Sample records for c d e

  1. Search for the rare decays J /ψ →D0e+e-+c .c . and ψ (3686 )→D0e+e-+c .c .

    NASA Astrophysics Data System (ADS)

    Ablikim, M.; Achasov, M. N.; Ahmed, S.; Albrecht, M.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Bakina, O.; Baldini Ferroli, R.; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Berger, N.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chai, J.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, J. C.; Chen, M. L.; Chen, S. J.; Chen, X. R.; Chen, Y. B.; Chu, X. K.; Cibinetto, G.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; de Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Dorjkhaidav, O.; Dou, Z. L.; Du, S. X.; Duan, P. F.; Fang, J.; Fang, S. S.; Fang, X.; Fang, Y.; Farinelli, R.; Fava, L.; Fegan, S.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, X. L.; Gao, Y.; Gao, Y. G.; Gao, Z.; Garzia, I.; Goetzen, K.; Gong, L.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, S.; Gu, Y. T.; Guo, A. Q.; Guo, L. B.; Guo, R. P.; Guo, Y. P.; Haddadi, Z.; Hafner, A.; Han, S.; Hao, X. Q.; Harris, F. A.; He, K. L.; He, X. Q.; Heinsius, F. H.; Held, T.; Heng, Y. K.; Holtmann, T.; Hou, Z. L.; Hu, C.; Hu, H. M.; Hu, T.; Hu, Y.; Huang, G. S.; Huang, J. S.; Huang, X. T.; Huang, X. Z.; Huang, Z. L.; Hussain, T.; Ikegami Andersson, W.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, X. S.; Jiang, X. Y.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Khan, T.; Kiese, P.; Kliemt, R.; Kloss, B.; Koch, L.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kuemmel, M.; Kuhlmann, M.; Kupsc, A.; Kühn, W.; Lange, J. S.; Lara, M.; Larin, P.; Lavezzi, L.; Leithoff, H.; Leng, C.; Li, C.; Li, Cheng; Li, D. M.; Li, F.; Li, F. Y.; Li, G.; Li, H. B.; Li, H. J.; Li, J. C.; Li, Jin; Li, Kang; Li, Ke; Li, Lei; Li, P. L.; Li, P. R.; Li, Q. Y.; Li, T.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B.; Liu, B. J.; Liu, C. X.; Liu, D.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. M.; Liu, Huanhuan; Liu, Huihui; Liu, J. B.; Liu, J. P.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, Ke; Liu, L. D.; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, Y. B.; Liu, Y. Y.; Liu, Z. A.; Liu, Zhiqing; Long, Y. F.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, T.; Luo, X. L.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, M. M.; Ma, Q. M.; Ma, T.; Ma, X. N.; Ma, X. Y.; Ma, Y. M.; Maas, F. E.; Maggiora, M.; Malik, Q. A.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Messchendorp, J. G.; Mezzadri, G.; Min, J.; Min, T. J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales Morales, C.; Morello, G.; Muchnoi, N. Yu.; Muramatsu, H.; Musiol, P.; Mustafa, A.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Pan, Y.; Papenbrock, M.; Patteri, P.; Pelizaeus, M.; Pellegrino, J.; Peng, H. P.; Peters, K.; Pettersson, J.; Ping, J. L.; Ping, R. G.; Poling, R.; Prasad, V.; Qi, H. R.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, J. J.; Qin, N.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Richter, M.; Ripka, M.; Rong, G.; Rosner, Ch.; Ruan, X. D.; Sarantsev, A.; Savrié, M.; Schnier, C.; Schoenning, K.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Song, J. J.; Song, W. M.; Song, X. Y.; Sosio, S.; Sowa, C.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, S. S.; Sun, X. H.; Sun, Y. J.; Sun, Y. K.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, G. Y.; Tang, X.; Tapan, I.; Tiemens, M.; Tsednee, B. T.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, Dan; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, P.; Wang, P. L.; Wang, W. P.; Wang, X. F.; Wang, Y.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. H.; Wang, Z. Y.; Wang, Zongyuan; Weber, T.; Wei, D. H.; Wei, J. H.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, L. J.; Wu, Z.; Xia, L.; Xia, Y.; Xiao, D.; Xiao, H.; Xiao, Y. J.; Xiao, Z. J.; Xie, Y. G.; Xie, Y. H.; Xiong, X. A.; Xiu, Q. L.; Xu, G. F.; Xu, J. J.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. J.; Yang, H. X.; Yang, L.; Yang, Y. H.; Yang, Y. X.; Ye, M.; Ye, M. H.; Yin, J. H.; You, Z. Y.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yuan, C. Z.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zeng, Y.; Zeng, Z.; Zhang, B. X.; Zhang, B. Y.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, S. Q.; Zhang, X. Y.; Zhang, Y. H.; Zhang, Y. T.; Zhang, Yang; Zhang, Yao; Zhang, Yu; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhou, Y. X.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, S. H.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zotti, L.; Zou, B. S.; Zou, J. H.; Besiii Collaboration

    2017-12-01

    Using the data samples of (1310.6 ±7.2 )×106 J /ψ events and (448.1 ±2.9 )×106 ψ (3686 ) events collected with the BESIII detector, we search for the rare decays J /ψ →D0e+e-+c .c . and ψ (3686 )→D0e+e-+c .c . No significant signals are observed and the corresponding upper limits on the branching fractions at the 90% confidence level are determined to be B (J /ψ →D0e+e-+c .c .)<8.5 ×10-8 and B (ψ (3686 )→D0e+e-+c .c .)<1.4 ×10-7 , respectively. Our limit on B (J /ψ →D0e+e-+c .c .) is more stringent by 2 orders of magnitude than the previous results, and B (ψ (3686 )→D0e+e-+c .c .) is measured for the first time.

  2. Search for the rare decays J / ψ → D 0 e + e − + c . c . and ψ ( 3686 ) → D 0 e + e − + c . c .

    DOE PAGES

    Ablikim, M.; Achasov, M. N.; Ahmed, S.; ...

    2017-12-01

    Using the data samples of (1310.6 ± 7.2) × 10 6 J / ψ events and (448.1 ± 2.9) × 106 (3686) events collected with the BESIII detector, we search for the rare decays J / ψ → D 0e +e - + c.c. and (3686) → D 0e +e - + c.c.. No significant signals are observed and the corresponding upper limits on the branching fractions at the 90% confidence level are determined to be B( J /more » ψ → D0e+e- + c.c.) < 8.5 × 10 -8 and B( (3686) → D0e+e- + c.c.) < 1.4 × 10 -7, respectively. Our limit on B( J / ψ → D 0e +e - + c.c.) is more stringent by two orders of magnitude than the previous results, and the B( (3686) → D 0e +e - + c.c.) is measured for the first time. « less

  3. Search for the rare decays J / ψ → D 0 e + e − + c . c . and ψ ( 3686 ) → D 0 e + e − + c . c .

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ablikim, M.; Achasov, M. N.; Ahmed, S.

    Using the data samples of (1310.6 ± 7.2) × 10 6 J / ψ events and (448.1 ± 2.9) × 106 (3686) events collected with the BESIII detector, we search for the rare decays J / ψ → D 0e +e - + c.c. and (3686) → D 0e +e - + c.c.. No significant signals are observed and the corresponding upper limits on the branching fractions at the 90% confidence level are determined to be B( J /more » ψ → D0e+e- + c.c.) < 8.5 × 10 -8 and B( (3686) → D0e+e- + c.c.) < 1.4 × 10 -7, respectively. Our limit on B( J / ψ → D 0e +e - + c.c.) is more stringent by two orders of magnitude than the previous results, and the B( (3686) → D 0e +e - + c.c.) is measured for the first time. « less

  4. Systems Engineering Measurement Primer

    DTIC Science & Technology

    1998-03-01

    Schermerhorn , R ., “Determining metrics for...maintenance process. 12 S e l e c t a n d S p e c i f y M e a s u r e s a n d I n d i c a t o r s C o l l e c t D a t a C a l c u l a t e I n d i c a...t o r s A n a l y z e t h e M e a s u r e s o r I n d i c a t o r s R e p o r t a n d U s e t h e R e s u l t s Issues Goals Risks A

  5. An effective diagnostic strategy for accurate detection of RhD variants including Asian DEL type in apparently RhD-negative blood donors in Korea.

    PubMed

    Seo, M H; Won, E J; Hong, Y J; Chun, S; Kwon, J R; Choi, Y S; Kim, J N; Lee, S A; Lim, A H; Kim, S H; Park, K U; Cho, D

    2016-11-01

    The purpose of this study was to provide an effective RHD genotyping strategy for the East Asian blood donors. RhD phenotyping, weak D testing and RhCE phenotyping were performed on 110 samples from members of the RhD-negative club, private organization composed of RhD-negative blood donors, in the GwangJu-Chonnam region of Korea. The RHD promoter, intron 4, and exons 7 and 10 were analysed by real-time PCR. Two nucleotide changes (c.1227 G>A, and c.1222 T>C) in exon 9 were analysed by sequencing. Of 110 RhD-negative club members, 79 (71·8%) showed complete deletion of the RHD gene, 10 (9·1%) showed results consistent with RHD-CE-D hybrid, and 21 (19·1%) showed amplification of RHD promoter, intron 4, and exons 7 and 10. Of the latter group, 16 (14·5%) were in the DEL blood group including c.1227 G>A (N = 14) and c.1222 T>C (N = 2), 2 (1·8%) were weak D, 1(0·9%) was partial D, and 2 (1·8%) were undetermined. The RhD-negative phenotype samples consisted of 58 C-E-c+e+, 19 C-E+c+e+, 3 C-E+c+e-, 21 C+E-c+e-, 6 C+E-c+e+ and 3 C+E-c-e + . Notably, all 58 samples with the C-E-c+e+ phenotype were revealed to have complete deletion of the RHD gene. The C-E-c+e+ phenotype showed 100% positive predictive value for detecting D-negative cases. RHD genotyping is not required in half of D-negative cases. We suggest here an effective RHD genotyping strategy for accurate detection of RhD variants in apparently RhD-negative blood donors in East Asia. © 2016 International Society of Blood Transfusion.

  6. Derivation of a Theory to Estimate the Kinetic Parameters for Systems with Multiple Substrates Competing for the Same Active Site on an Enzyme

    DTIC Science & Technology

    2006-12-01

    where a = (k2+k3)/(k1A) = KmA/A; b = (k5+k6)/(k4B) = KmB/B; c = (k8+k9)/(k7C) = KmC /C; and d = (k11+k12)/(k10D) = KmD/D...in terms of the system parameters EA/E0 = (A/KmA) / (1 + A/KmA + B/KmB + C/ KmC + D/KmD) EB/E0 = (B/KmB) / (1 + A/KmA + B/KmB + C/ KmC + D/KmD...EC/E0 = (C/ KmC ) / (1 + A/KmA + B/KmB + C/ KmC + D/KmD) ED/E0 = (D/KmD) / (1 + A/KmA + B/KmB + C/ KmC + D/KmD) The fraction of free enzyme existing

  7. 15 CFR 740.20 - License Exception Strategic Trade Authorization (STA).

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... Exception STA may not be used for any item controlled by ECCN 1C351.a, .b, .c, d.11, .d.12 or .e, ECCNs 1C352, 1C353, 1C354, 1C360, 1E001 (i.e., for technology, as specified in ECCN 1E001, for items controlled by ECCN 1C351.a, .b, .c, .d.11, .d.12 or .e or ECCNs 1C352, 1C353, 1C354 or 1C360) or ECCN 1E351...

  8. 15 CFR 740.20 - License Exception Strategic Trade Authorization (STA).

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... Exception STA may not be used for any item controlled by ECCN 1C351.a, .b, .c, d.11, .d.12 or .e, ECCNs 1C352, 1C353, 1C354, 1C360, 1E001 (i.e., for technology, as specified in ECCN 1E001, for items controlled by ECCN 1C351.a, .b, .c, .d.11, .d.12 or .e or ECCNs 1C352, 1C353, 1C354 or 1C360) or ECCN 1E351...

  9. Department of Defense Youth Poll Wave 10 - December 2005. Overview Report

    DTIC Science & Technology

    2006-07-01

    Fishbein , M . & Ajzen , I . (1975). Belief, attitude, intention and behavior: An introduction to theory...a n d E x p e c t e d O u t c o m e s A s s o c ia t e d w it h M il i t a r y S e r v ic e I n f lu e n c e r s M i l i t a r y B e l ie...f s a n d Y o u t h M o t iv a t io n t o C o m p ly Y o u t h A t t i t u d e s N o r m s Y o u t h C o n f id e n c e in S u c c e s

  10. MATREX Simulation Architecture

    DTIC Science & Technology

    2008-03-10

    r e S u p p o r t M i n e s , C o u n t e r m i n e s U n m a n n e d S y s t e m s L o g...i s t i c s N e t w o r k e d E f f e c t s C o m m a n d & C o n t r o l C o n s i s t e n t & H i g h - R e s M i s s i l e M o d e...l i n g C o n s i s t

  11. ELF Communications System Ecological Monitoring Program: Electromagnetic Field Measurements and Engineering Support

    DTIC Science & Technology

    1994-04-01

    1 lfm ýA a I - @0 38Ud U 0 E loll I0 F4J O 3Uv ~:~3 Igaas .1c % jWC (9 Um IDP. 0 di d0 1.00 00 .d .d d V d d~ di dI C-14 rM D0209- II dUmW o iNc cl...5C15-1 (In River) I FIGURE E-6. MEASUREMENT POINT AT TRANSMISSION UNE; 5C15-1. E-9 IITRI D06209-1 I I 0CS I C .00o tD I I- U, I S IcEoE 0 E0 a-0

  12. Nonlinear Burning Stability of Solid Propellants.

    DTIC Science & Technology

    1983-12-31

    de f()dO dX dO dX - dx d o d do d 20"--- - f( e ) 2- dX dX dX dX2 Therefore, the steady thermal profile for the same nondimensio- nal temperature...PF ,) C ( e ) de -H )-(1-r )Fo+q (0 gis 0 -C c o out s At the crossing of qg,s(P,R) with qg,s(P,Fo,®_ ), steady solutions R(P, Fo,1 ) vs qg,s are singled...PAGE (Wbrm Dets Entered) Is.-7 *0*" UNCLASSIFIED . " E C U R ITV C L A S S IF IC A T IO N O F T 0 IS P A G rwhI e D o ra E m, -- 20. Continued

  13. High voltage cathode compositions for lithium-ion batteries

    DOEpatents

    Lu, Zhonghua; Eberman, Kevin W

    2017-03-21

    A lithium transition metal oxide composition. The composition has the formula Li.sub.a[Li.sub.bNi.sub.cMn.sub.dCo.sub.e]O.sub.2, where a.gtoreq.0.9, b.gtoreq.0, c>0, d>0, e>0, b+c+d+e=1, 1.05.ltoreq.c/d.ltoreq.1.4, 0.05.ltoreq.e.ltoreq.0.30, 0.9.ltoreq.(a+b)/M.ltoreq.1.06, and M=c+d+e. The composition has an O3 type structure.

  14. On Orbit Performance of the Defense Meteorological Satellite Program (DMSP) 5D3 Spacecraft Power System

    DTIC Science & Technology

    2011-12-30

    TD O £ c c ^ co — £ °> S5 o E r^ I— E o> ^ LO o 2 O c Q. £ g * CO O =3 CO E c CX) IT) <* CD Q_ C E _Q i_...fe co oo h- O I I I CO (D CO p CO c5 "S _c co o o CO _ TD 5 *> =3 CD -K Ö) s i- CO c 2 o) o .E o CO...CD •o O 0 -4—» CO CD E Ü Q. •D o TD ^ CO O O E CD •+—. CD O CD (D >> ^ >% •4—< *§ CD -•-• O) CD _Q _£Z C CD = < •o D)

  15. Observation of a Neutral Structure near the D D¯* Mass Threshold in e+e-→(D D¯ *)0π0 at √{s }=4.226 and 4.257 GeV

    NASA Astrophysics Data System (ADS)

    Ablikim, M.; Achasov, M. N.; Ai, X. C.; Albayrak, O.; Albrecht, M.; Ambrose, D. J.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Ferroli, R. Baldini; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, H. Y.; Chen, J. C.; Chen, M. L.; Chen, S. Chen; Chen, S. J.; Chen, X.; Chen, X. R.; Chen, Y. B.; Cheng, H. P.; Chu, X. K.; Cibinetto, G.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; de Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Du, S. X.; Duan, P. F.; Fan, J. Z.; Fang, J.; Fang, S. S.; Fang, X.; Fang, Y.; Fava, L.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, X. L.; Gao, X. Y.; Gao, Y.; Gao, Z.; Garzia, I.; Goetzen, K.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guan, Y. H.; Guo, A. Q.; Guo, L. B.; Guo, R. P.; Guo, Y.; Guo, Y. P.; Haddadi, Z.; Hafner, A.; Han, S.; Hao, X. Q.; Harris, F. A.; He, K. L.; He, X. Q.; Held, T.; Heng, Y. K.; Hou, Z. L.; Hu, C.; Hu, H. M.; Hu, J. F.; Hu, T.; Hu, Y.; Huang, G. M.; Huang, G. S.; Huang, J. S.; Huang, X. T.; Huang, Y.; Hussain, T.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, L. W.; Jiang, X. S.; Jiang, X. Y.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Kiese, P.; Kliemt, R.; Kloss, B.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kühn, W.; Kupsc, A.; Lange, J. S.; Lara, M.; Larin, P.; Leng, C.; Li, C.; Li, Cheng; Li, D. M.; Li, F.; Li, F. Y.; Li, G.; Li, H. B.; Li, H. J.; Li, J. C.; Li, Jin; Li, K.; Li, K.; Li, Lei; Li, P. R.; Li, T.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. M.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, J. J.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B. J.; Liu, C. X.; Liu, D.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. H.; Liu, H. H.; Liu, H. M.; Liu, J.; Liu, J. B.; Liu, J. P.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, L. D.; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqing; Loehner, H.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, T.; Luo, X. L.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, M. M.; Ma, Q. M.; Ma, T.; Ma, X. N.; Ma, X. Y.; Maas, F. E.; Maggiora, M.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Messchendorp, J. G.; Min, J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales, C. Morales; Moriya, K.; Muchnoi, N. Yu.; Muramatsu, H.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Pan, Y.; Patteri, P.; Pelizaeus, M.; Peng, H. P.; Peters, K.; Pettersson, J.; Ping, J. L.; Ping, R. G.; Poling, R.; Prasad, V.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, L. Q.; Qin, N.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Ripka, M.; Rong, G.; Rosner, Ch.; Ruan, X. D.; Sarantsev, A.; Savrié, M.; Schoenning, K.; Schumann, S.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Shi, M.; Song, W. M.; Song, X. Y.; Sosio, S.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, S. S.; Sun, X. H.; Sun, Y. J.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, X.; Tapan, I.; Thorndike, E. H.; Tiemens, M.; Ullrich, M.; Uman, I.; Varner, G. S.; Wang, B.; Wang, D.; Wang, D. Y.; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, P.; Wang, P. L.; Wang, S. G.; Wang, W.; Wang, W. P.; Wang, X. F.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. H.; Wang, Z. Y.; Wang, Z. Y.; Weber, T.; Wei, D. H.; Wei, J. B.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, L. J.; Wu, Z.; Xia, L.; Xia, L. G.; Xia, Y.; Xiao, D.; Xiao, H.; Xiao, Z. J.; Xie, Y. G.; Xiu, Q. L.; Xu, G. F.; Xu, J. J.; Xu, L.; Xu, Q. J.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. J.; Yang, H. X.; Yang, L.; Yang, Y.; Yang, Y. X.; Ye, M.; Ye, M. H.; Yin, J. H.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yuan, C. Z.; Yuan, W. L.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zallo, A.; Zeng, Y.; Zeng, Z.; Zhang, B. X.; Zhang, B. Y.; Zhang, C.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J.; Zhang, J. J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, X. Y.; Zhang, Y.; Zhang, Y. N.; Zhang, Y. H.; Zhang, Y. T.; Zhang, Yu; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, Q. W.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, S. H.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zotti, L.; Zou, B. S.; Zou, J. H.; Besiii Collaboration

    2015-11-01

    A neutral structure in the D D¯* system around the D D¯* mass threshold is observed with a statistical significance greater than 10 σ in the processes e+e-→D+D*-π0+c . c . and e+e-→D0D¯ *0π0+c . c . at √{s }=4.226 and 4.257 GeV in the BESIII experiment. The structure is denoted as Zc(3885 )0. Assuming the presence of a resonance, its pole mass and width are determined to be [3885. 7-5.7+4.3 (stat )±8.4 (syst )] MeV /c2 and [3 5-12+11(stat )±15 (syst )] MeV , respectively. The Born cross sections are measured to be σ [e+e-→Zc(3885 )0π0,Zc(3885 )0→D D¯ *]=[77 ±13 (stat )±17 (syst )] pb at 4.226 GeV and [47 ±9 (stat )±10 (syst )] pb at 4.257 GeV. The ratio of decay rates B [Zc(3885 )0→D+D*-+c .c .] /B [Zc(3885 )0→D0D¯ *0+c .c .] is determined to be 0.96 ±0.18 (stat )±0.12 (syst ) , consistent with no isospin violation in the process, Zc(3885 )0→D D¯*.

  16. Thin-Film Optical Switch.

    DTIC Science & Technology

    1976-09-01

    UNCLASSIFIED St Cu* ITY C LA S S I F I C A T I O N OF tIllS PAGE (W~I. , 0.i. Ent.,.~d) REPODT rVW IIMEIITATIAII PACE READ INSTRUCTIONS...MEASUREMENTS 10 A. Ef fec t ive Channel Guide Width 10 13. Rid ge For mation St udies 10 C. Wave guide Loss Measurement s 10 D. Tape r Coup ling Eff...of less coup l ing e f f i c i e n c y at t h e t aper l e n g t h of 900 ~ rn . Ne l son 2 has c o n s i d e r e d the e f f i c i e n c y of

  17. A Hybrid Approach for Fault Detection in Autonomous Physical Agents

    DTIC Science & Technology

    2014-05-01

    r l e c c f t d f a d c r r r t m e o i m s f U m d o s a u v c o t c r c t a c u n b S...escription e a set of attrib d, heading, pi et of values for alue assigned to t i s 1 l m a o p a r tr l c tr w o t n data H & ow detection mode roach is...dete Note that any ch can be used t e an autonomou e SFDD

  18. Prime Contract Awards by Region and State, Fiscal Years 1980, 1981, 1982.

    DTIC Science & Technology

    1982-01-01

    40 C c 0 0) M .0.6 co L t2 CD ; : -j .S0 9 - t o) 0 m LL * 2 c M 0 r- E-0C 13 0U) c CL 0 &OO a) U. 0 a. c (0 c C CL E 0.0 C* o... 0 L:,e 0 c o4 Cl...0’ C, CL~ -0 .0 E 0 0 Mo~ U)o 0~ . .~ 4) m (D L)04 3 L> 0 0L _0 C_ - - Z m v ( _. ,’. (D. >~ 40 0 ob 0 0 c M 0 00 - 4-0 Cc Or M U)0 E a) U- CL 9 ...fO4) oE - 4 0. 0 0 i E . _c 0 M O-~ d -E - _ 0 0 0)0 000 0 C 0U0 0 0 >. EL 4) 4) 0 D - or 5 >. o- 0 0c & :Co( *4) r CD 0.00-. , ) 0> 0 0 0 0)O = - 0 9

  19. 30 CFR 902.15 - Approval of Alaska regulatory program amendments.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...), .185(a)(3), (4), (5), .207(c)(5)(C), .213(g), (h), .323(a) through (d), .325(b), (c), (d)(1), (2), (3...), .349(2)(A), .353(a)(1), (2), (3), .371(d)(1) through (4), .373(b), (c), (d), .375(b), (e) through (h...), .491(a), (1), (6), (7), (8), (c)(4) through (8), (e), (f), .901(e), .907(c) through (h), (j). December...

  20. 30 CFR 902.15 - Approval of Alaska regulatory program amendments.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...), .185(a)(3), (4), (5), .207(c)(5)(C), .213(g), (h), .323(a) through (d), .325(b), (c), (d)(1), (2), (3...), .349(2)(A), .353(a)(1), (2), (3), .371(d)(1) through (4), .373(b), (c), (d), .375(b), (e) through (h...), .491(a), (1), (6), (7), (8), (c)(4) through (8), (e), (f), .901(e), .907(c) through (h), (j). December...

  1. BciD Is a Radical S-Adenosyl-l-methionine (SAM) Enzyme That Completes Bacteriochlorophyllide e Biosynthesis by Oxidizing a Methyl Group into a Formyl Group at C-7.

    PubMed

    Thweatt, Jennifer L; Ferlez, Bryan H; Golbeck, John H; Bryant, Donald A

    2017-01-27

    Green bacteria are chlorophotorophs that synthesize bacteriochlorophyll (BChl) c, d, or e, which assemble into supramolecular, nanotubular structures in large light-harvesting structures called chlorosomes. The biosynthetic pathways of these chlorophylls are known except for one reaction. Null mutants of bciD, which encodes a putative radical S-adenosyl-l-methionine (SAM) protein, are unable to synthesize BChl e but accumulate BChl c; however, it is unknown whether BciD is sufficient to convert BChl c (or its precursor, bacteriochlorophyllide (BChlide) c) into BChl e (or BChlide e). To determine the function of BciD, we expressed the bciD gene of Chlorobaculum limnaeum strain DSMZ 1677 T in Escherichia coli and purified the enzyme under anoxic conditions. Electron paramagnetic resonance spectroscopy of BciD indicated that it contains a single [4Fe-4S] cluster. In assays containing SAM, BChlide c or d, and sodium dithionite, BciD catalyzed the conversion of SAM into 5'-deoxyadenosine and BChlide c or d into BChlide e or f, respectively. Our analyses also identified intermediates that are proposed to be 7 1 -OH-BChlide c and d Thus, BciD is a radical SAM enzyme that converts the methyl group of BChlide c or d into the formyl group of BChlide e or f This probably occurs by a mechanism involving consecutive hydroxylation reactions of the C-7 methyl group to form a geminal diol intermediate, which spontaneously dehydrates to produce the final products, BChlide e or BChlide f The demonstration that BciD is sufficient to catalyze the conversion of BChlide c into BChlide e completes the biosynthetic pathways for all "Chlorobium chlorophylls." © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Task Force Delay Study. Denver Stapleton International Airport, Volume II.

    DTIC Science & Technology

    1980-03-01

    Stephen L. 11. Hockaday Manager Sl H/j c 2nclosure cc: x. Fred Jaeger bcc: Mr. Herb Hubbard, UAL TFD Correspondence H. Fan 0 JI-. *~ ~ E ~ n ti ~’L1 -J (D...34 Attachment E contains a list of additional delay experiments discussed at the previous Task Force meeting. I I P M. M. &6 Co. Mr. Phillip J. LaRochelle March... E -05B Western. C-01, C7.O3, C-05, CO2 , C-04, C-06, Continental,, C-07, C-09, C-11, C-15, C-10, C-12, C-14, C-16 Trans World,, D-01, D-03, D-05, D-07

  3. Condition Based Maintenance Technology Impacts Study for the Military Land Environment

    DTIC Science & Technology

    2014-08-01

    3a, 2g 3b,3m,3j,3e,3d,3f,3a,3c,3i 3c,3d,3h,3n 3d,3h 3e,3k,3i 3f,3h UNCLASSIFIED DSTO-RR-0404 UNCLASSIFIED 158 3g ,3c 3h,4b 3i,3m,3j,CBM...3e -> 3k 3i Egress of 2: 3n -> 3h 4b Egress of 2: 3k -> 3j 5c Egress of 2: 4d -> 3g 3c Egress of 1: 3a -> 2g Egress of 1: 1b -> 2g Egress...Ingress+Egress of 8: 2d 3b 3g 4d 4f -> 3c -> 3d 3h 3n Ingress+Egress of 7: 1b 2e 3a -> 2g -> 3b 2e 2c 2f Ingress+Egress of 7: 2a 2d 6b 6c -> 2b -> 3a

  4. Enzyme-linked immunosorbent assays for Z-DNA.

    PubMed

    Thomas, M J; Strobl, J S

    1988-10-01

    Dot blot and transblot enzyme-linked immunosorbent assays (e.l.i.s.a.) are described which provide sensitive non-radioactive methods for screening Z-DNA-specific antisera and for detecting Z-DNA in polydeoxyribonucleotides and supercoiled plasmids. In the alkaline phosphatase dot blot e.l.i.s.a., Z-DNA, Br-poly(dG-dC).poly(dG-dC), or B-DNA, poly(dG-dC).poly(dG-dC), poly(dA-dT).poly(dA-dT), Br-poly(dI-dC).poly(dI-dC), or salmon sperm DNA were spotted onto nitrocellulose discs and baked. The e.l.i.s.a. was conducted in 48-well culture dishes at 37 degrees C using a rabbit polyclonal antiserum developed against Br-poly(dG-dC).poly(dG-dC), an alkaline phosphatase-conjugated second antibody, and p-nitrophenol as the substrate. Under conditions where antibody concentrations were not limiting, alkaline phosphatase activity was linear for 2 h. Dot blot e.l.i.s.a. conditions are described which allow quantification of Z-DNA [Br-poly(dG-dC).poly(dG-dC)] within the range 5-250 ng. Dot blot and transblot horseradish peroxidase e.l.i.s.a. are described that detect Z-DNA within supercoiled plasmid DNAs immobilized on diazophenylthioether (DPT) paper. In the transblot e.l.i.s.a., plasmid pUC8 derivatives containing 16, 24, or 32 residues of Z-DNA were electrophoresed in agarose gels and electrophoretically transferred to DPT paper. Z-DNA-antibody complexes were detected by the horseradish peroxidase-catalysed conversion of 4-chloro-1-naphthol to a coloured product that was covalently bound to the DPT paper. Z-DNA antibody reactivity was specific for supercoiled Z-DNA containing plasmids after removal of the antibodies cross-reactive with B-DNA by absorption onto native DNA-cellulose. The transblot e.l.i.s.a. was sensitive enough to detect 16 base pairs of alternating G-C residues in 100 ng of pUC8 DNA.

  5. Observation of a Neutral Structure near the DD[over ¯]^{*} Mass Threshold in e^{+}e^{-}→(DD[over ¯]^{*})^{0}π^{0} at sqrt[s]=4.226 and 4.257 GeV.

    PubMed

    Ablikim, M; Achasov, M N; Ai, X C; Albayrak, O; Albrecht, M; Ambrose, D J; Amoroso, A; An, F F; An, Q; Bai, J Z; Ferroli, R Baldini; Ban, Y; Bennett, D W; Bennett, J V; Bertani, M; Bettoni, D; Bian, J M; Bianchi, F; Boger, E; Boyko, I; Briere, R A; Cai, H; Cai, X; Cakir, O; Calcaterra, A; Cao, G F; Cetin, S A; Chang, J F; Chelkov, G; Chen, G; Chen, H S; Chen, H Y; Chen, J C; Chen, M L; Chen, S Chen; Chen, S J; Chen, X; Chen, X R; Chen, Y B; Cheng, H P; Chu, X K; Cibinetto, G; Dai, H L; Dai, J P; Dbeyssi, A; Dedovich, D; Deng, Z Y; Denig, A; Denysenko, I; Destefanis, M; De Mori, F; Ding, Y; Dong, C; Dong, J; Dong, L Y; Dong, M Y; Du, S X; Duan, P F; Fan, J Z; Fang, J; Fang, S S; Fang, X; Fang, Y; Fava, L; Feldbauer, F; Felici, G; Feng, C Q; Fioravanti, E; Fritsch, M; Fu, C D; Gao, Q; Gao, X L; Gao, X Y; Gao, Y; Gao, Z; Garzia, I; Goetzen, K; Gong, W X; Gradl, W; Greco, M; Gu, M H; Gu, Y T; Guan, Y H; Guo, A Q; Guo, L B; Guo, R P; Guo, Y; Guo, Y P; Haddadi, Z; Hafner, A; Han, S; Hao, X Q; Harris, F A; He, K L; He, X Q; Held, T; Heng, Y K; Hou, Z L; Hu, C; Hu, H M; Hu, J F; Hu, T; Hu, Y; Huang, G M; Huang, G S; Huang, J S; Huang, X T; Huang, Y; Hussain, T; Ji, Q; Ji, Q P; Ji, X B; Ji, X L; Jiang, L W; Jiang, X S; Jiang, X Y; Jiao, J B; Jiao, Z; Jin, D P; Jin, S; Johansson, T; Julin, A; Kalantar-Nayestanaki, N; Kang, X L; Kang, X S; Kavatsyuk, M; Ke, B C; Kiese, P; Kliemt, R; Kloss, B; Kolcu, O B; Kopf, B; Kornicer, M; Kühn, W; Kupsc, A; Lange, J S; Lara, M; Larin, P; Leng, C; Li, C; Li, Cheng; Li, D M; Li, F; Li, F Y; Li, G; Li, H B; Li, H J; Li, J C; Li, Jin; Li, K; Li, K; Li, Lei; Li, P R; Li, T; Li, W D; Li, W G; Li, X L; Li, X M; Li, X N; Li, X Q; Li, Z B; Liang, H; Liang, J J; Liang, Y F; Liang, Y T; Liao, G R; Lin, D X; Liu, B J; Liu, C X; Liu, D; Liu, F H; Liu, Fang; Liu, Feng; Liu, H B; Liu, H H; Liu, H H; Liu, H M; Liu, J; Liu, J B; Liu, J P; Liu, J Y; Liu, K; Liu, K Y; Liu, L D; Liu, P L; Liu, Q; Liu, S B; Liu, X; Liu, Y B; Liu, Z A; Liu, Zhiqing; Loehner, H; Lou, X C; Lu, H J; Lu, J G; Lu, Y; Lu, Y P; Luo, C L; Luo, M X; Luo, T; Luo, X L; Lyu, X R; Ma, F C; Ma, H L; Ma, L L; Ma, M M; Ma, Q M; Ma, T; Ma, X N; Ma, X Y; Maas, F E; Maggiora, M; Mao, Y J; Mao, Z P; Marcello, S; Messchendorp, J G; Min, J; Mitchell, R E; Mo, X H; Mo, Y J; Morales, C Morales; Moriya, K; Muchnoi, N Yu; Muramatsu, H; Nefedov, Y; Nerling, F; Nikolaev, I B; Ning, Z; Nisar, S; Niu, S L; Niu, X Y; Olsen, S L; Ouyang, Q; Pacetti, S; Pan, Y; Patteri, P; Pelizaeus, M; Peng, H P; Peters, K; Pettersson, J; Ping, J L; Ping, R G; Poling, R; Prasad, V; Qi, M; Qian, S; Qiao, C F; Qin, L Q; Qin, N; Qin, X S; Qin, Z H; Qiu, J F; Rashid, K H; Redmer, C F; Ripka, M; Rong, G; Rosner, Ch; Ruan, X D; Sarantsev, A; Savrié, M; Schoenning, K; Schumann, S; Shan, W; Shao, M; Shen, C P; Shen, P X; Shen, X Y; Sheng, H Y; Shi, M; Song, W M; Song, X Y; Sosio, S; Spataro, S; Sun, G X; Sun, J F; Sun, S S; Sun, X H; Sun, Y J; Sun, Y Z; Sun, Z J; Sun, Z T; Tang, C J; Tang, X; Tapan, I; Thorndike, E H; Tiemens, M; Ullrich, M; Uman, I; Varner, G S; Wang, B; Wang, D; Wang, D Y; Wang, K; Wang, L L; Wang, L S; Wang, M; Wang, P; Wang, P L; Wang, S G; Wang, W; Wang, W P; Wang, X F; Wang, Y D; Wang, Y F; Wang, Y Q; Wang, Z; Wang, Z G; Wang, Z H; Wang, Z Y; Wang, Z Y; Weber, T; Wei, D H; Wei, J B; Weidenkaff, P; Wen, S P; Wiedner, U; Wolke, M; Wu, L H; Wu, L J; Wu, Z; Xia, L; Xia, L G; Xia, Y; Xiao, D; Xiao, H; Xiao, Z J; Xie, Y G; Xiu, Q L; Xu, G F; Xu, J J; Xu, L; Xu, Q J; Xu, X P; Yan, L; Yan, W B; Yan, W C; Yan, Y H; Yang, H J; Yang, H X; Yang, L; Yang, Y; Yang, Y X; Ye, M; Ye, M H; Yin, J H; Yu, B X; Yu, C X; Yu, J S; Yuan, C Z; Yuan, W L; Yuan, Y; Yuncu, A; Zafar, A A; Zallo, A; Zeng, Y; Zeng, Z; Zhang, B X; Zhang, B Y; Zhang, C; Zhang, C C; Zhang, D H; Zhang, H H; Zhang, H Y; Zhang, J; Zhang, J J; Zhang, J L; Zhang, J Q; Zhang, J W; Zhang, J Y; Zhang, J Z; Zhang, K; Zhang, L; Zhang, X Y; Zhang, Y; Zhang, Y N; Zhang, Y H; Zhang, Y T; Zhang, Yu; Zhang, Z H; Zhang, Z P; Zhang, Z Y; Zhao, G; Zhao, J W; Zhao, J Y; Zhao, J Z; Zhao, Lei; Zhao, Ling; Zhao, M G; Zhao, Q; Zhao, Q W; Zhao, S J; Zhao, T C; Zhao, Y B; Zhao, Z G; Zhemchugov, A; Zheng, B; Zheng, J P; Zheng, W J; Zheng, Y H; Zhong, B; Zhou, L; Zhou, X; Zhou, X K; Zhou, X R; Zhou, X Y; Zhu, K; Zhu, K J; Zhu, S; Zhu, S H; Zhu, X L; Zhu, Y C; Zhu, Y S; Zhu, Z A; Zhuang, J; Zotti, L; Zou, B S; Zou, J H

    2015-11-27

    A neutral structure in the DD[over ¯]^{*} system around the DD[over ¯]^{*} mass threshold is observed with a statistical significance greater than 10σ in the processes e^{+}e^{-}→D^{+}D^{*-}π^{0}+c.c. and e^{+}e^{-}→D^{0}D[over ¯]^{*0}π^{0}+c.c. at sqrt[s]=4.226 and 4.257 GeV in the BESIII experiment. The structure is denoted as Z_{c}(3885)^{0}. Assuming the presence of a resonance, its pole mass and width are determined to be [3885.7_{-5.7}^{+4.3}(stat)±8.4(syst)]  MeV/c^{2} and [35_{-12}^{+11}(stat)±15(syst)]  MeV, respectively. The Born cross sections are measured to be σ[e^{+}e^{-}→Z_{c}(3885)^{0}π^{0},Z_{c}(3885)^{0}→DD[over ¯]^{*}]=[77±13(stat)±17(syst)]  pb at 4.226 GeV and [47±9(stat)±10(syst)]  pb at 4.257 GeV. The ratio of decay rates B[Z_{c}(3885)^{0}→D^{+}D^{*-}+c.c.]/B[Z_{c}(3885)^{0}→D^{0}D[over ¯]^{*0}+c.c.] is determined to be 0.96±0.18(stat)±0.12(syst), consistent with no isospin violation in the process, Z_{c}(3885)^{0}→DD[over ¯]^{*}.

  6. Bulletin of the American Astronomical Society. Volume 36, Number 1, 2004

    DTIC Science & Technology

    2004-01-01

    A. S., Van Malderen, R., Uytterhoeven, K., Davignon, G., Dunham, E. W., Olkin , C. B., Taylor, B. W., Wasserman, L. H., Clancy, K., Person, M. J...Leggett, S. K., Levine, S. E., Moon, D.-S., Olkin , C. B., Osip, D. J., Pasachoff, J. M., Penprase, B. E., Person, M. J., Qu, S., Rayner, J. T., Rob...Moon, D.-S., Buie, M. W., Dunham, E. W., Olkin , C. B., Taylor, B., Kern, S. D., Qu, S., Salyk, C. V., Leggett, S. K., Levine, S. E., and Stone, R. C

  7. Biological Treatment of Composition B Wastewaters. 2. Analysis of Performance of Holston Army Ammunition Plant Wastewater Treatment Facility, January 1985 through August 1986

    DTIC Science & Technology

    1988-08-18

    CONTENTS (cont.) C. Daily Average Nitrate Nitrogen, Upper Neutralization Basin .................................. 44 D . Daily Average Temperature (°C...PLANr WASTEWATER TREATMENT FACILITY, JANUARY 1985 THROUGH AUGUST 1986 W. DICKINSON BURROWS, Ph.D., P.E. in- T C ELIZABetH T. PAULSONS D ROBERT P...CARNAHAN, Ph.D., P.E.:.EL E C-T E FEB 0 6 1990. D Prepared for U.S. ARMY TOXIC AND PAZARDOUS MATERIALS AGENCY ABERDEEN PROVING GROUND, D ) 21010-5401 by U S

  8. Understanding the Delay in Onset of Pagets Disease of Bone

    DTIC Science & Technology

    2015-09-01

    gacaacccaggacaggaccgagccacctgcaaggaagagaaggcaggcagttcgggtctc D N P G Q D R A T C K E E K A G S S G L MVP gene D N P G Q D R A T C K E...E K A G S S G L MVV gene agcaaaccatgcctctcagcaattggatcaactgaaggcggtgcacctcgcatccgcggt S K P C L S A I G S T E G G A P R...I R G MVP gene S K P C L S A I G S T E G G A P R I R G MVV gene

  9. Statistical Reproducibility of the Dynamic and Static Fatigue Experiments.

    DTIC Science & Technology

    1980-10-01

    82171a no 3 a s d e te rm-,I n ed7 from t Ynamic ’ra-,4-e 2x oe r imen. Figure 2. T-he c oeffic 4e nt o - v arari an ( C . o f .4eib L’ sIatce --ar a-:e...e rc lecnnique to aeterr-ine zne v~iidit of the assumptions. - .2 Static Fatioue Static -aticue tests entai- , the reDeatec measuremen- c - azure ...ress -ance ncreased, anc- tec.-ease: zs n :El ~ c a -amet: -7 4creas2c. -o r a ze sac, nC~e 3Es3 ra-.<e ~ D 3 s ar, c a s n amD-e , s e : ) rrc uCb c 0

  10. Management: Department of the Army Productivity Improvement Program

    DTIC Science & Technology

    1982-08-01

    VEPs will submit semi-annually to HQDA ( DACA -MP) WASH DC 20310 a statistical summary of VE actions (RCS DD- I&L (SA&A) 1138) in the format shown in...A r m y c o m m a n d s / s e p a r a t e a g e n c i e s w i l l furnish one copy of each to the Comptrol- ler of the Army, HQDA, ATTN: DACA - MP...d e d C h a n g e s t o P u b l i c a t i o n s a n d Blank Forms) direct to HQDA ( DACA - RPM) WASH DC 20310. D i s t r i b u t i o n . A c t i v e A

  11. Performance Analysis of Polymorphous Computing Architectures

    DTIC Science & Technology

    2001-01-01

    G H F Proc 5 : 4 : 3 11 1 Figure 3. Self-timed execution. D C B F G H E D B H EA CG...F D C B F G H E D B H EA CG F AProc 1 Proc 2 Proc 3 Proc 4 Proc 5 185 cution pattern when the application graph in Figure 2 is executed in a self...transform, a quadra- E Figure 10. Self-timed execution with first-iteration actors denoted by T. D B H E CG F D C B F G H E D B H EA CG F A 18 T T T

  12. Observation of an alternative χc 0(2 P ) candidate in e+e-→J /ψ D D ¯

    NASA Astrophysics Data System (ADS)

    Chilikin, K.; Adachi, I.; Aihara, H.; Al Said, S.; Asner, D. M.; Aulchenko, V.; Ayad, R.; Babu, V.; Badhrees, I.; Bakich, A. M.; Bansal, V.; Barberio, E.; Besson, D.; Bhardwaj, V.; Bhuyan, B.; Biswal, J.; Bobrov, A.; Bondar, A.; Bozek, A.; Bračko, M.; Browder, T. E.; Červenkov, D.; Chekelian, V.; Chen, A.; Cheon, B. G.; Cho, K.; Choi, Y.; Cinabro, D.; Dash, N.; Di Carlo, S.; Doležal, Z.; Drásal, Z.; Dutta, D.; Eidelman, S.; Farhat, H.; Fast, J. E.; Ferber, T.; Fulsom, B. G.; Gaur, V.; Gabyshev, N.; Garmash, A.; Gillard, R.; Goldenzweig, P.; Haba, J.; Hara, T.; Hayasaka, K.; Hou, W.-S.; Inami, K.; Ishikawa, A.; Itoh, R.; Iwasaki, Y.; Jacobs, W. W.; Jaegle, I.; Jeon, H. B.; Jin, Y.; Joffe, D.; Joo, K. K.; Julius, T.; Kang, K. H.; Karyan, G.; Katrenko, P.; Kim, D. Y.; Kim, H. J.; Kim, J. B.; Kim, K. T.; Kim, M. J.; Kim, S. H.; Kim, Y. J.; Kinoshita, K.; Kodyš, P.; Korpar, S.; Kotchetkov, D.; Križan, P.; Krokovny, P.; Kuhr, T.; Kulasiri, R.; Kuzmin, A.; Kwon, Y.-J.; Lange, J. S.; Li, L.; Li Gioi, L.; Libby, J.; Liventsev, D.; Lubej, M.; Luo, T.; Masuda, M.; Matsuda, T.; Matvienko, D.; Miyabayashi, K.; Miyata, H.; Mizuk, R.; Mohanty, G. B.; Moon, H. K.; Mori, T.; Mussa, R.; Nakano, E.; Nakao, M.; Nanut, T.; Nath, K. J.; Natkaniec, Z.; Nayak, M.; Niiyama, M.; Nisar, N. K.; Nishida, S.; Ogawa, S.; Okuno, S.; Olsen, S. L.; Ono, H.; Pakhlov, P.; Pakhlova, G.; Pal, B.; Pardi, S.; Park, H.; Paul, S.; Pestotnik, R.; Piilonen, L. E.; Pulvermacher, C.; Ritter, M.; Sahoo, H.; Sakai, Y.; Salehi, M.; Sandilya, S.; Santelj, L.; Sanuki, T.; Schneider, O.; Schnell, G.; Schwanda, C.; Seino, Y.; Senyo, K.; Seon, O.; Sevior, M. E.; Shebalin, V.; Shen, C. P.; Shibata, T.-A.; Shiu, J.-G.; Sokolov, A.; Solovieva, E.; Starič, M.; Sumiyoshi, T.; Takizawa, M.; Tamponi, U.; Tanida, K.; Tenchini, F.; Trabelsi, K.; Uchida, M.; Uehara, S.; Uglov, T.; Uno, S.; Usov, Y.; Van Hulse, C.; Varner, G.; Vinokurova, A.; Vossen, A.; Wang, C. H.; Wang, M.-Z.; Wang, P.; Watanabe, M.; Watanabe, Y.; Widmann, E.; Won, E.; Yamamoto, H.; Yamashita, Y.; Ye, H.; Yuan, C. Z.; Yusa, Y.; Zhang, Z. P.; Zhilich, V.; Zhulanov, V.; Zupanc, A.; Belle Collaboration

    2017-06-01

    We perform a full amplitude analysis of the process e+e-→J /ψ D D ¯ , where D refers to either D0 or D+. A new charmoniumlike state X*(3860 ) that decays to D D ¯ is observed with a significance of 6.5 σ . Its mass is (3862-32+26-13+40) MeV /c2 , and its width is (201-67+154-82+88) MeV . The JP C=0++ hypothesis is favored over the 2++ hypothesis at the level of 2.5 σ . The analysis is based on the 980 fb-1 data sample collected by the Belle detector at the asymmetric-energy e+e- collider KEKB.

  13. Hybrid Scenario Development Methodology and Tool: An Arctic-Oriented Scenario Example

    DTIC Science & Technology

    2011-07-01

    T E N D S T A T E = S C E N A R I O T R I G G E R P O I N T SECURITY(INC DEFENCE) LEGAL ENVIRONMENTAL...SECURITY(INC DEFENCE) S C E N A R I O D E V E L O P M E N T E N D S T A T E = S C E N A R I O T R I G G E R P O I N T

  14. Genomic Characterization of KIR2DL4 in Families and Unrelated Individuals Reveals Extensive Diversity in Exon and Intron Sequences Including a Common Frameshift Variation Occurring in Several Alleles

    DTIC Science & Technology

    2005-01-18

    r A L 1 3 3 4 1 4 ) w a s u s e d a s a re fe re n c e . D a s h e s in d ic a te id e n ti...le d th e tr a n s m e m b ra n e e xo n a s e xo n 7 in o rd e r to k e e p th e re la ti o n s h ip a m o n g K IR e xo n s in th e d if fe re n t...g e n e s c o n s is te n t. N u c le o ti d e p o s it io n s w e

  15. Sensitivity Analysis of Empirical Parameters in the Ionosphere-Plasmasphere Model

    DTIC Science & Technology

    2011-03-01

    IFM output grid (Gardner , 2010). The longitudes have to be fit as well because the IPM flux tubes form a type of ‘ S ...n d 2 0 d a y ru n , a n d th e ri g h t p lo t is th e d iff e re n c e . A ft e r d a y fi v e , th e m o d e l o u tp u t h a s re a ch e d st e a ...lo c a ti o n s * . T h

  16. Design of a Persistence Server for the Relational Hypergraph Model

    DTIC Science & Technology

    1999-12-01

    HH C O o _CD 󈧷 u _D- CO CD...X c 2 II E 2 § o c >» C .3 .2 Q — "a O u >» 00 HH 1) Ü CJ > 00 O CO > PH S .2 .22 J 5 c -a zz O (50 to C "x ’S...X CS 3 X & O « 1 H < X X es es d d e e cj cj 3 3 o o E a 3 HH c CS e e o o 3 3 aa oa o o o <-. a o 3 — pa ^ tad

  17. Research on Fire-Resistant Diesel Fuel.

    DTIC Science & Technology

    1981-12-01

    1[ >1 1? 1F RESEARCH ON FIRE-RESISTANT DIESEL FUEL INTERIM REPORT AFLRL No. 145 By W.D. Weatherford, Jr. G.E. Fodor M.D. Kanakia D.W. Naegeli B.R...GRANT NUMBER(S) W.D. Weatherford, Jr., G.E. Fodor, DAAK7O-80-C-OOO1 M.D. Kanakia, D.W. Naegeli , B.R. Wright (AFLRL) DAAK7O-82-C-OOO1 andF.W...Filters in Fuel Systems of U.S. Army Vehicles I:I , i , , , =- 111 REFERENCES 1. Weatherford, W.D., Jr. Fodor, G.E., Naegeli , D.W., Owens, E.C., Wright

  18. Assessment of Chemical Solution Synthesis and Properties of Gd2Zr2O7 Thin Films as Buffer Layers for Second-Generation High-Temperature Superconductor Wires (Postprint)

    DTIC Science & Technology

    2012-02-01

    AC05-00OR22725. REFERENCES 1. D.P. Norton, A. Goyal, J.D. Budai, D.K. Christen, D.M. Kroeger, E.D. Specht , Q. He, B. Saffian, M. Paranthaman, C.E...critical current density. Science 274, 755 (1996). 2. A. Goyal, D.P. Norton, J.D. Budai, M. Paranthaman, E.D. Specht , D.M. Kroeger, D.K. Christen, Q...D.K. Christen, M. Paranthaman, E.D. Specht , J.D. Budai, Q. He, B. Saffian, F.A. List, D.F. Lee, E. Hatfield, P.M. Martin, C.E. Klabunde, J. Mathis

  19. Numerical scoring for the Classic BILAG index.

    PubMed

    Cresswell, Lynne; Yee, Chee-Seng; Farewell, Vernon; Rahman, Anisur; Teh, Lee-Suan; Griffiths, Bridget; Bruce, Ian N; Ahmad, Yasmeen; Prabu, Athiveeraramapandian; Akil, Mohammed; McHugh, Neil; Toescu, Veronica; D'Cruz, David; Khamashta, Munther A; Maddison, Peter; Isenberg, David A; Gordon, Caroline

    2009-12-01

    To develop an additive numerical scoring scheme for the Classic BILAG index. SLE patients were recruited into this multi-centre cross-sectional study. At every assessment, data were collected on disease activity and therapy. Logistic regression was used to model an increase in therapy, as an indicator of active disease, by the Classic BILAG score in eight systems. As both indicate inactivity, scores of D and E were set to 0 and used as the baseline in the fitted model. The coefficients from the fitted model were used to determine the numerical values for Grades A, B and C. Different scoring schemes were then compared using receiver operating characteristic (ROC) curves. Validation analysis was performed using assessments from a single centre. There were 1510 assessments from 369 SLE patients. The currently used coding scheme (A = 9, B = 3, C = 1 and D/E = 0) did not fit the data well. The regression model suggested three possible numerical scoring schemes: (i) A = 11, B = 6, C = 1 and D/E = 0; (ii) A = 12, B = 6, C = 1 and D/E = 0; and (iii) A = 11, B = 7, C = 1 and D/E = 0. These schemes produced comparable ROC curves. Based on this, A = 12, B = 6, C = 1 and D/E = 0 seemed a reasonable and practical choice. The validation analysis suggested that although the A = 12, B = 6, C = 1 and D/E = 0 coding is still reasonable, a scheme with slightly less weighting for B, such as A = 12, B = 5, C = 1 and D/E = 0, may be more appropriate. A reasonable additive numerical scoring scheme based on treatment decision for the Classic BILAG index is A = 12, B = 5, C = 1, D = 0 and E = 0.

  20. Numerical scoring for the Classic BILAG index

    PubMed Central

    Cresswell, Lynne; Yee, Chee-Seng; Farewell, Vernon; Rahman, Anisur; Teh, Lee-Suan; Griffiths, Bridget; Bruce, Ian N.; Ahmad, Yasmeen; Prabu, Athiveeraramapandian; Akil, Mohammed; McHugh, Neil; Toescu, Veronica; D’Cruz, David; Khamashta, Munther A.; Maddison, Peter; Isenberg, David A.

    2009-01-01

    Objective. To develop an additive numerical scoring scheme for the Classic BILAG index. Methods. SLE patients were recruited into this multi-centre cross-sectional study. At every assessment, data were collected on disease activity and therapy. Logistic regression was used to model an increase in therapy, as an indicator of active disease, by the Classic BILAG score in eight systems. As both indicate inactivity, scores of D and E were set to 0 and used as the baseline in the fitted model. The coefficients from the fitted model were used to determine the numerical values for Grades A, B and C. Different scoring schemes were then compared using receiver operating characteristic (ROC) curves. Validation analysis was performed using assessments from a single centre. Results. There were 1510 assessments from 369 SLE patients. The currently used coding scheme (A = 9, B = 3, C = 1 and D/E = 0) did not fit the data well. The regression model suggested three possible numerical scoring schemes: (i) A = 11, B = 6, C = 1 and D/E = 0; (ii) A = 12, B = 6, C = 1 and D/E = 0; and (iii) A = 11, B = 7, C = 1 and D/E = 0. These schemes produced comparable ROC curves. Based on this, A = 12, B = 6, C = 1 and D/E = 0 seemed a reasonable and practical choice. The validation analysis suggested that although the A = 12, B = 6, C = 1 and D/E = 0 coding is still reasonable, a scheme with slightly less weighting for B, such as A = 12, B = 5, C = 1 and D/E = 0, may be more appropriate. Conclusions. A reasonable additive numerical scoring scheme based on treatment decision for the Classic BILAG index is A = 12, B = 5, C = 1, D = 0 and E = 0. PMID:19779027

  1. Identification of surface-exposed domains on the reducing side of photosystem I

    NASA Technical Reports Server (NTRS)

    Xu, Q.; Guikema, J. A.; Chitnis, P. R.; Spooner, B. S. (Principal Investigator)

    1994-01-01

    Photosystem I (PSI) is a multisubunit enzyme that catalyzes the light-driven oxidation of plastocyanin or cytochrome c6 and the concomitant photoreduction of ferredoxin or flavodoxin. To identify the surface-exposed domains in PSI of the cyanobacterium Synechocystis sp. PCC 6803, we mapped the regions in PsaE, PsaD, and PsaF that are accessible to proteases and N-hydroxysuccinimidobiotin (NHS-biotin). Upon exposure of PSI complexes to a low concentration of endoproteinase glutamic acid (Glu)-C, PsaE was cleaved to 7.1- and 6.6-kD N-terminal fragments without significant cleavage of other subunits. Glu63 and Glu67, located near the C terminus of PsaE, were the most likely cleavage sites. At higher protease concentrations, the PsaE fragments were further cleaved and an N-terminal 9.8-kD PsaD fragment accumulated, demonstrating the accessibility of Glu residue(s) in the C-terminal domain of PsaD to the protease. Besides these major, primary cleavage products, several secondary cleavage sites on PsaD, PsaE, and PsaF were also identified. PsaF resisted proteolysis when PsaD and PsaE were intact. Glu88 and Glu124 of PsaF became susceptible to endoproteinase Glu-C upon extensive cleavage of PsaD and PsaE. Modification of PSI proteins with NHS-biotin and subsequent cleavage by endoproteinase Glu-C or thermolysin showed that the intact PsaE and PsaD, but not their major degradation products lacking C-terminal domains, were heavily biotinylated. Therefore, lysine-74 at the C terminus of PsaE was accessible for biotinylation. Similarly, lysine-107, or lysine-118, or both in PsaD could be modified by NHS-biotin.

  2. The National Shipbuilding Research Program. A Common Sense Design Manual for Producibility of Hull Foundations

    DTIC Science & Technology

    1996-06-01

    FAMILY OF STANDARD FOUNDATION TYPES TYPE 6 TYPE _TYPE 18 TYPE 24 C o m p u t e r M o d e l Hull Mounted Bottom Shell Gril lage C o m p u t e r M o d... Gril lage S T A N D A R D FOUNDATION TYPE 1 C o m p u t e r M o d e l Hull Mounted Bottom Shell Frame 3. FLANGE BENDING LONGITUDINAL L FRAME BENDING 2

  3. Ecological landscape elements: long-term monitoring in Great Britain, the Countryside Survey 1978-2007 and beyond

    NASA Astrophysics Data System (ADS)

    Wood, Claire M.; Bunce, Robert G. H.; Norton, Lisa R.; Maskell, Lindsay C.; Smart, Simon M.; Scott, W. Andrew; Henrys, Peter A.; Howard, David C.; Wright, Simon M.; Brown, Michael J.; Scott, Rod J.; Stuart, Rick C.; Watkins, John W.

    2018-04-01

    The Countryside Survey (CS) of Great Britain (GB) provides a unique and statistically robust series of datasets, consisting of an extensive set of repeated ecological measurements at a national scale, covering a time span of 29 years. CS was first undertaken in 1978 to provide a baseline for ecological and land use change monitoring in the rural environment of GB, following a stratified random design, based on 1 km squares. Originally, eight random 1 km squares were drawn from each of 32 environmental classes, thus comprising 256 sample squares in the 1978 survey. The number of these sites increased to 382 in 1984, 506 in 1990, 569 in 1998 and 591 in 2007. Detailed information regarding vegetation types and land use was mapped in all five surveys, allowing reporting by defined standard habitat classifications. Additionally, point and linear landscape features (such as trees and hedgerows) are available from all surveys after 1978. From these stratified, randomly located sample squares, information can be converted into national estimates, with associated error terms. Other data, relating to soils, freshwater and vegetation, were also sampled on analogous dates. However, the present paper describes only the surveys of landscape features and habitats. The resulting datasets provide a unique, comprehensive, quantitative ecological coverage of extent and change in these features in GB. Basic results are presented and their implications discussed. However, much opportunity for further analyses remains. Data from each of the survey years are available via the following DOIs: Landscape area data 1978: https://doi.org/10.5285/86c017ba-dc62-46f0-ad13-c862bf31740e, 1984: https://doi.org/10.5285/b656bb43-448d-4b2c-aade-7993aa243ea3, 1990: https://doi.org/10.5285/94f664e5-10f2-4655-bfe6-44d745f5dca7, 1998: https://doi.org/10.5285/1e050028-5c55-42f4-a0ea-c895d827b824, and 2007: https://doi.org/10.5285/bf189c57-61eb-4339-a7b3-d2e81fdde28d; Landscape linear feature data 1984: https://doi.org/10.5285/a3f5665c-94b2-4c46-909e-a98be97857e5, 1990: https://doi.org/10.5285/311daad4-bc8c-485a-bc8a-e0d054889219, 1998: https://doi.org/10.5285/8aaf6f8c-c245-46bb-8a2a-f0db012b2643 and 2007: https://doi.org/10.5285/e1d31245-4c0a-4dee-b36c-b23f1a697f88, Landscape point feature data 1984: https://doi.org/10.5285/124b872e-036e-4dd3-8316-476b5f42c16e, 1990: https://doi.org/10.5285/1481bc63-80d7-4d18-bcba-8804aa0a9e1b, 1998: https://doi.org/10.5285/ed10944f-40c8-4913-b3f5-13c8e844e153 and 2007: https://doi.org/10.5285/55dc5fd7-d3f7-4440-b8a7-7187f8b0550b.

  4. Reorganization of equivalence classes: effects of preliminary training and meaningful stimuli.

    PubMed

    Arntzen, Erik; Nartey, Richard K; Fields, Lanny

    2018-05-01

    In Condition 1, adults learned the baseline relations for the three equivalence classes A1-B1-C1-D1-E1, A2-B2-C2-D2-E2, and A3-B3-C3-D3-E3. Classes contained abstract shapes in the ABS and four preliminary training groups. Each class in the PIC group contained one picture and four abstract shapes. Before class formation for four other groups, preliminary training involved establishing identity (CC) or arbitrary (CX) relations either with or without a delay. Without preliminary training, classes formed with low and high likelihoods in the ABS and PIC groups, respectively. Preliminary training with no delay produced modest increases in class formation, while preliminary training with delay produced large increases in class formation. Condition 2 replicated Condition 1 but with training of reassigned BC and CD relations that linked C from one class to B and D from another class: B1-C2, B2-C3, B3-C1, C2-D1, C3-D2, and C1-D3. Subsequent tests assessed the emergence of the reorganized classes A1-B1-C2-D1-E1, A2-B2-C3-D2-E2, and A3-B3-C1-D3-E3. All preliminary training procedures increased likelihood of forming the reorganized classes to the level seen in the PIC group. Greater gains were produced by preliminary training with no delays than with delays. Test performances also showed how preliminary training influenced baseline acquisition speed and participant-defined relations. © 2018 Society for the Experimental Analysis of Behavior.

  5. Risk Factors for Chorioamnion Infection and Adverse Pregnancy Outcome Among Active-Duty Military women and Dependent Women

    DTIC Science & Technology

    1998-10-01

    0 00 012 IIOTI -- 00 0 Z 0 0 REFERENCES 1. McGann, E. F., Winchester, M. I., Carter, D . P ., Martin, J. N., Jr., Bass, D ., Morrison, J. C. Factors...Women: 1982-1992. 0a014 14. Magann, E. F., Winchester, M. I., Carter, D . P ., Martin, J. N., Jr., Bass, D ., and Morrison, J. C. Factors adversely...D ZHI CE) 10T CD ZC I eC-) 3Z co 00 000 CD CD) z_ < zll CD 1a 1 1 S C) I 1 icD=---I i !! Iz .i 3, z6 z,- !0 D Iz~=3 S--I_ 11001D The current C

  6. PLA Naval Aviation Training and Operations

    DTIC Science & Technology

    2017-12-20

    cr aft Ty p es,” Re n mi n H aij u n , 1 6 A pril 2 0 1 3, p. 3. 3 3 I bi d. 3 4 K o u Yo n g qi a n g, Li Yi mi n, a n d Li X u ef e n g, “ Ta k e...6 a e 4 d 0 d 6 c 1.s ht ml. C h e n Z h e, Z h u Weij u n, a n d Z h u Ya, “ Yo u n g Offi c ers a n d E nlist e d Pers o n n el i n a N ort h S e a...ct o b er 2 0 1 4 , p. 3. MI S SI O N S, O R G A NI Z A TI O N A L S T R U C T U R E, A N D T R AI NI N G ( 2 0 1 3- 1 5) 8 5 K o u Yo n g qi a n g

  7. MEMS Lens Scanners for Free-Space Optical Interconnects

    DTIC Science & Technology

    2011-12-15

    22] D. C. O ? Brien , G. E. Faulkner, T. D. Wilkinson, B. Robertson, and D. G. Leyva, “Design and Analysis of an Adaptive Board-to-Board Dynamic...trenches on 20 µm device layer. (c-d) Deposit and pattern low-stress nitride and polysilicon for electrical isolation. (e) DRIE for MEMS structures...Telecentric Lateral Shift Board Translation (mm) D is p la c e m e n t o f S p o t (  m ) 0 0.5 1 1.5 2 0 100 200 300 400 Tilt Error Board Tilt (deg) D

  8. 75 FR 22508 - Airworthiness Directives; Eurocopter France Model AS350B, BA, B1, B2, B3, C, D, and D1; AS 355E...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-29

    ... Airworthiness Directives; Eurocopter France Model AS350B, BA, B1, B2, B3, C, D, and D1; AS 355E, F, F1, F2, N... (b) None. Applicability (c) This AD applies to Model AS350B, BA, B1, B2, B3, C, D and D1; and AS 355E..., both dated November 16, 2005, is approved by the Director of the Federal Register as of May 14, 2010...

  9. Flow-Field Measurements in the Windward Surface Shock Layer of Space Shuttle Orbiter Configurations at Mach Number 8

    DTIC Science & Technology

    1975-07-01

    pitot p robes . T e m p e r a - tu re probe TT 2 was 0.010 in. in d i a m e t e r and was used as the p r i m a r y i n s t r u m e n t . P...lower pitot probe , PPl , was c o n s t r u c t e d of 0. 0 2 0 - i n . - O D tubing t a p e r e d to 0 .014 in. at the t ip and had an ins ide...t ion in the model boundary l a y e r . The o the r pitot probe , PP2, was loca ted about 1.0 in. above PPl and was c o n s t r u c t e d of

  10. Worldwide U.S. Active Duty Military Deaths. Alphabetical Index by Name, 1 October 1979 Through 30 September 1994

    DTIC Science & Technology

    1994-09-30

    DE LME NDO G E R A R D O MAR I GZA A I R F O R C E D E LMUNDO L I LY F E D E R I S NAVY D E LOACH B O B B Y D E A N A I R F ORCE D E LOGE B...YAN LAMON EAR LE JAME S ARTHUR EAR LEY KEN W EAR LEY R OB E R T WI L L IAM J R EAR LS M I CHAE L G EAR LS OMAR DALE EAR LY BE N JAMIN J R...8 9 B R OOK LYN E 0 4 2 2 F e b 8 2 KEN TON E 0 7 14 D e c 9 1 R OCKH I L L 0 0 2 1 4 J u l 8 1 T E XAS C I T Y E 0 6 24 Oc t 7 9

  11. Metal-Arc Welded Ti-6Al-4V, Ti-4Al-4V, and Ti-5Al-2 and 1/2 SN Titanium Alloys

    DTIC Science & Technology

    1959-05-01

    x . 7 8 8 - x 2 . 1 2 i n c h ) V n o t c h Charpy i m p a c t spec imen . MATERIALS COHN* .25 . 2 3 The m a t e r i a l s u s e d d...i e d V n o t c h Charpy i m p a c t spec imen i n a s t a n d a r d i m p a c t machine w i th anvi l s modified so t h a t the center...of percussion of the pendulum coincided with the center of the impact specimen, This FIGURE 3: SUBSIZE T E N S I L E SPECIMEN FIGURE 4

  12. Optimization of Daily Flight Training Schedules

    DTIC Science & Technology

    2014-03-01

    iep iep ip X s e p Y i e p L i e p W...SOLO L CQ CQ | | 2 , | d d d iep iep ip p P p Pe e E e e E p P P Y L W i d i I               (3) SOLO L CQ | | 2 , | d d iep ... iep p P p Pe e E e e E Y L i d i I           (4) 1 , | , "CQ" o s sep s p p X s e e C e      (5) 0 0 | 2 , s d s sep s e C p

  13. Publications - PDF 93-47 | Alaska Division of Geological & Geophysical

    Science.gov Websites

    content DGGS PDF 93-47 Publication Details Title: Geologic map of the Sleetmute C-7, D-7, C-8, and D-8 ., Harris, E.E., Kline, J.T., and Miller, M.L., 1993, Geologic map of the Sleetmute C-7, D-7, C-8, and D-8 Sleetmute C-7, C-8, D-7 and D-8 quadrangles, Horn Mountain Area, southwest Alaska, scale 1:63,360 (34.0 M

  14. The Processing and Mechanical Properties of High Temperature/ High Performance Composites. Processing/Property Correlations. Book 4

    DTIC Science & Technology

    1994-03-01

    Metals Park , Ohio(1088). 42. E.W. Colin s, The Physical Metallurgy of Ti Alloys, pp.111-21-. ASM, Metals Park , Ohio (198 43. C.R. Brooos, Heat...Treatment. Structure and Properties of Nonferrous Alloys, pp.361-376. ASM, Metals Park , Ohio (1982). 44. W.C. Ha-rigan, Jr., Met. Trans. A 5, 565 (1974). 45...CJ 0 c0 CMJ 0 1~~ 00 0; 0D/D ’sseils; eJI~suG LO) C~i 0 Cl E -i E 0z Ln C; 0 DO/D ’SsOJIS teU! WON LO E C 0. 22.0 x In 0o 0)- 00D LO qw)r 0; ; 0 0i 6 0

  15. 76 FR 70046 - Airworthiness Directives; Eurocopter France Model AS350B, B1, B2, B3, BA, C, D, and D1; and...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-10

    ... Airworthiness Directives; Eurocopter France Model AS350B, B1, B2, B3, BA, C, D, and D1; and AS355E, F, F1, F2, N... France (Eurocopter) Model AS350B, B1, B2, B3, BA, C, D, and D1 helicopters; and Model AS355E, F, F1, F2... (AD 2003- 22-06), for Eurocopter Model AS350B, B1, B2, B3, BA, C, D, and D1; and Model AS355E, F, F1...

  16. Survey of Laser-Produced Pressure and Impulse Data

    DTIC Science & Technology

    1988-01-01

    Marseille, Marseille, France; C.E.A. Limeil-Service H.D.E., St. Georges , France Experimental Conditions: Laser: TEA C02 Wavelength: 10.6 pm Pulse energy: to...Mecanique des Fluides de Marseille, Marseille, France; C.E.A. Limeil-Service H.D.E., St. Georges , France Experimental Conditions: Laser: TEA CO2 Wavelength...34 Authors : C.L. Bohn, M.D. Stephen, F. Eng, J.C. Souders, G.A. Brost , T.F. Deaton, B.W. Duvall, and J.T. Tinsley Citation: "Mechanical coupling of an

  17. ErbB2 Trafficking and Signaling in Human Vestibular Schwannomas

    DTIC Science & Technology

    2008-10-01

    E -Mail...R ho G D I A. B. C. D. E . ER K /R ho G D I ER K /R ho G D I pE R K/ ER K pE R K/ ER K pE R K/ ER K pE R K/ ER K pE R K/ ER K pE R K/ ER K pE R K/ ER...c on tr ol ) 0 20 40 60 80 100 Control I-JIP 30 μM I-JIP 100 μM SP60025 20 μM B rd U- po si tiv e V S ce lls (% c on tr ol ) B rd U- po si tiv e

  18. 48 CFR 1827.409 - Solicitation provisions and contract clauses. (NASA supplements paragraph (a), (b), (c), (d), (e...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... and contract clauses. (NASA supplements paragraph (a), (b), (c), (d), (e), (i), and (k)) 1827.409... Solicitation provisions and contract clauses. (NASA supplements paragraph (a), (b), (c), (d), (e), (i), and (k.... (k)(i) The contracting officer shall add paragraph (e) as set forth in 1852.227-19(a) to the clause...

  19. Navy Nearshore Ocean Prediction Systems

    DTIC Science & Technology

    2014-09-01

    SYSTEMS B Y J AYA R A M V E E R A M O N Y, M A R K D . O R Z E C H , K A C E Y L . E D W A R D S , M I C H A E L G I L L I G A N , J E I K O O...tthor(s) Name(s) (FirstMl est), Code, Afliliation not NR,L / layaram Vet~ramony 7 Mark D 01’%ech 732 Kacey L...Edwards 732{ Michael Gilligan NAVO Eric Terrill Unlv. of CA- Soripp~ rony dePaolo Unlv. of CA. Scripps s intend~ d to offer this paper to the (Nt;~m& of

  20. 4TH International Topical Conference on High-Power Electron and Ion-Beam Research and Technology, held in Palaiseau, France, 29 June - 3 July 1981.

    DTIC Science & Technology

    1981-10-09

    N. Camarcat (Centre d’Etudes de Valduc ) noted that the French were new in this field and presented the results of the experiments on LIB production...Beam Production on Low Impedance Generators" N. Camarcat et al. C.E.A.-D.A.M.-S.E.C.R. Centre d’Etudes de Valduc , France 7...Acceleration on the Thalie Generator" J. Cortella et al. C.E.A.-D.A.M.-S.E.C.R. Centre d’Etudes de Valduc , France ION PRODUCTION II "The Work on High

  1. The single crystal elastic constants of hexagonal SiC to 1000 C

    NASA Technical Reports Server (NTRS)

    Li, Z.; Bradt, R. C.

    1988-01-01

    The relationships between the sound velocities in the cubic and hexagonal crystal structures and the tensor transformations for the two structures are applied to determine the elastic stiffnesses for the hexagonal structures of SiC to 1000 C. These results are then applied to calculate the polycrystalline elastic moduli, E and G, and their temperature variations. The calculated values for E and G at 20 C are 420 and 180 GPa; for (dE/dT) and (dG/dT), the values are -0.020 and -0.007 GPa/C, respectively.These agree well with published experimental values for E and G of dense polycrystalline alpha silicon carbides.

  2. System Synthesis for Polymorphous Computing Architectures

    DTIC Science & Technology

    2002-02-01

    G H F Proc 5 : 4 : 3 11 1 Figure 3. Self-timed execution. D C B F G H E D B H EA CG F D C B F G H E D B H EA CG F AProc 1 Proc 2...first-iteration actors denoted by T. D B H E CG F D C B F G H E D B H EA CG F A 18 T T T T Proc 3 Proc 4 Proc 5 Proc 1 Proc 2 1 T⁄ T trmin30 ture-mirror...Phase1Algo( , ) = transientReduction( ) Output T G S′ S G T S′ S S′ Figure 11. Pseudocode to find

  3. Understanding behavior under nonverbal transitive-inference procedures: Stimulus-control-topography analyses.

    PubMed

    Galizio, Ann; Doughty, Adam H; Williams, Dean C; Saunders, Kathryn J

    2017-07-01

    Following training with verbal stimulus relations involving A is greater than B and B is greater than C, verbally-competent individuals reliably select A>C when asked "which is greater, A or C?" (i.e., verbal transitive inference). This result is easy to interpret. Nonhuman animals and humans with and without intellectual disabilities have been exposed to nonverbal transitive-inference procedures involving trained arbitrary stimulus relations. Following the training of A+B-, B+C-, C+D-, and D+E-, B reliably is selected over D (i.e., nonverbal transitive inference). Such findings are more challenging to interpret. The present research explored accounts of nonverbal transitive inference based in transitive inference per se, reinforcement, such as value-transfer theory, and operant stimulus control. In Experiment 1, college students selected B>G following the training of A+B-, B+C-, C+D-///E+F-, F+G-, and G+H- (where///signifies the omission of D+E-). In Experiment 2, college students selected B>G following the training of A+B-, B+C-, C+D-///E+F-, F+G-, and G+X- (where X refers to 10 stimuli that alternated across trials). In Experiment 3, college students selected G>B following the training of Y+B-, B+C-, C+D-///E+F-, F+G-, and G+X- (where Y and X refer to 10 stimuli, respectively, that alternated across trials). These findings are discussed in the context of operant stimulus control by offering an approach based in stimulus B typically acquiring only a select stimulus control topography. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. The Solar Mass Ejection Imager (SMEI) Space Experiment

    DTIC Science & Technology

    2015-01-30

    Price, S., Radick, R. R., Sagalyn, R., Sinclair, D., Simnett, G. M., Eyles, C. J ., Cooke, M. P., Tappin, S. J ., Kuchar, T ., Mizuno, D. R., Webb, D. F...207. [3] Kaiser, M. L., Kucera, T . A., Davila, J . M., St. Cyr, O. C., Guhathakurta, M., and Christian, E., “The STEREO Mission: An Introduction...D. F., Mizuno, D. R., Buffington, A., Cooke, M. P., Eyles, C. J ., Fry, C. D., Gentile, L. C., Hick, P. P., Holladay, P. E., Howard, T . A., Hewitt

  5. Final Environmental Assessment for Proposed Airspace Changes for Paradise East and Paradise West Military Operations Areas (MOAs) at Mountain Home Air Force Base (MHAFB) Idaho

    DTIC Science & Technology

    2010-03-29

    IR FO R C E\\ 32 99 91 AI R SP A C E EA \\G IS \\M X D \\F IG U R E- A LT ER N AT IV E A. M X D M KO U BE K...basis. BO I \\\\O W L\\ PR O J\\ M O U N TA IN H O M EA IR FO R C E\\ 32 99 91 AI R SP A C E EA \\G IS \\M X D \\F IG U R E- A LT ER N AT IV E B. M X D M KO...MTR. MTR segments are identified and charted as either IR routes (IFR) or VR routes

  6. N2C2M2 Experimentation and Validation: Understanding Its C2 Approaches and Implications

    DTIC Science & Technology

    2010-06-01

    C O N FL IC TE D D EC O N FL IC TE D C O O R D IN A TE D C O LL A B O R A TI...Interactions (Shares and Posts) Log File LE VE L Fa ct oi d Se t Tr ia l TO TA L Va lu e TO TA L Va lu e / Su bj ec t Te nd en cy C TC TL s...80% 90% 100% CO N FL IC TE

  7. Enhanced vector borne disease surveillance of California Culex mosquito populations reveals spatial and species-specific barriers of infection.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    VanderNoot, Victoria A.; Curtis, Deanna Joy; Koh, Chung-Yan

    Monitor i ng in f ectio n s in v ect o rs su c h as m osquit o es, s a nd fl i es, tsetse fl i es, a nd ticks to i denti f y hu m a n path o gens m a y s e r v e as a n ear l y w arn i ng det e ction system t o dir e ct loc a l g o v er n ment dise a se pr e v en t i v e m easu r e s . Onemore » major hurdle i n de t ection is the abi l i t y to scre e n l arge n u mbers of v e c t ors for h uman patho g ens w i thout t h e u s e of ge n o t y pe - s p ecific m o lecu l ar tec h nique s . N e x t genera t ion s equ e nc i ng (NG S ) pr o v i des a n unbi a sed p latfo r m capab l e of identi f y i ng k n o w n a n d unk n o w n p ath o ge n s circula t ing w i thin a v e ctor p opul a tion, but utili z ing t h is te c h nolo g y i s tim e - con s u ming a n d cos t l y for v ecto r -b o rne disease su r v e illan c e pr o gra m s. T o addr e s s this w e d e v e lop e d cos t -eff e ct i v e Ilumina(r) R NA- S eq l i bra r y p r epara t ion m e thodol o gies i n con j u n ction w i t h an automa t ed c ompu t at i onal a n a l y sis pipel i n e to ch a racter i ze t h e microbial popula t ions c ircula t i n g in Cu l e x m o squit o e s (Cul e x qui n quef a s c iatu s , C ul e x quinq u efasc i atus / pip i ens co m pl e x h y bri d s, and C u l e x ta r salis ) t hroug h out Californ i a. W e assembled 2 0 n o vel a n d w e l l -do c ume n ted a r b o v i ruses repres e nting mem b e rs of B u n y a v ir i da e , F l a v i virid a e, If a virida e , Meson i v i rida e , Nid o v iri d ae, O rtho m y x o virid a e, Pa r v o v iri d ae, Re o virid a e, R h a b d o v i rid a e, T y m o v iri d ae, a s w ell as s e v e r al u n assi g n e d v irus e s . In addit i o n, w e m app e d mRNA s pecies to d i vergent s peci e s of t r y panos o ma a nd pl a s modium eu k a r yotic parasit e s and cha r a c terized t he p r oka r yot i c microb i al c o mposit i on to i d enti f y bacteri a l tran s c r ipts der i v ed from wolba c hia, clo s tridi u m, m y c oplas m a, fusoba c terium and c am p y l o bacter bac t er i al spec i e s . W e utilized the s e mic r obial transcri p tomes pre s e nt in g e ogra p hical l y defined Cul e x po p ul a tions to defi n e spatial and m osqui t o specie s -spec i fic ba r r iers of i n fecti o n. T he v i r ome and microbi o me c o mpos i tion id e ntified in e ach mosqui t o p o ol pr o v i ded suf f icient resolut i on to dete r m i ne both the mosq u ito species and the g e o graphic regi o n in Californ i a w h e re t h e mosqui t o po o l orig i n ated. T his d a ta pr o v i des ins i ght in t o the compl e x i t y of microb i al spec i es cir c ulati n g in med i cal l y i mport a nt Culex mosqui t oes a nd t h eir potent i al im p act o n t he tran s missi o n of v ector-b o rne human / veter i na r y p a t hogens in C a liforn i a.« less

  8. Shape Representation in V4: Investigating Position-Specific Tuning for Boundary Confirmation with the Standard Model of Object Recognition

    DTIC Science & Technology

    2004-11-01

    s s a c h u s e t t s i n s t ...i t u t e o f t e c h n o l o g y, c a m b r i d g e , m a 0 2 1 3 9 u s a — w w w . c s a i l . m i t . e d u m a ss a c h u se t t s i n...st i t u t e o f t e c h n o l o g y — co m p u t e r sc i e n ce a n d a r t i f ic ia l i n t e l l ig e n ce l a b o ra t o r y

  9. Restricted L1 Estimators and Their Covariances,

    DTIC Science & Technology

    1980-06-01

    CD22 w =e 1-.< l’ -- I -M Ce -=, -2 C 22 CD -. 00 CD LJ L":v, wD .-C >-C CD U., -D -a 22J CD: CD. Vt. U.1 . CD* 31- a UOC CD I" -J zI == CŖ - 1- InCC.J...C 22 CC:.: 2 15Cb In0’C C 4 t’ 3 CD.2-cm I- I.- iC2 CD-3SJ U. cc CDam CC 22 0.-J~ I- iD C Me CC .JJ . A.2 Dt-2C. 2. D ~ 2 CD, Z-i- C -J 2Cn LI CD22 ...22 "I.- bII CD 0.-..CW I -- k- -o. CDCD-c =DDCCC-ce CDI- 22eCCDC.C I-L- 5 2wI-CDUct. I4.CDgCD Ci L., 2=9 E Mm t,2 cm CD22 ,,- D.-.2RCC Ce:CD .Cc n 9

  10. Microemulsion-Type Fire-Resistant Diesel Fuel.

    DTIC Science & Technology

    1984-12-31

    Interface Sci., 42, 381 (1983). (SPEC22.A) 76 V. REFERENCES 1. Weatherford, W.D., Jr.; Fodor, G.E.; Naegeli , D.W.; Owens, E.C.; and Wright, B.R.; and...OO01 and DAAK70-80-C-OOOI, Report AFLRL No. il, December 1979 (Government Accession No. AD A083610). 2. Weatherford, W.D., Jr.; Fodor, G.E.; Naegeli , D.W...130, September 1980 (Government Accession No. AD A090129). 4. Weatherford, W.D., Jr.; Fodor, G.E.; Kanakia, M.D.; Naegeli , D.W.; and Wright, B.R

  11. AFOSR Technical Report Summaries

    DTIC Science & Technology

    1989-09-01

    A)m 41CI- z) 3 0 -L M W ) 4- 4’ CL i0 .C4j tD 030 a - 10.C LU)I 4- -- L 00 (a -03 533 m) m0 O JL NI Cz( . 203 0 03 u4 0 02 E - 4, CL L 1 % 4 034 0 m...8217 04% UC >( L 0. I M 1 0- 0. L 0 L - ~C 4 0 4 1 W L4 -001 - CM 1 u-E22E e (U O~0U. ’-03; - >0 t a CC L0 C) - tD L" - I& 0 (U IA -4 L 0(Z4UOCCC;E - 04...Lu 0 z r U. (D~ 0 4) D- C " > C4, 3 4 (a , ( CF L 3: 41 (A 14 MCL- - 3UV ) L-44.’U C > > O 0 0- -.oA LL 0 C =W C 0CC- -C W JV M CU 4’ (A <Z V (A 4) > 4 Z

  12. The Role of the Sonic Hedgehog Pathway for Prostate Cancer Progression

    DTIC Science & Technology

    2008-02-01

    lo ap m in e TS U -t om at id in e...TS U -c yc lo ap m in e D U 14 5- to m at id in e D u1 45 -c yc lo pa m in e Page 8 of 13 (page number not for citation purposes) Molecular Cancer...without matrigels) (B). 0 10 20 30 40 50 60 P C 3- to m at id in e P C 3- cy cl op am in e LN -C A P -t om at id in e LN -C A P -c yc lo ap m in e TS U

  13. Planning, Programming, and Budgeting System (PPBS)/Multi-year Programming: Reading Guide

    DTIC Science & Technology

    2010-09-01

    51 B -4 Potter, Barry H ., and Jack Diamond. Guidelines for Public Expenditure...IS PA GE 1 9 b . TE LE P H ON E N U M B E R ( I n c l u d e A r e a C o d e ) U U U ...I N S T I T U T E F O R D E F E N S E A N A LY S E S IDA Document D-4057 Log: H 10-000982 September 2010 Planning, Programming, and Budgeting

  14. A Feedforward Compensation Technique for Use in Mitigating Platform Induced Jitter

    DTIC Science & Technology

    2010-05-06

    Mounting Screw Holes Leveling Valve (3 per system) Control Arm 72 A P P E N D I X H : L a s e r D i o d e Class 5mW, Class IIIa Typical...8217Connected’); C4 = ’Yes’ TF1 =strcmp(C1, C2);TF2=strcmp(C3, C4); if ~ TF1 ; unload(tg); load(tg,’DEV3_rev19’); tg=xpctarget.xpc; end if

  15. An Experimental Investigation of Techniques to Suppress Edgetones from Perforated Wind Tunnel Walls

    DTIC Science & Technology

    1975-08-01

    s e e m i t t e d by the p e r f o r a t e d wa l l s h a s b e e n u n d e r s t udy f o r s e v e r a l y e a r s at AEDC. A r e c e...ld at low supe r son i c speeds . Actual s amples of pe r fo ra t ed walls f r o m the t h ree t r a n s o n i c tunnels were t es ted...c t i o n flow and wal l angle that gave a r e a s o n a b l y f la t axia l Mach n u m b e r d i s t r i b u t i o n t h roughou t the

  16. David Miller | NREL

    Science.gov Websites

    Publications D.C. Miller, E. Annigoni, A. Ballion, J.G. Bokria, L.S. Bruckman, D.M. Burns, X. Chen, L. Elliott , J. Feng, R.H. French, S. Fowler, C.C. Honeker, M.D. Kempe, H. Khonkar, M. Köhl, L.-E. Perret-Aebi , L. Elliott, L. Feng, R.H. French, S. Fowler, X. Gu, P.L. Hacke, C.C. Honeker, M.D. Kempe, H. Khonkar

  17. The Use of Statistical Measures to Validate System Dynamics Models

    DTIC Science & Technology

    1992-03-01

    C15: (T) [W15] +[FORMMSE]CI4 D15: (T) [W12] +B15-$B$19 E15: (T) +C15-$C$19 F15: (T) (W30] +D15*E15 A16: (T) [W15] +[FORMMSE]AI5 B16 : (T) (W331...FORMMSE]BI5 C16: (T) [W151 +[FORMMSE]C15 D16: (T) [W121 + B16 -$B$19 E16: (T) +C16-$C$19 46 F16: (T) [W30] +D16*El6 A17: (T) [W15] +[FORMMSE]A16 F17: (T...W30] @SUM(F7. .F16) A19: (T) CW151 "Mean= B19: (T) [W331 @AVG(B7. . Bl6 ) C19: (T) [W153 QAVG(C7. .C16) E19: (T) 11r= F19: (T) [W30] ((1/A17)*(F17))/((B20

  18. High-level ab initio predictions for the ionization energy, bond dissociation energies, and heats of formations of iron carbide (FeC) and its cation (FeC+).

    PubMed

    Lau, Kai-Chung; Chang, Yih-Chung; Lam, Chow-Shing; Ng, C Y

    2009-12-31

    The ionization energy (IE) of FeC and the 0 K bond dissociation energies (D(0)) and the heats of formation at 0 K (DeltaH(o)(f0)) and 298 K (DeltaH(o)(f298)) for FeC and FeC(+) are predicted by the single-reference wave function based CCSDTQ(Full)/CBS approach, which involves the approximation to the complete basis set (CBS) limit at the coupled cluster level up to full quadruple excitations. The zero-point vibrational energy (ZPVE) correction, the core-valence electronic corrections (up to CCSDT level), spin-orbit couplings, and relativistic effects (up to CCSDTQ level) are included in the calculations. The present calculations provide the correct symmetry predictions for the ground states of FeC and FeC(+) to be (3)Delta and (2)Delta, respectively. We have also examined the theoretical harmonic vibrational frequencies of FeC/FeC(+) at the ROHF-UCCSD(T) and UHF-UCCSD(T) levels. While the UHF-UCCSD(T) harmonic frequencies are in good agreement with the experimental measurements, the ROHF-UCCSD(T) yields significantly higher harmonic frequency predictions for FeC/FeC(+). The CCSDTQ(Full)/CBS IE(FeC) = 7.565 eV is found to compare favorably with the experimental IE value of 7.59318 +/- 0.00006 eV, suggesting that the single-reference-based coupled cluster theory is capable of providing reliable IE prediction for FeC, despite its multireference character. The CCSDTQ(Full)/CBS D(0)(Fe(+)-C) and D(0)(Fe-C) give the prediction of D(0)(Fe(+)-C) - D(0)(Fe-C) = 0.334 eV, which is consistent with the experimental determination of 0.3094 +/- 0.0001 eV. The D(0) calculations also support the experimental D(0)(Fe(+)-C) = 4.1 +/- 0.3 eV and D(0)(Fe-C) = 3.8 +/- 0.3 eV determined by the previous ion photodissociation study. The present calculations also provide the DeltaH(o)(f0)(DeltaH(o)(f298)) predictions for FeC/FeC(+). The analysis of the correction terms in these calculations shows that the core-valence and valence-valence electronic correlations beyond CCSD(T) wave function and the relativistic effects make significant contributions to the calculated thermochemical properties of FeC/FeC(+). For the experimental D(0) and DeltaH(o)(f0) values of FeC/FeC(+), which are not known to high precision, we recommend the CCSDTQ(Full)/CBS predictions [D(0)(Fe-C) = 3.778 eV, D(0)(Fe(+)-C) = 4.112 eV, DeltaH(o)(f0)(FeC) = 760.8 kJ/mol and DeltaH(o)(f0)(FeC(+)) = 1490.6 kJ/mol] based on the ZPVE corrections using the experimental vibrational frequencies of FeC and FeC(+).

  19. Elliptic Integrals in the Minkowski Plane

    DTIC Science & Technology

    1991-05-09

    factorial Pochhammer notation F(a + k) (a)k - (a) Let F(a, b , c denote the hypergeometric function. Assume c - a - b = d , where d is a positive...integer. Then in a neighborhood of C = 1 , ((d) F(a+ b+d) d-1 (a)n (b)n )n(22) F(a , b , a + b + d , () = E~ )rb+ 0-’)n( ) r(a +d) r(b +d) n =O0( ’d’ n...axes a , b and eccentriaty e = c where c = Ta2 - b2 . Let P denote one of the foci of the ellipse. Then (26) 1 1 1 2 and(26) ar+(K, P) 2 -er F(- 1

  20. Severe Weather Guide - Mediterranean Ports. 2. Naples

    DTIC Science & Technology

    1988-01-01

    Include Security Classification) S^ere Weather Guide - Mediterranean Ports - 2. Naples (U) ? SONAi <^UTHOR(S) .■/ L,^glebretson, Ronald E. (LCDR...AN ( j. ) HIJ-H F’B (2i 040200 ■ CI ’ 3) (U) C A (b) o I..; i E W C E A F’ P L. IC A T.[ G N Ei IN ! E R N...threatened try actual or -forecast 51 r D n q w i n d s , n i g n a e a s , r s s t r i c t e d v i s i D1111 y o i- thunderstcjrms m the port

  1. Joint Force Quarterly. Number 21, Spring 1999

    DTIC Science & Technology

    1999-03-01

    T H E J O I N T W O R L D 113 Doctrine ■ O F F T H E S H E L F 115 Mahan’s Blindness and Brilliance: A Review Essay...er ) U . S . A ir Fo rc e (J oe B el a) 2d M ar in e D iv is io n, C om ba t C am er a (J ac ob A . F ul le r) Marines in Norway for Battle...98. 2d M ar in e D iv is

  2. Crosstalk between Vitamins A, B12, D, K, C, and E Status and Arterial Stiffness.

    PubMed

    Mozos, Ioana; Stoian, Dana; Luca, Constantin Tudor

    2017-01-01

    Arterial stiffness is associated with cardiovascular risk, morbidity, and mortality. The present paper reviews the main vitamins related to arterial stiffness and enabling destiffening, their mechanisms of action, providing a brief description of the latest studies in the area, and their implications for primary cardiovascular prevention, clinical practice, and therapy. Despite inconsistent evidence for destiffening induced by vitamin supplementation in several randomized clinical trials, positive results were obtained in specific populations. The main mechanisms are related to antiatherogenic effects, improvement of endothelial function (vitamins A, C, D, and E) and metabolic profile (vitamins A, B12, C, D, and K), inhibition of the renin-angiotensin-aldosterone system (vitamin D), anti-inflammatory (vitamins A, D, E, and K) and antioxidant effects (vitamins A, C, and E), decrease of homocysteine level (vitamin B12), and reversing calcification of arteries (vitamin K). Vitamins A, B12, C, D, E, and K status is important in evaluating cardiovascular risk, and vitamin supplementation may be an effective, individualized, and inexpensive destiffening therapy.

  3. The Operational Equations of State, 4: The Dulong-Petit Equation of State for Hydrocode

    DTIC Science & Technology

    2012-07-01

    1 1 , 2 2 ln T T T T V S S V S V S HHC C H V V E S V C C E E P VdE E E V d e CT e d V CT...71. 9. Grinfeld, M. A. Thermodynamic Methods in the Theory of Heterogeneous Systems , Longman, New York, 1991. NO. OF COPIES ORGANIZATION

  4. 7 CFR 959.322 - Handling regulation.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... comply with paragraphs (a) through (c) or (d) or (e) of this section; except that onions handled during the period June 5 through July 15 shall comply with paragraphs (c) or (d) or (e) of this section. (a... any onions regulated hereunder, except pursuant to paragraphs (d), (e)(1), or (e)(2) of this section...

  5. 78 FR 32865 - Procedures To Establish Appropriate Minimum Block Sizes for Large Notional Off-Facility Swaps and...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-31

    ... Financial Integrity of Markets c. Price Discovery d. Sound Risk Management Practices e. Other Public... Discovery d. Sound Risk Management Practices e. Other Public Interest Considerations E. Costs and Benefits..., Competitiveness and Financial Integrity c. Price Discovery d. Sound Risk Management Practices e. Other Public...

  6. Instrumentation for Detecting Hazardous Materials.

    DTIC Science & Technology

    1980-06-01

    CATALOG NUMBER 1940-4)_ _ _ _ _ _ 4. TITLE (,.d Subtitle) _ JVE OF r , AL*3O.[OYE_ D .- / Final ; , .. P - 4^NSTRUtENTAT ION FOR DETECTING HAZARDOUS...CL a D- 4- a ... E - 0US m -i M r i US U Ci 0 Ui . Ci C) Ci. 4.. 9* Ci0 44. 4-S i C U i 5U - . ’- -) 0 C- c -CiOZ E 0 04 CiC C’ - E-.0 m N 4- 10 m E4...1 z 0 - C)4 -4 54-1 C)) 04Q). 0U $4i 4I - 40. U a) 0)U r -H 0) -a 0r- u 1-- 1% 4J ( C.) 4 0 0 4~J >1) C) r ’ (0 4 T - -4 U) C C) 0 *- C)0 - 4 f 04 C) C

  7. Impaired Relational Organization of Propositions, but Intact Transitive Inference, in Aging: Implications for Understanding Underlying Neural Integrity

    ERIC Educational Resources Information Center

    Ryan, Jennifer D.; Moses, Sandra N.; Villate, Christina

    2009-01-01

    The ability to perform relational proposition-based reasoning was assessed in younger and older adults using the transitive inference task in which subjects learned a series of premise pairs (A greater than B, B greater than C, C greater than D, D greater than E, E greater than F) and were asked to make inference judgments (B?D, B?E, C?E).…

  8. EnviroAtlas Tree Cover Configuration and Connectivity, Water Background Web Service

    EPA Pesticide Factsheets

    This EnviroAtlas web service supports research and online mapping activities related to EnviroAtlas (https://www.epa.gov/enviroatlas). The 1-meter resolution tree cover configuration and connectivity map categorizes tree cover into structural elements (e.g. core, edge, connector, etc.). Source imagery varies by community. For specific information about methods and accuracy of each community's tree cover configuration and connectivity classification, consult their individual metadata records: Austin, TX (https://edg.epa.gov/metadata/catalog/search/resource/details.page?uuid=%7B29D2B039-905C-4825-B0B4-9315122D6A9F%7D); Cleveland, OH (https://edg.epa.gov/metadata/catalog/search/resource/details.page?uuid=%7B03cd54e1-4328-402e-ba75-e198ea9fbdc7%7D); Des Moines, IA (https://edg.epa.gov/metadata/catalog/search/resource/details.page?uuid=%7B350A83E6-10A2-4D5D-97E6-F7F368D268BB%7D); Durham, NC (https://edg.epa.gov/metadata/catalog/search/resource/details.page?uuid=%7BC337BA5F-8275-4BA8-9647-F63C443F317D%7D); Fresno, CA (https://edg.epa.gov/metadata/catalog/search/resource/details.page?uuid=%7B84B98749-9C1C-4679-AE24-9B9C0998EBA5%7D); Green Bay, WI (https://edg.epa.gov/metadata/catalog/search/resource/details.page?uuid=%7B69E48A44-3D30-4E84-A764-38FBDCCAC3D0%7D); Memphis, TN (https://edg.epa.gov/metadata/catalog/search/resource/details.page?uuid=%7BB7313ADA-04F7-4D80-ABBA-77E753AAD002%7D); Milwaukee, WI (https://edg.epa.gov/metadata/catalog/search/resource/details.page?u

  9. 17 CFR 200.30-3 - Delegation of authority to Director of Division of Trading and Markets.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...(h) (§§ 240.14e-4(c), 240.14e-5(d), and 240.15c2-11(h) of this chapter), and Rules 101(d), 102(e...)(1)(viii)(G), § 240.15c3-1e(a)(1)(ix)(C), § 240.15c3-1e(a)(4), § 240.15c3-1g(b)(1)(i)(H), and § 240... Commission pursuant to sections 5318A(a)(4), 5318A(e)(2) and 5318(h)(2) of the Bank Secrecy Act (31 U.S.C...

  10. Opto-Electronic Systems Research. Image Recovery from Partial Fresnel Zone Information

    DTIC Science & Technology

    1988-03-01

    c E. zq D 40 & 0v -E 0C cE. #1. C 4- 0 ’ A ED - 4-0 T r CCE...in Figs. 2-4( a ), 2-4(b), 2-4( c ), and 2- 4(d) respectively. The phase is represented by 256 grey levels, with a phase which is just greater than - n... a grey scale from black to white. - 30- ( a ) ZF = 0.0 (b) ZF = 0.5 - . .. ( C ) ZF = 3.0 (d) ZF = 8.0 Fig. 2-5 Results of reconstructing an object

  11. Organizational Work and the Perceived Quality of Life: Toward a Conceptual Model.

    DTIC Science & Technology

    1984-08-01

    portion of Figure 2, arrows from the environment (A or B) and from the person ( C ) join together and lead to domain activities (D or E ) as a way of...thereby enhancing the perceived quality of marital life, and ultimately an improved pQL overall (path B- E - C -D-F-J-L in Figure 2). A single work variable may...from the two domain-related activities (A- C , B- C , D- C , or E - C ). All arrows leading into either of the two environmental sectors (A and B) rep- V

  12. Excess electron is trapped in a large single molecular cage C60F60.

    PubMed

    Wang, Yin-Feng; Li, Zhi-Ru; Wu, Di; Sun, Chia-Chung; Gu, Feng-Long

    2010-01-15

    A new kind of solvated electron systems, sphere-shaped e(-)@C60F60 (I(h)) and capsule-shaped e(-)@C60F60 (D6h), in contrast to the endohedral complex M@C60, is represented at the B3LYP/6-31G(d) + dBF (diffusive basis functions) density functional theory. It is proven, by examining the singly occupied molecular orbital (SOMO) and the spin density map of e(-)@C60F60, that the excess electron is indeed encapsulated inside the C60F60 cage. The shape of the electron cloud in SOMO matches with the shape of C60F60 cage. These cage-like single molecular solvated electrons have considerably large vertical electron detachment energies VDE of 4.95 (I(h)) and 4.67 eV (D6h) at B3LYP/6-31+G(3df) + dBF level compared to the VDE of 3.2 eV for an electron in bulk water (Coe et al., Int Rev Phys Chem 2001, 20, 33) and that of 3.66 eV for e(-)@C20F20 (Irikura, J Phys Chem A 2008, 112, 983), which shows their higher stability. The VDE of the sphere-shaped e(-)@C60F60 (I(h)) is greater than that of the capsule-shaped e(-)@C60F60 (D6h), indicating that the excess electron prefers to reside in the cage with the higher symmetry to form the more stable solvated electron. It is also noticed that the cage size [7.994 (I(h)), 5.714 and 9.978 A (D6h) in diameter] is much larger than that (2.826 A) of (H2O)20- dodecahedral cluster (Khan, Chem Phys Lett 2005, 401, 85). Copyright 2009 Wiley Periodicals, Inc.

  13. Proceedings of Advanced Planning Briefing for Industry. Part 1

    DTIC Science & Technology

    1965-12-01

    t h e flow o f in format ion and i d e a s must be both t o you and from you. We thus welcome t h e oppo r tun i t y o f p r e sen t i...megawatt, l i g h t wa te r moderated and c o o l e d , h i g h l y e n r i c h e d uranium , the rmal t y p e t h a t i s c o n s t a n t l y...a l s . Our c u r r e n t programs i n b e r y l l i u m and i n uranium have n o t t h e e x t e n s i v e - n e s s o f t h e e a r l i

  14. Disentangling the role of the Y(4260) in e+e- →D*Dbar* and Ds* Dbars* via line shape studies

    NASA Astrophysics Data System (ADS)

    Xue, Si-Run; Jing, Hao-Jie; Guo, Feng-Kun; Zhao, Qiang

    2018-04-01

    Whether the Y (4260) can couple to open charm channels has been a crucial issue for understanding its nature. The available experimental data suggest that the cross section line shapes of exclusive processes in e+e- annihilations have nontrivial structures around the mass region of the Y (4260). As part of a series of studies of the Y (4260) as mainly a D bar D1 (2420) + c . c . molecular state, we show that the partial widths of the Y (4260) to the two-body open charm channels of e+e- →D*Dbar* and Ds* D bars* are much smaller than that to D bar D* π + c . c . . The line shapes measured by the Belle Collaboration for these two channels can be well described by the vector charmonium states ψ (4040), ψ (4160) and ψ (4415) together with the Y (4260). It turns out that the interference of the Y (4260) with the other charmonia produces a dip around 4.22 GeV in the e+e- →D*Dbar* cross section line shape. The data also show an evidence for the strong coupling of the Y (4260) to the DDbar1 (2420), in line with the expectation in the hadronic molecular scenario for the Y (4260).

  15. Analyzing the Telecommunications Equipment Sector Using a Qualitative Framework

    DTIC Science & Technology

    2014-10-01

    N C E & T E C H N O L O G Y P O L I C Y I N S T I T U T E...I E N C E & T E C H N O L O G Y P O L I C Y I N S T I T U T E IDA Document D-5346 Analyzing the Telecommunications Equipment Sector Using a...Opportunity In ve st m en ts , S m al l B us in es s In no va tio n R es ea rc h (S B IR ) C oo pe ra tiv e R es ea rc h an d Pr od uc tio n

  16. 77 FR 29904 - Approval and Promulgation of Implementation Plans; Oregon: Infrastructure Requirements for the...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-21

    ...: (A), (B), (C), (D)(ii), (E), (F), (G), (H), (J), (K), (L), and (M). DATES: This action is effective... elements for the 1997 8-hour ozone NAAQS: (A), (B), (C), (D)(ii), (E), (F), (G), (H), (J), (K), (L), and (M... 1997 ozone NAAQS: (A), (B), (C), (D)(ii), (E), (F), (G), (H), (J), (K), (L), (M). EPA is taking no...

  17. 40 CFR 52.173 - Visibility protection.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... disapproved; (iii) Reg. 19.1505 (A)(1) and (2), (B), (C), (D)(1) and (2), (E), (F)(1) and (2), (G)(1) and (2... the State regulation is disapproved; (iii) Reg. 19.1505 (A)(1) and (2), (B), (C), (D)(1) and (2), (E.... 19.1505 (A)(1) and (2), (B), (C), (D)(1) and (2), (E), (F)(1) and (2), (G)(1) and (2), (H), (I)(1...

  18. 40 CFR 52.173 - Visibility protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... disapproved; (iii) Reg. 19.1505 (A)(1) and (2), (B), (C), (D)(1) and (2), (E), (F)(1) and (2), (G)(1) and (2... the State regulation is disapproved; (iii) Reg. 19.1505 (A)(1) and (2), (B), (C), (D)(1) and (2), (E.... 19.1505 (A)(1) and (2), (B), (C), (D)(1) and (2), (E), (F)(1) and (2), (G)(1) and (2), (H), (I)(1...

  19. 40 CFR 52.173 - Visibility protection.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... disapproved; (iii) Reg. 19.1505 (A)(1) and (2), (B), (C), (D)(1) and (2), (E), (F)(1) and (2), (G)(1) and (2... the State regulation is disapproved; (iii) Reg. 19.1505 (A)(1) and (2), (B), (C), (D)(1) and (2), (E.... 19.1505 (A)(1) and (2), (B), (C), (D)(1) and (2), (E), (F)(1) and (2), (G)(1) and (2), (H), (I)(1...

  20. Study of Avalanche Discharge Lasers.

    DTIC Science & Technology

    1983-09-30

    tic a com ponents ued fosr . o sern tio of X e1 .~i fluorescence an l se S o u r cs wi t as o e r i r s p e s u r e s a n d c r r e n t obseT...R. P . Akins and S. C. Lin, Appl. Phys. Lett. 28, 221 (1976). A 4. C. P . Wang, H. Mirels, D. G. Sutton, and S. N . Suchard, Appl. Phys. Lett. 28 , 326...intensity at the output coupling mirror, Ia , which deter- mines the laser oscillator output power PL P viz., I + n [ exp(2. 303D)+ Raexp(-Z. 33D) f , (9

  1. 26 CFR 1.469-0 - Table of contents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... for investment. (C) Property used in a trade or business. (D) Lodging rented for convenience of...)(3)-(e)(1) [Reserved] (2) Trade or business activity. (e)(3)(i)-(e)(3)(ii) [Reserved] (iii) Average... rent. (e)(3)(iv)-(e)(3)(vi)(C) [Reserved] (D) Lodging rented for convenience of employer. (E...

  2. PAMELA/ATIC anomaly from the meta-stable extra dark matter component and the leptophilic Yukawa interaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kyae, Bumseok, E-mail: bkyae@phya.snu.ac.kr

    We present a supersymmetric model with two dark matter (DM) components explaining the galactic positron excess observed by PAMELA/HEAT and ATIC/PPB-BETS: One is the conventional (bino-like) lightest supersymmetric particle (LSP) χ, and the other is a TeV scale meta-stable neutral singlet N{sub D}, which is a Dirac fermion (N,N{sup c}). In this model, N{sub D} decays dominantly into χe{sup +}e{sup −} through an R parity preserving dimension 6 operator with the life time τ{sub N} ∼ 10{sup 26} sec. We introduce a pair of vector-like superheavy SU(2) lepton doublets (L,L{sup c}) and lepton singlets (E,E{sup c}). The dimension 6 operatormore » leading to the N{sub D} decay is generated from the leptophilic Yukawa interactions by W superset of Ne{sup c}E+Lh{sub d}E{sup c}+m{sub 3/2}l{sub 1}L{sup c} with the dimensionless couplings of order unity, and the gauge interaction by L superset of (2){sup 1/2}g' e-tilde {sup c*}e{sup c}χ+h.c. The superheavy masses of the vector-like leptons (M{sub L},M{sub E} ∼ 10{sup 16} GeV) are responsible for the longevity of N{sub D}. The low energy field spectrum in this model is just the MSSM fields and N{sub D}. Even for the case that the portion of N{sub D} is much smaller than that of χ in the total DM density [O(10{sup −10}) ∼< n{sub N{sub D}}/n{sub χ}], the observed positron excess can be explained by adopting relatively lighter masses of the vector-like leptons (10{sup 13} GeV ∼< M{sub L,E} ∼< 10{sup 16} GeV). The smallness of the electron mass is also explained. This model is easily embedded in the flipped SU(5) grand unification, which is a leptophilic unified theory.« less

  3. Exercise Dread Night: Using Allied Medical Publication-8(C) to Estimate Chemical, Biological, Radiological, and Nuclear (CBRN) Casualties

    DTIC Science & Technology

    2010-08-01

    I N S T I T U T E F O R D E F E N S E A N A LY S E S IDA Document D-4130 August 2010 Exercise “Dread Night”: Using Allied Medical Publication-8(C...scientific and technical expertise, and conduct related research on other national challenges. I N S T I T U T E F O R D E F E N S E A N A LY S E...insult can be simply postulated, but it can also be calculated using the methodology described in AMedP-8(C). The latter approach was the one taken in

  4. Mechanisms of Polymer Curing and Thermal Degradation

    DTIC Science & Technology

    1979-12-01

    respectively. 29 0)- Fi . J . IR S e t u f i ( - 3 E hy y p e o y Ph n l S f n .30 z Iii 41 rI2P6i4000 3500 3000 42500 §200010 6010 2010 0 0 0 0...Polymer X Obs.6(_pm) Obs.(ppmA H 7.9,8.0 g,h 7.8 g,h 7.5 I ,e 7.5 i ,c,2 7.3 b,e 6.0-7.2 b,d,f,j,=CH 7.2 d 7.0 f,j 3.1 a HC C =- T O" 7.9 g 7.9 g 7.3 b...e 7.4 b,e 7.1 d 6.0-7.1 c,d,f,=CH 7.0 f,c 3.1 a 3.1 a aFor X 0 H, ggh, f= i b Based on first-order analysis of multiplets. 37 t TABLE 4. SUMMARY OF 13C

  5. Modified Coulomb-Dipole Theory for 2e Photoionization

    NASA Technical Reports Server (NTRS)

    2004-01-01

    In the light of recent experiment on 2e photoionization of Li near threshold, we have considered a modification of the Coulomb-dipole theory, retaining the basic assumption that the threshold is dominated by asymmetric events in phase space [implies r(sub 1), k(sub 1)) greater than or equal to 2(r(sub 2), k(sub )]. In this region [in a collinear model, 2/r(sub 12) approached + 2/(r(sub 1)+r(sub 2)] the interaction reduces to V(rIsub 1) is greater than or equal to 2r(sub 2) is identically equal to [(-Z/r(sub 2)-(A-1)/r(sub 1)] + [(-2r(sub 2)/r(sub 1 exp 2)] is identically equal to V(sub c)+[V(sub d)]. For two electron emission Z = 2, thus both electrons see a Coulomb potential (V(sub c)) asymptotically, albeit each seeing a different charge. The residual potential (V(sub d)) is dipole in character. Writing the total psi = psi (sub c) + psi(sub d) = delta psi, and noting that. (T+V(sub c)-E)psy(sub c) = 0 and (T+V(sub c))psi(sub d) = 0 can be solved exactly, we find, substituting psi into the complete Schrod. Eq., that delta psi = -(H-E)(exp -1)(V(sub d) psi(sub 0)+V(sub c psi (sub 1). Using the fact that the absolute value of V(sub c) is much more than the absolute value of V(sub d) in almost all of configuration space, we can replace H by H(sub 0) in 9H-E)(exp -1) to obtain an improved approximation psi (improved) = psi(sub c) + psi(sub d) -(H(sub 0)-E)(exp -1) (V(sub c) psi (sub 0) + V(sub c) psi(sub 1). Here's the Green's function (H(sub 0)-E)(exp -1), can be exhibited explicitly, but the last term in psi (improved) is small, compared to the first two terms. Inserting them into the transition matrix element, which one handles in the usual way, we obtain in the limit E approaches 0, the threshold law: Q(E) alpha E + M(E)E(exp 5/4) + higher order (Eq. 1a). The modulation function, M(E), is a well-defined (but very non-trivial integral, but it is expected to be well approximated by a sinusoidal function containing a dipole phase term (M(E) = c sin[alpha log (E) + micron] (Eq. 1b). Experimental results show definite modulations, and are well fitted by Eqs (1).

  6. Automation of the Marine Corps Planning Process

    DTIC Science & Technology

    2014-06-01

    I & IV P ro b le m Fr am in g C h ap te r II  JT C W  C P O F  IO Sv 1 C O A D e ve lo p m e n t C O A W ar -G am e C O A C o m p...S  JA D IC S  P SS -S O F  St ri ke Li n k  C ID N E  IO Sv 2  IO Sv 3  M ar in e Li n k Command & Control C h ap te r II I

  7. Defense Logistics Agency Disposition Services Needs to Improve Demilitarization Program Self-Assessment Evaluations - Redacted

    DTIC Science & Technology

    2016-12-20

    Program Self -Assessment Evaluations I N T E G R I T Y  E F F I C I E N C Y  A C C O U N T A B I L I T Y  E X C E L L E N C E Mission Our mission...Project No. D2016-D000RD-0057.000) │ i Results in Brief Defense Logistics Agency Disposition Services Needs to Improve Demilitarization Program Self ...mutilation contractor3 in Holbrook, New York, the two sites we visited. However, for self -assessment evaluations4 at three DLA Centralized

  8. Observation of an alternative χ c 0 ( 2 P ) candidate in e + e - → J / ψ D D ¯

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chilikin, K.; Adachi, I.; Aihara, H.

    We perform a full amplitude analysis of the process e + e - → J/ψmore » $$D\\bar{D}$$, where D refers to either D 0 or D +. A new charmoniumlike state X*(3860) that decays to$$D\\bar{D}$$ is observed with a significance of 6.5σ. Its mass is (3862 $$+26+40\\atop{-32-13}$$) MeV=c 2, and its width is (201 $$+154+88\\atop{-67-82}$$) MeV. The J PC 0 ++ hypothesis is favored over the 2 ++ hypothesis at the level of 2.5σ.« less

  9. The Army’s Wireless Communications Programs

    DTIC Science & Technology

    2009-02-11

    20Plans%20First%20AEHF% 20Launch%20Early%20Next%20Year&channel= awst .9 CBO Other Strategic Wireless Communications Programs The Army invests in a number...O N G R E SS O F T H E U N IT E D ST AT E S C O N G R E SSIO N A L B U D G E T O FFIC E W A SH IN G T O N , D C 20515

  10. 47 CFR 95.633 - Emission bandwidth.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... is 4 kHz. The authorized bandwidth for emission type A1D or A3E is 8 kHz. The authorized bandwidth for emission type F1D, G1D, F3E or G3E is 20 kHz. (b) The authorized bandwidth for any emission type transmitted by an R/C transmitter is 8 kHz. (c) The authorized bandwidth for emission type F3E or F2D...

  11. 47 CFR 95.633 - Emission bandwidth.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... is 4 kHz. The authorized bandwidth for emission type A1D or A3E is 8 kHz. The authorized bandwidth for emission type F1D, G1D, F3E or G3E is 20 kHz. (b) The authorized bandwidth for any emission type transmitted by an R/C transmitter is 8 kHz. (c) The authorized bandwidth for emission type F3E or F2D...

  12. 47 CFR 95.633 - Emission bandwidth.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... is 4 kHz. The authorized bandwidth for emission type A1D or A3E is 8 kHz. The authorized bandwidth for emission type F1D, G1D, F3E or G3E is 20 kHz. (b) The authorized bandwidth for any emission type transmitted by an R/C transmitter is 8 kHz. (c) The authorized bandwidth for emission type F3E or F2D...

  13. Characteristic of Enterococcus faecium clinical isolates with quinupristin/dalfopristin resistance in China.

    PubMed

    Wang, Shanshan; Guo, Yinjuan; Lv, Jingnan; Qi, Xiuqin; Li, Dan; Chen, Zengqiang; Zhang, Xueqing; Wang, Liangxing; Yu, Fangyou

    2016-10-21

    Quinupristin/dalfopristin (Q/D) is a valuable alternative antibiotic to vancomycin for the treatment of multi-drug resistant Enterococcus faecium infections. However, resistance to Q/D in E. faecium clinical isolates and nosocomial dissemination of Q/D-resistant E. faecium have been reported in several countries and should be of concern. From January 2012 to December 2015, 911 E. faecium clinical isolates were isolated from various specimens of inpatients at the first Affiliated Hospital of Wenzhou Medical University located in Wenzhou, east China. Of 911 E. faecium clinical isolates, 9 (1.0 %, 9/911) were resistant to Q/D, with the Q/D MIC values of 64 mg/L(1), 32 mg/L(1), 16 mg/L(3), 8 mg/L(1) and 4 mg/L(3) determined by broth microdilution. All Q/D-resistant isolates were susceptible to vancomycin, tigecycline and teicoplanin but resistant to penicillin, ampicillin and erythromycin. vatE was only found in one Q/D-resistant E. faecium isolate while vatD was not detected in any of the isolates tested. 8 of 9 Q/D-resistant E. faecium isolates were found be positive for both ermB and msrC. The combinations of Q/D resistance determinants were ermB-msrC (7 isolates) and ermB-msrC-vatE (one isolate). ST78, ST761, ST94, ST21 and ST323 accounted for 4, 2, 1, 1 and 1 isolate, respectively, among which ST78 was the prevalent ST. Q/D-resistant E. faecium clinical isolates were first described in China. Carriage of vatE, ermB and msrC was responsible for Q/D resistance.

  14. Microcomputers and the Electrical Engineer.

    DTIC Science & Technology

    1984-07-01

    B6 10*SIN(B4*B1I) 12 BII+B6 10*SIN(B4*812) 13 B12+B6 1O*SIN(B4*BI3) 14 B13+B6 10*SIN(B4*B14) 15 B14+B6 10*SIN(B4*BI5) 16 B15+B6 10*SIN(B4* Bl6 ) 17 B16 ...C15)),AND(D15,NOT(EI5 16 0 0 1 0 OR(AND( B16 ,NOT(C16)),AND(D16,NOT(E16 a17 0 0 0 1 OR(AND(B17,NOT(C17)),AND(D17,NOT(E17 18 0 0 0 0 OR(AND(B18,NOT(C18...NOT(E15)) 16 0 0 010 AND(AND( Bl6 ,NOT(Cl7)),AND(D16,NOT(E16)) 18 0) 0 0 0 AND(AND(B18,NOT(C18)),AND(D18,NOT(E18)) 19 Figure 3 I A IIBIJCIIDIIEII F I 1

  15. Unit Ministry Team Religious Support to Casualties on the Airland Battlefield

    DTIC Science & Technology

    1987-10-28

    282 Mononucleosis , Mod 283 Hepatitis, Infectious 284 Cholecystitis, Severe 285 Cholecystitis, Mod 286 Pancreatitis Acute, Sev 287 Cirrhosis, Severe...Ministry A-5 APPENDIX B - Methodology B-l APPENDIX C - Modal C-l APPENDIX D - Data D-l Patient Description and Treatment Data D-l Hospital Suamary...Support, AirLand Battla E-l Echelons of Medical Treatment E-3 Mass Casualtias E-5 Evacuation E-5 Madical Regulating E-6 Employment E-7

  16. The Effect of Strakes on Vortical Flows Applied to Aircraft.

    DTIC Science & Technology

    1984-03-31

    ORDONEZ 31 NRR 84 UNCLASSIFIED VK! PR-1983 22 EOARD-TR-94-14 RFOSR-83-8i26 F /G 2014 ML _mhhhhhmhhmml Iommomom Ilffffffffffff Big I. ’z.’ MICROCOPY...dS - f dS (1) ’A This equation does not take into account the effect of pressure gradients between the control surfaces. The total head formula is...000 E+0 C’_. 3C’’)C .r.,E+ 02 0, 15C’C’C ’E+ (2 - . 129704E-12 -C’. 120900E- 12 0. 250’)’OE+02 1’ 5 f ’ 0CCE+ 02 -0 176122E+02 -0. 194824E+00 0. 2rQCQ

  17. Crosstalk between Vitamins A, B12, D, K, C, and E Status and Arterial Stiffness

    PubMed Central

    Luca, Constantin Tudor

    2017-01-01

    Arterial stiffness is associated with cardiovascular risk, morbidity, and mortality. The present paper reviews the main vitamins related to arterial stiffness and enabling destiffening, their mechanisms of action, providing a brief description of the latest studies in the area, and their implications for primary cardiovascular prevention, clinical practice, and therapy. Despite inconsistent evidence for destiffening induced by vitamin supplementation in several randomized clinical trials, positive results were obtained in specific populations. The main mechanisms are related to antiatherogenic effects, improvement of endothelial function (vitamins A, C, D, and E) and metabolic profile (vitamins A, B12, C, D, and K), inhibition of the renin-angiotensin-aldosterone system (vitamin D), anti-inflammatory (vitamins A, D, E, and K) and antioxidant effects (vitamins A, C, and E), decrease of homocysteine level (vitamin B12), and reversing calcification of arteries (vitamin K). Vitamins A, B12, C, D, E, and K status is important in evaluating cardiovascular risk, and vitamin supplementation may be an effective, individualized, and inexpensive destiffening therapy. PMID:28167849

  18. China’s ASAT Test: Motivations and Implications

    DTIC Science & Technology

    2007-01-01

    h i l l i P c . S a u n D e r S and c h a r l e S D . l u t e S Dr. Phillip C. saunders and Colonel Charles D. Lutes, UsaF, are senior Research...at <www.aviationweek.com/aw/generic/story_generic. jsp?channel= awst &id=news/aw012207p2.xml>. 11 Chris Buckley, “China confirms satellite test, says

  19. Deviatoric Constitutive Relationship for Anisotropic Materials

    DTIC Science & Technology

    1987-06-01

    SEFF = VMISES ICHECK (1) = 0 DEPSBP = 0. CALL XFORM (STR(I),STR(2),STR(3),STR(4),STR(5),STR(6), & SR2 ,SZ2 ,ST2 ,SZT2 ,SRT2 ,SRZ2,-TH) GO TO 310...END I F C c Yield h a s occured: D e t e r m i n e ALF, t h e f r a c t i o n of s t r a i n c t h a t is pre-y ie ld . C I F ( ICHECK ...c e l s e m u s t d e t e r m i n e e l a s t i c f r a c t i o n ( a l f ) (see V a v r i c k , J o h n s o n ) C ICHECK (1) = 1 TERM1 = 0

  20. Momentum Flux Measurements from Under Expanded Orifices: Applications for Micropropulsion Systems

    DTIC Science & Technology

    2001-01-11

    S., Helvajian , H ., "Batch-Fabricated dA Microthrusters: Initial Results," AIAA paper 96-dpb c2988, July 1996. ,’ \\ 5. Kohler, J., Jonsson, M.,.Simu, U...experimental configuration, the accomplished at very !,v stagnation pmass flow meter operated in the continuuma c c o m p li s h e d ~ ~ ~ I t v e y k w...s a n i o n p r e s s u r er e i e t o u h t p s u e r a g , s d e . operation where the molecule mean free path is regime through the pressure r.ge

  1. Atomic Engineering of Superconductors by Design

    DTIC Science & Technology

    2014-10-23

    Kumah, J. H. Ngai, E. D. Specht , D. A. Arena, F. J. Walker, C. H. Ahn. Phase diagram of compressively strained nickelate thin films, Applied Physics...1940 (2014)10.1002/adma.201304256). 3. A. S. Disa, D. P. Kumah, J. H. Ngai, E. D. Specht , D. A. Arena, F. J. Walker, C. H. Ahn, Phase diagram of

  2. High-Resolution Study of the C-D Stretching Bands of 12C 6D 6 and 13C 6D 6

    NASA Astrophysics Data System (ADS)

    Pliva, J.; Johns, J. W. C.; Goodman, L.

    1994-01-01

    The perpendicular C-D stretching bands ν 12 (species E1 u) were measured for two isotopomers of benzene with D6 h symmetry. 12C 6D 6 and 13C 6D 6, on a high-resolution Fourier transform spectrometer. Both bands show effects of fairly strong perturbations by states resulting from combinations of low-frequency vibrations. The ν 12 state of 12C 6D 6 is in Fermi resonance with the combination ν 2 + ν 3 whose pP lines, enhanced by the resonance, are observed just below the pP branches of ν 12. An x, y-type Coriolis interaction with an unidentified state of symmetry E2 u, and another anharmonic interaction with an unknown E1 u state, have also been detected in the spectrum. These interactions were included, along with the Fermi resonance and the rotational l-resonance and -doubling, in the Hamiltonian used in the analysis of this band. For the ν 12 band of the 13C 6D 6 isotopomer, a strong perturbation by an anharmonic resonance with the E1 u state ν 7 + ν 11 + ν 14 and a much weaker perturbation. presumably by a z-type Coriolis interaction with an unidentified perturber, have been observed and taken into account in the analysis. Spectroscopic constants are reported for the ν 12 states of the two isotopic species, and parameters obtained for the various perturbers and coupling constants are also listed. It is found that the ζ sum for the E1 u vibrations of all D6 h isotopomers of benzene differs slightly from the theoretical value of ∑ζ t = -1.

  3. Responses of Cholinergic and Noncholinergic Renshaw Cell Receptors After Acute and Chronic Exposure to Anticholinesterases.

    DTIC Science & Technology

    1983-07-01

    SECURITY CLASSIFICATION OF THIS PAGEMten. Deae Eneered; WILIM . ANMEER . . A .- M P D t JIG3.9) 0D O R E P O S E.O AHL N R M YC A N D I N C L I N I R...ESA C A N S H AWE V E L L E PT O R N AH ANes, Iowa 5A0011 AF ROCTE AD HROIC SEOSRE TAN TIONETES ( U.S. ARY ANNAL RSUARY RN EO NTCMMN Fort Detrick...supramaximal antidromic ventral root stimulation (fig. 23a-f), with less effect on frequency of the discharge. As seen in figure 23 (a,b,c, cf. d, e ,f

  4. 77 FR 23322 - Proposed Information Collection (Report of General Information) Activity: Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-18

    ... Information. d. VA Form 21-0820c, Report of Defense Finance and Accounting Service (DFAS). e. VA Form 21-0820d.... VA Form 21-0820c, Report of Defense Finance and Accounting Service (DFAS)--2,500. e. VA Form 21-0820d... Nursing Home Information--30,000. d. VA Form 21-0820c, Report of Defense Finance and Accounting Service...

  5. Evaluating the Effectiveness of Air Force Foundational Cyberspace Training

    DTIC Science & Technology

    2012-06-14

    fileticket=zAcDCP6H2T4%3d&tabid=56&mid=415 (accessed 25 May 2012). VIT .1 Vita . U N I T E D S T A T E S A I R F O R C E MAJOR APRIL...as of May 2012) VIT .2 . U N I T E D S T A T E S A I R F O R C E MAJOR APRIL L. WIMMER ASSIGNMENTS 1. September 2000

  6. United States Air Force Statistical Digest, Fiscal Year 1961. Sixteenth Edition

    DTIC Science & Technology

    1961-09-30

    E __ _ SUBJECT: Public Release Approval Request I...for 1945-2005 (Please include page count) A UTHORIORGANIZA TION: ____ ----"""SA’-"F’-’-~""M"-’-"C~ E __ _ PRESENTATION TO: General Public DATE: As...34"C t=€~dC( 16 (Print Reviewer’S Name/duty title/phone numbyr) ;::" - e -. (fv ~ 1\\ :;’" e c ŕ-0 I"’ rt ~ D5 I\\P/I-+O (:c, 17 -5 GOO .J REPl:Y

  7. Motivation: A Seminar to Assist Charge Nurses in Understanding Motivation and Worker Behavior

    DTIC Science & Technology

    1988-05-01

    c . Growth needs - need for personal growth and development. 0 2. Alderfer - believes...H 0s 0. rj 4 a3Lr ()3 0 L) 0 -P E000 0) - - -O൱ =1 0 -j Ln - .0 03 0:44 U- 0 -a 6 .1-. c 41 0 c Ii - - u t- <I, LO0 E D, fn 441 0~-t 0 0~( 1-a-i-I...U -7- 0 Fi1aU 0C >. 0 s .0> 0 .0 -,~~L -.. 0~~a tn V wC co c 0 >4 u t4 _-.,d ~ ’ C OC)o E LL 0C) 4J. -H - C C ) -, E - E 00 Z C a 0 C )

  8. 76 FR 56130 - Approval and Promulgation of Air Quality Implementation Plans; Maryland; Section 110(a)(2...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-12

    ... NAAQS dated October 22, 2008: 110(a)(2)(A), (B), (C), (D)(ii), (E), (F), (G), (H), (J), (K), (L), and (M...), (B), (C), (D)(ii), (E), (F), (G), (H), (J), (K), (L), and (M), or portions thereof. DATES: Written..., K, L, M. November 30, 2007 G April 3, 2008 A, B, C, D(ii), E, F, G, H, J, K, L, M. April 16, 2010 G...

  9. Computational Methods for Feedback Controllers for Aerodynamics Flow Applications

    DTIC Science & Technology

    2007-08-15

    Iteration #, and y-translation by: »> Fy=[unf(:,8);runA(:,8);runB(:,8);runC(:,8);runD(:,S); runE (:,8)]; >> Oy-[unf(:,23) ;runA(:,23) ;runB(:,23) ;runC(:,23...runD(:,23) ; runE (:,23)]; >> Iter-[unf(:,1);runA(U ,l);runB(:,l);runC(:,l) ;runD(:,l); runE (:,l)]; >> plot(Fy) Cobalt version 4.0 €blso!,,tic,,. ř-21

  10. 76 FR 47062 - Approval and Promulgation of Air Quality Implementation Plans; West Virginia; Section 110(a)(2...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-04

    ... 22, 2008: 110(a)(2)(A), (B), (C), (D)(ii), (E), (F), (G), (H), (J), (K), (L), and (M), or portions... CAA section 110(a)(2)(A), (B), (C), (D)(ii), (E), (F), (G), (H), (J), (K), (L), and (M), or portions... sections 110(a)(2)(A), (B), (C), (D)(ii), (E), (F), (G), (H), (J), (K), (L), and (M), or portions thereof...

  11. Bulk amorphous steels based on Fe alloys

    DOEpatents

    Lu, ZhaoPing; Liu, Chain T.

    2006-05-30

    A bulk amorphous alloy has the approximate composition: Fe.sub.(100-a-b-c-d-e)Y.sub.aMn.sub.bT.sub.cM.sub.dX.sub.e wherein: T includes at least one of the group consisting of: Ni, Cu, Cr and Co; M includes at least one of the group consisting of W, Mo, Nb, Ta, Al and Ti; X includes at least one of the group consisting of Co, Ni and Cr; a is an atomic percentage, and a<5; b is an atomic percentage, and b.ltoreq.25; c is an atomic percentage, and c.ltoreq.25; d is an atomic percentage, and d.ltoreq.25; and e is an atomic percentage, and 5.ltoreq.e.ltoreq.30.

  12. Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

    PubMed Central

    Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

    2011-01-01

    Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

  13. Publications - Plafker, George and Berg, H.C., 1994 | Alaska Division of

    Science.gov Websites

    , M.S., Smith, T.E., Berg, H.C., Andersen, G.L., Chipp, E.R., Gaard, D.R., Burton, P.J., Dunbler, John ., Newberry, R.J., Rogers, R.K., Rubin, C.M., Swainbank, R.C., Smith, P.R., and Stephens, Jackie, 1994 , H.C., Brew, D.A., Grybeck, Donald, Robinson, M.S., Smith, T.E., and Yeend, Warren, 1994, Metallogenic

  14. Range Finding 14-Day and 90-Day Subchronic Feeding Studies with N,N-Dipropylcyclohexanecarboxamide in Rats. Phase 4.

    DTIC Science & Technology

    1986-12-01

    Y CLS$1F-.AT N OF THIS...1 MN cD jO 0 -O Ocn00 ~ c" W) 400’ rno n + a9 .9 .i , vi 4 -W cm C44. y c 000 CD %D 1% CD-. U 4 CnN C! - N ON N N TV o 00 e~. r, ML 4r WL ne 0...to N D N4 ’aN N " Nf Y N Nm 00 1C’ bq D Wc iG f". rC W C4 No N N D On ’-0 0 0 f" .4l cc W.4 LoP doE N 04 In Ins. +. V. 0 0 fn 10 C Go 0D C 00’ 4o

  15. Investigation of Fire-Vulnerability-Reduction Effectiveness of Fire-Resistant Diesel Fuel in Armored Vehicular Fuel Tanks

    DTIC Science & Technology

    1980-09-30

    Aberdeen Proving Ground, Maryland, September 1976. 2. Weatherford, W.D., Jr., Fodor, G.E., Naegeli , D.W., Owens, E.C., Wright, B.R., and Schaekel, F.W...Weatherford, W.I)., Jr., Fodor, G.E., Naegeli , D.W., Owens, E.C., Wright, B.R., and Schaekel, F.W., "Development of Army Fire-Resistant Diesel Fuel," Interim

  16. Climate and Conflict: A Comment on Hsiang et al.’s Reply to Buhaug et al

    DTIC Science & Technology

    2014-01-01

    Jonas Nordkvelle 106011 c . THIS PAGE The public reporting burden for this collection of information is estimated to average 1 hour per response, including...conflict relationship. D e sign : M e d icin eh e ad s.co m E d ito r: A gn e te Sch jø n sb y C o ve r p h o to P atrick Sicco li / G am m a-R...odds with the assumption of causal homogeneity. c ) For reasons explained in b), we believe a meta-analysis of the empirical climate- conflict

  17. Flexible exportation mechanisms of arthrofactin in Pseudomonas sp. MIS38.

    PubMed

    Lim, S P; Roongsawang, N; Washio, K; Morikawa, M

    2009-07-01

    To obtain further insights into transportation mechanisms of a most effective biosurfactant, arthrofactin in Pseudomonas sp. MIS38. A cluster genes arfA/B/C encodes an arthrofactin synthetase complex (ArfA/B/C). Downstream of the arfA/B/C lie genes encoding a putative periplasmic protein (ArfD, 362 aa) and a putative ATP-binding cassette transporter (ArfE, 651 aa), namely arfD and arfE, respectively. The arfA/B/C, arfD, and arfE form an operon suggesting their functional connection. Gene knockout mutants ArfD:Km, ArfE:Km, ArfD:Tc/ArfE:Km, and gene overexpression strains MIS38(pME6032_arfD/E) and ArfE:Km(pME6032_arfD/E) were prepared and analysed for arthrofactin production profiles. It was found that the production levels of arthrofactin were temporally reduced in the mutants or increased in the gene overexpression strains, but they eventually became similar level to that of MIS38. Addition of ABC transporter inhibitors, glibenclamide and sodium ortho-vanadate dramatically reduced the production levels of arthrofactin. This excludes a possibility that arthrofactin is exported by diffusion with the aid of its own high surfactant activity. ArfD/E is not an exclusive but a primary exporter of arthrofactin during early growth stage. Reduction in the arthrofactin productivity of arfD and arfE knockout mutants was eventually rescued by another ABC transporter system. Effects of arfD and arfE overexpression were evident only for 1-day cultivation. Multiple ATP dependent active transporter systems are responsible for the production of arthrofactin. Pseudomonas bacteria are characterized to be endued with multiple exporter and efflux systems for secondary metabolites including antibiotics, plant toxins, and biosurfactants. The present work demonstrates exceptionally flexible and highly controlled transportation mechanisms of a most effective lipopeptide biosurfactant, arthrofactin in Pseudomonas sp. MIS38. Because lipopeptide biosurfactants are known to enhance efficacy of bioactive compounds and arfA/B/C/D/E orthologous genes are also found in plant pathogenic P. fluorescens and P. syringae strains, the knowledge would also contribute to develop a technology controlling plant diseases.

  18. Lake Ladora and Lake Mary Phase 2 Data Addendum Site 2-17 Task No. 20 - Lower Lakes Version 3.1.

    DTIC Science & Technology

    1988-10-01

    4 E4 1>E 0 0 m 41 a l 0 0 1. 1-0 0. A 0a L I 0a c0 C4 LI C S .-4 ItI * M 1 0 0C41 C4 0 .4 .1 L E- .0 C 5 L I4 I10L d 0 0 0 000 0 ii 0 0 8 000 0d 0kI 4...L N L S 0L 4)4N L? 4C 0) 0C 0 P) 4?10-0 0 L E- n’ 4 0 O W L IL 0 0 3, 0 CJ -i J- tD >.nx i I 009H t98 )-)I- , 00 *I080000 *000- 00 888 0 00088 00000

  19. ASW Fusion on a PC

    DTIC Science & Technology

    2004-06-01

    14 C. AOU GENERATION ....................................................................................15 D ...25 C. ESTIMATING INITIAL TARGET LOCATION ......................................27 D . ESTIMATING AN AOU...the East-West Direction Estimated Mean Velocity in the North-South D E Xµ = = E-W Vel N-S Velirection lon lat µ µ µ µ

  20. Sunlight, Sea Ice, and the Ice Albedo Feedback in a Changing Arctic Sea Ice Cover

    DTIC Science & Technology

    2015-09-30

    PUBLICATIONS Carmack, E .; I. Polyakov; L. Padman; I. Fer; E . Hunke; J. Hutchings; J. Jackson; D. Kelley; R. Kwok; C. Layton ; D.K. Perovich; O. Persson; B...Heygster, M. Huntemann, P. Schwarz, G. Birnbaum, C. Polashenski, D. Perovich, E . Zege, A. Malinka and A. Prikchach (2015), The melt pond fraction and

  1. Response Protocol Toolbox: Planning for and Responding to Drinking Water Contamination Threats and Incidents. Response Guidelines

    DTIC Science & Technology

    2004-08-01

    sp ec if ic ra d io n u cl id es 9 0 0 S er ie s 3 2 In te ri m F in al – A u g u st 2 0 0 4 R E S...in je ct io n , h ea d sp ac e S ee M o d u le 4 A n a ly si s: G C /M S , G C , H P L C , L C -M S U n k n o w n in o rg an ic s 1 L...er f o r th e m et er o r k it u se d d u ri n g s

  2. Socio-behavioral considerations in the role of militant extremism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bernard, Michael Lewis; Backus, George A.; Beyeler, Walter E.

    This paper discusses relevant findings and theories regarding the role of ideology, culture, and context in shaping the behaviors of individuals within violent social movements. Accordingly, this focus concerns the comparative weight placed on ideology and culture (expressed principles and motives) versus external factors as chief influencers for the propensity of individuals to act outside of the norms of society and politics by resorting to violent behaviors. In doing so, we have drawn upon theory from anthropology, behavioral economics, political science, psychology, and sociology to better understand how these variables give birth to and nurture militant social movements. F umore » r t h e r d i s s e m i n a t i o n o n l y a s a u t h o r i z e d t o U . S . G o v e r n m e n t a g e n c i e s a n d t h e i r c o n t r a c t o r s ; o t h e r r e q u e s t s s h a l l b e a p p r o v e d b y t h e o r i g i n a t i n g f a c i l i t y o r h i g h e r D O E p r o g r a m m a t i c a u t h o r i t y .« less

  3. SOCIO-BEHAVIORALCONSIDERATIONS IN THE ROLE OF MILITANT EXTREMISM.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bernard, Michael Lewis; Backus, George A.; Beyeler, Walter E.

    This paper discusses relevant findings and theories regarding the role of ideology, culture, and context in shaping the behaviors of individuals within violent social movements. Accordingly, this focus concerns the comparative weight placed on ideology and culture (expressed principles and motives) versus external factors as chief influencers for the propensity of individuals to act outside of the norms of society and politics by resorting to violent behaviors. In doing so, we have drawn upon theory from anthropology, behavioral economics, political science, psychology, and sociology to better understand how these variables give birth to and nurture militant social movements. F umore » r t h e r d i s s e m i n a t i o n o n l y a s a u t h o r i z e d t o U . S . G o v e r n m e n t a g e n c i e s a n d t h e i r c o n t r a c t o r s ; o t h e r r e q u e s t s s h a l l b e a p p r o v e d b y t h e o r i g i n a t i n g f a c i l i t y o r h i g h e r D O E p r o g r a m m a t i c a u t h o r i t y .« less

  4. Geographic List of Prime Contract Awards. Oct 92-Sep 93. FY 93. (Absarokee, Montana-Truth or Consequences, New Mexico). Part 8

    DTIC Science & Technology

    1994-03-01

    4- wi 01 (A I- s- 4-’ (A (4 m) 5- C - U 0 0 0 U) 01 0) U) d’ I V) V) ( 1 ) < (0 4S) L C 0 4-) 4) 01 _0 0 > c a) c L 4-) S 1 . - u U C -’ S.- CD 0 C 0 C...4J fo to - i’ Ca 0 cu -n0 C C Co (a IV Q) (n ’C ’C C ) C C E in 0) M) =4 5- L M1 -. 4- I ’ 3: t l) 01 c/) U) C En a) M- 4- .i 4- C C: < -M 44 ’ 1 , . U...0L.0 0) *’- (D M > to -.- - - 0 ’C to It SC a -’ C - = C 4 C ’ E m 4- o S- Li. U 1 :4- :j 4- 4-’ E a 0) 4.- C) 0 (D -- o -’- E C/) < 0 TE >% 4-’ 0- 4

  5. Prime Contract Awards Alphabetically by Contractor, By State or Country, and Place, FY 84. Part 2. (Bay Area Controls - Cirtech Corporation).

    DTIC Science & Technology

    1984-01-01

    AC._E All ot ter edotons are oosolete. 747 to z ’ -’ (1 0A co 0 Y N N M) ( D ) D ) () C) ftN NII C N ~ N ID 0 Iq N N Q0I ) e D0 N I-’ N 17 -0 CDN Z O...L) C ) 0 0q D C .0~ ~ ~ ~ ~ C -)0 )- C- - C- I- - C-----)- NNN- 0 w iIw w r I ca - - N NNc N N IN ’mN N NNNNidN N CC N N: N - 0 0’ L)W C YWa*i c N Y...W N’ K) c) X K x K)4 K) Y a) w0 N)~ N--4 N N- K) d K)- ---------- ) N ) N )- N CO D0 .0 0N 0 00 0 0 0 K)NNN 0) K) 0 0 0 Vi0ac.o )0 0OO N NON C) 0 0D K

  6. Inter-serotype comparison of polysaccharides produced by extracellular enzymes from Streptococcus mutans.

    PubMed

    Yakushiji, T; Inoue, M; Koga, T

    1984-04-15

    The biochemical and morphological characteristics of polysaccharides synthesized from sucrose by extracellular enzymes from D-glucose-grown Streptococcus mutans representing serotypes a-g were compared. The polysaccharides synthesized by the enzymes from serotypes a, d, and g formed visible aggregates and firmly adhered to glass surfaces, whereas those formed by the enzymes from serotypes b, c, e, and f floated homogeneously and were poorly adherent. The enzymes of serotypes a, d, and g produced large amounts of water-insoluble polysaccharides (IPs, D-glucans), and those of serotypes b, c, e, and f water-soluble polysaccharides (SPs, D-glucans and D- fructans ). As compared with the IPs of serotypes b, c, e, and f, the IPs of serotypes a, d, and g (a) contained a higher proportion of (1----3)-alpha-D-glucosidic linkages and alpha-D-(1----3,6) branch linkages; (b) showed higher susceptibility to (1----3)-alpha-D-glucanase (serotype a excepted) and lower (1----6)-alpha-D-glucanase sensitivity; (c) contained larger amounts of high-molecular-weight fractions; (d) showed higher intrinsic viscosities (serotype b excepted); and (e) had lower S. mutans cell-agglutination activities. On electron-microscope observation, the IPs of all serotypes showed two fibrillar components; a double-stranded fibril, with short, fluffy protrusions extending out of its periphery, and a fine, single-stranded fibril. Thus, the serotypes could be divided into two major groups: a, d, and g; and b, c, e, and f. No similar grouping of serotypes was indicated by the chemical and morphological properties of SPs.

  7. [Relationship between serum lipids and status of vitamin C and E as antioxidants in Venezuelan elderly people].

    PubMed

    Meertens, Lesbia; Ruido, Tathiana; Díaz, Nayka; Naddaf, Gloria; Rodríguez, Adelmo; Solano, Liseti

    2008-12-01

    During aging there is a tendency towards hyperlipidemia and changes in the distribution of lipoproteins. A decline in the functioning of the body's antioxidant defense system is also observed at this time. The objective of this study was to establish the relationship between serum concentrations of total cholesterol and fractions, triglycerides, and Vitamins C and E. 61 adults over 60 years of age were evaluated from January to March, 2006. Nutritional status was diagnosed by BMI (WHO); serum levels of triglycerides (TG), total cholesterol (TC) and fractions (HDL-c and LDL-c) were determined by enzyme method; Vitamin C (colorimetric method) and Vitamin E by HPLC. ATPIII values were used as a reference for risk of TG, TC, HDL, LDL-c, vitamin C: > 0.9 mg/dL (normal), < 0.9 mg/dL (deficit); vitamin E: = 1300 microg/dL (normal), 1300 = microg /dL (deficit). Consumption of vitamins C and E were estimated by the direct weighing method 3 days per week. According to BMI, 19.7% had nutritional deficit, 39.3% overweight, and 11.5% obesity. TG, TC, LDL-c levels were at risk in females, and HDL-c in both genders. Prevalence of risk for heart disease was: TG (45.2%), HDL-c (51.1%), and LDL-c (52.5%). Consumption and serum levels of vitamin E were low in both genders. There was no association between variables. A significant and positive correlation between TG, TC, LDL-C, serum vitamin E, and BMI was observed. The female group showed overweight, hypertriglyceridemia and hypercholesterolemia, HDL-c and LDL-c at risk, and vitamin E deficiency, all of which are important risk factors for cardiovascular disease in this age group.

  8. Fate of the Tetraquark Candidate Z_{c}(3900) from Lattice QCD.

    PubMed

    Ikeda, Yoichi; Aoki, Sinya; Doi, Takumi; Gongyo, Shinya; Hatsuda, Tetsuo; Inoue, Takashi; Iritani, Takumi; Ishii, Noriyoshi; Murano, Keiko; Sasaki, Kenji

    2016-12-09

    The possible exotic meson Z_{c}(3900), found in e^{+}e^{-} reactions, is studied by the method of coupled-channel scattering in lattice QCD. The interactions among πJ/ψ, ρη_{c}, and D[over ¯]D^{*} channels are derived from (2+1)-flavor QCD simulations at m_{π}=410-700  MeV. The interactions are dominated by the off-diagonal πJ/ψ-D[over ¯]D^{*} and ρη_{c}-D[over ¯]D^{*} couplings, which indicates that the Z_{c}(3900) is not a usual resonance but a threshold cusp. Semiphenomenological analyses with the coupled-channel interaction are also presented to confirm this conclusion.

  9. A Genetic Interaction Screen for Breast Cancer Progression Driver Genes

    DTIC Science & Technology

    2014-08-01

    M D A -M B -2 3 1 M D A -M B -4 3 6 N o rm a l p r im a ry B re a s t C e lls P r im a ry T N B C KEY RESEARCH ACCOMPLISHMENTS: • Screening PB...GRANT NUMBER W81XWH-12-1-0082 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) 5d. PROJECT NUMBER Tian Xu, PhD 5d. PROJECT NUMBER 5e. TASK NUMBER E-Mail...tian.xu@yale.edu 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME( S ) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER Yale

  10. Resource Recovery Technology Application Document.

    DTIC Science & Technology

    1982-06-01

    B-6 Electrostatic Precipitator (APC-C) ......................B-1O Venturi Scrubber (APC D) B-15 C Combustion Equipment (CE) C-1 Modular... Scrubber APC-D P. 1 of 4 CONTROLIII COMPONENT DESCRIPTION Types Available - Competing Components Type a. Venturi e. Moving bed Venturi b. Flooded disc f...Clean Gas to Demister (Used Separate Liquid from Gas Stream) / F C Scrubber Wall Liquid Inlet D Scrubber Liquid at Venturi Throat Inlet B E Venturi

  11. Fluorescent Silicate Materials for the Detection of Paraoxon

    DTIC Science & Technology

    2010-03-19

    1108-1115. 31. Brandhuber , D .; Peterlik, H.; Huesing, N. Facile Self-Assembly Processes to Phenylene-Bridged Silica Monoliths with Four Levels of...2320 Relative Pressure (P/P 0) 0.0 0.2 0.4 0.6 0.8 1.0 N 2 A ds or be d (c m 3 / g ST P) 100 A. N2 Sorption...Isotherms C. XRD Spectra 2 1 2 3 4 In te ns ity 0E0 5E4 1E5 2E5 1E3 4E3 Pore Diameter () 0 50 100 150 200 dV / d lo g( D ) ( cm 3 / g) 0 1 2 3 B. Pore

  12. Smart Water Conservation System for Irrigated Landscape

    DTIC Science & Technology

    2016-05-01

    Ir ri ga tio n Sy st em s Ir ri... ire d fo r i rr ig at io n. Le ss w at er u se d re su lts in re du ce d en er gy us ag e. C on tro lle r c ol le ct s a nd e va lu at es re...al -ti m e se ns or d at a to de te rm in e w he n it is n ec es sa ry to ir rig at e an d ho w m uc h w at er to a pp ly b as ed

  13. Dinardokanshones C-E, isonardoeudesmols A-D and nardoeudesmol D from Nardostachys jatamansi DC.

    PubMed

    Wu, Hong-Hua; Deng, Xu; Zhang, Hu; Chen, Ying-Peng; Ying, Shu-Song; Wu, Yi-Jing; Liu, Yan-Ting; Zhu, Yan; Gao, Xiu-Mei; Xu, Yan-Tong; Li, Li

    2018-06-01

    Dinardokanshones C-E, three sesquiterpenoid dimers comprising an unusual nornardosinane-type sesquiterpenoid core and an aristolane-type sesquiterpenoid unit conjugated by an extra pyran or furan ring, together with monomeric sesquiterpenoids isonardoeudesmols A-D and nardoeudesmol D, were isolated from the underground parts of Nardostachys jatamansi DC. Structures of the eight compounds were elucidated by analysis of the extensive spectroscopic data, and their absolute configurations were established by analysis of NOESY and X-ray diffraction data, combined with computational electronic circular dichroism (ECD) calculations. The results of SERT activity assay revealed that isonardoeudesmol D and nardoeudesmol D significantly inhibited SERT activity, while dinardokanshones D-E and isonardoeudesmols B-C significantly enhanced SERT activity, among which dinardokanshone D exhibited the strongest effect. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Beta-catenin: A Potential Survival Marker of Breast Cancer Stem Cells

    DTIC Science & Technology

    2006-09-01

    T. C., Alexander, C. M., Georges-Labouesse, E., Van der Neut , R., Kreidberg, J. A., Jones, C. J., Sonnenberg, A. and Streuli, C. H. (2001...de Lau, W., Oving, I., Hurlstone, A., van der Horn, K., Batlle, E., Coudreuse, D., Haramis, A. P., Tjon-Pon-Fong, M., Moerer, P., van den Born, M...Scherer, D. C., Willert, K., Hintz, L., Nusse, R. & Weissman, I. L. (2003) Nature 423, 409-14. 36. van de Wetering, M., Sancho, E., Verweij, C

  15. The Expected Cardiovascular Benefit of Plasma Cholesterol Lowering with or Without LDL-C Targets in Healthy Individuals at Higher Cardiovascular Risk.

    PubMed

    Cesena, Fernando Henpin Yue; Laurinavicius, Antonio Gabriele; Valente, Viviane A; Conceição, Raquel D; Santos, Raul D; Bittencourt, Marcio S

    2017-06-01

    There is controversy whether management of blood cholesterol should be based or not on LDL-cholesterol (LDL-c) target concentrations. To compare the estimated impact of different lipid-lowering strategies, based or not on LDL-c targets, on the risk of major cardiovascular events in a population with higher cardiovascular risk. We included consecutive individuals undergoing a routine health screening in a single center who had a 10-year risk for atherosclerotic cardiovascular disease (ASCVD) ≥ 7.5% (pooled cohort equations, ACC/AHA, 2013). For each individual, we simulated two strategies based on LDL-c target (≤ 100 mg/dL [Starget-100] or ≤ 70 mg/dL [Starget-70]) and two strategies based on percent LDL-c reduction (30% [S30%] or 50% [S50%]). In 1,897 subjects (57 ± 7 years, 96% men, 10-year ASCVD risk 13.7 ± 7.1%), LDL-c would be lowered from 141 ± 33 mg/dL to 99 ± 23 mg/dL in S30%, 71 ± 16 mg/dL in S50%, 98 ± 9 mg/dL in Starget-100, and 70 ± 2 mg/dL in Starget-70. Ten-year ASCVD risk would be reduced to 8.8 ± 4.8% in S50% and 8.9 ± 5.2 in Starget-70. The number of major cardiovascular events prevented in 10 years per 1,000 individuals would be 32 in S30%, 31 in Starget-100, 49 in S50%, and 48 in Starget-70. Compared with Starget-70, S50% would prevent more events in the lower LDL-c tertile and fewer events in the higher LDL-c tertile. The more aggressive lipid-lowering approaches simulated in this study, based on LDL-c target or percent reduction, may potentially prevent approximately 50% more hard cardiovascular events in the population compared with the less intensive treatments. Baseline LDL-c determines which strategy (based or not on LDL-c target) is more appropriate at the individual level. Há controvérsias sobre se o controle do colesterol plasmático deve ou não se basear em metas de concentração de colesterol LDL (LDL-c). Comparar o impacto estimado de diferentes estratégias hipolipemiantes, baseadas ou não em metas de LDL-c, sobre o risco de eventos cardiovasculares maiores em uma população de risco cardiovascular mais elevado. Foram incluídos indivíduos consecutivamente submetidos a uma avaliação rotineira de saúde em um único centro e que apresentavam um risco em 10 anos de doença cardiovascular aterosclerótica (DCVAS) ≥ 7,5% ("pooled cohort equations", ACC/AHA, 2013). Para cada indivíduo, foram simuladas duas estratégias baseadas em meta de LDL-c (≤ 100 mg/dL [Emeta-100] ou ≤ 70 mg/dL [Emeta-70]) e duas estratégias baseadas em redução percentual do LDL-c (30% [E30%] ou 50% [E50%]). Em 1.897 indivíduos (57 ± 7 anos, 96% homens, risco em 10 anos de DCVAS 13,7 ± 7,1%), o LDL-c seria reduzido de 141 ± 33 mg/dL para 99 ± 23 mg/dL na E30%, 71 ± 16 mg/dL na E50%, 98 ± 9 mg/dL na Emeta-100 e 70 ± 2 mg/dL na Emeta-70. O risco em 10 anos de DCVAS seria reduzido para 8,8 ± 4,8% na E50% e para 8,9 ± 5,2 na Emeta-70. O número de eventos cardiovasculares maiores prevenidos em 10 anos por 1.000 indivíduos seria de 32 na E30%, 31 na Emeta-100, 49 na E50% e 48 na Emeta-70. Em comparação com a Emeta-70, a E50% evitaria mais eventos no tercil inferior de LDL-c e menos eventos no tercil superior de LDL-c. As abordagens hipolipemiantes mais agressivas simuladas neste estudo, com base em meta de LDL-c ou redução percentual, podem potencialmente prevenir cerca de 50% mais eventos cardiovasculares graves na população em comparação com os tratamentos menos intensivos. Os níveis basais de LDL-c determinam qual estratégia (baseada ou não em meta de LDL-c) é mais apropriada para cada indivíduo.

  16. Cosmic Explosions in Three Dimensions

    NASA Astrophysics Data System (ADS)

    Höflich, Peter; Kumar, Pawan; Wheeler, J. Craig

    2011-08-01

    Introduction: 3-D Explosions: a meditation on rotation (and magnetic fields) J. C. Wheeler; Part I. Supernovae: Observations Today: 1. Supernova explosions: lessons from spectropolarimetry L. Wang; 2. Spectropolarimetric observations of Supernovae A. Filippenko and D. C. Leonard; 3. Observed and physical properties of type II plateau supernovae M. Hamuy; 4. SN1997B and the different types of Type Ic Supernovae A. Clocchiatti, B. Leibundgut, J. Spyromilio, S. Benetti, E. Cappelaro, M. Turatto and M. Phillips; 5. Near-infrared spectroscopy of stripped-envelope Supernovae C. L. Gerardy, R. A. Fesen, G. H. Marion, P. Hoeflich and J. C. Wheeler; 6. Morphology of Supernovae remnants R. Fesen; 7. The evolution of Supernova remnants in the winds of massive stars V. Dwarkadas; 8. Types for the galactic Supernovae B. E. Schaefer; Part II. Theory of Thermonuclear Supernovae: 9. Semi-steady burning evolutionary sequences for CAL 83 and CAL 87: supersoft X-ray binaries are Supernovae Ia progenitors S. Starrfield, F. X. Timmes, W. R. Hix, E. M. Sion, W. M. Sparks and S. Dwyer; 10. Type Ia Supernovae progenitors: effects of the spin-up of the white dwarfs S.-C. Yoon and N. Langer; 11. Terrestrial combustion: feedback to the stars E. S. Oran; 12. Non-spherical delayed detonations E. Livne; 13. Numerical simulations of Type Ia Supernovae: deflagrations and detonations V. N. Gamezo, A. M. Khokhlov and E. S. Oran; 14. Type Ia Supernovae: spectroscopic surprises D. Branch; 15. Aspherity effects in Supernovae P. Hoeflich, C. Gerardy and R. Quimby; 16. Broad light curve SneIa: asphericity or something else? A. Howell and P. Nugent; 17. Synthetic spectrum methods for 3-D SN models R. Thomas; 18. A hole in Ia' spectroscopic and polarimetric signatures of SN Ia asymmetry due to a companion star D. Kasen; 19. Hunting for the signatures of 3-D explosions with 1-D synthetic spectra E. Lentz, E. Baron and P. H. Hauschildt; 20. On the variation of the peak luminosity of Type Ia J. W. Truran, E. X. Timmes and E. F. Brown; Part III. Theory of Core Collapse Supernovae: 21. Rotation of core collapse progenitors: single and binary stars N. Langer; 22. Large scale convection and the convective Supernova mechanism S. Colgate and M. E. Herant; 23. Topics in core-collapse Supernova A. Burrows, C. D. Ott and C. Meakin; 24. MHD Supernova jets: the missing link D. Meier and M. Nakamura; 25. Effects of super strong magnetic fields in core collapse Supernovae I. S. Akiyama; 26. Non radial instability of stalled accretion shocks advective-acoustic cycle T. Foglizzo and P. Galletti; 27. Asymmetry effects in Hypernovae K. Maeda, K. Nomoto, J. Deng and P.A. Mazzali; 28. Turbulent MHD jet collimation and thermal driving P. T. Williams; Part IV. Magnetars, N-Stars, Pulsars: 29. Supernova remnants and pulsar wind nebulae R. Chevalier; 30. X-Ray signatures of Supernovae D. Swartz; 31. Asymmetric Supernovae and Neutron Star Kicks D. Lai and D. Q. Lamb; 32. Triggers of magnetar outbursts R. Duncan; 33. Turbulent MHD Jet Collimation and Thermal Driving P. Williams; 34. The interplay between nuclear electron capture and fluid dynamics in core collapse Supernovae W. R. Hix, O. E. B. Messer and A. Mezzacappa; Part V. Gamma-Ray Bursts: 35. GRB 021004 and Gamma-ray burst distances B. E. Schaefer; 36. Gamma-ray bursts as a laboratory for the study of Type Ic Supernovae D. Q. Lamb, T. Q. Donaghy and C. Graziani; 37. The diversity of cosmic explosions: Gamma-ray bursts and Type Ib/c Supernovae E. Berger; 38. A GRB simulation using 3D relativistic hydrodynamics J. Cannizo, N. Gehrels and E. T. Vishniac; 39. The first direct link in the Supernova/GRB connection: GRB 030329 and SN 2003dh T. Matheson; Part VI. Summary: 40. Three-dimensional explosions C. Wheeler.

  17. Fiscal Year 2010 Budget Request. Summary Justification

    DTIC Science & Technology

    2009-05-01

    FISCAL YEAR 2010 BUDGET REQUEST S U M M A R Y J U S T I F I C A T I O N • M A Y 2 0 0 9 U N I T E D S T A T E S D E P A R T M E N T O F D...E F E N S E Report Documentation Page Form ApprovedOMB No. 0704-0188 Public reporting burden for the collection of information is estimated to average...Justification 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7

  18. Patrick Air Force Base Storm Water Pollution Prevention Plan.

    DTIC Science & Technology

    1994-09-01

    CE 00 0O L 2- E0 .0 cl ci = 0 L) cz C C 00 H cz - ~.CIn U -. 0 0 - - E o nC .C) 0 2;l C)i En C) u C CIO cz _ C>) C) 0 u E-) a) Z L) 0o~bo coo 0 - . cn...as soon as practi-distated and lo dal c rq ir nts anderas, cable after significant modification areS tate, an d local req u irem en ts an d asm a e t...the duration between the storm event and fecal coliform (counts per 100 mL). sampled and the end of the previous measur- able (greater than 0.1 inch

  19. Observation of a narrow meson decaying to D+sπ0γ at a mass of 2.458 GeV/c2

    NASA Astrophysics Data System (ADS)

    Aubert, B.; Barate, R.; Boutigny, D.; Gaillard, J.-M.; Hicheur, A.; Karyotakis, Y.; Lees, J. P.; Robbe, P.; Tisserand, V.; Zghiche, A.; Palano, A.; Pompili, A.; Chen, J. C.; Qi, N. D.; Rong, G.; Wang, P.; Zhu, Y. S.; Eigen, G.; Ofte, I.; Stugu, B.; Abrams, G. S.; Borgland, A. W.; Breon, A. B.; Brown, D. N.; Button-Shafer, J.; Cahn, R. N.; Charles, E.; Day, C. T.; Gill, M. S.; Gritsan, A. V.; Groysman, Y.; Jacobsen, R. G.; Kadel, R. W.; Kadyk, J.; Kerth, L. T.; Kolomensky, Yu. G.; Kukartsev, G.; Leclerc, C.; Levi, M. E.; Lynch, G.; Mir, L. M.; Oddone, P. J.; Orimoto, T. J.; Pripstein, M.; Roe, N. A.; Romosan, A.; Ronan, M. T.; Shelkov, V. G.; Telnov, A. V.; Wenzel, W. A.; Ford, K.; Harrison, T. J.; Hawkes, C. M.; Knowles, D. J.; Morgan, S. E.; Penny, R. C.; Watson, A. T.; Watson, N. K.; Goetzen, K.; Held, T.; Koch, H.; Lewandowski, B.; Pelizaeus, M.; Peters, K.; Schmuecker, H.; Steinke, M.; Boyd, J. T.; Chevalier, N.; Cottingham, W. N.; Kelly, M. P.; Latham, T. E.; Mackay, C.; Wilson, F. F.; Abe, K.; Cuhadar-Donszelmann, T.; Hearty, C.; Mattison, T. S.; McKenna, J. A.; Thiessen, D.; Kyberd, P.; McKemey, A. K.; Teodorescu, L.; Blinov, V. E.; Bukin, A. D.; Golubev, V. B.; Ivanchenko, V. N.; Kravchenko, E. A.; Onuchin, A. P.; Serednyakov, S. I.; Skovpen, Yu. I.; Solodov, E. P.; Yushkov, A. N.; Best, D.; Bruinsma, M.; Chao, M.; Kirkby, D.; Lankford, A. J.; Mandelkern, M.; Mommsen, R. K.; Roethel, W.; Stoker, D. P.; Buchanan, C.; Hartfiel, B. L.; Gary, J. W.; Layter, J.; Shen, B. C.; Wang, K.; del Re, D.; Hadavand, H. K.; Hill, E. J.; Macfarlane, D. B.; Paar, H. P.; Rahatlou, Sh.; Sharma, V.; Berryhill, J. W.; Campagnari, C.; Dahmes, B.; Kuznetsova, N.; Levy, S. L.; Long, O.; Lu, A.; Mazur, M. A.; Richman, J. D.; Verkerke, W.; Beck, T. W.; Beringer, J.; Eisner, A. M.; Heusch, C. A.; Lockman, W. S.; Schalk, T.; Schmitz, R. E.; Schumm, B. A.; Seiden, A.; Turri, M.; Walkowiak, W.; Williams, D. C.; Wilson, M. G.; Albert, J.; Chen, E.; Dubois-Felsmann, G. P.; Dvoretskii, A.; Erwin, R. J.; Hitlin, D. G.; Narsky, I.; Piatenko, T.; Porter, F. C.; Ryd, A.; Samuel, A.; Yang, S.; Jayatilleke, S.; Mancinelli, G.; Meadows, B. T.; Sokoloff, M. D.; Abe, T.; Blanc, F.; Bloom, P.; Chen, S.; Clark, P. J.; Ford, W. T.; Nauenberg, U.; Olivas, A.; Rankin, P.; Roy, J.; Smith, J. G.; van Hoek, W. C.; Zhang, L.; Harton, J. L.; Hu, T.; Soffer, A.; Toki, W. H.; Wilson, R. J.; Zhang, J.; Altenburg, D.; Brandt, T.; Brose, J.; Colberg, T.; Dickopp, M.; Dubitzky, R. S.; Hauke, A.; Lacker, H. M.; Maly, E.; Müller-Pfefferkorn, R.; Nogowski, R.; Otto, S.; Schubert, J.; Schubert, K. R.; Schwierz, R.; Spaan, B.; Wilden, L.; Bernard, D.; Bonneaud, G. R.; Brochard, F.; Cohen-Tanugi, J.; Grenier, P.; Thiebaux, Ch.; Vasileiadis, G.; Verderi, M.; Khan, A.; Lavin, D.; Muheim, F.; Playfer, S.; Swain, J. E.; Andreotti, M.; Azzolini, V.; Bettoni, D.; Bozzi, C.; Calabrese, R.; Cibinetto, G.; Luppi, E.; Negrini, M.; Piemontese, L.; Sarti, A.; Treadwell, E.; Anulli, F.; Baldini-Ferroli, R.; Biasini, M.; Calcaterra, A.; de Sangro, R.; Falciai, D.; Finocchiaro, G.; Patteri, P.; Peruzzi, I. M.; Piccolo, M.; Pioppi, M.; Zallo, A.; Buzzo, A.; Capra, R.; Contri, R.; Crosetti, G.; Lo Vetere, M.; Macri, M.; Monge, M. R.; Passaggio, S.; Patrignani, C.; Robutti, E.; Santroni, A.; Tosi, S.; Bailey, S.; Morii, M.; Won, E.; Bhimji, W.; Bowerman, D. A.; Dauncey, P. D.; Egede, U.; Eschrich, I.; Gaillard, J. R.; Morton, G. W.; Nash, J. A.; Sanders, P.; Taylor, G. P.; Grenier, G. J.; Lee, S.-J.; Mallik, U.; Cochran, J.; Crawley, H. B.; Lamsa, J.; Meyer, W. T.; Prell, S.; Rosenberg, E. I.; Yi, J.; Davier, M.; Grosdidier, G.; Höcker, A.; Laplace, S.; Le Diberder, F.; Lepeltier, V.; Lutz, A. M.; Petersen, T. C.; Plaszczynski, S.; Schune, M. H.; Tantot, L.; Wormser, G.; Brigljević, V.; Cheng, C. H.; Lange, D. J.; Simani, M. C.; Wright, D. M.; Bevan, A. J.; Coleman, J. P.; Fry, J. R.; Gabathuler, E.; Gamet, R.; Kay, M.; Parry, R. J.; Payne, D. J.; Sloane, R. J.; Touramanis, C.; Back, J. J.; Harrison, P. F.; Shorthouse, H. W.; Vidal, P. B.; Brown, C. L.; Cowan, G.; Flack, R. L.; Flaecher, H. U.; George, S.; Green, M. G.; Kurup, A.; Marker, C. E.; McMahon, T. R.; Ricciardi, S.; Salvatore, F.; Vaitsas, G.; Winter, M. A.; Brown, D.; Davis, C. L.; Allison, J.; Barlow, N. R.; Barlow, R. J.; Hart, P. A.; Hodgkinson, M. C.; Jackson, F.; Lafferty, G. D.; Lyon, A. J.; Weatherall, J. H.; Williams, J. C.; Farbin, A.; Jawahery, A.; Kovalskyi, D.; Lae, C. K.; Lillard, V.; Roberts, D. A.; Blaylock, G.; Dallapiccola, C.; Flood, K. T.; Hertzbach, S. S.; Kofler, R.; Koptchev, V. B.; Moore, T. B.; Saremi, S.; Staengle, H.; Willocq, S.; Cowan, R.; Sciolla, G.; Taylor, F.; Yamamoto, R. K.; Mangeol, D. J.; Patel, P. M.; Robertson, S. H.; Lazzaro, A.; Palombo, F.; Bauer, J. M.; Cremaldi, L.; Eschenburg, V.; Godang, R.; Kroeger, R.; Reidy, J.; Sanders, D. A.; Summers, D. J.; Zhao, H. W.; Brunet, S.; Cote-Ahern, D.; Taras, P.; Nicholson, H.; Cartaro, C.; Cavallo, N.; de Nardo, G.; Fabozzi, F.; Gatto, C.; Lista, L.; Paolucci, P.; Piccolo, D.; Sciacca, C.; Baak, M. A.; Raven, G.; Losecco, J. M.; Gabriel, T. A.; Brau, B.; Gan, K. K.; Honscheid, K.; Hufnagel, D.; Kagan, H.; Kass, R.; Pulliam, T.; Wong, Q. K.; Brau, J.; Frey, R.; Potter, C. T.; Sinev, N. B.; Strom, D.; Torrence, E.; Colecchia, F.; Dorigo, A.; Galeazzi, F.; Margoni, M.; Morandin, M.; Posocco, M.; Rotondo, M.; Simonetto, F.; Stroili, R.; Tiozzo, G.; Voci, C.; Benayoun, M.; Briand, H.; Chauveau, J.; David, P.; de La Vaissière, Ch.; del Buono, L.; Hamon, O.; John, M. J.; Leruste, Ph.; Ocariz, J.; Pivk, M.; Roos, L.; Stark, J.; T'jampens, S.; Therin, G.; Manfredi, P. F.; Re, V.; Behera, P. K.; Gladney, L.; Guo, Q. H.; Panetta, J.; Angelini, C.; Batignani, G.; Bettarini, S.; Bondioli, M.; Bucci, F.; Calderini, G.; Carpinelli, M.; del Gamba, V.; Forti, F.; Giorgi, M. A.; Lusiani, A.; Marchiori, G.; Martinez-Vidal, F.; Morganti, M.; Neri, N.; Paoloni, E.; Rama, M.; Rizzo, G.; Sandrelli, F.; Walsh, J.; Haire, M.; Judd, D.; Paick, K.; Wagoner, D. E.; Danielson, N.; Elmer, P.; Lu, C.; Miftakov, V.; Olsen, J.; Smith, A. J.; Tanaka, H. A.; Varnes, E. W.; Bellini, F.; Cavoto, G.; Faccini, R.; Ferrarotto, F.; Ferroni, F.; Gaspero, M.; Mazzoni, M. A.; Morganti, S.; Pierini, M.; Piredda, G.; Safai Tehrani, F.; Voena, C.; Christ, S.; Wagner, G.; Waldi, R.; Adye, T.; de Groot, N.; Franek, B.; Geddes, N. I.; Gopal, G. P.; Olaiya, E. O.; Xella, S. M.; Aleksan, R.; Emery, S.; Gaidot, A.; Ganzhur, S. F.; Giraud, P.-F.; Hamel de Monchenault, G.; Kozanecki, W.; Langer, M.; Legendre, M.; London, G. W.; Mayer, B.; Schott, G.; Vasseur, G.; Yeche, Ch.; Zito, M.; Purohit, M. V.; Weidemann, A. W.; Yumiceva, F. X.; Aston, D.; Bartelt, J.; Bartoldus, R.; Berger, N.; Boyarski, A. M.; Buchmueller, O. L.; Convery, M. R.; Coupal, D. P.; Dong, D.; Dorfan, J.; Dujmic, D.; Dunwoodie, W.; Field, R. C.; Glanzman, T.; Gowdy, S. J.; Grauges-Pous, E.; Hadig, T.; Halyo, V.; Hryn'ova, T.; Innes, W. R.; Jessop, C. P.; Kelsey, M. H.; Kim, P.; Kocian, M. L.; Langenegger, U.; Leith, D. W.; Libby, J.; Luitz, S.; Luth, V.; Lynch, H. L.; Marsiske, H.; Messner, R.; Muller, D. R.; O'Grady, C. P.; Ozcan, V. E.; Perazzo, A.; Perl, M.; Petrak, S.; Ratcliff, B. N.; Roodman, A.; Salnikov, A. A.; Schindler, R. H.; Schwiening, J.; Simi, G.; Snyder, A.; Soha, A.; Stelzer, J.; Su, D.; Sullivan, M. K.; Va'Vra, J.; Wagner, S. R.; Weaver, M.; Weinstein, A. J.; Wisniewski, W. J.; Wright, D. H.; Young, C. C.; Burchat, P. R.; Edwards, A. J.; Meyer, T. I.; Petersen, B. A.; Roat, C.; Ahmed, M.; Ahmed, S.; Alam, M. S.; Ernst, J. A.; Saeed, M. A.; Saleem, M.; Wappler, F. R.; Bugg, W.; Krishnamurthy, M.; Spanier, S. M.; Eckmann, R.; Kim, H.; Ritchie, J. L.; Schwitters, R. F.; Izen, J. M.; Kitayama, I.; Lou, X. C.; Ye, S.; Bianchi, F.; Bona, M.; Gallo, F.; Gamba, D.; Borean, C.; Bosisio, L.; della Ricca, G.; Dittongo, S.; Grancagnolo, S.; Lanceri, L.; Poropat, P.; Vitale, L.; Vuagnin, G.; Panvini, R. S.; Banerjee, Sw.; Brown, C. M.; Fortin, D.; Jackson, P. D.; Kowalewski, R.; Roney, J. M.; Band, H. R.; Dasu, S.; Datta, M.; Eichenbaum, A. M.; Johnson, J. R.; Kutter, P. E.; Li, H.; Liu, R.; di Lodovico, F.; Mihalyi, A.; Mohapatra, A. K.; Pan, Y.; Prepost, R.; Sekula, S. J.; von Wimmersperg-Toeller, J. H.; Wu, J.; Wu, S. L.; Yu, Z.; Neal, H.

    2004-02-01

    A narrow state, which we label DsJ(2458)+, with a mass 2458.0±1.0 (stat)±1.0 (syst) MeV/c2, is observed in the inclusive D+sπ0γ mass distribution in 91 fb-1 of e+e- annihilation data recorded by the BABAR detector at the SLAC PEP-II asymmetric-energy e+e- storage ring. The observed width is consistent with the experimental resolution. The data favor decay through D*s(2112)+π0 rather than through D*sJ(2317)+γ. An analysis of D+sπ0 data accounting for the influence of the DsJ(2458)+ produces a D*sJ(2317)+ mass of 2317.3±0.4 (stat)±0.8 (syst) MeV/c2.

  20. 75 FR 31340 - Approval and Promulgation of Air Quality Implementation Plans; Delaware; Section 110(a)(2...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-03

    ... 1997 PM 2.5 NAAQS, dated October 22, 2008: 110(a)(2)(A), (B), (C), (D)(ii), (E), (F), (G), (H), (J), (K... made such findings for the 1997 8- hour ozone NAAQS on March 27, 2008 (73 FR 16205) and on October 22... December 13, 2007 A, B, C, D(ii), E, F, A, B, C, D(ii), E, F, G, H, J, K, L, M. G, H, J, K, L, M. March 12...

  1. 75 FR 27510 - Approval and Promulgation of Air Quality Implementation Plans; State of West Virginia; Section...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-17

    ... 1997 PM 2.5 NAAQS dated October 22, 2008: 110(a)(2)(A), (B), (C), (D)(ii), (E), (F), (G), (H), (J), (K... 16205) and on October 22, 2008 (73 FR 62902) for the 1997 PM 2.5 NAAQS. These completeness findings did....5 2006 PM2.5 December 3, 2007 A, C, D(ii), E, F, G, J, K, L. April 3, 2008 A, C, D(ii), E, F, J, L...

  2. Supersaturated Self-Assembled Charge-Selective Interfacial Layers for Organic Solar Cells

    DTIC Science & Technology

    2014-11-24

    N. E.; Ratcliff, E. L.; Jenkins, J. L.; Armstrong, N. R.; Giordano, A. J.; Hotchkiss, P. J.; Marder, S. R.; Campbell, C. T.; Ginger , D. S. J. Phys...H. X.; Schlenker, C. W.; Giordano, A. J.; Garcia, A.; Smith, O. L.; Olson, D. C.; Marder, S. R.; Ginger , D. S. J. Phys. Chem. Lett. 2013, 4, 4038

  3. An Investigation of Long Term Orbits About the Planet Mars Using a Dynamic Atmosphere Model

    DTIC Science & Technology

    1989-12-01

    O ( c IT1 I,5")) Figure 1.2: Ionosphere...20.1272 2TC - Met*t210 | ’K 40 - Ix cl o ~ /2-. o 6 230 220Z- \\AW - Ii Z10 - A €, c , , , , zoo- ’, I ,, O - %%" ISIO- %% 170- U Figure 1.4: Atmospheric...sini +’I-e2 R n ’ C ’. dk -_ -e2 R + h coti R - k P’yI-e 2 R (.1.1.4d) dt na- h na2it-e2 i haS O r)LN d121 IR (. .1. 4e) dt na2 sini il-e2 i dLN

  4. 2005 Tri-Service Infrastructure Systems Conference and Exhibition. Volume 10, Track 12

    DTIC Science & Technology

    2005-08-04

    Schmidt Track 12 Greenup L&D Miter Gate Repair and...j uv en ile fi sh p as sa ge o n ty pi ca l d es ig n cr ite ria R ob er t B uc hh ol z H yd ra ul ic d es ig n of ju ve ni le fis h pa ss...C hi ca go se w er sy st em s E rn es to G o T R A C K 1 8 C iv il M e ch a n ic a l S e ss io n 1 8 D N ew c oa tin g pr od uc ts fo

  5. Factors Affecting the Vertical Motion of a Zero-Pressure, Polyethylene, Free Balloon

    DTIC Science & Technology

    1985-05-31

    Delle Traiettorie Dei Palloni Stratos- ferici Per Missioni Di Lunga Durata, Instituto di Tecnologia Aerospaziale, Universita di Boma (translation). 19...2) TD=E2-V ( 3D , 2) !%..TI)/DX ~(C.LI.EI) GO0TO 900 Tr (ALIS(rD) LT..01o) Hl=II1*EXFP(-CC*DX/Y(JD,2)) 1)T X 600- ( D rI.eVJD,2)+R1*DX IF (A&OS...MD.GE.U.01) 3P=H1*((Y(JD.?*)/TK)**(CCR)) IF (AL133(TD).LT.0.01) 9P-H14"IXP(-CL’*DXlY( 3D ,2)) c PREFSSUR~E CONVWRGI!NCE CHECK c C:0IRiiCTS MONOTONIC

  6. Mimicking phosphorylation of Ser-74 on human deoxycytidine kinase selectively increases catalytic activity for dC and dC analogues.

    PubMed

    McSorley, Theresa; Ort, Stephan; Hazra, Saugata; Lavie, Arnon; Konrad, Manfred

    2008-03-05

    Intracellular phosphorylation of dCK on Ser-74 results in increased nucleoside kinase activity. We mimicked this phosphorylation by a Ser-74-Glu mutation in bacterially produced dCK and investigated kinetic parameters using various nucleoside substrates. The S74E mutation increases the k(cat) values 11-fold for dC, and 3-fold for the anti-cancer analogues dFdC and AraC. In contrast, the rate is decreased for the purine substrates. In HEK293 cells, we found that by comparing transiently transfected dCK(S74E)-GFP and wild-type dCK-GFP, mimicking the phosphorylation of Ser-74 has no effect on cellular localisation. We note that phosphorylation may represent a mechanism to enhance the catalytic activity of the relatively slow dCK enzyme.

  7. Modular Extensions of Unitary Braided Fusion Categories and 2+1D Topological/SPT Orders with Symmetries

    NASA Astrophysics Data System (ADS)

    Lan, Tian; Kong, Liang; Wen, Xiao-Gang

    2017-04-01

    A finite bosonic or fermionic symmetry can be described uniquely by a symmetric fusion category E. In this work, we propose that 2+1D topological/SPT orders with a fixed finite symmetry E are classified, up to {E_8} quantum Hall states, by the unitary modular tensor categories C over E and the modular extensions of each C. In the case C=E, we prove that the set M_{ext}(E) of all modular extensions of E has a natural structure of a finite abelian group. We also prove that the set M_{ext}(C) of all modular extensions of E, if not empty, is equipped with a natural M_{ext}(C)-action that is free and transitive. Namely, the set M_{ext}(C) is an M_{ext}(E)-torsor. As special cases, we explain in detail how the group M_{ext}(E) recovers the well-known group-cohomology classification of the 2+1D bosonic SPT orders and Kitaev's 16 fold ways. We also discuss briefly the behavior of the group M_{ext}(E) under the symmetry-breaking processes and its relation to Witt groups.

  8. Hypertrophic Cardiomyopathy Cardiac Troponin C Mutations Differentially Affect Slow Skeletal and Cardiac Muscle Regulation

    PubMed Central

    Veltri, Tiago; Landim-Vieira, Maicon; Parvatiyar, Michelle S.; Gonzalez-Martinez, David; Dieseldorff Jones, Karissa M.; Michell, Clara A.; Dweck, David; Landstrom, Andrew P.; Chase, P. Bryant; Pinto, Jose R.

    2017-01-01

    Mutations in TNNC1—the gene encoding cardiac troponin C (cTnC)—that have been associated with hypertrophic cardiomyopathy (HCM) and cardiac dysfunction may also affect Ca2+-regulation and function of slow skeletal muscle since the same gene is expressed in both cardiac and slow skeletal muscle. Therefore, we reconstituted rabbit soleus fibers and bovine masseter myofibrils with mutant cTnCs (A8V, C84Y, E134D, and D145E) associated with HCM to investigate their effects on contractile force and ATPase rates, respectively. Previously, we showed that these HCM cTnC mutants, except for E134D, increased the Ca2+ sensitivity of force development in cardiac preparations. In the current study, an increase in Ca2+ sensitivity of isometric force was only observed for the C84Y mutant when reconstituted in soleus fibers. Incorporation of cTnC C84Y in bovine masseter myofibrils reduced the ATPase activity at saturating [Ca2+], whereas, incorporation of cTnC D145E increased the ATPase activity at inhibiting and saturating [Ca2+]. We also tested whether reconstitution of cardiac fibers with troponin complexes containing the cTnC mutants and slow skeletal troponin I (ssTnI) could emulate the slow skeletal functional phenotype. Reconstitution of cardiac fibers with troponin complexes containing ssTnI attenuated the Ca2+ sensitization of isometric force when cTnC A8V and D145E were present; however, it was enhanced for C84Y. In summary, although the A8V and D145E mutants are present in both muscle types, their functional phenotype is more prominent in cardiac muscle than in slow skeletal muscle, which has implications for the protein-protein interactions within the troponin complex. The C84Y mutant warrants further investigation since it drastically alters the properties of both muscle types and may account for the earlier clinical onset in the proband. PMID:28473771

  9. Electronic band structure and Shubnikov-de Haas effect in two-dimensional semimetallic InAs/GaSb nanostructure superlattice

    NASA Astrophysics Data System (ADS)

    Boutramine, Abderrazak; Nafidi, Abdelhakim; Barkissy, Driss; El-Frikhe, Es-Said; Charifi, Hicham; Elanique, Abdellatif; Chaib, Hassan

    2016-02-01

    We have investigated the band structure E( d = d 1 + d 2), E( k z) and E( k p), respectively, as a function of the SL period, d, in the growth direction and in plan of InAs( d 1 = 160 Å)/GaSb( d 2 = 105 Å) type II superlattice, performed in the envelope function formalism with the valence band offset, Λ, of 510 meV at 4.2 K. For the ratio d 1/ d 2 = 1.52, d and Λ dependence of the SL energy band gap show that the semiconductor-to-semimetal transition takes place at d c = 173 Å and Λ c = 463 meV. Therefore, this sample is semimetallic. The position of the Fermi level, E F = 500.2 meV, indicates n type conductivity. The spectra of energy, E( k z, k p), show a negative band gap of -48.3 meV. The cutoff wavelength | λ c| = 25.7 µm indicates that this sample can be used as a far-infrared detector. Further, we have interpreted the minima of the magnetoresistance oscillations, Shubnikov-de Haas effect, observed by D. M. Symons et al.

  10. Measurements of e + e - pairs from open heavy flavor in p + p and d + A collisions at s NN = 200 GeV

    DOE PAGES

    Adare, A.; Afanasiev, S.; Aidala, C.; ...

    2017-08-18

    In this paper, we report a measurement of e +e - pairs from semileptonic heavy-flavor decays in p + p collisions at √sNN = 200 GeV. The e +e - pair yield frommore » $$b\\overline{b}$$ and $$c\\overline{c}$$ is separated by exploiting a double differential fit done simultaneously in dielectron invariant mass and p T. We used three different event generators, pythia, mc@nlo, and powheg, to simulate the e +e - spectra from $$c\\overline{c}$$ and $$b\\overline{b}$$ production. The data can be well described by all three generators within the detector acceptance. However, when using the generators to extrapolate to 4π, significant differences are observed for the total cross section. These difference are less pronounced for $$b\\overline{b}$$ than for $$c\\overline{c}$$. The same model dependence was observed in already published d + A data. Lastly, the p + p data are also directly compared with d + A data in mass and p T, and within the statistical accuracy no nuclear modification is seen.« less

  11. Measurements of e + e - pairs from open heavy flavor in p + p and d + A collisions at s NN = 200 GeV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adare, A.; Afanasiev, S.; Aidala, C.

    In this paper, we report a measurement of e +e - pairs from semileptonic heavy-flavor decays in p + p collisions at √sNN = 200 GeV. The e +e - pair yield frommore » $$b\\overline{b}$$ and $$c\\overline{c}$$ is separated by exploiting a double differential fit done simultaneously in dielectron invariant mass and p T. We used three different event generators, pythia, mc@nlo, and powheg, to simulate the e +e - spectra from $$c\\overline{c}$$ and $$b\\overline{b}$$ production. The data can be well described by all three generators within the detector acceptance. However, when using the generators to extrapolate to 4π, significant differences are observed for the total cross section. These difference are less pronounced for $$b\\overline{b}$$ than for $$c\\overline{c}$$. The same model dependence was observed in already published d + A data. Lastly, the p + p data are also directly compared with d + A data in mass and p T, and within the statistical accuracy no nuclear modification is seen.« less

  12. Measurements of e+e- pairs from open heavy flavor in p +p and d +A collisions at √{sNN}=200 GeV

    NASA Astrophysics Data System (ADS)

    Adare, A.; Afanasiev, S.; Aidala, C.; Ajitanand, N. N.; Akiba, Y.; Al-Bataineh, H.; Alexander, J.; Alfred, M.; Aoki, K.; Apadula, N.; Aphecetche, L.; Asai, J.; Atomssa, E. T.; Averbeck, R.; Awes, T. C.; Ayuso, C.; Azmoun, B.; Babintsev, V.; Bagoly, A.; Bai, M.; Baksay, G.; Baksay, L.; Baldisseri, A.; Barish, K. N.; Barnes, P. D.; Bassalleck, B.; Basye, A. T.; Bathe, S.; Batsouli, S.; Baublis, V.; Baumann, C.; Bazilevsky, A.; Belikov, S.; Belmont, R.; Bennett, R.; Berdnikov, A.; Berdnikov, Y.; Bickley, A. A.; Blau, D. S.; Boer, M.; Boissevain, J. G.; Bok, J. S.; Borel, H.; Boyle, K.; Brooks, M. L.; Bryslawskyj, J.; Buesching, H.; Bumazhnov, V.; Bunce, G.; Butler, C.; Butsyk, S.; Camacho, C. M.; Campbell, S.; Canoa Roman, V.; Chang, B. S.; Chang, W. C.; Charvet, J.-L.; Chernichenko, S.; Chi, C. Y.; Chiu, M.; Choi, I. J.; Choudhury, R. K.; Chujo, T.; Chung, P.; Churyn, A.; Cianciolo, V.; Citron, Z.; Cole, B. A.; Connors, M.; Constantin, P.; Csanád, M.; Csörgő, T.; Dahms, T.; Dairaku, S.; Danley, T. W.; Das, K.; David, G.; Deblasio, K.; Dehmelt, K.; Denisov, A.; D'Enterria, D.; Deshpande, A.; Desmond, E. J.; Dietzsch, O.; Dion, A.; Do, J. H.; Donadelli, M.; Drapier, O.; Drees, A.; Drees, K. A.; Dubey, A. K.; Dumancic, M.; Durham, J. M.; Durum, A.; Dutta, D.; Dzhordzhadze, V.; Efremenko, Y. V.; Elder, T.; Ellinghaus, F.; Engelmore, T.; Enokizono, A.; En'yo, H.; Esumi, S.; Eyser, K. O.; Fadem, B.; Fan, W.; Feege, N.; Fields, D. E.; Finger, M.; Finger, M.; Fleuret, F.; Fokin, S. L.; Fraenkel, Z.; Frantz, J. E.; Franz, A.; Frawley, A. D.; Fujiwara, K.; Fukao, Y.; Fukuda, Y.; Fusayasu, T.; Gal, C.; Garishvili, I.; Ge, H.; Glenn, A.; Gong, H.; Gonin, M.; Gosset, J.; Goto, Y.; Granier de Cassagnac, R.; Grau, N.; Greene, S. V.; Grosse Perdekamp, M.; Gunji, T.; Gustafsson, H.-Å.; Hachiya, T.; Hadj Henni, A.; Haggerty, J. S.; Hahn, K. I.; Hamagaki, H.; Han, R.; Han, S. Y.; Hartouni, E. P.; Haruna, K.; Hasegawa, S.; Haseler, T. O. S.; Haslum, E.; Hayano, R.; He, X.; Heffner, M.; Hemmick, T. K.; Hester, T.; Hill, J. C.; Hill, K.; Hohlmann, M.; Holzmann, W.; Homma, K.; Hong, B.; Horaguchi, T.; Hornback, D.; Hoshino, T.; Hotvedt, N.; Huang, J.; Huang, S.; Ichihara, T.; Ichimiya, R.; Iinuma, H.; Ikeda, Y.; Imai, K.; Imrek, J.; Inaba, M.; Isenhower, D.; Ishihara, M.; Isobe, T.; Issah, M.; Isupov, A.; Ito, Y.; Ivanishchev, D.; Jacak, B. V.; Ji, Z.; Jia, J.; Jin, J.; Johnson, B. M.; Joo, K. S.; Jorjadze, V.; Jouan, D.; Jumper, D. S.; Kajihara, F.; Kametani, S.; Kamihara, N.; Kamin, J.; Kang, J. H.; Kapukchyan, D.; Kapustinsky, J.; Karthas, S.; Kawall, D.; Kazantsev, A. V.; Kempel, T.; Khachatryan, V.; Khanzadeev, A.; Kijima, K. M.; Kikuchi, J.; Kim, B. I.; Kim, C.; Kim, D. H.; Kim, D. J.; Kim, E.; Kim, E.-J.; Kim, M.; Kim, M. H.; Kim, S. H.; Kincses, D.; Kinney, E.; Kiriluk, K.; Kiss, Á.; Kistenev, E.; Klay, J.; Klein-Boesing, C.; Koblesky, T.; Kochenda, L.; Komkov, B.; Konno, M.; Koster, J.; Kotov, D.; Kozlov, A.; Král, A.; Kravitz, A.; Kudo, S.; Kunde, G. J.; Kurita, K.; Kurosawa, M.; Kweon, M. J.; Kwon, Y.; Kyle, G. S.; Lacey, R.; Lai, Y. S.; Lajoie, J. G.; Lallow, E. O.; Layton, D.; Lebedev, A.; Lee, D. M.; Lee, K. B.; Lee, T.; Leitch, M. J.; Leite, M. A. L.; Lenzi, B.; Leung, Y. H.; Lewis, N. A.; Li, X.; Li, X.; Liebing, P.; Lim, S. H.; Liška, T.; Litvinenko, A.; Liu, H.; Liu, L. D.; Liu, M. X.; Loggins, V.-R.; Lokos, S.; Love, B.; Lynch, D.; Maguire, C. F.; Majoros, T.; Makdisi, Y. I.; Makek, M.; Malakhov, A.; Malik, M. D.; Manko, V. I.; Mannel, E.; Mao, Y.; Mašek, L.; Masui, H.; Matathias, F.; McCumber, M.; McGaughey, P. L.; McGlinchey, D.; Means, N.; Meredith, B.; Miake, Y.; Mignerey, A. C.; Mihalik, D. E.; Mikeš, P.; Miki, K.; Milov, A.; Mishra, M.; Mitchell, J. T.; Mitsuka, G.; Mohanty, A. K.; Moon, T.; Morino, Y.; Morreale, A.; Morrison, D. P.; Morrow, S. I. M.; Moukhanova, T. V.; Mukhopadhyay, D.; Murakami, T.; Murata, J.; Nagai, K.; Nagamiya, S.; Nagashima, K.; Nagashima, T.; Nagle, J. L.; Naglis, M.; Nagy, M. I.; Nakagawa, I.; Nakagomi, H.; Nakamiya, Y.; Nakamura, T.; Nakano, K.; Nattrass, C.; Newby, J.; Nguyen, M.; Niida, T.; Nouicer, R.; Novák, T.; Novitzky, N.; Novotny, R.; Nyanin, A. S.; O'Brien, E.; Oda, S. X.; Ogilvie, C. A.; Oka, M.; Okada, K.; Onuki, Y.; Orjuela Koop, J. D.; Osborn, J. D.; Oskarsson, A.; Ouchida, M.; Ozawa, K.; Pak, R.; Palounek, A. P. T.; Pantuev, V.; Papavassiliou, V.; Park, J.; Park, J. S.; Park, S.; Park, W. J.; Pate, S. F.; Patel, M.; Pei, H.; Peng, J.-C.; Peng, W.; Pereira, H.; Perepelitsa, D. V.; Perera, G. D. N.; Peresedov, V.; Peressounko, D. Yu.; Perezlara, C. E.; Petti, R.; Phipps, M.; Pinkenburg, C.; Pun, A.; Purschke, M. L.; Purwar, A. K.; Qu, H.; Radzevich, P. V.; Rak, J.; Rakotozafindrabe, A.; Ravinovich, I.; Read, K. F.; Rembeczki, S.; Reygers, K.; Riabov, V.; Riabov, Y.; Richford, D.; Rinn, T.; Roach, D.; Roche, G.; Rolnick, S. D.; Rosati, M.; Rosendahl, S. S. E.; Rosnet, P.; Rowan, Z.; Rukoyatkin, P.; Runchey, J.; Ružička, P.; Rykov, V. L.; Sahlmueller, B.; Saito, N.; Sakaguchi, T.; Sakai, S.; Sakashita, K.; Sako, H.; Samsonov, V.; Sarsour, M.; Sato, K.; Sato, S.; Sato, T.; Sawada, S.; Schaefer, B.; Schmoll, B. K.; Schmoll, B. K.; Sedgwick, K.; Seele, J.; Seidl, R.; Semenov, A. Yu.; Semenov, V.; Sen, A.; Seto, R.; Sexton, A.; Sharma, D.; Shein, I.; Shibata, T.-A.; Shigaki, K.; Shimomura, M.; Shoji, K.; Shukla, P.; Sickles, A.; Silva, C. L.; Silvermyr, D.; Silvestre, C.; Sim, K. S.; Singh, B. K.; Singh, C. P.; Singh, V.; Skoby, M. J.; Slunečka, M.; Smith, K. L.; Soldatov, A.; Soltz, R. A.; Sondheim, W. E.; Sorensen, S. P.; Sourikova, I. V.; Staley, F.; Stankus, P. W.; Stenlund, E.; Stepanov, M.; Ster, A.; Stoll, S. P.; Sugitate, T.; Suire, C.; Sukhanov, A.; Syed, S.; Sziklai, J.; Takagui, E. M.; Taketani, A.; Tanabe, R.; Tanaka, Y.; Tanida, K.; Tannenbaum, M. J.; Tarafdar, S.; Taranenko, A.; Tarján, P.; Tarnai, G.; Themann, H.; Thomas, T. L.; Tieulent, R.; Timilsina, A.; Togawa, M.; Toia, A.; Tomášek, L.; Tomášek, M.; Tomita, Y.; Torii, H.; Towell, C. L.; Towell, R. S.; Tram, V.-N.; Tserruya, I.; Tsuchimoto, Y.; Ueda, Y.; Ujvari, B.; Vale, C.; Valle, H.; van Hecke, H. W.; Vazquez-Carson, S.; Veicht, A.; Velkovska, J.; Vértesi, R.; Vinogradov, A. A.; Virius, M.; Vrba, V.; Vznuzdaev, E.; Wang, X. R.; Wang, Z.; Watanabe, Y.; Wei, F.; Wessels, J.; White, S. N.; Winter, D.; Wong, C. P.; Woody, C. L.; Wysocki, M.; Xie, W.; Xu, C.; Xu, Q.; Yamaguchi, Y. L.; Yamaura, K.; Yang, R.; Yanovich, A.; Yin, P.; Ying, J.; Yokkaichi, S.; Yoo, J. H.; Yoon, I.; Young, G. R.; Younus, I.; Yu, H.; Yushmanov, I. E.; Zajc, W. A.; Zaudtke, O.; Zhang, C.; Zharko, S.; Zhou, S.; Zolin, L.; Zou, L.; Phenix Collaboration

    2017-08-01

    We report a measurement of e+e- pairs from semileptonic heavy-flavor decays in p +p collisions at √{s NN}=200 GeV. The e+e- pair yield from b b ¯ and c c ¯ is separated by exploiting a double differential fit done simultaneously in dielectron invariant mass and pT. We used three different event generators, pythia, mc@nlo, and powheg, to simulate the e+e- spectra from c c ¯ and b b ¯ production. The data can be well described by all three generators within the detector acceptance. However, when using the generators to extrapolate to 4 π , significant differences are observed for the total cross section. These difference are less pronounced for b b ¯ than for c c ¯ . The same model dependence was observed in already published d +A data. The p +p data are also directly compared with d +A data in mass and pT, and within the statistical accuracy no nuclear modification is seen.

  13. Optical Pumping of the Electronic and Nuclear Spin of Single Charge-Tunable Quantum Dots

    DTIC Science & Technology

    2005-02-02

    Optical Pumping of the Electronic and Nuclear Spin of Single Charge-Tunable Quantum Dots A. S . Bracker,1 E. A. Stinaff,1 D. Gammon,1 M. E. Ware,1 J...G. Tischler,1 A. Shabaev,1 Al. L. Efros,1 D. Park,1 D. Gershoni,2 V. L. Korenev ,3 and I. A. Merkulov3 1Naval Research Laboratory, Washington, D.C...intensity (open circles), the PRL 94, 047402 (2005) P H Y S I C A L R E V I E W L E T T E R S week ending 4 FEBRUARY 2005 0031-9007=05=94(4)=047402(4

  14. 15 CFR 4.34 - Specific exemptions.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ...—COMMERCE/DEPT-14; and (ii) The foregoing are exempted from 5 U.S.C. 552a (c)(3), (d), (e)(1), (e)(4)(G), (H... Censuses—COMMERCE/ CENSUS-5; (E) Population Census Personal Service Records for 1900 and All Subsequent... Midshipman Personnel Files—COMMERCE/MA-18; (D) USMMA Non-Appropriated fund Employees—COMMERCE/MA-19; (E...

  15. 15 CFR 4.34 - Specific exemptions.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ...—COMMERCE/DEPT-14; and (ii) The foregoing are exempted from 5 U.S.C. 552a (c)(3), (d), (e)(1), (e)(4)(G), (H... Censuses—COMMERCE/ CENSUS-5; (E) Population Census Personal Service Records for 1900 and All Subsequent... Midshipman Personnel Files—COMMERCE/MA-18; (D) USMMA Non-Appropriated fund Employees—COMMERCE/MA-19; (E...

  16. 15 CFR 4.34 - Specific exemptions.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ...—COMMERCE/DEPT-14; and (ii) The foregoing are exempted from 5 U.S.C. 552a (c)(3), (d), (e)(1), (e)(4)(G), (H... Censuses—COMMERCE/ CENSUS-5; (E) Population Census Personal Service Records for 1900 and All Subsequent... Midshipman Personnel Files—COMMERCE/MA-18; (D) USMMA Non-Appropriated fund Employees—COMMERCE/MA-19; (E...

  17. 15 CFR 4.34 - Specific exemptions.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...—COMMERCE/DEPT-14; and (ii) The foregoing are exempted from 5 U.S.C. 552a (c)(3), (d), (e)(1), (e)(4)(G), (H... Censuses—COMMERCE/ CENSUS-5; (E) Population Census Personal Service Records for 1900 and All Subsequent... Midshipman Personnel Files—COMMERCE/MA-18; (D) USMMA Non-Appropriated fund Employees—COMMERCE/MA-19; (E...

  18. 15 CFR 4.34 - Specific exemptions.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...—COMMERCE/DEPT-14; and (ii) The foregoing are exempted from 5 U.S.C. 552a (c)(3), (d), (e)(1), (e)(4)(G), (H... Censuses—COMMERCE/ CENSUS-5; (E) Population Census Personal Service Records for 1900 and All Subsequent... Midshipman Personnel Files—COMMERCE/MA-18; (D) USMMA Non-Appropriated fund Employees—COMMERCE/MA-19; (E...

  19. Effects of Standard Extremity on Mixed Standard Scale Performance Ratings.

    DTIC Science & Technology

    1983-03-01

    e C co lude’d th bt Ih e mixed standard scal, f:rm.0l porf(, r ,t l J, wul I...levels. MSSI (hE) was con, posed c.f s t ;4tri 4 .rts re f I t i nq m a x I Iy extreme scal e Sva Iues for each c .,f th: f ur diicn s iorr rI, r so...8217rte on the appraisal i nstrum n . I I (ME) w . c ,.,pos d of stat..ment(. with mcderately ext- r ,?’, e sc I e val I.... IS I I I F) was co0. o e J

  20. Lubricant Performance and Evaluation.

    DTIC Science & Technology

    1987-06-01

    Robert E. Kauffman * University of Day..on Research InstituteI Dayton, Ohio 4546; Jun 1987 S U- 4BD Interim Technical Report For Period17 June 1985...InI 133 43-.-l 311 u0.C ) 4- ta 0 0)0 m~tO tD r-ww D Chm4- -4 CD ") I-MW--- L)Ci 00 LnCD 0000004.4.(AJC cctO 0~ CO 4 LAU, CL 4) 4i M0 m 0 cmi CA...L)E- CP L) C,1-4 P)1- lz 1 0 "’ dccE-4 C") LA tD wx I (𔃻 :D W wI 363 0 -4 0) %0 0** *A ONV 9) kn k )4) 12LnA 4-4 0 0m - O .Dt-C%0 ~ 0 -0 *-LA .h %D

  1. Analysis and Design of Ultra Wide-Band and High-Power Microwave Pulse Interactions With Electronic Circuits and Systems

    DTIC Science & Technology

    2007-02-28

    upset, latch -up or failure of systems of digital components. A digital system can be in many different states, depending on its internal functioning...the Interface between Isorefractive Half-spaces A Y,A0 + B I (c). Cavity-Backed Gap in a Corner (d). A Right-Angle Isorefractive Wedge Structure z LL...ikjI I E2,:, (e) . A +-l l(ii (c). e Ca ity-Backedfraptive MatCoeria (d. BeRgt-Angl Isorefractive Wedge -Structur B V-T A.. D .F V-0 G x V-:x C E Y’-2

  2. Indirect-Cost Management Guide: Navigating the Sea of Overhead

    DTIC Science & Technology

    2001-10-01

    This is very advantageous to both the contractor and the government be- cause it enables each to become more effi- cient by capitalizing on significant...They are accumulated and then transferred for allocation as an indirect expense. T R A N S F E R R E D T O G & A I N D I R E C T C O S T D I R E C T C O ...463 173 1,773 FICA Taxes 14,804 17,488 8,327 1,943 3,049 925 1,851 694 1,578 Unempl Taxes 1,851 2,186 1,041 243 381 116 231 87 1,064 Retirement Plan

  3. 75 FR 28317 - Notice of Final Federal Agency Actions on Proposed Highways in Michigan

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-20

    ... 1964 [42 U.S.C 2000(d)-2000(d)(1)]; American Indians Religious Freedom Act [42 U.S.C. 1996]; Farmland... Populations; E.O. 11593, Protection and Enhancement of Cultural Resources; E.O. 13007, Indian Sacred Sites; E...

  4. Search for rare and forbidden decays D+ --> h+/- e+/- e+.

    PubMed

    He, Q; Muramatsu, H; Park, C S; Thorndike, E H; Coan, T E; Gao, Y S; Liu, F; Artuso, M; Boulahouache, C; Blusk, S; Butt, J; Dorjkhaidav, O; Li, J; Menaa, N; Mountain, R; Nandakumar, R; Randrianarivony, K; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Csorna, S E; Bonvicini, G; Cinabro, D; Dubrovin, M; Briere, R A; Chen, G P; Chen, J; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Rosner, J L; Adam, N E; Alexander, J P; Berkelman, K; Cassel, D G; Crede, V; Duboscq, J E; Ecklund, K M; Ehrlich, R; Fields, L; Galik, R S; Gibbons, L; Gittelman, B; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Meyer, T O; Onyisi, P U E; Patterson, J R; Peterson, D; Phillips, E A; Pivarski, J; Riley, D; Ryd, A; Sadoff, A J; Schwarthoff, H; Shi, X; Shepherd, M R; Stroiney, S; Sun, W M; Urner, D; Wilksen, T; Weaver, K M; Weinberger, M; Athar, S B; Avery, P; Breva-Newell, L; Patel, R; Potlia, V; Stoeck, H; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Gollin, G D; Karliner, I; Kim, D; Lowrey, N; Naik, P; Sedlack, C; Selen, M; White, E J; Williams, J; Wiss, J; Asner, D M; Edwards, K W; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Gong, D T; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Li, S Z; Poling, R; Scott, A W; Smith, A; Dobbs, S; Metreveli, Z; Seth, K K; Tomaradze, A; Zweber, P; Ernst, J; Severini, H; Dytman, S A; Love, W; Mehrabyan, S; Mueller, J A; Savinov, V; Li, Z; Lopez, A; Mendez, H; Ramirez, J; Huang, G S; Miller, D H; Pavlunin, V; Sanghi, B; Shipsey, I P J; Adams, G S; Cravey, M; Cummings, J P; Danko, I; Napolitano, J

    2005-11-25

    Using 0.8 x 10(6) D+ D- pairs collected with the CLEO-c detector at the psi(3770) resonance, we have searched for flavor-changing neutral current and lepton-number-violating decays of D+ mesons to final states with dielectrons. We find no indication of either, obtaining 90% confidence level upper limits of B(D+ --> pi+ e+ e-) < 7.4 x 10(-6), B(D+ --> pi- e+ d+) < 3.6 x 10(-6), B(D+ --> K+ e+ e-) < 6.2 x 10(-6), and B(D+ --> K- e+ e+) < 4.5 x 10(-6).

  5. A Critical Analysis of the U.S. Marine Corps 04XX Logistics Community

    DTIC Science & Technology

    2013-04-15

    logistics community. Study .!Manuscript c. PAGE COUNT d . SUBJECT AREA 221 An examination of the training and readiness of a specific military...occupational field. 2. AUTHOR/SPEAKER e. NA M E (LasT. First. M iddle lnhia/J b . RANK c . T ITLE Lathers, Jolm, D. GS-12 Instructional Systems/ Training ...Specialist d. OFFICE e. AGENCY Marine Corps Combat Service Support Schools DoD, DoN, USMC, TECOM, Ground Training Branch 3 . PRESENTATION/ PUBLICA

  6. Molecular Biology of STLV-III and HTLV-IV

    DTIC Science & Technology

    1990-08-22

    8217 AT( ACCA CTCAT.(3CA 5 Ci.T G,- .... ; . , P P, ( L D O S H s v H I -U" G r L "S " V " " , 3 E E 7 ’ T - ’ ’ ’ TJ - " t f? I f T G A- C-. C .T ’ CA8C P...R S N T V K N S D’ . Y S T m 2: G ! Y ’) V V G v I L L R 7 V T Y I’ ,9 M 3: i E F M C f7 E e I V C? iT C? e S . (N*’ 1 . Flist 5At(3CTAGC’’TAATGrAG

  7. Approximate Reasoning and the REVEAL Software System. Users Guide.

    DTIC Science & Technology

    1985-03-01

    Oi O O Sko mwr-r . . U~ -n APPENDIX B TACTICAL MODEL REVEAL CONTEXT *-4 u)63U .0 W -4 - 0-oLL 0 LA,- X -4 .- q 0 S... 0 03 Q C4U u r= <c El) ty E:, Ui...u .jI - k0 jC~ q ( 0t’ COr *o (0 C) V)0 r C C-r’ ko o A Ul -)- - ’ r) -UIUrU 0<D( . .* . . . . . . . . . . . (S 0< )(D< ()%D(D ( - Z C D IDC ()tD...i.N 0 0t0-400 U Uo 03 V4’U ko 0 o.... L) 4 40.). .4.4’ 403p03 L) -4 - --4 .- 4v V4 4 U)- U) 0 0U)U I u )uU) u ) - P tn V -C ) V~U)~) E -4 R -- 4

  8. EnviroAtlas Estimated Percent Tree Cover Along Walkable Roads Web Service

    EPA Pesticide Factsheets

    This EnviroAtlas dataset estimates tree cover along walkable roads. The road width is estimated for each road and percent tree cover is calculated in a 8.5 meter strip beginning at the estimated road edge. Percent tree cover is calculated for each block between road intersections. Tree cover provides valuable benefits to neighborhood residents and walkers by providing shade, improved aesthetics, and outdoor gathering spaces. For specific information about each community's Estimated Percent Tree Cover Along Walkable Roads layer, consult their individual metadata records: Austin, TX (https://edg.epa.gov/metadata/catalog/search/resource/details.page?uuid=%7B4876FD99-C14A-464A-9E31-5CB5F2225687%7D); Cleveland, OH (https://edg.epa.gov/metadata/catalog/search/resource/details.page?uuid=%7B28e3f937-6f22-45c5-98cf-1707b0fc92df%7D); Des Moines, IA (https://edg.epa.gov/metadata/catalog/search/resource/details.page?uuid=%7B09FE7D60-B636-405C-BB07-68147DFE8CAF%7D); Durham, NC (https://edg.epa.gov/metadata/catalog/search/resource/details.page?uuid=%7BF341A26B-4972-4C6B-B675-9B5E02F4F25F%7D); Fresno, CA (https://edg.epa.gov/metadata/catalog/search/resource/details.page?uuid=%7BB71334B9-C53A-4674-A739-1031969E5163%7D); Green Bay, WI (https://edg.epa.gov/metadata/catalog/search/resource/details.page?uuid=%7BB9AFEBED-9C29-4DB0-8B54-0CAF58BE5A2D%7D); Memphis, TN (https://edg.epa.gov/metadata/catalog/search/resource/details.page?uuid=%7BBE552E7A-A789-4AA9-ADF9-234109C6517E%7D); Mi

  9. Indian Ocean Validation,

    DTIC Science & Technology

    1987-09-01

    S9 fd 30 2 D0i 0m10 20 802 AR. Oy ad n A o io in 3 0 3 7 ..n . . . w o w., , ... .. . . . . d ata m gaterng eie ws amdfe Lito sT-1 Omeg nav~igtion AE...signals propagated from each of N stations over paths of 2-10 length dl, d2, ... as shown in Figure 2.1. Station 2 Station N Station 1 D dl SUBJECT Figure...t2* = (d1* - d2*)/c + ( El - 62) t2* - t3* = (d2* - d3*)/c + ( E2 - E3) t*N 1 - t*N - ( d *N 1 - dN*)/c + ( N-1 EN) (6) 47he results obtained in

  10. A Computational Study of the Chemical Kinetics of Hydrogen Combustion.

    DTIC Science & Technology

    1981-01-28

    204), 465 (1951). 22. D.R. Warren, Proc. Roy. Soc. London, Ser A(211), 86 (1952). 23. D.R. Stull and H. Prophet, JANAF Thermochemical Tables, 2nd...G. von Elbe and B. Lewis, J. Chem. Phys.. 9. p. 194 (1941). 61. A.M. Dean . D.C. Steiner and E.E. Wang, Combustion and Flame. 32, p. 73 (1978). 62. C.C

  11. 77 FR 26355 - Notice of Final Federal Agency Actions on Avenida Rio Salado/Broadway Road

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-03

    ...: Civil Rights Act of 1964 [42 U.S.C. 2000(d)-2000(d)(1)]; American Indian Religious Freedom Act [42 U.S.C... of Cultural Resources; E.O. 13007 Indian Sacred Sites; E.O. 13287 Preserve America; E.O. 13175...

  12. 75 FR 59325 - Notice of Final Federal Agency Actions on Proposed Highway in North Carolina

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-27

    ...: Civil Rights Act of 1964 [42 U.S.C. 2000(d)-2000(d)(1)]; American Indian Religious Freedom Act [42 U.S.C... of Cultural Resources; E.O. 13007 Indian Sacred Sites; E.O. 13287 Preserve America; E.O. 13175...

  13. 75 FR 25309 - Notice of Final Federal Agency Actions on Proposed Expanded Intermodal Freight Terminal in Michigan

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-07

    ... 1964 [42 U.S.C. 2000(d)-2000(d)(1)]; American Indians Religious Freedom Act [42 U.S.C. 1996]; Farmland...; E.O. 11593, Protection and Enhancement of Cultural Resources; E.O. 13007, Indian Sacred Sites; E.O...

  14. 77 FR 531 - Notice of Limitation on Claims Against a Proposed Transportation Project

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-05

    ...: Civil Rights Act of 1964 [42 U.S.C. 2000(d)-2000(d)(1)); American Indian Religious Freedom Act [42 U.S.C... Populations; E.O. 11593 Protection and Enhancement of Cultural Resources; E.O. 13007 Indian Sacred Sites; E.O...

  15. Increasing Regulatory Acceptance of Passive Samplers

    DTIC Science & Technology

    2010-12-01

    microextraction ( SPME ) • Accumulate freely-dissolved organic contaminants from surrounding water into a solid phase • Contaminant concentrations of the...based on SPME (pg/L) D i s s o l v e d C o n c e n t r a t i o n b a s e d o n M u s s e l s ( p g / L ) 4,4’-DDE 4,4’-DDD 4,4’-DDT 1:1 line

  16. 9 CFR 114.9 - Outline of Production guidelines.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... each satisfactory test. A. Purity. B. Safety. C. Potency. D. Other tests. VI. Post preparatory steps. A... test. A. Purity. B. Safety. C. Potency. D. Moisture, if desiccated. E. Any other tests. VI. Post.... Potency. D. Any other tests. E. Include any additional pertinent information. IV. Post preparatory steps...

  17. 9 CFR 114.9 - Outline of Production guidelines.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... each satisfactory test. A. Purity. B. Safety. C. Potency. D. Other tests. VI. Post preparatory steps. A... test. A. Purity. B. Safety. C. Potency. D. Moisture, if desiccated. E. Any other tests. VI. Post.... Potency. D. Any other tests. E. Include any additional pertinent information. IV. Post preparatory steps...

  18. 9 CFR 114.9 - Outline of Production guidelines.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... each satisfactory test. A. Purity. B. Safety. C. Potency. D. Other tests. VI. Post preparatory steps. A... test. A. Purity. B. Safety. C. Potency. D. Moisture, if desiccated. E. Any other tests. VI. Post.... Potency. D. Any other tests. E. Include any additional pertinent information. IV. Post preparatory steps...

  19. 9 CFR 114.9 - Outline of Production guidelines.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... each satisfactory test. A. Purity. B. Safety. C. Potency. D. Other tests. VI. Post preparatory steps. A... test. A. Purity. B. Safety. C. Potency. D. Moisture, if desiccated. E. Any other tests. VI. Post.... Potency. D. Any other tests. E. Include any additional pertinent information. IV. Post preparatory steps...

  20. 9 CFR 114.9 - Outline of Production guidelines.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... each satisfactory test. A. Purity. B. Safety. C. Potency. D. Other tests. VI. Post preparatory steps. A... test. A. Purity. B. Safety. C. Potency. D. Moisture, if desiccated. E. Any other tests. VI. Post.... Potency. D. Any other tests. E. Include any additional pertinent information. IV. Post preparatory steps...

  1. Space Stations.

    DTIC Science & Technology

    1980-04-01

    4 C X 0Z C X - . -0 a m -- L ( U -. W 0 t a - a L 0 r 0 5 U w ( U f i C 0 -a- .. s -an 21.Z IZ W 0 *1 0 0 5 a . - C o ag CL W3 Iz, go, Cc’s "X i -J...50 4- a o r.) LU 0 . A9 0 A (A0 - -VZ % AG 0n W.- C-C- ’-O CL N. L) a D > ) InS r -a 0a C 4 C065 E- 04- 0j cv c I- 0 L U) a -- C GD - - L -z Cd ~J C 1...0 0 -C 041 a OC 0. CW0 McL (n. C/C w. &U - 0. a) O : 0 JC O V EW( W WC -’ - C’. 2 0. L U 0- U 0 10---id - ’D 4)c C(C C’d 0. E- aG do il- W WCD C E L C

  2. Proteomic identification of proteins translocated to membrane microdomains upon treatment of fibroblasts with the glycosphingolipid, C8-beta-D-lactosylceramide.

    PubMed

    Kim, Seong-Youl; Wang, Teng-ke; Singh, Raman Deep; Wheatley, Christine L; Marks, David L; Pagano, Richard E

    2009-09-01

    Plasma membrane (PM) microdomains, including caveolae and other cholesterol-enriched subcompartments, are involved in the regulation of many cellular processes, including endocytosis, attachment and signaling. We recently reported that brief incubation of human skin fibroblasts with the synthetic glycosphingolipid, D-erythro-octanoyl-lactosylceramide (C8-D-e-LacCer), stimulates endocytosis via caveolae and induces the appearance of micron-size microdomains on the PM. To further understand the effects of C8-D-e-LacCer treatment on PM microdomains, we used a detergent-free method to isolate microdomain-enriched membranes from fibroblasts treated +/-C8-D-e-LacCer, and performed 2-DE and mass spectrophotometry to identify proteins that were altered in their distribution in microdomains. Several proteins were identified in the microdomain-enriched fractions, including lipid transfer proteins and proteins related to the functions of small GTPases. One protein, Rho-associated protein kinase 2 (ROCK2), was verified by Western blotting to occur in microdomain fractions and to increase in these fractions after D-e-LacCer treatment. Immunofluorescence revealed that ROCK2 exhibited an increased localization at or near the PM in C8-D-e-LacCer-treated cells. In contrast, ROCK2 distribution in microdomains was decreased by treatment of cells with C8-L-threo-lactosylceramide, a glycosphingolipid with non-natural stereochemistry. This study identifies new microdomain-associated proteins and provides evidence that microdomains play a role in the regulation of the Rho/ROCK signaling pathway.

  3. 17beta-estradiol stimulates the growth of human keratinocytes by inducing cyclin D2 expression.

    PubMed

    Kanda, Naoko; Watanabe, Shinichi

    2004-08-01

    Estrogen is reported to prevent age-associated epidermal thinning in the skin. We examined if 17beta-estradiol (E2) may enhance the growth of human keratinocytes, focusing on its effects on the expression of cell cycle-regulatory proteins. E2 enhanced proliferation, bromodeoxyuridine incorporation of keratinocytes, and increased the proportion of cells in the S phase. The E2-induced stimulation of proliferation and bromodeoxyuridine incorporation was suppressed by antisense oligonucleotide against cyclin D2, which induces G1 to S phase progression. E2 increased protein and mRNA levels of cyclin D2, and resultantly enhanced assembly and kinase activities of cyclin D2-cyclin-dependent kinases 4 or 6 complexes. E2 enhanced cyclin D2 promoter activity, and the element homologous to cAMP response element (CRE) on the promoter was responsible for the effect. Cyclin D2 expression was enhanced by antiestrogens, ICI 182,780 and 4-hydroxytamoxifen, and membrane-impermeable bovine serum albumin-conjugated E2, indicating the effects via membrane E2-binding sites. E2 increased the enhancer activity of CRE-like element and the amount of phosphorylated cAMP response element binding protein (CREB) binding this element, and the increases were suppressed by H-89, an inhibitor of cAMP-dependent protein kinase A. H-89 also suppressed E2-induced cyclin D2 expression, proliferation, and bromodeoxyuridine incorporation in keratinocytes. Antisense oligonucleotide against G-protein-coupled receptor GPR30 suppressed the E2-induced increases of phosphorylated CREB, cyclin D2 level, proliferation, and bromodeoxyuridine incorporation in keratinocytes. These results suggest that E2 may stimulate the growth of keratinocytes by inducing cyclin D2 expression via CREB phosphorylation by protein kinase A, dependent on cAMP. These effects of E2 may be mediated via cell surface GPR30.

  4. Probability of Detection Study to Assess the Performance of Nondestructive Inspection Methods for Wind Turbine Blades.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Roach, Dennis P.; Rice, Thomas M.; Paquette, Joshua

    Wind turbine blades pose a unique set of inspection challenges that span from very thick and attentive spar cap structures to porous bond lines, varying core material and a multitude of manufacturing defects of interest. The need for viable, accurate nondestructive inspection (NDI) technology becomes more important as the cost per blade, and lost revenue from downtime, grows. NDI methods must not only be able to contend with the challenges associated with inspecting extremely thick composite laminates and subsurface bond lines, but must also address new inspection requirements stemming from the growing understanding of blade structural aging phenomena. Under itsmore » Blade Reliability Collaborative program, Sandia Labs quantitatively assessed the performance of a wide range of NDI methods that are candidates for wind blade inspections. Custom wind turbine blade test specimens, containing engineered defects, were used to determine critical aspects of NDI performance including sensitivity, accuracy, repeatability, speed of inspection coverage, and ease of equipment deployment. The detection of fabrication defects helps enhance plant reliability and increase blade life while improved inspection of operating blades can result in efficient blade maintenance, facilitate repairs before critical damage levels are reached and minimize turbine downtime. The Sandia Wind Blade Flaw Detection Experiment was completed to evaluate different NDI methods that have demonstrated promise for interrogating wind blades for manufacturing flaws or in-service damage. These tests provided the Probability of Detection information needed to generate industry-wide performance curves that quantify: 1) how well current inspection techniques are able to reliably find flaws in wind turbine blades (industry baseline) and 2) the degree of improvements possible through integrating more advanced NDI techniques and procedures. _____________ S a n d i a N a t i o n a l L a b o r a t o r i e s i s a m u l t i m i s s i o n l a b o r a t o r y m a n a g e d a n d o p e r a t e d b y N a t i o n a l T e c h n o l o g y a n d E n g i n e e r i n g S o l u t i o n s o f S a n d i a , L L C , a w h o l l y o w n e d s u b s i d i a r y o f H o n e y w e l l I n t e r n a t i o n a l , I n c . , f o r t h e U . S . D e p a r t m e n t o f E n e r g y ' s N a t i o n a l N u c l e a r S e c u r i t y A d m i n i s t r a t i o n u n d e r c o n t r a c t D E - N A 0 0 0 3 5 2 5 .« less

  5. Mimicking phosphorylation of Ser-74 on human deoxycytidine kinase selectively increases catalytic activity for dC and dC analogues

    PubMed Central

    McSorley, Theresa; Ort, Stephan; Hazra, Saugata; Lavie, Arnon; Konrad, Manfred

    2009-01-01

    Intracellular phosphorylation of dCK on Ser-74 results in increased nucleoside kinase activity. We mimicked this phosphorylation by a Ser-74-Glu mutation in bacterially produced dCK and investigated kinetic parameters using various nucleoside substrates. The S74E mutation increases the kcat values 11-fold for dC, and 3-fold for the anti-cancer analogues dFdC and AraC. In contrast, the rate is decreased for the purine substrates. In HEK293 cells, we found that by comparing transiently transfected dCK(S74E)-GFP and wild-type dCK-GFP, mimicking the phosphorylation of Ser-74 has no effect on cellular localisation. We note that phosphorylation may represent a mechanism to enhance the catalytic activity of the relatively slow dCK enzyme. PMID:18258203

  6. Prophylactic Fasciotomy in a Porcine Model of Extremity Trauma

    DTIC Science & Technology

    2014-07-16

    Morrison, MRCS,b,c,d Jerry R. Spencer , BS,a James D. Ross, PhD,a and Todd E. Rasmussen, MD, FACSa,e,f,* a59th Medical Wing, Joint Base San Antonio, San...NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Percival T. J., Patel S., Markov N. P., Morrison J. J., Spencer J. R., Ross J. D., Rasmussen T. E., 5d...initiative. J Vasc Surg 2009;50:549. [5] Sohn VY, Arthurs ZM, Herbert GS, Beekley AC, Sebesta JA. Demographics, treatment, and early outcomes in

  7. Economical Development of Complex Computer Systems

    DTIC Science & Technology

    1992-08-15

    margins typically encountered in the ........ beginning of a product’s life cycle, and shorten the payback period.4 leS D ~~~~LC~~~ Jr4.tt L~s.c...recurring, and other related costsincurred, or estimated to be incurr in the design, research and development (R& D ), investment, operation, maintenance...on the basis of cost. D E C R ’Item I E Incorporatento A-ml S .... .. EF D Y ..... S F R Technology& : Recnser 0 N P T Item N A -- Y E -- B N ’’A D

  8. Projections of Demand for Waterborne Transportation, Ohio River Basin, 1980, 1990, 2000, 2020, 2040. Volume 9. Group VII. Ores and Minerals.

    DTIC Science & Technology

    1980-12-01

    U l 0 0 ) C 4140 c4 34jE 04 0)t 03.- In lo No ID 0ID 6)ID M). U 0 ( in cc m m m c m mm m a a) la.0u) 0r- 02d)20 C ’N C ~ 3 C -27- c -o 0 It14’ 0 14 tn...N 1.D/ c4 0)00E w.~ 0 V-- -"- -- V04 M1)4VdW -4I -..- 1. 0001M.-40 00 4D4J.’ ::l c:; Q o u00 0 0.0 a 0~~ ~ m𔃺 w , 0-0m.-Q)uH 1.4 0 : . 0 4140 .0 ZZl...Statistical Report. 1969-78 eds. Washington, D.C.: AISI , 1970-79. American Metal Market. Metal Statistics. 1970 -d. New York: Fairchild, 1976. "Facts and

  9. A Small-Unit Amphibious Operation Combat Model.

    DTIC Science & Technology

    1983-03-01

    7THE FuNCTICNS HloSPD, IND PNG, "tHE ARGUMENT T C IS 71IE TIME SIhCE 11-E ’othvE 6EYNG 40ORESSE-D C CPCSSEO IHE 50CO PETER GFFSHCFE M4ARK~ C...SSpD𔃿FFD0(I m PXX()-A.ACCNG5SI.* G /SZPO PXY( ! )-(?.! !ANLC4-’,*( -Al ISSP; C ALL VAL(,ES N~C% IN PETERS CN 0 -- 109000 GRID 1CC CCT114UE REtC(5...EACH SUCH ELLIPSE NE IS=0 C lIiiAXaC . IF(NCVcL!*EQ.Cl GCIO 270 Do ZeC K;I;fGFSC I A’IGX( I) I 𔄁. IGY (K I NaNC(IX, IY) IF(?d.EQ.0D GC TC 26C 128

  10. 2009 Biometrics Conference

    DTIC Science & Technology

    2009-01-28

    STATEMENT USNORTHCOM ti i t d d t H l d D f d an c pa es an con uc s ome an e ense an Civil Support operations within the assigned area of responsibility... operational goals and objectives of HSPD-24 and make our world a safer place to live and work. Promotional Partners: Increase your company or organization...INFORMATION Ir i tech, Inc. S A I C B o o z A l l e n H a m i l t o n Aware, Inc. H i t ach i A mer i c a , LT D Companies that will be displaying

  11. The Linearized Unsteady Lifting Surface Theory Applied to the Pump-Jet Propulsive System.

    DTIC Science & Technology

    1981-08-01

    61 REFERENCES .......... ....................... ... 63 FIGURES (1-5) APPENDIX A: Evaluation of the e - AND...25 TR-2173 From the e D-integration it is determined that m5= ji , because 2n i(ms lOeD { 2rT for m5- =O (47) S deD { 0 otherwise 0 Since the L-H...rDPR 2 rDPRc SLORO-’"D&t+G Rn - XD R) On substituting I c im 71 7 __ l 7 e(IkIp )K (Iki eiTkdk ( 61 ) RRD m 7=- m7 ( Rm( rD) where 0 eRO - YPD "c2t

  12. NRL Plasma Formulary. Revision

    DTIC Science & Technology

    1990-01-01

    Description SI Gaussian 9B 1l0B Faraday’s law V x E -- V x E =-- at c Ot c9D 10D 4wr Ampere’s law V x H + J V x H =- + -J at c Ot c Poisson equation V - D = p...Froude Fr V/(g L) 1/ 2 t(Inertial force/gravitational or V/NL buoyancy force) 1 /2 Gay- Lussac Ga 1/fOAT Inverse of relative change in volume during... law heat coefficient, k = crAT0ax Volumetric expansion coefficient, dV/V = )3dT Bulk modulus (units kg m 1 s - 2) 6R, AV, Ap, AT Imposed difference in

  13. Physical Mechanism of the Lower-Hybrid-Drift Instability in a Collisional Plasma.

    DTIC Science & Technology

    1981-01-30

    8217 70Q SaCE .A-.D A> AT TN R~~ . WIL.IAMRS 01CI " CUT% 755O -řA ol2’ 4’TN E_."D-NP F. WIMItNITZ 01:y A’ ’N. LOGE 02CY ATTN D’E_,D).p C. MOAZED 0:2’ All% c

  14. COIN 1.0 Formulation

    DTIC Science & Technology

    2010-05-01

    Anderson , C , Keltner , D , John , OP 2003 “Emotional convergence between people over time” Journal of Personality and Social...E T E C H N I C A L R E P O R T COIN 1.0 Formulation The views, opinions and/or findings contained in this report are...Figure 5-35. Animated Time Series DORP 5-37 Figure 36: The elements of power 2 Figure D -1. Agent Schematic

  15. Growth of YBCO Thin Films on TiN(001) and CeO2-Coated TiN Surfaces

    DTIC Science & Technology

    2012-02-01

    Paranthaman, E.D. Specht , D.M. Kroeger, D.K. Christen, Q. He, B. Saffian, F.A. List, D.F. Lee, P.M. Martin, C.E. Klabunde, E. Hatfield, V.K. Sikka...Appl. Phys. Lett. 69 (1996) 1795. [4] M. Paranthaman, A. Goyal, F.A. List, E.D. Specht , D.F. Lee, P.M. Martin, Q. He, D.K. Christen, D.P. Norton, J.D

  16. CBR Operations in Cold Weather: A Bibliography. Volume 1

    DTIC Science & Technology

    1989-11-01

    JOHNSTON R C SWAMP OAK TEST DATA DOD/DROLS ; HANNEMANN M M D ANALYSIS. 514727L ;HALLANGER N L ;KROTH J R ;WESTLAKE WILFRED J ; HAMILTON WILLIAM M 1953...E 1963 HANNA ALFRED E; SIMULATED COLD WEATHER DOD/DROLS RADIOLOGICAL DECONTAMINATION 296248 OF RECOVERY EQUIPMENT. HANNEMANN M M D 1967 JOHNSTON R C...SWAMP OAK TEST DATA DOD/DROLS ; HANNEMANN M M D ANALYSIS. 514727L ;HALLANGER N L ;KROTH J R ;WESTLAKE WILFRED J : 37 HELLBERG E N 1961 TAYLOR D

  17. 78 FR 54947 - Notice of Final Federal Agency Actions on Proposed US 1 Improvements-Rockingham, Richmond County, NC

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-06

    ...: Civil Rights Act of 1964 [42 U.S.C. 2000(d)-2000(d)(1)]; American Indian Religious Freedom Act [42 U.S.C... Populations; E.O. 11593 Protection and Enhancement of Cultural Resources; E.O. 13007 Indian Sacred Sites; E.O...

  18. Tripolar Stability: The Future of Nuclear Relations Among the United States, Russia, and China

    DTIC Science & Technology

    2002-09-01

    I N S T I T U T E F O R D E F E N S E A N A L Y S E S D E F E N S E T H R E A T R E D U C T I O N A G E N C Y Tripolar Stability: The Future of... Tripolar Stability: The Future of Nuclear Relations Among the United States, Russia, and China Brad Roberts PREFACE Since the creation of the...here were first sketched out in a symposium convened at IDA on July 28 on nuclear tripolarity , where thoughtful presentations were made on facets

  19. A Very Compact Rijndael S-box

    DTIC Science & Technology

    2005-05-17

    6A 01101010 40 r8 107 6B 01101011 84 N4 108 6C 01101100 250 R 109 6D 01101101 133 s128 110 6E 01101110 61 S64 111 6F 01101111 186 n64 112 70 01110000...210 D2 11010010 132 l128 109 6D 01101101 133 s128 183 B7 10110111 134 C128 194 C2 11000010 135 T 128 93 5D 01011101 136 α8 231 E7 11100111 137 g128

  20. 77 FR 1656 - Proposed Establishment of Restricted Areas R-5402, R-5403A, R-5403B, R-5403C, R-5403D, R-5403E, R...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-11

    ...-0117; Airspace Docket No. 09-AGL-31] RIN 2120-AI92 Proposed Establishment of Restricted Areas R-5402, R-5403A, R- 5403B, R-5403C, R-5403D, R-5403E, R-5403F; Devils Lake, ND AGENCY: Federal Aviation... Restricted Areas R-5402, R-5403A, R-5403B, R- 5403C, R-5403D, R-5403E, R-5403F; Devils Lake, ND (76 FR 72869...

  1. Effects of Pin Detached Space on Heat Transfer and Pin-Fin Arrays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Siw, Sin Chien; Chyu, Minking K.; Shih, Tom I. -P.

    2012-01-01

    Heat transfer and pressure characteristics in a rectangular channel with pin-fin arrays of partial detachment from one of the endwalls have been experimentally studied. The overall channel geometry (W=76.2 mm, E=25.4 mm) simulates an internal cooling passage of wide aspect ratio (3:1) in a gas turbine airfoil. With a given pin diameter, D=6.35 mm=¼E, three different pin-fin height-to-diameter ratios, H/D=4, 3, and 2, were examined. Each of these three cases corresponds to a specific pin array geometry of detachment spacing (C) between the pin tip and one of the endwalls, i.e., C/D=0, 1, 2, respectively. The Reynolds number, based onmore » the hydraulic diameter of the unobstructed cross-section and the mean bulk velocity, ranges from 10,000 to 25,000. The experiment employs a hybrid technique based on transient liquid crystal imaging to obtain the distributions of the local heat transfer coefficient over all of the participating surfaces, including the endwalls and all the pin elements. Experimental results reveal that the presence of a detached space between the pin tip and the endwall has a significant effect on the convective heat transfer and pressure loss in the channel. The presence of pin-to-endwall spacing promotes wall-flow interaction, generates additional separated shear layers, and augments turbulent transport. In general, an increase in detached spacing, or C/D, leads to lower heat transfer enhancement and pressure drop. However, C/D=1, i.e., H/D=3, of a staggered array configuration exhibits the highest heat transfer enhancement, followed by the cases of C/D=0 and C/D=2, i.e., H/D=4 or 2, respectively.« less

  2. Giardia duodenalis genotypes in domestic and wild animals from Romania identified by PCR-RFLP targeting the gdh gene.

    PubMed

    Adriana, Gyӧrke; Zsuzsa, Kalmár; Mirabela Oana, Dumitrache; Mircea, Gherman Călin; Viorica, Mircean

    2016-02-15

    Sixty Giardia duodenalis isolates from domestic (n=49) and wild (n=11) animals (dogs, cats, deers, wolves, raccoon dog and muskrat) were analysed by PCR-RFLP at glutamate dehydrogenase locus (gdh). The isolates were obtained from positive feces samples for Giardia cysts analysed by flotation technique with saturated sodium chloride solution (specific gravity 1.28). Three G. duodenalis genotypes were identified: C (10/60; 16.7%); D (42/60; 70.0%); and E (7/60; 11.7%). In dogs all three genotypes were found, with the following prevalences: 76.9% genotype D (30/39); 23.1% C (9/39); 2.6% genotype E (1/39). One dog was co-infected with C and D genotypes. In cats we identified only G. duodenalis genotype D. Wolves and raccoon dog harbored infection with G. duodenalis genotype D, deers with E type and muskrat C type. This is the first study regarding genotyping of G. duodenalis in cats and wild animals from Romania. To the best of our knowledge, this is the first report of assemblages E in roe deers; assemblage C in wolves and muskrat; and assemblage D in raccoon dog. Copyright © 2016. Published by Elsevier B.V.

  3. Forster energy transfer in chlorosomes of green photosynthetic bacteria

    NASA Technical Reports Server (NTRS)

    Causgrove, T. P.; Brune, D. C.; Blankenship, R. E.

    1992-01-01

    Energy transfer properties of whole cells and chlorosome antenna complexes isolated from the green sulfur bacteria Chlorobium limicola (containing bacteriochlorophyll c), Chlorobium vibrioforme (containing bacteriochlorophyll d) and Pelodictyon phaeoclathratiforme (containing bacteriochlorophyll e) were measured. The spectral overlap of the major chlorosome pigment (bacteriochlorophyll c, d or, e) with the bacteriochlorophyll a B795 chlorosome baseplate pigment is greatest for bacteriochlorophyll c and smallest for bacteriochlorophyll e. The absorbance and fluorescence spectra of isolated chlorosomes were measured, fitted to gaussian curves and the overlap factors with B795 calculated. Energy transfer times from the bacteriochlorophyll c, d or e to B795 were measured in whole cells and the results interpreted in terms of the Forster theory of energy transfer.

  4. Assessing the Need for Curriculum or Delivery Revisions to the D.A.R.E.[R] K-4 Visitation Lessons: A Qualitative Inquiry

    ERIC Educational Resources Information Center

    Witte, Jeffrey H.

    2011-01-01

    Over the last several decades, research has questioned the effectiveness of the D.A.R.E.[c] (Drug Abuse Resistance Education) program. D.A.R.E.[c] has also experienced cuts based on budget restrictions and personnel reallocations within police agencies, as well as competing demands for classroom time. Although concerted efforts have been made to…

  5. Observation of D+→ηe+νe

    NASA Astrophysics Data System (ADS)

    Mitchell, R. E.; Shepherd, M. R.; Besson, D.; Pedlar, T. K.; Cronin-Hennessy, D.; Gao, K. Y.; Hietala, J.; Kubota, Y.; Klein, T.; Lang, B. W.; Poling, R.; Scott, A. W.; Smith, A.; Zweber, P.; Dobbs, S.; Metreveli, Z.; Seth, K. K.; Tomaradze, A.; Ernst, J.; Ecklund, K. M.; Severini, H.; Love, W.; Savinov, V.; Aquines, O.; Lopez, A.; Mehrabyan, S.; Mendez, H.; Ramirez, J.; Huang, G. S.; Miller, D. H.; Pavlunin, V.; Sanghi, B.; Shipsey, I. P. J.; Xin, B.; Adams, G. S.; Anderson, M.; Cummings, J. P.; Danko, I.; Hu, D.; Moziak, B.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C. S.; Thorndike, E. H.; Yang, F.; Artuso, M.; Blusk, S.; Butt, J.; Li, J.; Menaa, N.; Mountain, R.; Nisar, S.; Randrianarivony, K.; Sia, R.; Skwarnicki, T.; Stone, S.; Wang, J. C.; Zhang, K.; Bonvicini, G.; Cinabro, D.; Dubrovin, M.; Lincoln, A.; Asner, D. M.; Edwards, K. W.; Naik, P.; Briere, R. A.; Ferguson, T.; Tatishvili, G.; Vogel, H.; Watkins, M. E.; Rosner, J. L.; Adam, N. E.; Alexander, J. P.; Cassel, D. G.; Duboscq, J. E.; Ehrlich, R.; Fields, L.; Galik, R. S.; Gibbons, L.; Gray, R.; Gray, S. W.; Hartill, D. L.; Heltsley, B. K.; Hertz, D.; Jones, C. D.; Kandaswamy, J.; Kreinick, D. L.; Kuznetsov, V. E.; Mahlke-Krüger, H.; Mohapatra, D.; Onyisi, P. U. E.; Patterson, J. R.; Peterson, D.; Pivarski, J.; Riley, D.; Ryd, A.; Sadoff, A. J.; Schwarthoff, H.; Shi, X.; Stroiney, S.; Sun, W. M.; Wilksen, T.; Athar, S. B.; Patel, R.; Potlia, V.; Yelton, J.; Rubin, P.; Cawlfield, C.; Eisenstein, B. I.; Karliner, I.; Kim, D.; Lowrey, N.; Selen, M.; White, E. J.; Wiss, J.

    2009-02-01

    Using a 281pb-1 data sample collected at the ψ(3770) resonance with the CLEO-c detector at the Cornell Electron Storage Ring, we report the first observation of D+→ηe+νe. We also set upper limits for D+→η'e+νe and D+→ϕe+νe that are about 2 orders of magnitude more restrictive than those obtained by previous experiments.

  6. Microwave spectrum of o-benzyne produced in a discharge nozzle

    NASA Astrophysics Data System (ADS)

    Kukolich, S. G.; Tanjaroon, C.; McCarthy, M. C.; Thaddeus, P.

    2003-08-01

    The microwave spectrum for o-benzyne was obtained by passing a dilute (<1%) mixture of benzene in neon through a pulsed-DC discharge nozzle source into a pulsed-beam, Fourier transform spectrometer. Rotational transitions were measured for the normal isotopomer, the two unique single-D isotopomers, and the 13C isotopomer and one of the 13C isotopomers. Benzynes have been known as reactive intermediates in organic reactions for many years, and have recently been implicated in gasoline combustion reactions and antitumor activity of enediynes. Twenty-seven b-type transitions for the normal isotopomer were fit to obtain A=6989.7292(6), B=5706.8062(6), and C=3140.3708(4) MHz, and five centrifugal distortion constants. The inertial defect is Δ=0.069 4 amu Å2, consistent with a planar structure. Hyperfine structure for the D1 (closest to the CtrpbndC bond) and D2 (furthest from the CtrpbndC bond), was analyzed to obtain deuterium quadrupole coupling strengths eQqaa(D1)=185(3) kHz, eQqbb(D1)=-85(2) kHz, eQqaa(D2)=5(13), and eQqbb(D2)=86(13) kHz. The C-D, bond axis quadrupole coupling strengths are compared with values for benzene. Spectra for the 13C6 and one of the 13C1 isotopomers were analyzed to obtain rotational constants. Kraitchman analysis and least-squares fitting provided nearly all of the structural parameters. The preliminary structural analysis yields an acetylenic C≡C bond length of 1.24 Å, in agreement with a recent NMR value. Density functional theory (DFT) calculations were used to obtain structural parameters, and values obtained are in very good agreement with present experimental results.

  7. An Interactive Computer Program for the Preliminary Design and Analysis of Marine Reduction Gears.

    DTIC Science & Technology

    1982-03-01

    4 E-4 c 043 04 4 E- PQ = 24 0 0 E- m 2054 4a =44 Env)2 d0 a b43 09 0 4 I6.4 44 = w. 0k2. . U)3c m 00 I= =C * 4 0 . O)U ad i 0 0~P In3 U= 4 40:M = 4 m...pa *Q4 2 c4~ .~ co N ra a9.* o H 00a = = :b4 H~ H U (3 C) U- of *4= t. E- H)40 UUO *n04 043 q N. W E-4 E-4 1.4-0 31 H 000 oi-4. H4 - M0 2I 2 04 E- HU...aO o %-c ’. %D in0 o f 3W -+V E4pa a noM pa pa pCa 0 pa H14 . pa H 1.4 pa ~00 MtH x 4 -4 U 4E4E4 0 E-4 H E ~ CaM N4 -40 0 UE- E.UE- u 0 c E4 0 9 E-4

  8. The Mira Variable S Orionis: Relationships Between the Photosphere, Molecular Layer, Dust Shell, and SiO Maser Shell at 4 Epochs

    DTIC Science & Technology

    2007-01-01

    C ., Gray, M. D., Humphreys, E. M. L ., Braithwaite, M. F ., & Field, D. 1995, A & A , 302, 797 Feast, M. W., Glass, I. S., Whitelock, P. A ., & Catchpole... C ., Bester, M., Degiacomi, C . G., Greenhill, L . J., & Townes, C . H. 1994, AJ, 107, 1469 Desmurs, J. F ., Bujarrabal, V., Colomer, F ., & Alcolea, J...2003, Proc. SPIE, 4838, 89 Gray, M. D., & Humphreys, E. M. L . 2000, New Astron., 5, 155 Haniff, C . A ., Scholz, M., & Tuthill,

  9. Military Fuels Refined from Paraho-II Shale Oil.

    DTIC Science & Technology

    1981-03-01

    FUELS REFINED O FROM PARAHO-II SHALE OIL INTERIM REPORT AFLRL No. 131 4!t by J.N. Bowden E.C. Owens D.W. Naegeli L.L. Stavinoha U.S. Army Fuels and...J.N./Bowden, E.C. /Owens, D.W./ Naegeli / DAAK70-78-C-0001 € L.L. Stavinoha DAAK70-80-C-0001 V 9 PERFORMING ORGANIZATION NAME AND ADDRESSES J0...Combustor Design and Oper- ating Conditions," Combustion Science and Technology, 19, 119, 1979. 16. Moses, C.A., and Naegeli , D.W., "Fuel Property

  10. Periodic Solutions of Prescribed Energy for a Class of Hamiltonian Systems.

    DTIC Science & Technology

    1984-09-01

    near ag1+2d’ e.g. X(x) ( C, (3.6) IU(x) - U(;)I e. PIuq (;)12 + o(q) 4 K2 PLq Now for £(x) 4 C, by ($3) and (3.6), -2 V(x) - (U(x) - (1 + 2d)) - 2...H(z(t)) E constant so ’(z) - 1 implies that z(t) e D. Lastly since A 0 0, making the change of time scale t + AtI shows z is a 2irA periodic solution

  11. Outcomes of Bacteremia in Burn Patients Involved in Combat Operations Overseas

    DTIC Science & Technology

    2008-03-01

    MD, Mark S Rasnake, MD, Duane R Hospenthal, MD, PhD, FACP, Steven E Wolf, MD, FACS BACKGROUND: Burn patients constitute approximately 5% of...GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) Ressner R. A., Murray C. K., Griffith M. E., Rasnake M. S ., Hospenthal D. R., Wolf S . E...5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME( S ) AND ADDRESS(ES) United States Army Institute of Surgical

  12. Tuning Porosity of YBa2Cu3O7-delta Vicinal Films by Insertion of Y2BaCuO5 Nanoparticles (Postprint)

    DTIC Science & Technology

    2012-02-01

    Paranthaman, E. D. Specht , D. M. Kroeger, D. K. Christen, Q. He, B. Saffian, F. A. List, D. F. Lee, P. M. Martin, C. E. Klabunde, E. Hartfield, and V. K...2000. 12B. W. Kang, A. Goyal, D. R. Lee, J. E. Mathis, E. D. Specht , P. M. Martin, D. M. Kroeger, M. Paranthaman, and S. Sathyamurthy, J. Mater. Res

  13. Electron and Nuclear Spin Interactions in the Optical Spectra of Single GaAs Quantum Dots

    DTIC Science & Technology

    2001-05-28

    VOLUME 86, NUMBER 22 P H Y S I C A L R E V I E W L E T T E R S 28 MAY 2001 5 Electron and Nuclear Spin Interactions in the Optical Spectra of Single...GaAs Quantum Dots D. Gammon, Al. L. Efros, T. A. Kennedy, M. Rosen, D. S . Katzer, and D. Park Naval Research Laboratory, Washington, D.C. 20375 S . W...Brown NIST, Gaithersburg, Maryland V. L. Korenev and I. A. Merkulov A. F. Ioffe Institute, St. Petersburg, Russia (Received 18 December 2000) Fine and

  14. 47 CFR 80.205 - Bandwidths.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... frequency deviation for F3E or G3E emission is as follows: (1) 5 kHz in the 72.0-73.0 MHz, 75.4-76.0 MHz and... 12 16K0A2D 20.0 A3E 6K00A3E 8.0 A3N 2 2K66A3N 2.8 A3X 3 3K20A3X 25.0 F1B 4 280HF1B 0.3 F1B 5 300HF1B 0.5 F1B 6 16KOF1B 20.0 F1C 2K80F1C 3.0 F1D 12 16K0F1D 20.0 F2B 6 16KOF2B 20.0 F2C 7 16KOF2C 20.0 F2D...

  15. Temporal stability of parasite distribution and genetic variability values of Contracaecum osculatum sp. D and C. osculatum sp. E (Nematoda: Anisakidae) from fish of the Ross Sea (Antarctica)

    PubMed Central

    Mattiucci, Simonetta; Cipriani, Paolo; Paoletti, Michela; Nardi, Valentina; Santoro, Mario; Bellisario, Bruno; Nascetti, Giuseppe

    2015-01-01

    The Ross Sea, Eastern Antarctica, is considered a “pristine ecosystem” and a biodiversity “hotspot” scarcely impacted by humans. The sibling species Contracaecum osculatum sp. D and C. osculatum sp. E are anisakid parasites embedded in the natural Antarctic marine ecosystem. Aims of this study were to: identify the larvae of C. osculatum (s.l.) recovered in fish hosts during the XXVII Italian Expedition to Antarctica (2011–2012); perform a comparative analysis of the contemporary parasitic load and genetic variability estimates of C. osculatum sp. D and C. osculatum sp. E with respect to samples collected during the expedition of 1993–1994; to provide ecological data on these parasites. 200 fish specimens (Chionodraco hamatus, Trematomus bernacchii, Trematomus hansoni, Trematomus newnesi) were analysed for Contracaecum sp. larvae, identified at species level by allozyme diagnostic markers and sequences analysis of the mtDNA cox2 gene. Statistically significant differences were found between the occurrence of C. osculatum sp. D and C. osculatum sp. E in different fish species. C. osculatum sp. E was more prevalent in T. bernacchii; while, a higher percentage of C. osculatum sp. D occurred in Ch. hamatus and T. hansoni. The two species also showed differences in the host infection site: C. osculatum sp. D showed higher percentage of infection in the fish liver. High genetic variability values at both nuclear and mitochondrial level were found in the two species in both sampling periods. The parasitic infection levels by C. osculatum sp. D and sp. E and their estimates of genetic variability showed no statistically significant variation over a temporal scale (2012 versus 1994). This suggests that the low habitat disturbance of the Antarctic region permits the maintenance of stable ecosystem trophic webs, which contributes to the maintenance of a large populations of anisakid nematodes with high genetic variability. PMID:26767164

  16. Laboratory diagnosis of von Willebrand disease type 1/2E (2A subtype IIE), type 1 Vicenza and mild type 1 caused by mutations in the D3, D4, B1-B3 and C1-C2 domains of the von Willebrand factor gene. Role of von Willebrand factor multimers and the von Willebrand factor propeptide/antigen ratio.

    PubMed

    Gadisseur, Alain; Berneman, Zwi; Schroyens, Wilfried; Michiels, Jan Jacques

    2009-01-01

    Autosomal dominant von Willebrand disease (VWD) type 1/2E is a quantitative/qualitative defect in the von Willebrand factor (VWF) caused by heterozygous cysteine and non-cysteine mutations in the D3 domain of the VWF gene and results in a secretion-multimerization-clearance defect in mutant VWF with the loss of large VWF multimers not due to proteolysis. The multimers of patients with dominant VWD type 1/2E due to mutations in the D3 domain show an aberrant triplet structure with lack of outer bands but with pronounced inner bands of the triplet structure combined with a relative decrease in large multimers reflecting heterozygosity for multimerization defects. There is a good response to desmopressin (DDAVP) followed by rapid clearance of VWF:antigen (Ag), factor VIII coagulant activity (FVIII:C) and VWF:ristocetin cofactor activity (RCo) as the main cause of VWD type 1 or 2 with typical 2E multimeric pattern (VWD type 1/2E). Cysteine mutations in the D3 domains (C1130, C1149 and C1190) show pronounced features of VWD 1/2E with the relative loss of large and relative increase in small VWF multimers with abnormal triplet structure in heterozygotes. Such abnormalities are less pronounced in patients with a milder form of VWD type 1 due to non-cysteine mutations W1144G, T1156M and W1120S in the D3 domain. VWD type 1 Vicenza is caused by the R1205H mutation in the D3 domain and characterized by equally low levels of FVIII:C, VWF:Ag and VWF:RCo. The response to DDAVP in VWD Vicenza is good for FVIII:C, VWF:Ag and VWF:RCo, which is followed by a rapid clearance in less than a few hours of FVIII:C and VWF parameters. The ratios for FVIII:C/VWF:Ag, VWF:RCo/Ag and VWF:CB/Ag remain normal before and after DDAVP indicating that VWD Vicenza clearly differs from VWD type 1, 1/2E and 2M. A new set of missense mutations in D4, B1-B3 and C1-C2 domains has been discovered as the cause of a mild VWD type 1 secretion defect with normal VWF multimers or smeary VWF multimeric pattern. Cysteine mutations in exons 38, 40, 42 and 43 (D4, B1-B3 and C1 domain), show smeary patterns (either smf or sm), with the presence of large VWF multimers and a laboratory phenotype of mild VWD type 1 with variable penetrance of bleeding manifestations. Recent studies showed that the ratio of VWF propeptide (pp) to VWF:Ag can be used to predict a shorter than normal half-life for VWF:Ag. There is a strong inverse correlation between rapid clearance of VWF:Ag after DDAVP and increased VWFpp/Ag ratios >10 in VWD type 1 Vicenza, and >2 in VWD type 1/2E but normal or slightly increased (1-<2) VWFpp/Ag ratios in mild-type VWD due to nonsense or missense mutations in the D1, D2, D4, B and C domains. Copyright (c) 2009 S. Karger AG, Basel.

  17. Development of Specialized Equipment to Measure Piezoelectric Coefficients of Polymer Piezoelectric Materials,

    DTIC Science & Technology

    1980-02-22

    definition g.l = (Voc/t)(F/wt) = field/stress 2. C =KT K 1E w/t (parallel plate capacitdnce formula) ’. VL = Voc Cx’/CL for CL > Cx 4.v g/wF Kt Eoewlt...V = (g3 1 /w)F 2. V L =(Cg/c,.v oc 3. V =(Cg/CL)(g31/w)F 4. Vstd = "d3 3"/C std F 5. V L/ Vst d = (C /C ) (g ’)(C /"d " )Sg L 31 std 33 01. 6. R (in...34 and the second T " e’hicial Note No. 1 - Theory of the use of Channel Products (’DT (X() d., meteor to measure d31 direct.]y on Piezoelect.rlc Ceramic

  18. Effects of injectable vitamins A, D, E and C on the health and growth rate of feedlot cattle destined for the Australian domestic market.

    PubMed

    Cusack, P M V; McMeniman, N P; Lean, I J

    2008-03-01

    To examine the effects of injectable vitamins A, D and E at feedlot entry on health and growth rate and the effects of injectable vitamin C at the time of treatment for bovine respiratory disease (BRD) on cattle health. Systematic allocation of 2465 cattle at feedlot entry to: a commercial vitamin A, D and E preparation at the label dose rate; commercial vitamin A, D and E at twice the label dose rate; a formulation with no vitamin D, a lower concentration of vitamin A and a higher concentration of vitamin E; and the oil-based carrier alone at volumes corresponding to the above treatments. Comparisons of growth rate, disease and mortality were made between the groups at the conclusion of the feeding period. In a separate experiment, 176 cattle were alternately administered injectable vitamin C at the time of treatment for BRD, or were not injected with vitamin C, and mortality was compared between the groups. There were no differences between cattle administered vitamin A, D and E at feedlot entry and the controls in growth rate (P=0.11), all diseases (P=0.99), BRD (P=0.60) or mortalities (P=0.95). Cattle treated with the higher vitamin E and lower vitamin A preparation had a higher (P=0.02) incidence of anorexia than the other groups. Fewer cattle treated with 5 g of vitamin C by intramuscular injection at the time of treatment with antibiotics for BRD subsequently died (P=0.04). The routine injection of cattle with vitamins A, D and E at feedlot entry is unlikely to result in improvements in health and growth rate where cattle are provided with these vitamins in their diets at concentrations equal to the National Research Council recommendations. Mortality rate in cattle diagnosed with BRD may be reduced by intramuscular injection of vitamin C at the time of treatment with antibiotics.

  19. The Analysis Phase of MITHRAS.

    DTIC Science & Technology

    1986-06-23

    o •% •% • " + ". " . _.% .+. + , + •’. .’ .’ % ..’ ,’ -. • + , .... "...."....................-.. . % - . - rr.tr-e. n-.,~,.-~ w w X- C W- W, WU- I...v- 1? HLI 12 HL T ~ ~~0 a. .- - cc cc CD u 8 A DC Cj 0NJ o’u o .21 0 S cDc 00 CO LU Z. -j z4 CD - cow m 0 /~~ W "~~ ZZ~ C w Nŕ*\\ co Li. 46~ Between...electrons. 75 1,6’ S 2 - =0 N E’ 0 z CD (D z 0 D E C E -z 2 ZO -U.1’ C4 Euc CD o LJo E

  20. Lipid metabolites with free-radical scavenging activity from Euphorbia helioscopia L.

    PubMed

    Cateni, F; Zilic, J; Altieri, T; Zacchigna, M; Procida, G; Gaggeri, R; Rossi, D; Collina, S

    2014-07-01

    The methanolic extract of the plant Euphorbia helioscopia L. exhibited an interesting free-radical scavenging activity. From the aerial parts of Euphorbia helioscopia L. (Euphorbiaceae), a complex mixture of seven cerebrosides together with glucoclionasterol, a digalactosyldiacylglycerol and a diacylmonogalactosylglycerol were identified. The structures of the cerebrosides were characterized as 1-O-β-D-glucosides of phytosphingosines, which comprised (2S, 3S, 4E, 8E)-2-amino-4(E),8(E)-octadecadiene-1,3-diol, (2S, 3S, 4E, 8Z)-2-amino-4(E),8(Z)-octadecadiene-1,3-diol, (2S, 3S, 4R, 8Z)-2-amino-8(Z)-octadecene-1,3,4-triol as long chain bases with seven 2-hydroxy fatty acids of varying chain lengths (C16, C24:1, C26:1, C24, C26, C28:1) linked to the amino group. The glycosylglycerides were characterized as (2S)-2,3-O-di-(9,12,15-octadecatrienoyl)-glyceryl-6-O-(α-D-galactopyranosyl)-β-D-galactopyranoside and (2S)-2,3-O-di-(9,12,15-octadecatrienoyl)-glyceryl-1-O-β-D-galactopyranoside. The structures were established on the basis of spectroscopic data and chemical reactions. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  1. Absorption Analysis Applied to Neutrons in a Thermal Column

    DTIC Science & Technology

    1960-11-01

    determined experimentally, 4’ . can be obtained from the inverse transform of A(B). The desired quantity, f (E) , is then obtained by use of Eq. (7); f(E-dE...where a and d were found to be 16. 76 and 0. 0256, respectively. This transform is also found in Table 1. The inverse transform of Eq. (20) is 2:d-e...yielded this fit was [b F-b fx -ax] T(x)--.e 1.1 Equation 1. 1 yielded the inverse transform , Ŕ when (I-a)(0 S(71) =, b e[b4c- c(2-a)- 4(Z-a)] 1.2 e

  2. Jupiter

    NASA Astrophysics Data System (ADS)

    Bagenal, Fran; Dowling, Timothy E.; McKinnon, William B.

    2007-03-01

    Preface; 1. Introduction F. Bagenal, T. E. Dowling and W. B. McKinnon; 2. The origin of Jupiter J. I. Lunine, A. Corandini, D. Gautier, T. C. Owen and G. Wuchterl; 3. The interior of Jupiter T. Guillot, D. J. Stevenson, W. B. Hubbard and D. Saumon; 4. The composition of the atmosphere of Jupiter F. W. Taylor, S. K. Atreya, Th. Encrenaz, D. M. Hunten, P. G. J. Irwin and T. C. Owen; 5. Jovian clouds and haze R. A. West, K. H. Baines, A. J. Friedson, D. Banfield, B. Ragent and F. W. Taylor; 6. Dynamics of Jupiter's atmosphere A. P. Ingersoll, T. E. Dowling, P. J. Gierasch, G. S. Orton, P. L. Read, A. Sánchez-Lavega, A. P. Showman, A. A. Simon-Miller and A. R. Vasavada; 7. The stratosphere of Jupiter J. I. Moses, T. Fouchet, R. V. Yelle, A. J. Friedson, G. S. Orton, B. Bézard, P. Drossart, G. R. Gladstone, T. Kostiuk and T. A. Livengood; 8. Lessons from Shoemaker-Levy 9 about Jupiter and planetary impacts J. Harrington, I. de Pater, S. H. Brecht, D. Deming, V. Meadows, K. Zahnle and P. D. Nicholson; 9. Jupiter's thermosphere and ionosphere R. V. Yelle and S. Miller; 10. Jovian dust: streams, clouds and rings H. Krüger, M. Horányi, A. V. Krivov and A. L. Graps; 11. Jupiter's ring-moon system J. A. Burns, D. P. Simonelli, M. R. Showalter, D. P. Hamilton, C. C. Porco, H. Throop and L. W. Esposito; 12. Jupiter's outer satellites and trojans D. C. Jewitt, S. Sheppard and C. Porco; 13. Interior composition, structure and dynamics of the Galilean satellites G. Schubert, J. D. Anderson, T. Spohn and W. B. McKinnon; 14. The lithosphere and surface of Io A. S. McEwen, L. P. Keszthelyi, R. Lopes, P. M. Schenk and J. R. Spencer; 15. Geology of Europa R. Greeley, C. F. Chyba, J. W. Head III, T. B. McCord, W. B. McKinnon, R. T. Pappalardo and P. Figueredo; 16. Geology of Ganymede R. T. Pappalardo, G. C. Collins, J. W. Head III, P. Helfenstein, T. B. McCord, J. M. Moore, L. M. Procktor, P. M. Shenk and J. R. Spencer; 17. Callisto J. M. Moore, C. R. Chapman. E. B. Bierhaus, R. Greeley, F. C. Chuang, J. Klemaszewski, R. N. Clark, J. B. Dalton, C. A. Hibbitts, P. M. Schenk, J. R. Spencer and R. Wagner; 18. Ages and interiors: the cratering record of the Galilean satellites P. M. Schenk, C. R. Chapman, K. Zahnle and J. M. Moore; 19. Satellite atmospheres M. A. McGrath, E. Lellouch, D. F. Strobel, P. D. Feldman and R. E. Johnson; 20. Radiation effects on the surfaces of the Galilean satellites R. E. Johnson, R. W. Carlson, J. F. Cooper, C. Paranicas, M. H. Moore and M. C. Wong; 21. Magnetospheric interactions with satellites M. G. Kivelson, F. Bagenal, W. S. Kurth, F. M. Neubauer, C. Paranicas and J. Saur; 22. Plasma interactions of Io with its plasma torus J. Saur, F. M. Neubauer, J. E. P. Connerney, P. Zarka and M. G. Kivelson; 23. The Io neutral clouds and plasma torus N. Thomas, F. Bagenal, T. W. Hill and J. K. Wilson; 24. The configuration of Jupiter's magnetosphere K. K. Khurana, M. G. Kivelson, V. M. Vasyliunas, N. Krupp, J. Woch, A. Lagg, B. H. Mauk and W. S. Kurth; 25. Dynamics of the Jovian magnetosphere N. Krupp, V. M. Vasyliunas, J. Woch, A. Lagg, K. K. Khurana, M. G. Kivelson, B. H. Mauk, E. C. Roelof, D. J. Williams, S. M. Krimigis, W. S. Kurth, L. A. Frank and W. R. Paterson; 26. Jupiter's Aurora J. T. Clarke, D. Grodent, S. W. H. Cowley, E. J. Bunce, P. Zarka, J. E. P. Connerney and T. Satoh; 27. Jupiter's inner radiation belts S. J. Bolton, R. M. Thorne, S. Bourdarie, I. de Pater and B. Mauk; Appendix 1. Maps and spectra of Jupiter and the Galilean satellites J. R. Spencer, R. W. Carlson, T. L. Becker and J. S. Blue; Appendix 2. Planetary parameters J. W. Weiss; Index.

  3. Bases for qudits from a nonstandard approach to SU(2)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kibler, M. R., E-mail: kibler@ipnl.in2p3.fr

    2011-06-15

    Bases of finite-dimensional Hilbert spaces (in dimension d) of relevance for quantum information and quantum computation are constructed from angular momentum theory and su(2) Lie algebraic methods. We report on a formula for deriving in one step the (1 + p)p qupits (i.e., qudits with d = p a prime integer) of a complete set of 1 + p mutually unbiased bases in C{sup p}. Repeated application of the formula can be used for generating mutually unbiased bases in C{sup d} with d = p{sup e} (e {>=} 2) a power of a prime integer. A connection between mutually unbiasedmore » bases and the unitary group SU(d) is briefly discussed in the case d = p{sup e}.« less

  4. 29 CFR 2203.2 - Definitions.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... procedure means the simplified procedures described at 5 U.S.C. 552b(d)(4) for announcing and closing...: (a) The deliberations required or permitted under §§ 2203.4(d) and 2203.5, e.g., a discussion of... include matters that are the responsibility of the Commission's Chairman. See, e.g., 29 U.S.C. 661(e...

  5. Effects of postexsanguination vascular infusion of cattle with a solution of saccharides, sodium chloride, phosphates, and vitamins C, E, or C+E on meat display-color stability.

    PubMed

    Yancey, E J; Hunt, M C; Dikeman, M E; Addis, P B; Katsanidis, E

    2001-10-01

    Grain-finished, high-percentage Charolais steers (n = 36) were selected for uniformity. Immediately after jugular vein exsanguination, 27 steers were infused at 10% of live weight via the carotid artery with a solution developed by MPSC, Inc. (St. Paul, MN) consisting of 98.52% water, 0.97% saccharides, 0.23% sodium chloride, and 0.28% phosphate blend plus either 500 ppm vitamin C (MPSC+C; n = 9), 500 ppm vitamin E (MPSC+E; n = 9), or 500 ppm vitamin C + 500 ppm vitamin E (MPSC+C+E; n = 9). Uninfused controls (CON) were exsanguinated conventionally. Carcasses were fabricated at 48 h postmortem. Longissimus thoracis (LT), psoas major (PM), and semimembranosus (SM) muscles were removed, vacuum-packaged, and stored at 2 degrees C until 14 d postmortem. Then, steaks 2.54 cm thick were sliced from the three muscles, placed on foam trays, and overwrapped with polyvinyl chloride film. Ground beef (GB) was formulated from the quadriceps femoris to contain 20% fat, mounded into 0.45-kg portions, placed on styrofoam trays, and wrapped with polyvinyl chloride film. Steaks were visually evaluated for uniformity and initial color on display d 0. Instrumental color measurements of L*, a*, b* and trained sensory panel color evaluations were obtained daily for 4 d (PM and GB) or 5 d (LT and SM) of display. No display time x treatment interaction existed for L*, a*, or b* values. The LT from CON cattle had more uniform color (P < 0.05) and was more cherry red than that from all infused cattle on d 0. Visual scores indicated that GB from MPSC+E cattle was more red (P < 0.05) than that from MPSC+C infused cattle throughout display, and GB from MPSC+E cattle was more red (P < 0.05) than that from CON cattle for the last 3 d of display. The vascular infusion solutions generally did not improve color or display-color stability of steaks, but the infusion solution with vitamin E did improve display-color stability of GB.

  6. Anti-D auto-immunization in a patient with weak D type 4.0.

    PubMed

    Ouchari, M; Chakroun, T; Abdelkefi, S; Romdhane, H; Houissa, B; Jemni Yacoub, S

    2014-03-01

    We report the case of a 56-year-old patient with blood group O+C-c+E-e+K-, followed for a myelodysplasic syndrome and treated by regular pheno-identical and compatible (RBCs) transfusion since December 2007. In June 2009, a positive crossmatch was found with 2 RBCs O+C-c+E-e+K-. A positive anti-body screening with a positive autocontrol was detected and anti-D was unidentified in the patient's serum. The DAT was positive (IgG) and elution identified an anti-D. The following assumptions were then made: it could be a partial D phenotype with anti-D alloantibodies or RH: 1 phenotype with an anti-D auto-antibodies. Molecular analysis by multiplex PCR and sequencing have depisted a weak D type 4.0 phenotype. In October 2009, over three months of RH:-1 RBC transfusion, the antibody screening and DAT (IgG) remained positive, and an eluate made from the patient's erythrocytes contained an anti-D. All these funding confirmed the autoimmune nature of the anti-D. This case report illustrates the importance of a well-conducted and immunohematological laboratories test in order to distinguish between auto- or allo-immune of anti-D in a RH: 1 poly-transfused patients. This distinction is of great importance for transfusion support. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  7. Bond Dissociation Energies of Tungsten Molecules: WC, WSi, WS, WSe, and WCl.

    PubMed

    Sevy, Andrew; Huffaker, Robert F; Morse, Michael D

    2017-12-14

    Resonant two-photon ionization spectroscopy was used to locate predissociation thresholds in WC, WSi, WS, WSe, and WCl, allowing bond dissociation energies to be measured for these species. Because of the high degree of vibronic congestion in the observed spectra, it is thought that the molecules dissociate as soon as the lowest separated atom limit is exceeded. From the observed predissociation thresholds, dissociation energies are assigned as D 0 (WC) = 5.289(8) eV, D 0 (WSi) = 3.103(10) eV, D 0 (WS) = 4.935(3) eV, D 0 (WSe) = 4.333(6) eV, and D 0 (WCl) = 3.818(6) eV. These results are combined with other data to obtain the ionization energy IE(WC) = 8.39(9) eV and the anionic bond dissociation energies of D 0 (W-C - ) = 6.181(17) eV, D 0 (W - -C) = 7.363(19) eV, D 0 (W-Si - ) ≤ 3.44(4) eV, and D 0 (W - -Si) ≤ 4.01(4) eV. Combination of the D 0 (WX) values with atomic enthalpies of formation also provides Δ f H 0K ° values for the gaseous WX molecules. Computational results are also provided, which shed some light on the electronic structure of these molecules.

  8. 75 FR 51083 - Office of Clinical and Preventive Services Maternal and Child Health Program: Project Choices...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-18

    ... defined by 25 U.S.C. 1603(d); A Tribal organization as defined by 25 U.S.C. 1603(e); or an Urban Indian.... 25 U.S.C. 1603(d). Tribal organization means the elected governing body or any legally established.... 1603(e). [[Page 51085

  9. 40 CFR 437.47 - Pretreatment standards for new sources (PSNS).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... subparts A, B, or C of this part may be subject to Multiple Wastestream Subcategory pretreatment standards representing the application of PSNS set forth in paragraphs (b), (c), (d), or (e) of this section if the... Multiple Wastestream Subcategory standards set forth in paragraphs (b), (c), (d) or (e) of this section; (2...

  10. 40 CFR 437.46 - Pretreatment standards for existing sources (PSES)

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... from subparts A, B, or C of this part may be subject to Multiple Wastestream Subcategory pretreatment standards representing the application of PSES set forth in paragraphs (b), (c), (d), or (e) of this section... applicable Multiple Wastestream Subcategory standards set forth in paragraphs (b), (c), (d) or (e) of this...

  11. Prime Contract Awards Alphabetically by Contractor, By State or Country, and Place, FY 84. Part 10. (Southern Ambulance Builders - Tucci & Sons, Inc).

    DTIC Science & Technology

    1984-01-01

    9- - 0 C) N’(Y C) 0 - 0) ) C~l00) 0 C) (MCDN Co) -’C’) N, () CmIf U)N c) U ) C) C) 1700D- -’ --- -U -N to) 00 WI . (Di 4- L) I .0 0atoc iD~la 0 0...Y00 E700 ITo ITO o ITOO ITO rTO IT I IO CL-I , - - - - - - .-- - - - - E . . . . . . .0>. M. 2y . * cmIf

  12. Corrosion-Control (CC) Program: Pilot Powder Coating Station Service Test.

    DTIC Science & Technology

    1986-03-14

    o CL oU C4 CL00 z ;,S Go 0 m~ CL - C9 uj4 U..~D o . ZC.F Go zz 2 0 I- - c t < m U, cc V V4 cg c ~ D GD...Spray Booth# Curing Oven and A2-58 UNIT TOTAL is_18 A2-1 1WOW - o 0 -1 Q S re. 10 U c Z. 2E E. a.E 8 tE 20 4AU ==- %A a 4 $AO - Lo 48 0 w 0 -IL .. 0.... 0...Laa 00 3-r Q’ IA E zo 0..0 -< 4o C a) Ia - o x c bi. l c *4 ’a a~~* coLo. 0V Ua- 41 w - a V 2 2 .8 h A a U to bo co i ac

  13. A Population Pharmacokinetic Modeling Approach Shows that Serum Penicillin G Concentrations Are Below Inhibitory Concentrations by Two Weeks after Benzathine Penicillin G Injection in the Majority of Young Adults

    DTIC Science & Technology

    2014-11-01

    H , El-Kholy AG, Madkour AA, Kaplan EL. 1996. Rheumatic fever prophylaxis using benzathine...by N A V A L H E A LT H R E S E A R C H C T R http://aac.asm .org/ D ow nloaded from received in the study. On day 1, which was sample 1, we...2015 by N A V A L H E A LT H R E S E A R C H C T R http://aac.asm .org/ D ow nloaded from mean of 0.006 g/ml for the other subjects.

  14. 78 FR 33605 - Process for a Designated Contract Market or Swap Execution Facility To Make a Swap Available to...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-04

    ... 37.10(c) and 38.12(c)--Applicability D. Sections 37.10(d) and 38.12(d)--Removal E. Annual Review F... 17 CFR 40.5(e), 40.6(c)(3). Upon the Commission approving a SEF's or DCM's available-to-trade... adequate pricing data'' of a subject swap. \\18\\ WMBAA Comment Letter at 2; MarketAxess Comment Letter at 9...

  15. Aircraft Landing Dynamic Analysis. Volume 1. Equations of Motion

    DTIC Science & Technology

    1987-11-09

    aQh Xp* (WB 1I H 3 Hh pg esd r f, d X, r B dIp ~ b X aH Hf (a, B + b B 3 b) + F d el 1N + b 60 The fB 2 equation is fBEB N G B f2B (M )CS a 1, N ] B...1 a a TBB (A s a’ Ga 3bg a=I a ah a C + F Hb ( B/eB ) B d 6be d H c + e TBg C l e H e 3 Hh Pg esdr x f ?Hd (a r + b XBr) 8 s ) H 3 f TB 1 b VB BY + g...nondecreasing on [a,b] then f is g integrable on [a,b] (Reference (3)). This is denoted by Jb f dg. In the special case where g = I (the identity

  16. Rio Grande Floodway, Truth or Consequences Unit, NM, Cuchillo Negro Dam Foundation Report. Volume 3. Appendix E, Appendix F and Appendix G

    DTIC Science & Technology

    1992-12-01

    8217. *Ck 0D ac X -i c4w 0 uC Lii c cn’L S a r ’ILL sit5 I-3C E-273 - U ) a U cr- LC3 : M ’Ai a. C. 1. LU41 L. L L 0 -4 D k -1 0 .9 p PL 4 410[Ciu E-274...731r W - -422.8 408;2" P62 :IP D"- 8UN 2006.50 255,000 310.000 fl -- ___919.3 1134.3 1379.0 ’eased an aWDox=mat 1.5 to 1 salary Factor 3/4-4-1/2 112.00

  17. TacSat-4 COMMx, Advanced SATCOM Experiment

    DTIC Science & Technology

    2009-01-01

    Schein, M. T. Marley, C. T. Apland, R. E. Lee, B. D . Williams, E. D . Schaefer, S. R. Vernon, P . D . Schwartz , B. L. Kantsiper, E. J. Finnegan;The...Lee, B. D . Williams, E. D . Schaefer, P . D . Schwartz, R. Denissen, B. Kantsiper, E. J. Finnegan; The Johns Hopkins University Applied Physics...Mission Ops Lead, NRL Code 8233 Bob Kuzma, TacSat-4 Payload Controller, NRL Code 8242 Bob Skalitzky, TacSat-4 Power Systems, NRL Code 8244 Doug Bentz

  18. Absolute branching fraction measurements of exclusive D+ semileptonic decays.

    PubMed

    Huang, G S; Miller, D H; Pavlunin, V; Sanghi, B; Shipsey, I P J; Adams, G S; Chasse, M; Cravey, M; Cummings, J P; Danko, I; Napolitano, J; He, Q; Muramatsu, H; Park, C S; Park, W; Thorndike, E H; Coan, T E; Gao, Y S; Liu, F; Artuso, M; Boulahouache, C; Blusk, S; Butt, J; Dambasuren, E; Dorjkhaidav, O; Li, J; Menaa, N; Mountain, R; Nandakumar, R; Randrianarivony, K; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Csorna, S E; Bonvicini, G; Cinabro, D; Dubrovin, M; Briere, R A; Chen, G P; Chen, J; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Rosner, J L; Adam, N E; Alexander, J P; Berkelman, K; Cassel, D G; Crede, V; Duboscq, J E; Ecklund, K M; Ehrlich, R; Fields, L; Gibbons, L; Gittelman, B; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Hsu, L; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Meyer, T O; Onyisi, P U E; Patterson, J R; Peterson, D; Phillips, E A; Pivarski, J; Riley, D; Ryd, A; Sadoff, A J; Schwarthoff, H; Shi, X; Shepherd, M R; Stroiney, S; Sun, W M; Urner, D; Weaver, K M; Wilksen, T; Weinberger, M; Athar, S B; Avery, P; Breva-Newell, L; Patel, R; Potlia, V; Stoeck, H; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Gollin, G D; Karliner, I; Kim, D; Lowrey, N; Naik, P; Sedlack, C; Selen, M; Williams, J; Wiss, J; Edwards, K W; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Gong, D T; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Li, S Z; Poling, R; Scott, A W; Smith, A; Dobbs, S; Metreveli, Z; Seth, K K; Tomaradze, A; Zweber, P; Ernst, J; Mahmood, A H; Severini, H; Asner, D M; Dytman, S A; Love, W; Mehrabyan, S; Mueller, J A; Savinov, V; Li, Z; Lopez, A; Mendez, H; Ramirez, J

    2005-10-28

    Using data collected at the psi(3770) resonance with the CLEO-c detector at the Cornell e+e- storage ring, we present improved measurements of the absolute branching fractions of D+decays to K0e+ve, pi0e+ve, K*0e+ve, and p0e+ve, and the first observation and absolute branching fraction measurement of D+ --> omega e+ve. We also report the most precise tests to date of isospin invariance in semileptonic D0 and D+ decays.

  19. Digit ratio (2D:4D) and salivary testosterone, oestradiol and cortisol levels under challenge: Evidence for prenatal effects on adult endocrine responses.

    PubMed

    Crewther, Blair; Cook, Christian; Kilduff, Liam; Manning, John

    2015-08-01

    Digit ratio (2D:4D) is a marker for prenatal sex steroids and a correlate of sporting performance. This association may exist because low 2D:4D is linked to high prenatal levels of testosterone (T) and low oestrogens (E). It was recently suggested that low 2D:4D, and particularly low right-left 2D:4D (or Dr-l), is a marker for T changes in response to physical and aggressive challenges. If correct, this link may in part explain the association between 2D:4D and sports performance. We tested this hypothesis in adults. Three experimental treatments were completed using a randomised, cross-over design; (i) cycle sprints plus an aggressive video (S+V), (ii) aggressive video plus cycle sprints (V+S), and (iii) a control session. 24 healthy adults (12 men and 12 women). Salivary T, oestradiol (E2) and cortisol (C) levels were measured on six occasions across each session and pooled for analysis. The S+V treatment was associated with a rise in T and C levels, and Dr-l was significantly and negatively correlated with T and E2 with these effects confined to men. The right 2D:4D and Dr-l were also negatively correlated with the T/C ratio and Dr-l negatively related to the E2/C ratio in men during the S+V treatment. We suggest that the hormonal responses to a challenge are programmed by prenatal levels of T and E with possible links to sporting performance in adulthood. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  20. Rhenium in homogeneous catalysis: [ReBrH(NO)(labile ligand)(large-bite-angle diphosphine)] complexes as highly active catalysts in olefin hydrogenations.

    PubMed

    Dudle, Balz; Rajesh, Kunjanpillai; Blacque, Olivier; Berke, Heinz

    2011-06-01

    The reaction of [ReBr(2)(MeCN)(NO)(P∩P)] (P∩P = 1,1'-bisdiphenylphosphinoferrocene (dppfc) (1a), 1,1'-bisdiisopropylphosphinopherrocene (diprpfc) (1b), 2,2'-bis(diphenylphosphino)diphenyl ether (dpephos) (1c), 10,11-dihydro-4,5-bis(diphenylphosphino)dibenzo[b,f]oxepine (homoxantphos) (1d) and 4,6-bis(diphenylphosphino)-10,10-dimethylphenoxasilin (Sixantphos) (1e)) led in the presence of HSiEt(3) and ethylene to formation of the ethylene hydride complexes [ReBrH(η(2)-C(2)H(4))(NO)(P∩P)] (3a,b,d), the MeCN ethyl complex [ReBr(Et)(MeCN)(NO)(dpephos)] (5c) and two ortho-metalated stereoisomers of [ReBr(η(2)-C(2)H(4))(NO)(η(3)-o-C(6)H(4)-Sixantphos)] 8e(up) and 8e(down). The complexes 3a,b,d, and 5c and the isomers of 8e showed high catalytic activity (TOFs ranging from 22 to 4870 h(-1), TONs up to 24000) in the hydrogenation of monosubstituted olefins. For 8e(down) and 8e(up) a remarkable functional group tolerance and catalyst stability were noticed. Kinetic experiments revealed k(obs) to be first order in c(cat) and c(H(2)) and zeroth order in c(olefin). Mechanistic studies and DFT calculations suggest the catalysis to proceed along an Osborn-type catalytic cycle with olefin before H(2) addition. The unsaturated key intermediates [ReBrH(NO)(P∩P)] (2a-e) could be intercepted with MeCN as [ReBrH(MeCN)(NO)(P∩P)] (10a-d) complexes or isolated as dimeric μ(2)-(H)(2) complexes [{ReBr(μ(2)-H)(NO)(P∩P)}(2)] (9b and 9e). Variation of the bidentate ligand demonstrated a crucial influence of the (large)-bite-angle on the catalytic performance and reactivity of 3a,b,d, 5c, and 8e. © 2011 American Chemical Society

  1. NRL Plasma Formulary

    DTIC Science & Technology

    2007-01-01

    1215 Jefferson Davis Highway, Suite 1204, Arlington VA 22202-4302. Respondents should be aware that notwithstanding any other provision of law , no...β/α3 (h̄c)−1 Resistance 4πǫ0/α (ǫ0/µ0) 1/2 Time 1 c Velocity α c−1 18 MAXWELL’S EQUATIONS Name or Description SI Gaussian Faraday’s law ∇ × E = −∂B...t ∇ × E = − 1 c ∂B ∂t Ampere’s law ∇ × H = ∂D ∂t + J ∇ × H = 1 c ∂D ∂t + 4π c J Poisson equation ∇ · D = ρ ∇ · D = 4πρ [Absence of magnetic ∇ · B = 0

  2. NRL: Plasma Formulary

    DTIC Science & Technology

    2004-12-01

    Jefferson Davis Highway, Suite 1204, Arlington VA 22202-4302. Respondents should be aware that notwithstanding any other provision of law , no person...Pressure β/α3 (h̄c)−1 Resistance 4π0/α (0/µ0) 1/2 Time 1 c Velocity α c−1 19 MAXWELL’S EQUATIONS Name or Description SI Gaussian Faraday’s law ∇ × E = −∂B...t ∇ × E = − 1 c ∂B ∂t Ampere’s law ∇ × H = ∂D ∂t + J ∇ × H = 1 c ∂D ∂t + 4π c J Poisson equation ∇ · D = ρ ∇ · D = 4πρ [Absence of magnetic ∇ · B = 0

  3. Taking Proof based Verified Computation a Few Steps Closer to Practicality (extended version)

    DTIC Science & Technology

    2012-06-27

    general s2 + s, in general V’s per-instance CPU costs Issue commit queries (e + 2c) · n/β (e + 2c) · n/β Process commit responses d d Issue PCP...size (# of instances) (§2.3) e: cost of encrypting an element in F d : cost of decrypting an encrypted element f : cost of multiplying in F h: cost of...domain D (such as the integers, Z, or the rationals, Q) to equivalent constraints over a finite field, the programmer or compiler performs 3We suspect

  4. Assessment/Review of Methanol Technology and Utilization as a Fuel.

    DTIC Science & Technology

    1982-07-01

    1981. 32. Owens, E.C., Naegeli , D.W., "Use of Low Molecular Weight Alcohols as Diesel Fuel Extenders (Proposal)," U.S. Army Fuels and Lubricants...34Potential Funding of R&D on Use of Alcohol as Aircraft Fuel," February 4, 1981. 38. Naegeli , D.W., "Dissociated Methanol as an Engine Fuel," Southwest...825-828, 1974. 41. Marbach, H.W., Jr., Owens, E.C., Ryan, T.W., Frame, E.A., Naegeli , D.W., "Evaluation of the effects of Alcohol Fuels on Spark

  5. 40 CFR 721.72 - Hazard communication program.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... irritation. (ii) Respiratory complications. (iii) Central nervous system effects. (iv) Internal organ effects... irritation (B) Respiratory complications (C) Central nervous system effects (D) Internal organ effects (E... irritation (B) Respiratory complications (C) Central nervous system effects (D) Internal organ effects (E...

  6. 40 CFR 721.72 - Hazard communication program.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... irritation. (ii) Respiratory complications. (iii) Central nervous system effects. (iv) Internal organ effects... irritation (B) Respiratory complications (C) Central nervous system effects (D) Internal organ effects (E... irritation (B) Respiratory complications (C) Central nervous system effects (D) Internal organ effects (E...

  7. 40 CFR 721.72 - Hazard communication program.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... irritation. (ii) Respiratory complications. (iii) Central nervous system effects. (iv) Internal organ effects... irritation (B) Respiratory complications (C) Central nervous system effects (D) Internal organ effects (E... irritation (B) Respiratory complications (C) Central nervous system effects (D) Internal organ effects (E...

  8. 40 CFR 721.72 - Hazard communication program.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... irritation. (ii) Respiratory complications. (iii) Central nervous system effects. (iv) Internal organ effects... irritation (B) Respiratory complications (C) Central nervous system effects (D) Internal organ effects (E... irritation (B) Respiratory complications (C) Central nervous system effects (D) Internal organ effects (E...

  9. 40 CFR 721.72 - Hazard communication program.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... irritation. (ii) Respiratory complications. (iii) Central nervous system effects. (iv) Internal organ effects... irritation (B) Respiratory complications (C) Central nervous system effects (D) Internal organ effects (E... irritation (B) Respiratory complications (C) Central nervous system effects (D) Internal organ effects (E...

  10. The Earth’s Radiation Belts.

    DTIC Science & Technology

    1983-09-20

    on -- 1d. It --- . d id-er, c S, blck -.o~b.1) ’Trapped radiation Steady-state miodels Adiabatic invariants Empirical flux models Diffusion equations...Shell -splitting, Transport theory Nuclear detonations Wave-oarticle interactions Effects on microelectronics 20 ABSTRACT ( C -0- n OR e -~ d . It -~e-lay...olo -i t i os5 at 500 ke\\% live lrtI’m i s pt, eOI iS .1: litv, ,Ie It if 5)ht* stIweo f iul-’t, wi te thle hie av itk, i il - il v t’il 1 Ltt sI c a

  11. 77 FR 34208 - Amendment of Class D and Class E Airspace; Leesburg, FL

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-11

    ... amends Class D and Class E airspace at Leesburg, FL, changing the airport's name to Leesburg... and public procedures under 5 U.S.C. 553(b) are unnecessary. The Class D airspace, Class E surface...-0445; Airspace Docket No. 12-ASO-27] Amendment of Class D and Class E Airspace; Leesburg, FL AGENCY...

  12. Production of CN (A2pi i) in the Photolysis of Acetonitrile at 158 nm.

    DTIC Science & Technology

    1985-09-30

    Publication in Chemical Physics Letters Laser Chemistry Division Department of Chemistry Howard University Washington, D. C. 20059 September 30, 1985...4o. 1 1 m HOWARD UNIVERSITY WASHINGTON. D.C. 20059 DEPARTMENT OF CHEMIST Uf’, 0 IAn - U, -E o𔃾 -I~; - " -- w °j"" = 0-- m U, - z fdm !8d k- p;7 I ×0...E. Walrafen Department of Chemistry Department of Chemistry Colorado State University Howard University Fort Collins, Colorado 80521 Washington, D.C

  13. Systematic Constraint Selection Strategy for Rate-Controlled Constrained-Equilibrium Modeling of Complex Nonequilibrium Chemical Kinetics

    NASA Astrophysics Data System (ADS)

    Beretta, Gian Paolo; Rivadossi, Luca; Janbozorgi, Mohammad

    2018-04-01

    Rate-Controlled Constrained-Equilibrium (RCCE) modeling of complex chemical kinetics provides acceptable accuracies with much fewer differential equations than for the fully Detailed Kinetic Model (DKM). Since its introduction by James C. Keck, a drawback of the RCCE scheme has been the absence of an automatable, systematic procedure to identify the constraints that most effectively warrant a desired level of approximation for a given range of initial, boundary, and thermodynamic conditions. An optimal constraint identification has been recently proposed. Given a DKM with S species, E elements, and R reactions, the procedure starts by running a probe DKM simulation to compute an S-vector that we call overall degree of disequilibrium (ODoD) because its scalar product with the S-vector formed by the stoichiometric coefficients of any reaction yields its degree of disequilibrium (DoD). The ODoD vector evolves in the same (S-E)-dimensional stoichiometric subspace spanned by the R stoichiometric S-vectors. Next we construct the rank-(S-E) matrix of ODoD traces obtained from the probe DKM numerical simulation and compute its singular value decomposition (SVD). By retaining only the first C largest singular values of the SVD and setting to zero all the others we obtain the best rank-C approximation of the matrix of ODoD traces whereby its columns span a C-dimensional subspace of the stoichiometric subspace. This in turn yields the best approximation of the evolution of the ODoD vector in terms of only C parameters that we call the constraint potentials. The resulting order-C RCCE approximate model reduces the number of independent differential equations related to species, mass, and energy balances from S+2 to C+E+2, with substantial computational savings when C ≪ S-E.

  14. Evaluation of Proposed U.S. Environmental Protection Agency Dredged Material Bioassays Using Great Lakes Sediments.

    DTIC Science & Technology

    1994-11-01

    U C U C U C .2 c𔄂 0 0 0 8 0 0 0 8 0 0 0 c; 0 Wu 0 I- CO w 010Apedx ltraeTet, iehae Moea Et CYC rE O6 6O 6!6o 6o 66 0. ) OD U) co Ow ol ’e cD )10v cv...ol U1 l 0 or I X I a ID X I ID ID ID I C- C% ’J CJ C. % CJ CJClJ CJ CJ ’ 𔃻 CJ C. ’ C1 2Apedx ltraeTet, iehae r0ea z CD V C!D Im 0 -~O 0 - 2 E a ~~0 0

  15. HPLC-ESI-MS/MS analysis of hemoglobin peptides in tryptic digests of dried-blood spot extracts detects HbS, HbC, HbD, HbE, HbO-Arab, and HbG-Philadelphia mutations.

    PubMed

    Haynes, Christopher A; Guerra, Stephanie L; Fontana, Jessalyn C; DeJesús, Víctor R

    2013-09-23

    Hemoglobinopathies are mutations resulting in abnormal globin chain structure; some have clinically significant outcomes such as anemia or reduced lifespan. Five β-globin mutations are (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), and (c.364G>A, p.E121K), resulting in HbS (sickle-cell hemoglobin), HbC, HbE, HbD-Los Angeles, and HbO-Arab, respectively. One α-globin mutation is (c.[207C>G or 207C>A], p.N68K), resulting in HbG-Philadelphia. HPLC-ESI-MS/MS analysis of dried-blood spot (DBS) punches from newborns extracted with a trypsin-containing solution provides greater than 90% coverage of α-, β-, and γ-globin amino acid sequences. Because the (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), (c.364G>A, p.E121K), and (c.[207C>G or 207C>A], p.N68K) mutations generate globin peptides with novel amino acid sequences, detecting one of these peptides in DBS extracts is indicative of the presence of a hemoglobinopathy in the newborn. The method described here can distinguish normal β-globin peptides from the mutant HbS, HbC, HbE, HbD-Los Angeles and HbO-Arab peptides, as well as normal α-globin peptide from the mutant HbG-Philadelphia peptide, allowing the identification of unaffected heterozygotes such as HbAS, and of compound heterozygotes such as HbASG-Philadelphia. This HPLC-ESI-MS/MS analytical approach provides information that is not available from traditional hemoglobin analyses such as isoelectric focusing and HPLC-UV. It is also capable of determining the amino acid sequence of hemoglobin peptides, potentially allowing the detection of numerous hemoglobinopathies resulting from point mutations. Published by Elsevier B.V.

  16. Benchmarking Commercial Reliability Practices.

    DTIC Science & Technology

    1995-07-01

    companies (70% of total), and to actually receive completed survey forms from 40 companies ( 60 % of participants, 40% of total identified). Reliability...E -20 -30 - A B C D E F G H I J KL MN OP Q R -40 - A = FMEA , B = FTA, C =Thermal Analysis, D = Sneak Circuit Analysis, E = Worst-Case Circuit Analysis...Failure Modes and Effects Analysis ( FMEA ), will be conducted. c. Commercial companies specify the environmental conditions for their products. In doing

  17. THE EVOLUTIONARY HISTORY OF PARTHENOGENETIC CNEMIDOPHORUS LEMNISCATUS (SAURIA, TEIIDAE). I. EVIDENCE FOR A HYBRID ORIGIN.

    PubMed

    Sites, Jack W; Peccinini-Seale, Denise M; Moritz, Craig; Wright, John W; Brown, Wesley M

    1990-07-01

    Chromosomes and allozymes were studied from chromosomally distinct unisexual (races B and C) and bisexual (races D and E) populations of the teiid lizard Cnemidophorus lemniscatus, and from selected outgroup taxa (C. murinus, C. nigricolor, Ameiva ameiva, and A. auberi). Karyotyping confirmed the racial identity of individuals and showed that the chromosomal composition of populations at specific localities has remained the same for 20 years. All individuals of both unisexual populations were heterozygous for a pericentric inversion that distinguishes D and E bisexuals. Also, the unisexuals were all heterozygous for 8 of 11 protein loci for which D and E were fixed or nearly fixed for different alleles. Most of these alleles represent derived states relative to the other Cnemidophorus and Ameiva analyzed, and the fixed heterozygote condition at these nine markers provides unequivocal support for the hypothesis that the unisexual C. lemniscatus arose by hybridization between ancestors genetically similar to extant D and E populations. At the remaining three loci for which D and E show fixed differences, the unisexuals were homozygous rather than heterozygous. This suggests that either (1) allozymes have been lost by mutations to null, silent, or convergent mobility states, (2) ancestral genotypes were similar to but not identical with the extant D and E races, and/or (3) limited recombination may occur between unisexual genomes. Allozyme-based genetic distances between D and E were large, suggesting that bisexual races D and E are genetically isolated; each race should be accorded full species status. This conclusion is supported by the absence of any clear biochemical evidence for their monophyly with respect to the other Cnemidophorus examined. Cladistic analyses of 17 phylogenetically informative loci revealed two equally parsimonious shortest trees, one supporting monophyly and the other paraphyly of the C. lemniscatus complex. Further testing of the monophyly of C. lemniscatus requires additional data. With the present study, the evidence that all parthenogenetic Cnemidophorus are of hybrid origin is complete. © 1990 The Society for the Study of Evolution.

  18. Staffing Cyber Operations (Briefing Charts)

    DTIC Science & Technology

    2015-05-01

    Ti tle 1 0 m is si on s  N o tim e to b ui ld th is re qu ire m en t i n th e P O M – R eq ui re m...o r f ro m a co or di na te d m ili ta ry o pe ra tio n of w hi ch th at a ct c on st itu te s an in te gr al p ar t  B el lig er en t...U se d C A P E F C oM To ol ; a dj us te d so m e fa ct or s  S ub st itu

  19. 75 FR 74624 - Approval and Promulgation of Implementation Plans; Georgia: Stage II Vapor Recovery

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-01

    ... public health and welfare, respectively. 75 FR 2938. Initially, EPA expected these NAAQS to become final... the fueling of motor vehicles. 42 U.S.C. 7511a(b)(3). Sections 182(c), 182(d) and 182(e) of the CAA... as well. 42 U.S.C. Sec. 7511a(c), (d), and (e). Accordingly, as a serious ozone nonattainment area...

  20. Deformations of W A,D,E SCFTs

    DOE PAGES

    Intriligator, Ken; Nardoni, Emily

    2016-09-08

    We discuss aspects of theories with superpotentials given by Arnold’s A, D, E singularities, particularly the novelties that arise when the fields are matrices. We focus on 4d N=1 variants of susy QCD, with U(N c ) or SU(N c ) gauge group, N f fundamental flavors, and adjoint matter fields X and Y appearing in W A,D,E (X, Y) superpotentials. Many of our considerations also apply in other possible contexts for matrix-variable W A,D,E . The 4d W A,D,E SQCD-type theories RG flow to superconformal field theories, and there are proposed duals in the literature for the W Ak,more » W Dk, and W E7 cases. As we review, the W Deven and W E7 duals rely on a conjectural, quantum truncation of the chiral ring. We explore these issues by considering various deformations of the W A,D,E superpotentials, and the resulting RG flows and IR theories. Rather than finding supporting evidence for the quantum truncation and W Deven and W E7 duals, we note some challenging evidence to the contrary.« less

  1. Murine Anti-vaccinia Virus D8 Antibodies Target Different Epitopes and Differ in Their Ability to Block D8 Binding to CS-E

    PubMed Central

    Matho, Michael H.; de Val, Natalia; Miller, Gregory M.; Brown, Joshua; Schlossman, Andrew; Meng, Xiangzhi; Crotty, Shane; Peters, Bjoern; Xiang, Yan; Hsieh-Wilson, Linda C.; Ward, Andrew B.; Zajonc, Dirk M.

    2014-01-01

    The IMV envelope protein D8 is an adhesion molecule and a major immunodominant antigen of vaccinia virus (VACV). Here we identified the optimal D8 ligand to be chondroitin sulfate E (CS-E). CS-E is characterized by a disaccharide moiety with two sulfated hydroxyl groups at positions 4′ and 6′ of GalNAc. To study the role of antibodies in preventing D8 adhesion to CS-E, we have used a panel of murine monoclonal antibodies, and tested their ability to compete with CS-E for D8 binding. Among four antibody specificity groups, MAbs of one group (group IV) fully abrogated CS-E binding, while MAbs of a second group (group III) displayed widely varying levels of CS-E blocking. Using EM, we identified the binding site for each antibody specificity group on D8. Recombinant D8 forms a hexameric arrangement, mediated by self-association of a small C-terminal domain of D8. We propose a model in which D8 oligomerization on the IMV would allow VACV to adhere to heterogeneous population of CS, including CS-C and potentially CS-A, while overall increasing binding efficiency to CS-E. PMID:25474621

  2. Murine anti-vaccinia virus D8 antibodies target different epitopes and differ in their ability to block D8 binding to CS-E.

    PubMed

    Matho, Michael H; de Val, Natalia; Miller, Gregory M; Brown, Joshua; Schlossman, Andrew; Meng, Xiangzhi; Crotty, Shane; Peters, Bjoern; Xiang, Yan; Hsieh-Wilson, Linda C; Ward, Andrew B; Zajonc, Dirk M

    2014-12-01

    The IMV envelope protein D8 is an adhesion molecule and a major immunodominant antigen of vaccinia virus (VACV). Here we identified the optimal D8 ligand to be chondroitin sulfate E (CS-E). CS-E is characterized by a disaccharide moiety with two sulfated hydroxyl groups at positions 4' and 6' of GalNAc. To study the role of antibodies in preventing D8 adhesion to CS-E, we have used a panel of murine monoclonal antibodies, and tested their ability to compete with CS-E for D8 binding. Among four antibody specificity groups, MAbs of one group (group IV) fully abrogated CS-E binding, while MAbs of a second group (group III) displayed widely varying levels of CS-E blocking. Using EM, we identified the binding site for each antibody specificity group on D8. Recombinant D8 forms a hexameric arrangement, mediated by self-association of a small C-terminal domain of D8. We propose a model in which D8 oligomerization on the IMV would allow VACV to adhere to heterogeneous population of CS, including CS-C and potentially CS-A, while overall increasing binding efficiency to CS-E.

  3. DOE Research and Development Accomplishments Site Index (A-Z)

    Science.gov Websites

    dropdown arrow Site Map A-Z Index Menu Synopsis A - Z Index A B C D E F G H I J K L M N O P Q R S T U V W X Buckminsterfullerene Curl Smalley Buckyball Curl Smalley TOP A B C D E F G H I J K L M N O P Q R S T U V W X Y Z C transcription Dresselhaus, Mildred (Millie) Drosophila dynamics TOP A B C D E F G H I J K L M N O P Q R S T U V

  4. Fuel Property Effects on Diesel Engine and Gas Turbine Combustor Performance.

    DTIC Science & Technology

    1981-11-01

    REPORT AFLRL No. 149 By A.F. Montemayor D.W. Naegeli -* L.G. Dodge E.C. Owens J.N. Bowden U.S. Army Fuels and Lubricants Research Laboratory Southwest...6800-120/ 1 7 AUTHOR18) S. CONTRACT ORt GRANT NUMBER(a) A.F. Vmotemeyor E. C. Owens DMA7-8O-C-0001 D. W. Naegeli J.N. Bowden DAAK70-82-C-OOO1 L.G...Acquisition Magazine, 18-20, September-October 1980. 5. Noses, C.A. and Naegeli , D.W., "Fuel Property Effects on Combustor Performance," ASME 79-GT-178

  5. An Analysis of the Max-Min Texture Measure.

    DTIC Science & Technology

    1982-01-01

    PANC 33 D2 Confusion Matrices for Scene A, IR 34 D3 Confusion Matrices for Scene B, PANC 35 D4 Confusion Matrices for Scene B, IR 36 D5 Confusion...Matrices for Scene C, PANC 37 D6 Confusion Matrices for Scene C, IR 38 D7 Confusion Matrices for Scene E, PANC 39 D8 Confusion Matrices for Scene E, IR 40...D9 Confusion Matrices for Scene H, PANC 41 DIO Confusion Matrices for Scene H, JR 42 3 .D 10CnuinMtie o cn ,IR4 AN ANALYSIS OF THE MAX-MIN TEXTURE

  6. Identification of cross-reactive proteins amongst different Curvularia species.

    PubMed

    Gupta, Ratna; Singh, Bhanu P; Sridhara, Susheela; Gaur, Shailendra N; Kumar, Raj; Chaudhary, Vijay K; Arora, Naveen

    2002-01-01

    Curvularia lunata is an important inhalant allergen. The present study was undertaken to investigate the shared IgG- and IgE-binding components among seven Curvularia species prevalent in the aerospora. Seven different Curvularia species were grown in a semisynthetic medium for 13 days. The extracts were analyzed by SDS-PAGE, immunoblot and ELISA/immunoblot inhibition using sera from C. lunata-positive patients and anti-C. lunata rabbit serum. Different Curvularia species showed 11-19 protein bands on SDS-PAGE. Proteins of 12, 20, 31, 45, 53, 78 and 97 kD were present in all the species. Eight out of 98 nasobronchial patients exhibited positive skin tests to C. lunata and to at least five Curvularia species. ELISA using these sera showed IgE binding with Curvularia species. Immunoblot using pooled anti-C. lunata sera from patients showed 5-12 allergenic proteins. Proteins of 12, 31, 45, 53 and 78 kD showed IgE binding in Curvularia species. Antibodies against C. lunata detected 6-14 antigenic proteins on immunoblot. Proteins of 31, 45 and 53 kD showed IgG binding in all the species. Proteins of 31 and 53 kD showed complete IgE/IgG binding inhibition. IgE/IgG ELISA inhibition showed dose-dependent inhibition in Curvularia species. C. lunata extract required 0.17 and 0.11 microg of protein for 50% IgE and IgG inhibition, respectively. C. clavata and C. pallescens required 10 times more protein to exhibit the same inhibition and other species required similar protein levels as those required by C. lunata. A high degree of cross-reactivity was observed between C. lunata and the six other Curvularia species tested. C. lunata and C. senegalensis shared maximum allergenic and antigenic components.

  7. Optical and Electrical Characterization of Melt-Grown Bulk Indium Gallium Arsenide and Indium Arsenic Phosphide Alloys

    DTIC Science & Technology

    2011-03-01

    order to find Eg/dT, we like to start with taking second derivatives of the absorption coefficient 53 g E EE t EEe E C dE d t g , 22 2...lower band, Nh) is closely related to the Fermi-Dirac distribution, Tk EE Ef B Fexp1 1 )( . (2.1) Here f(E) is the probability of occupying...47 ., , /)( gg g EEE EEEEA EECe tg (4.3) Here the C and A parameters are constants for a given material, for instance, A is

  8. Thalmann Algorithm Decompression Table Generation Software Design Document

    DTIC Science & Technology

    2010-09-01

    Undersea and Hyperbaric Medical Society for seawater at 4ºC.12 With this latter unrounded value...LA S TO P/ D IN C ) M IR E F = M (IR EF ,ID X ) R G I = (M IR EF – (P IN F+ 1. 0) )/N G R U M O D E ≥ 2 30 0 Y E S Le tte r g ro up : P R E F...Kensington, MD: Undersea and Hyperbaric Medical Society, 2002), pp. 118–136. 13. H. D. Van Liew, “Pressure Conversion Table,” Undersea

  9. The Greek-Turkish Rapprochement Process, 1999-2004: Paradigm Shift or Epi-phenomenon

    DTIC Science & Technology

    2004-12-01

    ke y U ni te d K in gd om T ot al N A T O E ur op e C an ad a U ni te d S ta te s T ot al N or th A m er ic a To ta l N A T O 1980 1990 2001... C . METHODOLOGY AND SOURCES...................................................... 4 D. SIGNIFICANCE...13 b. Gradual Reciprocation in Tension Reduction .......... 14 C . STATES’ COOPERATION AND

  10. Implementing the Army NetCentric Data Strategy in a ServiceOriented Environment

    DTIC Science & Technology

    2009-04-23

    D a t a D i s c o v e r y Data Retrieval Data Subscription Data Discovery D a t a A c c e s s Artifact Discovery Federated Search Data Search Data...define common interfaces to search and  retrieve data across the enterprise.  • Patterns • Search • Status • Receive – Services • Federated   Search • Artifact

  11. Thermal Properties of Mineralized and Non Mineralized Type I Collagen in Bone

    DTIC Science & Technology

    2002-04-01

    Heredial, E. Villarreal", J. Ocotldn-Flores2, A. L. Gomez-Cortes’, F. J. Aranda-Manteca 5, E. Orozco’ and L. Bucio’. lInstituto de Fisica , UNAM, Ciudad... Investigaciones en Materiales, UNAM, Ciudad Universitaria, Coyoacan. C.P. 04510. Mexico. D.F.41nstituto de Investigaciones Antropologicas, UNAM...Universitaria, Coyoacan. C.P. 01000, Mexico. D.F.2Centro de -instrumentos, UNAM, Ciudad Universitaria, Coyoacan. C.P. 04510. Mexico. D.F.3Instituto de

  12. 40 CFR 437.45 - New source performance standards (NSPS).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... to this subpart which combines treated or untreated wastes from subparts A, B, or C of this part may... NSPS set forth in paragraphs (b), (c), (d), or (e) of this section if the discharger agrees to the... Subcategory limitations set forth in paragraphs (b), (c), (d) or (e) of this section; (2) The discharger will...

  13. Impact of charged amino acid substitution in the transmembrane domain of L-alanine exporter, AlaE, of Escherichia coli on the L-alanine export.

    PubMed

    Kim, Seryoung; Ihara, Kohei; Katsube, Satoshi; Ando, Tasuke; Isogai, Emiko; Yoneyama, Hiroshi

    2017-01-01

    The Escherichia coli alaE gene encodes the L-alanine exporter, AlaE, that catalyzes active export of L-alanine using proton electrochemical potential. The transporter comprises only 149 amino acid residues and four predicted transmembrane domains (TMs), which contain three charged amino acid residues. The AlaE-deficient L-alanine non-metabolizing cells (ΔalaE cells) appeared hypersusceptible to L-alanyl-L-alanine showing a minimum inhibitory concentration (MIC) of 2.5 µg/ml for the dipeptide due to a toxic accumulation of L-alanine. To elucidate the mechanism by which AlaE exports L-alanine, we replaced charged amino acid residues in the TMs, glutamic acid-30 (TM-I), arginine-45 (TM-II), and aspartic acid-84 (TM-III) with their respective charge-conserved amino acid or a net neutral cysteine. The ΔalaE cells producing R45K or R45C appeared hypersusceptible to the dipeptide, indicating that arginine-45 is essential for AlaE activity. MIC of the dipeptide in the ΔalaE cells expressing E30D and E30C was 156 µg/ml and >10,000 µg/ml, respectively, thereby suggesting that a negative charge at this position is not essential. The ΔalaE cells expressing D84E or D84C showed an MIC >10,000 and 78 µg/ml, respectively, implying that a negative charge is required at this position. These results were generally consistent with that of the L-alanine accumulation experiments in intact cells. We therefore concluded that charged amino acid residues (R45 and D84) in the AlaE transmembrane domain play a pivotal role in L-alanine export. Replacement of three cysteine residues at C22, C28 (both in TM-I), and C135 (C-terminal region) with alanine showed only a marginal effect on L-alanine export.

  14. Optimal energy distribution of carbohydrate intake for Japanese elderly patients with type 2 diabetes: the Japanese Elderly Intervention Trial.

    PubMed

    Kamada, Chiemi; Yoshimura, Hidenori; Okumura, Ryota; Takahashi, Keiko; Iimuro, Satoshi; Ohashi, Yasuo; Araki, Atsushi; Umegaki, Hiroyuki; Sakurai, Takashi; Yoshimura, Yukio; Ito, Hideki

    2012-04-01

    In diet therapy for diabetes, optimal energy intake and the energy distribution of macronutrients (protein : fat : carbohydrate [PFC] energy ratio) are important. We aimed to clarify the correlation between the PFC energy ratio and metabolic parameters including glycated hemoglobin A1c (HbA1c) and triglycerides in Japanese elderly patients with type 2 diabetes mellitus aged 65 years or older. Participants were 1173 diabetic patients aged 65 years or older with serum HbA1c level of >/=7.4% enrolled in the Japanese Elderly Diabetes Intervention Trial (J-EDIT). The participants were divided into four groups by the percentage of total energy intake (%E) of carbohydrate (C1: less than 55%E, C2: 55%E or more and less than 60%E, C3: 60%E or more and less than 65%E, and C4: 65%E or more). Relations of %E of carbohydrate to HbA1c and other metabolic parameters, energy intake and nutritional intake were examined. Furthermore, the subjects were divided into four categories by HbA1c levels by quartile method (Q1: less than 7.90%, Q2: 7.90% or more and less than 8.30%, Q3: 8.30% or more and less than 8.80%, Q4: 8.80% or more). Relations of HbA1c to other metabolic parameters, energy intake and nutritional intake were examined. The mean HbA1c levels in the four groups were C1: 8.40%, C2: 8.50%, C3: 8.41% and C4: 8.36% in men, and C1: 8.51%, C2: 8.47%, C3: 8.35% and C4: 8.52% in women, respectively. There were no significant differences and linear trend in HbA1c levels across groups. The mean triglyceride levels were in the range of 122-128 mg/dL in men from C1 to C3, although it was significantly higher in C4 (177 mg/dL). The mean triglyceride levels were in the range of 128-136 mg/dL in women from C1 to C3, although it was significantly higher in Q4 (150 mg/dL). Amounts of protein and fat intakes decreased with an increase of %E of carbohydrate, although amount of carbohydrate intake did not change significantly. As a result, %E of protein and fat, and energy intake decreased in both men and women with an increase in %E of carbohydrate. Among the four quartiles divided by HbA1c levels, there were no significant differences in energy intake and PFC energy ratio. The present study suggests that, within the range studied, the carbohydrate energy ratio has no correlation with HbA1c levels. However, serum triglyceride levels increased and high-density lipoprotein cholesterol levels decreased significantly, with an increase of %E of carbohydrate in men, and the same tendencies were observed in women. Furthermore, in patients with 65%E or more of carbohydrate, serum triglyceride levels exceeded 150 mg/dL, which is the recommended treatment target for diabetic patients. These results suggest that the ideal %E of carbohydrate for Japanese elderly type 2 diabetes is less than 65. The lower limit of %E of carbohydrate could not be determined from the present study. © 2012 Japan Geriatrics Society.

  15. Oxidative stability and sensory and functional properties of eggs from laying hens fed supranutritional doses of vitamins E and C.

    PubMed

    Franchini, A; Sirri, F; Tallarico, N; Minelli, G; Iaffaldano, N; Meluzzi, A

    2002-11-01

    This study evaluated the effects of two dietary doses of vitamins E and C supplemented separately and together, on the content of vitamin E in the yolk, on the lipid stability of fresh and stored eggs, and on their sensory and functional properties. Hy-Line Brown hens (n = 216) received a basal diet for 8 wk supplemented with 100 or 200 mg DL-alpha-tocopheryl acetate (E100 or E200, respectively)/kg, 500 or 1,000 mg ascorbic acid (C500 and C1000, respectively)/kg, or 100 mg DL-alpha-tocopheryl acetate plus 500 mg ascorbic acid (E100+C500)/kg, whereas the control group received no supplementation. Fresh eggs and eggs stored 30,60, and 90 d at 4 C or stored 28 d at room temperature were analyzed for vitamin E content and TBA-reactive substances (TBARS). We also evaluated functional properties of fresh and cooked eggs and sensory properties of boiled and scrambled eggs. The yolk content of vitamin E depended on the level of dietary addition and decreased after 90 d of storage at 4 C or after 28 d at 25 C. Vitamin supplementation had no effect on fresh or refrigerated eggs, whereas 4 wk of storage at room temperature increased TBARS in the control and the group supplemented with the highest doses of vitamins. Ascorbic acid improved Haugh units and elasticity of albumen gels, whereas cohesiveness and hardness of yolk, albumen and whole-egg gels were not affected by dietary treatment. Panelists were not able to distinguish treated eggs from control eggs.

  16. A Study of the Jettisoning of JP-4 Fuel in the Atmosphere

    DTIC Science & Technology

    1975-11-01

    t e r m i n e d by m e a s u r i n g the s tagna t ion p r e s s u r e with a pitot probe , shown in Fig. 21, with the s p h e r i c a l t...ip. The rod loca ted to the r igh t of the pitot probe was loca ted in the s a m e photographic plane as the suspended J P - 4 drop- le t...of Atomiza t ion in C a r b u r e t o r s . " NACA TM 518, 1929. 13. Lapple , C. E . , Henry , J . P . , J r . , and Blake, D. E. " A t o

  17. Into the Wind, Against the Tide: Change and the Operational Commander

    DTIC Science & Technology

    1994-02-08

    j~y ~LY T.C&.C4C SAV "RE 0 DOCUMENTATION AD-A279 635 * -~l; .,Ec*. Ty~’ CA/S5;; CA7:GS Ab RZESiR.CT;Vd A - 27 3 * tUNCLASSIFIED D C.. * -...... €v...Z ;U -C -DISTRIBUTION STATEMENT A : APPROVED FOR . DECLASS CAT:Cr. . PUBLIC RELEASE; DISTRIBUTION IS UNLIMITED. E.NAMY -FPRO~N RAN ZA- ON NAME...this .... . e~efsc~ ..... ,71 p .... ,,--’ a -1 .b --,r,,,-t n ecessarily a ,.-. d ’-,y ’-,e .=avo.=* ,,at 1;. COSATI CODES 18. SU ECt TERIMS (Continue

  18. 49 CFR 173.52 - Classification codes and compatibility groups of explosives.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... or hypergolic liquid) E 1.1E1.2E 1.4E Article containing a secondary detonating explosive substance...-S 1.1 1.1A 1.1B 1.1C 1.1D 1.1E 1.1F 1.1G 1.1J 1.1L 9 1.2 1.2B 1.2C 1.2D 1.2E 1.2F 1.2G 1.2H 1.2J 1...

  19. MRAPs, Irregular Warfare, and Pentagon Reform

    DTIC Science & Technology

    2009-01-01

    76 JFQ / issue 55, 4 th quarter 2009 ndupress .ndu.edu MRAPs, Irregular Warfare, and Pentagon Reform By C h r i s t o p h e r J . l a m b , m...a t t h e w J . s C h m i D t , and b e r i t g . F i t z s i m m o n s Mine resistant ambush protected (MRAP) vehicles offer an excellent...issue 55, 4 th quarter 2009 / JFQ 77 LAMB, SCHMIDT, and FITZSIMMONS By C h r i s t o p h e r J . l a m b , m a t t h e w J . s C h m i D t

  20. C2 Fragmentation Energy of C60 Revisited: Theory Disagrees with Most Experiments

    NASA Technical Reports Server (NTRS)

    Boese, A. Daniel; Scuseria, Gustavo E.

    1998-01-01

    Following our earlier work on the subject, we have carried out density functional theory (DFT) and second-order Moller-Plesset perturbation theory (MP2) calculations of the dissociation energy of the reaction C60 yields C58 + C2 using polarized basis sets and geometries optimized with DFT methods. The present theoretical results support an electronic fragmentation energy D(sub e) around 10-11 eV in disagreement with most experimental results that place the dissociation energy D(sub o) (including zero point energy) around 7-8 eV. The plausible errors remaining in the theoretical calculations are unlikely to account for this big difference (2-4 eV).

  1. Introduction to Some Fundamental Concepts of General Relativity and to Their Required Use in Some Modern Timekeeping Systems

    DTIC Science & Technology

    1981-12-01

    t e d Riemann Curvature Wnsor and R i s the Curva ture ~ c 2 l ) a r . I n 1917, Karl Schwarzschi ld s o l v e d t h e s e e q u a t i o n...tu re of time a l o n e . I t is t h e Schwarzschild met r ic t h a t leads t o the famous concept n f t h e black h o l e . This is a...01 Well, it can: 2 m - I - - - - - 0 r c 2 Figure 2 4 One calls t h i s va lue of r t h e Schwarzschild b d l u s and o f t e n

  2. Unclassified Publications of Lincoln Laboratory 1 January-31 December 1993. Volume 19

    DTIC Science & Technology

    1993-12-31

    Netishen, CM. Rothschild, M. Blundell, R Papa, D.C. Brown, E.R. Parker, CD. Shirley, L.G. Ariel, E.D. Hallerman , G.R. Payson, H.C Vivilecchia...Gustafson, T.K., JA-6838 Hallerman , G.R., JA-6932 Hallowell, R.G., MS-10253 Halversen, S.D., JA-6948, MS-10057, MS-10114 Hanes, A.S., JA-6924

  3. Fuel Microemulsions for Jet Engine Smoke Reduction

    DTIC Science & Technology

    1980-05-01

    ESL-TR-80-25 FUEL MICROEMULSIONS FOR JET ENGINE SMOKE REDUCTION LEVEL$: 0• D.W. NAEGELI , G.E. FODOR, C.A. MOSES MOBILE ENERGY DIVISION 1N•j SOUTHWEST...Moses, C.A, and D.W. Naegeli , "Fuel Property Effects on Combustor Per- formance," AS!E Paper 79-GT-178, San Diego, CA, January 1979. 17. Naegeli , D.W

  4. Cloud Climatology Derived from the AFGWC (Air Force Global Weather Central) 3D-Nephanalysis for January and July 1979.

    DTIC Science & Technology

    1987-01-15

    January 1979. 29 Coo E 1979 2~0 C NHOOO. 03 to F *N9 90 E Januar y T i a J d e 1979 ClIou d 20 0 t0i 1 31 " -M No n t h I y 90 w Fig. 14 The monthly...r- 4 -Vto C UovjS 3H 3AOV 30 IJWII H913Hono-4 9__ . bases. The cloud amount from the visual satellite processor is obtained by comparing the 64...satellite analyses are combined to produce a single satellite c .. 10 1n 0 a 0 c ____ ___ ____ ___ ____ ___ a__ _ a0 0 0 "w -4 O *0u mC 07 o v" 0 0. cr. 4" L

  5. Effect of Glyceraldehyde Cross-Linking on a Rabbit Bullous Keratopathy Model.

    PubMed

    Wang, Mengmeng

    2015-01-01

    Background. To evaluate the effects of corneal glyceraldehyde CXL on the rabbit bullous keratopathy models established by descemetorhexis. Methods. Fifteen rabbits were randomly divided into five groups. Group A (n = 3) is the control group. The right eyes of animals in Groups B,C, D, and E (n = 3, resp.) were suffered with descemetorhexis procedures. From the 8th day to the 14th day postoperatively, the right eyes in Groups C and D were instilled with hyperosmolar drops and glyceraldehyde drops, respectively; the right eyes in Group E were instilled with both hyperosmolar drops and glyceraldehyde drops. Central corneal thickness (CCT), corneal transparency score, and histopathological analysis were applied on the eyes in each group. Results. Compared with Group A, statistically significant increase in CCT and corneal transparency score was found in Groups B, C, D, and E at 7 d postoperatively (P < 0.05) and in Groups C, D, and E at 14 d postoperatively (P < 0.05). Conclusion. Chemical CXL technique using glyceraldehyde improved the CCT and corneal transparency of the rabbit bullous keratopathy models. Topical instillation with glyceraldehyde and hyperosmolar solutions seems to be a good choice for the bullous keratopathy treatment.

  6. Coagulopathy and Shock on Admission is Associated with Mortality for Children with Traumatic Injuries at Combat Support Hospitals

    DTIC Science & Technology

    2012-01-01

    Charles E . Wade, PhD; Lorne H. Blackbourne, MD; Philip C. Spinella, MD Trauma remains one of the most common causes of death in all age groups...the U.S. Government. The authors have not disclosed any potential conflicts of interest. For information regarding this article, E -mail: Jpatregnani...ELEMENT NUMBER 6. AUTHOR(S) Patregnani J. T., Borgman M. A., Maegele M., Wade C. E ., Blackbourne L. H., Spinella P. C., 5d. PROJECT NUMBER 5e. TASK

  7. Petrographic Analysis of Cores from Plant 42

    DTIC Science & Technology

    2016-10-01

    ER D C TR -X X- D R AF T Petrographic Analysis of Cores from Plant 42 E n gi n ee r R es ea rc h a n d D ev el op m en t C en te r...E. Rae Reed-Gore, Kyle Klaus, and Robert D. Moser October 2016 Approved for public release; distribution is unlimited. The U.S. Army...ORIGINATOR. ii Figures and Tables Figures Figure 1. Test location map of AF Plant 42 with core number locations. ............................. 2

  8. An Adaptive Inpainting Algorithm Based on DCT Induced Wavelet Regularization

    DTIC Science & Technology

    2013-01-01

    research in image processing. Applications of image inpainting include old films restoration, video inpainting [4], de -interlacing of video sequences...show 5 (a) (b) (c) (d) (e) (f) Fig. 1. Performance of various inpainting algorithms for a cartoon image with text. (a) the original test image; (b...the test image with text; inpainted images by (c) SF (PSNR=37.38 dB); (d) SF-LDCT (PSNR=37.37 dB); (e) MCA (PSNR=37.04 dB); and (f) the proposed

  9. Exploring the Integration of COSYSMO with a Model-Based Systems Engineering Methodology in Early Trade Space Analytics and Decisions

    DTIC Science & Technology

    2016-06-01

    UAV system but had a larger scope. The publishing timeline for the second UAV model and this thesis ...r l o g i c a l ) t h a t can be used t o d e s c r i b e a p a r t o f t h e model . < / d e s c r i p t i o n > 7 <h idden> f a l s e < / h idden...July). Program manager e -tool kit: Hierarchy of models and simulations . [Online]. Available: https://acc.dau.mil/CommunityBrowser.aspx?id= 294530

  10. 76 FR 69125 - Amendment of Restricted Areas R-2104A, B, C, D and E; Huntsville, AL

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-08

    ...-0693; Airspace Docket No. 11-ASO-29] RIN 2120-AA66 Amendment of Restricted Areas R-2104A, B, C, D and E... changes the using agency name for Restricted Area R-2104 A through E, Huntsville, AL to read ``Commander... that the FAA change the name of the using agency for Restricted Areas R-2104A through E to ``Commander...

  11. Optoelectronics Research Center

    DTIC Science & Technology

    2012-01-03

    Stone, A. Malcoci, R. E. Miles, and I . Camara Mayorga, Electron. Lett., 41, 128–129, (2005). 10S. D. Roh, T. S. Yeoh, R. B. Swint, A. E. Huber, C. Y...and K. A. Shore, Unlocking dynamical diversity, Wiley, 2005. 14F. Grillot, K. Veselinov, M. Gioannini, I . Montrosset, J. Even, R. Piron, E. Homeyer, S...Bimberg, IEEE J. Sel. Topics Quantum Electron., 8, pp. 984-991, (2002). 16M. A. Cataluna, D. I . Nikitichev, S. Mikroulis, H. Simos, C. Simos, C

  12. 78 FR 49116 - Airworthiness Directives; Eurocopter France Helicopters

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-13

    ..., B2, B3, BA, C, D, and D1 helicopters; and Model AS355E, F, F1, F2, N, and NP helicopters. The... certain Eurocopter Model AS350B, B1, B2, B3, BA, C, D, and D1 and Model AS355E, F, F1, F2, N, and NP... pilot if certain regulatory recordkeeping requirements are met. As such, AD 2011-22-05 currently...

  13. Mode Competition in the Quasioptical Gyrotron

    DTIC Science & Technology

    1990-05-30

    dvid Jd n J C nH ]d. v1 dCl v-1 J dC4 vm M Jd ;v M_ &(vl- v1 ) 6(vn - vn °) & r- vm ). (B18) It is clear from (B16)-( BI8 ) that r, G and D depend...AZ 85721 Attn: Dr. Willis E. Lamb, Jr. 1 copy Physical Sciences, Inc. 635 Slaters Lane #G101 Alexandria, VA 22314-1112 ATTN: Dr. M.E. Read 1 copy

  14. 75 FR 18833 - Agency Information Collection Activities: Existing Collection; Emergency Extension

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-13

    .... Abstract: Section 709(c) of Title VII of the Civil Rights Act of 1964, as amended, 42 U.S.C. 2000e-8(c... minorities and women. The data are shared with several other Federal agencies. Pursuant to section 709(d) of Title VII of the Civil Rights Act of 1964, U.S.C. 2000e-8(d), as amended, EEO-4 data is shared with...

  15. Dollar Summary of Federal Supply Classification and Service Category by Company. Section 1: Supplies and Equipment. Fiscal Year 1993. (6105 Motors, Electrical, Able Inc. - 9999 Miscellaneous, Zulu Pacific Air Service). Part 2

    DTIC Science & Technology

    1994-03-01

    W) CV) Ln C4 ý qr v 0 V m tD Ln mw qw co en CY) m Pý- CD CA CL 0 E x 0 ui 0 (D tO lD r,. rý. ej 0 Cn 0 Cj CY) (D (n Go L) W L) 0 LO CY) (Y) Cl rý m w...C " L~ 0 - -L C. L. L. s- ol U=~ M0C0 o.-0eý= G CO C- Co*-I’U rC ’U td 06 0 060 0 m 0 f’>-𔃾J (n 4- (d )O00 ŕ 0 4- ed - 4- 1’-O 0 0 0 - 05 4dS- 4...Mcc CL L) 41 CL 0 cc U) = cn u 0 c 4n td (D (n u u z w go to 0 LID = a. - I u L) U - < 0 w (D CL 0 w cn u I-- u 0 ww < I-- z 1-- 0 (n cy 4 = (D Cn L

  16. Development of Nanoplatelet Composites

    DTIC Science & Technology

    2008-12-08

    Graphite Intercalation Compounds and Applications, Oxford University Press, 2003. 27 S. Stankovich, D.A. Dikin , D.H.B. Dommett, K.H. Kohlhaas, E.J...Chemistry C 111,7565(2007). 30 S. Stankovich, D.A. Dikin , G.H.B. Dommett, K.M. Kolhaas, E.J. Zimney, E.A. Stach, R.D. Piner, S.T. Ngyuen, and R.A. Ruoff

  17. A Very Compact Rijndael S-Box

    DTIC Science & Technology

    2004-09-28

    01101011 84 N4 108 6C 01101100 250 R 109 6D 01101101 133 s128 110 6E 01101110 61 S64 111 6F 01101111 186 n64 112 70 01110000 43 m 113 71 01110001 121...109 6D 01101101 133 s128 183 B7 10110111 134 C128 194 C2 11000010 135 T 128 93 5D 01011101 136 α8 231 E7 11100111 137 g128 50 32 00110010 138 N128 86

  18. 17 CFR Appendix B to Part 190 - Special Bankruptcy Distributions

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... €50 U.K. C €100 U.K., Germany, or Japan Location Actual asset balance U.S. $50 U.K. €100 Germany €50.... C $20 U.S. C €50 Germany D $100. U.S. D £300 U.K. D €100 U.K., Germany, or Japan E $80 U.S. E ¥10,000 Japan Location Actual asset balance U.S. $200 U.K. £200 U.K. €100 Germany €50 Japan ¥10,000...

  19. Foundations of Isomer Physics for Energy Applications

    DTIC Science & Technology

    2008-10-16

    demon.eo.iik/ fitzpcak.htm), 2005 TV, Institute of Nuclear Physics, University of Cologne. Germany. www.ikp.uni-koeln.de/~ fitz /. 2003 Efficiency...14] Boston. D. T. Joss, E. S. Paul , A. T. Semple, N. J. O’Brien, C. M. Parry, A. V. Afanasjev, and I. Ragnarsson, Phys. Rev. C 60,024307(1999). [15...19] and M. Ishii, Z. Phys. A 347. 41 (1993). A. J. Boston. E. S. Paul , C. J. Chiara, M. Devlin. D. B. Fossan. S. J. Freeman. D. R. LaFosse

  20. Human Ozone (O3) Exposure Alters Serum Profile of Lipid Metabolites

    EPA Science Inventory

    HUMAN OZONE (O3) EXPOSURE ALTERS SERUM PROFILE OF LIPID METABOLITES Miller, D B.1; Kodavanti, U P.2 Karoly, E D.3; Cascio W.E2, Ghio, A J. 21. UNC-Chapel Hill, Chapel Hill, N.C., United States. 2. NHEERL, U.S. EPA, RTP, N.C., United States. 3. METABOLON INC., Durham, N.C., United...

  1. 78 FR 24465 - Ballard Terminal Railroad Company, L.L.C.-Acquisition and Operation Exemption-Woodinville...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-25

    ... National Trails System Act, 16 U.S.C. 1247(d). Ballard also seeks the right to provide common carrier rail... use negotiations under 16 U.S.C. 1247(d).\\2\\ The Board seeks comments from interested persons on... submitted either via the Board's e-filing format or in the traditional paper format. Any person using e...

  2. Flight Problems, Problems in Starting Service,

    DTIC Science & Technology

    1977-01-03

    h i l e a t the same time preserving hi gh f l i g h t r egu la r i t~ l e a d s to t h e fa c t t h a t the t e c h n i cal s t a r t i n g... assembl ies and pa r t s of the a i r c r a f t d~ein the previous flight (R R ), the p r o b a b i l i t y of4pr esence in the landing airport of an...of the assemblies , sets and blocks /P.- can be exchange d in a single hour in case of defects. Furthermore , in the newly constructed L-lOll

  3. Spectroscopic characterization, antimicrobial activity and molecular docking study of novel azo-imine functionalized sulphamethoxazoles

    NASA Astrophysics Data System (ADS)

    Sahu, Nilima; Mondal, Sudipa; Naskar, Kaushik; Mahapatra, Ananya Das; Gupta, Suvroma; Slawin, Alexandra M. Z.; Chattopadhyay, Debprasad; Sinha, Chittaranjan

    2018-03-01

    [SMXsbnd Ndbnd Nsbnd C6H3sbnd (p-OH)(msbnd CHO)] (1) reacts with ArNH2 to synthesize Schiff bases, [SMXsbnd Ndbnd Nsbnd C6H3sbnd (psbnd OH)(msbnd HCdbnd Nsbnd Ar)] (Ar = sbnd C6H5 (2a), sbnd C6H4sbnd psbnd CH3 (2b), sbnd C6H4sbnd psbnd OCH3 (2c), sbnd C6H4sbnd psbnd Cl (2d), sbnd C6H4sbnd psbnd NO2 (2e), sbnd C10H7 (2f)) and the products have been assessed for antibacterial properties against Gram positive bacteria, B. subtillis: IC50 (μg/ml): 39.2 (1), 60.1 (2a), 64.0 (2b), 85.6 (2c), 55.1 (2d), 88.4 (2e) and 65.1 (2f); and Gram negative bacteria, E. coli: IC50 (μg/ml): 159.0 (1), 151.4 (2a), 155.3 (2b), 140 (2c), 156.0 (2d), 153.5 (2e) and 157 (2f). The cell line toxicity (Vero cells) has also been evaluated with these compounds and EC50 (μg/ml) values are 129.9 (1), 74.2 (2a) and 93.0 (2b), 191.9 (2c), 99.1 (2d), 93.2 (2e) and 62.0 (2f). The anti-viral efficiency against harpies virus (HSVsbnd 1F ATCC-733) infection demonstrates that the compound 1 has highest selectivity index (CC50/EC50), 5.06 than the compounds 2a-f (CC50/EC50: 1.18 (2a), 1.42 (2b), 3.50 (2c), 1.45 (2d), 1.58 (2e), 1.29 (2f)). The compounds have been spectroscopically characterized and the structural confirmation has been established in one case by single crystal X-ray diffraction studies of 2c. In silico Molecular Docking study has been done using optimized geometries of the compounds to search the most favored binding mode of these drugs and hence useful to explain their competitive drug efficiency.

  4. Comprehensive Review of the Future Role of the Reserve Component. Volume 1. Executive Summary and Main Report

    DTIC Science & Technology

    2011-04-05

    C t r Source Integrated Security Posture Defense Planning Scenario April 2008 28 Using selected DoD planning scenarios8 that cover the...Military Sourcing for DoD Humanitarian Crisis Response D C R Mil t r S r i 1. AC primary source for DoD response 2. Some pre-planned RC required...immediately 3. Most RC follow on CRISIS + 30 DAYS Days N o ti o n a l P e rc e n t o f T o ta l F o rc e President Invokes PRC

  5. Limits on neutral D mixing in semileptonic decays

    NASA Astrophysics Data System (ADS)

    Cawlfield, C.; Eisenstein, B. I.; Gollin, G. D.; Karliner, I.; Kim, D.; Lowrey, N.; Naik, P.; Sedlack, C.; Selen, M.; Williams, J.; Wiss, J.; Edwards, K. W.; Besson, D.; Pedlar, T. K.; Cronin-Hennessy, D.; Gao, K. Y.; Gong, D. T.; Kubota, Y.; Klein, T.; Lang, B. W.; Li, S. Z.; Poling, R.; Scott, A. W.; Smith, A.; Dobbs, S.; Metreveli, Z.; Seth, K. K.; Tomaradze, A.; Zweber, P.; Ernst, J.; Mahmood, A. H.; Arms, K.; Gan, K. K.; Severini, H.; Asner, D. M.; Dytman, S. A.; Love, W.; Mehrabyan, S.; Mueller, J. A.; Savinov, V.; Li, Z.; Lopez, A.; Mendez, H.; Ramirez, J.; Huang, G. S.; Miller, D. H.; Pavlunin, V.; Sanghi, B.; Shibata, E. I.; Shipsey, I. P.; Adams, G. S.; Chasse, M.; Cravey, M.; Cummings, J. P.; Danko, I.; Napolitano, J.; He, Q.; Muramatsu, H.; Park, C. S.; Park, W.; Thorndike, E. H.; Coan, T. E.; Gao, Y. S.; Liu, F.; Stroynowski, R.; Artuso, M.; Boulahouache, C.; Blusk, S.; Butt, J.; Dambasuren, E.; Dorjkhaidav, O.; Li, J.; Menaa, N.; Mountain, R.; Nandakumar, R.; Redjimi, R.; Sia, R.; Skwarnicki, T.; Stone, S.; Wang, J. C.; Zhang, K.; Csorna, S. E.; Bonvicini, G.; Cinabro, D.; Dubrovin, M.; McGee, S.; Bornheim, A.; Pappas, S. P.; Weinstein, A. J.; Nelson, H. N.; Briere, R. A.; Chen, G. P.; Chen, J.; Ferguson, T.; Tatishvili, G.; Vogel, H.; Watkins, M. E.; Rosner, J. L.; Adam, N. E.; Alexander, J. P.; Berkelman, K.; Cassel, D. G.; Crede, V.; Duboscq, J. E.; Ecklund, K. M.; Ehrlich, R.; Fields, L.; Gibbons, L.; Gittelman, B.; Gray, R.; Gray, S. W.; Hartill, D. L.; Heltsley, B. K.; Hertz, D.; Hsu, L.; Jones, C. D.; Kandaswamy, J.; Kreinick, D. L.; Kuznetsov, V. E.; Mahlke-Krüger, H.; Meyer, T. O.; Onyisi, P. U.; Patterson, J. R.; Peterson, D.; Pivarski, J.; Riley, D.; Ryd, A.; Sadoff, A. J.; Schwarthoff, H.; Shepherd, M. R.; Stroiney, S.; Sun, W. M.; Urner, D.; Wilksen, T.; Weinberger, M.; Athar, S. B.; Avery, P.; Breva-Newell, L.; Patel, R.; Potlia, V.; Stoeck, H.; Yelton, J.; Rubin, P.

    2005-04-01

    Using the CLEO II.V detector observing e+e- collisions at around 10.6 GeV we search for neutral D mixing in semileptonic D0 decays tagged in charged D* decays. Combining the results from the Keν and K*eν channels we find that the rate for D mixing is less than 0.0078 at 90% C.L.

  6. Adsorption, sedimentation, and inactivation of E. coli within wastewater treatment wetlands.

    PubMed

    Boutilier, L; Jamieson, R; Gordon, R; Lake, C; Hart, W

    2009-09-01

    Bacteria fate and transport within constructed wetlands must be understood if engineered wetlands are to become a reliable form of wastewater treatment. This study investigated the relative importance of microbial treatment mechanisms in constructed wetlands treating both domestic and agricultural wastewater. Escherichia coli (E. coli) inactivation, adsorption, and settling rates were measured in the lab within two types of wastewater (dairy wastewater lagoon effluent and domestic septic tank effluent). In situ E. coli inactivation was also measured within a domestic wastewater treatment wetland and the adsorption of E. coli was also measured within the wetland effluent. Inactivation of E. coli appears to be the most significant contributor to E. coli removal within the wastewaters and wetland environments examined in this study. E. coli survived longer within the dairy wastewater (DW) compared to the domestic wastewater treatment wetland water (WW). First order rate constants for E. coli inactivation within the WW in the lab ranged from 0.09 day(-1) (d(-1)) at 7.6 degrees C to 0.18d(-1) at 22.8 degrees C. The average in situ rate constant observed within the domestic wetland ranged from 0.02 d(-1) to 0.03 d(-1) at an average water temperature of 17 degrees C. First order rate constants for E. coli inactivation within the DW ranged from 0.01 d(-1) at 7.7 degrees C to 0.04 d(-1) at 24.6 degrees C. Calculated distribution coefficients (K(d)) were 19,000 mL g(-1), 324,000 mL g(-1), and 293 mL g(-1) for E. coli with domestic septic tank effluent (STE), treated wetland effluent (WLE), and DW, respectively. Approximately 50%, 20%, and 90% of E. coli were "free floating" or associated with particles <5 microm in size within the STE, WLE, and DW respectively. Although 10-50% of E. coli were found to associate with particles >5 microm within both the STE and DW, settling did not appear to contribute to E. coli removal within sedimentation experiments, indicating that the particles the bacteria were associated with had very small settling velocities. The results of this study highlight the importance of wastewater characterization when designing a treatment wetland system for bacterial removal. This study illustrated the level of variability in E. coli removal processes that can be observed within different wastewater, and wetland environments.

  7. Corrosion influencée par les micro-organismes : influence du biofilm sur la corrosion des aciers, techniques et résultats recents

    NASA Astrophysics Data System (ADS)

    Feugeas, F.; Magnin, J. P.; Cornet, A.; Rameau, J. J.

    1997-03-01

    Microbiologically Influenced Corrosion (M.I.C.) studied since the beginning of this century, is responsible for the degradation of many metallic equipments. This study is a review of results dealing with M.I.C. on several types of steels as: carbon steels, stainless steels, welded steels and covered steels. M.I.C. occurs only in presence of a biofilm. The first part of this study describes chemical and physical factors involved in its development, technical methods for studying biofilms, and its contribution in the corrosion process. The second part is devoted to the study of M.I.C. cases linked with metal nature and different aqueous environments and the last part reviews the mainly mecanisms of biocorrosion. La Corrosion Influencée par les Micro-organismes (C.I.M.) ou biocorrosion, phénomène étudié depuis le début du siècle, est responsable de la dégradation d'un grand nombre d'ouvrages métalliques. Cette étude a pour but de faire le point des connaissances sur la corrosion influencée microbiologiquement de divers types d'aciers au carbone, d'aciers inoxydables, d'assemblages soudés et d'aciers revêtus. La C.I.M. n'apparaît qu'en présence d'un biofilm. La première partie de cette étude décrit les facteurs physico-chimiques impliqués dans la formation du biofilm, ces moyens d'études ainsi que son action dans le processus de biocorrosion. La seconde partie est consacrée à la description des cas de biocorrosion classés en fonction de la nature des métaux et des milieux avec lesquels ils sont en contact. La dernière partie de ce document passe en revue les principaux mécanismes de biocorrosion décrits.

  8. Magnetostatic Surface Field Measurement Facility.

    DTIC Science & Technology

    1986-12-01

    Sphere 106 4 Page C .2 Acoustically Hard Prolate 10 8 HC.3 Perfectly Conducting Sphere 110 C .4 Some Implications 113 C .5 References 115 APPENDIX D 117 0.1...I/a2+ r2+z2 - 2ar cos a d -3, C 2 var 1 -K2 )K - / - E Jo 3ɚ- (2.37) and since J cos a da 0 0 we have . ... 1 2)K A = - -~i)Ej + 0 (k 3) . (2.38...assumed exp(jwt) time convention. C - We begin by analyzing one of our eight secondary distribution sub- systems, as shown in Fig. D .2. V -j- Z 0j B e Vx

  9. Behavioral and Physiological Effects of Leukotriene C4

    DTIC Science & Technology

    1990-01-01

    Vasoconstrictor effects of the same time course as that found for the sup- leukotrienes C4 and D4 in the feline mesenteric pression of locomotor...of dogs by leukotriene 34. Roth D M. Lefer D L, Hock C E, Lefer A M. C4. Journal of the American College of Cardiology Effects of peptide

  10. Accretion-powered Compact Binaries

    NASA Astrophysics Data System (ADS)

    Mauche, Christopher W.

    2003-12-01

    Preface; The workshop logo; A short history of the CV workshop F. A. Córdova; Part I. Observations: 1. Low mass x-ray binaries A. P. Cowley, P. C. Schmidtke, D. Crampton, J. B. Hutchings, C. A. Haswell, E. L. Robinson, K. D. Horne, H. M. Johnston, S. R. Kulkarni, S. Kitamoto, X. Han, R. M. Hjellming, R. M. Wagner, S. L. Morris, P. Hertz, A. N. Parmar, L. Stella, P. Giommi, P. J. Callanan, T. Naylor, P. A. Charles, C. D. Bailyn, J. N. Imamura, T. Steiman-Cameron, J. Kristian, J. Middleditch, L. Angelini and J. P. Noris; 2. Nonmagnetic cataclysmic variables R. S. Polidan, C. W. Mauche, R. A. Wade, R. H. Kaitchuck, E. M. Schlegel, P. A. Hantzios, R. C. Smith, J. H. Wood, F. Hessman, A. Fiedler, D. H. P. Jones, J. Casares, P. A. Charles, J. van Paradijs, E. Harlaftis, T. Naylor, G. Sonneborn, B. J. M. Hassall, K. Horne, C. A. la Dous, A. W. Shafter, N. A. Hawkins, D. A. H. Buckley, D. J. Sullivan, F. V. Hessman, V. S. Dhillon, T. R. Marsh, J. Singh, S. Seetha, F. Giovannelli, A. Bianchini, E. M. Sion, D. J. Mullan, H. L. Shipman, G. Machin, P. J. Callanan, S. B. Howell, P. Szkody, E. M. Schlegel and R. F. Webbink; 3. Magnetic cataclysmic variables C. Hellier, K. O. Mason, C. W. Mauche, G. S. Miller, J. C. Raymond, F. K. Lamb, J. Patterson, A. J. Norton, M. G. Watson, A. R. King, I. M. McHardy, H. Lehto, J. P. Osborne, E. L. Robinson, A. W. Shafter, S. Balachandran, S. R. Rosen, J. Krautter, W. Buchholz, D. A. H. Buckley, I. R. Tuoly, D. Crampton, B. Warner, R. M. Prestage, B. N. Ashoka, M. Mouchet, J. M. Bonnet-Bidaud, J. M. Hameury, P. Szkody, P. Garnavich, S. Howell, T. Kii, M. Cropper, K. Mason, J. Bailey, D. T. Wickramasinghe, L. Ferrario, K. Beuermann, A. D. Schwope, H.-C. Thomas, S. Jordan, J. Schachter, A. V. Filippenko, S. M. Kahn, F. B. S. Paerels, K. Mukai, M. L. Edgar, S. Larsson, R. F. Jameson, A. R. King, A. Silber, R. Remillard, H. Bradt, M. Ishida, T. Ohashi and G. D. Schmidt; Part II. Accretion Theory: 4. Nonmagnetic W. Kley, F. Geyer, H. Herold, H. Ruder, R. Whitehurst, A. King, J. C. Wheeler, S. Mineshige, M. Huang, S. W. Kim, Y. Tuchman, T. R. Kallman and J. A. Woods; 5. Magnetic M. T. Wolff, J. N. Imamura, K. S. Wood, J. H. Gardner, S. J. Litchfield, J. J. Brainerd, G. Chanmugan, K. Wu, J. Frank, T. Hanawa, K. Hirotani and N. Kawai; Part III. Novae S. Starrfield, R. M. Hjellming, A. B. Tomaney, A. W. Shafter, A. Cassatella, P. L. Selvelli, R. Gilmozzi, A. Bianchini, M. Friedjung, H. Ritter, M. J. Politano, M. Livio, R. F. Webbink, K. Horne, W. F. Welsh, R. A. Wade, J. Krauttler, M. A. J. Snijders, N. Vogt, L. H. Barrera, H. Barwig, K.-H Mantel, R. Gilmozzi, A. Shankar, A. Burkert, J. W. Truran and J. Hayes: Part IV. Evolution I. Iben Jr, M. S. Hjellming, R. E. Taam, M. Politano, F. D'Antona, I. Mazzitelli, H. Ritter, J. M. Hameury, A. R. King, J. P. Lasota, R. Popham, R. Narayan, J. Isern, J. Laybay, R. Canal, D. García, A. S. Fruchter, S. R. Kulkarni, R. W. Romani, A. Ray, W. Kluzniak, S. Miyaji and G. Chanmugam; Subject index; Star index.

  11. Self-Passivation of POSS-Kapton-Polyimides in the Presence of Atomic Oxygen (Preprint)

    DTIC Science & Technology

    2007-10-29

    3. Koontz , S. L., Leger, L. J., Visentine, J. T., Hunton, D. E., Cross, J. B., and Hakes, C. L., “EOIM-III Mass Spectroscopy and Polymer Chemistry...1983. 88(A12): p. 170-188. 14. Koontz , S.L., Leger, L. J., Rickman, S. L., Hakes, C. L., Bui, D. T., Hunton, D. E. and Cross, J.B., "Oxygen

  12. 75 FR 69061 - Senior Executive Service; Performance Review Board

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-10

    ..., Linda C Burrows, Charles W Buttress, Larry D Buzzard, Christine M Cadieux, Gena E Callahan, Samuel N... Bekkedahl, Larry N Bell, Melody C Berkowitz, Barry E Bieniawski, Andrew J Bishop, Clarence T Bishop, Tracey..., Douglas E Kane, Michael C Kaplan, Stan M Kearney, James H Kelly, Henry C Kelly, Larry C Kenchington, Henry...

  13. Super (a, d)-Cycle-Antimagic Total Labeling on Triangular Ladder Graph and Generalized Jahangir Graph

    NASA Astrophysics Data System (ADS)

    Roswitha, Mania; Amanda, Anna; Sri Martini, Titin; Winarno, Bowo

    2017-06-01

    Let G(V (G), E(G)) be a finite simple graph with |V (G)| = G and |E(G)| = eG . Let H be a subgraph of G. The graph G is said to be (a, d)-H-antimagic covering if every edge in G belongs to at least one of the subgraphs G isomorphic to H and there is a bijective function ξ : V ∪ E → {1, 2, …,νG + eG } such that all subgraphs H‧ isomorphic to H, the H‧ -weights w(H‧)=∑v∈V(H‧)ξ(v)+∑e∈E(H‧)ξ(e) constitutes an arithmetic progression {a, a + d, a + 2d, …, a + (t - 1)d}, where a and d are positive integers and t is the number of subgraphs G isomorphic to H. Such a labeling is called super if the vertices contain the smallest possible labels. This research provides super (a, d)-C 3-antimagic total labelng on triangular ladder TLn for n ≥ 2 and super (a, d)-C s+2-antimagic total labeling on generalized Jahangir Jk,s for k ≥ 2 and s ≥ 2.

  14. DoD Housing Management

    DTIC Science & Technology

    1993-09-01

    E, below. The forms are approved for electronic generation and distribution. * 1-7 0 C~L0 _ 0 C 0I U)2 Ea 0 0 0 U! 0 3: X 9 0 V~ 0 CD co L. 8p 6 V- I...and inspection by installation personnel. e. Costs above installation level, such as costs attributable to Engineer Districts, Public Works Offices...the major command or engineering field dMsion ’). For DoD Component area summary reports, leave bla’*. C-1 Go %a M -ý - f N 4I- -t C-4.𔃻-1 .7 %10O O

  15. 39 CFR 3010.2 - Types of rate adjustments for market dominant products.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ..., authorized under 39 U.S.C. 3622(d)(1)(E), is based on exigent circumstances. (b) Upon the establishment of... adjustment, authorized under 39 U.S.C. 3622(d)(1)(D), is based on the statutory annual limitation. A Type 1-B rate adjustment, authorized under 39 U.S.C. 3622(d)(2)(C), is based on an exception to the annual...

  16. 8111/8116 Security Police Staff Officers 8121/8124 Security Police Officers AFSC: 81XX

    DTIC Science & Technology

    1992-02-01

    c 6I4 .1 4 6 5 . 5 6 -6 0 m 0 60 . 0.. C afa 0 -6 0 1 0 .4 L 0 CL & f6 C 6.4 6%. 4 040E .~ ~ a 0 0.41.ft i 0 a 0w m a 2m 2 0 0. Mv 0U 4 0. L.~ 0 0ty...m ~ SC 6& Ct D0 CC Z~C)d Ř-66 64 I Ř.64C0 Ř E~ L 𔄀 6660 LO U64 W . .0 C 𔄀 -4 0L 6 0 L 1- 4 0ŘC C #.4 f6 ൶ 0 151 6W ~ )d6I.ILC E 11 .4 6.4...L - - R~ . ( *U # ACCa .4 % 40 a - 4- 1 4 4-L 0 *-46.40 50 a .40C CL 0 Ŕ 1 0. 0 OUUCC>CU.U0C4-LSa LC .CaC CW~ift-4C .4,4f L .4 -S(( a-..CA a COC *-. 4

  17. Morale, Welfare, and Recreation: Nonappropriated Funds Personnel Policy

    DTIC Science & Technology

    2002-04-01

    Nonappropriated Fund Instrumentality established for the purpose of providing installation/community MWR activi- ties, including food and beverage , retail...2002 H i s t o r y . T h i s p r i n t i n g p u b l i s h e s a r e v i s i o n o f t h i s r e g u l a t i o n . B e c a u s e t h e p u b l i c...a t i o n h a s b e e n e x t e n s i v e l y r e v i s e d , t h e c h a n g e d p o r t i o n s h a v e n o t b e e n highlighted. Summary. This

  18. 32 CFR Appendix C to Part 310 - DoD Blanket Routine Uses

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false DoD Blanket Routine Uses C Appendix C to Part...) PRIVACY PROGRAM DOD PRIVACY PROGRAM Pt. 310, App. C Appendix C to Part 310—DoD Blanket Routine Uses (See paragraph (c) of § 310.22 of subpart E) A. Routine Use—Law Enforcement If a system of records maintained by...

  19. Theoretical and Numerical Analysis for Non-Linear Interface Problems

    DTIC Science & Technology

    2007-04-19

    Report 17 . LIMITATION OF ABSTRACT SAR 15. NUMBER OF PAGES 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 5c. PROGRAM ELEMENT NUMBER 5b...8217$94ZY.4,;X/,)@4P*<I $𔃽AC+4)@4&@C+&[CE*]\\_^ \\_`<ab#^c5J$’&+&+$’*.3%&d4&@(-421$e/’>f$𔃽gC+"% 4Ph =42097%&R*,I/,B8CE*.5J/<CE$𔃻 Ci/,)@:.42C )@41

  20. Parallel sequencing lives, or what makes large sequencing projects successful

    PubMed Central

    Cuartero, Yasmina; Stadhouders, Ralph; Graf, Thomas; Marti-Renom, Marc A; Beato, Miguel

    2017-01-01

    Abstract T47D_rep2 and b1913e6c1_51720e9cf were 2 Hi-C samples. They were born and processed at the same time, yet their fates were very different. The life of b1913e6c1_51720e9cf was simple and fruitful, while that of T47D_rep2 was full of accidents and sorrow. At the heart of these differences lies the fact that b1913e6c1_51720e9cf was born under a lab culture of Documentation, Automation, Traceability, and Autonomy and compliance with the FAIR Principles. Their lives are a lesson for those who wish to embark on the journey of managing high-throughput sequencing data. PMID:29048533

  1. Editorial: Focus on Laser- and Beam-Driven Plasma Accelerators

    NASA Astrophysics Data System (ADS)

    Joshi, Chan; Malka, Victor

    2010-04-01

    The ability of short but intense laser pulses to generate high-energy electrons and ions from gaseous and solid targets has been well known since the early days of the laser fusion program. However, during the past decade there has been an explosion of experimental and theoretical activity in this area of laser-matter interaction, driven by the prospect of realizing table-top plasma accelerators for research, medical and industrial uses, and also relatively small and inexpensive plasma accelerators for high-energy physics at the frontier of particle physics. In this focus issue on laser- and beam-driven plasma accelerators, the latest advances in this field are described. Focus on Laser- and Beam-Driven Plasma Accelerators Contents Slow wave plasma structures for direct electron acceleration B D Layer, J P Palastro, A G York, T M Antonsen and H M Milchberg Cold injection for electron wakefield acceleration X Davoine, A Beck, A Lifschitz, V Malka and E Lefebvre Enhanced proton flux in the MeV range by defocused laser irradiation J S Green, D C Carroll, C Brenner, B Dromey, P S Foster, S Kar, Y T Li, K Markey, P McKenna, D Neely, A P L Robinson, M J V Streeter, M Tolley, C-G Wahlström, M H Xu and M Zepf Dose-dependent biological damage of tumour cells by laser-accelerated proton beams S D Kraft, C Richter, K Zeil, M Baumann, E Beyreuther, S Bock, M Bussmann, T E Cowan, Y Dammene, W Enghardt, U Helbig, L Karsch, T Kluge, L Laschinsky, E Lessmann, J Metzkes, D Naumburger, R Sauerbrey, M. Scḧrer, M Sobiella, J Woithe, U Schramm and J Pawelke The optimum plasma density for plasma wakefield excitation in the blowout regime W Lu, W An, M Zhou, C Joshi, C Huang and W B Mori Plasma wakefield acceleration experiments at FACET M J Hogan, T O Raubenheimer, A Seryi, P Muggli, T Katsouleas, C Huang, W Lu, W An, K A Marsh, W B Mori, C E Clayton and C Joshi Electron trapping and acceleration on a downward density ramp: a two-stage approach R M G M Trines, R Bingham, Z Najmudin, S Mangles, L O Silva, R Fonseca and P A Norreys Electro-optic shocks from blowout laser wakefields D F Gordon, A Ting, M H Helle, D Kaganovich and B Hafizi Onset of self-steepening of intense laser pulses in plasmas J Vieira, F Fiúza, L O Silva, M Tzoufras and W B Mori Analysis of laser wakefield dynamics in capillary tubes N E Andreev, K Cassou, F Wojda, G Genoud, M Burza, O Lundh, A Persson, B Cros, V E Fortov and C-G Wahlstrom Characterization of the beam loading effects in a laser plasma accelerator C Rechatin, J Faure, X Davoine, O Lundh, J Lim, A Ben-Ismaïl, F Burgy, A Tafzi, A Lifschitz, E Lefebvre and V Malka Energy gain scaling with plasma length and density in the plasma wakefield accelerator P Muggli, I Blumenfeld, C E Clayton, F J Decker, M J Hogan, C Huang, R Ischebeck, R H Iverson, C Joshi, T Katsouleas, N Kirby, W Lu, K A Marsh, W B Mori, E Oz, R H Siemann, D R Walz and M Zhou Generation of tens of GeV quasi-monoenergetic proton beams from a moving double layer formed by ultraintense lasers at intensity 1021-1023Wcm-2 Lu-Le Yu, Han Xu, Wei-Min Wang, Zheng-Ming Sheng, Bai-Fei Shen, Wei Yu and Jie Zhang Carbon ion acceleration from thin foil targets irradiated by ultrahigh-contrast, ultraintense laser pulses D C Carroll, O Tresca, R Prasad, L Romagnani, P S Foster, P Gallegos, S Ter-Avetisyan, J S Green, M J V Streeter, N Dover, C A J Palmer, C M Brenner, F H Cameron, K E Quinn, J Schreiber, A P L Robinson, T Baeva, M N Quinn, X H Yuan, Z Najmudin, M Zepf, D Neely, M Borghesi and P McKenna Numerical modelling of a 10-cm-long multi-GeV laser wakefield accelerator driven by a self-guided petawatt pulse S Y Kalmykov, S A Yi, A Beck, A F Lifschitz, X Davoine, E Lefebvre, A Pukhov, V Khudik, G Shvets, S A Reed, P Dong, X Wang, D Du, S Bedacht, R Zgadzaj, W Henderson, A Bernstein, G Dyer, M Martinez, E Gaul, T Ditmire and M C Downer Effects of laser prepulses on laser-induced proton generation D Batani, R Jafer, M Veltcheva, R Dezulian, O Lundh, F Lindau, A Persson, K Osvay, C-G Wahlström, D C Carroll, P McKenna, A Flacco and V Malka Proton acceleration by moderately relativistic laser pulses interacting with solid density targets Erik Lefebvre, Laurent Gremillet, Anna Lévy, Rachel Nuter, Patrizio Antici, Michaël Carrié, Tiberio Ceccotti, Mathieu Drouin, Julien Fuchs, Victor Malka and David Neely Holographic visualization of laser wakefields P Dong, S A Reed, S A Yi, S Kalmykov, Z Y Li, G Shvets, N H Matlis, C McGuffey, S S Bulanov, V Chvykov, G Kalintchenko, K Krushelnick, A Maksimchuk, T Matsuoka, A G R Thomas, V Yanovsky and M C Downer The scaling of proton energies in ultrashort pulse laser plasma acceleration K Zeil, S D Kraft, S Bock, M Bussmann, T E Cowan, T Kluge, J Metzkes, T Richter, R Sauerbrey and U Schramm Plasma cavitation in ultraintense laser interactions with underdense helium plasmas P M Nilson, S P D Mangles, L Willingale, M C Kaluza, A G R Thomas, M Tatarakis, R J Clarke, K L Lancaster, S Karsch, J Schreiber, Z Najmudin, A E Dangor and K Krushelnick Radiation pressure acceleration of ultrathin foils Andrea Macchi, Silvia Veghini, Tatyana V Liseykina and Francesco Pegoraro Target normal sheath acceleration: theory, comparison with experiments and future perspectives Matteo Passoni, Luca Bertagna and Alessandro Zani Generation of a highly collimated, mono-energetic electron beam from laser-driven plasma-based acceleration Sanyasi Rao Bobbili, Anand Moorti, Prasad Anant Naik and Parshotam Dass Gupta Controlled electron acceleration in the bubble regime by optimizing plasma density Meng Wen, Baifei Shen, Xiaomei Zhang, Fengchao Wang, Zhangying Jin, Liangliang Ji, Wenpeng Wang, Jiancai Xu and Kazuhisa Nakajima A multidimensional theory for electron trapping by a plasma wake generated in the bubble regime I Kostyukov, E Nerush, A Pukhov and V Seredov Investigation of the role of plasma channels as waveguides for laser-wakefield accelerators T P A Ibbotson, N Bourgeois, T P Rowlands-Rees, L S Caballero, S I Bajlekov, P A Walker, S Kneip, S P D Mangles, S R Nagel, C A J Palmer, N Delerue, G Doucas, D Urner, O Chekhlov, R J Clarke, E Divall, K Ertel, P Foster, S J Hawkes, C J Hooker, B Parry, P P Rajeev, M J V Streeter and S M Hooker Divergence of fast ions generated by interaction of intense ultra-high contrast laser pulses with thin foils A Andreev, T Ceccotti, A Levy, K Platonov and Ph Martin The application of laser-driven proton beams to the radiography of intense laser-hohlraum interactions G Sarri, C A Cecchetti, L Romagnani, C M Brown, D J Hoarty, S James, J Morton, M E Dieckmann, R Jung, O Willi, S V Bulanov, F Pegoraro and M Borghesi Laser-driven particle and photon beams and some applications K W D Ledingham and W Galster Target shape effects on monoenergetic GeV proton acceleration Min Chen, Tong-Pu Yu, Alexander Pukhov and Zheng-Ming Sheng

  2. U.S. EPA, Pesticide Product Label, AATREX 4L HERBICIDE, 03/27/1986

    EPA Pesticide Factsheets

    2011-04-13

    ... "d-~f'\\! I "'''.d' ill' (,fes,"1 ill iI[:';'Cill,Of' fel"'l:> .. e t"e"" .. ·t" iI s .. eep t>.() . 0' O!"ef 5",: .. 0 '...,p .• I"'1."! ., ilpp"cat.c'" Of ... s •• " .op,o .. ed CO"laC! ...

  3. 76 FR 17136 - Medical Devices; Availability of Safety and Effectiveness Summaries for Premarket Approval...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-28

    ... section 515(d)(4) and (e)(2) of the Federal Food, Drug, and Cosmetic Act (the FD&C Act) (21 U.S.C. 360e(d......... Dako Denmark A/S..... HercepTest kit Approved October 20, 2010. P080009 Ethicon Endo-Surgery, SEDASYS...

  4. 76 FR 17660 - National Institute of Mental Health; Notice of Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-30

    ... Health, Neuroscience Center, 6001 Executive Boulevard, Conference Room C/D/E, Rockville, MD 20852. Open...: National Institutes of Health, Neuroscience Center, 6001 Executive Boulevard, Conference Room C/D/E..., NIH, Neuroscience Center, 6001 Executive Blvd., Room 6154, MSC 9609, Bethesda, MD 20892-9609, 301-443...

  5. Final Environmental Assessment Test Operations at Arnold Engineering Development Center. Volumes 1 & 2

    DTIC Science & Technology

    2008-06-01

    ir Fo rc e B as e, T en ne ss ee Fi gu re 1 -2 A er od yn am ic s A er op ro pu ls io n S pa ce & M is si le In fr as...lin es /te xt - fa ci lit ie s in s ta nd by o r m ot hb al le d st at us H ea lth , S af et y an d E nv ir on m en ta l M an ag em en t S ys...yp er so ni c C A er ot he rm al C A FC L La b H E AT -H 2 C C O S

  6. 15 CFR 740.14 - Baggage (BAG).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... to Country Groups D:1, D:2, D:3, D:4, or E:1. (See Supplement No. 1 of this part). (e) Special... or reexport encryption commodities and software to any destination not in Country Group E:1 of... United States as defined by 8 U.S.C. 1101(a)(20) (except a national of a country listed in Country Group...

  7. Spectroscopie du Furanne et du Thiophene Par Diffusion Inelastique D'electrons

    NASA Astrophysics Data System (ADS)

    Lotfi, Said

    Nous avons etudie les molecules de furanne ( rm C_4H_4O) et de thiophene (rm C_4H_4O) au moyen de la spectroscopie de diffusion inelastique d'electrons. Pour (rm C_4H_4O), les spectres realises dans differentes conditions d'energie d'impact et d'angle de diffusion contiennent des singularites ou des families de pics correspondant a: (1) des vibrations de l'etat fondamental dans le domaine 0-0.5 eV, (2) des etats triplets ^3 B_1 et ^3 A_1 qui dominent la region 3-5.5 eV, (3) des etats de valences, entre 5 et 10 eV, dont certains son accompagnes de progressions vibrationnelles, soit ~ A _1B_2, ~ B ^1A_1 et ~ C ^1A_1, (4) toujours entre 5 et 10 eV, deux series de Ryhdberg (rm 1a_2to nda_2 et rm 1a_2to npb_2) qui convergent vers la premiere limite d'ionisation de la molecule, avec une progression vibrationnelle associee au mdoe nu_4 pour la seconde, et une troisieme serie (rm 2b_1to nsa_1 ) convergent vers la seconde limite d'ionisation accompagnee de la progression de mode nu _1. Pour rm C_4H_4S, nos spectres presentent les memes etats de vibration et les memes etats triplets que pour rm C_4H _4O. Nous avons releve egalement, dans la region de 5 a 10 eV, des etats de valence ~ A ^1A_1 (ou ~ A ^1B_2), ~ B ^1A_1 (ou ~ B ^1B _2) et ~ C ^1A_1 (ou ~ C ^1B_2). Pour la premiere fois, par la spectroscopie de diffusion inelastique d'electrons, de nombreux pics ont ete identifies et attribues, dans le cadre de ce travail. Il s'agit, notamment, des etats de vibration de l'etat electronique fondamental de ces molecules et egalement de certains etats de Rydberg dans le cas du furanne.

  8. An Overview of DoD Policy for and Administration of Independent Research and Development

    DTIC Science & Technology

    1975-05-01

    Anderson, Captain William J. Lewandowski, Major James C . Roan, and Mr. Lloyd G. Mitchell to mention a few) kept the author abreast the latest...D Cost Principles (1959) A-I B. AEC Cost Principles for IR&D B-I C . Section 203, Public Law 91-441 C -i D. DOD IR&D Cost Principles (1971) D-1 E...Arii~bd Services Pkocurement Regulations ASRSC Armed Services Research Specialists Cotiitiiittee BOB Buireau bf the Budgse C Comptroiler CITE

  9. AFOSR (Air Force Office of Scientific Research) Technical Report Summaries, October-December 1986

    DTIC Science & Technology

    1986-12-01

    Li LC~~~ C’:i OLL-r C, t’---~~ 7L L >, C~’-C (A f6 -c a. - Lr z - j- > L < C.L C, --- -- Cil m- i Ci c C cc <~ C2- C: CfL’Clf S CLUL 0-’C L al~ C0...n 3C LC - - U -L Cl - rn. xLI -0 - i a CCU W > U .0 -Mu V) C~ c v.(D 0) L) U L m cl c c c > 0 m,) MC0) z JLN < 0 rn C) aCCa - zi C-- -( ECIC , :zz...8217)O Ln .1. tE C- L C, 0 - m m7 r, 7C D 01 n L )cC t- 62 0) L) L L it L)C L C L.-) a)mC - r e 7C -. f6 L- a, -2 Ci -CI D- > w Ul WU mit C > Cin - .~ 0

  10. Comprehensive Performance Limits for Divers’ Underwater Breathing Gear: Consequences of Adopting Diver-Focused Limits

    DTIC Science & Technology

    2007-01-01

    Tidal PCO 2," Undersea Biomed. Res., Vol. 15 (Suppl., 1988), p. 39. 17. D. Warkander, G. K. Nagasawa, W. T. Norfleet, and C. E. G. Lundgren, "Dyspnea...Workshop, Bethesda, MD, 1989. 35. D. E. Warkander, W. T. Norfleet, G. K. Nagasawa, and C. E. G. Lundgren, "CO2 Retention with Minimal Symptoms but Severe

  11. Energy Savings Opportunity Survey (ESOS) of Schofield Barracks Family Housing, Areas A, D, E, F, I, J, K-1. Volume 1

    DTIC Science & Technology

    1992-09-09

    Q ^ C. DESIGN COST £|0*7o) j O .?>?, D. ENERGY CREDIT CALC (1A+1B+1CJX.9 j 3 3j / Lf C. SALVAGE VALUE OF EXISTING EQUIPMENT...BY INVESTMFNT COSTS A. CONSTRUCTION COST ß. SIOH CS-S^O C. DESIGN COST £ 10*7»^ Ü. ENERGY CREDIT CALC (1A*1B+1C)X.9 E. SALVAGE VALUE OF...COST B. SIOH CS-S^O C. DESIGN COST ( lo7o") Ü. ENERGY CREDIT CALC (1A+IB+1C)X.9 E. SALVAGE VALUE OF EXISTING EQUIPMENT F. TOTAL INVESTMENT (ID-IE

  12. Understanding and Targeting Cell Growth Networks in Breast Cancer

    DTIC Science & Technology

    2013-04-01

    Threonine   198...Winkeler   C.L.,   Toso   E.A.,   Gwinn   A.S.,   Pelletier   C.L.   and  Weber   J.D.     (2009).       Threonine ...Toso   E.A.,   Gwinn   A.S.,   Pelletier   C.L.   and  Weber   J.D.     (2009).       Threonine  

  13. 40 CFR 437.42 - Effluent limitations attainable by the application of the best practicable control technology...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... subpart which combines treated or untreated wastes from subparts A, B, or C of this part may be subject to... paragraphs (b), (c), (d), or (e) of this section if the discharger agrees to the following conditions in its... set forth in (b), (c), (d) or (e); (2) The discharger will notify its NPDES permit writer at the time...

  14. Compile-Time Partitioning and Scheduling of Parallel Programs. Extended Summary,

    DTIC Science & Technology

    1986-01-01

    OO-MI70 9PROGRAMS EXTENED, SUMNNRY(U) STANFORD, UNIV CA COMPUTERSYSTEMS LAO V SARKAR ET AL. L986 MDA9S3-SS-C-S432 UNCLASSIFIEDj F/ G 9/2 H El- 1 9 5...9 C M E h h h" E P RIIN N E O UI G O Fh E L i E Eu Iwle ui J l~I-O IWI INW 2-5 1= 13.111 2-2 l o U l1 . A 12- "m ’- - "- m°" m ’o ’ l ’. , " l...J. A. et al. "Parallel Processing: A Smart Compiler and a Dumb Machine". SIGPLAN Notices 19, 6 (June 1984). 8. Gajski , D. D., Padua, D. K. & Kuck, D

  15. Triterpenoid saponins from Echinopsis macrogona (Cactaceae).

    PubMed

    Okazaki, Sachie; Kinoshita, Kaoru; Ito, Satoru; Koyama, Kiyotaka; Yuasa, Hiroshi; Takahashi, Kunio

    2011-01-01

    Triterpene saponins, pachanosides C1, E1, F1 and G1 (1-4), and bridgesides A1, C1, C2, D1, D2, E1 and E2 (5-11) were isolated from Echinopsis macrogona. Compounds 1-4 were saponins with pachanane type triterpene saponins, while the others (5-11) were oleanane type triterpene saponins. While the aglycones of 2-4 and 8-11 were hitherto unknown, the structure of pachanol C was revised in this paper. Their structures were elucidated on the basis of chemical and physicochemical evidence. Copyright © 2010 Elsevier Ltd. All rights reserved.

  16. Differential affinities of MinD and MinE to anionic phospholipid influence Min Patterning dynamics in vitro

    PubMed Central

    Vecchiarelli, Anthony G.; Li, Min; Mizuuchi, Michiyo; Mizuuchi, Kiyoshi

    2014-01-01

    The E. coli Min system forms a cell-pole-to-cell-pole oscillator that positions the divisome at mid-cell. The MinD ATPase binds the membrane and recruits the cell division inhibitor MinC. MinE interacts with and releases MinD (and MinC) from the membrane. The chase of MinD by MinE creates the in vivo oscillator that maintains a low level of the division inhibitor at mid-cell. In vitro reconstitution and visualization of Min proteins on a supported lipid bilayer has provided significant advances in understanding Min patterns in vivo. Here we studied the effects of flow, lipid composition, and salt concentration on Min patterning. Flow and no-flow conditions both supported Min protein patterns with somewhat different characteristics. Without flow, MinD and MinE formed spiraling waves. MinD and, to a greater extent MinE, have stronger affinities for anionic phospholipid. MinD-independent binding of MinE to anionic lipid resulted in slower and narrower waves. MinE binding to the bilayer was also more susceptible to changes in ionic strength than MinD. We find that modulating protein diffusion with flow, or membrane binding affinities with changes in lipid composition or salt concentration, can differentially affect the retention time of MinD and MinE, leading to spatiotemporal changes in Min patterning. PMID:24930948

  17. Review of Reports on Lake Erie - Lake Ontario Waterway, New York. Appendix D. Economics.

    DTIC Science & Technology

    1973-10-01

    Venezuela (29 percent). Canada produced 48.3 million tons of iron ore in 1970 ,of which 23.9 million tons were exported to the United States (14.4 million...grain traffic, 1971 D-14 D-6 U.S. - Great Lakes grain exports 1960 - 1971 and projected D-15 D-7 U.S. doal traffic, Lake Erie - Lake Ontario, 1958-1970...Soybeans Wheat Barley Oats Rice Sorghum Grains Flaxseed Oilseeds, n.e.c. Tobacco, leaf Hay and Fodder Field crops, n.e.c. Fresh fruits Co ffee Cocoa beans

  18. The role of the hippocampus in transitive inference

    PubMed Central

    Zalesak, Martin; Heckers, Stephan

    2009-01-01

    Transitive inference (TI) is the ability to infer the relationship between items (e.g., A>C) after having learned a set of premise pairs (e.g., A>B and B>C). Previous studies in humans have identified a distributed neural network, including cortex, hippocampus, and thalamus, during TI judgments. We studied two aspects of TI using fMRI of subjects who had acquired the 6-item sequence (A>B>C>D>E>F) of visual stimuli. First, the identification of novel pairs not containing end items (i.e., B>D, C>E, B>E) was associated with greater left hippocampal activation when compared to the identification of novel pairs containing end items A and F. This demonstrates that the identification of stimulus pairs requiring the flexible representation of a sequence is associated with hippocampal activation. Second, for the three novel pairs devoid of end items we found greater right hippocampal activation for pairs B>D and C>E compared with pair B>E. This indicates that TI decisions on pairs derived from more adjacent items in the sequence are associated with greater hippocampal activation. Hippocampal activation thus scales with the degree of relational processing necessary for TI judgments. Both findings confirm a role of the hippocampus in transitive inference in humans. PMID:19216061

  19. Subgrid geoelectric field specification for GIC modeling

    NASA Astrophysics Data System (ADS)

    Butala, M.; Grawe, M.; Kamalabadi, F.; Makela, J. J.

    2017-12-01

    Geomagnetically induced currents (GICs) result from surface geomagnetic field (ěc{B}) variation driven by space weather disturbances. For the most intense disturbances, the consequences can range from power grid instability to even widespread failure. Modeling GICs to assess vulnerability requires the specification of the surface geoelectric field (ěc{E}) at all spatial locations coincident with the electric power system. In this study, we investigate how to best reproduce ěc{E} given the available sparse, irregularly spaced magnetometer measurements of ěc{B} and suitable electromagnetic transfer functions (EMTFs) to transform the local ěc{B} to ěc{E}. The assessment is made against ground truth from publicly available ěc{E} measurements provided by the EarthScope magnetotelluric (MT) array, a set of 7 fixed and several transportable joint ěc{B} and ěc{E} sensors. The scope of this study spans several dimensions: geomagnetic disturbance intensity, spatial interpolation scheme, and EMTF type, i.e., 1-D models based on studies of local geology and 3-D models derived from the EarthScope MT data.

  20. Annual Report for Fiscal Year 1973-1974 of the Chief, National Guard Bureau

    DTIC Science & Technology

    1974-01-01

    El -jS C (« " u Ü ■= O Ct3 E03 >.3 O C 3 « m’ «g« am i^^ Q c. w 9Z IP ao re o c t re ui tn « c S re< u)£ ill- c rat ■ c 0! I n... el c c ro o rö o0- tl C31 in 0) sill E Q E ro 03 £ CO i m £ 0! QJ ■D C 03 3 o 5 oipo I 5^ 5 Q 0) (U 03 C •& JK...fit»« 0) « CO El <c^ ■en a _ 73 cö co Q sz c £ ~ b b OTi- cuO o II nil < %* co 2 5 co ’D s; o co £ O c i il llii t u. < Ü

  1. Evaluation of relational reasoning by a transitive inference task in attention-deficit/hyperactivity disorder.

    PubMed

    Brunamonti, Emiliano; Costanzo, Floriana; Mammì, Anna; Rufini, Cristina; Veneziani, Diletta; Pani, Pierpaolo; Vicari, Stefano; Ferraina, Stefano; Menghini, Deny

    2017-02-01

    Here we explored whether children with ADHD have a deficit in relational reasoning, a skill subtending the acquisition of many cognitive abilities and social rules. We analyzed the performance of a group of children with ADHD during a transitive inference task, a task requiring first to learn the reciprocal relationship between adjacent items of a rank ordered series (e.g., A>B; B>C; C>D; D>E; E>F), and second, to deduct the relationship between novel pairs of items never matched during the learning (e.g., B>D; C>E). As a main result, we observed that children with ADHD were impaired in performing inferential reasoning problems. The deficit in relational reasoning was found to be related to the difficulty in managing a unified representation of ordered items. The present finding documented a novel deficit in ADHD, contributing to improving the understanding of the disorder. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  2. Involvement with Prior Job, Social Support, and the Perceived Quality of Life Among the Unemployed.

    DTIC Science & Technology

    1985-10-01

    C ’. .) 0t CL *= 0J$ 3 4 4- =~ 5- E 0- C > 4 0 0 -H,--- 0 04~ D 0 0 4- a) P’ 4 1 M - 1-J a)I r -i cJ C14 H 0 If0 "*~- 0u w U...irstance, and oD¢ychoioqica] counr ixnq. T.,’ aLs;ence o; auiv i- . - . . . . . + + . .+ + + = +- + : .- - -- - - .- -. • ,- e . .- ’ . r ...44 * -4O5- - 𔃽: 0 r : -4 C1nC r :, C 04a n0 C4-W V)0’. d) 4- ’.o -44 -4 0’ ’-0 U) - - 41 r_~ w~ V0 .. e0P 0 0 nM C .ri4- W - 0r 41 -4- ca a) Aj cu 0

  3. Absolute branching fraction measurements of exclusive D0 semileptonic decays.

    PubMed

    Coan, T E; Gao, Y S; Liu, F; Artuso, M; Boulahouache, C; Blusk, S; Butt, J; Dambasuren, E; Dorjkhaidav, O; Li, J; Menaa, N; Mountain, R; Nandakumar, R; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Csorna, S E; Bonvicini, G; Cinabro, D; Dubrovin, M; Briere, R A; Chen, G P; Chen, J; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Rosner, J L; Adam, N E; Alexander, J P; Berkelman, K; Cassel, D G; Crede, V; Duboscq, J E; Ecklund, K M; Ehrlich, R; Fields, L; Gibbons, L; Gittelman, B; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Hsu, L; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Meyer, T O; Onyisi, P U E; Patterson, J R; Peterson, D; Pivarski, J; Phillips, E A; Riley, D; Ryd, A; Sadoff, A J; Schwarthoff, H; Shepherd, M R; Stroiney, S; Sun, W M; Urner, D; Wilksen, T; Weinberger, M; Athar, S B; Avery, P; Breva-Newell, L; Patel, R; Potlia, V; Stoeck, H; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Gollin, G D; Karliner, I; Kim, D; Lowrey, N; Naik, P; Sedlack, C; Selen, M; Williams, J; Wiss, J; Edwards, K W; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Gong, D T; Kubota, Y; Klein, T; Lang, B W; Li, S Z; Poling, R; Scott, A W; Smith, A; Dobbs, S; Metreveli, Z; Seth, K K; Tomaradze, A; Zweber, P; Ernst, J; Mahmood, A H; Severini, H; Asner, D M; Dytman, S A; Love, W; Mehrabyan, S; Mueller, J A; Savinov, V; Li, Z; Lopez, A; Mendez, H; Ramirez, J; Huang, G S; Miller, D H; Pavlunin, V; Sanghi, B; Shibata, E I; Shipsey, I P J; Adams, G S; Chasse, M; Cravey, M; Cummings, J P; Danko, I; Napolitano, J; He, Q; Muramatsu, H; Park, C S; Park, W; Thorndike, E H

    2005-10-28

    With the first data sample collected by the CLEO-c detector at the psi(3770) resonance we have studied four exclusive semileptonic decays of the D0 meson. Our results include the first observation and absolute branching fraction measurement for D0 --> p-e+ve and improved measurements of the absolute branching fractions for D0 decays to K-e+ve, pi-e+ve, and K*-e+ve.

  4. The detection of Rh antigens (D,C,c,E,e) on bloodstains by a micro-elution technique using low ionic strength solution (LISS) and papain-treated red cells.

    PubMed

    Bargagna, M; Sabelli, M; Giacomelli, C

    1982-01-01

    Ninety experimental bloodstains, were examined, with the intention of detecting the principal Rh antigens, by using a micro-elution method improved by the use of low ionic strength solution (LISS) and papain-treated red cells. This method makes it possible to employ most commercially produced sera in routine forensic haematology laboratory work. The antigens could regularly be detected in stains of the following ages: D, C and c in stains of at least 6 months, E in stains of at least 4 months, and e in stains of at least 2 months.

  5. A Precise Measurement of the Deuteron Elastic Structure Function A(Q 2)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Honegger, Andrian

    1999-12-07

    During summer 1997 experiment 394-018 measured the deuteron tensor polarization in D(e,e'more » $$vec\\{d}$$) scattering in Hall C at Jefferson Laboratory. In a momentum transfer range between 0.66 and 1.8 (GeV=c) 2, with slight changes in the experimental setup, the collaboration performed six precision measurements of the deuteron structure function A(Q 2) in elastic D(e,e'd) scattering . Scattered electrons and recoil deuterons were detected in coincidence in the High Momentum Spectrometer and the recoil polarimeter POLDER, respectively. At every kinematics H(e,e') data were taken to study systematic effects of the measurement. These new precise measurements resolve discrepancies between older data sets and put significant constraints on existing models of the deuteron electromagnetic structure. This work was supported by the Swiss National Science Foundation, the French Centre National de la Recherche Scientifique and the Commissariat 'a l'Energie Atomique, the U.S. Department of Energy and the National Science Foundation and the K.C. Wong Foundation.« less

  6. Effect of solvent quality on aggregate structures of common surfactants.

    PubMed

    Hollamby, Martin J; Tabor, Rico; Mutch, Kevin J; Trickett, Kieran; Eastoe, Julian; Heenan, Richard K; Grillo, Isabelle

    2008-11-04

    Aggregate structures of two model surfactants, AOT and C12E5 are studied in pure solvents D2O, dioxane-d8 (d-diox) and cyclohexane-d12 (C6D12) as well as in formulated D2O/d-diox and d-diox/C6D12 mixtures. As such these solvents and mixtures span a wide and continuous range of polarities. Small-angle neutron scattering (SANS) has been employed to follow an evolution of the preferred aggregate curvature, from normal micelles in high polarity solvents, through to reversed micelles in low polarity media. SANS has also been used to elucidate the micellar size, shape as well as to highlight intermicellar interactions. The results shed new light on the nature of aggregation structures in intermediate polarity solvents, and point to a region of solvent quality (as characterized by Hildebrand Solubility Parameter, Snyder polarity parameter or dielectric constant) in which aggregation is not favored. Finally these observed trends in aggregation as a function of solvent quality are successfully used to predict the self-assembly behavior of C12E5 in a different solvent, hexane-d14 (C6D14).

  7. Annual Trauma Anesthesia and Critical Care Symposium (6th) Held in Baltimore, MD on 20-23 May 1993

    DTIC Science & Technology

    1993-10-01

    increasing intracranial pressure, and increased metabolic demand (e.g. seizures or fever ), however, may be attenuated with appropriate care. In...Dyspnea C. Cyanosis D. Headache E. Irritability F. Confusion G. Tachycardia S H. Pyrexia I. Petechial Rash VII. Clinical Findings (Severe F.E.S.) A...Frank Pulmonary Edema B. Convulsions/Coma C. ECG Showing Right Heart Strain D. Pyrexia E. Petechial Hemorrhage F. Jaundice G. Renal Impairment S O

  8. Frequency Comb Spectroscopy - From IR to XUV

    DTIC Science & Technology

    2015-06-09

    time resolution of 25 s. Publications: [1] A. Cingöz, Yost, D. C. , Allison, T. K. , Ruehl, A. , Fermann, M. E. , Hartl , I. , and Ye, J...J. , Eikema, K. S. E. , Fermann, M. E. , Hartl , I. , and Ye, J. , “Full phase stabilization of a Yb:fiber femtosecond frequency comb via high...D. C. , Allison, T. K. , Ruehl, A. , Fermann, M. E. , Hartl , I. , and Ye, J. , “Direct frequency comb spectroscopy in the extreme ultraviolet”, Nature

  9. Personality and Politics: The Untold Story of Robert S. McNamara and Curtis E. Lemay

    DTIC Science & Technology

    2012-06-01

    James H. Douglas, Jr . F.F. Everest William C. Garland Harry E. Goldsworthy Brian S. Gunderson Ernest C. Hardin, Jr . Michael J. Ingelido Leon W...Schriever Alton D. Slay Frederick H. Smith F.H. Smith, Jr . Guyford H. Steven Maxwell D. Taylor John W. Vogt Adriel N. Williams E.M. Zuckert...of Oahu, Hawaii. 22 Curtis E. LeMay Oral History Interview conducted by Edgar F. Puryear, Jr . 17

  10. 1,2-Dichlorohexafluoro-Cyclobutane (1,2-c-C4F6Cl2, R-316c) a Potent Ozone Depleting Substance and Greenhouse Gas: Atmospheric Loss Processes, Lifetimes, and Ozone Depletion and Global Warming Potentials for the (E) and (Z) stereoisomers

    NASA Technical Reports Server (NTRS)

    Papadimitriou, Vassileios C.; McGillen, Max R.; Smith, Shona C.; Jubb, Aaron M.; Portmann, Robert W.; Hall, Bradley D.; Fleming, Eric L.; Jackman, Charles H.; Burkholder, James B.

    2013-01-01

    The atmospheric processing of (E)- and (Z)-1,2-dichlorohexafluorocyclobutane (1,2-c-C4F6Cl2, R-316c) was examined in this work as the ozone depleting (ODP) and global warming (GWP) potentials of this proposed replacement compound are presently unknown. The predominant atmospheric loss processes and infrared absorption spectra of the R-316c isomers were measured to provide a basis to evaluate their atmospheric lifetimes and, thus, ODPs and GWPs. UV absorption spectra were measured between 184.95 to 230 nm at temperatures between 214 and 296 K and a parametrization for use in atmospheric modeling is presented. The Cl atom quantum yield in the 193 nm photolysis of R- 316c was measured to be 1.90 +/- 0.27. Hexafluorocyclobutene (c-C4F6) was determined to be a photolysis co-product with molar yields of 0.7 and 1.0 (+/-10%) for (E)- and (Z)-R-316c, respectively. The 296 K total rate coefficient for the O(1D) + R-316c reaction, i.e., O(1D) loss, was measured to be (1.56 +/- 0.11) × 10(exp -10)cu cm/ molecule/s and the reactive rate coefficient, i.e., R-316c loss, was measured to be (1.36 +/- 0.20) × 10(exp -10)cu cm/molecule/s corresponding to a approx. 88% reactive yield. Rate coefficient upper-limits for the OH and O3 reaction with R-316c were determined to be <2.3 × 10(exp -17) and <2.0 × 10(exp -22)cu cm/molecule/s, respectively, at 296 K. The quoted uncertainty limits are 2(sigma) and include estimated systematic errors. Local and global annually averaged lifetimes for the (E)- and (Z)-R-316c isomers were calculated using a 2-D atmospheric model to be 74.6 +/- 3 and 114.1 +/-10 years, respectively, where the estimated uncertainties are due solely to the uncertainty in the UV absorption spectra. Stratospheric photolysis is the predominant atmospheric loss process for both isomers with the O(1D) reaction making a minor, approx. 2% for the (E) isomer and 7% for the (Z) isomer, contribution to the total atmospheric loss. Ozone depletion potentials for (E)- and (Z)-R-316c were calculated using the 2-D model to be 0.46 and 0.54, respectively. Infrared absorption spectra for (E)- and (Z)-R-316c were measured at 296 K and used to estimate their radiative efficiencies (REs) and GWPs; 100-year time-horizon GWPs of 4160 and 5400 were obtained for (E)- and (Z)-R-316c, respectively. Both isomers of R-316c are shown in this work to be long-lived ozone depleting substances and potent greenhouse gases.

  11. Prime Contract Awards by FSC/SVC and Purchasing Office in Excess of $100,000. FY 1993. Part 4. Q101 Dependent Medicare Services - Z300 Main/Restoration Activities

    DTIC Science & Technology

    1994-03-01

    4e A[ -C U) caa -j cn40 -j = L o o t U~ V)0 (4 *OF Laa el 9L cn U 4 COUn Lfl4oe I- lv, *) Ci - W 4 ) u wm.) (.3n 04 LU 0 en 01 c- >- a) N (A3 03 wto...C)1 01 DU cn 0 4Nq PC0 %.W 0 .4 00 1* 0(V)10(000omONW0010 Nw ýwo W4 MW~( ,4..(-4 W to(D cn C.) Ln N. CY CU A -I-0 In Om ce 401NN0 t .. ( -4 en qt0...0D00~00 EYýI - o v %- 1.L DCJ o m m00D-acDl 4-4cvný L 0 (D -it(CVI~ ý Iv f ( v.Or-c u Lj0 ( en () GO o~ 0. UU 41 LU o n y ( -0 V3O E e)Nw0W0 0 (14 -t c

  12. Observation of a Novel Low-Lying Excited State in Zinc Complexes.

    DTIC Science & Technology

    1985-01-22

    Illinois 61801 Washington, D.C. 20375 Dr. W. M. Jackson Dr. George E. Walrafen Department of Chemistry Department of Chemistry Howard University Howard ... University Washington, D.C. 20059 Washington, D.C. 20059 Dr. M. S. Wrighton Dr. Joe Brandelik Department of Chemistry AFWAL/AADO-1 Massachusetts

  13. Study of the semileptonic charm decays D0→π-e+νe, D+→π0e+νe, D0→K-e+νe, and D+→ Kmacr 0e+νe

    NASA Astrophysics Data System (ADS)

    Dobbs, S.; Metreveli, Z.; Seth, K. K.; Tomaradze, A.; Ernst, J.; Severini, H.; Dytman, S. A.; Love, W.; Savinov, V.; Aquines, O.; Li, Z.; Lopez, A.; Mehrabyan, S.; Mendez, H.; Ramirez, J.; Huang, G. S.; Miller, D. H.; Pavlunin, V.; Sanghi, B.; Shipsey, I. P. J.; Xin, B.; Adams, G. S.; Anderson, M.; Cummings, J. P.; Danko, I.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C. S.; Thorndike, E. H.; Yang, F.; Coan, T. E.; Gao, Y. S.; Liu, F.; Artuso, M.; Blusk, S.; Butt, J.; Li, J.; Menaa, N.; Mountain, R.; Nisar, S.; Randrianarivony, K.; Redjimi, R.; Sia, R.; Skwarnicki, T.; Stone, S.; Wang, J. C.; Zhang, K.; Csorna, S. E.; Bonvicini, G.; Cinabro, D.; Dubrovin, M.; Lincoln, A.; Asner, D. M.; Edwards, K. W.; Briere, R. A.; Brock, I.; Chen, J.; Ferguson, T.; Tatishvili, G.; Vogel, H.; Watkins, M. E.; Rosner, J. L.; Adam, N. E.; Alexander, J. P.; Berkelman, K.; Cassel, D. G.; Duboscq, J. E.; Ecklund, K. M.; Ehrlich, R.; Fields, L.; Gibbons, L.; Gray, R.; Gray, S. W.; Hartill, D. L.; Heltsley, B. K.; Hertz, D.; Jones, C. D.; Kandaswamy, J.; Kreinick, D. L.; Kuznetsov, V. E.; Mahlke-Krüger, H.; Onyisi, P. U. E.; Patterson, J. R.; Peterson, D.; Pivarski, J.; Riley, D.; Ryd, A.; Sadoff, A. J.; Schwarthoff, H.; Shi, X.; Stroiney, S.; Sun, W. M.; Wilksen, T.; Weinberger, M.; Athar, S. B.; Patel, R.; Potlia, V.; Yelton, J.; Rubin, P.; Cawlfield, C.; Eisenstein, B. I.; Karliner, I.; Kim, D.; Lowrey, N.; Naik, P.; Sedlack, C.; Selen, M.; White, E. J.; Wiss, J.; Shepherd, M. R.; Besson, D.; Pedlar, T. K.; Cronin-Hennessy, D.; Gao, K. Y.; Gong, D. T.; Hietala, J.; Kubota, Y.; Klein, T.; Lang, B. W.; Poling, R.; Scott, A. W.; Smith, A.; Zweber, P.

    2008-06-01

    Using a sample of 1.8 million D Dmacr mesons collected at the ψ(3770) with the CLEO-c detector, we study the semileptonic decays D0→π-e+νe, D+→π0e+νe, D0→K-e+νe, and D+→ Kmacr 0e+νe. For the total branching fractions we find B(D0→π-e+νe)=0.299(11)(9)%, B(D+→π0e+νe)=0.373(22)(13)%, B(D0→K-e+νe)=3.56(3)(9)%, and B(D+→ Kmacr 0e+νe)=8.53(13)(23)%, where the first error is statistical and the second systematic. In addition, form factors are studied through fits to the partial branching fractions obtained in five q2 ranges. By combining our results with recent unquenched lattice calculations, we obtain |Vcd|=0.217(9)(4)(23) and |Vcs|=1.015(10)(11)(106), where the final error is theoretical.

  14. Affordability of Defense Acquisition Programs

    DTIC Science & Technology

    2015-02-01

    I N S T I T U T E F O R D E F E N S E A N A L Y S E S IDA Paper P-5243 Redacted February 2015 Affordability of Defense Acquisition Programs...Gene H. Porter, Project Leader Kathleen M. Conley C. Vance Gordon R . Royce Kneece, Jr. Brian Q. Rieksts Alan H. Shaw David M. Tate INSTITUTE FOR DEFENSE...Kathleen M. Conley C. Vance Gordon R . Royce Kneece, Jr. Brian Q. Rieksts Alan H. Shaw David M. Tate I N S T I T U T E F O R D E F E N S E A N A L Y S E

  15. 24 CFR 16.15 - Specific exemptions.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...), (e)(1), (e)(4) (G), (H), (I), and (f). This exemption allows the Department to withhold records... under 5 U.S.C. 552(k)(5) from the requirements of 5 U.S.C. 552a (c)(3), (d), (e)(1), (e)(4), (G), (H... subsection (e)(1) because it is often impossible to determine relevance or necessity of information in pre...

  16. Acute Respiratory Distress Syndrome Secondary to Inhalation of Chlorine Gas in Sheep

    DTIC Science & Technology

    2006-05-01

    group.52,53 The pulmonary parenchyma was separated into four regions based on the Hounsfield unit (HU) ranges reported by Gattinoni et al.54...values from Dunnet’s t test, comparing groups 2, 3, and 4 to group 1. Hyper, fraction of pixels in the lung slice with Hounsfield Unit (HU) values in...D. K. Jordan, B. S. Dick, E. J. Fudge, J. Baird, C. A. Hardin, D. E. Cancio, L. C. 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7

  17. Nothing New Under the Sun: Benefiting from the Great Lessons of History to Develop a Coherent Cyberspace Deterrence Strategy

    DTIC Science & Technology

    2012-05-12

    LESSONS OF HISTORY TO DEVELOP A COHERENT CYBERSPACE DETERRENCE STRATEGY 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHDR!SI 5d. PROJECT ...AFOSR-82-1234. 5c. PROGRAM ELEMENT NUMBER. Enter all program element numbers as they appear in the report, e.g. 61101 A. 5d. PROJECT NUMBER...Enter all project numbers as they appear in the report, e.g. 1F665702D1257; ILIR. 5e. TASK NUMBER. Enter all task numbers as they appear in the

  18. PBP5, PBP6 and DacD play different roles in intrinsic β-lactam resistance of Escherichia coli.

    PubMed

    Sarkar, Sujoy Kumar; Dutta, Mouparna; Chowdhury, Chiranjit; Kumar, Akash; Ghosh, Anindya S

    2011-09-01

    Escherichia coli PBP5, PBP6 and DacD, encoded by dacA, dacC and dacD, respectively, share substantial amino acid identity and together constitute ~50 % of the total penicillin-binding proteins of E. coli. PBP5 helps maintain intrinsic β-lactam resistance within the cell. To test if PBP6 and DacD play simlar roles, we deleted dacC and dacD individually, and dacC in combination with dacA, from E. coli 2443 and compared β-lactam sensitivity of the mutants and the parent strain. β-Lactam resistance was complemented by wild-type, but not dd-carboxypeptidase-deficient PBP5, confirming that enzymic activity of PBP5 is essential for β-lactam resistance. Deletion of dacC and expression of PBP6 during exponential or stationary phase did not alter β-lactam resistance of a dacA mutant. Expression of DacD during mid-exponential phase partially restored β-lactam resistance of the dacA mutant. Therefore, PBP5 dd-carboxypeptidase activity is essential for intrinsic β-lactam resistance of E. coli and DacD can partially compensate for PBP5 in this capacity, whereas PBP6 cannot.

  19. Department of the Army Procurement Programs. Committee Staff Procurement Backup Book FY 2001 Budget Estimate. Procurement of Ammunition, Army.

    DTIC Science & Technology

    2000-02-01

    tD c...UJ _i UJ 2 o o UJ 1- 2 O o 2 o w «N o 0. § >- u. Ü u z til < V 3 _i < 2 u. a. -b o 3 CN i 0. o a. CO ci a. T- T- 1^ tD ...Tf <=f >- CM CN CN u_ © CD •a a> J3 o o CD CO to Z c CM Ö Ö Ö £ E >• "*" T~ JB tD u_ ~ UJ a. E E ɘ o a. o c i o o CM CM CM W a CM

  20. Hepatitis C Screening in the Behavioral Healthcare Setting

    MedlinePlus

    ... Academies Press. 15 Hagan, H., Pouget, E. R., & Des Jarlais, D. C. (2011). A systematic review and ... B., Zeremski, M., Jacobson, I. M., Hagan, H., Des Jarlais, D. C., & Talal, A. H. (2013). Determinants ...

  1. Absolute branching fraction measurements for D+ and D0 inclusive semileptonic decays.

    PubMed

    Adam, N E; Alexander, J P; Berkelman, K; Cassel, D G; Duboscq, J E; Ecklund, K M; Ehrlich, R; Fields, L; Gibbons, L; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Meyer, T O; Onyisi, P U E; Patterson, J R; Peterson, D; Pivarski, J; Riley, D; Ryd, A; Sadoff, A J; Schwarthoff, H; Shi, X; Stroiney, S; Sun, W M; Wilksen, T; Weinberger, M; Athar, S B; Patel, R; Potlia, V; Stoeck, H; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Karliner, I; Kim, D; Lowrey, N; Naik, P; Sedlack, C; Selen, M; White, E J; Wiss, J; Shepherd, M R; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Gong, D T; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Poling, R; Scott, A W; Smith, A; Dobbs, S; Metreveli, Z; Seth, K K; Tomaradze, A; Zweber, P; Ernst, J; Severini, H; Dytman, S A; Love, W; Savinov, V; Aquines, O; Li, Z; Lopez, A; Mehrabyan, S; Mendez, H; Ramirez, J; Huang, G S; Miller, D H; Pavlunin, V; Sanghi, B; Shipsey, I P J; Xin, B; Adams, G S; Anderson, M; Cummings, J P; Danko, I; Napolitano, J; He, Q; Insler, J; Muramatsu, H; Park, C S; Thorndike, E H; Coan, T E; Gao, Y S; Liu, F; Artuso, M; Blusk, S; Butt, J; Li, J; Menaa, N; Mountain, R; Nisar, S; Randrianarivony, K; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Csorna, S E; Bonvicini, G; Cinabro, D; Dubrovin, M; Lincoln, A; Asner, D M; Edwards, K W; Briere, R A; Brock, I; Chen, J; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Rosner, J L

    2006-12-22

    We present measurements of the inclusive branching fractions for the decays D+-->Xe+ nu(e) and D0-->Xe+ nu(e), using 281 pb(-1) of data collected on the psi(3770) resonance with the CLEO-c detector. We find B(D0-->Xe+ nu(e)) = (6.46+/-0.17+/-0.13)% and B(D+-->Xe+ nu(e)) = (16.13+/-0.20+/-0.33)%. Using the known D meson lifetimes, we obtain the ratio Gamma(D+)sl/Gamma(D0)sl = 0.985+/-0.028+/-0.015, confirming isospin invariance at the level of 3%. The positron momentum spectra from D+ and D0 have consistent shapes.

  2. NRL (Naval Research Laboratory) Plasma Formulary. Revised.

    DTIC Science & Technology

    1987-01-01

    ac)- 1 Resistance 4 7r o /Ar (Co//1o ) 1/2 Time 1 c Velocity Ck c- 18 MAXWELL’S EQUATIONS Name or Description SI f Gaussian OB 1lOB Faraday’s law V...x E -- V x E =- D t c Ot OD 1OD 4 -r Ampere’s law V x H = 6 +J x H = -+-J t c Ot c Poisson equation V • D = p V • D = 41rp [Absence of magnetic V...force/gravitational or V/NL buoyancy force) 1/ 2 Gay- Lussac Ga 1/1AT Inverse of relative change in volume during heating Grashof Gr gL S AT/ v

  3. Simulating Radar Signals for Detection Performance Evaluation.

    DTIC Science & Technology

    1981-02-01

    defined by g = e-(aO/e 3dB) 2 (70) where a = 1.6651 and 0 3dB Is the one-way half-power heamwidth, we note that from (60) and (68) a=( 03dB) 2 , ( 71 ...8217erform;ice of Some Nonparametric Rank Tests and an Alpplication to Radar," JEEE ’’ra.. Information Theory , Vol. IT-16, pp 309- 318 (c!;pecjally Section...V1 1 1 C . fl I V IC ’A It N FI (.LLTrif -I~d P’LE (,%I I CiRCS-SE CT IC& AREA C vu I$1 i rKI I %1 : 111. C I -PjI Ik ~I G%ft- 71 -Y: I I LAl. I J10F

  4. Field Demonstration Test Report for the AN/TRN-41 TACAN Navigational Set

    DTIC Science & Technology

    1977-01-14

    8217■- ’-■-»’-’■«"-"»« ^■„„„^»m.^, i IT imiiiriiMii mmmm mmvt.mMimvti\\i\\. „Muummmmmmm - i 8 x ♦- c c e& III us Ul Q. > D- <N o <- ♦* c ■n * 11 > x a < S ... op C V E * E 3 C E in m > x c a < 1? o z 00 > X a < CM > X ■a I a < x ɘ E c E a 10 < a c a> a a

  5. 20 CFR 903.8 - Exemptions.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... records only where appropriate from the following provisions: sections (c)(3); (d); (e)(1); (e)(4)(G), (e)(4)(H), and (e)(4)(I); and (f) of 5 U.S.C. 552a. (c) Reasons for claimed exemptions: (1) The Privacy Act of 1974 creates several methods by which individuals may learn of and obtain records containing...

  6. 20 CFR 903.8 - Exemptions.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... following provisions: subsections (c)(3), (d)(1), (2), (3) and (4), (e)(1), (c)(4)(G), (H) and (I), and (f... of 1974 creates several methods by which individuals may learn of and obtain records containing... investigating such individuals; subsections (d)(1), (e)(4)(H) and (f)(2), (3) and (5) establish the ability of...

  7. 32. SECTIONS AA, BB, CC, DD, AND EE WASTE CALCINATION ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    32. SECTIONS A-A, B-B, C-C, D-D, AND E-E WASTE CALCINATION FACILITY SHOWING RELATIONSHIPS OF DIFFERENT FLOOR LEVELS TO ONE ANOTHER. INEEL DRAWING NUMBER 200-0633-00-287-106353. FLUOR NUMBER 5775-CPP-633-A-3. - Idaho National Engineering Laboratory, Old Waste Calcining Facility, Scoville, Butte County, ID

  8. 75 FR 59741 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease COC69113

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-28

    ... the provisions of 30 U.S.C. 188(d) and (e), and 43 CFR 3108.2-3(a) and (b), the Bureau of Land... Section 31(d) and (e) of the Mineral Lands Leasing Act of 1920 (30 U.S.C. 188), and the BLM is proposing...

  9. 76 FR 28450 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease; Nevada

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-17

    ... terminated oil and gas lease. SUMMARY: Pursuant to the provisions of 30 U.S.C. 188(d) and (e), and 43 CFR... of the lease as set out in Section 31(d) and (e) of the Mineral Leasing Act of 1920 (30 U.S.C. 188...

  10. 78 FR 71731 - 2014 Standards for the Renewable Fuel Standard Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-29

    ... of E85 Consumption c. Proposed Projection of E85 Consumption in 2014 d. Estimating Total Ethanol Consumption in 2014 2. Estimating Availability of Non-Ethanol Renewable Fuel Volumes a. Non-Ethanol Cellulosic... Biofuel c. Option 3: Availability, Growth, and Limits on Ethanol Consumption D. Summary of Proposed Volume...

  11. 77 FR 24972 - National Institute of Mental Health Notice of Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-26

    ..., Neuroscience Center, 6001 Executive Boulevard, Conference Room C/D/E, Rockville, MD 20852. Closed: 1:15 p.m. to..., Neuroscience Center, 6001 Executive Boulevard, Conference Room C/D/E, Rockville, MD 20852. Contact Person: Jane... Health, NIH, Neuroscience Center, 6001 Executive Blvd., Room 6154, MSC 9609, Bethesda, MD 20892-9609, 301...

  12. 76 FR 51379 - National Institute of Mental Health Notice of Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-18

    ..., Neuroscience Center, 6001 Executive Boulevard, Conference Room C/D/E, Rockville, MD 20852. Closed: 1:30 p.m. to..., Neuroscience Center, 6001 Executive Boulevard, Conference Room C/D/E, Rockville, MD 20852. Contact Person: Jane..., NIH, Neuroscience Center, 6001 Executive Blvd., Room 6154, MSC 9609, Bethesda, MD 20892-9609, 301-443...

  13. 78 FR 52551 - National Institute of Mental Health; Notice of Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-23

    ...), Neuroscience Center, 6001 Executive Boulevard, Conference Room C/D/E, Rockville, MD 20852. Closed: 2:30 p.m. to..., Neuroscience Center, 6001 Executive Boulevard, Conference Room C/D/E, Rockville, MD 20852. Contact Person: Jane... Health, NIH, Neuroscience Center, 6001 Executive Blvd., Room 6154, MSC 9609, Bethesda, MD 20892-9609, 301...

  14. 77 FR 48998 - National Institute of Mental Health; Notice of Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-15

    ... Neuroscience Center, 6001 Executive Boulevard, Conference Room C/D/E, Rockville, MD 20852. Closed: 2:30 p.m. to... Neuroscience Center, 6001 Executive Boulevard, Conference Room C/D/E, Rockville, MD 20852. Contact Person: Jane... Health, NIH, Neuroscience Center, 6001 Executive Blvd., Room 6154, MSC 9609, Bethesda, MD 20892-9609, 301...

  15. Putative inhibitory training of a stimulus makes it a facilitator: a within-subject comparison of visual and auditory stimuli in autoshaping.

    PubMed

    Nakajima, S

    2000-03-14

    Pigeons were trained with the A+, AB-, ABC+, AD- and ADE+ task where each of stimulus A and stimulus compounds ABC and ADE signalled food (positive trials), and each of stimulus compounds AB and AD signalled no food (negative trials). Stimuli A, B, C and E were small visual figures localised on a response key, and stimulus D was a white noise. Stimulus B was more effective than D as an inhibitor of responding to A during the training. After the birds learned to respond exclusively on the positive trials, effects of B and D on responding to C and E, respectively, were tested by comparing C, BC, E and DE trials. Stimulus B continuously facilitated responding to C on the BC test trials, but D's facilitative effect was observed only on the first DE test trial. Stimulus B also facilitated responding to E on BE test trials. Implications for the Rescorla-Wagner elemental model and the Pearce configural model of Pavlovian conditioning were discussed.

  16. GPI Spectra of HR 8799 c, d, and e from 1.5 to 2.4 μm with KLIP Forward Modeling

    NASA Astrophysics Data System (ADS)

    Greenbaum, Alexandra Z.; Pueyo, Laurent; Ruffio, Jean-Baptiste; Wang, Jason J.; De Rosa, Robert J.; Aguilar, Jonathan; Rameau, Julien; Barman, Travis; Marois, Christian; Marley, Mark S.; Konopacky, Quinn; Rajan, Abhijith; Macintosh, Bruce; Ansdell, Megan; Arriaga, Pauline; Bailey, Vanessa P.; Bulger, Joanna; Burrows, Adam S.; Chilcote, Jeffrey; Cotten, Tara; Doyon, Rene; Duchêne, Gaspard; Fitzgerald, Michael P.; Follette, Katherine B.; Gerard, Benjamin; Goodsell, Stephen J.; Graham, James R.; Hibon, Pascale; Hung, Li-Wei; Ingraham, Patrick; Kalas, Paul; Larkin, James E.; Maire, Jérôme; Marchis, Franck; Metchev, Stanimir; Millar-Blanchaer, Maxwell A.; Nielsen, Eric L.; Norton, Andrew; Oppenheimer, Rebecca; Palmer, David; Patience, Jennifer; Perrin, Marshall D.; Poyneer, Lisa; Rantakyrö, Fredrik T.; Savransky, Dmitry; Schneider, Adam C.; Sivaramakrishnan, Anand; Song, Inseok; Soummer, Rémi; Thomas, Sandrine; Wallace, J. Kent; Ward-Duong, Kimberly; Wiktorowicz, Sloane; Wolff, Schuyler

    2018-06-01

    We explore KLIP forward modeling spectral extraction on Gemini Planet Imager coronagraphic data of HR 8799, using PyKLIP, and show algorithm stability with varying KLIP parameters. We report new and re-reduced spectrophotometry of HR 8799 c, d, and e in the H and K bands. We discuss a strategy for choosing optimal KLIP PSF subtraction parameters by injecting simulated sources and recovering them over a range of parameters. The K1/K2 spectra for HR 8799 c and d are similar to previously published results from the same data set. We also present a K-band spectrum of HR 8799 e for the first time and show that our H-band spectra agree well with previously published spectra from the VLT/SPHERE instrument. We show that HR 8799 c and d show significant differences in their H and K spectra, but do not find any conclusive differences between d and e, nor between c and e, likely due to large error bars in the recovered spectrum of e. Compared to M-, L-, and T-type field brown dwarfs, all three planets are most consistent with mid- and late-L spectral types. All objects are consistent with low gravity, but a lack of standard spectra for low gravity limit the ability to fit the best spectral type. We discuss how dedicated modeling efforts can better fit HR 8799 planets’ near-IR flux, as well as how differences between the properties of these planets can be further explored.

  17. The evolution of flaring and non-flaring active regions

    NASA Astrophysics Data System (ADS)

    Kilcik, A.; Yurchyshyn, V.; Sahin, S.; Sarp, V.; Obridko, V.; Ozguc, A.; Rozelot, J. P.

    2018-06-01

    According to the modified Zurich classification, sunspot groups are classified into seven different classes (A, B, C, D, E, F and H) based on their morphology and evolution. In this classification, classes A and B, which are small groups, describe the beginning of sunspot evolution, while classes D, E and F describe the large and evolved groups. Class C describes the middle phase of sunspot evolution and the class H describes the end of sunspot evolution. Here, we compare the lifetime and temporal evolution of flaring and non-flaring active regions (ARs), and the flaring effect on ARs in these groups in detail for the last two solar cycles (1996 through 2016). Our main findings are as follows: (i) Flaring sunspot groups have longer lifetimes than non-flaring ones. (ii) Most of the class A, B and C flaring ARs rapidly evolve to higher classes, while this is not applicable for non-flaring ARs. More than 50 per cent of the flaring A, B and C groups changed morphologically, while the remaining D, E, F and H groups did not change remarkably after the flare activity. (iii) 75 per cent of all flaring sunspot groups are large and complex. (iv) There is a significant increase in the sunspot group area in classes A, B, C, D and H after flaring activity. In contrast, the sunspot group area of classes E and F decreased. The sunspot counts of classes D, E and F decreased as well, while classes A, B, C and H showed an increase.

  18. Vegetation and Channel Morphology Responses to Ordinary High Water Discharge Events in Arid West Stream Channels

    DTIC Science & Technology

    2009-05-01

    a rc h a n d E n gi n e e ri n g La b o ra to ry Approved for public release; distribution is unlimited. ERDC/CRREL TR-09-5 May 2009...21 Appendix B . Aerial Imagery and Discharge Events..........................................................................22 Appendix C...3 Figure 2. The Arid West region as defined by Land Resource Regions B , C, and D

  19. NAVSEA 05D Ship Design and Certification Network Knowledge Management Project

    DTIC Science & Technology

    2007-09-12

    Junod , Vinek Kaistha N SW C C D -C IS D -2 00 7/ 00 1 REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188 Public reporting burden for this...NUMBER 5d. PROJECT NUMBER 5e. TASK NUMBER 6. AUTHOR(S) John Junod , LCdr Mark Read, Vinek Kaistha 5f. WORK UNIT NUMBER 06-1-2002

  20. 75 FR 29601 - Notice of Final Federal Agency Actions on a Proposed Highway Project in California

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-26

    ... Act (RCRA) [42 U.S.C. 6901-6992(k)]. 9. Executive Orders: E.O. 11990 Protection of Wetlands; E.O... Preservation Act of 1966, as amended [16 U.S.C. 470(aa)-11]; Archeological Resources Protection Act of 1977 [16... and Economic: Civil Rights Act of 1964 [42 U.S.C. 2000(d)-2000(d)(1)]; Farmland Protection Policy Act...

  1. Parallel sequencing lives, or what makes large sequencing projects successful.

    PubMed

    Quilez, Javier; Vidal, Enrique; Dily, François Le; Serra, François; Cuartero, Yasmina; Stadhouders, Ralph; Graf, Thomas; Marti-Renom, Marc A; Beato, Miguel; Filion, Guillaume

    2017-11-01

    T47D_rep2 and b1913e6c1_51720e9cf were 2 Hi-C samples. They were born and processed at the same time, yet their fates were very different. The life of b1913e6c1_51720e9cf was simple and fruitful, while that of T47D_rep2 was full of accidents and sorrow. At the heart of these differences lies the fact that b1913e6c1_51720e9cf was born under a lab culture of Documentation, Automation, Traceability, and Autonomy and compliance with the FAIR Principles. Their lives are a lesson for those who wish to embark on the journey of managing high-throughput sequencing data. © The Author 2017. Published by Oxford University Press.

  2. Highly sulfated hexasaccharide sequences isolated from chondroitin sulfate of shark fin cartilage: insights into the sugar sequences with bioactivities.

    PubMed

    Mizumoto, Shuji; Murakoshi, Saori; Kalayanamitra, Kittiwan; Deepa, Sarama Sathyaseelan; Fukui, Shigeyuki; Kongtawelert, Prachya; Yamada, Shuhei; Sugahara, Kazuyuki

    2013-02-01

    Chondroitin sulfate (CS) chains regulate the development of the central nervous system in vertebrates and are linear polysaccharides consisting of variously sulfated repeating disaccharides, [-4GlcUAβ1-3GalNAcβ1-](n), where GlcUA and GalNAc represent D-glucuronic acid and N-acetyl-D-galactosamine, respectively. CS chains containing D-disaccharide units [GlcUA(2-O-sulfate)-GalNAc(6-O-sulfate)] are involved in the development of cerebellar Purkinje cells and neurite outgrowth-promoting activity through interaction with a neurotrophic factor, pleiotrophin, resulting in the regulation of signaling. In this study, to obtain further structural information on the CS chains containing d-disaccharide units involved in brain development, oligosaccharides containing D-units were isolated from a shark fin cartilage. Seven novel hexasaccharide sequences, ΔO-D-D, ΔA-D-D, ΔC-D-D, ΔE-A-D, ΔD-D-C, ΔE-D-D and ΔA-B-D, in addition to three previously reported sequences, ΔC-A-D, ΔC-D-C and ΔA-D-A, were isolated from a CS preparation of shark fin cartilage after exhaustive digestion with chondroitinase AC-I, which cannot act on the galactosaminidic linkages bound to D-units. The symbol Δ stands for a 4,5-unsaturated bond of uronic acids, whereas A, B, C, D, E and O represent [GlcUA-GalNAc(4-O-sulfate)], [GlcUA(2-O-sulfate)-GalNAc(4-O-sulfate)], [GlcUA-GalNAc(6-O-sulfate)], [GlcUA(2-O-sulfate)-GalNAc(6-O-sulfate)], [GlcUA-GalNAc(4-O-, 6-O-sulfate)] and [GlcUA-GalNAc], respectively. In binding studies using an anti-CS monoclonal antibody, MO-225, the epitopes of which are involved in cerebellar development in mammals, novel epitope structures, ΔA-D-A, ΔA-D-D and ΔA-B-D, were revealed. Hexasaccharides containing two consecutive D-units or a B-unit will be useful for the structural and functional analyses of CS chains particularly in the neuroglycobiological fields.

  3. In-Situ Approach to Introduce Flux Pinning in YBCO (Postprint)

    DTIC Science & Technology

    2012-02-01

    Malozemoff, N. Nguyen, E. Siegal, D. Buczek, J. Lynch, J. Scudiere, M. Rupich, A. Goyal, E.D. Specht , P. Martin, and M. Paranthaman, Supercond. Sci...Peterson, L. Stan, and L.A. Emmert, Physica C. 382,43-47 (2002). [10] A. Goyal, D.F. Lee, F.A. List, E.D. Specht , R. Feenstra, M. Paranthaman, X. Cui, S.W...Gapud, M. Varela, M. Paranthaman, A. 0. Ijaduola, E.D. Specht , J.R. Thompson, O.K. Christen, S.J. Pennycook, and F.A. List, Supercond. Sci. Techno

  4. Biochemical and genetic characterization of the vanC-2 vancomycin resistance gene cluster of Enterococcus casseliflavus ATCC 25788.

    PubMed

    Dutta, Ireena; Reynolds, Peter E

    2002-10-01

    The vanC-2 cluster of Enterococcus casseliflavus ATCC 25788 consisted of five genes (vanC-2, vanXY(C-2), vanT(C-2), vanR(C-2), and vanS(C-2)) and shared the same organization as the vanC cluster of E. gallinarum BM4174. The proteins encoded by these genes displayed a high degree of amino acid identity to the proteins encoded within the vanC gene cluster. The putative D,D-dipeptidase-D,D-carboxypeptidase, VanXY(C-2), exhibited 81% amino acid identity to VanXY(C), and VanT(C-2) displayed 65% amino acid identity to the serine racemase, VanT. VanR(C-2) and VanS(C-2) displayed high degrees of identity to VanR(C) and VanS(C), respectively, and contained the conserved residues identified as important to their function as a response regulator and histidine kinase, respectively. Resistance to vancomycin was expressed inducibly in E. casseliflavus ATCC 25788 and required an extended period of induction. Analysis of peptidoglycan precursors revealed that UDP-N-acetylmuramyl-L-Ala-delta-D-Glu-L-Lys-D-Ala-D-Ser could not be detected until several hours after the addition of vancomycin, and its appearance coincided with the resumption of growth. The introduction of additional copies of the vanT(C-2) gene, encoding a putative serine racemase, and the presence of supplementary D-serine in the growth medium both significantly reduced the period before growth resumed after addition of vancomycin. This suggested that the availability of D-serine plays an important role in the induction process.

  5. Shielding Analysis of a Small Compact Space Nuclear Reactor

    DTIC Science & Technology

    1987-08-01

    RESPONSE) =4, MAXWELLIAN FISSION SPECTRUM (ILNTEGRAL RESPONSE) =5, LOS ALAMOS FISSION SPECTRUM, 1982 (INTEGRAL RESPONSE) =6, VITAMIN C NEUTRON SPECTRUM...Appendices Appendix A: Calculations of Effective Radii.. A-1 Appendix B: Atom Density Calculations for FEMPlD and FEMP2D ................ B-I Appendix C ...FEMPID and FEM22D Data........... C -i Appendix D: Energy Group Definition .......... D-I Appendix E: Transport Equation, Legendr4 Polynomial

  6. The Subchronic Inhalation Toxicity of DF2 (Diesel Fuel) Used in Vehicle Engine Exhaust Smoke Systems (VEESS).

    DTIC Science & Technology

    1986-03-01

    4-I +4 .- -+ + _C tL+ + + +i + T + +- + - -) 4. c_ --- - * - 4A _ __ _ -- 0 0 ICx" C ) 4j cliou 0 N4cr(\\lc’ + + ++ ++ + + +1 -4++111+ = 0 m x...Charles L. Crouse SP6 David C . Burnett Garnet E. Affleck Dale H. Heitkamp Edmund G. Cummings, Ph.D. Carlyle Lilly Richard L. Farrand, Ph.D. Joseph J...Feeney, Ph.D. Robert W. Dorsey Michael Rausa SP6 Mohammed S. Ghumman Ernest H. Kandel Robert D. Armstrong Jeffrey D. Bergmann William C . Stark. John

  7. Development of Thermoplastic Structural Adhesives

    DTIC Science & Technology

    1977-03-01

    v. Q a u (J «a: 0) ,— 3: o ! < o r- <" •t— •r— c o QJ +J i u- ! -C E N E S- S- u •r- •r— tD O UJ on OL 3 -r...r— 1- •o • t>. 3: CO oc 0) o 3 C7> o U. ^ <a in >- (ISd) Hi9N3MiS aV3HS dVl 70 1 ■■V’jiWi- • fcia,-- j^e^a^^^^ jaj ^^^jjM^t^j^t

  8. Summary of Synoptic Meteorological Observations. Indonesian Coastal Marine Areas. Volume 1. Area 1 - Southeast Sumatra. Area 2 - Christmas Island. Area 3 - Sunda Strait. Area 4 - Northwest Java Sea. Area 5 - Bangka Island Northwest. Area 6 - Natuna Island. Area 7 - Sarawak

    DTIC Science & Technology

    1975-04-01

    AD/ A -006 923 SUMMARY OF SYNOPTIC METEOROLOGICAL OBSERVATIONS. INDONESIAN COASTAL MARINE AREAS. VOLUME I. AREA 1 - SOUTHEAST SUMATRA. AREA 2...Weather Service Command Washington, D. C. April 1975 ;V, A DISTRIBUTED BY: Nausm Tsciulca Iufennls Suvm• U. S. DEPARTMENT OF COMMERCE 2 z z 0 0 ~ > o CI2LI...00 4 bO >~ d) cn q 00 ca (n~ -0E 4) fl) U C 0 E CD o :Cu -V 0. Cau . .t $4 Cu a X k) 04. " # Cu c.. - u 0- u c0 E Q =E 0 ca- 1 ca 4).,u 04$ = a )E ==r

  9. Evaluation of the Effects of Atorvastatin and Ischemic Postconditioning Preventing on the Ischemia and Reperfusion Injury: Experimental Study in Rats

    PubMed Central

    Pontes, Henrique Budib Dorsa; Pontes, José Carlos Dorsa Vieira; de Azevedo Neto, Euler; Vendas, Giovanna Serra da Cruz; Miranda, João Victor Cunha; Dias, Letícia do Espírito Santos; Oliva, João Victor Durães Gomes; de Almeida, Murilo Henrique Martins; Chaves, Ian de Oliveira; Sampaio, Tricia Luna; dos Santos, Carlos Henrique Marques; Dourado, Doroty Mesquita

    2018-01-01

    Introduction Reperfusion injury leads to systemic morphological and functional pathological alterations. Some techniques are already estabilished to attenuate the damage induced by reperfusion. Ischemic preconditioning is one of the standard procedures. In the last 20 years, several experimental trials demonstrated that the ischemic postconditioning presents similar effectiveness. Recently experimental trials demonstrated that statins could be used as pharmacological preconditioning. Methods 41 Wistar rats (Rattus norvegicus albinus) were distributed in 5 groups: Ischemia and Reperfusion (A), Ischemic Postconditioning (B), Statin (C), Ischemic Postconditioning + Statins (D) and SHAM (E). After euthanasia, lungs, liver, kidneys and ileum were resected and submitted to histopathological analysis. Results The average of lung parenchymal injury was A=3.6, B=1.6, C=1.2, D=1.2, E=1 (P=0.0029). The average of liver parenchymal injury was A=3, B=1.5, C=1.2, D=1.2, E = 0 (P<0.0001). The average of renal parenchymal injury was A=4, B=2.44, C=1.22, D=1.11, E=1 (P<0.0001). The average of intestinal parenchymal injury was A=2, B=0.66, C=0, D=0, E=0 (P=0.0006). The results were submitted to statistics applying Kruskal-Wallis test, estabilishing level of significance P<0.05. Conclusion Groups submitted to ischemic postconditioning, to pre-treatment with statins and both methods associated demonstrated less remote reperfusion injuries, compared to the group submitted to ischemia and reperfusion without protection. PMID:29617505

  10. Research progress in some traditional and non-traditional medicinal species in the USDA, ARS, PGRCU (S9) germplasm collection

    USDA-ARS?s Scientific Manuscript database

    Flavonoids and anthocyanins have shown anti-cancer activities in humans. Therefore, fruit and leaves from several accessions of Abutilon theophrasti Medik., and seeds from Desmodium discolor Vogel, D. incanum (G. Mey) D.C., D. intortum (Mill.) Urb., D. sandwicense E. Mey., D. tortuosum (Sw.) D.C., H...

  11. Contributions of Severe Burn and Disuse to Bone Structure and Strength in Rats

    DTIC Science & Technology

    2013-01-01

    Johnson d, S.E. Wolf a,e, C.E. Wade a,b a US Army Institute of Surgical Research, 3611 Rawley E Chambers, Fort Sam Houston, TX 78234, USA b The...of Surgical Research, JBSA Fort Sam Houston, TX 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10...Miner Res 1991;6:759-66. [13] Laib A, Barou O, Vico L, Lafage-Proust MH, Alexandre C, Rugsegger P. 3D micro- computed tomography of trabecular and

  12. Dollar Summary of Federal Supply Classification and Service Category by Company, FY 85. Part 10 (7035-9150).

    DTIC Science & Technology

    1985-01-01

    U nU p U ) ( A W c AV )U IlDl00 0 (0 0 0a( 0C x III z z zzzz .II, I_ . b4 " " . Iac ) tNe x x x k~e Y e x x w f1 e h L&, ala. " " . . . . ala aL a...4 1 4 1 4 14 w4 m4 14 14 u4 14 14 w4 14 LL Z 4 " 15. x. "n 1-2111 w < f1 -40 >- co0 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 z a10 LA 01 U)X 2 2 2...a a acca ala a an 1 am W n U A ( n U maA U n ( ) C U ) ( ) V )( 0ma, a 0 C Dc ( p0 . ma a D ( D C D 0 c 9 c 9 C 9 0 C amaw w w w w iu jw w L w u L L

  13. 29 CFR Appendix C to Subpart M of... - Personal Fall Arrest Systems

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... with the requirements in § 1926.502(d). Paragraphs (b), (c), (d) and (e) of this Appendix describe test... Appendix D of this subpart, the test methods listed here in Appendix C can also be used to assist employers... operation. (c) Strength test. (1) During the testing of all systems, a test weight of 300 pounds plus or...

  14. 29 CFR Appendix C to Subpart M of... - Personal Fall Arrest Systems

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... with the requirements in § 1926.502(d). Paragraphs (b), (c), (d) and (e) of this appendix describe test... appendix D of this subpart, the test methods listed here in appendix C can also be used to assist employers... operation. (c) Strength test. (1) During the testing of all systems, a test weight of 300 pounds plus or...

  15. Pin1 as a Biomarker of ER+ Breast Cancers to Predict the Response to Tamoxifen and mTOR Inhibitors

    DTIC Science & Technology

    2010-04-01

    Miller, R . E ., Brasel, K., De Smedt, T., Maraskovsky, E ., Maliszewski, C . R ., Lynch, D. H., Smith, J., Pulendran, B., Roux, E . R ., Teepe, M., Lyman...regulated by S100A9 protein, J Exp Med 205, 2235-2249. 27. Ewens, A., Luo, L., Berleth, E ., Alderfer , J., Wollman, R ., Hafeez, B. B., Kanter, P...antitumor immunity, Cancer Immunol Immunother. 3. Diaz-Montero, C . M., Salem, M. L., Nishimura, M. I., Garrett-Mayer, E ., Cole, D. J., and Montero, A

  16. Collaborative study of irregular erythrocyte antibodies in Japan: results from the Japanese study group of allo-immunity and antigen diversity in Asian populations.

    PubMed

    Takeshita, Akihiro; Watanabe, Hiroko; Fijihara, Harumi; Oshida, Machiko; Yurugi, Kimiko; Tomoda, Yutaka; Uchikawa, Makoto; Kino, Shuichi; Ohto, Hitoshi

    2010-08-01

    As a national study, we evaluated the frequencies of irregular erythrocyte antibodies (Abs) by gender and history of transfusion or pregnancy. In total, data from 248,785 patients were analyzed, from whom 4222 irregular erythrocyte Abs were detected in 3554 cases (1.43%). Abs frequencies in these 4222 cases were as follows: anti-E, 26%; anti-Le(a), 26%; anti-P(1), 11%; anti-M, 6%; anti-E+c, 4%; anti-Fy(b), 4%; anti-Di(a), 3%; anti-Le(b), 3%; and anti-D, 2%. In pregnancy, anti-D (5%), anti-Jr(a) (3%) and anti-E+c (6%) Abs were, with statistical significance, more frequent. Among transfused patients, anti-E (38%), anti-E+c (8%), anti-Jk(a) (4%), anti-e+C (2%) and anti-E+Jk(a) (1%) Abs were, with statistical significance, more frequent. (c) 2010 Elsevier Ltd. All rights reserved.

  17. Oceanographic Analyses and Forecasts for Fleet Support (Services and Codes). Revised.

    DTIC Science & Technology

    1967-08-01

    unit of thousands is omitted.) 11I SOUND VELOCITY PROFILE The SVP message form will normally follow the TD profile to which it pertains in the following...i ra 0 0 a 3’: VE C//3 000Q F- A E-4 =) 4-4 0.. 0- P4 C4 L) r. ~ N C)(D~ > a) CO C4 IHQ N E- .,1 0 r 4 4-4 V L 04 04 0 0 = rz - r- i r- 4(0 Ow ( (D

  18. Measurement of the absolute branching fraction of D s 0 * ( 2317 ) ± → π 0 D s ±

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ablikim, M.; Achasov, M. N.; Ahmed, S.

    The process e +e - →more » $$D_{s}^*$$ +$$D_{s0}^*$$(2317) - +c.c. is observed for the first time with the data sample of 567 pb -1 collected with the BESIII detector operating at the BEPCII collider at a center-of-mass energy ps = 4.6 GeV. The statistical significance of the D s0(2317) ± signal is 5.8 and the mass is measured to be (2318.3 ± 1.2 ± 1.2) MeV/c 2. The absolute branching fraction B($$D_{s0}^*$$(2317) ± → π 0$$D_s^±$$) is measured as $$1.00_{-0.14}^{+0.00}$$(stat)$$_{-0.14}^{+0.00}$$(syst) for the first time. The uncertainties are statistical and systematic, respectively.« less

  19. Measurement of the absolute branching fraction of D s 0 * ( 2317 ) ± → π 0 D s ±

    DOE PAGES

    Ablikim, M.; Achasov, M. N.; Ahmed, S.; ...

    2018-03-01

    The process e +e - →more » $$D_{s}^*$$ +$$D_{s0}^*$$(2317) - +c.c. is observed for the first time with the data sample of 567 pb -1 collected with the BESIII detector operating at the BEPCII collider at a center-of-mass energy ps = 4.6 GeV. The statistical significance of the D s0(2317) ± signal is 5.8 and the mass is measured to be (2318.3 ± 1.2 ± 1.2) MeV/c 2. The absolute branching fraction B($$D_{s0}^*$$(2317) ± → π 0$$D_s^±$$) is measured as $$1.00_{-0.14}^{+0.00}$$(stat)$$_{-0.14}^{+0.00}$$(syst) for the first time. The uncertainties are statistical and systematic, respectively.« less

  20. In Vivo-Selected Pyrazinoic Acid-Resistant Mycobacterium tuberculosis Strains Harbor Missense Mutations in the Aspartate Decarboxylase PanD and the Unfoldase ClpC1.

    PubMed

    Gopal, Pooja; Tasneen, Rokeya; Yee, Michelle; Lanoix, Jean-Philippe; Sarathy, Jansy; Rasic, George; Li, Liping; Dartois, Véronique; Nuermberger, Eric; Dick, Thomas

    2017-07-14

    Through mutant selection on agar containing pyrazinoic acid (POA), the bioactive form of the prodrug pyrazinamide (PZA), we recently showed that missense mutations in the aspartate decarboxylase PanD and the unfoldase ClpC1, and loss-of-function mutation of polyketide synthases Mas and PpsA-E involved in phthiocerol dimycocerosate synthesis, cause resistance to POA and PZA in Mycobacterium tuberculosis. Here we first asked whether these in vitro-selected POA/PZA-resistant mutants are attenuated in vivo, to potentially explain the lack of evidence of these mutations among PZA-resistant clinical isolates. Infection of mice with panD, clpC1, and mas/ppsA-E mutants showed that whereas growth of clpC1 and mas/ppsA-E mutants was attenuated, the panD mutant grew as well as the wild-type. To determine whether these resistance mechanisms can emerge within the host, mice infected with wild-type M. tuberculosis were treated with POA, and POA-resistant colonies were confirmed for PZA and POA resistance. Genome sequencing revealed that 82 and 18% of the strains contained missense mutations in panD and clpC1, respectively. Consistent with their lower fitness and POA resistance level, independent mas/ppsA-E mutants were not found. In conclusion, we show that the POA/PZA resistance mechanisms due to panD and clpC1 missense mutations are recapitulated in vivo. Whereas the representative clpC1 mutant was attenuated for growth in the mouse infection model, providing a possible explanation for their absence among clinical isolates, the growth kinetics of the representative panD mutant was unaffected. Why POA/PZA resistance-conferring panD mutations are observed in POA-treated mice but not yet among clinical strains isolated from PZA-treated patients remains to be determined.

  1. U.S. EPA, Pesticide Product Label, RESIDUAL INSECTICIDE PRESSURIZED SPRAY, 04/19/1968

    EPA Pesticide Factsheets

    2011-04-13

    ... I ; I', j , I:.' , . o D. ~ ('. I I (Ii • C r: o~ r+ I-' ~, ~t .-t. eD· ~ . .' t< u 'J • ... c ~'Io ~. c-~ ,'"1 r', ": I';': c: r._l ~ :1 (-~I r; r+ o -'. 0, 0 1t' . • 'j ( . .. j ...., c: d '.f. · ' . C ...

  2. Comparison of five methods for the estimation of methane production from vented in vitro systems.

    PubMed

    Alvarez Hess, P S; Eckard, R J; Jacobs, J L; Hannah, M C; Moate, P J

    2018-05-23

    There are several methods for estimating methane production (MP) from feedstuffs in vented in vitro systems. One method (A; "gold standard") measures methane proportions in the incubation bottle's head space (HS) and in the vented gas collected in gas bags. Four other methods (B, C, D and E) measure methane proportion in a single gas sample from HS. Method B assumes the same methane proportion in the vented gas as in HS, method C assumes constant methane to carbon dioxide ratio, method D has been developed based on empirical data and method E assumes constant individual venting volumes. This study aimed to compare the MP predictions from these methods to that of the gold standard method under different incubation scenarios, to validate these methods based on their concordance with a gold standard method. Methods C, D and E had greater concordance (0.85, 0.88 and 0.81), lower root mean square error (RMSE) (0.80, 0.72 and 0.85) and lower mean bias (0.20, 0.35, -0.35) with the gold standard than did method B (concordance 0.67, RMSE 1.49 and mean bias 1.26). Methods D and E were simpler to perform than method C and method D was slightly more accurate than method E. Based on precision, accuracy and simplicity of implementation, it is recommended that, when method A cannot be used, methods D and E are preferred to estimate MP from vented in vitro systems. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  3. Analysis of Particulates in the Exhaust Plume of a TF30 Engine at Military Power.

    DTIC Science & Technology

    1984-05-01

    DIADAH-LCA (2) flHDAR LCAI1’ 2, D)AfI-L(:E (21 DRtDAR-LCE-C. Cieistry Branch (1 DRtDAB-LCE-D (2) D1IDAR-LCNI (2) DRDAR-LCM-SA. R. Westerdahl (1) DRDAR...DRDAR-LCM-SA, R. Westerdahl (1) DBRDAR-LCN-C, Concepts and Analysis Branch (4) DRDAR-LCU (2) DFIDAB-LCU-E (1) 4 Army Ballistic Research Laboratory

  4. Solid State Research, 1975:3

    DTIC Science & Technology

    1975-08-15

    Heckscher T. F. Deutsch H. Kildal D. L. Spears I. Melngailis T. C. Haiman P. L. Kelley R. S. Eng D. L. Spears H. R. Fetterman H. R... Fetterman H. R. Schlossberg* W. E. Barch 1975 International IEEE/APS Symposium and USNC/URSI Meeting, Urbana, Illinois, 4 June 1975 * Author not...ft. Chinn, S. R. Del-eo, ft. E. Deutsch, T. F. Fetterman , II. R. Hancock, R. C. II. Ileckscher, Kildal, II. Larsen, D. M. Mandel, P

  5. Search at BaBar for D^0--\\overlineD^0 Mixing using Semileptonic Decays.

    NASA Astrophysics Data System (ADS)

    Flood, Kevin

    2004-05-01

    Based on a 87 fb-1 dataset acquired by the Babar experiment running on and near the Υ(4S) from 1999-2002, a new upper limit is set on the rate of D^0--\\overlineD^0 mixing using the decay modes D^*+ arrow π^+ D^0, D^0 arrow [K / K^*]eν (+c.c.). These modes offer unambiguous initial and final-state charm flavor tags, and allow the combined use of the D^0 lifetime and D^*+--D^0 mass difference (Δ M) in a global likelihood fit. The high-statistics sample of reconstructed unmixed semileptonic D^0 decays is used to model Δ M and the time-dependence of mixed events directly from the data. Neural networks are used both to select events and to fully reconstruct the D^0. The current world-best published limit on semileptonic charm mixing is 5x10-3 (90% C.L.) (E791).

  6. Wind-Tunnel Tests of Air Inlet and Outlet Openings on a Streamline Body

    DTIC Science & Technology

    1940-11-01

    e. , ko :3,%me 9_s +h.o stat- e -orossu_re of _’ ._c%_rn:zl "".: ._ ,_.ac o ,., zio;7 in the vicinit?r of the 0ooni_=.o _._., _.c.di _’:,._.......] ch...m!ine b,-’,,.d’_; were carr’.ed to 4:50 nJ.!es _qer Ko -Qr. ’_he t __%_ O? %x.:(" 0. .... __ _S were gtu o_:. ,-r:: oil _ _r miles per b.c_ro Th:’s...8217c,.’_u41:L:’zc; bo a’_ dis- - trib_._tion,, 0_0..-.,:.5_ ts.e :.7o:_’.:r,_:,r& . ........ :-or of ’ sko >qd::" zo r_orc- _’_C;.,’_.D0C]’"̂ .. _3

  7. Vasculature-Specific Adenovirus Vectors for Gene Therapy of Prostate Cancer

    DTIC Science & Technology

    2008-02-01

    Renata Pasqualini (University of Texas M.D. Anderson Cancer Center). This assay showed excellent binding of the wt fiber to sCAR and no binding...Bernasconi, R. Kain, D. Rajotte, S. Krajewski, H. M. Ellerby, D. E. Bredesen, R. Pasqualini , and E. Ruoslahti. 2002. Targeting the prostate for...D. Bucana, E. Koivunen, D. Cahill, P. Troncoso, K. A. Baggerly, R. D. Pentz, K. A. Do, C. J. Logothetis, and R. Pasqualini . 2002. Steps toward

  8. Individual and combined efficacies of mild heat and ultraviolet-c radiation against Escherichia coli O157:H7, Salmonella enterica, and Listeria monocytogenes in coconut liquid endosperm.

    PubMed

    Gabriel, Alonzo A; Ostonal, Jeffrey M; Cristobal, Jannelle O; Pagal, Gladess A; Armada, John Vincent E

    2018-07-20

    This study determined the inactivation kinetic parameters of selected pathogens in heat, ultraviolet-C and combined heat-UV-C treated coconut liquid endosperm. Separate cocktails of Escherichia coli O157:H7, Salmonella enterica serovars, and Listeria monocytogenes strains were inoculated into coconut liquid endosperm (pH 5.15, TSS 4.4 o Bx, TA 0.062% malic acid, extinction coefficient (ε) at 254 nm of 0.0154 cm -1 ) for inactivation studies. Result showed that all organisms generally exhibited a log-linear heat inactivation behavior (R 2 0.81-0.99). The E. coli O157:H7 cocktail (D 55  = 19.75 min, D 57  = 10.79 min, D 60  = 3.38 min, and D 63  = 0.46 min) was found to be significantly more resistant (P > 0.05) than the tested cocktail of L. monocytogenes (D 55  = 11.68 min, D 57  = 4.53 min, D 60  = 1.82 min and D 63  = 0.26 min) and S. enterica cocktail (D 55  = 3.08 min, D 57  = 2.60 min, D 60  = 0.89 min and D 63  = 0.25 min). Despite the differences in D T values, computed z values for L. monocytogenes cocktail (5.12 ± 0.43 °C) and E. coli O157:H7 cocktail (4.95 ± 0.12 °C) were not significantly different (P > 0.05), but were both significantly (P < 0.05) lower than that of S. enterica cocktail (7.10 ± 0.15 °C). All test organisms also exhibited a generally log-linear UV-C inactivation behavior (R 2 0.90-0.99) with E. coli O157:H7 cocktail (D UV-C  = 25.26 mJ/cm 2 ) demonstrating greatest resistance to UV-C than S. enterica (D UV-C  = 24.65 mJ/cm 2 ) and L. monocytogenes (D UV-C  = 17.30 mJ/cm 2 ) cocktails. The D 55 values of each organism cocktail were used to calculate for the 3-log reduction heating process schedules, during which UV-C treatments were simultaneously applied. Lethal rates (F values) calculations in the combined processes revealed that within the 3-log reduction heating processes, co-exposure of UV-C resulted in 5.62 to 6.20 log reductions in the test organism populations. Heating caused 69.3, 97.2, and 67.4% of the reduction in E. coli O157:H7, S. enterica and L. monocytogenes cocktails, respectively. These results can be used as baseline data in the establishment of mild heat treatment in combination with UV-C process schedules for coconut liquid endosperm and other similar products. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Study of the decays D + → η ( ' ) e + ν e

    DOE PAGES

    Ablikim, M.; Achasov, M. N.; Ahmed, S.; ...

    2018-05-31

    The charm semileptonic decays D + → ηe +v e and D + → η'e+v e are studied with a sample of e +e - collision data corresponding to an integrated luminosity of 2.93 fb -1 collected atmore » $$ \\sqrt{s}=3.773 $$ GeV with the BESIII detector. We measure the branching fractions for D+ → ηe+v e to be (10.74 ± 0.81 ± 0.51) x 10 -4, and for D+ → → η'e+v e to be (1.91 ± 0.51 ± 0.13) x 10 -4, where the uncertainties are statistical and systematic, respectively. In addition, we perform a measurement of the form factor in the decay D+ → ηe+v e. All the results are consistent with those obtained by the CLEO-c experiment.« less

  10. Study of the decays D + → η ( ' ) e + ν e

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ablikim, M.; Achasov, M. N.; Ahmed, S.

    The charm semileptonic decays D + → ηe +v e and D + → η'e+v e are studied with a sample of e +e - collision data corresponding to an integrated luminosity of 2.93 fb -1 collected atmore » $$ \\sqrt{s}=3.773 $$ GeV with the BESIII detector. We measure the branching fractions for D+ → ηe+v e to be (10.74 ± 0.81 ± 0.51) x 10 -4, and for D+ → → η'e+v e to be (1.91 ± 0.51 ± 0.13) x 10 -4, where the uncertainties are statistical and systematic, respectively. In addition, we perform a measurement of the form factor in the decay D+ → ηe+v e. All the results are consistent with those obtained by the CLEO-c experiment.« less

  11. 28 CFR 2.81 - Reparole decisions.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Reparole decisions. (a) If the prisoner is not serving a new, parolable D.C. Code sentence, the Commission... parole on a new D.C. Code felony sentence that has been aggregated with the prisoner's parole violation... new D.C. Code felony sentence but the prisoner's parole violation term has not commenced (i.e., the...

  12. 28 CFR 2.81 - Reparole decisions.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Reparole decisions. (a) If the prisoner is not serving a new, parolable D.C. Code sentence, the Commission... parole on a new D.C. Code felony sentence that has been aggregated with the prisoner's parole violation... new D.C. Code felony sentence but the prisoner's parole violation term has not commenced (i.e., the...

  13. Early reduced myocardial diastolic function in children and adolescents with type 1 diabetes mellitus a population-based study.

    PubMed

    Brunvand, Leif; Fugelseth, Drude; Stensaeth, Knut Håkon; Dahl-Jørgensen, Knut; Margeirsdottir, Hanna Dis

    2016-05-25

    Reduced diastolic myocardial function is an early sign of diabetic cardiomyopathy. The aim of this study was to test the hypothesis that children and adolescents with type 1 diabetes mellitus (T1D), but without other known complications, have early reduced diastolic myocardial function diagnosed with echocardiographic color tissue Doppler imaging (cTDI). cTDI examination was carried out in 173 T1D patients and 62 age-matched controls. The T1D-patients were 8-18 years old with (mean (SD)) diabetes duration of 5.6 (3.4) years and HbA1c of 8.4 (1.3). All were treated with either insulin pumps or 4-6 daily insulin injections. cTDI early (E') and late (A') peak diastolic velocities and systolic peak velocity were measured from the lateral, septal, anterior and posterior mitral annulus and from the lateral tricuspidal annulus. Myocardial diastolic function was reduced in the T1D-patients with higher peak A'-velocity and lower E'/A'-ratio in all registrations. Overall mean (SD) mitral E'/A'-ratio was 2.3 (0.5) in T1D and 2.7 (0.6) in the controls (p < 0001). The overall mitral E'/A'-ratio was negative associated with blood pressure (BP) and body mass index (BMI). Stratifying all participants into three groups according to BMI (<25, 25-75, >75 centile, respectively), the T1D had lower E'/A'-values in all stratified groups, except for in the highest BMI-group where both T1D and controls had the lowest E'/A'-ratio. Systolic function did not differ in any of the measurements. There were no associations with sex, diabetes duration, carotid artery intima-media-thickness, vessel elasticity or HbA1c. Diabetic children and adolescents using modern intensive insulin treatment had echocardiographic signs of reduced diastolic myocardial function despite short duration of disease. The reduced function was associated with higher BP and higher BMI.

  14. Search for B decays to final states with the η c meson

    DOE PAGES

    Vinokurova, A.; Kuzmin, A.; Eidelman, S.; ...

    2015-06-18

    We report a search for B decays to selected final states with the η c meson: B ± → K ±η cπ +π -, B ± → K ±η cω, B ± → K ±η cη and B ± → K ±η cπ 0. The analysis is based on 772 × 10 6 BB-bar pairs collected at the Υ(4S) resonance with the Belle detector at the KEKB asymmetric-energy e +e - collider. We set 90% confidence level upper limits on the branching fractions of the studied B decay modes, independent of intermediate resonances, in the range (0.6–5.3) × 10 -4.more » We also search for molecular-state candidates in the D 0D*-bar 0 - D-bar 0D* 0, D 0D-bar 0 + D-bar 0D 0 and D* 0D*-bar 0 + D*-bar 0D* 0 combinations, neutral partners of the Z(3900) ± and Z(4020) ±, and a poorly understood state X(3915) as possible intermediate states in the decay chain, and set 90% confidence level upper limits on the product of branching fractions to the mentioned intermediate states and decay branching fractions of these states in the range (0.6–6.9) × 10 -5.« less

  15. 2008 Evaluation of the DoD Voting Assistance Program

    DTIC Science & Technology

    2009-04-30

    tion reports fro~ VAOs and t he NVAP Web site . We a lso conside red arti cles, NAVADMINs , e;nails fro:n the Navy Vot~ng Act ion Of ficer (NVAOl...a nce. (DODD 133. 1 3) Response : Sixty o f s i xty-seven (83\\) r e cruitme nt o ff ice vo ting personne l c o mp l ete d requ i red training, a s...e: Per OPNAVINST 1 742. 18, VAOs are requ: red to conduct t r ainin-g at t he unit level. Ma n y c ommands c ov e r absen t ee reg i s trat ion and

  16. Workshop on Hydrogen Storage and Generation for Medium-Power and -Energy Applications

    DTIC Science & Technology

    1998-02-01

    Vukovic , and B. E. Conway, J . Phys. Chem., 81, 2271(1977). [10].V. Lakshminarayanna, R...d O >ri O 1 O CM Ö CM O O +1 O O O 1 OO O O CO 0 Ö CO O ö s CO • 3 >-. BO _o ■3 c j = 0 i i ■c 3 8 1 09 Is... J ’o e < * g «-• s -.2 If CO «9 3 J3 E "c to U 𔃽 ’S o S es O ,<D c . 8^. 5 3 OS 3 60 - p v> 30 ŗ 8

  17. Effect of Hypertrophic Cardiomyopathy-Linked Troponin C Mutations on the Response of Reconstituted Thin Filaments to Calcium upon Troponin I Phosphorylation†

    PubMed Central

    Albury, Acchia N. J.; Swindle, Nicholas; Swartz, Darl R.; Tikunova, Svetlana B.

    2012-01-01

    The objective of this work was to investigate the effect of hypertrophic cardiomyopathy-linked A8V and E134D mutations in cardiac troponin C (cTnC) on the response of reconstituted thin filaments to calcium upon phosphorylation of cardiac troponin I (cTnI) by protein kinase A. The phosphorylation of cTnI at protein kinase A sites was mimicked by S22D/S23D mutation in cTnI. Our results demonstrate that the A8V and E134D mutations had no effect on the extent of calcium desensitization of reconstituted thin filaments induced by cTnI pseudo-phosphorylation. However, the A8V mutation enhanced the effect of cTnI pseudo-phosphorylation on the rate of calcium dissociation from reconstituted thin filaments and on calcium dependence of actomyosin ATPase. Consequently, while the A8V mutation still led to a slower rate of calcium dissociation from reconstituted thin filaments upon pseudo-phosphorylation of cTnI, the ability of the A8V mutation to decrease the rate of calcium dissociation was diminished. In addition, the ability of the A8V mutation to sensitize actomyosin ATPase to calcium was diminished after cTnI was replaced by the phosphorylation mimetic of cTnI. Consistent with the hypothesis that the E134D mutation is benign, it exerted minor to no effect on the rate of calcium dissociation from reconstituted thin filaments, and on calcium sensitivity of actomyosin ATPase, regardless of cTnI phosphorylation status. In conclusion, our study enhances understanding of how cardiomyopathy-linked cTnC mutations affect the response of reconstituted thin filaments to calcium upon cTnI phosphorylation. PMID:22489623

  18. Military Aircraft Modernization: A Better Solution to Manage the Fighter Shortfall - the Sole Answer is NOT the F-35 Program

    DTIC Science & Technology

    2017-04-21

    oclc. org /eds/ detai I/ detai l?vid=5 &sid=5b9e08 b 7-0abf- 4502-a8 l d-42c5 l Od59863%40sessionmgr I 07 &hid= I 04&bdata=JnNpdGU9ZWRzLWxpdm...eds.b.ebscohost.com.nduezproxy.idm.oclc. org /eds/detail/detail?vid=9&sid=5b9e08b7-0abf-4502-a8 l d-42c5 l Od59863%40sessionmgr I 07 &hid= I 04&bdata...nduezproxy. i dm. ocl c. org / eds/pdfviewer/pdfvi ewer?vid = l 3&sid=5b9e08b7-0abf-4502-a8 l d-42c5 l Od59863%40sessionmgr l 07&hid= l 04 (accessed December

  19. State Space Methods in Multidimensional Digital Signal Processing

    DTIC Science & Technology

    1991-01-01

    2-D finite difference equation with quarter-plane support is given by [1]. Li L-2 Ll L2 g (nln2) =E E Zb(jl,j2)f(n,-j, n 2 -j 2 ) - E a(jl,j2) g (n, - j...B2 [ g (n , n2)] = [C1 C2 1 Sq’(n nl2) ]+ D [f (ni, n 2 )] (2.2) Roesser’s state space model is based upon assigning state variables to the output of...QH(n - 1,n2) + [ B1 [f(nl,n2)]Qv(ni, n2) I A3 A411 Qv(nl, n2 -1 1 B2 [ g (n 1 ,n 2 )] = [C1 C 2] Q(n - n) + D[f(nin 2 )] (2.5) I Qv(ni,n2- 1) 1 In this

  20. Cultural Resources Literature Search and Records Review - Upper Mississippi River Basin. Volume 7. Pool 6.

    DTIC Science & Technology

    1983-01-01

    H 0- -1 . 0 - d U. 0- 4 X, i * ’w 7 E-4 rj U) r- c0 0 -4 P 4 H4 E-4 E 0- 4%D.10 0 -4 $4 )t% U4 ) H- to) 440 Ur- H- N -4-1 4--)4J 4 4-) U)iU $4 -.4 C...34I W,4. * 4-i W ) U z u L. U U En $-4 $4 -4 X M Z a)~ U4. ) 0 )c~ (a aUD ) La 0 -r - go)> 4l) Cl V U) M l W ’- V U) H-U) -4 35Cl ( P ’.44 0 $- Q ~- -H U...gr I E U C0 0C) t41-H. H- V U) 4.) En 0--4 10uVr LA I H- r- C3 U -4$k V C4J W :: - c Q)~ r. CN C3 r i-, 11 H - N n 04 004 4J E- 4 M 0 04 -4 UU) 94 0 p

  1. Manned Certification Tests of the Modernized MK 16 MOD 1

    DTIC Science & Technology

    2013-11-01

    CERTIFICATION TESTS OF THE MODERNIZED MK 16 MOD 1 Authors: D. E . Warkander, Ph.D. D. J. Doolette, Ph.D...PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Dan E . Warkander; David J. Doolette; Paul C. Algra 5d. PROJECT NUMBER 5e. TASK NUMBER 10-08 5f. WORK UNIT...electronics must be turned on when calibrating the secondary display. 11 REFERENCES 1. R. P. Layton , Unmanned Evaluation of the Modernized MK 16 MOD

  2. Tri-Service Literacy and Readability: Workshop Proceedings.

    DTIC Science & Technology

    1980-03-01

    LN zC t’ DC D -2l C CC U CC., r C CzC.C-.C, CC C ~ ., caCQ.. *’UC - -C CL UQC’CC Ci - CT 0 --. . C DJZDCU- CC C C. C C...8217 flCCD.- CC, CCC~4J o zC C-Ca C ,.-C,-.O ,-,- CC CC,.. -- r C C,- -z~~~~~~~~~~~~~~~ (U’~’ C- O’ ,.0 C CCC,.. D Ca D CCCO.C - 0.a l F--Ci E CC CC CDO C C...understanding in problem solving. In Catellan, N. J., Jr., Pisoni, D . B., & Potts G. R . (Eds.), Cognitive theory. Hillsdale, NJ: Lawrence Erlbaum

  3. Microwave spectrum of 2,6-dimethylcyclohexanone

    NASA Astrophysics Data System (ADS)

    Jang, Heesu; Shim, Jae-Seol; Oh, Jung Jin

    2017-07-01

    The rotational spectrum of 2,6-dimethylcyclohexanone (DMCHO) was measured in the frequency region from 6 to 12 GHz. Among three possible conformational isomers, two conformers were identified where two methyl groups are aligned in the equatorial/equatorial (ee) and the equatorial/axial (ea) positions. Both b-type and c-type transitions for (e,e)-2,6-DMCHO, and a-type, b-type, and c-type transitions for (e,a)-2,6-DMCHO were assigned to determine the rotational constants and quartic centrifugal distortion constants based on the Watson-A reduction Hamiltonian: (ee) A = 2150.95789(48) MHz, B = 1578.76212(40) MHz, C = 990.19141(45) MHz, ΔJ = 0.086(11) kHz, ΔJK = -0.134(20) kHz, ΔK = 0.298(15) kHz, δJ = 23.4(24) Hz, and δK = 101.4(77) Hz; and (ea) A = 2082.62538(83) MHz, B = 1566.59564(59) MHz, C = 1113.90153(75) MHz, ΔJ = 0.066(23) kHz. In addition, dipole moment components of the two isomers were determined by Stark effect measurements: (ee) μb = 2.6673(12) D, μc = 1.0379(11) D, μtotal = 2.8621(12) D; and (ea) μa = 1.385(253) D, μb = 2.358(104) D, μc = 1.172(21) D, μtotal = 2.975(144) D. Ab initio calculations for all three isomers were compared with each other and with experimental results.

  4. Novel Visualization of Large Health Related Data Sets

    DTIC Science & Technology

    2015-03-01

    Health Record Data: A Systematic Review B: McPeek Hinz E, Borland D, Shah H, West V, Hammond WE. Temporal Visualization of Diabetes Mellitus via Hemoglobin ...H, Borland D, McPeek Hinz E, West V, Hammond WE. Demonstration of Temporal Visualization of Diabetes Mellitus via Hemoglobin A1C Levels E... Hemoglobin A1c Levels and MultivariateVisualization of System-Wide National Health Service Data Using Radial Coordinates. (Copies in Appendix) 4.3

  5. Radiation Hard Sensors for Surveillance.

    DTIC Science & Technology

    1988-03-11

    track position measurements were noted. E. Heijne (CERN) reported on the degradation of silicon detectors for doses larger than 2x10 11 muons /cm 2...Workshop on Transmission and Emission Computerized Tomography , July 1978, Seoul, Korea Nahmias C., Kenyon D.B., Garnett E.S.: Optimization of...crystal size in emission computed tomography . IEEE Trans ,.-.e Nucl Sci NS-27: 529-532, 1980. Mullani N.A., Ficke D.C., Ter-Pogossian M.M.: Cesium Fluoride

  6. Department of the Navy FY 1993 Budget Estimates, DoD Base Closure and Realignment Program 2. Justification Data Submitted to Congress January 1992

    DTIC Science & Technology

    1992-01-01

    DESIGN WAS MOST RECENTLY USED: (3) TOTAL COST (C) - (A) + (B) OR (0) + ( E ): (SO0O) (A) PRODUCTION OF PLANS AND SPECIFICATIONS ......... _1: (B) ALL... E ) IN-HOUSE . . . . . . . . . . . . . . . . . . . . . . . . (4) CONSTRUCTION START .................... .. - (MONTH AND...Z. (2) BASIS: (A) STANDARD OR DEFINITIVE DESIGN: YES__NO.. _ (B) WHERE DESIGN WAS MOST RECENTLY USED: (3) TOTAL COST (C) - (A) + (B) OR (D) + ( E

  7. 78 FR 34709 - Proposed Information Collection (Application for CHAMPVA Benefits); Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-10

    ...-5870 or Fax (202) 495-5397. SUPPLEMENTARY INFORMATION: Under the PRA of 1995 (Pub. L. 104-13; 44 U.S.C...,402 hours. c. VA Form 10-7959c--6,728 hours. d. VA Form 10-7959d--467 hours. e. VA Form 10-7959e--1500... Technology, U.S. Department of Veterans Affairs. [FR Doc. 2013-13693 Filed 6-7-13; 8:45 am] BILLING CODE 8320...

  8. Learning about associations: evidence for a hierarchical account of occasion setting.

    PubMed

    Bonardi, Charlotte; Jennings, Dómhnall

    2009-07-01

    In 2 experiments rats were trained on a switching discrimination, with 4 occasion setters, A, B, C, and D and 2 target stimuli, x and y. When signaled either by A or by B, x was reinforced with food and y was not, whereas when signaled either by C or by D these reinforcement relations were reversed (i.e., A: --> x+, A: y --> -, B: x --> +, B: y --> -, C: x --> -, C: y --> +, D: x --> -, D: y --> +). In a subsequent Stage A was paired with shock, and then the degree to which food-reinforced (Experiment 1a) and nonreinforced (Experiment 1b) presentations of x and y were capable of eliciting fear was assessed. Those conditioned stimulus (CS)/unconditioned stimulus (US) relations that had been operative in the presence of the fear-eliciting occasion setter A (i.e., x --> +, y --> -) elicited more fear than the alternative CS/US combinations (i.e., x --> -, y --> +). The implications of these findings are discussed with reference to theories of occasion setting and of configural learning.

  9. Frontiers of X-Ray Astronomy

    NASA Astrophysics Data System (ADS)

    Fabian, Andrew C.; Pounds, Kenneth A.; Blandford, Roger D.

    2004-07-01

    Preface; 1. Forty years on from Aerobee 150: a personal perspective K. Pounds; 2. X-ray spectroscopy of astrophysical plasmas S. M. Kahn, E. Behar, A. Kinkhabwala and D. W. Savin; 3. X-rays from stars M. Gudel; 4. X-ray observations of accreting white-dwarf systems M. Cropper, G. Ramsay, C. Hellier, K. Mukai, C. Mauche and D. Pandel; 5. Accretion flows in X-ray binaries C. Done; 6. Recent X-ray observations of supernova remnants C. R. Canizares; 7. Luminous X-ray sources in spiral and star-forming galaxies M. Ward; 8. Cosmological constraints from Chandra observations of galaxy clusters S. W. Allen; 9. Clusters of galaxies: a cosmological probe R. Mushotzky; 10. Obscured active galactic nuclei: the hidden side of the X-ray Universe G. Matt; 11. The Chandra Deep Field-North Survey and the cosmic X-ray background W. N. Brandt, D. M. Alexander, F. E. Bauer and A. E. Hornschemeier; 12. Hunting the first black holes G. Hasinger; 13. X-ray astronomy in the new millennium: a summary R. D. Blandford.

  10. Detection of Translational Equivalence

    DTIC Science & Technology

    2001-05-01

    13L_6�4 1 5 68739 :;pE6 9 C:@O7365 H8735$:XF87fES>132�E6T9:> :;9`?�C:’¿ � dTÀÄE~;W9C:’> M739 E1)132x9C:@1 65$:;9;H�8;9 >ES6...Y47 @O4 HR@O739 :<JH8;-E65�7c<RAT6873eE~4ÈF> 1 5 > 73e’e?E65�9 :4C6RE~Q$H: `®�CREO;EO;’�:;9 EP@P@SH8;9 > M739 :<­�TAY736�: U873e’FR

  11. Triazolopyridinyl-acrylonitrile derivatives as antimicrotubule agents: Synthesis, in vitro and in silico characterization of antiproliferative activity, inhibition of tubulin polymerization and binding thermodynamics.

    PubMed

    Briguglio, Irene; Laurini, Erik; Pirisi, Maria Antonietta; Piras, Sandra; Corona, Paola; Fermeglia, Maurizio; Pricl, Sabrina; Carta, Antonio

    2017-12-01

    In this paper we report the synthesis, in vitro anticancer activity, and the experimental/computational characterization of mechanism of action of a new series of E isomers of triazolo[4,5-b/c]pyridin-acrylonitrile derivatives (6c-g, 7d-e, 8d-e, 9c-f, 10d-e, 11d-e). All new compounds are endowed with moderate to interesting antiproliferative activity against 9 different cancer cell lines derived from solid and hematological human tumors. Fluorescence-based assays prove that these molecules interfere with tubulin polymerization. Furthermore, isothermal titration calorimetry (ITC) provides full tubulin/compound binding thermodynamics, thereby ultimately qualifying and quantifying the interactions of these molecular series with the target protein. Lastly, the analysis based on the tight coupling of in vitro and in silico modeling of the interactions between tubulin and the title compounds allows to propose a molecular rationale for their biological activity. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  12. 75 FR 53981 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease CACA 47609, California

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-02

    ...: Under the provisions of 30 U.S.C. 188(d) and (e), and 43 CFR 3108.2-3(a) and (b)(1), the Bureau of Land... Sections 31(d) and (e) of the Mineral Leasing Act of 1920 (30 U.S.C. 188), and the BLM is proposing to...

  13. 76 FR 22422 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease CACA 49187, California

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-21

    .... SUMMARY: Under the provisions of 30 U.S.C. 188(d) and (e), and 43 CFR 3108.2-3(a) and (b)(1), the Bureau... in Sections 31(d) and (e) of the Mineral Leasing Act of 1920 (30 U.S.C. 188), and the Bureau of Land...

  14. 75 FR 29364 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease COC63019

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-25

    ...: Under the provisions of 30 U.S.C. 188(d) and (e), and 43 CFR 3108.2-3(a) and (b)(1), the Bureau of Land... set out in Section 31(d) and (e) of the Mineral Lands Leasing Act of 1920 (30 U.S.C. 188), and the BLM...

  15. 77 FR 9959 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease CACA 50123, California

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-21

    .... SUMMARY: Under the provisions of 30 U.S.C. 188(d) and (e), and 43 CFR 3108.2-3(a) and (b)(1), the Bureau... in Sections 31(d) and (e) of the Mineral Leasing Act of 1920 (30 U.S.C. 188), and the Bureau of Land...

  16. 75 FR 12255 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease WYW150539, Wyoming

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-15

    ... provisions of 30 U.S.C. 188(d) and (e), and 43 CFR 3108.2-3(a) and (b)(2), the Bureau of Land Management (BLM... sections 31(d) and (e) of the Mineral Lands Leasing Act of 1920 (30 U.S.C. 188), and the BLM is proposing...

  17. 75 FR 440 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease, WYW160181, Wyoming

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-01-05

    ... the provisions of 30 U.S.C. 188(d) and (e), and 43 CFR 3108.2-3(a) and (b)(2), the Bureau of Land... set out in Sections 31(d) and (e) of the Mineral Lands Leasing Act of 1920 (30 U.S.C. 188), and the...

  18. 48 CFR 1827.302 - Policy. (NASA supplements paragraphs (a), (b), (c), (d), (e), (f), (g), and (i)).

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Policy. (NASA supplements paragraphs (a), (b), (c), (d), (e), (f), (g), and (i)). 1827.302 Section 1827.302 Federal Acquisition... the performance of experimental, developmental, or research work with a small business firm or a...

  19. Preparation of 3,3'-azobis(6-amino-1,2,4,5-tetrazine)

    DOEpatents

    Hiskey, Michael A.; Chavez, David E.; Naud, Darren

    2002-01-01

    The compound of the structure ##STR1## where a, b, c, d and e are 0 or 1 and a+b+c+d+e is from 0 to 5 is disclosed together with the species 3,3'-azobis(6-amino-1,2,4,5-tetrazine) and a process of preparing such compounds.

  20. The Catabolite Repressor Protein-Cyclic AMP Complex Regulates csgD and Biofilm Formation in Uropathogenic Escherichia coli.

    PubMed

    Hufnagel, David A; Evans, Margery L; Greene, Sarah E; Pinkner, Jerome S; Hultgren, Scott J; Chapman, Matthew R

    2016-12-15

    The extracellular matrix protects Escherichia coli from immune cells, oxidative stress, predation, and other environmental stresses. Production of the E. coli extracellular matrix is regulated by transcription factors that are tuned to environmental conditions. The biofilm master regulator protein CsgD upregulates curli and cellulose, the two major polymers in the extracellular matrix of uropathogenic E. coli (UPEC) biofilms. We found that cyclic AMP (cAMP) regulates curli, cellulose, and UPEC biofilms through csgD The alarmone cAMP is produced by adenylate cyclase (CyaA), and deletion of cyaA resulted in reduced extracellular matrix production and biofilm formation. The catabolite repressor protein (CRP) positively regulated csgD transcription, leading to curli and cellulose production in the UPEC isolate, UTI89. Glucose, a known inhibitor of CyaA activity, blocked extracellular matrix formation when added to the growth medium. The mutant strains ΔcyaA and Δcrp did not produce rugose biofilms, pellicles, curli, cellulose, or CsgD. Three putative CRP binding sites were identified within the csgD-csgB intergenic region, and purified CRP could gel shift the csgD-csgB intergenic region. Additionally, we found that CRP binded upstream of kpsMT, which encodes machinery for K1 capsule production. Together our work shows that cAMP and CRP influence E. coli biofilms through transcriptional regulation of csgD IMPORTANCE The catabolite repressor protein (CRP)-cyclic AMP (cAMP) complex influences the transcription of ∼7% of genes on the Escherichia coli chromosome (D. Zheng, C. Constantinidou, J. L. Hobman, and S. D. Minchin, Nucleic Acids Res 32:5874-5893, 2004, https://dx.doi.org/10.1093/nar/gkh908). Glucose inhibits E. coli biofilm formation, and ΔcyaA and Δcrp mutants show impaired biofilm formation (D. W. Jackson, J.W. Simecka, and T. Romeo, J Bacteriol 184:3406-3410, 2002, https://dx.doi.org/10.1128/JB.184.12.3406-3410.2002). We determined that the cAMP-CRP complex regulates curli and cellulose production and the formation of rugose and pellicle biofilms through csgD Additionally, we propose that cAMP may work as a signaling compound for uropathogenic E. coli (UPEC) to transition from the bladder lumen to inside epithelial cells for intracellular bacterial community formation through K1 capsule regulation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  1. The BPS spectrum of the 4d {N}=2 SCFT's H 1, H 2, D 4, E 6, E 7, E 8

    NASA Astrophysics Data System (ADS)

    Cecotti, Sergio; Del Zotto, Michele

    2013-06-01

    Extending results of 1112.3984, we show that all rank 1 {N}=2 SCFT's in the sequence H 1, H 2, D 4 E 6, E 7, E 8 have canonical finite BPS chambers containing precisely 2 h(F) = 12(∆ - 1) hypermultiplets. The BPS spectrum of the canonical BPS chambers saturates the conformal central charge c, and satisfies some intriguing numerology.

  2. The Effects of Truth Bias on Artifact-User Relationships: An Investigation of Factors for Improving Deception Detection in Artifact Produced Information

    DTIC Science & Technology

    1998-08-07

    Scenarios 124 APPENDIX B - Information Manipulation Descriptions 132 vi APPENDIX C - PC-III Screens 146 APPENDIX D - Discrepancy Reporting Sheet 162...in Figure 3-2. • A rtifact Truth Bias D e c e p tio n D ete ctio n A bility t Figure 3-2 - Artifact Truth Bias and Deception Detection...discrepancy recording sheet is provided in Appendix D . For each to the courses, a series of data manipulations was incorporated into the database

  3. Computational Identification and Analysis of Signaling Subnetworks with Distinct Functional Roles in the Regulation of TNF Production

    DTIC Science & Technology

    2016-01-04

    extract four distinct quantitative features of response timing and intensity: the trajectory peak height, the peak time, the area under the curve, and...J., 2007, 21, 325–332. 16 S. L. Werner, J. D. Kearns, V. Zadorozhnaya, C. Lynch, E. O’Dea, M. P. Boldin , A. Ma, D. Baltimore and A. Hoffmann, Genes...Werner, J. D. Kearns, V. Zadorozhnaya, C. Lynch, E. O’Dea, M. P. Boldin , A. Ma, D. Baltimore and A. Hoffmann, Genes Dev., 2008, 22, 2093–2101. 58 J

  4. Research and Development of Methods for Estimating Physicochemical Properties of Organic Compounds of Environmental Concern. Part 1.

    DTIC Science & Technology

    1981-06-01

    REEHL, D H ROSENBLATT OAMD 17-8-C-8073 UNCLASSIFIED ADL-C-A2426 PT- 1 NL 6 fllfllflfflfl lll mhhhhhhhh IIIIIIIIIIIIII IIIIIIIIIIIIII IIIIIIIIIIIIII...PHASE 11 (PART 1 OF 2 PARTS) by Warren J. Lyman, Ph.D.- Michael J. Hayes James D. Blrkett, Ph.D. Leslie H. Nelken Sara E. Bysshe Carl E. Rechstelner...CONtES PART 1 Executive Summary 2 Acknowedgmnwt 4 Table of Cotnts 7 Ust of Tables 23 List of FIgures 36 Introduction 39 1 - Octanol/Wter Partition

  5. Evaluation of the mtDNA-COII Region Based Species Specific Assay for Identifying Members of the Anopheles culicifacies Species Complex

    PubMed Central

    Manonmani, Arulsamy Mary; Mathivanan, Ashok Kumar; Sadanandane, Candassamy; Jambulingam, Purushothaman

    2013-01-01

    Background: Anopheles culicifacies, a major malarial vector has been recognized as a complex of five sibling species, A, B, C, D and E. These sibling species exhibit varied vectorial capacity, host specificity and susceptibility to malarial parasites/ insecticides. In this study, a PCR assay developed earlier for distinguishing the five individual species was validated on samples of An. culicifacies collected from various parts of India. Methods: The samples were initially screened using the rDNA-ITS2 region based primers which categorised the samples into either A/D group or B/C/E group. A proportion of samples belonging to each group were subjected to the mtDNA-COII PCR assay for identifying individual species. Results: Among the 615 samples analysed by rDNA-ITS2 PCR assay, 303 were found to belong to A/D group and 299 to B/C/E group while 13 turned negative. Among 163 samples belonging to A/D group, only one sample displayed the profile characteristic of species A and among the 176 samples falling in the B/C/E group, 51 were identified as species B, 14 as species C and 41 as species E respectively by the mtDNA-COII PCR assay. Samples exhibiting products diagnostic of B/C/E, when subjected to PCR-RFLP assay identified 15 samples as species E. Conclusion: Validation of the mtDNA-COII PCR assay on large number of samples showed that this technique cannot be used universally to distinguish the 5 members of this species complex, as it has been designed based on minor/single base differences observed in the COII region. PMID:24409441

  6. Candida alocasiicola sp. nov., Candida hainanensis sp. nov., Candida heveicola sp. nov. and Candida musiphila sp. nov., novel anamorphic, ascomycetous yeast species isolated from plants.

    PubMed

    Wang, Shi-An; Jia, Jian-Hua; Bai, Feng-Yan

    2008-08-01

    In a taxonomic study on the ascomycetous yeasts isolated from plant materials collected in tropical forests in Yunnan and Hainan Provinces, southern China, four strains isolated from tree sap (YJ2E(T)) and flowers (YF9E(T), YWZH3C(T) and YYF2A(T)) were revealed to represent four undescribed yeast species. Molecular phylogenetic analysis based on the large subunit (26S) rRNA gene D1/D2 domain sequences showed that strain YJ2E(T) was located in a clade together with Candida haemulonii and C. pseudohaemulonii. Strain YF9E(T) was most closely related to C. azyma and strain YWZH3C(T) to C. sorbophila and C. spandovensis. Strain YYF2A(T) was clustered in a clade containing small-spored Metschnikowia species and related anamorphic Candida species. The new strains differed from their closely related described species by more than 10% mismatches in the D1/D2 domain. No sexual states were observed for the four strains on various sporulation media. The new species are therefore assigned to the genus Candida and described as Candida alocasiicola sp. nov. (type strain, YF9E(T) = AS 2.3484(T) = CBS 10702(T)), Candida hainanensis sp. nov. (type strain, YYF2A(T) = AS 2.3478(T) = CBS 10696(T)), Candida heveicola sp. nov. (type strain, YJ2E(T) = AS 2.3483(T) = CBS 10701(T)) and Candida musiphila sp. nov. (type strain, YWZH3C(T) = AS 2.3479(T) = CBS 10697(T)).

  7. Dollar Summary of Prime Contract Awards over $25,000 by Contractor, State or Country, and Place. Part 1 (102 Construction Inc, Oklahoma City, Oklahoma -- Bay Cities Refuse Co, Sunnyvale AFS, California), FY1991

    DTIC Science & Technology

    1991-01-01

    L I-m 0d 0 td 4 10.1-4 4L o ) 0-40 # 2 I XI i( iC c u :W ( W .1 1- Ie ix W0- cc -4- (00 0 0-0 CO I E 00N0 00((0 UU) 0 0 0 3 00 o *zz a txa...43 td 00 0N -4 t - ) CZ IS WI - IL < (M I. 1.- (0 (0 z -- 0 0N f 1 Ii Iu -4 --4z L 0 I CI D- = 0- x I- c ow ( I- I I e 0 I.I. w 0 1Q4 0 0- I0.- C )C...LU 05 01t- 0 00 -4-4 o~c cc I- I c P:M 0 4e 1 C1 cl-4 -4 44 N I c 00 td E(0 c0 10 00 w 4 4- N N < 4-0 -4-4 - 0 c I 44 - 9 -I M IA- I 00 E >I (,C. 14

  8. A Set of Organizational-Climate Measures: Internal Consistency, Factor Structure, and Predictive Power.

    DTIC Science & Technology

    1983-10-01

    E 5-- 4 5 5 5 5 5- * r 4.)Ce. 41 V V "a V V (Ai NC N NC C NCMC C NCc xC N C LUJ C ) 0 D 0 M Lc 0~ N flYN Lfl to 4/)44 (Y, LL. 41 4 4-W 0L t to 4,ia 4...tUo ) )4 ) C 4- 0 L. 1 0 4-- Li CA 0 C =4 apL 0 r -W wc -1 4- 4C- U+ d)1 4-4 C - L- U) E (1) CD (1) (1)- t0 0a L- -i CL LA- fC--A W3 07: - > " TO -- ~ * A...cninr-O 0 = (A .0 >n r -.4 0 0 i L 00 0 00 4-) 4. - 4 ,- E 0 .( CZ CJz V r CL 00

  9. The Traveling Wave Amplifier as a Bistable Oscillator

    DTIC Science & Technology

    1956-01-01

    2n)t + 5/4 e V m Vtt Cos(m-2n)t + 5/16 e vm VA Gos(m+4n)t + 5/16 e vm Vtt Cos(m-4n)t Again Collecting Terms E 0 = 1/2 b Vrt +l/2bVfi + 3/8 d Vrft...3 ( ~ c V ft + 5/8 e VA + 15/4 e V ~ V J ’ + 15/8 e V in V n) + Cos2mt (1/2 b Vfn + 1/2 d Vrt + 3/2 d V~ V~) III-3 Again Collecting Terms (Cont’d

  10. 31 CFR 315.32 - Series A, B, C, D, F, G, J, and K bonds.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Series A, B, C, D, F, G, J, and K.... SAVINGS BONDS, SERIES A, B, C, D, E, F, G, H, J, AND K, AND U.S. SAVINGS NOTES Interest § 315.32 Series A, B, C, D, F, G, J, and K bonds. All bonds of these series have matured and no longer earn interest. ...

  11. 31 CFR 315.32 - Series A, B, C, D, F, G, J, and K bonds.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance:Treasury 2 2013-07-01 2013-07-01 false Series A, B, C, D, F, G, J, and K.... SAVINGS BONDS, SERIES A, B, C, D, E, F, G, H, J, AND K, AND U.S. SAVINGS NOTES Interest § 315.32 Series A, B, C, D, F, G, J, and K bonds. All bonds of these series have matured and no longer earn interest. ...

  12. 31 CFR 315.32 - Series A, B, C, D, F, G, J, and K bonds.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Series A, B, C, D, F, G, J, and K.... SAVINGS BONDS, SERIES A, B, C, D, E, F, G, H, J, AND K, AND U.S. SAVINGS NOTES Interest § 315.32 Series A, B, C, D, F, G, J, and K bonds. All bonds of these series have matured and no longer earn interest. ...

  13. Artificial Intelligence and Expert Systems

    DTIC Science & Technology

    1986-03-01

    O R R E C T I N G • NOT P R O T E C T E D oEMOTION oFATIGUE oUNAVAILABLE oBIAS olMPERIAL • STABLE (COLD) o lNDEFAT IGABLE eAVAILABLE eLESS... oBIAS olMPERIAL • STABLE (COLD) o lNDEFAT IGABLE eAVAILABLE oLESS BIAS o lMPERSONAL DODCI 1085-.85 THE COMPUTER EVOLUTION I I I • C o m p

  14. Complement-induced histamine release from human basophils. III. Effect of pharmacologic agents.

    PubMed

    Hook, W A; Siraganian, R P

    1977-02-01

    Human serum activated with zymosan generates a factor (C5a) that releases histamine from autologous basophils. Previously we have presented evidence that this mechanism for C5a-induced release differs from IgE-mediated reactions. The effect of several pharmacologic agents known to alter IgE-mediated release was studied to determine whether they have a similar action on serum-induced release. Deuterium oxide (D2O), which enhances allergic release, inhibited in a concentration-dependent fashion the serum-induced reaction at incubation temperatures of 25 and 32 degrees C. The colchicine-induced inhibition was not reversed by D2O. Cytochalasin B, which gives a variable enhancement of IgE-mediated release, had a marked enhancing effect on the serum-induced reaction in all subjects tested. The following agents known to inhibit the IgE-mediated reaction also inhibited serum-induced release at 25 degrees C: colchicine, dibutyryl cyclic AMP, aminophylline, isoproterenol, cholera toxin, chlorphenesin, diethylcarbamazine, and 2-deoxy-D-glucose. These results suggest that the serum-induced release is modulated by intracellular cyclic AMP, requires energy, and is enhanced by the disruption of microfilaments. The lack of an effect by D2O would suggest that microtubular stabilization is not required. The data can be interpreted to indicate that IgE- and C5a-mediated reactions diverge at a late stage in the histamine release pathway.

  15. East Coast Air Combat Maneuvering Range (EC/ACMR) Ocean Tower Construction Completion Report.

    DTIC Science & Technology

    1978-03-01

    c)D Sa con itionS.r n lectricaldes St rm oactlvtto ~Utost 311fa :... ea rjn d~ ,Rjon,&gj B. ADMIN a m . cu a C. OPERATIONS: O;erations at Tower F3 ...nections. D. EQUIP STATUS - NONE E. LOGISTICS - NONE F. TRAINING NONE C. SAFETY - NO ACCIDENTS H. t,.EDICAL- NO INJURIES 1. ,ORALE- Nigh ad Tower f3 ...74. .-- Y .~lile B-. driven 59 ftv/5 6 0, 060, and 040 haieers; AV B,"F - e driven 57 ft w/5 6 0 and 040 hammers; AV BPP 82 v/540. Total weather time

  16. Rational Design of Regulators of Programmed Cell Death in Human Breast Cancer

    DTIC Science & Technology

    2003-07-01

    1992). 2. R. E. Ellis, J . Y. Yuan, H. R. Horvitz, Annu Rev Cell Biol 7, 663-98 (1991). 3. A. Strasser, D. C. Huang, D. L. Vaux, Biochim Biophys Acta...1333, F151-78 (1997). 4. C. B. Thompson, Science 267, 1456-62 (1995). DAMD17-99-1-9362 17 5. D. T. Chao, S. J . Korsmeyer, Annu Rev Immunol 16, 395...419 (1998). 6. J . C. Reed, Adv Pharmacol 41, 501-32 (1997). 7. S. Cory, Annu Rev Immunol 13, 513-43 (1995). 8. E. Yang, S. J . Korsmeyer, Blood 88

  17. Hydrogen collisions with transition metal surfaces: Universal electronically nonadiabatic adsorption

    NASA Astrophysics Data System (ADS)

    Dorenkamp, Yvonne; Jiang, Hongyan; Köckert, Hansjochen; Hertl, Nils; Kammler, Marvin; Janke, Svenja M.; Kandratsenka, Alexander; Wodtke, Alec M.; Bünermann, Oliver

    2018-01-01

    Inelastic scattering of H and D atoms from the (111) surfaces of six fcc transition metals (Au, Pt, Ag, Pd, Cu, and Ni) was investigated, and in each case, excitation of electron-hole pairs dominates the inelasticity. The results are very similar for all six metals. Differences in the average kinetic energy losses between metals can mainly be attributed to different efficiencies in the coupling to phonons due to the different masses of the metal atoms. The experimental observations can be reproduced by molecular dynamics simulations based on full-dimensional potential energy surfaces and including electronic excitations by using electronic friction in the local density friction approximation. The determining factors for the energy loss are the electron density at the surface, which is similar for all six metals, and the mass ratio between the impinging atoms and the surface atoms. Details of the electronic structure of the metal do not play a significant role. The experimentally validated simulations are used to explore sticking over a wide range of incidence conditions. We find that the sticking probability increases for H and D collisions near normal incidence—consistent with a previously reported penetration-resurfacing mechanism. The sticking probability for H or D on any of these metals may be represented as a simple function of the incidence energy, Ein, metal atom mass, M, and incidence angle, 𝜗i n. S =(S0+a ṡEi n+b ṡM ) *(1 -h (𝜗i n-c ) (1 -cos(𝜗 i n-c ) d ṡh (Ei n-e ) (Ei n-e ) ) ) , where h is the Heaviside step function and for H, S0 = 1.081, a = -0.125 eV-1, b =-8.40 ṡ1 0-4 u-1, c = 28.88°, d = 1.166 eV-1, and e = 0.442 eV; whereas for D, S0 = 1.120, a = -0.124 eV-1, b =-1.20 ṡ1 0-3 u-1, c = 28.62°, d = 1.196 eV-1, and e = 0.474 eV.

  18. Solar Energy.

    DTIC Science & Technology

    1980-04-01

    r G 2 W to* L- .0 -- >0m0 L tox >- td . U74o m Et -t C V).--01- MU a#CO Cmto (D 3- 4h - ’- ; %14 4 , c o ’ow ft 000 -- -t4ME’toL0S:Oj- D- C - L 1: 0) d...I- C M-D w 0A--DC C 0 c c 0 :3 -DmC tD 4)Oft- (A OU .l C). 4A LDQC4--U-- M*; U.;O 0 fu ,0 4 a> U W, GD >. 0 D GDI GDO; )D Co C U ODDDL MG (n 4 In 41...r4C4 󈧭 u 41 C, a, -300c’- 41..𔃼 : WC WA 140U Zm L: 1 >. O X424.a 0 L E -0 0) z’ a- W - 3uV ’oC o w mc C-1 (000 40 02 .D Ga cr > -4 II -, 0r0 OC L

  19. Tree bark suber-included particles: A long-term accumulation site for elements of atmospheric origin

    NASA Astrophysics Data System (ADS)

    Catinon, Mickaël; Ayrault, Sophie; Spadini, Lorenzo; Boudouma, Omar; Asta, Juliette; Tissut, Michel; Ravanel, Patrick

    2011-02-01

    The deposition of atmospheric elements on and into the bark of 4-year-old Fraxinus excelsior L. was studied. The elemental composition of the suber tissue was established through ICP-MS analysis and the presence of solid mineral particles included in this suber was established and described through SEM-EDX. Fractionation of the suber elements mixture was obtained after ashing at 550 °C through successive water (C fraction) and HNO 3 2 M (D fraction) extraction, leading to an insoluble residue mainly composed of the solid mineral particles (E fraction). The triplicated % weight of C, D and E were respectively 34.4 ± 2.7, 64.8 ± 2.7 and 0.8 ± 0.1% of the suber ashes weight. The main component of C was K, of D was Ca. Noticeable amounts of Mg were also observed in D. The E fraction, composed of insoluble particles, was mostly constituted of geogenic products, with elements such as Si, Al, K, Mg, representing primary minerals. E also contained Ca 3(PO 4) 2 and concentrated the main part of Pb and Fe. Moreover, The SEM-EDX analysis evidenced that this fraction also concentrated several types of fly ashes of industrial origin. The study of the distribution between C, D and E was analysed through ICP-MS with respect to their origin. The origin of the elements found in such bark was either geogenic (clay, micas, quartz…), anthropogenic or biogenic (for instance large amounts of solid Ca organic salts having a storage role). As opposed to the E fraction, the C fraction, mainly composed of highly soluble K+ is characteristic of a biological pool of plant origin. In fraction D, the very high amount of Ca++ corresponds to two different origins: biological or acid soluble minerals such as calcite. Furthermore, the D fraction contains the most part of pollutants of anthropic origin such as Zn, Cu, Ni, Co, Cd. As a whole, the fractionation procedure of the suber samples allows to separate elements as a function of their origin but also gives valuable information on distribution and speciation of trace elements.

  20. Final Environmental Assessment for FY07-11 BRAC Construction Requirements at Andrews Air Force Base, Maryland

    DTIC Science & Technology

    2007-09-01

    IO B LV D G S T AR KA N S AS R D FIRST ST AT LA N TA A... IO A VE C S T O A K ST SALEM RD K N ER R D R M AD IS O N D R STARKEY AVE TENNESSEE AVE PATRICK RD S. D AK O TA A VE TOPE KA ST VANDE NBERG...DR CHIC AGO DR TY LE R R D CELME R LN HALL CT WACO LN BUNKER HILL ST O P ER AT IO N S D R MAPL E CT SEATTLE AVE RE NO DR O R E G O N C IR AL

  1. Structure And Mutagenic Conversion of E(1) Dehydrase: at the Crossroads of Dehydration, Amino Transfer, And Epimerization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smith, P.; Szu, P.-H.; Bui, C.

    2009-05-26

    Pyridoxal 5'-phosphate (PLP) and pyridoxamine 5'-phosphate (PMP) are highly versatile coenzymes whose importance is well recognized. The capability of PLP/PMP-dependent enzymes to catalyze a diverse array of chemical reactions is attributed to fine-tuning of the cofactor-substrate interactions in the active site. CDP-6-deoxy-l-threo-d-glycero-4-hexulose 3-dehydrase (E1), along with its reductase (E{sub 3}), catalyzes the C-3 deoxygenation of CDP-4-keto-6-deoxy-d-glucose to form the dehydrated product, CDP-4-keto-3,6-dideoxy-d-glucose, in the ascarylose biosynthetic pathway. This product is the progenitor to most 3,6-dideoxyhexoses, which are the major antigenic determinants of many Gram-negative pathogens. The dimeric [2Fe-2S] protein, E{sub 1}, cloned from Yersinia pseudotuberculosis, is the only known enzymemore » whose catalysis involves the direct participation of PMP in one-electron redox chemistry. E{sub 1} also contains an unusual [2Fe-2S] cluster with a previously unknown binding motif (C-X{sub 57}-C-X{sub 1}-C-X{sub 7}-C). Herein we report the first X-ray crystal structure of E{sub 1}, which exhibits an aspartate aminotransferase (AAT) fold. A comparison of the E{sub 1} active site architecture with homologous structures uncovers residues critical for the dehydration versus transamination activity. Site-directed mutagenesis of four E{sub 1} residues, D194H, Y217H, H220K, and F345H, converted E{sub 1} from a PMP-dependent dehydrase to a PLP/glutamate-dependent aminotransferase. The E{sub 1} quadruple mutant, having been conferred this altered enzyme activity, can transaminate the natural substrate to CDP-4,6-dideoxy-4-amino-d-galactose without E{sub 3}. Taken together, these results provide the molecular basis of the functional switch of E{sub 1} toward dehydration, epimerization, and transamination. The insights gained from these studies can be used for the development of inhibitors of disease-relevant PLP/PMP-dependent enzymes.« less

  2. Measurement of the absolute branching fraction of Ds+ --> tau+ nutau decay.

    PubMed

    Ecklund, K M; Love, W; Savinov, V; Lopez, A; Mendez, H; Ramirez, J; Ge, J Y; Miller, D H; Shipsey, I P J; Xin, B; Adams, G S; Anderson, M; Cummings, J P; Danko, I; Hu, D; Moziak, B; Napolitano, J; He, Q; Insler, J; Muramatsu, H; Park, C S; Thorndike, E H; Yang, F; Artuso, M; Blusk, S; Khalil, S; Li, J; Mountain, R; Nisar, S; Randrianarivony, K; Sultana, N; Skwarnicki, T; Stone, S; Wang, J C; Zhang, L M; Bonvicini, G; Cinabro, D; Dubrovin, M; Lincoln, A; Rademacker, J; Asner, D M; Edwards, K W; Naik, P; Reed, J; Briere, R A; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Rosner, J L; Alexander, J P; Cassel, D G; Duboscq, J E; Ehrlich, R; Fields, L; Gibbons, L; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Mohapatra, D; Onyisi, P U E; Patterson, J R; Peterson, D; Riley, D; Ryd, A; Sadoff, A J; Shi, X; Stroiney, S; Sun, W M; Wilksen, T; Athar, S B; Patel, R; Yelton, J; Rubin, P; Eisenstein, B I; Karliner, I; Mehrabyan, S; Lowrey, N; Selen, M; White, E J; Wiss, J; Mitchell, R E; Shepherd, M R; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Poling, R; Scott, A W; Zweber, P; Dobbs, S; Metreveli, Z; Seth, K K; Tomaradze, A; Libby, J; Powell, A; Wilkinson, G

    2008-04-25

    Using a sample of tagged D(s)(+) decays collected near the D(s)(*+/-)D(s)(-/+) peak production energy in e(+)e(-) collisions with the CLEO-c detector, we study the leptonic decay D(s)(+)-->tau(+)nu(tau) via the decay channel tau(+)-->e(+)nu(e)nu(tau). We measure B(D(s)(+)-->tau(+)nu(tau))=(6.17+/-0.71+/-0.34)%, where the first error is statistical and the second systematic. Combining this result with our measurements of D(s)(+)-->mu(+)nu(mu) and D(s)(+)-->tau(+)nu(tau) (via tau(+)-->pi(+)nu(tau)), we determine f(D(s))=(274+/-10+/-5) MeV.

  3. 78 FR 59085 - Notice of Final Federal Agency Action on Proposed Highway in California

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-25

    .... 2000(d)-2000(d)(1)]; American Indian Religious Freedom Act [42 U.S.C. 1996]; Farmland Protection Policy... of Cultural Resources; E.O. 13007 Indian Sacred Sites; E.O. 13287 Preserve America; E.O. 13175...

  4. 1,2-Dichlorohexafluoro-cyclobutane (1,2-c-C4F6Cl2, R-316c) a potent ozone depleting substance and greenhouse gas: atmospheric loss processes, lifetimes, and ozone depletion and global warming potentials for the (E) and (Z) stereoisomers.

    PubMed

    Papadimitriou, Vassileios C; McGillen, Max R; Smith, Shona C; Jubb, Aaron M; Portmann, Robert W; Hall, Bradley D; Fleming, Eric L; Jackman, Charles H; Burkholder, James B

    2013-10-31

    The atmospheric processing of (E)- and (Z)-1,2-dichlorohexafluoro-cyclobutane (1,2-c-C4F6Cl2, R-316c) was examined in this work as the ozone depleting (ODP) and global warming (GWP) potentials of this proposed replacement compound are presently unknown. The predominant atmospheric loss processes and infrared absorption spectra of the R-316c isomers were measured to provide a basis to evaluate their atmospheric lifetimes and, thus, ODPs and GWPs. UV absorption spectra were measured between 184.95 to 230 nm at temperatures between 214 and 296 K and a parametrization for use in atmospheric modeling is presented. The Cl atom quantum yield in the 193 nm photolysis of R-316c was measured to be 1.90 ± 0.27. Hexafluorocyclobutene (c-C4F6) was determined to be a photolysis co-product with molar yields of 0.7 and 1.0 (±10%) for (E)- and (Z)-R-316c, respectively. The 296 K total rate coefficient for the O((1)D) + R-316c reaction, i.e., O((1)D) loss, was measured to be (1.56 ± 0.11) × 10(-10) cm(3) molecule(-1) s(-1) and the reactive rate coefficient, i.e., R-316c loss, was measured to be (1.36 ± 0.20) × 10(-10) cm(3) molecule(-1) s(-1) corresponding to a ~88% reactive yield. Rate coefficient upper-limits for the OH and O3 reaction with R-316c were determined to be <2.3 × 10(-17) and <2.0 × 10(-22) cm(3) molecule(-1) s(-1), respectively, at 296 K. The quoted uncertainty limits are 2σ and include estimated systematic errors. Local and global annually averaged lifetimes for the (E)- and (Z)-R-316c isomers were calculated using a 2-D atmospheric model to be 74.6 ± 3 and 114.1 ± 10 years, respectively, where the estimated uncertainties are due solely to the uncertainty in the UV absorption spectra. Stratospheric photolysis is the predominant atmospheric loss process for both isomers with the O((1)D) reaction making a minor, ~2% for the (E) isomer and 7% for the (Z) isomer, contribution to the total atmospheric loss. Ozone depletion potentials for (E)- and (Z)-R-316c were calculated using the 2-D model to be 0.46 and 0.54, respectively. Infrared absorption spectra for (E)- and (Z)-R-316c were measured at 296 K and used to estimate their radiative efficiencies (REs) and GWPs; 100-year time-horizon GWPs of 4160 and 5400 were obtained for (E)- and (Z)-R-316c, respectively. Both isomers of R-316c are shown in this work to be long-lived ozone depleting substances and potent greenhouse gases.

  5. Benzofuranyl Esters: Synthesis, Crystal Structure Determination, Antimicrobial and Antioxidant Activities.

    PubMed

    Kumar, C S Chidan; Then, Li Yee; Chia, Tze Shyang; Chandraju, Siddegowda; Win, Yip-Foo; Sulaiman, Shaida Fariza; Hashim, Nurul Shafiqah; Ooi, Kheng Leong; Quah, Ching Kheng; Fun, Hoong-Kun

    2015-09-11

    A series of five new 2-(1-benzofuran-2-yl)-2-oxoethyl 4-(un/substituted)benzoates 4(a-e), with the general formula of C₈H₅O(C=O)CH₂O(C=O)C₆H₄X, X = H, Cl, CH₃, OCH₃ or NO₂, was synthesized in high purity and good yield under mild conditions. The synthesized products 4(a-e) were characterized by FTIR, ¹H-, (13)C- and ¹H-(13)C HMQC NMR spectroscopic analysis and their 3D structures were confirmed by single-crystal X-ray diffraction studies. These compounds were screened for their antimicrobial and antioxidant activities. The tested compounds showed antimicrobial ability in the order of 4b < 4a < 4c < 4d < 4e and the highest potency with minimum inhibition concentration (MIC) value of 125 µg/mL was observed for 4e. The results of antioxidant activities revealed the highest activity for compound 4e (32.62% ± 1.34%) in diphenyl-2-picrylhydrazyl (DPPH) radical scavenging, 4d (31.01% ± 4.35%) in ferric reducing antioxidant power (FRAP) assay and 4a (27.11% ± 1.06%) in metal chelating (MC) activity.

  6. Publications - PDF 95-33E | Alaska Division of Geological & Geophysical

    Science.gov Websites

    content DGGS PDF 95-33E Publication Details Title: Geologic hazards map of the Charley River D-1, C-1, and part of the B-1 quadrangles, east-central Alaska Authors: Pinney, D.S., Clough, J.G., Reifenstuhl, R.R ., Reifenstuhl, R.R., and Liss, S.A., 1995, Geologic hazards map of the Charley River D-1, C-1, and part of the B

  7. Thermo-optical properties of Alexandrite laser crystal

    NASA Astrophysics Data System (ADS)

    Loiko, Pavel; Ghanbari, Shirin; Matrosov, Vladimir; Yumashev, Konstantin; Major, Arkady

    2018-02-01

    Alexandrite is a well-known material for broadly tunable and power-scalable near-IR lasers. We measured the thermal coefficients of the optical path (TCOP) and thermo-optic coefficients (TOCs) of Alexandrite at 632.8 nm for three principal light polarizations, E || a, E || b and E || c. All TOCs are positive and show a notable polarization-anisotropy, dna/dT = 5.5, dnb/dT = 7.0 and dnc/dT = 14.9×10-6 K-1. We also characterized thermal lensing in a continuous-wave Alexandrite laser which used a Brewster-oriented c-cut 0.16 at.% Cr3+ doped BeAl2O4 crystal pumped at 532 nm and emitted at 750.9 nm (E || b). The measured thermal lens was positive and astigmatic. The sensitivity factors of the thermal lens (Mx,y = dDx,y/dPabs) were found to be Mx = 1.74 and My = 2.38 [m-1/W].

  8. Association of different biomarkers of renal function with D-dimer levels in patients with type 1 diabetes mellitus (renal biomarkers and D-dimer in diabetes).

    PubMed

    Domingueti, Caroline Pereira; Fóscolo, Rodrigo Bastos; Dusse, Luci Maria S; Reis, Janice Sepúlveda; Carvalho, Maria das Graças; Gomes, Karina Braga; Fernandes, Ana Paula

    2018-02-01

    Objective This study aimed to evaluate the association between different renal biomarkers with D-Dimer levels in diabetes mellitus (DM1) patients group classified as: low D-Dimer levels (< 318 ng/mL), which included first and second D-Dimer tertiles, and high D-Dimer levels (≥ 318 ng/mL), which included third D-Dimer tertile. Materials and methods D-Dimer and cystatin C were measured by ELISA. Creatinine and urea were determined by enzymatic method. Estimated glomerular filtration rate (eGFR) was calculated using CKD-EPI equation. Albuminuria was assessed by immunoturbidimetry. Presence of renal disease was evaluated using each renal biomarker: creatinine, urea, cystatin C, eGFR and albuminuria. Bivariate logistic regression analysis was performed to assess which renal biomarkers are associated with high D-Dimer levels and odds ratio was calculated. After, multivariate logistic regression analysis was performed to assess which renal biomarkers are associated with high D-Dimer levels (after adjusting for sex and age) and odds ratio was calculated. Results Cystatin C presented a better association [OR of 9.8 (3.8-25.5)] with high D-Dimer levels than albuminuria, creatinine, eGFR and urea [OR of 5.3 (2.2-12.9), 8.4 (2.5-25.4), 9.1 (2.6-31.4) and 3.5 (1.4-8.4), respectively] after adjusting for sex and age. All biomarkers showed a good association with D-Dimer levels, and consequently, with hypercoagulability status, and cystatin C showed the best association among them. Conclusion Therefore, cystatin C might be useful to detect patients with incipient diabetic kidney disease that present an increased risk of cardiovascular disease, contributing to an early adoption of reno and cardioprotective therapies.

  9. Total reaction cross sections of electronic state-specified transition metal cations: V + +C2H6, C3H8, and C2H4 at 0.2 eV

    NASA Astrophysics Data System (ADS)

    Sanders, Lary; Hanton, Scott D.; Weisshaar, James C.

    1990-03-01

    We describe a crossed beam experiment which measures total cross sections for reaction of electronic state-specified V+ with small hydrocarbons at well-defined collision energy E=0.2 eV. The V+ state distribution created at each ionizing wavelength is directly measured by angle-integrated photoelectron spectroscopy (preceding paper). Reactant and product ions are collected and analyzed by pulsed time-of-flight mass spectrometry following a reaction time of 6 μs. Tests of the performance of the apparatus are described in detail. Our experiment defines the reactant V+ electronic state distribution and the collision energy much more precisely than previous work. For all three hydrocarbons C2H6, C3H8, and C2H4, H2 elimination products dominate at 0.2 eV. We observe a dramatic dependence of cross section on the V+ electronic term. The second excited term 3d34s(3F) is more reactive than either lower energy quintet term 3d4(5D) or 3d34s(5F) by a factor of ≥270, 80, and ≥6 for the C2H6, C3H8, and C2H4 reactions, respectively. The 3d34s(3F) reaction cross sections at 0.2 eV are 20±11 Å2, 37±19 Å2, and 2.7±1.6 Å2, respectively, compared with Langevin cross sections of ˜80 Å2. For the C2H6 and C3H8 reactions, cross sections are independent of initial spin-orbit level J within the 3F term to the limits of our accuracy. Comparison with earlier work by Armentrout and co-workers shows that electronic excitation to d3s(3F) is far more effective at promoting H2 elimination than addition of the same total kinetic energy to reactants. Electron spin is clearly a key determinant of V+ reactivity with small hydrocarbons. We suggest that triplet V+ reacts much more efficiently than quintet V+ because of its ability to conserve total electron spin along paths to insertion in a C-H bond of the hydrocarbon.

  10. Lebbeckoside C, a new triterpenoid saponin from the stem barks of Albizia lebbeck inhibits the growth of human glioblastoma cells.

    PubMed

    Noté, Olivier Placide; Ngo Mbing, Joséphine; Kilhoffer, Marie-Claude; Pegnyemb, Dieudonné Emmanuel; Lobstein, Annelise

    2018-02-19

    One new acacic acid-type saponin, named lebbeckoside C (1), was isolated from the stem barks of Albizia lebbeck. Its structure was established on the basis of extensive analysis of 1D and 2D NMR ( 1 H, 13 C NMR, DEPT, COSY, TOCSY, ROESY, HSQC and HMBC) experiments, HRESIMS studies, and by chemical evidence as 3-O-[β-d-xylopyranosyl-(l→2)-β-d-fucopyranosyl-(1→6)-[β-d-glucopyranosyl(1→2)]-β-d-glucopyranosyl]-21-O-{(2E,6S)-6-O-{4-O-[(2E,6S)-2,6-dimethyl-6-O-(β-d-quinovopyranosyl)octa-2,7-dienoyl]-4-O-[(2E,6S)-2,6-dimethyl-6-O-(β-d-quinovopyranosyl)octa-2,7-dienoyl]-β-d-quinovopyranosyl}-2,6-dimethylocta-2,7-dienoyl}acacic acid 28 O-[β-d-quinovopyranosyl-(l→3)-[α-l-arabinofuranosyl-(l→4)]-α-l-rhamnopyranosyl-(l→2)-β-d-glucopyranosyl] ester. The isolated saponin (1) displayed significant cytotoxic activity against the human glioblastoma cell line U-87 MG and TG1 stem-like glioma cells isolated from a patient tumor with IC 50 values of 1.69 and 1.44 μM, respectively.

  11. 5 CFR 720.306 - Responsibilities of The Office of Personnel Management.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... support agency programs for disabled veterans. (c) Semiannual Reports. As provided by 38 U.S.C. 2014(d... affirmative action programs for disabled veterans. (d) Report to Congress. As required by 38 U.S.C. 2014(e...

  12. The cell wall and cell division gene cluster in the Mra operon of Pseudomonas aeruginosa: cloning, production, and purification of active enzymes.

    PubMed

    Azzolina, B A; Yuan, X; Anderson, M S; El-Sherbeini, M

    2001-04-01

    We have cloned the Pseudomonas aeruginosa cell wall biosynthesis and cell division gene cluster that corresponds to the mra operon in the 2-min region of the Escherichia coli chromosome. The organization of the two chromosomal regions in P. aeruginosa and E. coli is remarkably similar with the following gene order: pbp3/pbpB, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, and envA/LpxC. All of the above P. aeruginosa genes are transcribed from the same strand of DNA with very small, if any, intragenic regions, indicating that these genes may constitute a single operon. All five amino acid ligases, MurC, MurD, MurE, MurF, and DdlB, in addition to MurG and MraY were cloned in expression vectors. The four recombinant P. aeruginosa Mur ligases, MurC, MurD, MurE, and MurF were overproduced in E. coli and purified as active enzymes. Copyright 2001 Academic Press.

  13. Statistical Software Engineering

    DTIC Science & Technology

    1998-04-13

    multiversion software subject to coincident errors. IEEE Trans. Software Eng. SE-11:1511-1517. Eckhardt, D.E., A.K Caglayan, J.C. Knight, L.D. Lee, D.F...J.C. and N.G. Leveson. 1986. Experimental evaluation of the assumption of independence in multiversion software. IEEE Trans. Software

  14. Real-Time Radio Wave Propagation for Mobile Ad-Hoc Network Emulation and Simulation Using General Purpose Graphics Processing Units (GPGPUs)

    DTIC Science & Technology

    2014-05-01

    COST-Walfisch- Ikegami model (14) estimates the received power predominantly on the basis of frequency and distance to the transmitter. Ray-optical (15...34 # $ $ # % & ’ ( ) * + , , - . / - 0 1 2 3 4 5 6 7 7 6 8 9 : ; < = > ? @ A B C ? D E F A B G H ? E E I J K L M N O P Q R S T U V W X S Y Z O Y [ Q [ \\ W O P...a b _ c _ d _ e f ` d g h ` i j k l l m n o p k q r s t u v w w x y z

  15. Mandolin Family Instruments

    NASA Astrophysics Data System (ADS)

    Cohen, David J.; Rossing, Thomas D.

    The mandolin family of instruments consists of plucked chordophones, each having eight strings in four double courses. With the exception of the mandobass, the courses are tuned in intervals of fifths, as are the strings in violin family instruments. The soprano member of the family is the mandolin, tuned G3-D4-A4-E5. The alto member of the family is the mandola, tuned C3-G3-D4-A4. The mandola is usually referred to simply as the mandola in the USA, but is called the tenor mandola in Europe. The tenor member of the family is the octave mandolin, tuned G2-D3-A3-E4. It is referred to as the octave mandolin in the USA, and as the octave mandola in Europe. The baritone member of the family is the mandocello, or mandoloncello, tuned C2-G2-D3-A3. A variant of the mandocello not common in the USA is the five-course liuto moderno, or simply liuto, designed for solo repertoire. Its courses are tuned C2-G2-D3-A3-E4. A mandobass was also made by more than one manufacturer during the early twentieth century, though none are manufactured today. They were fretted instruments with single string courses tuned E1-A1-D2-G2. There are currently a few luthiers making piccolo mandolins, tuned C4-G4-D5-A5.

  16. Metal Binding by the D,DX35E Motif of Human Immunodeficiency Virus Type 1 Integrase: Selective Rescue of Cys Substitutions by Mn2+ In Vitro

    PubMed Central

    Gao, Kui; Wong, Steven; Bushman, Frederic

    2004-01-01

    The D,DX35E motif characteristic of retroviral integrase enzymes (INs) is expected to bind the required metal cofactors (Mg2+ or Mn2+), but direct evidence for a catalytic role has been lacking. Here we used a metal rescue strategy to investigate metal binding. We established conditions for analysis of an activity of IN, disintegration, in both Mg2+ and Mn2+, and tested IN mutants with cysteine substitutions in each acidic residue of the D,DX35E motif. Mn2+ but not Mg2+ can bind tightly to Cys, so if metal binding at the acidic residues is mechanistically important, it is expected that the Cys-substituted enzymes would be active in the presence of Mn2+ only. Of the three acidic residues, a strong metal rescue effect was obtained for D116C, a weaker rescue was seen for D64C, and no rescue was seen with E152C. Modest rescue could also be detected for D116C in normal integration in vitro. Comparison to Ser and Ala substitutions at D116 established that the rescue was selective for Cys. Further studies of the response to pH suggest that the metal cofactor may stabilize the deprotonated nucleophile active in catalysis, and studies of the response to NaCl titrations disclose an additional role for the metal cofactor in stabilizing the IN-DNA complex. PMID:15194746

  17. Search for C=+ charmonium and bottomonium states in e{sup +}e{sup -}{yields}{gamma}+ X at B factories

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li Dan; Chao Kuangta; He Zhiguo

    2009-12-01

    We study the production of C=+ charmonium states X in e{sup +}e{sup -}{yields}{gamma}+X at B factories with X={eta}{sub c}(nS) (n=1, 2, 3), {chi}{sub cJ}(mP) (m=1, 2), and {sup 1}D{sub 2}(1D). In the S- and P-wave case, contributions of QED with one-loop QCD corrections are calculated within the framework of nonrelativistic QCD (NRQCD), and in the D-wave case only the QED contribution is considered. We find that in most cases the one-loop QCD corrections are negative and moderate, in contrast to the case of double charmonium production e{sup +}e{sup -}{yields}J/{psi}+X, where one-loop QCD corrections are positive and large in most cases.more » We also find that the production cross sections of some of these states in e{sup +}e{sup -}{yields}{gamma}+X are larger than that in e{sup +}e{sup -}{yields}J/{psi}+X by an order of magnitude even after the negative one-loop QCD corrections are included. We then argue that search for the X(3872), X(3940), Y(3940), and X(4160) in e{sup +}e{sup -}{yields}{gamma}+X at B factories may be helpful to clarify the nature of these states. For completeness, the production of bottomonium states in e{sup +}e{sup -} annihilation is also discussed.« less

  18. U.S. EPA, Pesticide Product Label, , 08/05/1971

    EPA Pesticide Factsheets

    2011-04-13

    ... ', <- j ' .. :.1 1 I'C"J~' I !cu:po(..d\\,;: c ... ~r r' 2 fcCI. In ! ," .; itt :',' C,i: r '\\ '''0'''-' r(' 'cl'l·(·.·h'll 1 , , ' . I j'-" :- I 1·,·i'_·'_I.U'·L:c'=+() q'. " j. 'd, (J'e 'II.! ...

  19. A framework for understanding waste management studies in construction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu Weisheng, E-mail: wilsonlu@hku.hk; Yuan Hongping, E-mail: hp.yuan@polyu.edu.hk

    2011-06-15

    During the past decades, construction and demolition (C and D) waste issues have received increasing attention from both practitioners and researchers around the world. A plethora of research relating to C and D waste management (WM) has been published in scholarly journals. However, a comprehensive understanding of the C and D WM research is somehow absent in spite of its proliferation. The aim of this paper is to develop a framework that helps readers understand the C and D WM research as archived in selected journals. Papers under the topic of C and D WM are retrieved based on amore » set of rigorous procedures. The information of these papers is then analyzed with the assistance of the Qualitative Social Research (QSR) software package NVivo. A framework for understanding C and D WM research is created based on the analytic results. By following the framework, a bibliometric analysis of research in C and D WM is presented, followed by an in-depth literature analysis. It is found that C and D generation, reduction, and recycling are the three major topics in the discipline of C and D WM. Future research is recommended to (a) investigate C and D waste issues in wider scopes including design, maintenance and demolition, (b) develop a unified measurement for waste generation so that WM performance can be compared across various economies, and (c) enhance effectiveness of WM approaches (e.g. waste charging scheme) based on new WM concepts (e.g. Extended Producer Responsibility). In addition to the above research findings, the approach for producing the research framework can be useful references for other studies which attempt to understand the research of a given discipline.« less

  20. A framework for understanding waste management studies in construction.

    PubMed

    Lu, Weisheng; Yuan, Hongping

    2011-06-01

    During the past decades, construction and demolition (C&D) waste issues have received increasing attention from both practitioners and researchers around the world. A plethora of research relating to C&D waste management (WM) has been published in scholarly journals. However, a comprehensive understanding of the C&D WM research is somehow absent in spite of its proliferation. The aim of this paper is to develop a framework that helps readers understand the C&D WM research as archived in selected journals. Papers under the topic of C&D WM are retrieved based on a set of rigorous procedures. The information of these papers is then analyzed with the assistance of the Qualitative Social Research (QSR) software package NVivo. A framework for understanding C&D WM research is created based on the analytic results. By following the framework, a bibliometric analysis of research in C&D WM is presented, followed by an in-depth literature analysis. It is found that C&D generation, reduction, and recycling are the three major topics in the discipline of C&D WM. Future research is recommended to (a) investigate C&D waste issues in wider scopes including design, maintenance and demolition, (b) develop a unified measurement for waste generation so that WM performance can be compared across various economies, and (c) enhance effectiveness of WM approaches (e.g. waste charging scheme) based on new WM concepts (e.g. Extended Producer Responsibility). In addition to the above research findings, the approach for producing the research framework can be useful references for other studies which attempt to understand the research of a given discipline. Copyright © 2011 Elsevier Ltd. All rights reserved.

Some links on this page may take you to non-federal websites. Their policies may differ from this site.
Top