all isolates, leaving the amplified fragments without cutting. SspI showed two fragments in Alexandria and Assuit small-sized isolates cut by the enzyme at 600-700-bp fragments, while Alexandria and Assuit large-sized cysts amplicons were not digested by this enzyme. The fourth enzyme, DraI, cut the PCR product of Alexandria large-sized cysts into two fragments (420-780 bp), while Assuit large-sized amplicon was not cut. It could be concluded that there was a far distance between the two local isolates (small and large sized), but there were no differences between the large-sized isolates.

  2. Enhancing reproductive performance in domestic dairy water buffalo (Bubalus bubalis).

    PubMed

    Zicarelli, L

    2010-01-01

    The purpose of the review is to describe the factors that affect fertility in domestic water buffalo (Bubalus bubalis) and the techniques that enable an improvement in reproductive performance. On Italian and Latin American farms where natural mating is practiced and bulls are always present in the herd, the inter-calving interval is approximately 400 days and the culling rate is lower than 15%. The buffalo has a tendency for seasonal reproductive activity. Reproduction is favoured when there is a decrease in day length. Ovarian activity stops if conception does not occur within 3 to 5 ovarian cycles. It is important, therefore, that appropriate management of the transition period is practiced, particularly with respect to the hygienic conditions of the uterus. In tropical countries located north of the equator, feed deficiencies and heat stress are considered the main factors that lead to poor fertility in the summer. In Pakistan, for example, the increase in body condition score during the autumn was associated with the commencement of the breeding season in buffaloes. Anoestrus is observed also in Italy, however, where the average daily temperature during the same period is 13.5 to 23.5 degrees C and feeding is constant throughout the year. The only common element between the two areas is the progressive increase in daylight hours between April and June and the day length greater than 12 hours up to September. In Italian herds that apply an out-of-season breeding strategy, an improvement in fertility (measured as the percentage of corpora lutea corresponding to subsequent pregnancy) is observed when water pools are present on the farm. This demonstrates that an improvement in environmental conditions reduces the incidence of embryonic mortality and/or abnormal cycles. To summarize, in the absence of serious nutritional problems, an improvement in environmental conditions increases fertility in buffalo.

  3. Production of wild buffalo (Bubalus arnee) embryos by interspecies somatic cell nuclear transfer using domestic buffalo (Bubalus bubalis) oocytes.

    PubMed

    Priya, D; Selokar, N L; Raja, A K; Saini, M; Sahare, A A; Nala, N; Palta, P; Chauhan, M S; Manik, R S; Singla, S K

    2014-04-01

    The objective of this study was to explore the possibility of producing wild buffalo embryos by interspecies somatic cell nuclear transfer (iSCNT) through handmade cloning using wild buffalo somatic cells and domestic buffalo (Bubalus bubalis) oocytes. Somatic cells derived from the ear skin of wild buffalo were found to express vimentin but not keratin and cytokeratin-18, indicating that they were of fibroblast origin. The population doubling time of skin fibroblasts from wild buffalo was significantly (p < 0.05) higher, and the cell proliferation rate was significantly (p < 0.05) lower compared with that of skin fibroblasts from domestic buffalo. Neither the cleavage (92.6 ± 2.0% vs 92.8 ± 2.0%) nor the blastocyst rate (42.4 ± 2.4% vs 38.7 ± 2.8%) was significantly different between the intraspecies cloned embryos produced using skin fibroblasts from domestic buffalo and interspecies cloned embryos produced using skin fibroblasts from wild buffalo. However, the total cell number (TCN) was significantly (p < 0.05) lower (192.0 ± 25.6 vs 345.7 ± 42.2), and the apoptotic index was significantly (p < 0.05) higher (15.1 ± 3.1 vs 8.0 ± 1.4) for interspecies than that for intraspecies cloned embryos. Following vitrification in open-pulled straws (OPS) and warming, although the cryosurvival rate of both types of cloned embryos, as indicated by their re-expansion rate, was not significantly different (34.8 ± 1.5% vs 47.8 ± 7.8), the apoptotic index was significantly (p < 0.05) higher for vitrified-warmed interspecies than that for corresponding intraspecies cloned embryos (48.9 ± 7.2 vs 23.9 ± 2.8). The global level of H3K18ac was significantly (p < 0.05) lower in interspecies cloned embryos than that in intraspecies cloned embryos. The expression level of HDAC1, DNMT3a and CASPASE3 was significantly (p < 0.05) higher, that of P53 was significantly (p < 0.05) lower in interspecies than in intraspecies embryos, whereas that of DNMT1 was similar between the two

  4. Evaluation of fasting metabolism of growing water buffalo (Bubalus, Bubalis).

    PubMed

    Qin, Guangsheng; Zou, Caixia; Pang, Chunying; Yang, Bingzhuan; Liang, Xianwei; Liu, Jianxin; Xia, Zhongsheng; Wen, Qiuyan; Yan, Tianhai

    2011-12-01

    The objectives of the present study were to evaluate fasting metabolism (FM) of water buffalo (Bubalus, Bubalis) at three stages of growth (12, 18 and 24 months) in Guangxi, China. Five female water buffalo were used for each age group and their live weight was on average 254, 326 and 338 kg, respectively. All animals were of average body condition, healthy and de-wormed before start of the study. Prior to a 6-day fasting period, buffalo were offered a mixed diet of forage and concentrates (70% and 30%, dry matter basis) on a restricted nutritional level (419 kJ/kg(0.75) of metabolizable energy, ME) for 15 days. Gas exchanges for each animal were determined for 3 days from day 4 of starvation, using open-circuit respiratory head hoods. Fasting body weight was 0.918 of live weight (P < 0.001, r(2) = 0.99). Both fasting heat production (FHP) and FM (MJ/day) increased significantly with increased age of animals (P < 0.05). Linear regression analysis indicated a positive relationship between fasting body weight (kg(0.75)) and FHP (MJ/day, P < 0.01, r(2) = 0.49) or FM (MJ/day P < 0.01, r(2) = 0.52) when using individual animal data across three groups. However, when expressed as kJ/kg(0.75) of fasting body weight, the differences in FHP or FM between three groups of animals were not significant. The present average FHP and FM (322 and 347 kJ/kg(0.75) of fasting body weight) were compatible to those published in the literature for water buffalo, beef and dairy cattle. The present FM data were also used to estimate net energy (NE(m)) and ME (ME(m)) requirements for maintenance for water buffalo. The results for these two parameters were similar to those for FHP and FM. There was no significant difference between three groups of buffalo in NE(m) or ME(m) when expressed as kJ/kg(0.75) of live weight. The present average NE(m) and ME(m) values (347 and 506 kJ/kg(0.75) of live weight) are close to those proposed by the Agricultural and Food Research Council adopted in UK for

  5. Evaluation of fasting metabolism of growing water buffalo (Bubalus, Bubalis).

    PubMed

    Qin, Guangsheng; Zou, Caixia; Pang, Chunying; Yang, Bingzhuan; Liang, Xianwei; Liu, Jianxin; Xia, Zhongsheng; Wen, Qiuyan; Yan, Tianhai

    2011-12-01

    The objectives of the present study were to evaluate fasting metabolism (FM) of water buffalo (Bubalus, Bubalis) at three stages of growth (12, 18 and 24 months) in Guangxi, China. Five female water buffalo were used for each age group and their live weight was on average 254, 326 and 338 kg, respectively. All animals were of average body condition, healthy and de-wormed before start of the study. Prior to a 6-day fasting period, buffalo were offered a mixed diet of forage and concentrates (70% and 30%, dry matter basis) on a restricted nutritional level (419 kJ/kg(0.75) of metabolizable energy, ME) for 15 days. Gas exchanges for each animal were determined for 3 days from day 4 of starvation, using open-circuit respiratory head hoods. Fasting body weight was 0.918 of live weight (P < 0.001, r(2) = 0.99). Both fasting heat production (FHP) and FM (MJ/day) increased significantly with increased age of animals (P < 0.05). Linear regression analysis indicated a positive relationship between fasting body weight (kg(0.75)) and FHP (MJ/day, P < 0.01, r(2) = 0.49) or FM (MJ/day P < 0.01, r(2) = 0.52) when using individual animal data across three groups. However, when expressed as kJ/kg(0.75) of fasting body weight, the differences in FHP or FM between three groups of animals were not significant. The present average FHP and FM (322 and 347 kJ/kg(0.75) of fasting body weight) were compatible to those published in the literature for water buffalo, beef and dairy cattle. The present FM data were also used to estimate net energy (NE(m)) and ME (ME(m)) requirements for maintenance for water buffalo. The results for these two parameters were similar to those for FHP and FM. There was no significant difference between three groups of buffalo in NE(m) or ME(m) when expressed as kJ/kg(0.75) of live weight. The present average NE(m) and ME(m) values (347 and 506 kJ/kg(0.75) of live weight) are close to those proposed by the Agricultural and Food Research Council adopted in UK for

  6. Characterization and kinetics studies of water buffalo (Bubalus bubalis) myoglobin.

    PubMed

    Dosi, Roberta; Di Maro, Antimo; Chambery, Angela; Colonna, Giovanni; Costantini, Susan; Geraci, Giuseppe; Parente, Augusto

    2006-10-01

    The colour of buffalo (Bubalus bubalis L.) meat is darker than bovine meat. Since meat colour depends on the concentration of myoglobin (Mb) and its oxidation state, we have determined the main structural and functional properties of buffalo Mb. Buffalo Mb was purified from longissimus dorsi muscles and its molecular mass determined by ESI Q-TOF mass spectrometry. The molecular mass 17,034.50 was 86.20 Da higher than the bovine Mb. This was confirmed by analysing its primary structure, using a combined approach based on Edman degradation and MALDI-TOF mass spectrometry. Comparing the amino acid sequences of both Mbs, we found three amino acid differences out of 153 amino acid residues. One is a conservative substitution (D(bov)141E(buf)), and the other two (A(bov)19T(buf) and A(bov)117D(buf)) are nonconservative. These amino acid substitutions are unlikely to cause structural changes because they are located far from the heme binding pocket, as revealed by the 3D structure of buffalo Mb elaborated by homology modelling. Stability analyses show no difference with the bovine Mb for helix E and only minor differences in the stability values for helices A and G. Moreover, autoxidation rates of purified buffalo and bovine myoglobins at 37 degrees C, pH 7.2, were almost identical, 0.052+/-0.001 h(-1) and 0.054+/-0.002 h(-1), respectively, as were their oxygen-binding Kd values, 3.7+/-0.1 microM and 3.5+/-0.1 microM, respectively. The percent of MetMb values were almost identical. The results presented here suggest that the darker buffalo meat depends on factors other than the oxidation rate of its Mb, as, for example, the Mb content (0.393+/-0.005 g/100 g of tissue) and consequently MetMb, which are almost twice as high as bovine meat (Mb: 0.209+/-0.003 g/100 g of tissue).

  7. Giardia and Cryptosporidium in water buffaloes (Bubalus bubalis).

    PubMed

    Rinaldi, L; Musella, V; Condoleo, R; Saralli, G; Veneziano, V; Bruni, G; Condoleo, R U; Cringoli, G

    2007-04-01

    A cross-sectional survey of Giardia duodenalis and Cryptosporidium parvum infection in the water buffalo (Bubalus bubalis) was carried out in central Italy. A geographical information system (GIS) was constructed utilizing as data-layers the topographic base map and the digital aerial photographs of the study area, as well as the geo-referenced points of all the buffalo farms. The survey was conducted on a sample of 90 farms, selected using a grid approach followed by proportional allocation. For this purpose, a grid representing quadrants of 5 x 5 km was overlaid on the study area within the GIS. As a result, the study area was divided in equal quadrants, and the number of farms sampled in each quadrant was proportional to the total number of study population in that quadrant. On each farm, faecal samples were collected per rectum from three to five asymptomatic buffalo calves, aged from 1 to 9 weeks. The total number of faecal samples collected was 347. Each faecal sample was tested for the presence of copro-antigens of G. duodenalis and of C. parvum using two commercially available enzyme-linked immunosorbent assays. Out of the 90 farms, 27 (30.0%) resulted positive for G. duodenalis and 22 (24.4%) for C. parvum. Co-infection was found in ten (11.1%) farms. With respect to animals, out of the 347 faecal samples, 63 (18.1%) were found to have antigens of G. duodenalis and 51 (14.7%) of C. parvum. Co-infection was found in ten buffalo calves (2.9%). The results of the logistic regression models showed a positive association between the positivity to G. duodenalis and the presence of sheep on farm and between the positivity to C. parvum and the high number of buffaloes on farms. No significant co-infection between the two protozoa was found. In conclusion, the findings of the present study, derived from a systematic territorial survey planned with GIS, are noteworthy because they provided additional data on C. parvum and the first evidence of G. duodenalis

  8. Sarcocystis dubeyi (Huong and Uggla, 1999) infection in water buffaloes (Bubalus bubalis) from Egypt

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Water buffaloes (Bubalus bubalis) are intermediate hosts for 4 species of Sarcocystis, i.e., S. fusiformis and S. buffalonis with cats as definitive hosts, S. levinei with dogs as definitive hosts, and S. dubeyi with an unknown definitive host, but thought to be zoonotic. Currently, the latter speci...

  9. Redescription of Sarcocystis fusiformis sarcocysts from the water buffalo (Bubalus bubalis)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Five species of Sarcocystis have been reported from the water buffalo (Bubalus bubalis): Sarcocystis fusiformis and Sarcocystis buffalonis have macrocysts and cats act as definitive hosts; Sarcocystis levinei has microcysts and dogs act as definitive host; Sarcocystis dubeyi and S. sinensis have mic...

  10. Effects of co-stocking smallmouth buffalo, Ictiobus bubalus, with channel catfish, Ictalurus punctatus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proliferative gill disease (PGD) in catfish is caused by the myxozoan Henneguya ictaluri. The complex life cycle requires Dero digitata as the oligochaete host. Efforts to control PGD by eradicating D. digitata have been unsuccessful. Smallmouth buffalo, Ictiobus bubalus, (SMB) are opportunistic bot...

  11. Biochemistry of the sarcocyst of Sarcocystis fusiformis of buffalo Bubalus bubalis.

    PubMed

    Chaudhry, R K; Kushwah, H S; Shah, H L

    1985-04-01

    Sarcocysts of Sarcocystis fusiformis from oesophageal muscles of naturally-infected Indian water buffalo (Bubalus bubalis) were analysed for total lipids, phospholipids, cholesterol, fatty acids and glycerides and total protein. Protein and phospholipids constituted the major portion of the sarcocyst. Acetylcholinesterase and glutamate-oxalo-acetate transaminase activities when assayed were higher than glutamate-pyruvate transaminase in sarcocysts.

  12. Ultrastructure and innervation of water buffalo (Bubalus bubalis) seminal vesicle.

    PubMed

    Abou-Elmagd, A; Kujat, R; Wrobel, K H

    1992-01-01

    The lining epithelium of secretory end pieces and central glandular duct in the seminal vesicle of the water buffalo (Bubalus bubalis) consists of columnar principal and small polymorphous basal cells. A system of intercellular and even intracellular canaliculi enlarges the secretory surface. The most prominent organelle of the columnar principal cells is the granular endoplasmic reticulum, forming large aggregates of parallel lamellae. Using antibodies against the neural cell adhesion molecule L1 and the neural marker protein gene product 9.5 (PGP 9.5), the innervation pattern of the seminal vesicle becomes evident. The muscular layer surrounding the propria contains a dense network of unmyelinated fibers. Thicker bundles traverse the muscular layer to reach the propria. Around glandular secretory tubules and below the epithelial lining of the glandular duct a tightly woven subepithelial plexus is observed which sends short penetrating branches into the basal zone of the epithelium. These intraepithelial nerves are devoid of Schwann cells and basal lamina (naked axons) and are situated within the intercellular spaces between principal and basal cells. Acetylcholinesterase histochemistry with short (1-2 h) incubation times, dopamine-beta-hydroxylase immunohistochemistry and ultrastructural study of transmitter-containing vesicles was performed. The results suggest that muscular contraction in the seminal vesicle is predominantly under the influence of the sympathetic nervous system, whereas secretory epithelial function is regulated by both sympathetic and parasympathetic fibers.

  13. A laparoscopic technique for in vivo observation of ovaries in the water buffalo (Bubalus bubalis).

    PubMed

    Jainudeen, M R; Bongso, T A; Ahmad, F B; Sharifuddin, W

    1982-07-10

    A technique was developed for observing the ovaries of the water buffalo (Bubalus bubalis) restrained in a standing position using a laparoscope (10 mm diameter, 600 mm length) inserted in the right paralumbar fossa after sedation with xylazine and local infiltration anaesthesia. Insufflation of the abdominal cavity with carbon dioxide was necessary to pass the laparoscope along the body wall to the pelvic inlet where both ovaries could be examined in detail with a manipulating probe inserted ipsilaterally. Twenty-one buffaloes were subjected to 50 laparoscopic examinations without infections or adverse reactions. Laparoscopy was a simple, reliable and rapid technique for repeated observation of the ovaries in the buffalo.

  14. Presence of inhibin in testes of the Indian water buffalo Bubalus bubalis.

    PubMed

    Sahni, G; Dasgupta, P R; Sheth, A R

    1981-08-01

    Isolation, purification and characterization of inhibin from the testes of the Indian buffalo Bubalus bubalis is described. The biological activity of the final product, which produced a single band on disc gel electrophoresis, was affected by heat treatment, 6 m urea, pH alteration and pepsin digestion. Chemically, it appeared to be a glycoprotein. The protein and carbohydrate components together accounted for a total of 63% of the dry weight, whereas 37% of the constituents were unknown.

  15. Scanning electron microscopy of Sarcocystis fusiformis from the water buffalo (Bubalus bubalis).

    PubMed

    Zaman, V; Robertson, T A; Papadimitriou, J M

    1980-06-01

    Scanning electron microscopy of Sarcocystis fusiformis from the water buffalo (Bubalus bubalis) reveals the presence of two cyst walls and distinct compartments within the cyst. Merozoites lie in large numbers in each compartment and in some cases are covered by a membrane-like exudate. Each merozoite has a micropore situated in the anterior half and ridge-like structures originate from the conoidal end and pass backwards along the body of the parasite.

  16. Effects of smallmouth buffalo, Ictiobus bubalus biomass on water transparency, nutrients, and productivity in shallow experimental ponds

    USGS Publications Warehouse

    Goetz, Daniel B.; Kroger, Robert; Miranda, Leandro E.

    2014-01-01

    The smallmouth buffalo Ictiobus bubalus is a native benthivore to floodplain lakes in the Yazoo River Basin, USA. Based on evidence from other benthivorous fish studies we hypothesized high biomasses of I. bubalus contribute to poor water quality conditions. We tested this hypothesis in shallow (< 1.5 m) 0.05 ha earthen ponds at three stocking biomasses over a 10-week period during the summer of 2012. The most notable results from the permutational multivariate analysis of variance suggest I. bubalus at high and moderate biomasses significantly (p < 0.05) enhanced turbidity and suspended solid levels while decreasing Secchi depth. Our results suggest that effects of I. bubalus on water clarity may have considerable ecological implications in natural habitats such as shallow floodplain lakes.

  17. Effects of smallmouth buffalo, Ictiobus bubalus biomass on water transparency, nutrients, and productivity in shallow experimental ponds.

    PubMed

    Goetz, D; Kröger, R; Miranda, L E

    2014-05-01

    The smallmouth buffalo Ictiobus bubalus is a native benthivore to floodplain lakes in the Yazoo River Basin, USA. Based on evidence from other benthivorous fish studies we hypothesized high biomasses of I. bubalus contribute to poor water quality conditions. We tested this hypothesis in shallow (<1.5 m) 0.05 ha earthen ponds at three stocking biomasses over a 10-week period during the summer of 2012. The most notable results from the permutational multivariate analysis of variance suggest I. bubalus at high and moderate biomasses significantly (p < 0.05) enhanced turbidity and suspended solid levels while decreasing Secchi depth. Our results suggest that effects of I. bubalus on water clarity may have considerable ecological implications in natural habitats such as shallow floodplain lakes.

  18. Seroprevalence of Toxoplasma gondii infection in water buffaloes (Bubalus bubalis) in Veracruz State, Mexico and its association with climatic factors

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Infection with Toxoplasma gondii in water buffaloes (Bubalus bubalis) is of epidemiological importance because of the risk for transmission to humans. We sought to determine the seroprevalence of T. gondii infection in 339 water buffaloes in Veracruz State, Mexico using the modified aggl...

  19. Mitochondrial DNA Variability of Domestic River Buffalo (Bubalus bubalis) Populations: Genetic Evidence for Domestication of River Buffalo in Indian Subcontinent.

    PubMed

    Nagarajan, Muniyandi; Nimisha, Koodali; Kumar, Satish

    2015-05-01

    River buffalo, Bubalus bubalis is a large bovine species frequently used livestock in southern Asia. It is believed that the river buffalo was domesticated from Bubalus arnee, the wild buffalo of mainland Asia, a few thousand years ago, probably during the period of Indus Valley civilization. However, the domestication history of the river buffalo has been the subject of debate for many decades mainly due to the lack of clear archeological evidence and the divisive conclusions of the genetic studies. Therefore, in order to understand the domestication history and genetic relationship among the various river buffalo populations, we analyzed 492-bp region of mitochondrial DNA control region sequences of 414 river buffalo sampled from India, Pakistan, Egypt, and Iran along with the available 403 swamp buffalo sequences. The phylogenetic analyses of our study along with the archaeological evidence suggest that the river buffalo was domesticated in an atypical manner involving continuous introgression of wild animals to the domestic stocks in Indian subcontinent prior to mature phase of Indus Valley civilization (2600-1900 BC). Specifically, our data exclude Mesopotamian region as the place of domestication of the river buffalo. PMID:25900921

  20. Mitochondrial DNA Variability of Domestic River Buffalo (Bubalus bubalis) Populations: Genetic Evidence for Domestication of River Buffalo in Indian Subcontinent

    PubMed Central

    Nagarajan, Muniyandi; Nimisha, Koodali; Kumar, Satish

    2015-01-01

    River buffalo, Bubalus bubalis is a large bovine species frequently used livestock in southern Asia. It is believed that the river buffalo was domesticated from Bubalus arnee, the wild buffalo of mainland Asia, a few thousand years ago, probably during the period of Indus Valley civilization. However, the domestication history of the river buffalo has been the subject of debate for many decades mainly due to the lack of clear archeological evidence and the divisive conclusions of the genetic studies. Therefore, in order to understand the domestication history and genetic relationship among the various river buffalo populations, we analyzed 492-bp region of mitochondrial DNA control region sequences of 414 river buffalo sampled from India, Pakistan, Egypt, and Iran along with the available 403 swamp buffalo sequences. The phylogenetic analyses of our study along with the archaeological evidence suggest that the river buffalo was domesticated in an atypical manner involving continuous introgression of wild animals to the domestic stocks in Indian subcontinent prior to mature phase of Indus Valley civilization (2600–1900 BC). Specifically, our data exclude Mesopotamian region as the place of domestication of the river buffalo. PMID:25900921

  1. Genetic relationship and diversity analysis of Indian water buffalo (Bubalus bubalis).

    PubMed

    Vijh, R K; Tantia, M S; Mishra, B; Bharani Kumar, S T

    2008-07-01

    The water buffalo (Bubalus bubalis) is an important dairy animal on the Indian subcontinent and in Southeast Asian countries. The diversity and differentiation among 12 populations or breeds of buffalo were studied. Data were generated and analyzed from 527 animals belonging to 10 recognized breeds and 2 additional populations of Indian buffalo by using 22 microsatellite loci. Relationships among buffalo breeds and populations were estimated based on genetic distances. The Bayesian analysis grouped 12 populations into 8 distinctive clusters. Geographically close breeds clustered together, except for the Jaffarabadi and Murrah, which were not in geographic contiguity. The Mantel test revealed nonsignificant correlations between genetic and geographic distances. This supports the hypothesis that buffaloes have been domesticated at different places for specific purposes. The phylogenetic relationship based on microsatellite loci supported the breed classification based on body size. The Toda breed, which is considered to be endangered, had genotypes similar to those of the surrounding buffalo populations.

  2. Abortion and foetal lesions induced by Neospora caninum in experimentally infected water buffalos (Bubalus bubalis).

    PubMed

    Chryssafidis, Andreas L; Cantón, Germán; Chianini, Francesca; Innes, Elisabeth A; Madureira, Ed H; Soares, Rodrigo M; Gennari, Solange M

    2015-01-01

    The water buffalo (Bubalus bubalis) is an important species in several countries for its milk and meat production, as well as for transport and other agricultural activities. It is, in general, considered more resistant than cattle to different parasitic diseases, also less demanding for forage quality. It has been postulated that buffalo may be resistant to abortion caused by neosporosis, because of high serological prevalences found in buffalo herds from different localities, with no description of Neospora caninum-related abortion. Recent studies have demonstrated the potential impact of neosporosis in pregnant water buffalo cows. In this work, three pregnant buffalo cows were experimentally infected with Nc-1 strain of N. caninum, and abortion was detected 35 days post-infection. Molecular and histopathological results found in post-mortem tissues are described and discussed, confirming the susceptibility of water buffalos to abortion caused by N. caninum.

  3. Buffalo (Bubalus bubali) Late Embryo and Foetus Development: A Morphological Analysis.

    PubMed

    Morini, A C; Pieri, Ncg; Roballo, Kcs; Martins, D S; Ambrósio, C E; Morini Junior, J C; Favaron, P O; Minervino, Ahh; Pereira, Fvt; Miglino, M A

    2016-08-01

    Many researches describe the embryonic developmental features in domestic animals; however, in farm animals, they are scarce. Most farm animal studies are related to assisted reproduction and embryos transfer techniques. But, morphological features and size measure to estimate the age gestation are rarely reported in literature. Thus, in this study, we described the developmental changes in the bubaline (Bubalus bubali) concepts from 21 to 60 days of gestation. Our results revealed that buffalo embryos similar morphological characteristics similar to other mammalian species. Also, similarities between bovine and bubaline persist; except on foetal stages when buffalos have a faster development than bovine. Therefore, buffalo's gestation period exhibits some varieties and accurate embryo age is more difficult. Yet, when we use a combination of the crown-rump, macroscopic analysis and alizarin red, it is possible to describe better the whole embryogenesis stages of the buffalo and which can contribute for future reproduction researches and applications in veterinary practice. PMID:27272250

  4. Biochemistry of the various fractions of sarcocysts of Sarcocystis fusiformis of buffalo (Bubalus bubalis).

    PubMed

    Khulbe, D C; Kushwah, A; Kushwah, H S

    1989-04-01

    A comparative biochemical study on the various fractions (cyst wall, cyst fluid and zoites) of the sarcocysts of Sarcocystis fusiformis from oesophageal muscles of naturally infected Indian water buffalo (Bubalus bubalis) was carried out. The study included analysis for glycogen, glucose, pyruvic acid, lactic acid, total lipids, phospholipids, cholesterol, triglycerides and fatty acids. The pattern and the distribution of various biochemical constituents varied in the different fractions. The cell wall had the maximum concentration of glucose and phospholipids. Of all the fractions, cell fluid showed the highest contents of pyruvate and lactate, but with a higher level of pyruvate than lactate.

  5. Some enzymes of gluconeogenesis in various fractions of sarcocysts of Sarcocystis fusiformis of buffalo (Bubalus bubalis).

    PubMed

    Gupta, R S; Kushwah, H S; Kushwah, A

    1994-03-01

    A biochemical study was conducted to assess the relative presence of some enzymes of gluconeogenesis in various fractions--the cyst wall, cyst fluid and zoites--of sarcocysts of Sarcocystis fusiformis obtained from the oesophageal muscles of naturally infected Indian water buffalo (Bubalus bubalis). The activities of fructose 1,6-diphosphatase and malic enzyme were beyond detectable limits. Phosphoenol pyruvate carboxykinase (PEPCK) activity was maximally present in the zoites, whereas glucose 6-phosphatase activity was highest in the cyst wall. PEPCK seemed to play a crucial role in carbon dioxide fixation metabolism.

  6. Sarcocystis fusiformis: some Krebs cycle enzymes in various fractions of sarcocysts of buffalo (Bubalus bubalis).

    PubMed

    Gupta, R S; Kushwah, H S; Kushwah, A

    1995-01-01

    A biochemical investigation was carried out on the relative presence of some enzymes of the Krebs cycle and of the associated energy metabolism in various fractions (namely, cyst wall, cyst fluid and zoites) of sarcocysts of Sarcocystis fusiformis from the oesophageal muscles of naturally infected Indian water buffalo (Bubalus bubalis). Except for malate dehydrogenase, the activities of aconitase, isocitrate dehydrogenase, succinate dehydrogenase and fumarase were beyond detectable limits, pointing to a non-functional Krebs cycle in the cysts of this parasite. The activities of adenosine triphosphatase and cytochromes were lowest in cyst fluid and were maximally depicted by cyst wall and zoites.

  7. In vitro production of cattle-water buffalo (Bos taurus--Bubalus bubalis) hybrid embryos.

    PubMed

    Kochhar, H P S; Rao, K B C Appa; Luciano, A M; Totey, S M; Gandolfi, F; Basrur, P K; King, W A

    2002-05-01

    Interspecific hybrid embryos are useful models for the study of maternal-fetal interactions, transmission pattern of species-specific markers and parental contributions to growth and developmental potential of pre-attachment embryos. In an attempt to investigate the possibility of producing hybrid embryos of domestic cattle (Bos taurus) and water buffalo (Bubalus bubalis), cattle oocytes were exposed to buffalo sperm and buffalo oocytes were exposed to cattle sperm and the cleavage rate and the post-fertilisation features of hybrid embryos up to the blastocyst stage were compared with those of buffalo and cattle embryos. The cleavage rate in buffalo oocytes exposed to cattle sperm was low (40.8%), with only 8.8% of these hybrid embryos reaching the blastocyst stage. Cattle oocytes exposed to buffalo sperm showed 86.3% cleavage, while 25.9% of these attained the blastocyst stage. The speed of development of both types of hybrids was intermediate between that of cattle and buffalo embryos, with hatching occurring on day 7.5 in hybrid embryos, day 8-9 in cattle and day 7 in buffalo. The proportions of cells contributing to the trophectoderm and the inner cell mass were closer to those of the maternal species in both types of hybrid embryos. Our results indicate that cattle-water buffalo hybrid embryos produced using inter species gametes are capable of developing to advanced blastocyst stages and that their in vitro fate, and developmental potential, are influenced by the origin of the oocyte.

  8. Characterization and chromosomal distribution of satellite DNA sequences of the water buffalo (Bubalus bubalis).

    PubMed

    Tanaka, K; Matsuda, Y; Masangkay, J S; Solis, C D; Anunciado, R V; Namikawa, T

    1999-01-01

    Satellite DNA sequences were isolated from the water buffalo (Bubalus bubalis) after digestion with two restriction endonucleases, BamHI and StuI. These satellite DNAs of the water buffalo were classified into two types by sequence analysis: one had an approximately 1,400 bp tandem repeat unit with 79% similarity to the bovine satellite I DNA; the other had an approximately 700 bp tandem repeat unit with 81% similarity to the bovine satellite II DNA. The chromosomal distribution of the satellite DNAs were examined in the river-type and the swamp-type buffaloes with direct R-banding fluorescence in situ hybridization. Both the buffalo satellite DNAs were localized to the centromeric regions of all chromosomes in the two types of buffaloes. The hybridization signals with the buffalo satellite I DNA on the acrocentric autosomes and X chromosome were much stronger than that on the biarmed autosomes and Y chromosome, which corresponded to the distribution of C-band-positive centromeric heterochromatin. This centromere-specific satellite DNA also existed in the interstitial region of the long arm of chromosome 1 of the swamp-type buffalo, which was the junction of the telomere-centromere tandem fusion that divided the karyotype in the two types of buffaloes. The intensity of the hybridization signals with buffalo satellite II DNA was almost the same over all the chromosomes, including the Y chromosome, and no additional hybridization signal was found in noncentromeric sites.

  9. Sarcocystis dubeyi (Huong and Uggla, 1999) infection in water buffaloes (Bubalus bubalis) from Egypt.

    PubMed

    Hilali, M; El-Seify, M; Zayed, A; El-Morsey, A; Dubey, J P

    2011-06-01

    Water buffaloes (Bubalus bubalis) are intermediate hosts for 4 species of Sarcocystis , i.e., Sarcocystis fusiformis and Sarcocystis buffalonis with cats as definitive hosts; Sarcocystis levinei with dogs as definitive hosts; and Sarcocystis dubeyi with an unknown definitive host but thought to be zoonotic. Currently, the latter species has been identified with certainty only from Vietnam. In the present study, sarcocysts of S. dubeyi are reported in 11 (30%) of 35 Egyptian water buffaloes from which the esophageal muscles were examined histologically. Sarcocysts were microscopic, measuring 180-250 × 70-110 µm in size. Ultrastructurally, the sarcocyst wall was 3.5-6.5 µm thick and had palisade-like villar protrusions which give it a striated appearance. The villar protrusions contained microtubules that were distributed along the whole villus. This is the first report of S. dubeyi from water buffaloes in Egypt.

  10. Molecular identification of Cryptosporidium parvum and Giardia duodenalis in the Italian water buffalo (Bubalus bubalis).

    PubMed

    Cacciò, Simone M; Rinaldi, Laura; Cringoli, Giuseppe; Condoleo, Renato; Pozio, Edoardo

    2007-11-30

    Livestock are commonly infected with protozoan parasites of the genera Cryptosporidium and Giardia, and some of the species and genotypes found in these animals have zoonotic significance. We characterized isolates of both parasites recovered from the Italian water buffalo (Bubalus bubalis), an economically important species whose milk is used for the production of "buffalo mozzarella" fresh cheese. Molecular analysis of the Cryptosporidium small subunit ribosomal DNA gene and of the Giardia beta-giardin gene shows the presence of both zoonotic parasites (Cryptosporidium parvum and Giardia duodenalis assemblage A) and host-specific parasites (G. duodenalis assemblage E), suggesting that water buffaloes can contribute to environmental contamination with oocysts and cysts potentially infectious to humans if their faeces are improperly disposed of. On the other hand, mozzarella cheese is probably a safe product, given that its production involves the treatment of cheese curd at 85-95 degrees C, which is likely to kill or inactivate the parasites.

  11. Characterization of PRLR and PPARGC1A genes in buffalo (Bubalus bubalis).

    PubMed

    Javed, Ruheena; Gautam, Sanjeev K; Vijh, Ramesh K; Tantia, Madhu S

    2011-10-01

    More than 40 million households in India depend at least partially on livestock production. Buffaloes are one of the major milk producers in India. The prolactin receptor (PRLR) gene and peroxisome proliferators activated receptor-γ coactivator 1-alpha (PPARGC1A) gene are reportedly associated with milk protein and milk fat yields in Bos taurus. In this study, we sequenced the PRLR and PPARGC1A genes in the water buffalo Bubalus bubalis. The PRLR and PPARGC1A genes coded for 581 and 819 amino acids, respectively. The B. bubalis PRLR gene differed from the corresponding Bos taurus at 21 positions and four differences with an additional arginine at position 620 in the PPARGC1A gene were found in the amino acid sequence. All of the changes were confirmed by cDNA sequencing. Twelve buffalo-specific single nucleotide polymorphisms (SNPs) were identified in both genes, with five of them being non-synonymous.

  12. Water buffalo (Bubalus bubalus arnee) allotypes: identification of two specificities controlled by independent genes.

    PubMed

    Iannelli, D; Capparelli, R

    1981-01-01

    Two water buffalo allotypes (B1 and C1) are described, which are located on distinct low molecular weight molecules. B1 is common to water buffalo and cattle. These two markers are inherited in a simple Mendelian manner and controlled by two independent genes.

  13. Isolation and sequence characterization of mammary derived growth inhibitor gene of riverine buffalo (Bubalus bubalis).

    PubMed

    Mukesh, M; Mishra, B P; Kataria, R S; Ahlawat, S P S; Sobti, R C

    2007-01-01

    In this study, attempts have been made to identify and characterize water buffalo (Bubalus bubalis) mammary derived growth inhibitor (MDGI) gene, isolated from a mammary gland cDNA library of lactating buffalo. The complete MDGI cDNA was of 698 nucleotides, consisting 61 nucleotides in 5' UTR, coding region of 402 nucleotides, and 235 nucleotides representing the 3' UTR. Comparison of nucleotide and deduced amino acid sequence data with that of MDGI/fatty acid binding protein (FABP) of other species shows three buffalo specific nucleotide changes while seven nucleotide changes were common to cattle and buffalo. Buffalo and cattle MDGI had 100% amino acid sequence similarity, which also shared three amino acid changes: 34 (Ala-Gly), 109 (Leu-Met), and 132 (Glu-Gln) as compared to other species. Comparison with FABPs reported from other cattle tissues revealed highest amino acid sequence similarity with FABP-heart (100%) and least with FABP-liver (20.5%). Phylogenetic analysis revealed cattle MDGI to be closest to buffalo, while mouse MDGI was distantly placed, whereas different tissue derived FABPs of cattle showed FABP-heart closest and FABP-epidermis most distantly placed from buffalo MDGI. This report also differs from the earlier findings that MDGI is intermediate of FABP-heart and adipose.

  14. A set of polymorphic DNA microsatellites useful in swamp and river buffalo (Bubalus bubalis).

    PubMed

    Moore, S S; Evans, D; Byrne, K; Barker, J S; Tan, S G; Vankan, D; Hetzel, D J

    1995-10-01

    DNA microsatellites have found widespread application in gene mapping, pedigree determination and population genetics. In closely related species such as bovids, heterologous polymerase chain reaction (PCR) primers may in some cases be used, bypassing the need to isolate and characterize microsatellite-containing sequences and design PCR primers. We report on the ability of a set of eighty bovine derived DNA microsatellite primers to amplify sequences in the two types (swamp and river) of water buffalo (Bubalus bubalis). Number of alleles and per cent heterozygosities in a large number of animals were determined on a subset of microsatellite loci selected on the robustness of the primers. These loci will form the basis of a set of polymorphic DNA markers for use in water buffalo.

  15. Water buffalo (Bubalus bubalus Arnee) allotypes: identification of a multiple allelic system.

    PubMed

    Iannelli, D

    1978-01-01

    This paper describes two allotypes of water buffalo controlled by two codominant allelic genes. The third allele is a null allele and behaves as a recessive one. The two detectable serum antigens are termed A1 and A2 and the third one (as yet undetectable) A0. The A1 antigen was recovered in the third peak and A2 antigen in the first peak following gel filtration through Sephadex G-200. The A1 antigen is common to water buffalo and cattle; the frequency of the corresponding gene (A1) was the same in both species.

  16. Analysis of conserved microsatellite sequences suggests closer relationship between water buffalo Bubalus bubalis and sheep Ovis aries.

    PubMed

    Mattapallil, M J; Ali, S

    1999-06-01

    The distribution and evolutionary pattern of the conserved microsatellite repeat sequences (CA)n, (TGG)6, and (GGAT)4 were studied to determine the divergence time and phylogenetic position of the water buffalo, Bubalus bubalis. The mean allelic frequencies of these repeat loci showed a high level of heterozygosity among the euartiodactyls (buffalo, cattle, sheep, and goat). Genetic distances calculated from the allelic frequencies of these microsatellites were used to position Bubalus bubalis in the phylogenetic tree. The tree topology revealed a closer proximity of the Bubalus bubalis to the Ovis aries (sheep) genome than to other domestic species. The estimated time of divergence of the water buffalo genome relative to cattle, goat, sheep, pig, rabbit, and horse was found to be 21, 0.5, 0.7, 94, 20.3, and 408 million years (Myr), respectively. Although water buffaloes share morphological and biochemical similarities with cattle, our study using the microsatellite sequences places the bubaline species in an entirely new phylogenetic position. Our results also suggest that with respect to these repeat loci, the water buffalo genome shares a common ancestry with sheep and goat after the divergence of subfamily Bovinae (Bos taurus) from the family Bovidae.

  17. The behaviour and welfare of buffaloes (Bubalus bubalis) in modern dairy enterprises.

    PubMed

    Napolitano, F; Pacelli, C; Grasso, F; Braghieri, A; De Rosa, G

    2013-10-01

    This review deals with the behaviour of river buffaloes (Bubalus bubalis), in confinement and in extensive conditions, also focusing on the effects of different housing and rearing conditions on their welfare. The behavioural repertoire expressed by buffaloes in extensive and intensive conditions is similar to those displayed by other domestic ruminants. However, through natural selection, buffaloes have also acquired several morphological, physiological and behavioural (i.e. wallowing) adaptations to hot climatic conditions. Buffaloes kept in intensive conditions and having no access to pasture and water for wallowing extend their periods of idling and are less often involved in investigative activities. Confinement is also associated with a reduction of space; however, no specific studies have been carried out to determine the specific requirements of this species. Space restriction can adversely affect various aspects of buffalo welfare, such as health (increased levels of lesions and injuries), social behaviour (increased number of agonistic interactions) and heat dissipation. The buffaloes, originating from tropical areas, are well adapted to large variations in food availability and quality, and to dietetic unbalances. As to human animal relationship, it has been observed that the incidence of stepping and kicking behaviour of buffaloes in the milking parlour is positively correlated with the frequency of oxytocin injections, whereas the frequency of positive stockperson interactions with the animals such as talking quietly, petting and gentle touching are negatively correlated with the number of kicks during milking. Data from farms where both dairy cattle and buffaloes are present show that avoidance distance measured in the pen is lower in buffaloes than in cattle. This may be attributed to the fact that buffaloes are generally recognised to be curious animals. Finally, the effects of different farming practices on animal-related indicators are described

  18. Mekong schistosomiasis. III: a parasitological survey of domestic water buffalo (Bubalus bubalis) on Khong Island, Laos.

    PubMed

    Schneider, C R; Kitikoon, V; Sornmani, S; Thirachantra, S

    1975-06-01

    Of 103 water buffalo (Bubalus bubalis) examined on Khong Island by means of the M.I.F.C. and hatching techniques, none were passing eggs resimbling those of the Mekong schistosome. One buffalo calf was infected with Orientobilharzia harinasutai and another with Schistosoma spindale; this is the first time these parasites have been reported from Laos. Since the buffalo that were examined had constant and year-round access to a part of the Mekong River that has been shown to be a site of heavy transmission of schistosomiasis to humans and dogs, it was considered that the buffalo would have acquired the infection with the human Mekong schistosome if this were possible. In the absence of buffalo necropsies, and since no eggs of the Mekong schistosome were detected in the stools of these animals, we assumed that they had either not become infected with this parasite or, if they had, that the infections did not produce eggs in the faeces which were detectable by the methods employed. On the basis of our examinations, it would not seem that domestic water buffalo are involved as reservoirs in the epidemiology of human schistosomiasis on Khong Island.

  19. Brucellosis in domestic water buffalo (Bubalus bubalis) of Trinidad and Tobago with comparative epidemiology to cattle.

    PubMed

    Fosgate, Geoffrey T; Diptee, Michael D; Ramnanan, Anil; Adesiyun, Abiodun Adewale

    2011-12-01

    The water buffalo is an important domestic animal worldwide, and the local Buffalypso variety was developed in Trinidad to have improved beef qualities. Brucellosis was diagnosed in Trinidad and Tobago during 1998 in both cattle and domestic water buffalo (Bubalus bubalis) populations. Brucellosis in the latter species is caused by infection with Brucella abortus, similar to bovine brucellosis. Control of brucellosis is of paramount importance to preservation of the genetic diversity of these animals in Trinidad, and this has been complicated by differences in the epidemiology of water buffalo and bovine brucellosis. Some diagnostic tests do not have comparable accuracy between the two species, and the RB51 vaccine does not adequately protect against infection in water buffalo. The water buffalo in Trinidad may also be more resistant to infection than cattle. Development of effective vaccination protocols is key to brucellosis control in Buffalypso in Trinidad, and prohibitions on import of virulent B. abortus strains for vaccine efficacy studies has impeded progress in this area. These Trinidadian strains are of variable virulence; some might be effective for challenge in vaccine efficacy studies, while other, of lower virulence, may be vaccine candidates for use in water buffalo.

  20. Traumatic Reticuloperitonitis in Water Buffalo (Bubalus bubalis): Clinical Findings and the Associated Inflammatory Response.

    PubMed

    El-Ashker, Maged; Salama, Mohamed; El-Boshy, Mohamed

    2013-01-01

    The present study was carried out to describe the clinical picture of traumatic reticuloperitonitis (TRP) in water buffalo (Bubalus bubalis) and to evaluate the inflammatory and immunologic responses for this clinical condition. Twenty-two buffalo with acute local TRP were monitored in our study. Additionally, 10 clinically healthy buffalo were randomly selected and served as controls. Acute local TRP was initially diagnosed by clinical examination and confirmed by ultrasonographic (USG) examination and/or necropsy findings. Blood samples were collected from all examined buffalo to measure the respective levels of tumor necrosis factor alpha (TNF-α), interleukin (IL)-1β, IL-6, IL-10 and interferon gamma (INF)-γ, serum amyloid A (SAA), C-reactive protein (CRP), haptoglobin (Hp), fibrinogen (Fb), and serum sialic acid (SSA). It was found that TNF-α, IL-1β, IL-6, IL-10, SAA, CRP, Hp, Fb, and SSA were significantly higher in buffalo with TRP than the controls. Our findings suggest that the examined immunologic variables were helpful in documenting the inflammatory response in buffalo with TRP. However, their diagnostic usefulness only becomes apparent when considered in tandem with the clinical findings for any given animal, its anamnesis, and a subsequent USG assessment. Due to the frequent complications of TRP, more accurate indicators of its occurrence and severity would be useful.

  1. Isolation and characterization of bovine parainfluenza virus type 3 from water buffaloes (Bubalus bubalis) in Argentina

    PubMed Central

    2012-01-01

    Background Parainfluenza virus type 3 (PIV3) was isolated from dairy buffaloes (Bubalus bubalis) naturally affected with respiratory and reproductive clinical conditions. Results Examination of nasal and vaginal swabs collected from 12 diseased buffaloes led to the isolation of three paramyxovirus isolates from two animals. Antigenic, morphological and biological characteristics of these three isolates were essentially similar to those of members of the Paramyxoviridae family. Antigenic analysis by direct immunofluorescence and cross neutralization test placed these isolates together with bovine parainfluenza virus type 3 (BPIV3). Nucleotide and amino acid phylogenetic analysis of partial matrix gene sequences of the buffalo isolates and six field BPIV3 isolates from bovines in Argentina were studied. Buffalo isolates were similar to genotype B (BPIV3b) while the six BPIV3 isolates were similar to genotypes A (BPIV3a) and C (BPIV3c). Conclusions This is the first characterization of BPIV3 in water buffalo. According to the samples analyzed, in Argentina, the genotype B was found in buffalo and the genotypes A and C were found in cattle. PMID:22716217

  2. Ciliate protozoa in the rumen of Brazilian water buffalo, Bubalus bubalis Linnaeus.

    PubMed

    Dehority, B A

    1979-11-01

    Total numbers and distribution of genera, subgenera and species were determined for the ciliate protozoa in rumen contents of 4 Brazilian water buffalo Bubalus bubalis Linnaeus. The fauna of one animal, housed in close proximity to European and zebu-type cattle, differed considerably from that of the remaining animals, which were somewhat isolated on a large ranch. Several of the protozoan species observed in the semi-isolated animals were first described in rumen contents from humped Indian cattle, and their subsequent occurrence in other hosts and geographic locations has been limited or absent. In all, 49 different species of protozoa were found, 8 of which have not been previously described. Three of the new species belong to the genus Entodinium: E. ciculum sp. n., E. spinonucleatum sp. n. and E. triangulum sp. n.; 4 to Diplodinium (Ostracodinium): D. (O.) brazili sp. n., D. (O.) esalqum sp. n., D. (O.) nucleolobum sp. n., and D. (O.) tiete sp. n.; and one to Diplodinium (Eudiplodinium): D. (E.) bubalus sp. n.

  3. Analysis of rumen methanogen diversity in water buffaloes (Bubalus bubalis) under three different diets.

    PubMed

    Franzolin, Raul; St-Pierre, Benoit; Northwood, Korinne; Wright, André-Denis G

    2012-07-01

    The water buffalo (Bubalus bubalis) is a prominent livestock species for the production of milk and meat in many countries. We investigated the diversity of rumen methanogens in Mediterranean water buffaloes maintained in Brazil under different diets: corn silage, grazing pasture, or sugar cane. A total of 467 clones were isolated from three methanogen 16S rRNA gene clone libraries that each represented a distinct feed type. The 467 clones were assigned to 19 species-level operational taxonomic units (OTUs). Four OTUs were represented in all three libraries, eight OTUs were library-specific, six OTUs were found in only the corn silage and pasture grazing libraries, and one OTU was shared only between pasture grazing and sugar cane libraries. We found that Methanobrevibacter-related sequences were the most abundant in the water buffaloes sampled for our analysis, in contrast to previously reported studies showing that Methanomicrobium mobile-like methanogens were the most abundant methanogens in water buffaloes of Murrah and Surti breeds sampled in India. Considering the worldwide distribution of water buffaloes and the likely wide variety of diets provided, our results combined with studies from other groups support that larger scope analyses of microbiomes for this livestock species would provide great insight into the contribution of geographical location, breed, and diet in determining the population structure of rumen microorganisms.

  4. Analysis of rumen methanogen diversity in water buffaloes (Bubalus bubalis) under three different diets.

    PubMed

    Franzolin, Raul; St-Pierre, Benoit; Northwood, Korinne; Wright, André-Denis G

    2012-07-01

    The water buffalo (Bubalus bubalis) is a prominent livestock species for the production of milk and meat in many countries. We investigated the diversity of rumen methanogens in Mediterranean water buffaloes maintained in Brazil under different diets: corn silage, grazing pasture, or sugar cane. A total of 467 clones were isolated from three methanogen 16S rRNA gene clone libraries that each represented a distinct feed type. The 467 clones were assigned to 19 species-level operational taxonomic units (OTUs). Four OTUs were represented in all three libraries, eight OTUs were library-specific, six OTUs were found in only the corn silage and pasture grazing libraries, and one OTU was shared only between pasture grazing and sugar cane libraries. We found that Methanobrevibacter-related sequences were the most abundant in the water buffaloes sampled for our analysis, in contrast to previously reported studies showing that Methanomicrobium mobile-like methanogens were the most abundant methanogens in water buffaloes of Murrah and Surti breeds sampled in India. Considering the worldwide distribution of water buffaloes and the likely wide variety of diets provided, our results combined with studies from other groups support that larger scope analyses of microbiomes for this livestock species would provide great insight into the contribution of geographical location, breed, and diet in determining the population structure of rumen microorganisms. PMID:22286379

  5. Detection of prion gene promoter and intron1 indel polymorphisms in Anatolian water buffalo (Bubalus bubalis).

    PubMed

    Oztabak, K; Ozkan, E; Soysal, I; Paya, I; Un, C

    2009-12-01

    Bovine spongiform encephalopathy (BSE) is a fatal disease caused by miss folded prion protein. Studies in the cattle, comparing genetic data from BSE diseased and healthy animals have shown that indel polymorphisms in the promoter and intron 1 of PRNP gene were associated with disease susceptibility. Several studies were conducted to find out allele and genotypic frequencies of indel polymorphisms in promoter and intron 1 of the cattle PRNP gene. Unlike domestic cattle and bison, no indel polymorphisms of the PRNP promoter and intron 1 were examined in any population of the water buffalo (Bubalus bubalis). Aim of this study was to analyse frequencies of allele, genotype, and haplotype of the indel polymorphisms (23 bp indel in promoter and 12 bp indel in intron 1) in prion protein coding gene (PRNP) of water buffalo. Therefore a PCR based procedure, previously used in cattle to detect indel polymorphisms of PRNP promoter and intron 1 locus, was applied to 106 Anatolian water buffalo DNAs. Our results have revealed high frequency of in variants and in23/in12 haplotype for PRNP promoter and intron 1 indel polymorphisms in water buffalo. The results of the study have demonstrated that frequencies of allele, genotype, and haplotype of the indel polymorphisms in PRNP gene of the Anatolian water buffalo are significantly different those from cattle and bison PRNP indel polymorphisms.

  6. Effect of age, sex and physiological stages on hematological indices of Banni buffalo (Bubalus bubalis)

    PubMed Central

    Patel, Mehul D.; Lateef, Abdul; Das, Hemen; Patel, Ajay S.; Patel, Ajay G.; Joshi, Axay B.

    2016-01-01

    Aim: To determine the physiological baseline values for hematological indices of Banni buffalo (Bubalus bubalis) as well as to assess their alteration due to age, sex and physiological stages. Materials and Methods: A total of 42 clinically healthy Banni buffaloes were categorized into seven groups (n=6): Group I (male calves ≤1 year), Group II (bulls >1 year), Group III (female calves ≤1 year), Group IV (pregnant lactating buffaloes), Group V (non-pregnant lactating buffaloes), Group VI (pregnant dry buffaloes), and Group VII (non-pregnant dry buffaloes). Blood samples collected aseptically from all the experimental groups were analyzed employing automated hematology analyzer. The data obtained were statistically analyzed; the mean and standard deviations were calculated and set as the reference values. Results: The erythrocytic indices viz. total erythrocytes count (TEC), hemoglobin, and packed cell volume (PCV) were significantly higher in bulls as compared to that of male calves unlike mean corpuscular volume, mean corpuscular hemoglobin (MCH), and MCH concentration. The female calves had higher TEC and PCV than the adult buffaloes irrespective of sex. The total leukocyte count (TLC) and neutrophil counts in male calves were significantly lower than the bulls unlike the eosinophil, while monocyte and basophil remained unchanged with age. The TLC, differential leukocyte count and platelet count varied non-significantly among the adult female groups at different physiological stages. However, neutrophils were found to be apparently higher in lactating buffaloes. Conclusion: The present study would be helpful for physiological characterization of this unique buffalo breed of Gujarat. Further, data generated may be a tool for monitoring the health and prognosis as well as diagnosis of diseases. PMID:27051182

  7. Physico-chemical characterization of growth hormone from water buffaloes (Bubalus bubalis).

    PubMed

    Maithal, K; Krishnamurty, H G; Muralidhar, K

    2001-12-01

    A purified preparation of growth hormone from pituitaries of water buffaloes (Bubalus bubalis) has been extensively characterized with regard to physico-chemical properties. The molecular size of buffalo GH (buGH) by electrospray ionization mass spectroscopy (ES-MS) was found to be 21394.00+/-8.44Da and its stokes radius was determined as 2.3 nm. Size heterogeneity in buffalo GH was checked both by electrophoresis and molecular sieve chromatography using 125I-labelled buffalo GH. Similar size heterogeneity was found in standard preparations of ovine and bovine growth hormones. Isoelectric focussing and chromatofocussing indicated charge heterogeneity in buffalo GH preparation. Major charge isoforms having pI of 7.2, 7.7 and minor forms in the pI range of 5.7 to 7.0 were found. Lectin chromatography on Concanavalin A matrix showed that less than 1% of buffalo GH was glycosylated. Heterogeneity in NH2-terminal sequence was also observed, with alanine, phenylalanine and methionine as the NH2-terminal residues as checked by dansyl and DABITC methods. Estimation of tryptophan residue indicated that a single tryptophan residue was present. Ellman's method showed presence of two disulfide bridges per mole of buffalo GH. Intrinsic fluorescence spectrum of buffalo GH exhibited lambda emission maximum at 337 nm. UV-CD spectrum showed that almost 48% of the secondary structure of buGH was constituted by alpha-helicity. The T(M) of buGH as determined by differential scanning calorimetric (DSC) studies was found to be 63 degrees C.

  8. Serological responses to Neospora caninum in experimentally and naturally infected water buffaloes (Bubalus bubalis).

    PubMed

    Rodrigues, A A R; Gennari, S M; Paula, V S O; Aguiar, D M; Fujii, T U; Starke-Buzeti, W; Machado, R Z; Dubey, J P

    2005-04-20

    The water buffalo (Bubalus bubalis) is an important natural host for Neospora caninum. Serologic responses to N. caninum were studied in experimentally and naturally infected water buffaloes in Brazil. Antibodies were assayed by the indirect fluorescent antibody test (IFAT) using a cut off value of 1:25. Six buffaloes were each inoculated subcutaneously with 5 x 10(6) live culture-derived tachyzoites of the cattle Illinois strain of N. caninum, and two calves were kept as uninoculated controls. Post-inoculation (p.i.) blood samples were collected weekly for 8 weeks and then monthly until 1 year p.i. All inoculated buffaloes developed IFAT titers of 1:100 or more between 7 and 11 days p.i. and the titers remained elevated until 7 weeks p.i. Antibody titers peaked to 1:1600 in 1, 1:800 in 3 and 1:400 in 2, usually by 3 weeks p.i. Antibody titers declined to 1:25 or 1:50 in all the six buffaloes by 12 months p.i. IFAT titers to N. caninum remained at an undetectable level (< 1:25) in both control uninoculated buffaloes. To follow the dynamics of N. caninum antibodies, sera from 29 buffaloes and their calves were collected for 1 year and assayed for N. caninum antibodies; 23 of 29 calves were seropositive (IFAT of 1:100 or more) at 1-2 day of age. Of these 23 calves, 17 remained seropositive during the study, while six became seronegative at four (two calves), six (one calf) seven (two calves) and eight (one calf) months of age. These findings suggest a high rate of neonatal transmission of N. caninum in buffaloes.

  9. [Immune-humoral response of water buffalo (Bubalus bubalis) against Anaplasma marginale (Theiler, 1910)].

    PubMed

    Gomes, Ricardo A; Machado, Rosangela Z; Starke-Buzetti, Wilma A; Bonesso, Maria A

    2008-01-01

    The aim of the present study was to analyze the humoral-immune response of water buffalo (Bubalus bubalis) naturally infected against Anaplasma marginale. For this work, colostrums/milk and blood samples were sequentially collected from buffalo cows prior and after partum for a period of 335 days and from buffalo calves from birth to 365 days after. The antibodies in the colostrums/milk and serum samples of these animals were determined using an ELISA indirect method and the data were analyzed as a mean of a group of animals with the matched ages during the period of 1999/2000 or individually during the year of 2005. The data from animals analyzed in group showed that the antibodies against A. marginale were in low concentration (below the cut off point: D.O. = 0.265 and ELISA levels, EL < or =3), in the sera of buffalo, during the first 90 and 105 days, respectively for cows and calves. Then, the levels of antibodies in the serum samples of buffalo calves, slightly raised to above the cut-off point and kept in higher levels up to approximately 365 days after birth, indicating active acquired immunity. Furthermore, when the animals were individually examined, the buffalo cows showed high antibody levels in the colostrums, but low levels in the blood stream during the first seven days post-partum, suggesting antibody transference from blood to mammary gland. In addition to that, buffalo calves showed high antibody levels during the first 24 hours after suckling colostrum, indicating a colostral passive immunity. By conclusion, the buffaloes were able to arm a humoral immune response against A. marginale and were considered reservoir of this parasite.

  10. Some glucose metabolic enzymes in various fractions of sarcocysts of Sarcocystis fusiformis of buffalo (Bubalus bubalis).

    PubMed

    Gupta, R S; Kushwah, H S; Kushwah, A

    1992-09-01

    A comparative biochemical study on some enzymes of glycogenolysis, glycolysis and the hexose monophosphate shunt pathway in various fractions (cyst wall, cyst fluid and zoites) of the sarcocysts of Sarcocystis fusiformis from the oesophageal muscles of naturally infected Indian water buffalo (Bubalus bubalis) was carried out. The pattern and the magnitude of enzymic activity differed markedly in these fractions. Phosphorylase, hexokinase, aldolase and pyruvate kinase showed their highest levels of activity in the zoites fractions, whereas lactate dehydrogenase was the highest in cyst fluid. Alcohol dehydrogenases were non-detectable. Glucose 6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase were localized in the cyst wall only. Zoites were considered to be the most active metabolic sites for glucose breakdown.

  11. Studies on Sarcocystis in Malaysia. I. Sarcocystis levinei n. sp. from the water buffalo Bubalus bubalis.

    PubMed

    Dissanaike, A S; Kan, S P

    1978-04-20

    Light and electron microscopic studies and feeding experiments have confirmed the presence of two species of Sarcocystis in the water buffalo Bubalus bubalis. One is the already known species with large macroscopic sarcocysts, Sarcocystis fusiformia (Railliet, 1897) Bernard and Bauche, 1912 and the other is S. levinei n. sp. which is being described in detail. The sarcocysts of S. levinei are 0.9 x 0.1 mm and the zoites in them 17.8 x 4.2 micrometer. Ultrastructurally, the primary cyst wall shows sloping villi with irregular wavy outlines. Within the villi are coarse granules and annulated fibrils. Trabeculae are present. The sexual stages of S. levinei occur in the subepithelial tissue of the small intestine of the dog and sporocysts shed by this definitive host are 15-16 by 10 micrometer.

  12. Culture, characterization and differentiation of cells from buffalo (Bubalus bubalis) amnion.

    PubMed

    Mann, A; Yadav, R P; Singh, J; Kumar, D; Singh, B; Yadav, P S

    2013-01-01

    Stem cells present an important tool in livestock assisted reproduction and veterinary therapeutic field such as tissue engineering. We report for the first time isolation of pluripotent stem cell-like cells expressing pluripotency markers (alkaline phospahatase, OCT-4, NANOG and SOX-2) from the amnion of water buffalo (Bubalus bubalis). The cells showed no apparent abnormalities in their chromosomal profiles before and after cryopreservation. The cytochemical staining revealed that pluripotent cells were capable of undergoing directed differentiation in vitro into osteocytes. It could be inferred that amnion-derived pluripotent stem cell-like cells can be isolated, cultured for many passages and differentiated into mesoderm lineage, and may be an alternative source to mesenchymal stem cells. These cells can have applications in assisted reproduction, developmental biological and regenerative medicine.

  13. Hematological and biochemical changes in water buffalo calves (Bubalus bubalis) infected with Trypanosoma evansi.

    PubMed

    Hilali, M; Abdel-Gawad, A; Nassar, A; Abdel-Wahab, A

    2006-06-30

    Four water buffalo calves (Bubalus bubalis) were each inoculated intravenously with 10(6)T. evansi (camel isolate) and the fifth calf kept as non-infected control. The blood and sera of all calves were examined every 4 days during the first month post-inoculation (pi) and then once weekly until the end of the experiment (88 days pi). They were examined for hematological and biochemical changes, liver and kidney function tests. Hemoglobin concentration (Hb%), packed cell volume (PCV) and red blood cell count were significantly decreased. Total leucocytic count, lymphocytes and monocytes showed significant increase. Liver function tests revealed significant elevation in the activity of lactate dehydrogenase enzyme (LDH), globulin, total biliruben and indirect biliruben while alkaline phosphatase enzyme showed significant decrease. Kidney function tests revealed significant decrease of both creatinine and urea.

  14. Mammary diffuse fibroadenomatoid hyperplasia in water buffalo (Bubalus bubalis): three cases.

    PubMed

    de Sant'Ana, Fabiano J F; Carvalho, Fausto C; de O Gamba, Conrado; Cassali, Geovanni D; Riet-Correa, Franklin; Schild, Ana L

    2014-03-12

    The current report describes 3 rare cases of mammary diffuse fibroadenomatoid hyperplasia in water buffalo (Bubalus bubalis). All of the animals were between 10 and 12 months of age. Grossly, the lesions consisted of severe diffuse swelling with homogeneous large masses in the udder. Surgical removal of the masses was curative. Microscopically, there was severe hyperplasia of the mammary epithelium and numerous well-differentiated and mildly pleomorphic acini and their associated ducts. Moderate proliferation of the fibrous connective tissue and the myoepithelial cells near the proliferating acini was also evident. The hyperplastic epithelial cells exhibited positive immunostaining for cytokeratin, estrogen receptors, and progesterone receptors. In addition, the myoepithelial cells displayed moderate positivity for alpha smooth muscle actin. Based on the clinical, morphologic, and immunohistochemical findings, a diagnosis of mammary diffuse fibroadenomatoid hyperplasia with probable hormonal influence was made.

  15. Sequence characterization and comparative analysis of the gastrotropin gene in buffalo (Bubalus bubalis).

    PubMed

    Stafuzza, N B; Borges, M M; Amaral-Trusty, M E J

    2014-01-01

    In this study, we compared the complete sequence of the FABP6 gene from an animal representing the Murrah breed of the river buffalo (Bubalus bubalis) with the gene sequence from different mammals. The buffalo FABP6 gene is 6105 bp in length and is organized into four exons (67, 176, 90, and 54 bp), three introns (1167, 1737, and 2649 bp), a 5ꞌUTR (93 bp), and a 3ꞌUTR (72 bp). A total of 22 repetitive elements were identified at the intronic level, and four of these (L1MC, L1M5, MIRb, and Charlie4z) were identified as being exclusive to buffalo. Comparative analysis between the FABP6 gene coding sequence and the amino acid sequence with its homologues from other mammalian species showed a percentage of identity varying from 79 to 98% at the DNA coding level and 70 to 96% at the amino acid level. In addition, the alignment of the gene sequence between the Murrah and the Mediterranean breeds revealed 20 potential single nucleotide polymorphisms, which could be candidates for validation in commercial buffalo populations. PMID:25526214

  16. Clinical and ultrasonographic observations of functional and mechanical intestinal obstruction in buffaloes (Bubalus bubalis)

    PubMed Central

    Khalphallah, Arafat; Aref, Nasr-Eldin M.; Elmeligy, Enas; El-Hawari, Sayed F.

    2016-01-01

    Aim: This study was designed for clinical and laboratory evaluation of intestinal obstruction (IO) in buffaloes (Bubalus bubalis) with special emphasis on the diagnostic value of ultrasonographic findings. Materials and Methods: A total number of 30 buffaloes were included in the study and divided into 2 groups: Healthy (n=10) and diseased group (n=20). Diseased buffaloes were admitted to the Veterinary Teaching Hospital at Assiut University, Egypt, with a history of anorexia, abdominal pain, various degrees of abdominal distention, and absence or presence of scanty mucoid faces. These animals were subjected to clinical and ultrasonographic as well as laboratory examinations. Results: Based on ultrasonographic findings, various forms of IO were diagnosed. Functional obstruction, paralytic ileus, was diagnosed in 17 cases (85%) while mechanical IO was diagnosed only in 3 cases (15%). Out of 17 cases of paralytic ileus, both proximal and distal ileuses were successfully imaged in 8 and 9 cases, respectively. Proximal ileus was imaged from the right dorsal flank region as a single dilated loop of diameter >6 cm, while distal ileus was imaged as multiple dilated loops of diameter <6 cm. Mechanical obstruction due to duodenal intussusception was visualized as two concentric rings with outer echogenic wall and hypoechoic lumen. All cases of IO showed leukocytosis, hypoproteinemia, and increased activity of alkaline phosphatase and aspartate aminotransferase. Conclusion: Ultrasonography proved to be an essential tool for diagnosis and differential diagnosis of various forms of IO in buffaloes. PMID:27284223

  17. Prevalence, biology, and distribution pattern of Sarcocystis infection in water buffalo (Bubalus bubalis) in Iran.

    PubMed

    Oryan, Ahmad; Ahmadi, Nasrollah; Mousavi, Seyed Mostafa Modarres

    2010-10-01

    This study was conducted to determine the prevalence, distribution pattern, and the Sarcocystis species involved in slaughtered water buffaloes (Bubalus bubalis) in the Khuzestan, Iran by macroscopic and histological examination. The esophagus, heart, diaphragm, tongue, masseter, and thigh muscles were investigated. Esophagus and thigh muscles of only 3 of the 100 examined water buffaloes (3%) were infected with macroscopic Sarcocystis, whereas at microscopic level Sarcocystis were found in 83 of the 100 examined animals (83%). The highest prevalence rate of microscopic cysts was found in masseter muscle (57.1%) and then followed by tongue, diaphragm, esophagus, heart, and finally, thigh muscles (30.0%). There was no significant difference between males (83.6%) and females (82.0%) or between two investigated age groups (2 years old, 88%). Based on the size of the sarcocysts, thickness of the walls and location of the cysts, Sarcocystis buffalonis as a macroscopic form and Sarcocystis levinei and Sarcocystis dubeyi as the microscopic forms were diagnosed in the examined muscles of the buffaloes of this area. Sarcocystis fusiformis was not seen in the examined organs of these buffaloes. The high prevalence rate of microscopic Sarcocystis in this region indicates that dogs have a more significant role than cats in transmission of these protozoa.

  18. Binucleate trophoblast giant cells in the water buffalo (Bubalus bubalis) placenta.

    PubMed

    Carvalho, A F; Klisch, K; Miglino, M A; Pereira, F T V; Bevilacqua, E

    2006-01-01

    The binucleate trophoblast giant cells (BNC) of the water buffalo, Bubalus bubalis, placenta were studied, with emphasis on the synthesis of BNC-specific proteins. Placentomal tissues of 27 water buffalos (2-10 months of pregnancy) were processed for light and electron microscopy. The frequency of BNCs was 20% of the trophoblastic cells in 2-3-month placentas and increased to 27% in the later stages. Ultrastructurally, binucleate cells displayed a prominent granular endoplasmic reticulum and Golgi apparatus, typical of cells involved with protein synthesis and exportation. The buffalo BNCs contained periodic acid-Schiff (PAS)-positive granules and reacted with antisera against bovine placental lactogen, prolactin-related protein-I, and pregnancy-associated glycoproteins. Lectin histochemistry with Dolichos biflorus agglutinin, Vicia villosa agglutinin, and Phaseolus vulgaris leucoagglutinin showed specific staining of BNCs. Different stages of BNC migration and fusion with uterine epithelial cells were observed. Trinucleate feto-maternal hybrid cells were the typical outcome of cell fusions. These cells underwent degeneration, with typical morphological features of apoptosis. The results revealed a strong homology between water buffalo and cattle BNCs concerning cell morphology, protein expression, glycosylation pattern, and characteristics of cell migration and fusion.

  19. Detection of Bovine viral diarrhea virus from three water buffalo fetuses (Bubalus bubalis) in southern Italy.

    PubMed

    Martucciello, Alessandra; De Mia, Gian Mario; Giammarioli, Monica; De Donato, Immacolata; Iovane, Giuseppe; Galiero, Giorgio

    2009-01-01

    Bovine viral diarrhea virus (BVDV) is an important pathogen that primarily infects ruminants, leading to several clinical problems including abortion. BVDV-specific antibodies were reported in a wide range of hosts within domestic and wildlife animal populations, and serological studies also indicated BVDV infection in buffaloes. The purpose of this study was to analyze the presence of BVDV in 2 water buffalo (Bubalus bubalis) herds with a history of abortion. Virus isolation from aborted fetuses and from maternal buffy coat and the molecular characterization of the isolates confirmed the presence of BVDV in these animals. The sequence analysis based on the 5' UTR and N(pro) coding regions of the Pestivirus genome revealed that the isolates belong to subgenotype 1b of BVDV. The findings of this study also suggest a possible role of BVDV in causing congenital infection in water buffalo. Its presence in fetal tissues as well as in maternal blood raises questions about the possible development of clinical disease or its influence in abortions in water buffalo.

  20. Cloning and biological characterization of buffalo (Bubalus bubalis) interferon-gamma.

    PubMed

    Premraj, Avinash; Sreekumar, E; Rasool, T J

    2006-02-01

    Interferon-gamma, a major immunomodulatory cytokine, of Indian water buffalo (Bubalus bubalis) was characterized at molecular level. Complementary DNA and essential promoter region were cloned and sequenced, and functional recombinant protein was expressed in bacterial system. The cDNA has 97.8% nucleotide identity with 11-nucleotide and four-amino acid variations, and the essential promoter region has 98.4% identity with five-nucleotide variations and a four-nucleotide deletion in comparison with the corresponding bovine sequences. All the major promoter elements such as NF IL-2 like motif, cyclosporin sensitive binding element and GATA motif are strictly conserved. Recombinant buffalo-IFN-gamma expressed in bacterial system reacted with an anti-bovine-IFN-gamma monoclonal antibody in Western blot and showed antiviral activity against buffalo pox virus in cultured Madin-Darby bovine kidney (MDBK) cells by inhibiting virus induced cytopathic effect. The study shows high level sequence similarity of IFN-gamma among ruminants. In view of the immunomodulatory and antiviral activities of IFN-gamma, this molecule will be useful in better understanding of the immune system of water buffaloes.

  1. Genetic resistance to Brucella abortus in the water buffalo (Bubalus bubalis).

    PubMed

    Borriello, Giorgia; Capparelli, Rosanna; Bianco, Michele; Fenizia, Domenico; Alfano, Flora; Capuano, Federico; Ercolini, Danilo; Parisi, Antonio; Roperto, Sante; Iannelli, Domenico

    2006-04-01

    Brucellosis is a costly disease of water buffaloes (Bubalus bubalis). Latent infections and prolonged incubation of the pathogen limit the efficacy of programs based on the eradication of infected animals. We exploited genetic selection for disease resistance as an approach to the control of water buffalo brucellosis. We tested 231 water buffalo cows for the presence of anti-Brucella abortus antibodies (by the agglutination and complement fixation tests) and the Nramp1 genotype (by PCR-denaturing gradient gel electrophoresis). When the 231 animals (58 cases and 173 controls) were divided into infected (seropositive) and noninfected (seronegative) groups and the Nramp1 genotypes were compared, the seropositive subjects were 52 out of 167 (31%) in the Nramp1A+ (Nramp1AA or Nramp1AB) group and 6 out of 64 (9.4%) in the Nramp1A- (Nramp1BB) group (odds ratio, 4.37; 95% confidence limits, 1.87 to 10.19; chi2, 11.65 for 1 degree of freedom). Monocytes from Nramp1BB subjects displayed significantly (P < 0.01) higher levels of Nramp1 mRNA than Nramp1AA subjects and also a significantly (P < 0.01) higher ability in controlling the intracellular replication of several Brucella species in vitro. Thus, selection for the Nramp1BB genotype can become a valuable tool for the control of water buffalo brucellosis in the areas where the disease is endemic.

  2. The serum lipoprotein pattern of water buffalo (Bubalus bubalis).

    PubMed

    Mondola, P; Santangelo, F; Santillo, M; Belfiore, A; Avallone, L; Cifaldi, S; d'Angelo, A; Pizzuti, G P

    1987-01-01

    1. The serum lipoprotein pattern of water buffalo was studied by means of electrophoresis and the lipoproteins were isolated by ultracentrifugation on the basis of their hydrated density. 2. High density lipoproteins (HDL) showed a higher level of cholesterol than did the other lipoproteins. Moreover, the level of phospholipids was higher in HDL than in very low density lipoproteins (VLDL). 3. The buffalo B100 apoprotein was similar to that of man and rat. Three apoproteins similar to human apo E, apo AI and AII were found in buffalo HDL, buffalo VLDL contained essentially apo B protein.

  3. Myxobolus ictiobus n. sp. and Myxobolus minutus n. sp. (Cnidaria: Myxobolidae) from the gills of the smallmouth buffalo Ictiobus bubalus Rafinesque (Cypriniformes: Castostomidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The smallmouth buffalo Ictiobus bubalus Rafinesque (Catostomidae) is native to North American waterways and occasionally grown in pond aquaculture. Species of Myxobolus Bütschli, 1882 have been reported from the gills, integument, and intestinal tract of buffalo fish, although there is ambiguity in ...

  4. Reproductive biotechniques in buffaloes (Bubalus bubalis): status, prospects and challenges.

    PubMed

    Singh, B; Chauhan, M S; Singla, S K; Gautam, S K; Verma, V; Manik, R S; Singh, A K; Sodhi, M; Mukesh, M

    2009-01-01

    The swamp buffalo holds tremendous potential in the livestock sector in Asian and Mediterranean countries. Current needs are the faster multiplication of superior genotypes and the conservation of endangered buffalo breeds. Recent advances in assisted reproductive technologies, including in vitro embryo production methodologies, offer enormous opportunities to not only improve productivity, but also to use buffaloes to produce novel products for applications to human health and nutrition. The use of molecular genomics will undoubtedly advance these technologies for their large-scale application and resolve the key problems currently associated with advanced reproductive techniques, such as animal cloning, stem cell technology and transgenesis. Preliminary success in the application of modern reproductive technologies warrants further research at the cellular and molecular levels before their commercial exploitation in buffalo breeding programmes. PMID:19383257

  5. Ameliorative effects of boron on serum profile in buffalo (Bubalus bubalis) fed high fluoride ration.

    PubMed

    Bharti, Vijay K; Gupta, Meenakshi; Lall, D

    2008-02-01

    An experiment was undertaken to evaluate the protective role of boron on the serum profile of buffalo calves fed a high fluoride ration. Twelve male Murrah buffalo (Bubalus bubalis) calves of 6-8 months age, divided into three groups of four calves in each, were fed basal diets and supplemented with sodium fluoride (NaF, 60 ppm) alone or in combination with borax (Na2B4O7.10H2O, 140 ppm) for 90 days. Boron (B) was added in the ration as borax to make @140 ppm boron (elemental B) on DM basis in treatment II. Dietary F caused a significant (p<0.05) depressing effect on serum Ca and Zn on day 90 which was improved with B supplementation. However, serum Fe and Cu did not show any significant change on F or F+B supplementation. The serum ALP and phosphorus level were increased significantly (p<0.05) on F feeding but declined significantly (p<0.05) when B was fed. The findings suggested beneficial effect of boron on serum minerals and ALP in buffalo calves fed high fluoride ration.

  6. An ultrastructural study of the Sertoli cell in the water buffalo (Bubalus bubalis).

    PubMed

    Kurohmaru, M; Yamashiro, S; Azmi, T I; Basrur, P K

    1992-03-01

    The ultrastructure of Sertoli cell in the water buffalo (Bubalus bubalis) was observed in a transmission electron microscope. The nucleus had homogeneous nucleoplasm, scarce heterochromatin and multivesicular nuclear body (MNB). The MNB was composed of numerous vesicles and ribosome-like dense structures. The vesicles varied in size and number and contained a sparse and flocculent substance. In the indentation of the nucleus, aggregates of ribosomes were frequently observed. In the apical and middle region of the cell, long mitochondria and microtubules were distributed parallel to the long axis of the cell. Non-laminated smooth ER and some ribosomes were also recognizable throughout this region. In the basal region, widely-distributed laminated smooth ER was characteristic. Microfilament bundles at ectoplasmic specialization were irregularly arranged. Frequently-emerged nodular processes occasionally separated from basal lamina and formed round structures within Sertoli cytoplasm. Although these characteristics of buffalo Sertoli cell were very similar to those of the bovine studied, the aggregate of ribosomes was more developed in the buffalo.

  7. Molecular characterization and prokaryotic expression of buffalo (Bubalus bubalis) Interleukin-6.

    PubMed

    Premraj, Avinash; Sreekumar, E; Nautiyal, Binita; Rasool, T J

    2006-02-01

    The study describes the characterization of Interleukin-6 cDNA and essential promoter sequences of the Indian Water Buffalo (Bubalus bubalis) and expression of the recombinant IL-6 in Escherichia coli. Buffalo IL-6 shows very high nucleotide level identity of the cDNA (98.7%) and promoter (98%) sequences with the corresponding cattle sequences. All the major regulatory elements of IL-6 promoter like AP-1, Multiple Response Element, NF-IL6, ETS binding domain and NF-kappaB binding sites show absolute conservation. Basal level IL-6 mRNA is detected in organs like liver, lung and spleen. Concanavalin A stimulated splenocytes produced maximum IL-6 mRNA at 8h poststimulation. Recombinant IL-6 production in JM109 (DE3) and BL21 (DE3) pLysS bacterial system is substantially enhanced by supplementation of rare codon tRNAs through co-transformation with a second plasmid. BL21 (DE3) pLysS strain is a more efficient producer of the IL-6 as it expressed two-fold more protein than by JM109 (DE3) cells. The study shows high-level conservation of IL-6 regulatory and coding sequences between cattle and buffalo, and indicates the use of a common reagent for studying the effects of this cytokine in these species.

  8. Sarcocystis dubeyi n. sp. (Protozoa: Sarcocystidae) in the water buffalo (Bubalus bubalis).

    PubMed

    Huong, L T; Uggla, A

    1999-02-01

    Sarcocystis dubeyi n. sp. is proposed for a species forming thick-walled, microscopic sarcocysts in striated muscular tissues of the water buffalo (Bubalus bubalis). Sarcocysts of S. dubeyi were found in histological sections of skeletal muscles and esophagus, but not in heart and tongue, of 8 (13%) of 60 water buffaloes examined in Ho Chi Minh City, Vietnam. Sarcocysts of S. dubeyi were up to 600 microns long and up to 200 microns wide. The cyst wall was 4.5-9 microns thick and was composed of tightly packed, cylindrical villar protrusions (Vp) that had a uniform width of up to 3 microns, a length of up to 8 microns, and a blunt, often flattened tip. The Vp contained microfilaments but no prominent electron-dense granules. The definitive host of S. dubeyi was not determined, but it could possibly be humans or other primates. By the present description, 4 Sarcocystis species are recognized in the water buffalo: the macrocyst-forming Sarcocystis fusiformis and S. buffalonis and the microcyst-forming S. levinei and S. dubeyi.

  9. Epizootic abortion related to infections by Chlamydophila abortus and Chlamydophila pecorum in water buffalo (Bubalus bubalis).

    PubMed

    Greco, G; Corrente, M; Buonavoglia, D; Campanile, G; Di Palo, R; Martella, V; Bellacicco, A L; D'Abramo, M; Buonavoglia, C

    2008-06-01

    Water buffalo (Bubalus bubalis) are affected by high rates of embryonic mortality and abortion related to infectious diseases and non-infectious factors. A number of viral and bacterial infections have been associated with reproductive failure, but there is limited information on the role of chlamydial infections. In order to investigate the presence and the role of Chlamydiaceae in water buffalo a retrospective study was performed in a herd with a history of reproductive failure. During an 11-month period, the pregnant heifers suffered an abortion rate of 36.8% between the 3rd and 7th month of pregnancy. Antibodies to Chlamydiaceae were detected in 57% of the aborted cows, and in 0% of the overtly healthy cows used as control. By a nested-PCR assay, three of 14 vaginal swabs from aborted animals tested positive for Chlamydophila agents and, additionally, three out of seven aborted fetuses tested positive for Chlamydophila spp., with two being co-infections by Cp. abortus and Cp. pecorum and one being characterised as Cp. abortus. Sequence analysis of the amplicons confirmed the results of the nested-PCR. The presence of anti-Chlamydiaceae antibodies in more than half of the aborting animals (P<0.002) and the detection of Chlamydophila agents in several fetal organs and in the vaginal swabs are consistent with the history of abortions observed in the herd and suggest an abortifacient role by Chlamydophila spp. in water buffalo (B. Bubalis) herds.

  10. Sarcocystis buffalonis n.sp. (Protozoa: Sarcocystidae) from the water buffalo (Bubalus bubalis) in Vietnam.

    PubMed

    Huong, L T; Dubey, J P; Nikkilä, T; Uggla, A

    1997-06-01

    Sarcocystis buffalonis n. sp. is proposed for a species forming thick-walled, macroscopic sarcocysts in skeletal muscles and the esophagus of the water buffalo (Bubalus bubalis). Sarcocysts of S. buffalonis were found in 68 (10.5%) of 647 buffalo carcasses examined grossly at slaughter in Ho Chi Minh City in southern Vietnam. Sarcocystis buffalonis sarcocysts were 1-8 mm long and 0.1-0.5 mm wide. The cyst wall was 3-7.7 microns thick and had palisadelike villar protrusions that were constricted at the base, expanded laterally in the mid-region, and tapered distally. The villar protrusions contained microfilaments and electron-dense granules. Sarcocysts of Sarcocystis fusiformis, the other well-known macroscopic species occurring in water buffalo, were also found in 60 of the 68 animals infected with S. buffalonis. Sarcocysts of S. fusiformis were thin walled and had characteristic cauliflowerlike villar protrusions. Two of 7 cats fed isolated S. buffalonis sarcocysts were found to have 12 x 8 microns sporocysts in their intestine or feces 10 days after inoculation.

  11. Hydrofluorosis in water buffalo (Bubalus bubalis) in India.

    PubMed

    Dwivedi, S K; Dey, S; Swarup, D

    1997-11-27

    The concentration of fluoride was determined in water, forage and urine and serum samples of buffaloes from the Unnao district of India. The water and forage samples contained 2.01 +/- 0.51 and 22.50 +/- 0.82 ppm of fluoride, respectively. The analysis of biosamples collected from the affected animals revealed higher levels of fluoride in serum (0.58 +/- 0.05 ppm) and urine (10.64 +/- 1.23 ppm). Clinical examination identified a 40.34% prevalence rate of clinical lesions suggestive of fluorosis in buffalo of this locality. Dental lesions were present invariably in all affected animals whereas lameness, painful bony exostosis and emaciation were recorded in 28.17%, 8.45% and 76.00% of the animals. Based on the clinical lesions and fluoride content in water, serum and urine, it was concluded that the problem of fluorosis in buffalo is attributable to drinking water containing toxic levels of fluoride.

  12. Optimization of Buffalo (Bubalus bubalis) Embryonic Stem Cell Culture System

    PubMed Central

    Zandi, Mohammad; Muzaffar, Musharifa; Shah, Syed Mohmad; Kumar Singh, Manoj; Palta, Prabhat; Kumar Singla, Suresh; Manik, Radheysham; Chauhan, Manmohan Singh

    2015-01-01

    Objective In order to retain an undifferentiated pluripotent state, embryonic stem (ES) cells have to be cultured on feeder cell layers. However, use of feeder layers limits stem cell research, since experimental data may result from a combined ES cell and feeder cell response to various stimuli. Materials and Methods In this experimental study, a buffalo ES cell line was established from in vitro derived blastocysts and characterized by the Alkaline phosphatase (AP) and immunoflourescence staining of various pluripotency markers. We examined the effect of various factors like fibroblast growth factor 2 (FGF-2), leukemia inhibitory factor (LIF) and Y-27632 to support the growth and maintenance of bubaline ES cells on gelatin coated dishes, in order to establish feeder free culture systems. We also analyzed the effect of feeder-conditioned media on stem cell growth in gelatin based cultures both in the presence as well as in the absence of the growth factors. Results The results showed that Y-27632, in the presence of FGF-2 and LIF, resulted in higher colony growth and increased expression of Nanog gene. Feeder-Conditioned Medium resulted in a significant increase in growth of buffalo ES cells on gelatin coated plates, however, feeder layer based cultures produced better results than gelatin based cultures. Feeder layers from buffalo fetal fibroblast cells can support buffalo ES cells for more than two years. Conclusion We developed a feeder free culture system that can maintain buffalo ES cells in the short term, as well as feeder layer based culture that can support the long term maintenance of buffalo ES cells. PMID:26199905

  13. Characterization of TLR4 signaling in water buffalo (Bubalus bubalis).

    PubMed

    Thanislass, J; Yuvaraj, G; Subba Reddy, K V

    2009-02-01

    Lipopolysaccharide (LPS) treatment of Peripheral Blood Mononuclear Cells (PBMC) isolated from the water buffalo resulted in the activation of TLR signaling intermediates as supported by the western blot of pERK. Activation of ERK resulted in phosphorylation of IkappaB-alpha which lead to its degradation which in turn followed by nuclear translocation of NF-kappaB, which is also supported by the western blot analysis. The nuclear translocation of NF-kappaB culminated in the induction of mRNA expression of TNF-alpha. Thus this study demonstrates the TLR signaling in PBMCs of water buffalo which is as similar to that reported earlier in mice and human beings.

  14. Neosporosis in water buffalo (Bubalus bubalis) in Southern Italy.

    PubMed

    Guarino, A; Fusco, G; Savini, G; Di Francesco, G; Cringoli, G

    2000-07-24

    A study was carried on 1377 water buffalo serum samples from 50 farms in southern Italy to test the presence of Neospora caninum antibodies by indirect fluorescence antibody test (IFAT). Rabbit anti-buffalo immunoglobulins conjugated to fluorescein were used in the test. Fluorescence in sera dilutions above 1:200 was considered as indicative of the presence of N. caninum antibodies. The overall prevalence of infection in the animals was 34.6%. The prevalence increased in relation to the age of subjects and most of the herds examined (82%) were found infected. In two farms abortions and neurological signs were reported. No suppurative inflammatory lesions were seen, but few protozoan-like cysts were observed on foetal tissues by histology.

  15. Histology of hemal nodes of the water buffalo (Bos bubalus).

    PubMed

    Zidan, Mohamed; Pabst, Reinhard

    2010-06-01

    Hemal nodes are independent lymphoid organs found in various mammals but are ignored by most immunologists. They seem to play a role in defense against blood-borne infections in some species. The structure of the hemal node has been described in various species but, so far, not in the water buffalo. Specimens were obtained from ten clinically healthy male animals (five calves: 2-3 months old; five bulls: 2-8 years old). Six hemal nodes were obtained from each animal from the mesenteric and perirectal region. The samples were studied by light and transmission electron microscopy. The hemal nodes are bean-shaped or spherical, with one hilus through which the hilus arteries and nerves enter the node and from which veins and lymphatics leave it. The buffalo hemal node has a thin capsule of connective tissue and a few smooth muscle cells. Trabeculae extend from the capsule partially dividing the parenchyma. Subcapsular and trabecular blood sinuses are present. The parenchyma is composed of irregular lymphoid cords rich in erythrocytes, macrophages, and plasma cells and is separated by blood sinuses of variable size engorged with blood. These blood sinuses drain into the trabecular sinuses and then into the subcapsular sinus. In calves, the size of the lymphoid cords is larger than that in adult bulls. Buffalo hemal nodes can be classified as typical hemal nodes, because they are definitely different from hemolymph nodes in other species. They may play a role in filtering the blood.

  16. Pathology of naturally occurring paratuberculosis in water buffaloes (Bubalus bubalis).

    PubMed

    Sivakumar, P; Tripathi, B N; Singh, N; Sharma, A K

    2006-07-01

    Gross and histologic lesions of paratuberculosis were studied in water buffaloes. Small intestines and associated mesenteric lymph nodes of 405 water buffaloes were examined. Of these, 20 animals having visible changes of intestinal thickening, mucosal corrugations, and enlargement of mesenteric lymph nodes exhibited histologic alteration characteristics of mild to moderate granulomatous inflammation. The histologic lesions observed in these animals were classified into 3 grades on the basis of type of cellular infiltration, granuloma formation, and presence of acid-fast bacilli. Grade-1 lesions observed in 8 animals were marked by the presence of scattered epithelioid macrophages amid large number of lymphocytes in the intestinal villi and in the paracortical regions of the associated mesenteric lymph nodes. Another 8 animals classified under grade-2 revealed microgranulomas, infiltration with a larger number of epithelioid macrophages besides lymphocytes in the intestinal villi, and granulomas in the mesenteric lymph nodes. Grade-3 lesions observed in 4 animals were characterized by the presence of epithelioid granulomas and giant cells in the intestines and the mesenteric lymph nodes. The Ziehl-Neelsen's stained tissue sections revealed acid-fast bacilli in grade-3 and -2 animals and acid-fast granular debris in grade-1 animals. Among these 20 buffaloes, 14 (70%) were positive in the IS900 specific polymerase chain reaction and 6 (30%) were positive in the bacterial culture.

  17. Postpartum ovarian follicular dynamics in primiparous and pluriparous Mediterranean Italian buffaloes (Bubalus bubalis).

    PubMed

    Presicce, Giorgio Antonio; Bella, Antonino; Terzano, Giuseppina Maria; De Santis, Giuseppe; Senatore, Elena Maria

    2005-03-15

    The objective of this study was to monitor ovarian function in postpartum primiparous and pluriparous Mediterranean Italian buffaloes (Bubalus bubalis) during months of increasing daylength. Ovarian ultrasound monitoring was carried out for a total of 60 days from calving in 10 primiparous and 10 pluriparous buffaloes. Progesterone was determined from calving until a week after first postpartum ovulation. The study was undertaken during months of increasing day length. Time required for complete postpartum uterine involution was 31 +/- 1.0 and 33 +/- 1.3 days in primiparous and pluriparous buffaloes respectively (P = 0.1). The first postpartum ovulation was recorded on 4 primiparous and 8 pluriparous buffaloes (P = 0.16). Time for first postpartum ovulation to occur was 25.5 +/- 6.9 and 15.5 +/- 1.3 days in primiparous and pluriparous buffaloes, respectively (P = 0.07). Overall, 8 of the 12 first postpartum ovulations (66.6%) occurred in the ovary contra-lateral to the one bearing the gravidic CL, one out of 4 in primiparous and 3 out of 8 in pluriparous buffaloes (P = 1.0). Following a first postpartum ovulation, 3 primiparous and 4 pluriparous buffaloes displayed a complete wave of follicular development leading to a new ovulation. Ovulation following parturition was not recorded in 6 primiparous and two pluriparous buffaloes for the 60 days of ultrasound monitoring. Growth rate (mm/d) and largest size (mm) of first postpartum ovulating follicle was 0.95 +/- 0.18 and 1.07 +/- 0.07 (P = 0.4), and 13.5 +/- 0.8 and 14.1 +/- 0.4 (P = 0.4) in primiparous and pluriparous buffaloes, respectively. Following calving, the total number of available antral follicles (> or =2 mm) declined gradually towards the end of the study period. Follicles greater or equal to 3 mm in diameter on the contrary showed a prominent increase in the first 2 weeks from calving. The number of follicles greater or equal to 3 mm in diameter was significantly higher in the ovary contra-lateral to

  18. Postpartum ovarian follicular dynamics in primiparous and pluriparous Mediterranean Italian buffaloes (Bubalus bubalis).

    PubMed

    Presicce, Giorgio Antonio; Bella, Antonino; Terzano, Giuseppina Maria; De Santis, Giuseppe; Senatore, Elena Maria

    2005-03-15

    The objective of this study was to monitor ovarian function in postpartum primiparous and pluriparous Mediterranean Italian buffaloes (Bubalus bubalis) during months of increasing daylength. Ovarian ultrasound monitoring was carried out for a total of 60 days from calving in 10 primiparous and 10 pluriparous buffaloes. Progesterone was determined from calving until a week after first postpartum ovulation. The study was undertaken during months of increasing day length. Time required for complete postpartum uterine involution was 31 +/- 1.0 and 33 +/- 1.3 days in primiparous and pluriparous buffaloes respectively (P = 0.1). The first postpartum ovulation was recorded on 4 primiparous and 8 pluriparous buffaloes (P = 0.16). Time for first postpartum ovulation to occur was 25.5 +/- 6.9 and 15.5 +/- 1.3 days in primiparous and pluriparous buffaloes, respectively (P = 0.07). Overall, 8 of the 12 first postpartum ovulations (66.6%) occurred in the ovary contra-lateral to the one bearing the gravidic CL, one out of 4 in primiparous and 3 out of 8 in pluriparous buffaloes (P = 1.0). Following a first postpartum ovulation, 3 primiparous and 4 pluriparous buffaloes displayed a complete wave of follicular development leading to a new ovulation. Ovulation following parturition was not recorded in 6 primiparous and two pluriparous buffaloes for the 60 days of ultrasound monitoring. Growth rate (mm/d) and largest size (mm) of first postpartum ovulating follicle was 0.95 +/- 0.18 and 1.07 +/- 0.07 (P = 0.4), and 13.5 +/- 0.8 and 14.1 +/- 0.4 (P = 0.4) in primiparous and pluriparous buffaloes, respectively. Following calving, the total number of available antral follicles (> or =2 mm) declined gradually towards the end of the study period. Follicles greater or equal to 3 mm in diameter on the contrary showed a prominent increase in the first 2 weeks from calving. The number of follicles greater or equal to 3 mm in diameter was significantly higher in the ovary contra-lateral to

  19. Serum biochemical and haematological reference intervals for water buffalo Bubalus bubalis heifers.

    PubMed

    Abd Ellah, Mahmoud R; Hamed, Maha I; Ibrahim, Derar R; Rateb, Hassan Z

    2014-01-01

    Based on a review of the literature, reference intervals for water buffalo (Bubalus bubalis) serum biochemistry and haematology have not previously been published. The current study was done to establish reference intervals for water buffalo heifers. The International Federation of Clinical Chemistry stated that at least 120 values are necessary to obtain reliable estimates for reference intervals. A total number of 127 clinically healthy buffalo heifers (1-2 years old) were included in the study. Animals were examined at buffalo farms that belong to Assiut Governorate, Egypt. Three types of samples were collected: serum samples for biochemical analysis, whole blood samples for haematological analysis and faecal samples for parasitological examination. Animals that fitted the inclusion criteria were included in the study. Biochemical analysis included serum total proteins, albumin, total globulins, alpha, beta and gamma globulin levels, and aspartate aminotransferase, alanine aminotransferase, gamma glutamyl transferase, creatine phosphokinase and lactate dehydrogenase activity. In addition to the above, serum creatinine, urea, total bilirubin, direct bilirubin, indirect bilirubin, sodium, potassium, chloride, magnesium, calcium, phosphorus, copper, zinc, iron, triglycerides, high density lipoprotein, low density lipoprotein, very low density lipoprotein, glucose levels and 20 haematological variables were measured. The 95.0% reference intervals were calculated by removing the upper and lower 2.5% of the interval for each serum biochemical constituent to give the 2.5 and 97.5 percentiles. Confidence intervals were calculated for each reference limit. Reference intervals from the current study were compared with established values for cows. The current study is as far as could be determined the first that establishes reference intervals for the serum biochemical and haematological parameters in water buffalo heifers.

  20. Immunodetection of coproantigens for the diagnosis of amphistomosis in naturally infected Indian Water Buffalo, Bubalus bubalis.

    PubMed

    Saifullah, Mohammad K; Ahmad, Gul; Abidi, Syed M A

    2013-01-16

    The infection of gastrointestinal helminths in livestock is routinely diagnosed by microscopical examination of faecal samples for the presence of ova/eggs but this approach becomes ineffective for the seasonally egg producing trematodes. Therefore, an alternative approach to detect the coproantigens of liver and rumen amphistomes, Gigantocotyle explanatum and Gastrothylax crumenifer respectively, infecting Indian water buffalo Bubalus bubalis, was undertaken using ELISA, immunodot and countercurrent immunoelectrophoresis (CCIEP). The hyperimmune polyclonal antisera were separately raised in rabbits against excretory/secretory (ES) antigens of both the flukes under study. An overall 70% buffalo faecal samples were tested positive for G. crumenifer and 75% for G. explanatum in Aligarh region. The ELISA results reflected higher infection intensity among individual buffaloes that was also observed at necropsy. Using the respective homologous hyperimmune antiserum, 55% buffaloes tested positive for G. crumenifer and 65% positive for G. explanatum in immunodot assay. Further, the faecal samples with high absorbance values in ELISA and strong immunodot reaction tested positive in CCIEP. The analysis of CCIEP result revealed two and one precipitin bands in G. crumenifer and G. explanatum respectively, indicating prominent antigenic differences in the coproantigens of these two parasites. Taken together, it is suggested that polyclonal antibodies could be conveniently used for the detection of coproantigens by ELISA and immunodot methods, particularly during the non-egg producing phase of the seasonally regulated reproductive cycle of the rumen amphistome G. crumenifer. It is concluded that the coproantigen detection is a good alternative over conventional method for the diagnosis of amphistomosis in livestock; however, further studies are required on a larger sample size of field buffaloes to augment the reproducibility of the present results.

  1. Molecular analyses detect natural coinfection of water buffaloes (Bubalus bubalis) with bovine viral diarrhea viruses (BVDV) in serologically negative animals.

    PubMed

    Craig, María I; König, Guido A; Benitez, Daniel F; Draghi, María G

    2015-01-01

    Infection of water buffaloes (Bubalus bubalis) with bovine viral diarrhea viruses (BVDV) has been confirmed in several studies by serological and molecular techniques. In order to determine the presence of persistently infected animals and circulating species and subtypes of BVDV we conducted this study on a buffalo herd, whose habitat was shared with bovine cattle (Bossp.). Our serological results showed a high level of positivity for BVDV-1 and BVDV-2 within the buffalo herd. The molecular analyses of blood samples in serologically negative animals revealed the presence of viral nucleic acid, confirming the existence of persistent infection in the buffaloes. Cloning and sequencing of the 5' UTR of some of these samples revealed the presence of naturally mix-infected buffaloes with at least two different subtypes (1a and 1b), and also with both BVDV species (BVDV-1 and BVDV-2).

  2. Induction of parturition in water buffaloes (Bubalus bubalis ).

    PubMed

    Prakash, B S; Madan, M L

    1985-02-01

    Parturition was induced in ten buffaloes by combining treatments of dexamethasone and vetoestrol, so that they calved about one month before the expected term. Either dexamethasone alone (Group B) or dexamethasone and vetoestrol (Group C) was used. Another five animals served as controls (Group A). Calving was induced in four animals in group B and three animals in group C after two injections of the compounds four days apart. The average time from first injection to calving for these animals was 117.22 hr and 117.66 hr for groups B and C respectively. Induced calves weighed less at birth (P < 0.05) averaging 24.4 and 26.2 kg for groups B and C respectively, than controls (Group A; 30.20 kg). The body weight gain/week among calves was not significantly different (P > 0.05). The service period, number of services/conception and the milk yield of the buffaloes induced to calve was not significantly different (P > 0.05) from their previous records.

  3. Neurophysin in the large luteal cell of the nonpregnant water buffalo (Bubalus bubalis): immunohistochemical localization.

    PubMed

    Fields, P A; Dubois, W; Shalash, M R; Fields, M J

    1987-12-01

    Light microscopy immunohistochemistry was used to localize neurophysin in the corpus luteum of the mid-luteal phase of the estrous cycle of the water buffalo (Bubalus bubalis). Corpora lutea weighing 0.39-0.65 g from a recent ovulation showed no staining. Corpora lutea identified with the late luteal phase showed only weak evidence of staining. The neurophysin staining was confined to a specific region of large oval-shaped cells (20-30 microns diameter), which had a very eosinophilic cytoplasm. The intense localization of staining to a distinct area of the cytoplasm was previously only observed in the corpus luteum of the cow. Corpora lutea obtained from all quadrants of pregnancy did not stain. Controls in which the neurophysin antiserum was substituted with serum from an unimmunized rabbit (normal rabbit serum) or neurophysin antiserum preabsorbed with bovine oxytocin-associated neurophysin I also did not stain. These data indicate the neurophysin is present in the mature corpus luteum of the nonpregnant water buffalo as it is in other nonpregnant ruminants, the ewe and cow.

  4. Characterisation of bubaline coronavirus strains associated with gastroenteritis in water buffalo (Bubalus bubalis) calves.

    PubMed

    Decaro, Nicola; Cirone, Francesco; Mari, Viviana; Nava, Donatella; Tinelli, Antonella; Elia, Gabriella; Di Sarno, Alessandra; Martella, Vito; Colaianni, Maria Loredana; Aprea, Giuseppe; Tempesta, Maria; Buonavoglia, Canio

    2010-10-26

    Recently, a coronavirus strain (179/07-11) was isolated from water buffalo (Bubalus bubalis) and the virus which displayed a strict genetic and biological relatedness with bovine coronavirus (BCoV) was referred to as bubaline coronavirus (BuCoV). Here, we report the characterisation of four BuCoVs strains identified in the faeces or intestinal contents of water buffalo calves with acute gastroenteritis. Single BuCoV infections were detected in all but one cases from which two clostridia species were also isolated. Sequence and phylogenetic analyses of the 5' end of the spike-protein gene showed that three BuCoVs were closely related to the prototype strain 179/07-11, whereas the fourth isolate (339/08-C) displayed a higher genetic identity to recent BCoV reference strains. Three strains adapted to the in vitro grow on human rectal tumour cells were also evaluated for their ability to replicate in a bovine cell line (Madin Darby bovine kidney) and to cause haemagglutination of chicken erythrocytes and all displayed biological properties similar to those already described for the prototype BuCoV. The present report shows that albeit genetically heterogeneous, the different BuCoV strains possess a common biological pattern which is different from most BCoV and BCoV-like isolates.

  5. Quantitative aspects of water buffalo (Bubalus bubalis) spermatogenesis.

    PubMed

    Pawar, H S; Wrobel, K H

    1991-12-01

    In the buffalo, seminiferous tubules occupy about 82% of the testis. Spermatogenesis can be divided into 6 stages according to characteristic cellular associations in the seminiferous epithelium. A-spermatogonia have a volume of approximately 1,400 microns3 and the highest absolute mitochondrial volume of all spermatogenic cells. B-spermatogonia display cellular, nuclear and mitochondrial volumes of approximately half the values of A-spermatogonia. From preleptotene (approximately 470 microns3) to late diplotene (approximately 2,300 microns3), the volume* of primary spermatocytes increases nearly five-fold; their nuclear volumes increase by 3.5 times within the same period. During zygotene mitochondrial cristae start to dilate. Grouping of mitochondria by a dense intermitochondrial substance is most prominent during pachytene and diplotene. In pachytene the absolute size of the Golgi apparatus more than doubles, indicating a high secretory activity. Through zygotene only rER is encountered; in pachytene and diplotene a tubular sER makes its first appearance. Secondary spermatocytes are found only in stage 4 of the cycle. Due to partial cell necrosis and autolytic events, late maturation phase spermatids display no more than 25% of the size of cap phase spermatids. There is no morphological evidence for an active uptake and digestion of residual bodies by the Sertoli cells. Also, no lipid cycle is present in the buffalo seminiferous epithelium. Morphometric evaluations reveal that 63% of all theoretically possible germ cells disappear from the seminiferous epithelium during spermatogenesis. Heavy cell loss is observed in stage 4 of the cycle in the spermatogonial fraction as well as during the second meiotic division.

  6. First molecular characterisation of Cryptosporidium and Giardia from Bubalus bubalis (water buffalo) in Victoria, Australia.

    PubMed

    Abeywardena, Harshanie; Jex, Aaron R; von Samson-Himmelstjerna, Georg; Haydon, Shane R; Stevens, Melita A; Gasser, Robin B

    2013-12-01

    We conducted a molecular epidemiological survey of Cryptosporidium and Giardia from Bubalus bubalis (water buffalo) on two extensive farms (450 km apart) in Victoria, Australia. Faecal samples (n=476) were collected from different age groups of water buffalo at two time points (six months apart) and tested using a PCR-based mutation scanning-targeted sequencing-phylogenetic approach, employing markers within the small subunit of ribosomal RNA (designated pSSU) and triose phosphate isomerase (ptpi) genes. Based on pSSU data, Cryptosporidium parvum, Cryptosporidium bovis and Cryptosporidium genotypes 1, 2 (each 99% similar genetically to Cryptosporidium ryanae) and 3 (99% similar to Cryptosporidium suis) were detected in two (0.4%), one (0.2%), 38 (8.0%), 16 (3.4%) and one (0.2%) of the 476 samples tested, respectively. Using ptpi, Giardia duodenalis assemblages A and E were detected in totals of 56 (11.8%) and six (1.3%) of these samples, respectively. Cryptosporidium was detected on both farms, whereas Giardia was detected only on farm B, and both genera were detected in 1.5% of all samples tested. The study showed that water buffaloes on these farms excreted C. parvum and/or G. duodenalis assemblage A, which are consistent with those found in humans, inferring that these particular pathogens are of zoonotic significance. Future work should focus on investigating, in a temporal and spatial manner, the prevalence and intensity of such infections in water buffaloes in various geographical regions in Australia and in other countries.

  7. Physico-chemical and immunological characteristics of pituitary prolactin from water buffaloes (Bubalus bubalis).

    PubMed

    Chadha, N; Kohli, R; Kumari, G L; Muralidhar, K

    1991-06-26

    Prolactin (PRL) was purified from freshly frozen pituitary glands of water buffaloes (Bubalus bubalis) by a combination of existing procedures of Ellis and Jiang and Wilhelmi involving serial extraction of different pituitary proteins. The partially purified preparation was further fractionated on DEAE-Sephadex followed by Sephadex G-100 chromatography. This was finally purified on HPLC. This preparation was found to be homogeneous by SDS-PAGE and HPLC and had a single N-terminus amino acid (Threonine). The molecular size was estimated to be 24K +/- 0.5 by SDS-PAGE and approximately 25K by GPC-HPLC. The buffalo PRL gave a dose dependent inhibition curve in a rat liver based radio receptor assay with a potency of 30-35 I.U./mg and also in a partial homologous RIA using 125I-buffalo PRL and rabbit anti-oPRL serum giving a potency of 30 I.U./mg. Metabolic labelling studies using 35SO4(2-) with buffalo pituitary minces showed the incorporation of radioactive sulfate into immunoprecipitable PRL-like material. Physico-chemical characterization of the site of the linkage between sulfate and PRL revealed the presence of Tyr-O-SO4 in bu-PRL. A high affinity monoclonal antibody (MAB) with Ka of 10(10) L/M, belonging to IgG1 isotype, and capable of cross reacting with ovine and bovine PRL was generated. This MAB was conformation specific as reduced and carboxymethylated PRL did not react with it. A homologous RIA system using this MAB has been standardised.

  8. Sarcocystis spp infection in Philippine water buffaloes (Bubalus bubalis).

    PubMed

    Claveria, F G; Cruz, M J; Lim, R S

    2000-01-01

    In a survey of sarcocysts in muscle tissues obtained from 142 water buffaloes, 65% of the carcasses had sarcocysts. Macroscopic and two forms of microscopic sarcocysts, the spindle-shaped or fusiform sarcocysts commonly occurring in the muscles of the esophagus, throat and limbs, and the globular to oval-shaped sarcocysts which were the dominant form in the diaphragm and cervical muscle tissues were noted. Ultrastructural analysis of macroscopic and microscopic sarcocysts and their cyst wall revealed two distinct species of Sarcocystis: the macroscopic species, Sarcocystis fusiformis which has been previously reported in Philippine carabaos possessing highly dendritic cauliflower-like projections emanating from the primary cyst wall, with annulated microfilaments and numerous electron dense granules: and the Sarcocystis levinei (Dissanaike and Kan, 1978) Huong, Dubey and Uggla. 1997 exhibiting a cyst wall with undulating and hair-like villar protrusions with expanded or dome-shaped base, intermediate finger-like, and distal tapering segments which at some points join to form conical tufts. Our findings represent the first report of S. levinei in the country supported with ultrastructural analysis of the sarcocysts and cyst wall, and likewise refute earlier published reports that all microscopic sarcocysts in Philippine carabaos are developing forms of the macroscopic species, S. fusiformis. Histopathological changes such as displacement and necrosis of the surrounding host muscle tissue were observed with macroscopic sarcocysts and histologically processed tissue samples containing microscopic fusiform sarcocysts. Necrotic myofibrils and mitochondria were evident in ultrathin sections.

  9. The effect of season on oocyte quality and developmental competence in Italian Mediterranean buffaloes (Bubalus bubalis).

    PubMed

    Di Francesco, Serena; Boccia, Lucia; Campanile, Giuseppe; Di Palo, Rossella; Vecchio, Domenico; Neglia, Gianluca; Zicarelli, Luigi; Gasparrini, Bianca

    2011-01-01

    At Italian latitudes, buffalo (Bubalus bubalis) is a seasonally polyestrous species, showing an improved reproductive efficiency when daylight decreases (autumn). The aim of the present study was to evaluate the influence of the season on buffalo oocyte recovery rate, on oocyte quality, assessed on morphological basis, and developmental competence after in vitro fertilization. For this purpose, buffalo ovaries were collected from a local abattoir and the oocytes obtained by aspirating the follicles were evaluated, classified and, if considered of good quality, devolved to the different procedures of IVEP. In general, no differences were found in terms of oocyte recovery per ovary among seasons, but interestingly, the percentage of small oocytes was higher (P<0.05) during spring and summer (0.9±0.1 and 0.9±0.2) compared to autumn and winter (0.3±0.1 and 0.2±0.1). Both cleavage and embryo rate increased during the period from October to December (71.7±3.1 and 26.5±2.1, respectively) compared to the period from April to June (58.0±2.4 and 18.8±1.6, respectively), thus reflecting the in vivo reproductive behavior. Nevertheless, it is worth emphasizing that transferrable embryos were produced in vitro, even during the unfavorable season, but with decreased efficiency. In conclusion, these results suggest to avoid the oocyte collection during spring when planning OPU trials in order to save resources and improve the benefits/costs ratio. PMID:21168984

  10. Comparative pharmacokinetics of ceftiofur hydrochloride and ceftiofur sodium after administration to water buffalo (Bubalus bubalis).

    PubMed

    Nie, Haiying; Feng, Xin; Peng, Jianbo; Liang, Liu; Lu, Chunyan; Tiwari, Roshan V; Tang, Shusheng; He, Jiakang

    2016-06-01

    OBJECTIVE To evaluate pharmacokinetics and bioavailability after administration of ceftiofur hydrochloride and ceftiofur sodium to water buffalo (Bubalus bubalis). ANIMALS 5 healthy adult water buffalo (3 males and 2 nonlactating females). PROCEDURES All animals received a dose (2.2 mg/kg) of 3 ceftiofur products (2 commercially available suspensions of ceftiofur hydrochloride [CEF1 and CEF2, IM] and ceftiofur sodium [CEF3, IV]). Blood samples were collected for up to 196 hours. Concentrations of ceftiofur in plasma were determined by use of high-performance liquid chromatography, and pharmacokinetic parameters were calculated on the basis of noncompartmental methods. RESULTS Most of the pharmacokinetic parameters, except for bioavailability and the area under the concentration-time curve extrapolated to infinity, were significantly different between the 2 products administered IM. Mean ± SD bioavailability of CEF1 and CEF2 was 89.57 ± 32.84% and 86.28 ± 11.49%, respectively, which indicated good absorption of both products. In addition, there was a longer drug residence time for CEF1 than for CEF2. Data analysis for CEF1 revealed a flip-flop phenomenon. CONCLUSIONS AND CLINICAL RELEVANCE In this study, there was good absorption of CEF1, and CEF1 had a longer drug residence time in vivo than did CEF2. On the basis of pharmacokinetic parameters and the in vitro antimicrobial susceptibility, a dosage regimen of 2.2 mg/kg administered at 48- and 36-hour intervals for CEF1 and CEF2, respectively, could be an appropriate choice for the treatment of buffalo with infectious diseases.

  11. Molecular mining of GGAA tagged transcripts and their expression in water buffalo Bubalus bubalis.

    PubMed

    Rawal, Leena; Ali, Safdar; Ali, Sher

    2012-01-15

    Repeat sequences are involved in regulation of gene expression both at the transcriptional and translational level. In the mammalian genomes, tri- and tetranucleotide repeats like ATA, AATA, GGAA and GAAA have been associated with diseases. In silico analysis of (GGAA)5 distribution across the species showed maximum number of this repeat in the mouse transcriptome compared to that in other species. Following this, we conducted minisatellite associated sequence amplification (MASA) to explore the buffalo's transcriptome using cDNA from different tissues and an oligo based on (GGAA)5 repeats. MASA uncovered twenty six mRNA transcripts showing homology to known genes in the database. qPCR studies showed the highest expression of twelve transcripts in the spleen. A transcript, pLRC107 with its partial sequence of 203 nucleotides showed sequence variation at several positions in spleen as compared to other four tissues examined. Transcript pLRC100 was found to represent the partial coding sequence of Bos taurus HECT {(homologous to E6-associated protein (UBE3A) carboxyl-terminus domain) and RCC1 (CHC1)-like domain (RLD) 1}, mRNA. We ascertained full length coding sequence of HECT gene and localized the same on buffalo chromosome 10 employing FISH. This gene was found to be conserved across the species. Another gene LRP8 uncovered in the process showed copy number variation between buffalo males (4-9) and females (34-54). The MASA approach enabled us to identify several genes in Bubalus bubalis without screening an entire cDNA library. The highest expression of 12 mRNA transcripts in spleen suggests their likely involvement with immuno transaction. A comprehensive knowledge of the repeat tagged transcriptomes is envisaged to help in understanding their significance in genome organization and evolution forming rich basis of functional and comparative genomics.

  12. Comparative pharmacokinetics of ceftiofur hydrochloride and ceftiofur sodium after administration to water buffalo (Bubalus bubalis).

    PubMed

    Nie, Haiying; Feng, Xin; Peng, Jianbo; Liang, Liu; Lu, Chunyan; Tiwari, Roshan V; Tang, Shusheng; He, Jiakang

    2016-06-01

    OBJECTIVE To evaluate pharmacokinetics and bioavailability after administration of ceftiofur hydrochloride and ceftiofur sodium to water buffalo (Bubalus bubalis). ANIMALS 5 healthy adult water buffalo (3 males and 2 nonlactating females). PROCEDURES All animals received a dose (2.2 mg/kg) of 3 ceftiofur products (2 commercially available suspensions of ceftiofur hydrochloride [CEF1 and CEF2, IM] and ceftiofur sodium [CEF3, IV]). Blood samples were collected for up to 196 hours. Concentrations of ceftiofur in plasma were determined by use of high-performance liquid chromatography, and pharmacokinetic parameters were calculated on the basis of noncompartmental methods. RESULTS Most of the pharmacokinetic parameters, except for bioavailability and the area under the concentration-time curve extrapolated to infinity, were significantly different between the 2 products administered IM. Mean ± SD bioavailability of CEF1 and CEF2 was 89.57 ± 32.84% and 86.28 ± 11.49%, respectively, which indicated good absorption of both products. In addition, there was a longer drug residence time for CEF1 than for CEF2. Data analysis for CEF1 revealed a flip-flop phenomenon. CONCLUSIONS AND CLINICAL RELEVANCE In this study, there was good absorption of CEF1, and CEF1 had a longer drug residence time in vivo than did CEF2. On the basis of pharmacokinetic parameters and the in vitro antimicrobial susceptibility, a dosage regimen of 2.2 mg/kg administered at 48- and 36-hour intervals for CEF1 and CEF2, respectively, could be an appropriate choice for the treatment of buffalo with infectious diseases. PMID:27227504

  13. Natural Babesia bovis Infection in Water Buffaloes (Bubalus bubalis) and Crossbred Cattle under Field Conditions in Egypt: a Preliminary Study

    PubMed Central

    Mahmmod, Yasser

    2014-01-01

    Background There is a little or no data available on the natural Babesia bovis (B. bovis) infection in water buffaloes (Bubalus bubalis) comparing to the available one for cattle. This study was conducted to investigate the natural B. bovis infection in water buffaloes in comparison to crossbred cattle under field conditions in Egypt. Methods: A total of 35 buffaloes and cattle were clinically and laboratory investigated from March to June 2008. Twenty-nine buffaloes and cattle out of 35 were naturally infected with B. bovis and showed signs of bovine babesiosis. Three cows and three buffaloes showed no clinical signs and were free from external, internal, and blood parasites served as control group. Results: Babesia bovis-infected cattle showed typical signs of bovine babesiosis while B. bovis-infected buffaloes showed a milder form (less severe) of the clinical signs. Advanced cases of cattle showed dark brown to dark red (coffee-color) urine, hemoglobinuria and nervous manifestations while these manifestations were not detected in the infected buffaloes. Hematological changes in both species however, these changes were less significant in buffaloes than those reported in cattle. Conclusion: This paper documents the first description of natural B. bovis infection in water buffaloes which were found to be more likely to be tolerant than cattle to the natural clinical infection with B. bovis and its subsequent haematological changes. Our finding may lead to a better understanding of the disease pattern of B. bovis infection under field conditions in buffaloes. PMID:25629060

  14. Analysis of mitochondrial D-loop region casts new light on domestic water buffalo (Bubalus bubalis) phylogeny.

    PubMed

    Kierstein, Gerold; Vallinoto, Marcelo; Silva, Artur; Schneider, Maria Paula; Iannuzzi, Leopoldo; Brenig, Bertram

    2004-02-01

    The phylogeny of water buffaloes (Bubalus bubalis) is still a matter of discussion, especially if the two types of domestic water buffalo (swamp and river) derived from different domestication events or if they are products of human selection. To obtain more insight, we analyzed the entire mitochondrial D-loop region of 80 water buffaloes of four different breeds, i.e., 19 swamp buffaloes (Carabao) and 61 river buffaloes (Murrah, Jafarabadi, and Mediterranean), sampled in Brazil and Italy. We detected 36 mitochondrial haplotypes with 128 polymorphic sites. Pooled with published data of South-East Asian and Australian water buffaloes and based on comprehensive median-joining network and population demography analyses we show evidence that both river and swamp buffaloes decent from one domestication event, probably in the Indian subcontinent. However, the today swamp buffaloes have an unravelled mitochondrial history, which can be explained by introgression of wild water buffalo mtDNA into domestic stocks. We are also discussing indications for an independent domestication of buffaloes in China.

  15. Saliva ferning, an unorthodox estrus detection method in water buffaloes (Bubalus bubalis).

    PubMed

    Ravinder, R; Kaipa, Onnureddy; Baddela, Vijay Simha; Singhal Sinha, Eshu; Singh, Prashant; Nayan, Varij; Velagala, Chandra Sekhar Naidu; Baithalu, Rubina Kumari; Onteru, Suneel Kumar; Singh, Dheer

    2016-09-15

    Estrus detection is a major problem in buffalo husbandry because of inconsistent expression of estrous signs at different seasons, and a high prevalence of the silent heat and postpartum anestrus in this species. Around 50% of the estrus events in buffaloes are currently undetected in the field conditions, resulting in a huge economic loss. Although the cervicovaginal fluid fern patterns confirm the estrus for a breeding decision, the fluid discharge is absent during the silent-heat condition. Therefore, the present study focused on the crystallization patterns of the saliva as an alternative method for estrus detection in buffaloes. Saliva is a body fluid available regularly, and its ferning ability before ovulation was established in women. In this study, eight female nonpregnant Murrah buffaloes (Bubalus bubalis) were considered during two experimental periods of 3 months each. One period was in summer with five animals, and another period was in rainy season with three animals. Estrus was determined by the estrus symptoms, ovarian ultrasonography, and salivary estradiol (E2) to progesterone (P4) ratio. A total of 450 saliva samples were collected from these animals on the daily basis. The salivary smear was prepared with 20 μL of the cell-free saliva on a clean glass slide, and its microscopic images were captured at a magnification of × 200. The images were used for fractal analysis as the salivary crystallization or fern patterns follow the fractal geometry. Saliva at estrus showed a typical symmetrical fern-like crystallization patterns with significantly (P < 0.05) lower fractal dimension values. Salivary estradiol levels and E2/P4 ratio were significantly (P < 0.05) higher at the estrus stage than those at the diestrus stage. An average period of an estrous cycle was 21.7 ± 2.7 days (n = 18 estrous cycles) in buffaloes on the basis of distinct salivary crystallization patterns. The proportion of estrus detection by the salivary fern patterns

  16. Saliva ferning, an unorthodox estrus detection method in water buffaloes (Bubalus bubalis).

    PubMed

    Ravinder, R; Kaipa, Onnureddy; Baddela, Vijay Simha; Singhal Sinha, Eshu; Singh, Prashant; Nayan, Varij; Velagala, Chandra Sekhar Naidu; Baithalu, Rubina Kumari; Onteru, Suneel Kumar; Singh, Dheer

    2016-09-15

    Estrus detection is a major problem in buffalo husbandry because of inconsistent expression of estrous signs at different seasons, and a high prevalence of the silent heat and postpartum anestrus in this species. Around 50% of the estrus events in buffaloes are currently undetected in the field conditions, resulting in a huge economic loss. Although the cervicovaginal fluid fern patterns confirm the estrus for a breeding decision, the fluid discharge is absent during the silent-heat condition. Therefore, the present study focused on the crystallization patterns of the saliva as an alternative method for estrus detection in buffaloes. Saliva is a body fluid available regularly, and its ferning ability before ovulation was established in women. In this study, eight female nonpregnant Murrah buffaloes (Bubalus bubalis) were considered during two experimental periods of 3 months each. One period was in summer with five animals, and another period was in rainy season with three animals. Estrus was determined by the estrus symptoms, ovarian ultrasonography, and salivary estradiol (E2) to progesterone (P4) ratio. A total of 450 saliva samples were collected from these animals on the daily basis. The salivary smear was prepared with 20 μL of the cell-free saliva on a clean glass slide, and its microscopic images were captured at a magnification of × 200. The images were used for fractal analysis as the salivary crystallization or fern patterns follow the fractal geometry. Saliva at estrus showed a typical symmetrical fern-like crystallization patterns with significantly (P < 0.05) lower fractal dimension values. Salivary estradiol levels and E2/P4 ratio were significantly (P < 0.05) higher at the estrus stage than those at the diestrus stage. An average period of an estrous cycle was 21.7 ± 2.7 days (n = 18 estrous cycles) in buffaloes on the basis of distinct salivary crystallization patterns. The proportion of estrus detection by the salivary fern patterns

  17. Identity of Sarcocystis species of the water buffalo (Bubalus bubalis) and cattle (Bos taurus) and the suppression of Sarcocystis sinensis as a nomen nudum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    There are uncertainties concerning the identity and host species specificity of Sarcocystis species of the water buffalo (Bubalus bubalis) and cattle (Bos taurus). Currently, in cattle three species are recognized with known endogenous stages, viz.: S. cruzi (with canine definitive host), S. hirsuta...

  18. Transcriptional Dynamics of Homeobox C11 Gene in Water Buffalo Bubalus bubalis

    PubMed Central

    Rawal, Leena; Pathak, Deepali; Sehgal, Neeta

    2015-01-01

    The Hox complex contains 39 genes clustered into four groups involved in cell differentiation and development. We cloned full-length sequence of Hoxc11 gene from water buffalo Bubalus bubalis, assessed its copy number, localized the same onto the chromosome 5, and studied its evolutionary conservation across the species. Northern hybridization of Hoxc11 showed a 2.2 kb band in the tissues analyzed. Real-Time PCR showed highest expression of Hoxc11 gene in lung followed by spleen, spermatozoa, and testis. Six interacting partners of this gene showed higher expression in spleen, lung, testis, and spermatozoa. During the early stages of development, Hoxc11 and its interacting partners both showed lower expression, which then became prominent during the age of 1–3 years, regressed drastically thereafter, and remained so until the animal's life time (∼20 years). The high expression of Hoxc11 and its interacting partners in spermatozoa and testis during the onset of puberty suggests its likely role in the differentiation of gonads and subsequent reproductive activities. Additional work on Hoxc11 especially, in the context of respiratory, immunological, and in/fertility in other species, including humans would be useful for establishing its broader biological significance towards the enrichment of functional and comparative genomics. PMID:25760398

  19. Transcriptional dynamics of homeobox C11 gene in water buffalo bubalus bubalis.

    PubMed

    Rawal, Leena; Pathak, Deepali; Sehgal, Neeta; Ali, Sher

    2015-06-01

    The Hox complex contains 39 genes clustered into four groups involved in cell differentiation and development. We cloned full-length sequence of Hoxc11 gene from water buffalo Bubalus bubalis, assessed its copy number, localized the same onto the chromosome 5, and studied its evolutionary conservation across the species. Northern hybridization of Hoxc11 showed a 2.2 kb band in the tissues analyzed. Real-Time PCR showed highest expression of Hoxc11 gene in lung followed by spleen, spermatozoa, and testis. Six interacting partners of this gene showed higher expression in spleen, lung, testis, and spermatozoa. During the early stages of development, Hoxc11 and its interacting partners both showed lower expression, which then became prominent during the age of 1-3 years, regressed drastically thereafter, and remained so until the animal's life time (∼ 20 years). The high expression of Hoxc11 and its interacting partners in spermatozoa and testis during the onset of puberty suggests its likely role in the differentiation of gonads and subsequent reproductive activities. Additional work on Hoxc11 especially, in the context of respiratory, immunological, and in/fertility in other species, including humans would be useful for establishing its broader biological significance towards the enrichment of functional and comparative genomics.

  20. Comparative Proteomic Analysis of Mature and Immature Oocytes of the Swamp Buffalo (Bubalus bubalis)

    PubMed Central

    Fu, Qiang; Liu, Zhen-Fang; Huang, Yu-Lin; Lu, Yang-Qing; Zhang, Ming

    2016-01-01

    Maternal protein components change markedly during mammalian oogenesis. Many of these proteins have yet to be characterized and verified. In this study, a proteomics approach was used to evaluate changes in proteins during oogenesis in the Swamp Buffalo (Bubalus bubalis). Proteins from 500 immature oocytes and 500 in vitro matured oocytes were subjected to two-dimensional electrophoresis, and more than 400 spots were detected. Image analysis indicated that 17 proteins were differentially expressed between the two groups. Eight proteins were identified by mass spectrometry. In mature oocytes, three proteins were down-regulated: major vault protein (MVP), N-acetyllactosaminide β-1,6-N-acetylglucosaminyl-transferase (GCNT-2), and gem-associated protein (GEMIN)8, whereas five other proteins, heat shock protein (HSP)60, Ras-responsive element-binding protein 1 (RREB-1), heat shock cognate 71 kDa protein (HSC71), hemoglobin subunit α (HBA), and BMP-2-inducible protein kinase (BMP-2K), were up-regulated. The expression profiles of HSP60 and GEMIN8 were further verified by Western blotting. The changes in HSP60 protein expression demonstrate the increasing need for mitochondrial protein importation to facilitate macromolecular assembly during oocyte maturation. The down-regulation of GEMIN8 production implies that RNA splicing is impaired in mature oocytes. PMID:26784167

  1. Molecular cloning, characterization, and expression studies of water buffalo (Bubalus bubalis) somatotropin.

    PubMed

    Sadaf, S; Khan, M A; Wilson, D B; Akhtar, M W

    2007-02-01

    Cloning, high-level expression, and characterization of the somatotropin (ST) gene of an indigenous Nili-Ravi breed of water buffalo Bubalus bubalis (BbST) are described. Coding, non-coding, and promoter regions of BbST were amplified and sequenced. Sequence analysis revealed several silent and two interesting point mutations on comparison with STs of other vertebrate species. One interesting variation in the BbST sequence was the replacement of a conserved glutamine residue by arginine. A plasmid was also constructed for the production of BbST in Escherichia coli BL21 (RIPL) CodonPlus, under the control of IPTG-inducible T7-lac promoter. High-level expression could be obtained by synthesizing a codon-optimized ST gene and expressing it in the form of inclusion bodies. The inclusion bodies represented over 20% of the E. coli cellular proteins. The biologically active conformation of purified BbST was confirmed by its efficient growth promoting activity in Nb2 cell proliferation assay. The expression system and purification strategy employed promise to be a useful approach to produce BbST for further use in structure-function studies and livestock industry.

  2. Occurrence of anti-Neospora caninum antibodies in water buffaloes (Bubalus bubalis) from the Northern region of Brazil.

    PubMed

    Gennari, Solange M; Rodrigues, Aline A R; Viana, Rinaldo B; Cardoso, Elyzabeth C

    2005-11-25

    Anti-Neospora caninum antibodies were determined in sera of 196 water buffaloes (Bubalus bubalis) from three farms of the northern region of Brazil, using an indirect fluorescent antibody test. Antibody titers were found in 139 (70.9%) buffaloes with dilution values ranging from > or =25 to <200 in 41 animals, > or =200 to <800 in 35 animals, and > or =800 in 63 animals. The number of animals presenting titers > or =800 was statistically higher (p<0.05). All farms presented positive animals, however, the occurrence was higher (p<0.05) in farm 1 (87.2%) when compared with farm 2 (65.7%) and farm 3 (65.8%). The occurrence by age groups presented no differences (p>0.05). Results indicate a high exposure of water buffaloes to N. caninum in the Northern region of Brazil.

  3. Evidence of congenital transmission of Neospora caninum in naturally infected water buffalo (Bubalus bubalis) fetus from Brazil.

    PubMed

    Chryssafidis, Andreas L; Soares, Rodrigo M; Rodrigues, Aline A R; Carvalho, Nelcio A T; Gennari, Solange Maria

    2011-03-01

    The aim of this study was to determine the congenital infection by Neospora caninum in the water buffalo (Bubalus bubalis), a natural intermediate host. Nine pregnant water buffalos, raised under free-grazing condition, were slaughtered, and their fetuses were collected. Samples of brain and thoracic fluid were obtained from those fetuses, with gestational ages ranging from 2 to 5 months. The DNA of N. caninum was detected and identified in the brain of one of those fetuses, using two PCR assays, one directed to the Nc5 gene and the other, to the common toxoplasmatiid ITS1 sequence. The DNA fragments produced on PCR were sequenced, and N. caninum was confirmed in the samples. No antibodies to N. caninum were detected on any sample of thoracic fluid by immunofluorescent antibody test (IFAT < 25). This is the first confirmation of congenital transmission of N. caninum in water buffalos.

  4. Redescription of Sarcocystis fusiformis sarcocysts from the water buffalo (Bubalus bubalis).

    PubMed

    Dubey, J P; Hilali, M; Van Wilpe, E; Verma, S K; Calero-Bernal, R; Abdel-Wahab, A

    2015-02-01

    Four valid species of Sarcocystis have been reported from the water buffalo (Bubalus bubalis): Sarcocystis fusiformis, Sarcocystis buffalonis, Sarcocystis levinei and Sarcocystis dubeyi. Here, we redescribe structure of S. fusiformis sarcocysts by scanning and transmission electron microscopy (SEM, TEM). Twenty-one macroscopic sarcocysts from oesophagus of the water buffalo in Egypt were examined by light microscopy, SEM and TEM. The sarcocyst wall was up to 9 μm thick, depending on the section and the technique. In 5 μm paraffin-embedded sections, the sarcocyst wall was indistinct, 2-5 μm thick and appeared smooth. In 1 μm plastic-embedded sections stained with toluidine blue, the sarcocyst wall was 2.5-5.2 μm thick and had branched villar protrusions (vp)-like branches of a dead tree. By SEM, the sarcocyst wall had a mesh-like structure with irregularly shaped vp that were folded over the sarcocyst wall. On each vp there were uniform papillomatous structures that were 100 nm wide. By TEM, vp were up to 6 μm long and contained filamentous tubular structures, most of which were parallel to the long axis of the projections; granules were absent from these tubules. By TEM, bradyzoites within the same cyst varied from 11.2 to 16.8 μm in length. By TEM, bradyzoites had a very long (10 μm) convoluted mitochondrion, up to 12 dense granules, but only 2 rhoptries. This redescription should help to differentiate the sarcocysts of S. fusiformis from similar sarcocysts in domestic and wild ruminants.

  5. Production of a Cloned Buffalo (Bubalus bubalis) Calf from Somatic Cells Isolated from Urine

    PubMed Central

    Madheshiya, Pankaj K.; Sahare, Amol A.; Jyotsana, Basanti; Singh, Karn P.; Saini, Monika; Raja, Anuj K.; Kaith, Sakshi; Singla, Suresh K.; Chauhan, Manmohan S.; Manik, Radhey S.

    2015-01-01

    Abstract This study was aimed at isolation of cells from urine and skin on the ventral part of the tails of healthy adult female buffaloes (Bubalus bubalis), an area rarely exposed to solar radiation, establishment of the cells in culture, and their use as donor cells for production of buffalo embryos by handmade cloning (HMC). The blastocyst rate and total cell number of urine- and tail skin–derived embryos were similar to those of control embryos derived from ear skin cells; however, their apoptotic index was lower (p<0.05) than that of control blastocysts. The global level of histone H3 acetylated at lysine 9 (H3K9ac) was similar in the three types of donor cells and in urine- and tail skin–derived HMC blastocysts and in vitro–fertilized (IVF) blastocysts (controls). The global level of histone H3 trimethylated at lysine 27 (H3K27me3) in the cells was in the order (p<0.05) urine≥tail skin>ear skin–derived cells, whereas in blastocysts, it was higher (p<0.05) in urine- and tail skin–derived HMC blastocysts than that in IVF blastocysts. The expression level of CASPASE3, CASPASE9, P53, DNMT1, DNMT3a, OCT4, and NANOG, which was similar in HMC blastocysts of three the groups, was lower (p<0.05) than that in IVF blastocysts, whereas that of HDAC1 was similar among the four groups. Following transfer of urine-derived embryos (n=10) to five recipients (two embryos/recipient), one of the recipients delivered a normal calf that is now 5 weeks old. PMID:26053516

  6. Carcass Characteristics and Meat Quality of Swamp Buffaloes (Bubalus bubalis) Fattened at Different Feeding Intensities.

    PubMed

    Lambertz, C; Panprasert, P; Holtz, W; Moors, E; Jaturasitha, S; Wicke, M; Gauly, M

    2014-04-01

    Twenty-four male 1-year old swamp buffaloes (Bubalus bubalis) were randomly allocated to 4 groups. One group grazed on guinea grass (GG) and another on guinea grass and the legume Stylosanthes guianensis (GL). The other two groups were kept in pens and fed freshly cut guinea grass and concentrate at an amount of 1.5% (GC1.5) and 2.0% (GC2.0) of body weight, respectively. The effect of the different feeding intensities on carcass characteristics and meat quality were assessed. The mean body weight at slaughter was 398 (±16) kg. Average daily gain was higher in concentrate-supplemented groups (570 and 540 g/d in GC1.5 and GC2.0, respectively) when compared to GG (316 g/d) and GL (354 g/d) (p<0.01). Likewise, the warm carcass weight was higher in GC1.5 and GC2.0 compared to GG and GL. Dressing percentage was 48.1% and 49.5% in GC1.5 and GC2.0 in comparison to 42.9% and 44.8% observed in GG and GL, respectively. Meat of Longissimus throracis from GC1.5 and GC2.0 was redder in color (p<0.01), while water holding capacity (drip and thawing loss) was improved in pasture-fed groups (p<0.05). Protein and fat content of Longissimus thoracis was higher in animals supplemented with concentrate (p<0.01), as was cholesterol content (p<0.05), whereas PUFA:SFA ratio was higher and n-6/n-3 ratio lower (p<0.01) in pasture-fed buffaloes. Results of the present study showed that the supplementation of pasture with concentrate enhances the growth and carcass characteristics of swamp buffaloes expressed in superior dressing percentage, better muscling, and redder meat with a higher content of protein and fat, whereas animals grazing only on pasture had a more favorable fatty acid profile and water holding capacity. In conclusion, the supplementation of concentrate at a rate of about 1.5% of body weight is recommended to improve the performance and carcass quality of buffaloes. PMID:25049987

  7. Carcass Characteristics and Meat Quality of Swamp Buffaloes (Bubalus bubalis) Fattened at Different Feeding Intensities

    PubMed Central

    Lambertz, C.; Panprasert, P.; Holtz, W.; Moors, E.; Jaturasitha, S.; Wicke, M.; Gauly, M.

    2014-01-01

    Twenty-four male 1-year old swamp buffaloes (Bubalus bubalis) were randomly allocated to 4 groups. One group grazed on guinea grass (GG) and another on guinea grass and the legume Stylosanthes guianensis (GL). The other two groups were kept in pens and fed freshly cut guinea grass and concentrate at an amount of 1.5% (GC1.5) and 2.0% (GC2.0) of body weight, respectively. The effect of the different feeding intensities on carcass characteristics and meat quality were assessed. The mean body weight at slaughter was 398 (±16) kg. Average daily gain was higher in concentrate-supplemented groups (570 and 540 g/d in GC1.5 and GC2.0, respectively) when compared to GG (316 g/d) and GL (354 g/d) (p<0.01). Likewise, the warm carcass weight was higher in GC1.5 and GC2.0 compared to GG and GL. Dressing percentage was 48.1% and 49.5% in GC1.5 and GC2.0 in comparison to 42.9% and 44.8% observed in GG and GL, respectively. Meat of Longissimus throracis from GC1.5 and GC2.0 was redder in color (p<0.01), while water holding capacity (drip and thawing loss) was improved in pasture-fed groups (p<0.05). Protein and fat content of Longissimus thoracis was higher in animals supplemented with concentrate (p<0.01), as was cholesterol content (p<0.05), whereas PUFA:SFA ratio was higher and n-6/n-3 ratio lower (p<0.01) in pasture-fed buffaloes. Results of the present study showed that the supplementation of pasture with concentrate enhances the growth and carcass characteristics of swamp buffaloes expressed in superior dressing percentage, better muscling, and redder meat with a higher content of protein and fat, whereas animals grazing only on pasture had a more favorable fatty acid profile and water holding capacity. In conclusion, the supplementation of concentrate at a rate of about 1.5% of body weight is recommended to improve the performance and carcass quality of buffaloes. PMID:25049987

  8. Plasma and milk kinetic of eprinomectin and moxidectin in lactating water buffaloes (Bubalus bubalis).

    PubMed

    Dupuy, Jacques; Sutra, Jean-François; Alvinerie, Michel; Rinaldi, Laura; Veneziano, Vincenzo; Mezzino, Laura; Pennacchio, Saverio; Cringoli, Giuseppe

    2008-11-01

    The pharmacokinetics and mammary excretion of moxidectin and eprinomectin were determined in water buffaloes (Bubalus bubalis) following topical administration of 0.5mgkg(-1). Following administration of moxidectin, plasma and milk concentrations of moxidectin increased to reach maximal concentrations (C(max)) of 5.46+/-3.50 and 23.76+/-16.63ngml(-1) at T(max) of 1.20+/-0.33 and 1.87+/-0.77 days in plasma and milk, respectively. The mean residence time (MRT) were similar for plasma and milk (5.27+/-0.45 and 5.87+/-0.80 days, respectively). The AUC value was 5-fold higher in milk (109.68+/-65.01ngdayml(-1)) than in plasma (23.66+/-12.26ngdayml(-1)). The ratio of AUC milk/plasma for moxidectin was 5.04+/-2.13. The moxidectin systemic availability (expressed as plasma AUC values) obtained in buffaloes was in the same range than those reported in cattle. The faster absorption and elimination processes of moxidectin were probably due to a lower storage in fat associated with the fact that animals were in lactation. Nevertheless, due to its high excretion in milk and its high detected maximum concentration in milk which is equivalent or higher to the Maximal Residue Level value (MRL) (40ngml(-1)), its use should be prohibited in lactating buffaloes. Concerning eprinomectin, the C(max) were of 2.74+/-0.89 and 3.40+/-1.68ngml(-1) at T(max) of 1.44+/-0.20 and 1.33+/-0.0.41 days in plasma and milk, respectively. The MRT and the AUC were similar for plasma (3.17+/-0.41 days and 11.43+/-4.01ngdayml(-1)) and milk (2.70+/-0.44 days and 8.49+/-3.33ngdayml(-1)). The ratio of AUC milk/plasma for eprinomectin was 0.76+/-0.16. The AUC value is 20 times lower than that reported in dairy cattle. The very low extent of mammary excretion and the milk levels reported lower than the MRL (20ngml(-1)) supports the permitted use of eprinomectin in lactating water buffaloes.

  9. Carcass Characteristics and Meat Quality of Swamp Buffaloes (Bubalus bubalis) Fattened at Different Feeding Intensities.

    PubMed

    Lambertz, C; Panprasert, P; Holtz, W; Moors, E; Jaturasitha, S; Wicke, M; Gauly, M

    2014-04-01

    Twenty-four male 1-year old swamp buffaloes (Bubalus bubalis) were randomly allocated to 4 groups. One group grazed on guinea grass (GG) and another on guinea grass and the legume Stylosanthes guianensis (GL). The other two groups were kept in pens and fed freshly cut guinea grass and concentrate at an amount of 1.5% (GC1.5) and 2.0% (GC2.0) of body weight, respectively. The effect of the different feeding intensities on carcass characteristics and meat quality were assessed. The mean body weight at slaughter was 398 (±16) kg. Average daily gain was higher in concentrate-supplemented groups (570 and 540 g/d in GC1.5 and GC2.0, respectively) when compared to GG (316 g/d) and GL (354 g/d) (p<0.01). Likewise, the warm carcass weight was higher in GC1.5 and GC2.0 compared to GG and GL. Dressing percentage was 48.1% and 49.5% in GC1.5 and GC2.0 in comparison to 42.9% and 44.8% observed in GG and GL, respectively. Meat of Longissimus throracis from GC1.5 and GC2.0 was redder in color (p<0.01), while water holding capacity (drip and thawing loss) was improved in pasture-fed groups (p<0.05). Protein and fat content of Longissimus thoracis was higher in animals supplemented with concentrate (p<0.01), as was cholesterol content (p<0.05), whereas PUFA:SFA ratio was higher and n-6/n-3 ratio lower (p<0.01) in pasture-fed buffaloes. Results of the present study showed that the supplementation of pasture with concentrate enhances the growth and carcass characteristics of swamp buffaloes expressed in superior dressing percentage, better muscling, and redder meat with a higher content of protein and fat, whereas animals grazing only on pasture had a more favorable fatty acid profile and water holding capacity. In conclusion, the supplementation of concentrate at a rate of about 1.5% of body weight is recommended to improve the performance and carcass quality of buffaloes.

  10. Transmission and virological studies of a malignant catarrhal fever syndrome in the Indonesian swamp buffalo (Bubalus bubalis).

    PubMed

    Hoffmann, D; Sobironingsih, S; Clarke, B C; Young, P J; Sendow, I

    1984-04-01

    A malignant catarrhal fever-like syndrome in indonesian swamp buffalo was experimentally transmitted to one of 2 Bos indicus and 3 of 3 Bos javanicus cattle by intravenous inoculation of 250 ml of citrated, whole blood from affected buffaloes. The 4 cattle developed clinical signs of disease on average 32.5 days after receiving the inoculation of blood. The 4 cattle died after a variable period of illness. None of a further 3 B. javanicus cattle inoculated intravenously with a spleen homogenate prepared from another affected buffalo developed the disease. The experimental disease was clinically and pathologically similar to the natural disease in buffaloes although differences were noted. Attempts to adapt the agent to mice, guinea pigs and rabbits failed. A cytopathic agent (Japanese encephalitis virus) was isolated from the spleen of one buffalo with clinical signs but was not considered significant. Sixty-three B. indicus, 7 B. javanicus (and 6 of their crosses), 3 B. taurus and 4 Bubalus bubalis (Murrah buffalo) were kept in the same quarters where 50 of 177 swamp buffaloes died between September 1979 and May 1982. Four of the 7 B. javanicus cattle developed the clinical signs of disease and died. All the other cattle in contact remained healthy. PMID:6743150

  11. Genetic diversity of Asian water buffalo (Bubalus bubalis): mitochondrial DNA D-loop and cytochrome b sequence variation.

    PubMed

    Lau, C H; Drinkwater, R D; Yusoff, K; Tan, S G; Hetzel, D J; Barker, J S

    1998-08-01

    Swamp and river buffalo mitochondrial DNA (mtDNA) was sequenced for 303 bp of the cytochrome b gene for 54 animals from 14 populations, and for 158 bp of the D-loop region for 80 animals from 11 populations. Only one cytochrome b haplotype was found in river buffalo. Of the four haplotypes identified in swamp buffalo, one found in all populations is apparently ancestral both to the other swamp haplotypes and to the river haplotype. The phylogenetic relationships among the 33 D-loop haplotypes, with a cluster of 11 found in swamp buffalo only, also support the evolution of domesticated swamp and river buffalo from an ancestral swamp-like animal, most likely represented today by the wild Asian buffalo (Bubalus arnee). The time of divergence of the swamp and river types, estimated from the D-loop data, is 28,000 to 87,000 years ago. We hypothesise that the species originated in mainland south-east Asia, and that it spread north to China and west to the Indian subcontinent, where the rive type evolved and was domesticated. Following domestication in China, the domesticated swamp buffalo spread through two separate routes, through Taiwan and the Philippines to the eastern islands of Borneo and Sulawesi, and south through mainland south-east Asia and then to the western islands of Indonesia.

  12. Hormonal dynamics and follicular turnover in prepuberal Mediterranean Italian buffaloes (Bubalus bubalis).

    PubMed

    Presicce, Giorgio Antonio; Parmeggiani, Albamaria; Senatore, Elena Maria; Stecco, Romana; Barile, Vittoria Lucia; De Mauro, Guillermo Javier; De Santis, Giuseppe; Maria Terzano, Giuseppina

    2003-08-01

    The aim of this study was the investigation of hormonal and ovarian follicular dynamics in prepuberal buffaloes (Bubalus bubalis) bred in Italy. Eleven 5-9-month old buffalo calves ranging in weight from 122 to 270kg, maintained under controlled nutritional and environmental conditions, underwent 50 days of ultrasonographic ovarian follicular monitoring in the months of October-December. Blood sampling for E(2) and FSH determination and ultrasonographic monitoring using a 7.5MHz linear probe and an ALOKA SSD-500 monitor were performed daily. No differences in any of the parameters under study were highlighted when calves were divided into two weight categories (<200 and >200kg) and thus data were pooled. In this study, values are reported as mean+/-S.D. A range of two-six regular follicular waves was reported among calves with an average of 4+/-1.1. Overall interval (days) between wave emergence was 9.9+/-2.8 and largest diameters (mm) of dominant and first subordinate follicles were 8.4+/-1.2 and 4.8+/-0.6, respectively (P<0.05). With the exception of one calf, some minor follicular waves (short waves or SWs; 1.6+/-1), lasting <10 days (6.1+/-1.2) were reported. They were monitored contemporaneously on the ovary contralateral (n=7) or ipsilateral (n=3) to the main follicular wave. Growth rate (mm per day) of dominant follicles (DF) was significantly faster than for corresponding subordinate follicles (SF) and follicles of SWs (1.08+/-0.2 versus 0.79+/-0.1 and 0.83+/-0.1, respectively, P<0.05). The static phase (days) lasted longer in DF compared to SF and SW (5.4+/-1.8 versus 2.4+/-1.2 and 2.6+/-1, respectively, P<0.05). The regressing phase (mm per day) was similar among DF, SF and SW (0.86+/-0.2, 0.94+/-0.2 and 0.84+/-0.1, respectively, P=0.09). Episodic spikes of E(2) and FSH were reported, corresponding to wave development throughout the course of investigation. In conclusion, the majority of buffalo calves displayed a typical pattern of regular follicular

  13. Hormonal dynamics and follicular turnover in prepuberal Mediterranean Italian buffaloes (Bubalus bubalis).

    PubMed

    Presicce, Giorgio Antonio; Parmeggiani, Albamaria; Senatore, Elena Maria; Stecco, Romana; Barile, Vittoria Lucia; De Mauro, Guillermo Javier; De Santis, Giuseppe; Maria Terzano, Giuseppina

    2003-08-01

    The aim of this study was the investigation of hormonal and ovarian follicular dynamics in prepuberal buffaloes (Bubalus bubalis) bred in Italy. Eleven 5-9-month old buffalo calves ranging in weight from 122 to 270kg, maintained under controlled nutritional and environmental conditions, underwent 50 days of ultrasonographic ovarian follicular monitoring in the months of October-December. Blood sampling for E(2) and FSH determination and ultrasonographic monitoring using a 7.5MHz linear probe and an ALOKA SSD-500 monitor were performed daily. No differences in any of the parameters under study were highlighted when calves were divided into two weight categories (<200 and >200kg) and thus data were pooled. In this study, values are reported as mean+/-S.D. A range of two-six regular follicular waves was reported among calves with an average of 4+/-1.1. Overall interval (days) between wave emergence was 9.9+/-2.8 and largest diameters (mm) of dominant and first subordinate follicles were 8.4+/-1.2 and 4.8+/-0.6, respectively (P<0.05). With the exception of one calf, some minor follicular waves (short waves or SWs; 1.6+/-1), lasting <10 days (6.1+/-1.2) were reported. They were monitored contemporaneously on the ovary contralateral (n=7) or ipsilateral (n=3) to the main follicular wave. Growth rate (mm per day) of dominant follicles (DF) was significantly faster than for corresponding subordinate follicles (SF) and follicles of SWs (1.08+/-0.2 versus 0.79+/-0.1 and 0.83+/-0.1, respectively, P<0.05). The static phase (days) lasted longer in DF compared to SF and SW (5.4+/-1.8 versus 2.4+/-1.2 and 2.6+/-1, respectively, P<0.05). The regressing phase (mm per day) was similar among DF, SF and SW (0.86+/-0.2, 0.94+/-0.2 and 0.84+/-0.1, respectively, P=0.09). Episodic spikes of E(2) and FSH were reported, corresponding to wave development throughout the course of investigation. In conclusion, the majority of buffalo calves displayed a typical pattern of regular follicular

  14. Evaluation of brucellosis RB51 vaccine for domestic water buffalo (Bubalus bubalis) in Trinidad.

    PubMed

    Fosgate, G T; Adesiyun, A A; Hird, D W; Johnson, W O; Hietala, S K; Schurig, G G; Ryan, J; Diptee, M D

    2003-05-15

    Thirty-two young domestic water buffalo (Bubalus bubalis) were obtained from a brucellosis-free farm to determine effectiveness of RB51 vaccination for prevention of Brucella infection under natural-exposure conditions in Trinidad. Study animals (20 males and 12 females 5-20 months old) were assigned to vaccination or control groups, using a block randomization design ensuring equal sex distributions between groups. The vaccination group received commercially available RB51 at the recommended calfhood dose of (1.0-3.4)x10(10) colony-forming units (CFU) and controls received 2ml sterile saline. Vaccination did not result in positive serologic results as measured by four traditional agglutination tests: standard tube agglutination test (STAT), standard plate agglutination test (SPAT), buffered plate agglutination test (BPAT), and card agglutination. Study animals were maintained in a brucellosis-positive herd in southern Trinidad with an estimated 56% prevalence to allow for natural exposure to B. abortus, which was evaluated using STAT, SPAT, BPAT, and card tests. Animals were sampled seven times over 2 years and were classified as positive if they had persistent agglutination titers or had Brucella isolated from specimens collected at completion of the study. Five of the original 32 study animals were lost to follow-up during the field trial. Six of the 14 (43%) vaccinated animals completing the study were classified as positive for Brucella infection-as were two of the 13 (15%) control animals (P=0.21). Isolates from four vaccinates and one control were confirmed as B. abortus biovar 1.

  15. Isolation of two cDNAs encoding MHC-DQA1 and -DQA2 from the water buffalo, Bubalus bubalis.

    PubMed

    Niranjan, Saket K; Deb, Sitangsu M; Sharma, Arjava; Mitra, Abhijit; Kumar, Subodh

    2009-08-15

    In the present study, we explored structural and functional variations and possible duplication of the major histocompatibility complex (MHC)-DQA gene in water buffalo (Bubalus bubalis). Two cDNA sequences, amplified from one individual water buffalo, were designated as Bubu-DQA1 (DQA*0101) and -DQA2 (DQA*2001). The percentage of nucleotide and amino acid similarity between Bubu-DQA1 and -DQA2 revealed that these sequences display more similarity to alleles of respective DQA1 and DQA2 genes from other ruminant species than to each other. The phylogenetic analysis also revealed a considerably larger genetic distance between these two genes than between homologous genes from other species. The larger genetic distance between DQA*0101 and DQA*2001, and the presence of different bovine DQA putative locus specific amino acid motifs, suggests these sequences are non-allelic. This finding is consistent with DQA gene duplication in other ruminants.

  16. The use of crossreactive monoclonal antibodies to characterize the immune system of the water buffalo (Bubalus bubalis).

    PubMed

    Davis, W C; Khalid, A M; Hamilton, M J; Ahn, J S; Park, Y H; Cantor, G H

    2001-08-01

    One of the major difficulties in studying the mechanisms of host defense in economically important species indigenous to Asia and the Middle East is the lack of monoclonal antibody (mAb) reagents that define the immune systems of species other than cattle, goats, sheep, and pigs. One strategy that could obviate this problem at minimal cost is to identify existing mAbs that recognize conserved epitopes on orthologous major histocompatibility complex (MHC) and leukocyte differentiation molecules. To explore the potential of this approach, we screened a large set of mAbs that recognize bovine MHC class I and II molecules and leukocyte differentiation molecules to identify mAbs that react with orthologous molecules in water buffalo. One hundred thirty eight were found that recognize conserved determinants on orthologous molecules. In addition to identifying a useful set of reagents, the study has provided insight into the composition of the immune system of the water buffalo (Bubalus bubalis).

  17. Serum acute phase proteins in control and Theileria annulata infected water buffaloes (Bubalus bubalis).

    PubMed

    El-Deeb, Wael M; Iacob, Olimpia C

    2012-11-23

    This study was carried out to ascertain the changes in acute phase proteins (APPs) and pro-inflammatory cytokines in Theileria annulata infected water buffalo. Thirty infected water buffaloes and 20 parasitologically free were used. In the present study there was significant (P ≤ 0.05) increase in haptoglobin (Hp), serum amyloid A (SAA), ceruloplasmin, α1-acid glycoprotein (AGP) and fibrinogen levels (2.18 ± 0.29 g/l, 156.58 ± 3.48 mg/l, 31.23 ± 1.25mg/dl, 370.23 ± 33.21 mg/l and 16.17 ± 1.18 g/l, respectively) in T. annulata infected water buffaloes when compared to healthy ones (0.13 ± 0.01 g/l, 23.9 ± 0.56 mg/l, 21.23 ± 1.21 mg/dl, 240.53 ± 22.45 mg/l and 4.2 ± 0.1 6g/l, respectively). Moreover, there was significant (P ≤ 0.05) increase in the levels of TNF-α, IL-1α, IL-6, IL-12, IL-1β and IFN-γ (2.55 ± 0.12 ng/ml, 98.32 ± 4.21 pg/ml, 152.32 ± 5.62 pg/ml, 26.44 ± 1.43 ng/ml, 240.33 ± 20.45 pg/ml and 123.65 ± 5.67 pg/ml, respectively) in T. annulata infected water buffaloes when compared to healthy ones (0.42 ± 0.04 ng/ml, 55.32 ± 3.21 pg/ml, 88.23 ± 3.21 pg/ml, 7.45 ± 0.67 ng/ml, 98.33 ± 3.45 pg/ml and 34.76 ± 1.56 pg/ml, respectively). There was also significant decrease (P ≤ 0.05) in the Hb content, PCV%, RBCs and WBCs counts in the diseased water buffaloes compared to the control ones. Neutropenia, eosinopenia, lymphopenia, monocytopenia and thrombocytopenia were also recorded. The biochemical changes revealed significant (P ≤ 0.05) elevation in the levels of AST, ALT, ALP, LDL-c, VLDL-c, BHBA and NEFA, with significant (P ≤ 0.05) decrease in the levels of total proteins, albumin, globulins, cholesterol, triglyceride, glucose, G6PD, calcium and phosphorus in T. annulata infected water buffaloes when compared to healthy ones. It could be concluded that APPs and pro-inflammatory cytokines could be used as a valuable biomarkers in T. annulata infected water buffaloes (Bubalus bubalis).

  18. Polymorphisms in MHC-DRA and -DRB alleles of water buffalo (Bubalus bubalis) reveal different features from cattle DR alleles.

    PubMed

    Sena, L; Schneider, M P C; Brenig, B; Honeycutt, R L; Womack, J E; Skow, L C

    2003-02-01

    Seventy-five individuals of Bubalus bubalis belonging to four different breeds, three of river buffalo and one of swamp buffalo, were studied for polymorphism in MHC DRB (Bubu-DRB) and DRA (Bubu-DRA) loci. Eight alleles of Bubu-DRB were found, and all alleles in the swamp type were shared with the three river breeds. All alleles sampled from the breed of European origin (Mediterranean) were present in breeds sampled in Brazil, thus variability of this locus may have been preserved to a great extent in the more recently founded Brazilian population. Bubu-DRB alleles contained higher proportions of synonymous vs. non-synonymous substitutions in the non-peptide-binding sites (PBS) region, in contrast to the pattern of variation found in BoLA-DRB3, the orthologous locus in cattle. This indicated that either the first domain exon (exon 2) of Bubu-DRB has not undergone as much recombination and/or gene conversion as in cattle alleles, or Bubu-DRB may be more ancient than BoLA-DRB3 alleles. Phylogenetic analysis of DRB alleles from Bubalus, Syncerus c. caffer, the Cape buffalo, and domestic cattle demonstrated transspecies polymorphism. Water buffalo contained two alleles of DRA that differed from each other in two amino acid positions, including one in the PBS (alpha22) that was also shared with Anoa depressicornis, the anoa. Discovery of variation in DRA was surprising as the first domain of DRA is a highly conserved polypeptide in mammals in general and especially in ruminants, where no other substitution in PBS was seen.

  19. Prevalence and distribution of Neospora caninum in water buffalo (Bubalus bubalis) and cattle in the Northern Territory of Australia.

    PubMed

    Neverauskas, Claudia E; Nasir, Amar; Reichel, Michael P

    2015-10-01

    The seroprevalence of Neospora caninum infection in water buffalo (Bubalus bubalis) and domestic cattle in the Northern Territory (NT) of Australia has never been determined. A total of 480 serum samples from water buffalo and 192 serum samples from cattle, collected by the NT Government from 1993 through to 2001, at 18 different survey sites throughout the Northern Territory were tested by commercial ELISA for anti-N. caninum antibodies. The water buffalo samples demonstrated a seroprevalence of 88.3% (95% CI ± 2.9%), while 31.8% (±6.1%) of the cattle sera tested positive for N. caninum antibodies. Individual buffalo from the same herd, sampled over years, showed considerable fluctuations in S/P ratios. Overall, seropositivity was consistent across buffalo herds, and showed a slight decline over the years. The study presents evidence for the first time that N. caninum infection in water buffalo in the Northern Territory is a highly endemic and that infection rates are higher than those for cattle. This is important for an understanding of any potential sylvatic life cycle of N. caninum in Northern Australia. This survey also tests cattle from that territory for the first time for evidence of N. caninum infection and makes an important contribution to the understanding of disease management issues for the beef industry in the region.

  20. Shedding of Neospora caninum oocysts by dogs fed tissues from naturally infected water buffaloes (Bubalus bubalis) from Brazil.

    PubMed

    Rodrigues, A A R; Gennari, S M; Aguiar, D M; Sreekumar, C; Hill, D E; Miska, K B; Vianna, M C B; Dubey, J P

    2004-10-01

    Attempts were made to isolate Neospora caninum from naturally infected water buffaloes (Bubalus bubalis) from Brazil. Brains from six buffaloes with indirect fluorescent antibodies (>1:100) to N. caninum were used to isolate the parasite by bioassay in dogs and gerbils followed by in vitro culture. Shedding of Neospora-like oocysts was noticed in dogs fed brains from three buffaloes (isolate designation NcBrBuf-1, 2 and 4). Two more isolates (NcBrBuf-3 and 5) were obtained by in vitro culture of the brains of gerbils previously infected with brains of two other buffaloes. The identity of the isolates was confirmed by biological and molecular methods. The isolates were found to be non-pathogenic to gerbils. All five isolates amplified the gene 5 amplicons using Neospora-specific PCR assay. The sequences of gene 5 fragments and the common toxoplasmatiid ITS-1 fragments were analyzed. The dynamics of oocyst production in the dogs indicate that water buffaloes are natural intermediate hosts for N. caninum. This is the first report of isolation of N. caninum from water buffaloes.

  1. Verocytotoxin-producing Escherichia coli O26 in raw water buffalo (Bubalus bubalis) milk products in Italy.

    PubMed

    Lorusso, Vanessa; Dambrosio, Angela; Quaglia, Nicoletta Cristiana; Parisi, Antonio; La Salandra, Giovanna; Lucifora, Giuseppe; Mula, Giuseppina; Virgilio, Sebastiano; Carosielli, Leonardo; Rella, Addolorata; Dario, Marco; Normanno, Giovanni

    2009-08-01

    Escherichia coli 026 is known as a verocytotoxin-producing E. coli (VTEC) organism that causes severe foodborne diseases such as hemorrhagic colitis and hemolytic uremic syndrome. Although cattle are the most important reservoir of VTEC, only a few reports on the role of water buffalo (Bubalus bubalis) as a reservoir of VTEC and on the presence of these organisms in their milk are available. However, in Southern Italy, where water buffalo are intensively reared, an outbreak of hemolytic uremic syndrome due to E. coli 026 has recently been reported, in which the consumption of typical dairy products was considered to be a common risk factor. The aims of this work were to assess the prevalence of E. coli O26 in raw water buffalo milk, to characterize the virulence gene profiles of the isolates, and to evaluate their phenotypic antimicrobial resistance pattern. Of 160 analyzed samples, 1 (0.6%) tested positive for E. coli O26, and the isolate showed the stx1+/stx2+/eae-/hlyA+ genotypic profile. The strain showed resistance against glycopeptides, macrolides, and penicillins. The presence of VTEC organisms in raw water buffalo milk could be considered to be a potential threat to consumers; however, the strict adherence to the processes used in the preparation of the most common buffalo dairy products could strongly mitigate the foodborne risk. To our knowledge, this article reports the first isolation and characterization of E. coli O26 VTEC in raw water buffalo milk.

  2. Sequence analysis of UTR and coding region of kappa-casein gene of Indian riverine buffalo (Bubalus bubalis).

    PubMed

    Mukesh, Manishi; Mishra, Bishnu P; Kataria, Ranjit S; Sobti, Ranbir C; Ahlawat, Shiv Pal S

    2006-04-01

    In this study, complete nucleotide as well as derived amino acid sequence characterization of water buffalo (Bubalus bubalis) kappa-casein gene has been presented. Kappa-casein cDNA clones were identified and isolated from a buffalo lactating mammary gland cDNA library. Sequence analysis of kappa-casein cDNA revealed 850 nucleotides with an open reading frame (ORF) of 573 nucleotides, encoding mature peptide of 169 amino acids. The 5' untranslated region (UTR) comprised 71 nucleotides, while 3' UTR was of 206 nucleotides. A total of 11 nucleotide and seven amino acid changes were observed in, buffalo (Bubalus bubalis) as compared to cattle (Bos taurus), sheep (Ovis aries) and goat (Capra hircus). Among these nucleotide changes, eight were unique in buffalo as they were fully conserved in cattle, sheep and goat. Majority of the nucleotide changes and all the amino acid changes; 14 (Asp-Glu), 19(Asp/Ser-Asn), 96(Ala-Thr), 126(Ala-Val), 128(Ala/Gly-Val), 156(Ala/Pro-Val) and 168(Ala/Glu-Val) were limited to exon IV. Three glycosylation sites, Thr 131, Thr 133 and Thr 142 reported in cattle and goat kappa-casein gene were also conserved in buffalo, however, in sheep Thr 142 was replaced by Ala. Chymosin hydrolysis site, between amino acids Phe 105 and Met 106, important for rennet coagulation process, were found to be conserved across four bovid species. Buffalo kappa-casein with the presence of amino acids Thr 136 and Ala 148 seems to be an intermediate of "A" and "B" variants of cattle. Comparison with other livestock species revealed buffalo kappa-casein sharing maximum nucleotide (95.5%) and amino acid (92.6%) similarity with cattle, whereas with pig it showed least sequence similarity of 76.0% and 53.2%, respectively. Phylogenetic analysis based on both nucleotide and amino acid sequence indicated buffalo kappa-casein grouping with cattle, while sheep and goat forming a separate cluster close to them. The non-ruminant species viz. camel, horse and pig were

  3. Biological and genetic analysis of a bovine-like coronavirus isolated from water buffalo (Bubalus bubalis) calves.

    PubMed

    Decaro, Nicola; Martella, Vito; Elia, Gabriella; Campolo, Marco; Mari, Viviana; Desario, Costantina; Lucente, Maria Stella; Lorusso, Alessio; Greco, Grazia; Corrente, Marialaura; Tempesta, Maria; Buonavoglia, Canio

    2008-01-01

    We describe the isolation, biological and genetic characterization of a host-range variant of bovine coronavirus (BCoV) detected in water buffalo (Bubalus bubalis). By conventional and real-time RT-PCR assays, the virus was demonstrated in the intestinal contents of two 20-day-old buffalo calves dead of a severe form of enteritis and in the feces of additional 17 buffalo calves with diarrhea. Virus isolation, hemagglutination and receptor-destroying enzyme activity showed that the buffalo coronavirus (BuCoV) is closely related to BCoV but possesses some different biological properties. Sequence and phylogenetic analyses of the 3' end (9.6 kb) of the BuCoV RNA revealed a genomic organization typical of group 2 coronaviruses. Moreover, the genetic distance between BuCoV and BCoV was proven to be the same or even higher than the distance between other ruminant coronaviruses and BCoV. In conclusion, our data support the existence of a host-range variant of BCoV associated with enteritis in buffaloes.

  4. Immunohistochemical demonstration of Trypanosoma evansi in tissues of experimentally infected rats and a naturally infected water buffalo (Bubalus bubalis).

    PubMed

    Sudarto, M W; Tabel, H; Haines, D M

    1990-04-01

    Trypanosoma evansi was demonstrated by an immunohistochemical technique in formalin-fixed paraffin-embedded tissues of experimentally infected rats. Trypanosoma evansi was visible readily, nuclei were stained darkly, the cytoplasm was stained moderately, and the cell membranes were delineated clearly. The parasites were present in small- to large-sized blood vessels of all organs, in extravascular spaces of ventricles and neuropil of the brain, and in interstitial tissues of the lung and testes. This method also stained nuclei but not cytoplasm or cell membranes of Trypanosoma congolense, and did not stain Trypanosoma theileri. In a water buffalo (Bubalus bubalis) with nonsuppurative meningoencephalitis, the presence of T. evansi could not be demonstrated by conventional histological stains. However, the trypanosomes were recognized readily in the Virchow-Robin spaces and neuropil of the brain by the immunohistochemical method.

  5. Effect of pen size on behavioral, endocrine, and immune responses of water buffalo (Bubalus bubalis) calves.

    PubMed

    Grasso, F; Napolitano, F; De Rosa, G; Quarantelli, T; Serpe, L; Bordi, A

    1999-08-01

    Female water buffalo (Bubalus bubalis) calves (n = 28) aged 7 to 10 d were divided into four groups of seven animals each to examine the effects of space allowance (Group A: 2.6 indoor m2 + 2.0 outdoor m2/calf; Group B: 2.6 indoor m2/calf; Group C: 1.5 indoor m2/calf; Group D: 1.0 indoor m2/calf) on behavioral, endocrine, and immune variables for a period of 60 d. Animals were offered 7 L/d of a commercial acidified milk substitute. The calves averaged 45.9 kg initially and 92.4 kg finally. The behavior observations were conducted 7 d after grouping and fortnightly thereafter. At wk 4 and 8, the phytohemagglutinin (PHA) skin test was performed to induce aspecific delayed hypersensitivity. At wk. 1 and 3, calves were injected i.m. with keyhole limpet hemocyanin. Antibody titers were determined at weekly intervals for 7 wk. Calves in pens with greater space allowance (Groups A and B) were less active than Groups C and D (P<.001). The latter groups were also observed feeding more often at wk 7 (P<.01). Calves provided with an outdoor paddock spent less time standing than Groups C and D (P<.01), and lay with a greater number of outstretched legs (P<.001). Groups C and D showed a lower reaction to PHA in both skin tests than did Groups A and B (P<.001 and P<.05, respectively). Group A showed an antibody response consistently higher than groups B, C, and D (P<.01, P<.05, and P<.05, respectively). At the end of the experimental period, the calves were subjected to an isolation test lasting 10 min. Group D showed a longer duration of movement with respect to Groups A and B (P<.01); animals from Group C walked more than did Group A (P<.05). Cortisol concentration evaluated 0, 10, 45, 90, 150, and 225 min after separation from the group was higher in Groups C and D than in Groups A and B (P<.01). For all animals, the highest cortisol level was observed immediately after the isolation test (P<.001). Space restriction resulted in evidence of stress in the animals as shown by

  6. Identification and genetic characterization of rabies virus from Egyptian water buffaloes (Bubalus bubalis) bitten by a fox.

    PubMed

    El-Tholoth, Mohamed; El-Beskawy, Mohamed; Hamed, Mohamed F

    2015-09-01

    Rabies is caused by negative strand RNA-virus classified in the genus Lyssavirus, family Rhabdoviridae of the order Mononegavirales. The aim of the present study was to identify and analyze nucleotides sequence of nucleoprotein (N) gene of rabies virus (RABV) from two cases of water buffaloes (Bubalus bubalis) bitten by a fox in Egypt, 2013. The diseased buffaloes showed nervous manifestations with fever. Specimens from brains of the buffaloes with suspected rabies were collected. RABV in collected samples was identified using direct fluorescent antibody (dFA) technique, histopathological examination and reverse transcription-polymerase chain reaction (RT-PCR). Also, nucleotides sequence of partially amplified nucleoprotein (N) gene was compared with the other street strains of RABV available on GenBank. The results revealed that RABV antigen was identified in the brains of diseased buffaloes by dFA technique and the characteristic intracytoplasmic inclusions (Negri bodies) and RABV nucleic acid were detected by histopathology and RT-PCR, respectively. The identified virus showed close genetic relationship with street strains identified previously from dogs in different Governorates in Egypt and with strains identified in Israel and Jordan indicating transmission of the virus between Egyptian Governorates with a potential transmission from and/or to our neighboring countries. PMID:26396980

  7. Loop-mediated isothermal amplification (LAMP) detection of Babesia orientalis in water buffalo (Bubalus babalis, Linnaeus, 1758) in China.

    PubMed

    He, Lan; Zhou, Yan-Qin; Oosthuizen, Marinda C; Zhao, Jun-Long

    2009-10-28

    Loop-mediated isothermal amplification (LAMP) is a rapid method with high specificity and efficiency under isothermal condition using a set of four specifically designed primers that recognize six distinct sequences on the target gene. In this study, a LAMP method was developed for specific detection of Babesia orientalis in water buffalo (Bubalus babalis, Linnaeus, 1758). Four primers were designed from the V4 hypervariable region of the 18S rRNA gene of B. orientalis. Blood samples were collected from B. orientalis experimentally infected water buffalo as well as from 165 water buffalo from eight different regions of the Hubei province, south China. Genomic DNA was extracted, subjected to the LAMP assay and compared with results obtained using a previously described semi-nested PCR. The LAMP assay proofed to be B. orientalis specific and more sensitive than the semi-nested PCR. While previously B. orientalis had not been reported north of the Yangtse River, our results show that B. orientalis has spread to the north of the river. This could pose a serious threat to the water buffalo industry.

  8. Identification and genetic characterization of rabies virus from Egyptian water buffaloes (Bubalus bubalis) bitten by a fox.

    PubMed

    El-Tholoth, Mohamed; El-Beskawy, Mohamed; Hamed, Mohamed F

    2015-09-01

    Rabies is caused by negative strand RNA-virus classified in the genus Lyssavirus, family Rhabdoviridae of the order Mononegavirales. The aim of the present study was to identify and analyze nucleotides sequence of nucleoprotein (N) gene of rabies virus (RABV) from two cases of water buffaloes (Bubalus bubalis) bitten by a fox in Egypt, 2013. The diseased buffaloes showed nervous manifestations with fever. Specimens from brains of the buffaloes with suspected rabies were collected. RABV in collected samples was identified using direct fluorescent antibody (dFA) technique, histopathological examination and reverse transcription-polymerase chain reaction (RT-PCR). Also, nucleotides sequence of partially amplified nucleoprotein (N) gene was compared with the other street strains of RABV available on GenBank. The results revealed that RABV antigen was identified in the brains of diseased buffaloes by dFA technique and the characteristic intracytoplasmic inclusions (Negri bodies) and RABV nucleic acid were detected by histopathology and RT-PCR, respectively. The identified virus showed close genetic relationship with street strains identified previously from dogs in different Governorates in Egypt and with strains identified in Israel and Jordan indicating transmission of the virus between Egyptian Governorates with a potential transmission from and/or to our neighboring countries.

  9. Buffalo (Bubalus bubalis) interleukin-12: analysis of expression profiles and functional cross-reactivity with bovine system.

    PubMed

    Premraj, Avinash; Sreekumar, E; Jain, Mamta; Rasool, T J

    2006-03-01

    Interleukin-12, a heterodimeric pro-inflammatory cytokine, from water buffaloes (Bubalus bubalis) was analyzed for its for its tissue specific expression and functionality. Concanavalin A stimulated splenocytes displayed an up-regulation of the IL-12 p40 subunit 8-24h post-stimulation, whereas the p35 subunit did not show any quantitative variation at different time intervals. Basal level expressions of both the subunits were observed by RT-PCR in spleen. In addition p40 transcripts could be detected in liver and p35 in brain and muscle tissues as well in very low levels. Functional recombinant buffalo IL-12 was expressed in HEK 293T cells as a heterodimer using foot-and-mouth disease virus 2A polypeptide as a linker. Culture supernatants from transfected cells contained a hetero-dimeric p70 subunit as revealed in western blot of the proteins separated by native polyacrylamide gel electrophoresis (PAGE) using a monoclonal antibody against bovine IL-12 p40. IL-12 containing culture supernatant induced production of nitric oxide in cultured splenocytes of both buffalo and bovine origin. Our study reveals that buffalo IL-12, which shares a high-level sequence identity with bovine IL-12, also has functional cross-reactivity with the bovine immune cells.

  10. Hormonal stimulation and oocyte maturational competence in prepuberal Mediterranean Italian buffaloes (Bubalus bubalis).

    PubMed

    Presicce, Giorgio Antonio; Senatore, Elena Maria; De Santis, Giuseppe; Stecco, Romana; Terzano, Giuseppina Maria; Borghese, Antonio; De Mauro, Guillermo Javier

    2002-04-15

    The objective of this study was to determine the best combined hormonal treatment to utilize in order to obtain a high number of good quality in vivo and in vitro matured oocytes from prepuberal Mediterranean Italian buffalo calves (Bubalus bubalis). Transvaginal ultrasound follicular aspiration was employed to recover oocytes from antral follicles. Fifteen barn housed buffalo calves, between 5 and 9 months of age were used in this study and randomly divided into control (Group A) and treated groups. A commercially available preparation of 2000 IU eCG was administered to animals in the treatment groups, followed by 2000 IU of hCG given either 12 h (Group B), or 24 h (Group C) before ovum pick up (OPU). From the time of administration of eCG treatments, the best timing for hCG administration before OPU was determined and integrated with the administration of 500 IU of FSH-LH in a decreasing dosage protocol over 4 days (Group D). Expanded cumulus oocyte complexes (COCs) recovered from all groups were immediately fixed for later aceto-orcein staining. All other COCs were processed for in vitro maturation using standard procedures and then fixed and stained for assessment of nuclear maturation. Collectively, hormonal stimulation did not increase the number of ovarian antral follicles available compared to the control group (P > 0.05), but did result in higher output of medium (Group B: 9.8 +/- 7.1; Group C: 3.4 +/- 6.7; Group D: 15.6 +/- 4.9 versus Group A: 1.6 +/- 2.2) and large follicles (Group B: 44.8 +/- 22.9; Group C: 8.7 +/- 6.1; Group D: 70.2 +/- 10 versus Group A: 6.1 +/- 6.3). Administration of hCG 12 h before follicle aspiration proved to be the best strategy to obtain high numbers of immature and mature oocytes from antral follicles (P < 0.05; Group B: 70.8 +/- 12 and Group D: 82 +/- 12.6 versus Group A: 43.6 +/- 13.9 and Group C: 27.2 +/- 13.9). A significantly higher number of expanded COCs was obtained from hormonally stimulated groups compared to the

  11. Methyl coenzyme M reductase (mcrA) gene based phylogenetic analysis of methanogens population in Murrah buffaloes (Bubalus bubalis).

    PubMed

    Chaudhary, Prem Prashant; Sirohi, Sunil Kumar; Singh, Dheer; Saxena, Jyoti

    2011-08-01

    The aim of the present study was to decipher the diversity of methanogens in rumen of Murrah buffaloes so that effective strategies can be made in order to mitigate methane emission from these methanogens. In the present study diversity of rumen methanogens in Murrah buffaloes (Bubalus bubalis) from North India was evaluated by using mcr-A gene library obtained from the pooled PCR product from four animals and by using MEGA4 software. A total of 104 clones were examined, revealing 26 different mcr-A gene sequences or phylotypes. Of the 26 phylotypes, 16 (64 of 104 clones) were less than 97% similar to any of the cultured strain of methanogens. Seven clone sequences were clustered with Methanomicrobium mobile and three clone sequences were clustered with Methanobrevibacter gottschalkii during the phylogenetic analysis. Uncultured group of methanogens comes out to be the major component of the methanogens community structure in Murrah buffaloes. Methanomicrobium phylotype comes out to be major phylotype among cultured methanogens followed by Methanobrevibacter phylotype. These results help in making effective strategies to check the growth of dominant communities in the rumen of this animal which in turn help in the reduction of methane emission in the environment and ultimately helps us in fighting with the problem of global warming.

  12. Genetic variation of foot-and-mouth disease virus isolates recovered from persistently infected water buffalo (Bubalus bubalis).

    PubMed

    Barros, José Júnior F; Malirat, Viviana; Rebello, Moacyr A; Costa, Eliane V; Bergmann, Ingrid E

    2007-02-25

    Genetic variation of foot-and-mouth disease virus (FMDV) isolates, serotype O, recovered serially over a 1-year period from persistently infected buffalos was assessed. The persistent state was established experimentally with plaque-purified FMDV, strain O(1)Campos, in five buffalos (Bubalus bubalis). Viral isolates collected from esophageal-pharyngeal (EP) fluids for up to 71 weeks after infection were analyzed at different times by nucleotide sequencing and T(1) RNase oligonucleotide fingerprinting to assess variability in the VP1-coding region and in the complete genome, respectively. Genetic variation increased, although irregularly, with time after infection. The highest values observed for the VP1-coding region and for the whole genome were 2.5% and 1.8%, respectively. High rates of fixation of mutations were observed using both methodologies, reaching values of 0.65 substitutions per nucleotide per year (s/nt/y) and 0.44s/nt/y for nucleotide sequencing and oligonucleotide fingerprinting, respectively, when selected samples recovered at close time periods were analyzed. The data herein indicate that complex mixtures of genotypes may arise during FMDV type O persistent infection in water buffalos, which can act as viral reservoirs and also represent a potential source of viral variants. These results fit within the quasi-species dynamics described for FMDV, in which viral populations are constituted by related, non-identical genomes that evolve independently from each other, and may predominate at a given time.

  13. Characterization of immune cell infiltration in the placentome of water buffaloes (Bubalus bubalis) infected with neospora caninum during pregnancy.

    PubMed

    Cantón, G J; Konrad, J L; Moore, D P; Caspe, S G; Palarea-Albaladejo, J; Campero, C M; Chianini, F

    2014-05-01

    Neospora caninum infection in cattle stimulates host immune responses, which may be responsible for placental damage leading to abortion. Susceptibility of water buffaloes (Bubalus bubalis) to neosporosis is not well understood, although vertical transmission and fetal death have been documented. The aim of this study was to characterize the immune response in the placentome of water buffalo following experimental infection in early gestation with the Nc-1 strain of N. caninum. Placentomes were examined by immunohistochemistry using antibodies specific for T-cell subsets, natural killer cells and CD79(αcy) cells. Placental inflammation was characterized by the infiltration of CD3(+) and CD4(+) T cells and T cells expressing the γδ T-cell receptor. The distribution of these cellular subsets in buffalo placentomes was similar to that previously described in cattle infected with N. caninum in early gestation, but the lesions were milder, which may explain the lower number of abortions observed in this species after infection.

  14. Evaluation of a fluorescence polarization assay for the detection of serum antibodies to Brucella abortus in water buffalo (Bubalus bubalis).

    PubMed

    Montagnaro, S; Longo, M; Mallardo, K; Pisanelli, G; De Martino, L; Fusco, G; Baldi, L; Pagnini, U; Iovane, G

    2008-09-15

    The fluorescence polarization assay (FPA) was evaluated for the serological diagnosis of brucellosis in water buffalo (Bubalus bubalis) in southern Italy. This assay uses O-polysaccharide prepared from Brucella abortus lipopolysaccharide conjugated with fluorescein isothiocyanate as a tracer. It has many methodological advantages over older, more established tests and can be performed in a fraction of the time. Sera from 890 buffalos from the Campania Region - 526 positive sera and 364 negative sera according to the complement fixation test (CFT) - were evaluated in this study. All samples were tested with the Rose Bengal test (RBT), CFT, and FPA in parallel and in blind fashion. Sensitivities (Sn) were 84.5% and 92.6%, and specificities (Sp) were 93.1% and 91.2% for RBT and FPA, respectively, relative to CFT. Finally, receiver operating characteristic (ROC) analysis suggested a cut-off value of 117 millipolarization (mP) units. On the whole, these results suggested that FPA might replace RBT in the diagnosis of buffalo brucellosis for its better performance relative to CFT, its adjustable cut-off useful in different epidemiological situations, its reliability, ease of performance, and for its potential application in field and high-throughput laboratories.

  15. Isolation of new pregnancy-associated glycoproteins from water buffalo (Bubalus bubalis) placenta by Vicia villosa affinity chromatography.

    PubMed

    Barbato, O; Sousa, N M; Klisch, K; Clerget, E; Debenedetti, A; Barile, V L; Malfatti, A; Beckers, J F

    2008-12-01

    The present study describes the isolation and characterization of new pregnancy-associated glycoprotein molecules (PAG) from midpregnancy and late-pregnancy placentas in the water buffalo (Bubalus bubalis). After extraction, the homogenates are subjected to acid and ammonium sulfate precipitations followed by DEAE chromatography. Subsequently, the water buffalo PAG (wbPAG) from these solutions are enriched by Vicia villosa agarose (VVA) affinity chromatography. As determined by western blotting with anti-PAG sera, the apparent molecular masses of the immunoreactive bands from the VVA peaks range from 59.5 to 75.8kDa and from 57.8 to 73.3kDa in the midpregnancy and late-pregnancy placentas, respectively. Amino-terminal microsequencing of the immunoreactive proteins has allowed the identification of three distinct wbPAG sequences, which have been deposited in the SwissProt database: RGSXLTIHPLRNIRDFFYVG (acc. no. P85048), RGSXLTILPLRNIID (acc. no. P85049), and RGSXLTHLPLRNI (acc. no. P85050). Their comparison to previously identified proteins has shown that two of them are new because they have not been described before. Our results confirm the suitability of VVA chromatography for the enrichment of the multiple PAG molecules expressed in buffalo placenta.

  16. Hot topic: Gene duplication at the α-lactalbumin locus: finding the evidence in water buffalo (Bubalus bubalus L.).

    PubMed

    Rullo, R; Di Luccia, A; Chianese, L; Pieragostini, E

    2010-05-01

    Studies on milk proteins revealed that a qualitative and quantitative polymorphism may often be found regarding alpha-lactalbumin (alpha-LA). In mammals, a similar phenomenon was widely documented in the alpha-globin system as the result of a gene duplication. The presence of several differently expressed alpha-lactalbumin gene (LALBA) products suggests that the mechanism underlying this phenomenon may involve nonallelic genes. To check this hypothesis, an experiment was set up to investigate the LALBA gene arrangement of a water buffalo exhibiting an alpha-LA phenotype characterized by a double-band pattern on PAGE isoelectric, focusing analysis of milk protein. In particular, the relative amount of protein inferred from the different intensity of the bands was consistent with a gene duplication. Thus, leukocyte DNA was extracted from a blood sample of the buffalo and amplified with 4 primers (2 RV-IVFW for PCR and 4 FW-IRV for nested PCR). The intergenic segments of the assumed duplicated gene were then amplified with 2 different PCR protocols. First, the segment limited by the third exon in the upstream gene and the second exon in the downstream gene was amplified by simple PCR, which gave aspecific results. Second, this PCR product was subjected to nested PCR, amplifying the segment limited by the fourth exon in the upstream gene and the first exon in the downstream gene, yielding an amplified nucleotide fragment of about 6,200 bp. Blood samples from an additional 15 buffalos were then analyzed in the same manner. The results obtained from the new samples confirmed the presence of an amplified nucleotide fragment of about 6,200 bp in most of them, though they all were characterized by an alpha-LA monomorphic phenotype. A couple of 6,200-bp fragments obtained were purified, cloned in pGEM-T easy vector system (Promega, Madison, WI) and sequenced. The sequence of the large DNA segments, containing the intergenic portion, was aligned with the LALBA gene (accession

  17. Local immune responses of the Chinese water buffalo, Bubalus bubalis, against Schistosoma japonicum larvae: crucial insights for vaccine design.

    PubMed

    McWilliam, Hamish E G; Piedrafita, David; Li, Yuesheng; Zheng, Mao; He, Yongkang; Yu, Xinling; McManus, Donald P; Meeusen, Els N T

    2013-01-01

    Asian schistosomiasis is a zoonotic parasitic disease infecting up to a million people and threatening tens of millions more. Control of this disease is hindered by the animal reservoirs of the parasite, in particular the water buffalo (Bubalus bubalis), which is responsible for significant levels of human transmission. A transmission-blocking vaccine administered to buffaloes is a realistic option which would aid in the control of schistosomiasis. This will however require a better understanding of the immunobiology of schistosomiasis in naturally exposed buffaloes, particularly the immune response to migrating schistosome larvae, which are the likely targets of an anti-schistosome vaccine. To address this need we investigated the immune response at the major sites of larval migration, the skin and the lungs, in previously exposed and re-challenged water buffaloes. In the skin, a strong allergic-type inflammatory response occurred, characterised by leukocyte and eosinophil infiltration including the formation of granulocytic abscesses. Additionally at the local skin site, interleukin-5 transcript levels were elevated, while interleukin-10 levels decreased. In the skin-draining lymph node (LN) a predominant type-2 profile was seen in stimulated cells, while in contrast a type-1 profile was detected in the lung draining LN, and these responses occurred consecutively, reflecting the timing of parasite migration. The intense type-2 immune response at the site of cercarial penetration is significantly different to that seen in naive and permissive animal models such as mice, and suggests a possible mechanism for immunity. Preliminary data also suggest a reduced and delayed immune response occurred in buffaloes given high cercarial challenge doses compared with moderate infections, particularly in the skin. This study offers a deeper understanding into the immunobiology of schistosomiasis in a natural host, which may aid in the future design of more effective vaccines.

  18. Characterization of Sarcocystis fusiformis based on sequencing and PCR-RFLP in water buffalo (Bubalus bubalis) in Iran.

    PubMed

    Oryan, Ahmad; Sharifiyazdi, Hassan; Khordadmehr, Monire; Larki, Sara

    2011-12-01

    Four Sarcocystis species, i.e., Sarcocystis fusiformis and Sarcocystis buffalonis with cats as definitive hosts, Sarcocystis levinei with dogs as definitive host, and Sarcocystis dubeyi with unknown definitive host, have previously been described from water buffalo (Bubalus bubalis). The aim of the present study was genetic characterization of the causative agent(s) of water buffalo sarcocystosis in Khuzestan Province, western Iran. RFLP-PCR and partial sequence analysis of 18S rDNA gene were used for the genetic characterization of the specimens directly obtained from water buffalo. In RFLP-PCR, four restriction enzymes (Dra1, Ssp1, Fok1 and Bsl1) were used for species discrimination of Sarcocystis spp. in this host. Comparison of the molecular sequencing results and RFLP-PCR pattern of the samples obtained in the present study with those previously reported for different Sarcocystis spp. revealed that all positive Sarcocystis samples represented S. fusiformis. To our knowledge, this is the first demonstration of the existence of S. fusiformis in the Iranian water buffalo population by a genetic approach. In addition, comparison between the alignments between the Iranian 18S rDNA sequences (HQ703791), made in this study, and those previously reported for S. fusiformis in different geographical location (accession nos. AF176927, AF176926, and U03071) showed the occurrence of local genetic polymorphisms and heterogeneity in this ribosomal locus. Despite the occurrence of some genetic variations in the hypervariable regions of the 18S rDNA in S. fusiformis, Dra I restriction site was conserved among all sequences available. According to the present study, it seems that cats have a more significant epidemiological role than dogs in transmission of sarcocystosis agent to water buffalo in Iran.

  19. Generation of induced pluripotent stem cells from buffalo (Bubalus bubalis) fetal fibroblasts with buffalo defined factors.

    PubMed

    Deng, Yanfei; Liu, Qingyou; Luo, Chan; Chen, Shibei; Li, Xiangping; Wang, Caizhu; Liu, Zhenzhen; Lei, Xiaocan; Zhang, Huina; Sun, Hongliang; Lu, Fenghua; Jiang, Jianrong; Shi, Deshun

    2012-09-01

    Ectopically, expression of defined factors could reprogram mammalian somatic cells into induced pluripotent stem cells (iPSCs), which initiates a new strategy to obtain pluripotent stem cell lines. Attempts have been made to generate buffalo pluripotent stem cells by culturing primary germ cells or inner cell mass, but the efficiency is extremely low. Here, we report a successful method to reprogram buffalo fetal fibroblasts (BFFs) into pluripotent stem cells [buffalo induced pluripotent stem cell (biPSCs)] by transduction of buffalo defined factors (Oct4, Sox2, Klf4, and c-Myc) using retroviral vectors. The established biPSCs displayed typical morphological characteristics of pluripotent stem cells, normal karyotype, positive staining of alkaline phosphatase, and expressed pluripotent markers including Oct4, Sox2, Nanog, Lin28, E-Cadherin, SSEA-1, SSEA-4, TRA-1-81, STAT3, and FOXD3. They could form embryoid bodies (EBs) in vitro and teratomas after injecting into the nude BALB/C mice, and 3 germ layers were identified in the EBs and teratomas. Methylation assay revealed that the promoters of Oct4 and Nanog were hypomethylated in biPSCs compared with BFFs and pre-biPSCs, while the promoters of Sox2 and E-Cadherin were hypomethylated in both BFFs and biPSCs. Further, inhibiting p53 expression by coexpression of SV40 large T antigen and buffalo defined factors in BFFs or treating BFFs with p53 inhibitor pifithrin-a (PFT) could increase the efficiency of biPSCs generation up to 3-fold, and nuclear transfer embryos reconstructed with biPSCs could develop to blastocysts. These results indicate that BFFs can be reprogrammed into biPSCs by buffalo defined factors, and the generation efficiency of biPSCs can be increased by inhibition of p53 expression. These efforts will provide a feasible approach for investigating buffalo stem cell signal pathways, establishing buffalo stem cell lines, and producing genetic modification buffaloes in the future. PMID:22420535

  20. Buffalo (Bubalus bubalis) interleukin-2: sequence analysis reveals high nucleotide and amino acid identity with interleukin-2 of cattle and other ruminants.

    PubMed

    Sreekumar, E; Premraj, A; Saravanakumar, M; Rasool, T J

    2002-08-01

    A 4400-bp genomic sequence and a 332-bp truncated cDNA sequence of the interleukin-2 (IL-2) gene of Indian water buffalo (Bubalus bubalis) were amplified by polymerase chain reaction and cloned. The coding sequence of the buffalo IL-2 gene was assembled from the 5' end of the genomic clone and the truncated cDNA clone. This sequence had 98.5% nucleotide identity and 98% amino acid identity with cattle IL-2. Three amino acid substitutions were observed at positions 63, 124 and 135. Comparison of the predicted protein structure of buffalo IL-2 with that of human and cattle IL-2 did not reveal significant differences. The putative amino acids responsible for IL-2 receptor binding were conserved in buffalo, cattle and human IL-2. The amino acid sequence of buffalo IL-2 also showed very high identity with that of other ruminants, indicating functional cross-reactivity.

  1. Potential functional gene diversity involved in methanogenesis and methanogenic community structure in Indian buffalo (Bubalus bubalis) rumen.

    PubMed

    Singh, Krishna M; Patel, Amrutlal K; Shah, Ravi K; Reddy, Bhaskar; Joshi, Chaitanya G

    2015-08-01

    Understanding the methanogen community structure and methanogenesis from Bubalus bubalis in India may be beneficial to methane mitigation. Our current understanding of the microbial processes leading to methane production is incomplete, and further advancement in the knowledge of methanogenesis pathways would provide means to manipulate its emission in the future. In the present study, we evaluated the methanogenic community structure in the rumen as well as their potential genes involved in methanogenesis. The taxonomic and metabolic profiles of methanogens were assessed by shotgun sequencing of rumen metagenome by Ion Torrent semiconductor sequencing. The buffalo rumen contained representative genera of all the families of methanogens. Members of Methanobacteriaceae were found to be dominant, followed by Methanosarcinaceae, Methanococcaceae, Methanocorpusculaceae, and Thermococcaceae. A total of 60 methanogenic genera were detected in buffalo rumen. Methanogens related to the genera Methanobrevibacter, Methanosarcina, Methanococcus, Methanocorpusculum, Methanothermobacter, and Methanosphaera were predominant, representing >70 % of total archaeal sequences. The metagenomic dataset indicated the presence of genes involved in the methanogenesis and acetogenesis pathways, and the main functional genes were those of key enzymes in the methanogenesis. Sequences related to CoB--CoM heterodisulfide reductase, methyl coenzyme M reductase, f420-dependent methylenetetrahydromethanopterin reductase, and formylmethanofuran dehydrogenase were predominant in rumen. In addition, methenyltetrahydrofolate cyclohydrolase, methylenetetrahydrofolate dehydrogenase, 5,10-methylenetetrahydrofolate reductase, and acetyl-coenzyme A synthetase were also recovered. PMID:25663664

  2. Molecular cloning, sequencing and structural studies of granulocyte-macrophage colony-stimulating factor (GM-CSF) from Indian water buffalo (Bubalus bubalis).

    PubMed

    Sugumar, Thennarasu; Pugalenthi, Ganesan; Harishankar, Murugesan; Dhinakar Raj, G

    2014-02-01

    Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine that is essential for growth and development of progenitors of granulocytes and monocytes/macrophages. In this study, we report molecular cloning, sequencing and characterization of GM-CSF from Indian water buffalo, Bubalus bubalis. In addition, we performed sequence and structural analysis for buffalo GM-CSF. Buffalo GM-CSF has been compared with 17 mammalian GM-CSFs using multiple sequence alignment and phylogenetic tree. Three-dimensional model for buffalo GM-CSF and human receptor complex was built using homology modelling to study cross-reactivity between two species. Detailed analysis was performed to study GM-CSF interface and various interactions at the interface.

  3. Effect of exogenous growth-hormone-releasing factor on blood metabolites and minerals in late maturing buffalo heifers (Bubalus bubalis).

    PubMed

    Haldar, A; Prakash, B S

    2007-08-01

    Previous studies have suggested that growth-hormone-releasing factor (GRF) enhanced growth and advanced puberty onset along with hormonal changes in buffalo heifers (Bubalus bubalis). However, it is not known to what extent exogenous GRF could influence blood metabolites and minerals to bring about puberty in buffalo heifers. Therefore, we planned to investigate the effect of exogenous bovine GRF (bGRF) on blood metabolites and minerals in buffalo heifers during a 3-month pre-treatment period, 9-month treatment period and 1-month post-treatment period. Six buffalo heifers were treated intravenously with bGRF (10 mug per 100 kg body weight) at 15-day interval for 9 months. Another six buffalo heifers of weight- and age-matched received requisite amount of vehicle (0.9% NaCl solution) during the same period. Exogenous bGRF enhanced (p < 0.01) plasma non-esterified fatty acids (NEFA) concentrations in treatment group when compared with control group during the treatment and post-treatment period, while plasma alpha-amino nitrogen (AAN) concentrations showed a decreasing trend (p < 0.05) in the treatment group when compared with the control group during the treatment and post-treatment periods. The plasma inorganic phosphorus (Pi) was found to be higher (p < 0.05) in the treatment group animals in comparison with the levels recorded in the control group animals during the treatment as well as post-treatment periods. However, there was no change (p > 0.05) in plasma glucose and calcium concentrations between the two groups. Plasma NEFA was found to be positively correlated with plasma growth hormone (GH); however, it was only significant for the treatment group (r = + 0.76; p < 0.05). Plasma AAN in the treatment group exhibited negative correlation with plasma GH (r = 0.72; p < 0.05), while plasma AAN and GH were recorded to be positively correlated in the control group (r = 0.47; p < 0.05). The present findings suggest that exogenous bGRF induces GH release that

  4. Characterisation of a Cryptosporidium isolate from water buffalo (Bubalus bubalis) by sequencing of a fragment of the Cryptosporidium oocyst wall protein gene (COWP).

    PubMed

    Gómez-Couso, H; Amar, C F L; McLauchlin, J; Ares-Mazás, E

    2005-07-15

    Cryptosporidium oocysts were detected using a direct immunofluorescence antibody test in the faeces of an asymptomatic water buffalo (Bubalus bubalis) heifer from a dairy farm close to Santiago de Compostela (NW Spain). Oocysts were morphologically indistinguishable from Cryptosporidium parvum. Using DNA extracted from this sample and a PCR-RFLP analysis of a 341 base pairs fragment of the Cryptosporidium oocyst wall protein (COWP) gene, a previously undescribed fragment pattern was generated. The COWP gene fragment was cloned and sequencing analyses revealed it to be similar to the C. parvum 'pig' genotype but with four base pairs substitutions.

  5. Serological and bacteriological responses of water buffalo (Bubalus bubalis) vaccinated with two doses of Brucella abortus strain RB51 vaccine.

    PubMed

    Ramnanan, Anil; Diptee, Michael; Asgarali, Zinora; Campbell, Mervyn; Adesiyun, Abiodun Adewale

    2012-10-01

    Thirty-two water buffalo (Bubalus bubalis) calves aged 6–10 months were used to evaluate serological responses to Brucella abortus strain RB51 (RB51) vaccination in a dose-response study and to compare the use of two selective media for the isolation of RB51. The animals were randomly divided into three treatment groups. Groups I-III received the recommended vaccine dose (RD) twice 4 weeks apart, RD twice 18 weeks apart and saline once, respectively. Lymph nodes were excised from the three groups and subjected to bacteriological examination to determine the frequency of detection of RB51. Pre- and post-vaccination blood samples were collected and tested for B. abortus antibodies using the buffered plate agglutination test (BPAT), complement fixation test (CFT), and dot-blot assay. Sera taken at all post-inoculation weeks (PIW) were negative for field strain B. abortus using the BPAT. Antibody responses to RB51 were demonstrated in all vaccinates but not in controls by CFT and dot-blot assay from 1 PIW up to 16 weeks following booster vaccination. The agreement for both assays was 80.7% and there was a linear interdependence with a Pearson's correlation coefficient value of 0.578. The frequency of isolation of RB51 from the two selective media used was not significantly different (P > 0.05).

  6. Detection of Mycobacterium avium subsp. paratuberculosis in intestinal and lymph node tissues of water buffaloes (Bubalus bubalis) by PCR and bacterial culture.

    PubMed

    Sivakumar, P; Tripathi, B N; Singh, Nem

    2005-07-01

    The efficacy of bacterial culture and IS900-specific polymerase chain reaction (PCR) was compared for the detection of Mycobacterium avium subsp. paratuberculosis (MAP) from the intestinal and mesenteric lymph node tissues of water buffaloes (Bubalus bubalis) showing lesions of paratuberculosis (Johne's disease). Out of 20 (4.9%) animals showing histological lesions suggestive of paratuberculosis, 14 (70%) and 6 (30%) were positive in the PCR and bacterial culture, respectively. The results of this study suggested that PCR was more sensitive than bacterial culture in detection of subclinical paratuberculosis in water buffaloes. The bacterial concentration from large amount of tissues by differential and density gradient centrifugation method was found to facilitate the diagnosis by smear examination and PCR. The specificity of the PCR was confirmed by the product size and restriction digestion pattern of the amplicons. The sequence analysis of the amplified products (626bp of IS900 gene) from buffalo strain showed more than 97% homology with the published sequences.

  7. Genetic differentiation of water buffalo (Bubalus bubalis) populations in China, Nepal and south-east Asia: inferences on the region of domestication of the swamp buffalo.

    PubMed

    Zhang, Y; Vankan, D; Zhang, Y; Barker, J S F

    2011-08-01

    Data from three published studies of genetic variation at 18 microsatellite loci in water buffalo populations in China (18 swamp type, two river type), Nepal (one wild, one domestic river, one hybrid) and south-east Asia (eight swamp, three river) were combined so as to gain a broader understanding of genetic relationships among the populations and their demographic history. Mean numbers of alleles and expected heterozygosities were significantly different among populations. Estimates of θ (a measure of population differentiation) were significant among the swamp populations for all loci and among the river populations for most loci. Differentiation among the Chinese swamp populations (which was due primarily to just one population) was much less than among the south-east Asian. The Nepal wild animals, phenotypically swamp type but genetically like river type, are significantly different from all the domestic river populations and presumably represent the ancestral Bubalus arnee (possibly with some river-type introgression). Relationships among the swamp populations (D(A) genetic distances, principal component analysis and structure analyses) show the south-east Asian populations separated into two groups by the Chinese populations. Given these relationships and the patterns of genetic variability, we postulate that the swamp buffalo was domesticated in the region of the far south of China, northern Thailand and Indochina. Following domestication, it spread south through peninsular Malaysia to Sumatra, Java and Sulawesi, and north through China, and then to Taiwan, the Philippines and Borneo. PMID:21749419

  8. Genetic differentiation of water buffalo (Bubalus bubalis) populations in China, Nepal and south-east Asia: inferences on the region of domestication of the swamp buffalo.

    PubMed

    Zhang, Y; Vankan, D; Zhang, Y; Barker, J S F

    2011-08-01

    Data from three published studies of genetic variation at 18 microsatellite loci in water buffalo populations in China (18 swamp type, two river type), Nepal (one wild, one domestic river, one hybrid) and south-east Asia (eight swamp, three river) were combined so as to gain a broader understanding of genetic relationships among the populations and their demographic history. Mean numbers of alleles and expected heterozygosities were significantly different among populations. Estimates of θ (a measure of population differentiation) were significant among the swamp populations for all loci and among the river populations for most loci. Differentiation among the Chinese swamp populations (which was due primarily to just one population) was much less than among the south-east Asian. The Nepal wild animals, phenotypically swamp type but genetically like river type, are significantly different from all the domestic river populations and presumably represent the ancestral Bubalus arnee (possibly with some river-type introgression). Relationships among the swamp populations (D(A) genetic distances, principal component analysis and structure analyses) show the south-east Asian populations separated into two groups by the Chinese populations. Given these relationships and the patterns of genetic variability, we postulate that the swamp buffalo was domesticated in the region of the far south of China, northern Thailand and Indochina. Following domestication, it spread south through peninsular Malaysia to Sumatra, Java and Sulawesi, and north through China, and then to Taiwan, the Philippines and Borneo.

  9. A diagnostic protocol to identify water buffaloes (Bubalus bubalis) vaccinated with Brucella abortus strain RB51 vaccine.

    PubMed

    Tittarelli, Manuela; Atzeni, Marcello; Calistri, Paolo; Di Giannatale, Elisabetta; Ferri, Nicola; Marchi, Enrico; Martucciello, Alessandra; De Massis, Fabrizio

    2015-01-01

    The use of live vaccine strain RB51 for vaccination of domestic water buffaloes (Bubalus bubalis) at risk of infection with Brucella abortus is permitted notwithstanding the plans for the eradication and only under strict veterinary control. The antibodies induced by RB51 vaccination are not detectable using conventional diagnostic techniques; therefore, it is necessary to have a specific diagnostic tool able to discriminate vaccinated from unvaccinated animals. The combination of a complement fixation test (CFT) with specific RB51 antigen (RB51-CFT) and a brucellin skin test has been demonstrated to be a reliable diagnostic system to identify single cattle (Bos taurus) vaccinated with RB51. So far, no data are available in the international scientific literature regarding the use of this test association in water buffalo. For this reason the suitability of this test combination has been evaluated in a water buffalo herd. One hundred twenty-seven animals farmed in a herd of Salerno province (Campania, Southern Italy), in the context of a presumptive unauthorized use of RB51 vaccine were chosen for this study. All tested animals resulted negative to Rose Bengal test (RBT) and complement fixation test (CFT) used for the detection of specific antibodies against Brucella field strains. Seventy-one animals (56%) developed RB51 antigen-specific CFT (RB51-CFT) antibodies against RB51 vaccine in a first sampling, while 104 animals (82%) gave positive result to a second serum sampling conducted 11 days after the intradermal inoculation of the RB51 brucellin. One hundred and seven animals (84%) showed a positive reaction to the RB51-CFT in at least 1 sampling, while 111 animals (87%) resulted positive to the RB51 brucellin skin test. Thus, analysing the results of the 3 testing in parallel, 119 animals (94%) were positive to at least 1 of the performed tests. The results suggest that the use in parallel of the RB51 brucellin skin test with RB51-CFT may represent a reliable

  10. Growth, metabolic status and ovarian function in buffalo (Bubalus bubalis) heifers fed a low energy or high energy diet.

    PubMed

    Campanile, G; Baruselli, P S; Vecchio, D; Prandi, A; Neglia, G; Carvalho, N A T; Sales, J N S; Gasparrini, B; D'Occhio, M J

    2010-10-01

    The aim was to establish the capacity of buffalo heifers to adapt their metabolic requirements to a low energy diet. Murrah buffalo (Bubalus bubalis) heifers undergoing regular estrous cycles were randomly assigned by age, live weight (LW) and body condition score (BCS) to a high energy group (HE, 5.8 milk forage units (MFU)/day, n=6) or low energy group (LE, 3.6 MFU/day, n=6). Circulating concentrations of metabolic substrates, metabolic hormones and reproductive hormones were determined weekly for 19 weeks. Ovarian follicular characteristics and oocyte parameters were also ascertained weekly. Heifers fed the LE diet had a better dry matter conversion than heifers fed the HE diet and the calculated daily energy provision was negative for heifers fed the LE diet (-0.248 MFU) and positive for heifers fed the HE diet (5.4 MFU). Heifers fed the HE diet had an increase in 50 kg LW over the duration of the study whereas LW remained constant for heifers fed the LE diet. The BCS of heifers fed the HE diet (4.2) was greater (P<0.05) than the BCS for heifers fed the LE diet (3.4). Heifers fed the HE diet had greater (P<0.05) circulating concentrations of metabolic substrates (glucose, total cholesterol and HDL cholesterol) and metabolic hormones (insulin, glucagon, leptin and T3) compared with heifers fed the LE diet. There were no significant differences in circulating reproductive hormones between the two groups of heifers. Ovarian follicular characteristics were similar for the two groups of heifers while heifers fed the LE diet tended to have oocytes of reduced quality compared with heifers fed the HE diet. The most notable finding was that heifers fed the LE diet had a negative calculated daily energy provision but were able to maintain LW and reproductive activity. It was concluded that buffalo heifers may potentially have the capacity to undergo metabolic adjustment and reduce their energy requirements when dietary energy is limiting. This adaptive capacity would

  11. Seroprevalence of Neospora caninum in female water buffaloes (Bubalus bubalis) from the southeastern region of Brazil.

    PubMed

    Fujii, T U; Kasai, N; Nishi, S M; Dubey, J P; Gennari, S M

    2001-08-31

    Antibodies to Neospora caninum were assayed in sera of 222 female water buffaloes from Ribeira Valley of São Paulo State, Brazil, using an indirect fluorescent antibody test (IFAT) and Neospora agglutination test (NAT). IFAT antibodies were found in 64% of buffaloes with titers of 1:25 (42 buffaloes), 1:50 (53 buffaloes), 1:100 (31 buffaloes), 1:200 (10 buffaloes), 1:400 (3 buffaloes), or > or =1:800 (3 buffaloes). NAT antibodies were found in 53% of buffaloes; in titers of 1:40 in 52 buffaloes, 1:80 in 27 buffaloes, 1:160 in 21 buffaloes, and > or =1:320 in 17 buffaloes. Results indicate a high prevalence of N. caninum exposure in water buffaloes in Brazil and warrant an investigation of the role of N. caninum as an abortifacient in water buffaloes.

  12. Detection of follicular apoptosis in water buffalo (Bubalus bubalis) ovary by histology and nick end labelling technique.

    PubMed

    Sreejalekshmi, P; Raghavendra, B S; Subramani, T Siva; Murthy, V Chandrashekara; Jamuna, K V; Prasad, R V; Ravindra, J P; Selvaraju, S

    2011-02-01

    The objective of this experiment was to assess the features and extent of follicular apoptosis in the water buffalo (Bubalus bubalis) ovary using classical histology and nick end labelling technique. Ovaries (n=40) procured from the slaughterhouse were used for the study. The sections (5 μm) were used for detection of terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labelling (TUNEL) and classical histology (H&E). Those follicles showing ≥ 5% TUNEL positivity (TUNEL assay) and pyknotic nuclei (histology) in granulosa cells were classified as atretic. Based on histology, the atretic primary and secondary follicles (%) were 93.82 and 95.62 respectively. The histology study reveals that the rates (%) of atresia in <1, 1-3, 3-5 mm and >5 mm were 36.90, 40.50, 62.84 and 74.5 respectively. Further the atretic tertiary follicles (%) were significantly lower than the primary and secondary classes of follicles. TUNEL assay reveals that the atretic rate (%) of tertiary follicles in <1, 1-3, 3-5 and ≥ 5 mm class follicles were 50.88, 53.84, 81.81 and 36.36 respectively. The percentage of atresia in >5 mm diameter follicles were significantly lower in TUNEL than histology. Percentages of granulosa and thecal cells positive for atresia by TUNEL were 30.7 ± 0.53 and 13.82 ± 0.18 respectively per follicle. The initial structural changes in atretic follicles were seen primarily in the granulosa cells. In severely atretic follicles TUNEL positive granulosa cells along with theca cells have to be considered in assessing the rate and extent of atresia.

  13. Studies of Sarcocystis in Malaysia. II. Comparative ultrastructure of the cyst wall and zoites of Sarcocystis levinei and Sarcocystis fusiformis from the water buffalo, Bubalus bubalis.

    PubMed

    Kan, S P; Dissanaike, A S

    1978-10-31

    The two species of Sarcocystis--S. levinei and S. fusiformis from the water buffalo, Bubalus bubalis, show some ultrastructural similarities in their cyst wall and zoites. The zoites of both species are of about the same size, banana-shaped and have 22 subpellicular microtubules, numerous micronemes, eight rhoptries, a micropore in the region of the micronemes, an elongated mitochondrion, and a nucleus. S. levinei has 200--300 micronemes and S. fusiformis has about 400. The sarcocysts of both species are trabeculated and their cyst walls have cytophaneres containing annulated fibrils and coarse, electron dense granules. The cytophaneres of S. levinei are sloping, with irregular, wavy outlines, whereas S. fusiformis has the cauliflower-type of cytophaneres. This difference in the appearance of the cytophaneres, together with the difference in size of the sarcocysts and their definitive hosts, further confirms that S. levinei and S. fusiformis are two distinct species in the water buffalo.

  14. Molecular cloning and expression profile analysis of interleukin-10 and interleukin-18 cDNA of Indian water buffalo (Bubalus bubalis).

    PubMed

    Premraj, Avinash; Sreekumar, E; Nautiyal, Binita; Rasool, T J

    2005-09-15

    The cDNAs encoding the interleukin-10 and interleukin-18 of Indian water buffalo (Bubalus bubalis) were cloned and sequenced. A 537 bp IL-10 cDNA fragment and a 623 bp IL-18 cDNA fragment were amplified by reverse transcriptase polymerase chain reaction (RT-PCR) from concanavalin A stimulated splenocytes. Sequence analysis of these cytokines revealed high level conservation at nucleic acid and protein level. Both these cytokines also showed strict conservation in the predicted secondary structure and critical amino acid residues compared to the ruminant homologues. Basal level expression of both IL-10 and IL-18 was observed in liver, lung and spleen. The expression level of IL-10 was not affected by mitogenic stimulation, whereas IL-18 was up regulated upon stimulation. The availability of these cytokine molecules will aid in the study of their role in the immunology and pathogenesis of infections in water buffalo.

  15. Seroprevalence of antibodies to Neospora caninum and Toxoplasma gondii in water buffaloes (Bubalus bubalis) from Egypt.

    PubMed

    Dubey, J P; Romand, S; Hilali, M; Kwok, O C; Thulliez, P

    1998-03-01

    Sera from 75 water buffaloes from Egypt were examined using a direct agglutination test incorporating mercaptoethanol for antibodies to Neospora caninum and Toxoplasma gondii. Antibodies to N. caninum were found in 51 (68%) of 75 buffaloes in titres of 1:20 (six buffaloes), 1:40 (15 buffaloes), 1:160 (one buffalo), 1:320 (one buffalo) and > or = 1:640 (28 buffaloes), using N. caninum formalin-preserved whole tachyzoites as antigen. Antibodies to T. gondii were not found in a 1:100 dilution of serum of any of the 75 buffaloes, using T. gondii as antigen, indicating specificity in the detection of antibodies to N. caninum. This is the first report of N. caninum prevalence in water buffaloes, which are economically very important domestic animals in developing countries.

  16. Identity of Sarcocystis species of the water buffalo (Bubalus bubalis) and cattle (Bos taurus) and the suppression of Sarcocystis sinensis as a nomen nudum.

    PubMed

    Dubey, J P; Fayer, R; Rosenthal, B M; Calero-Bernal, R; Uggla, A

    2014-09-15

    There are uncertainties concerning the identity and host species specificity of Sarcocystis species of the water buffalo (Bubalus bubalis) and cattle (Bos taurus). Currently, in cattle three species are recognized with known endogenous stages, viz.: S. cruzi (with canine definitive host), S. hirsuta (feline definitive host), and S. hominis (primate definitive host). Recently, a fourth Sarcocystis species with an unknown life cycle has been reported from cattle. In the water buffalo, four species of Sarcocystis have been described: S. fusiformis (feline definitive host), S. buffalonis (feline definitive host), S. levinei (canine definitive host), and S. dubeyi (definitive host unknown but not cat or dog). Besides, there are studies of Sarcocystis infections in buffalo and cattle from China with results that are difficult to interpret and validate. For example, some of the studies report transmission of Sarcocystis species between cattle and buffalo, but steps to preclude exogenous exposures were not reported. A species of the water buffalo, 'S. sinensis', was proposed at a Chinese national conference in 1990, and published as an abstract without figures and with no archived type specimens for verification. The International Code of Zoological Nomenclature Articles 9 and 10 state that "abstracts of articles, papers, posters, text of lectures, and similar material when issued primarily to participants at meetings, symposia, colloquia or congress does not constitute published work"; therefore, S. sinensis is a nomen nudum.

  17. High genetic diversity and distribution of Bubu-DQA alleles in swamp buffaloes (Bubalus bubalis carabanesis): identification of new Bubu-DQA loci and haplotypes.

    PubMed

    Mishra, S K; Niranjan, S K; Banerjee, B; Dubey, P K; Gonge, D S; Mishra, B P; Kataria, R S

    2016-07-01

    In this study, genetic diversity analysis of MHC class II-DQA locus helped in identification of 25 new Bubu-DQA nucleotide sequences in swamp buffaloes (Bubalus bubalis carabanesis, Bubu). Phylogenetic analysis revealed the distribution of the buffalo DQA sequences in two major clusters of DQA1 and DQA2 genes, sharing common lineages with corresponding cattle alleles, possibly due to trans-species evolution. However, a highly divergent sequence, Bubu-DQA*2501, homologous to cattle (BoLA) DQA3 allele, was identified, indicating the existence of an additional locus; putative DQA3 in buffalo. PCR-RFLP analysis revealed extensive duplication of DQA locus in swamp buffaloes, sharing DQA1, DQA2, and DQA3 alleles in different combinations in duplicated haplotypes. Higher dN than dS values and Wu-Kabat variability at peptide-binding regions in Bubu-DQA indicated high polymorphism with balancing selection. Levels of genetic diversity within DQA sequences and duplication in a small population of swamp buffalo indicate the genetic richness of the species, important for fitness. PMID:27177904

  18. Molecular characterization of coding sequences and analysis of Toll-like receptor 3 mRNA expression in water buffalo (Bubalus bubalis) and nilgai (Boselaphus tragocamelus).

    PubMed

    Dhara, Animesh; Saini, Mohini; Das, Dhanjit K; Swarup, Devendra; Sharma, Bhaskar; Kumar, Satish; Gupta, Praveen K

    2007-01-01

    Toll-like receptor 3 (TLR3), an antiviral innate immunity receptor recognizes double-stranded RNA, preferably of viral origin and induces type I interferon production, which causes maturation of phagocytes and subsequent release of chemical mediators from phagocytes against some viral infections. The present study has characterized TLR3 complementary DNA (cDNA) in buffalo (Bubalus bubalis) and nilgai (Boselaphus tragocamelus). TLR3 coding sequences of both buffalo and nilgai were amplified from cultured dendritic cell cDNA and cloned in pGEMT-easy vector for characterization by restriction endonucleases and nucleotide sequencing. Sequence analysis reveals that 2,715-bp-long TLR3 open reading frame encoding 904 amino acids in buffalo as well as nilgai is similar to that of cattle. Buffalo TLR3 has 98.6 and 97.9% identity at nucleotide level with nilgai and cattle, respectively. Likewise, buffalo TLR3 amino acids share 96.7% identity with cattle and 97.8% with nilgai. Non-synonymous substitutions exceeding synonymous substitutions indicate evolution of this receptor through positive selection among these three ruminant species. Buffalo and nilgai appear to have diverged from a common ancestor in phylogenetic analysis. Predicted protein structures of buffalo and nilgai TLR3 from deduced amino acid sequences indicate that the buffalo and nilgai TLR3 ectodomain may be more efficient in ligand binding than that of cattle. Furthermore, TLR3 messenger RNA expression in tissues as quantified by real-time PCR was found higher in nilgai than buffalo.

  19. Early pregnancy detection of Iraqi riverine buffalo (Bubalus bubalis) using the BioPRYN enzyme-linked immunosorbent assay for PSPB and the progesterone assay.

    PubMed

    Abdulkareem, T A; Al-Sharifi, S A M; Ishak, M A; Eidan, S M; Alnimr, M A; Passavant, C W; Branen, J R; Sasser, R G

    2011-06-01

    This study was undertaken to detect pregnancy in Iraqi riverine buffalo (Bubalus bubalis) using three different methods (rectal palpation, plasma progesterone concentration and detection of the presence of pregnancy-specific protein B (PSPB) with the BioPRYN(®) enzyme-linked immunosorbent assay (ELISA) test. The aim of the study was to identify the most sensitive, early and accurate method for detecting pregnancy. Twenty-two female riverine buffalo that were 6.0 ± 0.93 years old were used. Four blood samples per buffalo were taken via jugular venipuncture at days 22-24, 32-34, 42-44 and 58-61 post-mating (PM) to measure the progesterone concentration (ng/ml) and to detect the presence of plasma PSPB. The rectal palpation method was employed to evaluate all buffalo on days 42-44 and 58-61 PM. The BioPRYN(®) test differed (p<0.01) from the other tests with earlier accuracy for detecting pregnant and non-pregnant buffalo. Eighty-eight percent of pregnant and 76.9% of non-pregnant buffalo were distinguished early (days 22-24 PM) using BioPRYN(®) and plasma PSPB-ELISA level (2.09 ± 0.12 ng/ml) in relation to 66.7% and 53.9% detected using the progesterone assay at similar days (4.30 ± 0.40 ng/ml). In conclusion, these results described, for the first time, the early and accurate pregnancy detection of water riverine buffalo using BioPRYN(®) technology and provided the plasma levels of PSPB using an ELISA test. These findings will improve the reproductive and productive efficiency of Iraqi riverine buffalo by adapting the recent management and reproductive strategies in Iraq and in the world.

  20. Identification of novel allelic variants of integrin beta 2 (ITGB2) gene and screening for Bubaline leukocyte adhesion deficiency syndrome in Indian water buffaloes (Bubalus bubalis).

    PubMed

    Sharma, Deepak; Kumar, Subodh; Deb, Sitangsu M; Mitra, Abhijit; Niranjan, Saket K; Naskar, Soumen; Sharma, Arjava

    2009-01-01

    A fragment of 570 bp corresponding to exon 5 and 6 of integrin beta 2 (ITGB2) gene was amplified for screening D128G mutation in one hundred and fifty two buffaloes (Bubalus bubalis) which causes bovine leukocyte adhesion deficiency syndrome (BLAD) in cattle, as well as to ascertain polymorphism. TaqI PCR-RFLP revealed no such mutation thus indicating the absence of bubaline leukocyte adhesion deficiency (BuLAD) allele in animals under study. However, the polymorphism studies using MspI restriction enzyme revealed two genotypic patterns viz. AA pattern (bands of 293, 141, 105, and 31 bp) and BB pattern (bands of 293, 105, 77, 64, and 31 bp). The sequences of A and B alleles were submitted to the GenBank (EU853307 and AY821799). PMID:19544212

  1. Identification of novel allelic variants of integrin beta 2 (ITGB2) gene and screening for Bubaline leukocyte adhesion deficiency syndrome in Indian water buffaloes (Bubalus bubalis).

    PubMed

    Sharma, Deepak; Kumar, Subodh; Deb, Sitangsu M; Mitra, Abhijit; Niranjan, Saket K; Naskar, Soumen; Sharma, Arjava

    2009-01-01

    A fragment of 570 bp corresponding to exon 5 and 6 of integrin beta 2 (ITGB2) gene was amplified for screening D128G mutation in one hundred and fifty two buffaloes (Bubalus bubalis) which causes bovine leukocyte adhesion deficiency syndrome (BLAD) in cattle, as well as to ascertain polymorphism. TaqI PCR-RFLP revealed no such mutation thus indicating the absence of bubaline leukocyte adhesion deficiency (BuLAD) allele in animals under study. However, the polymorphism studies using MspI restriction enzyme revealed two genotypic patterns viz. AA pattern (bands of 293, 141, 105, and 31 bp) and BB pattern (bands of 293, 105, 77, 64, and 31 bp). The sequences of A and B alleles were submitted to the GenBank (EU853307 and AY821799).

  2. Normal haematological and biochemical values for the swamp buffalo (Bubalus bubalis) in Australia.

    PubMed

    Canfield, P J; Best, F G; Fairburn, A J; Purdie, J; Gilham, M

    1984-03-01

    Blood samples were collected from 24 immature male, 55 immature female and 99 mature female water buffalo kept at an experimental farm in the Northern Territory. Haematological analysis was performed on blood collected in dipotassium--ethylene diamine tetra acetic acid while biochemical analysis was performed on serum and plasma (for glucose) samples. Haematological values of mature buffalo were similar to those recorded for swamp buffalo in Malaysia. Blood cell appearances were similar to those reported for adult Indian river buffalo though values recorded for red cell components were higher. Statistical analysis revealed no significant differences between immature male and female buffalo. Red cell components, eosinophils, total plasma and serum proteins, albumin, gamma globulins, inorganic phosphate and the enzyme gamma-glutamyl transferase were significantly higher for mature female buffalo when compared to immature females. Reasons for the differences were not fully determined but the effect of age and nutritional status in combination with a variable period of domestication were considered.

  3. Serum prolactin levels of non-cycling murrah buffaloes (Bubalus bubalis ).

    PubMed

    Kaker, M L; Razdan, M N; Galhotra, M M

    1982-05-01

    Prolactin levels were quantified by double antibody radio-immunoassay in the blood sampled daily for 24 days, from 9 non-cyclic Murrah buffaloes during hot months (ambient temp.41 to 43 degrees C). All buffaloes were kept in open loose housing. Three buffaloes were sprinkled with water for half an hour twice daily between 1200 and 1430 h to overcome partly the effect of heat during the period of investigation. Mean prolactin levels of 6 unsprinkled buffaloes ranged on different days from 249 to 739 ng/ml serum. The range of averages in case of 3 sprinkled animals was from 152 to 342 ng/ml serum. Buffaloes subjected to sprinkling had significantly (P / 0.01) lower prolactin levels than control buffalo.

  4. Glomerulonephritis in water buffaloes (Bubalus bubalis) naturally infected by Fasciola hepatica.

    PubMed

    Marques, Sandra Márcia Tietz; Scroferneker, Maria Lúcia; Edelweiss, Maria Isabel Albano

    2004-08-13

    Glomerulonephritis caused by Fasciola hepatica was observed in buffaloes. Renal biopsies of 20 buffaloes, 11 with F. hepatica and 9 uninfected buffaloes (controls), were examined by light microscopy, direct and indirect immunofluorescence, and immunohistochemical analysis. The biopsies of seven (63.6%) infected buffaloes revealed membranoproliferative glomerulonephritis, three biopsies (27.3%) showed mesangioproliferative glomerulonephritis, and one kidney presented normal biopsy specimens. In the control group, seven buffaloes (77.8%) presented normal biopsy specimens, while two (22.2%) revealed glomerulonephritis-one with a membranoproliferative pattern, and the other with a mesangioproliferative pattern-with extensive inflammatory cell infiltrate. Our conclusion is that glomerulopathy is associated with fascioliasis and that buffaloes are suitable as a naturally existing experimental model of renal injury by circulating immune complexes.

  5. Evaluation of indirect TaSP enzyme-linked immunosorbent assay for diagnosis of tropical theileriosis in cattle (Bos indicus) and water buffaloes (Bubalus bubalis) in Egypt.

    PubMed

    Mohamed, Amr M; Abdel-Rady, Ahmed; Ahmed, Laila S; El-Hosary, Amira

    2012-05-25

    The aim of the present study was to evaluate the validity of Theileria annulata surface protein (TaSP)-ELISA, in comparison with traditional microscopic test, for the diagnosis of T. annulata infection among Egyptian baladi cattle (Bos taurus) and water buffaloes (Bubalus bubalis). Molecular confirmation of infection using T. annulata merozoite surface (Tams-1) target amplification by PCR was used as a gold standard. A total of 76 clinically suspected animals including 64 baladi cattle and 12 water buffaloes were investigated in the current study by the three methods. Based on the PCR-confirmed results, the evaluation study revealed higher sensitivity of TaSP-ELISA (72.9% and 75%) as compared to microscopic examination (58.3% and 50%) among cattle and buffaloes, respectively. On the other hand, the specificity of TaSP-ELISA in diagnosis of T. annulata infection was higher (87.5%) in baladi cattle as compared to water buffaloes (37.5%). In conclusion, TaSP-ELISA was shown to be suitable for the diagnosis of T. annulata infection in cattle under field conditions.

  6. Comparative study on responses of cattle and water buffalo (Bubalus bubalis) to experimental inoculation of Brucella abortus biovar 1 by the intraconjunctival route--a preliminary report.

    PubMed

    Adesiyun, Abiodun A; Fosgate, Geoff T; Persad, Anil; Campbell, Mervyn; Seebaransingh, Ravi; Stewart-Johnson, Alva

    2010-12-01

    The preliminary study was conducted to assess the virulence of a strain of Brucella abortus (1969D) and to compare the susceptibility of water buffalo and cattle calves to infection by the intraconjunctival route. Seven of each cattle and water buffalo (Bubalus bubalis) calves aged 3-6 months were inoculated intraconjunctivally with counts ranging from 1.5 × 10(7) to 1.7 × 10(10) colony forming units of B. abortus. Animals were monitored over an 8-week period for clinical manifestations and serological and hematological evidence of infection. At slaughter, eight lymph nodes from each animal were sampled for bacteriological and histopathological assessments. Lymph nodes from three water buffalo (43%) and five cattle (71%) yielded B. abortus (P=0.048). Parotid/prescapular lymph nodes were most sensitive in detecting B. abortus. Our data suggest that B. abortus strain 1969D may be used as challenge strain, and water buffalo appeared to have a lower susceptibility to B. abortus infection than cattle.

  7. No change in mRNA expression of immune-related genes in peripheral blood mononuclear cells challenged with Theileria annulata in Murrah buffalo (Bubalus bubalis).

    PubMed

    Panigrahi, Manjit; Kumar, Amod; Bhushan, Bharat; Ghosh, Srikant; Saravanan, B C; Sulabh, Sourabh; Parida, Subhashree; Gaur, Gyanendra Kumar

    2016-07-01

    Water buffaloes (Bubalus bubalis) act as carrier to Theileria annulata and show less clinical sign of tropical theileriosis as compared to indigenous and exotic cattle. Differential expression of immune-related genes such as major histocompatibility complex, class II, DQ alpha 1 (MHC-DQα), signal-regulatory protein alpha (SIRPA), prion protein (PRNP), Toll-like receptor 10 (TLR10), c-musculoaponeurotic fibrosarcoma oncogene homolog (cMAF) and V-maf avian musculoaponeurotic fibrosarcoma oncogene homolog B (MAFB) genes influence host resistance to this disease in exotic, crossbred and indigenous cattle. In the present study we examined the differential mRNA expression of the abovesaid immune-related genes in response to T. annulata infection in buffaloes. Peripheral blood mononuclear cells (PBMCs) harvested from blood samples of buffaloes were challenged with ground-up tick supernatant carrying T. annulata sporozoites in vitro. After 48h of in vitro challenge qPCR was employed to measure the relative mRNA expression of MHC-DQα, SIRPA, PRNP, TLR10, cMAF and MAFB genes in infected and control PBMCs. In the current study, the selected genes showed no change in mRNA expression after T.annulata infection which indicates that they have little role in providing host resistance to theileriosis in buffaloes.

  8. Development and evaluation of real-time PCR assay for the detection of Babesia orientalis in water buffalo (Bubalus bubalis, Linnaeus, 1758).

    PubMed

    He, Lan; Feng, Hui-Hui; Zhang, Qin-Li; Zhang, Wen-Jie; Khan, Muhanmad Kasib; Hu, Min; Zhou, Yan-Qin; Zhao, Jun-Long

    2011-12-01

    Babesia orientalis is the causative agent of babesiosis in water buffalo (Bubalus babalis, Linnaeus, 1758). In this study, a TaqMan real-time PCR assay was developed for quantitative detection of B. orientalis in water buffalo. Hybridization probe and oligonucleotide primers were designed based on the v4 region of 18S rRNA gene. Detection limit was determined at 2 parasites. Blood samples were collected from experimentally infected water buffalo, as well as from 180 field samples, which were collected from 4 different geographical locations to the north and south of the Yangtse River. The parasite was detected by real-time PCR on day 2 until day 39 post-infection, while reverse line blot (RLB) was on day 6 until day 36 in experimentally infected water buffalo. For the results of 180 field samples, statistical analysis showed no significant difference in relative effectiveness of real-time PCR and RLB. The analysis also indicated that there was no difference in the prevalence of B. orientalis between the regions of south and north of the Yangtse River by both the real-time PCR assay and RLB detection. These results indicated that the parasite infection has spread to the north of the Yangtse River.

  9. No change in mRNA expression of immune-related genes in peripheral blood mononuclear cells challenged with Theileria annulata in Murrah buffalo (Bubalus bubalis).

    PubMed

    Panigrahi, Manjit; Kumar, Amod; Bhushan, Bharat; Ghosh, Srikant; Saravanan, B C; Sulabh, Sourabh; Parida, Subhashree; Gaur, Gyanendra Kumar

    2016-07-01

    Water buffaloes (Bubalus bubalis) act as carrier to Theileria annulata and show less clinical sign of tropical theileriosis as compared to indigenous and exotic cattle. Differential expression of immune-related genes such as major histocompatibility complex, class II, DQ alpha 1 (MHC-DQα), signal-regulatory protein alpha (SIRPA), prion protein (PRNP), Toll-like receptor 10 (TLR10), c-musculoaponeurotic fibrosarcoma oncogene homolog (cMAF) and V-maf avian musculoaponeurotic fibrosarcoma oncogene homolog B (MAFB) genes influence host resistance to this disease in exotic, crossbred and indigenous cattle. In the present study we examined the differential mRNA expression of the abovesaid immune-related genes in response to T. annulata infection in buffaloes. Peripheral blood mononuclear cells (PBMCs) harvested from blood samples of buffaloes were challenged with ground-up tick supernatant carrying T. annulata sporozoites in vitro. After 48h of in vitro challenge qPCR was employed to measure the relative mRNA expression of MHC-DQα, SIRPA, PRNP, TLR10, cMAF and MAFB genes in infected and control PBMCs. In the current study, the selected genes showed no change in mRNA expression after T.annulata infection which indicates that they have little role in providing host resistance to theileriosis in buffaloes. PMID:26997138

  10. The complete coding region sequence of river buffalo (Bubalus bubalis) SRY gene.

    PubMed

    Parma, Pietro; Feligini, Maria; Greppi, Gianfranco; Enne, Giuseppe

    2004-02-01

    The Y-linked SRY gene is responsible for testis determination in mammals. Mutations in this gene can lead to XY Gonadal Dysgenesis, an abnormal sexual phenotype described in humans, cattle, horses and river buffalo. We report here the complete river buffalo SRY sequence in order to enable the genetic diagnosis of this disease. The SRY sequence was also used to confirm the evolutionary divergence time between cattle and river buffalo 10 million years ago.

  11. Cloning and sequencing of Indian water buffalo (Bubalus bubalis) interleukin-3 cDNA.

    PubMed

    Thennarasu, S; Harishankar, M; Raj, G Dhinakar

    2012-06-01

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.

  12. DGAT1, GH, GHR, PRL and PRLR polymorphism in water buffalo (Bubalus bubalis).

    PubMed

    Shi, D-S; Wang, J; Yang, Y; Lu, F-H; Li, X-P; Liu, Q-Y

    2012-04-01

    The polymorphism of several genes has been shown to affect the milk composition traits in dairy cattle, including DGAT1-exon8 K232A, GH-intron3 MspI, GH-exon5 AluI, GHR-exon8 F279Y, PRL-exon3 RsaI and PRLR-exon3 S18N. However, the polymorphism and effects of these genes on the milk traits of water buffalo are still unclear. In this study, four DNA pooling samples from Murrah, Nili-ravi, Murrah-Nili-Swamp crossbreed and Chinese swamp buffalo were constructed, respectively, and polymorphism of these sites was investigated using PCR-Single-strand conformation polymorphism and sequencing. Twenty-eight inter-specific single-nucleotide polymorphism (SNPs) were found in these six assayed gene fragments between buffalo and dairy cattle, including nine intra-specific SNPs among buffalo groups. All buffalo fixed a K allele genotype in DGAT1-exon8, MspI(+) restriction site(c nucleotide) and AluI(+) site(c nucleotide) at intron3 and exon5 of GH gene, F allele genotype of F279Y mutation in GHR gene, RsaI(-) restriction site at PRL-exon3/exon4 and N allele genotype of S18N mutation at PRLR-exon3. It provides an indirect evidence that water buffalo have fixed alleles with genotypes reported in dairy cattle, which is thought to be responsible for high milk fat, high protein content and low milk yield. Moreover, three new intra-specific SNPs were found including 275th bp (c/t) in DGAT1 of Murrah buffalo, 109th bp (t/a) in PRL-exon3/exon4 and 43rd bp (c/t) in PRLR-exon3 of Chinese swamp buffalo. Information provided in this study will be useful in further studies to improve buffalo breeding for better lactation performances.

  13. Rumen ciliate faunae of water buffalo (Bubalus bubalis) and goat (Capra hircus) in Nepal.

    PubMed

    Gurung, Yam Bahadur; Parajuli, Nirmal; Miyazaki, Yutaka; Imai, Soichi; Kobayashi, Kosaku

    2002-03-01

    Rumen ciliate composition of river-type water buffalo and goat in Nepal was surveyed. As the result of survey, 13 genera representing 52 species and 20 formae of the ciliates were identified. Of them 13 genera with 44 species and 9 formae were found from the water buffalo and 8 genera with 21 species and 12 formae from the goat. The present paper shows the first report of Hsiungella triciliata, Entodinium brevispinum, E. convexum, E. javanicum, E. rectangulatum f. rectangulatum, E. rectangulatum f. lobosospinosum, Diplodinium nanum, D. psittaceum, D. sinhalicum and Ostracodinium quadrivesiculatum from water buffalo and Epidinium ecaudatum f. parvicaudatum from goat.

  14. Seroprevalence of Toxoplasma gondii in water buffaloes (Bubalus bubalis) in South-West of Iran.

    PubMed

    Hamidinejat, Hossein; Ghorbanpour, Masoud; Nabavi, Leily; Haji Hajikolaie, Mohammad Rahim; Razi Jalali, Mohammad Hossein

    2010-08-01

    The prevalence of antibodies to Toxoplasma gondii was conducted in 300 buffaloes from Ahvaz, Kouzestan province, southwest of Iran. Blood sera were screened using a Modified agglutination test (MAT) incorporating 2-mercaptoethanol. Positive reactions in sera dilutions above 1:25 were considered as indicative for the presence of T. gondii antibodies. The overall prevalence of infection in the animals was 14.33% with titers of 1:25 in 21, 1:50 in 12, 1:100 in 6, 1:200 in 2 and 1:400 in 2. The prevalence was different in relation to the sex with buffaloes with 19.7% and 7% in females and males respectively. These results indicate that T. gondii infection in water buffaloes of Khouzestan is relatively high and consumption of buffalo meat may be a risk factor for humans in Ahvaz, southwest of Iran.

  15. ZFX and ZFY loci in water buffalo (Bubalus bubalis): potential for sex identification.

    PubMed

    Pande, A; Totey, S M

    1998-01-01

    In the present study a small region of ZFX and ZFY loci in buffalo have been amplified by polymerase chain reaction (PCR). Restriction fragment length polymorphism (RFLP) was also uncovered that can distinguish between male and female buffalo DNA. The study also found a second copy of the ZFX loci (ZFXR) present in both male and female. Sequence analysis showed that ZFXR has a single base deletion that results in a redundant putative protein.

  16. Molecular cloning and expression analysis of the STAT1 gene in the water buffalo (Bubalus bubalis).

    PubMed

    Deng, Tingxian; Pang, Chunying; Zhu, Peng; Liao, Biyun; Zhang, Ming; Yang, Bingzhuang; Liang, Xianwei

    2015-01-01

    Signal transducer and activator of transcription 1 (STAT1) is a critical component of the transcription factor complex in the interferon (IFN) signaling pathways. Of the seven STAT isoforms, STAT1 is a key mediator of type I and type III IFN signaling, but limited information is available for the STAT genes in the water buffalo. Here, we amplified and identified the complete coding sequence (CDS) of the buffalo STAT1 gene by using reverse transcription polymerase chain reaction (RT-PCR). Sequence analysis indicated that the buffalo STAT1 gene length size was 3437 bp, containing an open reading frame (ORF) of 2244 bp that encoded 747 amino acids for the first time. The buffalo STAT1 CDS showed 99, 98, 89, 93, 86, 85, and 87% identity with that of Bos taurus, Ovis aries, Homo sapiens, Sus scrofa, Rattus norvegicus, Mus musculus, and Capra hircus. The phylogenetic analyses revealed that the nearest relationship existed between the water buffalo and B. taurus. The STAT1 gene was ubiquitously expressed in 11 buffalo tissues by real-time PCR, whereas STAT1 was expressed at higher levels in the lymph. The STAT1 gene contained five targeted microRNA sequences compared with the B. taurus by the miRBase software that provide a fundamental for identifying the STAT1 gene function.

  17. Progesterone supplementation during multiple ovulation treatment in buffalo species (Bubalus bubalis).

    PubMed

    Neglia, Gianluca; Gasparrini, Bianca; Vecchio, Domenico; Rubessa, Marcello; Di Palo, Rossella; Zicarelli, Luigi; Campanile, Giuseppe

    2010-08-01

    The aim of this study was to evaluate the effect of exogenous progesterone supplementation on superovulatory response in buffaloes that has undergone a multiple ovulation program. Fourteen Mediterranean buffaloes were divided into two groups and received a 4-day decreasing dosage of an equal mixture of 500 IU of FSH and LH starting on day 8 of the cycle. In group A (n = 7) a progesterone-releasing intravaginal device was removed on day 8, whereas in group B (n = 7) it was left till day 10, when PGF2alpha was administered. Eighty hours later, buffaloes were artificially inseminated and after 6 days they undergone uterine flushing. A higher (P < 0.05) number of corpora lutea (8.3 vs. 5.7) and embryo/flushing/buffalo (2.3 vs. 1.3) were recorded in group B vs. group A if responsive buffaloes are considered (n = 12) and the number of corpora lutea was highly correlated with the number of embryos (r = 0.65; P < 0.05). In conclusion, progesterone supplementation during the first 2 days of the superovulation treatment seems to enhance the recovery rate in buffalo species. A high ovulation rate, associated with a high number of corpora lutea, can represent a parameter for estimating embryo recovery. PMID:20411328

  18. Shedding of Brucella abortus rough mutant strain RB51 in milk of water buffalo (Bubalus bubalis).

    PubMed

    Longo, Mariangela; Mallardo, Karina; Montagnaro, Serena; De Martino, Luisa; Gallo, Sergio; Fusco, Giovanna; Galiero, Giorgio; Guarino, Achille; Pagnini, Ugo; Iovane, Giuseppe

    2009-07-01

    The objective of this study was to determine if Brucella abortus rough mutant strain RB51 (SRB51) is eliminated in buffalo milk. Thirty Brucella-free female buffaloes were used in this study: ten 4-5 years old were inoculated with the triple of the recommended calfhood dose of SRB51 by subcutaneous route, ten 2-3 years old at the first lactation were previously vaccinated twice as calves with triple the recommended calf dose of RB51, while five 4-5 years old and five 2-3 years old not vaccinated Brucella-free female buffaloes served as controls. Milk samples were taken aseptically on a daily basis for the first 30 days and weekly for the second and third months. The samples were inoculated on selective media for isolation of SRB51 and incubated for 11 days. Moreover, PCR analysis was also performed directly on milk samples. SRB51 was isolated from milk samples only during the first week post-vaccination while RB51 DNA was detected during the first week till the fourth week post-vaccination only in water buffaloes vaccinated as adults. The identification of Brucella RB51 in milk samples, strongly suggests that this Brucella vaccine could be excreted in milk of buffalo cows vaccinated as adults, while our data demonstrate that the vaccine is safe for use in buffaloes vaccinated as calves in which it was not excreted in milk.

  19. Ovarian follicular dynamics and hormonal profiles in heifer and mixed-parity Mediterranean Italian buffaloes (Bubalus bubalis) following an estrus synchronization protocol.

    PubMed

    Presicce, Giorgio Antonio; Senatore, Elena Maria; Bella, Antonino; De Santis, Giuseppe; Barile, Vittoria Lucia; De Mauro, Guillermo Javier; Terzano, Giuseppina Maria; Stecco, Romana; Parmeggiani, Albamaria

    2004-05-01

    The primary objective was to elucidate ovarian follicular dynamics and hormonal profiles in nulliparous heifer (HE; n = 11 ) and mixed-parity (MP; n=10 ) Mediterranean Italian water buffaloes (Bubalus bubalis) following an estrus synchronization protocol. Both groups received a progesterone releasing intravaginal device (PRID) implant for 10 days; a luteolytic dose of synthetic prostaglandin was given 7 days after PRID insertion. Daily ultrasound monitoring and collection of blood to determine plasma concentrations estradiol and progesterone started 1 day after PRID removal and lasted for 55 and 65 days in HE and MP buffaloes, respectively. Data analysis was restricted to the first 5 days after PRID removal and to one estrus cycle following induced ovulation. The HE buffaloes were not inseminated and only one ovulated within 5 days after PRID removal; the remainder ovulated between 8 and 48 days after PRID removal (except one in which ovulation was never detected). All HP buffaloes were inseminated 72, 96 and 120 h after PRID removal; seven buffaloes ovulated within 5 days after PRID removal and two were pregnant. Mean diameter of the largest follicle was significantly smaller in HE than MP buffaloes the first 4 days after PRID removal. There was a parity by time interaction ( P=0.0047 ) for plasma progesterone concentrations; progesterone was higher in HE than MP buffaloes 1 day after PRID removal, but the converse was true 2 days after PRID removal. After induced ovulation, HE buffaloes exhibited a one-wave ( n=5; length of cycle, 8-12 days), two-wave ( n=4; range: 20-26 days) or three-wave cycle ( n=1; 25 days). In contrast, all non-pregnant MP buffaloes ( n=8 ) had a two-wave cycle (range: 19-25 days). For buffaloes with two-wave cycles, the growth rate and diameter of the largest follicle was significantly smaller in HE than MP buffaloes for both the first follicular wave (1.3mm versus 1.7 mm per day and 10.5 mm versus 13.3 mm, respectively) and the second

  20. Ovarian follicular dynamics and hormonal profiles in heifer and mixed-parity Mediterranean Italian buffaloes (Bubalus bubalis) following an estrus synchronization protocol.

    PubMed

    Presicce, Giorgio Antonio; Senatore, Elena Maria; Bella, Antonino; De Santis, Giuseppe; Barile, Vittoria Lucia; De Mauro, Guillermo Javier; Terzano, Giuseppina Maria; Stecco, Romana; Parmeggiani, Albamaria

    2004-05-01

    The primary objective was to elucidate ovarian follicular dynamics and hormonal profiles in nulliparous heifer (HE; n = 11 ) and mixed-parity (MP; n=10 ) Mediterranean Italian water buffaloes (Bubalus bubalis) following an estrus synchronization protocol. Both groups received a progesterone releasing intravaginal device (PRID) implant for 10 days; a luteolytic dose of synthetic prostaglandin was given 7 days after PRID insertion. Daily ultrasound monitoring and collection of blood to determine plasma concentrations estradiol and progesterone started 1 day after PRID removal and lasted for 55 and 65 days in HE and MP buffaloes, respectively. Data analysis was restricted to the first 5 days after PRID removal and to one estrus cycle following induced ovulation. The HE buffaloes were not inseminated and only one ovulated within 5 days after PRID removal; the remainder ovulated between 8 and 48 days after PRID removal (except one in which ovulation was never detected). All HP buffaloes were inseminated 72, 96 and 120 h after PRID removal; seven buffaloes ovulated within 5 days after PRID removal and two were pregnant. Mean diameter of the largest follicle was significantly smaller in HE than MP buffaloes the first 4 days after PRID removal. There was a parity by time interaction ( P=0.0047 ) for plasma progesterone concentrations; progesterone was higher in HE than MP buffaloes 1 day after PRID removal, but the converse was true 2 days after PRID removal. After induced ovulation, HE buffaloes exhibited a one-wave ( n=5; length of cycle, 8-12 days), two-wave ( n=4; range: 20-26 days) or three-wave cycle ( n=1; 25 days). In contrast, all non-pregnant MP buffaloes ( n=8 ) had a two-wave cycle (range: 19-25 days). For buffaloes with two-wave cycles, the growth rate and diameter of the largest follicle was significantly smaller in HE than MP buffaloes for both the first follicular wave (1.3mm versus 1.7 mm per day and 10.5 mm versus 13.3 mm, respectively) and the second

  1. Comparative evaluation of halothane anaesthesia in medetomidine-butorphanol and midazolam-butorphanol premedicated water buffaloes (Bubalus bubalis).

    PubMed

    Malik, V; Kinjavdekar, P; Amarpal; Aithal, H P; Pawde, A M; Surbhi

    2011-03-01

    Six clinically healthy male water buffaloes (Bubalus bubalis) 2-3 years of age and weighing 290-325 kg were used for 2 different treatments (H1 and H2). The animals of group H1 were premedicated with medetomidine (2.5 g/kg,i.v.) and butorphanol (0.05 mg/kg, i.v.), while in group H2 midazolam (0.25 mg/kg) and butorphanol (0.05 mg/kg) were used intravenously. Induction of anaesthesia was achieved by 5% thiopental sodium in H1 (3.85 +/- 0.63 mg/kg) and H2 (6.96 +/- 0.45 mg/kg) groups. The anaesthesia was maintained with halothane in 100 % oxygen through a large animal anaesthetic machine. Better analgesia and sedation with a significantly lower dose of thiopental for induction and significantly higher values of sternal recumbency time and standing time were recorded in group H1 than in group H2, whereas no significant (P > 0.05) difference for the halothane concentration was observed between groups H1 and H2. Significant decrease in heart rate was observed in group H1 whereas it significantly increased in group H2. In both groups, RR decreased during the preanaesthetic period, which increased significantly (P < 0.01) after halothane administration. In both groups a significant (P < 0.01) fallin RT was recorded from 20 min to the end of observation period. A significant (P < 0.05) fall in MAP was observed in group H1 from 15 min until the end, while in group H2 MAP increased nonsignificantly (P > 0.05) after premedication and a significant (P < 0.05) occurredafter thiopental administration. In both groups a significant (P < 0.01) increase in CVP and a significant (P < 0.01) decrease in SpO2 were observed after premedication which persisted up to 120 min. ECG changes included significant (P < 0.01) decrease and increase in QRS amplitudes in groups H1 and H2 respectively, a significant (P < 0.05) increase in PR interval was recorded at 15 min in group H1, a significant (P < 0.05) decrease in PR interval in group H2, a significant (P < 0.05) decrease in T wave amplitude

  2. Molecular characterization of oxytocin receptor gene in water buffalo (Bubalus bubalis).

    PubMed

    Arunmozhi, N; Singh, S K; Sarath, T; Agarwal, S K; Doiphode, A; Shankar, U

    2014-10-01

    Buffaloes are known for their productivity as compared to average yielding cows due to higher fat percentage, better feed conversion ability and disease resistance. On the other hand, the reproductive performances of buffaloes are often considered as poor owing to late sexual maturity, weak/silent oestrus, repeat breeder and prolonged intercalving interval. The study of cascade of events during oestrus and oestrous cycle can be useful for the improvement of reproductive efficiency of buffaloes. More precisely, the hormonal changes initiated at the molecular level within the animal determine the reproductive nature of the species. Nucleotide/protein sequence analysis serves as a vital tool in analysing the binding of the hormones for their effect or functions. In this study, we have reported cloning and characterization of the complete coding (cDNA) sequence of oxytocin receptor gene (OXTR) in buffaloes. Buffalo OXTR gene contains an uninterrupted ORF of 1176 nucleotides corresponding to an inferred polypeptide length of 391 amino acids (aa). The molecular weight of the deduced aa sequence was found to be 43 kDa with an isoelectric point of 9.253 and 16.328 charge at pH 7.0. The deduced protein sequence consists of 38 strongly basic (+) (K,R), 22 strongly acidic (-) (D,E), 186 hydrophobic (A, I, L, F, W, V) and 95 Polar (N, C, Q, S, T, Y) aa. Results indicated that aspartate (D) at aa position 85 and D, R and C at aa positions 136, 137 and 138, respectively, are conserved in buffaloes. The buffalo OXTR gene shared a per cent similarity ranging from 84.7 to 98.1 and 88.5 to 97.7 at nucleotide and deduced aa sequence levels, respectively, with that of other species. Phylogram constructed on the basis of either nucleotide or deduced aa sequences of buffalo OXTR gene showed that buffalo, cattle and sheep have diverged from human and swine and formed a separate clad. The buffalo sequence has shown maximum similarity and closeness with cattle followed by sheep both at

  3. Rapid sexing of water buffalo (Bubalus bubalis) embryos using loop-mediated isothermal amplification.

    PubMed

    Hirayama, Hiroki; Kageyama, Soichi; Takahashi, Yoshiyuki; Moriyasu, Satoru; Sawai, Ken; Onoe, Sadao; Watanabe, Keiko; Kojiya, Shinichi; Notomi, Tsugunori; Minamihashi, Akira

    2006-09-15

    Loop-mediated isothermal amplification (LAMP) is a novel DNA amplification method that amplifies a target sequence specifically under isothermal conditions. The objective of this study was to identify a Y chromosome-specific sequence in water buffalo and to establish an efficient procedure for embryo sexing by LAMP. The homologues of a Y chromosome-specific sequence, bovine repeat Y-associated.2, in swamp and river buffalo were cloned, and designated swamp buffalo repeat Y-associated.2 and river buffalo repeat Y-associated.2, respectively. Sexing by LAMP was performed using primers for swamp buffalo repeat Y-associated.2. A 12S rRNA was also amplified by LAMP as a control reaction in both male and female. The minimal amount of the template DNA required for LAMP appeared to be 0.1-10 pg. The sensitivity was further examined using swamp buffalo fibroblasts as templates. When fibroblasts were lysed with NaOH, the minimal cell number required for detection of both male-specific and male-female common DNA appeared to be two cells, whereas correct determination of sex could not be achieved using fibroblasts lysed by heat denaturation. Embryo sexing was also performed using blastomeres from interspecies nuclear transfer embryos. The sex determined by LAMP for blastomeres corresponded with the sex of nuclear donor cells in analyses using four or five blastomeres as templates. The LAMP reaction required only about 45 min, and the total time for embryo sexing, including DNA extraction, was about 1 h. In conclusion, the present procedure without thermal cycling and electrophoresis was reliable and applicable for water buffalo embryos.

  4. Follicle turnover and pregnancy rates following oestrus synchronization protocols in Mediterranean Italian buffaloes (Bubalus bubalis).

    PubMed

    Presicce, G A; Senatore, E M; De Santis, G; Bella, A

    2005-10-01

    An ultrasound assessment of follicle turnover following two different protocols for synchronization of oestrus and ovulation, as well as an assessment of achieved synchronization between ovulation and AI and conception rates in nulliparous and pluriparous buffaloes were carried out during months of increasing day length. Nulliparous buffaloes (n = 30) were subjected only to Ovsynch protocol whereas pluriparous buffaloes (n = 31) were assigned to Ovsynch (n = 14) or to PRID-pregnant mare serum gonadotrophin (PMSG) (n = 17) protocol according to the presence of functional CL confirming cyclic and acyclic conditions. Ultrasound examination of ovarian follicular dynamics at critical days in the course of synchronization treatments was employed to monitor the fate of the largest available follicles at the beginning of treatments. Such available dominant follicle would persist throughout the protocol as ovulating follicle (no-follicle shift) or would regress giving way to a new follicle to become dominant and ovulate (follicle shift). Furthermore, ultrasound monitoring would determine the degree of synchronization of ovulation and final outcome represented by pregnancy rates. Pregnancy rate following Ovsynch protocol was 40% (12/30) and 42.8% (6/14) in nulliparous and pluriparous buffaloes respectively (p = 0.8575). Most ovulations were synchronized and recorded at AI and the following day in nulliparous (24/30; 80%) and pluriparous (12/14; 85.7%) buffaloes respectively (p = 1.000). A follicle shift was recorded in 14 of 30 (46.6%) and 11 of 14 (78.5%) in nulliparous and pluriparous buffaloes respectively (p = 0.0466). Among established pregnancies: eight derived from follicle shift (66.6%) and four from no-follicle shift (33.3%) in nulliparous buffaloes, p = 0.0729 whereas in pluriparous buffaloes five (83.3%) derived from follicle shift and one from no-follicle shift (16.6%), p = 0.6154. Collectively, from 18 pregnancies in nulliparous and pluriparous buffaloes

  5. Follicle turnover and pregnancy rates following oestrus synchronization protocols in Mediterranean Italian buffaloes (Bubalus bubalis).

    PubMed

    Presicce, G A; Senatore, E M; De Santis, G; Bella, A

    2005-10-01

    An ultrasound assessment of follicle turnover following two different protocols for synchronization of oestrus and ovulation, as well as an assessment of achieved synchronization between ovulation and AI and conception rates in nulliparous and pluriparous buffaloes were carried out during months of increasing day length. Nulliparous buffaloes (n = 30) were subjected only to Ovsynch protocol whereas pluriparous buffaloes (n = 31) were assigned to Ovsynch (n = 14) or to PRID-pregnant mare serum gonadotrophin (PMSG) (n = 17) protocol according to the presence of functional CL confirming cyclic and acyclic conditions. Ultrasound examination of ovarian follicular dynamics at critical days in the course of synchronization treatments was employed to monitor the fate of the largest available follicles at the beginning of treatments. Such available dominant follicle would persist throughout the protocol as ovulating follicle (no-follicle shift) or would regress giving way to a new follicle to become dominant and ovulate (follicle shift). Furthermore, ultrasound monitoring would determine the degree of synchronization of ovulation and final outcome represented by pregnancy rates. Pregnancy rate following Ovsynch protocol was 40% (12/30) and 42.8% (6/14) in nulliparous and pluriparous buffaloes respectively (p = 0.8575). Most ovulations were synchronized and recorded at AI and the following day in nulliparous (24/30; 80%) and pluriparous (12/14; 85.7%) buffaloes respectively (p = 1.000). A follicle shift was recorded in 14 of 30 (46.6%) and 11 of 14 (78.5%) in nulliparous and pluriparous buffaloes respectively (p = 0.0466). Among established pregnancies: eight derived from follicle shift (66.6%) and four from no-follicle shift (33.3%) in nulliparous buffaloes, p = 0.0729 whereas in pluriparous buffaloes five (83.3%) derived from follicle shift and one from no-follicle shift (16.6%), p = 0.6154. Collectively, from 18 pregnancies in nulliparous and pluriparous buffaloes

  6. Pregnancies established from handmade cloned blastocysts reconstructed using skin fibroblasts in buffalo (Bubalus bubalis).

    PubMed

    Shah, R A; George, A; Singh, M K; Kumar, D; Anand, T; Chauhan, M S; Manik, R S; Palta, P; Singla, S K

    2009-05-01

    Handmade cloning (HMC), a simple, micromanipulation-free cloning technique, has been applied for the production of cloned embryos and offspring in many livestock species. The objective of the present study was to compare the effect of donor cell type on developmental competence of HMC embryos and to explore the possibility of establishing pregnancies using these embryos in buffalo. After technical optimization of the HMC procedure for in vitro development of cloned blastocysts, various donor cells were compared for their developmental efficiency. Using buffalo fetal-, newborn-, adult fibroblasts and cumulus cells, blastocyst production rates obtained from reconstructed embryos were 24.0+/-1.8% (35/145), 33.0+/-8.0% (56/163), 21.0+/-9.3% (29/133) and 49.6+/-1.9% (77/154), respectively. Blastocyst rates were higher (P<0.05) in cumulus cell reconstructed embryos in comparison to those derived from fetal or adult fibroblasts. Pregnancy diagnosis (transrectal ultrasonography) was carried out at Day 40 of gestation. Following transfer of HMC embryos reconstructed using newborn fibroblasts 25% (2/8) buffaloes were pregnant and are at Days 201 and 94 of gestation, whereas after transfer of HMC embryos reconstructed using fetal fibroblasts, 20% (1/5) buffaloes were pregnant and are at Day 73 of gestation. In conclusion, HMC could be a simple and efficient technique for the production of cloned embryos for establishing pregnancies in buffalo.

  7. Molecular detection of bovine immunodeficiency virus in water buffaloes (Bubalus bubalis) from the Amazon region, Brazil.

    PubMed

    Albernaz, Tatiane Teles; Leite, Rômulo Cerqueira; Reis, Jenner Karlison Pimenta; de Sousa Rodrigues, Ana Paula; da Cunha Kassar, Telissa; Resende, Claudia Fideles; de Oliveira, Cairo Henrique Sousa; Silva, Rafaela das Mercês; Salvarani, Felipe Masiero; Barbosa, José Diomedes

    2015-12-01

    Bovine immunodeficiency is a chronic progressive disease caused by a lentivirus that affects cattle and buffaloes. Although the infection has been described in cattle in some countries, including in Brazil, there are only two reports of infection in buffaloes: one in Pakistan and one in Cambodia. The aim of the present study was to survey the occurrence of bovine immunodeficiency virus (BIV) in water buffaloes from the Amazon region, Pará state, Brazil. BIV proviral DNA was surveyed in 607 whole blood samples of water buffaloes from 10 farms located in the state of Pará using semi-nested polymerase chain reaction (PCR) (PCR-SN) to amplify the pol region of the viral genome. Of the 607 samples tested, 27 (4.4 %) were positive for BIV proviral DNA. The amplified fragments were confirmed by sequence analysis after cloning and nucleotide sequencing. The sequence obtained had 99 % similarity to the reference strain (R-29). The present study provides important epidemiological data because BIV was detected for the first time in water buffaloes in Brazil. Further, the results suggest the possibility of the virus being a risk factor for herd health because it may be a potential causal agent of chronic disease and, also may be associated to other infectious diseases.

  8. Serum concentrations of haptoglobin and serum amyloid A in water buffaloes (Bubalus bubalis) with abomasal ulcer.

    PubMed

    Tajik, Javad; Nazifi, Saeed; Heidari, Mahdi; Babazadeh, Marzieh

    2012-01-01

    To evaluate the serum concentrations of haptoglobin (Hp) and serum amyloid A (SAA) in water buffaloes with abomasal ulcers, the abomasums of 100 randomly selected water buffaloes were examined after slaughter. Type I abomasal ulcers were found in 56 out of 100 buffaloes. Serum concentrations of Hp and SAA were measured. There was no significant difference between affected and non-affected buffaloes in the serum concentrations of Hp and SAA. The serum concentrations of Hp and SAA had no significant correlation with age and the serum SAA revealed no significant correlation with the number of abomasal ulcers. A significant correlation was found between the serum Hp and the number of abomasal ulcers (r =0.29, p = 0.04). There was no significant difference in the serum concentrations of Hp and SAA between buffaloes with different ulcer locations in the abomasums. Although more work on a larger number of animals is required in this area, it seems that the measurement of the serum Hp can be used to predict the abundance of type I abomasal ulcers.

  9. A simplified laparoscopy technique for repeated ovarian observation in the water buffalo (Bubalus bubalis).

    PubMed

    Ambrose, J D; Manik, R S; Singla, S K; Madan, M L

    1993-09-01

    A simplified technique of laparoscopy was developed for ovarian observation in the riverine buffalo, through a right paralumbar incision. The technique differed from previously described ones in that it involved only a single puncture and required no abdominal insufflation. A Hopkins 0 degrees forward viewing endoscope (5.5 mm x 500 mm) in combination with an endoscope sheath having a built-in instrument channel, and a long flexible forceps (630 mm) were used. Of the 23 observation attempts on 13 buffalo, 21 successful observations were conducted. Laparoscopies were performed using a combination of Xylazine, local infiltration and epidural anesthesia in a standing position. Six repeated observations were made within a 21-day period on 1 buffalo, with no postoperative complications. Observation of both left and right ovaries was possible through the same puncture. The technique was useful in buffalo to confirm ovarian structures which could not be determined with certainty through palpation per rectum. Our results suggest that the single puncture laparoscopy technique can be safely used for repeated ovarian examination in the water buffalo.

  10. Diagnosis of Sarcocystis spp. in cattle (Bos taurus) and water buffalo (Bubalus bubalis) in Northern Vietnam.

    PubMed

    Jehle, C; Dinkel, A; Sander, A; Morent, M; Romig, T; Luc, P V; De, T V; Thai, V V; Mackenstedt, U

    2009-12-23

    Our aim was to develop a method for species diagnosis and to obtain data on the prevalence of Sarcocystis infections in cattle and water buffalo in the Son La Province of Northern Vietnam. Meat samples of naturally infected animals were examined by light and electron microscopy as well as by molecular methods. A PCR of part of the 18S rDNA gene followed by RFLP analysis was modified to detect infections with different Sarcocystis spp. in cattle and water buffaloes slaughtered in the Son La Province. It showed to be an economical method to detect multiple infections with Sarcocystis spp. Sequence analysis of the PCR amplicons was performed with selected samples and the results were compared with published sequences. With these methods the following Sarcocystis spp. were identified in cattle: Sarcocystis hirsuta, Sarcocystis cruzi and Sarcocystis hominis. Water buffaloes were infected with Sarcocystis fusiformis, S. cruzi, S. hominis and S. hirsuta. The results indicate that Sarcocystis spp. infecting cattle are also able to infect water buffaloes. So the validity of certain Sarcocystis spp. of water buffalo is discussed. Bovine lifestock in Northern Vietnam were commonly infected with Sarcocystis spp.

  11. Pheno- and genotyping of Brucella abortus biovar 5 isolated from a water buffalo (Bubalus bubalis) fetus: First case reported in the Americas.

    PubMed

    Martínez, Diana; Thompson, Carolina; Draghi, Graciela; Canavesio, Vilma; Jacobo, Roberto; Zimmer, Patricia; Elena, Sebastián; Nicola, Ana M; de Echaide, Susana Torioni

    2014-09-17

    An isolate of Brucella spp. from an aborted water buffalo (Bubalus bubalis) fetus was characterized based on its pheno- and genotype. The phenotype was defined by carbon dioxide requirement, hydrogen sulfide production, sensitivity to thionin and basic fuchsin and agglutination with Brucella A and M monospecific antisera. The genotype was based on the amplification of the following genes: bcsp31, omp2ab, and eri and the species-specific localization of the insertion sequence IS711 in the Brucella chromosome via B. abortus-B. melitensis-B. ovis-B. suis (AMOS)-PCR. Unexpectedly, the isolate showed a phenotype different from B. abortus bv 1, the most prevalent strain in cattle in Argentina, and from vaccine strain 19, currently used in bovines and water buffaloes. Genotyping supported the phenotypic results, as the analysis of the omp2ab gene sequence showed an identical pattern to either B. abortus bv 5 or B. melitensis. Finally, the AMOS PCR generated a 1700-bp fragment from the isolate, different than those amplified from B. abortus bv 1 (498bp) and B. melitensis (731bp), confirming the presence of B. abortus bv 5. The OIE/FAO Reference Laboratory for Brucellosis confirmed this typing. This is the first report of B. abortus bv 5 from a water buffalo in the Americas.

  12. Interleukin-12 subunits p35 and p40 of Indian water buffalo (Bubalus bubalis) maintain high sequence homology with those of other ruminants.

    PubMed

    Premraj, A; Sreekumar, E; Nautiyal, B; Rasool, T J

    2005-06-01

    The immune system of Indian water buffalo (Bubalus bubalis), one of the major dairy animals of the tropics, has received little attention. cDNAs encoding the two subunits of the heterodimeric interleukin (IL)-12 of Indian water buffalo were isolated from concanavalin A-stimulated lymphocytes. The 710-bp p35 and 1012-bp p40 subunits were amplified by reverse transcriptase polymerase chain reaction (RT-PCR), cloned, sequenced and compared with other ruminant sequences. The IL-12 p35 subunit cDNA had nine nucleotide variations and shared 98.1% amino acid identity with the cattle IL-12 p35. The IL-12 p40 cDNA had 13 nucleotide variations and had 97.5% amino acid identity with the cattle IL-12 p40. Both the subunits showed strict conservation in the predicted secondary structure and critical amino acid residues compared with other ruminant IL-12 molecules. Buffalo IL-12 p40 recombinant protein expressed in Escherichia coli cross-reacted with cattle anti-IL-12 p40 monoclonal antibody. Our study indicates a high level of conservation of this key cytokine among ruminants.

  13. Standardisation of an indirect enzyme-linked immunosorbent assay for the detection of Brucella antibodies in milk from water buffalo (Bubalus bubalis) in Italy.

    PubMed

    Tittarelli, Manuela; Bonfini, Barbara; De Massis, Fabrizio; Giovannini, Armando; Scacchia, Massimo

    2011-01-01

    An indirect enzyme-linked immunosorbent assay (ELISA) was evaluated for the detection of Brucella antibodies in milk from water buffalo (Bubalus bubalis Linnaeus, 1758). The test accuracy was evaluated on milk samples from the Campania Region in Italy. A total of 100 negative samples were collected from 10 officially brucellosis-free herds in Salerno Province, while 30 positive samples were collected from 3 herds in Caserta Province, where animals gave positive results to the official tests and it was here that Brucella abortus biovar 1 had been isolated. Test sensitivity was 100%, with a confidence interval (CI) of 90.8%-100%, while specificity was 98% (CI 93%-99.4%) on individual milk samples. To simulate bulk milk samples from herds infected at various levels of infection, dilutions from 1:10 to 1:100 of positive milk samples in negative milk were also used. The probability of detecting antibodies in positive milk samples was higher than 50% up to a dilution of 1:50 in negative milk. Considering the average national water buffalo herd size, the probability of identifying infection in a water buffalo herd by bulk milk testing is 50% (CI 33.1%-66.9%) in the worst case scenario of a single infected animal contributing to the bulk milk.

  14. High nucleotide and amino acid sequence similarities in tumour necrosis factor-alpha amongst Indian buffalo (Bubalus bubalis), Indian cattle (Bos indicus) and other ruminants.

    PubMed

    Gupta, P K; Bind, R B; Walunj, S S; Saini, M

    2004-08-01

    Tumour necrosis factor-alpha (TNF-alpha) mRNA from Indian water buffalo (Bubalus bubalis) and Indian cattle (Bos indicus) was reverse transcribed and amplified using reverse transcriptase-polymerase chain reaction (RT-PCR). The nucleotide sequences of cDNAs were determined after cloning into pGEM-T-Easy vector (Promega, Madison, WI) and compared with reported nucleotide sequences of TNF-alpha cDNA from other species. The nucleotide sequences of TNF-alpha from Indian cattle revealed significantly high similarities at nucleotide (99.2%) and amino acid (100%) levels with those of cattle (Bos taurus; Zebu). The sequences from buffalo had 98.4% nucleotide and 99.1% amino acid similarities with Indian cattle, indicating functional cross-reactivity. One amino acid deletion at position 63 and one substitution (A-->P) at position 64 were observed in buffalo compared with Indian cattle. The amino acid deletion at position 63 was predicted due to differences in pre-mRNA splicing.

  15. Bovine herpesvirus 6 in buffaloes (Bubalus bulalis) from the Amazon region, Brazil.

    PubMed

    de Oliveira, Cairo Henrique Sousa; de Oliveira, Fernanda Gonçalves; Gasparini, Marcela Ribeiro; Galinari, Grazielle Cossenzo Florentino; Lima, Graciela Kunrath; Fonseca, Antônio Augusto; Barbosa, José Diomedes; Barbosa-Stancioli, Edel Figueiredo; Leite, Rômulo Cerqueira; Dos Reis, Jenner Karlisson Pimenta

    2015-02-01

    This study presents the first description of Bovine herpesvirus 6 (BoHV-6) that was isolated from buffaloes of Amazon region in Brazil. Phylogenetic analysis showed that the BoHV-6 Brazilian strains clustered with the sequence of BoHV-6 from elsewhere available at the GenBank. It was observed in some buffaloes with lymphoproliferative disease in one herd, thus the animals were also tested for Bovine leukemia virus (BLV), which has been associated to lymphoma in bovines. All animals were negative to BLV. These results indicate that BoHV-6 is present in buffaloes in Brazil, but the importance and impact of this infection and its association with any illness is still undefined.

  16. A radiation hybrid map of river buffalo (Bubalus bubalis) chromosome 1 (BBU1).

    PubMed

    Miziara, M N; Goldammer, T; Stafuzza, N B; Ianella, P; Agarwala, R; Schaffer, A A; Elliott, J S; Riggs, P K; Womack, J E; Amaral, M E J

    2007-01-01

    The largest chromosome in the river buffalo karyotype, BBU1, is a submetacentric chromosome with reported homology between BBU1q and bovine chromosome 1 and between BBU1p and BTA27. We present the first radiation hybrid map of this chromosome containing 69 cattle derived markers including 48 coding genes, 17 microsatellites and four ESTs distributed in two linkage groups spanning a total length of 1330.1 cR(5000). The RH map was constructed based on analysis of a recently developed river buffalo-hamster whole genome radiation hybrid (BBURH(5000)) panel. The retention frequency of individual markers across the panel ranged from 17.8 to 52.2%. With few exceptions, the order of markers within linkage groups is identical to the order established for corresponding cattle RH maps. The BBU1 map provides a starting point for comparison of gene order rearrangements between river buffalo chromosome 1 and its bovine homologs.

  17. Clinical, haematological and therapeutic studies on tropical theileriosis in water buffaloes (Bubalus bubalis) in Egypt.

    PubMed

    Osman, Salama A; Al-Gaabary, Magdy H

    2007-05-31

    Thirty buffaloes naturally infected with Theileria annulata and 10 parasitologically free controls were used to determine the potential clinical, haematological and therapeutic impact of tropical theileriosis in Egypt. The clinical signs in the infected buffaloes were pyrexia (40.5-41.5 degrees C), enlargement of superficial lymph nodes, slight nasal and ocular discharges, salivation, anaemia and respiratory distress. Eye lesions also were recorded. There was a significant decrease in erythrocyte counts and haemoglobin content and a significant decrease in total leucocyte counts in infected buffaloes compared to controls. Early treatment with buparvaquone was 100% effective in eliminating the protozoan parasites from the blood and lymph nodes and led to an improvement in the clinical state whereas treatment in the later stages of the disease whilst eliminating the parasites failed to improve the clinical condition of the animal.

  18. Histology and ultrastructure of the lymph nodes of the buffalo (Bos bubalus).

    PubMed

    Zidan, M; Pabst, R

    2015-06-01

    Pre-scapular, femoral and mesenteric lymph nodes from five buffalo calves and five buffalo bulls were studied using light and transmission electron microscopy. The nodes were surrounded with a thin capsule of dense connective tissue and smooth muscles. Subcapsular and trabecular lymphatic sinuses were lined with endothelial cells resting on a basement membrane. The cortex was formed by lymphoid follicles and inter-follicular lymphocytes. Primary and secondary follicles were observed. The medulla was made up of medullary cords of lymphocytes separated by lymphatic sinuses. These sinuses were lined with a discontinuous epithelium and interestingly crossed by reticular fibres. High endothelial venules were found in the paracortical area. Several lymphocytes were observed infiltrating the wall of these venules. The lymph nodes of the Egyptian water buffalo showed a typical structure compared with the majority of mammals, with no age-related structural variation.

  19. Ketosis in buffalo (Bubalus bubalis): clinical findings and the associated oxidative stress level.

    PubMed

    Youssef, Mohamed A; El-Khodery, Sabry Ahmed; El-deeb, Wael M; Abou El-Amaiem, Waleed E E

    2010-12-01

    As little is known about the oxidant/antioxidant status in buffalo with ketosis, the present study was delineated to assess the oxidative stress level associated with clinical ketosis in water buffalo. A total of 91 parturient buffalo at smallholder farms were studied (61 suspected to be ketotic and 30 healthy). Clinical and biochemical investigations were carried out for each buffalo. Based on clinical findings and the level of beta-hydroxybutyrate (BHB), buffalo were allocated into ketotic (42), subclinical cases (19). Clinically, there was an association between clinical ketosis and anorexia (p<0.001), constipation (p<0.001), decreased milk yield (p<0.001), ruminal stasis (p<0.001), and loss of body condition (p<0.01). Biochemically, in clinical ketosis compared with subclinical and control cases, there was a significant increase (p<0.05) of BHB, malondialdehyde (MDA), nitric oxide (NO), aspartate aminotransferase (AST), L-alanine aminotransferase (ALT). However, there was a significant decrease of glucose, phosphorus, magnesium,total cholesterol and HDL-cholesterol. There was a positive correlation between BHB and MDA (r=0.433), BHB and NO (r=0.37), MDA and NO (r=0.515), and Glucose and phosphorus(r=0.521). However, there was a negative correlation between BHB and glucose (r= -0.341) and HDL and NO (r= -0.379). The result of the present study indicates that hyperketonemia in buffalo is associated with an increase of oxidative stress levels. Further studies need to be done on the efficacy of antioxidants as an ancillary treatment to relief the oxidative stress caused by ketosis.

  20. Endocrinological evaluation of the induction of superovulation with PMSG in water buffalo (Bubalus bubalis).

    PubMed

    Schallenberger, E; Wagner, H G; Papa, R; Hartl, P; Tenhumberg, H

    1990-08-01

    Ten nonlactating buffalo were superovulated with 3000 IU PMSG. Luteolysis was induced with 500 microg Cloprostenol (PG) 60 and 72 h after PMSG. Five buffalo were alloted for natural mating and five were bred by artificial insemination 60 and 84 h after the first PG treatment. Since four buffalo developed pyometra, only 6 of 10 underwent embryo collection successfully 180 to 190 h after PG. Three buffalo yielded only one morula each, while the remaining three yielded a total of two, three and four morulae and/or blastocysts as well als zero, one and three unfertilized ova, respectively. Six of the ten buffalo were assigned to an intensive blood collection regimen. Mean concentrations of progesterone (ng/ml) increased from 1.9 at PMSG stimulation to 4.8 at induction of luteolysis and decreased to a nadir of 0.2 about 72 h after PG treatment. The preovulatory surge of LH occurred 36 +/- 9 h after PG and was low in magnitude (7.3 +/- 1.3 ng/ml). Stimulation of 3 to 12 follicles resulted in concentrations of estradiol-17beta exceeding 5 pg/ml within 48 h after PMSG treatment and reaching a maximum of 32 +/- 11 pg/ml about the time of the preovulatory surge. Only in two individuals did concentrations decrease below 5 pg/ml within the following 12 h. In the other four buffalo 3 to 10 unovulated structures remained palpable, secreting estradiol-17beta far exceeding the preovulatory concentrations. The fast appearing, low magnitude LH surges were key problems resulting from PMSG treatment. They caused unovulated endocrinologically active follicles. High estrogen levels during the early luteal period may activate subclinical uterine infections, which in turn may negatively affect embryonic development.

  1. Soya-lecithin in extender improves the freezability and fertility of buffalo (Bubalus bubalis) bull spermatozoa.

    PubMed

    Akhter, S; Ansari, M S; Andrabi, S M H; Rakha, B A; Ullah, N; Khalid, M

    2012-10-01

    Egg yolk is routinely used as a cryoprotectant in semen extenders. However, it may contain cryoprotective antagonists, and there are hygienic risks associated with its use. Proteins of plant origin, like soya-lecithin, lack these hazards. The aim of this study was to use soya-lecithin as a cryoprotectant in extender and to investigate its effects on in vitro quality and in vivo fertility of buffalo semen. Semen from three buffalo bulls was frozen in tris-citric extender containing 5.0%, 10% or 15% soya-lecithin or 20% egg yolk. Sperm motility, plasma membrane integrity and viability were assessed post-dilution, pre-freezing and post-thaw. In Post-dilution and pre-freezing, the values for motility, plasma membrane integrity and viability remained higher (p ≤ 0.05) in extenders containing 10% soya-lecithin and control compared with extender containing 5% and 15% soya-lecithin. However, motility, plasma membrane integrity and viability were higher (p < 0.05) in extender containing 10% soya-lecithin compared with control and extenders containing 5% and 15% soya-lecithin. Semen from two buffalo bulls was frozen in tris-citric extender containing either 10% soya-lecithin or 20% egg yolk. Higher (p < 0.05) fertility rate was recorded in buffaloes inseminated with semen containing 10% soya-lecithin (56%) compared with 20% egg yolk (41.5%). The results suggest that 10% soya-lecithin in extender improves the freezability and fertility of buffalo bull spermatozoa and can be used as an alternate to egg yolk in cryopreservation of buffalo semen.

  2. Molecular characterization of MHC-DRB cDNA in water buffalo (Bubalus bubalis).

    PubMed

    Naskar, Soumen; Deb, Sitangsu M; Niranjan, Saket K; Kumar, Subodh; Sharma, Deepak; Sakaram, Durgam; Sharma, Arjava

    2012-01-01

    In the present study, water buffalo MHC (Bubu)-DRB cDNA was cloned and characterized. The 1022 base long-amplified cDNA product encompassed a single open reading frame of 801 bases that coded for 266 amino acids. The Bubu-DRB sequence showed maximum homology with the BoLA-DRB3*0101 allele of cattle. A total of seven amino acid residues were found to be unique for the Bubu-DRB sequence. The majority of amino acid substitutions was observed in the β(1) domain. Residues associated with important functions were mostly conserved. Water buffalo DRB was phylogenetically closer to goat DRB*A.

  3. Dystocia due to urinary bladder carcinoma in two water buffaloes (bubalus bubalis) - Clinical case report.

    PubMed

    Nanda, A S; Sharma, R D

    1985-09-01

    Two buffaloes with full-term pregnancy suffered from dystocia because the cervix did not dilate in spite of strong labour pains and other parturition signs shown by each animal. The urinary bladder, cervix, vagina and surrounding area were very firm. Dead, emphysemated fetuses were removed by caesarean in each case and anuria was also noticed. One buffalo died and the other was euthanised after surgery because it did not improve. The post-mortem examinations revealed transitional cell carcinoma of urinary bladder infiltrating the cervix, vagina and surrounding area in each case.

  4. Studies on activation and levels of haemolytic complement of buffalo (Bubalus bubalis). 1. Classical complement pathway.

    PubMed

    Jain, A; Goel, M C

    1989-12-01

    Optimum conditions for haemolytic complement (HC) assay in buffalo serum were standardized. In all, 11 indicator systems of red blood cells (RBC) and haemolysins were investigated. Maximum HC CH50 titre was obtained with rabbit RBC sensitized with goat haemolysin. The effect of pH, Ca2+ and Mg2+ concentration, ionic strength, time and temperature were studied. Of all the variables, ionic strength influenced the HC activity most significantly. The standard system for titrating the HC consisted of rabbit RBC sensitized with goat haemolysin, sucrose-veronal buffer with pH 7.5, ionic strength 0.023 M and Ca2+ and Mg2+ concentrations 6 x 10(-4) and 2 x 10(-3) M, respectively. Incubation at 37 degrees C for 2 h gave highest haemolytic activity. With this protocol 5-7-fold higher HC activity was recorded than with prestandardized conditions. Levels of HC were determined in the sera of 98 buffaloes aged from 1 month to 12 years. The lowest mean CH50 units of 401 +/- 0.35 per ml were recorded in buffalo calves below 3 months of age. The mean HC levels increased with age, reaching peak values of 2349 +/- 62.25 CH50 units/ml in 2-3-year-old buffalo. Animals in the age group 5-12 years had significantly decreased (P less than 0.05) mean HC levels of 1545 +/- 68.94.

  5. Synaptonemal complex analysis of hybrid and purebred water buffaloes (Bubalus bubalis).

    PubMed

    Dai, K; Gillies, C B; Dollin, A E; Hilmi, M

    1994-01-01

    The morphology of the synaptonemal complex (SC) in river (2n = 50) and swamp (2n = 48) water buffaloes and their hybrids, was studied by electron microscopic analysis. In 2n = 49 hybrids, F2 and backcrosses the formation and pairing behaviour of a trivalent at zygotene-pachytene confirmed that river and swamp buffaloes differ by a centromere-to-telomere (C-T) tandem fusion. While 29% of spermatocytes from a purebred river buffalo and 16% from a purebred swamp buffalo had pairing abnormalities, a significantly higher frequency of abnormalities (48-72%) was recorded in F1, F2, and backcrosses with 2n = 48, 49 or 50. Highest abnormality frequencies occurred in 2n = 49 bulls. Abnormal pairing configurations often resulted from interactions between unpaired chromosome axes or segments. Zygotene-pachytene meiotic progress appeared delayed in hybrid bulls, and the frequency of SC abnormalities decreased from XY type I substage to type V substage. The variation in SC abnormality data from hybrids was consistent with the levels of sperm abnormality previously reported.

  6. Identification of pregnancy-associated glycoproteins by peptide mass fingerprinting in water buffalo (Bubalus bubalis).

    PubMed

    Kumar, Pradeep; Saxena, Abhishake; Singh, S K; Sharma, R K; Singh, I; Agarwal, S K

    2014-08-01

    Ruminant placentas synthesize pregnancy-associated glycoproteins (PAGs) during pregnancy, which serve as biomarkers of pregnancy. The present study was conducted to verify, whether PAGs are expressed in buffalo placenta by using lectin-based affinity chromatography and peptide mass finger printing (PMF). Fetal cotyledonary tissues were collected from gravid uteri procured from slaughtered house. Proteins were extracted and subjected to wheat germ agglutinin (WGA) lectin affinity chromatography to isolate the PAGs. The isolated glycoproteins were separated by one-dimensional SDS-PAGE. PMF results of the 75 kDa protein revealed presence of two PAGs (PAG-7 and -11). The PAG-7 consisted of about 170 mass signals, of which 16 were assigned to corresponding/translated cDNA sequences of buffalo PAG-7, leading to sequence coverage of 40%. PMF result of PAG-11 showed 170 mass signals, of which 15 were assigned to buffalo PAG-11, leading to sequence coverage of 34%. In conclusion, the glycoprotein isolated from placental extract corresponding to 75 kDa band on SDS PAGE gel was a mixture of PAG-7 and -11, which may help in development of suitable diagnostics for pregnancy in buffalo.

  7. Changes in biochemical composition of follicular fluid during reproductive acyclicity in water buffalo (Bubalus bubalis).

    PubMed

    Khan, F A; Das, G K; Pande, Megha; Mir, R A; Shankar, Uma

    2011-08-01

    This study describes the changes in biochemical composition of follicular fluid during reproductive acyclicity in buffalo. A total of 73 pairs of ovaries collected from 26 reproductively acyclic and 47 reproductively cyclic buffaloes were used in the investigation. Ovarian follicles were classified into small (5.0-6.9 mm), medium (7.0-9.9 mm) and large (≥10.0 mm) sized categories depending upon their diameter. Follicular fluid was aspirated, processed and assayed for glucose, cholesterol, total protein, acid phosphatase and alkaline phosphatase. Glucose concentration was lesser in reproductively acyclic compared to cyclic buffaloes (19.3 ± 2.59 mg/dl compared to 32.6 ± 2.60 mg/dl; P<0.05), mainly due to difference in concentration between small sized follicles (12.4 ± 2.59 mg/dl compared to 28.0 ± 3.32 mg/dl; P<0.05). Cholesterol concentration was also lesser in reproductively acyclic compared to cyclic buffaloes (32.2 ± 2.14 mg/dl compared to 35.5 ± 2.16 mg/dl; P<0.05) and this was related to the lesser concentration found in large follicles (13.8 ± 3.45 mg/dl compared to 37.2 ± 4.10mg/dl; P<0.001). Total protein and acid phosphatase levels were not affected by either the reproductive cyclicity status or the follicular size (4.9 ± 1.07 g/dl to 6.0 ± 0.28 g/dl and 1.2 ± 0.17 U/dl to 2.5 ± 1.22 U/dl, respectively). An increased alkaline phosphatase activity was, however, observed in reproductively acyclic compared to cyclic buffaloes (27.5 ± 3.08 U/dl compared to 14.0 ± 1.09 U/dl; P<0.0001). In conclusion, results of the present study indicate an alteration in the biochemical composition of follicular fluid during reproductive acyclicity in buffalo. The findings provide further support to the notion that poor nutrition is an important factor triggering reproductive acyclicity in buffalo.

  8. Collagen-IV supported embryoid bodies formation and differentiation from buffalo (Bubalus bubalis) embryonic stem cells

    SciTech Connect

    Taru Sharma, G.; Dubey, Pawan K.; Verma, Om Prakash; Pratheesh, M.D.; Nath, Amar; Sai Kumar, G.

    2012-08-03

    Graphical abstract: EBs formation, characterization and expression of germinal layers marker genes of in vivo developed teratoma using four different types of extracellular matrices. Highlights: Black-Right-Pointing-Pointer Collagen-IV matrix is found cytocompatible for EBs formation and differentiation. Black-Right-Pointing-Pointer Established 3D microenvironment for ES cells development and differentiation into three germ layers. Black-Right-Pointing-Pointer Collagen-IV may be useful as promising candidate for ES cells based therapeutic applications. -- Abstract: Embryoid bodies (EBs) are used as in vitro model to study early extraembryonic tissue formation and differentiation. In this study, a novel method using three dimensional extracellular matrices for in vitro generation of EBs from buffalo embryonic stem (ES) cells and its differentiation potential by teratoma formation was successfully established. In vitro derived inner cell masses (ICMs) of hatched buffalo blastocyst were cultured on buffalo fetal fibroblast feeder layer for primary cell colony formation. For generation of EBs, pluripotent ES cells were seeded onto four different types of extracellular matrices viz; collagen-IV, laminin, fibronectin and matrigel using undifferentiating ES cell culture medium. After 5 days of culture, ESCs gradually grew into aggregates and formed simple EBs having circular structures. Twenty-six days later, they formed cystic EBs over collagen matrix with higher EBs formation and greater proliferation rate as compared to other extracellular matrices. Studies involving histological observations, fluorescence microscopy and RT-PCR analysis of the in vivo developed teratoma revealed that presence of all the three germ layer derivatives viz. ectoderm (NCAM), mesoderm (Flk-1) and endoderm (AFP). In conclusion, the method described here demonstrates a simple and cost-effective way of generating EBs from buffalo ES cells. Collagen-IV matrix was found cytocompatible as it

  9. Pregnancy rates following AI with sexed semen in Mediterranean Italian buffalo heifers (Bubalus bubalis).

    PubMed

    Campanile, G; Gasparrini, B; Vecchio, D; Neglia, G; Senatore, E M; Bella, A; Presicce, G A; Zicarelli, L

    2011-08-01

    The use of sexed semen in farm animal production and genetic improvement has been shown to be feasible with variable degree of efficiency in a number of species, and proved to be economically viable in cattle. In the last two decades, various newly developed reproductive technologies applicable in buffaloes have mushroomed. Recently, following the birth of the first buffalo calves using AI with sexed semen, commercial interest to exploit sexing of semen in this species too is aroused. In order to verify the successful adoption of this technology in the buffalo, the present study on the use of sexed semen for AI was carried out and compared with conventional artificial insemination using nonsexed semen. A total of 379 buffalo heifers were used for synchronization of ovulation using the Presynch protocol in the South of Italy. Selected animals at the time of AI were randomly allocated to three different experiment groups: (1) 102 animals subjected to AI in the body of the uterus with sexed semen (SS body); (2) 104 animals subjected to AI in the horn of the uterus with sexed semen (SS horn); and (3) 106 animals subjected to AI in the body of the uterus with conventional nonsexed semen (NSS body). Semen of three buffalo bulls was sexed by a collaborating company and commercially distributed in 0.25 mL straws with a total of 2 million sexed spermatozoa. Pregnancy rates were first assessed at Day 28 following AI, and rechecked at Day 45 by ultrasound. Pregnancy rates were nonsignificantly different between animals inseminated with sexed or nonsexed semen: 80/206 (38.8%) and 40/106 (37.7%), respectively (P = 0.85). However, site of insemination of sexed semen affected pregnancy rate significantly as higher pregnancy rates were obtained when sexed semen was deposited into the body rather than the horn of the uterus: 46/101 (45.5%) and 34/105 (32.3%), respectively (P = 0.05). In conclusion, the use of sexed semen in buffalo heifers gave satisfactory and similar pregnancy

  10. Development of buffalo (Bubalus bubalis) embryonic stem cell lines from somatic cell nuclear transferred blastocysts.

    PubMed

    Shah, Syed Mohmad; Saini, Neha; Ashraf, Syma; Singh, Manoj K; Manik, Radheysham; Singla, Suresh K; Palta, Prabhat; Chauhan, Manmohan Singh

    2015-11-01

    We developed buffalo embryonic stem cell lines from somatic cell nuclear transfer derived blastocysts, produced by hand-guided cloning technique. The inner cell mass of the blastocyst was cut mechanically using a Microblade and cultured onto feeder cells in buffalo embryonic stem (ES) cell culture medium at 38 °C in a 5% CO2 incubator. The stem cell colonies were characterized for alkaline phosphatase activity, karyotype, pluripotency and self-renewal markers like OCT4, NANOG, SOX2, c-Myc, FOXD3, SSEA-1, SSEA-4, TRA-1-60, TRA-1-81 and CD90. The cell lines also possessed the capability to differentiate across all the three germ layers under spontaneous differentiation conditions. PMID:26987926

  11. Plasma hormonal and electrolyte alterations in cycling buffaloes ( Bubalus bubalis) during hot summer months

    NASA Astrophysics Data System (ADS)

    Singh, Narinder; Chaudhary, K. C.

    1992-09-01

    Plasma levels of progesterone, prolactin, luteinizing hormone, and electrolytes were monitored by radioimmunoassay in ten cycling buffaloes maintained at Punjab Agricultural University, Ludhiana during the hot summer months of June July. The plasma progesterone concentration ranged from 0.28±0.04 to 3.09±0.03 ng/ml at various stages of the oestrous cycle. Prolactin values ranged from 319±23 to 371±25 ng/ml and LH levels from 0.95±0.05 to 1.35±0.08 ng/ml. Concentrations differed significantly ( P⩽0.05) at various stages of the cycle. Levels of electrolytes, viz. Ca+ +, Na+ and K+, were well within the normal range. The high levels of prolactin, progesterone and LH during the hot summer were assessed in relation to poor reproductive efficiency in buffaloes.

  12. A new surgical approach to internal genitalia in water buffalo (Bubalus bubalis): a preliminary study.

    PubMed

    Petrov, M; Karaivanov, C; Petrov, D

    1994-02-01

    New surgical access to internal genitalia through either the left or right lateral wall of the pelvic cavity was sought in 3 multiparous buffalo cows. (MurrahxMediterranean buffalo crossbreed). An incision 12 to 13 cm long was made in the dorso-caudal part of the regio glutea, equidistant from the tuber ischiadicum and the most prominent point of the crista sacralis mediana (in the space confined dorsally by the caudal part of os sacrum and first 2 to 3 vertebrae coccygeae and ventrally by the spina ischiadica of os ischii), just at the site where the lateral wall of the pelvic cavity is thinnest. Ovaries, oviducts and uterine horns were successfully exteriorized through this glutea approach in all 3 animals.

  13. Molecular characterization of Trypanosoma evansi isolates from water buffaloes (Bubalus bubalis) in the Philippines.

    PubMed

    Villareal, Marjo V; Mingala, Claro N; Rivera, Windell L

    2013-03-01

    Trypanosoma evansi infection in the Philippines is frequently reported to affect the country's livestock, particularly, the buffaloes. To assess the prevalence and intraspecific diversity of T. evansi in the country, blood samples from water buffaloes in different geographical regions were collected during an outbreak. T. evansi was detected in all 79 animals tested using PCR targeting the RoTat 1.2 VSG gene. Sequencing of the rDNA complete internal transcribed spacer (ITS) region including the 5.8S subunit showed high similarity (99-100%) between Philippine isolates and known T. evansi isolates in Genbank. Tree construction based on the same region confirmed the close relationship between Philippine and reported Thai isolates as compared to Egyptian isolates separated by relatively small genetic distances, 47 polymorphisms, despite the clustering in four branches. Overall, the results of this study prove genetic diversity within T. evansi species despite previous reports on limited heterogeneity among isolates worldwide.

  14. Expression of pluripotency genes in buffalo (Bubalus bubalis) amniotic fluid cells.

    PubMed

    Yadav, P S; Mann, A; Singh, V; Yashveer, S; Sharma, R K; Singh, I

    2011-08-01

    Recent findings suggest that mammalian amniotic fluid (AF) is a source of multipotent stem cells (SCs), which can be used in regenerative medicine and assisted reproduction. We report the isolation, culture and characterization of amniotic fluid-derived cells from pregnant water buffalo uterus. These undifferentiated AF cells expanded without feeder layer over a period of 100 days up to passages 20 and the expression of alkaline phosphatase (AP), Oct-4, Nanog and Sox-2, GAPDH and β-actin could be detected by RT-PCR. The cells exhibited uniform morphology and normal chromosome number. The up-regulation or down-regulation of transcription factors of each gene varied with passage number. We conclude that putative bubaline AF cells can be cultured and maintained in vitro for a prolonged period and offer a potential source of multipotent cells for applications including assisted reproduction in buffalo.

  15. Physicochemical properties and oxidative inactivation of soluble lectin from water buffalo (Bubalus bubalis) brain.

    PubMed

    Rizvi, Sabika; Banu, Naheed

    2008-03-01

    Lectins are carbohydrate-binding proteins present in a wide variety of plants and animals, which serve various important physiological functions. A soluble beta-galactoside binding lectin has been isolated and purified to homogeneity from buffalo brain using ammonium sulphate precipitation (40-70%) and gel permeation chromatography on Sephadex G50-80 column. The molecular weight of buffalo brain lectin (BBL) as determined by SDS-PAGE under reducing and non-reducing conditions was 14.2 kDa, however, with gel filtration it was 28.5 kDa, revealing the dimeric form of protein. The neutral sugar content of the soluble lectin was estimated to be 3.3%. The BBL showed highest affinity for lactose and other sugar moieties in glycosidic form, suggesting it to be a beta-galactoside binding lectin. The association constant for lactose binding as evidenced by Scatchard analysis was 6.6 x 10(3) M(-1) showing two carbohydrate binding sites per lectin molecule. A total inhibition of lectin activity was observed by denaturants like guanidine HCl, thiourea and urea at 6 M concentration. The treatment of BBL with oxidizing agent destroyed its agglutination activity, abolished its fluorescence, and shifted its UV absorption maxima from 282 to 250 nm. The effect of H2O2 was greatly prevented by lactose indicating that BBL is more stable in the presence of its specific ligand. The purified lectin was investigated for its brain cell aggregation properties by testing its ability to agglutinate cells isolated from buffalo and goat brains. Rate of aggregation of buffalo brain cells by purified protein was more than the goat brain cells. The data from above study suggests that the isolated lectin may belong to the galectin-1 family but is glycosylated unlike those purified till date.

  16. Pharmacokinetics, urinary excretion and plasma protein binding of ofloxacin in water buffalo calves (Bubalus bubalis).

    PubMed

    Ola, Ajay K; Sandhu, Harpal S; Dumka, Vinod K; Ranjan, Bibhuti

    2013-04-18

    Pharmacokinetics and urinary excretion of an intravenous dose of 5 mg.kg-1 ofloxacin were investigated in water buffalo calves. Plasma concentrations of ofloxacin were determined by high-performance liquid chromatography. Ofloxacin was rapidly distributed from the central to the peripheral compartment as evidenced by a short distribution half-life (0.09 h ± 0.003 h) and high K12 (4.7 h(-1) ± 0.1 h(-1)), and was detected in plasma for 8 h. The large volume of distribution (2.48 L.kg(-1) ± 0.18 L.kg(-1)) obtained in this study indicated high distribution of ofloxacin in water buffalo calves. The elimination half-life, the area under the plasma drug concentration-time curve and total body clearance were 2.11 h ± 0.13 h, 6.20 µg.mL(-1) ± 0.23 µg.mL(-1).h and 0.81 mL.kg(-1).h(-1) ± 0.03 mL.kg(-1).h(-1), respectively. About 18.7% of administered drug was bound to plasma proteins and approximately 32.5% of the administered dose was recovered in urine within 48 h. The results of the study indicated a favourable pharmacokinetic profile of ofloxacin in water buffalo calves, which suggests that ofloxacin may be effective against urinary pathogens in this species.

  17. Short communication: Detection of human Torque teno virus in the milk of water buffaloes (Bubalus bubalis).

    PubMed

    Roperto, S; Paciello, O; Paolini, F; Pagnini, U; Palma, E; Di Palo, R; Russo, V; Roperto, F; Venuti, A

    2009-12-01

    Forty-four raw milk and 15 serum samples from 44 healthy water buffaloes reared in Caserta, southern Italy, the most important region in Europe for buffalo breeding, were examined to evaluate the presence of Torque teno viruses (TTV) using molecular tools. Furthermore, 8 pooled pasteurized milk samples (from dairy factories having excellent sanitary conditions) and 6 Mozzarella cheese samples were also tested. Four of the cheese samples were commercial Mozzarella cheese; the remaining 2 were prepared with TTV-containing milk. Human TTV were detected and confirmed by sequencing in 7 samples of milk (approximately 16%). No TTV were found in serum, pooled pasteurized milk, or Mozzarella cheese samples. The samples of Mozzarella cheese prepared with TTV-containing milk did not show any presence of TTV, which provides evidence that standard methodological procedures to prepare Mozzarella cheese seem to affect viral structure, making this food fit for human consumption. The 7 TTV species from water buffaloes were identified as genotypes corresponding to the tth31 (3 cases), sle 1981, sle 2031, and NLC030 (2 cases each) human isolates. Although cross-species infection may occur, detection of TTV DNA in milk but not in serum led us to believe that its presence could be due to human contamination rather than a true infection. Finally, the mode of transmission of TTV has not been determined. Contaminated of the food chain with TTV may be a potential risk for human health, representing one of the multiple routes of infection.

  18. Comparative studies on the superovulatory effect of PMSG and FSH in water buffalo (Bubalus bubalis ).

    PubMed

    Karaivanov, C

    1986-07-01

    A total of thirty-eight lactating water buffalo cows were treated in four experiments simultaneously either with FSH (first group) or PMSG(second group). To the first group (half of the animals), a total dose of 40 mg FSH-P at 12-hr intervals was given i.m. within a 4-day period. The second group was treated i.m. with 3000 IU PMSG (Gestyl). Forty-eight hours after initiation of the superovulatory treatment all buffaloes were given 500 ug Cloprostenol. Fi seen buffaloes from the FSH-treated group (78.9%) and 17 from the second group (89.5%) came into heat at average PGF 2 alpha/standing heat intervals of 42.8+/-1.48 and 44.8+/-2.31, respectively. Superovulatory treatment resulted in meath number of 4.3+/-0.87 and 1.9+/-0.50 CL and 0.5+/-0.24 and 2.2+/-0.82 follicles for the first and second group. Twenty-five eggs were recovered after non-surgical flushing from 8 of 13 flushes in the first group and all except one were fertilized and classified as good embryos. Twelve eggs were recovered from 4 of 11 flushes in the second group and 11 of the eggs were fertilized and 10 of them classified as good ones.

  19. [Superovulation and the production of embryos in the water buffalo (Bubalus bubalis) in Bulgaria].

    PubMed

    Vlakhov, K; Karaivanov, Kh; Petrov, M; Kacheva, D

    1986-01-01

    A total of thirty water buffalo cows aged 3 to 8 years were treated for superovulation over the July-October period. Nine of the animals were injected with FSH at the rate of 40 mg at 12-hour intervals in the course of 4 consecutive days, and the remaining 21 animals were injected with 3,000 IU gestyl in the middle of the luteal phase. Forty-eight hours after stimulation started both groups were treated with 500 micrograms cloprostenol. Five out of the 9 buffalo cows (55.5 per cent) of group I and 15 out of 12 buffalo cows (71.4 per cent) of group II manifested estrus at an average interval of 44.4 +/- 3.6 and 40.5 +/- 3.29 hours, respectively, following the application of cloprostenol. The superovulatory treatment of the animals of the two groups led to average values of 5.6 +/- 1.89 and 4.0 +/- 0.98 corpora lutea and 1.0 +/- 0.63 and 2.7 +/- 1.41 follicules larger than 8 mm; 2.6 +/- 1.60 and 2.1 +/- 0.94 embryos of high quality were obtained through the use of a nonsurgical method of flushing.

  20. Cryptosporidiosis in buffalo calves (Bubalus bubalis): prevalence and potential risk factors.

    PubMed

    El-Khodery, Sabry A; Osman, Salama A

    2008-08-01

    The objective of the present study was to describe the prevalence and risk factors associated with cryptosporidiosis in buffalo calves in Middle Egypt. During one year, 458 fecal samples were collected from buffalo calves less than 3 month age in 55 small scale herds and examined for the presence of Cryptosporidium oocysts. Data describing age, gender, season, and herd management practices were gathered to assess potential risk factors. Fecal examination showed that 14.19% of the examined calves were positive for Cryptosporidium spp. Calves at 1-15 days were at the highest risk (P < 0.001), and a significant relationship between season and infection (P < 0.05) was recorded. A significant association between infection and hygiene (P < 0.001), type of floor (P < 0.01) and source of water (P < 0.01) was also recorded. Statistical analysis concerning the clinical signs and fecal characteristics revealed a significant association with fecal consistency (P < 0.001), presence of blood (P < 0.01) and mucous (P < 0.01). Moreover, a significant association was found between infection and the desire for suckling (P < 0.05) and tenesmus (P < 0.05). The results of the present study demonstrated the strong relation between infections by Cryptosporidium spp. and diarrhea in buffalo calves.

  1. Redescription of Sarcocystis levinei Dissanaike and Kan, 1978 (Protozoa: Sarcocystidae) of the water buffalo (Bubalus bubalis).

    PubMed

    Huong, L T; Dubey, J P; Uggla, A

    1997-12-01

    Sarcocystis levinei Dissanaike and Kan, 1978, is redescribed because the original description was a mixture of 2 species, the amended S. levinei and the newly recognized S. buffalonis Huong, Dubey, Nikkilä, and Uggla, 1997. In histological sections, S. levinei sarcocysts are microscopic, up to 640 microm long and up to 95 microm wide. Ultrastructurally, the cyst wall is thin (< 1.0 microm thick) with a minute undulating surface and smooth, hairlike villar protrusions arising at irregular distances from the cyst wall. The villar protrusions have a dome-shaped base (approximately 0.5 microm thick), a fingerlike middle part, and a tapering distal end (<0.1 microm thick). The morphological features of the sarcocyst resemble those of S. cruzi (Hasselman, 1926) Wenyon, 1926, of cattle. Sarcocystis levinei sarcocysts were found in striated muscles including heart, esophagus, tongue, and skeletal muscle. The buffalo myocardium is parasitized exclusively by S. levinei, whereas >1 Sarcocystis species may occur concurrently in other muscular tissues of water buffaloes. Two dogs, but not 2 cats, fed water buffalo hearts infected with S. levinei sarcocysts shed sporocysts measuring 9.5-10.5 x 14.0-16.5 microm starting from days 16 and 18, respectively.

  2. Biochemical and hormonal composition of follicular cysts in water buffalo (Bubalus bubalis).

    PubMed

    Khan, F A; Das, G K; Pande, Megha; Pathak, M K; Sarkar, M

    2011-03-01

    The objective of this study was to examine the follicular fluid biochemical and hormonal changes associated with ovarian follicular cysts in buffalo. Follicular fluid was aspirated from eight cysts and eight preovulatory follicles, and subjected to biochemical and hormonal analyses. Cysts were characterized by a greater (P<0.01) concentration of nitric oxide and lesser concentrations of ascorbic acid and glucose than that of preovulatory follicles (P<0.01 and P<0.05, respectively). Furthermore, follicular cysts had greater concentrations of progesterone (P<0.001), triiodothyronine (T(3)) and cortisol (P<0.05) and lesser concentrations of insulin (P<0.001) than preovulatory follicles. The results indicate follicular cysts in buffalo have an altered biochemical and hormonal composition. The alterations include increases in nitric oxide, progesterone, cortisol and T(3) concentrations with a concurrent reduction in ascorbic acid, insulin and glucose concentrations. The study suggests that greater progesterone concentrations possibly inhibit the onset of LH surge resulting in formation of follicular cysts in buffalo. In addition, it implies the plausible role of intra-ovarian regulators such as nitric oxide, ascorbic acid and insulin in development of the condition.

  3. Genetic variation within and relationships among populations of Asian water buffalo (Bubalus bubalis).

    PubMed

    Barker, J S; Tan, S G; Selvaraj, O S; Mukherjee, T K

    1997-02-01

    Genetic variation at 53 protein-coding loci (25 polymorphic) was analysed for 17 water buffalo populations-12 swamp, three Lankan and two of the Murrah breed (river type), to determine the magnitude of genetic differentiation and the genetic relationships among the populations. In accord with previous cytological studies, the Lankan buffalo clearly are river type. Significant deviations from Hardy-Weinberg equilibrium were shown for a number of locus-population combinations, with all populations but one showing significant heterogeneity in these deviations among loci. By contrast, heterogeneity among populations for each locus was much less, indicating locus-specific deviations, which suggest selection affecting allele frequencies at some loci. There was significant genetic differentiation among populations of both the swamp and river types. The differentiation among the swamp populations may reflect the geography of south-east Asia and the presumed spread of the swamp buffalo through this region. Phylogenies derived from pairwise genetic distance estimates show the clear separation of swamp and river types, but the topology of the swamp populations shows rather poor consistency with their geographic locations. For at least one population (Australia), it is clear that bottleneck effects have distorted the phylogenetic topology. Average genetic distances for both the swamp and river types, as compared with previous studies of livestock breeds, show that the genetic differentiation of each of these sets of populations is of the same order of magnitude as that among well-recognized and established breeds of other species.

  4. Isolation and functional characterization of buffalo (Bubalus bubalis) β-casein promoter for driving mammary epithelial cell-specific gene expression.

    PubMed

    Ganguli, Nirmalya; Ganguli, Nilanjana; Usmani, Abul; Majumdar, Subeer S

    2015-03-20

    Therapeutic proteins are produced in microbes, mammalian cell lines, and body fluids by applying recombinant DNA technology. They are required for compensating the deficiency of essential proteins in patients. Animal bioreactors producing such valuable bio-pharmaceuticals in body fluids have lately emerged as efficient and cost-effective expression systems. Promoters, along with other regulatory elements of genes coding for milk proteins, have been cloned from few species for directing the expression of desired proteins in the milk of farm animals. However, buffaloes, which are the second largest source of milk production in the world, have remained unexplored for such use. Since mammary epithelial cell-specific β-casein is the most abundantly expressed protein found in buffalo milk, we have isolated the promoter region and the transcriptional regulatory element along with exon 1, Intron 1 and partial exon 2 of the β-casein gene from the genome of the Indian river buffalo (Bubalus bubalis) and have characterized the same (GenBank accession no. KF612339). Mammary epithelial cells of buffalo and human (MCF7) expressed Enhanced green fluorescent protein (EGFP) upon transfection with the construct where egfp was cloned under the β-casein promoter. Transfected HEK-293 cells failed to express EGFP. Transgenic female mice generated using this construct expressed EGFP in the milk gland during lactation, without leaky expression in any other organs. This promoter also drove expression of recombinant human Interferonγ suggesting its use for expressing recombinant bio-pharmaceuticals in the milk of buffalo or other farm animals. Additionally, this may also allow breast gland-specific gene expression for remediation of breast gland-associated diseases.

  5. Isolation and functional characterization of buffalo (Bubalus bubalis) β-casein promoter for driving mammary epithelial cell-specific gene expression.

    PubMed

    Ganguli, Nirmalya; Ganguli, Nilanjana; Usmani, Abul; Majumdar, Subeer S

    2015-03-20

    Therapeutic proteins are produced in microbes, mammalian cell lines, and body fluids by applying recombinant DNA technology. They are required for compensating the deficiency of essential proteins in patients. Animal bioreactors producing such valuable bio-pharmaceuticals in body fluids have lately emerged as efficient and cost-effective expression systems. Promoters, along with other regulatory elements of genes coding for milk proteins, have been cloned from few species for directing the expression of desired proteins in the milk of farm animals. However, buffaloes, which are the second largest source of milk production in the world, have remained unexplored for such use. Since mammary epithelial cell-specific β-casein is the most abundantly expressed protein found in buffalo milk, we have isolated the promoter region and the transcriptional regulatory element along with exon 1, Intron 1 and partial exon 2 of the β-casein gene from the genome of the Indian river buffalo (Bubalus bubalis) and have characterized the same (GenBank accession no. KF612339). Mammary epithelial cells of buffalo and human (MCF7) expressed Enhanced green fluorescent protein (EGFP) upon transfection with the construct where egfp was cloned under the β-casein promoter. Transfected HEK-293 cells failed to express EGFP. Transgenic female mice generated using this construct expressed EGFP in the milk gland during lactation, without leaky expression in any other organs. This promoter also drove expression of recombinant human Interferonγ suggesting its use for expressing recombinant bio-pharmaceuticals in the milk of buffalo or other farm animals. Additionally, this may also allow breast gland-specific gene expression for remediation of breast gland-associated diseases. PMID:25678138

  6. Microvascular architecture of the fetal cotyledons in water buffaloes (Bubalus bubalis) during different stages of pregnancy.

    PubMed

    Abd-Elnaeim, Mahmoud M M; Miglino, Maria Augélica; Pfarrer, Chistiane; Leiser, Rudolf

    2003-07-01

    To elucidate the morphological background of physiological differences between bovine and buffalo gestation forty-two placentae ranging from the 3rd to 10th month of pregnancy were used to study the microvascular architecture of the fetal cotyledons in the buffalo. The tissues were prepared for light and scanning electron microscopy by paraformaldehyde fixation and corrosion casting of the fetal cotyledonary vascular system. Histology and vascular casts revealed the buffalo fetal cotyledons to consist of a series of conical villous trees changing from a wide to slender shape during pregnancy, and with a base strictly facing the fetal side. The branches of these trees, intermediate and terminal villi, projected radially from the stem, thus representing a rough type of villous tree. A second type of tree lacked these branches and was therefore termed smooth villus. The rough type was most prevalent, and the intermediate and terminal villi showed capillary complexes arranged in stories by the 4th to 5th month of gestation. The stories became broader and denser with the progress of pregnancy (6th to 7th month of gestation), due to extensive growth of new capillaries and simultaneous development of convolutions causing the vascular ridges of the terminal villi to appear bushy. Near term (9th to 10th month) the capillary system became very dense, particularly at the margin of the vascular ridges, leaving only narrow spaces for the corresponding maternal septal tissue. In detail, at its base the trunk of each villous tree contained a single central stem artery which originated from the allantochorionic arterial system, and 1-3 parallel peripheral stem veins. When approaching the cone tip, these vessels branched into new stem arteries and veins, each giving rise to arterioles and venules according to the principle vascularization of the stem villus first, followed by intermediate and terminal villi. The capillary complex of the terminal villi consisted of arterial

  7. Oocyte recovery by ovum pick up and embryo production in river buffaloes (Bubalus bubalis).

    PubMed

    Manjunatha, B M; Ravindra, J P; Gupta, P S P; Devaraj, M; Nandi, S

    2008-08-01

    Ovum pick up (OPU) was conducted twice a week for 12 weeks in six cycling, non-descriptive (local breed), Indian buffaloes to study the efficiency of OPU on recovery of oocytes for embryo production. OPU was performed using an ultrasound equipment with a 5-MHz transvaginal transducer, a single-lumen, 18-gauge, 55-cm-long needle and a constant vacuum pressure of 110 mmHg. The number and size of follicles were determined before puncture. The recovered oocytes were graded, washed, matured for 24 h and then fertilized with frozen-thawed semen, followed by embryo culture on the oviductal monolayer. The mean number of follicles observed per animal per session did not differ between animals or between puncture sessions. A mean number of 3.62 +/- 0.32 mm follicles were observed, 2.90 +/- 0.15 mm follicles were punctured and 1.21 +/- 0.07 oocytes were recovered per animal per session, with an average recovery rate of 42%. Of the total oocytes recovered, 64% were suitable for in vitro embryo production (grade A + B) whereas 36% were classified to be of grades C + D. A mean number of 0.25 +/- 0.2 transferable embryos was produced in vitro per buffalo per session with a transferable embryo production rate of 32%. In conclusion, this study demonstrated that twice-a-week OPU could be applied repeatedly, without any adverse effects on the follicular growth and oocyte recovery and that recovered oocytes could be used for in vitro embryo production in buffaloes.

  8. Carbonic anhydrase and acid base balance in relation to thermal stress in buffaloes ( Bubalus bubalis)

    NASA Astrophysics Data System (ADS)

    Mehta, S. N.; Gangwar, P. C.

    1983-03-01

    The blood samples from fifteen normal lactating buffaloes were taken from December 15th 1978 to 31st August, 1979. Depending upon the climatic conditions, the whole period of study was divided into four seasons. The mean values of carbonic anhydrase (moles CO2/l/sec×10-5) were 3.08±0.26, 4.94±0.44, 5.23±0.35, 6.44±0.32 in pregnant and 4.87±0.27, 4.53±0.41, 4.74±0.45, 6.36±0.40 in non-pregnant animals during winter, spring, hot and dry and hot and humid seasons. Mean values of pO2 (mm Hg) were 31.26±1.41, 31.92±0.61, 35.90±0.59, 33.80 ±0.67 in pregnant and 31.89±0.44, 31.53±0.54, 35.52±0.69, 31.65±0.95 in non-pregnant buffaloes during winter, spring, hot and dry and hot and humid periods, respectively. There were highly significant (P< 0.01) differences between seasons with respect to pO2, pCO2, actual HCO3 and heamoglobin. However, PCV changed significantly (P<0.01) with the physiological status of the animal. Different correlation of biochemical parameters with climatic elements were discussed. Thus, the shifts in the levels of carbonic anhydrase, HCO3 and heamoglobin may prove to be a better tool/index for thermal stress in buffaloes.

  9. Domestic cats (Felis catus) are definitive hosts for Sarcocystis sinensis from water buffaloes (Bubalus bubalis)

    PubMed Central

    GJERDE, Bjørn; HILALI, Mosaad

    2016-01-01

    The definitive hosts of Sarcocystis sinensis in water buffaloes have hitherto been unknown, but the close similarity of this species to the cat-transmitted Sarcocystis bovifelis in cattle suggested they were felids. In a previous study, two domestic cats were fed macroscopic sarcocysts of Sarcocystis fusiformis contained within or dissected from the esophageal muscles of water buffaloes, while no microscopic sarcocysts of S. sinensis were noticed. Both cats started shedding small numbers of sporocysts 8–10 days post infection (dpi) and were euthanized 15 dpi. Using a PCR-based molecular assay targeting the mitochondrial cox1 gene of S. fusiformis, both cats were shown to act as definitive hosts for this species. In the present study, DNA samples derived from oocysts/sporocysts in the intestinal mucosa of both cats were further examined by PCR for the presence of S. sinensis using 2 newly designed primers selectively targeting the cox1 gene of this species. All 6 DNA samples examined from each cat tested positive for S. sinensis. A 1,038-bp-long portion of cox1 was amplified and sequenced as 2 overlapping fragments from 5 of these DNA samples. The 5 sequences shared 99.3–100% identity with 7 previous cox1 sequences of S. sinensis obtained from sarcocysts in water buffaloes. Additionally, amplification of the ITS1 region with primers targeting various Sarcocystis spp., yielded amplicons of 2 different lengths, corresponding to those obtained from sarcocyst isolates of S. sinensis and S. fusiformis, respectively. This is the first study to show that cats act as definitive hosts for S. sinensis. PMID:27075117

  10. In vivo differentiation potential of buffalo (Bubalus bubalis) embryonic stem cell.

    PubMed

    Verma, Om Prakash; Kumar, Rajesh; Nath, Amar; Sharma, Manjinder; Dubey, Pawan Kumar; Kumar, G Sai; Sharma, G Taru

    2012-06-01

    Embryonic stem cells (ESCs) derived from inner cell mass (ICM) of mammalian blastocyst are having indefinite proliferation and differentiation capability for any type of cell lineages. In the present study, ICMs of in vitro-derived buffalo blastocysts were cultured into two different culture systems using buffalo fetal fibroblast as somatic cell support and Matrigel as synthetic support to obtain pluripotent buffalo embryonic stem cell (buESC) colonies. Pluripotency of the ESCs were characterised through pluripotency markers whereas, their differentiation capability was assessed by teratoma assay using immuno-compromised mice. Cumulus ooccyte complexes from slaughter house-derived ovaries were subjected to in vitro maturation, in vitro fertilization and in vitro culture to generate blastocysts. Total 262 blastocysts were derived through IVEP with 11.83 % (31/262) hatching rate. To generate buESCs, 15 ICMs from hatched blastocysts were cultured on mitomycin-C-treated homologous fetal fibroblast feeder layer, whereas the leftover 16 ICMs were cultured on extra-cellular matrix (Matrigel). No significant differences were observed for primary ESCs colony formation between two culture systems. Primary colonies as well as passaged ESCs were characterised by alkaline phosphatase staining, karyotyping and expression of transcription-based stem cell markers, OCT-4 and cell surface antigens SSEA-4 and TRA-1-60. Batch of ESCs found positive for pluripotency markers and showing normal karyotype after fifteenth passage were inoculated into eight immuno-compromised mice through subcutaneous and intramuscular route. Subcutaneous route of inoculation was found to be better than intramuscular route. Developed teratomas were excised surgically and subjected to histological analysis. Histological findings revealed presence of all the three germinal layer derivatives in teratoma sections. Presence of germinal layer derivatives were further confirmed by reverse transcriptase

  11. Effect of incubation on freezability of cholesterol-loaded cyclodextrin treated buffalo (Bubalus bubalis) spermatozoa

    PubMed Central

    Lone, S. A.; Prasad, J. K.; Ghosh, S. K.; Das, G. K.; Balamurugan, B.; Katiyar, R.; Verma, M. R.

    2016-01-01

    Aim: The aim of this study was to investigate the effect of incubation on freezability of cholesterol loaded cyclodextrin (CLC) treated buffalo spermatozoa. Materials and Methods: Semen samples with mass motility of 3+ and greater, collected from Murrah buffalo bulls were utilized. Immediately after collection, four equal groups of semen sample were made. Group I was kept as control and diluted with Tris upto concentration of 60×106 sperm/ml, where as Groups II, III, and IV were treated with CLC at 3 mg/120× 106 spermatozoa, incubated at 37°C for action of CLC for 10, 15 and 20 min, respectively, and diluted with tris upto concentration of 60×106 sperm/ml. All groups were subjected to equilibration and freezing. The evaluation of semen samples from all groups was carried out at fresh, pre-freeze and post-thaw stage for progressive motility, viability and hypo-osmotic swelling response (HOS response). Results: At the pre-freeze stage, significantly (p<0.05) higher percentage of progressive motility and viability was observed in treatment groups as compared to control with no significant difference among treatment groups. HOS response was significantly (p<0.05) higher in treatment groups as compared to control at pre-freeze stage. At post-thaw stage, significantly (p<0.05) higher percentage of progressive motility, viability and HOS response was recorded in Group II as compared to control and other treatment groups (III and IV). Group II retained significant post-thaw motility and viability at various post-thaw incubation periods. Conclusion: Incubation period of 10 min for CLC treated buffalo spermatozoa yielded significantly higher results in terms of freezability as compared to incubation for 15 and 20 min. PMID:27051205

  12. Domestic cats (Felis catus) are definitive hosts for Sarcocystis sinensis from water buffaloes (Bubalus bubalis).

    PubMed

    Gjerde, Bjørn; Hilali, Mosaad

    2016-08-01

    The definitive hosts of Sarcocystis sinensis in water buffaloes have hitherto been unknown, but the close similarity of this species to the cat-transmitted Sarcocystis bovifelis in cattle suggested they were felids. In a previous study, two domestic cats were fed macroscopic sarcocysts of Sarcocystis fusiformis contained within or dissected from the esophageal muscles of water buffaloes, while no microscopic sarcocysts of S. sinensis were noticed. Both cats started shedding small numbers of sporocysts 8-10 days post infection (dpi) and were euthanized 15 dpi. Using a PCR-based molecular assay targeting the mitochondrial cox1 gene of S. fusiformis, both cats were shown to act as definitive hosts for this species. In the present study, DNA samples derived from oocysts/sporocysts in the intestinal mucosa of both cats were further examined by PCR for the presence of S. sinensis using 2 newly designed primers selectively targeting the cox1 gene of this species. All 6 DNA samples examined from each cat tested positive for S. sinensis. A 1,038-bp-long portion of cox1 was amplified and sequenced as 2 overlapping fragments from 5 of these DNA samples. The 5 sequences shared 99.3-100% identity with 7 previous cox1 sequences of S. sinensis obtained from sarcocysts in water buffaloes. Additionally, amplification of the ITS1 region with primers targeting various Sarcocystis spp., yielded amplicons of 2 different lengths, corresponding to those obtained from sarcocyst isolates of S. sinensis and S. fusiformis, respectively. This is the first study to show that cats act as definitive hosts for S. sinensis.

  13. Domestic cats (Felis catus) are definitive hosts for Sarcocystis sinensis from water buffaloes (Bubalus bubalis).

    PubMed

    Gjerde, Bjørn; Hilali, Mosaad

    2016-08-01

    The definitive hosts of Sarcocystis sinensis in water buffaloes have hitherto been unknown, but the close similarity of this species to the cat-transmitted Sarcocystis bovifelis in cattle suggested they were felids. In a previous study, two domestic cats were fed macroscopic sarcocysts of Sarcocystis fusiformis contained within or dissected from the esophageal muscles of water buffaloes, while no microscopic sarcocysts of S. sinensis were noticed. Both cats started shedding small numbers of sporocysts 8-10 days post infection (dpi) and were euthanized 15 dpi. Using a PCR-based molecular assay targeting the mitochondrial cox1 gene of S. fusiformis, both cats were shown to act as definitive hosts for this species. In the present study, DNA samples derived from oocysts/sporocysts in the intestinal mucosa of both cats were further examined by PCR for the presence of S. sinensis using 2 newly designed primers selectively targeting the cox1 gene of this species. All 6 DNA samples examined from each cat tested positive for S. sinensis. A 1,038-bp-long portion of cox1 was amplified and sequenced as 2 overlapping fragments from 5 of these DNA samples. The 5 sequences shared 99.3-100% identity with 7 previous cox1 sequences of S. sinensis obtained from sarcocysts in water buffaloes. Additionally, amplification of the ITS1 region with primers targeting various Sarcocystis spp., yielded amplicons of 2 different lengths, corresponding to those obtained from sarcocyst isolates of S. sinensis and S. fusiformis, respectively. This is the first study to show that cats act as definitive hosts for S. sinensis. PMID:27075117

  14. Effect of melatonin on maturation capacity and fertilization of Nili-Ravi buffalo (Bubalus bubalis) oocytes

    PubMed Central

    Nagina, G.; Asima, A.; Nemat, U.; Shamim, A.

    2016-01-01

    This study evaluated the effect of melatonin supplementation of in vitro maturation media on in vitro maturation (IVM) and in vitro fertilization (IVF) rate of buffalo oocytes. Cumulus oocytes complexes (COCs) were aspirated from follicles of 2-8 mm diameter. In experiment I, COCs were matured in IVM medium supplemented with 0 (control), 250, 500, and 1000 μM melatonin for 22-24 hours in CO2 incubator at 38.5°C with 5% CO2 and at 95% relative humidity. The maturation rate did not differ in media supplemented with melatonin at 250 μM, 500 μM, 1000 μM and control (0 μM). In experiment II, the matured oocytes were fertilized in 50 μl droplets of Tyrode’s Albumin Lactate Pyruvate (TALP) medium having 10 ug/ml heparin for sperm (2 million/ml) capacitation. The fertilization droplets were then kept for incubation at 5% CO2, 39°C and at 95% relative humidity for 18 hours. The fertilization rate was assessed by sperm penetration and pronuclear formation. Fertilization rate was improved when maturation medium was supplemented with 250 μM melatonin compared to control. In conclusion, melatonin supplementation to serum free maturation media at 250 μM improved the fertilization rate of buffalo oocytes. PMID:27540514

  15. Inhibitory potential of Buffalo (Bubalus bubalis) colostrum immunoglobulin G on Klebsiella pneumoniae.

    PubMed

    L S, Mamatha Bhanu; Nishimura, S-I; H S, Aparna

    2016-07-01

    The unique components of colostrum like free oligosaccharides and glycoconjugates are known to offer resistance to enzymatic digestion in the gastrointestinal tract and have the ability to inhibit the localized adherence of enteropathogens to the digestive tract of the neonates. In this context, we have evaluated the in vitro effect of buffalo colostrum immunoglobulin G on human pathogen Klebsiella pneumoniae, a predominant multidrug resistant pathogen associated with nasocomial infections. The investigation revealed growth inhibitory potential of immunoglobulin G in a dose dependent manner supported by scanning electron microscopic studies. The N-glycan enriched fraction of immunoglobulin G after PNGase treatment was found more effective, comparable to ampicillin than native immunoglobulin G supporting the fact that colostrum derived oligosaccharides is crucial and act as ideal substrates for undesirable and pathogenic bacteria. The MALDI TOF/TOF analysis confirmed the glycostructures of abundant N-glycans of immunoglobulin G exerting antibacterial activity. The proteomic analysis revealed variations between control and treated cells and expression of chemotaxis-CheY protein (14kDa) was evidenced in response to immunoglobulin G treatment. Hence, it would be interesting to investigate the mode of inhibition of multidrug-resistant K. pneumoniae by buffalo colostrum immunoglobulin G with the identification of a newly expressed signalling protein.

  16. Genetic parameters for milk, fat and protein yields in Murrah buffaloes (Bubalus bubalis Artiodactyla, Bovidae)

    PubMed Central

    2010-01-01

    The objective of the present study was to estimate genetic parameters for test-day milk, fat and protein yields and 305-day-yields in Murrah buffaloes. 4,757 complete lactations of Murrah buffaloes were analyzed. Co-variance components were estimated by the restricted maximum likelihood method. The models included additive direct genetic and permanent environmental effects as random effects, and the fixed effects of contemporary group, milking number and age of the cow at calving as linear and quadratic covariables. Contemporary groups were defined by herd-year-month of test for test-day yields and by herd-year-season of calving for 305-day yields. The heritability estimates obtained by two-trait analysis ranged from 0.15 to 0.24 for milk, 0.16 to 0.23 for protein and 0.13 to 0.22 for fat, yields. Genetic and phenotypic correlations were all positive. The observed population additive genetic variation indicated that selection might be an effective tool in changing population means in milk, fat and protein yields. PMID:21637608

  17. Effect of melatonin on maturation capacity and fertilization of Nili-Ravi buffalo (Bubalus bubalis) oocytes.

    PubMed

    Nagina, G; Asima, A; Nemat, U; Shamim, A

    2016-01-01

    This study evaluated the effect of melatonin supplementation of in vitro maturation media on in vitro maturation (IVM) and in vitro fertilization (IVF) rate of buffalo oocytes. Cumulus oocytes complexes (COCs) were aspirated from follicles of 2-8 mm diameter. In experiment I, COCs were matured in IVM medium supplemented with 0 (control), 250, 500, and 1000 μM melatonin for 22-24 hours in CO2 incubator at 38.5°C with 5% CO2 and at 95% relative humidity. The maturation rate did not differ in media supplemented with melatonin at 250 μM, 500 μM, 1000 μM and control (0 μM). In experiment II, the matured oocytes were fertilized in 50 μl droplets of Tyrode's Albumin Lactate Pyruvate (TALP) medium having 10 ug/ml heparin for sperm (2 million/ml) capacitation. The fertilization droplets were then kept for incubation at 5% CO2, 39°C and at 95% relative humidity for 18 hours. The fertilization rate was assessed by sperm penetration and pronuclear formation. Fertilization rate was improved when maturation medium was supplemented with 250 μM melatonin compared to control. In conclusion, melatonin supplementation to serum free maturation media at 250 μM improved the fertilization rate of buffalo oocytes. PMID:27540514

  18. Expression profile of toll like receptors in a range of water buffalo tissues (Bubalus bubalis).

    PubMed

    Vahanan, B Mayil; Raj, G Dhinakar; Pawar, Rahul Mohan Chandra; Gopinath, V P; Raja, A; Thangavelu, A

    2008-11-15

    The present study was carried out to determine the expression profile of toll-like receptors (TLRs) 1-10 in buffalo peripheral blood mononuclear cells (PBMNC), neutrophils, spleen, liver, lung, heart, kidney, ovary and uterus using reverse transcriptase polymerase chain reaction (RT-PCR) with bovine TLR-specific primers The buffalo TLR partial nucleotide sequences had 95-98% nucleotide homology with bovine TLR sequences available in the GenBank. PBMNC expressed all TLRs except TLR1 and neutrophils expressed all TLRs except TLR3. Expression of all TLRs was observed in spleen, lung and liver tissues. Wide range of TLR mRNA expression was observed in heart, which lacked the expression of only TLR10. Among the tissues analyzed kidneys had the least repertoire of TLR expression. The kidney tissue revealed mRNA expression of only TLR2, TLR5, TLR7 and TLR9. Among the reproductive tissues analyzed, uterus expressed a wide range of TLRs such as 2, 5, 7, 8, 9 and 10 while ovary expressed all TLRs except TLR1 indicating their immuno competence.

  19. A comparison of FLOTAC and CFF techniques in detecting gastrointestinal parasites in water buffaloes (Bubalus bubalis).

    PubMed

    Salvador, Roderick T; Abalos, Rogelyn P; Ruba, Angeline M; Mingala, Claro N

    2014-01-01

    The objective of the study was to compare the usefulness of FLOTAC and centrifugal fecal flotation (CFF) techniques. More specifically, the taxonomic classes (Nematoda and Cestoda) of endoparasites present in fecal samples of buffaloes are identified, the sensitivity and specificity of FLOTAC relative to CFF are calculated, and the agreement of both techniques is evaluated using Kappa statistics. Fresh fecal samples from 220 buffaloes in 10 municipalities were collected. Sheather's sugar was used as a flotation solution for both the FLOTAC and CFF techniques. Of the 220 animals, 109 samples were nematode positive and 111 samples were nematode negative according to the FLOTAC technique, while 74 were found to be positive and 146 negative according to the CFF technique. No cestodes were detected by either technique. The calculated sensitivity for FLOTAC is 89.19% and its specificity is 70.55%. Kappa statistics revealed moderate agreement (k = 0.535) between the two techniques in detecting nematodes. The prevalence observed based on FLOTAC and CFF test were 49.54% (109/220; 95% CI: 47.75-56.34) and 33.64% (72/220; 95% CI: 27.42-40.3), respectively.

  20. Effect of spray and evaporative cooling on certain galactopoietic responses in buffaloes (Bubalus bubalis).

    PubMed

    Sharma, A K; Gangwar, P C

    1981-01-01

    Nine normal lactating Murrah buffaloes from Punjab Agricultural University Dairy herd were used to assess the effect of spray and evaporative cooling on certain galactopoietic responses in buffaloes in three equal groups of control (Group I), showers (Group II) and evaporative cooling (Group III). At 10.30, 12.30, 14.30 and 16.30 h daily the animals in Group II were given showers for fifteen minutes while the animals of Group III were kept on evaporative cooling system from 07.00 to 21.00 h daily. All the animals of Groups I, II and III were given showers by splashing water on their bodies with buckets once a day as a general routine being practised in the farm. Physical parameters included were dry bulb temperature, wet bulb temperature, maximum and minimum temperature, light intensity, % R. H., total day length and cooling power of air. The various galactopoietic responses recorded were the let down time, the milking time, the milk yield, the average flow rate, the fat and lactose percentages. The results of this study revealed that the showers amd the evaporative cooling were responsible for increasing the galactopoietic responses, i. e. the milk yield, the milking time, the the average flow rate and decreasing the let down time in both the periods. This may be attributed to the added comfort to such animals.

  1. The microanatomy of the palatine tonsils of the buffalo (Bos bubalus).

    PubMed

    Zidan, Mohamed; Pabst, Reinhard

    2011-02-15

    The palatine tonsils play a key role in initiating immune responses against antigens entering the body through the mouth. They are also replication sites of some pathogens. There is no data available about the structure of the palatine tonsils of the Egyptian water buffalo. Therefore, palatine tonsils of 14 clinically healthy buffalo bulls (2-3 years old) were examined macroscopically and microscopically using light, and transmission electron microscopes. The tonsils had an elongated kidney shape with a central invagination (tonsillar fossa) containing a single macroscopic opening leading to a small central cavity (tonsillar sinus). A number of macroscopic crypts originated from this sinus (internal crypts). Besides the tonsillar fossa, also small macroscopic crypts (external crypts) were present. The tonsils were enclosed by a thin connective tissue capsule and septa divided the tonsils into incomplete lobes. Within these encapsulated organs mucous glands were very obvious. Each crypt was highly branched and lined with stratified squamous non-keratinized epithelium. Several lymphoid cells infiltrated between the epithelial cells forming patches of lymphoepithelium. The crypt lumen contained lymphocytes, neutrophils and erythrocytes. Lymph nodules with clear germinal centers extended under the epithelial surface. Diffusely distributed lymphocytes were found in the narrow interfollicular region. High endothelial venules, interdigitating dendritic cells, macrophages and plasma cells were observed among the diffuse lymphocytes. Lymphatics filled with lymphocytes drained the tonsils.

  2. Diagnostic and prognostic indicators of omasal impaction in buffaloes (Bubalus bubalis).

    PubMed

    Toor, A S; Saini, N S

    2008-03-01

    Twelve of 46 female buffaloes with abdominal disorders were diagnosed with omasal impaction. They had been fed finely chopped machine-prepared straw. They were characterised by anorexia, an absence of defecation, abdominal distension, ruminal hypomotility or atony and a suspension of rumination. Omasal impaction was confirmed upon left flank laparorumenotomy on the basis of the size of the omasum and the consistency of its contents. After ruminal evacuation, a long flexible pipe was introduced through the reticulo-omasal orifice and the omasal contents were flushed back into the rumen with water under moderate pressure. Hyponatraemia, hypochloraemia, hypokalaemia and hypophosphataemia were consistent features in most cases. However, two buffaloes that later died had lower levels of plasma chloride, no reticulo-omasal orifice tone and were in an advanced stage of pregnancy. The level of total protein in peritoneal fluid was higher than normal, but the total white cell count was within the normal range. All the animals started passing faeces 36 to 48 hours after surgery. The presence of reticulo-omasal orifice tone and a plasma chloride level above 75 mmol/l were indicators of a good prognosis.

  3. Microvascular architecture of the near-term uterine caruncles in water buffaloes (Bubalus bubalis).

    PubMed

    Abd-Elnaeim, M M M; Miglino, M A; Leiser, R

    2007-06-01

    The present investigation was carried out on five near-term pregnant water buffaloes for studying the microvascular architecture of the uterine caruncles. The vascular casts were obtained by injection of 4:1 mixture of mercox and methylmethacrylate through the branches of the uterine arteries. After complete polymerization of the plastic, corrosion was conducted in 20% potassium hydroxide, then the vessel casts were immersed in distilled water, cut into small pieces, sputter coated with gold, and examined by using a scanning electron microscope. The buffalo uterine caruncle is highly vascularized through two slightly convoluted arteries and a single less tortuous vein. The arteries branch into several stem arteries at the base of the uterine caruncle, which follow nearly straight course in the primary septa towards the fetal side. During the courses of these stem arteries arterioles of variable diameters arise. The arterioles run in the secondary and tertiary septae and at this location arterioles and venules are connected through a voluminous capillary complex. The latter consists of capillaries of greatly variable diameters with vigorous coiling and sinusoidally dilated zones. From the capillary complexes the blood is driven through postcapillary venules back to the tertiary, secondary and primary septa, respectively, and then converge into stem veins which leave the caruncles through the branches of the uterine vein.

  4. Immunohistochemical studies of the epididymal duct in Egyptian water buffalo (Bubalus bubalis).

    PubMed

    Alkafafy, Mohamed; Elnasharty, Mohamed; Sayed-Ahmed, Ahmed; Abdrabou, Mohamed

    2011-02-01

    Using immunohistochemistry (IHC), this study aimed to evaluate the regional distribution pattern of some biologically active proteins in the epididymis of Egyptian water buffalo and to determine the structural-functional relationships of the different epididymal structures. Wax-embedded sections from different regions of the epididymal duct from adult, clinically healthy, buffalo bulls were used. Primary antibodies against angiotensin converting enzyme (ACE), S-100, galactosyltransferase (GalTase), alpha smooth muscle actin (α-SMA), connexin 43 (Cx43) and vascular endothelial growth factor (VEGF) were used for immunohistochemical studies. The results showed that, in addition to the well-known principal and basal cells, the epididymal epithelium, similar to that of other species, possessed apical cells and intraepithelial leukocytes. IHC showed that, with the exception of VEGF which reacted negatively, all antibodies used displayed variable reactivity in the different epididymal structures. Apical cells expressed a strong reaction with ACE along the entire length of the duct. The principal cells in the caput epididymis exhibited a distinct reactivity with S-100 and GalTase. The peritubular muscular coat displayed a marked immunostaining for α-SMA and for Cx43. In conclusion these findings showed a regional-specific distribution pattern, distinct from that in bovine bulls. Some potential functional capacities, especially absorptive and secretory ones, are discussed in relation to the different epididymal regions.

  5. Ear-tag retention and identification methods for extensively managed water buffalo (Bubalus bubalis) in Trinidad.

    PubMed

    Fosgate, G T; Adesiyun, A A; Hird, D W

    2006-03-16

    Thirty-two young domestic water buffalo were studied to evaluate ear-tag retention during an epidemiologic field trial. Plastic ear-tags were placed in both ears before the start of the trial, which was implemented in an extensively managed domestic water buffalo herd of approximately 1000 animals in Trinidad from 1999-2001. The presence or absence of ear-tags was recorded at the times of animal handling. The rate of ear-tag loss was modeled using a parametric survival analysis assuming an exponential rate of loss. A gamma distribution was used to estimate the amount of time that each animal would be positively identified based only on the presence or absence of one or more ear-tags. The overall median ear-tag retention was 272 days. The estimated rate of ear-tag loss was 0.0024 ear-tags lost per day. The use of ear-tags alone might not be sufficient for long-term identification of extensively managed animal populations.

  6. Transplacental transfer of iron in the water buffalo (Bubalus bubalis): uteroferrin and erythrophagocytosis.

    PubMed

    Pereira, F T V; Braga, F C; Burioli, K C; Kfoury, J R; Oliveira, L J; Papa, P C; Carvalho, A F; Ambrósio, C E; Bazer, F W; Miglino, M A

    2010-10-01

    The objectives of this investigation were to understand transplacental transport of iron by secreted uteroferrin (UF) and haemophagous areas of water buffalo placenta and clarify the role(s) of blood extravasation at the placental-maternal interface. Placentomes and interplacentomal region of 51 placentae at various stages of gestation were fixed, processed for light and transmission electron microscopy, histochemistry and immunohistochemistry. Haemophagous areas were present in placentomes collected between 4 and 10 months of pregnancy. Perl's reaction for ferric iron was negative in placentomes, but positive in endometrial glands. Positive staining for UF indicated areas in which it was being taken up by phagocytosis and/or fluid phase pinocytosis in areolae of the interplacentomal mesenchyme, with little staining in endometrial stroma. Imunohistochemistry detected UF in trophectoderm of haemophagous regions of placentomes and in other parts of the foetal villous tree, but the strongest immunostaining was in the epithelial cells and lumen of uterine glands. Ultrastructural analyses indicated that erythrophagocytosis was occurring and that erythrocytes were present inside cells of the chorion that also contained endocytic vesicles and caveolae. Results of this study indicate that both the haemophagous areas of placentomes and the areolae at the interface between chorion and endometrial glands are important sites for iron transfer from mother to foetal-placental tissues in buffalo throughout pregnancy.

  7. Paracrystalline structures in the epithelial principal cells of the epididymis of water buffalo (Bubalus bubalis).

    PubMed

    Santos, J N; Dolder, H

    1999-06-01

    The ultrastructure of many principal cells in the cauda epididymis of water buffaloes with ages varying between 4, 18, 24, 30 and 36 months, revealed, in many cells, the presence of long, curved paracrystalline structures that are quite large and frequently encountered in the cytoplasm, usually near the nucleus. Concomitantly or not, smaller rod-like, hexagonal or curled structures can be found in the nucleus. Both structures, cytoplasmic and intranuclear, are made up of a sheath of parallel filaments. These paracrystals may appear as thin, regularly spaced filaments that are associated with fine, evenly spaced subunits. Occasionally, the association of paracrystalline structures with membranes similar to the endoplasmic reticulum was observed, but no membranes were consistently found in close contact with the nuclear crystalloids. It is postulated that both structures are proteinaceous and may represent stored enzymes or substances present in the intraluminal fluid, which are absorbed and initially stored in numerous intraepithelial vacuoles of the corpus and cauda of the buffalo epididymis.

  8. Clinicopathological and ultrasonographic findings in 40 water buffaloes (Bubalus bubalis) with traumatic pericarditis.

    PubMed

    Mohamed, T

    2010-11-20

    Forty buffaloes with traumatic pericarditis were examined to characterise the ultrasonographic findings in buffaloes with traumatic pericarditis, determine the extent of the lesions and assess the prognosis. The most noticeable clinical presentations were presternal oedema (73 per cent) and jugular and mammary vein distension (88 per cent). Laboratory findings included neutrophilic leucocytosis, elevated total protein concentration, hypoalbuminaemia, hypergammaglobulinaemia and increased concentration of free fatty acids. Ultrasonographically, fluid in the pericardium appeared as either mild or massive anechoic accumulations containing fibrin threads or were imaged as homogenous, echogenic pericardial effusions. Moderate to severe corrugation of the reticular wall was observed. Deposits of fibrinous tissue interspersed with fluid pockets were seen between the reticulum, dorsal ruminal sac and diaphragm. Perireticular and mediastinal abscesses were imaged and appeared as echogenic lines with anechoic, echogenic, homogenous or heterogeneous contents. Additional ultrasonographic findings included hepatomegaly, dilation of the caudal vena cava, hepatic and portal veins, ascites, echogenic pleural effusions and vegetations of the tricuspid, mitral and pulmonary valves. The ultrasonographic findings were confirmed at postmortem examination.

  9. First isolation of Escherichia coli O157:H7 from faecal and milk specimens from anatolian water buffaloes (Bubalus bubalus) in Turkey.

    PubMed

    Seker, E; Yardimci, H

    2008-12-01

    Three hundred rectal faecal samples and 213 raw milk samples obtained from the tanks and containers were examined using standard cultural methods. Escherichia coli O157:H7 was isolated from 11 (3.7%) of 300 faecal samples and 3 (1.4%) of 213 raw milk samples. It was determined that 8 (73%) of E. coli O157:H7 strains isolated from faecal samples originated from water buffaloes younger than 2 years of age and 3 (27%) from 2-year-old and older water buffaloes. This is the 1st isolation of Escherichia coli O157:H7 from faecal and milk samples of water buffaloes in Turkey.

  10. Xylazine, ketamine and their combination for lumbar epidural analgesia in water buffalo calves (Bubalus bubalis).

    PubMed

    Singh, P; Pratap, K; Kinjavdekar, P; Aithal, H P; Singh, G R; Pathak, R

    2006-10-01

    The study was conducted to evaluate the effects of xylazine individually (0.05 mg/kg), ketamine individually (2.5 mg/kg), and a combination of xylazine and ketamine (0.05 mg/kg and 2.5 mg/kg) after lumbar epidural administration in water buffalo calves. Fifteen non-descript, male water buffalo calves of 6-8 months of age weighing between 55 and 75 kg were randomly placed in three groups (groups A, B and C). The agents were administered at the first lumbar epidural space. Clinico-physiological parameters, such as analgesia, ataxia, sedation, salivation, heart rate, respiratory rate and rectal temperature were studied. Other haematological and biochemical parameters monitored were haemoglobin, packed cell volume, total leukocyte count, plasma glucose, cortisol, protein albumin, globulin, blood urea nitrogen (BUN), creatinine, alanineamino transferase (ALT), sodium, potassium and chloride. The onset of analgesia (mean +/- SEM) was faster in group C (3.2 +/- 0.20 min) compared with that of group B (4.6 +/- 0.22 min) and group A (34.0 +/- 1.86 min). Analgesia of the thorax, flank, inguinal region, hind limbs, perineum and tail was complete in group C, but mild to moderate in groups A and B. Ataxia was severe in group C and mild in groups A and B. Mild to deep sedation was produced by groups A and C animals. Group B animals failed to produce sedation. Longer duration and greater depth of analgesia was produced in animals of group C. Heart rate, respiratory rate and rectal temperature decreased in groups A and C. The haematological parameters decreased in all the groups. The biochemical parameters like glucose, cortisol, BUN, creatinine, and ALT increased in all the animals. However, total proteins and albumin decreased in the three groups. The plasma electrolytes sodium, potassium and chloride did not show any significant change. The results of this study indicated a possible synergistic analgesic interaction between epidurally administered xylazine and ketamine, without

  11. Comparative therapeutic effect of toltrazuril, sulphadimidine and amprolium on Eimeria bovis and Eimeria zuernii given at different times following infection in buffalo calves (Bubalus bubalis).

    PubMed

    Ghanem, Mohamed M; Radwaan, Mervat E; Moustafa, Abdel Moneim M; Ebeid, Mohamed H

    2008-04-17

    We compared the therapeutic effect of three anticoccidial drugs (toltrazuril, sulphadimidine and amprolium) in buffalo (Bubalus bubalis) calves experimentally infected with Eimeria bovis (E. bovis) and E. zuernii oocysts (3 x 104oocyst/calf). Buffalo calves (1.5-4 month old, 70-kg body weight) were randomly allocated into 3 groups (9 calves each). Group T was experimentally infected with oocysts and treated with toltrazuril (20 mg/kg BW twice orally at a 1-week interval). Group S was experimentally infected with oocysts and treated with sulphadimidine (125 mg/kg injected IM followed by half dose for 4 successive days). Group A was experimentally infected with oocysts and treated with amprolium (50 mg/kg orally for 7 successive days). Each group had three subgroups (three calves/subgroup) to represent timing of the drug administration: 1st day of coccidia infection (FD), onset of clinical signs of coccidiosis (CC), and onset of oocyst shedding into the faeces (OS). Clinical signs, body-weight gain (BWG) and number of oocysts per gram feces (OPG) were monitored daily for 35 days post-infection (DPI). The OPG were reduced (but the BWG was not different) in the T calves compared to S and A calves. Within the same group, treatment from the 1st day of infection reduced the OPG and increased the BWG compared to the later treatment timings. PMID:18262668

  12. Genome-wide search of the genes tagged with the consensus of 33.6 repeat loci in buffalo Bubalus bubalis employing minisatellite-associated sequence amplification.

    PubMed

    Pathak, Deepali; Srivastava, Jyoti; Samad, Rana; Parwez, Iqbal; Kumar, Sudhir; Ali, Sher

    2010-06-01

    Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5' CCTCCAGCCCTCCTCCAGCCCT 3'), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.

  13. Organizational and expressional uniqueness of a testis-specific mRNA transcript of protooncogene c-kit receptor in water buffalo Bubalus bubalis.

    PubMed

    Srivastava, Jyoti; Premi, Sanjay; Garg, Lalit C; Ali, Sher

    2006-09-01

    Protooncogene c-kit receptor is implicated with spermatogenesis, melanogenesis, and hematopoeisis, and undergoes tissue/stage specific alternate splicing. We have isolated 2973-bp full-length cDNA sequence (CDS) of this gene from testis and other tissues of water buffalo Bubalus bubalis. Upon comparison, the c-kit sequences showed tissue specific nucleotide changes resulting in novel truncated peptides. These peptides lacked intracellular and/or transmembrane domains in all the tissues except testis. Other alternately spliced tissue-specific transcripts were also detected, which are the integral parts of the open reading frame and have been reported in other mammals. Phylogenetic analysis of the sequences revealed unique tyrosine kinase domain in buffalo. Copy number calculation and expressional analysis of c-kit using real-time PCR established its single copy status and highest expression (137-177 folds) in testis compared to that (least) in liver. c-kit expression was detected in semen samples although 10 times lesser compared to that in testis. The highest expression of c-kit in testis and the presence of mRNA transcript in sperms substantiate its predominant role in spermatogenesis. This study establishes unequivocal involvement of an autosomal gene c-kit receptor in testicular function.

  14. Tissue-specific promoter methylation coincides with Cyp19 gene expression in buffalo (Bubalus bubalis) placenta of different stages of gestation.

    PubMed

    Ghai, Sandeep; Monga, Rachna; Mohanty, T K; Chauhan, M S; Singh, Dheer

    2010-11-01

    Aromatase is the key enzyme for estrogen biosynthesis and is encoded by Cyp19 gene. Placental cotyledons are the main site of Cyp19 gene expression during pregnancy. The present study was aimed to investigate if DNA methylation and thus epigenetic mechanisms play a potential role in stage-specific regulation of Cyp19 expression in placental cotyledons of pregnant water buffaloes (Bubalus bubalis). Significantly higher expression of Cyp19 gene (p<0.05) in placental cotyledons of early gestation period and post parturition period was found in comparison to mid-gestation placenta. Tissue-specific promoter driven transcript analyses showed that the change in expression was mainly due to change in the relative abundance of transcripts from exon I.1 while the transcripts from exon II showed comparatively less variation. Methylation analysis of 5 CpG dinucleotides of placenta-specific promoter I.1 and proximal promoter, PII showed hypo-methylation of PI.1 in early and term placenta while hyper-methylation in mid-placenta. However, PII was found to be hypomethylated in all the three tissues. In conclusion, result of the present study demonstrated that stage-specific methylation status of PI.1, the major promoter responsible for aromatase expression in buffalo placental cotyledons, coincides with the change in expression of Cyp19 gene in different stages of pregnancy.

  15. The oxidant defence system in water-buffaloes (Bubalus bubalis) experimentally infected with Anaplasma marginale.

    PubMed

    Reddy, G R; More, T; Sharma, S P; Singh, L N

    1988-03-01

    The glutathione (GSH) -oxidant defence system protects the erythrocytes and leucocytes from oxidative damage. Leucocyte -superoxide dismutase (SOD), GSH-peroxidase (GSH-px), GSH-reductase (GR), GSH-S-transferase (GSH-S-t) and arginase were examined in samples from buffaloes infected with Anaplasma marginale. All the enzymes, except arginase, were also studied in the red cell haemolysates from these animals. GSH-S-t, GSH- and glutathione-reductase (GR) levels in leucocytes decreased in infected animals suggesting a decline in the efficiency of the GSH-oxidant defence system. SOD levels increased but there was no change in leucocyte-arginase activity due to infection. Infection caused no significant changes in red cell SOD, GSH-px, GR and GSH. However, GSH-S-t significantly decreased (P less than 0.05).

  16. Sarcocystis fusiformis: some protein metabolic enzymes in various fractions of sarcocysts of buffalo (Bubalus bubalis).

    PubMed

    Gupta, R S; Kushwah, H S; Kushwah, A

    1993-01-01

    An investigation on the relative presence of some protein metabolic enzymes, namely aspartate aminotransferase (AST), alanine aminotransferase (ALT), NAD+ and NADP+ dependent glutamate dehydrogenase (GLDH) and arginase in cyst wall (CW), cyst fluid (CF) and zoite (ZT) fractions of the sarcocysts of Sarcocystis fusiformis in the oesophageal muscles of Indian water buffalo was carried out. Both the transaminases were present in all the fractions of the cyst, although in variable amounts. There was a higher level of AST activity than of ALT activity. AST activity was the highest in ZT, whereas ALT activity was at a maximum in the CF fraction. The levels of activity of NAD+ and NADP+ dependent GLDH and arginase remained beyond detectable limits. The study revealed that the intermediates of carbohydrate metabolism are linked to protein metabolism by transaminases. The possibility of concomitant removal of ammonia and its subsequent incorporation into the urea cycle is ruled out in this parasitic protozoan.

  17. Cloning and sequencing of the rDNA gene family of the water buffalo (Bubalus bubalis).

    PubMed

    Pang, C Y; Deng, T X; Tang, D S; Yang, C Y; Jiang, H; Yang, B Z; Liang, X W

    2012-01-01

    The rDNA genes coding for ribosomal RNA in animals are complicated repeat sequences with high GC content. We amplified water buffalo rDNA gene sequences with the long and accurate (LA) PCR method, using LA Taq DNA polymerase and GC buffer, based on bioinformatic analysis of related organisms. The rDNA genes were found to consist of 9016 nucleotides, including three rRNA genes and two internal transcribed spacers (ITS), which we named 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 28S rRNA. We tested and optimized conditions for cloning these complicated rDNA sequences, including specific rules of primer design, improvements in the reaction system, and selection of the DNA polymerase.

  18. Water Buffalo (Bubalus bubalis) as a spontaneous animal model of Vitiligo.

    PubMed

    Singh, Vijay Pal; Motiani, Rajender K; Singh, Archana; Malik, Garima; Aggarwal, Rangoli; Pratap, Kunal; Wani, Mohan R; Gokhale, Suresh B; Natarajan, Vivek T; Gokhale, Rajesh S

    2016-07-01

    Vitiligo is a multifactorial acquired depigmenting disorder. Recent insights into the molecular mechanisms driving the gradual destruction of melanocytes in vitiligo will likely lead to the discovery of novel therapies, which need to be evaluated in animal models that closely recapitulate the pathogenesis of human vitiligo. In humans, vitiligo is characterized by a spontaneous loss of functional melanocytes from the epidermis, but most animal models of vitiligo are either inducible or genetically programmed. Here, we report that acquired depigmentation in water buffalo recapitulates molecular, histological, immunohistochemical, and ultrastructural changes observed in human vitiligo and hence could be used as a model to study vitiligo pathogenesis and facilitate the discovery and evaluation of therapeutic interventions for vitiligo.

  19. Atypical cilia in the tracheal epithelium of healthy water buffaloes (Bubalus bubalis).

    PubMed

    Bruno, F; Dallai, R; Galati, P; Pazzanese, P; Roperto, F

    1999-07-01

    Samples of tracheal mucosa were obtained from 10 healthy adult water buffaloes and 50 000 cilia were examined ultrastructurally. Ciliary abnormalities were found in all 10 subjects. Atypical cilia occurred as compound cilia (up to 1.5%), intracytoplasmic cilia (0.07%) and swollen cilia (0.05%). The microtubular pattern was determined in 5000 cross-sectioned cilia, with about 7% showing axonemal abnormalities in which peripheral defects prevailed. Some electron-dense plugs appeared inside the cylinder lumen of 2.5% of basal bodies. Freeze-fracture studies revealed a ciliary necklace composed of up to eight rows of intramembranous particles. This fine detail appeared to differ from that of other small and large ruminants.

  20. Water Buffalo (Bubalus bubalis) as a spontaneous animal model of Vitiligo.

    PubMed

    Singh, Vijay Pal; Motiani, Rajender K; Singh, Archana; Malik, Garima; Aggarwal, Rangoli; Pratap, Kunal; Wani, Mohan R; Gokhale, Suresh B; Natarajan, Vivek T; Gokhale, Rajesh S

    2016-07-01

    Vitiligo is a multifactorial acquired depigmenting disorder. Recent insights into the molecular mechanisms driving the gradual destruction of melanocytes in vitiligo will likely lead to the discovery of novel therapies, which need to be evaluated in animal models that closely recapitulate the pathogenesis of human vitiligo. In humans, vitiligo is characterized by a spontaneous loss of functional melanocytes from the epidermis, but most animal models of vitiligo are either inducible or genetically programmed. Here, we report that acquired depigmentation in water buffalo recapitulates molecular, histological, immunohistochemical, and ultrastructural changes observed in human vitiligo and hence could be used as a model to study vitiligo pathogenesis and facilitate the discovery and evaluation of therapeutic interventions for vitiligo. PMID:27124831

  1. Genetic Evaluation of Dual-Purpose Buffaloes (Bubalus bubalis) in Colombia Using Principal Component Analysis.

    PubMed

    Agudelo-Gómez, Divier; Pineda-Sierra, Sebastian; Cerón-Muñoz, Mario Fernando

    2015-01-01

    Genealogy and productive information of 48621 dual-purpose buffaloes born in Colombia between years 1996 and 2014 was used. The following traits were assessed using one-trait models: milk yield at 270 days (MY270), age at first calving (AFC), weaning weight (WW), and weights at the following ages: first year (W12), 18 months (W18), and 2 years (W24). Direct additive genetic and residual random effects were included in all the traits. Maternal permanent environmental and maternal additive genetic effects were included for WW and W12. The fixed effects were: contemporary group (for all traits), sex (for WW, W12, W18, and W24), parity (for WW, W12, and MY270). Age was included as covariate for WW, W12, W18 and W24. Principal component analysis (PCA) was conducted using the genetic values of 133 breeding males whose breeding-value reliability was higher than 50% for all the traits in order to define the number of principal components (PC) which would explain most of the variation. The highest heritabilities were for W18 and MY270, and the lowest for AFC; with 0.53, 0.23, and 0.17, respectively. The first three PCs represented 66% of the total variance. Correlation of the first PC with meat production traits was higher than 0.73, and it was -0.38 with AFC. Correlations of the second PC with maternal genetic component traits for WW and W12 were above 0.75. The third PC had 0.84 correlation with MY270. PCA is an alternative approach for analyzing traits in dual-purpose buffaloes and reduces the dimension of the traits.

  2. Genetic Evaluation of Dual-Purpose Buffaloes (Bubalus bubalis) in Colombia Using Principal Component Analysis

    PubMed Central

    Agudelo-Gómez, Divier; Pineda-Sierra, Sebastian; Cerón-Muñoz, Mario Fernando

    2015-01-01

    Genealogy and productive information of 48621 dual-purpose buffaloes born in Colombia between years 1996 and 2014 was used. The following traits were assessed using one-trait models: milk yield at 270 days (MY270), age at first calving (AFC), weaning weight (WW), and weights at the following ages: first year (W12), 18 months (W18), and 2 years (W24). Direct additive genetic and residual random effects were included in all the traits. Maternal permanent environmental and maternal additive genetic effects were included for WW and W12. The fixed effects were: contemporary group (for all traits), sex (for WW, W12, W18, and W24), parity (for WW, W12, and MY270). Age was included as covariate for WW, W12, W18 and W24. Principal component analysis (PCA) was conducted using the genetic values of 133 breeding males whose breeding-value reliability was higher than 50% for all the traits in order to define the number of principal components (PC) which would explain most of the variation. The highest heritabilities were for W18 and MY270, and the lowest for AFC; with 0.53, 0.23, and 0.17, respectively. The first three PCs represented 66% of the total variance. Correlation of the first PC with meat production traits was higher than 0.73, and it was -0.38 with AFC. Correlations of the second PC with maternal genetic component traits for WW and W12 were above 0.75. The third PC had 0.84 correlation with MY270. PCA is an alternative approach for analyzing traits in dual-purpose buffaloes and reduces the dimension of the traits. PMID:26230093

  3. Effect of supplemental light on growth, prolactin, progesterone and luteinizing hormone in water buffalo ( Bubalus bubalis)

    NASA Astrophysics Data System (ADS)

    Perera, K. S.; Gwazdauskas, F. C.; Akers, R. M.; McGilliard, M. L.

    1989-06-01

    Fifty non-pregnant Surti buffalo heifers aged between 17 and 42 months ( n=24, <24 months; n=26, >24 months) were randomly assigned to groups subject to either natural daylight +4h supplemental light ( n=25) or natural day light ( n=25), to study changes in growth, serum prolactin (Prl), progesterone (P4) and luteinizing hormone (LH) to supplemental lighting. Ambient temperatures (T) and relative humidity (RH) generally were >27° C and <70% during the day-time, respectively. Light-supplemented heifers had 16.2 kg net body weight (BW) gain at 9 weeks compared to 20.8 kg for controls, but higher mean Prl after 6.5 weeks ( P<0.01), and higher P4 (0.41 vs 0.19 ng/ml; P<0.06) than control heifers. Older heifers had 39.7% greater BW ( P<0.01), but a net 4.3% BW gain compared to a 10.1% gain for younger heifers at 10 weeks. Older, light-supplemented heifers had higher mean P4 (0.63 vs 0.19 ng/ml; P<0.07) than the other groups. These weight and hormonal changes suggest that 4 h supplemental light can alter growth and endocrine function in buffaloes under similar planes of nutrition. While light supplementation did not have a positive effect on body wieght during the 10 week study, body weight and endocrine changes due to supplemental light may be important factors for initiation of reproductive cyclicity.

  4. Ultrastructural changes in the sublingual salivary gland of prenatal buffalo (Bubalus bubalis)

    PubMed Central

    Singh, A. D.; Singh, Opinder

    2016-01-01

    Aim: The present study was aimed to elucidate ultrastructural changes in the development of sublingual salivary gland of buffalo during prenatal life. Materials and Methods: The study was carried out on sublingual salivary gland of 36 buffalo fetuses ranging from 13.2 cm curved crown-rump length (CVRL) (88th day) to full term. The fetuses were categorized into three groups based on their CVRL. Results: The cells lining the terminal tubules were undifferentiated with poorly developed cytoplasmic organelles but lacked secretory granules (SGs) at 13.2 cm CVRL (88th day). The SGs appeared first in the form of membrane-bound secretory vesicles with homogeneous electron-dense as well as electron-lucent contents at 21.2 cm CVRL (122nd day); however, mucous acinar cells contained electron-lucent granules, while serous secretory cells as well as serous demilunes showed electron-dense granules at 34 cm CVRL (150th day) of prenatal life. At 53.5 cm CVRL (194th day), both mucous and serous acini were differentiated by the density of SGs. Conclusion: The cytoplasm of acinar cells was filled with mitochondria, rough endoplasmic reticulum, and Golgi profiles in mid and late fetal age groups. The SGs were increased in number during the late fetal age group. The myoepithelial cells (MECs) were located at the base of the acinar cells as well as intercalated and striated ducts and were stellate in shape. The ultrastructure of MEC revealed a parallel stream of myofilaments in the cytoplasm and its processes. The mucous cells were predominantly present in the sublingual salivary gland and were pyramidal in shape. PMID:27057120

  5. Effect of supplemental light on growth, prolactin, progesterone and luteinizing hormone in water buffalo (Bubalus bubalis).

    PubMed

    Perera, K S; Gwazdauskas, F C; Akers, R M; McGilliard, M L

    1989-06-01

    Fifty non-pregnant Surti buffalo heifers aged between 17 and 42 months (n = 24, less than 24 months; n = 26, greater than 24 months) were randomly assigned to groups subject to either natural daylight +4 h supplemental light (n = 25) or natural day light (n = 25), to study changes in growth, serum prolactin (Prl), progesterone (P4) and luteinizing hormone (LH) to supplemental lighting. Ambient temperatures (T) and relative humidity (RH) generally were greater than 27 degrees C and less than 70% during the daytime, respectively. Light-supplemented heifers had 16.2 kg net body weight (BW) gain at 9 weeks compared to 20.8 kg for controls, but higher mean Prl after 6.5 weeks (P less than 0.01), and higher P4 (0.41 vs 0.19 ng/ml; P less than 0.06) than control heifers. Older heifers had 39.7% greater BW (P less than 0.01), but a net 4.3% BW gain compared to a 10.1% gain for younger heifers at 10 weeks. Older, light-supplemented heifers had higher mean P4 (0.63 vs 0.19 ng/ml; P less than 0.07) than the other groups. These weight and hormonal changes suggest that 4 h supplemental light can alter growth and endocrine function in buffaloes under similar planes of nutrition. While light supplementation did not have a positive effect on body weight during the 10 week study, body weight and endocrine changes due to supplemental light may be important factors for initiation of reproductive cyclicity. PMID:2759726

  6. Single-dose pharmacokinetics of marbofloxacin in Egyptian buffalo (Bubalus bubalis L.) steers.

    PubMed

    Goudah, Ayman; Abd El-Aty, Abd El-Aty M; Regmi, Nanda L; Shin, Ho-Chul; Shimoda, Minoru; Shim, Jae-Han

    2007-01-01

    The objective of this study was to investigate the pharmacokinetics of marbofloxacin (MAR) following intravenous (iv) and intramuscular (im) administration of a 2.0 mg/kg body weight dosage to five healthy Egyptian buffalo steers. A cross-over design was used with a washout period of 2 weeks. Blood samples were obtained at 0, 5,10,15, and 20 min and at 0.5,0.75,1,2,4,6,8,10,12,24,30 and 48 hours after marbofloxacin administration. The serum marbofloxacin concentrations were quantitated using a modified agar diffusion bioassay method. Marbofloxacin exhibited a relatively high volume of distribution at steady-state (Vdss = 1.77 Lkg), which suggests good tissue penetration, and a total body clearance (Cltot) of 0.18 L/kgxh,which is associated with a long elimination half-life (tl/2beta = 7.52 h). Marbofloxacin was rapidly absorbed at a dosage of 2.0 mg/kg after im administration with an observed maximum serum concentration (Cmax) value of 2.004 microg/mL obtained at a time to peak concentration (tmax) of 0.5 h, and an absolute bioavailability (F %) of 86.79 +/- 5.53 %. The protein-binding ranged from 22 to 24.6 % with an average of 23.4 %. In conclusion, single iv and im administered doses of marbofloxacin were well tolerated by Egyptian buffalo steers. A dosage of 2 mg/kg body weight might not be enough to treat infections caused by bacteria with minimum inhibitory concentration (MIC) at or above 0.2 microg/mL, based on the calculated area under the inhibitory concentration (AUIC).

  7. Effect of supplemental light on growth, prolactin, progesterone and luteinizing hormone in water buffalo (Bubalus bubalis).

    PubMed

    Perera, K S; Gwazdauskas, F C; Akers, R M; McGilliard, M L

    1989-06-01

    Fifty non-pregnant Surti buffalo heifers aged between 17 and 42 months (n = 24, less than 24 months; n = 26, greater than 24 months) were randomly assigned to groups subject to either natural daylight +4 h supplemental light (n = 25) or natural day light (n = 25), to study changes in growth, serum prolactin (Prl), progesterone (P4) and luteinizing hormone (LH) to supplemental lighting. Ambient temperatures (T) and relative humidity (RH) generally were greater than 27 degrees C and less than 70% during the daytime, respectively. Light-supplemented heifers had 16.2 kg net body weight (BW) gain at 9 weeks compared to 20.8 kg for controls, but higher mean Prl after 6.5 weeks (P less than 0.01), and higher P4 (0.41 vs 0.19 ng/ml; P less than 0.06) than control heifers. Older heifers had 39.7% greater BW (P less than 0.01), but a net 4.3% BW gain compared to a 10.1% gain for younger heifers at 10 weeks. Older, light-supplemented heifers had higher mean P4 (0.63 vs 0.19 ng/ml; P less than 0.07) than the other groups. These weight and hormonal changes suggest that 4 h supplemental light can alter growth and endocrine function in buffaloes under similar planes of nutrition. While light supplementation did not have a positive effect on body weight during the 10 week study, body weight and endocrine changes due to supplemental light may be important factors for initiation of reproductive cyclicity.

  8. The in vitro effect of leptin on semen quality of water buffalo (Bubalus bubalis) bulls.

    PubMed

    Khaki, Amir; Batavani, Rooz Ali; Najafi, Gholamreza

    2013-01-01

    The purpose of this study was to evaluate the probable effects of leptin addition in different levels to the semen extender on sperm quality (motility and motility parameters, viability, sperm membrane integrity, and DNA damage). Semen specimens were evaluated immediately after leptin addition, equilibration time and after thawing the frozen semen. Five healthy buffalo bulls (5 ejaculates from each bull) were used. Each ejaculate was diluted at 37 ˚C with tris-based extender containing 0 (control), 10, 20, 50, 100, and 200 ng mL(-1) leptin. The diluted semen was kept 4 hr in refrigerator to reach to the equilibration time and then packed in 0.5 mL French straws and frozen in liquid nitrogen. Our results showed that, in the fresh semen, no significant difference was observed in all sperm quality parameters evaluated among all of the examined leptin concentrations. Addition of 10 ng mL(-1) leptin into semen extender significantly preserved sperm motility, all of the motility parameters, and viability in equilibrated semen compared to that of control group. However, in vitro addition of 200 ng mL(-1) leptin, significantly decreased theses parameters. In the frozen thawed semen, all leptin concentrations decreased sperm motility and viability, but significant decrease was observed in concentrations of 100 and 200 ng mL(-1). Adding leptin to semen extender did not have any significant influence on sperm DNA damage and sperm membrane integrity in all examined groups. These findings suggest that in vitro addition of 10 ng mL(-1) leptin could preserve sperm motility and viability in cooled semen of buffaloes.

  9. Genetic Evaluation of Dual-Purpose Buffaloes (Bubalus bubalis) in Colombia Using Principal Component Analysis.

    PubMed

    Agudelo-Gómez, Divier; Pineda-Sierra, Sebastian; Cerón-Muñoz, Mario Fernando

    2015-01-01

    Genealogy and productive information of 48621 dual-purpose buffaloes born in Colombia between years 1996 and 2014 was used. The following traits were assessed using one-trait models: milk yield at 270 days (MY270), age at first calving (AFC), weaning weight (WW), and weights at the following ages: first year (W12), 18 months (W18), and 2 years (W24). Direct additive genetic and residual random effects were included in all the traits. Maternal permanent environmental and maternal additive genetic effects were included for WW and W12. The fixed effects were: contemporary group (for all traits), sex (for WW, W12, W18, and W24), parity (for WW, W12, and MY270). Age was included as covariate for WW, W12, W18 and W24. Principal component analysis (PCA) was conducted using the genetic values of 133 breeding males whose breeding-value reliability was higher than 50% for all the traits in order to define the number of principal components (PC) which would explain most of the variation. The highest heritabilities were for W18 and MY270, and the lowest for AFC; with 0.53, 0.23, and 0.17, respectively. The first three PCs represented 66% of the total variance. Correlation of the first PC with meat production traits was higher than 0.73, and it was -0.38 with AFC. Correlations of the second PC with maternal genetic component traits for WW and W12 were above 0.75. The third PC had 0.84 correlation with MY270. PCA is an alternative approach for analyzing traits in dual-purpose buffaloes and reduces the dimension of the traits. PMID:26230093

  10. Expression profiling of major heat shock protein genes during different seasons in cattle (Bos indicus) and buffalo (Bubalus bubalis) under tropical climatic condition.

    PubMed

    Kumar, Anil; Ashraf, Syma; Goud, T Sridhar; Grewal, Anita; Singh, S V; Yadav, B R; Upadhyay, R C

    2015-07-01

    Heat shock proteins consist of highly conserved stress proteins, expressed in response to stress and play crucial roles in environmental stress tolerance and adaptation. The present study was conducted to identify major types of genes under the HSP70 family and other HSPs and to evaluate their expression pattern in Sahiwal and Tharparkar breeds of zebu cattle (Bos indicus) and Murrah buffalo (Bubalus bubalis) with respect to different seasons. Quantitative real time polymerase chain reaction was performed to analyze the transcript variants of three HSP70 family genes (HSPA1A, HSPA1B, and HSPA8) and HSP10, HSP60, HSP90 and HSF1 in each breed. The major finding of this study was the higher abundance of all the studied HSP genes during summer and winter compared to spring season, but the magnitude of increase was higher during summer as compared to winter. HSPA1A and HSPA1B genes showed maximal induction (P<0.001) during summer and winter while HSP60 and HSP10 were found to be the second most abundantly expressed HSPs. The relative mRNA abundance of HSF1 significantly increased (P<0.001) in Murrah buffalo compared to Tharparkar and Sahiwal cattle during summer and winter. Expression pattern of heat shock protein genes indicated that amongst the breeds, the expression was higher in Murrah buffalo compared to Sahiwal and Tharparkar cattle, thereby indicating the more adaptive capacity of later during periods of stress. Hence, this study suggests that heat shock protein genes may be conveniently used as biomarkers for assessing stress response in cattle and buffalo and the expression is species and breed-specific. Furthermore, the variation in expression is associated with heat tolerance and adaptation to different climatic conditions.

  11. Evidence for bovine besnoitiosis in Egypt-first serosurvey of Besnoitia besnoiti in cattle and water buffalo (Bubalus bubalis) in Egypt.

    PubMed

    Ashmawy, Karam Imam; Abu-Akkada, Somaia Saif

    2014-03-01

    The present study evaluated the presence of specific antibodies against Besnoitia besnoiti in cattle and water buffalo (Bubalus bubalis) in Egypt. Sera from cattle (n = 216) and water buffaloes (n = 133) collected from five different provinces of Egypt (Behera, Alexandria, Assuit, Gharbia, and Matrouh) were analyzed. Testing for B. besnoiti antibodies by PrioCHECK® Besnoitia Ab 2.0 ELISA initially identified 13.75 % (48 out of 349) of individual sera as positive at the manufacturer's suggested cutoff threshold, 15 percent positivity (PP). Statistically significant associations between B. besnoiti prevalence, species, sex, age, and geographical distribution were observed. Seropositive animals were distributed in all of the provinces from which animals were sampled except Gharbia province. Assuit province showed the highest percentage of infection (30.76 %) followed by Matrouh, Alexandria, and Behera provinces (25, 16.29, and 9.6 %, respectively). The highest infection rate of B. besnoiti was significantly higher in cattle (17.13 %) than in water buffaloes (9.02 %). Positive cases were observed in all age categories. While the highest infection rate (17.13 %) was recorded in the age group 5-10 years followed by the age group 1-5 years (15.38 %), and only one positive case (1.58 %) was recorded in the age group less than 1 year. The highest infection rate of B. besnoiti infection was recorded in the female animals (14.95 %) followed by the male animals (8.33). This is the first report on the detection of B. besnoiti in cattle and water buffaloes in Egypt.

  12. Sustained delivery of exogenous melatonin influences biomarkers of oxidative stress and total antioxidant capacity in summer-stressed anestrous water buffalo (Bubalus bubalis).

    PubMed

    Kumar, Ashok; Mehrotra, S; Singh, G; Narayanan, K; Das, G K; Soni, Y K; Singh, Mahak; Mahla, A S; Srivastava, N; Verma, M R

    2015-06-01

    High ambient temperature during summer in tropical and subtropical countries predisposes water buffaloes (Bubalus bubalis) to develop oxidative stress having antigonadotropic and antisteroidogenic actions. Melatonin is a regulator of seasonal reproduction in photoperiodic species and highly effective antioxidant and free radical scavenger. Therefore, a study was designed to evaluate the effect of sustained-release melatonin on biomarkers of oxidative stress i.e., the serum malondialdehyde (MDA) and nitric oxide (NO), and the total antioxidant capacity (TAC). For the study, postpartum buffaloes diagnosed as summer anestrus (absence of overt signs of estrus, concurrent rectal examination, and RIA for serum progesterone) were grouped as treated (single subcutaneous injection of melatonin at 18 mg/50 kg body weight dissolved in sterilized corn oil as vehicle, n = 20) and untreated (subcutaneous sterilized corn oil, n = 8). Blood sampling for estimation of serum TAC and MDA (mmol/L) and NO (μmol/L) was carried out at 4 days of interval from 8 days before treatment till 28 days after treatment or for the ensuing entire cycle length. Results showed serum TAC concentration was higher in the treatment group with a significant (P < 0.05) increasing trend, whereas MDA and NO revealed a significant (P < 0.05) decline. Serum MDA and NO were higher in control compared with those of treatment group. Moreover, buffaloes in the treatment group showed 90% estrus induction with 18.06 ± 1.57 days mean interval from treatment to the onset of estrus. These results report that melatonin has a protective effect by elevating antioxidant status and reducing oxidative stress resulting in the induction of cyclicity in summer-stressed anestrous buffaloes.

  13. Short communication: effects of systemic treatment with penethamate hydriodide on udder health and milk yields in dry primiparous Mediterranean buffaloes (Bubalus bubalis).

    PubMed

    Guccione, J; Pesce, A; Pascale, M; Tommasini, N; Garofalo, F; Di Loria, A; Cortese, L; Salzano, C; Ciaramella, P

    2014-01-01

    The effects of penethamate hydriodide (Mamyzin, Boehringer Ingelheim, Ingelheim, Germany) on udder health and milk yields were evaluated in primiparous Mediterranean buffaloes (Bubalus bubalis). An intramuscular administration of 10 million international units was performed in 20 buffaloes at 7 d precalving (treatment group; TG), and 20 animals were enrolled as the control group (CG). Evening milk samplings were performed at 10, 30, and 60 d in milk (DIM). Somatic cell count (SCC) values were evaluated on composite milk samples, whereas bacteriological culture and California Mastitis Test were performed on quarter milk. Daily milk yields were recorded after all milkings. After 60 DIM, composite milk samples from each animal were collected for monthly SCC and bacteriological culture until drying off. Statistically significant differences were found between the prevalence of mastitic quarters in the 2 groups at 10 and 30 DIM, and between the incidence of mastitic animals during the examined period (TG: 4/20, 20% vs. CG: 10/20, 50%). Even though lower and higher values of SCC and milk yields were found in TG during each sampling, statistically significant differences were only found at 30 (SCC) and 60 DIM (milk yields). In our study, the antibiotic administration precalving showed good bactericidal activity against the most common udder-specific pathogens that cause mastitis in primiparous Mediterranean buffaloes, and greater efficacy was observed at 10 and 30 DIM compared with 60 DIM. Given the significant decrease in SCC and increase in yields achieved, use of this antibiotic could be economically beneficial in buffalo breeding. PMID:24565324

  14. Effect of egg yolk powder on freezability of Murrah buffalo (Bubalus bubalis) semen

    PubMed Central

    Kumar, N.; Lone, S. A.; Prasad, J. K.; Jan, M. H.; Ghosh, S. K.

    2016-01-01

    Aim: The aim of this study was to investigate the effect of commercial egg yolk powder as an alternative to fresh egg yolk on freezability of Murrah buffalo semen. Materials and Methods: Semen samples (12) from 3 Murrah buffaloes (4 from each bull) with mass motility (≥3+) and total motility (70% and above) were utilized in this study. Immediately after collection, each sample was divided into four groups. Groups I was diluted up to 60×106 sperm/ml with tris extender containing 10% fresh egg yolk and Groups II, III, and IV were diluted up to 60×106 sperm/ml with tris extender containing 2%, 4%, and 6% egg yolk powder, respectively. Semen samples were processed and cryopreserved followed by examination of frozen semen samples after 24 h. Semen samples from each group were evaluated for total motility, viability, acrosomal integrity, abnormality, and hypo-osmotic swelling test (HOST) response after dilution, pre-freeze, and post-thaw stage. Results: Pre-freeze total motility was significantly (p<0.05) higher in Groups III and IV as compared to Groups I and II, and post-thaw total motility was significantly (p<0.01) higher in Group III as compared to other three groups. Viability was significantly (p<0.05) higher in Groups II, III, and IV than Group I at the pre-freeze stage. Significantly (p<0.01) higher viability and acrosomal integrity were recorded in Group III as compared to other three groups at the post-thaw stage. Abnormality was significantly (p<0.05) higher in Group IV than other three groups. HOST response was significantly (p<0.05) higher in Groups II and III than Groups I and IV at the pre-freeze and post-thaw stages. Conclusion: Addition of egg yolk powder at 4% level yielded significantly better results in terms of post-thaw semen quality as compared to the fresh egg yolk and other concentrations of egg yolk powder (2% and 6%). PMID:27397983

  15. Buffalo (Bubalus bubalis) term amniotic-membrane-derived cells exhibited mesenchymal stem cells characteristics in vitro.

    PubMed

    Ghosh, Kaushalya; Kumar, Rajesh; Singh, Jarnail; Gahlawat, S K; Kumar, Dharmendra; Selokar, Naresh Lalaji; Yadav, S P; Gulati, B R; Yadav, P S

    2015-10-01

    Recent studies suggested that placentae amniotic membrane is a valuable source of stem cells in human as well as in livestock species. Advantages of amnion over other sources of stem cells included abundant availability, ethically non-objectionable and non-invasive source. The aim of the present study was the isolation, culture and characterization of amniotic-membrane-derived mesenchymal stem cells from term placentae collected postpartum in buffalo. We have observed that both presumptive epithelial-like and fibroblast-like cells were cultured and maintained from term amnion. These cells were shown the positive expression of pluripotency markers (OCT-4, SOX-2, NANOG, TERT), mesenchymal stem cell markers (CD29, CD44, CD105) and negative for haematopoietic marker (CD34) genes at different passages. In addition, these cells were also positive for alkaline phosphatase staining. Stem-ness potential of any stem cells is determined by their potential to differentiate into specific lineages of cell type. In the present study, we have successfully differentiated the amniotic-membrane-derived cells into adipogenic, chondrogenic and osteogenic lineages of cells in vitro. In conclusion, the results of this study demonstrate that amniotic-membrane-derived cells expressed pluripotent and mesenchymal stem cells markers and have propensity to differentiate into cells of mesenchymal lineage cell type upon directed differentiation in vitro.

  16. Characterization of Arcobacter suis isolated from water buffalo (Bubalus bubalis) milk.

    PubMed

    Giacometti, Federica; Salas-Massó, Nuria; Serraino, Andrea; Figueras, Maria José

    2015-10-01

    During a survey in a dairy plant in Italy, the second strain (strain FG 206) of Arcobacter suis described in the literature was isolated from raw water buffalo milk. The objective of this study was to confirm the species identification, better define the species by comparing its characteristics with those of the reference strain (F41(T) = CECT 7833(T) = LMG 26152(T)) and to investigate its potential clinical relevance by detecting the virulence gene pattern of the new strain. Phenotypical characterization and 16S rRNA-RFLP gave a complete overlap of results for the two strains. As expected, an RFLP pattern common to A. suis and Arcobacter defluvii was obtained by MseI endonuclease digestion, and a pattern specific for A. suis was obtained by BfaI endonuclease digestion. 16S rRNA sequencing and multilocus phylogenetic analysis (MLPA) showed a robust relatedness of strain FG 206 to the A. suis type strain F41(T). The recovery of strain FG 206 from a dairy plant shows that this species of Arcobacter is present in the food chain. Like the type strain recovered from pig meat, the species A. suis may not be confined to a single type of food.

  17. Metagenomic analysis of Surti buffalo (Bubalus bubalis) rumen: a preliminary study.

    PubMed

    Singh, Krishna M; Ahir, Viral B; Tripathi, Ajai K; Ramani, Umed V; Sajnani, Manisha; Koringa, Prakash G; Jakhesara, Subhash; Pandya, Paresh R; Rank, Dharamsi N; Murty, Duggirala S; Kothari, Ramesh K; Joshi, Chaitanya G

    2012-04-01

    The complex microbiome of the rumen functions as an effective system for the conversion of plant cell wall biomass to microbial proteins, short chain fatty acids and gases. In this study, metagenomic approaches were used to study the microbial populations and metabolic potential of the microbial community. DNA was extracted from Surti Buffalo rumen samples (four treatments diet) and sequenced separately using a 454 GS FLX Titanium system. We used comparative metagenomics to examine metabolic potential and phylogenetic composition from pyrosequence data generated in four samples, considering phylogenetic composition and metabolic potentials in the rumen may remarkably be different with respect to nutrient utilization. Assignment of metagenomic sequences to SEED categories of the Metagenome Rapid Annotation using Subsystem Technology (MG-RAST) server revealed a genetic profile characteristic of fermentation of carbohydrates in a high roughage diet. The distribution of phylotypes and environmental gene tags (EGTs) detected within each rumen sample were dominated by Bacteroidetes/Chlorobi, Firmicutes and Proteobacteria in all the samples. The results of this study could help to determine the role of rumen microbes and their enzymes in plant polysaccharide breakdown is fundamental to understanding digestion and maximising productivity in ruminant animals. PMID:21947953

  18. Quantitative morphology of the testicular tubular epithelium in the water buffalo (Bubalus bubalis).

    PubMed

    Wrobel, K H; Pawar, H S

    1992-01-01

    Ultrastructural features and morphometric evaluations of water buffalo seminiferous epithelium are reported for the 6 phases of the spermatogenic cycle. The relative Sertoli cell volume varies between 30% (phase 4) and 39% (phase 8), the calculated volume of a Sertoli cell between 7118 microns3 and 8968 microns3 (phase 4). Smooth ER is the organelle that exhibits the most prominent changes in Sertoli cells during the spermatogenic cycle: it occupies about 6% in phase 3 and 21% in phase 4. All spermatogenic cells of the same clone present cytoplasmic bridges among them. From preleptotene (about 470 microns3) to late diplotene (about 2300 microns3) the volume of a primary spermatocyte increases nearly 5-fold; their nuclear volumes increase 3.5-fold in the same period. Secondary spermatocytes are found only in phase 4 of the cycle. Due to partial cell necrosis and autolysis late maturation phase spermatids display not more than 25% of the size of early cap phase spermatids. 63% of all numerically possible germ cells disappear from the seminiferous epithelium during spermatogenesis. Particularly heavy cell loss is observed in phase 4 and involves the spermatogonial fraction as well as cells during the second meiotic division.

  19. Natural trematode infection in liver of water buffalo (Bubalus bubalis): histopathological investigation.

    PubMed

    Haque, Masoodul; Mohan, Chandra; Ahmad, Imtiaz

    2011-06-01

    This study reports the infection of liver and bile ducts, carried out from November 2008 to April 2010, on 730 randomly selected water buffaloes-Bubalusbubalis, infected with the amphistome trematode parasite Explanatum explanatum (Creplin, 1847) Fukui, 1929. Macroscopic examination revealed massive infection of adult fluke in bile ducts and intrahepatic ductules in 131 (18%) cases. The predominant features were multifocal granulomatous nodules throughout the luminal surface of the bile ducts. Histopathological study of 4 μm thick tissue sections cut adjacent to and through the site of attachment of individual worm and stained with hematoxylin and eosin revealed intense infiltration of inflammatory cells such as lymphocytes, macrophages, plasma cells, eosinophils as well as fibrocytes. This was associated with fibrosis and thickening of the bile ducts. Due to high level of prevalence and intensity of natural infection, amphistomiasis appears to be endemic in this geographical region and probably represent one of the most important animal health problems. It is hoped that the study may draw attention to the need for educating farmers, regarding the economic importance of infection of these amphistome parasites and also for the development of control strategies to prevent the spread of infection to ruminants.

  20. Mannose-binding lectin haplotypes influence Brucella abortus infection in the water buffalo (Bubalus bubalis).

    PubMed

    Capparelli, R; Parlato, M; Amoroso, M G; Roperto, S; Marabelli, R; Roperto, F; Iannelli, D

    2008-04-01

    A case-control study established that the haplotype pair HYA/HYA at the MBL (mannose binding lectin) locus of water buffalo is associated with resistance to Brucella abortus infection (P < 10(-7)) and the haplotype pairs LYD/LYD with susceptibility to the same pathogen (P < 10(-7)). The subjects included in the present study were tested twice-at a 1-month interval-for the presence of anti-B. abortus antibodies in the serum by agglutination, complement fixation and flow cytometry. Cases (335 subjects) included animals consistently positive to all these tests; controls (335 subjects) comprised animals exposed yet negative by the same tests. The serum from genetically resistant subjects displayed in vitro significantly higher antibacterial activity compared to the serum from genetically susceptible subjects, lending biological significance to the results from the association study. Inhibition of the antibacterial activity following heat treatment of the serum, addition of specific MBL inhibitors (EDTA, mannose, N-acetyl-D: -glucosamine) or anti-human MBL antiserum provide convincing evidence that the antibacterial activity present in the serum results from the interaction between MBL and B. abortus. A replication study (comprising 100 cases and 100 controls) confirmed the results from the original study.

  1. Evidence of Fasciola spp. resistance to albendazole, triclabendazole and bromofenofos in water buffaloes (Bubalus bubalis).

    PubMed

    Venturina, Virginia M; Alejandro, Ma Antonette F; Baltazar, Cyril P; Abes, Nancy S; Mingala, Claro N

    2015-01-01

    Fasciolosis caused by Fasciola spp. is considered the most important helminth infection of ruminants in tropical countries. Anthelmintic resistance has become a global concern. This study compared the efficacy of the commonly used anthelmintics, determined the toxicity level and any indication of resistance. Thirty two water buffaloes naturally-infected with Fasciola spp. were used to determine the efficacy of triclabendazole (TBZ), albendazole (ABZ), and bromofenofos (BRO) using Fecal Egg Count Reduction Test (FECRT). To test the toxicity of the drugs given, serum glutamic-pyruvic transaminase (SGPT) was evaluated before and within one week after treatment. One dose administration of ABZ registered an efficacy of 79.17%, 73.33% for TBZ and 70.83% for BRO. Efficacy in two dose- treatment group was 83.33% for both BRO and ABZ, and 90.00% for TBZ. Two dose-treatment was effective for TBZ (90%), ineffective for BRO and ABZ. SGPT levels were not significantly different between pre-treatment and post- treatment across all treatments. Giving one or two doses of anthelmintics, at one month interval, does not increase the efficacy of the three drugs tested. The study also implies that anthelmintic resistance may have developed in the animals.

  2. Ultrastructural study of Sarcocystis fusiformis (Railliet, 1897) infecting the Indian water buffalo (Bubalus bubalis) of Egypt.

    PubMed

    Ghaffar, F A; Hilali, M; Scholtyseck, E

    1978-09-01

    Sarcocysts from the muscular layer of the oesophagus of 20 Indian water buffaloes (about 7--10 years old) have been collected in Egypt and studied by means of electron microscopy in Bonn (West Germany). Large and small cysts have been observed. The large type ranged from 7--30 X 3--7 mm, and the small cysts measured 1.3--5.1 X 0.7--2.2 mm. The metrocytes of both types of cysts as well as the merozoites were very similar concerning their shape, size and ultrastructural characteristics. The metrocytes of the large and small cysts were mostly located at the peripheral region of the cysts and multiplied by endodyogeny. They were variable in shape and size. They ranged from 7.6 X 4.8 micrometer to 9.2 X 5.4 micrometer. Most of them exhibited deep invaginations of their pellicle. Their cytoplasm was electron pale and often extremely vacuolated. The merozoites of both types of cysts were elongated with a length ranging from 14.6--17.0 micrometer and showed all characteristic organelles of these cells (conoid, rhoptries, micronemes, subpellicular microtubules etc.) The wall of the large and small cysts showed no distinct morphological differences. The great similarities between the walls of the two types of cysts as well as between the micromorphology of the developmental stages (metrocytes and merozoites) lead to the conclusion that the two types of cysts examined may belong to one species of Sarcocystis.

  3. Purification and some properties of galectin-1 derived from water buffalo (Bubalus bubalis) brain.

    PubMed

    Ola, M Shamsul; Tabish, M; Khan, F H; Banu, Naheed

    2007-06-01

    An increasing number of galectins have been found in various animal species, the most abundant of which is galectin-1. The purpose of the present study was to purify and characterize galectin-1 from buffalo brain. We purified the galectin using a combination of ammonium sulphate fractionation and affinity chromatography and the homogeneity was determined by both native polyacrylamide gel electrophoresis (PAGE) and denaturing SDS-PAGE. The molecular weight of the galectin as determined by SDS-PAGE under reducing conditions and by gel filtration column under native conditions was 13.8 and 24.5 kDa, respectively, suggesting a dimeric form of galectin. The most potent inhibitor of the galectin activity was lactose, giving complete inhibition of hemagglutination at 0.8 mM. Galectin showed higher specificity towards human blood group A. Free thiol groups were estimated at a molar ratio of 2.9. The effects of alkylating reagents (iodoacetate and iodoacetamide) on saccharide binding of the galectin were studied. Both alkylating reagents significantly inactivated the activity of the galectin within 20 min. The temperature and pH stability of the galectin were determined. Our findings based on physico-chemical properties, carbohydrate and blood group specificities of the galectin may have future implications in biological and clinical applications.

  4. Evidence of Fasciola spp. resistance to albendazole, triclabendazole and bromofenofos in water buffaloes (Bubalus bubalis).

    PubMed

    Venturina, Virginia M; Alejandro, Ma Antonette F; Baltazar, Cyril P; Abes, Nancy S; Mingala, Claro N

    2015-01-01

    Fasciolosis caused by Fasciola spp. is considered the most important helminth infection of ruminants in tropical countries. Anthelmintic resistance has become a global concern. This study compared the efficacy of the commonly used anthelmintics, determined the toxicity level and any indication of resistance. Thirty two water buffaloes naturally-infected with Fasciola spp. were used to determine the efficacy of triclabendazole (TBZ), albendazole (ABZ), and bromofenofos (BRO) using Fecal Egg Count Reduction Test (FECRT). To test the toxicity of the drugs given, serum glutamic-pyruvic transaminase (SGPT) was evaluated before and within one week after treatment. One dose administration of ABZ registered an efficacy of 79.17%, 73.33% for TBZ and 70.83% for BRO. Efficacy in two dose- treatment group was 83.33% for both BRO and ABZ, and 90.00% for TBZ. Two dose-treatment was effective for TBZ (90%), ineffective for BRO and ABZ. SGPT levels were not significantly different between pre-treatment and post- treatment across all treatments. Giving one or two doses of anthelmintics, at one month interval, does not increase the efficacy of the three drugs tested. The study also implies that anthelmintic resistance may have developed in the animals. PMID:26878627

  5. Short communication: Role of Streptococcus pluranimalium in Mediterranean buffaloes (Bubalus bubalis) with different udder health statuses.

    PubMed

    Guccione, J; Perreten, V; Steiner, A; Thomann, A; Pesce, A; Ciaramella, P; Bodmer, M

    2016-04-01

    The aims of the current study were to describe presence and clinical role over time of Streptococcus pluranimalium isolated in milk samples of Mediterranean buffalo (MB). Two hundred composite milk samples originating from 40 primiparous MB were collected at 10, 30, 60, 90, and 150d in milk (DIM) and from 20 pluriparous MB at 77 to 120 DIM. Milk samples were used for analysis of somatic cell counts, bacteriological cultures, and identification (matrix-assisted laser desorption/ionization time-of-flight mass spectrometry). Nine of 200 (4.5%) samples of primiparous MB and 3 of 20 (15%) samples of pluriparous MB were positive for Strep. pluranimalium. The prevalence of the bacterium in primipari was 0% (0/40) at 10, 30, and 150 DIM, whereas it was 5 (2/40) and 17.5% (7/40) at 60 and 90 DIM, respectively. Eight primipari were positive only once, whereas 1 was positive at 2 different samplings. Mono-infection was not detected in any of the age categories or udder health status. Infections were transient in primipari. Clinical mastitis was observed in primipari once at 90 DIM, subclinical mastitis detected twice in the same animals at 60 and 90 DIM, and intramammary infections were diagnosed 1 and 5 times at 60 and 90 DIM in primipari, respectively, whereas 3 infections were diagnosed in pluripari. The clinical reflections demonstrate for the first time the presence of Strep. pluranimalium in MB and its association with different udder health status. Nevertheless, it cannot be excluded that the bacterium may simply follow a pattern of commensal or opportunistic behavior, taking advantage of a preexisting bacterial udder infection. PMID:26805969

  6. Diurnal changes in concentration of rumen ciliates and in occurrence of dividing forms in water buffalo (Bubalus bubalus) fed once daily.

    PubMed

    Michalowski, T

    1977-04-01

    When buffalo were fed once daily, significant diurnal variations in concentration of rumen ciliates and occurrence of dividing protozoa were found. Differences in proportions of dividing Entodinium- and Diplodinium-type ciliates were also observed. Results obtained suggest that the range of diurnal fluctuations in rumen protozoa concentration may be related to the percentage of dividing cells in populaitons of these organisms.

  7. Modulatory role of leptin on ovarian functions in water buffalo (Bubalus bubalis).

    PubMed

    Reshma, R; Mishra, S R; Thakur, N; Parmar, M S; Somal, A; Bharti, M K; Pandey, S; Chandra, V; Chouhan, V S; Verma, M R; Singh, G; Sharma, G T; Maurya, V P; Sarkar, M

    2016-10-15

    The aim of the present study was to demonstrate the modulatory role of leptin on bubaline granulosa cells (GCs) and luteal cells (LCs) functions using an in vitro cell culture system and to establish a cross talk between leptin and insulin-like growth factor-1 (IGF-1). GCs were collected from group IV follicles (>13 mm size) and LCs from mid-luteal phase corpus luteum and were grown in serum-containing media supplemented with leptin at three different dose rates (0.1, 1, and 10 ng/mL) and time durations (24, 48, and 72 hours). We evaluated the production and secretion of estradiol (E2) and progesterone (P4) using RIA and the mRNA expression of steroidogenic acute regulatory protein (STARD1), cytochrome P450 cholesterol side-chain cleavage (CYP11A1), 3β-hydroxysteroid dehydrogenase (3β-HSD), cytochrome P450 aromatase (CYP19A1), sterol regulatory element-binding protein 1 (SREBP1), steroidogenic factor-1 (SF1), anti-apoptotic gene PCNA, pro-apoptotic gene caspase 3 and endothelial cell marker, Von Willebrand factor (vWF), using quantitative real-time polymerase chain reaction. The results depicted a direct inhibitory action of leptin on GCs steroidogenesis in a time-dependent manner (P < 0.05), whereas in the presence of IGF-1 the inhibitory effect was reverted. Furthermore, leptin augmented both cellular proliferation (PCNA) and apoptosis (caspase 3). On the other hand, in LCs, leptin alone showed an apparent stimulatory effect on steroidogenesis (P < 0.05); however, in the presence of IGF-1, an antagonistic effect was witnessed. Moreover, leptin had an inhibitory effect on apoptosis while promoted cellular proliferation and angiogenesis. These findings were further strengthened by immunocytochemistry. To conclude, these observations for the first time reported that in buffaloes leptin has a direct dose-, time-, and tissue-dependent effect on ovarian steroidogenesis, angiogenesis, and cytoprotection, and furthermore, it can regulate the effect of systemic

  8. Modulatory role of leptin on ovarian functions in water buffalo (Bubalus bubalis).

    PubMed

    Reshma, R; Mishra, S R; Thakur, N; Parmar, M S; Somal, A; Bharti, M K; Pandey, S; Chandra, V; Chouhan, V S; Verma, M R; Singh, G; Sharma, G T; Maurya, V P; Sarkar, M

    2016-10-15

    The aim of the present study was to demonstrate the modulatory role of leptin on bubaline granulosa cells (GCs) and luteal cells (LCs) functions using an in vitro cell culture system and to establish a cross talk between leptin and insulin-like growth factor-1 (IGF-1). GCs were collected from group IV follicles (>13 mm size) and LCs from mid-luteal phase corpus luteum and were grown in serum-containing media supplemented with leptin at three different dose rates (0.1, 1, and 10 ng/mL) and time durations (24, 48, and 72 hours). We evaluated the production and secretion of estradiol (E2) and progesterone (P4) using RIA and the mRNA expression of steroidogenic acute regulatory protein (STARD1), cytochrome P450 cholesterol side-chain cleavage (CYP11A1), 3β-hydroxysteroid dehydrogenase (3β-HSD), cytochrome P450 aromatase (CYP19A1), sterol regulatory element-binding protein 1 (SREBP1), steroidogenic factor-1 (SF1), anti-apoptotic gene PCNA, pro-apoptotic gene caspase 3 and endothelial cell marker, Von Willebrand factor (vWF), using quantitative real-time polymerase chain reaction. The results depicted a direct inhibitory action of leptin on GCs steroidogenesis in a time-dependent manner (P < 0.05), whereas in the presence of IGF-1 the inhibitory effect was reverted. Furthermore, leptin augmented both cellular proliferation (PCNA) and apoptosis (caspase 3). On the other hand, in LCs, leptin alone showed an apparent stimulatory effect on steroidogenesis (P < 0.05); however, in the presence of IGF-1, an antagonistic effect was witnessed. Moreover, leptin had an inhibitory effect on apoptosis while promoted cellular proliferation and angiogenesis. These findings were further strengthened by immunocytochemistry. To conclude, these observations for the first time reported that in buffaloes leptin has a direct dose-, time-, and tissue-dependent effect on ovarian steroidogenesis, angiogenesis, and cytoprotection, and furthermore, it can regulate the effect of systemic

  9. Apoptosis during spontaneous and prostaglandin F(2alpha)-induced luteal regression in the buffalo cow (Bubalus bubalis): involvement of mitogen-activated protein kinases.

    PubMed

    Yadav, Vijay K; Sudhagar, Ranga R; Medhamurthy, R

    2002-09-01

    The present study was conducted to evaluate whether the corpus luteum (CL) of the water buffalo (Bubalus bubalis) cow undergoes luteal regression by the process of apoptosis and to examine the involvement of mitogen-activated protein (MAP) kinases during prostaglandin (PG) F(2alpha)-induced luteolysis. Sections of CL from late in the estrous cycle, i.e., during spontaneous luteolysis, stained for 4',6'-diamidino-2-phenylindole revealed increased numbers of condensed nuclei, indicating cell death by apoptosis, which was confirmed further by the occurrence of pronounced oligonucleosome formation. For morphological and biochemical characterization during PGF(2alpha)-induced apoptosis, CL were collected at 0, 4, 12, and 18 h after injection of 750 micro g of Tiaprost, a synthetic analogue of PGF(2alpha), to midestrous buffalo cows. Serum progesterone concentrations fell within 4 h and decreased (P < 0.05) maximally by 18 h. Concomitant decreases (P < 0.05) in the levels of steroidogenic acute regulatory mRNA and protein were observed in CL during 12-18 h, with the more profound effect on mRNA levels. Quantitative analysis of the genomic DNA showed a >5-fold increase (P < 0.05) in the low molecular weight DNA fragments by 18 h postinjection. Immunoblot analysis of CL tissue lysates showed increased (P < 0.05) levels of phospho-Jun N-terminal kinase (JNK) 1 (4- to 14-fold during 4-18 h) and phospho-p38 (2- to 4-fold at 18 h). Immunohistochemical evaluation of CL sections revealed an increased nuclear localization of phospho-JNK after treatment. These findings demonstrate that the CL of the buffalo cow undergoes cell death by the process of apoptosis both during spontaneous and PGF(2alpha)-induced luteolysis and that MAP kinases are involved during PGF(2alpha)-mediated apoptosis in the CL.

  10. Cellular conservation of endangered midget buffalo (Lowland Anoa, Bubalus quarlesi) by establishment of primary cultured cell, and its immortalization with expression of cell cycle regulators.

    PubMed

    Fukuda, Tomokazu; Iino, Yuuka; Eitsuka, Takahiro; Onuma, Manabu; Katayama, Masafumi; Murata, Koichi; Inoue-Murayama, Miho; Hara, Kumiko; Isogai, Emiko; Kiyono, Tohru

    2016-10-01

    Lowland Anoa has become endangered due to hunting and human activity. Protection and breeding of endangered species in a controlled environment is the best way of conservation. However, it is not possible to adopt this approach for all endangered species because of the cost involved and the ever-increasing number of critically endangered species. In consideration of these limitations to the conventional conservation methods, we established a primary cell culture of endangered buffalo (Lowland Anoa, Bubalus quarlesi), for the preservation of this biological resource. In addition, we introduced human derived, mutant cyclin dependent kinase 4 (CDK4), Cyclin D, and telomerase reverse transcriptase (TERT) into the primary cells. The successful introduction of these three genes was confirmed by western blot with specific antibodies, and enzymatic activity. We also showed that the expression of mutant CDK4, Cyclin D, and TERT allows us to efficiently establish an immortalized cell line, with an intact chromosome pattern, from Lowland Anoa. To the best of our knowledge, this study is the first investigation that established an immortalized cell line of an endangered wild animal species.

  11. Cellular conservation of endangered midget buffalo (Lowland Anoa, Bubalus quarlesi) by establishment of primary cultured cell, and its immortalization with expression of cell cycle regulators.

    PubMed

    Fukuda, Tomokazu; Iino, Yuuka; Eitsuka, Takahiro; Onuma, Manabu; Katayama, Masafumi; Murata, Koichi; Inoue-Murayama, Miho; Hara, Kumiko; Isogai, Emiko; Kiyono, Tohru

    2016-10-01

    Lowland Anoa has become endangered due to hunting and human activity. Protection and breeding of endangered species in a controlled environment is the best way of conservation. However, it is not possible to adopt this approach for all endangered species because of the cost involved and the ever-increasing number of critically endangered species. In consideration of these limitations to the conventional conservation methods, we established a primary cell culture of endangered buffalo (Lowland Anoa, Bubalus quarlesi), for the preservation of this biological resource. In addition, we introduced human derived, mutant cyclin dependent kinase 4 (CDK4), Cyclin D, and telomerase reverse transcriptase (TERT) into the primary cells. The successful introduction of these three genes was confirmed by western blot with specific antibodies, and enzymatic activity. We also showed that the expression of mutant CDK4, Cyclin D, and TERT allows us to efficiently establish an immortalized cell line, with an intact chromosome pattern, from Lowland Anoa. To the best of our knowledge, this study is the first investigation that established an immortalized cell line of an endangered wild animal species. PMID:27449922

  12. Post-exposure serological and bacteriological responses of water buffalo (Bubalus bubalis) to Brucella abortus biovar 1 following vaccination with Brucella abortus strain RB51.

    PubMed

    Diptee, M D; Asgarali, Z; Campbell, M; Fosgate, G; Adesiyun, A A

    2007-12-01

    Serological and bacteriological responses to Brucella abortus biovar 1 following vaccination with B. abortus strain RB51 (RB51) were evaluated in thirty domestic water buffalo (Bubalus bubalis) randomly divided into five treatment groups. Groups I to V received, respectively, the recommended dose (RD) of RB51 vaccine once, RD twice 4 weeks apart, double RD once, double RD twice 4 weeks apart, and saline once (control). Vaccination did not result in a serological response. Experimental animals released 27 weeks post initial inoculation (27 PIIW) into a brucellosis-positive herd failed to seroconvert after 29 weeks. Experimental challenge commenced at 57 PIIW. All animals received B. abortus biovar 1 intraconjunctivally at 0, 5 and 9 weeks post experimental exposure (PEEW). Serum samples collected at 4, 8 and 13 PEEW were negative. At 16 PEEW all animals received B. abortus biovar 1 subcutaneously (SC), and all seroconverted by 20 PEEW. Five of twenty-six animals were positive for Brucella infection on bacterial culture. Brucella abortus biovar 1 was isolated from three animals; B. abortus RB51 was isolated from two. Treatment group, age and sex had no effect on the isolation of Brucellae (P>0.05).

  13. Effects of growth hormone-releasing factor on growth hormone response, growth and feed conversion efficiency in buffalo heifers (Bubalus bubalis).

    PubMed

    Haldar, A; Prakash, B S

    2007-09-01

    The aim of this study was to determine the benefits of growth hormone-releasing factor (GRF) on growth and feed conversion efficiency (FCE) in buffaloes. Twelve Murrah buffalo heifers (Bubalus bubalis) of mean age 24.8 months and mean body weight 302.4kg were divided into two groups (treatment and control) with six animals in each group. The buffaloes were given intravenous injections of bovine GRF (bGRF) at a dose rate of 10microg/100kg body weight or an equal volume of saline at 15-day intervals for a period of 9 months. Plasma growth hormone (GH) responses to bGRF challenge were measured in blood samples collected at 90-day intervals on days 1, 90, 180 and 270 and samples were taken at -60, -30, 0, +10, +20, +30, +60, +120 and +180min relative to bGRF injection. Blood samples were also collected weekly by jugular venepuncture for the quantification of plasma GH. The average growth rate (AGR) and FCE of all animals were recorded at 15-day intervals. Plasma GH concentrations increased (P=0.001) steadily following bGRF challenge, peaking 10-20min after challenge and declining to baseline by 180min. In the treatment group, there were no significant differences (P>0.05) in either the peak heights of the GH response or the area under the curve (AUC) of the GH response after bGRF challenge on any of the four occasions of intensive bleeding. There were overall increases in plasma GH concentrations (P<0.01), AGR (P<0.01) and FCE (P=0.05) in the treatment group compared with the control animals. The study showed that GH responsiveness to administration of bGRF at 15-day intervals over 9 months of treatment remained unchanged in buffalo heifers. Exogenous bGRF treatment for a long period can therefore enhance GH release leading to higher growth rates and better feed conversion efficiency in buffalo heifers. PMID:17113797

  14. The effect of a high-roughage diet on the metabolism of aromatic compounds by rumen microbes: a metagenomic study using Mehsani buffalo (Bubalus bubalis).

    PubMed

    Prajapati, Vimalkumar S; Purohit, Hemant J; Raje, Dhananjay V; Parmar, Nidhi; Patel, Anand B; Jones, Oliver A H; Joshi, Chaitanya G

    2016-02-01

    In developing countries, livestock are often fed a high-lignin, low-nutrient diet that is rich in aromatic compounds. It is therefore important to understand the structure of the microbial community responsible for the metabolism of these substances. A metagenomic analysis was therefore carried out to assess the microbial communities associated with the liquid and solid fractions of rumen biomaterial from domestic Mehsani buffalo (Bubalus bubalis) fed with varying proportions of roughage. The experimental design consisted of three feeding regimes (50, 75 and 100 % roughage) and two roughage types (green and dry). Genes associated with aromatic compound degradation were assessed via high-throughput DNA sequencing. A total of 3914.94 Mb data were generated from all treatment groups. Genes coding for functional responses associated with aromatic compound metabolism were more prevalent in the liquid fraction of rumen samples than solid fractions. Statistically significant differences (p < 0.05) were also observed between treatment groups. These differences were dependent on the proportion of roughage fed to the animal, with the type of roughage having little effect. The genes present in the highest abundance in all treatment groups were those related to aromatic compound catabolism. At the phylum level, Bacteroidetes were dominant in all treatments closely followed by the Firmicutes. This study demonstrates the use of feed type to selectively enrich microbial communities capable of metabolizing aromatic compounds in the rumen of domestic buffalo. The results may help to improve nutrient utilization efficiency in livestock and are thus of interest to farming industries, particularly in developing countries, worldwide.

  15. Effects of in vitro selenium addition to the semen extender on the spermatozoa characteristics before and after freezing in water buffaloes (Bubalus bubalis).

    PubMed

    Dorostkar, Kamran; Alavi-Shoushtari, Sayed Mortaza; Mokarizadeh, Aram

    2012-01-01

    The aim of the present study was to investigate the effect of in vitro supplementation of selenium on fresh and frozen spermatozoa quality of buffalo (Bubalus bubalis) bulls. Five healthy buffalo bulls (5 ejaculates from each bull) were used. Each ejaculate was diluted at 37 ˚C with tris-based extender containing 0 (control), 0.5, 1, 2, 4 and 8 µg mL(-1) sodium selenite and the sperm motility and viability were evaluated at 0 (T0) (immediately after dilution), 60 (T1) and 120 (T2) min after diluting semen. In the second step, semen samples were diluted with tris-egg yolk-glycerol extender containing the same amounts of sodium selenite, cooled to 4 ˚C, equilibrated and semen parameters (motility, viability, membrane integrity and DNA damage) were estimated. Then, the semen was packed in 0.5 mL French straws and frozen in liquid nitrogen. Later, the semen was thawed and analyzed for the same parameters, as well as total antioxidant capacity. Results showed that addition of 1 and 2 µgmL(-1) selenium to the semen extender significantly increased the sperm motility of fresh and equilibrated semen compared to the control without affecting other parameters. However, in frozen-thawed semen, extenders containing 1 and 2 µg mL(-1) selenium significantly improved sperm motility, viability, membrane integrity and semen total antioxidant capacity and also resulted in lower DNA damaged sperms. In this study selenium supplementation of semen extender of 4 and 8 µg mL(-1) had deleterious effects on sperm parameters as early as the samples were prepared for freezing.

  16. Myxobolus ictiobus n. sp. and Myxobolus minutus n. sp. (Cnidaria: Myxobolidae) from the gills of the smallmouth buffalo Ictiobus bubalus Rafinesque (Cypriniformes: Catostomidae).

    PubMed

    Rosser, Thomas G; Griffin, Matt J; Quiniou, Sylvie M A; Alberson, Neely R; Woodyard, Ethan T; Mischke, Charles C; Greenway, Terrence E; Wise, David J; Pote, Linda M

    2016-07-01

    The smallmouth buffalo Ictiobus bubalus Rafinesque (Catostomidae) is native to North American waterways and occasionally grown in pond aquaculture. Species of Myxobolus Bütschli, 1882 have been reported from the gills, integument, and intestinal tract of buffalo fish, although there is ambiguity in some host records. In the summer of 2013, thirteen adult smallmouth buffalo were seined from a 0.1-acre (0.04-hectare) experimental research pond at the Thad Cochran National Warmwater Aquaculture Center in Stoneville, Mississippi, USA, and examined for the presence of parasitic infection. Two previously unknown species of Myxobolus were observed parasitising the gills. Plasmodia of the two species differed from each other in both size and shape. Morphologically the two species were distinct from one another and from other Myxobolus spp. previously reported from buffalo fish. Myxospores of Myxobolus ictiobus n. sp. were spherical and measured 12.7-14.5 (13.9 ± 0.4) µm in length and 10.7-13.6 (12.5 ± 0.7) µm in width with a thickness of 10.3-14.8 (12.6 ± 2.3) µm. Polar capsules measured 5.6-7.4 (6.6 ± 0.4) µm in length and 3.7-4.9 (4.5 ± 0.8) µm in width and each contained a coiled polar filament with 5-6 turns. Myxospores of Myxobolus minutus n. sp. were circular in shape and measured 7.4-9.6 (8.6 ± 0.7) µm in length and 7.5-9.9 (8.8 ± 0.7) µm in width with a thickness of 6.5-7.3 (6.7 ± 0.3) µm. Polar capsules measured 3.6-4.9 (4.3 ± 0.3) µm in length and 2.8-3.8 (3.3 ± 0.3) µm and each contained a coiled polar filament with 5-6 turns. Supplemental 18S rRNA gene sequencing identified unique sequences for each isolate. Phylogenetic analysis of 18S rRNA sequences demonstrated a strong clustering of both isolates with other species of Myxobolus from cypriniform fish. PMID:27307169

  17. Improvement in the diagnosis of Brucella abortus infections in naturally infected water buffaloes (Bubalus bubalis) using an ELISA with a Protein-G-based indicator system.

    PubMed

    Kumar, Manish; Chand, Puran

    2011-12-01

    Brucellosis caused by Brucella abortus in domestic water buffaloes (Bubalus bubalis) raised under the traditional system of husbandry in northern India was diagnosed using an enzyme-linked immunosorbent assays (ELISA) with a Protein-G-based indicator system (Protein-G ELISA). A total of 1,551 animals that are positive (N = 61), negative (N = 243), and suspected (N = 1,247) for brucellosis were examined. Rose bengal test (RBT) was used to predict the disease, and accordingly, animals were dichotomized in positive and negative population for receiver operating characteristic (ROC) curve analysis to determine the sensitivity, the specificity, and the performance index of Protein-G ELISA. Taking all animals (N = 1551) into account, the ROC curve analysis revealed cut off value of 29.6% positivity (%P) with 98.40% and 94.94%, sensitivity and specificity, respectively. The results were compared with ELISA in which anti-bovine conjugate was used. The cut off in ELISA was 37.9%P and sensitivity and specificity were 96.26% and 97.07%, respectively. The performance indexes of both the assays were almost equal and were 193.34 for Protein-G ELISA and 193.33 for ELISA. The cut off values of both the tests changed, if only known positive (N = 61) and known negative (N = 243) animals were used for ROC curve analysis, and accordingly, changes in sensitivity and specificity were observed with significant decrease of performance indexes of both the tests. The high optical density (P < 0.0001) background signal with negative serum control and high %P (P < 0.0001) in sera from negative population were noticed in ELISA in comparison to Protein-G ELISA.

  18. Effects of long-term GH-releasing factor administration on patterns of GH and LH secretion in growing female buffaloes (Bubalus bubalis).

    PubMed

    Mondal, M; Prakash, B S

    2004-01-01

    To investigate the effects of long-term GH-releasing factor (GRF) administration on the patterns of GH and LH secretion in growing female Murrah buffalo (Bubalus bubalis) calves, 12 buffaloes of 6-8 months of age were divided into two groups (treatment and control groups) of six each in such a way that average body weight between the groups did not differ significantly (P > 0.05). Both the groups were administered i.v. with either synthetic bovine GRF (bGRF(1-44)-NH(2)) at 10 microg/100 kg body weight (treatment group) or an equal volume of normal saline (control group) at intervals of 15 days until 18 injections had been completed (9 months). Blood samples collected prior to and after the first and last injection of GRF at -60, -45, -30, -15, -10, -5 min and +5, +10, +15, +30 min, and thereafter at intervals of 15 min up to 8 h post-injection, were assayed for plasma GH and LH. Plasma progesterone was also estimated in twice-a-week samples to assess whether either group had begun ovarian cyclicity. The body weight of all animals was recorded twice a week. In all animals, a peak of GH was recorded within 5-20 min and 5-30 min after the first and last GRF injections and post-injection mean values for plasma GH were significantly (P < 0.01) higher compared with the control group of animals. Although peak GH values after the first and last GRF injection did not differ (P > 0.05), GH levels were maintained at a higher level for a longer time after the last GRF injection compared with the first (240 vs 150 min). The area under the GH response curve after the last GRF injection was found to be significantly (P < 0.01) higher than after the first injection (9344 +/- 99.7 vs 7763 +/- 112.4 ng/ml x min). The mean post-injection plasma LH levels of the treatment group were significantly (P < 0.01) higher after both the first and last GRF injections than in the control group of animals. Interestingly, compared with the first GRF injection, the pre-injection plasma LH level

  19. Cytogenetic analysis of the tamaraw (Bubalus mindorensis): a comparison of R-banded karyotype and chromosomal distribution of centromeric satellite DNAs, telomeric sequence, and 18S-28S rRNA genes with domestic water buffaloes.

    PubMed

    Tanaka, K; Matsuda, Y; Masangkay, J S; Solis, C D; Anunciado, R V; Kuro-o, M; Namikawa, T

    2000-01-01

    The karyotype of the tamaraw (Bubalus mindorensis, 2n = 46) was investigated by RBG-banding technique and compared with those of the river and the swamp cytotypes of domestic water buffalo (B. bubalis). The tamaraw karyotype consisted of 6 submetacentric and 16 acrocentric autosome pairs (NAA = 56), and X and Y chromosomes. The RBG-banded karyotype of the three taxa had a high degree of homology, and the tamaraw karyotype could be explained by a Robertsonian translocation between chromosomes 7 and 15 and by a telomere-centromere tandem fusion between chromosomes 4p and 12 of the standardized river buffalo cytotype (2n = 50, NAA = 58). The buffalo satellite I and II DNAs were localized to the centromeric regions of all the tamaraw chromosomes. The biarmed chromosome 2 of the tamaraw resulting from the fusion between chromosomes 7 and 15 of the standard contained much larger amounts of the satellite I DNA than the other biarmed chromosomes, suggesting that this chromosome was formed by a relatively recent Robertsonian fusion. The (TTAGGG)n telomeric sequence was specifically localized to the telomeric region of all the buffalo chromosomes. The 18S + 28S rDNA was localized to the telomeric regions of the chromosomes 5p, 7, 19, 21, and 22 of the tamaraw and of their homologous chromosomes in the river and swamp buffalo cytotypes.

  20. Amount of mRNA and localization of vascular endothelial growth factor and its receptors in the ovarian follicle during estrous cycle of water buffalo (Bubalus bubalis).

    PubMed

    Babitha, V; Panda, R P; Yadav, V P; Chouhan, V S; Dangi, S S; Khan, F A; Singh, G; Bag, S; Taru Sharma, G; Silvia, W J; Sarkar, M

    2013-03-01

    The objective of the present study was to characterize the temporal patterns of gene expression for vascular endothelial growth factors (VEGF) and VEGF receptors during ovarian follicular growth, development and maturation in buffalo (Bubalus bubalis). Follicles were classified into four groups according to size and the concentration of estradiol-17β (E2) in follicular fluid (FF): Group I (small), 4-6mm diameter, E2>0.5ng/ml of FF; Group II (medium), 7-9mm, E2=0.5-5ng/ml; Group III (large), 10-13mm, E2=5-40ng/ml; Group IV(pre-ovulatory), >13mm, E2>180ng/ml). The mRNAs for FSH receptor (FSHR), LH receptor (LHR) and aromatase (CYP19A1) in theca interna and granulosa layers were also determined, further defining the maturational state of each group. The relative expression of VEGF isoforms (120, 164, and 188 amino acid forms), as determined by quantitative real-time PCR (qRT-PCR), increased during follicular development in both the granulosa (P<0.05) and theca layers. Relative amounts of VEGF receptors (VEGFR-1 and VEGFR-2) were least in granulosa cell (GC) and theca interna cell (TI) layers of Gp-I follicles. The amount of VEGFR-2 transcripts increased in the granulosa layer throughout development, reaching a maximum in Gp-IV follicles (P<0.05). The relative amount of VEGF isoforms and receptors in follicle lysates, as determined by western blotting, increased throughout follicular maturation to maximum amounts in pre-ovulatory follicles. Immunohistochemistry revealed a clear localization of VEGF isoforms and receptors in both steroidogenic cell types (GC and TI) and of VEGF receptors in the vascular endothelial cells of the thecal blood vessels. The most intense immunofluorescence was evident in pre-ovulatory follicles compared to other smaller follicles. These data provide evidence that the VEGF may contribute to the extensive capillary proliferation associated with the increase in size, selection, and maturation of the pre-ovulatory follicle. This may facilitate

  1. Activation and Inhibition of The Wnt3A Signaling Pathway in Buffalo (Bubalus bubalis) Embryonic Stem Cells: Effects of WNT3A, Bio and Dkk1

    PubMed Central

    Zandi, Mohammad; Shah, Syed Mohamad; Muzaffar, Musharifa; Kumar Singh, Manoj; Palta, Prabhat; Kumar Singla, Suresh; Sham Manik, Radhey; Chauhan, Manmohan Singh

    2015-01-01

    Background This research studies the effects of activation and inhibition of Wnt3A signaling pathway in buffalo (Bubalus bubalis) embryonic stem (ES) cell-like cells. Materials and Methods To carry on this experimental study, the effects of activation and inhibition of Wnt3A signaling in buffalo ES cell-like cells were examined using Bio (0.5 mM) combined with WNT3A (200 ng/ml), as an activator, and Dickkopf-1 (Dkk1, 250 ng/ml), as an inhibitor, of the pathway. ES cells were cultured up to three weeks in ES cell medium without fibroblast growth factor-2 (FGF-2) and leukemia inhibitory factor (LIF), but in the presence of Bio, WNT3A, Bio+WNT3A and Dkk1. The effects of these supplements were measured on the mean area of ES cell colonies and on the expression levels of a number of important genes related to pluripotency (Oct4, Nanog, Sox2 and c-Myc) and the Wnt pathway (β-catenin). ES cell colonies cultured in ES cell medium that contained optimized quantities of LIF and FGF-2 were used as the control. Data were collected for week-1 and week-3 treated cultures. In addition, WNT3A-transfected ES cells were compared with the respective mock-transfected colonies, either alone or in combination with Dkk1 for expression of β-catenin and the pluripotency-related genes. Data were analyzed by ANOVA, and statistical significance was accepted at P<0.05. Results Among various examined concentrations of Bio (0.5-5 mM), the optimum effect was observed at the 0.5 mM dose as indicated by colony area and expressions of pluripotency-related genes at both weeks-1 and -3 culture periods. At this concentration,the expressions of Nanog, Oct3/4, Sox2, c-Myc and β-catenin genes were nonsignificantly higher compared to the controls. Expressions of these genes were highest in the Bio+WNT3A treated group, followed by the WNT3A and Bio-supplemented groups, and lowest in the Dkk1-treated group. The WNT-transfected colonies showed higher expressions compared to both mock and Dkk1-treated mock

  2. Differential developmental competence and gene expression patterns in buffalo (Bubalus bubalis) nuclear transfer embryos reconstructed with fetal fibroblasts and amnion mesenchymal stem cells.

    PubMed

    Sadeesh Em; Shah, Fozia; Yadav, P S

    2016-10-01

    The developmental ability and gene expression pattern at 8- to 16-cell and blastocyst stages of buffalo (Bubalus bubalis) nuclear transfer (NT) embryos from fetal fibroblasts (FFs), amnion mesenchymal stem cells (AMSCs) and in vitro fertilized (IVF) embryos were compared in the present studies. The in vitro expanded buffalo FFs showed a typical "S" shape growth curve with a doubling time of 41.4 h and stained positive for vimentin. The in vitro cultured undifferentiated AMSCs showed a doubling time of 39.5 h and stained positive for alkaline phosphatase, and these cells also showed expression of pluripotency markers (OCT 4, SOX 2, NANOG), and mesenchymal stem cell markers (CD29, CD44) and were negative for haematopoietic marker (CD34) genes at different passages. Further, when AMSCs were exposed to corresponding induction conditions, these cells differentiated into adipogenic, chondrogenic and osteogenic lineages which were confirmed through oil red O, alcian blue and alizarin staining, respectively. Donor cells at 3-4 passage were employed for NT. The cleavage rate was significantly (P < 0.05) higher in IVF than in FF-NT and AMSC-NT embryos (82.6 ± 8.2 vs. 64.6 ± 1.3 and 72.3 ± 2.2 %, respectively). However, blastocyst rates in IVF and AMSC-NT embryos (30.6 ± 2.7 and 28.9 ± 3.1 %) did not differ and were significantly (P < 0.05) higher than FF-NT (19.5 ± 1.8 %). Total cell number did not show significant (P > 0.05) differences between IVF and AMSC-NT embryos (186.7 ± 4.2, 171.2 ± 3.8, respectively) but were significantly (P < 0.05) higher than that from FF-NT (151.3 ± 4.1). Alterations in the expression pattern of genes implicated in transcription and pluripotency (OCT4, STAT3, NANOG), DNA methylation (DNMT1, DNMT3A), histone deacetylation (HDAC2), growth factor signaling and imprinting (IGF2, IGF2R), apoptosis (BAX, BCL2), metabolism (GLUT1) and oxidative stress (MnSOD) regulation were observed in cloned embryos. The

  3. Controlled breeding and reproductive management in water buffaloes (Bubalus bubalis) using Eazi Breed controlled internal drug release.

    PubMed

    Hiremath, Shivayogi; Ramesha, Kerekoppa P

    2015-01-01

    Buffalo reproduction is considerably affected by late maturity, poor oestrus symptoms and long postpartum periods. This study was undertaken to evaluate the efficiency of Eazi Breed controlled internal drug release (CIDR), an intravaginal progesterone-releasing device, in relation to oestrus and fertility. Five hundred true anoestrus buffalo cows, in the age group 4-6 years in 10 villages of Dharwad district in Karnataka state in India, were randomly selected and treated with CIDR for 9 days. Two mL of Cidirol (1 mg oestradiol benzoate) was administered intramuscularly to all animals on day 10. Forty-two buffaloes (8.4%) that failed to show oestrus signs (1.6%) or showed weak signs of oestrus (6.8%) after the first treatment were treated again 72 h after the Cidriol injection with a new device, and inseminated after the expression of oestrus. After the second treatment all the animals showed oestrus signs. The percentage of buffaloes showing intense oestrus was 67.40%, intermediate oestrus was shown by 25.80%, whilst 6.80% buffaloes showed weak oestrus even after the second treatment. The buffaloes showing oestrus signs were inseminated twice with an interval of 12 h, starting 12 h after the start of the oestrus signs. In 86 buffaloes showing prolonged oestrus signs a third insemination was done. The conception rates were 85.16%, 60.47% and 44.11% respectively in buffaloes showing intense, intermediate and weak oestrus. Transrectal palpation of the genital tract was performed 45-60 days post-insemination to diagnose pregnancy status, and in doubtful cases pregnancy was reconfirmed at 90 days after insemination. Out of 500 buffaloes treated in this way 380 animals became pregnant and the pregnancy rate was 76%. This study revealed the usefulness of Eazi Breed CIDR along with Cidirol treatment in buffaloes to improve their reproductive performance. PMID:26244580

  4. Production of interspecies handmade cloned embryos by nuclear transfer of cattle, goat and rat fibroblasts to buffalo (Bubalus bubalis) oocytes.

    PubMed

    Selokar, N L; George, A; Saha, A P; Sharma, R; Muzaffer, M; Shah, R A; Palta, P; Chauhan, M S; Manik, R S; Singla, S K

    2011-02-01

    The possibility of producing interspecies handmade cloned (iHMC) embryos by nuclear transfer from donor cells of cattle, goat and rat using buffalo oocytes as recipient cytoplasts was explored. Zona-free buffalo oocytes were enucleated by protrusion cone-guided bisection with a microblade. After electrofusion with somatic cells, reconstructed oocytes were activated by calcimycin A23187, treated with 6-dimethylaminopurine and were cultured in K-RVCL-50® medium for 8 days. Although the cleavage rate was not significantly different when buffalo, cattle, goat or rat cells were used as donor nuclei (74.6 ± 3.8, 82.8 ± 5.3, 86.0 ± 4.9 and 82.3 ± 3.6%, respectively), the blastocyst rate was significantly higher (P<0.01) for buffalo (51.4 ± 2.6) than for cattle (3.5 ± 1.0) or the goat (2.2 ± 0.9), whereas none of the embryos crossed the 32-cell stage when rat cells were used. However, the total cell number was similar for buffalo-buffalo (175.0 ± 5.07) and cattle-buffalo embryos (178.0 ± 11.84). Following transfer of 3 buffalo-buffalo embryos each to 6 recipients, 3 were found to be pregnant, though the pregnancies were not carried to full term. These results suggest that interspecies blastocyst stage embryos can be produced by iHMC using buffalo cytoplasts and differentiated somatic cells from cattle and goat and that the source of donor nucleus affects the developmental competence of interspecies embryos.

  5. Controlled breeding and reproductive management in water buffaloes (Bubalus bubalis) using Eazi Breed controlled internal drug release.

    PubMed

    Hiremath, Shivayogi; Ramesha, Kerekoppa P

    2015-06-04

    Buffalo reproduction is considerably affected by late maturity, poor oestrus symptoms and long postpartum periods. This study was undertaken to evaluate the efficiency of Eazi Breed controlled internal drug release (CIDR), an intravaginal progesterone-releasing device, in relation to oestrus and fertility. Five hundred true anoestrus buffalo cows, in the age group 4-6 years in 10 villages of Dharwad district in Karnataka state in India, were randomly selected and treated with CIDR for 9 days. Two mL of Cidirol (1 mg oestradiol benzoate) was administered intramuscularly to all animals on day 10. Forty-two buffaloes (8.4%) that failed to show oestrus signs (1.6%) or showed weak signs of oestrus (6.8%) after the first treatment were treated again 72 h after the Cidriol injection with a new device, and inseminated after the expression of oestrus. After the second treatment all the animals showed oestrus signs. The percentage of buffaloes showing intense oestrus was 67.40%, intermediate oestrus was shown by 25.80%, whilst 6.80% buffaloes showed weak oestrus even after the second treatment. The buffaloes showing oestrus signs were inseminated twice with an interval of 12 h, starting 12 h after the start of the oestrus signs. In 86 buffaloes showing prolonged oestrus signs a third insemination was done. The conception rates were 85.16%, 60.47% and 44.11% respectively in buffaloes showing intense, intermediate and weak oestrus. Transrectal palpation of the genital tract was performed 45-60 days post-insemination to diagnose pregnancy status, and in doubtful cases pregnancy was reconfirmed at 90 days after insemination. Out of 500 buffaloes treated in this way 380 animals became pregnant and the pregnancy rate was 76%. This study revealed the usefulness of Eazi Breed CIDR along with Cidirol treatment in buffaloes to improve their reproductive performance.

  6. Association analysis of polymorphism in thyroglobulin gene promoter with milk production traits in riverine buffalo (Bubalus bubalis).

    PubMed

    Dubey, P K; Goyal, S; Mishra, S K; Yadav, A K; Kathiravan, P; Arora, R; Malik, R; Kataria, R S

    2015-09-01

    Polymorphism within the promoter region of bovine thyroglobulin has been reported to be associated with milk and meat quality. In this study, we investigated the genetic variation within thyroglobulin promoter region of swamp and riverine buffaloes using PCR-SSCP technique and sequencing, and also analyzing association of polymorphism with the milk production traits. The study revealed four conformational patterns, A, B, C, and D among 323 buffaloes of two riverine breeds and different swamp populations. The frequency of SSCP variant 'A' was found to be invariably high among all buffalo populations. Variant 'C' was found to be absent in pure swamp population and present with higher frequency among riverine dairy breeds Mehsana and Nili Ravi. Frequency of D variant was observed to be highest in buffalo population, representing riverine and hybrid types. Sequencing of three representative PCR products of each of the SSCP variants, revealed three polymorphic sites responsible, 33C > T, 176G > T and 221C > T, in the buffalo TG promoter region. Further, association studies of SSCP variants with various milk production and milk quality traits indicated significant effect on fat percentage in buffaloes belonging to Mehsana and Nili Ravi dairy breeds. The preliminary results also showed the substantial variations in the distribution of SSCP variants' frequencies across swamp and riverine buffaloes, two distinct populations being reared for meat and milk production, respectively. PMID:26273563

  7. Association analysis of polymorphism in thyroglobulin gene promoter with milk production traits in riverine buffalo (Bubalus bubalis)

    PubMed Central

    Dubey, P.K.; Goyal, S.; Mishra, S.K.; Yadav, A.K.; Kathiravan, P.; Arora, R.; Malik, R.; Kataria, R.S.

    2015-01-01

    Polymorphism within the promoter region of bovine thyroglobulin has been reported to be associated with milk and meat quality. In this study, we investigated the genetic variation within thyroglobulin promoter region of swamp and riverine buffaloes using PCR–SSCP technique and sequencing, and also analyzing association of polymorphism with the milk production traits. The study revealed four conformational patterns, A, B, C, and D among 323 buffaloes of two riverine breeds and different swamp populations. The frequency of SSCP variant ‘A’ was found to be invariably high among all buffalo populations. Variant ‘C’ was found to be absent in pure swamp population and present with higher frequency among riverine dairy breeds Mehsana and Nili Ravi. Frequency of D variant was observed to be highest in buffalo population, representing riverine and hybrid types. Sequencing of three representative PCR products of each of the SSCP variants, revealed three polymorphic sites responsible, 33C > T, 176G > T and 221C > T, in the buffalo TG promoter region. Further, association studies of SSCP variants with various milk production and milk quality traits indicated significant effect on fat percentage in buffaloes belonging to Mehsana and Nili Ravi dairy breeds. The preliminary results also showed the substantial variations in the distribution of SSCP variants' frequencies across swamp and riverine buffaloes, two distinct populations being reared for meat and milk production, respectively. PMID:26273563

  8. Seroprevalence and risk factors associated with exposure of water buffalo (Bubalus bubalis) to Neospora caninum in northeast Thailand.

    PubMed

    Kengradomkij, Chanya; Inpankaew, Tawin; Kamyingkird, Ketsarin; Wongpanit, Kannika; Wongnakphet, Sirichai; Mitchell, Thomas J; Xuan, Xuenan; Igarashi, Ikuo; Jittapalapong, Sathaporn; Stich, Roger W

    2015-01-15

    Water buffalo are important draft animals for agriculture in resource-restricted areas worldwide. Water buffalo were shown to be experimentally susceptible to infection with Neospora caninum, potentially affected by neosporosis, and naturally exposed to the parasite in Asia. Although enzootic to Thailand, the distribution of N. caninum among Thai water buffalo is unclear. The objectives of this study were to determine the seroprevalence of N. caninum among water buffalo of northeast Thailand and to identify risk factors associated with their exposure to N. caninum. Sera from 628 water buffalo from 288 farms were tested with an indirect fluorescent antibody test (IFAT). A total of 57 samples from 48 herds contained antibodies to N. caninum, indicating overall seroprevalence of 9.1% and 16.7% among individual animals and herds, respectively. The overall seroprevalence was highest in provinces located in the Khorat Basin in the southern part of the region tested. Host age was also associated with seroprevalence, with the greatest seroprevalence (16.1%) among buffalo over 10 years of age, followed by 5-10 years of age (13.4%), 3-5 years (9.2%), and less than 3 years (1.2%). These results collectively suggested that horizontal transmission from canine definitive hosts was an important route of water buffalo exposure to N. caninum. These results also verified the importance of risk factor analysis for effective bovine neosporosis control strategies at the local level.

  9. Comparative study of four saprophytic leptospira strains as screening antigens in the serodiagnosis of leptospirosis in water buffaloes (Bubalus bubalis).

    PubMed

    Girio, R J; Yanaguita, R M; Mathias, L A

    1985-03-01

    The profitability of four saprophytic leptospira strains (Buenos Aires, Patoc 1, Rufino and São Paulo) as polyvalent antigen in the serodiagnosis of leptospirosis in water buffaloes was studied by the microscopic agglutination test. From 104 examined sera tested against 16 pathogenic leptospira serotypes, 52 were positives and 52 were negatives. The results led to the conclusion that from four studied strains, Buenos Aires strain showed the best results when utilized in screening tests for the serodiagnosis of leptospirosis in water buffaloes. The other three strains showed a good specificity but their sensibilities were poor and therefore should not be recommended for diagnosing water buffalo leptospirosis.

  10. Polymorphism of mitochondrial DNAs of Yunnan domestic water buffaloes, Bubalus bubalis, in China, based on restriction endonuclease cleavage patterns.

    PubMed

    Hu, W; Xu, B; Lian, L

    1997-08-01

    Restriction endonuclease cleavage patterns of mitochondrial DNA(mtDNA) of three local types of Yunnan native water buffalo were analyzed using 18 enzymes which recognize six nucleotides. Among the 12 animals analyzed, 3 of 18 enzymes, BamHI, EcoRI, and Scal, revealed polymorphisms. Three mtDNA types were identified. The results indicate that a relatively low level of mtDNA variation exists in Yunnan domestic water buffaloes. The origin of Chinese buffalo derived from Yunnan province of China is discussed.

  11. Reticulo-ruminal motility in cattle (Bos indicus) and water buffaloes (Bubalus bubalis) fed a low quality roughage diet.

    PubMed

    McSweeney, C S; Kennedy, P M; John, A

    1989-01-01

    1. The effect of A and B sequence contractions of the reticulo-rumen on passage rate of digesta was compared in buffaloes and cattle fed low quality rhodes grass. 2. Both species ate the same amount per unit body weight but buffaloes spent 53% more time ruminating than cattle. 3. Buffaloes had fewer A and B sequence contractions each day and the rate of these contractions during eating, ruminating and at rest were slower. 4. A larger pool of fine feed particles in the rumen of buffaloes, generated by extra ruminating activity was associated with the 30% shorter mean residence time of particulate matter in the forestomach compared with cattle. 5. It is concluded that the difference in the number and frequency of contractions between the species was insufficient to affect passage rate of digesta from the stomach.

  12. Alterations in follicular fluid estradiol, progesterone and insulin concentrations during ovarian acyclicity in water buffalo (Bubalus bubalis).

    PubMed

    Khan, F A; Das, G K; Pande, Megha; Sarkar, M; Mahapatra, R K; Shankar, Uma

    2012-01-01

    Ovarian acyclicity is one of the most important causes of infertility in water buffalo. Recent studies have indicated alterations in the composition of follicular fluid during the condition. The aim of this study was to determine the changes in follicular fluid concentrations of estradiol, progesterone and insulin during ovarian acyclicity in water buffalo. Ovaries were collected from 50 acyclic and 95 cyclic (control) buffaloes and follicular fluid was aspirated from small (5.0-6.9 mm), medium (7.0-9.9 mm) and large (≥10.0 mm) sized follicles. Estradiol concentration was lower (P<0.0001) in acyclic (1.4 ± 0.09 ng/ml) than in cyclic (3.3 ± 0.18 ng/ml) buffaloes. Regardless of the ovarian cyclic status, there was an increase (P<0.01) in estradiol concentration with the increase in follicle size; the mean concentrations were 2.4 ± 0.16 ng/ml, 2.8 ± 0.29 ng/ml and 3.5 ± 0.41 ng/ml in small, medium and large follicles, respectively. A higher (P<0.001) progesterone concentration was recorded in acyclic (24.3 ± 2.61 ng/ml) compared to the cyclic (7.6 ± 0.79 ng/ml) group. Furthermore, acyclic buffaloes had a lower (P<0.05) concentration of insulin in the follicular fluid than that of cyclic buffaloes (15.2 ± 1.55 μIU/ml versus 25.9 ± 2.78 μIU/ml, respectively). In conclusion, acyclic buffaloes have lower concentrations of estradiol and insulin concurrent with higher concentrations of progesterone in the follicular fluid. These hormonal changes in the follicular microenvironment are possibly a manifestation of the disturbances in the normal follicular development leading to anovulation and anestrus in acyclic buffaloes.

  13. The occurrence of nymphal stage of Linguatula serrata in water buffaloes (Bubalus bubalis): nymphal morphometry and lymph node pathology.

    PubMed

    Sivakumar, P; Sankar, M; Nambi, P A; Praveena, P E; Singh, N

    2005-12-01

    The mesenteric lymph nodes (MLN) of buffaloes (n = 100) were examined for the presence of parasitic infection. The nymphal stage of Linguatula serrata was observed in two buffaloes. A single white-coloured nymph with transversely striated spines on a segmented body, two pairs of oral suckers and hooks was observed in the MLN. The morphometrics of the nymphs were studied. The affected lymph nodes were grossly enlarged with cyst and showed pathological lesions of fibroblastic reaction with a mild underlying inflammatory zone.

  14. Modelling lactation curve for milk fat to protein ratio in Iranian buffaloes (Bubalus bubalis) using non-linear mixed models.

    PubMed

    Hossein-Zadeh, Navid Ghavi

    2016-08-01

    The aim of this study was to compare seven non-linear mathematical models (Brody, Wood, Dhanoa, Sikka, Nelder, Rook and Dijkstra) to examine their efficiency in describing the lactation curves for milk fat to protein ratio (FPR) in Iranian buffaloes. Data were 43 818 test-day records for FPR from the first three lactations of Iranian buffaloes which were collected on 523 dairy herds in the period from 1996 to 2012 by the Animal Breeding Center of Iran. Each model was fitted to monthly FPR records of buffaloes using the non-linear mixed model procedure (PROC NLMIXED) in SAS and the parameters were estimated. The models were tested for goodness of fit using Akaike's information criterion (AIC), Bayesian information criterion (BIC) and log maximum likelihood (-2 Log L). The Nelder and Sikka mixed models provided the best fit of lactation curve for FPR in the first and second lactations of Iranian buffaloes, respectively. However, Wood, Dhanoa and Sikka mixed models provided the best fit of lactation curve for FPR in the third parity buffaloes. Evaluation of first, second and third lactation features showed that all models, except for Dijkstra model in the third lactation, under-predicted test time at which daily FPR was minimum. On the other hand, minimum FPR was over-predicted by all equations. Evaluation of the different models used in this study indicated that non-linear mixed models were sufficient for fitting test-day FPR records of Iranian buffaloes. PMID:27600968

  15. Microscopical and serological studies on Sarcocystis infection with first report of S. cruzi in buffaloes (Bubalus bubalis) in Assiut, Egypt.

    PubMed

    Metwally, Asmaa M; Abd Ellah, Mahmoud R; Al-Hosary, Amira A; Omar, Mosaab A

    2014-12-01

    This study was performed for the purpose of investigating the prevalence and the species composition of Sarcocystis spp. in buffaloes in Assiut province, Egypt. Macroscopically we reported the infection of buffaloes with Sarcocystis fusiformis, while microscopically three Sarcocystis species (Sarcocystis cruzi, Sarcocystis levinei and Sarcocystis hominis) cysts were recognized, and were differentiated by their morphological features using both histopathological sections and electron microscope scanning. Regarding the prevalence of Sarcocystis species among buffaloes in Assiut province, we reported that, using gross examination of 90 buffaloes' esophagus, only 23 samples out of 90 (25.5 %) were found to be infected; on the other hand, by using microscopical examination, the prevalence was 27.7 % (25 samples out of 90 samples were found to be infected). Using ELISA, 85 samples out of 90 (94.4 %) were found positive, an overall prevalence of 94.4 %. In this work we concluded that customary meat inspection methods in abattoirs in Egypt are insufficient for detecting Sarcocystis infection. Due to the presence of hidden or microscopic cysts, we strongly recommend the use of combined microscopical examination and ELISA for Sarcocystis diagnosis, to avoid human infection of such zoonotic parasite and to control the consequent disease. In addition, this study introduced the first report of S. cruzi in buffaloes in Egypt, and proved the hypothesis that S. cruzi is able to use animals such as water buffalo as intermediate hosts.

  16. Modelling lactation curve for milk fat to protein ratio in Iranian buffaloes (Bubalus bubalis) using non-linear mixed models.

    PubMed

    Hossein-Zadeh, Navid Ghavi

    2016-08-01

    The aim of this study was to compare seven non-linear mathematical models (Brody, Wood, Dhanoa, Sikka, Nelder, Rook and Dijkstra) to examine their efficiency in describing the lactation curves for milk fat to protein ratio (FPR) in Iranian buffaloes. Data were 43 818 test-day records for FPR from the first three lactations of Iranian buffaloes which were collected on 523 dairy herds in the period from 1996 to 2012 by the Animal Breeding Center of Iran. Each model was fitted to monthly FPR records of buffaloes using the non-linear mixed model procedure (PROC NLMIXED) in SAS and the parameters were estimated. The models were tested for goodness of fit using Akaike's information criterion (AIC), Bayesian information criterion (BIC) and log maximum likelihood (-2 Log L). The Nelder and Sikka mixed models provided the best fit of lactation curve for FPR in the first and second lactations of Iranian buffaloes, respectively. However, Wood, Dhanoa and Sikka mixed models provided the best fit of lactation curve for FPR in the third parity buffaloes. Evaluation of first, second and third lactation features showed that all models, except for Dijkstra model in the third lactation, under-predicted test time at which daily FPR was minimum. On the other hand, minimum FPR was over-predicted by all equations. Evaluation of the different models used in this study indicated that non-linear mixed models were sufficient for fitting test-day FPR records of Iranian buffaloes.

  17. Novel polymorphisms of the IGF1R gene and their association with average daily gain in Egyptian buffalo (Bubalus bubalis).

    PubMed

    El-Magd, M A; Abbas, H E; El-kattawy, A M; Mokhbatly, A

    2013-08-01

    The objective of this study was to detect insulin-like growth factor 1 receptor (IGF1R) polymorphisms, their allele, and genotype frequencies and to determine associations between these polymorphisms and growth traits in Egyptian water buffalo. Three loci of the IGF1R coding region were amplified by RT-PCR and, subsequently, subjected to sequence analysis, followed by single-strand conformation polymorphism to identify different allelic patterns. A total of 11 novel polymorphisms were detected; 6 SNPs among Egyptian water buffaloes and 5 polymorphisms compared with Indian buffalo (Y12700). Three of those polymorphisms; GAG Indel polymorphism, C261G, and G263C SNPs, were nonsynonymous mutations. The GAG Indel polymorphism led to deletion of E (glutamic) amino acid (aa) in the IGF1R of Egyptian water buffaloes compared with Indian buffalo. However, C261G SNP, which replaced A (alanine) by G (glycine) aa, and G263C SNP, which changed A (alanine) to P (proline) aa, were detected among Egyptian water buffaloes. Three different single-strand conformation polymorphism patterns were observed in exon 21: CC/CC, GG/GG, and CG/GC with frequencies of 0.291, 0.253, and 0.556, respectively. The heterozygous animals (CG/GC) had a higher ADG than homozygous animals (CC/CC and GG/GG) from birth to 6 mo of age. We conclude that the heterozygous haplotype, C261G/G263C, in exon 21 of the IGF1R gene is associated with the ADG during the early stages of life (from birth to 6 mo of age) and could be used as a genetic marker for selection of growth traits in Egyptian buffalo.

  18. Impact of gonadotropin supplementation on the expression of germ cell marker genes (MATER, ZAR1, GDF9, and BMP15) during in vitro maturation of buffalo (Bubalus bubalis) oocyte.

    PubMed

    Nath, Amar; Sharma, Veena; Dubey, Pawan K; Pratheesh, M D; Gade, Nitin E; Saikumar, G; Sharma, G Taru

    2013-01-01

    The present study was designed to investigate whether gonadotropins [follicle-stimulating hormone (FSH) and luteinizing hormone (LH)] and buffalo follicular fluid (bFF) supplementation in maturation medium influences the transcript abundance of germ cell marker genes [maternal antigen that embryos require (MATER), Zygote arrest 1 (ZAR1), growth differentiation factor 9 (GDF9), and bone morphogenetic protein 15 (BMP15)] mRNA in buffalo (Bubalus bubalis) oocytes. Buffalo ovaries were collected from local abattoir, oocytes were aspirated from antral follicles (5-8 mm) and matured in vitro using two different maturation regimens, viz, group A: gonadotropin (FSH and LH) and group B: non-gonadotropin-supplemented maturation medium containing 20% buffalo follicular fluid (bFF). mRNA was isolated from immature (330) and in vitro matured oocytes from both the groups (A, 320; B, 340), and reverse transcribed using Moloney murine leukemia virus reverse transcriptase. Expression levels of MATER, ZAR1, GDF9, and BMP15 mRNA transcripts were analyzed in oocytes of both maturation groups as well as immature oocytes using real-time PCR. QPCR results showed that GDF9 and BMP15 transcripts were significantly (p<0.05) influenced with gonadotropins and bFF supplementation during in vitro maturation of buffalo oocyte; however, MATER and ZAR1 transcripts were not influenced with gonadotropins and bFF supplementation in vitro. These results indicated that the expression levels of MATER, ZAR1, GDF9, and BMP15 mRNA were varied differentially during in vitro maturation of buffalo oocyte and were found to be gonadotropins (FSH and LH) or bFF dependent for GDF9 and BMP15.

  19. Detection of Sarcocystis spp. in cattle (Bos taurus) and water buffaloes (Bubalus bubalis) in Iran by PCR-RFLP.

    PubMed

    Hamidinejat, Hossein; Razi Jalali, Mohammad Hossein; Gharibi, Darioush; Molayan, Pedram Haddad

    2015-12-01

    Sarcocystis species are cyst-forming intracellular protozoan parasites. Cattle are mainly infected with Sarcocystis cruzi, Sarcocystis hominis and Sarcocystis hirsuta. Water buffaloes are intermediate hosts for Sarcocystis fusiformis, Sarcocystis levinei (S. cruzi-like species), Sarcocystis dubeyi, Sarcocystis sinensis (S. hominis-like species) and Sarcocystis buffalonis (S. hirsuta- like species). The aim of this study was Identification of Sarcocystis spp. in slaughtered cattle and water buffaloes in Ahvaz, Khuzestan province by PCR-restriction fragment length polymorphism. Meat inspection was done on 124 cattle and 147 water buffaloes. From each animal tissue samples (each 50 g) from heart, esophagus, diaphragm and intercostal muscle were collected during meat inspection. Samples examined with digestion method. Genomic DNA of 80 positive samples was extracted and their 18S rRNA gene was amplified. PCR products were digested by restricted enzymes (FokI, SspI and DraI). S. cruzi in cattle and S. fusiformis in water buffaloes were identified. Our study clarified that sarcocystosis in cattle in Ahvaz district may be results acute infection according to determined species, but in buffaloes as S. fusiformis was detected we may expect only economic loss follow up slaughterhouse inspection. PMID:26688630

  20. Detection of Sarcocystis spp. in cattle (Bos taurus) and water buffaloes (Bubalus bubalis) in Iran by PCR-RFLP.

    PubMed

    Hamidinejat, Hossein; Razi Jalali, Mohammad Hossein; Gharibi, Darioush; Molayan, Pedram Haddad

    2015-12-01

    Sarcocystis species are cyst-forming intracellular protozoan parasites. Cattle are mainly infected with Sarcocystis cruzi, Sarcocystis hominis and Sarcocystis hirsuta. Water buffaloes are intermediate hosts for Sarcocystis fusiformis, Sarcocystis levinei (S. cruzi-like species), Sarcocystis dubeyi, Sarcocystis sinensis (S. hominis-like species) and Sarcocystis buffalonis (S. hirsuta- like species). The aim of this study was Identification of Sarcocystis spp. in slaughtered cattle and water buffaloes in Ahvaz, Khuzestan province by PCR-restriction fragment length polymorphism. Meat inspection was done on 124 cattle and 147 water buffaloes. From each animal tissue samples (each 50 g) from heart, esophagus, diaphragm and intercostal muscle were collected during meat inspection. Samples examined with digestion method. Genomic DNA of 80 positive samples was extracted and their 18S rRNA gene was amplified. PCR products were digested by restricted enzymes (FokI, SspI and DraI). S. cruzi in cattle and S. fusiformis in water buffaloes were identified. Our study clarified that sarcocystosis in cattle in Ahvaz district may be results acute infection according to determined species, but in buffaloes as S. fusiformis was detected we may expect only economic loss follow up slaughterhouse inspection.

  1. Occurrence of antibodies against Neospora caninum in water buffaloes (Bubalus bubalis) on four ranches in Corrientes province, Argentina.

    PubMed

    Campero, C M; Pérez, A; Moore, D P; Crudeli, G; Benitez, D; Draghi, M G; Cano, D; Konrad, J L; Odeón, A C

    2007-11-30

    The aim of the present work was to describe the occurrence of antibodies to Neospora caninum in water buffaloes on four ranches located in Corrientes province in the northeast of Argentina. Antibodies against N. caninum were determined in sera of 449 water buffaloes by using an indirect fluorescent antibody test (IFAT). A Bayesian logistic regression mixed model was used to quantify the strength of association between positive serological results to N. caninum and gender, age and category (calf, steer, heifer, cow) as risk factors. Antibody titers were found in 287 (64%) buffaloes. All ranches had seropositive animals. Age was more strongly associated with positive results to N. caninum (OR: 1.4; CI 95%: 0.86-2.22) than gender (OR: 1.02, CI 95%: 0.40-2.59) and category (OR: 0.88, CI 95%: 0.57-0.88). Results suggest a high exposure of water buffaloes to N. caninum by postnatal transmission in these four ranches located in Corrientes province, Argentina. Further studies are needed to quantify the consequences of Neospora-infections in the water buffalo industry.

  2. Methanogen diversity in the rumen of Indian Surti buffalo (Bubalus bubalis), assessed by 16S rDNA analysis.

    PubMed

    Singh, K M; Tripathi, A K; Pandya, P R; Parnerkar, S; Rank, D N; Kothari, R K; Joshi, C G

    2012-06-01

    The methanogenic communities in buffalo rumen were characterized using a culture-independent approach of a pooled sample of rumen fluid from three adult Surti buffaloes. Buffalo rumen is likely to include species of various methanogens, so 16S rDNA sequences were amplified and cloned from the sample. A total of 171 clones were sequenced to examine 16S rDNA sequence similarity. About 52.63% sequences (90 clones) had ≥ 90% similarity, whereas, 46.78% of the sequences (81 clones) were 75-89% similar to 16S rDNA database sequences, respectively. Phylogenetic analyses were also used to infer the makeup of methanogenic communities in the rumen of Surti buffalo. As a result, we distinguished 23 operational taxonomic units (OTUs) based on unique 16S rDNA sequences: 12 OTUs (52.17%) affiliated to Methanomicrobiales order, 10 OTUs (43.47%) of the order Methanobacteriales and one OTU (4.34%) of Methanosarcina barkeri like clone, respectively. In addition, the population of Methanomicrobiales and Methabacteriales orders were also observed, accounting 4% and 2.17% of total archea. This study has revealed the largest assortment of hydrogenotrophic methanogens phylotypes ever identified from rumen of Surti buffaloes. PMID:21507441

  3. Development of a sequential multicolor-FISH approach with 13 chromosome-specific painting probes for the rapid identification of river buffalo (Bubalus bubalis, 2n = 50) chromosomes.

    PubMed

    Pauciullo, Alfredo; Perucatti, Angela; Iannuzzi, Alessandra; Incarnato, Domenico; Genualdo, Viviana; Di Berardino, Dino; Iannuzzi, Leopoldo

    2014-08-01

    The development of new molecular techniques (array CGH, M-FISH, SKY-FISH, etc.) has led to great advancements in the entire field of molecular cytogenetics. However, the application of these methods is still very limited in farm animals. In the present study, we report, for the first time, the production of 13 river buffalo (Bubalus bubalis, 2n = 50) chromosome-specific painting probes, generated via chromosome microdissection and the DOP-PCR procedure. A sequential multicolor-FISH approach is also proposed on the same slide for the rapid identification of river buffalo chromosome/arms, namely, 1p-1q, 2p-2q, 3p-3q, 4p-4q, 5p-5q, 18, X, and Y, using both conventional and late-replicating banded chromosome preparations counterstained by DAPI. The provided 'bank' of chromosome-specific painting probes is useful for any further cytogenetic investigation not only for the buffalo breeds, but also for other species of the family Bovidae, such as cattle, sheep, and goats, for chromosome abnormality diagnosis, and, more generally, for evolutionary studies.

  4. Detection of bovine viral diarrhoea virus (BVDV) nucleic acid and antigen in different organs of water buffaloes (Bubalus bubalis).

    PubMed

    Craig, M I; Venzano, A; König, G; Morris, W E; Jiménez, L; Juliá, S; Capellino, F; Blanco Viera, J; Weber, E L

    2008-08-01

    Bovine viral diarrhoea virus (BVDV) is a pestivirus that infects mainly bovine cattle. Nevertheless, there are several reports about infections in other members of the Artiodactyla order including serological studies, that indicate infection of BVDV in buffaloes. The aim of this article is to study the presence of BVDV in three young water buffaloes, displaying nonspecific clinical signs, compatible with the BVDV infection. Both immunohistochemistry and RT-PCR confirmed the presence of BVDV in the animals. The sequence analysis on RT-PCR amplicons revealed high identity with reference strains of genotypes 1a and 1b. Although BVDV was unequivocally identified in the sick animals, it has not been proved it is responsible for the clinical signs. Further studies are needed to clarify the pathogenic role of BVDV infection in this animal species, and the role of buffaloes in the epidemiology of BVDV infection.

  5. In vitro embryo production in buffalo (Bubalus bubalis) using sexed sperm and oocytes from ovum pick up.

    PubMed

    Liang, X W; Lu, Y Q; Chen, M T; Zhang, X F; Lu, S S; Zhang, M; Pang, C Y; Huang, F X; Lu, K H

    2008-04-15

    The objective was to explore the use of sexed sperm and OPU-derived oocytes in an IVP system to produce sex-preselected bubaline embryos. Oocytes were recovered from 20 fertile Murrah and Nili-Ravi buffalo cows by repeated (twice weekly) ultrasound-guided transvaginal ovum pick up (OPU), or by aspiration of abbatoir-derived bubaline ovaries, and subjected to IVF, using frozen-thawed sexed or unsexed bubaline semen. On average, 4.6 oocytes were retrieved per buffalo per session (70.9% were Grades A or B). Following IVF with sexed sperm, oocytes derived from OPU had similar developmental competence as those from abattoir-derived ovaries, in terms of cleavage rate (57.6 vs. 50.4%, P=0.357) and blastocyst development rate (16.0 vs. 23.9%, P=0.237). Furthermore, using frozen-thawed sexed versus unsexed semen did not affect rates of cleavage (50.5 vs. 50.9%, P=0.978) or blastocyst development (15.3 vs. 19.1%, P=0.291) after IVF using OPU-derived oocytes. Of the embryos produced in an OPU-IVP system, 9 of 34 sexed fresh embryos (26.5%) and 5 of 43 sexed frozen embryos (11.6%) transferred to recipients established pregnancies, whereas 7 of 26 unsexed fresh embryos (26.9%) and 6 out of 39 unsexed frozen embryos (15.4%) transferred to recipients established pregnancies. Eleven sex-preselected buffalo calves (10 females and one male) and 10 sexed buffalo calves (six females and four males) were born following embryo transfer. In the present study, OPU, sperm sexing technology, IVP, and embryo transfer, were used to produce sex-preselected buffalo calves. This study provided proof of concept for further research and wider field application of these technologies in buffalo.

  6. Developmental failure of hybrid embryos generated by in vitro fertilization of water buffalo (Bubalus bubalis) oocyte with bovine spermatozoa.

    PubMed

    Patil, Shekhar; Totey, Satish

    2003-03-01

    The developmental potential of inter-species hybrid embryos produced by in vitro fertilization of in vitro matured buffalo oocytes with bovine spermatozoa was studied with a view to investigate pre-implantation embryo development and its gross morphology, early embryonic gene expression, and embryonic genome activation. Fertilization events with both buffalo and cattle spermatozoa were almost similar. Overall fertilization rate with cattle spermatozoa was 78.4% was not significantly different from that of buffalo spermatozoa (80.2%). Initial cleavage rate between buffalo and hybrid embryo was also similar, and there was no significant difference in their developmental rate till 8-cell stage (26.0 +/- 4.1 vs. 24.3 +/- 4.8). However, only 5.3% of hybrid embryos developed into blastocyst stage compared to 21.7% in buffalo. mRNA phenotyping of insulin-like growth factor family (Insulin, insulin receptor, IGF-I, IGF-I receptor, IGF-II, and IGF-II receptor) and glucose transporter isoforms (GLUT-I, II, III, IV) in hybrid embryos clearly showed that these molecules were not expressed after 8-cell stage onward. Similarly, as observed in buffalo embryos, incorporation of (35)S-methionine and (3)H-uridine could not be observed in hybrid embryos from 8-cell stage onward. This suggests that the maternal-zygotic genome activation did not occur in hybrid embryos. Differential staining also showed that the blastomere stopped dividing after 8-cell stage. Collectively, these parameters clearly showed that there was developmental failure of hybrid embryos.

  7. Follicular characteristics and intrafollicular concentrations of nitric oxide and ascorbic acid during ovarian acyclicity in water buffalo (Bubalus bubalis).

    PubMed

    Khan, Firdous Ahmad; Das, Goutam Kumar

    2012-01-01

    The objective of this study was to examine the follicular characteristics and intrafollicular concentrations of nitric oxide and ascorbic acid during ovarian acyclicity in buffaloes. Ovaries were collected from 56 acyclic and 95 cyclic buffaloes at slaughter, surface follicle number was counted and follicles were classified into small (5.0-6.9 mm), medium (7.0-9.9 mm), and large (≥ 10.0 mm) size categories based on their diameter. Follicular fluid was aspirated and assayed for nitric oxide, ascorbic acid, estradiol, and progesterone. Acyclic buffaloes had a higher (P<0.05) number of medium-sized follicles and a lower (P<0.001) number of large follicles than the cyclic ones. In acyclic animals, the number of large follicles was lower (P<0.01) than in medium size category which in turn was lower (P<0.001) than the number of small follicles. In contrast, the number of medium and large follicles was not different (P>0.05) in the cyclic control. However, the number of small-sized follicles was higher (P<0.001) compared to the other two categories. The incidence of large-sized follicles was lower (P<0.05) in acyclic buffalo population compared to the cyclic control. Evaluation of estrogenic status demonstrated that all the follicles of acyclic buffaloes are estrogen-inactive (E (2)/P (4) ratio<1). Small- and medium-sized follicles of acyclic buffaloes had higher concentrations of nitric oxide (P<0.05 and P<0.001, respectively) and lower concentrations of ascorbic acid (P<0.05 and P<0.01, respectively) than the corresponding size estrogen-active follicles of their cyclic counterparts. In conclusion, this study indicates that follicular development continues during acyclicity in buffaloes. Although follicles in some acyclic buffaloes attain a size corresponding to morphological dominance, they are unable to achieve functional dominance, perhaps due to an altered balance of intrafollicular nitric oxide and ascorbic acid and, as a result, these follicles instead of

  8. Influence of season on corpus luteum structure and function and AI outcome in the Italian Mediterranean buffalo (Bubalus bubalis).

    PubMed

    Di Francesco, S; Neglia, G; Vecchio, D; Rossi, P; Russo, M; Zicarelli, L; D'Occhio, M J; Campanile, G

    2012-11-01

    The aim was to ascertain whether relationships between corpus luteum (CL) vascularization, CL function, and pregnancy outcome in AI in buffaloes were consistent across the breeding season and transition period to the nonbreeding season in a Mediterranean environment. Stage of the estrous cycle in Italian Mediterranean buffaloes was synchronized using the Ovsynch with timed AI program and buffaloes were mated by AI in both the breeding season (N = 131) and transition period (N = 125). Detailed investigation of CL structure and function was undertaken in 39 buffaloes at each of the respective times using realtime B-mode/color-Doppler ultrasonography on Days 10 and 20 after AI. Progesterone (P4) concentrations were determined by RIA in all buffaloes. Pregnancy rate on Day 45 after AI was greater (P < 0.05) during the breeding season (58.0%) than the transitional period (45.6%) and this was primarily the result of a lower (P < 0.05) late embryonic mortality during the breeding season (7.3%) compared with the transition period (23%). Circulating concentrations of P4 on Days 10 and 20 after AI were greater (P < 0.01) during the breeding season (4.6 ± 0.3 and 3.4 ± 0.2, respectively) than during the transition period (1.6 ± 0.12 and 1.8 ± 0.2, respectively), and this was independent of reproductive status as there was no interaction between pregnancy and season. Corpus luteum time average medium velocity at Day 10 after AI was greater (P < 0.01) during the breeding season (19.3 ± 1.5) than in the transitional period (8.3 ± 0.7). There were positive correlations in pregnant buffaloes between CL time average medium velocity and P4 concentrations on Day 10 (r = 0.722; P < 0.01) and Day 20 (r = 0.446; P < 0.01) after AI. The findings were interpreted to indicate that relationships between CL vascularization, CL function, and pregnancy outcome in AI in buffaloes are consistent across the breeding season and transition period to the nonbreeding season. The distinction

  9. Energy metabolites, lipid variables and lactation performance of periparturient Murrah buffaloes (Bubalus bubalis) fed on diet supplemented with inorganic chromium.

    PubMed

    Zade, Satish; Mani, Veena; Deka, Rijusmita Sarma; Kumar, Muneendra; Kaur, Harjit; Kewalramani, Neelam J; Tyagi, Amrish Kumar

    2014-06-01

    The aim of this study was to elucidate the effects of chromium (Cr) supplementation as inorganic Cr (CrCl3·6H2O) on energy balance, lipid peroxidation, and lactation performance in periparturient Murrah buffaloes. Twenty-four multiparous Murrah buffaloes according to lactation, parity, body mass, and expected calving date were divided equally. Experimental buffaloes were randomly assigned to four treatment diets: a control diet and three diets with an inorganic Cr supplementation at 0.5, 1.0, and 1.5 mg of Cr/kg dry matter (DM), respectively from 60 days before expected calving date until 60 days of lactation. Milk productions of buffaloes were recorded every day until 60 days in milk. Blood samples were collected at days -60, -45, -30,-21, -15, -7, -3, 0, 7, 15, 21, 30, 45, and 60 days relative to actual calving for determination of plasma glucose, nonesterified fatty acid (NEFA), thiobarbituric acid reactive substance (TBARS), total cholesterol, total protein, albumin, blood urea nitrogen (BUN), and minerals. Adding inorganic Cr to the diet of Murrah buffaloes increased milk yield. Percentage of fat and total solid yield increased significantly through the experiment in the Cr-supplemented group. At the day of calving, buffaloes showed a decrease in dry matter intake (DMI), plasma glucose, and zinc (Zn) and Cr concentrations. In contrast, plasma NEFA, TBARS, and copper (Cu) levels were found highest at the day of calving among all groups. Cr supplementation increased peripheral blood glucose concentration while decreased level of NEFA and TBARS was recorded in Cr-fed buffaloes. Supplemental Cr had no effect on plasma cholesterol, total protein, albumin, and BUN in periparturient period. Dietary Cr supplementation had positive effect on plasma Cr concentration, but the plasma concentration of Cu, Zn, and iron (Fe) was not affected by different dietary Cr level supplementation. The results suggest that dietary inorganic Cr supplementation improved milk yield by

  10. A possible case of caprine-associated malignant catarrhal fever in a domestic water buffalo (Bubalus bubalis) in Switzerland

    PubMed Central

    2011-01-01

    Background Malignant catarrhal fever (MCF) is a fatal herpesvirus infection, affecting various wild and domestic ruminants all over the world. Water buffaloes were reported to be particularly susceptible for the ovine herpesvirus-2 (OvHV-2) causing the sheep-associated form of MCF (SA-MCF). This report describes the first case of possibly caprine-associated malignant catarrhal fever symptoms in a domestic water buffalo in Switzerland. Case presentation The buffalo cow presented with persistent fever, dyspnoea, nasal bleeding and haematuria. Despite symptomatic therapy, the buffalo died and was submitted to post mortem examination. Major findings were an abomasal ulceration, a mild haemorrhagic cystitis and multifocal haemorrhages on the epicardium and on serosal and mucosal surfaces. Eyes and oral cavity were not affected. Histopathology revealed a mild to moderate lymphohistiocytic vasculitis limited to the brain and the urinary bladder. Although these findings are typical for MCF, OvHV-2 DNA was not detected in peripheral blood lymphocytes or in paraffin-embedded brain, using an OvHV-2 specific real time PCR. With the aid of a panherpesvirus PCR, a caprine herpesvirus-2 (CpHV-2) sequence could be amplified from both samples. Conclusions To our knowledge, this is the first report of malignant catarrhal fever in the subfamily Bovinae, where the presence of CpHV-2 could be demonstrated. The etiological context has yet to be evaluated. PMID:22132808

  11. Haematological profile on non-lactating Mediterranean buffaloes (Bubalus bubalis) ranging in age from 24 months to 14 years.

    PubMed

    Ciaramella, P; Corona, M; Ambrosio, R; Consalvo, F; Persechino, A

    2005-08-01

    Haematological studies were performed on 100 clinically normal non-lactating Mediterranean buffalo species ranging in age from 24 months to 14 years, to determinate the range of normal haematological values for this ruminant species. The animals were divided in 5 groups according to age: Group I, 2-3 years old which had never calved, Group II, 3-4 years old (primipara buffaloes), Group III, 5-7 years old, Group IV 8-10 years old and Group V over 10 years of age. All the haematological values obtained were comparable with the normal values found in adult cattle, and similar to those reported in Indian water buffalo species. The heifer buffalo showed an higher values for packed cell volume (PCV) compared with the older animals, but lower values for mean corpuscular haemoglobin concentration (MCHC) and mean corpuscular haemoglobin (MCH) (P 0.01). In animals above 8 years of age, the white cell count was lower with a significant reduction in absolute values of lymphocytes (P 0.01). Higher absolute values of eosinophils levels was found in the group V (P 0.01). PMID:15894028

  12. Chromosomal localization, copy number assessment, and transcriptional status of BamHI repeat fractions in water buffalo Bubalus bubalis.

    PubMed

    Pathak, Deepali; Srivastava, Jyoti; Premi, Sanjay; Tiwari, Madhulika; Garg, Lalit C; Kumar, Sudhir; Ali, Sher

    2006-04-01

    Higher eukaryotes contain a wide variety of repetitive DNA, although their functions often remain unknown. We describe cloning, chromosomal localization, copy number assessment, and transcriptional status of 1378- and 673-bp repeat fractions in the buffalo genome. The pDS5, representing the 1378-bp fragment, showed FISH signals in the centromeric region of acrocentric chromosomes only, whereas pDS4, corresponding to 673 bp, detected signals in the centromeric regions of all the chromosomes. Crosshybridization studies of pDS5 and pDS4 with genomic DNA from different sources showed signals only in buffalo, cattle, goat, and sheep. Real-time PCR analysis uncovered 1234 and 3420 copies of pDS5 and pDS4 fragments per the haploid genome, corresponding to 30 and 68 copies per chromosome, respectively. Analysis of cDNA from different tissues of buffalo with Real-time PCR showed maximum expression of pDS5 and pDS4 in the spleen and liver, respectively. Phylogenetic analysis of these sequences showed a close relationship between buffalo and cattle. The prospect of this approach in comparative genomics is highlighted.

  13. Seroepidemiology of Neospora caninum and Toxoplasma gondii in cattle and water buffaloes (Bubalus bubalis) in the People's Republic of China.

    PubMed

    Yu, Jinhai; Xia, Zhaofei; Liu, Qun; Liu, Jing; Ding, Jun; Zhang, Wei

    2007-01-19

    A seroepidemiological survey of Neospora caninum and Toxoplasma gondii in cattle and water buffaloes was carried out in the People's Republic of China. Serum samples were obtained from dairy (n=262, 9 herds in 9 provinces) and beef cattle (n=10, 1 herd) and water buffaloes (n=40) in China. All sera were tested for antibodies to N. caninum and T. gondii by an enzyme-linked immunosorbent assay (ELISA) and an indirect agglutination test (IAT), respectively. The overall seroprevalence of N. caninum in dairy cattle was 17.2% (45/262), and the herds seroprevalence of N. caninum was 88.9% (8/9), and antibodies to T. gondii were present in 6 cows (2.3%). None of the cows had antibodies against both T. gondii and N. caninum. Antibodies to T. gondii or N. caninum were not found in beef cattle or water buffaloes. The seroprevalence of N. caninum in aborting cows (20.2%) was higher than that in non-aborting cows (16.6%) with an odds ratio of 1.26 (95% CI, 0.54-2.95), but the difference was not statistically significant (P>0.05). There was no apparent association of N. caninum seropositivity with age or number of pregnancies. This is the first report on the seroprevalence of N. caninum in cattle and water buffaloes in China.

  14. Bacterial diversity in the rumen of Indian Surti buffalo (Bubalus bubalis), assessed by 16S rDNA analysis.

    PubMed

    Pandya, P R; Singh, K M; Parnerkar, S; Tripathi, A K; Mehta, H H; Rank, D N; Kothari, R K; Joshi, C G

    2010-01-01

    Bacterial communities in buffalo rumen were characterized using a culture-independent approach for a pooled sample of rumen fluid from 3 adult Surti buffaloes. Buffalo rumen is likely to include species of various bacterial phyla, so 16S rDNA sequences were amplified and cloned from the sample. A total of 191 clones were sequenced and similarities to known 16S rDNA sequences were examined. About 62.82% sequences (120 clones) had >90% similarity to the 16S rDNA database sequences. Furthermore, about 34.03% of the sequences (65 clones) were 85-89% similar to 16S rDNA database sequences. For the remaining 3.14%; the similarity was lower than 85% Phylogenetic analyses were also used to infer the makeup of bacterial communities in the rumen of Surti buffalo. As a result, we distinguished 42 operational taxonomic units (OTUs) based on unique 16S r DNA sequences: 19 OTUs affiliated to an unidentified group (45.23% of total OTUs), 11 OTUs of the phylum Firmicutes, also known as the low G+C group (26.19%), 7 OTUs of the Cytophaga-Flexibacter-Bacteroides phylum (16.66%), 4 OTUs of Spirochaetes (9.52%), and 1 OTU of Actinobacteria (2.38%). These include 10 single-clone OTUs, so Good's coverage (94.76%) of 16S rRNA libraries indicated that sequences identified in the libraries represent the majority of bacterial diversity present in rumen. PMID:20720314

  15. Haematological profile on non-lactating Mediterranean buffaloes (Bubalus bubalis) ranging in age from 24 months to 14 years.

    PubMed

    Ciaramella, P; Corona, M; Ambrosio, R; Consalvo, F; Persechino, A

    2005-08-01

    Haematological studies were performed on 100 clinically normal non-lactating Mediterranean buffalo species ranging in age from 24 months to 14 years, to determinate the range of normal haematological values for this ruminant species. The animals were divided in 5 groups according to age: Group I, 2-3 years old which had never calved, Group II, 3-4 years old (primipara buffaloes), Group III, 5-7 years old, Group IV 8-10 years old and Group V over 10 years of age. All the haematological values obtained were comparable with the normal values found in adult cattle, and similar to those reported in Indian water buffalo species. The heifer buffalo showed an higher values for packed cell volume (PCV) compared with the older animals, but lower values for mean corpuscular haemoglobin concentration (MCHC) and mean corpuscular haemoglobin (MCH) (P 0.01). In animals above 8 years of age, the white cell count was lower with a significant reduction in absolute values of lymphocytes (P 0.01). Higher absolute values of eosinophils levels was found in the group V (P 0.01).

  16. Comparison of follicular dynamics, superovulatory response, and embryo recovery between estradiol based and conventional superstimulation protocol in buffaloes (Bubalus bubalis)

    PubMed Central

    Singh, Narinder; Dhaliwal, G. S.; Malik, V. S.; Dadarwal, D.; Honparkhe, M.; Singhal, S.; Brar, P. S.

    2015-01-01

    Aim: To evaluate the follicular dynamics, superovulatory response, and embryo recovery following superstimulatory treatment initiated at estradiol-17β induced follicular wave emergence and its comparison with conventional superstimulatory protocol in buffaloes. Materials and Methods: Six normal cycling pluriparous buffaloes, lactating, 90-180 days post-partum, and weighing between 500 and 660 kg were superstimulated twice with a withdrawal period of 35 days in between two treatments. In superstimulation protocol-1 (estradiol group) buffaloes were administered estradiol-17β (2 mg, i.m.) and eazibreed controlled internal drug release (CIDR) was inserted intravaginally (day=0) at the random stage of the estrous cycle. On the day 4, buffaloes were superstimulated using follicle stimulating hormone (FSH) 400 mg, divided into 10 tapering doses given at 12 hourly intervals. Prostaglandin F2α analogs (PGF2α) was administered at day 7.5 and day 8, and CIDR was removed with the second PGF2α injection. In superstimulation protocol - 2 (conventional group) buffaloes were superstimulated on the 10th day of the estrous cycle with same FSH dose regimen and similar timings for PGF2α injections. In both groups, half of the buffaloes were treated with luteinizing hormone (LH) 25 mg and other half with 100 ug buserelin; gonadotrophin releasing hormone (GnRH) analog at 12 h after the end of FSH treatment. All buffaloes in both protocols were inseminated twice at 12 and 24 h of LH/GnRH treatment. Daily ultrasonography was performed to record the size and number of follicles and superovulatory response. Results: Significantly higher number of small follicles (<8 mm) was present at the time of initiation of superstimulatory treatment in the estradiol group compared to the conventional group (12.5±0.80 vs. 7.3±1.21, respectively, p=0.019), however, the number of ovulatory size follicles (≥8 mm) did not differ significantly between the respective groups (15.5±1.24 vs. 12.2±1

  17. Genetic analysis of river, swamp and hybrid buffaloes of north-east India throw new light on phylogeography of water buffalo (Bubalus bubalis).

    PubMed

    Mishra, B P; Dubey, P K; Prakash, B; Kathiravan, P; Goyal, S; Sadana, D K; Das, G C; Goswami, R N; Bhasin, V; Joshi, B K; Kataria, R S

    2015-12-01

    This study analysed buffaloes from north-east India and compared their nuclear and mitochondrial DNA variations with buffaloes of mainland India, China, Mediterranean and South-East Asia. Microsatellite genotypes of 338 buffaloes including 210 from six north-east Indian buffalo populations and three mainland Indian breeds were analysed to evaluate their genetic structure and evolutionary relationships. Phylogenetic analysis and multidimensional scaling plot of pairwise FST revealed the clustering of all swamp-type buffaloes of north-east India with Lower Assamese (significantly hybrid type) buffaloes in one plane and all the mainland river buffaloes in another plane while the upper Assamese buffaloes being distinct from both these clusters. Analysis of mtDNA D-loop region of 530-bp length was performed on 345 sequences belonging to 23 buffalo populations from various geographical regions to establish the phylogeography of Indian water buffalo. The swamp buffaloes of north-east India clustered with both the lineages of Chinese swamp buffalo. Multidimensional scaling display of pairwise FST derived from mitochondrial DNA data showed clustering of upper Assamese, Chilika and Mediterranean buffaloes distinctly from all the other Indian buffalo populations. Median-joining network analysis further confirmed the distinctness and ancestral nature of these buffaloes. The study revealed north-east region of India forming part of the wider hybrid zone of water buffalo that may probably extend from north-east India to South-East Asia.

  18. Genetic analysis of river, swamp and hybrid buffaloes of north-east India throw new light on phylogeography of water buffalo (Bubalus bubalis).

    PubMed

    Mishra, B P; Dubey, P K; Prakash, B; Kathiravan, P; Goyal, S; Sadana, D K; Das, G C; Goswami, R N; Bhasin, V; Joshi, B K; Kataria, R S

    2015-12-01

    This study analysed buffaloes from north-east India and compared their nuclear and mitochondrial DNA variations with buffaloes of mainland India, China, Mediterranean and South-East Asia. Microsatellite genotypes of 338 buffaloes including 210 from six north-east Indian buffalo populations and three mainland Indian breeds were analysed to evaluate their genetic structure and evolutionary relationships. Phylogenetic analysis and multidimensional scaling plot of pairwise FST revealed the clustering of all swamp-type buffaloes of north-east India with Lower Assamese (significantly hybrid type) buffaloes in one plane and all the mainland river buffaloes in another plane while the upper Assamese buffaloes being distinct from both these clusters. Analysis of mtDNA D-loop region of 530-bp length was performed on 345 sequences belonging to 23 buffalo populations from various geographical regions to establish the phylogeography of Indian water buffalo. The swamp buffaloes of north-east India clustered with both the lineages of Chinese swamp buffalo. Multidimensional scaling display of pairwise FST derived from mitochondrial DNA data showed clustering of upper Assamese, Chilika and Mediterranean buffaloes distinctly from all the other Indian buffalo populations. Median-joining network analysis further confirmed the distinctness and ancestral nature of these buffaloes. The study revealed north-east region of India forming part of the wider hybrid zone of water buffalo that may probably extend from north-east India to South-East Asia. PMID:25780854

  19. Supplementation of Slow-Release Melatonin Improves Recovery of Ovarian Cyclicity and Conception in Summer Anoestrous Buffaloes (Bubalus bubalis).

    PubMed

    Kumar, A; Mehrotra, S; Singh, G; Maurya, V P; Narayanan, K; Mahla, A S; Chaudhari, R K; Singh, M; Soni, Y K; Kumawat, B L; Dabas, S K; Srivastava, N

    2016-02-01

    The role of melatonin as a protective neurohormone against restoring cyclicity in summer anoestrous animals in photoperiod species has gained wider acceptance. This study was designed to uncover the evidence the slow-release melatonin (MLT) has on initiation of ovarian cyclicity and conception rate (CR) in summer anoestrous buffaloes. Thus, buffaloes diagnosed as summer anoestrous (absence of overt signs of oestrus, concurrent rectal examination and radioimmunoassay for serum progesterone at 10 days interval) were grouped as untreated (Group I, sterilized corn oil, n = 8) and treated (Group II, single subcutaneous injection of MLT @18 mg/50 kg bwt in sterilized corn oil, n = 20). Animals treated and detected in oestrus were artificially inseminated (AI) followed by division into Group III (second dose of MLT on 5th day post-AI, n = 8) and Group IV (no melatonin administration, n = 10). Blood samples were collected at 4 days interval for estimation of serum MLT, progesterone and oestrogen using radioimmunoassay kit. Mean oestrous induction rate (OIR), oestrous induction interval (OII), interoestrous interval (IOI) and CR were estimated. Compared to control, concentration of melatonin was significantly (p < 0.05) higher in treated group ranging from 14.34 ± 1.72 to 412.31 ± 14.47 pg/ml whereas other two hormones did not show any concentration difference. Melatonin-administered buffaloes showed significantly (p < 0.05) higher (90%) OIR with OII of 18.06 ± 1.57 days. Results showed improvement in conception rate in buffaloes administered with post-insemination melatonin. It can be concluded from the study that slow-release melatonin supplementation restored cyclicity in summer anoestrous animals resulting in improvement in conception rate in buffaloes.

  20. Body condition, energy balance and immune status of periparturient Murrah buffaloes (Bubalus bubalis) supplemented with inorganic chromium.

    PubMed

    Deka, Rijusmita Sarma; Mani, Veena; Kumar, Muneendra; Shiwajirao, Zade Satish; Tyagi, Amrish Kumar; Kaur, Harjit

    2014-10-01

    Periparturient Murrah buffaloes were used to determine whether body condition, energy balance and immune status are affected by inorganic Cr supplementation. Twenty-four Murrah buffaloes were blocked into four groups having six animals in each group and fed for 60 days pre-partum to 150 days post-partum. Feeding regimen was same in all the groups except that these were supplemented with 0.0, 0.5, 1.0 and 1.5 of Cr per kilogram of dry matter (DM) in the four respective groups. Buffaloes were weighed at fortnightly intervals. Blood samples were collected from the jugular vein at days -60, -30, -15, -7, 0, 7, 15, 30, 60, 90, 120 and 150 of experimental feeding for the estimation of non-esterified fatty acid (NEFA), beta-hydroxybutyric acid (BHBA), Cr level, lymphocyte proliferation, neutrophil phagocytic activity, plasma total immunoglobulin (TIg), immunoglobulin G (IgG) and cortisol levels. Results revealed that with approaching parturition, dry matter intake (DMI), immune response and plasma Cr level decreased (P < 0.05) gradually and minimum values were observed on the day of parturition in all groups. In contrast, body condition score (BCS), plasma NEFA and BHBA concentrations showed increasing (P < 0.05) trends towards calving and level decreased after calving. Dietary Cr supplementation did not have any effect on DMI and BCS, but immune response and plasma Cr concentration showed a positive correlation with dietary Cr supplementation. Buffaloes supplemented with 1.5 mg/kg Cr had significantly (P < 0.05) low plasma NEFA and BHBA concentrations. The results of present findings indicated that dietary inorganic Cr supplementation reduced lipid mobilization and improved immune response in periparturient buffaloes.

  1. Molecular cloning, sequence characterization, and gene expression profiling of a novel water buffalo (Bubalus bubalis) gene, AGPAT6.

    PubMed

    Song, S; Huo, J L; Li, D L; Yuan, Y Y; Yuan, F; Miao, Y W

    2013-01-01

    Several 1-acylglycerol-3-phosphate-O-acyltransferases (AGPATs) can acylate lysophosphatidic acid to produce phosphatidic acid. Of the eight AGPAT isoforms, AGPAT6 is a crucial enzyme for glycerolipids and triacylglycerol biosynthesis in some mammalian tissues. We amplified and identified the complete coding sequence (CDS) of the water buffalo AGPAT6 gene by using the reverse transcription-polymerase chain reaction, based on the conversed sequence information of the cattle or expressed sequence tags of other Bovidae species. This novel gene was deposited in the NCBI database (accession No. JX518941). Sequence analysis revealed that the CDS of this AGPAT6 encodes a 456-amino acid enzyme (molecular mass = 52 kDa; pI = 9.34). Water buffalo AGPAT6 contains three hydrophobic transmembrane regions and a signal 37-amino acid peptide, localized in the cytoplasm. The deduced amino acid sequences share 99, 98, 98, 97, 98, 98, 97 and 95% identity with their homologous sequences from cattle, horse, human, mouse, orangutan, pig, rat, and chicken, respectively. The phylogenetic tree analysis based on the AGPAT6 CDS showed that water buffalo has a closer genetic relationship with cattle than with other species. Tissue expression profile analysis shows that this gene is highly expressed in the mammary gland, moderately expressed in the heart, muscle, liver, and brain; weakly expressed in the pituitary gland, spleen, and lung; and almost silently expressed in the small intestine, skin, kidney, and adipose tissues. Four predicted microRNA target sites are found in the water buffalo AGPAT6 CDS. These results will establish a foundation for further insights into this novel water buffalo gene. PMID:24114207

  2. The effects of high temperature and roof modification on physiological responses of swamp buffalo ( Bubalus bubalis) in the tropics

    NASA Astrophysics Data System (ADS)

    Khongdee, Titaporn; Sripoon, S.; Vajrabukka, C.

    2013-05-01

    The objective of the experiments reported here was to measure the effects of cooling techniques (Modified roof vs Normal roof) on the performance and physiology of 12 young male buffaloes with a similar live weight of 160 kg. The study was conducted at Chainat Agriculture and Technology College, Chainat Province, Thailand. The animals were divided randomly into two groups, each group comprising six buffaloes, and the two groups were studied to evaluate the effects of modified roofing (normal roof fitted with woven polypropylene shade cloth) on the subjects' physiological responses to heat stress under hot humid conditions. The modified roof resulted in lowered heat stress in buffaloes compared to those under a standard roof. The difference was shown by the buffaloes having a significantly lower mean rectal temperature (39.14 ± 0.07 vs 40.00 ± 0.10°C) and plasma cortisol (2.14 ± 0.24 vs 3.38 ± 0.37 ng/ml). The average daily water consumption was significantly lower in the MR group (MR, 29.71 ± 0.86 vs NR, 34.14 ± 1.06 L head -1 day-1), while there was a tendency for the roughage intake to be higher in the MR group compared to that of the NR group (MR, 5.88 ± 0.18 vs NR, 6.44 ± 0.19 kg head-1 -1 day-1; P = 0.0508). It was concluded that roof modification facilitated a reduction in heat load from roof re-radiation, and was an effective means of alleviating thermal stress in young buffaloes.

  3. Molecular cloning, sequence characterization, and gene expression profiling of a novel water buffalo (Bubalus bubalis) gene, AGPAT6.

    PubMed

    Song, S; Huo, J L; Li, D L; Yuan, Y Y; Yuan, F; Miao, Y W

    2013-10-01

    Several 1-acylglycerol-3-phosphate-O-acyltransferases (AGPATs) can acylate lysophosphatidic acid to produce phosphatidic acid. Of the eight AGPAT isoforms, AGPAT6 is a crucial enzyme for glycerolipids and triacylglycerol biosynthesis in some mammalian tissues. We amplified and identified the complete coding sequence (CDS) of the water buffalo AGPAT6 gene by using the reverse transcription-polymerase chain reaction, based on the conversed sequence information of the cattle or expressed sequence tags of other Bovidae species. This novel gene was deposited in the NCBI database (accession No. JX518941). Sequence analysis revealed that the CDS of this AGPAT6 encodes a 456-amino acid enzyme (molecular mass = 52 kDa; pI = 9.34). Water buffalo AGPAT6 contains three hydrophobic transmembrane regions and a signal 37-amino acid peptide, localized in the cytoplasm. The deduced amino acid sequences share 99, 98, 98, 97, 98, 98, 97 and 95% identity with their homologous sequences from cattle, horse, human, mouse, orangutan, pig, rat, and chicken, respectively. The phylogenetic tree analysis based on the AGPAT6 CDS showed that water buffalo has a closer genetic relationship with cattle than with other species. Tissue expression profile analysis shows that this gene is highly expressed in the mammary gland, moderately expressed in the heart, muscle, liver, and brain; weakly expressed in the pituitary gland, spleen, and lung; and almost silently expressed in the small intestine, skin, kidney, and adipose tissues. Four predicted microRNA target sites are found in the water buffalo AGPAT6 CDS. These results will establish a foundation for further insights into this novel water buffalo gene.

  4. Body condition, energy balance and immune status of periparturient Murrah buffaloes (Bubalus bubalis) supplemented with inorganic chromium.

    PubMed

    Deka, Rijusmita Sarma; Mani, Veena; Kumar, Muneendra; Shiwajirao, Zade Satish; Tyagi, Amrish Kumar; Kaur, Harjit

    2014-10-01

    Periparturient Murrah buffaloes were used to determine whether body condition, energy balance and immune status are affected by inorganic Cr supplementation. Twenty-four Murrah buffaloes were blocked into four groups having six animals in each group and fed for 60 days pre-partum to 150 days post-partum. Feeding regimen was same in all the groups except that these were supplemented with 0.0, 0.5, 1.0 and 1.5 of Cr per kilogram of dry matter (DM) in the four respective groups. Buffaloes were weighed at fortnightly intervals. Blood samples were collected from the jugular vein at days -60, -30, -15, -7, 0, 7, 15, 30, 60, 90, 120 and 150 of experimental feeding for the estimation of non-esterified fatty acid (NEFA), beta-hydroxybutyric acid (BHBA), Cr level, lymphocyte proliferation, neutrophil phagocytic activity, plasma total immunoglobulin (TIg), immunoglobulin G (IgG) and cortisol levels. Results revealed that with approaching parturition, dry matter intake (DMI), immune response and plasma Cr level decreased (P < 0.05) gradually and minimum values were observed on the day of parturition in all groups. In contrast, body condition score (BCS), plasma NEFA and BHBA concentrations showed increasing (P < 0.05) trends towards calving and level decreased after calving. Dietary Cr supplementation did not have any effect on DMI and BCS, but immune response and plasma Cr concentration showed a positive correlation with dietary Cr supplementation. Buffaloes supplemented with 1.5 mg/kg Cr had significantly (P < 0.05) low plasma NEFA and BHBA concentrations. The results of present findings indicated that dietary inorganic Cr supplementation reduced lipid mobilization and improved immune response in periparturient buffaloes. PMID:25037066

  5. The effects of high temperature and roof modification on physiological responses of swamp buffalo (Bubalus bubalis) in the tropics.

    PubMed

    Khongdee, Titaporn; Sripoon, S; Vajrabukka, C

    2013-05-01

    The objective of the experiments reported here was to measure the effects of cooling techniques (Modified roof vs Normal roof) on the performance and physiology of 12 young male buffaloes with a similar live weight of 160 kg. The study was conducted at Chainat Agriculture and Technology College, Chainat Province, Thailand. The animals were divided randomly into two groups, each group comprising six buffaloes, and the two groups were studied to evaluate the effects of modified roofing (normal roof fitted with woven polypropylene shade cloth) on the subjects' physiological responses to heat stress under hot humid conditions. The modified roof resulted in lowered heat stress in buffaloes compared to those under a standard roof. The difference was shown by the buffaloes having a significantly lower mean rectal temperature (39.14 ± 0.07 vs 40.00 ± 0.10°C) and plasma cortisol (2.14 ± 0.24 vs 3.38 ± 0.37 ng/ml). The average daily water consumption was significantly lower in the MR group (MR, 29.71 ± 0.86 vs NR, 34.14 ± 1.06 L head (-1) day(-1)), while there was a tendency for the roughage intake to be higher in the MR group compared to that of the NR group (MR, 5.88 ± 0.18 vs NR, 6.44 ± 0.19 kg head-1 (-1) day(-1); P = 0.0508). It was concluded that roof modification facilitated a reduction in heat load from roof re-radiation, and was an effective means of alleviating thermal stress in young buffaloes.

  6. Clinical outcomes and molecular genotyping of Staphylococcus aureus isolated from milk samples of dairy primiparous Mediterranean buffaloes (Bubalus bubalis).

    PubMed

    Guccione, J; Cosandey, A; Pesce, A; Di Loria, A; Pascale, M; Piantedosi, D; Steiner, A; Graber, H U; Ciaramella, P

    2014-12-01

    Staphylococcus aureus is one of the most important pathogens causing mastitis in dairy cows and in Mediterranean buffaloes. Genotype B (GTB) is contagious in dairy cows and may occur in up to 87% of cows of a dairy herd. It was the aim of this study to evaluate genotypes present, clinical outcomes, and prevalence of Staph. aureus in milk samples of primiparous Mediterranean dairy buffaloes. Two hundred composite milk samples originating from 40 primiparous buffaloes were collected from May to June 2012, at d 10, 30, 60, 90, and 150 d in milk (DIM) to perform somatic cell counts and bacteriological cultures. Daily milk yields were recorded. Before parturition until 40 to 50 DIM, all primiparous animals were housed separated from the pluriparous animals. Milking was performed in the same milking parlor, but the primiparous animals were milked first. After 50 DIM, the primiparous were mixed with the pluriparous animals, including the milking procedure. Individual quarter samples were collected from each animal, and aliquots of 1 mL were mixed and used for molecular identification and genotyping of Staph. aureus. The identification of Staph. aureus was performed verifying the presence of nuc gene by nuc gene PCR. All the nuc-positive isolates were subjected to genotype analysis by means of PCR amplification of the 16S-23S rRNA intergenic spacer region and analyzed by a miniaturized electrophoresis system. Of all 200 composite samples, 41 (20.5%) were positive for Staph. aureus, and no genotype other than GTB was identified. The prevalence of samples positive for Staph. aureus was 0% at 10 DIM and increased to a maximum of 22/40 (55%) at 90 DIM. During the period of interest, 14 buffaloes tested positive for Staph. aureus once, 6 were positive twice, and 5 were positive 3 times, whereas 15 animals were negative at every sampling. At 90 and 150 DIM, 7 (17.5%) and 3 buffaloes (7.5%), respectively, showed clinical mastitis (CM), and only 1 (2.5%) showed CM at both

  7. Minimum number of spermatozoa per dose in Mediterranean Italian buffalo (Bubalus bubalis) using sexed frozen semen and conventional artificial insemination.

    PubMed

    Gaviraghi, A; Puglisi, R; Balduzzi, D; Severgnini, A; Bornaghi, V; Bongioni, G; Frana, A; Gandini, L M; Lukaj, A; Bonacina, C; Galli, A

    2013-05-01

    In buffaloes, AI with sexed semen is not fully optimized, and the procedure has only been performed using the approach currently in use for cattle. The objective of the present work was to compare the pregnancy rates in Mediterranean Italian buffalo cows inseminated with sexed frozen-thawed semen at 2, 4, 6, and 8 million sperm per dose, using the Ovsynch protocol and conventional AI at a fixed time. Fresh ejaculates from three buffalo bulls were processed according to Beltsville sperm sorting technology, and packaged in 0.25-mL straws with two total concentrations of 2 and 4 million live sorted sperm per straw. After thawing, semen was evaluated for total motility, forward motility, average path velocity, membrane and DNA integrity, and membrane fluidity. Sorting efficiency was estimated using a real time polymerase chain reaction method developed and validated in our laboratory. The artificial inseminations were conducted during the breeding season on 849 Italian Mediterranean buffalo heifers and cows distributed in 13 farms in northern and central Italy. No significant difference in quality parameters was reported between nonsexed and sexed straws produced with 2 and 4 million sperm. Lower pregnancy rate (P < 0.001) was reported when inseminating doses of sexed semen at 2 million were used (53/170; 31.2%), with respect to conventional nonsexed (78/142; 54.9%), and sexed doses at 4, 6, and 8 million spermatozoa (102/205, 49.8%; 84/175, 48.0%; and 74/157, 47.1%, respectively). No differences were evident using conventional doses and sexed semen with sperm numbers equal or higher than 4 million per dose. Pregnancies were not affected by the sire; 39/82 (47.6%), 120/270 (44.4%), and 151/355 (42.5%), respectively, for the three bulls. Variability in pregnancy rates observed in different herds was not significant. Furthermore, no significant difference was reported between pregnancies obtained with sexed semen in heifers and multiparous, respectively, 179/407 (44

  8. Serological diagnosis of brucellosis in water buffaloes (Bubalus bubalis): comparison among complement fixation, serum agglutination and rose bengal plate test.

    PubMed

    Mathias, L A; Pinto, A A

    1983-12-01

    The results of a comparative study among complement fixation (CFT), plate agglutination (PAT), tube agglutination (TAT) and Rose Bengal plate tests ( RBPT ) to the serodiagnosis of brucellosis in Indian buffaloes are reported. Sera from 212 buffaloes unvaccinated against brucellosis were examined and the CFT was able to reveal significant titres in sera with low agglutinating titres. From 109 sera which did not show agglutination titres in the PAT, four showed complement fixing titre greater than 1 in 200. All the positive sera to the RBPT gave complement fixing titre equal to or greater than 1 in 20. In sera that showed negative result to the RBPT the CFT was able to reveal relatively high titres. From 131 sera negative to the RBPT five showed complement fixing titres greater than 1 in 60.

  9. [First notification of Eimeria bareillyi (Apicomplexa: Eimeridae) in feces of buffalo calves (Bubalus bubalis) naturally infected in Minas Gerais, Brazil].

    PubMed

    Bastianetto, Eduardo; Freitas, Carolina M V; Bello, Ana Cristina P P; Cunha, Arildo P; Dalla Rosa, Ricardo C; Leite, Romário C

    2008-09-01

    In this study the evolution of Eimeriosis in naturally infected calves was analyzed during 23 days starting at birth. The specie E. bareillyi was first identified in feces culture. Later other species of Eimeria already described in water buffalo were identified. The animals which died were submitted to necropsy, revealing macroscopic lesions in the ileum region. Histological analyses of the ileum region showed acute necrotic enteritis and the presence of Eimeria sp. in different developmental stages. Early infection by this parasite could be responsible for a secondary bacterial infection trough the intestinal lesions. The utilization of prophylactic medication and the therapeutic treatment of clinical Coccidiosis in water buffalo calves are necessary to their satisfactory development and surveillance.

  10. Water buffaloes (Bubalus bubalis) identified as an important reservoir of Shiga toxin-producing Escherichia coli in Brazil.

    PubMed

    Oliveira, Murilo G; Brito, José R Feitosa; Carvalho, Roberta R; Guth, Beatriz E C; Gomes, Tânia A T; Vieira, Mônica A M; Kato, Maria A M F; Ramos, Isabel I; Vaz, Tânia M I; Irino, Kinue

    2007-09-01

    The presence of Shiga toxin-producing Escherichia coli (STEC) in water buffaloes is reported for the first time in South America. The prevalence of STEC ranged from 0 to 64% depending on the farm. STEC isolates exhibiting the genetic profiles stx(1)stx(2)ehxA iha saa and stx(2)ehxA iha saa predominated. Of the 20 distinct serotypes identified, more than 50% corresponded to serotypes associated with human diseases.

  11. Generation of bovine (Bos indicus) and buffalo (Bubalus bubalis) adipose tissue derived stem cells: isolation, characterization, and multipotentiality.

    PubMed

    Sampaio, R V; Chiaratti, M R; Santos, D C N; Bressan, F F; Sangalli, J R; Sá, A L A; Silva, T V G; Costa, N N; Cordeiro, M S; Santos, S S D; Ambrosio, C E; Adona, P R; Meirelles, F V; Miranda, M S; Ohashi, O M

    2015-01-15

    Adult stem cells are known for their plasticity and their potential to differentiate into several different cell types; these characteristics have implications for cell therapy and reproductive biotechnologies. In this study, we report on the isolation and characterization of mesenchymal stem cells (MSC) derived from bovine and buffalo adipose tissue. Cells isolated using enzymatic digestion of bovine and buffalo adipose-tissue biopsy samples were grown in vitro for at least 15 passages, verifying their capacity to proliferate. These cells were also subjected to immunophenotypic characterization for the presence of CD90, CD105, and CD79, and the absence of CD45, CD34, and CD73, which are positive and negative markers of MSC, respectively. To prove their multipotency, the cells were induced to differentiate into three different cell types, chondrocytes, osteoblasts, and adipocytes, which were stained with tissue-specific dyes (Chondrogenic-Alcian Blue, Osteogenic-Alizarin Red, and Adipogenic-Oil-Red O, respectively) to confirm differentiation. Gene expression analysis of pluripotency-related genes was also conducted. Our results suggest that adipose tissue from bovines and buffalos can be used as a source of MSC, making adipose tissue-derived cells an interesting option for cell therapy and regenerative medicine. Additionally, these findings have implications for reproductive biotechnology because the use of MSC as nuclear donors has been linked to an increase in the efficiency of nuclear transfer.

  12. Phenotypic Characterization and Multivariate Analysis to Explain Body Conformation in Lesser Known Buffalo (Bubalus bubalis) from North India

    PubMed Central

    Vohra, V.; Niranjan, S. K.; Mishra, A. K.; Jamuna, V.; Chopra, A.; Sharma, Neelesh; Jeong, Dong Kee

    2015-01-01

    Phenotypic characterization and body biometric in 13 traits (height at withers, body length, chest girth, paunch girth, ear length, tail length, length of tail up to switch, face length, face width, horn length, circumference of horn at base, distances between pin bone and hip bone) were recorded in 233 adult Gojri buffaloes from Punjab and Himachal Pradesh states of India. Traits were analysed by using varimax rotated principal component analysis (PCA) with Kaiser Normalization to explain body conformation. PCA revealed four components which explained about 70.9% of the total variation. First component described the general body conformation and explained 31.5% of total variation. It was represented by significant positive high loading of height at wither, body length, heart girth, face length and face width. The communality ranged from 0.83 (hip bone distance) to 0.45 (horn length) and unique factors ranged from 0.16 to 0.55 for all these 13 different biometric traits. Present study suggests that first principal component can be used in the evaluation and comparison of body conformation in buffaloes and thus provides an opportunity to distinguish between early and late maturing to adult, based on a small group of biometric traits to explain body conformation in adult buffaloes. PMID:25656215

  13. First established pregnancies in Mediterranean Italian buffaloes (Bubalus bubalis) following deposition of sexed spermatozoa near the utero tubal junction.

    PubMed

    Presicce, G A; Verberckmoes, S; Senatore, E M; Klinc, P; Rath, D

    2005-02-01

    At the time of AI following Ovsynch protocol, a total of 51 buffaloes were randomly divided in a first group (n = 30) subjected to conventional AI into the uterine body with 20 million non-sex sorted frozen-thawed spermatozoa, while a second group (n = 21) was inseminated near the utero-tubal junction (UTJ) ipsilateral to the ovary carrying the preovulatory follicle with 2.5 million live (4 million total) sex-sorted frozen-thawed spermatozoa. The semen used for flowcytometric sorting was collected and processed on a farm in Italy, and then shipped to a laboratory in Germany. Eleven buffaloes were inseminated with X-chromosome bearing spermatozoa and 10 with Y-chromosome bearing spermatozoa. Conception rates after conventional and UTJ inseminations were 43.3% (n = 13) and 42.8% (n = 9) respectively (p = 0.97). Eight of the nine foetuses obtained after insemination with sexed spermatozoa corresponded to the sex as predicted by the cell sorting procedure (five male and four female foetuses by ultrasound vs six male and three female foetuses by cell sorting). In conclusion, for the first time buffalo semen has been successfully subjected to procedures for flowcytometric sperm sorting and freezing. Low doses of sexed spermatozoa have been deposited near the UTJ giving conception rates similar to those of conventional AI with full dose. PMID:15655005

  14. Quantification of water buffalo (Bubalus bubalis) cytokine expression in response to inactivated foot-and-mouth disease (FMD) vaccine.

    PubMed

    Mingala, Claro N; Konnai, Satoru; Venturina, Fe A; Onuma, Misao; Ohashi, Kazuhiko

    2009-10-01

    This study describes the quantification of cytokine expression of vaccinated water buffaloes with FMD inactivated vaccine. Using real-time PCR quantification assay, expression of Th1 (IL-2, IL-12p40, IFNgamma); Th2 (IL-4, IL-10) and inflammatory (IL-6, TNFalpha) cytokines were quantified weekly for the entire three-week duration of the experiment. It was noted that IFNgamma, IL-10 and TNFalpha had peaked on week three post-vaccination while the remaining cytokines peaked on the second week and decreased by the third week. The counteraction between IFNgamma and IL-4 was noted as well as the possible suppressive action of IL-10 to that of IL-2 and IL-12, which is a common phenomenon between Th1 and Th2 cytokines. Synergy between TNFa and IL-6 was also observed. These findings suggest that within the immune system of water buffalo there is a dynamic cell-mediated and humoral interaction in response to immunogen. This assessment of the cytokine expressions is vital for the study of water buffalo disease progression and concurring protective immune responses.

  15. Cloning, sequencing and expression of cDNA of bovine neutrophil beta-defensin from water buffalo (Bubalus bubalis).

    PubMed

    Bera, B C; Chaudhury, P; Bhattacharya, D; Bera, A K; Das, S K

    2007-06-01

    Neutrophil beta-defensins have been identified as naturally occurring potent antibacterial cationic peptides serving as effector molecules of innate immunity that provide a first line of defence against pathogens. Considering the broad-spectrum antimicrobial activity against microorganisms and role in innate immunity of the neutrophil beta-defensins, it has been characterized in many livestock species including cattle, sheep, caprine and porcines. Here we report the isolation, cloning, sequencing and expression of precursor bovine neutrophil beta-defensin isolated from Indian water buffalo. Full-length cDNA was amplified using reverse transcription polymerase chain reaction (RT-PCR). The cDNA contained an open reading frame of 192 bp encoding a putative polypeptide of 63 amino acids. Deduced amino acid sequence of buffalo BNBD4 showed varying amino acid identity with the published sequences of related beta-defensins of other domestic ruminant species ranging from 67.18 to 79.68%. Recombinant buffalo defensin was produced in Escherichia coli as fusion protein.

  16. Analysis of SLC11A1 gene expression in healthy water buffalo (Bubalus bubalis) blood cells using qPCR.

    PubMed

    Crisà, A; De Matteis, G; Scatà, M C; Moioli, B

    2013-01-01

    SLC11A1 (solute carrier family 11 member 1 protein) gene influences the initial phase of bacterial cellular infections through macrophage activation. Recent literature on buffalo has attempted to associate the genotype of the polymorphic microsatellite located in the 3'untranslated region (3'UTR) of the gene, with either susceptibility to brucellosis or with improved macrophage function. Carriers of the (GT)16 allele have been reported to be resistant to brucellosis. In this study we analyzed the steady-state level of SLC11A1 expression in a serologically negative herd of 26 animals differing by the number of (GT)n microsatellite repeats by using a reverse transcriptase quantitative real-time polymerase chain reaction approach. We evaluated five different reference genes, which had not been reported previously, for use in gene expression experiments in buffalo blood. However, we did not find any significant difference between buffalo carriers of the different microsatellite alleles, with respect to SLC11A1 expression in whole blood or in blood fractions [peripheral blood mononuclear cells (PBMC) and polymorphonuclear leukocytes/granulocytes (PMN/G)]. Conversely, there was a difference between the blood fractions in their SLC11A1 expression levels, with the PMN/G fraction having a higher expression level than the PBMC fraction (P < 0.015).

  17. Studies on the histogenesis of the tunica mucosa of the stomach of the Egyptian water buffalo (Bos bubalus L.).

    PubMed

    Osman, A H; Berg, R

    1981-01-01

    The histogenesis of the ruminal mucosa was studied in 9 buffalo fetuses (CRL 90--730 mm) and one suckling female buffalo calf. The Lamina epithelialis was found to consist of a basal and superficial layer. The former consists firstly of 2--4 cell layers and becomes later reduced to only one, made up to columnar cells; the latter one consists firstly of about 9 cell layers and increases then to 28--35, depending on the ruminal compartment. The epithelium shows its embryological feature, i.e. all nuclei are directed to the luminal cell pole. The first incidence of the ruminal papillary formation in the Egyptian water buffalo is observed in fetuses of 170 mm CRL. The histogenetic steps of the formation of the ruminal papillae are the aggregation of the cells of the basal layer and of the Lamina propria; the undulations with involvement of the basal layer of the Lamina epithelialis, basement membrane and Lamina propria; formation of humps from the undulations; formation of papillae. The papillary primordia are seen first in the Atrium ruminis and in the caudoventral blind sac simultaneously. The suckling calf has still no definite ruminal papillae. Only their tips are projecting to a different extent into the lumen.

  18. Early development and location of embryos in the reproductive tract of Nili Ravi buffalo (Bubalus bubalis): a retrospective analysis.

    PubMed

    Anwar, M; Ullah, N

    1998-04-15

    One year data on embryo recovery were analyzed to study the development and descent of preimplantation embryos in Nili Ravi water buffalo. Forty-five superovulatory attempts were performed on 23 buffalo. A total of 45 embryos were recovered either nonsurgically or after slaughtering the animals at various time intervals (85 to 176 h) post estrus. Embryos were located in the oviducts at 85 h after estrus. At 108 h post estrus, most of them (78%) were recovered from the uteri. The embryos had 8 to 16 cells at 85 h post estrus, grew to morulae at 108 h and to compact morulae at 125 h post estrus. Early blastocysts were observed at 141 h post estrus. Blastocysts were predominant (69%) at 156 to 176 h after estrus; no hatched blastocysts were recovered during this time interval. Based on our findings, embryo recovery at around 150 h post estrus (i.e., Day 6 of the cycle) is recommended for compact morulae or blastocysts in the water buffalo.

  19. Impact of livestock hygiene education programs on mastitis in smallholder water buffalo (Bubalus bubalis) in Chitwan, Nepal.

    PubMed

    Ng, Linda; Jost, Christine; Robyn, Misha; Dhakal, I P; Bett, Bernard; Dhakal, Pramod; Khadka, Rupak

    2010-09-01

    A project implemented from 2003 to 2005 trained women in Chitwan District, Nepal, in hygienic dairy production using a process of social mobilization. The aim of this research was to assess if the prevalence of mastitis in water buffalo in the households of women who were trained was lower one year after training than in untrained households, if the training influenced knowledge and practices for the prevention or control of mastitis, and if these practices and knowledge were associated with a lower prevalence of mastitis. A total of 202 households from Eastern and Western Chitwan District were included in the study. Of these, 60 households had participated in the project and 142 had not. Milk samples were collected from 129 households (33 project households and 96 non-project households). Clinical mastitis was determined using visual inspection of udders and detection of macroscopic clots and flakes in milk. The California Mastitis Test was used to diagnose sub-clinical mastitis from milk samples, and the IDEXX SNAP test to identify the presence of tetracycline residues. The prevalence of mastitis in trained households (39.4%) was 43.78% of that in untrained households (60.4%), lower but not significantly so (p=0.08, 95% CI 0.17-1.12). Thirteen indicators of knowledge or practice for the control or prevention of mastitis were more likely to occur in trained households, four significantly so (not consuming milk from sick buffalo (p=0.001), using soap to wash hands before milking (p=0.001), discarding milk after antibiotic usage (p=0.01), and choosing appropriate flooring for their livestock (p=0.03)). Trained households that discarded milk from sick buffalo were 2.96 times more likely to have at least one animal with mastitis in the household (p=0.03, 95% CI 1.15-7.65). Trained households that knew to wash buffalos' teats after milking were less likely (OR 0.25) to have mastitis in their herd (p=0.02, 95% CI 0.08-0.80). Of the 138 buffalos tested, only one tested

  20. Impact of livestock hygiene education programs on mastitis in smallholder water buffalo (Bubalus bubalis) in Chitwan, Nepal.

    PubMed

    Ng, Linda; Jost, Christine; Robyn, Misha; Dhakal, I P; Bett, Bernard; Dhakal, Pramod; Khadka, Rupak

    2010-09-01

    A project implemented from 2003 to 2005 trained women in Chitwan District, Nepal, in hygienic dairy production using a process of social mobilization. The aim of this research was to assess if the prevalence of mastitis in water buffalo in the households of women who were trained was lower one year after training than in untrained households, if the training influenced knowledge and practices for the prevention or control of mastitis, and if these practices and knowledge were associated with a lower prevalence of mastitis. A total of 202 households from Eastern and Western Chitwan District were included in the study. Of these, 60 households had participated in the project and 142 had not. Milk samples were collected from 129 households (33 project households and 96 non-project households). Clinical mastitis was determined using visual inspection of udders and detection of macroscopic clots and flakes in milk. The California Mastitis Test was used to diagnose sub-clinical mastitis from milk samples, and the IDEXX SNAP test to identify the presence of tetracycline residues. The prevalence of mastitis in trained households (39.4%) was 43.78% of that in untrained households (60.4%), lower but not significantly so (p=0.08, 95% CI 0.17-1.12). Thirteen indicators of knowledge or practice for the control or prevention of mastitis were more likely to occur in trained households, four significantly so (not consuming milk from sick buffalo (p=0.001), using soap to wash hands before milking (p=0.001), discarding milk after antibiotic usage (p=0.01), and choosing appropriate flooring for their livestock (p=0.03)). Trained households that discarded milk from sick buffalo were 2.96 times more likely to have at least one animal with mastitis in the household (p=0.03, 95% CI 1.15-7.65). Trained households that knew to wash buffalos' teats after milking were less likely (OR 0.25) to have mastitis in their herd (p=0.02, 95% CI 0.08-0.80). Of the 138 buffalos tested, only one tested

  1. Impact of Heat Stress on Cellular and Transcriptional Adaptation of Mammary Epithelial Cells in Riverine Buffalo (Bubalus Bubalis)

    PubMed Central

    Kapila, Neha; Sharma, Ankita; Kishore, Amit; Sodhi, Monika; Tripathi, Pawan K.; Mohanty, Ashok K.

    2016-01-01

    The present study aims to identify the heat responsive genes and biological pathways in heat stressed buffalo mammary epithelial cells (MECs). The primary mammary epithelial cells of riverine buffalo were exposed to thermal stress at 42°C for one hour. The cells were subsequently allowed to recover at 37°C and harvested at different time intervals (30 min to 48 h) along with control samples (un-stressed). In order to assess the impact of heat stress in buffalo MECs, several in-vitro cellular parameters (lactate dehydrogenase activity, cell proliferation assay, cellular viability, cell death and apoptosis) and transcriptional studies were conducted. The heat stress resulted in overall decrease in cell viability and cell proliferation of MECs while induction of cellular apoptosis and necrosis. The transcriptomic profile of heat stressed MECs was generated using Agilent 44 K bovine oligonucleotide array and at cutoff criteria of ≥3-or ≤3 fold change, a total of 153 genes were observed to be upregulated while 8 genes were down regulated across all time points post heat stress. The genes that were specifically up-regulated or down-regulated were identified as heat responsive genes. The upregulated genes in heat stressed MECs belonged to heat shock family viz., HSPA6, HSPB8, DNAJB2, HSPA1A. Along with HSPs, genes like BOLA, MRPL55, PFKFB3, PSMC2, ENDODD1, ARID5A, and SENP3 were also upregulated. Microarray data revealed that the heat responsive genes belonged to different functional classes viz., chaperons; immune responsive; cell proliferation and metabolism related. Gene ontology analysis revealed enrichment of several biological processes like; cellular process, metabolic process, response to stimulus, biological regulation, immune system processes and signaling. The transcriptome analysis data was further validated by RT-qPCR studies. Several HSP (HSP40, HSP60, HSP70, HSP90, and HSPB1), apoptotic (Bax and Bcl2), immune (IL6, TNFα and NF-kβ) and oxidative

  2. Metagenomic analysis of virulence-associated and antibiotic resistance genes of microbes in rumen of Indian buffalo (Bubalus bubalis).

    PubMed

    Singh, K M; Jakhesara, S J; Koringa, P G; Rank, D N; Joshi, C G

    2012-10-10

    A major research goal in rumen microbial ecology is to understand the relationship between community composition and its function, particularly involved in fermentation process is of a potential interest. The buffalo rumen microbiota impacts human food safety as well as animal health. Although the bacteria of bovine rumen have been well characterized, techniques have been lacking to correlate total community structure with gene function. We applied 454 next generations sequencing technology to characterize general microbial diversity present in buffalo rumen metagenome and also identified the repertoire of microbial genes present, including genes associated with antibiotic resistance and bacterial virulence. Results suggest that over six percent (6.44%) of the sequences from our buffalo rumen pool sample could be categorized as virulence genes and genes associated with resistance to antibiotic and toxic compounds (RATC), which is a higher proportion of virulence genes reported from metagenome samples of chicken cecum (5.39%), cow rumen (4.43%) and Sargasso sea (2.95%). However, it was lower than the proportion found in cow milk (11.33%) cattle faeces (8.4%), Antarctic marine derived lake (8.45%), human fecal (7.7%) and farm soil (7.79%). The dynamic nature of metagenomic data, together with the large number of RATC classes observed in samples from widely different ecologies indicates that metagenomic data can be used to track potential targets and relative amounts of antibiotic resistance genes in individual animals. In addition, these data can be also used to generate antibiotic resistance gene profiles to facilitate an understanding of the ecology of the microbial communities in each habitat as well as the epidemiology of antibiotic resistant gene transport between and among habitats.

  3. Evaluation of Analgesic Effect of Caudal Epidural Tramadol, Tramadol-Lidocaine, and Lidocaine in Water Buffalo Calves (Bubalus bubalis)

    PubMed Central

    Atiba, Ayman; Ghazy, Alaa; Gomaa, Naglaa; Kamal, Tarek; Shukry, Mustafa

    2015-01-01

    Aim of this study was to compare the analgesic effect of tramadol and a combination of tramadol-lidocaine with that produced by lidocaine administration in the epidural space in buffalo calves. In a prospective randomized crossover study, ten male buffalo calves were used to compare the epidural analgesic effect of tramadol (1 mg/kg) and tramadol-lidocaine combination (0.5 mg/kg and 0.11 mg/kg, resp.) with that produced by 2% lidocaine (0.22 mg/kg). Loss of sensation was examined by pin-prick test. Onset time, duration, and degree of analgesia and ataxia were recorded after each treatment. Heart rate (HR), respiratory rate (RR), rectal temperature, and haematobiochemical parameters were recorded after all treatments. Time to onset and duration of analgesia, respectively, were as follows: tramadol 11 ± 2 min and 208 ± 15 min; tramadol-lidocaine 6 ± 2 min and 168 ± 9 min; lidocaine 4 ± 1 min and 67 ± 13 min. Onset time and duration were significantly longer with tramadol than the other treatments. Duration was significantly longer with tramadol-lidocaine than lidocaine. Ataxia was mildly observed in tramadol-lidocaine and was moderate in lidocaine. HR, RR, and rectal temperature did not differ significantly from baseline after any treatment. Haematobiochemical parameters returned to basal levels by 24 h after all treatments. This combination might be clinically useful to provide analgesia in buffalo for long-duration surgical procedures. PMID:26770870

  4. Metagenomic analysis of virulence-associated and antibiotic resistance genes of microbes in rumen of Indian buffalo (Bubalus bubalis).

    PubMed

    Singh, K M; Jakhesara, S J; Koringa, P G; Rank, D N; Joshi, C G

    2012-10-10

    A major research goal in rumen microbial ecology is to understand the relationship between community composition and its function, particularly involved in fermentation process is of a potential interest. The buffalo rumen microbiota impacts human food safety as well as animal health. Although the bacteria of bovine rumen have been well characterized, techniques have been lacking to correlate total community structure with gene function. We applied 454 next generations sequencing technology to characterize general microbial diversity present in buffalo rumen metagenome and also identified the repertoire of microbial genes present, including genes associated with antibiotic resistance and bacterial virulence. Results suggest that over six percent (6.44%) of the sequences from our buffalo rumen pool sample could be categorized as virulence genes and genes associated with resistance to antibiotic and toxic compounds (RATC), which is a higher proportion of virulence genes reported from metagenome samples of chicken cecum (5.39%), cow rumen (4.43%) and Sargasso sea (2.95%). However, it was lower than the proportion found in cow milk (11.33%) cattle faeces (8.4%), Antarctic marine derived lake (8.45%), human fecal (7.7%) and farm soil (7.79%). The dynamic nature of metagenomic data, together with the large number of RATC classes observed in samples from widely different ecologies indicates that metagenomic data can be used to track potential targets and relative amounts of antibiotic resistance genes in individual animals. In addition, these data can be also used to generate antibiotic resistance gene profiles to facilitate an understanding of the ecology of the microbial communities in each habitat as well as the epidemiology of antibiotic resistant gene transport between and among habitats. PMID:22850272

  5. Changes in plasma growth hormone (GH) and secretion patterns of GH and luteinizing hormone in buffaloes (Bubalus bubalis) during growth.

    PubMed

    Mondal, Mohan; Prakash, B S

    2004-08-01

    To assess the changes of plasma growth hormone (GH) and secretion patterns of GH and luteinizing hormone (LH) during growth in buffaloes, six growing female Murrah buffalo calves (mean age 6+/-0.9 months and body weight 66+/-6 kg) were selected. Plasma samples were collected twice a week for 52 weeks for GH and LH assay. To examine for pulsatile secretion samples were collected at 15 minutes interval for 9 hr at weeks 6 and 42 for GH and LH measurements. Plasma progesterone was also estimated in twice-a-week samples to assess whether any of the buffalo had begun ovarian cyclicity. The body weight of all animals was recorded at weekly interval. Plasma GH concentration decreased (P < 0.01) only up to week 29 and showed an increasing trend (P < 0.01) thereafter. The ratio of plasma GH to body weight declined (P < 0.01) throughout the entire experimental period. Plasma GH showed a declining trend only up to when the animals attained 155 kg body weight and thereafter showed an increasing trend (P < 0.01). Plasma GH revealed distinct pulsatile patterns of release, with a mean of 6 and 5 pulses in the 6-week and 42-week samples, respectively. The plasma LH concentrations around the 42-week time period were significantly higher (P < 0.01) than at the 6-week time period, and they exhibited pulsatility. No animal reached puberty until the end of the experiment. In summary, plasma GH levels have a definite pattern of change during growth and patterns of secretion of plasma GH and LH also have a relation with body weight in this species of animal. PMID:15554346

  6. Proteomic profiles of the embryonic chorioamnion and uterine caruncles in buffaloes (Bubalus bubalis) with normal and retarded embryonic development.

    PubMed

    Balestrieri, Maria Luisa; Gasparrini, Bianca; Neglia, Gianluca; Vecchio, Domenico; Strazzullo, Maria; Giovane, Alfonso; Servillo, Luigi; Zicarelli, Luigi; D'Occhio, Michael J; Campanile, Giuseppe

    2013-05-01

    The aim of this study was to compare the proteome profiles of the chorioamnion and corresponding caruncle for buffalo embryos that had either normal or retarded development on Day 25 after artificial insemination (AI). In experiment 1, embryos that were to subsequently undergo late embryonic mortality had a smaller width on Day 25 after AI than embryos associated with pregnancy on Day 45 after AI. In experiment 2, 25 Italian Mediterranean buffaloes underwent transrectal ultrasonography on Day 25 after AI, and pregnant animals were categorized as one of two groups based on embryonic width: normal embryos (embryonic width > 2.7 mm) and retarded embryos (embryonic width < 2.7 mm). Three buffaloes of each group were slaughtered on Day 27 after AI to collect chorioamnion and caruncle tissues for subsequent proteomic analyses. Two-dimensional difference gel electrophoresis (2D-DIGE) and matrix-assisted laser desorption/ionization-time-of-flight/time-of-flight mass spectrometer analysis were used to ascertain the proteomic profiles. To confirm 2D-DIGE-results, three selected proteins were analyzed by Western blot. The proteomic profiles of the chorioamnion of retarded embryos and the corresponding caruncles showed differences in the expression of several proteins compared to normal embryos. In particular, a down-regulation was observed for proteins involved in protein folding (HSP 90-alpha, calreticulin), calcium binding (annexin A1, annexin A2), and coagulation (fibrinogen alpha-chain) (P < 0.05), whereas proteins involved in protease inhibition (alpha-1-antiproteinase, serpin H1, serpin A3-8), DNA and RNA binding (heterogeneous nuclear ribonucleoproteins A2/B1 and K), chromosome segregation (serine/threonine-protein phosphatase 2A), cytoskeletal organization (ezrin), cell redox homeostasis (amine oxidase-A), and hemoglobin binding (haptoglobin) were up-regulated (P < 0.05). PMID:23575152

  7. Is one-wave follicular growth during the estrous cycle a usual phenomenon in water buffaloes (Bubalus bubalis)?

    PubMed

    Awasthi, M K; Khare, Abhishek; Kavani, F S; Siddiquee, G M; Panchal, M T; Shah, R R

    2006-05-01

    The pattern of growth and regression of ovarian follicles was monitored once daily for one complete estrous cycle in eight individual water buffaloes by ultrasonographic scanning of the ovaries for an entire interovulatory interval of normal cycle length. One-wave follicular growth was observed in five animals and two-wave follicular growth in three buffaloes during the estrous cycle. The first follicular wave of a two-wave cycle emerged significantly earlier (P < 0.05) than the emergence of the solitary wave of a one-wave cycle. One- and two-wave cycles differed significantly (P < 0.05) with respect to the mean interovulatory interval (21.0 +/- 0.54 days versus 22.7 +/- 0.33 days) and the mean interestrus interval (20.8 +/- 0.58 days versus 22.3 +/- 0.66 days). The overall linear growth rate of the ovulatory follicle was significantly greater (P < 0.01) in a two-wave cycle compared to that of a one-wave cycle (1.17 +/- 0.33 mm/day versus 0.32 +/- 0.01 mm/day). In a one-wave pattern, the growth profile of the solitary dominant follicle was atypical, showing three distinct phases, i.e. growth phase, regression phase and regrowth phase culminating in ovulation. The level of plasma progesterone steadily increased from day 0 of estrous cycle, attained peak level on day 14 and declined thereafter. A slower growth rate of the dominant follicle was observed in the presence of higher plasma progesterone concentration. The present study shows that one-wave follicular growth is a normal phenomenon in suckled water buffaloes.

  8. Genetic diversity of Asian water buffalo (Bubalus bubalis): microsatellite variation and a comparison with protein-coding loci.

    PubMed

    Barker, J S; Moore, S S; Hetzel, D J; Evans, D; Tan, S G; Byrne, K

    1997-04-01

    Twenty-one microsatellite loci in 11 populations of Asian water buffalo (eight swamp, three river type) were analysed and, within and among populations, genetic variability was compared with results from 25 polymorphic protein-coding loci. Within-population mean heterozygosity ranged from 0.380-0.615, approximately twice that estimated from the protein-coding loci (0.184-0.346). Only eight significant departures from Hardy-Weinberg equilibrium (involving four loci) were detected; global tests showed significant heterozygote deficiencies for these four loci. Non-amplifying alleles are likely to be segregating in some or all populations for one of these loci, and probably for the other three. There was significant differentiation between the swamp and river types of water buffalo, and among populations within each buffalo type. Estimates of theta (measure of population differentiation) for each locus for the eight swamp populations were all highly significant (mean theta = 0.168 +/- 0.018). Mean theta for protein-coding loci was not significantly different (0.182 +/- 0.041). The variance among protein-coding loci was significantly higher than among microsatellite loci, suggesting balancing selection affecting allele frequencies at some protein-coding loci. Genetic distances show clear separation of the swamp and river types, which were estimated to have diverged at least 10,000-15,000 years ago. The topology of the swamp populations' microsatellite tree is consistent with their geographical distribution and their presumed spread through south-east Asia. By contrast, the tree based on the protein-coding loci distances is quite different, being clearly distorted by a bottleneck effect in one population, and possibly in at least two others. As many domestic livestock breeds are possibly descended from small numbers of founders, microsatellite-based trees are to be preferred in assessing breed genetic relationships.

  9. Evaluation of Analgesic Effect of Caudal Epidural Tramadol, Tramadol-Lidocaine, and Lidocaine in Water Buffalo Calves (Bubalus bubalis).

    PubMed

    Atiba, Ayman; Ghazy, Alaa; Gomaa, Naglaa; Kamal, Tarek; Shukry, Mustafa

    2015-01-01

    Aim of this study was to compare the analgesic effect of tramadol and a combination of tramadol-lidocaine with that produced by lidocaine administration in the epidural space in buffalo calves. In a prospective randomized crossover study, ten male buffalo calves were used to compare the epidural analgesic effect of tramadol (1 mg/kg) and tramadol-lidocaine combination (0.5 mg/kg and 0.11 mg/kg, resp.) with that produced by 2% lidocaine (0.22 mg/kg). Loss of sensation was examined by pin-prick test. Onset time, duration, and degree of analgesia and ataxia were recorded after each treatment. Heart rate (HR), respiratory rate (RR), rectal temperature, and haematobiochemical parameters were recorded after all treatments. Time to onset and duration of analgesia, respectively, were as follows: tramadol 11 ± 2 min and 208 ± 15 min; tramadol-lidocaine 6 ± 2 min and 168 ± 9 min; lidocaine 4 ± 1 min and 67 ± 13 min. Onset time and duration were significantly longer with tramadol than the other treatments. Duration was significantly longer with tramadol-lidocaine than lidocaine. Ataxia was mildly observed in tramadol-lidocaine and was moderate in lidocaine. HR, RR, and rectal temperature did not differ significantly from baseline after any treatment. Haematobiochemical parameters returned to basal levels by 24 h after all treatments. This combination might be clinically useful to provide analgesia in buffalo for long-duration surgical procedures.

  10. Effects of xylazine, lignocaine and their combination for lumber epidural analgesia in water buffalo calves (Bubalus bubalis).

    PubMed

    Singh, P; Pratap, K; Amarpal; Kinjavdekar, P; Aithal, H P; Singh, G R

    2005-09-01

    The study was conducted to evaluate the effects of xylazine alone (0.05 mg/kg), lignocaine alone (2.0 mg/kg) and a combination of xylazine and lignocaine (0.05 mg/kg and 2.0 mg/kg, respectively) after lumbar epidural administration in water buffalo calves. Fifteen nondescript, male water buffalo calves of 6-8 months of age and weighing between 55 and 75 kg were randomly placed in 3 groups (A, B and C). The agents were administered at the 1st lumbar epidural space. Clinico-physiological parameters such as analgesia, ataxia, sedation, salivation, heart rate, respiratory rate and rectal temperature were studied. Other haematological and biochemical parameters monitored were haemoglobin, packed cell volume, total leukocyte count, plasma glucose, cortisol, protein albumin, globulin, blood urea nitrogen, creatinine, ALT, sodium, potassium and chloride. The onset of analgesia was faster in group C (3.0 +/- 0.44 min) compared with that of group B (4.4 +/- 0.40 min) and group A (34.0 +/- 1.86 min). Analgesia of the thorax, flank, inguinal region, hind limbs, perineum and tail was complete in group C, but mild to moderate in groups A and B. Ataxia was severe in groups B and C and mild in group A. Mild to deep sedation were produced by groups A and C animals. Longer duration and greater depth of analgesia was produced in animals in group C. Heart rate, respiratory rate and rectal temperature decreased in groups A and C. The haematological parameters decreased in all the groups. The biochemical parameters like glucose, cortisol, blood urea nitrogen, creatinine, ALT increased in all the animals. However, total proteins and albumin decreased in the 3 groups. The plasma electrolytes sodium, potassium and chloride did not show any significant change. The results of this study indicated a possible additive analgesic interaction between epidurally administered xylazine and lignocaine, without causing any marked systemic effects in water buffalo calves.

  11. Evaluation of Analgesic Effect of Caudal Epidural Tramadol, Tramadol-Lidocaine, and Lidocaine in Water Buffalo Calves (Bubalus bubalis).

    PubMed

    Atiba, Ayman; Ghazy, Alaa; Gomaa, Naglaa; Kamal, Tarek; Shukry, Mustafa

    2015-01-01

    Aim of this study was to compare the analgesic effect of tramadol and a combination of tramadol-lidocaine with that produced by lidocaine administration in the epidural space in buffalo calves. In a prospective randomized crossover study, ten male buffalo calves were used to compare the epidural analgesic effect of tramadol (1 mg/kg) and tramadol-lidocaine combination (0.5 mg/kg and 0.11 mg/kg, resp.) with that produced by 2% lidocaine (0.22 mg/kg). Loss of sensation was examined by pin-prick test. Onset time, duration, and degree of analgesia and ataxia were recorded after each treatment. Heart rate (HR), respiratory rate (RR), rectal temperature, and haematobiochemical parameters were recorded after all treatments. Time to onset and duration of analgesia, respectively, were as follows: tramadol 11 ± 2 min and 208 ± 15 min; tramadol-lidocaine 6 ± 2 min and 168 ± 9 min; lidocaine 4 ± 1 min and 67 ± 13 min. Onset time and duration were significantly longer with tramadol than the other treatments. Duration was significantly longer with tramadol-lidocaine than lidocaine. Ataxia was mildly observed in tramadol-lidocaine and was moderate in lidocaine. HR, RR, and rectal temperature did not differ significantly from baseline after any treatment. Haematobiochemical parameters returned to basal levels by 24 h after all treatments. This combination might be clinically useful to provide analgesia in buffalo for long-duration surgical procedures. PMID:26770870

  12. Clinicophysiological and haemodynamic effects of fentanyl with xylazine, medetomidine and dexmedetomidine in isoflurane-anaesthetised water buffaloes (Bubalus bubalis).

    PubMed

    Singh, Gyan D; Kinjavdekar, Prakash; Amarpal; Aithal, Hari P; Pawde, Abhijeet M; Zama, Malik M S; Singh, Jasmeet; Tiwary, Ramesh

    2013-03-18

    The present study was undertaken to investigate the sedative, analgesic and clinical effects of xylazine, medetomidine and dexmedetomidine with fentanyl as pre-anaesthetics in water buffaloes and to compare the dose-sparing effect of xylazine, medetomidine and dexmedetomidine on thiopental for induction and isoflurane for maintenance of anaesthesia in water buffaloes. Six male water buffaloes randomly received intravenous fentanyl (5.0 µg/kg body weight) and xylazine (0.05 mg/kg body weight), fentanyl (5.0 µg/kg body weight) and medetomidine (2.5 µg/kg body weight), fentanyl (5.0 µg/kg body weight) and dexmedetomidine (5.0 µg/kg body weight) at weekly intervals in groups I1, I2 and I3, respectively. After 15 min, the animals were restrained in right lateral recumbency and anaesthesia was induced by 5% thiopental sodium administered intravenously. The intubated animal was connected to the large animal anaesthesia machine and isoflurane in 100% oxygen (5 L/min) was insufflated for 60 min. The treatments were compared by clinicophysiological, haematobiochemical and haemodynamic parameters. Fentanyl-medetomidine and fentanyl-dexmedetomidine produced more cardiovascular depression during the pre-anaesthetic period but less depression of cardio-respiratory dynamics in the post induction and maintenance period. Quicker recovery was recorded in I2 and I3 groups. A lower dose of thiopental was required in group I3 (4.33 mg/kg ± 0.66 mg/kg) than in groups I2 (4.41 mg/kg ± 0.98 mg/kg) and I1 (4.83 mg/kg ± 0.79 mg/kg). The dose of isoflurane was less in group I3 (45.50 mL ± 5.45 mL) than in group I1 and I2 (48.66 mL ± 5.10 mL and 48.00 mL ± 6.38 mL). Better anaesthesia was recorded with fentanyl-dexmedetomidine-thiopental-isoflurane (group I3) than with fentanyl-medetomidine-thiopental-isoflurane (group I2) and fentanyl-xylazine-thiopental-isoflurane (group I1). Fentanyl-medetomidine and fentanyl-dexmedetomidine were better pre-anaesthetic agents in comparison to

  13. Effect of additional chromium supplementation on health status, metabolic responses, and performance traits in periparturient Murrah Buffaloes (Bubalus bubalis).

    PubMed

    Deka, Rijusmita Sarma; Mani, Veena; Kumar, Muneendra; Zade, Shiwajirao Satish; Upadhaya, Ramesh Chand; Kaur, Harjit

    2015-02-01

    This study was conducted to determine the effects of inorganic chromium (Cr) on body condition, metabolic responses, lactation performance, and reproductive parameters in periparturient Murrah buffaloes. Twenty-four multiparous advanced pregnant Murrah buffaloes were randomly assigned to four treatment diets. Feeding regimen was the same in all the groups, except that the animals in the four respective groups were additionally supplemented with 0.0, 0.5, 1.0, and 1.5 mg of Cr/kg dry matter (DM) from day 60 prepartum to 150 days postpartum. Dry matter intake (DMI) and milk production were recorded every day, while body condition score (BCS) and whole blood samples were collected at days -60, -45, -30, -15, -7, -3, 0, 3, 7, 15, 30, 45, 60, 90, 120, and 150 relative to actual calving. As the days to calving advanced, DMI, plasma glucose, insulin, leptin, and Cr levels decreased (P < 0.05), and the levels were minimum on the day of calving. In contrast, the concentration of nonesterified fatty acid (NEFA) increased (P < 0.05) and was found to be highest at parturition. No change in DMI as well as BCS was observed due to dietary treatments. Supplementation of Cr improved plasma concentration of glucose, leptin, and Cr levels. However, the concentration of insulin decreased (P < 0.05) with the increased level of supplemental Cr. Milk yield (kg/day) was improved significantly (P < 0.05) in groups supplemented with 1.0 or 1.5 mg Cr/DM; however, only a small change was recorded in the group fed 0.5 mg Cr/kg DM. Fat-corrected milk and energy-corrected milk were 28.78 and 42.32 % and 28.76 and 41.68 % higher in the 1.0 and 1.5 mg Cr/DM groups, respectively. Dietary Cr supplementation during the peripartum period had beneficial effects on the reproductive performance of buffaloes. These results could be interpreted as an improvement in the body condition, metabolic response, milk yield, efficiency of milk production and nutrient utilization, and

  14. Microbial population in the rumen of swamp buffalo (Bubalus bubalis) as influenced by coconut oil and mangosteen peel supplementation.

    PubMed

    Pilajun, R; Wanapat, M

    2013-06-01

    Four, rumen fistulated swamp buffalo bulls were used to study microbial populations in the rumen when supplemented with coconut oil and mangosteen peel. Animals were randomly assigned to a 4 × 4 Latin square design. Four treatments were un-supplemented (Control), supplementation with coconut oil at 50 g/kg (CO5), supplementation with mangosteen peel at 30 g/kg (MP3) and supplementation with CO5 and MP3 (COM), of total DM intake. Animals received concentrate at 10 g/kg of BW, and rice straw was given ad libitum. Abundance of total bacteria was increased by CO5 supplementation, whereas populations of protozoa and Fibrobacter succinogenes were reduced by CO5 and COM supplementation. Dietary supplementation did not affect methanogen, Ruminococcus flavefaciens or Ruminococcus albus abundances. Dietary treatments changed denaturing gradient gel electrophoresis (DGGE) band patterns of methanogens and protozoa when compared with the control group, especially when supplemented with MP3. Supplementation of COM resulted in the greatest difference in pattern of DGGE bands for total bacteria compared with the control. Coconut oil and mangosteen peel supplementation resulted in changing of rumen microbial abundances and communities; however, combination of them could be more benefit to improve rumen fermentation of swamp buffalo fed on rice straw.

  15. Equivalency of buffalo (Bubalus bubalis) embryonic stem cells derived from fertilized, parthenogenetic, and hand-made cloned embryos.

    PubMed

    Muzaffar, Musharifa; Selokar, Naresh L; Singh, Karn P; Zandi, Mohammad; Singh, Manoj K; Shah, Riaz A; Chauhan, Manmohan S; Singla, Suresh K; Palta, Prabhat; Manik, Radheysham

    2012-06-01

    This study was aimed at establishing buffalo embryonic stem cells (ESCs) from in vitro fertilized (IVF), parthenogenetic, and hand-made cloned (HMC) embryos and to check their equivalency in terms of stem cell marker expression, longevity, proliferation, and differentiation pattern. ESCs derived from all three sources were found by immunofluorescence to express the pluripotency markers SSEA-4, TRA-1-60, TRA-1-81, OCT4, and SOX2 and were able to form embryoid bodies containing cells expressing genes specific to endoderm (AFP, HNF4, and GATA4), mesoderm (MSX1, BMP4, and ASA), and ectoderm (cytokeratin 8 and NF68). Reverse transcriptase PCR (RT-PCR) showed cells from all sources to be positive for pluripotency markers OCT4, SOX2, NANOG, STAT3, REX1, FOXD3, NUCLEOSTEMIN, and TELOMERASE. Pluripotency markers OCT4, SOX2, NANOG, and c-MYC were also analyzed by real-time PCR. No significant differences were observed among ESCs from all three sources for all these genes except NANOG, whose expression was higher (p<0.05) in HMC-derived ESCs (6.897±2.3) compared to that in parthenogenesis- and IVF-derived cells (1.603±0.315 and 1±0, respectively). Pluripotent, stable buffalo ESC lines derived from IVF, parthenogenesis, and HMC embryos may be genetically manipulated to provide a powerful tool for studies involving embryonic development, genomic imprinting, gene targeting, cloning, chimera formation, and transgenic animal production.

  16. Butylated hydroxytoluene inclusion in semen extender improves the post-thawed semen quality of Nili-Ravi buffalo (Bubalus bubalis).

    PubMed

    Ijaz, A; Hussain, A; Aleem, M; Yousaf, M S; Rehman, H

    2009-05-01

    The study was carried out to evaluate the potential impact of butylated hydroxytoluene (BHT) on the frozen-thawed semen quality of Nili-Ravi buffalo bulls. Ejaculated bull semen was extended in a Tris-citrate egg yolk extender containing various concentrations of BHT (0.5, 1.0, 2.0 and 3.0mM). Semen was frozen at -196 degrees C using 50 x 10(6) spermatozoa per 0.5 mL straws. Five straws from each treatment were thawed to assess the semen quality in terms of sperm motility, viability, plasma membrane integrity and acrosomal integrity. Post-thawed sperm motility was determined using a phase-contrast microscope. Viability, plasma membrane integrity and acrosomal integrity were evaluated by the supravital staining, hypo-osmotic swelling test and normal acrosomal reaction, respectively. The highest (P<0.05) motility, acrosomal integrity and hypo-osmotic swelling response of spermatozoa was achieved by addition of 1.0 and 2.0mM BHT to semen extender. However, highest (P<0.05) viability of spermatozoa was achieved by inclusion of 2.0mM BHT. The higher concentration of BHT (3.0mM) reduced the motility, acrosomal integrity, viability and hypo-osmotic swelling response of the spermatozoa compared to other concentration used. In conclusion, BHT when added in the semen extender can improve the semen quality of buffalo bulls.

  17. Effects of milk feeding, frequency and concentration on weaning and buffalo (Bubalus bubalis) calf growth, health and behaviour.

    PubMed

    Vecchio, Domenico; Di Palo, Rossella; De Carlo, Esterina; Esposito, Luigi; Presicce, Giorgio Antonio; Martucciello, Alessandra; Chiosi, Emilio; Rossi, Pasquale; Neglia, Gianluca; Campanile, Giuseppe

    2013-11-01

    Growth, weight at birth and daily weight gain (DWG) on 12 water buffalo calves, starting from 6 days of age until completion of weaning, was investigated in this study. Different feeding regimens were given to two groups of animals with regard to daily milk replacer: (1) group 1 (G1) received a double concentration in single administration; whereas (2) group 2 (G2) received the same amount of milk replacer split twice daily. Blood samples were collected from each calf on days 6, 30, 60 and 90 to evaluate acute phase proteins (haptoglobin), bactericide activity, lysozime, total protein content and biochemical parameters. No differences were observed between the two groups in terms of dry matter intake, feed efficiency and live body weight at the end of the study. Interestingly, a significantly (P < 0.05) reduced DWG was observed earlier in G1 (day 45) than in G2 (day 60). Gastrointestinal disorders were not recorded throughout the experimental period, and no significant differences were recorded between the two groups for all considered parameters. This study confirms the possibility of utilising one daily administration of milk replacer in water buffalo calf during weaning. This new approach facilitates calves management, without interfering with calves growing performances. PMID:23712396

  18. Effects of milk feeding, frequency and concentration on weaning and buffalo (Bubalus bubalis) calf growth, health and behaviour.

    PubMed

    Vecchio, Domenico; Di Palo, Rossella; De Carlo, Esterina; Esposito, Luigi; Presicce, Giorgio Antonio; Martucciello, Alessandra; Chiosi, Emilio; Rossi, Pasquale; Neglia, Gianluca; Campanile, Giuseppe

    2013-11-01

    Growth, weight at birth and daily weight gain (DWG) on 12 water buffalo calves, starting from 6 days of age until completion of weaning, was investigated in this study. Different feeding regimens were given to two groups of animals with regard to daily milk replacer: (1) group 1 (G1) received a double concentration in single administration; whereas (2) group 2 (G2) received the same amount of milk replacer split twice daily. Blood samples were collected from each calf on days 6, 30, 60 and 90 to evaluate acute phase proteins (haptoglobin), bactericide activity, lysozime, total protein content and biochemical parameters. No differences were observed between the two groups in terms of dry matter intake, feed efficiency and live body weight at the end of the study. Interestingly, a significantly (P < 0.05) reduced DWG was observed earlier in G1 (day 45) than in G2 (day 60). Gastrointestinal disorders were not recorded throughout the experimental period, and no significant differences were recorded between the two groups for all considered parameters. This study confirms the possibility of utilising one daily administration of milk replacer in water buffalo calf during weaning. This new approach facilitates calves management, without interfering with calves growing performances.

  19. Nutrient utilisation, growth performance and blood metabolites in Murrah buffalo calves (Bubalus bubalis) divergently selected for residual feed intake.

    PubMed

    Sharma, Vijay K; Kundu, Shivlal S; Prusty, Sonali; Datt, Chander; Kumar, Muneendra

    2016-12-01

    The aim of this study was to evaluate differences in efficiency of feed utilisation between buffalo calves with low and high residual feed intake (RFI) by comparing feed intake, nutrient digestibility, growth traits and blood metabolites. Eighteen male Murrah buffalo calves (aged 4-6 months; 70 ± 1.0 kg body weight) were fed ad libitum with a total mixed ration for 120 d. Based on linear regression models involving dry matter intake (DMI), average daily gain (ADG) and mid-test metabolic body size, calves were assigned into low and high RFI groups. The RFI varied from -0.33 to +0.28 kg DM/d with an average RFI of -0.14 and 0.14 kg DM/d in low and high RFI calves, respectively. Calves had a mean DMI of 1.9 and 2.4 kg/d and an ADG of 0.5 and 0.6 kg/d in low and high RFI groups, respectively. Low RFI calves ate 19.0% less DM each day and required significantly less metabolisable energy for maintenance compared with high RFI calves (12.5 vs. 16.7 MJ/d). Nutrient digestibility and nitrogen balance did not differ among low and high RFI calves. In more efficient animals (low RFI calves) higher (p < 0.05) plasma level of growth hormone, insulin-like growth factor-1 (IGF-1), triiodothyronine (T3) and lower concentration of thyroxin hormone were detected. No significant differences in levels of insulin, hydroxyproline, plasma and urine creatinine, total protein and albumin between high and low RFI groups were found. Blood metabolites showed significant (p < 0.05) differences at initial and final stages of study in both groups. At final stage of study, RFI showed negative correlations with growth hormone, IGF-1, T3, urine creatinine and albumin. Low RFI buffalo calves are more efficient in feed utilisation and the differences in blood metabolites are probably due to differences in feed intake and body metabolism. PMID:27666680

  20. Buffalo (Bubalus bubalis) epiphyseal proteins counteract arsenic-induced oxidative stress in brain, heart, and liver of female rats.

    PubMed

    Bharti, Vijay K; Srivastava, R S; Sharma, B; Malik, J K

    2012-05-01

    Arsenic (As) toxicity through induction of oxidative stress is a well-known mechanism of organ toxicity. To address this problem, buffalo epiphyseal proteins (BEP, at 100 μg/kg BW, i.p. for 28 days) were administered intraperitoneally to female Wistar rats exposed to As (100 ppm sodium arsenite via drinking water for 28 days). Arsenic exposure resulted in marked elevation in lipid peroxidation in brain, cardiac, and hepatic tissues, whereas significant (p < 0.05) adverse change in catalase, superoxide dismutase, glutathione reductase, glutathione peroxidase, and reduced glutathione level were observed in cardiac, hepatic, and brain tissues of As-administered animals. BEP significantly (p < 0.05) counteracted all the adverse changes in antioxidant defense system brought about by As administration. Based on these results, we consider BEP as a potent antioxidant to be used for protection from arsenic-induced oxidative stress related damage of vital organs.

  1. Protective effect of the Nramp1 BB genotype against Brucella abortus in the water buffalo (Bubalus bubalis).

    PubMed

    Capparelli, Rosanna; Alfano, Flora; Amoroso, Maria Grazia; Borriello, Giorgia; Fenizia, Domenico; Bianco, Antonio; Roperto, Sante; Roperto, Franco; Iannelli, Domenico

    2007-02-01

    We tested 413 water buffalo cows (142 cases and 271 controls) for the presence of anti-Brucella abortus antibodies (by the skin test, the agglutination test, and the complement fixation test) and the Nramp1 genotype (by capillary electrophoresis). Four alleles (Nramp1A, -B, -C, and -D) were detected in the 3' untranslated region of the Nramp1 gene. The BB genotype was represented among only controls, providing evidence that this genotype confers resistance to Brucella abortus. The monocytes from the BB (resistant) subjects displayed a higher basal level of Nramp1 mRNA and a lower number of viable intracellular bacteria than did the monocytes from AA (susceptible) subjects. The higher basal level of the antibacterial protein Nramp1 most probably provides the BB animals with the possibility of controlling bacteria immediately after their entry inside the cell.

  2. Molecular characterization of interferon regulatory factor 1 in Bubalus bubalis.

    PubMed

    Stafuzza, N B; Borges, M M; Amaral-Trusty, M E J

    2015-01-01

    Interferon regulatory factor 1 (IRF1) is functionally diverse in the regulation of immune response and is considered to be an important candidate gene for studying disease susceptibility in mammals. In this paper, we characterized the whole sequence of the IRF1 gene in river buffalo (Bubalus bubalis) and compared genomic and the amino acid sequences between different species. The buffalo IRF1 gene was 7099 bp long and organized into 10 exons and nine introns. Its molecular structure showed exactly the same number of exons (10) and introns (nine) in bovids, mice, horses, humans, and chickens. However, rats did not have exon 5, but had the largest exon 4, which suggests that exon 5 was incorporated into exon 4. The coding and the amino acid sequences of the gene showed that identity varied from 73 to 99% at the coding sequence level and from 61 to 100% at the amino acid level when compared with other mammals and chickens. Comparative analysis of the gene sequence between two different buffalo breeds, Murrah and Mediterranean, revealed six potential SNPs that are primarily located in the 5' and 3'UTRs. PMID:26400319

  3. Involvement of the nervous system following experimental infection with Pasteurella multocida B:2 in buffalo (Bubalus bubalis): A clinicopathological study.

    PubMed

    Marza, Ali Dhiaa; Jesse, Faez Firdaus Abdullah; Ahmed, Ihsan Muneer; Chung, Eric Lim Teik; Ibrahim, Hayder Hamzah; Zamri-Saad, Mohd; Omar, Abdul Rahman; Abu Bakar, Md Zuki; Saharee, Abdul Aziz; Haron, Abdul Wahid; Alwan, Mohammed Jwaid; Lila, Mohd Azmi Mohd

    2016-04-01

    Haemorrhagic septicaemia (HS) is an acute, fatal, septicaemic disease of cattle and buffaloes caused by one of two specific serotypes of Pasteurella multocida B:2 and E:2 in Asian and African, respectively. It is well known that HS affect mainly the respiratory and digestive tracts. However, involvement of the nervous system in pathogenesis of HS has been reported in previous studies without details. In this study, nine buffalo calves of 8 months old were distributed into three groups. Animals of Group 1 and 2 were inoculated orally and subcutaneously with 10 ml of 1 × 10(12) cfu/ml of P. multocida B:2, respectively, while animals of Group 3 were inoculated orally with 10 ml of phosphate buffer saline as a control. All calves in Group 1 and Group 3 were euthanised after 504 h (21 day) post-infection, while calves in Group 2 had to euthanise after 12 h post-infection as they develop sever clinical signs of HS. Significant differences were found in Group 2 in the mean scores of clinical signs, gross and histopathological changes which mainly affect different anatomic regions of the nervous system. In addition, successful bacterial isolation of P. multocida B:2 were obtained from different sites of the nervous system. On the other hand, less sever, clinical, gross and histopathological changes were found in Group 1. These results provide for the first time strong evidence of involving of the nervous system in pathogenesis of HS, especially in the peracute stage of the disease. PMID:26850845

  4. Molecular characterization and expression profile of uterine serpin (SERPINA14) during different reproductive phases in water buffalo (Bubalus bubalis).

    PubMed

    Kandasamy, Sukumar; Jain, Asit; Kumar, Rohit; Agarwal, Sudhir K; Joshi, Paritosh; Mitra, Abhijit

    2010-10-01

    Uterine serpins (SERPINA14) play important roles during pregnancy in the farm animals. In this study, we have cloned and characterized cDNA sequence encoding the bubaline SERPINA14. We also studied its spatio-temporal expression in the uterine endometrium. The bubaline SERPINA14 has an open reading frame of 1299bp. Itshares ∼90% identity with the SERPINA14 of other ruminant livestock species. Phylogenetically, bubaline SERPINA14 has been placed in the same clade that contained other mammalian homologues with a maximum identity to bovine SERPINA14. Using an anti-ovine monoclonal antibody, Western blot analysis of the uterine fluid of buffalo during the early stage of pregnancy confirmed the presence of SERPINA14 of about 48,000Da. The results of quantitative real time PCR (RT-qPCR) as well as in situ hybridization demonstrated a stage and tissue specific expression of bubaline SERPINA14. The level of SERPINA14 mRNA was low during stage I (Days 3-5), which increased (P<0.05) during stage II (Days 6-15) and then subsequently declined during stage III (Days 16-21) of the estrus cycle. During early pregnancy (Days ∼30 of gestation) the level of SERPINA14 mRNA was as high as that during stage II of the estrus cycle. The SERPINA14 mRNA was localized in the glandular epithelium. The differential spatio-temporal expression of SERPINA14 in the uterine endometrium of buffalo suggests its plausible important roles in reproduction.

  5. Expression of growth factor ligand and receptor genes in preimplantation stage water buffalo (Bubalus bubalis) embryos and oviduct epithelial cells.

    PubMed

    Daliri, M; Rao, K B; Kaur, G; Garg, S; Patil, S; Totey, S M

    1999-09-01

    The temporal pattern of expression of genes for several growth factor ligands and receptors was examined in preimplantation water buffalo embryos and oviduct epithelial cells using RT-PCR. The identity of the resulting PCR products was confirmed by their expected size, restriction analysis, Southern blot hybridization and nucleotide sequence analysis. Preimplantation stage embryos from the one-cell to the blastocyst stage were derived after maturation, fertilization and culture of oocytes in vitro. Expression of members of the insulin-like growth factor (IGF) family was observed predominantly in preimplantation stage embryos and oviduct epithelial cells. Similarly, transcripts encoding insulin and IGF-I receptors were detected at each stage of embryonic development. The mRNA transcript of the IGF-I receptor was not detected in oviduct epithelial cells, but a prominent band corresponding to the insulin receptor was observed. Insulin and IGF-II mRNA were expressed as maternal transcripts that were not detected at the two- to four-cell stage but were present as zygotic transcripts at the eight-cell stage. Transcripts encoding IGF-I were detected in oviduct epithelial cells, but were not observed in any of the preimplantation stage embryos. Transforming growth factor (TGF) alpha and beta and epidermal growth factor mRNA transcripts were not detected in any of the preimplantation stage embryos. These results indicate that IGF-I acts via a paracrine mechanism to promote growth and development of preimplantation water buffalo embryos. Similarly, IGF-II appears to act through a heterologous autocrine mechanism via the IGF-I or the insulin receptor. Furthermore, the presence of TGF-alpha in oviduct epithelial cells indicates that it may have a critical role during development.

  6. Efficiency to reach age of puberty and behaviour of buffalo heifers (Bubalus bubalis) kept on pasture or in confinement.

    PubMed

    Sabia, E; Napolitano, F; De Rosa, G; Terzano, G M; Barile, V L; Braghieri, A; Pacelli, C

    2014-11-01

    In order to evaluate the influence of rearing system (free-ranging (FR) v. confinement (C)) on buffalo heifer efficiency to reach age of puberty and on behavioural and immune functions, two experiments were conducted from September 2010 to October 2011. In Experiment I, 32 subjects aged 8 to 9 months at the start of experiment were used. A total of 16 animals (group C) were group housed in an indoor slatted floor pen (4 m2/animal) with an outdoor paddock (4 m2/animal); 16 others grazed on a Mediterranean natural pasture of 40 ha (group FR). Behavioural data were collected and organic matter digestibility, blood metabolites and progesterone were determined. At the end of the experiment, a novel object test and a skin test were conducted, and the avoidance distance (AD) at the manger was measured. Free-ranging animals were able to express natural behaviours such as wallowing and grazing. C animals devoted more time to the novel object than FR animals, whereas AD at manger was lower in group FR than in group C (P<0.01). Cellular immune response was higher in FR heifers than in C animals (P<0.01). FR animals also showed a higher digestibility of organic matter (P<0.01). Heifers from group FR had higher plasma concentrations of non-esterified fatty acids (P<0.001) and lower concentrations of glucose than heifers from group C (P<0.001). C animals showed higher daily weight gains (P<0.01) and weight at the puberty (P<0.05), but there were no differences in terms of age of puberty between the two groups. The intakes of dry matter (DM), CP and energy to reach the age of puberty were similar in both groups. In order to verify whether the results obtained in Experiment I could be replicated in different rearing conditions (reduced pasture availability, different location and altitude), a second experiment was conducted on 26 animals, where only onset of age of puberty and metabolic profile were monitored. In Experiment II, 13 heifers grazed on a natural pasture of 5 ha, other

  7. Efficiency to reach age of puberty and behaviour of buffalo heifers (Bubalus bubalis) kept on pasture or in confinement.

    PubMed

    Sabia, E; Napolitano, F; De Rosa, G; Terzano, G M; Barile, V L; Braghieri, A; Pacelli, C

    2014-11-01

    In order to evaluate the influence of rearing system (free-ranging (FR) v. confinement (C)) on buffalo heifer efficiency to reach age of puberty and on behavioural and immune functions, two experiments were conducted from September 2010 to October 2011. In Experiment I, 32 subjects aged 8 to 9 months at the start of experiment were used. A total of 16 animals (group C) were group housed in an indoor slatted floor pen (4 m2/animal) with an outdoor paddock (4 m2/animal); 16 others grazed on a Mediterranean natural pasture of 40 ha (group FR). Behavioural data were collected and organic matter digestibility, blood metabolites and progesterone were determined. At the end of the experiment, a novel object test and a skin test were conducted, and the avoidance distance (AD) at the manger was measured. Free-ranging animals were able to express natural behaviours such as wallowing and grazing. C animals devoted more time to the novel object than FR animals, whereas AD at manger was lower in group FR than in group C (P<0.01). Cellular immune response was higher in FR heifers than in C animals (P<0.01). FR animals also showed a higher digestibility of organic matter (P<0.01). Heifers from group FR had higher plasma concentrations of non-esterified fatty acids (P<0.001) and lower concentrations of glucose than heifers from group C (P<0.001). C animals showed higher daily weight gains (P<0.01) and weight at the puberty (P<0.05), but there were no differences in terms of age of puberty between the two groups. The intakes of dry matter (DM), CP and energy to reach the age of puberty were similar in both groups. In order to verify whether the results obtained in Experiment I could be replicated in different rearing conditions (reduced pasture availability, different location and altitude), a second experiment was conducted on 26 animals, where only onset of age of puberty and metabolic profile were monitored. In Experiment II, 13 heifers grazed on a natural pasture of 5 ha, other

  8. Effect of equilibration times, freezing, and thawing rates on post-thaw quality of buffalo (Bubalus bubalis) bull spermatozoa.

    PubMed

    Shah, S A H; Andrabi, S M H; Qureshi, I Z

    2016-09-01

    The effects of equilibration times (E1, 2 h; E2, 4 h; E3, 6 h), freezing rates (FR1, manual, 5 cm above liquid nitrogen (LN2 ) for 10 min, plunging in LN2 ; FR2, programmable ultra-fast, holding at +4 °C for 2 min, from 4 to -10 °C at -10 °C/min, from -10 to -20 °C at -15 °C/min, from -20 to -120 °C at -60 °C/min, holding at -120 °C for 30 sec, plunging in LN2 ), and thawing rates (T1, 37 °C for 30 sec; T2, 50 °C for 15 sec; T3, 70 °C for 7 sec) were evaluated on quality of buffalo bull spermatozoa. Progressive motility (%), rapid velocity (%), average path velocity (VAP, μm/s), straight line velocity (VSL, μm/s), and mitochondrial transmembrane potential (%) were higher (p < 0.05) with E2, FR2, and T3 compared to other groups. Sperm curved line velocity (VCL, μm/s) was higher (p < 0.05) with E2 and FR2 compared to other groups. Sperm straightness (%) and linearity (LIN, %) were higher (p < 0.05) with E2 compared to other groups. Sperm LIN was affected (p < 0.05) with T3 compared to other groups. Supravital-plasma membrane integrity (%), viability and acrosome integrity (%) of spermatozoa were higher (p < 0.05) with E2 and FR2 compared to other groups. Sperm DNA integrity (%) was higher (p < 0.05) with FR2 and T1 compared to other groups. We concluded that inclusion of 4 h-equilibration time, programmable ultra-fast freezing rate, and rapid thawing at 70 °C for 7 sec in cryopreservation protocol improves the post-thaw quality of buffalo bull spermatozoa. PMID:27153390

  9. Effects of the seminal plasma zinc content and catalase activity on the semen quality of water buffalo (Bubalus bubalis) bulls.

    PubMed

    Alavi-Shoushtari, S M; Rezai, S Asri; Ansari, M H Kh; Khaki, A

    2009-01-15

    In order to determine zinc and catalase content of seminal plasma in the buffalo and to study their associations with the semen characteristics, 54 semen samples were collected from 10 buffalo bulls; semen volume and sperm concentration, gross and progressive motility and viability were evaluated, seminal plasma was then harvested by centrifugation and its zinc content was estimated by atomic absorption spectrophotometer and its catalase activity determined by using a commercial kit. The zinc content of the seminal plasma (Mean +/- SEM) was recorded as 154.40 +/- 1.74 mg L(-1), while, the mean catalase value was 32.00 +/- 0.42 U mL(-1). The mean zinc values was highly correlated with sperm progressive motility and viability and with catalase values (p = 0.000 for all) and also was associated with gross motility (p = 0.020) and negatively with abnormal morphology (p = 0.049). The catalase values were highly associated with sperm progressive motility, viability and zinc content (p = 0.000 for all) and was associated with sperm gross motility (p = 0.024). For further clarification of these correlations, the samples were categorized in three groups of excellent (Ex, >90% motile, n = 33), good (Go, 80-89% motile, n = 15) and moderate (Mo, <79% motile, n = 6) according to their percentage of sperm motility. The mean progressive motility in Ex group was 92.54 +/- 0.51%, in Go group was 81.66 +/- 0.62% and in Mo group was 71.66 +/- 1.05%. The mean zinc and catalase values were recorded as 161.07 +/- 1.63 mg L(-1) and 33.41 +/- 0.34 U mL(-1) in Ex, 146.70 +/- 1.91 mg L(-1) and 31.01 +/- 0.67 in Go and 136.42 +/- 4.97 mg L(-1) and 26.51 +/- 0.87 U mL(-1) in Mo groups. The mean zinc value in Ex group was highly associated with sperm motility, viability and catalase values, in Go group was associated with catalase values and highly associated with sperm abnormal morphology and in Mo group it was highly associations with catalase values only. The mean catalase value in Ex group

  10. Interferon-alpha genes from Bos and Bubalus bubalus.

    PubMed

    Shi, Xiju; Xia, Chun; Pan, Baoliang; Wang, Ming

    2006-01-01

    Interferon-a genes were cloned from six breeds of three species of two genera (three Chinese native cattle breeds of yellow cattle, wild yak and HuanHu domestic yak, one European breed of Holstein cow, and two water buffalo breeds of FuAn water buffalo and FuZhong water buffalo) by direct PCR. The PCR products were directly inserted into the expression vector to be sequenced and expressed. Sequence analysis showed that IFN-a genes of six clones were composed of 498 nucleotides, encoding a mature polypeptide with 166 amino acids. Compared with the published BoIFN-a subtypes, the IFN-a gene of Holstein cow had only one point mutation with the BoIFN-aA subtype. The IFN-a gene of yellow cattle was similar to the BoIFN-aD subtype with amino acid identity of 97.0% and may be considered as a new subtype, namely, BoIFN-aD1. The other four IFN-a genes, cloned from wild yak and HuanHu domestic yak, FuAn water buffalo, and FuZhong water buffalo, represented four new subtypes, namely, BoIFN-aI, BoIFN-aJ, BuIFN-a1, and BuIFN-a2, respectively. Each of the six clones was expressed in E. coli with molecular weight of approximately 20 kDa by SDS-PAGE and Western blot analyses. Antiviral activity assays showed that the six recombinant IFN-a (rIFN-a) all exhibited 1,000 times higher antiviral activity in the MDBK/VSV cell line than in the CEF/VSV one. Moreover, the rIFN-as could inhibit infectious bovine rhinotracheitis virus replication in the MDBK cell line using CPE inhibition method. The results suggested that rIFN-as a potential agent for clinical application against virus diseases in cattle industry.

  11. Occurrence of Theileria and Babesia species in water buffalo (Bubalus babalis, Linnaeus, 1758) in the Hubei province, South China.

    PubMed

    He, Lan; Feng, Hui-Hui; Zhang, Wen-Jie; Zhang, Qing-Li; Fang, Rui; Wang, Li-Xia; Tu, Pan; Zhou, Yan-Qin; Zhao, Jun-Long; Oosthuizen, Marinda C

    2012-05-25

    The presence and prevalence of tick-borne haemoparasites in water buffalo from the Hubei province, south China was investigated using the reverse line blot (RLB) hybridization assay and phylogenetic analysis of the parasite 18S rRNA gene. Theileria buffeli (19.1%) was the most frequently found species in all of the locations, followed by Babesia orientalis (8.9%), Babesia bovis (1.0%) and Babesia bigemina (0.7%). Only 12 (3.9%) of the samples had mixed infections. Eleven samples with single infections were selected for further characterization using 18S rRNA gene sequence analysis. Phylogenetic analysis showed that the eight T. buffeli 18S rRNA gene sequences obtained grouped into four clusters, of which three grouped with the known T. buffeli types B and D. The remaining five grouped separately from the previously describe T. buffeli types, constituting new T. buffeli types. The two B. bigemina 18S rRNA gene sequences obtained grouped closely with B. bigemina Kunming; this serves as the first report of B. bigemina in the Hubei province. The B. orientalis Daye 18S rRNA gene sequence obtained grouped closely with the previously reported B. orientalis Wuhan strain and with Babesia sp. Kashi 1 and Kashi 2.

  12. Bone morphogenetic protein 4 (BMP4) induces buffalo (Bubalus bubalis) embryonic stem cell differentiation into germ cells.

    PubMed

    Shah, Syed Mohmad; Saini, Neha; Ashraf, Syma; Singh, Manoj Kumar; Manik, Radhey Sham; Singla, Suresh Kumar; Palta, Prabhat; Chauhan, Manmohan Singh

    2015-12-01

    The aim of the present study was to investigate the effect of Bone morphogenetic protein 4 (BMP4) stimulation on differentiation of buffalo embryonic stem (ES) cells into germ lineage cells. ES cells were subjected to in vitro differentiation in floating and adherent cultures, under different BMP4 concentrations (20, 50 and 100 ngml(-1)) for different culture intervals (4, 8 and 14 days). qPCR analysis revealed that BMP4 at a concentration of 50-100 ngml(-1) for a culture period of 14 days led to maximum induction of germ lineage genes like DAZL, VASA, PLZF (PGC-specific); SYCP3, MLH1, TNP1/2 and PRM2 (Meiotic genes); BOULE and TEKT1 (Spermatocyte markers); GDF9, ZP2 and 3 (Oocyte markers). The expression levels of all the genes were significantly higher under BMP4 differentiation as compared to BMP4 + NOGGIN and spontaneously differentiated cultures. Immunocytochemical analysis of embryoid bodies (EBs) and monolayer adherent cultures revealed expression of PGC- (c-KIT, DAZL and VASA); Meiotic- (SYCP3, MLH1 and PROTAMINE1); Spermatocyte- (ACROSIN and HAPRIN); and Oocyte- markers (GDF9 and ZP4). Western blotting was positive for VASA, GDF9 and ZP4. Oocyte-like structures (OLS) obtained in monolayer differentiated cultures harbored a big nucleus and a ZP4 coat. They showed embryonic development and progressed through 2-cell, 4-cell, 8-cell and blastocyst-like structures. Global DNA methylation analysis showed significantly (p < 0.05) decreased levels of 5-methyl-2-deoxycytidine in EBs obtained in optimum differentiation medium. The expression of meiotic markers coupled with expression of spermatocyte and oocyte markers is an indication of post-meiotic progression into spermatogenesis and oogenesis, respectively.

  13. Effects of in vitro copper sulphate supplementation on the ejaculated sperm characteristics in water buffaloes (Bubalus bubalis).

    PubMed

    Tabassomi, Mehdi; Alavi-Shoushtari, Sayed Mortaza

    2013-01-01

    This study was carried out to investigate effects of copper sulphate (CuSO4) additive to semen extenders on sperm parameters: progressive motility, viability, membrane integrity and DNA damage, after semen dilution and cryopreservation. Semen samples of 5 buffalo bulls of 3-5 years old were collected at 5 different occasions during the autumn 2011. A total number of 25 samples were used in each examination. Sperm progressive motility and viability were measured at 0 (T0), 60 (T1) and 120 (T2) min after diluting semen in tris-citric acid extender containing 0 (control), 0.004, 0.008, 0.016, 0.032 and 0.064 mg L(-1) CuSO4. Later, semen was diluted in a tris-citric acid-egg yolk-glycerol extender containing the same amounts of CuSO4, cooled to 4 ˚C and kept refrigerated for 4 hr to equilibrate, sperm progressive motility, viability, membrane integrity and DNA damage were estimated. Then, semen was packed in 0.5 mL French straws and frozen in liquid nitrogen. Later, the frozen semen was thawed in 37 ˚C water bath for 30 sec, and the same parameters as well as total antioxidant capacity (TAC) of the frozen-thawed semen were estimated. The results showed that copper additive at the rate of 0.032 mg L(-1) gives a better protection of sperms through the process of dilution, equilibration and freeze-thawing than that in control and other Cu concentrations, while 0.064 mg L(-1) CuSO4 had deleterious effect on the sperm.

  14. Sperm surface hyaluronan binding protein (HABP1) interacts with zona pellucida of water buffalo (Bubalus bubalis) through its clustered mannose residues.

    PubMed

    Ghosh, Ilora; Datta, Kasturi

    2003-02-01

    Sperm-oocyte interaction during fertilization is multiphasic, with multicomponent events, taking place between zona pellucida (ZP) glycoproteins and sperm surface receptor. d-mannosylated glycoproteins, the major constituents of ZP are considered to serve as ligands for sperm binding. The presence of hyaluronan binding protein 1 (HABP1) on sperm surface of different mammals including cattle and its possible involvement in sperm function is already reported. Recently, we have demonstrated the specificity of clustered mannose as another ligand for HABP1 (Kumar et al., 2001: J Biosci 26:325-332). Here, we report that only N-linked mannosylated zona-glycoproteins bind to sperm surface HABP1. Labeled HABP1 interacts with ZP of intact oocyte of Bubalus bubalis, which can be competed with unlabeled HABP1 or excess d-mannosylated albumin (DMA). This data suggests the specific interaction of HABP1 with ZP, through clustered mannose residues. In order to examine the physiological significance of such an interaction, the capacity of sperm binding to oocytes under in vitro fertilization plates was examined either in presence of DMA alone or in combination with HABP1. The number of sperms, bound to oocytes was observed to reduce significantly in presence of DMA, which could be reversed by the addition of purified recombinant HABP1 (rHABP1) in the same plate. This suggests that sperm surface HABP1 may act as mannose binding sites for zona recognition.

  15. Cloning of a buffalo (Bubalus bubalis) prostaglandin F(2alpha) receptor: changes in its expression and concentration in the buffalo cow corpus luteum.

    PubMed

    Verma-Kumar, Shalu; Srinivas, S V; Muraly, P; Yadav, Vijay K; Medhamurthy, R

    2004-06-01

    Acting primarily through its specific G protein-coupled receptor termed FPr, prostaglandin (PG) F(2alpha) induces regression of the corpus luteum (CL) at the end of a non-fertile oestrous cycle. This study was aimed at cloning a full-length cDNA for FPr and determining its expression and protein concentrations during different stages of CL development in the water buffalo. Serum progesterone and StAR expression were determined to establish temporal relationships between indices of steroidogenesis and changes in FPr expression at different stages of CL development. In contrast to the dairy cow, the stage IV CL (day 20 of the oestrous cycle) did not appear to be functionally regressed in the buffalo. Molecular cloning of a cDNA encoding the buffalo FPr yielded a full length 2193 bp FPr cDNA containing a single open reading frame encoding a 362 amino acid protein with seven putative membrane-spanning domains. The deduced buffalo FPr amino acid sequence possesses a high degree of identity with the other mammalian homologues. Steady state concentration of buffalo FPr transcript increased (P > 0.05) from stage I to stage II/III, and declined at 18 h post PGF(2alpha) injection. The FPr concentration expressed as fmol/microg of plasma membrane protein showed an increase (P > 0.05) from stage I (1.98 +/- 0.10), through stage II/III (2.42 +/- 0.48) to stage IV (2.77 +/- 0.18). High affinity FPr was observed in stage I (K(d) 4.86 nmol) and stage II/III (K(d) 6.28 nmol) while low affinity FPr (K(d) 19.44 nmol) was observed in stage IV. In conclusion, we have cloned a full length FPr cDNA from buffalo cow CL and observed that FPr mRNA expression, receptor number and affinity did not vary significantly (P > 0.05) within the luteal phase of the oestrous cycle.

  16. Characterization and expression profile of complete functional domain of granulysin/NK-lysin homologue (buffalo-lysin) gene of water buffalo (Bubalus bubalis).

    PubMed

    Kandasamy, Sukumar; Mitra, Abhijit

    2009-04-15

    Granulysin (GNLY)/NK-lysin (NKL) is an effector antimicrobial cationic peptide expressed in the cytotoxic and natural killer lymphocytes. We report here cDNA sequence (405bp) encoding the complete functional domain of buffalo-lysin (bu-lysin), and its expression profile in the various tissues. The nucleotide sequence of bu-lysin exhibited >85% identity with the bovine lysin. Comparison of the deduced amino acid sequence of bu-lysin with those of GNLY/NKL of different species revealed the conservation of six cysteine (Cys) residues and five alpha helices. Unlike the homologues in other species, bu-lysin composed of 11 positively charged Lys residues as in equine. The expression of bu-lysin mRNA in the in vitro cultured lymphocytes was inducible and increased markedly (p<0.05) in a dose dependant manner when incubated with Concanavalin A (ConA). The expression of bu-lysin mRNA in the different tissues was variable: comparatively higher in the spleen and lymph node, moderate in the uterine endometrium and low in the liver and kidney. These results indicate the existence and active expression of GNLY/NKL homologue in water buffalo having a significant influence in immune response.

  17. A comparative study on efficiency of adult fibroblasts and amniotic fluid-derived stem cells as donor cells for production of hand-made cloned buffalo (Bubalus bubalis) embryos.

    PubMed

    Em, Sadeesh; Kataria, Meena; Shah, Fozia; Yadav, P S

    2016-08-01

    The efficiency of two cell types, namely adult fibroblasts, and amniotic fluid stem (AFS) cells as nuclear donor cells for somatic cell nuclear transfer by hand-made cloning in buffalo (Bubalus bubalis) was compared. The in vitro expanded buffalo adult fibroblast cells showed a typical "S" shape growth curve with a doubling time of 40.8 h and stained positive for vimentin. The in vitro cultured undifferentiated AFS cells showed a doubling time of 33.2 h and stained positive for alkaline phosphatase, these cells were also found positive for undifferentiated embryonic stem cell markers like OCT-4, NANOG and SOX-2, which accentuate their pluripotent property. Further, when AFS cells were exposed to corresponding induction conditions, these cells differentiated into osteogenic, adipogenic and chondrogenic lineages which was confirmed through alizaran, oil red O and alcian blue staining, respectively. Cultured adult fibroblasts and AFS cells of passages 10-15 and 8-12, respectively, were used as nuclear donors. A total of 94 embryos were reconstructed using adult fibroblast as donor cells with cleavage and blastocyst production rate of 62.8 ± 1.8 and 19.1 ± 1.5, respectively. An overall cleavage and blastocyst formation rate of 71.1 ± 1.2 and 29.9 ± 2.2 was obtained when 97 embryos were reconstructed using AFS cells as donor cells. There were no significant differences (P > 0.05) in reconstructed efficiency between the cloned embryos derived from two donor cells, whereas the results showed that there were significant differences (P < 0.05) in cleavage and blastocyst rates between the cloned embryos derived from two donor cell groups. Average total cell numbers for blastocyst generated using AFS cells (172.4 ± 5.8) was significantly (P < 0.05) higher than from adult fibroblasts (148.2 ± 6.1). This study suggests that the in vitro developmental potential of the cloned embryos derived from AFS cells were higher than that of the cloned embryos

  18. Transcriptional status of known and novel genes tagged with consensus of 33.15 repeat loci employing minisatellite-associated sequence amplification (MASA) and real-time PCR in water buffalo, Bubalus bubalis.

    PubMed

    Srivastava, Jyoti; Premi, Sanjay; Pathak, Deepali; Ahsan, Zaid; Tiwari, Madhulika; Garg, Lalit C; Ali, Sher

    2006-01-01

    We conducted minisatellite-associated sequence amplification (MASA) with an oligo (5' CACCTCTCCACCTGCC 3') based on consensus of 33.15 repeat loci using cDNA from the testis, ovary, spleen, kidney, heart, liver, and lung of water buffalo Bubalus bubalis and uncovered 25 amplicons of six different sizes (1,263, 846/847, 602, 576, 487, and 324 base pairs). These fragments, cloned and sequenced, were found to represent several functional, regulatory, and structural genes. Blast search of all the 25 amplicons showed homologies with 43 transcribing genes across the species. Of these, the 846/847-bp fragment, having homology with the adenylate kinase gene, showed nucleotide changes at six identical places in the ovary and testis. The 1,263; 324; and 487-bp fragments showed homology with the secreted modular calcium binding protein (SMOC-1), leucine-rich repeat neuronal 6A (LRRN6A) mRNA, and human TTTY5 mRNA, respectively. Real-time PCR showed maximum expression of AKL, LRRN6A, and T-cell receptor gamma (TCR-gamma)-like genes in the testis, SMOC-1 in the liver, and the T-cell receptor-like (TCRL) gene in the spleen compared to those used as endogenous control. We construe that these genes have evolved from a common progenitor and conformed to various biological functions during the course of evolution. MASA approach coupled with real-time PCR has potentials to uncover accurate expression of a large number of genes within and across the species circumventing the screening of cDNA library.

  19. Characterization of leptin receptor gene in Bubalus bubalis and association analysis with body measurement traits.

    PubMed

    De Matteis, Giovanna; Scatà, Maria Carmela; Catillo, Gennaro; Terzano, Giuseppina Maria; Grandoni, Francesco; Napolitano, Francesco

    2015-06-01

    Leptin has a pleiotropic effect on regulating appetite, energy metabolism, growth, reproduction, body composition and immunity. This property supports leptin and its receptor as candidate genes for evaluating genetic polymorphisms to associate with growth, milk yield and other economic traits. The aim of this study is to characterize the leptin receptor gene in Bubalus bubalis, to identify single-nucleotide polymorphism (SNP) sites in different coding and non-coding regions and to analyse potential associations between SNPs identified and the body measurements traits of growing buffalo heifers. A group of 64 animals were genotyped by direct sequencing and twenty-eight SNPs were detected. A sequence analysis revealed the presence of nine interesting SNPs in gene sequence. The association analysis of polymorphisms with the body measurements traits of growing buffalo heifers shows significant statistical effects on chest depth and sacrum height. Therefore according to the results obtained from this study, the leptin receptor gene appears to have potential effects on the body measurement traits of Bubalus bubalis. PMID:25431006

  20. Molecular assays reveal the presence of Theileria spp. and Babesia spp. in Asian water buffaloes (Bubalus bubalis, Linnaeus, 1758) in the Amazon region of Brazil.

    PubMed

    Silveira, Júlia A G; de Oliveira, Cairo H S; Silvestre, Bruna T; Albernaz, Tatiana T; Leite, Rômulo C; Barbosa, José D; Oliveira, Carlos M C; Ribeiro, Múcio F B

    2016-07-01

    Approximately 50% of buffalo herds in Brazil are located in Pará state in northern Brazil. There are several properties where cattle and buffalo live and graze together, and thus, buffalo pathogens may threaten the health of cattle and vice versa. Therefore, knowledge of infectious agents of buffalo is essential for maintaining healthy livestock. Clinical disease caused by Theileria and Babesia parasites in the Asian water buffalo is not common, although these animals may act as reservoir hosts, and the detection of these hemoparasites in buffaloes is as important as it is in cattle. Studies of the infection of buffaloes by hemoparasites in Brazil are scarce. The objective of the present study was to investigate the occurrence of Piroplasmida parasites in Asian water buffaloes in the state of Pará in the Amazon region of Brazil using nested PCR assays and phylogenetic analysis. The 18S rRNA gene and ITS complete region were amplified from DNA extracted from blood samples collected from 308 apparently healthy buffaloes bred on six properties in the state of Pará, Brazil. The prevalence of positive buffalo samples was 4.2% (13/308) for Theileria spp., 3.6% (11/308) for Babesia bovis and 1% (3/308) for Babesia bigemina. Animals infected with Theileria were detected in 50% (3/6) of the assessed properties. Phylogenetic analyses indicated that the Theileria species detected in this study were closely related to Theileria buffeli, Theileria orientalis and Theileria sinensis. To our knowledge, this is the first report of Theileria in Asian water buffaloes in the Americas. The majority of Theileria-positive buffaloes (11/13) belong to a property that has a history of animals presenting lymphoproliferative disease of unknown etiology. Therefore, the present research suggests that this disorder can be associated with Theileria infection in this property. Our results provide new insights on the distribution and biological aspects of hemoparasites transmissible from

  1. Molecular assays reveal the presence of Theileria spp. and Babesia spp. in Asian water buffaloes (Bubalus bubalis, Linnaeus, 1758) in the Amazon region of Brazil.

    PubMed

    Silveira, Júlia A G; de Oliveira, Cairo H S; Silvestre, Bruna T; Albernaz, Tatiana T; Leite, Rômulo C; Barbosa, José D; Oliveira, Carlos M C; Ribeiro, Múcio F B

    2016-07-01

    Approximately 50% of buffalo herds in Brazil are located in Pará state in northern Brazil. There are several properties where cattle and buffalo live and graze together, and thus, buffalo pathogens may threaten the health of cattle and vice versa. Therefore, knowledge of infectious agents of buffalo is essential for maintaining healthy livestock. Clinical disease caused by Theileria and Babesia parasites in the Asian water buffalo is not common, although these animals may act as reservoir hosts, and the detection of these hemoparasites in buffaloes is as important as it is in cattle. Studies of the infection of buffaloes by hemoparasites in Brazil are scarce. The objective of the present study was to investigate the occurrence of Piroplasmida parasites in Asian water buffaloes in the state of Pará in the Amazon region of Brazil using nested PCR assays and phylogenetic analysis. The 18S rRNA gene and ITS complete region were amplified from DNA extracted from blood samples collected from 308 apparently healthy buffaloes bred on six properties in the state of Pará, Brazil. The prevalence of positive buffalo samples was 4.2% (13/308) for Theileria spp., 3.6% (11/308) for Babesia bovis and 1% (3/308) for Babesia bigemina. Animals infected with Theileria were detected in 50% (3/6) of the assessed properties. Phylogenetic analyses indicated that the Theileria species detected in this study were closely related to Theileria buffeli, Theileria orientalis and Theileria sinensis. To our knowledge, this is the first report of Theileria in Asian water buffaloes in the Americas. The majority of Theileria-positive buffaloes (11/13) belong to a property that has a history of animals presenting lymphoproliferative disease of unknown etiology. Therefore, the present research suggests that this disorder can be associated with Theileria infection in this property. Our results provide new insights on the distribution and biological aspects of hemoparasites transmissible from

  2. Identification of polymorphism in fatty acid binding protein 3 (FABP3) gene and its association with milk fat traits in riverine buffalo (Bubalus bubalis).

    PubMed

    Dubey, Praveen Kumar; Goyal, Shubham; Mishra, Shailendra Kumar; Arora, Reena; Mukesh, Manishi; Niranjan, Saket Kumar; Kathiravan, Periasamy; Kataria, Ranjit Singh

    2016-04-01

    The fatty acid binding protein 3 (FABP3) gene, known to be associated with fat percentage of milk and meat in bovines, was screened among swamp and riverine buffaloes for polymorphism detection and further association with milk fat contents. An SNP g.307C > T was identified in the intron 2 (+53 exon 2) region of FABP3 gene of Indian buffaloes. The SNP identified was genotyped in 692 animals belonging to 15 riverine, swamp and hybrid (riverine × swamp) buffalo populations of diverse phenotypes and utilities, by PCR-RFLP. A marked contrast was observed between the C and T allele frequencies in three types of buffaloes. The frequency of C allele ranged from 0.67 to 0.96 in pure swamp buffalo populations, with the highest in Mizoram (0.96). Whereas the frequency of T allele was high across all the Indian riverine buffalo breeds, ranging from 0.57 to 0.96. None of the genotypes at FABP3 g.307C > T locus was found to have significant association with milk fat and other production traits in Mehsana dairy buffalo breed. Our study revealed marked differences in the allele frequencies between riverine and swamp buffaloes at FABP3 g.307C > T locus, without any significant association with different milk traits in riverine buffaloes.

  3. The efficacy and safety of alphacypermethrin as a pour-on treatment for water buffalo (Bubalus bubalis) infested with Haematopinus tuberculatus (Phthiraptera: Haematopinidae).

    PubMed

    Veneziano, Vincenzo; Neglia, Gianluca; Cimmino, Roberta; Balestrieri, Anna; Rufrano, Domenico; Bastianetto, Eduardo; Santoro, Mario; Gokbulut, Cengiz

    2013-08-01

    The sucking louse Haematopinus tuberculatus (Burmeister 1839) is an ectoparasite of buffaloes, cattle, camels, and American bison. Alphacypermethrin (ACYP) is a pyrethroid insecticide commonly used to control arthropods of veterinary and public health interest. Therapeutics, such as antiparasitic compounds, is often administered to buffaloes based on dosage and intervals recommended for cattle because very few drugs have buffalo-specific label indications. A trial was conducted on 20 louse-infested buffaloes at a farm to assess the efficacy and safety of ACYP pour-on, at the manufacturer's recommended dose for cattle, on buffaloes naturally infested by H. tuberculatus. Ten animals were assigned to ACYP-treated group (ACYP-group) and ten to untreated control group (C-group). On day 0, all ACYP-group buffaloes received alphacypermethrin pour-on. Louse counts were performed on days -1, 7, 14, 21, 28, 35, 42, 49, and 56 at eight predilection sites on the skin of each buffalo. ACYP was completely effective (100%) at day 7, highly effective (99.8%) at day 14, and completely effective (100%) from day 21 until the end of the study (day 56 post-treatment). During the trial, ACYP was well tolerated by all animals as there were no observed clinically adverse reactions. The results of this trial suggest that ACYP is an effective, safe, and user-friendly compound suitable for treatment of buffaloes with natural louse infestations.

  4. Clinical and haematological study on water buffaloes (Bubalus bubalis) and crossbred cattle naturally infected with Theileria annulata in Sharkia province, Egypt.

    PubMed

    Mahmmod, Yasser S; Elbalkemy, Farouk A; Klaas, Ilka C; Elmekkawy, Mamdouh F; Monazie, Afaf M

    2011-09-01

    This study was conducted to investigate the clinical and haematological findings in water buffaloes and crossbred cattle naturally infected with Theileria annulata with special reference to the clinical picture of tropical theileriosis in Egyptian buffaloes. A total 50 field cases of buffaloes and cattle was clinically and laboratory investigated from March to June 2008. Forty-four buffaloes and cattle out of 50 were naturally infected with T. annulata and showed typical signs of infection. Six animals showed no clinical signs and were free from external, internal, and blood parasites. The clinical findings of examined cattle and buffaloes showed typical signs of tropical theileriosis: fever, enlargement of the superficial lymph nodes, severe lacrimation, bilateral conjunctivitis, photophobia, and corneal opacity. It was clear that the severity of clinical signs in infected buffaloes was more prominent than in infected cattle with persistence of some lesions after recovery as corneal opacity and pulmonary lesions. Haematological analysis revealed a significant decrease in RBCS count, PCV%, haemoglobin amount, and WBCs in the infected animals when compared to the control group. It was concluded from our study that T. annulata infection is associated with impairment and alteration of blood parameters in both cattle and water buffaloes. Theileriosis in water buffaloes might cause irreversible ocular changes that could lead to complete blindness. Data obtained in this study might be the basis for subsequent studies under natural and experimental field conditions.

  5. Importation of in vitro-produced Bubalus bubalis embryos from Italy into the United States: a case report.

    PubMed

    BonDurant, R H; Drost, M; Zambrano-Varon, J; Campanile, G; Gasparrini, B; Zicarelli, L

    2007-08-01

    On December 19, 2005, 14 in vitro-fertilized water buffalo (Bubalus bubalis) embryos, which had been cryopreserved by vitrification, were thawed and transferred into B. bubalis recipients in California. The embryos had been produced in Italy, following transvaginal oocyte pickup (TVOPU), with subsequent in vitro maturation, insemination, and culture. This case study relates our experience in meeting the regulatory criteria, established by the Animal Import/Export Office of the USDA-Animal and Plant Health Inspection Service (USDA-APHIS), in order to successfully import these embryos into the USA.

  6. Nucleotide diversity of mitochondrial DNAs between the swamp and the river types of domestic water buffaloes, Bubalus bubalis, based on restriction endonuclease cleavage patterns.

    PubMed

    Tanaka, K; Yamagata, T; Masangkay, J S; Faruque, M O; Vu-Binh, D; Salundik; Mansjoer, S S; Kawamoto, Y; Namikawa, T

    1995-06-01

    Cleavage patterns of mitochondrial DNAs (mtDNAs) by 15 restriction endonucleases were analyzed for 10 swamp and 13 river types of domestic water buffaloes. Digestions with nine enzymes exhibited polymorphisms giving two or three kinds of cleavage patterns. Five mtDNA types were identified, three types in the swamp buffaloes of the Philippines, Vietnam, and Indonesia (S-types) and two types in the river buffaloes of Bangladesh and Pakistan (R-types). Nucleotide diversities ranged from 0.2 to 0.6% within the S- and R-types and from 1.9 to 2.4% between the R-types and the S-types. These values indicated that R-type and S-type mtDNAs differentiated at the subspecific level of other mammalian species reported. The possibility of polyphyletic domestication in different places is discussed for the origin of two distinct types of domestic water buffaloes.

  7. A complementary diagnosis of naturally occurring tuberculosis in water buffaloes (Bubalus bubalis) in Rio de Janeiro using a MPB70-ELISA, Brazil.

    PubMed

    Zarden, Carlos F O; Marassi, Carla D; Oelemann, Walter; Lilienbaum, Walter

    2013-06-01

    As tuberculosis is still a worldwide infection and buffalo breeding represents an important economic activity in various countries, the purpose of this study was to employ an enzyme-linked immunosorbent assay (ELISA) using MPB70 as a capture antigen for the diagnosis of naturally occurring tuberculosis in water buffaloes in Brazil. After the introduction of newly acquired cattle onto a tuberculosis (TB) free farm, an outbreak of TB was recorded in a mixed herd comprising water buffaloes (21) and cattle (46). The entire herd was tested by intradermal tuberculin injection (ITT) and positive animals were slaughtered and tested by culture, polymerase chain reaction (PCR), and ELISA. From the 21 buffaloes sampled, three were reactive by ITT. All the three had positive culture and ELISA, while PCR was positive in two of them. Besides that, one ITT-negative buffalo was slaughtered and presented positive results by both culture and ELISA, and was considered as anergic. Although there were only few animals, those findings demonstrate the diagnostic usefulness of an MPB70-ELISA to correctly detect Mycobacterium bovis tuberculosis in water buffaloes.

  8. Post-warming hatching and birth of live calves following transfer of in vitro-derived vitrified water buffalo (Bubalus bubalis) embryos.

    PubMed

    Hufana-Duran, Danilda; Pedro, Prudencio B; Venturina, Hernando V; Hufana, Rogelio D; Salazar, Apolinario L; Duran, Peregrino G; Cruz, Libertado C

    2004-05-01

    Viability of in vitro-derived vitrified-warmed preimplantation stage buffalo embryos were assessed in vitro and in vivo. Oocytes were collected from ovaries of slaughtered riverine buffaloes, matured and fertilized in vitro with frozen semen from riverine buffalo bull and cultured on cumulus cell monolayers. Resultant preimplantation stage embryos were cryopreserved by vitrification with ethylene glycol, ficoll and sucrose. Seventy-one frozen embryos were warmed in 0.5M sucrose and were further cultured in vitro for 72 h to assess hatching rate. On the other hand, 95 embryos were transferred non-surgically to riverine buffalo recipients to assess development competence in vivo through detection of pregnancy and birth of live calves. Hatching rate of 83.10% (59/71) was noted among embryos cultured in vitro. Pregnancy rate was 16.36% (9/55) while calving rate was 10.91% (6/55) after transfer of in vitro-derived vitrified-warmed embryos to recipient animals. Six healthy and normal calves with average birth weight of 38.75+/-3.55 kg were born from the transferred embryos. These results indicate the viability of vitrified in vitro-derived buffalo embryos and the potential application of in vitro embryo production and vitrification techniques for production and transport of buffalo embryos from germplasm-rich sources to guarantee genetic improvement in many parts of the world.

  9. Synchronization of follicular wave emergence following ultrasound-guided transvaginal follicle ablation or estradiol-17β administration in water buffalo (Bubalus bubalis).

    PubMed

    Honparkhe, M; Gandotra, V K; Matharoo, J S; Ghuman, S P S; Dadarwal, D; Singh, Jaswant

    2014-04-01

    The aim of this study was to assess the synchrony in follicular wave emergence and subsequent ovulation following dominant follicle ablation or estradiol-17β administration. Six cycling Murrah buffaloes were sequentially allotted to three groups, that is, control, follicular ablation, and estradiol-17β groups. For the control group, buffaloes at random stages of estrous cycle were examined daily by transrectal ultrasonography for 14 days and the day of wave emergence was recorded. Following induced luteolysis and ovulation (Day 0), these buffaloes were included in the ablation group. All follicles (>5mm) were ablated on Day 3 or 5 or 7 (n=2 each day). Seven days after the ablation, these buffaloes were administered prostaglandin F2α to induce luteolysis and ovulation. Following this, buffaloes were included in the estradiol treatment group with estradiol administered on similar days as for ablation in the ablation group. Luteolysis was induced nine days after the estradiol injection. All animals of the treatment groups were subjected to transrectal ultrasound and blood samplings daily from treatment to induced ovulation. The follicular waves emerged significantly earlier (P=0.001) in both the ablation (2.1±0.79 days) and estradiol (4.0±0.25 days) treatment groups than the control group (8.3±0.88 days). The deviation from mean day of ovulation was greater (P=0.02) for the control group buffaloes (1.66±0.3 day) than those of the treatment groups (ablation, 0.76±0.2 and estradiol, 0.58±0.2 day). In conclusion, both ablation and estradiol resulted in synchronous emergence of a new follicular wave irrespective of stage at which the treatment was given, with greater synchrony of ovulations in water buffalo.

  10. Conception rate after fixed time insemination following ovsynch protocol with and without progesterone supplementation in cyclic and non-cyclic Mediterranean Italian buffaloes (Bubalus bubalis).

    PubMed

    De Rensis, F; Ronci, G; Guarneri, P; Nguyen, Bui Xuan; Presicce, G A; Huszenicza, G; Scaramuzzi, R J

    2005-04-15

    The aim of this study was to test the effect of progesterone supplementation to Ovsynch protocol in cyclic and non-cyclic Mediterranean Italian buffaloes on conception rate after fixed time artificial insemination. From 169 pluriparous buffaloes, 2 groups were identified and subjected to: (1) Ovsynch protocol (OV; n=83) and (2) Ovsynch protocol with the supplementation of progesterone from days 0 to 7 (OV+PROG.; n=86). All cows were inseminated 16-20 h after the second GnRH administration. Within each group, non-cyclic buffaloes were identified (OV=21 and OV+PROG.=20). Overall conception rate was significantly higher in cyclic compared to non-cyclic buffaloes: 43.7% versus 17.0%, respectively, P=0.001. A significant effect of progesterone supplementation on conception rate was observed in non-cyclic buffaloes (30% versus 4.7%, P=0.04) but not in cyclic buffaloes (51.5% versus 35.7%, P=0.077). Collectively, the presence of a large follicle (>or=10 mm) detected at the beginning of the Ovsynch protocol by ultrasound significantly affected conception rate (44% versus 8%, P=0.01). The findings of the present study suggest that (i) progesterone supplementation to the Ovsynch protocol in buffaloes increases conception rate in non-cyclic animals, (ii) the presence of a large follicle at the beginning of the Ovsynch protocol is a determining factor for a successful synchronization of ovulation and high conception rates and (iii) ultrasound monitoring can improve the overall efficiency by selectively identifying more suitable cycling animals carrying a responsive follicle at the time of first GnRH administration. PMID:15823341

  11. Clinical and biochemical studies on Theileria annulata in Egyptian buffaloes (Bubalus bubalis) with particular orientation to oxidative stress and ketosis relationship.

    PubMed

    El-Deeb, Wael M; Younis, Emad E

    2009-10-14

    This study was carried out on 68 Theileria annulata naturally infected buffaloes in addition to 25 parasitologically free buffaloes distributed in small herds at Dakahlia and Gharbya governorates, Egypt, to demonstrate the clinical picture associated with theileriosis in this buffaloes with particular emphasis to the oxidative stress and ketosis relationship. Clinical signs recorded in infected buffaloes were in the form of fever, enlargement of one or more lymph node, ocular discharge, corneal opacity, skin lesions, decreased milk yield, pale mucous membrane and anorexia. Blood and serum analysis revealed significant (pbuffaloes.

  12. Evaluation of the card agglutination test (CATT/T. evansi) for detection of Trypanosoma evansi infection in water buffaloes (Bubalus bubalis) in Egypt.

    PubMed

    Hilali, M; Abdel-Gawad, A; Nassar, A; Abdel-Wahab, A; Magnus, E; Büscher, P

    2004-05-01

    A card agglutination test (CATT/T. evansi) was evaluated for detection of antibodies against Trypanosoma evansi (T. evansi) in experimentally and naturally infected buffaloes. Four calves were inoculated with a strain of T. evansi isolated from a dromedary camel. Parasitological examination of the calves revealed trypanosomes in the blood from days 4 to 9 post-inoculation (PI). General emaciation appeared from day 26 PI and aggravated until the end of the experiment (day 88 PI). Antibodies against T. evansi were detectable from day 8 PI till the end of the experiment. Parasitological examination of 200 water buffalo blood samples obtained from slaughterhouses revealed negative results. Serological examination of these animals showed that 48 (24%) water buffaloes had anti-T. evansi antibodies. PMID:15110402

  13. Short communication: Variable number of tandem repeat polymorphisms in DGAT1 gene of buffaloes (Bubalus bubalis) is associated with milk constituents.

    PubMed

    Cardoso, D F; de Souza, G F P; Aspilcueta-Borquis, R R; Araujo Neto, F R; de Camargo, G M F; Hurtado-Lugo, N A; Scalez, D C B; de Freitas, A C; Albuquerque, L G; Tonhati, H

    2015-05-01

    The diacylglycerol-O-transferase 1 gene is a positional and functional candidate for milk composition traits. The objective of this study was to evaluate the segregation of the variable number of tandem repeat polymorphisms in the regulatory region of diacylglycerol-O-transferase 1 gene in a water buffalo herd, and to assess the association of this mutation with milk production traits. For this purpose, 196 Murrah buffalo cows were genotyped by PCR. The association of the marker with total milk, fat, and protein yields at 305 d of lactation, milk fat and protein percentage, and somatic cell scores were evaluated by single-trait analyses using a generalized mixed model. Two segregating alleles were identified in the population. The allele with 2 repeats affected fat percentage favorably. The present results suggest that this polymorphism is an interesting marker to include in the genetic evaluation of buffaloes.

  14. Evaluation of the card agglutination test (CATT/T. evansi) for detection of Trypanosoma evansi infection in water buffaloes (Bubalus bubalis) in Egypt.

    PubMed

    Hilali, M; Abdel-Gawad, A; Nassar, A; Abdel-Wahab, A; Magnus, E; Büscher, P

    2004-05-01

    A card agglutination test (CATT/T. evansi) was evaluated for detection of antibodies against Trypanosoma evansi (T. evansi) in experimentally and naturally infected buffaloes. Four calves were inoculated with a strain of T. evansi isolated from a dromedary camel. Parasitological examination of the calves revealed trypanosomes in the blood from days 4 to 9 post-inoculation (PI). General emaciation appeared from day 26 PI and aggravated until the end of the experiment (day 88 PI). Antibodies against T. evansi were detectable from day 8 PI till the end of the experiment. Parasitological examination of 200 water buffalo blood samples obtained from slaughterhouses revealed negative results. Serological examination of these animals showed that 48 (24%) water buffaloes had anti-T. evansi antibodies.

  15. Bovine papillomavirus type 2 infects the urinary bladder of water buffalo (Bubalus bubalis) and plays a crucial role in bubaline urothelial carcinogenesis.

    PubMed

    Roperto, Sante; Russo, Valeria; Ozkul, Ayhan; Sepici-Dincel, Aylin; Maiolino, Paola; Borzacchiello, Giuseppe; Marcus, Ioan; Esposito, Iolanda; Riccardi, Marita Georgia; Roperto, Franco

    2013-02-01

    Bovine papillomavirus type 2 (BPV-2) has been shown to infect and play a role in urinary bladder carcinogenesis of buffaloes grazed on pastures with ferns from the Marmara and Black Sea Regions of Turkey. BPV-2 DNA has been found in both neoplastic and non-neoplastic lesions of the urinary bladder. Furthermore, this virus may be a normal inhabitant of the urinary bladder since BPV-2 DNA has also been detected in clinically normal buffaloes. The viral activation by fern immunosuppressant or carcinogen may trigger the urothelial cell transformation. The E5 oncoprotein was solely detected in urothelial tumours and appeared to be co-localized with the overexpressed and phosphorylated platelet derived growth factor (PDGF) β receptor in a double-colour immunofluorescence assay. Our results indicate that the E5-PDGF β receptor interaction also occurs in spontaneous tumours of the bubaline urinary bladder, revealing an additional role of BPV-2 in bladder carcinogenesis of buffaloes.

  16. Impact of buserelin acetate or hCG administration on day 12 post-ovulation on subsequent luteal profile and conception rate in buffalo (Bubalus bubalis).

    PubMed

    Pandey, A K; Ghuman, S P S; Dhaliwal, G S; Kumar, Ajeet; Agarwal, S K

    2013-01-30

    The present study investigated the impact of gonadotropic hormone administration on day 12 post-ovulation on subsequent luteal profile and conception rate in buffaloes. All the buffaloes (n=48) were estrus synchronized by a synthetic analogue of prostaglandin F(2α) (PGF(2α)), administered 11 days apart, followed by insemination during mid to late estrus. To examine the effect of mid-luteal phase hormonal treatment, buffaloes were randomly divided into control (normal saline, n=14), d12-BA (buserelin acetate, 20μg, n=17) and d12-hCG (hCG, 3000IU, n=17) groups. Ovaries were scanned on the day of induced estrus to measure the preovulatory follicle (POF) diameter and on days 5, 12, 16 and 21 post-ovulation to examine the alterations in corpus luteum (CL) diameter. On the day of each sonography, blood samples were collected for the estimation of plasma progesterone. In treatment groups, luteal profile (CL diameter and plasma progesterone) on day 16-21 post-ovulation was better (P<0.05) as well as first service conception rate was higher (52.9% in each treatment group vs. 28.6%, P>0.05) compared to controls. All the pregnant buffaloes exhibited higher (P<0.05) plasma progesterone on various post-ovulation days than their respective non-pregnant counterparts. Treatment-induced accessory corpus luteum (ACL) formation was observed in 58.8 per cent and 70.6 per cent buffaloes of d12-BA and d12-hCG group, respectively, that also had higher (P<0.05) plasma progesterone compared to controls. Compared to the spontaneous CL, the diameter of ACL was less (P<0.05) in the treatment groups. In conclusion, buserelin acetate and hCG administration on day 12 post-ovulation leads to accessory CL formation, improves luteal profile and consequently increases conception rate in buffaloes.

  17. Identification, molecular characterization, and tissue expression of parathyroid hormone-related protein gene (PTHrP) from water buffalo (Bubalus bubalis).

    PubMed

    Liu, J; Qian, L D; Huo, J L; Bi, B L; Li, D L; Wang, S F; Chen, T; Li, L J; Mao, H M; Miao, Y W

    2015-03-27

    Parathyroid hormone-related protein (PTHrP) is involved in the deposition of milk calcium in mammal lactation, but its role in buffalo is unclear. In this study, the full-length coding sequence of the water buffalo PTHrP gene was first isolated using reverse transcription-polymerase chain reaction. The protein was then subjected to molecular characterization using bioinformatic methods, and the tissue expression pattern was further assayed by semi-quantitative reverse-transcription polymerase chain reaction. The water buffalo PTHrP gene contains an open reading frame of 534 base pairs encoding a polypeptide of 177 amino acid residues, a theoretical molecular weight of 20.32 kDa, and an isoelectric point of 10.00. In addition, water buffalo PTHrP was predicted to contain a signal peptide, a typical hydrophobic region with no hydrophobic transmembrane regions, and to exert its function in the cell nucleus. A conserved domain of parathyroid superfamily from amino acids 34-114 was observed in the polypeptide. Sequence comparison and the phylogenetic analysis showed that the sequence of the water buffalo PTHrP protein shared high homology with that of other mammals, particularly cattle and goat. Among the 16 tissues examined, the PTHrP gene was only expressed in adipose tissue, placenta, uterine wall, hypophysis, and mammary gland tissue, but gene expression levels were higher in the uterus wall and adipose tissue. The results of this study suggest that the PTHrP gene plays an important role in the deposition of milk calcium of water buffalo.

  18. Dietary Inorganic Chromium in Summer-Exposed Buffalo Calves (Bubalus bubalis): Effects on Biomarkers of Heat Stress, Immune Status, and Endocrine Variables.

    PubMed

    Kumar, Muneendra; Kaur, Harjit; Deka, Rijusmita Sarma; Mani, Veena; Tyagi, Amrish Kumar; Chandra, Gulab

    2015-09-01

    The aim of this study was to evaluate the effect of different levels of inorganic chromium (Cr) on heat stress, immune response, and hormonal variation in Murrah buffalo calves during the summer season. Twenty-four growing Murrah buffalo calves were randomly allocated into four treatments for a period of 120 days. Feeding regimen was same in all the groups, except the buffalo calves in treatment groups were additionally supplemented with 0.5, 1.0, and 1.5 mg of inorganic Cr/kg dry matter. Buffalo calves were monitored daily for physiological variables and dry matter intake (DMI) and fortnightly for body weight change. Blood samples were collected at day 0, 15, 30, 45, 60, 75, 90, 105, and 120 and analyzed for heat shock protein 70 (Hsp 70), lymphocyte proliferation, neutrophil phagocytic activity, immunoglobulin, ferric reducing antioxidant power (FRAP) assay, insulin, cortisol and thyroid hormones, and Cr levels. Dietary Cr supplementation did not have any effect on DMI, growth performance, and physiological variables. However, lymphocyte proliferation, neutrophil phagocytic activity, plasma immunoglobulin, FRAP value, and plasma Cr concentration increased significantly (P < 0.05) with increase in levels of Cr. Adding Cr to the diet of summer-exposed buffalo calves did not show any effect on plasma levels of thyroid hormone, while concentration of insulin, cortisol, and Hsp 70 decreased (P < 0.05). Supplementation of inorganic Cr to the diet of buffalo calves reared under high ambient temperature improved heat tolerance, immune status without affecting nutrient intake, and growth performance. PMID:25762098

  19. Impact of Buserelin Acetate or hCG Administration on the Day of First Artificial Insemination on Subsequent Luteal Profile and Conception Rate in Murrah Buffalo (Bubalus bubalis).

    PubMed

    Pandey, A K; Ghuman, Sps; Dhaliwal, G S; Agarwal, S K; Phogat, J B

    2016-08-01

    This study was designed to investigate the impact of buserelin acetate (BA) or human chorionic gonadotropin (hCG) administration on the day of first artificial insemination (AI) on subsequent luteal profile (diameter of corpus luteum (CL) and plasma progesterone) and conception rate in Murrah buffalo. The present experiment was carried out at two locations in 117 buffalo that were oestrus-synchronized using cloprostenol (500 μg) administered (i.m.) 11 days apart followed by AI during standing oestrus. Based on treatment (i.m.) at the time of AI, buffalo were randomly categorized (n = 39 in each group) into control (isotonic saline solution, 5 ml), dAI-BA (buserelin acetate, 20 μg) and dAI-hCG (hCG, 3000 IU) group. Out of these, 14 buffalo of each group were subjected to ovarian ultrasonography on the day of oestrus to monitor the preovulatory follicle and on days 5, 12, 16 and 21 post-ovulation to monitor CL diameter. On the day of each sonography, jugular vein blood samples were collected for the estimation of progesterone concentrations. All the buffalo (n = 117) were confirmed for pregnancy on day 40 post-ovulation. The conception rate was better (p < 0.05) in dAI-BA (51.3%) and dAI-hCG (66.7%) groups as compared to their control counterparts (30.8%). Furthermore, the buffalo of dAI-hCG group had improved (p < 0.05) luteal profile, whereas the buffalo of dAI-BA group failed (p > 0.05) to exhibit stimulatory impact of treatment on luteal profile when compared to control group. In brief, buserelin acetate or hCG treatment on the day of first AI leads to an increase in conception rate; however, an appreciable impact on post-ovulation luteal profile was observed only in hCG-treated Murrah buffalo. PMID:27170495

  20. Cholesterol and fatty acid composition of longissimus thoracis from water buffalo (Bubalus bubalis) and Brahman-influenced cattle raised under savannah conditions.

    PubMed

    Giuffrida-Mendoza, Maria; Arenas de Moreno, Lilia; Huerta-Leidenz, Nelson; Uzcátegui-Bracho, Sojan; Valero-Leal, Kutchynskaya; Romero, Sonia; Rodas-González, Argenis

    2015-08-01

    Male (n=66) water buffalo (Buffalo) and Brahman-influenced cattle (Brahman) were born, raised, weaned, fattened on grazing savannah and harvested at two different ages (19 and 24months) to compare lipid composition of the longissimus thoracis muscle. Half of the animals were castrated at seven months of age (MOA) to examine the castration effects. At 24 MOA Brahman steers showed the highest content of total lipids (P<0.05). No significant variation was detected in cholesterol content for either the main or interaction effects in the age groups. Some individual fatty acids varied with the species (P<0.05), however, interspecific similarities were found in fatty acid ratios. For health-related indices, only atherogenic index (AI) showed lower values in favor of Buffalo meat (P<0.05) at both harvesting ages. Although, meat derived from both bovid groups was leaner and showed lower cholesterol level, AI indicates that Buffalo meat might be beneficial from a human health standpoint.

  1. Cholesterol and fatty acid composition of longissimus thoracis from water buffalo (Bubalus bubalis) and Brahman-influenced cattle raised under savannah conditions.

    PubMed

    Giuffrida-Mendoza, Maria; Arenas de Moreno, Lilia; Huerta-Leidenz, Nelson; Uzcátegui-Bracho, Sojan; Valero-Leal, Kutchynskaya; Romero, Sonia; Rodas-González, Argenis

    2015-08-01

    Male (n=66) water buffalo (Buffalo) and Brahman-influenced cattle (Brahman) were born, raised, weaned, fattened on grazing savannah and harvested at two different ages (19 and 24months) to compare lipid composition of the longissimus thoracis muscle. Half of the animals were castrated at seven months of age (MOA) to examine the castration effects. At 24 MOA Brahman steers showed the highest content of total lipids (P<0.05). No significant variation was detected in cholesterol content for either the main or interaction effects in the age groups. Some individual fatty acids varied with the species (P<0.05), however, interspecific similarities were found in fatty acid ratios. For health-related indices, only atherogenic index (AI) showed lower values in favor of Buffalo meat (P<0.05) at both harvesting ages. Although, meat derived from both bovid groups was leaner and showed lower cholesterol level, AI indicates that Buffalo meat might be beneficial from a human health standpoint. PMID:25879797

  2. A PCR-based RFLP analysis of Sarcocystis cruzi (Protozoa: Sarcocystidae) in Yunnan Province, PR China, reveals the water buffalo (Bubalus bubalis) as a natural intermediate host.

    PubMed

    Li, Qing-Qing; Yang, Zha-Qing; Zuo, Yang-Xian; Attwood, S W; Chen, Xin-Wen; Zhang, Ya-Ping

    2002-12-01

    A polymerase chain reaction-based restriction fragment length polymorphism (RFLP) approach is used to examine Sarcocystis cruzi-like taxa from the atypical intermediate host, water buffalo, in Yunnan, People's Republic of China. The loci examined lie within the 18S rRNA gene. A total of 15 water buffalo isolates are compared with those of 10 S. cruzi from cattle. RFLP patterns for the S. cruzi isolates from cattle and the S. cruzi-like taxon from water buffalo are found to be identical with all the 12 restriction enzymes used. Interpopulation variation between samples from Kunming and Gengma (Yunnan) is found to be undetectable at these loci for both S. cruzi and the S. cruzi-like taxon. But RFLPs are found between the S. cruzi taxa and S. suihominis from pigs at the same study sites. These findings support the hypothesis that S. cruzi is able to use the water buffalo as an intermediate host and is not restricted to cattle as was previously supposed.

  3. Identification of Sarcocystis hominis-like (Protozoa: Sarcocystidae) cyst in water buffalo (Bubalus bubalis) based on 18S rRNA gene sequences.

    PubMed

    Yang, Z Q; Zuo, Y X; Ding, B; Chen, X W; Luo, J; Zhang, Y P

    2001-08-01

    DNA templates were extracted from isolates of Sarcocystis hominis-like cysts collected from cattle and water buffalo, as well as from Sarcocystis fusiformis cysts and Sarcocystis suihominis cysts. The 18S rRNA genes were amplified using DNA from a single cyst as the templates. Approximately 1,367-1,440 bp sequences were obtained. The sequence difference in isolates of Sarcocystis hominis-like cysts from water buffaloes, and isolates of S. hominis cysts from cattle were very low, only about 0.1%, much lower than the lowest value (1.7%) among different species. Combined with their morphological structure, these sequence data indicate that the 4 isolates from cattle and water buffalo might be the same species, i.e., S. hominis, suggesting that both cattle and water buffalo may serve as the intermediate hosts for this parasite. Apparently, this is the first report using a single cyst to do such work and is a useful way to distinguish the Sarcocystis cyst in an intermediate host that may be simultaneously infected by several different Sarcocystis species.

  4. Occurrence of conjugated linoleic acid in longissimus dorsi muscle of water buffalo (Bubalus bubalis) and zebu-type cattle raised under savannah conditions.

    PubMed

    de Mendoza, M Giuffrida; de Moreno, L Arenas; Huerta-Leidenz, N; Uzcátegui-Bracho, S; Beriain, M J; Smith, G C

    2005-01-01

    Lipid extracts from longissimus dorsi muscles of 64 water buffaloes and 68 zebu-type cattle were used to quantify the amount (mg/g of lipids) of total conjugated linoleic acid (CLA), CLA isomers c9, t11 and t10, c12 and linoleic acid (LA), according to species (buffaloes and cattle), age (slaughter groups at 7, 17, 19 or 24 months of age) and gender (bulls and steers). The effects of gender and age were significant (P<0.05) but marginal. Comparisons of lipid extracts from buffaloes vs. cattle showed that total CLA (1.83 vs. 1.47 mg/g), CLA c9, t11 (1.27 vs. 1.01 mg/g) and CLA t10, c12 (0.56 vs. 0.47 mg/g) isomers as well as the CLA/LA ratio (0.10 vs. 0.07) were higher (P<0.05) in buffalo lipids. Considering the sparingly low lipid concentrations (<2 g/100 g of fresh muscle) none of the meat species should be considered a significant source of CLA.

  5. Effects of long-term growth hormone-releasing factor administration on plasma growth hormone, luteinizing hormone and progesterone profiles in growing female buffaloes (Bubalus bubalis).

    PubMed

    Mondal, M; Prakash, B S

    2004-10-01

    To investigate the effects of long-term growth hormone-releasing factor (GRF) administration on plasma growth hormone (GH), LH and progesterone and body weight gain in growing buffalo calves, 12 female Murrah buffaloes within the age group of 6-8 months of age were divided into two groups (treatment and control groups) of six each in such a way so that average body weights between the groups did not differ (p > 0.05). Control buffaloes were not given any hormonal treatment and treatment group buffaloes were treated with synthetic bovine GRF [bGRF (1-44)-NH(2)] at the rate of 10 microg/100 kg body weight intravenously at an interval of 15 days from week 6 (5-week pre-treatment period) till 18 injections were completed (week 6-42 treatment period) and thereafter, effect of exogenous GRF were observed for 10-week post-treatment period. Jugular blood samples were drawn twice a week at 3-4-day intervals for plasma GH, LH and progesterone quantification. Body weight of all animals was recorded twice a week. During pre-treatment period, mean plasma GH, LH and progesterone did not differ (p > 0.05) between the groups. But during treatment as well as post-treatment period, mean plasma GH levels were found to be significantly (p < 0.01) higher in treatment than control group of buffaloes. Administration of GRF for longer term sustained a higher level of plasma GH even after cessation of treatment. GRF-treated buffaloes attained higher (p < 0.01) body weight than the controls. Repeated GRF administration for long-term significantly (p < 0.01) increased plasma LH and progesterone. In conclusion, repeated long-term exogenous GRF administration induces and even enhances GH release without any sign of refractoriness. GRF may, therefore, be used to induce daily GH release without loss of responsiveness over an extended period of time in young growing female buffaloes and it may assist these animals to grow faster. PMID:15367266

  6. Changes in uterine protein secretion during luteal and follicular phases and detection of phosphatases during luteal phase of estrous cycle in buffaloes (Bubalus bubalis).

    PubMed

    Chandra Roy, Sudhir; Uma Suganthi, R; Ghosh, Jyotirmoy

    2006-04-15

    Changes in uterine proteins during different reproductive states and their functional significance though known in other species have not been established in buffaloes. An attempt has been made to unravel the changes in composition of buffalo uterine secretion with growth and regression of corpora-lutea during early, mid and late luteal and follicular phase of estrous cycle using gel filtration and electrophoresis techniques. Also the phosphatases activities in luteal phase uterine secretions have been studied. Gel filtration chromatography analysis revealed a protein peak in void volume of the column, the intensity of which was more in all the luteal phase samples than follicular phase samples. Alkaline phosphatase was also found eluted in the void volume. The other three uterus-specific peaks (Peaks V-VII) were detected below 13.7 kd molecular weight. There were at least five peaks of acid phosphatases activity in chromatogram. Silver staining of SDS-PAGE gel detected as many as 40 protein bands in the uterine fluid of which nine proteins were glycoproteins. Molecular weight (MW) comparison revealed the major protein band at 66 kd which could be serum albumin. Comparison of uterine proteins with serum protein bands revealed a 93.5 kd glycoprotein in buffalo serum that did not appear in uterine fluid and at least 11 uterus-specific protein bands (506, 470, 241, 114, 49, 38, 33, 26, 19.2, 16, and 14.3 kd). The 38 and 19.2 kd bands were luteal-stage specific. Intense periodic acid Schiff's (PAS) stained bands in uterine proteins compared to serum indicated glycosylation process in endometrial epithelial cells. The study suggested that buffalo uterine secretion contained mainly serum and several uterus-specific proteins of which few were luteal phase specific. Further study on characterizing the unique or most abundant proteins and defining their role in uterine functions would help to address the cause of low reproduction rate in buffaloes. PMID:16213013

  7. Impact of buserelin acetate or hCG administration on day 5 post-ovulation on subsequent luteal profile and conception rate in Murrah buffalo (Bubalus bubalis).

    PubMed

    Pandey, A K; Dhaliwal, G S; Ghuman, S P S; Agarwal, S K

    2015-11-01

    The present study aimed to establish the impact of buserelin acetate or hCG administration on day 5 post-ovulation on subsequent luteal profile and conception rate in buffalo. The buffalo (n=45) were subjected to an estrous synchronization protocol (synthetic analog of PGF2α administered, through intramuscular route, 11 days apart), followed by artificial insemination (AI) during mid to late estrus. On day 5 post-ovulation, buffalo were administered (i.m.) normal saline (Control, n=14), buserelin acetate (20μg, d5-BA, n=14) or human chorionic gonadotropin (3000IU, d5-hCG, n=17). Ovarian ultrasonography was conducted on the day of induced estrus and on days 0, 5, 12, 16 and 21 post-ovulation to assess preovulatory follicle or corpus luteum (CL) diameter. Also, on these days, jugular vein blood sampling was conducted for the estimation of plasma progesterone. First service conception rate was greater (χ(2)=5.18, P>0.05) in d5-BA and d5-hCG groups (71.4% and 47.1%, respectively) as compared to control (28.6%). Both treatment groups had a greater (P<0.05) CL diameter and plasma progesterone during the post-treatment period in comparison to that control treatment group. Treatment-induced accessory CL formation was observed in 92.9% and 76.5% buffalo of d5-BA and d5-hCG groups, respectively. In conclusion, buserelin acetate and hCG administration on day 5 post-ovulation leads to accessory CL formation that may have a role in enhancing conception rate.

  8. Comparative genomic analysis of buffalo (Bubalus bubalis) NOD1 and NOD2 receptors and their functional role in in-vitro cellular immune response.

    PubMed

    Brahma, Biswajit; Kumar, Sushil; De, Bidhan Chandra; Mishra, Purusottam; Patra, Mahesh Chandra; Gaur, Deepak; Chopra, Meenu; Gautam, Devika; Mahanty, Sourav; Malik, Hrudananda; Malakar, Dhruba; Datta, Tirtha Kumar; De, Sachinandan

    2015-01-01

    Nucleotide binding and oligomerization domain (NOD)-like receptors (NLRs) are innate immune receptors that recognize bacterial cell wall components and initiate host immune response. Structure and function of NLRs have been well studied in human and mice, but little information exists on genetic composition and role of these receptors in innate immune system of water buffalo--a species known for its exceptional disease resistance. Here, a comparative study on the functional domains of NOD1 and NOD2 was performed across different species. The NOD mediated in-vitro cellular responses were studied in buffalo peripheral blood mononuclear cells, resident macrophages, mammary epithelial, and fibroblast cells. Buffalo NOD1 (buNOD1) and buNOD2 showed conserved domain architectures as found in other mammals. The domains of buNOD1 and buNOD2 showed analogy in secondary and tertiary conformations. Constitutive expressions of NODs were ubiquitous in different tissues. Following treatment with NOD agonists, peripheral lymphocytes showed an IFN-γ response along-with production of pro-inflammatory cytokines. Alveolar macrophages and mammary epithelial cells showed NOD mediated in-vitro immune response through NF-κB dependent pathway. Fibroblasts showed pro-inflammatory cytokine response following agonist treatment. Our study demonstrates that both immune and non-immune cells could generate NOD-mediated responses to pathogens though the type and magnitude of response depend on the cell types. The structural basis of ligand recognition by buffalo NODs and knowledge of immune response by different cell types could be useful for development of non-infective innate immune modulators and next generation anti-inflammatory compounds.

  9. Optimization of embryo culture conditions for increasing efficiency of cloning in buffalo (Bubalus bubalis) and generation of transgenic embryos via cloning.

    PubMed

    Wadhwa, Neerja; Kunj, Neetu; Tiwari, Shuchita; Saraiya, Megha; Majumdar, Subeer S

    2009-09-01

    Cloning in bovine species is marred by low efficiency of blastocyst formation. Any increase in the efficiency of blastocyst formation upon nuclear transfer will greatly enhance the efficiency of cloning. In the present study, the effect of various media, protein sources, and growth factors on the development of cloned buffalo embryos was evaluated. Among various combinations tested, culture of cloned embryos in TCM-199 media on the feeder layer of Buffalo Oviductal Epithelial Cells (BOEC) in the presence of bovine serum albumin-free fatty acid (BSA-FFA) and leukemia inhibitory factor (LIF) provided most suitable environment for efficient development of cloned blastocysts. Under these conditions, we achieved a blastocyst formation rate of 43%, which is better than those reported previously. Because preimplantation embryonic development, in vivo, occurs in an environment of oviductal cells, the blastocysts generated by this method may presumably be more suitable for implantation and further development. Additionally, we generated green blastocysts from enucleated oocytes by transfer of nuclei from cells transfected with EGFP transgene, showing possibility of transgenesis via cloning in this species. To our knowledge, this is the first report regarding the production of transgenic cloned buffalo embryos and their developmental competence with respect to various media, cocultures, and supplements.

  10. Differences in developmental competence and gene expression profiles between buffalo (Bubalus bubalis) preimplantation embryos cultured in three different embryo culture media.

    PubMed

    Sadeesh, E M; Selokar, N L; Balhara, A K; Yadav, P S

    2016-10-01

    The objective of this study was to compare effects of in vitro culture systems on embryonic development and expression patterns of developmentally important genes in preimplantation buffalo embryos. After IVM/IVF presumptive zygotes were cultured in one of three systems: undefined TCM-199, mCR2aa medium supplemented with 10 % FBS and defined PVA-myo-inositol-phosphate-EGF medium. No (P > 0.05) differences at 2-cell, 4-cell and 8-cell to 16- cell stages were observed among the three cultured media used, however, increased (P < 0.05) blastocyst yield, cell number and hatching rate were found in defined medium compared to undefined media. The expression patterns of genes implicated in embryo metabolism (GLUT-1), anti-apoptosis (BCL-2), imprinting (IGF-2R), DNA methylation (DNMT-3A) and maternal recognition of pregnancy (IFNT) were increased (P < 0.05) in hatched blastocysts derived from defined medium compared to undefined media. In conclusion, serum-free, defined medium improved developmental competence of in vitro cultured buffalo embryos. Whether these differences in morphological development and gene expression have long-term effects on buffalo calves born after embryo transfer remains unknown. However, it is possible that early adaptations of the preimplantation embryo to its environment persist during fetal and post-natal development. PMID:27481470

  11. The effect of evolution on homologous proteins: a comparison between the chromophore microenvironments of Italian water buffalo (Bos bubalus, L.) and sperm whale apomyoglobin.

    PubMed

    Colonna, G; Irace, G; Parlato, G; Aloj, S M; Balestrieri, C

    1978-02-15

    The perturbing effect of guanidium hydrochloride and pH on the molecular structure of water buffalo apomyoglobin has been investigated by circular dichroism in the far and near ultraviolet and by fluorescence. In the wavelength region between 320 and 260 nm the circular dichroic spectrum of the globin is highly structured and the contributions of the aromatic chromophores have been resolved. Buffalo apomyoglobin undergoes a structural transition at neutral pH which involves elements of the secondary and tertiary structure, as indicated by changes of dichroic activity of the peptide and aromatic chromophores and the fluorescence of the two tryptophanyl residues. The possibility of charge-transfer complex between indole and imidazole is discussed. A major structural transition with abrupt unfolding takes place in the pH region between 5.6 and 4.3. Below pH 4.3 the peptide helical residues, which survive the acid transition, appear to be resistent to further acidification to pH 2.0 while tryptophanyl emission is quenched and shifted to longer wavelengths. A structural transition occurs also in alkali above pH 10, which has been detected by the same techniques. The relationships between buffalo and sperm whale apomyoglobin are discussed.

  12. Pregnancies established from water buffalo (Bubalus bubalis) blastocysts derived from in vitro matured, in vitro fertilized oocytes and co-cultured with cumulus and oviductal cells.

    PubMed

    Madan, M L; Chauhan, M S; Singla, S K; Manik, R S

    1994-09-01

    Buffalo ovaries were collected immediately after slaughter and were transported to laboratory in sterile saline at 37 degrees C. Follicular oocytes with the cumulus mass aspirated from 2 to 6 mm in diameter follicles were cultured in TCM-199 medium supplemented with 10% buffalo estrus serum (BES) in 5% CO(2) at 38.5 degrees C. After 20 to 24 h of incubation, the oocytes were inseminated with precapacitated frozen thawed spermatozoa for 6 h. The fertilization rate was 78.15% of the matured oocytes. Over an in vitro culture period of 3 to 9 d, 4.02% of the inseminated oocytes developed to the morula stage when cultured with cumulus cells alone and 17.83% when cumulus cells plus oviductal epithelial cells were used. The percentage of developed blastocysts was very low (0.57%) when the oocytes were co-cultured with cumulus cells from the original oocytes. However, 8% of the inseminated oocytes that were denuded 3 d after insemination developed to the blastocyst stage when they were co-cultured with cumulus and oviductal epithelial cells. Sixteen early/expanded blastocysts were transferred non-surgically to 16 recipients. Four of the 16 recipients became pregnant, of which 2 delivered normal buffalo male calves.

  13. Immunolocalization of pulmonary intravascular macrophages, TLR4, TLR9 and IL-8 in normal and Pasteurella multocida-infected lungs of water buffalo (Bubalus bubalis).

    PubMed

    Sethi, R S; Brar, R S; Singh, O; Singh, B

    2011-01-01

    Water buffalo are of considerable economic significance in South East Asia, but these animals suffer from many bacterial respiratory diseases including haemorrhagic septicaemia caused by Pasteurella multocida. Bacterial respiratory diseases of animals cause lung inflammation that is characterized by the activation of Toll-like receptors (TLRs) expressed on macrophages, expression of chemokines and recruitment of neutrophils and monocytes. Pulmonary intravascular macrophages (PIMs) present in the alveolar septa play a critical role in lung inflammation, but there are no data on the immunolocalization of PIMs or the expression of TLRs and chemokines such as interleukin (IL)-8, in the lungs of water buffalo. The present study compares the occurrence of PIMs, TLR4, TLR9 and IL-8 in the lungs of normal water buffalo and those infected with P. multocida. Labelling of PIMs with the anti-human macrophage antibody (MCA874G) demonstrated an increase in this population in inflamed lungs. TLR4 and IL-8 were detected in the alveolar septa, airway epithelium and endothelium of large blood vessels of normal lungs. TLR9 expression was similar to that of TLR4, but TLR9 was not expressed by the endothelium of arteries and veins. While the expression of TLR9 and IL-8 was increased in the inflamed lungs compared with normal lungs, TLR4 labelling intensity remained unchanged or was reduced. The expression of these molecules potentially plays a role in the regulation of lung inflammation.

  14. Semi-quantitative RT-PCR analysis of fat metabolism genes in mammary tissue of lactating and non-lactating water buffalo (Bubalus bubalis).

    PubMed

    Yadav, Poonam; Mukesh, Manishi; Kataria, Ranjit Singh; Yadav, Anita; Mohanty, Ashok Kumar; Mishra, Bishnu Prasad

    2012-04-01

    Understanding the mechanism of milk fat synthesis and secretion is important for dairy industry, as the nature of the cream fraction influences the manufacturing properties and organoleptic qualities of milk and dairy products. So, there is a need to understand the mechanism of milk fat synthesis and to elucidate the key genes regulating milk fat synthesis by studying the expression of genes involved in milk fat synthesis. Present manuscript reports the expression of genes involved in milk fat synthesis and metabolism in buffalo mammary tissue. The expression of lipogenic genes was studied in lactating and non-lactating mammary tissue of water buffalo by semi-quantitative reverse transcription PCR expression analysis. The genes studied were acetyl-CoA carboxylase (ACACA), stearoyl-CoA desaturase (SCD), 3 hydroxybutyrate dehydrogenase (BDH), LIPIN, lipoprotein lipase (LPL), peroxisome proliferator-activated receptor gamma (PPARG), and sterol regulatory element binding protein (SREBF). The expression of ACACA, BDH, LIPIN, PPARG, LPL, and SREBF was higher in lactating as compared to non-lactating buffalo whereas no difference was found in the expression of SCD between both the stages.

  15. Expression and localization of vascular endothelial growth factor and its receptors in the corpus luteum during oestrous cycle in water buffaloes (Bubalus bubalis).

    PubMed

    Chouhan, V S; Panda, R P; Yadav, V P; Babitha, V; Khan, F A; Das, G K; Gupta, M; Dangi, S S; Singh, G; Bag, S; Sharma, G T; Berisha, B; Schams, D; Sarkar, M

    2013-10-01

    The aim of this study was to document the expression and localization of VEGF system comprising of VEGF isoforms (VEGF 120, VEGF 164 and VEGF 188) and their receptors (VEGFR1 and VEGFR2) in buffalo corpus luteum (CL) obtained from different stages of the oestrous cycle. Real-time RT-PCR (qPCR), Western blot and immunohistochemistry were applied to investigate mRNA expression, protein expression and localization of examined factors. In general, all the components of VEGF system (the VEGF isoforms and their receptors) were found in the water buffalo CL during the oestrous cycle. The mRNA as well as protein expression of VEGF system was highest during the early and mid-luteal phase, which later steadily decreased (p < 0.05) after day 10 to reach the lowest level in regressed CL. As demonstrated by immunohistochemistry, VEGF protein was localized predominantly in luteal cells; however, VEGFR1 and VEGFR2 were localized in luteal cells as well as in endothelial cells. In conclusion, the dynamics of expression and localization of VEGF system in buffalo corpora lutea during the luteal phase were demonstrated in this study, indicating the possible role of VEGF system in the regulation of luteal angiogenesis and proliferation of luteal as well as endothelial cells through their non-angiogenic function.

  16. Development of water buffalo (Bubalus bubalis) embryos from in vitro matured oocytes reconstructed with fetal skin fibroblast cells as donor nuclei.

    PubMed

    Meena, C R; Das, S K

    2006-07-01

    The present study was carried out to explore the feasibility of using buffalo fetal skin fibroblasts as donor nuclei and to find out the developmental competence of embryos following transfer of these nuclei to in vitro matured enucleated buffalo oocytes. Skin cells were isolated from 1 to 2-month-old fetuses obtained from slaughterhouse, by enzymatic digestion (0.5% w/v trypsin +0.05% w/v collagenase in Dulbecco's PBS) for 15-20 min. The cells were washed 4 times with Dulbecco's PBS and then once with RPMI-1640+10% FBS by centrifugation at 600 x g. The cells were then cultured in the same medium in a CO2 incubator (5% CO2 in air) at 38.5 degrees C for 2-3 days. Cumulus-oocyte complexes (COCs) collected from slaughterhouse buffalo ovaries were subjected to IVM in the IVM medium (TCM-199 + 5 microg/ml FSH-P + 10 microg/ml LH+10% FBS) for 20-22 h in a CO2 incubator (5% CO2 in air) at 38.5 degrees C. Oocytes were denuded with 0.1% trypsin followed by repeated pipetting and then enucleated by aspirating the first polar body with 10-15% of nearby cytoplasm with a micromanipulator. Two different types of donor cells (growing cells and those arrested with cytochalasin-B) were used for reconstruction of oocytes. The reconstructs were electro fused and incubated in the activation medium (TCM-199 + 8 microg/ml cytochalasin-B+10% FBS) for 4 h. These were then cultured in IVC medium (TCM-199+10% FBS) in a CO2 incubator (5% CO2 in air) at 38.5 degrees C for 48 h. The cleaved embryos were then co-cultured with buffalo oviduct cells in embryo development media (EDM). Out of 119 denuded matured oocytes which were enucleated and reconstructed with growing cells, 78 (65.5%) were electro fused, activated and cultured, out of which 4 (5.1%) reconstructs cleaved and developed to 2-cell stage, 3 (3.8%) reached to 4-cell stage and 3 (3.8%) reached to 8-cell stage. In the synchronized group, out of 62 denuded matured oocytes which were reconstructed with cytochalasin-B blocked cells, 40

  17. Exploring genetic polymorphism in innate immune genes in Indian cattle (Bos indicus) and buffalo (Bubalus bubalis) using next generation sequencing technology.

    PubMed

    Patel, Shreya M; Koringa, Prakash G; Nathani, Neelam M; Patel, Namrata V; Shah, Tejash M; Joshi, Chaitanya G

    2015-02-01

    Activation of innate immunity initiates various cascades of reactions that largely contribute to defense against physical, microbial or chemical damage, prompt for damage repair and removal of causative organisms as well as restoration of tissue homeostasis. Genetic polymorphism in innate immune genes plays prominent role in disease resistance capabilities in various breeds of cattle and buffalo. Here we studied single nucleotide variations (SNP/SNV) and haplotype structure in innate immune genes viz CHGA, CHGB, CHGC, NRAMP1, NRAMP2, DEFB1, BNBD4, BNBD5, TAP and LAP in Gir cattle and Murrah buffalo. Targeted sequencing of exonic regions of these genes was performed by Ion Torrent PGM sequencing platform. The sequence reads obtained corresponding to coding regions of these genes were mapped to reference genome of cattle BosTau7 by BWA program using genome analysis tool kit (GATK). Further variant analysis by Unified Genotyper revealed 54 and 224 SNPs in Gir and Murrah respectively and also 32 SNVs was identified. Among these SNPs 43, 36, 11,32,81,21 and 22 variations were in CHGA, CHGB, CHGC, NRAMP1, NRAMP2, DEFB1 and TAP genes respectively. Among these identified 278 SNPs, 24 were found to be reported in the dbSNP database. Variant analysis was followed by structure formation of haplotypes based on multiple SNPs using SAS software revealed a large number of haplotypes. The SNP discovery in innate immune genes in cattle and buffalo breeds of India would advance our understanding of role of these genes in determining the disease resistance/susceptibility in Indian breeds. The identified SNPs and haplotype data would also provide a wealth of sequence information for conservation studies, selective breeding and designing future strategies for identifying disease associations involving samples from distinct populations. PMID:26925373

  18. Exploring genetic polymorphism in innate immune genes in Indian cattle (Bos indicus) and buffalo (Bubalus bubalis) using next generation sequencing technology.

    PubMed

    Patel, Shreya M; Koringa, Prakash G; Nathani, Neelam M; Patel, Namrata V; Shah, Tejash M; Joshi, Chaitanya G

    2015-02-01

    Activation of innate immunity initiates various cascades of reactions that largely contribute to defense against physical, microbial or chemical damage, prompt for damage repair and removal of causative organisms as well as restoration of tissue homeostasis. Genetic polymorphism in innate immune genes plays prominent role in disease resistance capabilities in various breeds of cattle and buffalo. Here we studied single nucleotide variations (SNP/SNV) and haplotype structure in innate immune genes viz CHGA, CHGB, CHGC, NRAMP1, NRAMP2, DEFB1, BNBD4, BNBD5, TAP and LAP in Gir cattle and Murrah buffalo. Targeted sequencing of exonic regions of these genes was performed by Ion Torrent PGM sequencing platform. The sequence reads obtained corresponding to coding regions of these genes were mapped to reference genome of cattle BosTau7 by BWA program using genome analysis tool kit (GATK). Further variant analysis by Unified Genotyper revealed 54 and 224 SNPs in Gir and Murrah respectively and also 32 SNVs was identified. Among these SNPs 43, 36, 11,32,81,21 and 22 variations were in CHGA, CHGB, CHGC, NRAMP1, NRAMP2, DEFB1 and TAP genes respectively. Among these identified 278 SNPs, 24 were found to be reported in the dbSNP database. Variant analysis was followed by structure formation of haplotypes based on multiple SNPs using SAS software revealed a large number of haplotypes. The SNP discovery in innate immune genes in cattle and buffalo breeds of India would advance our understanding of role of these genes in determining the disease resistance/susceptibility in Indian breeds. The identified SNPs and haplotype data would also provide a wealth of sequence information for conservation studies, selective breeding and designing future strategies for identifying disease associations involving samples from distinct populations.

  19. Assessment of intracellular Ca2+, cAMP and 1,2-diacylglycerol in cryopreserved buffalo (Bubalus bubalis) spermatozoa on supplementation of taurine and trehalose in the extender.

    PubMed

    Singh, V K; Atreja, S K; Kumar, R; Chhillar, S; Singh, A K

    2012-08-01

    In mammalian spermatozoa, intracellular calcium plays a major role in sperm functions like motility and capacitation. Cryopreservation-induced modifications to sperm membrane result in an influx of intracellular calcium affecting calcium-dependent intracellular signalling pathways. Intracellular calcium activates adenyl cyclase to produce cAMP that activates phospholipase A(2) (PLA(2) ) and phospholipase C (PLC) generating lysophosphatidyl choline, 1,2-diacylglycerol (DAG) and IP(3) , acting as intracellular secondary messengers required for sperm capacitation. Present study was designed to determine levels of intracellular calcium, cAMP and DAG in fresh and frozen-thawed buffalo spermatozoa cryopreserved in the presence and absence of taurine or trehalose. A total number of nine ejaculates from three randomly chosen buffalo bulls were cryopreserved in Tris-based egg yolk extender and thawed in warm water at 37°C. The cAMP was measured by enzyme immuno assay, and intracellular calcium was quantified using fluorescent dye FURA 2-AM. Total lipid was extracted from spermatozoa, and DAG was estimated using thin layer chromatography followed by spectrophotometric analysis. Intracellular calcium, cAMP and DAG levels in spermatozoa were significantly (p < 0.01) increased following cryopreservation as compared to fresh ejaculate. Addition of taurine or trehalose to the freezing medium significantly decreased (p < 0.01) the levels of intracellular calcium and cAMP in frozen-thawed spermatozoa. 1,2-diacylglycerol content was also decreased significantly (p < 0.01) in spermatozoa cryopreserved in presence of additives. Moreover, significant (p < 0.01) improvement in post-thaw motility, viability and membrane integrity of spermatozoa on addition of taurine or trehalose clearly indicated the reduced level of capacitation-like changes in buffalo spermatozoa.

  20. Effect of source and dose of probiotics and exogenous fibrolytic enzymes (EFE) on intake, feed efficiency, and growth of male buffalo (Bubalus bubalis) calves.

    PubMed

    Malik, Raman; Bandla, Srinivas

    2010-08-01

    Probiotics of Lactobacillus acidophilus, Saccharomyces cerevisiae, and Aspergillus niger and three commercial exogenous fibrolytic enzymes (EFE) were tested in vitro to select best source and optimum dose followed by in vivo studies on male buffalo calves. Bacterial (P < 0.001) and protozoal population were increased significantly (P < 0.001) with probiotics and EFE. In vitro dry matter digestibility was more (P < 0.001) on L. acidophilus and then on S. cerevisiae. Dose required for L. acidophilus and S. cerevisiae probiotics was 1 x 10(9) and 3 x 10(9) cfu/flask, respectively. Cellulase and xylanase were effective at 4,000 and 12,500 IU/kg DM. In vitro cell wall digestibility was increased (P < 0.001) when probiotics and EFE were used together. Best source and optimum dose of probiotics and EFE were fed to 18 male buffalo calves with concentrate supplement (CS). Calves were randomly divided into three groups either without probiotics and EFE (CG) or with probiotics (EG(1)) or probiotics combined with EFE (EG(2)) on wheat straw diet. Organic matter, neutral detergent fiber, and acid detergent fiber digestibility was improved significantly. Average daily weight gain (ADG) and feed efficiency were significantly higher (P < 0.001) in EG(2) than EG(1) or CG. Final body weight was 4% and 12% and feed efficiency was 2.6% or 1.6% more (P < 0.001) in EG(2) compared to CG or EG(1), respectively. Fortification of CS with probiotics and EFE together had more impact on FE and ADG in buffalo calves. PMID:20401692

  1. Evaluation of Milk Trace Elements, Lactate Dehydrogenase, Alkaline Phosphatase and Aspartate Aminotransferase Activity of Subclinical Mastitis as and Indicator of Subclinical Mastitis in Riverine Buffalo (Bubalus bubalis).

    PubMed

    Guha, Anirban; Gera, Sandeep; Sharma, Anshu

    2012-03-01

    Mastitis is a highly morbid disease that requires detection at the subclinical stage. Tropical countries like India mainly depend on milch buffaloes for milk. The present study was conducted to investigate whether the trace minerals viz. copper (Cu), iron (Fe), zinc (Zn), cobalt (Co) and manganese (Mn) and enzyme activity of lactate dehydrogenase (LDH), alkaline phosphatase (ALP) and aspartate aminotransferase (AST) in riverine buffalo milk can be used as an indicator of subclinical mastitis (SCM) with the aim of developing suitable diagnostic kit for SCM. Trace elements and enzyme activity in milk were estimated with Atomic absorption Spectrophotometer, GBC 932 plus and biochemical methods, respectively. Somatic cell count (SCC) was done microscopically. The cultural examination revealed Gram positive bacteria as the most prevalent etiological agent. A statistically significant (p<0.01) increase in SCC, Fe, Zn, Co and LDH occurred in SCM milk containing gram positive bacterial agents only. ALP was found to be elevated in milk infected by both gram positive and negative bacteria. The percent sensitivity, specificity and accuracy, predictive values and likelihood ratios were calculated taking bacterial culture examination and SCC≥2×10(5) cells/ml of milk as the benchmark. Only ALP and Zn, the former being superior, were found to be suitable for diagnosis of SCM irrespective of etiological agents. LDH, Co and Fe can be introduced in the screening programs where Gram positive bacteria are omnipresent. It is recommended that both ALP and Zn be measured together in milk to diagnose buffalo SCM, irrespective of etiology. PMID:25049573

  2. Seasonal and Ageing-Depending Changes of Aquaporins 1 and 9 Expression in the Genital Tract of Buffalo Bulls (Bubalus bubalis).

    PubMed

    Arrighi, S; Bosi, G; Accogli, G; Desantis, S

    2016-08-01

    The presence of Aquaporins 1 (AQP1) and 9 (AQP9), integral membrane water channels that facilitate rapid passive movement of water and solutes, was immunohistochemically detected in the excurrent ducts collected from sexually mature buffalo bulls of proven fertility during the mating (late autumn-winter) and non-mating (late spring to the beginning of autumn) seasons. Furthermore, the research was performed also on the epididymal cauda of a senile buffalo bull with inactive testis. Aquaporins 1 and 9 were immunolocalized at distinct levels. In the efferent ducts, AQP1 immunoreactivity was strongly evidenced at the apical surface of the non-ciliated cells and weakly along the basal membrane of the epithelial cells. The latter reactivity disappeared during the non-mating season. No AQP1 immunoreactivity was detected in the epithelium of epididymis and vas deferens, whereas AQP1 was expressed in the smooth muscle layer of the vas deferens. Aquaporin 1 was present in the blood vessels and in small nerve bundles all along the genital tract. The supranuclear zone of the epididymal principal cells was AQP9 immunoreactive, limited to the corpus and cauda regions, and vas deferens. The samples collected in the two reproductive seasons showed a weaker AQP9 immunoreactivity during the non-mating season. A typical AQP9 immunoreactivity was noticed in the old buffalo examined. The tested AQP molecules showed a different expression pattern in comparison with laboratory mammals, primates, equine, dog and cat. In addition, seasonal differences were noticed which are possibly useful in regard to the comprehension of the morphophysiology of reproduction in the bubaline species, which are still a matter of debate.

  3. Seasonal and Ageing-Depending Changes of Aquaporins 1 and 9 Expression in the Genital Tract of Buffalo Bulls (Bubalus bubalis).

    PubMed

    Arrighi, S; Bosi, G; Accogli, G; Desantis, S

    2016-08-01

    The presence of Aquaporins 1 (AQP1) and 9 (AQP9), integral membrane water channels that facilitate rapid passive movement of water and solutes, was immunohistochemically detected in the excurrent ducts collected from sexually mature buffalo bulls of proven fertility during the mating (late autumn-winter) and non-mating (late spring to the beginning of autumn) seasons. Furthermore, the research was performed also on the epididymal cauda of a senile buffalo bull with inactive testis. Aquaporins 1 and 9 were immunolocalized at distinct levels. In the efferent ducts, AQP1 immunoreactivity was strongly evidenced at the apical surface of the non-ciliated cells and weakly along the basal membrane of the epithelial cells. The latter reactivity disappeared during the non-mating season. No AQP1 immunoreactivity was detected in the epithelium of epididymis and vas deferens, whereas AQP1 was expressed in the smooth muscle layer of the vas deferens. Aquaporin 1 was present in the blood vessels and in small nerve bundles all along the genital tract. The supranuclear zone of the epididymal principal cells was AQP9 immunoreactive, limited to the corpus and cauda regions, and vas deferens. The samples collected in the two reproductive seasons showed a weaker AQP9 immunoreactivity during the non-mating season. A typical AQP9 immunoreactivity was noticed in the old buffalo examined. The tested AQP molecules showed a different expression pattern in comparison with laboratory mammals, primates, equine, dog and cat. In addition, seasonal differences were noticed which are possibly useful in regard to the comprehension of the morphophysiology of reproduction in the bubaline species, which are still a matter of debate. PMID:27260501

  4. Analysis of genetic variations across regulatory and coding regions of kappa-casein gene of Indian native cattle (Bos indicus) and buffalo (Bubalus bubalis)

    PubMed Central

    Kishore, Amit; Mukesh, M.; Sobti, R.C.; Kataria, R.S.; Mishra, B.P.; Sodhi, Monika

    2014-01-01

    The promoter region of kappa-casein (κ-CN) gene in Indian native cattle and buffalo breeds was sequenced and analyzed for nucleotide variations. Sequence comparison across breeds of Indian cattle revealed a total of 7 variations in the promoter region, of which − 515 G/T, − 427 C/T, − 385 C/T, − 283 A/G and − 251 C/T were located within consensus binding sites for octamer-binding protein (OCT1)/pregnancy specific mammary nuclear factor (PMF), activator protein-2 (AP2), hepatocyte nuclear factor (HNF-1) and GAL4 transcription factors (TFs), respectively. These variations might be involved in gain or loss of potential transcription factor binding sites (TFBSs). Unlike the other 4 variants, the − 283 (A/G) variant located within HNF-1 TFBS was specific to Indian cattle as this change has not been observed in the Bos taurus sequence. Other TFBSs viz., MGF, TBP, NF-1, milk box and C/EBP were conserved across species. For the Indian native buffalo breeds, only 3 changes were identified in the promoter region; − 305 (A/C), − 160 (T/C) and − 141 (A/G) and most of the TFBSs were found to be conserved. However, deletion of two adjacent nucleotides located in and around binding site for C/EBP TF was identified in buffalo when compared with promoter sequence of bovine κ-CN. For κ-CN of Indian native cattle, a strong linkage disequilibrium (LD) was observed for variations 515 G/T, − 427 C/T and − 385 C/T in the promoter region; and for variations at codons 136 and 148 of exon-IV. Further, among intragenic haplotypes, variation − 427 C/T was found to be in LD with variations at codons 136 and 148. The information generated in the present work provides comprehensive characterization of κ-CN gene promoter and coding regions in Indian cattle and buffaloes and reported variations could become important candidates for carrying out further research in dairy traits. PMID:25606460

  5. A note on the effect of different methods of emasculation on gain in body weight in Indian buffalo (Bubalus bubalis) calves.

    PubMed

    Saxena, O P; Rao, G S

    1978-01-01

    The effect of Burdizzo, Russian and vasectomy methods of castration on the gain in body weight was studied over a period of 2 1/2 months in the buffalo calves of two age groups (1--1 1/2 years and 2 1/2--3 years). The gain in body weight (1--1 1/2 years age group) has been significantly greater (P less than 0.05) in the control animals (30.3 +/- 3.38 kg) as well as those emasculated by the vasectomy (31.3 +/- 1.4 kg) method in comparison to the other two methods. PMID:686390

  6. Mast cell and eosinophils in the wall of the gut and eosinophils in the blood stream during Toxocara vitulorum infection of the water buffalo calves (Bubalus bubalis).

    PubMed

    Neves, Maria F; Starke-Buzetti, Wilma A; Castro, Alessandra M M G

    2003-04-01

    Toxocara vitulorum is a pathogenic nematode from the small intestine of very young buffalo calves. To understand the development of the inflammatory responses in the wall of the gut, samples of tissues were removed from the duodenum, jejunum and ileum of buffalo calves naturally infected with T. vitulorum during the beginning of the infection, at the peak of egg output, as well as during the periods of rejection of the worms and post-rejection. Two additional control groups of uninfected calves (by anti-helminthic therapy of their mothers and after the birth) were also necropsied on days 30 and 50 after birth. Blood samples were fortnightly collected from birth to 174 days post-birth. Blood smears were prepared and stained with Giemsa for eosinophils. The parasitological status of buffalo calves was evaluated through weekly fecal egg counts (EPG) from 1 to 106 days after birth, which revealed that T. vitulorum egg shedding started on day 11, reached the peak of the infection on day 49 and finally expelled the parasites between days 50 and 85 after birth. In the infected buffalo calves, the mast cell population increased significantly, by two-fold in the mucosa (villus-crypt unit (VCU)) of the duodenum and four-fold in the proximal jejunum; but these increases were statistically significant only at the peak of the infection. Although mast cell numbers increased in the mucosa of the ileum as well as in both the submucosal and muscle tissues of the duodenum, proximal jejunum and ileum, the data was not significantly different from the controls. Eosinophil numbers increased in the mucosa of the duodenum (two-five times higher than the control) and proximal jejunum (three-five-fold) during the period of the infection (beginning, peak and rejection). The relative numbers of eosinophils increased in the blood stream from the second to the seventh week. In conclusion, T. vitulorum infection elicited mastocytosis and tissue eosinophilia in the duodenum and proximal jejunum

  7. Ultrastructural localization of wheat germ agglutinin binding sites on the sperm surface of water buffalo (Bubalus bubalis). A fracture label study.

    PubMed

    Bains, H K; Pabst, M A; Werner, G; Bawa, S R

    1993-10-01

    In the present study we have examined the plasma membrane surface organization employing fluorescein isothiocyanate linked wheat germ agglutinin (WGA) of the cauda epididymal and ejaculated spermatozoa of water buffalo. Intramembrane particle distribution pattern in the various segments of the spermatozoa has also been observed. WGA-ovomucoid gold has been used to study the distribution of sialoproteins on the sperm surface. With fracture label, WGA receptor sites have been identified on the fractured membrane halves of the sperm plasma membrane overlying the acrosome as well as the middle piece and the principle piece.

  8. Fatal Theileria orientalis N2 genotype infection among Asian water buffaloes (Bubalus bubalis) in a commercial dairy farm in Kerala, India.

    PubMed

    Vinodkumar, Kulangara; Shyma, Varikkottil; Justin, Davis Kollannur; Ashok, Sivasailam; Anu, Joseph Parassery; Mini, Kattilveetil; Muhammedkutty, Varikkottil; Sasidharan, Suchithra; Chullipparambil, Sunanda

    2016-01-01

    Fifteen dairy buffaloes of a farm in the state of Kerala, India developed fatal oriental theileriosis within 2 months of their procurement. Typical piroplasms of Theileria orientalis were observed in the erythrocytes of all affected animals by Giemsa-Leishman staining of blood smears. Case fatality rate was 87·5% (seven out of eight) in the clinically progressed cases. Therapeutic management with anti-theilerial drugs buparvaquone and oxytetracycline led to recovery of seven other animals in less advanced stages of the disease. The aim of this study was to determine the reasons for increased virulence of this pathogen, hitherto considered to be benign. Acute haemolytic anaemia was the predominant haematological finding in the affected animals. Lymphocytic infiltration and degeneration of vital organs leading to functional derangement was the cause of the high mortality. Identification of T. orientalis was confirmed by polymerase chain reaction (PCR). DNA sequencing of the PCR products revealed close identity with already reported sequences of T. orientalis/buffeli N2 genotype. The sequences were deposited in GenBank with accession number KM609973 and KM043772. Rhipicephalus ticks, previously not reported as vectors for oriental theileriosis, were identified as the potential vectors. This is the first report of fatal oriental theileriosis in Asian water buffaloes. PMID:26522773

  9. Fatal Theileria orientalis N2 genotype infection among Asian water buffaloes (Bubalus bubalis) in a commercial dairy farm in Kerala, India.

    PubMed

    Vinodkumar, Kulangara; Shyma, Varikkottil; Justin, Davis Kollannur; Ashok, Sivasailam; Anu, Joseph Parassery; Mini, Kattilveetil; Muhammedkutty, Varikkottil; Sasidharan, Suchithra; Chullipparambil, Sunanda

    2016-01-01

    Fifteen dairy buffaloes of a farm in the state of Kerala, India developed fatal oriental theileriosis within 2 months of their procurement. Typical piroplasms of Theileria orientalis were observed in the erythrocytes of all affected animals by Giemsa-Leishman staining of blood smears. Case fatality rate was 87·5% (seven out of eight) in the clinically progressed cases. Therapeutic management with anti-theilerial drugs buparvaquone and oxytetracycline led to recovery of seven other animals in less advanced stages of the disease. The aim of this study was to determine the reasons for increased virulence of this pathogen, hitherto considered to be benign. Acute haemolytic anaemia was the predominant haematological finding in the affected animals. Lymphocytic infiltration and degeneration of vital organs leading to functional derangement was the cause of the high mortality. Identification of T. orientalis was confirmed by polymerase chain reaction (PCR). DNA sequencing of the PCR products revealed close identity with already reported sequences of T. orientalis/buffeli N2 genotype. The sequences were deposited in GenBank with accession number KM609973 and KM043772. Rhipicephalus ticks, previously not reported as vectors for oriental theileriosis, were identified as the potential vectors. This is the first report of fatal oriental theileriosis in Asian water buffaloes.

  10. Comparison of the tuberculin test, histopathological examination, and bacterial culture for the diagnosis of tuberculosis (Mycobacterium bovis) in buffaloes (Bubalus bubalis) in Brazil.

    PubMed

    Albernaz, Tatiane Teles; Oliveira, Carlos Magno Chaves; Lima, Danillo Henrique da Silva; da Silva e Silva, Natália; Cardoso, Douglas Pinheiro; Lopes, Cinthia Távora Albuquerque; Brito, Marilene de Farias; da Silva, Jenevaldo Barbosa; Salvarani, Felipe Masiero; Leite, Rômulo Cerqueira; Barbosa, José Diomedes

    2015-08-01

    Tuberculosis is a disease with a great zoonotic potential. It is considered a major obstacle to cattle production and is responsible for severe losses in several production systems. A comparative cervical test (CCT) was performed in 1140 buffaloes from different mesoregions of the state of Pará, Brazil, with the aim of comparing the sensitivity and specificity of CCT with histopathological examination and bacterial culture. Of the animals tested using CCT, 4.65% (53/1140) were positive, 2.98% (34/1140) were inconclusive, and 92.36% (1053/1140) were negative. Among the 168 sacrificed animals, 33 were positive, 18 were inconclusive, and 117 were negative by CCT, and samples from the sacrificed animals were collected for histopathological examination and bacterial culture. A qualitative evaluation of the tuberculin test was performed by comparing the test results with the histopathological and bacteriological results. The latter two tests yielded a prevalence of 4.16%, a sensitivity of 71.43%, and a specificity of 82.61%. Based on these results, we concluded that CCT yielded satisfactory results and can be applied in diagnostic studies in buffaloes. The prevalence rate obtained using three distinct diagnostic methods suggests that Mycobacterium bovis was present in a few animals in the population evaluated.

  11. Improvement of liquid and frozen-thawed semen quality of Nili-Ravi buffalo bulls (Bubalus bubalis) through supplementation of fat.

    PubMed

    Adeel, M; Ijaz, A; Aleem, M; Rehman, H; Yousaf, M S; Jabbar, M A

    2009-05-01

    The aim of the study was to investigate the effects of dietary fat on quality of liquid and frozen-thawed semen of Nili-Ravi buffalo bulls. Adult bulls (n=21) were fed a balanced ration (Con; n=7) or the same ration either containing sunflower oil (SF-O; n=7) or whole sunflower seeds (SF-S; n=7) for 63 days. Body weight and body condition score of each bull was recorded on days 0, 30 and 60 of the experiment. Semen was collected on days 39, 46, 53 and 60, frozen by a fast method and stored at -196 degrees C for 24h. Sperm motility was assessed using a bright field microscope. Plasma membrane integrity of fresh and frozen-thawed spermatozoa was assessed using a hypo-osmotic swelling (HOS) assay. The concentration of spermatozoa and volume of semen was not different among groups on various days of collection. Sunflower-enriched diets did not affect the motility and number of HOS-positive spermatozoa in the fresh semen. Motility and HOS of post-thawed spermatozoa were higher (p<0.05) in bulls fed the sunflower-enriched diets. Similarly, diets did not affect the body condition score and body weight of bulls. In conclusion, feeding of sunflower oil or sunflower seed as fat sources can improve the quality of buffalo bull spermatozoa. PMID:19246083

  12. Effects of plane of nutrition on growth, feed intake, digestibility and nitrogen balance in Murrah graded male buffalo (Bubalus bubalis) calves in Nepal.

    PubMed

    Kumagai, Hajime; Baral, Bodh R; Shiino, Tatsu; Devkota, Naba R; Oishi, Kazato; Hirooka, Hiroyuki; Kolachhapati, Mana R; Tiwari, Ishwor C P

    2012-01-01

    An experiment was conducted using 17 male buffalo calves to assess the effects of plane of nutrition on dry matter intake (DMI), daily gain (DG), body size measurement, apparent digestibility and nitrogen (N) balance. To attain 250kg BW, the calves were allocated into three groups: H, L-H and L, receiving the concentrate at 1.50% of BW, 0.75% of BW until 190kg BW and 1.50% thereafter and 0.75% of BW, respectively. The animals had ad libitum access to urea-treated rice straw (UTRS). The DMI of UTRS through the experiment was higher in L and L-H than H, showing 3.52, 2.90 and 2.62kg/day, respectively (P<0.01), but the total DMI did not differ among the treatment groups. The DG throughout the experiment was high in the order of H, L-H and L, showing 0.72, 0.57 and 0.45kg, respectively (P<0.01). The digestibility of DM, organic matter, crude protein, neutral and acid detergent fiber and N retention were higher in H than in L (P<0.05). The findings of this study thus revealed the greater DG has an advantage of shortening the growing period around 3months, and consequently increasing benefit in fattening of buffalo calves in Nepal. PMID:22250739

  13. Influence of the duration of in vitro maturation and gamete co-incubation on the efficiency of in vitro embryo development in Italian Mediterranean buffalo (Bubalus bubalis).

    PubMed

    Gasparrini, Bianca; De Rosa, Anna; Attanasio, Laura; Boccia, Lucia; Di Palo, Rossella; Campanile, Giuseppe; Zicarelli, Luigi

    2008-05-01

    The aim of this study was to investigate the effect of the duration of oocyte in vitro maturation (IVM) and gamete co-incubation on the in vitro embryo (IVEP) production efficiency in River buffalo. In Experiment 1, abattoir-derived cumulus oocyte complexes were fixed at 0, 3, 6, 9, 12, 15, 18, 21 and 24 h after the start of in vitro maturation to study the kinetics of nuclear maturation. In Experiment 2, cumulus oocyte complexes were fertilized in vitro following in vitro maturation for 18, 21, 24, 27 or 30 h. After 20 h of gamete co-incubation, presumptive zygotes were denuded and cultured in vitro in synthetic oviduct fluid (SOF) medium. In Experiment 3, following in vitro maturation and fertilization, presumptive zygotes were removed from fertilization drops at 8, 12, 16 and 20 h post-insemination (pi) and placed in culture as described above. Representative samples of oocytes were fixed at 4, 8, 12, 16 and 20 h to evaluate the sperm penetration rate and the incidence of polyspermy at different co-incubation times. The main conclusions of the study are that: (1) the majority of buffalo oocytes accomplish nuclear maturation between 21 and 24 h after the start of in vitro maturation; (2) both cleavage and blastocyst rates linearly decrease with increasing duration of in vitro maturation (from 18 to 30 h); (3) sperm-oocyte incubation for at least 16 h is required for maximum blastocyst yields. PMID:17481834

  14. A new translocation t(1p;18) in an Italian Mediterranean river buffalo (Bubalus bubalis, 2n = 50) bull: cytogenetic, fertility and inheritance studies.

    PubMed

    Albarella, S; Ciotola, F; Coletta, A; Genualdo, V; Iannuzzi, L; Peretti, V

    2013-01-01

    In recent years increasing attention has been paid to the cytogenetic control of Italian Mediterranean river buffalo (BBU) bulls authorized as sires which are registered in the stud book. Chromosome abnormalities described in this species are mainly numerical and affecting sex chromosomes. During routine cytogenetic analyses performed on young Italian Mediterranean river buffa