Sample records for c-c chemokine ligand

  1. Dienogest inhibits C-C motif chemokine ligand 20 expression in human endometriotic epithelial cells.

    PubMed

    Mita, Shizuka; Nakakuki, Masanori; Ichioka, Masayuki; Shimizu, Yutaka; Hashiba, Masamichi; Miyazaki, Hiroyasu; Kyo, Satoru

    2017-07-01

    C-C motif chemokine ligand 20 is thought to contribute to the development of endometriosis by recruiting Th17 lymphocytes into endometriotic foci. The present study investigated the effects of dienogest, a progesterone receptor agonist used to treat endometriosis, on C-C motif chemokine ligand 20 expression by endometriotic cells. Effects of dienogest on mRNA expression and protein secretion of C-C motif chemokine ligand 20 induced by interleukin 1β were assessed in three immortalized endometriotic epithelial cell lines, parental cells (EMosis-CC/TERT1), and stably expressing human progesterone receptor isoform A (EMosis-CC/TERT1/PRA+) or isoform B (EMosis-CC/TERT1/PRA-/PRB+). Dienogest markedly inhibited interleukin 1β-stimulated C-C motif chemokine ligand 20 mRNA expression and protein secretion in EMosis-CC/TERT1/PRA-/PRB+, which was abrogated by the progesterone receptor antagonist RU486. In EMosis-CC/TERT1/PRA+, dienogest slightly inhibited C-C motif chemokine ligand 20 mRNA and protein. In EMosis-CC/TERT1, dienogest slightly inhibited C-C motif chemokine ligand 20 mRNA, but had no effect on C-C motif chemokine ligand 20 protein. Dienogest inhibited interleukin 1β-induced up-regulation of C-C motif chemokine ligand 20 in endometriotic epithelial cells, mainly mediated by progesterone receptor B. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Relationships Among Obesity, Type 2 Diabetes, and Plasma Cytokines in African American Women.

    PubMed

    Denis, Gerald V; Sebastiani, Paola; Andrieu, Guillaume; Tran, Anna H; Strissel, Katherine J; Lombardi, Frank L; Palmer, Julie R

    2017-11-01

    The principal objective of this investigation was to identify novel cytokine associations with BMI and type 2 diabetes (T2D). Cytokines were profiled from African American women with obesity who donated plasma to the Komen Tissue Bank. Multiplex bead arrays of analytes were used to quantify 88 cytokines and chemokines in association with clinical diagnoses of metabolic health. Regression models were generated after elimination of outliers. Among women with obesity, T2D was associated with breast adipocyte hypertrophy and with six plasma analytes, including four chemokines (chemokine [C-C motif] ligand 2, chemokine [C-C motif] ligand 16, chemokine [C-X-C motif] ligand 1, and chemokine [C-X-C motif] ligand 16) and two growth factors (interleukin 2 and epidermal growth factor). In addition, three analytes were associated with obesity independently of diabetes: interleukin 4, soluble CD40 ligand, and chemokine (C-C motif) ligand 3. Profiling of inflammatory cytokines combined with measures of BMI may produce a more personalized risk assessment for obesity-associated disease in African American women. © 2017 The Obesity Society.

  3. Hepatocyte Growth Factor and Interleukin-6 in Prostate Cancer Bone Metastasis

    DTIC Science & Technology

    2006-06-01

    Wif1 Wnt inhibitory factor 1 ## ## ## ## Cxcl4 Chemokine (C-X-C motif) ligand 4 ## ## ## ## Cxcl12 Chemokine (C-X-C motif) ligand 12...CGGCTGAAGAACAACAACAG GGCGTCTGACTCACACCTCT Clu CAGCTGGCTAACCTCACACA AACAGCTTCACCACCACCTC Cxcl4 AGTCCTGAGCTGCTGCTTCT CCCAGAGGAGATGGTCTTCA Col1A1 GAGAGCATGACCGATGGATT

  4. Semaphorin4D Drives CD8+ T-Cell Lesional Trafficking in Oral Lichen Planus via CXCL9/CXCL10 Upregulations in Oral Keratinocytes.

    PubMed

    Ke, Yao; Dang, Erle; Shen, Shengxian; Zhang, Tongmei; Qiao, Hongjiang; Chang, Yuqian; Liu, Qing; Wang, Gang

    2017-11-01

    Chemokine-mediated CD8 + T-cell recruitment is an essential but not well-established event for the persistence of oral lichen planus (OLP). Semaphorin 4D (Sema4D)/CD100 is implicated in immune dysfunction, chemokine modulation, and cell migration, which are critical aspects for OLP progression, but its implication in OLP pathogenesis has not been determined. In this study, we sought to explicate the effect of Sema4D on human oral keratinocytes and its capacity to drive CD8 + T-cell lesional trafficking via chemokine modulation. We found that upregulations of sSema4D in OLP tissues and blood were positively correlated with disease severity and activity. In vitro observation revealed that Sema4D induced C-X-C motif chemokine ligand 9/C-X-C motif chemokine ligand 10 production by binding to plexin-B1 via protein kinase B-NF-κB cascade in human oral keratinocytes, which elicited OLP CD8 + T-cell migration. We also confirmed using clinical samples that elevated C-X-C motif chemokine ligand 9/C-X-C motif chemokine ligand 10 levels were positively correlated with sSema4D levels in OLP lesions and serum. Notably, we determined matrix metalloproteinase-9 as a new proteolytic enzyme for the cleavage of sSema4D from the T-cell surface, which may contribute to the high levels of sSema4D in OLP lesions and serum. Our findings conclusively revealed an amplification feedback loop involving T cells, chemokines, and Sema4D-dependent signal that promotes OLP progression. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Distinct CCL2, CCL5, CCL11, CCL27, IL-17, IL-6, BDNF serum profiles correlate to different job-stress outcomes.

    PubMed

    Polacchini, Alessio; Girardi, Damiano; Falco, Alessandra; Zanotta, Nunzia; Comar, Manola; De Carlo, Nicola Alberto; Tongiorgi, Enrico

    2018-02-01

    Chronic psychosocial stress at workplace is an important factor in the development of physical and mental illness. Objective biological measures of chronic stress are still lacking, but inflammatory response and growth factors are increasingly considered as potential stress biomarkers. Therefore, we investigated the relationship between psychophysical strain and serum levels of 48 chemokines, cytokines and growth factors measured using a multiplex immunoassay, and serum brain-derived neurotrophic factor (BDNF) measured by ELISA. Severity of psychophysical strain was scored in 115 healthy hospital workers using specific scales for anxiety, depression-like emotion, gastrointestinal or cardiac disturbances, and ergonomic dysfunction. Multivariate analysis revealed that higher anxiety scale scores were correlated with lower serum chemokine C-C motif ligand-2 (CCL2/MCP-1), chemokine C-C motif ligand-5 (CCL5/RANTES), chemokine C-C motif ligand-27 (CCL27/CTACK), chemokine C-C motif ligand-11 (CCL11/Eotaxin) and interleukin-6 (IL-6); gastrointestinal disturbances correlated with increased levels of interleukin-17 (IL-17) and reduced CCL11/Eotaxin, CCL27/CTACK and CCL2/MCP-1; while cardiac dysfunctions associate only to reduced CCL27/CTACK, and ergonomic dysfunction correlated with increased BDNF and reduced CCL11/Eotaxin and CCL5/RANTES. Thus, these 7 serum factors may provide a distinct signature for each different stress-related psychophysical outcome giving indications on individual vulnerabilities.

  6. Indole-3-carbinol and 3’, 3’-diindolylmethane modulate androgen effect up-regulation on C-C chemokine ligand 2 and monocyte attraction to prostate cancer cells

    USDA-ARS?s Scientific Manuscript database

    Inflammation has a role in prostate tumorigenesis. Recruitment of inflammatory monocytes to the tumor site is mediated by C-C chemokine ligand 2 (CCL2) through binding to its receptor CCR2. We hypothesized that androgen could modulate CCL2 expression in hormone-responsive prostate cancer cells, and ...

  7. CDIP-2, a synthetic peptide derived from chemokine (C-C motif) ligand 13 (CCL13), ameliorates allergic airway inflammation

    PubMed Central

    Mendez-Enriquez, E; Melendez, Y; Martinez, F; Baay, G; Huerta-Yepez, S; Gonzalez-Bonilla, C; Fortoul, T I; Soldevila, G; García-Zepeda, E A

    2008-01-01

    Airway inflammation is characterized by selective recruitment of mononuclear and granulocytic cells. This recruitment is mediated by the action of chemotactic cytokines, such as chemokines. A number of chemokines and their receptors have been identified and proposed as potential therapeutic agents in allergic airway inflammation. One of these chemokines is chemokine (C-C motif) ligand 13 (CCL13), a CC chemokine that has been associated with allergic inflammatory diseases such as asthma and allergic rhinitis. To investigate alternative therapeutic agents to alleviate allergic inflammatory diseases, a number of chemokine-derived synthetic peptides were designed and tested for their ability to modulate in vitro and in vivo chemokine-mediated functions. Our results show that one of these peptides, CDIP-2, displayed antagonist functions in in vitro chemotaxis assays using monocytic cell lines. In addition, we found that CDIP-2 significantly reduced peribronchial, perivascular infiltrate and mucus overproduction in an ovalbumin-induced allergic lung inflammation murine model. Thus, CDIP-2 may be considered as part of a novel group of anti-inflammatory agents based on chemokine-derived synthetic peptides. PMID:18336592

  8. CDIP-2, a synthetic peptide derived from chemokine (C-C motif) ligand 13 (CCL13), ameliorates allergic airway inflammation.

    PubMed

    Mendez-Enriquez, E; Melendez, Y; Martinez, F; Baay, G; Huerta-Yepez, S; Gonzalez-Bonilla, C; Fortoul, T I; Soldevila, G; García-Zepeda, E A

    2008-05-01

    Airway inflammation is characterized by selective recruitment of mononuclear and granulocytic cells. This recruitment is mediated by the action of chemotactic cytokines, such as chemokines. A number of chemokines and their receptors have been identified and proposed as potential therapeutic agents in allergic airway inflammation. One of these chemokines is chemokine (C-C motif) ligand 13 (CCL13), a CC chemokine that has been associated with allergic inflammatory diseases such as asthma and allergic rhinitis. To investigate alternative therapeutic agents to alleviate allergic inflammatory diseases, a number of chemokine-derived synthetic peptides were designed and tested for their ability to modulate in vitro and in vivo chemokine-mediated functions. Our results show that one of these peptides, CDIP-2, displayed antagonist functions in in vitro chemotaxis assays using monocytic cell lines. In addition, we found that CDIP-2 significantly reduced peribronchial, perivascular infiltrate and mucus overproduction in an ovalbumin-induced allergic lung inflammation murine model. Thus, CDIP-2 may be considered as part of a novel group of anti-inflammatory agents based on chemokine-derived synthetic peptides.

  9. The primary growth of laryngeal squamous cell carcinoma cells in vitro is effectively supported by paired cancer-associated fibroblasts alone.

    PubMed

    Wang, Mei; Wu, Chunping; Guo, Yu; Cao, Xiaojuan; Zheng, Wenwei; Fan, Guo-Kang

    2017-05-01

    Most primarily cultured laryngeal squamous cell carcinoma cells are difficult to propagate in vitro and have a low survival rate. However, in our previous work to establish a laryngeal squamous cell carcinoma cell line, we found that laryngeal cancer-associated fibroblasts appeared to strongly inhibit the apoptosis of primarily cultured laryngeal squamous cell carcinoma cells in vitro. In this study, we investigated whether paired laryngeal cancer-associated fibroblasts alone can effectively support the growth of primarily cultured laryngeal squamous cell carcinoma cells in vitro. In all, 29 laryngeal squamous cell carcinoma specimens were collected and primarily cultured. The laryngeal squamous cell carcinoma cells were separated from cancer-associated fibroblasts by differential trypsinization and continuously subcultured. Morphological changes of the cultured laryngeal squamous cell carcinoma cells were observed. Immunocytofluorescence was used to authenticate the identity of the cancer-associated fibroblasts and laryngeal squamous cell carcinoma cells. Flow cytometry was used to quantify the proportion of apoptotic cells. Western blot was used to detect the protein levels of caspase-3. Enzyme-linked immunosorbent assay was used to detect the levels of chemokine (C-X-C motif) ligand 12, chemokine (C-X-C motif) ligand 7, hepatocyte growth factor, and fibroblast growth factor 1 in the supernatants of the laryngeal squamous cell carcinoma and control cells. AMD3100 (a chemokine (C-X-C motif) receptor 4 antagonist) and an anti-chemokine (C-X-C motif) ligand 7 antibody were used to block the tumor-supporting capacity of cancer-associated fibroblasts. Significant apoptotic changes were detected in the morphology of laryngeal squamous cell carcinoma cells detached from cancer-associated fibroblasts. The percentage of apoptotic laryngeal squamous cell carcinoma cells and the protein levels of caspase-3 increased gradually in subsequent subcultures. In contrast, no significant differences in the proliferation capacity of laryngeal squamous cell carcinoma cells cocultured with cancer-associated fibroblasts were detected during subculturing. High level of chemokine (C-X-C motif) ligand 12 was detected in the culture supernatant of cancer-associated fibroblasts. The tumor-supporting effect of cancer-associated fibroblasts was significantly inhibited by AMD3100. Our findings demonstrate that the paired laryngeal cancer-associated fibroblasts alone are sufficient to support the primary growth of laryngeal squamous cell carcinoma cells in vitro and that the chemokine (C-X-C motif) ligand 12/chemokine (C-X-C motif) receptor 4 axis is one of the major contributors.

  10. Dual GPCR and GAG mimicry by the M3 chemokine decoy receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alexander-Brett, Jennifer M.; Fremont, Daved H.

    2008-09-23

    Viruses have evolved a myriad of evasion strategies focused on undermining chemokine-mediated immune surveillance, exemplified by the mouse {gamma}-herpesvirus 68 M3 decoy receptor. Crystal structures of M3 in complex with C chemokine ligand 1/lymphotactin and CC chemokine ligand 2/monocyte chemoattractant protein 1 reveal that invariant chemokine features associated with G protein-coupled receptor binding are primarily recognized by the decoy C-terminal domain, whereas the N-terminal domain (NTD) reconfigures to engage divergent basic residue clusters on the surface of chemokines. Favorable electrostatic forces dramatically enhance the association kinetics of chemokine binding by M3, with a primary role ascribed to acidic NTD regionsmore » that effectively mimic glycosaminoglycan interactions. Thus, M3 employs two distinct mechanisms of chemical imitation to potently sequester chemokines, thereby inhibiting chemokine receptor binding events as well as the formation of chemotactic gradients necessary for directed leukocyte trafficking.« less

  11. The chemokine decoy receptor D6 prevents excessive inflammation and adverse ventricular remodeling after myocardial infarction.

    PubMed

    Cochain, Clément; Auvynet, Constance; Poupel, Lucie; Vilar, José; Dumeau, Edouard; Richart, Adèle; Récalde, Alice; Zouggari, Yasmine; Yin, Kiave Yune Ho Wang; Bruneval, Patrick; Renault, Gilles; Marchiol, Carmen; Bonnin, Philippe; Lévy, Bernard; Bonecchi, Raffaella; Locati, Massimo; Combadière, Christophe; Silvestre, Jean-Sébastien

    2012-09-01

    Leukocyte infiltration in ischemic areas is a hallmark of myocardial infarction, and overwhelming infiltration of innate immune cells has been shown to promote adverse remodeling and cardiac rupture. Recruitment of inflammatory cells in the ischemic heart depends highly on the family of CC-chemokines and their receptors. Here, we hypothesized that the chemokine decoy receptor D6, which specifically binds and scavenges inflammatory CC-chemokines, might limit inflammation and adverse cardiac remodeling after infarction. D6 was expressed in human and murine infarcted myocardium. In a murine model of myocardial infarction, D6 deficiency led to increased chemokine (C-C motif) ligand 2 and chemokine (C-C motif) ligand 3 levels in the ischemic heart. D6-deficient (D6(-/-)) infarcts displayed increased infiltration of pathogenic neutrophils and Ly6Chi monocytes, associated with strong matrix metalloproteinase-9 and matrix metalloproteinase-2 activities in the ischemic heart. D6(-/-) mice were cardiac rupture prone after myocardial infarction, and functional analysis revealed that D6(-/-) hearts had features of adverse remodeling with left ventricle dilation and reduced ejection fraction. Bone marrow chimera experiments showed that leukocyte-borne D6 had no role in this setting, and that leukocyte-specific chemokine (C-C motif) receptor 2 deficiency rescued the adverse phenotype observed in D6(-/-) mice. We show for the first time that the chemokine decoy receptor D6 limits CC-chemokine-dependent pathogenic inflammation and is required for adequate cardiac remodeling after myocardial infarction.

  12. Comprehensive analysis of chemokine-induced cAMP-inhibitory responses using a real-time luminescent biosensor.

    PubMed

    Felouzis, Virginia; Hermand, Patricia; de Laissardière, Guy Trambly; Combadière, Christophe; Deterre, Philippe

    2016-01-01

    Chemokine receptors are members of the G-protein-coupled receptor (GPCR) family coupled to members of the Gi class, whose primary function is to inhibit the cellular adenylate cyclase. We used a cAMP-related and PKA-based luminescent biosensor (GloSensor™ F-22) to monitor the real-time downstream response of chemokine receptors, especially CX3CR1 and CXCR4, after activation with their cognate ligands CX3CL1 and CXCL12. We found that the amplitudes and kinetic profiles of the chemokine responses were conserved in various cell types and were independent of the nature and concentration of the molecules used for cAMP prestimulation, including either the adenylate cyclase activator forskolin or ligands mediating Gs-mediated responses like prostaglandin E2 or beta-adrenergic agonist. We conclude that the cAMP chemokine response is robustly conserved in various inflammatory conditions. Moreover, the cAMP-related luminescent biosensor appears as a valuable tool to analyze the details of Gi-mediated cAMP-inhibitory cellular responses, even in native conditions and could help to decipher their precise role in cell function. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Evidence for chemokine synergy during neutrophil migration in ARDS.

    PubMed

    Williams, Andrew E; José, Ricardo J; Mercer, Paul F; Brealey, David; Parekh, Dhruv; Thickett, David R; O'Kane, Cecelia; McAuley, Danny F; Chambers, Rachel C

    2017-01-01

    Acute respiratory distress syndrome (ARDS) is a life-threatening condition characterised by pulmonary oedema, respiratory failure and severe inflammation. ARDS is further characterised by the recruitment of neutrophils into the lung interstitium and alveolar space. The factors that regulate neutrophil infiltration into the inflamed lung and our understanding of the pathomechanisms in ARDS remain incomplete. This study aimed at determining the role of the chemokine (C-C motif) ligand (CCL)2 and CCL7 in ARDS. CCL2 and CCL7 protein levels were measured in bronchoalveolar lavage (BAL) fluid obtained from lipopolysaccharide(LPS)-challenged human volunteers and two separate cohorts of patients with ARDS. Neutrophil chemotaxis to ARDS BAL fluid was evaluated and the contribution of each was assessed and compared with chemokine (C-X-C motif) ligand 8 (CXCL8). Chemokine receptor expression on neutrophils from blood or BAL fluid of patients with ARDS was analysed by flow cytometry. CCL2 and CCL7 were significantly elevated in BAL fluid recovered from LPS-challenged volunteers and patients with ARDS. BAL fluid from patients with ARDS was highly chemotactic for human neutrophils and neutralising either CCL2 or CCL7 attenuated the neutrophil chemotactic response. Moreover, CCL2 and CCL7 synergised with CXCL8 to promote neutrophil migration. Furthermore, neutrophils isolated from the blood or BAL fluid differentially regulated the cell surface expression of chemokine (C-X-C motif) receptor 1 and C-C chemokine receptor type 2 during ARDS. This study highlights important inflammatory chemokines involved in regulating neutrophil migration, which may have potential value as therapeutic targets for the treatment of ARDS. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  14. Evidence for chemokine synergy during neutrophil migration in ARDS

    PubMed Central

    Williams, Andrew E; José, Ricardo J; Mercer, Paul F; Brealey, David; Parekh, Dhruv; Thickett, David R; O'Kane, Cecelia; McAuley, Danny F; Chambers, Rachel C

    2017-01-01

    Background Acute respiratory distress syndrome (ARDS) is a life-threatening condition characterised by pulmonary oedema, respiratory failure and severe inflammation. ARDS is further characterised by the recruitment of neutrophils into the lung interstitium and alveolar space. Objectives The factors that regulate neutrophil infiltration into the inflamed lung and our understanding of the pathomechanisms in ARDS remain incomplete. This study aimed at determining the role of the chemokine (C-C motif) ligand (CCL)2 and CCL7 in ARDS. Methods CCL2 and CCL7 protein levels were measured in bronchoalveolar lavage (BAL) fluid obtained from lipopolysaccharide(LPS)-challenged human volunteers and two separate cohorts of patients with ARDS. Neutrophil chemotaxis to ARDS BAL fluid was evaluated and the contribution of each was assessed and compared with chemokine (C-X-C motif) ligand 8 (CXCL8). Chemokine receptor expression on neutrophils from blood or BAL fluid of patients with ARDS was analysed by flow cytometry. Results CCL2 and CCL7 were significantly elevated in BAL fluid recovered from LPS-challenged volunteers and patients with ARDS. BAL fluid from patients with ARDS was highly chemotactic for human neutrophils and neutralising either CCL2 or CCL7 attenuated the neutrophil chemotactic response. Moreover, CCL2 and CCL7 synergised with CXCL8 to promote neutrophil migration. Furthermore, neutrophils isolated from the blood or BAL fluid differentially regulated the cell surface expression of chemokine (C-X-C motif) receptor 1 and C-C chemokine receptor type 2 during ARDS. Conclusion This study highlights important inflammatory chemokines involved in regulating neutrophil migration, which may have potential value as therapeutic targets for the treatment of ARDS. PMID:27496101

  15. Clinical and Immunological Outcome in Cutaneous Leishmaniasis Patients Treated with Pentoxifylline

    PubMed Central

    Brito, Graça; Dourado, Mayra; Polari, Ludmila; Celestino, Daniela; Carvalho, Lucas P.; Queiroz, Adriano; Carvalho, Edgar M.; Machado, Paulo R. L.; Passos, Sara

    2014-01-01

    Pentoxifylline is a tumor necrosis factor-α (TNF-α) inhibitor that also attenuates the immune response and decreases tissue inflammation. The association of pentoxifylline with antimony improves the cure rate of mucosal and cutaneous leishmaniasis. In this randomized and double blind pilot trial, cure rate was higher, although not significant, in patients who received antimony plus pentoxifylline than in those patients receiving antimony plus placebo. A significant decrease in TNF-α and interferon-γ (IFN-γ) levels during therapy was more pronounced in the antimony plus pentoxifylline group, whereas CCL-3 (Chemokine [C-C motif] ligand 3) decreased similarly in both groups. The increased levels of CXCL-9 (Chemokine [C-X-C motif] ligand 9) during therapy were lower in the antimony plus pentoxifylline group. Therapy with pentoxifylline modifies cytokines and chemokines production, which may be associated with therapeutic outcome. PMID:24567316

  16. The Chemokine Receptor CXCR6 Evokes Reverse Signaling via the Transmembrane Chemokine CXCL16

    PubMed Central

    Adamski, Vivian; Mentlein, Rolf; Lucius, Ralph; Synowitz, Michael; Held-Feindt, Janka; Hattermann, Kirsten

    2017-01-01

    Reverse signaling is a signaling mechanism where transmembrane or membrane-bound ligands transduce signals and exert biological effects upon binding of their specific receptors, enabling a bidirectional signaling between ligand and receptor-expressing cells. In this study, we address the question of whether the transmembrane chemokine (C-X-C motif) ligand 16, CXCL16 is able to transduce reverse signaling and investigate the biological consequences. For this, we used human glioblastoma cell lines and a melanoma cell line as in vitro models to show that stimulation with recombinant C-X-C chemokine receptor 6 (CXCR6) or CXCR6-containing membrane preparations induces intracellular (reverse) signaling. Specificity was verified by RNAi experiments and by transfection with expression vectors for the intact CXCL16 and an intracellularly-truncated form of CXCL16. We showed that reverse signaling via CXCL16 promotes migration in CXCL16-expressing melanoma and glioblastoma cells, but does not affect proliferation or protection from chemically-induced apoptosis. Additionally, fast migrating cells isolated from freshly surgically-resected gliomas show a differential expression pattern for CXCL16 in comparison to slowly-migrating cells, enabling a possible functional role of the reverse signaling of the CXCL16/CXCR6 pair in human brain tumor progression in vivo. PMID:28698473

  17. The Chemokine Receptor CXCR6 Evokes Reverse Signaling via the Transmembrane Chemokine CXCL16.

    PubMed

    Adamski, Vivian; Mentlein, Rolf; Lucius, Ralph; Synowitz, Michael; Held-Feindt, Janka; Hattermann, Kirsten

    2017-07-08

    Reverse signaling is a signaling mechanism where transmembrane or membrane-bound ligands transduce signals and exert biological effects upon binding of their specific receptors, enabling a bidirectional signaling between ligand and receptor-expressing cells. In this study, we address the question of whether the transmembrane chemokine (C-X-C motif) ligand 16, CXCL16 is able to transduce reverse signaling and investigate the biological consequences. For this, we used human glioblastoma cell lines and a melanoma cell line as in vitro models to show that stimulation with recombinant C-X-C chemokine receptor 6 (CXCR6) or CXCR6-containing membrane preparations induces intracellular (reverse) signaling. Specificity was verified by RNAi experiments and by transfection with expression vectors for the intact CXCL16 and an intracellularly-truncated form of CXCL16. We showed that reverse signaling via CXCL16 promotes migration in CXCL16-expressing melanoma and glioblastoma cells, but does not affect proliferation or protection from chemically-induced apoptosis. Additionally, fast migrating cells isolated from freshly surgically-resected gliomas show a differential expression pattern for CXCL16 in comparison to slowly-migrating cells, enabling a possible functional role of the reverse signaling of the CXCL16/CXCR6 pair in human brain tumor progression in vivo.

  18. Asthmatic bronchial epithelium activated by the proteolytic allergen Der p 1 increases selective dendritic cell recruitment.

    PubMed

    Pichavant, Muriel; Charbonnier, Anne-Sophie; Taront, Solenne; Brichet, Anne; Wallaert, Benoît; Pestel, Joel; Tonnel, André-Bernard; Gosset, Philippe

    2005-04-01

    Airway dendritic cells (DCs) are crucial for allergen-induced sensitization and inflammation in allergic asthma. After allergen challenge, an increased number of DCs is observed in airway epithelium from patients with allergy. Because Der p 1, a cysteine protease allergen from Dermatophagoides pteronyssinus , induces chemokine production by bronchial epithelial cells (BECs), the purpose of this investigation was to evaluate the capacity of BEC exposed to Der p 1 to recruit DCs. Chemotactic activity of BEAS-2B, a bronchial epithelial cell line, and BECs from nonatopic controls and patients with allergic asthma was evaluated on the migration of precursors, immature and mature monocyte-derived DCs (MDDCs), and CD34 + -derived Langerhans cells (LCs). C-C chemokine ligand (CCL)-2, CCL5, and C-X-C chemokine ligand 10 production by BEAS-2B and BEC was increased after Der p 1 exposure, whereas the proenzyme proDer p 1 devoid of enzymatic activity had no effect. Der p 1 stimulation of BEAS-2B and BEC from both groups increased significantly the recruitment of MDDC precursors, depending on CCL2, CCL5, and C-X-C chemokine ligand 10 production. In a reconstituted polarized epithelium, apical application of Der p 1 enhanced MDDC precursor migration into the epithelial layer. Moreover, Der p 1 stimulation of BEC from patients with asthma but not from controls increased the migration of LC precursors, mainly dependent on CCL20 secretion. No migration of immature and mature DCs was observed. These data confirmed that BECs participate in the homeostasis of the DC network present within the bronchial epithelium through the secretion of chemokines. In allergic asthma, upregulation of CCL20 production induced LC recruitment, the role of which remains to be determined.

  19. Targeting chemokine (C-C motif) ligand 2 (CCL2) as an example of translation of cancer molecular biology to the clinic.

    PubMed

    Zhang, Jian; Patel, Lalit; Pienta, Kenneth J

    2010-01-01

    Chemokines are a family of small and secreted proteins that play pleiotropic roles in inflammation-related pathological diseases, including cancer. Among the identified 50 human chemokines, chemokine (C-C motif) ligand 2 (CCL2) is of particular importance in cancer development since it serves as one of the key mediators of interactions between tumor and host cells. CCL2 is produced by cancer cells and multiple different host cells within the tumor microenvironment. CCL2 mediates tumorigenesis in many different cancer types. For example, CCL2 has been reported to promote prostate cancer cell proliferation, migration, invasion, and survival, via binding to its functional receptor CCR2. Furthermore, CCL2 induces the recruitment of macrophages and induces angiogenesis and matrix remodeling. Targeting CCL2 has been demonstrated as an effective therapeutic approach in preclinical prostate cancer models, and currently, neutralizing monoclonal antibody against CCL2 has entered into clinical trials in prostate cancer. In this chapter, targeting CCL2 in prostate cancer will be used as an example to show translation of laboratory findings from cancer molecular biology to the clinic. Copyright © 2010 Elsevier Inc. All rights reserved.

  20. UP-REGULATION OF IL-6, IL-8 AND CCL2 GENE EXPRESSION AFTER ACUTE INFLAMMATION: CORRELATION TO CLINICAL PAIN

    PubMed Central

    Wang, Xiao-Min; Hamza, May; Wu, Tai-Xia; Dionne, Raymond A.

    2012-01-01

    Tissue injury initiates a cascade of inflammatory mediators and hyperalgesic substances including prostaglandins, cytokines and chemokines. Using microarray and qRT-PCR gene expression analyses, the present study evaluated changes in gene expression of a cascade of cytokines following acute inflammation and the correlation between the changes in the gene expression level and pain intensity in the oral surgery clinical model of acute inflammation. Tissue injury resulted in a significant up-regulation in the gene expression of Interleukin-6 (IL-6; 63.3-fold), IL-8 (8.1-fold), chemokine (C-C motif) ligand 2 (CCL2; 8.9-fold), chemokine (C-X-C motif) ligand 1 (CXCL1; 30.5-fold), chemokine (C-X-C motif) ligand 2 (CXCL2; 26-fold) and annexin A1 (ANXA1; 12-fold). The up-regulation of IL-6 gene expression was significantly correlated to the up-regulation on the gene expression of IL-8, CCL2, CXCL1 and CXCL2. Interestingly, the tissue injury induced up-regulation of IL-6 gene expression, IL-8 and CCL2 were positively correlated to pain intensity at 3 hours post-surgery, the onset of acute inflammatory pain. However, ketorolac treatment did not have a significant effect on the gene expression of IL-6, IL-8, CCL2, CXCL2 and ANXA1 at the same time point of acute inflammation. These results demonstrate that up-regulation of IL-6, IL-8 and CCL2 gene expression contributes to the development of acute inflammation and inflammatory pain. The lack of effect for ketorolac on the expression of these gene products may be related to the ceiling analgesic effects of non-steroidal anti-inflammatory drugs. PMID:19233564

  1. Impact of genetic variations in C-C chemokine receptors and ligands on infectious diseases.

    PubMed

    Qidwai, Tabish; Khan, M Y

    2016-10-01

    Chemokine receptors and ligands are crucial for extensive immune response against infectious diseases such as malaria, leishmaniasis, HIV and tuberculosis and a wide variety of other diseases. Role of chemokines are evidenced in the activation and regulation of immune cell migration which is important for immune response against diseases. Outcome of disease is determined by complex interaction among pathogen, host genetic variability and surrounding milieu. Variation in expression or function of chemokines caused by genetic polymorphisms could be associated with attenuated immune responses. Exploration of chemokine genetic polymorphisms in therapeutic response, gene regulation and disease outcome is important. Infectious agents in human host alter the expression of chemokines via epigenetic alterations and thus contribute to disease pathogenesis. Although some fragmentary data are available on chemokine genetic variations and their contribution in diseases, no unequivocal conclusion has been arrived as yet. We therefore, aim to investigate the association of CCR5-CCL5 and CCR2-CCL2 genetic polymorphisms with different infectious diseases, transcriptional regulation of gene, disease severity and response to therapy. Furthermore, the role of epigenetics in genes related to chemokines and infectious disease are also discussed. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  2. Peroxisome proliferator-activated receptor {alpha} agonists modulate Th1 and Th2 chemokine secretion in normal thyrocytes and Graves' disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Antonelli, Alessandro, E-mail: a.antonelli@med.unipi.it; Ferrari, Silvia Martina, E-mail: sm.ferrari@int.med.unipi.it; Frascerra, Silvia, E-mail: lafrasce@gmail.com

    2011-07-01

    Until now, no data are present about the effect of peroxisome proliferator-activated receptor (PPAR){alpha} activation on the prototype Th1 [chemokine (C-X-C motif) ligand (CXCL)10] (CXCL10) and Th2 [chemokine (C-C motif) ligand 2] (CCL2) chemokines secretion in thyroid cells. The role of PPAR{alpha} and PPAR{gamma} activation on CXCL10 and CCL2 secretion was tested in Graves' disease (GD) and control primary thyrocytes stimulated with interferon (IFN){gamma} and tumor necrosis factor (TNF){alpha}. IFN{gamma} stimulated both CXCL10 and CCL2 secretion in primary GD and control thyrocytes. TNF{alpha} alone stimulated CCL2 secretion, while had no effect on CXCL10. The combination of IFN{gamma} and TNF{alpha} hadmore » a synergistic effect both on CXCL10 and CCL2 chemokines in GD thyrocytes at levels comparable to those of controls. PPAR{alpha} activators inhibited the secretion of both chemokines (stimulated with IFN{gamma} and TNF{alpha}) at a level higher (for CXCL10, about 60-72%) than PPAR{gamma} agonists (about 25-35%), which were confirmed to inhibit CXCL10, but not CCL2. Our data show that CCL2 is modulated by IFN{gamma} and TNF{alpha} in GD and normal thyrocytes. Furthermore we first show that PPAR{alpha} activators inhibit the secretion of CXCL10 and CCL2 in thyrocytes, suggesting that PPAR{alpha} may be involved in the modulation of the immune response in the thyroid.« less

  3. Skeletal muscle cell contraction reduces a novel myokine, chemokine (C-X-C motif) ligand 10 (CXCL10): potential roles in exercise-regulated angiogenesis.

    PubMed

    Ishiuchi, Yuri; Sato, Hitoshi; Tsujimura, Kazuki; Kawaguchi, Hideo; Matsuwaki, Takashi; Yamanouchi, Keitaro; Nishihara, Masugi; Nedachi, Taku

    2018-01-01

    Accumulating evidence indicates that skeletal muscle secrets proteins referred to as myokines and that exercise contributes to their regulation. In this study, we propose that chemokine (C-X-C motif) ligand 10 (CXCL10) functions as a novel myokine. Initially, we stimulated differentiated C2C12 myotubes with or without electrical pulse stimulation (EPS) to identify novel myokines. Cytokine array analysis revealed that CXCL10 secretion was significantly reduced by EPS, which was further confirmed by enzyme-linked immunosorbent assay and quantitative polymerase chain reaction analysis. Treadmill experiments in mice identified significant reduction of Cxcl10 gene expression in the soleus muscle. Additionally, contraction-dependent p38 MAPK activation appeared to be involved in this reduction. Furthermore, C2C12 conditioned medium obtained after applying EPS could induce survival of MSS31, a vascular endothelial cell model, which was partially attenuated by the addition of recombinant CXCL10. Overall, our findings suggest CXCL10 as a novel exercise-reducible myokine, to control endothelial cell viability.

  4. The C-C motif chemokine ligands CCL5, CCL11, and CCL24 induce the migration of circulating fibrocytes from patients with severe asthma.

    PubMed

    Isgrò, M; Bianchetti, L; Marini, M A; Bellini, A; Schmidt, M; Mattoli, S

    2013-07-01

    The C-C motif chemokine ligand 5 (CCL5), CCL11, and CCL24 are involved in the pathogenesis of asthma, and their function is mainly associated with the airway recruitment of eosinophils. This study tested their ability to induce the migration of circulating fibrocytes, which may contribute to the development of irreversible airflow obstruction in severe asthma. The sputum fluid phase (SFP) from patients with severe/treatment-refractory asthma (PwSA) contained elevated concentrations of CCL5, CCL11, and CCL24 in comparison with the SFP from patients with non-severe/treatment-responsive asthma (PwNSA). The circulating fibrocytes from PwSA expressed the receptors for these chemokines at increased levels and migrated in response to recombinant CCL5, CCL11, and CCL24. The SFP from PwSA induced the migration of autologous fibrocytes, and its activity was significantly attenuated by neutralization of endogenous CCL5, CCL11, and CCL24. These findings suggest that CCL5, CCL11, and CCL24 may contribute to the airway recruitment of fibrocytes in severe asthma.

  5. Microarray analysis of gene expression in West Nile virus–infected human retinal pigment epithelium

    PubMed Central

    Munoz-Erazo, Luis; Natoli, Ricardo; Provis, Jan Marie; Madigan, Michelle Catherine

    2012-01-01

    Purpose To identify key genes differentially expressed in the human retinal pigment epithelium (hRPE) following low-level West Nile virus (WNV) infection. Methods Primary hRPE and retinal pigment epithelium cell line (ARPE-19) cells were infected with WNV (multiplicity of infection 1). RNA extracted from mock-infected and WNV-infected cells was assessed for differential expression of genes using Affymetrix microarray. Quantitative real-time PCR analysis of 23 genes was used to validate the microarray results. Results Functional annotation clustering of the microarray data showed that gene clusters involved in immune and antiviral responses ranked highly, involving genes such as chemokine (C-C motif) ligand 2 (CCL2), chemokine (C-C motif) ligand 5 (CCL5), chemokine (C-X-C motif) ligand 10 (CXCL10), and toll like receptor 3 (TLR3). In conjunction with the quantitative real-time PCR analysis, other novel genes regulated by WNV infection included indoleamine 2,3-dioxygenase (IDO1), genes involved in the transforming growth factor–β pathway (bone morphogenetic protein and activin membrane-bound inhibitor homolog [BAMBI] and activating transcription factor 3 [ATF3]), and genes involved in apoptosis (tumor necrosis factor receptor superfamily, member 10d [TNFRSF10D]). WNV-infected RPE did not produce any interferon-γ, suggesting that IDO1 is induced by other soluble factors, by the virus alone, or both. Conclusions Low-level WNV infection of hRPE cells induced expression of genes that are typically associated with the host cell response to virus infection. We also identified other genes, including IDO1 and BAMBI, that may influence the RPE and therefore outer blood-retinal barrier integrity during ocular infection and inflammation, or are associated with degeneration, as seen for example in aging. PMID:22509103

  6. Platelet-rich plasma affects bacterial growth in vitro.

    PubMed

    Mariani, Erminia; Filardo, Giuseppe; Canella, Valentina; Berlingeri, Andrea; Bielli, Alessandra; Cattini, Luca; Landini, Maria Paola; Kon, Elizaveta; Marcacci, Maurilio; Facchini, Andrea

    2014-09-01

    Platelet-rich plasma (PRP), a blood derivative rich in platelets, is a relatively new technique used in tissue regeneration and engineering. The increased quantity of platelets makes this formulation of considerable value for their role in tissue healing and microbicidal activity. This activity was investigated against five of the most important strains involved in nosocomial infections (Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae and Streptococcus faecalis) to understand the prophylactic role of pure (P)-PRP. Microbicidal proteins released from activated P-PRP platelets were also determined. The microbicidal activity of P-PRP and platelet-poor plasma (PPP) was evaluated on different concentrations of the five bacterial strains incubated for 1, 2, 4 and 18 h and plated on agar for 18-24 h. P-PRP and PPP-released microbicidal proteins were evaluated by means of multiplex bead-based immunoassays. P-PRP and PPP inhibited bacterial growth for up to 2 h of incubation. The effect of P-PRP was significantly higher than that of PPP, mainly at the low seeding concentrations and/or shorter incubation times, depending on the bacterial strain. Chemokine (C-C motif) ligand-3, chemokine (C-C motif) ligand-5 and chemokine (C-X-C motif) ligand-1 were the molecules mostly related to Pseudomonas aeruginosa, Staphylococcus aureus and Streptococcus faecalis inhibition. Escherichia coli and Klebsiella pneumoniae were less influenced. The present results show that P-PRP might supply an early protection against bacterial contaminations during surgical interventions because the inhibitory activity is already evident from the first hour of treatment, which suggests that physiological molecules supplied in loco might be important in the time frame needed for the activation of the innate immune response. Copyright © 2014 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  7. C-X-C motif chemokine ligand 10 produced by mouse Sertoli cells in response to mumps virus infection induces male germ cell apoptosis

    PubMed Central

    Jiang, Qian; Wang, Fei; Shi, Lili; Zhao, Xiang; Gong, Maolei; Liu, Weihua; Song, Chengyi; Li, Qihan; Chen, Yongmei; Wu, Han; Han, Daishu

    2017-01-01

    Mumps virus (MuV) infection usually results in germ cell degeneration in the testis, which is an etiological factor for male infertility. However, the mechanisms by which MuV infection damages male germ cells remain unclear. The present study showed that C-X-C motif chemokine ligand 10 (CXCL10) is produced by mouse Sertoli cells in response to MuV infection, which induces germ cell apoptosis through the activation of caspase-3. CXC chemokine receptor 3 (CXCR3), a functional receptor of CXCL10, is constitutively expressed in male germ cells. Neutralizing antibodies against CXCR3 and an inhibitor of caspase-3 activation significantly inhibited CXCL10-induced male germ cell apoptosis. Furthermore, the tumor necrosis factor-α (TNF-α) upregulated CXCL10 production in Sertoli cells after MuV infection. The knockout of either CXCL10 or TNF-α reduced germ cell apoptosis in the co-cultures of germ cells and Sertoli cells in response to MuV infection. Local injection of MuV into the testes of mice confirmed the involvement of CXCL10 in germ cell apoptosis in vivo. These results provide novel insights into MuV-induced germ cell apoptosis in the testis. PMID:29072682

  8. Assessment of CCL2 and CXCL8 chemokines in serum, bronchoalveolar lavage fluid and lung tissue samples from dogs affected with canine idiopathic pulmonary fibrosis.

    PubMed

    Roels, Elodie; Krafft, Emilie; Farnir, Frederic; Holopainen, Saila; Laurila, Henna P; Rajamäki, Minna M; Day, Michael J; Antoine, Nadine; Pirottin, Dimitri; Clercx, Cecile

    2015-10-01

    Canine idiopathic pulmonary fibrosis (CIPF) is a progressive disease of the lung parenchyma that is more prevalent in dogs of the West Highland white terrier (WHWT) breed. Since the chemokines (C-C motif) ligand 2 (CCL2) and (C-X-C motif) ligand 8 (CXCL8) have been implicated in pulmonary fibrosis in humans, the aim of the present study was to investigate whether these same chemokines are involved in the pathogenesis of CIPF. CCL2 and CXCL8 concentrations were measured by ELISA in serum and bronchoalveolar lavage fluid (BALF) from healthy dogs and WHWTs affected with CIPF. Expression of the genes encoding CCL2 and CXCL8 and their respective receptors, namely (C-C motif) receptor 2 (CCR2) and (C-X-C motif) receptor 2 (CXCR2), was compared in unaffected lung tissue and biopsies from dogs affected with CIPF by quantitative PCR and localisation of CCL2 and CXCL8 proteins were determined by immunohistochemistry. Significantly greater CCL2 and CXCL8 concentrations were found in the BALF from WHWTs affected with CIPF, compared with healthy dogs. Significantly greater serum concentrations of CCL2, but not CXCL8, were found in CIPF-affected dogs compared with healthy WHWTs. No differences in relative gene expression for CCL2, CXCL8, CCR2 or CXCR2 were observed when comparing lung biopsies from control dogs and those affected with CIPF. In affected lung tissues, immunolabelling for CCL2 and CXCL8 was observed in bronchial airway epithelial cells in dogs affected with CIPF. The study findings suggest that both CCL2 and CXCL8 are involved in the pathogenesis of CIPF. Further studies are required to determine whether these chemokines might have a clinical use as biomarkers of fibrosis or as targets for therapeutic intervention. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. A role for the CXCR4-CXCL12 axis in the little skate, Leucoraja erinacea.

    PubMed

    Hersh, Taylor A; Dimond, Alexandria L; Ruth, Brittany A; Lupica, Noah V; Bruce, Jacob C; Kelley, John M; King, Benjamin L; Lutton, Bram V

    2018-04-11

    The interaction between C-X-C chemokine receptor type 4 (CXCR4) and its cognate ligand, C-X-C motif chemokine ligand 12 (CXCL12), plays a critical role in regulating hematopoietic stem cell activation and subsequent cellular mobilization. Extensive studies of these genes have been conducted in mammals, but much less is known about the expression and function of CXCR4 and CXCL12 in non-mammalian vertebrates. In the present study, we identify simultaneous expression of CXCR4 and CXCL12 orthologues in the epigonal organ (the primary hematopoietic tissue) of the little skate, Leucoraja erinacea. Genetic and phylogenetic analyses were functionally supported by significant mobilization of leukocytes following administration of Plerixafor: a CXCR4 antagonist and clinically important drug. Our results provide evidence that, as in humans, Plerixafor disrupts CXCR4/CXCL12 binding in the little skate, facilitating release of leukocytes into the bloodstream. Our study illustrates the value of the little skate as a model organism, particularly in studies of hematopoiesis, and potentially for pre-clinical research on hematological and vascular disorders.

  10. Differences in innate immune response gene regulation in the middle ear of children who are otitis prone and in those not otitis prone

    PubMed Central

    Casey, Janet; Pichichero, Michael

    2016-01-01

    Objective: Acute otitis media (AOM) causes an inflammatory response in the middle ear. We assessed differences in innate immune responses involved in bacterial defense at onset of AOM in children who were stringently defined as otitis prone (sOP) and children not otitis prone (NOP). Study Design: Innate immune genes analysis from middle ear fluid (MEF) samples of children. Methods: Genes of toll-like receptors (TLR), nod-like and retinoic acid-inducible gene-I-like receptors, downstream effectors important for inflammation and apoptosis, including cytokines and chemokines, were studied from MEF samples by using a real-time polymerase chain reaction array. Protein levels of differentially regulated genes were measured by Luminex. Results: Gene expression in MEF among children who were sOP was significantly different in upregulation of interleukin 8, secretory leukocyte peptidase inhibitor, and chemokine (C-C motif) ligand 3, and in downregulation of interferon regulatory factor 7 and its related signaling molecules interferon alpha, Toll-like receptor adaptor molecule 2, chemokine (C-C motif) ligand 5, and mitogen-activated protein kinase 8 compared with children who were NOP. Differences in innate gene regulation were similar when AOM was caused by Streptococcus pneumoniae or nontypeable Haemophilus influenzae. Conclusion: Innate-immune response genes are differentially regulated in children who were sOP compared with children with NOP. PMID:28124644

  11. CCL17 and CCL22/CCR4 signaling is a strong candidate for novel targeted therapy against nasal natural killer/T-cell lymphoma

    PubMed Central

    Kumai, Takumi; Kobayashi, Hiroya; Komabayashi, Yuki; Ueda, Seigo; Kishibe, Kan; Ohkuri, Takayuki; Takahara, Miki; Celis, Esteban; Harabuchi, Yasuaki

    2015-01-01

    Nasal natural killer/T-cell lymphoma (NNKTL) is associated with Epstein–Barr virus and has a poor prognosis because of local invasion and/or multiple dissemination. Various chemokines play a role in tumor proliferation and invasion, and chemokine receptors including the C-C chemokine receptor 4 (CCR4) are recognized as potential targets for treating hematologic malignancies. The aim of the present study was to determine whether specific chemokines are produced by NNKTL. We compared chemokine expression patterns in culture supernatants of NNKTL cell lines with those of other lymphoma or leukemia cell lines using chemokine protein array and ELISA. Chemokine (C-C motif) ligand (CCL) 17 and CCL22 were highly produced by NNKTL cell lines as compared to the other cell lines. In addition, CCL17 and CCL22 were readily observed in the sera of NNKTL patients. The levels of these chemokines were significantly higher in patients than in healthy controls. Furthermore, we detected the expression of CCR4 (the receptor for CCL17 and CCL22) on the surface of NNKTL cell lines and in tissues of NNKTL patients. Anti-CCR4 monoclonal antibody (mAb) efficiently induced antibody-dependent cellular cytotoxicity mediated by natural killer cells against NNKTL cell lines. Our results suggest that CCL17 and CCL22 may be important factors in the development of NNKTL and open up the possibility of immunotherapy of this lymphoma using anti-CCR4 mAb. PMID:25754123

  12. Single nucleotide polymorphism of CC chemokine ligand 5 promoter gene in recipients may predict the risk of chronic graft-versus-host disease and its severity after allogeneic transplantation.

    PubMed

    Kim, Dong Hwan; Jung, Hee Du; Lee, Nan Young; Sohn, Sang Kyun

    2007-10-15

    Leukocyte trafficking, regulated by chemokine ligands and their receptors, involves in the pathogenesis of graft-versus-host disease (GVHD) including CC ligand 5 (CCL5) or CC receptor 5 (CCR5). The current study analyzed the association of acute or chronic GVHD (cGVHD) with the CCR5/CCL5 gene single nucleotide polymorphisms (SNPs) of recipients and donors. We evaluated the SNPs of CCL5 promoter gene at position -28 (rs1800825)/-403 (rs2107538) and CCR5 gene at 59029 (rs1799987) in 72 recipients and donors using polymerase chain reaction/RFLP (Restriction Fragment Length Polymorphism) methods. With a median follow up of 924 days for survivors (range 48-2,360 days), the CG genotype of CCL5 gene at position -28 in recipients was significantly associated with a higher incidence of cGVHD (P=0.004), extensive cGVHD (P=0.038 by Seattle's criteria), and severe grade of cGVHD at presentation (P=0.017 by prognostic grading by Apkek et al.) compared to CC genotype. In terms of haplotype analysis, the recipients with AG haplotype of CCL5 gene also showed a higher incidence of cGVHD (P=0.003), extensive cGVHD (P=0.023), and more severe grade of cGVHD (P=0.020). However, there was no association of CCL5/CCR5 SNPs with acute GVHD. The donors' genotype of CCL5/CCR5 was not associated with the risk of cGVHD. The CCL5 promoter gene polymorphism of recipients was associated with the risk of cGVHD and its severity. The current study suggested an involvement of CCL5 in leukocyte trafficking for the development of cGVHD.

  13. Murine lung eosinophil activation and chemokine production in allergic airway inflammation

    PubMed Central

    Rose, C Edward; Lannigan, Joanne A; Kim, Paul; Lee, James J; Fu, Shu Man; Sung, Sun-sang J

    2010-01-01

    Eosinophils play important roles in asthma and lung infections. Murine models are widely used for assessing the functional significance and mechanistic basis for eosinophil involvements in these diseases. However, little is known about tissue eosinophils in homeostasis. In addition, little data on eosinophil chemokine production during allergic airway inflammation are available. In this study, the properties and functions of homeostatic and activated eosinophils were compared. Eosinophils from normal tissues expressed costimulation and adhesion molecules B7-1, B7-2 and ICAM-1 for Ag presentation but little major histocompatibility complex (MHC) class II, and were found to be poor stimulators of T-cell proliferation. However, these eosinophils expressed high levels of chemokine mRNA including C10, macrophage inflammatory protein (MIP)-1α, MIP-1γ, MIP-2, eotaxin and monocyte chemoattractant protein-5 (MCP-5), and produced chemokine proteins. Eosinophil intracellular chemokines decreased rapidly with concomitant surface marker downregulation upon in vitro culturing consistent with piecemeal degranulation. Lung eosinophils from mice with induced allergic airway inflammation exhibited increased chemokines mRNA expression and chemokines protein production and upregulated MHC class II and CD11c expression. They were also found to be the predominant producers of the CCR1 ligands CCL6/C10 and CCL9/MIP-1γ in inflamed lungs. Eosinophil production of C10 and MIP-1γ correlated with the marked influx of CD11bhigh lung dendritic cells during allergic airway inflammation and the high expression of CCR1 on these dendritic cells (DCs). The study provided baseline information on tissue eosinophils, documented the upregulation of activation markers and chemokine production in activated eosinophils, and indicated that eosinophils were a key chemokine-producing cell type in allergic lung inflammation. PMID:20622891

  14. Silibinin, a novel chemokine receptor type 4 antagonist, inhibits chemokine ligand 12-induced migration in breast cancer cells.

    PubMed

    Wang, Yan; Liang, Wei-Cheng; Pan, Wen-Liang; Law, Wai-Kit; Hu, Jian-Shu; Ip, Denis Tsz-Ming; Waye, Mary Miu-Yee; Ng, Tzi-Bun; Wan, David Chi-Cheong

    2014-09-25

    C-X-C chemokine receptor type 4 (CXCR4) signaling has been demonstrated to be involved in cancer invasion and migration; therefore, CXCR4 antagonist can serve as an anti-cancer drug by preventing tumor metastasis. This study aimed to identify the CXCR4 antagonists that could reduce and/or inhibit tumor metastasis from natural products. According to the molecular docking screening, we reported here silibinin as a novel CXCR4 antagonist. Biochemical characterization showed that silibinin blocked chemokine ligand 12 (CXCL12)-induced CXCR4 internalization by competitive binding to CXCR4, therefore inhibiting downstream intracellular signaling. In human breast cancer cells MDA-MB-231, which expresses high levels of CXCR4, inhibition of CXCL12-induced chemomigration can be found under silibinin treatment. Overexpression of CXCL12 sensitized MDA-MB-231 cells to the inhibition of silibinin, which was abolished by CXCR4 knockdown. The inhibition of silibinin was also observed in MCF-7/CXCR4 cells rather than MCF-7 cells that express low level of CXCR4. Our work demonstrated that silibinin is a novel CXCR4 antagonist that may have potential therapeutic use for prevention of tumor metastasis. Copyright © 2014 Elsevier GmbH. All rights reserved.

  15. Furin is a chemokine-modifying enzyme: in vitro and in vivo processing of CXCL10 generates a C-terminally truncated chemokine retaining full activity.

    PubMed

    Hensbergen, Paul J; Verzijl, Dennis; Balog, Crina I A; Dijkman, Remco; van der Schors, Roel C; van der Raaij-Helmer, Elizabeth M H; van der Plas, Mariena J A; Leurs, Rob; Deelder, André M; Smit, Martine J; Tensen, Cornelis P

    2004-04-02

    Chemokines comprise a class of structurally related proteins that are involved in many aspects of leukocyte migration under basal and inflammatory conditions. In addition to the large number of genes, limited processing of these proteins by a variety of enzymes enhances the complexity of the total spectrum of chemokine variants. We have recently shown that the native chemokine CXCL10 is processed at the C terminus, thereby shedding the last four amino acids. The present study was performed to elucidate the mechanism in vivo and in vitro and to study the biological activity of this novel isoform of CXCL10. Using a combination of protein purification and mass spectrometric techniques, we show that the production of C-terminally truncated CXCL10 by primary keratinocytes is inhibited in vivo by a specific inhibitor of pro-protein convertases (e.g. furin) but not by inhibition of matrix metalloproteinases. Moreover, CXCL10 is processed by furin in vitro, which is abrogated by a mutation in the furin recognition site. Using GTPgammaS binding, Ca(2+) mobilization, and chemotaxis assays, we demonstrate that the C-terminally truncated CXCL10 variant is a potent ligand for CXCR3. Moreover, the inverse agonist activity on the virally encoded receptor ORF74 and the direct antibacterial activity of CXCL10 are fully retained. Hence, we have identified furin as a novel chemokine-modifying enzyme in vitro and most probably also in vivo, generating a C-terminally truncated CXCL10, which fully retains its (inverse) agonistic properties.

  16. Structure-function analysis of the extracellular domains of the Duffy antigen/receptor for chemokines: characterization of antibody and chemokine binding sites.

    PubMed

    Tournamille, Christophe; Filipe, Anne; Wasniowska, Kazimiera; Gane, Pierre; Lisowska, Elwira; Cartron, Jean-Pierre; Colin, Yves; Le Van Kim, Caroline

    2003-09-01

    The Duffy antigen/receptor for chemokines (DARC), a seven-transmembrane glycoprotein carrying the Duffy (Fy) blood group, acts as a widely expressed promiscuous chemokine receptor. In a structure-function study, we analysed the binding of chemokines and anti-Fy monoclonal antibodies (mAbs) to K562 cells expressing 39 mutant forms of DARC with alanine substitutions spread out on the four extracellular domains (ECDs). Using synthetic peptides, we defined previously the Fy6 epitope (22-FEDVW-26), and we characterized the Fya epitope as the linear sequence 41-YGANLE-46. In agreement with these results, mutations of F22-E23, V25 and Y41, G42, N44, L45 on ECD1 abolished the binding of anti-Fy6 and anti-Fya mAbs to K562 cells respectively, Anti-Fy3 binding was abolished by D58-D59 (ECD1), R124 (ECD2), D263 and D283 (ECD4) substitutions. Mutations of C51 (ECD1), C129 (ECD2), C195 (ECD3) and C276 (ECD4 severely reduced anti-Fy3 and CXC-chemokine ligand 8 (CXCL-8) binding. CXCL-8 binding was also abrogated by mutations of F22-E23, P50 (ECD1) and D263, R267, D283 (ECD4). These results defined the Fya epitope and suggested that (1) two disulphide bridges are involved in the creation of an active chemokine binding pocket; (2) a limited number of amino acids in ECDs 1-4 participate in CXCL-8 binding; and (3) Fy3 is a conformation-dependent epitope involving all ECDs. We also showed that N-glycosylation of DARC occurred on N16SS and did not influence antibody and chemokine binding.

  17. Cerebrospinal fluid cyto-/chemokine profile during acute herpes simplex virus induced anti-N-methyl-d-aspartate receptor encephalitis and in chronic neurological sequelae.

    PubMed

    Kothur, Kavitha; Gill, Deepak; Wong, Melanie; Mohammad, Shekeeb S; Bandodkar, Sushil; Arbunckle, Susan; Wienholt, Louise; Dale, Russell C

    2017-08-01

    To examine the cytokine/chemokine profile of cerebrospinal fluid (CSF) during acute herpes simplex virus-induced N-methyl-d-aspartate receptor (NMDAR) autoimmunity and in chronic/relapsing post-herpes simplex virus encephalitis (HSE) neurological syndromes. We measured longitudinal serial CSF cyto-/chemokines (n=34) and a glial marker (calcium-binding astroglial protein, S100B) in one patient during acute HSE and subsequent anti-NMDAR encephalitis, and compared the results with those from two patients with anti-NMDAR encephalitis without preceding HSE. We also compared cyto-/chemokines in cross-sectional CSF samples from three children with previous HSE who had ongoing chronic or relapsing neurological symptoms (2yr 9 mo-16y after HSE) with those in a group of children having non-inflammatory neurological conditions (n=20). Acute HSE showed elevation of a broad range of all T-helper-subset-related cyto-/chemokines and S100B whereas the post-HSE anti-NMDAR encephalitis phase showed persistent elevation of two of five T-helper-1 (chemokine [C-X-C motif] ligand 9 [CXCL9], CXCL10), three of five predominantly B-cell (CXCL13, CCL19, a proliferation-inducing ligand [APRIL])-mediated cyto-/chemokines, and interferon-α. The post-HSE anti-NMDAR encephalitis inflammatory response was more pronounced than anti-NMDAR encephalitis. All three chronic post-HSE cases showed persistent elevation of CXCL9, CXCL10, and interferon-α, and there was histopathological evidence of chronic lymphocytic inflammation in one biopsied case 7 years after HSE. Two of three chronic cases showed a modest response to immune therapy. HSE-induced anti-NMDAR encephalitis is a complex and pronounced inflammatory syndrome. There is persistent CSF upregulation of cyto-/chemokines in chronic or relapsing post-HSE neurological symptoms, which may be modifiable with immune therapy. The elevated cyto-/chemokines may be targets of monoclonal therapies. © 2017 Mac Keith Press.

  18. Hepatocytes express functional NOD1 and NOD2 receptors: A role for NOD1 in hepatocyte CC and CXC chemokine production

    PubMed Central

    Scott, Melanie J.; Chen, Christine; Sun, Qian; Billiar, Timothy R.

    2010-01-01

    Background & Aims NOD-like receptors are recently described cytosolic pattern recognition receptors. NOD1 and NOD2 are members of this family that recognize bacterial cell wall components, diaminopimelic acid and muramyl dipeptide, respectively. Both NOD1 and NOD2 have been associated with many inflammatory diseases, although their role in liver inflammation and infection has not been well studied. Materials and Methods We investigated the role of NOD receptors in mouse liver by assessing expression and activation of NOD1 and NOD2 in liver and primary isolated hepatocytes from C57BL/6 mice. Results Both NOD1 and NOD2 mRNA and protein were highly expressed in hepatocytes and liver. RIP2, the main signaling partner for NODs, was also expressed. Stimulation of hepatocytes with NOD1 ligand (C12-iEDAP) induced NFκB activation, activation of MAP kinases and expression of chemokines CCL5 (RANTES) and CXCL1 (KC). C12-iEDAP also synergized with interferon (IFN)γ to increase iNOS expression and production of nitric oxide. Despite activating NFκB, NOD1 ligand did not upregulate hepatocyte production of the acute phase proteins lipopolysaccharide binding protein, serum amyloid A, or soluble CD14 in cell culture supernatants, or upregulate mRNA expression of lipopolysaccharide binding protein, serum amyloid A, C-reactive protein, or serum amyloid P. NOD2 ligand (MDP) did not activate hepatocytes when given alone, but did synergize with Toll-like receptor ligands, lipopolysaccharide (LPS), and polyI:C to activate NFκB and MAPK. Conclusions All together these data suggest an important role for hepatocyte NOD1 in attracting leukocytes to the liver during infection and for hepatic NLRs to augment innate immune responses to pathogens. PMID:20615568

  19. C-C motif ligand 5 promotes migration of prostate cancer cells in the prostate cancer bone metastasis microenvironment.

    PubMed

    Urata, Satoko; Izumi, Kouji; Hiratsuka, Kaoru; Maolake, Aerken; Natsagdorj, Ariunbold; Shigehara, Kazuyoshi; Iwamoto, Hiroaki; Kadomoto, Suguru; Makino, Tomoyuki; Naito, Renato; Kadono, Yoshifumi; Lin, Wen-Jye; Wufuer, Guzailinuer; Narimoto, Kazutaka; Mizokami, Atsushi

    2018-03-01

    Chemokines and their receptors have key roles in cancer progression. The present study investigated chemokine activity in the prostate cancer bone metastasis microenvironment. Growth and migration of human prostate cancer cells were assayed in cocultures with bone stromal cells. The migration of LNCaP cells significantly increased when co-cultured with bone stromal cells isolated from prostate cancer bone metastases. Cytokine array analysis of conditioned medium from bone stromal cell cultures identified CCL5 as a concentration-dependent promoter of LNCaP cell migration. The migration of LNCaP cells was suppressed when C-C motif ligand 5 (CCL5) neutralizing antibody was added to cocultures with bone stromal cells. Knockdown of androgen receptor with small interfering RNA increased the migration of LNCaP cells compared with control cells, and CCL5 did not promote the migration of androgen receptor knockdown LNCaP. Elevated CCL5 secretion in bone stromal cells from metastatic lesions induced prostate cancer cell migration by a mechanism consistent with CCL5 activity upstream of androgen receptor signaling. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  20. Chemokine (c-c motif) receptor 2 mediates mechanical and cold hypersensitivity in sickle cell disease mice.

    PubMed

    Sadler, Katelyn E; Zappia, Katherine J; O'Hara, Crystal L; Langer, Sarah N; Weyer, Andy D; Hillery, Cheryl A; Stucky, Cheryl L

    2018-04-23

    Approximately one third of individuals with sickle cell disease (SCD) develop chronic pain. This debilitating pain is inadequately treated because the underlying mechanisms driving the pain are poorly understood. In addition to persistent pain, SCD patients are also in a tonically pro-inflammatory state. Previous studies have revealed that there are elevated plasma levels of many inflammatory mediators including chemokine (c-c motif) ligand 2 (CCL2) in individuals with SCD. Using a transgenic mouse model of SCD, we investigated the contributions of CCL2 signaling to SCD-related pain. Inhibition of the chemokine receptor 2 (CCR2), but not CCR4, alleviated the behavioral mechanical and cold hypersensitivity in SCD. Further, acute CCR2 blockade reversed both the behavioral and the in vitro responsiveness of sensory neurons to an agonist of TRPV1, a neuronal ion channel previously implicated in SCD pain. These results provide insight into the immune-mediated regulation of hypersensitivity in SCD and could inform future development of analgesics or therapeutic measures to prevent chronic pain.

  1. Structural Analysis of Chemokine Receptor–Ligand Interactions

    PubMed Central

    2017-01-01

    This review focuses on the construction and application of structural chemokine receptor models for the elucidation of molecular determinants of chemokine receptor modulation and the structure-based discovery and design of chemokine receptor ligands. A comparative analysis of ligand binding pockets in chemokine receptors is presented, including a detailed description of the CXCR4, CCR2, CCR5, CCR9, and US28 X-ray structures, and their implication for modeling molecular interactions of chemokine receptors with small-molecule ligands, peptide ligands, and large antibodies and chemokines. These studies demonstrate how the integration of new structural information on chemokine receptors with extensive structure–activity relationship and site-directed mutagenesis data facilitates the prediction of the structure of chemokine receptor–ligand complexes that have not been crystallized. Finally, a review of structure-based ligand discovery and design studies based on chemokine receptor crystal structures and homology models illustrates the possibilities and challenges to find novel ligands for chemokine receptors. PMID:28165741

  2. Therapeutic Targeting of CC Ligand 21 or CC Chemokine Receptor 7 Abrogates Pulmonary Fibrosis Induced by the Adoptive Transfer of Human Pulmonary Fibroblasts to Immunodeficient Mice

    PubMed Central

    Pierce, Elizabeth M.; Carpenter, Kristin; Jakubzick, Claudia; Kunkel, Steven L.; Flaherty, Kevin R.; Martinez, Fernando J.; Hogaboam, Cory M.

    2007-01-01

    Idiopathic interstitial pneumonias (IIPs) are a collection of pulmonary fibrotic diseases of unknown etiopathogenesis. CC chemokine receptor 7 (CCR7) is expressed in IIP biopsies and primary fibroblast lines, but its role in pulmonary fibrosis was not previously examined. To study the in vivo role of CCR7 in a novel model of pulmonary fibrosis, 1.0 × 106 primary fibroblasts grown from idiopathic pulmonary fibrosis/usual interstitial pneumonia, nonspecific interstitial pneumonia, or histologically normal biopsies were injected intravenously into C.B-17 severe combined immunodeficiency (SCID)/beige (bg) mice. At days 35 and 63 after idiopathic pulmonary fibrosis/usual interstitial pneumonia fibroblast injection, patchy interstitial fibrosis and increased hydroxyproline were present in the lungs of immunodeficient mice. Adoptively transferred nonspecific interstitial pneumonia fibroblasts caused a more diffuse interstitial fibrosis and increased hydroxyproline levels at both times, but injected normal human fibroblasts did not induce interstitial remodeling changes in C.B-17SCID/bg mice. Systemic therapeutic immunoneutralization of either human CCR7 or CC ligand 21, its ligand, significantly attenuated the pulmonary fibrosis in groups of C.B-17SCID/bg mice that received either type of IIP fibroblasts. Thus, the present study demonstrates that pulmonary fibrosis is initiated by the intravenous introduction of primary human fibroblast lines into immunodeficient mice, and this fibrotic response is dependent on the interaction between CC ligand 21 and CCR7. PMID:17392156

  3. Ccl22/MDC, is a prostaglandin dependent pyrogen, acting in the anterior hypothalamus to induce hyperthermia via activation of brown adipose tissue

    PubMed Central

    Osborn, Olivia; Sanchez-Alavez, Manuel; Dubins, Jeffrey S.; Gonzalez, Alejandro Sanchez; Morrison, Brad; Hadcock, John R.; Bartfai, Tamas

    2011-01-01

    CC Chemokine ligand 22 (Ccl22) is a selective, high affinity ligand at the CC chemokine receptor 4 (Ccr4). We have identified cDNAs encoding both ligand and receptor of the Ccl22-Ccr4 pair in cDNA libraries of the anterior hypothalamus/preoptic area (AH/POA) by PCR. The AH/POA is the key brain region where endogenous pyrogens have been shown to act on warm sensitive neurons to affect thermogenesis in brown adipose tissue (BAT) and other thermogenically responsive tissues. We show that functional Ccr4 receptors are present in the AH/POA neurons as injection of Ccl22 into the POA but not to other hypothalamic nuclei induces an increase in core body temperature as measured by radiotelemetry. Indomethacin (5mg/kg s.c) pretreatment markedly reduced the hyperthermia evoked by POA injection of Ccl22 (10 ng/0.5ul) and thus suggests that this hyperthermia is mediated through cyclooxygenase activation and thus likely through the formation and action of the pyrogen prostaglandin E2. The temperature elevation involves a decrease in the respiratory exchange ratio and increased activation of the brown adipose tissue as demonstrated by 18F-FDG –PET imaging. We describe a novel role to the ligand Ccl22 and its receptor Ccr4 in the anterior hypothalamus in temperature regulation that depends on the synthesis of the endogenous pyrogen, prostaglandin E2. PMID:21177120

  4. Stress-caused Anergy of Leukocytes towards Staphylococcal enterotoxin B and Exposure Transcriptome Signatures

    DTIC Science & Technology

    2015-05-28

    Chemokine (C-X-C motif ) ligand 10 − 77.7 − 53.6 − 14.4 AU138239 INDO Indoleamine- pyrrole 2,3 dioxygenase − 29.3 − 31.5 − 14.0 AV734258 CCL8 Chemokine...immunomodulatory enzyme indoleamine- pyrrole 2,3 dioxygenase (INDO), the growth factors CSF1 and CSF2 and other T-cell response genes. Using NSC...2.8 − 2.2 AK026053 BCL2 B-cell CLL/lymphoma 2 − 2.2 − 2.0 − 2.3 − 2.2 AB015331 INDO Indoleamine- pyrrole 2,3 dioxygenase − 2.1 − 29.3 − 2.2 − 31.5

  5. Potentially probiotic Lactobacillus strains with anti-proliferative activity induce cytokine/chemokine production and neutrophil recruitment in mice.

    PubMed

    Saxami, G; Karapetsas, A; Chondrou, P; Vasiliadis, S; Lamprianidou, E; Kotsianidis, I; Ypsilantis, P; Botaitis, S; Simopoulos, C; Galanis, A

    2017-08-24

    Lactobacillus pentosus B281 and Lactobacillus plantarum B282 are two Lactobacillus strains previously isolated from fermented table olives. Both strains were found to possess probiotic properties and displayed desirable technological characteristics for application as starters in novel functional food production. In the present study the anti-proliferative and immunostimulatory activities of the two strains were investigated. Firstly, we demonstrated that live L. pentosus B281 and L. plantarum B282 significantly inhibited the growth of human colon cancer cells (Caco-2) in a time- and dose-dependent manner. By employing the air pouch system in mice, we showed that administration of both strains led to a rapid and statistically significant infiltration of leukocytes in the air pouch exudates. The phenotypical characterisation of the recruited immune cells was performed by flow cytometry analysis. We demonstrated that the majority of the infiltrated leukocytes were neutrophils. Finally by using the Mouse Cytokine Array Panel A Detection Antibody cocktail, we showed that both strains induced the expression of granulocyte-colony stimulating factor, interleukin (IL)-1α, IL-1β, IL-6, chemokine (C-X-C motif) ligand (CXCL)-1, chemokine (C-C motif) ligand (CCL)-3, CCL-4, and CXCL-2 and diminished the expression levels of soluble intercellular adhesion molecule, macrophage colony-stimulating factor and metallopeptidase inhibitor 1. Our results showed that both strains display anti-proliferative and immunostimulatory properties equal or even better in some cases than those of established and commonly used probiotic strains. These findings further support the probiotic character of the two strains.

  6. Vitamin D Receptor Activation Reduces Angiotensin-II-Induced Dissecting Abdominal Aortic Aneurysm in Apolipoprotein E-Knockout Mice.

    PubMed

    Martorell, Sara; Hueso, Luisa; Gonzalez-Navarro, Herminia; Collado, Aida; Sanz, Maria-Jesus; Piqueras, Laura

    2016-08-01

    Abdominal aortic aneurysm (AAA) is a vascular disorder characterized by chronic inflammation of the aortic wall. Low concentrations of vitamin D3 are associated with AAA development; however, the potential direct effect of vitamin D3 on AAA remains unknown. This study evaluates the effect of oral treatment with the vitamin D3 receptor (VDR) ligand, calcitriol, on dissecting AAA induced by angiotensin-II (Ang-II) infusion in apoE(-/-) mice. Oral treatment with calcitriol reduced Ang-II-induced dissecting AAA formation in apoE(-/-) mice, which was unrelated to systolic blood pressure or plasma cholesterol concentrations. Immunohistochemistry and reverse-transcription polymerase chain reaction analysis demonstrated a significant increase in macrophage infiltration, neovessel formation, matrix metalloproteinase-2 and matrix metalloproteinase-9, chemokine (CCL2 [(C-C motif) ligand 2], CCL5 [(C-C motif) ligand 5], and CXCL1 [(C-X-C motif) ligand 1]) and vascular endothelial growth factor expression in suprarenal aortic walls of apoE(-/-) mice infused with Ang-II, and all were significantly reduced by cotreatment with calcitriol. Phosphorylation of extracellular signal-regulated kinases 1/2, p38 mitogen-activated protein kinase, and nuclear factor-κB was also decreased in the suprarenal aortas of apoE(-/-) mice cotreated with calcitriol. These effects were accompanied by a marked increase in VDR-retinoid X receptor (RXR) interaction in the aortas of calcitriol-treated mice. In vitro, VDR activation by calcitriol in human endothelial cells inhibited Ang-II-induced leukocyte-endothelial cell interactions, morphogenesis, and production of endothelial proinflammatory and angiogenic chemokines through VDR-RXR interactions, and knockdown of VDR or RXR abolished the inhibitory effects of calcitriol. VDR activation reduces dissecting AAA formation induced by Ang-II in apoE(-/-) mice and may constitute a novel therapeutic strategy to prevent AAA progression. © 2016 American Heart Association, Inc.

  7. Inactivated Sendai virus particle upregulates cancer cell expression of intercellular adhesion molecule-1 and enhances natural killer cell sensitivity on cancer cells.

    PubMed

    Li, Simin; Nishikawa, Tomoyuki; Kaneda, Yasufumi

    2017-12-01

    We have already reported that the inactivated Sendai virus (hemagglutinating virus of Japan; HVJ) envelope (HVJ-E) has multiple anticancer effects, including induction of cancer-selective cell death and activation of anticancer immunity. The HVJ-E stimulates dendritic cells to produce cytokines and chemokines such as β-interferon, interleukin-6, chemokine (C-C motif) ligand 5, and chemokine (C-X-C motif) ligand 10, which activate both CD8 + T cells and natural killer (NK) cells and recruit them to the tumor microenvironment. However, the effect of HVJ-E on modulating the sensitivity of cancer cells to immune cell attack has yet to be investigated. In this study, we found that HVJ-E induced the production of intercellular adhesion molecule-1 (ICAM-1, CD54), a ligand of lymphocyte function-associated antigen 1, in several cancer cell lines through the activation of nuclear factor-κB downstream of retinoic acid-inducible gene I and the mitochondrial antiviral signaling pathway. The upregulation of ICAM-1 on the surface of cancer cells increased the sensitivity of cancer cells to NK cells. Knocking out expression of ICAM-1 in MDA-MB-231 cells using the CRISPR/Cas9 method significantly reduced the killing effect of NK cells on ICAM-1-depleted MDA-MB-231 cells. In addition, HVJ-E suppressed tumor growth in MDA-MB-231 tumor-bearing SCID mice, and the HVJ-E antitumor effect was impaired when NK cells were depleted by treatment with the anti-asialo GM1 antibody. Our findings suggest that HVJ-E enhances NK cell sensitivity against cancer cells by increasing ICAM-1 expression on the cancer cell surface. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  8. Immune response CC chemokines CCL2 and CCL5 are associated with pulmonary sarcoidosis

    PubMed Central

    2011-01-01

    Background Pulmonary sarcoidosis involves an intense leukocyte infiltration of the lung with the formation of non-necrotizing granulomas. CC chemokines (chemokine (C-C motif) ligand 2 (CCL2)-CCL5) are chemoattractants of mononuclear cells and act through seven transmembrane G-coupled receptors. Previous studies have demonstrated conflicting results with regard to the associations of these chemokines with sarcoidosis. In an effort to clarify previous discrepancies, we performed the largest observational study to date of CC chemokines in bronchoalveolar lavage fluid (BALF) from patients with pulmonary sarcoidosis. Results BALF chemokine levels from 72 patients affected by pulmonary sarcoidosis were analyzed by enzyme-linked immunosorbent assay (ELISA) and compared to 8 healthy volunteers. BALF CCL3 and CCL4 levels from pulmonary sarcoidosis patients were not increased compared to controls. However, CCL2 and CCL5 levels were elevated, and subgroup analysis showed higher levels of both chemokines in all stages of pulmonary sarcoidosis. CCL2, CCL5, CC chemokine receptor type 1 (CCR1), CCR2 and CCR3 were expressed from mononuclear cells forming the lung granulomas, while CCR5 was only found on mast cells. Conclusions These data suggest that CCL2 and CCL5 are important mediators in recruiting CCR1, CCR2, and CCR3 expressing mononuclear cells as well as CCR5-expressing mast cells during all stages of pulmonary sarcoidosis. PMID:21463523

  9. Immune response CC chemokines CCL2 and CCL5 are associated with pulmonary sarcoidosis.

    PubMed

    Palchevskiy, Vyacheslav; Hashemi, Nastran; Weigt, Stephen S; Xue, Ying Ying; Derhovanessian, Ariss; Keane, Michael P; Strieter, Robert M; Fishbein, Michael C; Deng, Jane C; Lynch, Joseph P; Elashoff, Robert; Belperio, John A

    2011-04-04

    Pulmonary sarcoidosis involves an intense leukocyte infiltration of the lung with the formation of non-necrotizing granulomas. CC chemokines (chemokine (C-C motif) ligand 2 (CCL2)-CCL5) are chemoattractants of mononuclear cells and act through seven transmembrane G-coupled receptors. Previous studies have demonstrated conflicting results with regard to the associations of these chemokines with sarcoidosis. In an effort to clarify previous discrepancies, we performed the largest observational study to date of CC chemokines in bronchoalveolar lavage fluid (BALF) from patients with pulmonary sarcoidosis. BALF chemokine levels from 72 patients affected by pulmonary sarcoidosis were analyzed by enzyme-linked immunosorbent assay (ELISA) and compared to 8 healthy volunteers. BALF CCL3 and CCL4 levels from pulmonary sarcoidosis patients were not increased compared to controls. However, CCL2 and CCL5 levels were elevated, and subgroup analysis showed higher levels of both chemokines in all stages of pulmonary sarcoidosis. CCL2, CCL5, CC chemokine receptor type 1 (CCR1), CCR2 and CCR3 were expressed from mononuclear cells forming the lung granulomas, while CCR5 was only found on mast cells. These data suggest that CCL2 and CCL5 are important mediators in recruiting CCR1, CCR2, and CCR3 expressing mononuclear cells as well as CCR5-expressing mast cells during all stages of pulmonary sarcoidosis.

  10. Ccl22/MDC, is a prostaglandin dependent pyrogen, acting in the anterior hypothalamus to induce hyperthermia via activation of brown adipose tissue.

    PubMed

    Osborn, Olivia; Sanchez-Alavez, Manuel; Dubins, Jeffrey S; Gonzalez, Alejandro Sanchez; Morrison, Brad; Hadcock, John R; Bartfai, Tamas

    2011-03-01

    CC Chemokine ligand 22 (Ccl22) is a selective, high affinity ligand at the CC chemokine receptor 4 (Ccr4). We have identified cDNAs encoding both ligand and receptor of the Ccl22-Ccr4 pair in cDNA libraries of the anterior hypothalamus/pre-optic area (AH/POA) by PCR. The AH/POA is the key brain region where endogenous pyrogens have been shown to act on warm sensitive neurons to affect thermogenesis in brown adipose tissue (BAT) and other thermogenically responsive tissues. We show that functional Ccr4 receptors are present in the AH/POA neurons as injection of Ccl22 into the POA but not to other hypothalamic nuclei induces an increase in core body temperature as measured by radiotelemetry. Indomethacin (5 mg/kg s.c) pre-treatment markedly reduced the hyperthermia evoked by POA injection of Ccl22 (10 ng/0.5 ul) and thus suggests that this hyperthermia is mediated through cyclooxygenase activation and thus likely through the formation and action of the pyrogen prostaglandin E2. The temperature elevation involves a decrease in the respiratory exchange ratio and increased activation of the brown adipose tissue as demonstrated by ¹⁸F-FDG-PET imaging. We describe a novel role to the ligand Ccl22 and its receptor Ccr4 in the anterior hypothalamus in temperature regulation that depends on the synthesis of the endogenous pyrogen, prostaglandin E2. Copyright © 2010 Elsevier Ltd. All rights reserved.

  11. Apigenin suppresses migration and invasion of transformed cells through down-regulation of C-X-C chemokine receptor 4 expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Lei; Kuang, Lisha; Hitron, John Andrew

    Environmental exposure to arsenic is known to cause various cancers. There are some potential relationships between cell malignant transformation and C-X-C chemokine receptor type 4 (CXCR4) expressions. Metastasis, one of the major characteristics of malignantly transformed cells, contributes to the high mortality of cells. CXCR4 and its natural chemokine ligand C-X-C motif ligand 12 (CXCL12) play a critical role in metastasis. Therefore, identification of nutritional factors which are able to inhibit CXCR4 is important for protection from environmental arsenic-induced carcinogenesis and for abolishing metastasis of malignantly transformed cells. The present study demonstrates that apigenin (4′,5,7-trihydroxyflavone), a natural dietary flavonoid, suppressedmore » CXCR4 expression in arsenic-transformed Beas-2B cells (B-AsT) and several other types of transformed/cancer cells in a dose- and time-dependent manner. Neither proteasome nor lysosome inhibitor had any effect in reducing the apigenin-induced down-regulation of CXCR4, indicating that apigenin-induced down-regulation of CXCR4 is not due to proteolytic degradation. The down-regulation of CXCR4 is mainly due to the inhibition of nuclear factor κB (NF-κB) transcriptional activity. Apigenin also abolished migration and invasion of transformed cells induced by CXCL12. In a xenograft mouse model, apigenin down-regulated CXCR4 expression and suppressed tumor growth. Taken together, our results show that apigenin is a novel inhibitor of CXCR4 expression. This dietary flavonoid has the potential to suppress migration and invasion of transformed cells and prevent environmental arsenic-induced carcinogenesis. - Highlights: • Apigenin has a potential in preventing environmental arsenic induced carcinogenesis. • Apigenin suppresses CXCR4 in malignant transformed cells in vitro and in vivo. • The down-regulation of CXCR4 is mainly due to inhibition of NF-κB activity.« less

  12. Substance P regulates macrophage inflammatory protein 3α/chemokine C-C ligand 20 (CCL20) with heme oxygenase-1 in human periodontal ligament cells

    PubMed Central

    Lee, S-K; Pi, S-H; Kim, S-H; Min, K-S; Lee, H-J; Chang, H-S; Kang, K-H; Kim, H-R; Shin, H-I; Lee, S-K; Kim, E-C

    2007-01-01

    Although substance P (SP), a potent proinflammatory peptide, is involved in inflammation and immune responses, the effect of SP on the expression of macrophage inflammatory protein 3α[MIP-3α, chemokine C-C ligand 20 (CCL20)] in periodontal ligament (PDL) cells is unknown. Equally enigmatic is the link between SP, the stress protein heme oxygenase-1 (HO-1), and CCL20 production. We investigated whether SP induces the release of chemokine CCL20 from immortalized PDL (IPDL) cells, and further clarify SP-mediated pathways. We also examined the relationship between HO-1 and CCL20 by treating PDL cells with SP. Incubating IPDL cells with SP increased expression of CCL20 mRNA and CCL20 protein in a dose–time-dependent manner. Highly selective p38 and extracellular-regulated kinase 1/2 (ERK1/2) inhibitors abrogated SP-induced expression of CCL20 in IPDL cells. SP is also responsible for initiating phosphorylation of IκB, degradation of IκB and activation of nuclear factor (NF)-κB. SP induced expression of HO-1 in both a concentration- and time-dependent manner, and CCL20 reflected similar patterns. The inductive effects of SP on HO-1 and CCL20 were enhanced by HO-1 inducer hemin and the membrane-permeable guanosine 3′,5′-monophosphate (cGMP) analogue 8-bromo-cGMP. Conversely, this pathway was inhibited by the HO-1 inhibitor zinc protoporphyrin IX (ZnPP IX) and the selective inhibitor of guanylate cyclase, 1H-(1,2,4)oxadiazole(4,3-a)quinoxalin-1-one (ODQ). We report herein the pathway that connects SP along with other modulators of neuroimmunoregulation to the induction of HO-1 and the inflammatory mediator macrophage inflammatory protein (MIP)-3α/CCL20 in IPDL cells, which play an important role in the development of periodontitis or inflammation during orthodontic tooth movement. PMID:17924972

  13. O-glycans direct selectin ligands to lipid rafts on leukocytes.

    PubMed

    Shao, Bojing; Yago, Tadayuki; Setiadi, Hendra; Wang, Ying; Mehta-D'souza, Padmaja; Fu, Jianxin; Crocker, Paul R; Rodgers, William; Xia, Lijun; McEver, Rodger P

    2015-07-14

    Palmitoylated cysteines typically target transmembrane proteins to domains enriched in cholesterol and sphingolipids (lipid rafts). P-selectin glycoprotein ligand-1 (PSGL-1), CD43, and CD44 are O-glycosylated proteins on leukocytes that associate with lipid rafts. During inflammation, they transduce signals by engaging selectins as leukocytes roll in venules, and they move to the raft-enriched uropods of polarized cells upon chemokine stimulation. It is not known how these glycoproteins associate with lipid rafts or whether this association is required for signaling or for translocation to uropods. Here, we found that loss of core 1-derived O-glycans in murine C1galt1(-/-) neutrophils blocked raft targeting of PSGL-1, CD43, and CD44, but not of other glycosylated proteins, as measured by resistance to solubilization in nonionic detergent and by copatching with a raft-resident sphingolipid on intact cells. Neuraminidase removal of sialic acids from wild-type neutrophils also blocked raft targeting. C1galt1(-/-) neutrophils or neuraminidase-treated neutrophils failed to activate tyrosine kinases when plated on immobilized anti-PSGL-1 or anti-CD44 F(ab')2. Furthermore, C1galt1(-/-) neutrophils incubated with anti-PSGL-1 F(ab')2 did not generate microparticles. In marked contrast, PSGL-1, CD43, and CD44 moved normally to the uropods of chemokine-stimulated C1galt1(-/-) neutrophils. These data define a role for core 1-derived O-glycans and terminal sialic acids in targeting glycoprotein ligands for selectins to lipid rafts of leukocytes. Preassociation of these glycoproteins with rafts is required for signaling but not for movement to uropods.

  14. Neurotensin stimulates sortilin and mTOR in human microglia inhibitable by methoxyluteolin, a potential therapeutic target for autism.

    PubMed

    Patel, Arti B; Tsilioni, Irene; Leeman, Susan E; Theoharides, Theoharis C

    2016-09-23

    We had reported elevated serum levels of the peptide neurotensin (NT) in children with autism spectrum disorders (ASD). Here, we show that NT stimulates primary human microglia, the resident immune cells of the brain, and the immortalized cell line of human microglia-SV40. NT (10 nM) increases the gene expression and release (P < 0.001) of the proinflammatory cytokine IL-1β and chemokine (C-X-C motif) ligand 8 (CXCL8), chemokine (C-C motif) ligand 2 (CCL2), and CCL5 from human microglia. NT also stimulates proliferation (P < 0.05) of microglia-SV40. Microglia express only the receptor 3 (NTR3)/sortilin and not the NTR1 or NTR2. The use of siRNA to target sortilin reduces (P < 0.001) the NT-stimulated cytokine and chemokine gene expression and release from human microglia. Stimulation with NT (10 nM) increases the gene expression of sortilin (P < 0.0001) and causes the receptor to be translocated from the cytoplasm to the cell surface, and to be secreted extracellularly. Our findings also show increased levels of sortilin (P < 0.0001) in the serum from children with ASD (n = 36), compared with healthy controls (n = 20). NT stimulation of microglia-SV40 causes activation of the mammalian target of rapamycin (mTOR) signaling kinase, as shown by phosphorylation of its substrates and inhibition of these responses by drugs that prevent mTOR activation. NT-stimulated responses are inhibited by the flavonoid methoxyluteolin (0.1-1 μM). The data provide a link between sortilin and the pathological findings of microglia and inflammation of the brain in ASD. Thus, inhibition of this pathway using methoxyluteolin could provide an effective treatment of ASD.

  15. Targeting CXCL12 from FAP-expressing carcinoma-associated fibroblasts synergizes with anti-PD-L1 immunotherapy in pancreatic cancer.

    PubMed

    Feig, Christine; Jones, James O; Kraman, Matthew; Wells, Richard J B; Deonarine, Andrew; Chan, Derek S; Connell, Claire M; Roberts, Edward W; Zhao, Qi; Caballero, Otavia L; Teichmann, Sarah A; Janowitz, Tobias; Jodrell, Duncan I; Tuveson, David A; Fearon, Douglas T

    2013-12-10

    An autochthonous model of pancreatic ductal adenocarcinoma (PDA) permitted the analysis of why immunotherapy is ineffective in this human disease. Despite finding that PDA-bearing mice had cancer cell-specific CD8(+) T cells, the mice, like human patients with PDA, did not respond to two immunological checkpoint antagonists that promote the function of T cells: anti-cytotoxic T-lymphocyte-associated protein 4 (α-CTLA-4) and α-programmed cell death 1 ligand 1 (α-PD-L1). Immune control of PDA growth was achieved, however, by depleting carcinoma-associated fibroblasts (CAFs) that express fibroblast activation protein (FAP). The depletion of the FAP(+) stromal cell also uncovered the antitumor effects of α-CTLA-4 and α-PD-L1, indicating that its immune suppressive activity accounts for the failure of these T-cell checkpoint antagonists. Three findings suggested that chemokine (C-X-C motif) ligand 12 (CXCL12) explained the overriding immunosuppression by the FAP(+) cell: T cells were absent from regions of the tumor containing cancer cells, cancer cells were coated with the chemokine, CXCL12, and the FAP(+) CAF was the principal source of CXCL12 in the tumor. Administering AMD3100, a CXCL12 receptor chemokine (C-X-C motif) receptor 4 inhibitor, induced rapid T-cell accumulation among cancer cells and acted synergistically with α-PD-L1 to greatly diminish cancer cells, which were identified by their loss of heterozygosity of Trp53 gene. The residual tumor was composed only of premalignant epithelial cells and inflammatory cells. Thus, a single protein, CXCL12, from a single stromal cell type, the FAP(+) CAF, may direct tumor immune evasion in a model of human PDA.

  16. Chemokine C-C motif ligand 33 is a key regulator of teleost fish barbel development.

    PubMed

    Zhou, Tao; Li, Ning; Jin, Yulin; Zeng, Qifan; Prabowo, Wendy; Liu, Yang; Tian, Changxu; Bao, Lisui; Liu, Shikai; Yuan, Zihao; Fu, Qiang; Gao, Sen; Gao, Dongya; Dunham, Rex; Shubin, Neil H; Liu, Zhanjiang

    2018-05-29

    Barbels are important sensory organs in teleosts, reptiles, and amphibians. The majority of ∼4,000 catfish species, such as the channel catfish ( Ictalurus punctatus ), possess abundant whisker-like barbels. However, barbel-less catfish, such as the bottlenose catfish ( Ageneiosus marmoratus ), do exist. Barbeled catfish and barbel-less catfish are ideal natural models for determination of the genomic basis for barbel development. In this work, we generated and annotated the genome sequences of the bottlenose catfish, conducted comparative and subtractive analyses using genome and transcriptome datasets, and identified differentially expressed genes during barbel regeneration. Here, we report that chemokine C-C motif ligand 33 ( ccl33 ), as a key regulator of barbel development and regeneration. It is present in barbeled fish but absent in barbel-less fish. The ccl33 genes are differentially expressed during barbel regeneration in a timing concordant with the timing of barbel regeneration. Knockout of ccl33 genes in the zebrafish ( Danio rerio ) resulted in various phenotypes, including complete loss of barbels, reduced barbel sizes, and curly barbels, suggesting that ccl33 is a key regulator of barbel development. Expression analysis indicated that paralogs of the ccl33 gene have both shared and specific expression patterns, most notably expressed highly in various parts of the head, such as the eye, brain, and mouth areas, supporting its role for barbel development.

  17. Polymorphisms in chemokine and receptor genes and gastric cancer risk and survival in a high risk Polish population.

    PubMed

    Gawron, Andrew J; Fought, Angela J; Lissowska, Jolanta; Ye, Weimin; Zhang, Xiao; Chow, Wong-Ho; Beane Freeman, Laura E; Hou, Lifang

    2011-03-01

    To examine if genetic variations in chemokine receptor and ligand genes are associated with gastric cancer risk and survival. The study included 298 cases and 417 controls from a population-based study of gastric cancer conducted in Warsaw, Poland in 1994-1996. We investigated seven single nucleotide polymorphisms in a chemokine ligand (CXCL12) and chemokine receptor (CCR2, CCR5, CX3CR1) genes and one frameshift deletion (CCR5) in blood leukocyte DNA in relation to gastric cancer risk and survival. Genotyping was conducted at the NCI Core Genotyping Facility. Odds ratios and 95% confidence intervals were computed using univariate and multivariate logistic regression models. Survival analysis was performed using Cox proportional hazards models. Gastric cancer risk was not associated with single chemokine polymorphisms. A CCR5 haplotype that contained the common alleles of IVS1+151 G>T (rs2734648), IVS2+80 C>T (rs1800024) and minor allele of IVS1+246 A>G (rs1799987) was associated with a borderline significantly increased risk (OR = 1.5, 95% CI: 1.0?2.2). For gastric cancer cases, there was a greater risk of death for carriers of the minor alleles of CCR2 Ex2+241 G>A (rs1799864) (HR = 1.5, 95% CI: 1.1-2.1) and CCR5 IVS2+80 C>T (rs1800024) (HR = 1.5, 95% CI: 1.1-2.1). Carriers of the CCR5 minor allele of IVS1+151 G>T (rs2734648) had a decreased risk of death compared to homozygote carriers of the common allele (HR = 0.8, 95% CI: 0.6-1.0). Our findings do not support an association between gastric cancer risk and single chemokine genetic variation. The observed associations between cancer risk and a CCR5 haplotype and between survival and polymorphisms in CCR2 and CCR5 need replication in future studies.

  18. Escin suppresses migration and invasion involving the alteration of CXCL16/CXCR6 axis in human gastric adenocarcinoma AGS cells.

    PubMed

    Lee, Hyun Sook; Hong, Ji Eun; Kim, Eun Ji; Kim, Sun Hyo

    2014-01-01

    Escin, a natural mixture of triterpene saponins isolated from horse chestnut, has been reported to possess anticancer activity in many human cancer cells. However, the effect of escin on the metastasis has not been studied. The present study examined the effect of escin on the migration and invasion of AGS human gastric cancer cells. To examine the effects of escin on metastatic capacities of gastric cancer cells, AGS cells were cultured in the presence of 0-4 μmol/L escin. Escin inhibited cell migration and invasion in AGS cells. However, escin did not affect the viability of these cells at these concentrations. The chemokine receptor and its ligands play an important role in cancer metastasis. Escin decreased the production of soluble C-X-C motif chemokine (CXCL)16 but increased the expression of trans-membranous CXCL16. The expression of C-X-C chemokine receptor (CXCR)6 was not affected by escin treatment. Exogenous CXCL16 reversed escin-induced migration inhibition. In addition, escin inhibited the phosphorylation of focal adhesion kinase and Akt. These results demonstrate that escin inhibited the migration and invasion of AGS cells, which is associated with altered CXCL16/CXCR6 axis. These findings suggest that escin has potential as an antimetastatic agent in gastric cancer.

  19. CC-Chemokine Ligand 2 (CCL2) Suppresses High Density Lipoprotein (HDL) Internalization and Cholesterol Efflux via CC-Chemokine Receptor 2 (CCR2) Induction and p42/44 Mitogen-activated Protein Kinase (MAPK) Activation in Human Endothelial Cells *

    PubMed Central

    Sun, Run-Lu; Huang, Can-Xia; Bao, Jin-Lan; Jiang, Jie-Yu; Zhang, Bo; Zhou, Shu-Xian; Cai, Wei-Bin; Wang, Hong; Wang, Jing-Feng; Zhang, Yu-Ling

    2016-01-01

    High density lipoprotein (HDL) has been proposed to be internalized and to promote reverse cholesterol transport in endothelial cells (ECs). However, the mechanism underlying these processes has not been studied. In this study, we aim to characterize HDL internalization and cholesterol efflux in ECs and regulatory mechanisms. We found mature HDL particles were reduced in patients with coronary artery disease (CAD), which was associated with an increase in CC-chemokine ligand 2 (CCL2). In cultured primary human coronary artery endothelial cells and human umbilical vein endothelial cells, we determined that CCL2 suppressed the binding (4 °C) and association (37 °C) of HDL to/with ECs and HDL cellular internalization. Furthermore, CCL2 inhibited [3H]cholesterol efflux to HDL/apoA1 in ECs. We further found that CCL2 induced CC-chemokine receptor 2 (CCR2) expression and siRNA-CCR2 reversed CCL2 suppression on HDL binding, association, internalization, and on cholesterol efflux in ECs. Moreover, CCL2 induced p42/44 mitogen-activated protein kinase (MAPK) phosphorylation via CCR2, and p42/44 MAPK inhibition reversed the suppression of CCL2 on HDL metabolism in ECs. Our study suggests that CCL2 was elevated in CAD patients. CCL2 suppressed HDL internalization and cholesterol efflux via CCR2 induction and p42/44 MAPK activation in ECs. CCL2 induction may contribute to impair HDL function and form atherosclerosis in CAD. PMID:27458015

  20. CCR7 directs the recruitment of T cells into inflamed pancreatic islets of nonobese diabetic (NOD) mice.

    PubMed

    Shan, Zhongyan; Xu, Baohui; Mikulowska-Mennis, Anna; Michie, Sara A

    2014-05-01

    Type 1 diabetes (T1D) is a T cell-mediated autoimmune disease characterized by the destruction of insulin-producing β cells in the pancreatic islets. The migration of T cells from blood vessels into pancreas is critical for the development of islet inflammation and β cell destruction in T1D. To define the roles of C-C chemokine receptor type 7 (CCR7) in recruitment of T cells into islets, we used laser capture microdissection to isolate tissue from inflamed islets of nonobese diabetic (NOD) mice and uninflamed islets of BALB/c and young NOD mice. RT-PCR analyses detected mRNAs for CCR7 and its chemokine ligands CCL19 (ELC; MIP-3β) and CCL21 (SLC) in captures from inflamed, but not from uninflamed, islets. Immunohistology studies revealed that high endothelial venules in inflamed islets co-express CCL21 protein and MAdCAM-1 (an adhesion molecule that recruits lymphocytes into islets). Desensitization of lymphocyte CCR7 blocked about 75 % of T cell migration from the bloodstream into inflamed islets, but had no effect on B cell migration into islets. These results indicate that CCR7 and its ligands are important in the recruitment of T cells into inflamed islets and thus in the pathogenesis of T1D.

  1. Chronic morphine and HIV-1 Tat promote differential central nervous system trafficking of CD3+ and Ly6C+ immune cells in a murine Streptococcus pneumoniae infection model.

    PubMed

    Dutta, Raini; Roy, Sabita

    2015-06-20

    Persistent systemic infection results in excessive trafficking of peripheral immune cells into the central nervous system (CNS), thereby contributing to sustained neuroinflammation that leads to neurocognitive deficits. In this study, we explored the role of opportunistic systemic infection with Streptococcus pneumoniae in the recruitment of peripheral leukocytes into the CNS and its contribution to HIV-1-associated neurocognitive disorders in opioid-dependent individuals. Wild-type B6CBAF1 (wt), μ-opioid receptor knockout (MORKO), FVB/N luciferase transgenic, and Toll-like receptor 2 and 4 knockout (TLR2KO and TLR4KO) mice were subcutaneously implanted with morphine/placebo pellet followed by HIV-1 Transactivator of transcription (Tat) protein injection intravenously and S. pneumoniae administration intraperitoneally. On postoperative day 5, brains perfused with phosphate-buffered saline were harvested and subjected to immunohistochemistry (for bacterial trafficking and chemokine ligand generation), flow cytometry (for phenotypic characterization of CNS trafficked immune cells), Western blot, and real-time PCR (for ligand expression). Our results show differential leukocyte trafficking of T lymphocytes (CD3+) and inflammatory monocytes (Ly6C+) into the CNS of mice treated with morphine, HIV-1 Tat, and/or S. pneumoniae. In addition, we demonstrate a Trojan horse mechanism for bacterial dissemination across the blood-brain barrier into the CNS by monocytes. Activation of TLRs on microglia induced a chemokine gradient that facilitated receptor-dependent trafficking of peripheral immune cells into the CNS. HIV-1 Tat induced trafficking of Ly6C+ and CD3+ cells into the CNS; infection with S. pneumoniae facilitated infiltration of only T lymphocytes into the CNS. We also observed differential chemokine secretion in the CNS, with CCL5 being the predominant chemokine following HIV-1 Tat treatment, which was potentiated further with morphine. S. pneumoniae alone led to preferential induction of CXCL12. Furthermore, we attributed a regulatory role for TLRs in the chemokine-mediated trafficking of leukocytes into the CNS. Chronic morphine and HIV-1 Tat, in the context of systemic S. pneumoniae co-infection, differentially modulated induction of TLR2/4, which consequently facilitated trafficking of TLR2 → CD3 + CCR5+ and TLR4 → Ly6C+(CCR5+/CXCR4+) immune cells into the CNS. Our murine study suggests that secondary infection in opioid-dependent individuals infected with HIV-1 augments peripheral leukocyte trafficking as a consequence of sustained chemokine gradients in the CNS.

  2. O-glycans direct selectin ligands to lipid rafts on leukocytes

    PubMed Central

    Shao, Bojing; Yago, Tadayuki; Setiadi, Hendra; Wang, Ying; Mehta-D’souza, Padmaja; Fu, Jianxin; Crocker, Paul R.; Rodgers, William; Xia, Lijun; McEver, Rodger P.

    2015-01-01

    Palmitoylated cysteines typically target transmembrane proteins to domains enriched in cholesterol and sphingolipids (lipid rafts). P-selectin glycoprotein ligand-1 (PSGL-1), CD43, and CD44 are O-glycosylated proteins on leukocytes that associate with lipid rafts. During inflammation, they transduce signals by engaging selectins as leukocytes roll in venules, and they move to the raft-enriched uropods of polarized cells upon chemokine stimulation. It is not known how these glycoproteins associate with lipid rafts or whether this association is required for signaling or for translocation to uropods. Here, we found that loss of core 1-derived O-glycans in murine C1galt1−/− neutrophils blocked raft targeting of PSGL-1, CD43, and CD44, but not of other glycosylated proteins, as measured by resistance to solubilization in nonionic detergent and by copatching with a raft-resident sphingolipid on intact cells. Neuraminidase removal of sialic acids from wild-type neutrophils also blocked raft targeting. C1galt1−/− neutrophils or neuraminidase-treated neutrophils failed to activate tyrosine kinases when plated on immobilized anti–PSGL-1 or anti-CD44 F(ab′)2. Furthermore, C1galt1−/− neutrophils incubated with anti–PSGL-1 F(ab′)2 did not generate microparticles. In marked contrast, PSGL-1, CD43, and CD44 moved normally to the uropods of chemokine-stimulated C1galt1−/− neutrophils. These data define a role for core 1-derived O-glycans and terminal sialic acids in targeting glycoprotein ligands for selectins to lipid rafts of leukocytes. Preassociation of these glycoproteins with rafts is required for signaling but not for movement to uropods. PMID:26124096

  3. Premalignant lesions skew spleen cell responses to immune modulation by adipocytes.

    PubMed

    Vielma, Silvana A; Klein, Richard L; Levingston, Corinne A; Young, M Rita I

    2013-05-01

    Obesity can promote a chronic inflammatory state and is associated with an increased risk for cancer. Since adipocytes can produce mediators that can regulate conventional immune cells, this study sought to determine if the presence of premalignant oral lesions would skew how immune cells respond to adipocyte-derived mediators to create an environment that may be more favorable for their progression toward cancer. While media conditioned by adipocytes stimulated normal spleen cell production of the T helper (Th) type-1 cytokines interleukin (IL)-2, interferon-γ (IFN-γ), IL-12 and granulocyte-monocyte colony-stimulating factor (GM CSF), media from premalignant lesion cells either blocked or had no added affect on the adipocyte-stimulated Th1 cytokine production. In contrast, media conditioned by premalignant lesion cells exacerbated adipocyte-stimulated spleen cell production of the Th2 cytokines IL-10 and IL-13, although it did not further enhance the adipocyte-stimulated spleen cell production of IL-4 and TGF-β. The premalignant lesion environment also heightened the adipocyte-stimulated spleen cell production of the inflammatory mediators IL 1α, IL-1β, IL-6 and IL-9, although it did not further increase the adipocyte-stimulated production of tumor necrosis factor-α (TNF-α). IL 17 production was unaffected by the adipocyte-derived mediators, but was synergistically triggered by adding media from premalignant lesion cells. These stimulatory effects on spleen cell production of Th2 and inflammatory mediators were not induced in the absence of media conditioned by adipocytes. In contrast, media conditioned by adipocytes did not stimulate production of predominantly monocyte-derived chemokine C-X-C motif ligand (CXCL)9, chemokine C-C motif ligand (CCL)3 or CCL4, although it stimulated production of CCL2 and the predominantly T cell-derived chemokine CCL5, which was the only chemokine whose production was further increased by media from premalignant lesions. These results suggest that the responsiveness of spleen cells to adipocyte-derived mediators is influenced by mediators from premalignant lesion cells to favor conventional immune cell production of a Th2 and inflammatory cytokines.

  4. CC-Chemokine Ligand 2 (CCL2) Suppresses High Density Lipoprotein (HDL) Internalization and Cholesterol Efflux via CC-Chemokine Receptor 2 (CCR2) Induction and p42/44 Mitogen-activated Protein Kinase (MAPK) Activation in Human Endothelial Cells.

    PubMed

    Sun, Run-Lu; Huang, Can-Xia; Bao, Jin-Lan; Jiang, Jie-Yu; Zhang, Bo; Zhou, Shu-Xian; Cai, Wei-Bin; Wang, Hong; Wang, Jing-Feng; Zhang, Yu-Ling

    2016-09-09

    High density lipoprotein (HDL) has been proposed to be internalized and to promote reverse cholesterol transport in endothelial cells (ECs). However, the mechanism underlying these processes has not been studied. In this study, we aim to characterize HDL internalization and cholesterol efflux in ECs and regulatory mechanisms. We found mature HDL particles were reduced in patients with coronary artery disease (CAD), which was associated with an increase in CC-chemokine ligand 2 (CCL2). In cultured primary human coronary artery endothelial cells and human umbilical vein endothelial cells, we determined that CCL2 suppressed the binding (4 °C) and association (37 °C) of HDL to/with ECs and HDL cellular internalization. Furthermore, CCL2 inhibited [(3)H]cholesterol efflux to HDL/apoA1 in ECs. We further found that CCL2 induced CC-chemokine receptor 2 (CCR2) expression and siRNA-CCR2 reversed CCL2 suppression on HDL binding, association, internalization, and on cholesterol efflux in ECs. Moreover, CCL2 induced p42/44 mitogen-activated protein kinase (MAPK) phosphorylation via CCR2, and p42/44 MAPK inhibition reversed the suppression of CCL2 on HDL metabolism in ECs. Our study suggests that CCL2 was elevated in CAD patients. CCL2 suppressed HDL internalization and cholesterol efflux via CCR2 induction and p42/44 MAPK activation in ECs. CCL2 induction may contribute to impair HDL function and form atherosclerosis in CAD. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Expression of inflammation-related genes is altered in gastric tissue of patients with advanced stages of NAFLD.

    PubMed

    Mehta, Rohini; Birerdinc, Aybike; Neupane, Arpan; Shamsaddini, Amirhossein; Afendy, Arian; Elariny, Hazem; Chandhoke, Vikas; Baranova, Ancha; Younossi, Zobair M

    2013-01-01

    Obesity is associated with chronic low-grade inflammation perpetuated by visceral adipose. Other organs, particularly stomach and intestine, may also overproduce proinflammatory molecules. We examined the gene expression patterns in gastric tissue of morbidly obese patients with nonalcoholic fatty liver disease (NAFLD) and compared the changes in gene expression in different histological forms of NAFLD. Stomach tissue samples from 20 morbidly obese NAFLD patients who were undergoing sleeve gastrectomy were profiled using qPCR for 84 genes encoding inflammatory cytokines, chemokines, their receptors, and other components of inflammatory cascades. Interleukin 8 receptor-beta (IL8RB) gene overexpression in gastric tissue was correlated with the presence of hepatic steatosis, hepatic fibrosis, and histologic diagnosis of nonalcoholic steatohepatitis (NASH). Expression levels of soluble interleukin 1 receptor antagonist (IL1RN) were correlated with the presence of NASH and hepatic fibrosis. mRNA levels of interleukin 8 (IL8), chemokine (C-C motif) ligand 4 (CCL4), and its receptor chemokine (C-C motif) receptor type 5 (CCR5) showed a significant increase in patients with advanced hepatic inflammation and were correlated with the severity of the hepatic inflammation. The results of our study suggest that changes in expression patterns for inflammatory molecule encoding genes within gastric tissue may contribute to the pathogenesis of obesity-related NAFLD.

  6. Expression of Inflammation-Related Genes Is Altered in Gastric Tissue of Patients with Advanced Stages of NAFLD

    PubMed Central

    Mehta, Rohini; Birerdinc, Aybike; Neupane, Arpan; Shamsaddini, Amirhossein; Afendy, Arian; Elariny, Hazem; Chandhoke, Vikas; Baranova, Ancha; Younossi, Zobair M.

    2013-01-01

    Obesity is associated with chronic low-grade inflammation perpetuated by visceral adipose. Other organs, particularly stomach and intestine, may also overproduce proinflammatory molecules. We examined the gene expression patterns in gastric tissue of morbidly obese patients with nonalcoholic fatty liver disease (NAFLD) and compared the changes in gene expression in different histological forms of NAFLD. Stomach tissue samples from 20 morbidly obese NAFLD patients who were undergoing sleeve gastrectomy were profiled using qPCR for 84 genes encoding inflammatory cytokines, chemokines, their receptors, and other components of inflammatory cascades. Interleukin 8 receptor-beta (IL8RB) gene overexpression in gastric tissue was correlated with the presence of hepatic steatosis, hepatic fibrosis, and histologic diagnosis of nonalcoholic steatohepatitis (NASH). Expression levels of soluble interleukin 1 receptor antagonist (IL1RN) were correlated with the presence of NASH and hepatic fibrosis. mRNA levels of interleukin 8 (IL8), chemokine (C-C motif) ligand 4 (CCL4), and its receptor chemokine (C-C motif) receptor type 5 (CCR5) showed a significant increase in patients with advanced hepatic inflammation and were correlated with the severity of the hepatic inflammation. The results of our study suggest that changes in expression patterns for inflammatory molecule encoding genes within gastric tissue may contribute to the pathogenesis of obesity-related NAFLD. PMID:23661906

  7. Chemokine (C-C motif) ligand 3 detection in the serum of persons exposed to asbestos: A patient-based study

    PubMed Central

    Xu, Jiegou; Alexander, David B; Iigo, Masaaki; Hamano, Hirokazu; Takahashi, Satoru; Yokoyama, Takako; Kato, Munehiro; Usami, Ikuji; Tokuyama, Takeshi; Tsutsumi, Masahiro; Tamura, Mouka; Oguri, Tetsuya; Niimi, Akio; Hayashi, Yoshimitsu; Yokoyama, Yoshifumi; Tonegawa, Ken; Fukamachi, Katsumi; Futakuchi, Mitsuru; Sakai, Yuto; Suzui, Masumi; Kamijima, Michihiro; Hisanaga, Naomi; Omori, Toyonori; Nakae, Dai; Hirose, Akihiko; Kanno, Jun; Tsuda, Hiroyuki

    2015-01-01

    Exposure to asbestos results in serious risk of developing lung and mesothelial diseases. Currently, there are no biomarkers that can be used to diagnose asbestos exposure. The purpose of the present study was to determine whether the levels or detection rate of chemokine (C-C motif) ligand 3 (CCL3) in the serum are elevated in persons exposed to asbestos. The primary study group consisted of 76 healthy subjects not exposed to asbestos and 172 healthy subjects possibly exposed to asbestos. The secondary study group consisted of 535 subjects possibly exposed to asbestos and diagnosed with pleural plaque (412), benign hydrothorax (10), asbestosis (86), lung cancer (17), and malignant mesothelioma (10). All study subjects who were possibly exposed to asbestos had a certificate of asbestos exposure issued by the Japanese Ministry of Health, Labour and Welfare. For the primary study group, levels of serum CCL3 did not differ between the two groups. However, the detection rate of CCL3 in the serum of healthy subjects possibly exposed to asbestos (30.2%) was significantly higher (P < 0.001) than for the control group (6.6%). The pleural plaque, benign hydrothorax, asbestosis, and lung cancer groups had serum CCL3 levels and detection rates similar to that of healthy subjects possibly exposed to asbestos. The CCL3 chemokine was detected in the serum of 9 of the 10 patients diagnosed with malignant mesothelioma. Three of the patients with malignant mesothelioma had exceptionally high CCL3 levels. Malignant mesothelioma cells from four biopsy cases and an autopsy case were positive for CCL3, possibly identifying the source of the CCL3 in the three malignant mesothelioma patients with exceptionally high serum CCL3 levels. In conclusion, a significantly higher percentage of healthy persons possibly exposed to asbestos had detectable levels of serum CCL3 compared to healthy unexposed control subjects. PMID:25940505

  8. MicroRNA-17-92 cluster promotes the proliferation and the chemokine production of keratinocytes: implication for the pathogenesis of psoriasis.

    PubMed

    Zhang, Weigang; Yi, Xiuli; An, Yawen; Guo, Sen; Li, Shuli; Song, Pu; Chang, Yuqian; Zhang, Shaolong; Gao, Tianwen; Wang, Gang; Li, Chunying

    2018-05-11

    Keratinocytes are the main epidermal cell type that constitutes the skin barrier against environmental damages, which emphasizes the balance between the growth and the death of keratinocytes in maintaining skin homeostasis. Aberrant proliferation of keratinocytes and the secretion of inflammatory factors from keratinocytes are related to the formation of chronic inflammatory skin diseases like psoriasis. MicroRNA-17-92 (miRNA-17-92 or miR-17-92) is a miRNA cluster that regulates cell growth and immunity, but the role of miR-17-92 cluster in keratinocytes and its relation to skin diseases have not been well investigated. In the present study, we initially found that miR-17-92 cluster promoted the proliferation and the cell-cycle progression of keratinocytes via suppressing cyclin-dependent kinase inhibitor 2B (CDKN2B). Furthermore, miR-17-92 cluster facilitated the secretion of C-X-C motif chemokine ligand 9 (CXCL9) and C-X-C motif chemokine ligand 10 (CXCL10) from keratinocytes by inhibiting suppressor of cytokine signaling 1 (SOCS1), which enhanced the chemotaxis for T lymphocytes formed by keratinocytes. In addition, we detected increased expression of miR-17-92 cluster in psoriatic lesions and the level of lesional miR-17-92 cluster was positively correlated with the disease severity in psoriasis patients. At last, miR-17-92 cluster was increased in keratinocytes by cytokines through the activation of signal transducers and activators of transcription 1 (STAT1) signaling pathway. Our findings demonstrate that cytokine-induced overexpression of miR-17-92 cluster can promote the proliferation and the immune function of keratinocytes, and thus may contribute to the development of inflammatory skin diseases like psoriasis, which implicates miR-17-92 cluster as a potential therapeutic target for psoriasis and other skin diseases with similar inflammatory pathogenesis.

  9. Absence of γ-Chain in Keratinocytes Alters Chemokine Secretion, Resulting in Reduced Immune Cell Recruitment.

    PubMed

    Nowak, Karolin; Linzner, Daniela; Thrasher, Adrian J; Lambert, Paul F; Di, Wei-Li; Burns, Siobhan O

    2017-10-01

    Loss-of-function mutations in the common gamma (γc) chain cytokine receptor subunit give rise to severe combined immunodeficiency characterized by lack of T and natural killer cells and infant death from infection. Hematopoietic stem cell transplantation or gene therapy offer a cure, but despite successful replacement of lymphoid immune lineages, a long-term risk of severe cutaneous human papilloma virus infections persists, possibly related to persistent γc-deficiency in other cell types. Here we show that keratinocytes, the only cell type directly infected by human papilloma virus, express functional γc and its co-receptors. After stimulation with the γc-ligand IL-15, γc-deficient keratinocytes show significantly impaired secretion of specific chemokines including CXCL1, CXCL8, and CCL20, resulting in reduced chemotaxis of dendritic cells and CD4 + T cells. Furthermore, γc-deficient keratinocytes also exhibit defective induction of T-cell chemotaxis in a model of stable human papilloma virus-18 infection. These findings suggest that persistent γc-deficiency in keratinocytes alters immune cell recruitment to the skin, which may contribute to the development and persistence of warts in this condition and would require different treatment approaches. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  10. C-type lectin Mincle is an activating receptor for pathogenic fungus, Malassezia

    PubMed Central

    Yamasaki, Sho; Matsumoto, Makoto; Takeuchi, Osamu; Matsuzawa, Tetsuhiro; Ishikawa, Eri; Sakuma, Machie; Tateno, Hiroaki; Uno, Jun; Hirabayashi, Jun; Mikami, Yuzuru; Takeda, Kiyoshi; Akira, Shizuo; Saito, Takashi

    2009-01-01

    Mincle (also called as Clec4e and Clecsf9) is a C-type lectin receptor expressed in activated phagocytes. Recently, we have demonstrated that Mincle is an FcRγ-associated activating receptor that senses damaged cells. To search an exogenous ligand(s), we screened pathogenic fungi using cell line expressing Mincle, FcRγ, and NFAT-GFP reporter. We found that Mincle specifically recognizes the Malassezia species among 50 different fungal species tested. Malassezia is a pathogenic fungus that causes skin diseases, such as tinea versicolor and atopic dermatitis, and fatal sepsis. However, the specific receptor on host cells has not been identified. Mutation of the putative mannose-binding motif within C-type lectin domain of Mincle abrogated Malassezia recognition. Analyses of glycoconjugate microarray revealed that Mincle selectively binds to α-mannose but not mannan. Thus, Mincle may recognize specific geometry of α-mannosyl residues on Malassezia species and use this to distinguish them from other fungi. Malassezia activated macrophages to produce inflammatory cytokines/chemokines. To elucidate the physiological function of Mincle, Mincle-deficient mice were established. Malassezia-induced cytokine/chemokine production by macrophages from Mincle−/− mice was significantly impaired. In vivo inflammatory responses against Malassezia was also impaired in Mincle−/− mice. These results indicate that Mincle is the first specific receptor for Malassezia species to be reported and plays a crucial role in immune responses to this fungus. PMID:19171887

  11. Polymorphisms in chemokine and receptor genes and gastric cancer risk and survival in a high risk Polish population

    PubMed Central

    Gawron, Andrew J.; Fought, Angela J.; Lissowska, Jolanta; Ye, Weimin; Zhang, Xiao; Chow, Wong-Ho; Freeman, Laura E. Beane; Hou, Lifang

    2010-01-01

    Objective To examine if genetic variations in chemokine receptor and ligand genes are associated with gastric cancer risk and survival. Methods The study included 298 cases and 417 controls from a population-based study of gastric cancer conducted in Warsaw, Poland in 1994–1996. We investigated seven single nucleotide polymorphisms in a chemokine ligand (CXCL12) and chemokine receptor (CCR2, CCR5, CX3CR1) genes and one frameshift deletion (CCR5) in blood leukocyte DNA in relation to gastric cancer risk and survival. Genotyping was conducted at the NCI Core Genotyping Facility. Odds ratios and 95% confidence intervals were computed using univariate and multivariate logistic regression models. Survival analysis was performed using Cox proportional hazards models. Results Gastric cancer risk was not associated with single chemokine polymorphisms. A CCR5 haplotype that contained the common alleles of IVS1+151 G>T (rs2734648), IVS2+80 C>T (rs1800024) and minor allele of IVS1+246 A>G (rs1799987) was associated with a borderline significantly increased risk (OR = 1.5, 95% CI: 1.0–2.2). For gastric cancer cases, there was a greater risk of death for carriers of the minor alleles of CCR2 Ex2+241 G>A (rs1799864) (HR = 1.5, 95% CI: 1.1–2.1) and CCR5 IVS2+80 C>T (rs1800024) (HR = 1.5, 95% CI: 1.1–2.1). Carriers of the CCR5 minor allele of IVS1+151 G>T (rs2734648) had a decreased risk of death compared to homozygote carriers of the common allele (HR = 0.8, 95% CI: 0.6–1.0). Conclusions Our findings do not support an association between gastric cancer risk and single chemokine genetic variation. The observed associations between cancer risk and a CCR5 haplotype and between survival and polymorphisms in CCR2 and CCR5 need replication in future studies. PMID:21091093

  12. Facilitation of Allergic Sensitization and Allergic Airway Inflammation by Pollen-Induced Innate Neutrophil Recruitment

    PubMed Central

    Hosoki, Koa; Aguilera-Aguirre, Leopoldo; Brasier, Allan R.; Kurosky, Alexander; Boldogh, Istvan

    2016-01-01

    Neutrophil recruitment is a hallmark of rapid innate immune responses. Exposure of airways of naive mice to pollens rapidly induces neutrophil recruitment. The innate mechanisms that regulate pollen-induced neutrophil recruitment and the contribution of this neutrophilic response to subsequent induction of allergic sensitization and inflammation need to be elucidated. Here we show that ragweed pollen extract (RWPE) challenge in naive mice induces C-X-C motif ligand (CXCL) chemokine synthesis, which stimulates chemokine (C-X-C motif) receptor 2 (CXCR2)-dependent recruitment of neutrophils into the airways. Deletion of Toll-like receptor 4 (TLR4) abolishes CXCL chemokine secretion and neutrophil recruitment induced by a single RWPE challenge and inhibits induction of allergic sensitization and airway inflammation after repeated exposures to RWPE. Forced induction of CXCL chemokine secretion and neutrophil recruitment in mice lacking TLR4 also reconstitutes the ability of multiple challenges of RWPE to induce allergic airway inflammation. Blocking RWPE-induced neutrophil recruitment in wild-type mice by administration of a CXCR2 inhibitor inhibits the ability of repeated exposures to RWPE to stimulate allergic sensitization and airway inflammation. Administration of neutrophils derived from naive donor mice into the airways of Tlr4 knockout recipient mice after each repeated RWPE challenge reconstitutes allergic sensitization and inflammation in these mice. Together these observations indicate that pollen-induced recruitment of neutrophils is TLR4 and CXCR2 dependent and that recruitment of neutrophils is a critical rate-limiting event that stimulates induction of allergic sensitization and airway inflammation. Inhibiting pollen-induced recruitment of neutrophils, such as by administration of CXCR2 antagonists, may be a novel strategy to prevent initiation of pollen-induced allergic airway inflammation. PMID:26086549

  13. Facilitation of Allergic Sensitization and Allergic Airway Inflammation by Pollen-Induced Innate Neutrophil Recruitment.

    PubMed

    Hosoki, Koa; Aguilera-Aguirre, Leopoldo; Brasier, Allan R; Kurosky, Alexander; Boldogh, Istvan; Sur, Sanjiv

    2016-01-01

    Neutrophil recruitment is a hallmark of rapid innate immune responses. Exposure of airways of naive mice to pollens rapidly induces neutrophil recruitment. The innate mechanisms that regulate pollen-induced neutrophil recruitment and the contribution of this neutrophilic response to subsequent induction of allergic sensitization and inflammation need to be elucidated. Here we show that ragweed pollen extract (RWPE) challenge in naive mice induces C-X-C motif ligand (CXCL) chemokine synthesis, which stimulates chemokine (C-X-C motif) receptor 2 (CXCR2)-dependent recruitment of neutrophils into the airways. Deletion of Toll-like receptor 4 (TLR4) abolishes CXCL chemokine secretion and neutrophil recruitment induced by a single RWPE challenge and inhibits induction of allergic sensitization and airway inflammation after repeated exposures to RWPE. Forced induction of CXCL chemokine secretion and neutrophil recruitment in mice lacking TLR4 also reconstitutes the ability of multiple challenges of RWPE to induce allergic airway inflammation. Blocking RWPE-induced neutrophil recruitment in wild-type mice by administration of a CXCR2 inhibitor inhibits the ability of repeated exposures to RWPE to stimulate allergic sensitization and airway inflammation. Administration of neutrophils derived from naive donor mice into the airways of Tlr4 knockout recipient mice after each repeated RWPE challenge reconstitutes allergic sensitization and inflammation in these mice. Together these observations indicate that pollen-induced recruitment of neutrophils is TLR4 and CXCR2 dependent and that recruitment of neutrophils is a critical rate-limiting event that stimulates induction of allergic sensitization and airway inflammation. Inhibiting pollen-induced recruitment of neutrophils, such as by administration of CXCR2 antagonists, may be a novel strategy to prevent initiation of pollen-induced allergic airway inflammation.

  14. Involvement of both the V2 and V3 Regions of the CCR5-Tropic Human Immunodeficiency Virus Type 1 Envelope in Reduced Sensitivity to Macrophage Inflammatory Protein 1α

    PubMed Central

    Maeda, Yosuke; Foda, Mohamed; Matsushita, Shuzo; Harada, Shinji

    2000-01-01

    To determine whether C-C chemokines play an important role in the phenotype switch of human immunodeficiency virus (HIV) from CCR5 to CXCR4 usage during the course of an infection in vivo, macrophage inflammatory protein (MIP)-1α-resistant variants were isolated from CCR5-tropic (R5) HIV-1 in vitro. The selected variants displayed reduced sensitivities to MIP-1α (fourfold) through CCR5-expressing CD4-HeLa/long terminal repeat–β-galactosidase (MAGI/CCR5) cells. The variants were also resistant to other natural ligands for CCR5, namely, MIP-1β (>4-fold) and RANTES (regulated upon activation, normal T-cell expressed and secreted) (6-fold). The env sequence analyses revealed that the variants had amino acid substitutions in V2 (valine 166 to methionine) and V3 (serine 303 to glycine), although the same V3 substitution appeared in virus passaged without MIP-1α. A single-round replication assay using a luciferase reporter HIV-1 strain pseudotyped with mutant envelopes confirmed that mutations in both V2 and V3 were necessary to confer the reduced sensitivity to MIP-1α, MIP-1β, and RANTES. However, the double mutant did not switch its chemokine receptor usage from CCR5 to CXCR4, indicating the altered recognition of CCR5 by this mutant. These results indicated that V2 combined with the V3 region of the CCR5-tropic HIV-1 envelope modulates the sensitivity of HIV-1 to C-C chemokines without altering the ability to use chemokine receptors. PMID:10644351

  15. Involvement of both the V2 and V3 regions of the CCR5-tropic human immunodeficiency virus type 1 envelope in reduced sensitivity to macrophage inflammatory protein 1alpha.

    PubMed

    Maeda, Y; Foda, M; Matsushita, S; Harada, S

    2000-02-01

    To determine whether C-C chemokines play an important role in the phenotype switch of human immunodeficiency virus (HIV) from CCR5 to CXCR4 usage during the course of an infection in vivo, macrophage inflammatory protein (MIP)-1alpha-resistant variants were isolated from CCR5-tropic (R5) HIV-1 in vitro. The selected variants displayed reduced sensitivities to MIP-1alpha (fourfold) through CCR5-expressing CD4-HeLa/long terminal repeat-beta-galactosidase (MAGI/CCR5) cells. The variants were also resistant to other natural ligands for CCR5, namely, MIP-1beta (>4-fold) and RANTES (regulated upon activation, normal T-cell expressed and secreted) (6-fold). The env sequence analyses revealed that the variants had amino acid substitutions in V2 (valine 166 to methionine) and V3 (serine 303 to glycine), although the same V3 substitution appeared in virus passaged without MIP-1alpha. A single-round replication assay using a luciferase reporter HIV-1 strain pseudotyped with mutant envelopes confirmed that mutations in both V2 and V3 were necessary to confer the reduced sensitivity to MIP-1alpha, MIP-1beta, and RANTES. However, the double mutant did not switch its chemokine receptor usage from CCR5 to CXCR4, indicating the altered recognition of CCR5 by this mutant. These results indicated that V2 combined with the V3 region of the CCR5-tropic HIV-1 envelope modulates the sensitivity of HIV-1 to C-C chemokines without altering the ability to use chemokine receptors.

  16. CXC chemokine ligand 4 (CXCL4) down-regulates CC chemokine receptor expression on human monocytes.

    PubMed

    Schwartzkopff, Franziska; Petersen, Frank; Grimm, Tobias Alexander; Brandt, Ernst

    2012-02-01

    During acute inflammation, monocytes are essential in abolishing invading micro-organisms and encouraging wound healing. Recruitment by CC chemokines is an important step in targeting monocytes to the inflamed tissue. However, cell surface expression of the corresponding chemokine receptors is subject to regulation by various endogenous stimuli which so far have not been comprehensively identified. We report that the platelet-derived CXC chemokine ligand 4 (CXCL4), a known activator of human monocytes, induces down-regulation of CC chemokine receptors (CCR) 1, -2, and -5, resulting in drastic impairment of monocyte chemotactic migration towards cognate CC chemokine ligands (CCL) for these receptors. Interestingly, CXCL4-mediated down-regulation of CCR1, CCR2 and CCR5 was strongly dependent on the chemokine's ability to stimulate autocrine/paracrine release of TNF-α. In turn, TNF-α induced the secretion CCL3 and CCL4, two chemokines selective for CCR1 and CCR5, while the secretion of CCR2-ligand CCL2 was TNF-α-independent. Culture supernatants of CXCL4-stimulated monocytes as well as chemokine-enriched preparations thereof reproduced CXCL4-induced CCR down-regulation. In conclusion, CXCL4 may act as a selective regulator of monocyte migration by stimulating the release of autocrine, receptor-desensitizing chemokine ligands. Our results stress a co-ordinating role for CXCL4 in the cross-talk between platelets and monocytes during early inflammation.

  17. Melatonin delays photoreceptor degeneration in a mouse model of autosomal recessive retinitis pigmentosa.

    PubMed

    Xu, Xiao-Jian; Wang, Shu-Min; Jin, Ying; Hu, Yun-Tao; Feng, Kang; Ma, Zhi-Zhong

    2017-10-01

    Retinitis pigmentosa (RP) comprises a group of incurable inherited retinal degenerations. Targeting common processes, instead of mutation-specific treatment, has proven to be an innovative strategy to combat debilitating retinal degeneration. Growing evidence indicates that melatonin possesses a potent activity against neurodegenerative disorders by mitigating cell damage associated with apoptosis and inflammation. Given the pleiotropic role of melatonin in central nervous system, the aim of the present study was to investigate whether melatonin would afford protection against retinal degeneration in autosomal recessive RP (arRP). Rd10, a well-characterized murine model of human arRP, received daily intraperitoneal injection of melatonin (15 mg/kg) between postnatal day (P) 13 and P30. Retinas treated with melatonin or vehicle were harvested for analysis at P30 and P45, respectively. The findings showed that melatonin could dampen the photoreceptors death and delay consequent retinal degeneration. We also observed that melatonin weakened the expression of glial fibrillary acidic protein (GFAP) in Müller cells. Additionally, melatonin could alleviate retinal inflammatory response visualized by IBA1 staining, which was further corroborated by downregulation of inflammation-related genes, such as tumor necrosis factor alpha (Tnf-α), chemokine (C-C motif) ligand 2 (Ccl2), and chemokine (C-X-C motif) ligand 10 (Cxcl10). These data revealed that melatonin could ameliorate retinal degeneration through potentially attenuating apoptosis, reactive gliosis, and microglial activation in rd10 mice. Moreover, these results suggest melatonin as a promising agent improving photoreceptors survival in human RP. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. UV Irradiation of Skin Enhances Glycolytic Flux and Reduces Migration Capabilities in Bone Marrow-Differentiated Dendritic Cells.

    PubMed

    McGonigle, Terence A; Keane, Kevin N; Ghaly, Simon; Carter, Kim W; Anderson, Denise; Scott, Naomi M; Goodridge, Helen S; Dwyer, Amy; Greenland, Eloise; Pixley, Fiona J; Newsholme, Philip; Hart, Prue H

    2017-09-01

    A systemic immunosuppression follows UV irradiation of the skin of humans and mice. In this study, dendritic cells (DCs) differentiating from the bone marrow (BM) of UV-irradiated mice had a reduced ability to migrate toward the chemokine (C-C motif) ligand 21. Fewer DCs also accumulated in the peritoneal cavity of UV-chimeric mice (ie, mice transplanted with BM from UV-irradiated mice) after injection of an inflammatory stimulus into that site. We hypothesized that different metabolic states underpin altered DC motility. Compared with DCs from the BM of nonirradiated mice, those from UV-irradiated mice produced more lactate, consumed more glucose, and had greater glycolytic flux in a bioenergetics stress test. Greater expression of 3-hydroxyanthranilate 3,4-dioxygenase was identified as a potential contributor to increased glycolysis. Inhibition of 3-hydroxyanthranilate 3,4-dioxygenase by 6-chloro-dl-tryptophan prevented both increased lactate production and reduced migration toward chemokine (C-C motif) ligand 21 by DCs differentiated from BM of UV-irradiated mice. UV-induced prostaglandin E 2 has been implicated as an intermediary in the effects of UV radiation on BM cells. DCs differentiating from BM cells pulsed in vitro for 2 hours with dimethyl prostaglandin E 2 were functionally similar to those from the BM of UV-irradiated mice. Reduced migration of DCs to lymph nodes associated with increased glycolytic flux may contribute to their reduced ability to initiate new immune responses in UV-irradiated mice. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  19. Association of CCL11 promoter polymorphisms with schizophrenia in a Korean population.

    PubMed

    Kang, Won Sub; Kim, Young Jong; Park, Hae Jeong; Kim, Su Kang; Paik, Jong-Woo; Kim, Jong Woo

    2018-05-20

    Immunological alterations and dysregulation of the inflammatory response have been suggested to play a crucial role in schizophrenia pathophysiology. Growing evidence supports the involvement of chemokines in brain development, thus many chemokines have been studied in relation with schizophrenia. The C-C motif chemokine ligand 11 (CCL11) has been shown to be related with synaptic plasticity and neurogenesis. Moreover, altered levels of CCL11 have been observed in schizophrenia patients. Therefore, we examined whether single nucleotide polymorphisms (SNPs) of the CCL11 in the promoter region contribute to susceptibility to schizophrenia. Four promoter SNPs [rs17809012 (-384T>C), rs16969415 (-426C>T), rs17735961 (-488C>A), and rs4795896 (576G>A)] were genotyped in 254 schizophrenia patients and 405 control subjects using Fluidigm SNPtype assays. The genotype frequency of CCL11 rs4795896 (-576G>A) showed significant association with schizophrenia in a recessive model (AA vs. GG/AG, p < 0.0001) and in a log-additive model (AG vs. AA vs. GG, p < 0.0001). The allele frequency of rs4795896 also showed a significant association with schizophrenia (p < 0.0001). Furthermore, haplotype analysis revealed that GCT, ACT, and GCC haplotypes containing rs4795896, rs17735961 and rs17809012 were significantly associated with schizophrenia (p = 0.0044, p < 0.0001, and p < 0.0001, respectively). Our results suggest that CCL11 promotor polymorphism is associated with increased risk for the development of schizophrenia in a Korean population. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Involvement of Escherichia coli in pathogenesis of xanthogranulomatous cholecystitis with scavenger receptor class A and CXCL16-CXCR6 interaction.

    PubMed

    Sawada, Seiko; Harada, Kenichi; Isse, Kumiko; Sato, Yasunori; Sasaki, Motoko; Kaizaki, Yasuharu; Nakanuma, Yasuni

    2007-10-01

    Xanthogranulomatous cholecystitis (XGC) is characterized by the infiltration of numerous foamy macrophages. Bacterial infection is thought to be involved in the pathogenesis of XGC. Using XGC and cultured murine biliary epithelial cells (BEC), the participation of E. coli and the role of the scavenger receptor class A (SCARA), as well as chemokine(C-X-C motif) ligand 16 (CXCL16) and its receptor chemokine(C-X-C motif) receptor 6 (CXCR6), were examined in the pathogenesis of XGC. E. coli components and genes were detected in XGC on immunohistochemistry and polymerase chain reaction (PCR), respectively. SCARA-recognizing E. coli was found in foamy macrophages aggregated in xanthogranulomatous lesions. CXCL16, which functions as a membrane-bound molecule and soluble chemokine to induce adhesion and migration of CXCR6(+) cells, was detected on gallbladder epithelia, and CXCR6(+)/CD8(+) T cells and CXCR6(+)/CD68(+) macrophages were also accumulated. In cultured BEC, CXCL16 mRNA and secreted soluble CXCL16 were constantly detected and upregulated by treatment with E. coli and lipopolysaccharide through Toll-like receptor 4. These suggest that SCARA in macrophages is involved in the phagocytosis of E. coli followed by foamy changes and that bacterial infection causes the upregulation of CXCL16 in gallbladder epithelia, leading to the chemoattraction of macrophages via CXCL16-CXCR6 interaction and formation of the characteristic histology of XGC.

  1. CXC chemokine ligand 16 is increased in gestational diabetes mellitus and preeclampsia and associated with lipoproteins in gestational diabetes mellitus at 5 years follow-up.

    PubMed

    Lekva, Tove; Michelsen, Annika E; Aukrust, Pål; Paasche Roland, Marie Cecilie; Henriksen, Tore; Bollerslev, Jens; Ueland, Thor

    2017-11-01

    Women with a history of gestational diabetes mellitus and preeclampsia are at increased risk of cardiovascular disease later in life, but the mechanism remains unclear. The aim of the study was to evaluate the association between CXC chemokine ligand 16 and indices of glucose metabolism, dyslipidemia and systemic inflammation in gestational diabetes mellitus and preeclampsia. This sub-study of the population-based prospective cohort included 310 women. Oral glucose tolerance test was performed during pregnancy and 5 years later along with lipid analysis. CXC chemokine ligand 16 was measured in plasma (protein) and peripheral blood mononuclear cells (messenger RNA) during pregnancy and at follow-up. Circulating CXC chemokine ligand 16 was higher in gestational diabetes mellitus women early in pregnancy and at follow-up, while higher in preeclampsia women late in pregnancy compared to control women. Messenger RNA of CXC chemokine ligand 16 in peripheral blood mononuclear cells were lower in gestational diabetes mellitus and preeclampsia women compared to control women. Increased circulating CXC chemokine ligand 16 level was associated with a higher apolipoprotein B and low-density lipoprotein cholesterol in gestational diabetes mellitus women but not in normal pregnancy at follow-up. Our study shows that women with gestational diabetes mellitus and preeclampsia had a dysregulated CXC chemokine ligand 16 during pregnancy, and in gestational diabetes mellitus, the increase in CXC chemokine ligand 16 early in pregnancy and after 5 years was strongly associated with their lipid profile.

  2. PGE2 pulsing of murine bone marrow cells reduces migration of daughter monocytes/macrophages in vitro and in vivo

    PubMed Central

    McGonigle, Terence A.; Dwyer, Amy R.; Greenland, Eloise L.; Scott, Naomi M.; Keane, Kevin N.; Newsholme, Philip; Goodridge, Helen S.; Zon, Leonard I.; Pixley, Fiona J.; Hart, Prue H.

    2018-01-01

    Monocytes/macrophages differentiating from bone marrow (BM) cells pulsed for 2 hours at 37°C with a stabilized derivative of prostaglandin E2, 16,16-dimethyl PGE2 (dmPGE2), migrated less efficiently toward a chemoattractant than monocytes/macrophages differentiated from BM cells pulsed with vehicle. To confirm that the effect on BM cells was long lasting and to replicate human BM transplantation, chimeric mice were established with donor BM cells pulsed for 2 hours with dmPGE2 before injection into marrow-ablated congenic recipient mice. After 12 weeks, when high levels (90%) of engraftment were obtained, regenerated BM-derived monocytes/macrophages differentiating in vitro or in vivo migrated inefficiently toward the chemokines colony-stimulating factor-1 (CSF-1) and chemokine (C-C motif) ligand 2 (CCL2) or thioglycollate, respectively. Our results reveal long-lasting changes to progenitor cells of monocytes/macrophages by a 2-hour dmPGE2 pulse that, in turn, limits the migration of their daughter cells to chemoattractants and inflammatory mediators. PMID:28822771

  3. AhR and Arnt differentially regulate NF-κB signaling and chemokine responses in human bronchial epithelial cells

    PubMed Central

    2014-01-01

    Background The aryl hydrocarbon receptor (AhR) has gradually emerged as a regulator of inflammation in the lung and other tissues. AhR may interact with the p65-subunit of the nuclear factor (NF)-κB transcription factors, but reported outcomes of AhR/NF-κB-interactions are conflicting. Some studies suggest that AhR possess pro-inflammatory activities while others suggest that AhR may be anti-inflammatory. The present study explored the impact of AhR and its binding partner AhR nuclear translocator (Arnt) on p65-activation and two differentially regulated chemokines, CXCL8 (IL-8) and CCL5 (RANTES), in human bronchial epithelial cells (BEAS-2B). Results Cells were exposed to CXCL8- and CCL5-inducing chemicals, 1-nitropyrene (1-NP) and 1-aminopyrene (1-AP) respectively, or the synthetic double-stranded RNA analogue, polyinosinic-polycytidylic acid (Poly I:C) which induced both chemokines. Only CXCL8, and not CCL5, appeared to be p65-dependent. Yet, constitutively active unligated AhR suppressed both CXCL8 and CCL5, as shown by siRNA knock-down and the AhR antagonist α-naphthoflavone. Moreover, AhR suppressed activation of p65 by TNF-α and Poly I:C as assessed by luciferase-assay and p65-phosphorylation at serine 536, without affecting basal p65-activity. In contrast, Arnt suppressed only CXCL8, but did not prevent the p65-activation directly. However, Arnt suppressed expression of the NF-κB-subunit RelB which is under transcriptional regulation by p65. Furthermore, AhR-ligands alone at high concentrations induced a moderate CXCL8-response, without affecting CCL5, but suppressed both CXCL8 and CCL5-responses by Poly I:C. Conclusion AhR and Arnt may differentially and independently regulate chemokine-responses induced by both inhaled pollutants and pulmonary infections. Constitutively active, unligated AhR suppressed the activation of p65, while Arnt may possibly interfere with the action of activated p65. Moreover, ligand-activated AhR suppressed CXCL8 and CCL5 responses by other agents, but AhR ligands alone induced CXCL8 responses when given at sufficiently high concentrations, thus underscoring the duality of AhR in regulation of inflammation. We propose that AhR-signaling may be a weak activator of p65-signaling that suppresses p65-activity induced by strong activators of NF-κB, but that its anti-inflammatory properties also are due to interference with additional pathways. PMID:25201625

  4. Glutamine supplementation attenuates expressions of adhesion molecules and chemokine receptors on T cells in a murine model of acute colitis.

    PubMed

    Hou, Yu-Chen; Wu, Jin-Ming; Wang, Ming-Yang; Wu, Ming-Hsun; Chen, Kuen-Yuan; Yeh, Sung-Ling; Lin, Ming-Tsan

    2014-01-01

    Migration of T cells into the colon plays a major role in the pathogenesis in inflammatory bowel disease. This study investigated the effects of glutamine (Gln) supplementation on chemokine receptors and adhesion molecules expressed by T cells in mice with dextran sulfate sodium- (DSS-) induced colitis. C57BL/6 mice were fed either a standard diet or a Gln diet replacing 25% of the total nitrogen. After being fed the diets for 5 days, half of the mice from both groups were given 1.5% DSS in drinking water to induce colitis. Mice were killed after 5 days of DSS exposure. DSS colitis resulted in higher expression levels of P-selectin glycoprotein ligand- (PSGL-) 1, leukocyte function-associated antigen- (LFA-) 1, and C-C chemokine receptor type 9 (CCR9) by T helper (Th) and cytotoxic T (Tc) cells, and mRNA levels of endothelial adhesion molecules in colons were upregulated. Gln supplementation decreased expressions of PSGL-1, LFA-1, and CCR9 by Th cells. Colonic gene expressions of endothelial adhesion molecules were also lower in Gln-colitis mice. Histological finding showed that colon infiltrating Th cells were less in the DSS group with Gln administration. Gln supplementation may ameliorate the inflammation of colitis possibly via suppression of T cell migration.

  5. EXPRESSION, PURIFICATION AND IN VITRO FUNCTIONAL RECONSTITUTION OF THE CHEMOKINE RECEPTOR CCR1

    PubMed Central

    Allen, Samantha J.; Ribeiro, Sofia; Horuk, Richard; Handel, Tracy M.

    2009-01-01

    Chemokine receptors are a specific class of G protein-coupled receptors (GPCRs) that control cell migration associated with routine immune surveillance, inflammation and development. In addition to their roles in normal physiology, these receptors and their ligands are involved in a large number of inflammatory diseases, cancer and AIDS, making them prime therapeutic targets in the pharmaceutical industry. Like other GPCRs, a significant obstacle in determining structures and characterizing mechanisms of activation has been the difficulty in obtaining high levels of pure, functional receptor. Here we describe a systematic effort to express the chemokine receptor CCR1 in mammalian cells, and to purify and reconstitute it in functional form. The highest expression levels were obtained using an inducible HEK293 system. The receptor was purified using a combination of N- (StrepII or Hemagglutinin) and C-terminal (His8) affinity tags. Function was assessed by ligand binding using a novel fluorescence polarization assay with fluorescein-labeled chemokine. A strict dependence of function on the detergent composition was observed, as solubilization of CCR1 in n-dodecyl-β-D-maltopyranoside/cholesteryl hemisuccinate yielded functional receptor with a Kd of 21 nM for the chemokine CCL14, whereas it was non-functional in phosphocholine detergents. Differences in function were observed despite the fact that both these detergent types maintained the receptor in a state characterized by monomers and small oligomers, but not large aggregates. While optimization is still warranted, yields of ~ 0.1–0.2mgs of pure functional receptor per 109 cells will permit biophysical studies of this medically important receptor. PMID:19275940

  6. The Chemokine Receptor CCR1 Is Constitutively Active, Which Leads to G Protein-independent, β-Arrestin-mediated Internalization*

    PubMed Central

    Gilliland, C. Taylor; Salanga, Catherina L.; Kawamura, Tetsuya; Trejo, JoAnn; Handel, Tracy M.

    2013-01-01

    Activation of G protein-coupled receptors by their associated ligands has been extensively studied, and increasing structural information about the molecular mechanisms underlying ligand-dependent receptor activation is beginning to emerge with the recent expansion in GPCR crystal structures. However, some GPCRs are also able to adopt active conformations in the absence of agonist binding that result in the initiation of signal transduction and receptor down-modulation. In this report, we show that the CC-type chemokine receptor 1 (CCR1) exhibits significant constitutive activity leading to a variety of cellular responses. CCR1 expression is sufficient to induce inhibition of cAMP formation, increased F-actin content, and basal migration of human and murine leukocytes. The constitutive activity leads to basal phosphorylation of the receptor, recruitment of β-arrestin-2, and subsequent receptor internalization. CCR1 concurrently engages Gαi and β-arrestin-2 in a multiprotein complex, which may be accommodated by homo-oligomerization or receptor clustering. The data suggest the presence of two functional states for CCR1; whereas receptor coupled to Gαi functions as a canonical GPCR, albeit with high constitutive activity, the CCR1·β-arrestin-2 complex is required for G protein-independent constitutive receptor internalization. The pertussis toxin-insensitive uptake of chemokine by the receptor suggests that the CCR1·β-arrestin-2 complex may be related to a potential scavenging function of the receptor, which may be important for maintenance of chemokine gradients and receptor responsiveness in complex fields of chemokines during inflammation. PMID:24056371

  7. CXC chemokine ligand 4 (Cxcl4) is a platelet-derived mediator of experimental liver fibrosis.

    PubMed

    Zaldivar, Mirko Moreno; Pauels, Katrin; von Hundelshausen, Philipp; Berres, Marie-Luise; Schmitz, Petra; Bornemann, Jörg; Kowalska, M Anna; Gassler, Nikolaus; Streetz, Konrad L; Weiskirchen, Ralf; Trautwein, Christian; Weber, Christian; Wasmuth, Hermann E

    2010-04-01

    Liver fibrosis is a major cause of morbidity and mortality worldwide. Platelets are involved in liver damage, but the underlying molecular mechanisms remain elusive. Here, we investigate the platelet-derived chemokine (C-X-C motif) ligand 4 (CXCL4) as a molecular mediator of fibrotic liver damage. Serum concentrations and intrahepatic messenger RNA of CXCL4 were measured in patients with chronic liver diseases and mice after toxic liver injury. Platelet aggregation in early fibrosis was determined by electron microscopy in patients and by immunohistochemistry in mice. Cxcl4(-/-) and wild-type mice were subjected to two models of chronic liver injury (CCl(4) and thioacetamide). The fibrotic phenotype was analyzed by histological, biochemical, and molecular analyses. Intrahepatic infiltration of immune cells was investigated by fluorescence-activated cell sorting, and stellate cells were stimulated with recombinant Cxcl4 in vitro. The results showed that patients with advanced hepatitis C virus-induced fibrosis or nonalcoholic steatohepatitis had increased serum levels and intrahepatic CXCL4 messenger RNA concentrations. Platelets were found directly adjacent to collagen fibrils. The CCl(4) and thioacetamide treatment led to an increase of hepatic Cxcl4 levels, platelet activation, and aggregation in early fibrosis in mice. Accordingly, genetic deletion of Cxcl4 in mice significantly reduced histological and biochemical liver damage in vivo, which was accompanied by changes in the expression of fibrosis-related genes (Timp-1 [tissue inhibitor of matrix metalloproteinase 1], Mmp9 [matrix metalloproteinase 9], Tgf-beta [transforming growth factor beta], IL10 [interleukin 10]). Functionally, Cxcl4(-/-) mice showed a strongly decreased infiltration of neutrophils (Ly6G) and CD8(+) T cells into the liver. In vitro, recombinant murine Cxcl4 stimulated the proliferation, chemotaxis, and chemokine expression of hepatic stellate cells. The results underscore an important role of platelets in chronic liver damage and imply a new target for antifibrotic therapies.

  8. Genome-wide association study of CSF levels of 59 alzheimer's disease candidate proteins: significant associations with proteins involved in amyloid processing and inflammation.

    PubMed

    Kauwe, John S K; Bailey, Matthew H; Ridge, Perry G; Perry, Rachel; Wadsworth, Mark E; Hoyt, Kaitlyn L; Staley, Lyndsay A; Karch, Celeste M; Harari, Oscar; Cruchaga, Carlos; Ainscough, Benjamin J; Bales, Kelly; Pickering, Eve H; Bertelsen, Sarah; Fagan, Anne M; Holtzman, David M; Morris, John C; Goate, Alison M

    2014-10-01

    Cerebrospinal fluid (CSF) 42 amino acid species of amyloid beta (Aβ42) and tau levels are strongly correlated with the presence of Alzheimer's disease (AD) neuropathology including amyloid plaques and neurodegeneration and have been successfully used as endophenotypes for genetic studies of AD. Additional CSF analytes may also serve as useful endophenotypes that capture other aspects of AD pathophysiology. Here we have conducted a genome-wide association study of CSF levels of 59 AD-related analytes. All analytes were measured using the Rules Based Medicine Human DiscoveryMAP Panel, which includes analytes relevant to several disease-related processes. Data from two independently collected and measured datasets, the Knight Alzheimer's Disease Research Center (ADRC) and Alzheimer's Disease Neuroimaging Initiative (ADNI), were analyzed separately, and combined results were obtained using meta-analysis. We identified genetic associations with CSF levels of 5 proteins (Angiotensin-converting enzyme (ACE), Chemokine (C-C motif) ligand 2 (CCL2), Chemokine (C-C motif) ligand 4 (CCL4), Interleukin 6 receptor (IL6R) and Matrix metalloproteinase-3 (MMP3)) with study-wide significant p-values (p<1.46×10-10) and significant, consistent evidence for association in both the Knight ADRC and the ADNI samples. These proteins are involved in amyloid processing and pro-inflammatory signaling. SNPs associated with ACE, IL6R and MMP3 protein levels are located within the coding regions of the corresponding structural gene. The SNPs associated with CSF levels of CCL4 and CCL2 are located in known chemokine binding proteins. The genetic associations reported here are novel and suggest mechanisms for genetic control of CSF and plasma levels of these disease-related proteins. Significant SNPs in ACE and MMP3 also showed association with AD risk. Our findings suggest that these proteins/pathways may be valuable therapeutic targets for AD. Robust associations in cognitively normal individuals suggest that these SNPs also influence regulation of these proteins more generally and may therefore be relevant to other diseases.

  9. Brain microvascular endothelial-astrocyte cell responses following Japanese encephalitis virus infection in an in vitro human blood-brain barrier model.

    PubMed

    Patabendige, Adjanie; Michael, Benedict D; Craig, Alister G; Solomon, Tom

    2018-06-01

    Japanese encephalitis virus (JEV) remains a leading cause of encephalitis, globally, which continues to grow in importance despite the availability of vaccines. Viral entry into the brain can occur via the blood-brain barrier (BBB), and inflammation at the BBB is a common final pathway in many brain infections. However, the role of the BBB during JEV infection and the contribution of the endothelial and astrocytic cell inflammation in facilitating virus entry into the brain are incompletely understood. We established a BBB model using human brain endothelial cells (HBECs) and human astrocytes. HBECs are polarised, and therefore the model was inoculated by JEV from the apical side to simulate the in vivo situation. The effects of JEV on the BBB permeability and release of inflammatory mediators from both apical and basolateral sides, representing the blood and the brain side respectively were investigated. JEV infected HBECs with limited active virus production, before crossing the BBB and infecting astrocytes. Control of JEV production by HBECs was associated with a significant increase in permeability, and with elevation of many host mediators, including cytokines, chemokines, cellular adhesion molecules, and matrix metalloproteases. When compared to the controls, significantly higher amounts of mediators were released from the apical side as opposed to the basolateral side. The increased release of mediators over time also correlated with increased BBB permeability. Treatment with dexamethasone led to a significant reduction in the release of interleukin 6 (IL6), C-C motif chemokine ligand 5 (CCL5) and C-X-C motif chemokine ligand 10 (CXCL10) from the apical side with a reduction in BBB disruption and no change in JEV production. The results are consistent with the hypothesis that JEV infection of the BBB triggers the production of a range of host mediators from both endothelial cells and astrocytes, which control JEV production but disrupt BBB integrity thus allowing virus entry into the brain. Dexamethasone treatment controlled the host response and limited BBB disruption in the model without increasing JEV production, supporting a re-investigation of its use therapeutically. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Characterization of the myometrial transcriptome in women with an arrest of dilatation during labor

    PubMed Central

    Chaemsaithong, Piya; Madan, Ichchha; Romero, Roberto; Than, Nandor G; Tarca, Adi L; Draghici, Sorin; Bhatti, Gaurav; Mazor, Moshe; Kim, Chong Jai; Hassan, Sonia S; Chaiworapongsa, Tinnakorn

    2014-01-01

    Objective The molecular basis of failure to progress in labor is poorly understood. This study was undertaken to characterize the myometrial transcriptome of patients with an arrest of dilatation (AODIL). Study design Human myometrium was prospectively collected from women in the following groups: 1) spontaneous term labor (TL; n=29); and 2) arrest of dilatation (AODIL; n=14). Gene expression was characterized using Illumina® HumanHT-12 microarrays. A moderated student t-test and false discovery rate adjustment were used for analysis. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) of selected genes was performed in an independent sample set. Pathway analysis was performed on the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway database using Pathway Analysis with Down-weighting of Overlapping Genes (PADOG). The Metacore knowledge base was also mined for pathway analysis. Results 1) 42 genes differentially expressed were identified in women with an AODIL; 2) gene ontology analysis indicated enrichment of biological processes, which included: regulation of angiogenesis, response to hypoxia, inflammatory response, and chemokine-mediated signaling pathway. Enriched molecular functions included: transcription repressor activity, Heat shock protein (Hsp) 90 binding, and nitric oxide synthase (NOS) activity; 3) Metacore analysis identified immune response chemokine (C-C motif) ligand 2 (CCL2) signaling, muscle contraction regulation of eNOS activity in endothelial cells, and Triiodothyronine and Thyroxine signaling as significantly over-represented (FDR<0.05); 4) qRT-PCR confirmed overexpression of Nitric oxide synthase 3 NOS3; hypoxic ischemic factor (HIF1A), Chemokine (C-C motif) ligand 2 (CCL2); angiopoietin-like 4 (ANGPTL4), ADAM metallopeptidase with thrombospondin type 1, motif 9 (ADAMTS9), G protein-coupled receptor 4 (GPR4), metallothionein 1A (MT1A), MT2A, selectin E (SELE) in an AODIL. Conclusion The myometrium of women with arrest of dilatation have a stereotypic transcriptome profile. This disorder was associated with a pattern of gene expression involved in muscle contraction, an inflammatory response, and hypoxia. This is the first comprehensive and unbiased examination of the molecular basis of an AODIL. PMID:23893668

  11. Prostaglandin F2alpha-F-prostanoid receptor signaling promotes neutrophil chemotaxis via chemokine (C-X-C motif) ligand 1 in endometrial adenocarcinoma.

    PubMed

    Wallace, Alison E; Sales, Kurt J; Catalano, Roberto D; Anderson, Richard A; Williams, Alistair R W; Wilson, Martin R; Schwarze, Jurgen; Wang, Hongwei; Rossi, Adriano G; Jabbour, Henry N

    2009-07-15

    The prostaglandin F(2alpha) (PGF(2alpha)) receptor (FP) is elevated in endometrial adenocarcinoma. This study found that PGF(2alpha) signaling via FP regulates expression of chemokine (C-X-C motif) ligand 1 (CXCL1) in endometrial adenocarcinoma cells. Expression of CXCL1 and its receptor, CXCR2, are elevated in cancer tissue compared with normal endometrium and localized to glandular epithelium, endothelium, and stroma. Treatment of Ishikawa cells stably transfected with the FP receptor (FPS cells) with 100 nmol/L PGF(2alpha) increased CXCL1 promoter activity, mRNA, and protein expression, and these effects were abolished by cotreatment of cells with FP antagonist or chemical inhibitors of Gq, epidermal growth factor receptor, and extracellular signal-regulated kinase. Similarly, CXCL1 was elevated in response to 100 nmol/L PGF(2alpha) in endometrial adenocarcinoma explant tissue. CXCL1 is a potent neutrophil chemoattractant. The expression of CXCR2 colocalized to neutrophils in endometrial adenocarcinoma and increased neutrophils were present in endometrial adenocarcinoma compared with normal endometrium. Conditioned media from PGF(2alpha)-treated FPS cells stimulated neutrophil chemotaxis, which could be abolished by CXCL1 protein immunoneutralization of the conditioned media or antagonism of CXCR2. Finally, xenograft tumors in nude mice arising from inoculation with FPS cells showed increased neutrophil infiltration compared with tumors arising from wild-type cells or following treatment of mice bearing FPS tumors with CXCL1-neutralizing antibody. In conclusion, our results show a novel PGF(2alpha)-FP pathway that may regulate the inflammatory microenvironment in endometrial adenocarcinoma via neutrophil chemotaxis.

  12. Rapid transport of CCL11 across the blood-brain barrier: regional variation and importance of blood cells.

    PubMed

    Erickson, Michelle A; Morofuji, Yoichi; Owen, Joshua B; Banks, William A

    2014-06-01

    Increased blood levels of the eotaxin chemokine C-C motif ligand 11 (CCL11) in aging were recently shown to negatively regulate adult hippocampal neurogenesis. How circulating CCL11 could affect the central nervous system (CNS) is not clear, but one possibility is that it can cross the blood-brain barrier (BBB). Here, we show that CCL11 undergoes bidirectional transport across the BBB. Transport of CCL11 from blood into whole brain (influx) showed biphasic kinetics, with a slow phase preceding a rapid phase of uptake. We found that the slow phase was explained by binding of CCL11 to cellular components in blood, whereas the rapid uptake phase was mediated by direct interactions with the BBB. CCL11, even at high doses, did not cause BBB disruption. All brain regions except striatum showed a delayed rapid-uptake phase. Striatum had only an early rapid-uptake phase, which was the fastest of any brain region. We also observed a slow but saturable transport system for CCL11 from brain to blood. C-C motif ligand 3 (CCR3), an important receptor for CCL11, did not facilitate CCL11 transport across the BBB, although high concentrations of a CCR3 inhibitor increased brain uptake without causing BBB disruption. Our results indicate that CCL11 in the circulation can access many regions of the brain outside of the neurogenic niche via transport across the BBB. This suggests that blood-borne CCL11 may have important physiologic functions in the CNS and implicates the BBB as an important regulator of physiologic versus pathologic effects of this chemokine.

  13. Rapid Transport of CCL11 across the Blood-Brain Barrier: Regional Variation and Importance of Blood Cells

    PubMed Central

    Erickson, Michelle A.; Morofuji, Yoichi; Owen, Joshua B.

    2014-01-01

    Increased blood levels of the eotaxin chemokine C-C motif ligand 11 (CCL11) in aging were recently shown to negatively regulate adult hippocampal neurogenesis. How circulating CCL11 could affect the central nervous system (CNS) is not clear, but one possibility is that it can cross the blood-brain barrier (BBB). Here, we show that CCL11 undergoes bidirectional transport across the BBB. Transport of CCL11 from blood into whole brain (influx) showed biphasic kinetics, with a slow phase preceding a rapid phase of uptake. We found that the slow phase was explained by binding of CCL11 to cellular components in blood, whereas the rapid uptake phase was mediated by direct interactions with the BBB. CCL11, even at high doses, did not cause BBB disruption. All brain regions except striatum showed a delayed rapid-uptake phase. Striatum had only an early rapid-uptake phase, which was the fastest of any brain region. We also observed a slow but saturable transport system for CCL11 from brain to blood. C-C motif ligand 3 (CCR3), an important receptor for CCL11, did not facilitate CCL11 transport across the BBB, although high concentrations of a CCR3 inhibitor increased brain uptake without causing BBB disruption. Our results indicate that CCL11 in the circulation can access many regions of the brain outside of the neurogenic niche via transport across the BBB. This suggests that blood-borne CCL11 may have important physiologic functions in the CNS and implicates the BBB as an important regulator of physiologic versus pathologic effects of this chemokine. PMID:24706984

  14. Phospholipase Cε deficiency delays the early stage of cutaneous wound healing and attenuates scar formation in mice.

    PubMed

    Zhu, Xiaolong; Sun, Yue; Mu, Xin; Guo, Pan; Gao, Fei; Zhang, Jing; Zhu, Yunjuan; Zhang, Xianzhi; Chen, Lingling; Ning, Zhiwei; Bai, Yunfeng; Ren, Jiling; Man, Maoqiang; Liu, Peimei; Hu, Lizhi

    2017-02-26

    This study aimed to investigate the role of phospholipase Cε (PLCε) in the skin wound healing process. PLCε, an effect factor of Ras/Rap small G protein, plays a crucial role in skin inflammation by regulating inflammatory cytokines. Inflammatory responses are closely associated with wound healing. Full-thickness skin wounds were made in the PLCε knockout (KO) and wild-type (WT) mice, and the healing process was analyzed. The macroscopic wound closure rate declined in the PLCε KO mice on days 3, 4, and 5 after wounding, following the decreased expression of interleukin (IL)-6, chemokine (C-X-C motif) ligand (Cxcl)-1, Cxcl-2, and chemokine (C-C motif) ligand (Ccl) 20. The proliferation rate of epidermal keratinocytes was not affected by PLCε, but silencing of PLCε resulted in the delayed migration of keratinocytes. Moreover, the scars were found to be much smaller in the PLCε KO mice than in the WT mice. The mRNA expression of Ccl20, collagen (Col) 6a1, and Col17a1 decreased in the PLCε KO mice. These results were in agreement with a previous hypothesis that PLCε might delay the early stage of cutaneous wound healing by inhibiting the migration of keratinocytes, and decrease the expression of Col6a1, Col17a1, and Ccl20 by inhibiting the inflammatory response to reduce scar formation. This study shed light on a novel role of PLCε in wound healing and provided new therapeutic approaches to target PLCε for diminishing scar formation after injury. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. High Levels of Chemokine C-C Motif Ligand 20 in Human Milk and Its Production by Oral Keratinocytes.

    PubMed

    Lourenço, Alan G; Komesu, Marilena C; Duarte, Geraldo; Del Ciampo, Luiz A; Mussi-Pinhata, Marisa M; Yamamoto, Aparecida Y

    2017-03-01

    Chemokine C-C motif ligand 20 (CCL20) is implicated in the formation and function of mucosal lymphoid tissues. Although CCL20 is secreted by many normal human tissues, no studies have evaluated the presence of CCL20 in human milk or its production by oral keratinocytes stimulated by human milk. To evaluate the presence of CCL20 in breast milk and verify CCL20 secretion in vitro by oral keratinocytes stimulated with human and bovine milk, as well as its possible association with breast milk lactoferrin levels. The levels of CCL20 and lactoferrin were measured by enzyme-linked immunosorbent assay in human milk at three different stages of maturation from 74 healthy breastfeeding mothers. In vitro, oral keratinocytes were stimulated with human and bovine milk, and CCL20 was measured in their supernatant. High concentrations of CCL20 were detected in the human breast milk samples obtained during the first week (1,777.07 pg/mL) and second week postpartum (1,523.44 pg/mL), with a significantly low concentration in samples at 3-6 weeks postpartum (238.42 pg/mL; p < 0.0001). Human breast milk at different weeks postpartum stimulated higher CCL20 secretion by oral keratinocytes compared with bovine milk (p < 0.05). Such stimulation had no association with breast milk lactoferrin concentration. CCl20 is present at high levels in human milk, predominantly in the first and second week postpartum, but at significantly lower levels at 3-6 weeks postpartum. Human milk is capable of stimulating CCL20 secretion by oral keratinocytes, and this induction had no association with breast milk lactoferrin concentration.

  16. Transient expression of CCL21as recombinant protein in tomato.

    PubMed

    Beihaghi, Maria; Marashi, Hasan; Bagheri, Abdolreza; Sankian, Mojtaba

    2018-03-01

    The main goal of this study was to investigate the possibility of expressing recombinant protein of C-C chemokine ligand 21 (CCL21) in Solanum lycopersicum via agroinfiltration. CCL21 is a chemokine can be used for anti-metastatic of cancer cell lines. To examine the expression of CCL21 protein in S. lycopersicum , the construct of ccl21 was synthesized. This construct was cloned into pBI121 and the resulting CCL21 plasmid was agro-infiltrated into S. lycopersicum leaves. Within three days after infiltration, Expression of the foreign gene was confirmed by quantitative Real-time PCR. A recombinant CCL21 protein was immunogenically detected by western blot, dot blot and ELISA assay. And results showed that the foreign gene was expressed in the transformed leaves in high level. Also scratch assay was used to investigate the role of this protein in anti-metastatic function. The results demonstrated anti-metastatic of cancer cells in the presence of this protein.

  17. Antimicrobial activity and regulation of CXCL9 and CXCL10 in oral keratinocytes.

    PubMed

    Marshall, Alison; Celentano, Antonio; Cirillo, Nicola; Mignogna, Michele D; McCullough, Michael; Porter, Stephen

    2016-10-01

    Chemokine (C-X-C motif) ligand (CXCL)9 and CXCL10 are dysregulated in oral inflammatory conditions, and it is not known if these chemokines target microorganisms that form oral biofilm. The aim of this study was to investigate the antimicrobial activity of CXCL9 and CXCL10 on oral microflora and their expression profiles in oral keratinocytes following exposure to inflammatory and infectious stimuli. Streptococcus sanguinis was used as a model and Escherichia coli as a positive control. The antimicrobial effect of CXCL9/CXCL10 was tested using a radial diffusion assay. mRNA transcripts were isolated from lipopolysaccharide (LPS)-treated and untreated (control) oral keratinocyte cell lines at 2-, 4-, 6-, and 8-h time-points of culture. The CXCL9/10 expression profile in the presence or absence of interferon-γ (IFN-γ) was assessed using semiquantitative PCR. Although both chemokines demonstrated antimicrobial activity, CXCL9 was the most effective chemokine against both S. sanguinis and E coli. mRNA for CXCL10 was expressed in control cells and its production was enhanced at all time-points following stimulation with LPS. Conversely, CXCL9 mRNA was not expressed in control or LPS-stimulated cells. Finally, stimulation with IFN-γ enhanced basal expression of both CXCL9 and CXCL10 in oral keratinocytes. Chemokines derived from oral epithelium, particularly CXCL9, demonstrate antimicrobial properties. Bacterial and inflammatory-stimulated up-regulation of CXCL9/10 could represent a key element in oral bacterial colonization homeostasis and host-defense mechanisms. © 2016 Eur J Oral Sci.

  18. Microglia, seen from the CX3CR1 angle

    PubMed Central

    Wolf, Yochai; Yona, Simon; Kim, Ki-Wook; Jung, Steffen

    2013-01-01

    Microglial cells in brain and spinal cord are characterized by high expression of the chemokine receptor CX3CR1. Expression of the sole CX3CR1 ligand, the membrane-tethered and sheddable chemokine CX3CL1/fractalkine, is restricted in the brain parenchyma to selected neurons. Here we summarize our current understanding of the physiological role of CX3CR1 for microglia function and the CX3C axis in microglial/neuronal crosstalk in homeostasis and under challenge. Moreover, we will discuss the efforts of our laboratory and others to exploit CX3CR1 promoter activity for the visualization and genetic manipulation of microglia to probe their functional contributions in the central nerve system (CNS) context. PMID:23507975

  19. The effect of very-low-calorie diet on mRNA expression of inflammation-related genes in subcutaneous adipose tissue and peripheral monocytes of obese patients with type 2 diabetes mellitus.

    PubMed

    Mraz, M; Lacinova, Z; Drapalova, J; Haluzikova, D; Horinek, A; Matoulek, M; Trachta, P; Kavalkova, P; Svacina, S; Haluzik, M

    2011-04-01

    Low-grade inflammation links obesity, type 2 diabetes mellitus (T2DM), and cardiovascular diseases. To explore the expression profile of genes involved in inflammatory pathways in adipose tissue and peripheral monocytes (PM) of obese patients with and without T2DM at baseline and after dietary intervention. Two-week intervention study with very-low-calorie diet (VLCD). University hospital. Twelve obese females with T2DM, 8 obese nondiabetic females (OB) and 15 healthy age-matched females. Two weeks of VLCD (2500 kJ/d). Metabolic parameters, circulating cytokines, hormones, and mRNA expression of 39 genes in sc adipose tissue (SCAT) and PM. Both T2DM and OB group had significantly increased serum concentrations of circulating proinflammatory factors (C-reactive protein, TNFα, IL-6, IL-8), mRNA expression of macrophage antigen CD68 and proinflammatory chemokines (CCL-2, -3, -7, -8, -17, -22) in SCAT and complementary chemokine receptors (CCR-1, -2, -3, -5) and other proinflammatory receptors (toll-like receptor 2 and 4, TNF receptor superfamily 1A and 1B, IL-6R) in PM, with OB group showing less pronounced chemoattracting and proinflammatory profile compared to T2DM group. In T2DM patients VLCD decreased body weight, improved metabolic profile, and decreased mRNA expression of up-regulated CCRs in PM and chemokines [CCL 8, chemokine (C-X-C motif) ligand 10] in SCAT. VLCD markedly increased mRNA expression of T-lymphocyte attracting chemokine CCL-17 in SCAT. Obese patients with and without T2DM have increased mRNA expression of chemotactic and proinflammatory factors in SCAT and expression of corresponding receptors in PM. Two weeks of VLCD significantly improved this profile in T2DM patients.

  20. Echovirus 6 Infects Human Exocrine and Endocrine Pancreatic Cells and Induces Pro-Inflammatory Innate Immune Response

    PubMed Central

    Sarmiento, Luis; Frisk, Gun; Anagandula, Mahesh; Hodik, Monika; Barchetta, Ilaria; Netanyah, Eitan; Cabrera-Rode, Eduardo; Cilio, Corrado M.

    2017-01-01

    Human enteroviruses (HEV), especially coxsackievirus serotype B (CVB) and echovirus (E), have been associated with diseases of both the exocrine and endocrine pancreas, but so far evidence on HEV infection in human pancreas has been reported only in islets and ductal cells. This study aimed to investigate the capability of echovirus strains to infect human exocrine and endocrine pancreatic cells. Infection of explanted human islets and exocrine cells with seven field strains of E6 caused cytopathic effect, virus titer increase and production of HEV protein VP1 in both cell types. Virus particles were found in islets and acinar cells infected with E6. No cytopathic effect or infectious progeny production was observed in exocrine cells exposed to the beta cell-tropic strains of E16 and E30. Endocrine cells responded to E6, E16 and E30 by upregulating the transcription of interferon-induced with helicase C domain 1 (IF1H1), 2′-5′-oligoadenylate synthetase 1 (OAS1), interferon-β (IFN-β), chemokine (C–X–C motif) ligand 10 (CXCL10) and chemokine (C–C motif) ligand 5 (CCL5). Echovirus 6, but not E16 or E30, led to increased transcription of these genes in exocrine cells. These data demonstrate for the first time that human exocrine cells represent a target for E6 infection and suggest that certain HEV serotypes can replicate in human pancreatic exocrine cells, while the pancreatic endocrine cells are permissive to a wider range of HEV. PMID:28146100

  1. Effects of ethanol on immune response in the brain: region-specific changes in aged mice.

    PubMed

    Kane, Cynthia J M; Phelan, Kevin D; Douglas, James C; Wagoner, Gail; Johnson, Jennifer Walker; Xu, Jihong; Drew, Paul D

    2013-05-23

    Alcohol abuse has dramatic effects on the health of the elderly. Recent studies indicate that ethanol increases immune activity in younger animals and that some of these proinflammatory molecules alter alcohol consumption and addiction. However, the effects of alcohol on immune activation in aged animals have not been thoroughly investigated. We compared the effects of ethanol on chemokine and cytokine expression in the hippocampus, cerebellum, and cerebral cortex of aged C57BL/6 mice. Mice were treated via gavage with 6 g/kg ethanol for 10 days and tissue was harvested 1 day post-treatment. Ethanol selectively increased mRNA levels of the chemokine (C-C motif) ligand 2/monocyte chemotactic protein-1 in the hippocampus and cerebellum, but not in the cortex of aged mice relative to control animals. In this paradigm, ethanol did not affect mRNA levels of the cytokines IL-6 or TNF-α in any of these brain regions in aged animals. Collectively, these data indicate a region-specific susceptibility to ethanol regulation of neuroinflammatory and addiction-related molecules in aged mice. These studies could have important implications concerning alcohol-induced neuropathology and alcohol addiction in the elderly.

  2. SECRET domain of variola virus CrmB protein can be a member of poxviral type II chemokine-binding proteins family

    PubMed Central

    2010-01-01

    Background Variola virus (VARV) the causative agent of smallpox, eradicated in 1980, have wide spectrum of immunomodulatory proteins to evade host immunity. Recently additional biological activity was discovered for VARV CrmB protein, known to bind and inhibit tumour necrosis factor (TNF) through its N-terminal domain homologous to cellular TNF receptors. Besides binding TNF, this protein was also shown to bind with high affinity several chemokines which recruit B- and T-lymphocytes and dendritic cells to sites of viral entry and replication. Ability to bind chemokines was shown to be associated with unique C-terminal domain of CrmB protein. This domain named SECRET (Smallpox virus-Encoded Chemokine Receptor) is unrelated to the host proteins and lacks significant homology with other known viral chemokine-binding proteins or any other known protein. Findings De novo modelling of VARV-CrmB SECRET domain spatial structure revealed its apparent structural homology with cowpox virus CC-chemokine binding protein (vCCI) and vaccinia virus A41 protein, despite low sequence identity between these three proteins. Potential ligand-binding surface of modelled VARV-CrmB SECRET domain was also predicted to bear prominent electronegative charge which is characteristic to known orthopoxviral chemokine-binding proteins. Conclusions Our results suggest that SECRET should be included into the family of poxviral type II chemokine-binding proteins and that it might have been evolved from the vCCI-like predecessor protein. PMID:20979600

  3. SECRET domain of variola virus CrmB protein can be a member of poxviral type II chemokine-binding proteins family.

    PubMed

    Antonets, Denis V; Nepomnyashchikh, Tatyana S; Shchelkunov, Sergei N

    2010-10-27

    Variola virus (VARV) the causative agent of smallpox, eradicated in 1980, have wide spectrum of immunomodulatory proteins to evade host immunity. Recently additional biological activity was discovered for VARV CrmB protein, known to bind and inhibit tumour necrosis factor (TNF) through its N-terminal domain homologous to cellular TNF receptors. Besides binding TNF, this protein was also shown to bind with high affinity several chemokines which recruit B- and T-lymphocytes and dendritic cells to sites of viral entry and replication. Ability to bind chemokines was shown to be associated with unique C-terminal domain of CrmB protein. This domain named SECRET (Smallpox virus-Encoded Chemokine Receptor) is unrelated to the host proteins and lacks significant homology with other known viral chemokine-binding proteins or any other known protein. De novo modelling of VARV-CrmB SECRET domain spatial structure revealed its apparent structural homology with cowpox virus CC-chemokine binding protein (vCCI) and vaccinia virus A41 protein, despite low sequence identity between these three proteins. Potential ligand-binding surface of modelled VARV-CrmB SECRET domain was also predicted to bear prominent electronegative charge which is characteristic to known orthopoxviral chemokine-binding proteins. Our results suggest that SECRET should be included into the family of poxviral type II chemokine-binding proteins and that it might have been evolved from the vCCI-like predecessor protein.

  4. Innate immune responses induced by lipopolysaccharide and lipoteichoic acid in primary goat mammary epithelial cells.

    PubMed

    Bulgari, Omar; Dong, Xianwen; Roca, Alfred L; Caroli, Anna M; Loor, Juan J

    2017-01-01

    Innate immune responses induced by in vitro stimulation of primary mammary epithelial cells (MEC) using Gram-negative lipopolysaccharide (LPS) and Gram-positive lipoteichoic acid (LTA) bacterial cell wall components are well- characterized in bovine species. The objective of the current study was to characterize the downstream regulation of the inflammatory response induced by Toll-like receptors in primary goat MEC (pgMEC). We performed quantitative real-time RT-PCR (qPCR) to measure mRNA levels of 9 genes involved in transcriptional regulation or antibacterial activity: Toll-like receptor 2 ( TLR2 ), Toll-like receptor 4 ( TLR4 ), prostaglandin-endoperoxide synthase 2 ( PTGS2 ), interferon induced protein with tetratricopeptide repeats 3 ( IFIT3 ), interferon regulatory factor 3 ( IRF3 ), myeloid differentiation primary response 88 ( MYD88 ), nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 ( NFKB1 ), Toll interacting protein ( TOLLIP ), and lactoferrin ( LTF ). Furthermore, we analyzed 7 cytokines involved in Toll-like receptor signaling pathways: C-C motif chemokine ligand 2 ( CCL2 ), C-C motif chemokine ligand 5 ( CCL5 ), C-X-C motif chemokine ligand 6 ( CXCL6 ), interleukin 8 ( CXCL8 ), interleukin 1 beta ( IL1B ), interleukin 6 ( IL6 ), and tumor necrosis factor alpha ( TNF ). Stimulation of pgMEC with LPS for 3 h led to an increase in expression of CCL2 , CXCL6 , IL6 , CXCL8 , PTGS2 , IFIT3 , MYD88 , NFKB1 , and TLR4 ( P  < 0.05). Except for IL6 , and PTGS2 , the same genes had greater expression than controls at 6 h post-LPS ( P  < 0.05). Expression of CCL5 , PTGS2 , IFIT3 , NFKB1 , TLR4 , and TOLLIP was greater than controls after 3 h of incubation with LTA ( P  < 0.05). Compared to controls, stimulation with LTA for 6 h led to greater expression of PTGS2 , IFIT3 , NFKB1 , and TOLLIP ( P  < 0.05) whereas the expression of CXCL6 , CXCL8 , and TLR4 was lower ( P  < 0.05). At 3 h incubation with both toxins compared to controls a greater expression ( P  < 0.05) of CCL2 , CCL5 , CXCL6 , CXCL8 , IL6 , PTGS2 , IFIT3 , IRF3 , MYD88 , and NFKB1 was detected. After 6 h of incubation with both toxins, the expression of CCL2 , CXCL6 , IFIT3 , MYD88 , NFKB1 , and TLR4 was higher than the controls ( P  < 0.05). Data indicate that in the goat MEC, LTA induces a weaker inflammatory response than LPS. This may be related to the observation that gram-positive bacteria cause chronic mastitis more often than gram-negative infections.

  5. Dysregulation of C-X-C motif ligand 10 during aging and association with cognitive performance.

    PubMed

    Bradburn, Steven; McPhee, Jamie; Bagley, Liam; Carroll, Michael; Slevin, Mark; Al-Shanti, Nasser; Barnouin, Yoann; Hogrel, Jean-Yves; Pääsuke, Mati; Gapeyeva, Helena; Maier, Andrea; Sipilä, Sarianna; Narici, Marco; Robinson, Andrew; Mann, David; Payton, Antony; Pendleton, Neil; Butler-Browne, Gillian; Murgatroyd, Chris

    2018-03-01

    Chronic low-grade inflammation during aging (inflammaging) is associated with cognitive decline and neurodegeneration; however, the mechanisms underlying inflammaging are unclear. We studied a population (n = 361) of healthy young and old adults from the MyoAge cohort. Peripheral levels of C-X-C motif chemokine ligand 10 (CXCL10) was found to be higher in older adults, compared with young, and negatively associated with working memory performance. This coincided with an age-related reduction in blood DNA methylation at specific CpGs within the CXCL10 gene promoter. In vitro analysis supported the role of DNA methylation in regulating CXCL10 transcription. A polymorphism (rs56061981) that altered methylation at one of these CpG sites further associated with working memory performance in 2 independent aging cohorts. Studying prefrontal cortex samples, we found higher CXCL10 protein levels in those with Alzheimer's disease, compared with aged controls. These findings support the association of peripheral inflammation, as demonstrated by CXCL10, in aging and cognitive decline. We reveal age-related epigenetic and genetic factors which contribute to the dysregulation of CXCL10. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Migrating Myeloid Cells Sense Temporal Dynamics of Chemoattractant Concentrations.

    PubMed

    Petrie Aronin, Caren E; Zhao, Yun M; Yoon, Justine S; Morgan, Nicole Y; Prüstel, Thorsten; Germain, Ronald N; Meier-Schellersheim, Martin

    2017-11-21

    Chemoattractant-mediated recruitment of hematopoietic cells to sites of pathogen growth or tissue damage is critical to host defense and organ homeostasis. Chemotaxis is typically considered to rely on spatial sensing, with cells following concentration gradients as long as these are present. Utilizing a microfluidic approach, we found that stable gradients of intermediate chemokines (CCL19 and CXCL12) failed to promote persistent directional migration of dendritic cells or neutrophils. Instead, rising chemokine concentrations were needed, implying that temporal sensing mechanisms controlled prolonged responses to these ligands. This behavior was found to depend on G-coupled receptor kinase-mediated negative regulation of receptor signaling and contrasted with responses to an end agonist chemoattractant (C5a), for which a stable gradient led to persistent migration. These findings identify temporal sensing as a key requirement for long-range myeloid cell migration to intermediate chemokines and provide insights into the mechanisms controlling immune cell motility in complex tissue environments. Published by Elsevier Inc.

  7. Silkworm dropping extract ameliorate trimellitic anhydride-induced allergic contact dermatitis by regulating Th1/Th2 immune response.

    PubMed

    Choi, Dae Woon; Kwon, Da-Ae; Jung, Sung Keun; See, Hye-Jeong; Jung, Sun Young; Shon, Dong-Hwa; Shin, Hee Soon

    2018-05-26

    Allergic contact dermatitis (ACD) is an inflammatory skin disease caused by hapten-specific immune response. Silkworm droppings are known to exert beneficial effects during the treatment of inflammatory diseases. Here, we studied whether topical treatment and oral administration of silkworm dropping extract (SDE) ameliorate trimellitic anhydride (TMA)-induced ACD. In ACD mice model, SDE treatment significantly suppressed the increase in both ear thickness and serum IgE levels. Furthermore, IL-1β and TNF-α levels were reduced by SDE. In allergic responses, SDE treatment significantly attenuated the production of the Th2-associated cytokine IL-4 in both ear tissue and draining lymph nodes. However, it increased the production of the Th1-mediated cytokine IL-12. Thus, these results showed that SDE attenuated TMA-induced ACD symptoms through regulation of Th1/Th2 immune response. Taken together, we suggest that SDE treatment might be a potential agent in the prevention or therapy of Th2-mediated inflammatory skin diseases such as ACD and atopic dermatitis. ACD: allergic contact dermatitis; AD: atopic dermatitis; APC: antigen presenting cells; CCL: chemokine (C-C motif) ligand; CCR: C-C chemokine receptor; Dex: dexamethasone; ELISA: enzyme-linked immunosorbent assay; IFN: interferon; Ig: immunoglobulin; IL: interleukin; OVA: ovalbumin; PS: prednisolone; SDE: silkworm dropping extract; Th: T helper; TMA: trimellitic anhydride; TNF: tumor necrosis factor.

  8. Antiinflammatory and Antimicrobial Effects of Thiocyanate in a Cystic Fibrosis Mouse Model

    PubMed Central

    Chandler, Joshua D.; Min, Elysia; Huang, Jie; McElroy, Cameron S.; Dickerhof, Nina; Mocatta, Tessa; Fletcher, Ashley A.; Evans, Christopher M.; Liang, Liping; Patel, Manisha; Kettle, Anthony J.; Nichols, David P.

    2015-01-01

    Thiocyanate (SCN) is used by the innate immune system, but less is known about its impact on inflammation and oxidative stress. Granulocytes oxidize SCN to evolve the bactericidal hypothiocyanous acid, which we previously demonstrated is metabolized by mammalian, but not bacterial, thioredoxin reductase (TrxR). There is also evidence that SCN is dysregulated in cystic fibrosis (CF), a disease marked by chronic infection and airway inflammation. To investigate antiinflammatory effects of SCN, we administered nebulized SCN or saline to β epithelial sodium channel (βENaC) mice, a phenotypic CF model. SCN significantly decreased airway neutrophil infiltrate and restored the redox ratio of glutathione in lung tissue and airway epithelial lining fluid to levels comparable to wild type. Furthermore, in Pseudomonas aeruginosa–infected βENaC and wild-type mice, SCN decreased inflammation, proinflammatory cytokines, and bacterial load. SCN also decreased airway neutrophil chemokine keratinocyte chemoattractant (also known as C-X-C motif chemokine ligand 1) and glutathione sulfonamide, a biomarker of granulocyte oxidative activity, in uninfected βENaC mice. Lung tissue TrxR activity and expression increased in inflamed lung tissue, providing in vivo evidence for the link between hypothiocyanous acid metabolism by TrxR and the promotion of selective biocide of pathogens. SCN treatment both suppressed inflammation and improved host defense, suggesting that nebulized SCN may have important therapeutic utility in diseases of both chronic airway inflammation and persistent bacterial infection, such as CF. PMID:25490247

  9. Rationally designed chemokine-based toxin targeting the viral G protein-coupled receptor US28 potently inhibits cytomegalovirus infection in vivo

    PubMed Central

    Spiess, Katja; Jeppesen, Mads G.; Malmgaard-Clausen, Mikkel; Krzywkowski, Karen; Dulal, Kalpana; Cheng, Tong; Hjortø, Gertrud M.; Larsen, Olav; Burg, John S.; Jarvis, Michael A.; Christopher Garcia, K.; Zhu, Hua; Kledal, Thomas N.; Rosenkilde, Mette M.

    2015-01-01

    The use of receptor–ligand interactions to direct toxins to kill diseased cells selectively has shown considerable promise for treatment of a number of cancers and, more recently, autoimmune disease. Here we move the fusion toxin protein (FTP) technology beyond cancer/autoimmune therapeutics to target the human viral pathogen, human cytomegalovirus (HCMV), on the basis of its expression of the 7TM G protein-coupled chemokine receptor US28. The virus origin of US28 provides an exceptional chemokine-binding profile with high selectivity and improved binding for the CX3C chemokine, CX3CL1. Moreover, US28 is constitutively internalizing by nature, providing highly effective FTP delivery. We designed a synthetic CX3CL1 variant engineered to have ultra-high affinity for US28 and greater specificity for US28 than the natural sole receptor for CX3CL1, CX3CR1, and we fused the synthetic variant with the cytotoxic domain of Pseudomonas Exotoxin A. This novel strategy of a rationally designed FTP provided unparalleled anti-HCMV efficacy and potency in vitro and in vivo. PMID:26080445

  10. High Aldehyde Dehydrogenase Activity Identifies a Subset of Human Mesenchymal Stromal Cells with Vascular Regenerative Potential.

    PubMed

    Sherman, Stephen E; Kuljanin, Miljan; Cooper, Tyler T; Putman, David M; Lajoie, Gilles A; Hess, David A

    2017-06-01

    During culture expansion, multipotent mesenchymal stromal cells (MSCs) differentially express aldehyde dehydrogenase (ALDH), an intracellular detoxification enzyme that protects long-lived cells against oxidative stress. Thus, MSC selection based on ALDH-activity may be used to reduce heterogeneity and distinguish MSC subsets with improved regenerative potency. After expansion of human bone marrow-derived MSCs, cell progeny was purified based on low versus high ALDH-activity (ALDH hi ) by fluorescence-activated cell sorting, and each subset was compared for multipotent stromal and provascular regenerative functions. Both ALDH l ° and ALDH hi MSC subsets demonstrated similar expression of stromal cell (>95% CD73 + , CD90 + , CD105 + ) and pericyte (>95% CD146 + ) surface markers and showed multipotent differentiation into bone, cartilage, and adipose cells in vitro. Conditioned media (CDM) generated by ALDH hi MSCs demonstrated a potent proliferative and prosurvival effect on human microvascular endothelial cells (HMVECs) under serum-free conditions and augmented HMVEC tube-forming capacity in growth factor-reduced matrices. After subcutaneous transplantation within directed in vivo angiogenesis assay implants into immunodeficient mice, ALDH hi MSC or CDM produced by ALDH hi MSC significantly augmented murine vascular cell recruitment and perfused vessel infiltration compared with ALDH l ° MSC. Although both subsets demonstrated strikingly similar mRNA expression patterns, quantitative proteomic analyses performed on subset-specific CDM revealed the ALDH hi MSC subset uniquely secreted multiple proangiogenic cytokines (vascular endothelial growth factor beta, platelet derived growth factor alpha, and angiogenin) and actively produced multiple factors with chemoattractant (transforming growth factor-β, C-X-C motif chemokine ligand 1, 2, and 3 (GRO), C-C motif chemokine ligand 5 (RANTES), monocyte chemotactic protein 1 (MCP-1), interleukin [IL]-6, IL-8) and matrix-modifying functions (tissue inhibitor of metalloprotinase 1 & 2 (TIMP1/2)). Collectively, MSCs selected for ALDH hi demonstrated enhanced proangiogenic secretory functions and represent a purified MSC subset amenable for vascular regenerative applications. Stem Cells 2017;35:1542-1553. © 2017 AlphaMed Press.

  11. Platelet lysate from whole blood-derived pooled platelet concentrates and apheresis-derived platelet concentrates for the isolation and expansion of human bone marrow mesenchymal stromal cells: production process, content and identification of active components

    PubMed Central

    Fekete, Natalie; Gadelorge, Mélanie; Fürst, Daniel; Maurer, Caroline; Dausend, Julia; Fleury-Cappellesso, Sandrine; Mailänder, Volker; Lotfi, Ramin; Ignatius, Anita; Sensebé, Luc; Bourin, Philippe; Schrezenmeier, Hubert; Rojewski, Markus Thomas

    2012-01-01

    Background aims The clinical use of human mesenchymal stromal cells (MSC) requires ex vivo expansion in media containing supplements such as fetal bovine serum or, alternatively, human platelet lysate (PL). Methods Platelet concentrates were frozen, quarantine stored, thawed and sterile filtered to obtain PL. PL content and its effect on fibroblast-colony-forming unit (CFU-F) formation, MSC proliferation and large-scale expansion were studied. Results PL contained high levels of basic fibroblast growth factor (bFGF), soluble CD40L (sCD40L), vascular cell adhesion molecule-1 (VCAM-1), intercellular adhesion molecule-1 (ICAM-1), platelet-derived growth factor AA (PDGF-AA), platelet-derived growth factor AB/BB (PDGF-AB/BB), chemokine (C-C) ligand 5 (CCL5; RANTES) transforming growth factor-β1 (TGF-β1) and chemokine (C-X-C) ligand 1/2/3 (GRO), with low batch-to-batch variability, and most were stable for up to 14 days. Inhibition of PDGF-BB and bFGF decreased MSC proliferation by about 20% and 50%, respectively. The strongest inhibition (about 75%) was observed with a combination of anti-bFGF + anti-PDGF-BB and anti-bFGF + anti-TGF-β1 + anti-PDGF-BB. Interestingly, various combinations of recombinant PDGF-BB, bFGF and TGF-β1 were not sufficient to promote cell proliferation. PL from whole blood-derived pooled platelet concentrates and apheresis platelet concentrates did not differ significantly in their growth-promoting activity on MSC. Conclusions PL enhances MSC proliferation and can be regarded as a safe tool for MSC expansion for clinical purposes. \\in particular, PDGF-BB and bFGF are essential components for the growth-promoting effect of PL, but are not sufficient for MSC proliferation. PMID:22296115

  12. Stage-specific differences in secretory profile of mesenchymal stromal cells (MSCs) subjected to early- vs late-stage OA synovial fluid.

    PubMed

    Gómez-Aristizábal, A; Sharma, A; Bakooshli, M A; Kapoor, M; Gilbert, P M; Viswanathan, S; Gandhi, R

    2017-05-01

    Although, mesenchymal stromal cells (MSCs) are being clinically investigated for their use in osteoarthritis (OA), it is unclear whether their postulated therapeutic properties are equally effective in the early- and late-stages of OA. In this study we investigated MSC cytokine secretion post-exposure to synovial fluid (SF), obtained from early- vs late-stage knee OA patients to justify a potential patient stratification strategy to maximize MSC-mediated treatment effects. Subjects were recruited and categorized into early- [Kellgren-Lawrence (KL) grade I/II, n = 12] and late-stage (KL-III/IV, n = 12) knee OA groups. SF samples were obtained, and their proteome was tested using multiplex assays, after 3-days culture, with and without MSCs. SFs cultured without MSCs were used as a baseline to identify MSC-secreted factors into SFs cultured with MSCs. Linear mixed-effect models and non-parametric tests were used to identify alterations in the MSC secretome during exposure to OA SF (3-days). MSCs cultured for 3-days in 0.5% fetal bovine serum (FBS)-supplemented medium were used to compare SF results with culture medium. Following exposure to OA SF, the MSC secretome contained proteins that are involved in tissue repair, angiogenesis, chemotaxis, matrix remodeling and the clotting process. However, chemokine (C-X-C motif) ligand-8 (CXCL8; chemoattractant), interleukin-6 (IL6) and chemokine (C-C motif) ligand 2 (CCL2) were elevated in the MSC-secretome in response to early- vs late-stage OA SF. Early- vs late-stage OA SF samples elicit a differential MSC secretome response, arguing for stratification of OA patients to maximize MSC-mediated therapeutic effects. Copyright © 2016 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

  13. Circulating Soluble Receptor Activator of Nuclear Factor Kappa B Ligand and C-C Motif Ligand 3 Correlate With Survival in Patients With Waldenström Macroglobulinemia.

    PubMed

    Eleutherakis-Papaiakovou, Evangelos; Kastritis, Efstathios; Gavriatopoulou, Maria; Christoulas, Dimitrios; Roussou, Maria; Ntanasis-Stathopoulos, Ioannis; Kanellias, Nikolaos; Papatheodorou, Athanasios; Dimopoulos, Meletios A; Terpos, Evangelos

    2018-06-01

    Serum receptor activator of nuclear factor κB ligand (sRANKL) and chemokine (C-C) motif ligand 3 (CCL-3) have been reported to be elevated in Waldenström macroglobulinemia (WM) patients. However, there are no published data regarding the prognostic value of these molecules in WM regarding progression-free and overall survival. To evaluate the effect of these markers of bone remodeling on survival parameters, we prospectively evaluated serum cytokines and biological markers in 55 patients with symptomatic WM before they received any kind of treatment. Serum levels of CCL-3 and bone remodeling markers were also evaluated in asymptomatic WM and IgM monoclonal gammopathy of undetermined significance. Furthermore, we assessed bone marrow biopsy samples from newly diagnosed WM patients for CCL-3 and RANKL expression. High circulating sRANKL values predicted shorter median overall survival (46 months vs. not reached, P = .025). High serum levels of CCL-3 predicted shorter median progression-free survival (27 months vs. not reached, P = .048). At bone marrow biopsy evaluation, the whole number of the neoplastic cells revealed strong cytoplasmic positivity for CCL-3, while the neoplastic clone did not express RANKL. We conclude that WM cells produce CCL-3 and possibly enhance the production of RANKL in the bone microenvironment. The correlation of sRANKL and CCL-3 with survival reveals the importance of these cytokines in disease biology and highlights the significance of the interactions between WM and stromal cells for the development of WM. Finally, these findings provide the rationale for the use of anti-RANKL and anti-CCL-3 drugs in animal models of WM before their clinical evaluation. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. Neuronal CCL2 is upregulated during hepatic encephalopathy and contributes to microglia activation and neurological decline

    PubMed Central

    2014-01-01

    Background Acute liver failure leads to systemic complications with one of the most dangerous being a decline in neurological function, termed hepatic encephalopathy. Neurological dysfunction is exacerbated by an increase of toxic metabolites in the brain that lead to neuroinflammation. Following various liver diseases, hepatic and circulating chemokines, such as chemokine ligand 2 (CCL2), are elevated, though their effects on the brain following acute liver injury and subsequent hepatic encephalopathy are unknown. CCL2 is known to activate microglia in other neuropathies, leading to a proinflammatory response. However, the effects of CCL2 on microglia activation and the pathogenesis of hepatic encephalopathy following acute liver injury remain to be determined. Methods Hepatic encephalopathy was induced in mice via injection of azoxymethane (AOM) in the presence or absence of INCB 3284 dimesylate (INCB), a chemokine receptor 2 inhibitor, or C 021 dihydrochloride (C021), a chemokine receptor 4 inhibitor. Mice were monitored for neurological decline and time to coma (loss of all reflexes) was recorded. Tissue was collected at coma and used for real-time PCR, immunoblots, ELISA, or immunostaining analyses to assess the activation of microglia and consequences on pro-inflammatory cytokine expression. Results Following AOM administration, microglia activation was significantly increased in AOM-treated mice compared to controls. Concentrations of CCL2 in the liver, serum, and cortex were significantly elevated in AOM-treated mice compared to controls. Systemic administration of INCB or C021 reduced liver damage as assessed by serum liver enzyme biochemistry. Administration of INCB or C021 significantly improved the neurological outcomes of AOM-treated mice, reduced microglia activation, reduced phosphorylation of ERK1/2, and alleviated AOM-induced cytokine upregulation. Conclusions These findings suggest that CCL2 is elevated systemically following acute liver injury and that CCL2 is involved in both the microglia activation and neurological decline associated with hepatic encephalopathy. Methods used to modulate CCL2 levels and/or reduce CCR2/CCR4 activity may be potential therapeutic targets for the management of hepatic encephalopathy due to acute liver injury. PMID:25012628

  15. Neuronal CCL2 is upregulated during hepatic encephalopathy and contributes to microglia activation and neurological decline.

    PubMed

    McMillin, Matthew; Frampton, Gabriel; Thompson, Michelle; Galindo, Cheryl; Standeford, Holly; Whittington, Eric; Alpini, Gianfranco; DeMorrow, Sharon

    2014-07-10

    Acute liver failure leads to systemic complications with one of the most dangerous being a decline in neurological function, termed hepatic encephalopathy. Neurological dysfunction is exacerbated by an increase of toxic metabolites in the brain that lead to neuroinflammation. Following various liver diseases, hepatic and circulating chemokines, such as chemokine ligand 2 (CCL2), are elevated, though their effects on the brain following acute liver injury and subsequent hepatic encephalopathy are unknown. CCL2 is known to activate microglia in other neuropathies, leading to a proinflammatory response. However, the effects of CCL2 on microglia activation and the pathogenesis of hepatic encephalopathy following acute liver injury remain to be determined. Hepatic encephalopathy was induced in mice via injection of azoxymethane (AOM) in the presence or absence of INCB 3284 dimesylate (INCB), a chemokine receptor 2 inhibitor, or C 021 dihydrochloride (C021), a chemokine receptor 4 inhibitor. Mice were monitored for neurological decline and time to coma (loss of all reflexes) was recorded. Tissue was collected at coma and used for real-time PCR, immunoblots, ELISA, or immunostaining analyses to assess the activation of microglia and consequences on pro-inflammatory cytokine expression. Following AOM administration, microglia activation was significantly increased in AOM-treated mice compared to controls. Concentrations of CCL2 in the liver, serum, and cortex were significantly elevated in AOM-treated mice compared to controls. Systemic administration of INCB or C021 reduced liver damage as assessed by serum liver enzyme biochemistry. Administration of INCB or C021 significantly improved the neurological outcomes of AOM-treated mice, reduced microglia activation, reduced phosphorylation of ERK1/2, and alleviated AOM-induced cytokine upregulation. These findings suggest that CCL2 is elevated systemically following acute liver injury and that CCL2 is involved in both the microglia activation and neurological decline associated with hepatic encephalopathy. Methods used to modulate CCL2 levels and/or reduce CCR2/CCR4 activity may be potential therapeutic targets for the management of hepatic encephalopathy due to acute liver injury.

  16. Glucocorticoid receptor interacts with PNRC2 in a ligand-dependent manner to recruit UPF1 for rapid mRNA degradation.

    PubMed

    Cho, Hana; Park, Ok Hyun; Park, Joori; Ryu, Incheol; Kim, Jeonghan; Ko, Jesang; Kim, Yoon Ki

    2015-03-31

    Glucocorticoid receptor (GR), which was originally known to function as a nuclear receptor, plays a role in rapid mRNA degradation by acting as an RNA-binding protein. The mechanism by which this process occurs remains unknown. Here, we demonstrate that GR, preloaded onto the 5'UTR of a target mRNA, recruits UPF1 through proline-rich nuclear receptor coregulatory protein 2 (PNRC2) in a ligand-dependent manner, so as to elicit rapid mRNA degradation. We call this process GR-mediated mRNA decay (GMD). Although GMD, nonsense-mediated mRNA decay (NMD), and staufen-mediated mRNA decay (SMD) share upstream frameshift 1 (UPF1) and PNRC2, we find that GMD is mechanistically distinct from NMD and SMD. We also identify de novo cellular GMD substrates using microarray analysis. Intriguingly, GMD functions in the chemotaxis of human monocytes by targeting chemokine (C-C motif) ligand 2 (CCL2) mRNA. Thus, our data provide molecular evidence of a posttranscriptional role of the well-studied nuclear hormone receptor, GR, which is traditionally considered a transcription factor.

  17. Enhanced humoural and cellular immune responses to influenza H7N9 antigen HA1-2 fused with flagellin in chickens.

    PubMed

    Song, Li; Xiong, Dan; Hu, Maozhi; Kang, Xilong; Pan, Zhiming; Jiao, Xinan

    2017-06-21

    Sudden increases in the number of human A (H7N9) cases reported during December and January have been observed in previous years. Most reported infection cases are due to prior exposure to live poultry or potentially contaminated environments. Low pathogenicity of influenza A (H7N9) virus in avian species complicates timely discovery of infected birds. Therefore, there is a pressing need to develop safe and effective anti-H7N9 vaccines for poultry to reduce the risk of human infection and prevent the emergence of novel mutated strains. In addition to a good antigen, an effective vaccine also requires an appropriate adjuvant to enhance its immunogenicity. Previously, we generated an H7N9 influenza recombinant subunit vaccine (HA1-2-fliC), in which haemagglutinin globular head domain (HA1-2) was fused with flagellin (fliC), a potent TLR5 ligand, and demonstrated that HA1-2-fliC elicited effective HA1-2-specific immune responses in mice. In this study, we determined flagellin-induced expression profiles of cytokines and chemokines in different types of avian immune cells in vitro and ex vivo. We found that flagellin significantly increased the expression levels of CXCL inflammatory chemokines (CXCLi1 and CXCLi2) and CCL chemokines (MIP-1β and MCP-3) in avian macrophage HD11 cells. In addition, HA1-2-fliC induced significant upregulation of cytokines (IL-1β, IL-6, IL-18 and IFN-γ) and chemokines (CXCLi1, CXCLi2 and MIP-1β) in ex vivo splenic lymphocytes and peripheral blood mononuclear cells (PBMCs), suggesting that flagellin promoted immune responses of avian cells in vitro. We also evaluated specific humoural and cellular immune responses induced by HA1-2-fliC and found that chickens immunised intramuscularly with HA1-2-fliC showed significantly higher HA1-2-specific immunoglobulin (Ig)G titers in serum. Furthermore, HA1-2-fliC potentiated cellular immune responses, as reflected by an increase in CD4 + and CD8 + T cells and proliferation of PBMCs. Significantly higher levels of IFN-γ and IL-4 in PBMCs from chickens vaccinated with HA1-2-fliC further indicated that HA1-2-fliC promoted a balanced Th1/Th2 immune response. We demonstrated that the use of the flagellin as an adjuvant potentiated immunogenicity of influenza subunit vaccine HA1-2 in vitro and in vivo. These findings provide a basis for the development of H7N9 influenza HA1-2 subunit vaccines for chickens.

  18. WY14,643, a PPARalpha ligand, attenuates expression of anti-glomerular basement membrane disease.

    PubMed

    Archer, D C; Frkanec, J T; Cromwell, J; Clopton, P; Cunard, R

    2007-11-01

    Peroxisome proliferator-activated receptor alpha (PPARalpha) ligands are medications used to treat hyperlipidaemia and atherosclerosis. Increasing evidence suggests that these agents are immunosuppressive. In the following studies we demonstrate that WY14,643, a PPARalpha ligand, attenuates expression of anti-glomerular basement membrane disease (AGBMD). C57BL/6 mice were fed 0.05% WY14,643 or control food and immunized with the non-collagenous domain of the alpha3 chain of Type IV collagen [alpha3(IV) NC1] in complete Freund's adjuvant (CFA). WY14,643 reduced proteinuria and greatly improved glomerular and tubulo-interstitial lesions. However, the PPARalpha ligand did not alter the extent of IgG-binding to the GBM. Immunohistochemical studies revealed that the prominent tubulo-interstitial infiltrates in the control-fed mice consisted predominately of F4/80(+) macrophages and WY14,643-feeding decreased significantly the number of renal macrophages. The synthetic PPARalpha ligand also reduced significantly expression of the chemokine, monocyte chemoattractant protein (MCP)-1/CCL2. Sera from mice immunized with AGBMD were also evaluated for antigen-specific IgGs. There was a significant increase in the IgG1 : IgG2c ratio and a decline in the intrarenal and splenocyte interferon (IFN)-gamma mRNA expression in the WY14,643-fed mice, suggesting that the PPARalpha ligand could skew the immune response to a less inflammatory T helper 2-type of response. These studies suggest that PPARalpha ligands may be a novel treatment for inflammatory renal disease.

  19. WY14,643, a PPARα ligand, attenuates expression of anti-glomerular basement membrane disease

    PubMed Central

    Archer, D C; Frkanec, J T; Cromwell, J; Clopton, P; Cunard, R

    2007-01-01

    Peroxisome proliferator-activated receptor alpha (PPARα) ligands are medications used to treat hyperlipidaemia and atherosclerosis. Increasing evidence suggests that these agents are immunosuppressive. In the following studies we demonstrate that WY14,643, a PPARα ligand, attenuates expression of anti-glomerular basement membrane disease (AGBMD). C57BL/6 mice were fed 0·05% WY14,643 or control food and immunized with the non-collagenous domain of the α3 chain of Type IV collagen [α3(IV) NC1] in complete Freund's adjuvant (CFA). WY14,643 reduced proteinuria and greatly improved glomerular and tubulo-interstitial lesions. However, the PPARα ligand did not alter the extent of IgG-binding to the GBM. Immunohistochemical studies revealed that the prominent tubulo-interstitial infiltrates in the control-fed mice consisted predominately of F4/80+ macrophages and WY14,643-feeding decreased significantly the number of renal macrophages. The synthetic PPARα ligand also reduced significantly expression of the chemokine, monocyte chemoattractant protein (MCP)-1/CCL2. Sera from mice immunized with AGBMD were also evaluated for antigen-specific IgGs. There was a significant increase in the IgG1 : IgG2c ratio and a decline in the intrarenal and splenocyte interferon (IFN)-γ mRNA expression in the WY14,643-fed mice, suggesting that the PPARα ligand could skew the immune response to a less inflammatory T helper 2-type of response. These studies suggest that PPARα ligands may be a novel treatment for inflammatory renal disease. PMID:17888025

  20. Synergistic inhibition in vivo of bone marrow myeloid progenitors by myelosuppressive chemokines and chemokine-accelerated recovery of progenitors after treatment of mice with Ara-C.

    PubMed

    Broxmeyer, Hal E; Pelus, Louis M; Kim, Chang H; Hangoc, Giao; Cooper, Scott; Hromas, Robert

    2006-08-01

    Selected chemokines suppress proliferation of hematopoietic progenitor cells (HPCs) in vitro; some of these have demonstrated inhibition of myelopoiesis in vivo. Because myelosuppressive chemokines synergize in vitro with other myelosuppressive chemokines, we sought to determine whether additional chemokines active in vitro were myelosuppressive in vivo and whether combinations of myelosuppressive chemokines synergized in vivo to dampen myelopoiesis. We also evaluated three chemokines in vivo for myeloprotection against Ara-C-induced decreases in HPCs. C3H/HeJ mice were used for analysis of in vivo influence of chemokines, with the end points being effects on absolute numbers and cycling status of HPCs. When used alone, CCL2, CCL3, CCL19, CCL20, CXCL4, CXCL5, CXCL8, CXCL9, and XCL1 caused dose-dependent significant decreases in absolute numbers and cycling status of HPCs in vivo. The following combinations of two chemokines resulted in in vivo myelosuppression at concentrations much lower than that induced by each chemokine alone: CCL3 plus either CXCL8 or CXCL4, CXCL8 plus CXCL4, CCL2 plus either CCL20 or CXCL9, CCL20 plus CXCL9, CXCL5 plus either XCL1 or CCL19, XCL1 plus CCL19, and CCL3 plus CCL19. Also, mice injected with CXCL8, CXCL4, or the chimeric CXCL8/CXCL4 protein CXCL8M1 manifested accelerated recovery of absolute numbers of HPCs in response to the toxic effects of Ara-C administration. A number of chemokines shown previously to manifest inhibitory effects in vitro for proliferation of HPCs are now demonstrated to also induce myelosuppression in vivo. Moreover, combinations of low dosages of two myelosuppressive chemokines when administered together demonstrate synergistic suppression in vivo. Additionally, chemokines, including a CXCL8M1 chimeric protein previously shown to manifest enhanced suppression of HPC proliferation in vitro and in vivo, accelerate HPC recovery after treatment of mice with Ara-C. These results may be of use for future clinical utility of chemokines in a myelosuppressive/myeloprotective setting.

  1. In vivo evolution of HIV-1 co-receptor usage and sensitivity to chemokine-mediated suppression.

    PubMed

    Scarlatti, G; Tresoldi, E; Björndal, A; Fredriksson, R; Colognesi, C; Deng, H K; Malnati, M S; Plebani, A; Siccardi, A G; Littman, D R; Fenyö, E M; Lusso, P

    1997-11-01

    Following the identification of the C-C chemokines RANTES, MIP-1alpha and MIP-1beta as major human immunodeficiency virus (HIV)-suppressive factors produced by CD8+ T cells, several chemokine receptors were found to serve as membrane co-receptors for primate immunodeficiency lentiretroviruses. The two most widely used co-receptors thus far recognized, CCR5 and CXCR4, are expressed by both activated T lymphocytes and mononuclear phagocytes. CCR5, a specific RANTES, MIP-1alpha and MIP-1 receptor, is used preferentially by non-MT2-tropic HIV-1 and HIV-2 strains and by simian immunodeficiency virus (SIV), whereas CXCR4, a receptor for the C-X-C chemokine SDF-1, is used by MT2-tropic HIV-1 and HIV-2, but not by SIV. Other receptors with a more restricted cellular distribution, such as CCR2b, CCR3 and STRL33, can also function as co-receptors for selected viral isolates. The third variable region (V3) of the gp120 envelope glycoprotein of HIV-1 has been fingered as a critical determinant of the co-receptor choice. Here, we document a consistent pattern of evolution of viral co-receptor usage and sensitivity to chemokine-mediated suppression in a longitudinal follow-up of children with progressive HIV-1 infection. Viral isolates obtained during the asymptomatic stages generally used only CCR5 as a co-receptor and were inhibited by RANTES, MIP-1alpha and MIP-1beta, but not by SDF-1. By contrast, the majority of the isolates derived after the progression of the disease were resistant to C-C chemokines, having acquired the ability to use CXCR4 and, in some cases, CCR3, while gradually losing CCR5 usage. Surprisingly, most of these isolates were also insensitive to SDF-1, even when used in combination with RANTES. An early acquisition of CXCR4 usage predicted a poor prognosis. In children who progressed to AIDS without a shift to CXCR4 usage, all the sequential isolates were CCR5-dependent but showed a reduced sensitivity to C-C chemokines. Discrete changes in the V3 domain of gp120 were associated with the loss of sensitivity to C-C chemokines and the shift in co-receptor usage. These results suggest an adaptive evolution of HIV-1 in vivo, leading to escape from the control of the antiviral C-C chemokines.

  2. Self-assembled adult adipose-derived stem cell spheroids combined with biomaterials promote wound healing in a rat skin repair model.

    PubMed

    Hsu, Shan-Hui; Hsieh, Pai-Shan

    2015-01-01

    Adult adipose-derived stem cells (ASCs) are a type of multipotent mesenchymal stem cells (MSCs) with easy availability and serve as a potential cell source for cell-based therapy. Three-dimensional MSC spheroids may be derived from the self-assembly of individual MSCs grown on certain polymer membranes. In this study, we demonstrated that the self-assembled ASC spheroids on chitosan-hyaluronan membranes expressed more cytokine genes (fibroblast growth factor 1, vascular endothelial growth factor, and chemokine [C-C motif] ligand 2) as well as migration-associated genes (chemokine [C-X-C motif] receptor type 4 and matrix metalloprotease 1) compared with ASC dispersed single cells grown on culture dish. To evaluate the in vivo effects of these spheroids, we applied ASC single cells and ASC spheroids in a designed rat skin repair model. Wounds of 15 × 15 mm were created on rat dorsal skin, where ASCs were administered and covered with hyaluronan gel/chitosan sponge to maintain a moist environment. Results showed that skin wounds treated with ASC spheroids had faster wound closure and a significantly higher ratio of angiogenesis. Tracking of fluorescently labeled ASCs showed close localization of ASC spheroids to microvessels, suggesting enhanced angiogenesis through paracrine effects. Based on the in vitro and in vivo results, the self-assembled ASC spheroids may be a promising cellular source for skin tissue engineering and wound regeneration. © 2014 by the Wound Healing Society.

  3. Effects of modified FOLFOX-6 chemotherapy on cellular immune function in patients with gastric cancer

    PubMed Central

    Wang, Liang; Zhou, Donger; Ren, Haitao; Chen, Yan

    2018-01-01

    Tumor immunosuppression serves an important role in the occurrence and development of gastric cancer. However, the effect of chemotherapy on the immune function of patients remains unclear. The present study aimed to investigate changes in cellular immune function and regulatory T cells (Tregs) in patients with gastric cancer prior to and following chemotherapy. In the peripheral blood of patients with gastric cancer, the percentage of CD4+ T cells was substantially decreased compared with that of healthy controls (11.39±5.91 vs. 22.34±3.37%, respectively; P<0.05). High frequencies of CD8+ T cells and Tregs were also observed in the peripheral blood of patients. Although the number of T cells decreased following chemotherapy (the proportions of CD4+ and CD8+ cells were 8.99±7.31 and 16.00±4.51%, respectively), the ratio of CD4+/CD8+ T cells increased (0.31±0.17 vs. 0.56±0.22; P<0.05). Furthermore, the level of C-C motif chemokine ligand 20 (CCL20) was increased in patients prior to chemotherapy compared with healthy controls. As the sole receptor for CCL20, a high level of expression of C-C motif chemokine receptor 6 on circulating Tregs was also identified in the patients, which decreased following chemotherapy. These results suggest that chemotherapy may efficiently promote cellular immune function and inhibit immunosuppression in patients with gastric cancer.

  4. Atorvastatin Reduces Plasma Levels of Chemokine (CXCL10) in Patients with Crohn's Disease

    PubMed Central

    Grip, Olof; Janciauskiene, Sabina

    2009-01-01

    Background In Crohn's disease high tissue expression and serum levels of chemokines and their receptors are known to correlate with disease activity. Because statins can reduce chemokine expression in patients with coronary diseases, we wanted to test whether this can be achieved in patients with Crohn's disease. Methodology/Principal Findings We investigated plasma levels of chemokines (CCL2, CCL4, CCL11, CCL13, CCL17, CCL22, CCL26, CXCL8, CXCL10) and endothelial cytokines (sP-selectin, sE-selectin, sICAM-3, thrombomodulin) in ten Crohn's disease patients before and after thirteen weeks' daily treatment with 80 mg atorvastatin. Of the 13 substances investigated, only CXCL10 was found to be significantly reduced (by 34%, p = 0.026) in all of the treated patients. Levels of CXCL10 correlated with C-reactive protein (r = 0.82, p<0.01). Conclusions/Significance CXCL10 is a ligand for the CXCR3 receptor, the activation of which results in the recruitment of T lymphocytes and the perpetuation of mucosal inflammation. Hence the reduction of plasma CXCL10 levels by atorvastatin may represent a candidate for an approach to the treatment of Crohns disease in the future. Trial Registration ClinicalTrials.gov NCT00454545 PMID:19421322

  5. Anti-inflammatory activity of traditional Chinese medicinal herbs.

    PubMed

    Pan, Min-Hsiung; Chiou, Yi-Shiou; Tsai, Mei-Ling; Ho, Chi-Tang

    2011-10-01

    Accumulating epidemiological and clinical evidence shows that inflammation is an important risk factor for various human diseases. Thus, suppressing chronic inflammation has the potential to delay, prevent, and control various chronic diseases, including cerebrovascular, cardiovascular, joint, skin, pulmonary, blood, lymph, liver, pancreatic, and intestinal diseases. Various natural products from traditional Chinese medicine (TCM) have been shown to safely suppress proinflammatory pathways and control inflammation-associated disease. In vivo and/or in vitro studies have demonstrated that anti-inflammatory effects of TCM occur by inhibition of the expression of master transcription factors (for example, nuclear factor-κB (NF-κB)), pro-inflammatory cytokines (for example, tumor necrosis factor-α (TNF-α), chemokines (for example, chemokine (C-C motif) ligand (CCL)-24), intercellular adhesion molecule expression and pro-inflammatory mediators (for example, inducible nitric oxide synthase (iNOS) and cyclooxygenase 2 (COX2)). However, a handful of review articles have focused on the anti-inflammatory activities of TCM and explore their possible mechanisms of action. In this review, we summarize recent research attempting to identify the anti-inflammatory constituents of TCM and their molecular targets that may create new opportunities for innovation in modern pharmacology.

  6. CCL2 and CCR2 variants are associated with skeletal muscle strength and change in strength with resistance training.

    PubMed

    Harmon, Brennan T; Orkunoglu-Suer, E Funda; Adham, Kasra; Larkin, Justin S; Gordish-Dressman, Heather; Clarkson, Priscilla M; Thompson, Paul D; Angelopoulos, Theodore J; Gordon, Paul M; Moyna, Niall M; Pescatello, Linda S; Visich, Paul S; Zoeller, Robert F; Hubal, Monica J; Tosi, Laura L; Hoffman, Eric P; Devaney, Joseph M

    2010-12-01

    Baseline muscle size and muscle adaptation to exercise are traits with high variability across individuals. Recent research has implicated several chemokines and their receptors in the pathogenesis of many conditions that are influenced by inflammatory processes, including muscle damage and repair. One specific chemokine, chemokine (C-C motif) ligand 2 (CCL2), is expressed by macrophages and muscle satellite cells, increases expression dramatically following muscle damage, and increases expression further with repeated bouts of exercise, suggesting that CCL2 plays a key role in muscle adaptation. The present study hypothesizes that genetic variations in CCL2 and its receptor (CCR2) may help explain muscle trait variability. College-aged subjects [n = 874, Functional Single-Nucleotide Polymorphisms Associated With Muscle Size and Strength (FAMUSS) cohort] underwent a 12-wk supervised strength-training program for the upper arm muscles. Muscle size (via MR imaging) and elbow flexion strength (1 repetition maximum and isometric) measurements were taken before and after training. The study participants were then genotyped for 11 genetic variants in CCL2 and five variants in CCR2. Variants in the CCL2 and CCR2 genes show strong associations with several pretraining muscle strength traits, indicating that inflammatory genes in skeletal muscle contribute to the polygenic system that determines muscle phenotypes. These associations extend across both sexes, and several of these genetic variants have been shown to influence gene regulation.

  7. Biliary tract instillation of a SMAC mimetic induces TRAIL-dependent acute sclerosing cholangitis-like injury in mice

    PubMed Central

    Guicciardi, Maria Eugenia; Krishnan, Anuradha; Bronk, Steven F; Hirsova, Petra; Griffith, Thomas S; Gores, Gregory J

    2017-01-01

    Primary sclerosing cholangitis (PSC) is a cholestatic liver disease of unknown etiopathogenesis characterized by fibrous cholangiopathy of large and small bile ducts. Systemic administration of a murine TNF-related apoptosis-inducing ligand (TRAIL) receptor agonist induces a sclerosing cholangitis injury in C57BL/6 mice, suggesting endogenous TRAIL may contribute to sclerosing cholangitis syndromes. Cellular inhibitor of apoptosis proteins (cIAP-1 and cIAP-2) are negative regulators of inflammation and TRAIL receptor signaling. We hypothesized that if endogenous TRAIL promotes sclerosing cholangitis, then cIAP depletion should also induce this biliary tract injury. Herein, we show that cIAP protein levels are reduced in the interlobular bile ducts of human PSC livers. Downregulation of cIAPs in normal human cholangiocytes in vitro by use of a SMAC mimetic (SM) induces moderate, ripoptosome-mediated apoptosis and RIP1-independent upregulation of proinflammatory cytokines and chemokines. Cytokine and chemokine expression was mediated by the non-canonical activation of NF-κB. To investigate whether downregulation of cIAPs is linked to generation of a PSC-like phenotype, an SM was directly instilled into the mouse biliary tree. Twelve hours after biliary instillation, TUNEL-positive cholangiocytes were identified; 5 days later, PSC-like changes were observed in the SM-treated mice, including a fibrous cholangiopathy of the interlobular bile ducts, portal inflammation, significant elevation of serum markers of cholestasis and cholangiographic evidence of intrahepatic biliary tract injury. In contrast, TRAIL and TRAIL-receptor deficient mice showed no sign of cholangiopathy following SM intrabiliary injection. We conclude that in vivo antagonism of cIAPs in mouse biliary epithelial cells is sufficient to trigger cholangiocytes apoptosis and a proinflammatory response resulting in a fibrous cholangiopathy resembling human sclerosing cholangitis. Therefore, downregulation of cIAPs in PSC cholangiocytes may contribute to the development of the disease. Our results also indicate that inhibition of TRAIL signaling pathways may be beneficial in the treatment of PSC. PMID:28055006

  8. Sex Differences in Psychiatric Comorbidity and Plasma Biomarkers for Cocaine Addiction in Abstinent Cocaine-Addicted Subjects in Outpatient Settings

    PubMed Central

    Pedraz, María; Araos, Pedro; García-Marchena, Nuria; Serrano, Antonia; Romero-Sanchiz, Pablo; Suárez, Juan; Castilla-Ortega, Estela; Mayoral-Cleries, Fermín; Ruiz, Juan Jesús; Pastor, Antoni; Barrios, Vicente; Chowen, Julie A.; Argente, Jesús; Torrens, Marta; de la Torre, Rafael; Rodríguez De Fonseca, Fernando; Pavón, Francisco Javier

    2015-01-01

    There are sex differences in the progression of drug addiction, relapse, and response to therapies. Because biological factors participate in these differences, they should be considered when using biomarkers for addiction. In the current study, we evaluated the sex differences in psychiatric comorbidity and the concentrations of plasma mediators that have been reported to be affected by cocaine. Fifty-five abstinent cocaine-addicted subjects diagnosed with lifetime cocaine use disorders (40 men and 15 women) and 73 healthy controls (48 men and 25 women) were clinically assessed with the diagnostic interview “Psychiatric Research Interview for Substance and Mental Disorders.” Plasma concentrations of chemokines, cytokines, N-acyl-ethanolamines, and 2-acyl-glycerols were analyzed according to history of cocaine addiction and sex, controlling for covariates age and body mass index (BMI). Relationships between these concentrations and variables related to cocaine addiction were also analyzed in addicted subjects. The results showed that the concentrations of chemokine (C-C motif) ligand 2/monocyte chemotactic protein-1 (CCL2/MCP-1) and chemokine (C-X-C motif) ligand 12/stromal cell-derived factor-1 (CXCL12/SDF-1) were only affected by history of cocaine addiction. The plasma concentrations of interleukin 1-beta (IL-1β), IL-6, IL-10, and tumor necrosis factor-alpha (TNFα) were affected by history of cocaine addiction and sex. In fact, whereas cytokine concentrations were higher in control women relative to men, these concentrations were reduced in cocaine-addicted women without changes in addicted men. Regarding fatty acid derivatives, history of cocaine addiction had a main effect on the concentration of each acyl derivative, whereas N-acyl-ethanolamines were increased overall in the cocaine group, 2-acyl-glycerols were decreased. Interestingly, N-palmitoleoyl-ethanolamine (POEA) was only increased in cocaine-addicted women. The covariate BMI had a significant effect on POEA and N-arachidonoyl-ethanolamine concentrations. Regarding psychiatric comorbidity in the cocaine group, women had lower incidence rates of comorbid substance use disorders than did men. For example, alcohol use disorders were found in 80% of men and 40% of women. In contrast, the addicted women had increased prevalences of comorbid psychiatric disorders (i.e., mood, anxiety, and psychosis disorders). Additionally, cocaine-addicted subjects showed a relationship between the concentrations of N-stearoyl-ethanolamine and 2-linoleoyl-glycerol and diagnosis of psychiatric comorbidity. These results demonstrate the existence of a sex influence on plasma biomarkers for cocaine addiction and on the presence of comorbid psychopathologies for clinical purposes. PMID:25762940

  9. The PNPLA3 I148M variant modulates the fibrogenic phenotype of human hepatic stellate cells.

    PubMed

    Bruschi, Francesca Virginia; Claudel, Thierry; Tardelli, Matteo; Caligiuri, Alessandra; Stulnig, Thomas M; Marra, Fabio; Trauner, Michael

    2017-06-01

    The genetic polymorphism I148M of patatin-like phospholipase domain-containing 3 (PNPLA3) is robustly associated with hepatic steatosis and its progression to steatohepatitis, fibrosis, and cancer. Hepatic stellate cells (HSCs) are key players in the development of liver fibrosis, but the role of PNPLA3 and its variant I148M in this process is poorly understood. Here we analyzed the expression of PNPLA3 during human HSC activation and thereby explored how a PNPLA3 variant impacts hepatic fibrogenesis. We show that expression of PNPLA3 gene and protein increases during the early phases of activation and remains elevated in fully activated HSCs (P < 0.01). Knockdown of PNPLA3 significantly decreases the profibrogenic protein alpha-smooth muscle actin (P < 0.05). Primary human I148M HSCs displayed significantly higher expression and release of proinflammatory cytokines, such as chemokine (C-C motif) ligand 5 (P < 0.01) and granulocyte-macrophage colony-stimulating factor (P < 0.001), thus contributing to migration of immune cells (P < 0.05). Primary I148M HSCs showed reduced retinol (P < 0.001) but higher lipid droplet content (P < 0.001). In line with this, LX-2 cells stably overexpressing I148M showed augmented proliferation and migration, lower retinol, and abolished retinoid X receptor/retinoid A receptor transcriptional activities but more lipid droplets. Knockdown of I148M PNPLA3 (P < 0.001) also reduces chemokine (C-C motif) ligand 5 and collagen1α1 expression (P < 0.05). Notably, I148M cells display reduced peroxisome proliferator-activated receptor gamma transcriptional activity, and this effect was attributed to increased c-Jun N-terminal kinase, thereby inhibiting peroxisome proliferator-activated receptor gamma through serine 84 phosphorylation and promoting activator protein 1 transcription. Conversely, the c-Jun N-terminal kinase inhibitor SP600125 and the peroxisome proliferator-activated receptor gamma agonist rosiglitazone decreased activator protein 1 promoter activity. These data indicate that PNPLA3 is required for HSC activation and that its genetic variant I148M potentiates the profibrogenic features of HSCs, providing a molecular mechanism for the higher risk of progression and severity of liver diseases conferred to patients carrying the I148M variant. (Hepatology 2017;65:1875-1890). © 2017 by the American Association for the Study of Liver Diseases.

  10. Sphingosine 1-Phosphate- and C-C Chemokine Receptor 2-Dependent Activation of CD4+ Plasmacytoid Dendritic Cells in the Bone Marrow Contributes to Signs of Sepsis-Induced Immunosuppression

    PubMed Central

    Smirnov, Anna; Pohlmann, Stephanie; Nehring, Melanie; Ali, Shafaqat; Mann-Nüttel, Ritu; Scheu, Stefanie; Antoni, Anne-Charlotte; Hansen, Wiebke; Büettner, Manuela; Gardiasch, Miriam J.; Westendorf, Astrid M.; Wirsdörfer, Florian; Pastille, Eva; Dudda, Marcel; Flohé, Stefanie B.

    2017-01-01

    Sepsis is the dysregulated response of the host to systemic, mostly bacterial infection, and is associated with an enhanced susceptibility to life-threatening opportunistic infections. During polymicrobial sepsis, dendritic cells (DCs) secrete enhanced levels of interleukin (IL) 10 due to an altered differentiation in the bone marrow and contribute to the development of immunosuppression. We investigated the origin of the altered DC differentiation using murine cecal ligation and puncture (CLP), a model for human polymicrobial sepsis. Bone marrow cells (BMC) were isolated after sham or CLP operation, the cellular composition was analyzed, and bone marrow-derived DCs (BMDCs) were generated in vitro. From 24 h on after CLP, BMC gave rise to BMDC that released enhanced levels of IL-10. In parallel, a population of CD11chiMHCII+CD4+ DCs expanded in the bone marrow in a MyD88-dependent manner. Prior depletion of the CD11chiMHCII+CD4+ DCs from BMC in vitro reversed the increased IL-10 secretion of subsequently differentiating BMDC. The expansion of the CD11chiMHCII+CD4+ DC population in the bone marrow after CLP required the function of sphingosine 1-phosphate receptors and C-C chemokine receptor (CCR) 2, the receptor for C-C chemokine ligand (CCL) 2, but was not associated with monocyte mobilization. CD11chiMHCII+CD4+ DCs were identified as plasmacytoid DCs (pDCs) that had acquired an activated phenotype according to their increased expression of MHC class II and CD86. A redistribution of CD4+ pDCs from MHC class II− to MHC class II+ cells concomitant with enhanced expression of CD11c finally led to the rise in the number of CD11chiMHCII+CD4+ DCs. Enhanced levels of CCL2 were found in the bone marrow of septic mice and the inhibition of CCR2 dampened the expression of CD86 on CD4+ pDCs after CLP in vitro. Depletion of pDCs reversed the bias of splenic DCs toward increased IL-10 synthesis after CLP in vivo. Thus, during polymicrobial sepsis, CD4+ pDCs are activated in the bone marrow and induce functional reprogramming of differentiating BMDC toward an immunosuppressive phenotype. PMID:29218051

  11. Alternative C-Terminal Helix Orientation Alters Chemokine Function

    PubMed Central

    Kuo, Je-Hung; Chen, Ya-Ping; Liu, Jai-Shin; Dubrac, Alexandre; Quemener, Cathy; Prats, Hervé; Bikfalvi, Andreas; Wu, Wen-guey; Sue, Shih-Che

    2013-01-01

    Chemokines, a subfamily of cytokines, are small, secreted proteins that mediate a variety of biological processes. Various chemokines adopt remarkable conserved tertiary structure comprising an anti-parallel β-sheet core domain followed by a C-terminal helix that packs onto the β-sheet. The conserved structural feature has been considered critical for chemokine function, including binding to cell surface receptor. The recently isolated variant, CXCL4L1, is a homologue of CXCL4 chemokine (or platelet factor 4) with potent anti-angiogenic activity and differed only in three amino acid residues of P58L, K66E, and L67H. In this study we show by x-ray structural determination that CXCL4L1 adopts a previously unrecognized structure at its C terminus. The orientation of the C-terminal helix protrudes into the aqueous space to expose the entire helix. The alternative helix orientation modifies the overall chemokine shape and surface properties. The L67H mutation is mainly responsible for the swing-out effect of the helix, whereas mutations of P58L and K66E only act secondarily. This is the first observation that reports an open conformation of the C-terminal helix in a chemokine. This change leads to a decrease of its glycosaminoglycan binding properties and to an enhancement of its anti-angiogenic and anti-tumor effects. This unique structure is recent in evolution and has allowed CXCL4L1 to gain novel functional properties. PMID:23536183

  12. Autocrine expression of the epidermal growth factor receptor ligand heparin-binding EGF-like growth factor in cervical cancer.

    PubMed

    Schrevel, Marlies; Osse, E Michelle; Prins, Frans A; Trimbos, J Baptist M Z; Fleuren, Gert Jan; Gorter, Arko; Jordanova, Ekaterina S

    2017-06-01

    In cervical cancer, the epidermal growth factor receptor (EGFR) is overexpressed in 70-90% of the cases and has been associated with poor prognosis. EGFR-based therapy is currently being explored in cervical cancer. We investigated which EGFR ligand is primarily expressed in cervical cancer and which cell type functions as the major source of this ligand. We hypothesized that macrophages are the main source of EGFR ligands and that a paracrine loop between tumor cells and macrophages is responsible for ligand expression. mRNA expression analysis was performed on 32 cervical cancer cases to determine the expression of the EGFR ligands amphiregulin, β-cellulin, epidermal growth factor (EGF), epiregulin, heparin-binding EGF-like growth factor (HB‑EGF) and transforming growth factor α (TGFα). Subsequently, protein expression was determined immunohistochemically on 36 additional cases. To assess whether macrophages are the major source of EGFR ligands, immunohistochemical double staining was performed on four representative tissue slides. Expression of the chemokines granulocyte-macrophage colony-stimulating factor (GM-CSF) and C-C motif ligand 2 (CCL2) was determined by mRNA in situ hybridization. Of the known EGFR ligands, HB‑EGF had the highest mRNA expression and HB‑EGF and EGFR protein expression were highly correlated. Tumor specimens with high EGFR expression showed higher numbers of macrophages, and higher expression of GM-CSF and CCL2, but only a small subset (9%) of macrophages was found to be HB‑EGF-positive. Strikingly, 78% of cervical cancer specimens were found to express HB‑EGF. Standardized assessment of staining intensity, using spectral imaging analysis, showed that HB‑EGF expression was higher in the tumor compartment than in the stromal compartment. These results suggest that HB‑EGF is an important EGFR ligand in cervical cancer and that cervical cancer cells are the predominant source of HB‑EGF. Therefore, we propose an autocrine EGFR stimulation model in cervical carcinomas.

  13. The XC chemokine receptor 1 is a conserved selective marker of mammalian cells homologous to mouse CD8α+ dendritic cells

    PubMed Central

    Crozat, Karine; Guiton, Rachel; Contreras, Vanessa; Feuillet, Vincent; Dutertre, Charles-Antoine; Ventre, Erwan; Vu Manh, Thien-Phong; Baranek, Thomas; Storset, Anne K.; Marvel, Jacqueline; Boudinot, Pierre; Hosmalin, Anne; Schwartz-Cornil, Isabelle

    2010-01-01

    Human BDCA3+ dendritic cells (DCs) were suggested to be homologous to mouse CD8α+ DCs. We demonstrate that human BDCA3+ DCs are more efficient than their BDCA1+ counterparts or plasmacytoid DCs (pDCs) in cross-presenting antigen and activating CD8+ T cells, which is similar to mouse CD8α+ DCs as compared with CD11b+ DCs or pDCs, although with more moderate differences between human DC subsets. Yet, no specific marker was known to be shared between homologous DC subsets across species. We found that XC chemokine receptor 1 (XCR1) is specifically expressed and active in mouse CD8α+, human BDCA3+, and sheep CD26+ DCs and is conserved across species. The mRNA encoding the XCR1 ligand chemokine (C motif) ligand 1 (XCL1) is selectively expressed in natural killer (NK) and CD8+ T lymphocytes at steady-state and is enhanced upon activation. Moreover, the Xcl1 mRNA is selectively expressed at high levels in central memory compared with naive CD8+ T lymphocytes. Finally, XCR1−/− mice have decreased early CD8+ T cell responses to Listeria monocytogenes infection, which is associated with higher bacterial loads early in infection. Therefore, XCR1 constitutes the first conserved specific marker for cell subsets homologous to mouse CD8α+ DCs in higher vertebrates and promotes their ability to activate early CD8+ T cell defenses against an intracellular pathogenic bacteria. PMID:20479118

  14. Corneal epithelial wound healing and bactericidal effect of conditioned medium from human uterine cervical stem cells.

    PubMed

    Bermudez, Maria A; Sendon-Lago, Juan; Eiro, Noemi; Treviño, Mercedes; Gonzalez, Francisco; Yebra-Pimentel, Eva; Giraldez, Maria Jesus; Macia, Manuel; Lamelas, Maria Luz; Saa, Jorge; Vizoso, Francisco; Perez-Fernandez, Roman

    2015-01-22

    To evaluate the effect of conditioned medium from human uterine cervical stem cells (CM-hUCESCs) on corneal epithelial healing in a rat model of dry eye after alkaline corneal epithelial ulcer. We also tested the bactericidal effect of CM-hUCESCs. Dry eye was induced in rats by extraocular lacrimal gland excision, and corneal ulcers were produced using NaOH. Corneal histologic evaluation was made with hematoxylin-eosin (H&E) staining. Real-time PCR was used to evaluate mRNA expression levels of proinflammatory cytokines. We also studied the bactericidal effect of CM-hUCESCs in vitro and on infected corneal contact lenses (CLs) using Escherichia coli and Staphylococcus epidermidis bacteria. In addition, in order to investigate proteins from CM-hUCESCs that could mediate these effects, we carried out a human cytokine antibody array. After injury, dry eyes treated with CM-hUCESCs significantly improved epithelial regeneration and showed reduced corneal macrophage inflammatory protein-1 alpha (MIP-1α) and TNF-α mRNA expression as compared to untreated eyes and eyes treated with culture medium or sodium hyaluronate ophthalmic drops. In addition, we found in CM-hUCESCs high levels of proteins, such as tissue inhibitors of metalloproteinases 1 and 2, fibroblast growth factor 6 and 7, urokinase receptor, and hepatocyte growth factor, that could mediate these effects. In vitro, CM-hUCESCs showed a clear bactericidal effect on both E. coli and S. epidermidis and CLs infected with S. epidermidis. Analyses of CM-hUCESCs showed elevated levels of proteins that could be involved in the bactericidal effect, such as the chemokine (C-X-C motif) ligands 1, 6, 8, 10, and the chemokine (C-C motif) ligands 5 and 20. Treatment with CM-hUCESCs improved wound healing of alkali-injured corneas and showed a strong bactericidal effect on CLs. Patients using CLs and suffering from dry eye, allergies induced by commercial solutions, or small corneal injuries could benefit from this treatment. Copyright 2015 The Association for Research in Vision and Ophthalmology, Inc.

  15. CXCR3 chemokine ligands during respiratory viral infections predict lung allograft dysfunction.

    PubMed

    Weigt, S S; Derhovanessian, A; Liao, E; Hu, S; Gregson, A L; Kubak, B M; Saggar, R; Saggar, R; Plachevskiy, V; Fishbein, M C; Lynch, J P; Ardehali, A; Ross, D J; Wang, H-J; Elashoff, R M; Belperio, J A

    2012-02-01

    Community-acquired respiratory viruses (CARV) can accelerate the development of lung allograft dysfunction, but the immunologic mechanisms are poorly understood. The chemokine receptor CXCR3 and its chemokine ligands, CXCL9, CXCL10 and CXCL11 have roles in the immune response to viruses and in the pathogenesis of bronchiolitis obliterans syndrome, the predominant manifestation of chronic lung allograft rejection. We explored the impact of CARV infection on CXCR3/ligand biology and explored the use of CXCR3 chemokines as biomarkers for subsequent lung allograft dysfunction. Seventeen lung transplant recipients with CARV infection had bronchoalveolar lavage fluid (BALF) available for analysis. For comparison, we included 34 BALF specimens (2 for each CARV case) that were negative for infection and collected at a duration posttransplant similar to a CARV case. The concentration of each CXCR3 chemokine was increased during CARV infection. Among CARV infected patients, a high BALF concentration of either CXCL10 or CXCL11 was predictive of a greater decline in forced expiratory volume in 1 s, 6 months later. CXCR3 chemokine concentrations provide prognostic information and this may have important implications for the development of novel treatment strategies to modify outcomes after CARV infection. © 2011 American Society of Transplantation and the American Society of Transplant Surgeons.

  16. Dual-Color Luciferase Complementation for Chemokine Receptor Signaling.

    PubMed

    Luker, Kathryn E; Luker, Gary D

    2016-01-01

    Chemokine receptors may share common ligands, setting up potential competition for ligand binding, and association of activated receptors with downstream signaling molecules such as β-arrestin. Determining the "winner" of competition for shared effector molecules is essential for understanding integrated functions of chemokine receptor signaling in normal physiology, disease, and response to therapy. We describe a dual-color click beetle luciferase complementation assay for cell-based analysis of interactions of two different chemokine receptors, CXCR4 and ACKR3, with the intracellular scaffolding protein β-arrestin 2. This assay provides real-time quantification of receptor activation and signaling in response to chemokine CXCL12. More broadly, this general imaging strategy can be applied to quantify interactions of any set of two proteins that interact with a common binding partner. © 2016 Elsevier Inc. All rights reserved.

  17. CCL19 with CCL21-tail displays enhanced glycosaminoglycan binding with retained chemotactic potency in dendritic cells.

    PubMed

    Jørgensen, Astrid S; Adogamhe, Pontian E; Laufer, Julia M; Legler, Daniel F; Veldkamp, Christopher T; Rosenkilde, Mette M; Hjortø, Gertrud M

    2018-05-16

    CCL19 is more potent than CCL21 in inducing chemotaxis of human dendritic cells (DC). This difference is attributed to 1) a stronger interaction of the basic C-terminal tail of CCL21 with acidic glycosaminoglycans (GAGs) in the environment and 2) an autoinhibitory function of this C-terminal tail. Moreover, different receptor docking modes and tissue expression patterns of CCL19 and CCL21 contribute to fine-tuned control of CCR7 signaling. Here, we investigate the effect of the tail of CCL21 on chemokine binding to GAGs and on CCR7 activation. We show that transfer of CCL21-tail to CCL19 (CCL19 CCL21-tail ) markedly increases binding of CCL19 to human dendritic cell surfaces, without impairing CCL19-induced intracellular calcium release or DC chemotaxis, although it causes reduced CCR7 internalization. The more potent chemotaxis induced by CCL19 and CCL19 CCL21-tail compared to CCL21 is not transferred to CCL21 by replacing its N-terminus with that of CCL19 (CCL21 CCL19-N-term ). Measurements of cAMP production in CHO cells uncover that CCL21-tail transfer (CCL19 CCL21-tail ) negatively affects CCL19 potency, whereas removal of CCL21-tail (CCL21 tailless ) increases signaling compared to full-length CCL21, indicating that the tail negatively affects signaling via cAMP. Similar to chemokine-driven calcium mobilization and chemotaxis, the potency of CCL21 in cAMP is not improved by transfer of the CCL19 N-terminus to CCL21 (CCL21 CCL19-N-term ). Together these results indicate that ligands containing CCL21 core and C-terminal tail (CCL21 and CCL21 CCL19-N-term ) are most restricted in their cAMP signaling; a phenotype attributed to a stronger GAG binding of CCL21 and defined structural differences between CCL19 and CCL21. ©2018 Society for Leukocyte Biology.

  18. Systematic Analysis of Cell-Type Differences in the Epithelial Secretome Reveals Insights into the Pathogenesis of RSV-Induced Lower Respiratory Tract Infections

    PubMed Central

    Zhao, Yingxin; Jamaluddin, Mohammad; Zhang, Yueqing; Sun, Hong; Ivanciuc, Teodora; Garofalo, Roberto P.; Brasier, Allan R.

    2017-01-01

    Lower respiratory tract infections (LRTIs) from Respiratory Syncytial Virus (RSV) are due, in part, to secreted signals from lower airway cells that modify immune response and trigger airway remodeling. To understand this process, we applied an unbiased quantitative proteomics analysis of the RSV-induced epithelial secretory response in cells representative of the trachea (hBECs) vs small airway bronchiolar cells (hSAECs). A workflow was established using telomerase- immortalized human epithelial cells that revealed highly reproducible cell type-specific differences in both secreted proteins and nanoparticles (exosomes). Approximately one-third of secretome proteins are exosomal, with the remainder from lysosomal and vacuolar compartments. We applied this workflow to three independently derived primary human cultures from trachea (phBECs) vs bronchioles (phSAECs). 577 differentially expressed proteins from control supernatants and 966 differentially expressed proteins from RSV-infected cell supernatants were identified at a 1% false discovery rate (FDR). Fifteen proteins unique to RSV-infected phBECs were regulated by epithelial-specific ets homology factor (EHF). 106 proteins unique to RSV-infected hSAECs were regulated by the transcription factor NFκB. In this latter group, we validated the differential expression of Chemokine (C-C Motif) Ligand 20 (CCL20)/macrophage-inducible protein (MIP)3α, thymic stromal lymphopoietin (TSLP) and chemokine (CC) ligand 3-like 1(CCL3-L1) because of their roles in Th2 polarization. CCL20/MIP3α was the most active mucin-inducing factor in the RSV-infected hSAEC secretome, and was differentially expressed in smaller airways in a mouse model of RSV infection. These studies provide insights into the complexity of innate responses, and regional differences in epithelial secretome participating in RSV LRTI-induced airway remodeling. PMID:28258195

  19. Prostaglandin F2α–F-Prostanoid Receptor Signalling Promotes Neutrophil Chemotaxis via Chemokine (CXC motif) Ligand-1 in Endometrial Adenocarcinoma

    PubMed Central

    Wallace, Alison E; Sales, Kurt J; Catalano, Roberto D; Anderson, Richard A; Williams, Alistair RW; Wilson, Martin R; Schwarze, Jurgen; Wang, Hongwei; Rossi, Adriano G; Jabbour, Henry N

    2009-01-01

    The prostaglandin F2α (PGF2α) receptor (FP) is elevated in endometrial adenocarcinoma. This study found that PGF2α signalling via FP regulates expression of chemokine (C-X-C motif) ligand 1 (CXCL1) in endometrial adenocarcinoma cells. Expression of CXCL1 and its receptor, CXCR2, are elevated in cancer tissue as compared to normal endometrium and localised to glandular epithelium, endothelium and stroma. Treatment of Ishikawa cells stably transfected with the FP receptor (FPS cells) with 100nM PGF2α increased CXCL1 promoter activity, mRNA and protein expression, and these effects were abolished by co-treatment of cells with FP antagonist or chemical inhibitors of Gq, EGFR and ERK. Similarly, CXCL1 was elevated in response to 100 nM PGF2α in endometrial adenocarcinoma explant tissue. CXCL1 is a potent neutrophil chemoattractant. The expression of CXCR2 colocalised to neutrophils in endometrial adenocarcinoma and increased neutrophils were present in endometrial adenocarcinoma compared with normal endometrium. Conditioned media from PGF2α-treated FPS cells stimulated neutrophil chemotaxis which could be abolished by CXCL1 protein immunoneutralisation of the conditioned media or antagonism of CXCR2. Finally, xenograft tumours in nude mice arising from inoculation with FPS cells showed increased neutrophil infiltration compared to tumours arising from wild-type cells or following treatment of mice bearing FPS tumours with CXCL1-neutralising antibody. In conclusion, our results demonstrate a novel PGF2α-FP pathway that may regulate the inflammatory microenvironment in endometrial adenocarcinoma via neutrophil chemotaxis. PMID:19549892

  20. The CC chemokine ligand (CCL) 1, upregulated by the viral transactivator Tax, can be downregulated by minocycline: possible implications for long-term treatment of HTLV-1-associated myelopathy/tropical spastic paraparesis.

    PubMed

    Saito, Mineki; Sejima, Hiroe; Naito, Tadasuke; Ushirogawa, Hiroshi; Matsuzaki, Toshio; Matsuura, Eiji; Tanaka, Yuetsu; Nakamura, Tatsufumi; Takashima, Hiroshi

    2017-12-04

    Chemokine (C-C motif) ligand 1 (CCL1) is produced by activated monocytes/ macrophages and T-lymphocytes, and acts as a potent attractant for Th2 cells and a subset of T-regulatory (Treg) cells. Previous reports have indicated that CCL1 is overexpressed in adult T-cell leukemia cells, mediating an autocrine anti-apoptotic loop. Because CCL1 is also known as a potent chemoattractant that plays a major role in inflammatory processes, we investigated the role of CCL1 in the pathogenesis of human T-cell leukemia virus type 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis (HAM/TSP). The results showed that: (1) CCL1 was preferentially expressed in HAM/TSP-derived HTLV-1-infected T-cell lines, (2) CCL1 expression was induced along with Tax expression in the Tax-inducible T-cell line JPX9, (3) transient Tax expression in an HTLV-1-negative T-cell line activated the CCL1 gene promoter, (4) plasma levels of CCL1 were significantly higher in patients with HAM/TSP than in HTLV-1-seronegative patients with multiple sclerosis and HTLV-1-infected asymptomatic healthy carriers, and (5) minocycline inhibited the production of CCL1 in HTLV-1-infected T-cell lines. The present results suggest that elevated CCL1 levels may be associated with the pathogenesis of HAM/TSP. Although further studies are required to determine the in vivo significance, minocycline may be considered as a potential candidate for the long-term treatment of HAM/TSP via its anti-inflammatory effects, which includes the inhibition of CCL1 expression.

  1. CXCR2 and CXCL4 regulate survival and self-renewal of hematopoietic stem/progenitor cells.

    PubMed

    Sinclair, Amy; Park, Laura; Shah, Mansi; Drotar, Mark; Calaminus, Simon; Hopcroft, Lisa E M; Kinstrie, Ross; Guitart, Amelie V; Dunn, Karen; Abraham, Sheela A; Sansom, Owen; Michie, Alison M; Machesky, Laura; Kranc, Kamil R; Graham, Gerard J; Pellicano, Francesca; Holyoake, Tessa L

    2016-07-21

    The regulation of hematopoietic stem cell (HSC) survival and self-renewal within the bone marrow (BM) niche is not well understood. We therefore investigated global transcriptomic profiling of normal human HSC/hematopoietic progenitor cells [HPCs], revealing that several chemokine ligands (CXCL1-4, CXCL6, CXCL10, CXCL11, and CXCL13) were upregulated in human quiescent CD34(+)Hoescht(-)Pyronin Y(-) and primitive CD34(+)38(-), as compared with proliferating CD34(+)Hoechst(+)Pyronin Y(+) and CD34(+)38(+) stem/progenitor cells. This suggested that chemokines might play an important role in the homeostasis of HSCs. In human CD34(+) hematopoietic cells, knockdown of CXCL4 or pharmacologic inhibition of the chemokine receptor CXCR2, significantly decreased cell viability and colony forming cell (CFC) potential. Studies on Cxcr2(-/-) mice demonstrated enhanced BM and spleen cellularity, with significantly increased numbers of HSCs, hematopoietic progenitor cell-1 (HPC-1), HPC-2, and Lin(-)Sca-1(+)c-Kit(+) subpopulations. Cxcr2(-/-) stem/progenitor cells showed reduced self-renewal capacity as measured in serial transplantation assays. Parallel studies on Cxcl4 demonstrated reduced numbers of CFC in primary and secondary assays following knockdown in murine c-Kit(+) cells, and Cxcl4(-/-) mice showed a decrease in HSC and reduced self-renewal capacity after secondary transplantation. These data demonstrate that the CXCR2 network and CXCL4 play a role in the maintenance of normal HSC/HPC cell fates, including survival and self-renewal. © 2016 by The American Society of Hematology.

  2. CXCR2 and CXCL4 regulate survival and self-renewal of hematopoietic stem/progenitor cells

    PubMed Central

    Sinclair, Amy; Park, Laura; Shah, Mansi; Drotar, Mark; Calaminus, Simon; Hopcroft, Lisa E. M.; Kinstrie, Ross; Guitart, Amelie V.; Dunn, Karen; Abraham, Sheela A.; Sansom, Owen; Michie, Alison M.; Machesky, Laura; Kranc, Kamil R.; Graham, Gerard J.; Pellicano, Francesca

    2016-01-01

    The regulation of hematopoietic stem cell (HSC) survival and self-renewal within the bone marrow (BM) niche is not well understood. We therefore investigated global transcriptomic profiling of normal human HSC/hematopoietic progenitor cells [HPCs], revealing that several chemokine ligands (CXCL1-4, CXCL6, CXCL10, CXCL11, and CXCL13) were upregulated in human quiescent CD34+Hoescht−Pyronin Y− and primitive CD34+38−, as compared with proliferating CD34+Hoechst+Pyronin Y+ and CD34+38+ stem/progenitor cells. This suggested that chemokines might play an important role in the homeostasis of HSCs. In human CD34+ hematopoietic cells, knockdown of CXCL4 or pharmacologic inhibition of the chemokine receptor CXCR2, significantly decreased cell viability and colony forming cell (CFC) potential. Studies on Cxcr2−/− mice demonstrated enhanced BM and spleen cellularity, with significantly increased numbers of HSCs, hematopoietic progenitor cell-1 (HPC-1), HPC-2, and Lin−Sca-1+c-Kit+ subpopulations. Cxcr2−/− stem/progenitor cells showed reduced self-renewal capacity as measured in serial transplantation assays. Parallel studies on Cxcl4 demonstrated reduced numbers of CFC in primary and secondary assays following knockdown in murine c-Kit+ cells, and Cxcl4−/− mice showed a decrease in HSC and reduced self-renewal capacity after secondary transplantation. These data demonstrate that the CXCR2 network and CXCL4 play a role in the maintenance of normal HSC/HPC cell fates, including survival and self-renewal. PMID:27222476

  3. Galectin-3 Mediates Tumor Cell-Stroma Interactions by Activating Pancreatic Stellate Cells to Produce Cytokines via Integrin Signaling.

    PubMed

    Zhao, Wei; Ajani, Jaffer A; Sushovan, Guha; Ochi, Nobuo; Hwang, Rosa; Hafley, Margarete; Johnson, Randy L; Bresalier, Robert S; Logsdon, Craig D; Zhang, Zhiqian; Song, Shumei

    2018-04-01

    Pancreatic ductal adenocarcinoma (PDAC) is characterized by activated pancreatic stellate cells (PSCs), abundance of extracellular matrix (ECM), and production of cytokines and chemokines. Galectin 3 (GAL3), a β-galactoside-specific lectin, contributes to PDAC development but its effects on the stroma and cytokine production are unclear. The effect of recombinant human GAL3 (rGAL3) on activation of PSCs, production of cytokines, and ECM proteins was determined by proliferation, invasion, cytokine array, and quantitative polymerase chain reaction. We assessed co-cultures of PDAC cells with GAL3 genetic alterations with PSCs. Production of interleukin 8 (IL8) and activities of nuclear factor (NF)-κB were determined by enzyme-linked immunosorbent assay and luciferase reporter analyses. We studied the effects of inhibitors of NF-κB and integrin-linked kinase (ILK) on pathways activated by rGAL3. In analyses of the Gene Expression Omnibus database and our dataset, we observed higher levels of GAL3, IL8, and other cytokines in PDAC than in nontumor tissues. Production of IL8, granulocyte-macrophage colony-stimulating factor, chemokine ligand 1, and C-C motif chemokine ligand 2 increased in PSCs exposed to rGAL3 compared with controls. Culture of PSCs with PDAC cells that express different levels of GAL3 resulted in proliferation and invasion of PSCs that increased with level of GAL3. GAL3 stimulated transcription of IL8 through integrin subunit beta 1 (ITGB1) on PSCs, which activates NF-κB through ILK. Inhibitors of ILK or NF-κB or a neutralizing antibody against ITGB1 blocked transcription and production of IL8 from PSCs induced by rGAL3. The GAL3 inhibitor significantly reduced growth and metastases of orthotopic tumors that formed from PDAC and PSC cells co-implanted in mice. GAL3 activates PSC cells to produce inflammatory cytokines via ITGB1signaling to ILK and activation of NF-κB. Inhibition of this pathway reduced growth and metastases of pancreatic orthotopic tumors in mice. Copyright © 2018 AGA Institute. Published by Elsevier Inc. All rights reserved.

  4. Increasing serum levels of vitamin A, D and E are associated with alterations of different inflammation markers in patients with multiple sclerosis.

    PubMed

    Røsjø, Egil; Myhr, Kjell-Morten; Løken-Amsrud, Kristin Ingeleiv; Bakke, Søren Jacob; Beiske, Antonie G; Bjerve, Kristian S; Hovdal, Harald; Lilleås, Finn; Midgard, Rune; Pedersen, Tom; Benth, Jūratė Saltytė; Torkildsen, Øivind; Wergeland, Stig; Michelsen, Annika E; Aukrust, Pål; Ueland, Thor; Holmøy, Trygve

    2014-06-15

    To explore the relationships between vitamin A, D and E and inflammation in relapsing remitting multiple sclerosis, we assessed their associations with 11 inflammation markers in 9 serial serum samples from 85 patients, before and during interferon-β1a treatment. A negative association was found between vitamin A and pentraxin 3 independent of interferon-β1a use, whereas positive associations between vitamin D and interleukin-1 receptor antagonist and secreted frizzled-related protein 3 were seen before, and between vitamin E and chemokine (C-X-C motif) ligand 16 during interferon-β1a treatment. These findings suggest associations with diverse inflammatory pathways, which may be differentially influenced by interferon-β1a treatment. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Identification of the pharmacophore of the CC chemokine-binding proteins Evasin-1 and -4 using phage display.

    PubMed

    Bonvin, Pauline; Dunn, Steven M; Rousseau, François; Dyer, Douglas P; Shaw, Jeffrey; Power, Christine A; Handel, Tracy M; Proudfoot, Amanda E I

    2014-11-14

    To elucidate the ligand-binding surface of the CC chemokine-binding proteins Evasin-1 and Evasin-4, produced by the tick Rhipicephalus sanguineus, we sought to identify the key determinants responsible for their different chemokine selectivities by expressing Evasin mutants using phage display. We first designed alanine mutants based on the Evasin-1·CCL3 complex structure and an in silico model of Evasin-4 bound to CCL3. The mutants were displayed on M13 phage particles, and binding to chemokine was assessed by ELISA. Selected variants were then produced as purified proteins and characterized by surface plasmon resonance analysis and inhibition of chemotaxis. The method was validated by confirming the importance of Phe-14 and Trp-89 to the inhibitory properties of Evasin-1 and led to the identification of a third crucial residue, Asn-88. Two amino acids, Glu-16 and Tyr-19, were identified as key residues for binding and inhibition of Evasin-4. In a parallel approach, we identified one clone (Y28Q/N60D) that showed a clear reduction in binding to CCL3, CCL5, and CCL8. It therefore appears that Evasin-1 and -4 use different pharmacophores to bind CC chemokines, with the principal binding occurring through the C terminus of Evasin-1, but through the N-terminal region of Evasin-4. However, both proteins appear to target chemokine N termini, presumably because these domains are key to receptor signaling. The results also suggest that phage display may offer a useful approach for rapid investigation of the pharmacophores of small inhibitory binding proteins. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Emerging role of chemokine CC motif ligand 4 related mechanisms in diabetes mellitus and cardiovascular disease: friends or foes?

    PubMed

    Chang, Ting-Ting; Chen, Jaw-Wen

    2016-08-24

    Chemokines are critical components in pathology. The roles of chemokine CC motif ligand 4 (CCL4) and its receptor are associated with diabetes mellitus (DM) and atherosclerosis cardiovascular diseases. However, due to the complexity of these diseases, the specific effects of CCL4 remain unclear, although recent reports have suggested that multiple pathways are related to CCL4. In this review, we provide an overview of the role and potential mechanisms of CCL4 and one of its major receptors, fifth CC chemokine receptor (CCR5), in DM and cardiovascular diseases. CCL4-related mechanisms, including CCL4 and CCR5, might provide potential therapeutic targets in DM and/or atherosclerosis cardiovascular diseases.

  7. Structural basis of ligand interaction with atypical chemokine receptor 3

    NASA Astrophysics Data System (ADS)

    Gustavsson, Martin; Wang, Liwen; van Gils, Noortje; Stephens, Bryan S.; Zhang, Penglie; Schall, Thomas J.; Yang, Sichun; Abagyan, Ruben; Chance, Mark R.; Kufareva, Irina; Handel, Tracy M.

    2017-01-01

    Chemokines drive cell migration through their interactions with seven-transmembrane (7TM) chemokine receptors on cell surfaces. The atypical chemokine receptor 3 (ACKR3) binds chemokines CXCL11 and CXCL12 and signals exclusively through β-arrestin-mediated pathways, without activating canonical G-protein signalling. This receptor is upregulated in numerous cancers making it a potential drug target. Here we collected over 100 distinct structural probes from radiolytic footprinting, disulfide trapping, and mutagenesis to map the structures of ACKR3:CXCL12 and ACKR3:small-molecule complexes, including dynamic regions that proved unresolvable by X-ray crystallography in homologous receptors. The data are integrated with molecular modelling to produce complete and cohesive experimentally driven models that confirm and expand on the existing knowledge of the architecture of receptor:chemokine and receptor:small-molecule complexes. Additionally, we detected and characterized ligand-induced conformational changes in the transmembrane and intracellular regions of ACKR3 that elucidate fundamental structural elements of agonism in this atypical receptor.

  8. Structural basis of ligand interaction with atypical chemokine receptor 3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gustavsson, Martin; Wang, Liwen; van Gils, Noortje

    2017-01-18

    Chemokines drive cell migration through their interactions with seven-transmembrane (7TM) chemokine receptors on cell surfaces. The atypical chemokine receptor 3 (ACKR3) binds chemokines CXCL11 and CXCL12 and signals exclusively through β-arrestin-mediated pathways, without activating canonical G-protein signalling. This receptor is upregulated in numerous cancers making it a potential drug target. Here we collected over 100 distinct structural probes from radiolytic footprinting, disulfide trapping, and mutagenesis to map the structures of ACKR3:CXCL12 and ACKR3:small-molecule complexes, including dynamic regions that proved unresolvable by X-ray crystallography in homologous receptors. The data are integrated with molecular modelling to produce complete and cohesive experimentally drivenmore » models that confirm and expand on the existing knowledge of the architecture of receptor:chemokine and receptor:small-molecule complexes. Additionally, we detected and characterized ligand-induced conformational changes in the transmembrane and intracellular regions of ACKR3 that elucidate fundamental structural elements of agonism in this atypical receptor.« less

  9. Structure of CC Chemokine Receptor 5 with a Potent Chemokine Antagonist Reveals Mechanisms of Chemokine Recognition and Molecular Mimicry by HIV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zheng, Yi; Han, Gye Won; Abagyan, Ruben

    CCR5 is the primary chemokine receptor utilized by HIV to infect leukocytes, whereas CCR5 ligands inhibit infection by blocking CCR5 engagement with HIV gp120. To guide the design of improved therapeutics, we solved the structure of CCR5 in complex with chemokine antagonist [5P7]CCL5. Several structural features appeared to contribute to the anti-HIV potency of [5P7]CCL5, including the distinct chemokine orientation relative to the receptor, the near-complete occupancy of the receptor binding pocket, the dense network of intermolecular hydrogen bonds, and the similarity of binding determinants with the FDA-approved HIV inhibitor Maraviroc. Molecular modeling indicated that HIV gp120 mimicked the chemokinemore » interaction with CCR5, providing an explanation for the ability of CCR5 to recognize diverse ligands and gp120 variants. Our findings reveal that structural plasticity facilitates receptor-chemokine specificity and enables exploitation by HIV, and provide insight into the design of small molecule and protein inhibitors for HIV and other CCR5-mediated diseases.« less

  10. Molecular Basis of Chemokine CXCL5-Glycosaminoglycan Interactions*

    PubMed Central

    2016-01-01

    Chemokines, a large family of highly versatile small soluble proteins, play crucial roles in defining innate and adaptive immune responses by regulating the trafficking of leukocytes, and also play a key role in various aspects of human physiology. Chemokines share the characteristic feature of reversibly existing as monomers and dimers, and their functional response is intimately coupled to interaction with glycosaminoglycans (GAGs). Currently, nothing is known regarding the structural basis or molecular mechanisms underlying CXCL5-GAG interactions. To address this missing knowledge, we characterized the interaction of a panel of heparin oligosaccharides to CXCL5 using solution NMR, isothermal titration calorimetry, and molecular dynamics simulations. NMR studies indicated that the dimer is the high-affinity GAG binding ligand and that lysine residues from the N-loop, 40s turn, β3 strand, and C-terminal helix mediate binding. Isothermal titration calorimetry indicated a stoichiometry of two oligosaccharides per CXCL5 dimer. NMR-based structural models reveal that these residues form a contiguous surface within a monomer and, interestingly, that the GAG-binding domain overlaps with the receptor-binding domain, indicating that a GAG-bound chemokine cannot activate the receptor. Molecular dynamics simulations indicate that the roles of the individual lysines are not equivalent and that helical lysines play a more prominent role in determining binding geometry and affinity. Further, binding interactions and GAG geometry in CXCL5 are novel and distinctly different compared with the related chemokines CXCL1 and CXCL8. We conclude that a finely tuned balance between the GAG-bound dimer and free soluble monomer regulates CXCL5-mediated receptor signaling and function. PMID:27471273

  11. An in vitro test system for compounds that modulate human inflammatory macrophage polarization.

    PubMed

    Shiratori, Hiromi; Feinweber, Carmen; Luckhardt, Sonja; Wallner, Nadja; Geisslinger, Gerd; Weigert, Andreas; Parnham, Michael J

    2018-06-16

    Macrophages undergo activation by pathophysiological stimuli to pro-inflammatory and bactericidal, or wound-healing and anti-inflammatory phenotypes, termed M1 or M2, respectively. Dysregulation of the M1-M2 balance is often associated with inflammatory diseases. Therefore, mechanisms of macrophage polarization may reveal new drug targets. We profiled six compounds with claimed modulatory effects on macrophage polarization using peripheral blood monocyte-derived macrophages. Based on the distinct mRNA or protein expression in macrophages stimulated either with M1 [lipopolysaccharide (LPS) + interferon-γ, IFNγ] or M2 interleukin-4 (IL-4) stimuli, we selected a combination of M1 (IL1β, tumor necrosis factor-α,TNFα, CC chemokine receptor 7, CCR7 and CD80) and M2 (chemokine (C-C motif) ligand 22, CCL22, CD200R and mannose receptor C type 1, MRC1) markers to monitor drug effects on "M1 polarization" or cells "pre-polarized to M1". Azithromycin (25-50μM), tofacitinib (2.5-5μM), hydroxychloroquine (40µg/ml) and pioglitazone (15-60μM) exhibit an anti-inflammatory profile because they downregulated M1 markers and upregulated some M2 markers when given both before and after M1 polarization. Lovastatin given before M1 polarization downregulated M1 marker genes but enhanced the M1 phenotype in macrophages pre-polarized with LPS and IFNγ. Methotrexate (1.25-5μM) did not modulate macrophage polarization. We have, thus, established a test system suitable to identify novel compounds or repurposed drugs that modulate inflammatory macrophage plasticity. Compounds with potential to reduce expression of molecules involved in inflammatory T cell activation (IL-1β, TNFα, CD80), while enhancing production of a major chemokine involved in recruitment of Tregs (CCL22) may be of interest for treating chronic inflammatory diseases. Copyright © 2018. Published by Elsevier B.V.

  12. Neuronal apoptotic signaling pathways probed and intervened by synthetically and modularly modified (SMM) chemokines.

    PubMed

    Choi, Won-Tak; Kaul, Marcus; Kumar, Santosh; Wang, Jun; Kumar, I M Krishna; Dong, Chang-Zhi; An, Jing; Lipton, Stuart A; Huang, Ziwei

    2007-03-09

    As the main coreceptors for human immunodeficiency virus type 1 (HIV-1) entry, CXCR4 and CCR5 play important roles in HIV-associated dementia (HAD). HIV-1 glycoprotein gp120 contributes to HAD by causing neuronal damage and death, either directly by triggering apoptotic pathways or indirectly by stimulating glial cells to release neurotoxins. Here, to understand the mechanism of CXCR4 or CCR5 signaling in neuronal apoptosis associated with HAD, we have applied synthetically and modularly modified (SMM)-chemokine analogs derived from natural stromal cell-derived factor-1alpha or viral macrophage inflammatory protein-II as chemical probes of the mechanism(s) whereby these SMM-chemokines prevent or promote neuronal apoptosis. We show that inherently neurotoxic natural ligands of CXCR4, such as stromal cell-derived factor-1alpha or viral macrophage inflammatory protein-II, can be modified to protect neurons from apoptosis induced by CXCR4-preferring gp120(IIIB), and that the inhibition of CCR5 by antagonist SMM-chemokines, unlike neuroprotective CCR5 natural ligands, leads to neurotoxicity by activating a p38 mitogen-activated protein kinase (MAPK)-dependent pathway. Furthermore, we discover distinct signaling pathways activated by different chemokine ligands that are either natural agonists or synthetic antagonists, thus demonstrating a chemical biology strategy of using chemically engineered inhibitors of chemokine receptors to study the signaling mechanism of neuronal apoptosis and survival.

  13. Adipochemokines induced by ultraviolet irradiation contribute to impaired fat metabolism in subcutaneous fat cells.

    PubMed

    Kim, E J; Kim, Y K; Kim, S; Kim, J E; Tian, Y D; Doh, E J; Lee, D H; Chung, J H

    2018-02-01

    Adipose tissue is now appreciated as the pivotal regulator of metabolic and endocrine functions. Subcutaneous (SC) fat, in contrast to visceral fat, may protect against metabolic syndrome and systemic inflammation. We demonstrated that chronic as well as acute ultraviolet (UV) irradiation to the skin induces loss of underlying SC fat. UV-irradiated SC fat may produce chemokines or cytokines that modulate lipid homeostasis and secretion of adipokines. To elucidate UV-induced specific adipochemokines implicated in UV-induced modulation of SC fat. Primary cultured adipocytes were treated with conditioned medium from UV- or sham-irradiated skin cells. Young and older healthy participants provided SC fat from sun-exposed and sun-protected skin. Sun-protected skin from other participants was irradiated with UV. Differentially expressed adipochemokines were screened by cytokine array, and confirmed in vitro and in vivo. The functions of select adipochemokines involved in lipid metabolism were examined via short interfering RNA-mediated knockdown of cognate receptors. Specific adipochemokines, including C-X-C motif chemokine (CXCL) family members such as CXCL5/ENA-78, and C-C motif chemokine (CCL) family members such as CCL20/MIP-3α and CCL5/RANTES, were greatly induced in SC fat by UV exposure. They could impair triglyceride synthesis via downregulation of lipogenic enzymes and sterol regulatory element-binding protein-1 through their respective cognate receptors, CXC chemokine receptor type (CXC-R)2, C-C chemokine receptor type (CCR)-6, and CCR-5. In addition, UV irradiation induced infiltration of adipose tissue macrophages responsible for the secretion of several chemokines into SC fat. These UV-induced adipochemokines may be implicated in the reduction of lipogenesis in SC fat, leading to impairment of fat homeostasis and associated comorbidities such as obesity. © 2017 British Association of Dermatologists.

  14. Effects of endurance exercise training on inflammatory circulating progenitor cell content in lean and obese adults.

    PubMed

    Niemiro, Grace M; Allen, Jacob M; Mailing, Lucy J; Khan, Naiman A; Holscher, Hannah D; Woods, Jeffrey A; De Lisio, Michael

    2018-06-19

    Chronic inflammation underlies many of the health decrements associated with obesity. Circulating progenitor cells can sense and respond to inflammatory stimuli, increasing the local inflammatory response within tissues. Here we show that 6 weeks of endurance exercise training significantly decreases inflammatory circulating progenitor cells in obese adults. These findings provide novel cellular mechanisms for the beneficial effects of exercise in obese adults. Circulating progenitor cells (CPCs) and subpopulations are normally found in the bone marrow, but can migrate to peripheral tissues to participate in local inflammation and/or remodelling. The purpose of this study was to compare the CPC response, particularly the inflammatory-primed haematopoietic stem and progenitor (HSPC) subpopulation, to a 6 week endurance exercise training (EET) intervention between lean and obese adults. Seventeen healthy weight (age: 23.9 ± 5.4 years, body mass index (BMI): 22.0 ± 2.6 kg m -2 ) and 10 obese (age: 29.0 ± 8.0 years, BMI: 33.1 ± 6.0 kg m -2 ) previously sedentary adults participated in an EET. Blood was collected before and after EET for quantification of CPCs and subpopulations via flow cytometry, colony forming unit assays and plasma concentrations of C-X-C motif chemokine 12 (CXCL12), granulocyte-colony stimulating factor (G-CSF), and chemokine (C-C motif) ligand 2 (CCL2). Exercise training reduced the number of circulating HSPCs and adipose tissue-derived mesenchymal stem cells (AT-MSCs). EET increased the colony forming potential of granulocytes and macrophages irrespective of BMI. EET reduced the number of HSPCs expressing the chemokine receptor CCR2 and the pro-inflammatory marker TLR4. EET-induced changes in adipose tissue-derived MSCs and bone marrow-derived MSCs were negatively related to changes in absolute fitness. Our results indicate that EET, regardless of BMI status, decreases CPCs and subpopulations, particularly those primed for contribution to tissue inflammation. © 2018 The Authors. The Journal of Physiology © 2018 The Physiological Society.

  15. New paradigms in chemokine receptor signal transduction: Moving beyond the two-site model.

    PubMed

    Kleist, Andrew B; Getschman, Anthony E; Ziarek, Joshua J; Nevins, Amanda M; Gauthier, Pierre-Arnaud; Chevigné, Andy; Szpakowska, Martyna; Volkman, Brian F

    2016-08-15

    Chemokine receptor (CKR) signaling forms the basis of essential immune cellular functions, and dysregulated CKR signaling underpins numerous disease processes of the immune system and beyond. CKRs, which belong to the seven transmembrane domain receptor (7TMR) superfamily, initiate signaling upon binding of endogenous, secreted chemokine ligands. Chemokine-CKR interactions are traditionally described by a two-step/two-site mechanism, in which the CKR N-terminus recognizes the chemokine globular core (i.e. site 1 interaction), followed by activation when the unstructured chemokine N-terminus is inserted into the receptor TM bundle (i.e. site 2 interaction). Several recent studies challenge the structural independence of sites 1 and 2 by demonstrating physical and allosteric links between these supposedly separate sites. Others contest the functional independence of these sites, identifying nuanced roles for site 1 and other interactions in CKR activation. These developments emerge within a rapidly changing landscape in which CKR signaling is influenced by receptor PTMs, chemokine and CKR dimerization, and endogenous non-chemokine ligands. Simultaneous advances in the structural and functional characterization of 7TMR biased signaling have altered how we understand promiscuous chemokine-CKR interactions. In this review, we explore new paradigms in CKR signal transduction by considering studies that depict a more intricate architecture governing the consequences of chemokine-CKR interactions. Published by Elsevier Inc.

  16. Proteases in agricultural dust induce lung inflammation through PAR-1 and PAR-2 activation.

    PubMed

    Romberger, Debra J; Heires, Art J; Nordgren, Tara M; Souder, Chelsea P; West, William; Liu, Xiang-de; Poole, Jill A; Toews, Myron L; Wyatt, Todd A

    2015-08-15

    Workers exposed to aerosolized dust present in concentrated animal feeding operations (CAFOs) are susceptible to inflammatory lung diseases, such as chronic obstructive pulmonary disease. Extracts of dust collected from hog CAFOs [hog dust extract (HDE)] are potent stimulators of lung inflammatory responses in several model systems. The observation that HDE contains active proteases prompted the present study, which evaluated the role of CAFO dust proteases in lung inflammatory processes and tested whether protease-activated receptors (PARs) are involved in the signaling pathway for these events. We hypothesized that the damaging proinflammatory effect of HDE is due, in part, to the proteolytic activation of PARs, and inhibiting the proteases in HDE or disrupting PAR activation would attenuate HDE-mediated inflammatory indexes in bronchial epithelial cells (BECs), in mouse lung slices in vitro, and in a murine in vivo exposure model. Human BECs and mouse lung slice cultures stimulated with 5% HDE released significantly more of each of the cytokines measured (IL-6, IL-8, TNF-α, keratinocyte-derived chemokine/CXC chemokine ligand 1, and macrophage inflammatory protein-2/CXC chemokine ligand 2) than controls, and these effects were markedly diminished by protease inhibition. Inhibition of PARs also blunted the HDE-induced cytokine release from BECs. In addition, protease depletion inhibited HDE-induced BEC intracellular PKCα and PKCε activation. C57BL/6J mice administered 12.5% HDE intranasally, either once or daily for 3 wk, exhibited increased total cellular and neutrophil influx, bronchial alveolar fluid inflammatory cytokines, lung histopathology, and inflammatory scores compared with mice receiving protease-depleted HDE. These data suggest that proteases in dust from CAFOs are important mediators of lung inflammation, and these proteases and their receptors may provide novel targets for therapeutic intervention in CAFO dust-induced airways disease.

  17. Chemokine Receptor CXCR4 Expression in Patients With Melanoma and Colorectal Cancer Liver Metastases and the Association With Disease Outcome

    PubMed Central

    Kim, Joseph; Mori, Takuji; Chen, Steven L.; Amersi, Farin F.; Martinez, Steve R.; Kuo, Christine; Turner, Roderick R.; Ye, Xing; Bilchik, Anton J.; Morton, Donald L.; Hoon, Dave S. B.

    2006-01-01

    Objective: To determine the role of chemokine receptor (CR) expression in patients with melanoma and colorectal cancer (CRC) liver metastases. Summary Background Data: Murine and in vitro models have identified CR as potential factors in organ-specific metastasis of multiple cancers. Chemokines via their respective receptors have been shown to promote cell migration to distant organs. Methods: Patients who underwent hepatic surgery for melanoma or CRC liver metastases were assessed. Screening cDNA microarrays of melanoma/CRC cell lines and tumor specimens were analyzed to identify CR. Microarray data were validated by quantitative real-time RT-PCR (qRT) in paraffin-embedded liver metastases. Migration assays and immunohistochemistry were performed to verify CR function and confirm CR expression, respectively. Results: Microarray analysis identified CXCR4 as the most common CR expressed by both cancers. qRT demonstrated CXCR4 expression in 24 of 27 (89%) melanoma and 28 of 29 (97%) CRC liver metastases. In vitro treatment of melanoma or CRC cells with CXCL12, the ligand for CXCR4, significantly increased cell migration (P < 0.001). Low versus high CXCR4 expression in CRC liver metastases correlated with a significant difference in overall survival (median 27 months vs. 10 months, respectively; P = 0.036). In melanoma, low versus high CXCR4 expression in liver metastases demonstrated no difference in overall survival (median 11 months vs. 8 months, respectively; P = not significant). Conclusions: CXCR4 is expressed and functional on melanoma and CRC cells. The ligand for CXCR4 is highly expressed in liver and may specifically attract melanoma and CRC CXCR4 (+) cells. Quantitative analysis of CXCR4 gene expression in patients with liver metastases has prognostic significance for disease outcome. PMID:16794396

  18. Small Molecule-Induced Complement Factor D (Adipsin) Promotes Lipid Accumulation and Adipocyte Differentiation

    PubMed Central

    Jang, Byung-Hyun; Chang, Seo-Hyuk; Yun, Ui Jeong; Park, Ki-Moon; Waki, Hironori; Li, Dean Y.; Tontonoz, Peter; Park, Kye Won

    2016-01-01

    Adipocytes are differentiated by various transcriptional cascades integrated on the master regulator, Pparγ. To discover new genes involved in adipocyte differentiation, preadipocytes were treated with three newly identified pro-adipogenic small molecules and GW7845 (a Pparγ agonist) for 24 hours and transcriptional profiling was analyzed. Four genes, Peroxisome proliferator-activated receptor γ (Pparγ), human complement factor D homolog (Cfd), Chemokine (C-C motif) ligand 9 (Ccl9), and GIPC PDZ Domain Containing Family Member 2 (Gipc2) were induced by at least two different small molecules but not by GW7845. Cfd and Ccl9 expressions were specific to adipocytes and they were altered in obese mice. Small hairpin RNA (shRNA) mediated knockdown of Cfd in preadipocytes inhibited lipid accumulation and expression of adipocyte markers during adipocyte differentiation. Overexpression of Cfd promoted adipocyte differentiation, increased C3a production, and led to induction of C3a receptor (C3aR) target gene expression. Similarly, treatments with C3a or C3aR agonist (C4494) also promoted adipogenesis. C3aR knockdown suppressed adipogenesis and impaired the pro-adipogenic effects of Cfd, further suggesting the necessity for C3aR signaling in Cfd-mediated pro-adipogenic axis. Together, these data show the action of Cfd in adipogenesis and underscore the application of small molecules to identify genes in adipocytes. PMID:27611793

  19. In vivo production of cytokines and beta (C-C) chemokines in human recurrent herpes simplex lesions--do herpes simplex virus-infected keratinocytes contribute to their production?

    PubMed

    Mikloska, Z; Danis, V A; Adams, S; Lloyd, A R; Adrian, D L; Cunningham, A L

    1998-04-01

    Recurrent human herpes simplex lesions are infiltrated by macrophages and CD4 and CD8 lymphocytes, which secrete cytokines and chemokines. Vesicle fluid was examined by ELISA for the presence of cytokines and beta (C-C) chemokines. On the first day of the lesion, high concentrations of interleukin (IL)-1beta, and IL-6, moderate concentrations of IL-1alpha and IL-10, and low concentrations of IL-12 and beta chemokines were found; levels of macrophage inflammatory protein (MIP)-1beta were significantly higher than levels of MIP-1alpha and RANTES. At day 3, the concentrations of IL-1beta, IL-6, and MIP-1beta were lower, whereas the levels of IL-10, IL-12, and MIP-1alpha remained similar, and the level of tumor necrosis factor-alpha was now detectable. Herpes simplex virus infection of keratinocytes in vitro stimulated production of beta chemokines followed by IL-12 and then IL-10, IL-1alpha, IL-1beta, and IL-6, indicating a potential role for these events in early recruitment, activation, and interferon-gamma production of CD4 cells in herpetic lesions.

  20. [CCL21 promotes the metastasis of human pancreatic cancer Panc-1 cells via epithelial- mesenchymal transition].

    PubMed

    Liu, Qing; Chen, Fangfang; Duan, Tanghai; Zhu, Haitao; Xie, Xiaodong; Wu, Yingying; Zhang, Zhijian; Wang, Dongqing

    2015-01-01

    To investigate the mechanism underlying that chemokine (C-C motif) ligand 21 (CCL21) promotes the metastasis ability of human pancreatic cancer Panc-1 cells. Transwell(TM) was used to access the chemotaxis effect of CCL21 on Panc-1 cells. Real-time quantitative PCR was performed to detect the expression of C-C chemokine receptor type 7 (CCR7) mRNA in the upper and lower chambers. Immunofluorescence staining and Western blotting were employed to examine the expressions of the epithelial-mesenchymal transition (EMT)-related proteins and CD133 of Panc-1 cells in the lower chamber, which were compared with those of the upper chamber as the control. The numbers of the Panc-1 cells induced by 0, 50, 100, 200 ng/mL CCL21 were 13.00 ± 3.00, 78.00 ± 9.00, 161.00 ± 11.00, 281.00 ± 17.00, respectively; with the increase of the concentration of CCL21, there were more cells migrating from the upper to the lower chamber; and the cells in the lower chamber expressed higher level of CCR7 mRNA than the ones staying in the upper chamber. The relative protein expressions of MMP-9, vimentin, E-cadherin and CD133 in the lower chamber were 0.42 ± 0.04, 0.36 ± 0.03, 0.12 ± 0.02, 0.46 ± 0.03, respectively, which were statistically significantly different from those in the upper chamber (0.15 ± 0.02, 0.25 ± 0.02, 0.25 ± 0.03, 0.13 ± 0.02, respectively). CCL21/CCR7 axis maybe play an important role in the metastasis of pancreatic cancer stem cells by EMT and up-regulation of MMP-9.

  1. Altered Expression of CXCL13 and CXCR5 in Intractable Temporal Lobe Epilepsy Patients and Pilocarpine-Induced Epileptic Rats.

    PubMed

    Li, Ruohan; Ma, Limin; Huang, Hao; Ou, Shu; Yuan, Jinxian; Xu, Tao; Yu, Xinyuan; Liu, Xi; Yang, Juan; Chen, Yangmei; Peng, Xi

    2017-02-01

    The mechanisms that underlie the pathogenesis of epilepsy are still unclear. Recent studies have indicated that inflammatory processes occurring in the brain are involved in a common and crucial mechanism in epileptogenesis. C-X-C motif chemokine ligand 13 (CXCL13) and its only receptor, C-X-C motif chemokine receptor 5 (CXCR5), are highly expressed in the central nervous system (CNS) and participate in inflammatory responses. The present study aimed to assess the expression of CXCL13 and CXCR5 in the brain tissues of both patients with intractable epilepsy (IE) and a rat model (lithium-pilocarpine) of temporal lobe epilepsy (TLE) to identify possible roles of the CXCL13-CXCR5 signaling pathway in epileptogenesis. Real-time quantitative polymerase chain reaction (RT-qPCR), immunohistochemical, double-labeled immunofluorescence and Western blot analyses were performed in this study. CXCL13 and CXCR5 mRNA expression and protein levels were found to be significantly up-regulated in the TLE patients and TLE rats. Further, CXCL13 and CXCR5 protein levels were altered during the different epileptic phases after onset of status epilepticus (SE) in the pilocarpine model rats, including the acute phase (6, 24, and 72 h), latent phase (7 and 14 days) and chronic phase (30 and 60 days groups). Moreover, double-labeled immunofluorescence analysis revealed that CXCL13 was mainly expressed in the cytomembranes and cytoplasm of neurons and astrocytes, while CXCR5 was mainly expressed in the cytomembranes and cytoplasm of neurons. Thus, the CXCL13-CXCR5 signaling pathway may play a possible pathogenic role in IE. CXCL13 and CXCR5 may represent potential biomarkers of brain inflammation in epileptic patients.

  2. Sequential treatment of CD34+ cells from patients with primary myelofibrosis with chromatin-modifying agents eliminate JAK2V617F-positive NOD/SCID marrow repopulating cells

    PubMed Central

    Wang, Xiaoli; Zhang, Wei; Tripodi, Joseph; Lu, Min; Xu, Mingjiang; Najfeld, Vesna; Li, Yan

    2010-01-01

    Because primary myelofibrosis (PMF) originates at the level of the pluripotent hematopoietic stem cell (HSC), we examined the effects of various therapeutic agents on the in vitro and in vivo behavior of PMF CD34+ cells. Treatment of PMF CD34+ cells with chromatin-modifying agents (CMAs) but not hydroxyurea, Janus kinase 2 (JAK2) inhibitors, or low doses of interferon-α led to the generation of greater numbers of CD34+ chemokine (C-X-C motif) receptor (CXCR)4+ cells, which were capable of migrating in response to chemokine (C-X-C motif) ligand (CXCL)12 and resulted in a reduction in the proportion of hematopoietic progenitor cells (HPCs) that were JAK2V617F+. Furthermore, sequential treatment of PMF CD34+ cells but not normal CD34+ cells with decitabine (5-aza-2′-deoxycytidine [5azaD]), followed by suberoylanilide hydroxamic acid (SAHA; 5azaD/SAHA), or trichostatin A (5azaD/TSA) resulted in a higher degree of apoptosis. Two to 6 months after the transplantation of CMAs treated JAK2V617F+ PMF CD34+ cells into nonobese diabetic/severe combined immunodeficient (SCID)/IL-2Rγnull mice, the percentage of JAK2V617F/JAK2total in human CD45+ marrow cells was dramatically reduced. These findings suggest that both PMF HPCs, short-term and long-term SCID repopulating cells (SRCs), are JAK2V617F+ and that JAK2V617F+ HPCs and SRCs can be eliminated by sequential treatment with CMAs. Sequential treatment with CMAs, therefore, represents a possible effective means of treating PMF at the level of the malignant SRC. PMID:20858855

  3. Disease-specific dynamic biomarkers selected by integrating inflammatory mediators with clinical informatics in ARDS patients with severe pneumonia.

    PubMed

    Chen, Chengshui; Shi, Lin; Li, Yuping; Wang, Xiangdong; Yang, Shuanying

    2016-06-01

    Acute respiratory distress syndrome (ARDS) is a heterogeneous syndrome that occurs as a result of various risk factors, including either direct or indirect lung injury, and systemic inflammation triggered also by severe pneumonia (SP). SP-ARDS-associated morbidity and mortality remains high also due to the lack of disease-specific biomarkers. The present study aimed at identifying disease-specific biomarkers in SP or SP-ARDS by integrating proteomic profiles of inflammatory mediators with clinical informatics. Plasma was sampled from the healthy as controls or patients with SP infected with bacteria or infection-associated SP-ARDS on the day of admission, day 3, and day 7. About 15 or 52 cytokines showed significant difference between SP and SP-ARDS patients with controls or 13 between SP-ARDS with SP alone and controls, including bone morphogenetic protein-15 (BMP-15), chemokine (C-X-C motif) ligand 16 (CXCL16), chemokine (C-X-C motif) receptor 3 (CXCR3), interleukin-6 (IL-6), protein NOV homolog (NOV/CCN3), glypican 3, insulin-like growth factor binding protein 4 (IGFBP-4), IL-5, IL-5 R alpha, IL-22 BP, leptin, MIP-1d, and orexin B with a significant correlation with Digital Evaluation Score System (DESS) scores. ARDS patients with overexpressed IL-6, CXCL16, or IGFBP-4 had significantly longer hospital stay and higher incidence of secondary infection. We also found higher levels of those mediators were associated with poor survival rates in patients with lung cancer and involved in the process of the epithelial mesenchymal transition of alveolar epithelial cells. Our preliminary study suggested that integration of proteomic profiles with clinical informatics as part of clinical bioinformatics is important to validate and optimize disease-specific and disease-staged biomarkers.

  4. A study of chemokines, chemokine receptors and interleukin-6 in patients with panic disorder, personality disorders and their co-morbidity.

    PubMed

    Ogłodek, Ewa A; Szota, Anna M; Just, Marek J; Szromek, Adam R; Araszkiewicz, Aleksander

    2016-08-01

    Stress may induce inflammatory changes in the immune system and activate pro-inflammatory cytokines and their receptors by activating the hypothalamic-pituitary-adrenal axis. 460 hospitalized patients with panic disorders (PD) and/or personality disorders (P) were studied. The study group comprised subjects with PD, avoidant personality disorder (APD), borderline personality disorder (BPD), obsessive-compulsive personality disorder (OCPD), and concomitant (PD+APD; PD+BPD; PD+OCPD). Each study group consisted of 60 subjects (30 females and 30 males). The control group included 20 females and 20 males without any history of mental disorder. ELISA was used to assess the levels of chemokines: CCL-5/RANTES (regulated on activation, normal T-cell expressed and secreted), CXCL-12/SDF-1 (stromal derived factor), their receptors CXCR-5 (C-C chemokine receptor type-5), CXCR-4 (chemokine C-X-C motif receptor-4), and IL-6. Statistically significant differences in the levels of CCL-5 and CCR-5 were revealed between all study groups. The greatest differences were found between the groups with PD+OCPD and PD+APD. Moreover, concomitance of PD with P significantly increased the level of chemokines and their receptors in all study groups versus the subjects with P alone. The results of the study show differences between the groups. To be specific, inflammatory markers were more elevated in the study groups than the controls. Therefore, chemokines and chemokine receptors may be used as inflammatory markers in patients with PD co-existent with P to indicate disease severity. PD was found to be a factor in maintaining inflammatory activity in the immune system in patients with P. Copyright © 2016 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  5. Maximal Unbiased Benchmarking Data Sets for Human Chemokine Receptors and Comparative Analysis.

    PubMed

    Xia, Jie; Reid, Terry-Elinor; Wu, Song; Zhang, Liangren; Wang, Xiang Simon

    2018-05-29

    Chemokine receptors (CRs) have long been druggable targets for the treatment of inflammatory diseases and HIV-1 infection. As a powerful technique, virtual screening (VS) has been widely applied to identifying small molecule leads for modern drug targets including CRs. For rational selection of a wide variety of VS approaches, ligand enrichment assessment based on a benchmarking data set has become an indispensable practice. However, the lack of versatile benchmarking sets for the whole CRs family that are able to unbiasedly evaluate every single approach including both structure- and ligand-based VS somewhat hinders modern drug discovery efforts. To address this issue, we constructed Maximal Unbiased Benchmarking Data sets for human Chemokine Receptors (MUBD-hCRs) using our recently developed tools of MUBD-DecoyMaker. The MUBD-hCRs encompasses 13 subtypes out of 20 chemokine receptors, composed of 404 ligands and 15756 decoys so far and is readily expandable in the future. It had been thoroughly validated that MUBD-hCRs ligands are chemically diverse while its decoys are maximal unbiased in terms of "artificial enrichment", "analogue bias". In addition, we studied the performance of MUBD-hCRs, in particular CXCR4 and CCR5 data sets, in ligand enrichment assessments of both structure- and ligand-based VS approaches in comparison with other benchmarking data sets available in the public domain and demonstrated that MUBD-hCRs is very capable of designating the optimal VS approach. MUBD-hCRs is a unique and maximal unbiased benchmarking set that covers major CRs subtypes so far.

  6. Stable Toll-Like Receptor 10 Knockdown in THP-1 Cells Reduces TLR-Ligand-Induced Proinflammatory Cytokine Expression.

    PubMed

    Le, Hai Van; Kim, Jae Young

    2016-06-01

    Toll-like receptor 10 (TLR10) is the only orphan receptor whose natural ligand and function are unknown among the 10 human TLRs. In this study, to test whether TLR10 recognizes some known TLR ligands, we established a stable TLR10 knockdown human monocytic cell line THP-1 using TLR10 short hairpin RNA lentiviral particle and puromycin selection. Among 60 TLR10 knockdown clones that were derived from each single transduced cell, six clones were randomly selected, and then one of those clones, named E7, was chosen for the functional study. E7 exhibited approximately 50% inhibition of TLR10 mRNA and protein expression. Of all the TLRs, only the expression of TLR10 changed significantly in this cell line. Additionally, phorbol 12-myristate 13-acetate-induced macrophage differentiation of TLR10 knockdown cells was not affected in the knockdown cells. When exposed to TLR ligands, such as synthetic diacylated lipoprotein (FSL-1), lipopolysaccharide (LPS), and flagellin, significant induction of proinflammatory cytokine gene expression including Interleukin-8 (IL-8), Interleukin-1 beta (IL-1β), Tumor necrosis factor-alpha (TNF-α) and Chemokine (C-C Motif) Ligand 20 (CCL20) expression, was found in the control THP-1 cells, whereas the TLR10 knockdown cells exhibited a significant reduction in the expression of IL-8, IL-1β, and CCL20. TNF-α was the only cytokine for which the expression did not decrease in the TLR10 knockdown cells from that measured in the control cells. Analysis of putative binding sites for transcription factors using a binding-site-prediction program revealed that the TNF-α promoter does not have putative binding sites for AP-1 or c-Jun, comprising a major transcription factor along with NF-κB for TLR signaling. Our results suggest that TLR10 is involved in the recognition of FSL-1, LPS, and flagellin and TLR-ligand-induced expression of TNF-α does not depend on TLR10.

  7. Recent developments in small molecule therapies for renal cell carcinoma.

    PubMed

    Song, Minsoo

    2017-12-15

    Renal cell carcinoma (RCC) is the most common type of kidney cancer in adults and is known to be the 10th most common type of cancer in the world. Most of the currently available RCC drugs are tyrosine kinase inhibitors (TKIs). However, combination therapies of TKIs and immune checkpoint inhibitors such as programmed cell death protein 1 (PD-1) and programmed cell death protein 1 ligand 1 (PD-L1) inhibitors are the focus of most of the final stage clinical trials. Meanwhile, other small molecule therapies for RCC that target indoleamine-2,3-dioxygenase (IDO1), glutaminase, C-X-C chemokine receptor 4 (CXCR4), and transglutaminase 2 (TG2) are emerging as the next generation of therapeutics. In this review, these three major streams for the development of small molecule drugs for RCC are described. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  8. Assessment of plasma chitotriosidase activity, CCL18/PARC concentration and NP-C suspicion index in the diagnosis of Niemann-Pick disease type C: a prospective observational study.

    PubMed

    De Castro-Orós, Isabel; Irún, Pilar; Cebolla, Jorge Javier; Rodriguez-Sureda, Victor; Mallén, Miguel; Pueyo, María Jesús; Mozas, Pilar; Dominguez, Carmen; Pocoví, Miguel

    2017-02-21

    Niemann-Pick disease type C (NP-C) is a rare, autosomal recessive neurodegenerative disease caused by mutations in either the NPC1 or NPC2 genes. The diagnosis of NP-C remains challenging due to the non-specific, heterogeneous nature of signs/symptoms. This study assessed the utility of plasma chitotriosidase (ChT) and Chemokine (C-C motif) ligand 18 (CCL18)/pulmonary and activation-regulated chemokine (PARC) in conjunction with the NP-C suspicion index (NP-C SI) for guiding confirmatory laboratory testing in patients with suspected NP-C. In a prospective observational cohort study, incorporating a retrospective determination of NP-C SI scores, two different diagnostic approaches were applied in two separate groups of unrelated patients from 51 Spanish medical centers (n = 118 in both groups). From Jan 2010 to Apr 2012 (Period 1), patients with ≥2 clinical signs/symptoms of NP-C were considered 'suspected NP-C' cases, and NPC1/NPC2 sequencing, plasma chitotriosidase (ChT), CCL18/PARC and sphingomyelinase levels were assessed. Based on findings in Period 1, plasma ChT and CCL18/PARC, and NP-C SI prediction scores were determined in a second group of patients between May 2012 and Apr 2014 (Period 2), and NPC1 and NPC2 were sequenced only in those with elevated ChT and/or elevated CCL18/PARC and/or NP-C SI ≥70. Filipin staining and 7-ketocholesterol (7-KC) measurements were performed in all patients with NP-C gene mutations, where possible. In total across Periods 1 and 2, 10/236 (4%) patients had a confirmed diagnosis o NP-C based on gene sequencing (5/118 [4.2%] in each Period): all of these patients had two causal NPC1 mutations. Single mutant NPC1 alleles were detected in 8/236 (3%) patients, overall. Positive filipin staining results comprised three classical and five variant biochemical phenotypes. No NPC2 mutations were detected. All patients with NPC1 mutations had high ChT activity, high CCL18/PARC concentrations and/or NP-C SI scores ≥70. Plasma 7-KC was higher than control cut-off values in all patients with two NPC1 mutations, and in the majority of patients with single mutations. Family studies identified three further NP-C patients. This approach may be very useful for laboratories that do not have mass spectrometry facilities and therefore, they cannot use other NP-C biomarkers for diagnosis.

  9. Stromal cell-derived factor-1{alpha} (SDF-1{alpha}/CXCL12) stimulates ovarian cancer cell growth through the EGF receptor transactivation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Porcile, Carola; Bajetto, Adriana; Barbieri, Federica

    2005-08-15

    Ovarian cancer (OC) is the leading cause of death in gynecologic diseases in which there is evidence for a complex chemokine network. Chemokines are a family of proteins that play an important role in tumor progression influencing cell proliferation, angiogenic/angiostatic processes, cell migration and metastasis, and, finally, regulating the immune cells recruitment into the tumor mass. We previously demonstrated that astrocytes and glioblastoma cells express both the chemokine receptor CXCR4 and its ligand stromal cell-derived factor-1 (SDF-1), and that SDF-1{alpha} treatment induced cell proliferation, supporting the hypothesis that chemokines may play an important role in tumor cells' growth in vitro.more » In the present study, we report that CXCR4 and SDF-1 are expressed in OC cell lines. We demonstrate that SDF-1{alpha} induces a dose-dependent proliferation in OC cells, by the specific interaction with CXCR4 and a biphasic activation of ERK1/2 and Akt kinases. Our results further indicate that CXCR4 activation induces EGF receptor (EGFR) phosphorylation that in turn was linked to the downstream intracellular kinases activation, ERK1/2 and Akt. In addition, we provide evidence for cytoplasmic tyrosine kinase (c-Src) involvement in the SDF-1/CXCR4-EGFR transactivation. These results suggest a possible important 'cross-talk' between SDF-1/CXCR4 and EGFR intracellular pathways that may link signals of cell proliferation in ovarian cancer.« less

  10. Chemokines expression during Leptospira interrogans serovar Copenhageni infection in resistant BALB/c and susceptible C3H/HeJ mice.

    PubMed

    da Silva, Josefa B; Ramos, Tatiane M V; de Franco, Marcelo; Paiva, Delhi; Ho, Paulo Lee; Martins, Elizabeth A L; Pereira, Martha M

    2009-08-01

    The role of innate immune responses in protection against leptospirosis remains unclear. We examined the expression of the chemokines CCL2/JE (MCP-1), CCL3/MIP-1 alpha (MIP-1 alpha) and CXCL1/KC (IL-8) regarding resistance and susceptibility to leptospirosis in experimental mice models BALB/c and C3H/HeJ, respectively. A virulent strain of Leptospira interrogans serovar Copenhageni was used in this study. Twenty-five animals of each mouse strain of C3H/HeJ and BALB/c, were infected intraperitoneally with 10(6) cells. Five un-infected animals of each strain were kept as control. Mortality of C3H/HeJ mouse was observed while BALB/c mice were asymptomatic. The presence of leptospire DNA in tissues of infected animals was demonstrated by PCR. Chemokines were measured in serum, spleen, liver, kidney and lung of both strains of animals using immunoenzymatic assay (ELISA). Elevations in the levels of chemokines MCP-1 and IL-8 occurred in all organs and sera of C3H/HeJ and BALB/c infected mice. The levels of MIP-1 alpha were lower when compared to MCP-1 and IL-8 in all analyzed organs, with a slight increase in liver and kidney. Our results indicate that the expression of inflammatory mediators can vary greatly, depending on the tissue and mouse strains. It is possible that the resistance to Leptospira can be partially correlated to the increase of MIP-1 alpha observed in BALB/c mice, while an increasing and a sustained expression of MCP-1 and IL-8 in the lungs of C3H/HeJ mice can be correlated to the severity and progression of leptospirosis.

  11. Structural determinants of ubiquitin-CXC chemokine receptor 4 interaction.

    PubMed

    Saini, Vikas; Marchese, Adriano; Tang, Wei-Jen; Majetschak, Matthias

    2011-12-23

    Ubiquitin, a post-translational protein modifier inside the cell, functions as a CXC chemokine receptor (CXCR) 4 agonist outside the cell. However, the structural determinants of the interaction between extracellular ubiquitin and CXCR4 remain unknown. Utilizing C-terminal truncated ubiquitin and ubiquitin mutants, in which surface residues that are known to interact with ubiquitin binding domains in interacting proteins are mutated (Phe-4, Leu-8, Ile-44, Asp-58, Val-70), we provide evidence that the ubiquitin-CXCR4 interaction follows a two-site binding mechanism in which the hydrophobic surfaces surrounding Phe-4 and Val-70 are important for receptor binding, whereas the flexible C terminus facilitates receptor activation. Based on these findings and the available crystal structures, we then modeled the ubiquitin-CXCR4 interface with the RosettaDock software followed by small manual adjustments, which were guided by charge complementarity and anticipation of a conformational switch of CXCR4 upon activation. This model suggests three residues of CXCR4 (Phe-29, Phe-189, Lys-271) as potential interaction sites. Binding studies with HEK293 cells overexpressing wild type and CXCR4 after site-directed mutagenesis confirm that these residues are important for ubiquitin binding but that they do not contribute to the binding of stromal cell-derived factor 1α. Our findings suggest that the structural determinants of the CXCR4 agonist activity of ubiquitin mimic the typical structure-function relationship of chemokines. Furthermore, we provide evidence for separate and specific ligand binding sites on CXCR4. As exogenous ubiquitin has been shown to possess therapeutic potential, our findings are expected to facilitate the structure-based design of new compounds with ubiquitin-mimetic actions on CXCR4.

  12. Biomarkers of disease activity in vitiligo: A systematic review.

    PubMed

    Speeckaert, R; Speeckaert, M; De Schepper, S; van Geel, N

    2017-09-01

    The pathophysiology of vitiligo is complex although recent research has discovered several markers which are linked to vitiligo and associated with disease activity. Besides providing insights into the driving mechanisms of vitiligo, these findings could reveal potential biomarkers. Activity markers can be used to monitor disease activity in clinical trials and may also be useful in daily practice. The aim of this systematic review was to document which factors have been associated with vitiligo activity in skin and blood. A second goal was to determine how well these factors are validated in terms of sensitivity and specificity as biomarkers to determine vitiligo activity. Both in skin (n=43) as in blood (n=66) an adequate number of studies fulfilled the predefined inclusion criteria. These studies used diverse methods and investigated a broad range of plausible biomarkers. Unfortunately, sensitivity and specificity analyses were scarce. In skin, simple histopathology with or without supplemental CD4 and CD8 stainings can still be considered as the gold standard, although more recently chemokine (C-X-C motif) ligand (CXCL) 9 and NLRP1 have demonstrated a good and possibly even better association with progressive disease. Regarding circulating biomarkers, cytokines (IL-1β, IL-17, IFN-γ, TGF-β), autoantibodies, oxidative stress markers, immune cells (Tregs), soluble CDs (sCD25, sCD27) and chemokines (CXCL9, CXCL10) are still competing. However, the two latter may be preferable as both chemokines and soluble CDs are easy to measure and the available studies display promising results. A large multicenter study could make more definitive statements regarding their sensitivity and specificity. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Thyroid disturbance related to chronic hepatitis C infection: role of CXCL10.

    PubMed

    Danilovic, Debora Lucia Seguro; Mendes-Correa, Maria Cassia; Chammas, Maria Cristina; Zambrini, Heverton; Barros, Raffaelle K; Marui, Suemi

    2013-01-01

    Association between autoimmune thyroid diseases (AITD) and hepatitis C is controversial, but may occur or worsen during alpha-interferon treatment. The mechanism responsible for autoimmune diseases in infected patients has not been fully elucidated. This study aims to evaluate the frequency of AITD in chronic hepatitis C and the association of chemokine (CXC motif) ligand 10 (CXCL10) and AITD. One hundred and three patients with chronic hepatitis C and 96 controls were prospectively selected to clinical, hormonal, thyroid autoimmunity and ultrasound exams, besides thyroxine-binding globulin (TBG) and CXCL10 measurements and hepatic biopsies. The frequency of AITD among infected subjects was similar to controls. TT3 and TT4 distributions were right shifted, as was TBG, which correlated to both of them. Thyroid heterogeneity and hypoechogenicity were associated with AITD. Increased vascularization was more prevalent in chronic hepatitis C.CXCL10 was higher in infected patients (p=0.007) but was not related to thyroid dysfunction. Increase in CXCL10 levels were consistent with hepatic necroinflammatory activity (p=0.011). In summary, no association was found between chronic hepatitis C and AITD. Infected subjects had higher TT3 and TT4 which were correlated to TBG. Increased CXCL10 was not associated to thyroid dysfunction in HCV-infected population.

  14. Lumican Peptides: Rational Design Targeting ALK5/TGFBRI

    NASA Astrophysics Data System (ADS)

    Gesteira, Tarsis Ferreira; Coulson-Thomas, Vivien J.; Yuan, Yong; Zhang, Jianhua; Nader, Helena B.; Kao, Winston W.-Y.

    2017-02-01

    Lumican, a small leucine rich proteoglycan (SLRP), is a component of extracellular matrix which also functions as a matrikine regulating multiple cell activities. In the cornea, lumican maintains corneal transparency by regulating collagen fibrillogenesis, promoting corneal epithelial wound healing, regulating gene expression and maintaining corneal homeostasis. We have recently shown that a peptide designed from the 13 C-terminal amino acids of lumican (LumC13) binds to ALK5/TGFBR1 (type1 receptor of TGFβ) to promote wound healing. Herein we evaluate the mechanism by which this synthetic C-terminal amphiphilic peptide (LumC13), binds to ALK5. These studies clearly reveal that LumC13-ALK5 form a stable complex. In order to determine the minimal amino acids required for the formation of a stable lumican/ALK5 complex derivatives of LumC13 were designed and their binding to ALK5 investigated in silico. These LumC13 derivatives were tested both in vitro and in vivo to evaluate their ability to promote corneal epithelial cell migration and corneal wound healing, respectively. These validations add to the therapeutic value of LumC13 (Lumikine) and aid its clinical relevance of promoting the healing of corneal epithelium debridement. Moreover, our data validates the efficacy of our computational approach to design active peptides based on interactions of receptor and chemokine/ligand.

  15. Diabetes increases the susceptibility to acute kidney injury after myocardial infarction through augmented activation of renal Toll-like receptors in rats.

    PubMed

    Ohno, Kouhei; Kuno, Atsushi; Murase, Hiromichi; Muratsubaki, Shingo; Miki, Takayuki; Tanno, Masaya; Yano, Toshiyuki; Ishikawa, Satoko; Yamashita, Tomohisa; Miura, Tetsuji

    2017-12-01

    Acute kidney injury (AKI) after acute myocardial infarction (MI) worsens the prognosis of MI patients. Although type 2 diabetes mellitus (DM) is a major risk factor of AKI after MI, the underlying mechanism remains unclear. Here, we examined the roles of renal Toll-like receptors (TLRs) in the impact of DM on AKI after MI. MI was induced by coronary artery ligation in Otsuka-Long-Evans-Tokushima fatty (OLETF) rats, a rat DM model, and Long-Evans-Tokushima-Otsuka (LETO) rats, nondiabetic controls. Sham-operated rats served as no-MI controls. Renal mRNA levels of TLR2 and myeloid differentiation factor 88 (MyD88) were significantly higher in sham-operated OLETF rats than in sham-operated LETO rats, although levels of TLR1, TLR3, and TLR4 were similar. At 12 h after MI, protein levels of kidney injury molecule-1 (KIM-1) and neutrophil gelatinase-associated lipocalin (NGAL) in the kidney were elevated by 5.3- and 4.0-fold, respectively, and their mRNA levels were increased in OLETF but not LETO rats. The increased KIM-1 and NGAL expression levels after MI in the OLETF kidney were associated with upregulated expression of TLR1, TLR2, TLR4, MyD88, IL-6, TNF-α, chemokine (C-C motif) ligand 2, and transforming growth factor-β 1 and also with activation of p38 MAPK, JNK, and NF-κB. Cu-CPT22, a TLR1/TLR2 antagonist, administered before MI significantly suppressed MI-induced upregulation of KIM-1, TLR2, TLR4, MyD88, and chemokine (C-C motif) ligand 2 levels and activation of NF-κB, whereas NGAL levels and IL-6 and TNF-α expression levels were unchanged. The results suggest that DM increases the susceptibility to AKI after acute MI by augmented activation of renal TLRs and that TLR1/TLR2-mediated signaling mediates KIM-1 upregulation after MI. NEW & NOTEWORTHY This is the first report to demonstrate the involvement of Toll-like recpetors (TLRs) in diabetes-induced susceptibility to acute kidney injury after acute myocardial infarction. We propose that the TLR1/TLR2 heterodimer may be a new therapeutic target for the prevention of acute kidney injury in diabetic patients. Copyright © 2017 the American Physiological Society.

  16. Role of stromal cell-derived factor 1 (SDF1/CXCL12) in regulating anterior pituitary function.

    PubMed

    Barbieri, Federica; Bajetto, Adriana; Porcile, Carola; Pattarozzi, Alessandra; Schettini, Gennaro; Florio, Tullio

    2007-03-01

    Chemokines are key factors involved in the regulation of immune response, through the activation and control of leukocyte traffic, lymphopoiesis and immune surveillance. However, a large number of chemokines and their receptors are expressed in central nervous system (CNS) cells, either constitutively or induced by inflammatory stimuli, playing a role in many neuropathological processes. Stromal cell-derived factor 1 (SDF1) is a chemokine whose extra-immunological localization and functions have been extensively studied. SDF1 and its receptor CXCR4 were identified in both neurons and glia of many brain areas, including the hypothalamus, as well as at the pituitary level. Importantly, SDF1 and CXCR4 expression is increased in brain tumors in which their activity induced tumor cell proliferation and brain parenchyma invasion. Despite their localization, to date very few reports addressed the role of CXCR4 and SDF1 in the modulation of the hypothalamus/pituitary axis and their possible involvement in the development of pituitary adenomas. In this review, we discuss previous literature data on the role of chemokines in normal and adenomatous pituitary cells, focusing on recent data from our group showing that CXCR4 activation controls proliferation and both prolactin and GH release in the pituitary adenoma cell line GH4C1 through a complex network of intracellular signals. Thus, the SDF1/CXCR4 system together with other chemokinergic ligand-receptor pairs, may represent a novel regulatory pathway for pituitary function and, possibly, be involved in pituitary adenoma development. These lines of evidence suggest that the inhibition of chemokine receptors may represent a novel pharmacological target for the treatment of pituitary adenomas.

  17. C–C Chemokines Released by Lipopolysaccharide (LPS)-stimulated Human Macrophages Suppress HIV-1 Infection in Both Macrophages and T Cells

    PubMed Central

    Verani, Alessia; Scarlatti, Gabriella; Comar, Manola; Tresoldi, Eleonora; Polo, Simona; Giacca, Mauro; Lusso, Paolo; Siccardi, Antonio G.; Vercelli, Donata

    1997-01-01

    Human immunodeficiency virus-1 (HIV-1) expression in monocyte-derived macrophages (MDM) infected in vitro is known to be inhibited by lipopolysaccharide (LPS). However, the mechanisms are incompletely understood. We show here that HIV-1 suppression is mediated by soluble factors released by MDM stimulated with physiologically significant concentrations of LPS. LPS-conditioned supernatants from MDM inhibited HIV-1 replication in both MDM and T cells. Depletion of C–C chemokines (RANTES, MIP-1α, and MIP-1β) neutralized the ability of LPS-conditioned supernatants to inhibit HIV-1 replication in MDM. A combination of recombinant C–C chemokines blocked HIV-1 infection as effectively as LPS. Here, we report an inhibitory effect of C–C chemokines on HIV replication in primary macrophages. Our results raise the possibility that monocytes may play a dual role in HIV infection: while representing a reservoir for the virus, they may contribute to the containment of the infection by releasing factors that suppress HIV replication not only in monocytes but also in T lymphocytes. PMID:9120386

  18. Vγ4 γδ T Cells Provide an Early Source of IL-17A and Accelerate Skin Graft Rejection.

    PubMed

    Li, Yashu; Huang, Zhenggen; Yan, Rongshuai; Liu, Meixi; Bai, Yang; Liang, Guangping; Zhang, Xiaorong; Hu, Xiaohong; Chen, Jian; Huang, Chibing; Liu, Baoyi; Luo, Gaoxing; Wu, Jun; He, Weifeng

    2017-12-01

    Activated γδ T cells have been shown to accelerate allograft rejection. However, the precise role of skin-resident γδ T cells and their subsets-Vγ5 (epidermis), Vγ1, and Vγ4 (dermis)-in skin graft rejection have not been identified. Here, using a male to female skin transplantation model, we demonstrated that Vγ4 T cells, rather than Vγ1 or Vγ5 T cells, accelerated skin graft rejection and that IL-17A was essential for Vγ4 T-cell-mediated skin graft rejection. Moreover, we found that Vγ4 T cells were required for early IL-17A production in the transplanted area, both in skin grafts and in the host epidermis around grafts. Additionally, the chemokine (C-C motif) ligand 20-chemokine receptor 6 pathway was essential for recruitment of Vγ4 T cells to the transplantation area, whereas both IL-1β and IL-23 induced IL-17A production from infiltrating cells. Lastly, Vγ4 T-cell-derived IL-17A promoted the accumulation of mature dendritic cells in draining lymph nodes to subsequently regulate αβ T-cell function after skin graft transplantation. Taken together, our data reveal that Vγ4 T cells accelerate skin graft rejection by providing an early source of IL-17A. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Cytotoxic T Lymphocyte Trafficking and Survival in an Augmented Fibrin Matrix Carrier

    PubMed Central

    Zou, Zhaoxia; Denny, Erin; Brown, Christine E.; Jensen, Michael C.; Li, Gang; Fujii, Tatsuhiro; Neman, Josh; Jandial, Rahul; Chen, Mike

    2012-01-01

    Cell-based therapies have intriguing potential for the treatment of a variety of neurological disorders. One such example is genetically engineered cytotoxic T lymphocytes (CTLs) that are being investigated in brain tumor clinical trials. The development of methods for CTL delivery is critical to their use in the laboratory and clinical setting. In our study, we determined whether CTLs can migrate through fibrin matrices and if their migration, survival, and function could be modulated by adding chemokines to the matrix. Our results indicated that CTLs can freely migrate through fibrin matrices. As expected, the addition of the monocyte chemotactic protein-1 (MCP-1), also known as chemokine C-C motif ligand 2 (CCL2), to the surrounding media increased egress of the CTLs out of the fibrin clot. Interleukin (IL) -2 and/or IL-15 embedded in the matrix enhanced T cell survival and further promoted T cell migration. The interleukin-13 receptor alpha 2 specific (IL-13R alpha2) T cells that traveled out of the fibrin clot retained the capacity to kill U251 glioma cells. In summary, CTLs can survive and migrate robustly in fibrin matrices. These processes can be influenced by modification of matrix constituents. We conclude that fibrin matrices may be suitable T cell carriers and can be used to facilitate understanding of T cell interaction with the surrounding microenvironment. PMID:22496835

  20. Cytotoxic T lymphocyte trafficking and survival in an augmented fibrin matrix carrier.

    PubMed

    Zou, Zhaoxia; Denny, Erin; Brown, Christine E; Jensen, Michael C; Li, Gang; Fujii, Tatsuhiro; Neman, Josh; Jandial, Rahul; Chen, Mike

    2012-01-01

    Cell-based therapies have intriguing potential for the treatment of a variety of neurological disorders. One such example is genetically engineered cytotoxic T lymphocytes (CTLs) that are being investigated in brain tumor clinical trials. The development of methods for CTL delivery is critical to their use in the laboratory and clinical setting. In our study, we determined whether CTLs can migrate through fibrin matrices and if their migration, survival, and function could be modulated by adding chemokines to the matrix. Our results indicated that CTLs can freely migrate through fibrin matrices. As expected, the addition of the monocyte chemotactic protein-1 (MCP-1), also known as chemokine C-C motif ligand 2 (CCL2), to the surrounding media increased egress of the CTLs out of the fibrin clot. Interleukin (IL) -2 and/or IL-15 embedded in the matrix enhanced T cell survival and further promoted T cell migration. The interleukin-13 receptor alpha 2 specific (IL-13R alpha2) T cells that traveled out of the fibrin clot retained the capacity to kill U251 glioma cells. In summary, CTLs can survive and migrate robustly in fibrin matrices. These processes can be influenced by modification of matrix constituents. We conclude that fibrin matrices may be suitable T cell carriers and can be used to facilitate understanding of T cell interaction with the surrounding microenvironment.

  1. In Vivo Tracking of Mesechymal Stem Cells Using Fluorescent Nanoparticles in an Osteochondral Repair Model

    PubMed Central

    Lee, Jong Min; Kim, Byung-Soo; Lee, Haeshin; Im, Gun-Il

    2012-01-01

    We devised and tested an in vivo system to monitor the migration of mesenchymal stem cells (MSCs) within the marrow cavity. In vitro studies confirmed that platelet-derived growth factor (PDGF)-AA had the most potent chemotactic effect of the tested factors, and possessed the greatest number of receptors in MSCs. MSCs were labeled with fluorescent nanoparticles and injected into the marrow cavity of nude rats through osteochondral defects created in the distal femur. The defects were sealed with HCF (heparin-conjugated fibrin) or PDGF-AA-loaded HCF. In the HCF-only group, the nanoparticle-labeled MSCs dispersed outside the marrow cavity within 3 days after injection. In the PDGF-AA-loaded HCF group, the labeled cells moved time-dependently for 14 days toward the osteochondral defect. HCF-PDGF in low dose (LD; 8.5 ng/µl) was more effective than HCF-PDGF in high dose (HD; 17 ng/µl) in recruiting the MSCs to the osteochondral defect. After 21 days, the defects treated with PDGF and transforming growth factor (TGF)-β1-loaded HCF showed excellent cartilage repair compared with other groups. Further studies confirmed that this in vivo osteochondral MSCs tracking system (IOMTS) worked for other chemoattractants (chemokine (C-C motif) ligand 2 (CCL2) and PDGF-BB). IOMTS can provide a useful tool to examine the effect of growth factors or chemokines on endogenous cartilage repair. PMID:22491215

  2. Role of inflammation in the development of renal damage and dysfunction in Angiotensin II-induced hypertension

    PubMed Central

    Liao, Tang-Dong; Yang, Xiao-Ping; Liu, Yun-He; Shesely, Edward G.; Cavasin, Maria A.; Kuziel, William A.; Pagano, Patrick J.; Carretero, Oscar A.

    2008-01-01

    Angiotensin II (Ang II)-induced hypertension is associated with an inflammatory response that may contribute to development of target organ damage. We tested the hypothesis that in Angiotensin II-induced hypertension, CC chemokine receptor 2 (CCR2) activation plays an important role in development of renal fibrosis, damage and dysfunction by causing: a) oxidative stress, b) macrophage infiltration, and c) cell proliferation. To test this hypothesis we used CCR2 knockout mice (CCR2−/−). The natural ligand of CCR2 is monocyte chemoattractant protein-1 (MCP-1), a chemokine important for macrophage recruitment and activation. CCR2−/− and age-matched wild-type (CCR2+/+) C57BL/6J mice were infused continuously with either Ang II (5.2 ng/10 g/min) or vehicle via osmotic mini-pumps for 2 or 4 weeks. Ang II infusion caused similar increases in systolic blood pressure and left ventricular hypertrophy in both strains of mice. However, in CCR2−/− mice with Ang II-induced hypertension, oxidative stress, macrophage infiltration, albuminuria and renal damage were significantly decreased and glomerular filtration rate was significantly higher than in CCR2+/+ mice. We concluded that in Ang II-induced hypertension, CCR2 activation plays an important role in development of hypertensive nephropathy via increased oxidative stress and inflammation. PMID:18541733

  3. Critical role of CXCL4 in the lung pathogenesis of influenza (H1N1) respiratory infection.

    PubMed

    Guo, L; Feng, K; Wang, Y C; Mei, J J; Ning, R T; Zheng, H W; Wang, J J; Worthen, G S; Wang, X; Song, J; Li, Q H; Liu, L D

    2017-11-01

    Annual epidemics and unexpected pandemics of influenza are threats to human health. Lung immune and inflammatory responses, such as those induced by respiratory infection influenza virus, determine the outcome of pulmonary pathogenesis. Platelet-derived chemokine (C-X-C motif) ligand 4 (CXCL4) has an immunoregulatory role in inflammatory diseases. Here we show that CXCL4 is associated with pulmonary influenza infection and has a critical role in protecting mice from fatal H1N1 virus respiratory infection. CXCL4 knockout resulted in diminished viral clearance from the lung and decreased lung inflammation during early infection but more severe lung pathology relative to wild-type mice during late infection. Additionally, CXCL4 deficiency decreased leukocyte accumulation in the infected lung with markedly decreased neutrophil infiltration into the lung during early infection and extensive leukocyte, especially lymphocyte accumulation at the late infection stage. Loss of CXCL4 did not affect the activation of adaptive immune T and B lymphocytes during the late stage of lung infection. Further study revealed that CXCL4 deficiency inhibited neutrophil recruitment to the infected mouse lung. Thus the above results identify CXCL4 as a vital immunoregulatory chemokine essential for protecting mice against influenza A virus infection, especially as it affects the development of lung injury and neutrophil mobilization to the inflamed lung.

  4. Exosomes Derived From Pancreatic Stellate Cells: MicroRNA Signature and Effects on Pancreatic Cancer Cells.

    PubMed

    Takikawa, Tetsuya; Masamune, Atsushi; Yoshida, Naoki; Hamada, Shin; Kogure, Takayuki; Shimosegawa, Tooru

    2017-01-01

    Pancreatic stellate cells (PSCs) interact with pancreatic cancer cells in the tumor microenvironment. Cell constituents including microRNAs may be exported from cells within membranous nanovesicles termed exosomes. Exosomes might play a pivotal role in intercellular communication. This study aimed to clarify the microRNA signature of PSC-derived exosomes and their effects on pancreatic cancer cells. Exosomes were prepared from the conditioned medium of immortalized human PSCs. MicroRNAs were prepared from the exosomes and their source PSCs, and the microRNA expression profiles were compared by microarray. The effects of PSC-derived exosomes on proliferation, migration, and the mRNA expression profiles were examined in pancreatic cancer cells. Pancreatic stellate cell-derived exosomes contained a variety of microRNAs including miR-21-5p. Several microRNAs such as miR-451a were enriched in exosomes compared to their source PSCs. Pancreatic stellate cell-derived exosomes stimulated the proliferation, migration and expression of mRNAs for chemokine (C - X - C motif) ligands 1 and 2 in pancreatic cancer cells. The stimulation of proliferation, migration, and chemokine gene expression by the conditioned medium of PSCs was suppressed by GW4869, an exosome inhibitor. We clarified the microRNA expression profile in PSC-derived exosomes. Pancreatic stellate cell-derived exosomes might play a role in the interactions between PSCs and pancreatic cancer cells.

  5. Mapping Interaction Sites on Human Chemokine Receptors by Deep Mutational Scanning.

    PubMed

    Heredia, Jeremiah D; Park, Jihye; Brubaker, Riley J; Szymanski, Steven K; Gill, Kevin S; Procko, Erik

    2018-06-01

    Chemokine receptors CXCR4 and CCR5 regulate WBC trafficking and are engaged by the HIV-1 envelope glycoprotein gp120 during infection. We combine a selection of human CXCR4 and CCR5 libraries comprising nearly all of ∼7000 single amino acid substitutions with deep sequencing to define sequence-activity landscapes for surface expression and ligand interactions. After consideration of sequence constraints for surface expression, known interaction sites with HIV-1-blocking Abs were appropriately identified as conserved residues following library sorting for Ab binding, validating the use of deep mutational scanning to map functional interaction sites in G protein-coupled receptors. Chemokine CXCL12 was found to interact with residues extending asymmetrically into the CXCR4 ligand-binding cavity, similar to the binding surface of CXCR4 recognized by an antagonistic viral chemokine previously observed crystallographically. CXCR4 mutations distal from the chemokine binding site were identified that enhance chemokine recognition. This included disruptive mutations in the G protein-coupling site that diminished calcium mobilization, as well as conservative mutations to a membrane-exposed site (CXCR4 residues H79 2.45 and W161 4.50 ) that increased ligand binding without loss of signaling. Compared with CXCR4-CXCL12 interactions, CCR5 residues conserved for gp120 (HIV-1 BaL strain) interactions map to a more expansive surface, mimicking how the cognate chemokine CCL5 makes contacts across the entire CCR5 binding cavity. Acidic substitutions in the CCR5 N terminus and extracellular loops enhanced gp120 binding. This study demonstrates how comprehensive mutational scanning can define functional interaction sites on receptors, and novel mutations that enhance receptor activities can be found simultaneously. Copyright © 2018 by The American Association of Immunologists, Inc.

  6. Enforced hematopoietic cell E- and L-selectin ligand (HCELL) expression primes transendothelial migration of human mesenchymal stem cells.

    PubMed

    Thankamony, Sai P; Sackstein, Robert

    2011-02-08

    According to the multistep model of cell migration, chemokine receptor engagement (step 2) triggers conversion of rolling interactions (step 1) into firm adhesion (step 3), yielding transendothelial migration. We recently reported that glycosyltransferase-programmed stereosubstitution (GPS) of CD44 on human mesenchymal stem cells (hMSCs) creates the E-selectin ligand HCELL (hematopoietic cell E-selectin/L-selectin ligand) and, despite absence of CXCR4, systemically administered HCELL(+)hMSCs display robust osteotropism visualized by intravital microscopy. Here we performed studies to define the molecular effectors of this process. We observed that engagement of hMSC HCELL with E-selectin triggers VLA-4 adhesiveness, resulting in shear-resistant adhesion to ligand VCAM-1. This VLA-4 activation is mediated via a Rac1/Rap1 GTPase signaling pathway, resulting in transendothelial migration on stimulated human umbilical vein endothelial cells without chemokine input. These findings indicate that hMSCs coordinately integrate CD44 ligation and integrin activation, circumventing chemokine-mediated signaling, yielding a step 2-bypass pathway of the canonical multistep paradigm of cell migration.

  7. CCL2 Serum Levels and Adiposity Are Associated with the Polymorphic Phenotypes -2518A on CCL2 and 64ILE on CCR2 in a Mexican Population with Insulin Resistance.

    PubMed

    Guzmán-Ornelas, Milton-Omar; Petri, Marcelo Heron; Vázquez-Del Mercado, Mónica; Chavarría-Ávila, Efraín; Corona-Meraz, Fernanda-Isadora; Ruíz-Quezada, Sandra-Luz; Madrigal-Ruíz, Perla-Monserrat; Castro-Albarrán, Jorge; Sandoval-García, Flavio; Navarro-Hernández, Rosa-Elena

    2016-01-01

    Genetic susceptibility has been described in insulin resistance (IR). Chemokine (C-C motif) ligand-2 (CCL2) is overexpressed in white adipose tissue and is the ligand of C-C motif receptor-2 (CCR2). The CCL2 G-2518A polymorphism is known to regulate gene expression, whereas the physiological effects of the CCR2Val64Ile polymorphism are unknown. The aim of the study is to investigate the relationship between these polymorphisms with soluble CCL2 levels (sCCL2), metabolic markers, and adiposity. In a cross-sectional study we included 380 Mexican-Mestizo individuals, classified with IR according to Stern criteria. Polymorphism was identified using PCR-RFLP/sequence-specific primers. Anthropometrics and metabolic markers were measured by routine methods and adipokines and sCCL2 by ELISA. The CCL2 polymorphism was associated with IR (polymorphic A+ phenotype frequencies were 70.9%, 82.6%, in individuals with and without IR, resp.). Phenotype carriers CCL2 (A+) displayed lower body mass and fat indexes, insulin and HOMA-IR, and higher adiponectin levels. Individuals with IR presented higher sCCL2 compared to individuals without IR and was associated with CCR2 (Ile+) phenotype. The double-polymorphic phenotype carriers (A+/Ile+) exhibited higher sCCL2 than double-wild-type phenotype carriers (A-/Ile-). The present findings suggest that sCCL2 production possibly will be associated with the adiposity and polymorphic phenotypes of CCL2 and CCR2, in Mexican-Mestizos with IR.

  8. Clinical utility of circulating matrix metalloproteinase-7 (MMP-7), CC chemokine ligand 18 (CCL18) and CC chemokine ligand 11 (CCL11) as markers for diagnosis of epithelial ovarian cancer.

    PubMed

    Zohny, Samir F; Fayed, Salah T

    2010-12-01

    Ovarian cancer remains a highly lethal disease. The aim of the present study was to evaluate the usefulness of measuring serum matrix metalloproteinase-7 (MMP-7), CC chemokine ligand 18 (CCL18) and CC chemokine ligand 11 (CCL11) in comparison with serum cancer antigen 125 (CA 125) for diagnosis of epithelial ovarian cancer (EOC). This study included 51 patients with EOC, 27 patients with benign ovarian lesions and 29 healthy volunteers. Serum CA 125 was determined by microparticle enzyme immunoassay, while serum MMP-7, CCL18 and CCL11 were measured using enzyme-linked immunosorbent assay. The sensitivity and specificity were 86.3% and 92.9% for CA 125, 80.4% and 87.5% for MMP-7, 84.3% and 91.1% for CCL18 and, 68.6% and 62.5% for CCL11. Combination of CA 125, MMP-7, CCL18 and CCL11 gave a promising sensitivity of 100%, but specificity was decreased to 60.7%. The combined use of serum CA 125, MMP-7, CCL18 and CCL11 effectively detected early stages EOC with high sensitivity of 94.4%. Our data indicate that serum MMP-7, CCL18 and CCL11, in combination with CA 125 could be useful in diagnosis of EOC.

  9. CC chemokine ligand 2 and CXC chemokine ligand 8 as neutrophil chemoattractant factors in canine idiopathic polyarthritis.

    PubMed

    Murakami, Kohei; Maeda, Shingo; Yonezawa, Tomohiro; Matsuki, Naoaki

    2016-12-01

    Canine idiopathic polyarthritis (IPA) is characterized by increased numbers of polymorphonuclear leukocytes (PMNs) in the synovial fluid (SF). In humans, CC chemokine ligand 2 (CCL2) and CXC chemokine ligand 8 (CXCL8) recruit monocytes and neutrophils, respectively, and are involved in various inflammatory disorders. The aim of this study was to assess the roles of these chemokines in driving PMNs infiltration into the joints of dogs with IPA. SF samples were collected from dogs with IPA (n=19) and healthy controls (n=8), and the concentrations of SF CCL2 and CXCL8 were determined by ELISA. Dogs with IPA had significantly higher concentrations of CCL2 (3316±2452pg/ml, mean±SD) and CXCL8 (3668±3879pg/ml) compared with the healthy controls (235±45pg/ml and <15.6pg/ml, respectively). Then, an in vitro chemotaxis assay was performed using a modified Boyden chamber (pore size: 3μm). SF from IPA dogs had a chemoattractant activity for PMNs that purified from the peripheral blood of a healthy dog. We subsequently found that combination treatment with MK-0812 (an antagonist of CCL2 receptor) and repertaxin (an antagonist of CXCL8 receptors) significantly inhibited the migration of PMNs to SF from IPA dogs. Thus, expression of the CCL2 receptor (chemokine (CC motif) receptor 2 (CCR2)) was examined using polymerase chain reaction and immunocytochemistry. Canine peripheral blood PMNs exhibited significantly higher CCR2 mRNA expression levels than those in monocytes. In addition, we observed strong CCR2 expression on PMNs obtained from healthy controls and IPA dogs, although mononuclear cells did not express CCR2. Taken together, the data suggest that CCL2 acts as a canine PMNs chemotactic factor as well as CXCL8 and both CCL2 and CXCL8 facilitate the infiltration of PMNs into the joints of dogs with IPA. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. 15-deoxy-Delta12,14-prostaglandin J2 inhibits INF-gamma-induced JAK/STAT1 signalling pathway activation and IP-10/CXCL10 expression in mesangial cells.

    PubMed

    Panzer, Ulf; Zahner, Gunther; Wienberg, Ulrike; Steinmetz, Oliver M; Peters, Anett; Turner, Jan-Eric; Paust, Hans-Joachim; Wolf, Gunter; Stahl, Rolf A K; Schneider, André

    2008-12-01

    Activators of the peroxisome proliferator-activated receptor gamma (PPARgamma), originally found to be implicated in lipid metabolism and glucose homeostasis, have been shown to modulate inflammatory responses through interference with cytokine and chemokine production. Given the central role of mesangial cell-derived chemokines in glomerular leukocyte recruitment in human and experimental glomerulonephritis, we studied the influence of natural and synthetic PPARgamma activators on INF-gamma-induced expression of the T cell-attracting chemokines IP-10/CXCL10, Mig/CXCL9 and I-TAC/CXCL11 in mouse mesangial cells. INF-gamma-treated mesangial cells were cultured in the presence or absence of either the naturally occurring PPARgamma ligand 15-deoxy-Delta(12,14)-prostaglandin J(2) (15d-PGJ(2)) or synthetic PPARgamma activators of the glitazone group. Chemokine mRNA and protein expression and activation of the JAK/STAT signalling pathway were analysed. The 15d-PGJ(2), but not synthetic PPARgamma ligands, dose-dependently inhibited INF-gamma-induced chemokine gene (mRNA and protein) expression. Combined results from EMSA and western blot analysis revealed the inhibitory ability of 15d-PGJ(2), but not of synthetic PPARgamma ligands, on IFN-gamma-induced tyrosine phosphorylation of JAK1, JAK2, STAT1 and nuclear STAT1 translocation and DNA binding. Our results demonstrate that 15d-PGJ(2) inhibits INF-gamma-induced chemokine expression in mesangial cells by targeting the JAK/STAT signalling pathway. This effect is independent of an interference with PPARgamma.

  11. CC-chemokine class inhibition attenuates pathological angiogenesis while preserving physiological angiogenesis.

    PubMed

    Ridiandries, Anisyah; Tan, Joanne T M; Ravindran, Dhanya; Williams, Helen; Medbury, Heather J; Lindsay, Laura; Hawkins, Clare; Prosser, Hamish C G; Bursill, Christina A

    2017-03-01

    Increasing evidence shows that CC-chemokines promote inflammatory-driven angiogenesis, with little to no effect on hypoxia-mediated angiogenesis. Inhibition of the CC-chemokine class may therefore affect angiogenesis differently depending on the pathophysiological context. We compared the effect of CC-chemokine inhibition in inflammatory and physiological conditions. In vitro , the broad-spectrum CC-chemokine inhibitor "35K" inhibited inflammatory-induced endothelial cell proliferation, migration, and tubulogenesis, with more modest effects in hypoxia. In vivo , adenoviruses were used to overexpress 35K (Ad35K) and GFP (AdGFP, control virus). Plasma chemokine activity was suppressed by Ad35K in both models. In the periarterial femoral cuff model of inflammatory-driven angiogenesis, overexpression of 35K inhibited adventitial neovessel formation compared with control AdGFP-infused mice. In contrast, 35K preserved neovascularization in the hindlimb ischemia model and had no effect on physiological neovascularization in the chick chorioallantoic membrane assay. Mechanistically, 2 key angiogenic proteins (VEGF and hypoxia-inducible factor-1α) were conditionally regulated by 35K, such that expression was inhibited in inflammation but was unchanged in hypoxia. In conclusion, CC-chemokine inhibition by 35K suppresses inflammatory-driven angiogenesis while preserving physiological ischemia-mediated angiogenesis via conditional regulation of VEGF and hypoxia-inducible factor-1α. CC-chemokine inhibition may be an alternative therapeutic strategy for suppressing diseases associated with inflammatory angiogenesis without inducing the side effects caused by global inhibition.- Ridiandries, A., Tan, J. T. M., Ravindran, D., Williams, H., Medbury, H. J., Lindsay, L., Hawkins, C., Prosser, H. C. G., Bursill, C. A. CC-chemokine class inhibition attenuates pathological angiogenesis while preserving physiological angiogenesis. © FASEB.

  12. Molecular and functional roles of 6C CC chemokine 19 in defense system of striped murrel Channa striatus.

    PubMed

    Arockiaraj, Jesu; Bhatt, Prasanth; Harikrishnan, Ramasamy; Arasu, Mariadhas Valan; Al-Dhabi, Naif Abdullah

    2015-08-01

    In this study, we have reported the molecular information of chemokine-19 (Chem19) from striped murrel Channa striatus (Cs). CsCC-Chem19 cDNA sequence was 555 base pair (bp) in length which is 68bp 5' untranslated region (UTR), 339bp translated region and 149bp 3' UTR. The translated region is encoded for a polypeptide of 112 amino acids. CsCC-Chem19 peptide contains a signal sequence between 1 and 26 and an interleukin (IL) 8 like domain between 24 and 89. The multiple sequence alignment showed a 'DCCL' motif, an indispensable motif present in all CC chemokines which was conserved throughout the evolution. Phylogenetic tree showed that CsCC-Chem19 formed a cluster with chemokine 19 from fishes. Secondary structure of CsCC-Chem19 revealed that the peptide contains maximum amount of coils (61.6%) compared to α-helices (25.9%%) and β-sheet (12.5%). Further, 3D analysis indicated that the cysteine residues at 33, 34, 59 and 75 making the disulfide bridges as 33 = 59 and 34 = 75. Significantly (P < 0.05) highest CsCC-Chem19 mRNA expression was observed in blood and it was up-regulated upon fungus and bacterial infection. Utilizing the coding region of CsCC-Chem19, recombinant CsCC-Chem19 protein was produced. The recombinant CsCC-Chem19 protein induced the cellular proliferation and respiratory burst activity of C. striatus peripheral blood leukocytes (PBL) in a concentration dependent manner. Moreover, the chemotactic activity showed that the recombinant CsCC-Chem19 significantly (P < 0.05) enhanced the movement of PBL of C. striatus. Conclusively, CsCC-Chem19 is a 6C CC chemokine having an ability to perform both inflammatory and homeostatic functions. However, further research is necessary to understand the potential of 6C CC chemokine 19 of C. striatus, particularly their regulatory ability on different cellular components in the defense system. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Cloning of human cDNA encoding a novel heptahelix receptor expressed in Burkitt's lymphoma and widely distributed in brain and peripheral tissues.

    PubMed

    Owman, C; Blay, P; Nilsson, C; Lolait, S J

    1996-11-12

    Using PCR with degenerate primers and screening of a human B-cell lymphoblast cDNA library, a full-length cDNA encoding a 375-amino-acid protein was isolated. It contains seven regions of hydrophobic amino acids probably representing membrane-spanning domains of a novel heptahelix receptor, tentatively named CMKRL2. It shows nearly 30% overall identity with the high-affinity IL8 receptor and similar degree of homology with other chemoattractant receptors, including the "fusin" coreceptors for HIV1. Measurements of various transduction pathways following application of a panel of chemokines to transfected cells failed to evoke any reproducible response. Although the natural ligand for CMKRL2 could, thus, not be identified, receptor expression in spleen and lymph nodes as well as in Burkitt's lymphoma (irrespective of EBV status) supports a functional role in activated B-cells. Receptor message was ubiquitously distributed in normal peripheral tissues and CNS, suggesting that CMKRL2 is expressed in widespread cell populations, such as macrophages and neuroglia.

  14. A Role for the Chemokine Receptor CCR6 in Mammalian Sperm Motility and Chemotaxis

    PubMed Central

    Caballero-Campo, Pedro; Buffone, Mariano G.; Benencia, Fabian; Conejo-García, José R.; Rinaudo, Paolo F.; Gerton, George L.

    2013-01-01

    Although recent evidence indicates that several chemokines and defensins, well-known as inflammatory mediators, are expressed in the male and female reproductive tracts, the location and functional significance of chemokine networks in sperm physiology and sperm reproductive tract interactions are poorly understood. To address this deficiency in our knowledge, we examined the expression and function in sperm of CCR6, a receptor common to several chemoattractant peptides, and screened several reproductive tract fluids for the presence of specific ligands. CCR6 protein is present in mouse and human sperm and mainly localized in the sperm tail with other minor patterns in sperm from mice (neck and acrosomal region) and men (neck and midpiece regions). As expected from the protein immunoblotting and immunofluorescence results, mouse Ccr6 mRNA is expressed in the testis. Furthermore, the Defb29 mRNA encoding the CCR6 ligand, β-defensin DEFB29, is expressed at high levels in the epididymis. As determined by protein chip analysis, several chemokines (including some that act through CCR6, such as CCL20/MIP-3α (formerly Macrophage Inflammatory Protein 3α) and protein hormones were present in human follicular fluid, endometrial secretions, and seminal plasma. In functional chemotaxis assays, capacitated human sperm exhibited a directional movement towards CCL20, and displayed modifications in motility parameters. Our data indicate that chemokine ligand/receptor interactions in the male and female genital tracts promote sperm motility and chemotaxis under non-inflammatory conditions. Therefore, some of the physiological reactions mediated by CCR6 ligands in male reproduction extend beyond a pro-inflammatory response and might find application in clinical reproduction and/or contraception. PMID:23765988

  15. Critical role of dendritic cells in T cell retention in the interfollicular region of Peyer's patches.

    PubMed

    Obata, Takashi; Shibata, Naoko; Goto, Yoshiyuki; Ishikawa, Izumi; Sato, Shintaro; Kunisawa, Jun; Kiyono, Hiroshi

    2013-07-15

    Peyer's patches (PPs) simultaneously initiate active and quiescent immune responses in the gut. The immunological function is achieved by the rigid regulation of cell distribution and trafficking, but how the cell distribution is maintained remains to be elucidated. In this study, we show that binding of stromal cell-derived lymphoid chemokines to conventional dendritic cells (cDCs) is essential for the retention of naive CD4(+) T cells in the interfollicular region (IFR) of PPs. Transitory depletion of CD11c(high) cDCs in mice rapidly impaired the IFR structure in the PPs without affecting B cell follicles or germinal centers, lymphoid chemokine production from stromal cells, or the immigration of naive T cells into the IFRs of PPs. The cDC-orchestrated retention of naive T cells was mediated by heparinase-sensitive molecules that were expressed on cDCs and bound the lymphoid chemokine CCL21 produced from stromal cells. These data collectively reveal that interactions among cDCs, stromal cells, and naive T cells are necessary for the formation of IFRs in the PPs.

  16. CCR2-V64I genetic polymorphism: a possible involvement in HER2+ breast cancer.

    PubMed

    Banin-Hirata, Bruna Karina; Losi-Guembarovski, Roberta; Oda, Julie Massayo Maeda; de Oliveira, Carlos Eduardo Coral; Campos, Clodoaldo Zago; Mazzuco, Tânia Longo; Borelli, Sueli Donizete; Ceribelli, Jesus Roberto; Watanabe, Maria Angelica Ehara

    2016-05-01

    Many tumor cells express chemokines and chemokine receptors, and these molecules can affect both tumor progression and anti-tumor immune response. Genetic polymorphisms of some chemokine receptors were found to be closely related to malignant tumors, especially in metastasis process, including breast cancer (BC). Considering this, it was investigated a possible role for CCR2-V64I (C-C chemokine receptor 2) and CCR5-Δ32 (C-C chemokine receptor 5) genetic variants in BC context. Patients were divided into subgroups according to immunohistochemical profile of estrogen (ER) and progesterone (PR) receptors and the human epidermal growth factor receptor 2 (HER2) overexpression. No significant associations were found in relation to susceptibility (CCR2-V64I: OR 1.32; 95 % CI 0.57-3.06; CCR5-∆32: OR 1.04; 95 % CI 0.60-1.81), clinical outcome (tumor size, lymph nodes commitment and/or distant metastasis, TNM staging and nuclear grade) or therapeutic response (recurrence and survival). However, it was found a significant correlation between CCR2-V64I allelic variant and HER2 immunohistochemical positive samples (p = 0.026). All in all, we demonstrate, for the first time, a positive correlation between CCR2 receptor gene polymorphism and a subgroup of BC related to poor prognosis, which deserves further investigation in larger samples for validation.

  17. Stability of Chronic Hepatitis-Related Parameters in Serum Samples After Long-Term Storage.

    PubMed

    Yu, Rentao; Dan, Yunjie; Xiang, Xiaomei; Zhou, Yi; Kuang, Xuemei; Yang, Ge; Tang, Yulan; Liu, Mingdong; Kong, Weilong; Tan, Wenting; Deng, Guohong

    2017-06-01

    Serum samples are widely used in clinical research, but a comprehensive research of the stability of parameters relevant to chronic hepatitis and the effect of a relatively long-term (up to 10 years) storage on the stability have rarely been studied. To investigate the stability of chronic hepatitis-related parameters in serum samples after long-term storage. The storage stability of common clinical parameters such as total bile acid (TBA), total bilirubin (TBIL), potassium, cholesterol, and protein parameters such as alanine aminotransferase (ALT), creatine kinase (CK), γ-glutamyltransferase (GGT), albumin, high-density lipoprotein (HDL) and also hepatitis B virus (HBV) DNA, hepatitis C virus (HCV) RNA, hepatitis B surface antigen (HBsAg), and chemokine (C-X-C motif) ligand 10 (CXCL10) were tested in serum samples after storing at -20°C or -70°C for 1, 2, 3, 7, 8, and 10 years. Levels of TBA, TBIL, and protein parameters such as ALT, CK, GGT, HDL, and HBsAg decreased significantly, but levels of potassium and cholesterol increased significantly after long-term storage, whereas blood glucose and triglycerides were stable during storage. HBV DNA remained stable at -70°C but changed at -20°C, whereas HCV RNA was stable after 1-, 2-, and 3-year storage. CXCL10 was still detectable after 8-year storage. Low temperatures (-70°C/80°C) are necessary for storage of serum samples in chronic hepatitis B research after long-term storage.

  18. Increased T follicular helper cells and germinal center B cells are required for cGVHD and bronchiolitis obliterans

    PubMed Central

    Flynn, Ryan; Du, Jing; Veenstra, Rachelle G.; Reichenbach, Dawn K.; Panoskaltsis-Mortari, Angela; Taylor, Patricia A.; Freeman, Gordon J.; Serody, Jonathan S.; Murphy, William J.; Munn, David H.; Sarantopoulos, Stefanie; Luznik, Leo; Maillard, Ivan; Koreth, John; Cutler, Corey; Soiffer, Robert J.; Antin, Joseph H.; Ritz, Jerome; Dubovsky, Jason A.; Byrd, John C.; MacDonald, Kelli P.; Hill, Geoff R.; Blazar, Bruce R.

    2014-01-01

    Chronic graft-versus-host disease (cGVHD) is a leading cause of morbidity and mortality after allogeneic hematopoietic stem cell transplantation. Having shown that germinal center (GC) formation and immunoglobulin deposition are required for multiorgan system cGVHD and associated bronchiolitis obliterans syndrome (BOS) in a murine model, we hypothesized that T follicular helper (Tfh) cells are necessary for cGVHD by supporting GC formation and maintenance. We show that increased frequency of Tfh cells correlated with increased GC B cells, cGVHD, and BOS. Although administering a highly depletionary anti-CD20 monoclonal antibody (mAb) to mice with established cGVHD resulted in peripheral B-cell depletion, B cells remained in the lung, and BOS was not reversed. BOS could be treated by eliminating production of interleukin-21 (IL-21) by donor T cells or IL-21 receptor (IL-21R) signaling of donor B cells. Development of BOS was dependent upon T cells expressing the chemokine receptor CXCR5 to facilitate T-cell trafficking to secondary lymphoid organ follicles. Blocking mAbs for IL-21/IL-21R, inducible T-cell costimulator (ICOS)/ICOS ligand, and CD40L/CD40 hindered GC formation and cGVHD. These data provide novel insights into cGVHD pathogenesis, indicate a role for Tfh cells in these processes, and suggest a new line of therapy using mAbs targeting Tfh cells to reverse cGVHD. PMID:24820310

  19. Isolation, Characterization, and Functional Analysis of Ferret Lymphatic Endothelial Cells

    PubMed Central

    Berendam, Stella J.; Fallert-Junecko, Beth A.; Murphy-Corb, Michael A.; Fuller, Deborah H.; Reinhart, Todd A.

    2014-01-01

    The lymphatic endothelium (LE) serves as a conduit for transport of immune cells and soluble antigens from peripheral tissues to draining lymph nodes (LNs), contributing to development of host immune responses and possibly dissemination of microbes. Lymphatic endothelial cells (LECs) are major constituents of the lymphatic endothelium. These specialized cells could play important roles in initiation of host innate immune responses through sensing of pathogen-associated molecular patterns (PAMPs) by pattern recognition receptors (PRRs), including toll-like receptors (TLRs). LECs secrete pro-inflammatory cytokines and chemokines to create local inflammatory conditions for recruitment of naïve antigen presenting cells (APCs) such as dendritic cells (DCs) to sites of infection and/or vaccine administration. In this study, we examined the innate immune potential of primary LEC populations derived from multiple tissues of an animal model for human infectious diseases -- the ferret. We generated a total of six primary LEC populations from lung, tracheal, and mesenteric LN tissues from three different ferrets. Standard RT-PCR characterization of these primary LECs showed that they varied in their expression of LEC markers. The ferret LECs were examined for their ability to respond to poly I:C (TLR3 and RIG-1 ligand) and other known TLR ligands as measured by production of proinflammatory cytokine (IFNα, IL6, IL10, Mx1, and TNFα) and chemokine (CCL5, CCL20, and CXCL10) mRNAs using real time RT-PCR. Poly I:C exposure induced robust proinflammatory responses by all of the primary ferret LECs. Chemotaxis was performed to determine the functional activity of CCL20 produced by the primary lung LECs and showed that the LEC-derived CCL20 was abundant and functional. Taken together, our results continue to reveal the innate immune potential of primary LECs during pathogen-host interactions and expand our understanding of the roles of LECs might play in health and disease in animal models. PMID:25540877

  20. Isolation, characterization, and functional analysis of ferret lymphatic endothelial cells.

    PubMed

    Berendam, Stella J; Fallert Junecko, Beth A; Murphey-Corb, Michael A; Fuller, Deborah H; Reinhart, Todd A

    2015-02-15

    The lymphatic endothelium (LE) serves as a conduit for transport of immune cells and soluble antigens from peripheral tissues to draining lymph nodes (LNs), contributing to development of host immune responses and possibly dissemination of microbes. Lymphatic endothelial cells (LECs) are major constituents of the lymphatic endothelium. These specialized cells could play important roles in initiation of host innate immune responses through sensing of pathogen-associated molecular patterns (PAMPs) by pattern recognition receptors (PRRs), including toll-like receptors (TLRs). LECs secrete pro-inflammatory cytokines and chemokines to create local inflammatory conditions for recruitment of naïve antigen presenting cells (APCs) such as dendritic cells (DCs) to sites of infection and/or vaccine administration. In this study, we examined the innate immune potential of primary LEC populations derived from multiple tissues of an animal model for human infectious diseases - the ferret. We generated a total of six primary LEC populations from lung, tracheal, and mesenteric LN tissues from three different ferrets. Standard RT-PCR characterization of these primary LECs showed that they varied in their expression of LEC markers. The ferret LECs were examined for their ability to respond to poly I:C (TLR3 and RIG-I ligand) and other known TLR ligands as measured by production of proinflammatory cytokine (IFNα, IL6, IL10, Mx1, and TNFα) and chemokine (CCL5, CCL20, and CXCL10) mRNAs using real time RT-PCR. Poly I:C exposure induced robust proinflammatory responses by all of the primary ferret LECs. Chemotaxis was performed to determine the functional activity of CCL20 produced by the primary lung LECs and showed that the LEC-derived CCL20 was abundant and functional. Taken together, our results continue to reveal the innate immune potential of primary LECs during pathogen-host interactions and expand our understanding of the roles LECs might play in health and disease in animal models. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Atypical Chemokine Receptor 1 polymorphism cannot be used as an indicator of liver fibrosis progression in Hepatitis C virus positive patients

    PubMed Central

    Shao, Lin-Nan; Zhang, Shu-Ting; Zhou, Shi-Hang; Yu, Wei-Jian; Liu, Ming

    2017-01-01

    Background & Objective: Atypical chemokine receptor 1(ACKR1) represents an atypical chemokine receptor that can bind promiscuously to various chemokines. Chemokines play a crucial role to recruit leukocyte subsets migration through the endothelium and into liver against the virus during the progression of hepatitis C virus (HCV) infection. Most HCV positive patients can lead to liver fibrosis. Hyaluronic acid (HA), laminin (LN), collagen IV(C-IV) and amino-terminal pro-peptide of Type-III pro-collagen (PIII NP) are indices of the extent of liver fibrosis. The aim of this study was to investigate the association between ACKR1 polymorphism and liver fibrosis with these four serum liver markers in HCV positive patients. Methods: From April 2015 to December 2015, a total of 210 patients (109 males and 101 females) with chronic HCV infection at Dalian Infectious Hospital were recruited to participate in this study. ACKR1 genotyping was using TaqMan probes method. HA, LN, C-IV and PIII NP were detected by using diagnostic kits. Results: We compared serum levels of HA, LN, C-IV and PIII NP between FY*A/FY*A and FY*A/FY*B patients and the differences were not significant (P=0.905, P=0.298, P=0.880 and P=0.470, respectively). Conclusions: This study has attempted to elucidate the role of ACKR1 polymorphism in liver fibrosis progression of HCV infection, our results demonstrated that ACKR1 polymorphism is not directly associated with the fibrogenesis in HCV positive patients. PMID:29142552

  2. Minimalist hybrid ligand/receptor-based pharmacophore model for CXCR4 applied to a small-library of marine natural products led to the identification of phidianidine a as a new CXCR4 ligand exhibiting antagonist activity.

    PubMed

    Vitale, Rosa Maria; Gatti, Monica; Carbone, Marianna; Barbieri, Federica; Felicità, Vera; Gavagnin, Margherita; Florio, Tullio; Amodeo, Pietro

    2013-12-20

    Here, we present a minimal hybrid ligand/receptor-based pharmacophore model (PM) for CXCR4, a chemokine receptor deeply involved in several pathologies, such as HIV infection, rheumatoid arthritis, cancer development/progression, and metastasization. This model, considerably simpler than those thus far proposed for this receptor, has been used to search for new CXCR4 inhibitors in a small marine natural product library available at ICB-CNR Institute (Pozzuoli, NA, Italy), since natural products, with their naturally selected chemical and functional diversity, represent a rich source of bioactive scaffolds; computational approaches allow searching for new scaffolds with a minimal waste of possibly precious natural product samples; and our "stripped-down" model substantially increases the probabilities of identifying potential hits even in small-sized libraries. This search, also validated by a systematic virtual screening of the same library, has led to the identification of a new CXCR4 ligand, phidianidine A (PHIA). Docking studies supported PHIA activity and suggested its possible binding modes to CXCR4. Using the CXCR4-expressing/CXCR7-negative GH4C1 cell line we show that PHIA inhibits CXCL12-induced DNA synthesis, cell migration, and ERK1/2 activation. The specificity of these effects was confirmed by the lack of PHIA activity in GH4C1 cells, in which siRNA highly reduces CXCR4 expression and the lack of cytoxicity of PHIA was also verified. Thus, PHIA represents a promising lead for a new family of CXCR4 modulators with wide margins of improvement in potency and specificity offered by the small and very simple underlying PM.

  3. Mutational analysis of the extracellular disulphide bridges of the atypical chemokine receptor ACKR3/CXCR7 uncovers multiple binding and activation modes for its chemokine and endogenous non-chemokine agonists.

    PubMed

    Szpakowska, Martyna; Meyrath, Max; Reynders, Nathan; Counson, Manuel; Hanson, Julien; Steyaert, Jan; Chevigné, Andy

    2018-07-01

    The atypical chemokine receptor ACKR3/CXCR7 plays crucial roles in numerous physiological processes but also in viral infection and cancer. ACKR3 shows strong propensity for activation and, unlike classical chemokine receptors, can respond to chemokines from both the CXC and CC families as well as to the endogenous peptides BAM22 and adrenomedullin. Moreover, despite belonging to the G protein coupled receptor family, its function appears to be mainly dependent on β-arrestin. ACKR3 has also been shown to continuously cycle between the plasma membrane and the endosomal compartments, suggesting a possible role as a scavenging receptor. So far, the molecular basis accounting for these atypical binding and signalling properties remains elusive. Noteworthy, ACKR3 extracellular domains bear three disulphide bridges. Two of them lie on top of the two main binding subpockets and are conserved among chemokine receptors, and one, specific to ACKR3, forms an intra-N terminus four-residue-loop of so far unknown function. Here, by mutational and functional studies, we examined the impact of the different disulphide bridges for ACKR3 folding, ligand binding and activation. We showed that, in contrast to most classical chemokine receptors, none of the extracellular disulphide bridges was essential for ACKR3 function. However, the disruption of the unique ACKR3 N-terminal loop drastically reduced the binding of CC chemokines whereas it only had a mild impact on CXC chemokine binding. Mutagenesis also uncovered that chemokine and endogenous non-chemokine ligands interact and activate ACKR3 according to distinct binding modes characterized by different transmembrane domain subpocket occupancy and N-terminal loop contribution, with BAM22 mimicking the binding mode of CC chemokine N terminus. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. Plasma Chemokines in Patients with Alcohol Use Disorders: Association of CCL11 (Eotaxin-1) with Psychiatric Comorbidity.

    PubMed

    García-Marchena, Nuria; Araos, Pedro Fernando; Barrios, Vicente; Sánchez-Marín, Laura; Chowen, Julie A; Pedraz, María; Castilla-Ortega, Estela; Romero-Sanchiz, Pablo; Ponce, Guillermo; Gavito, Ana L; Decara, Juan; Silva, Daniel; Torrens, Marta; Argente, Jesús; Rubio, Gabriel; Serrano, Antonia; de Fonseca, Fernando Rodríguez; Pavón, Francisco Javier

    2016-01-01

    Recent studies have linked changes in peripheral chemokine concentrations to the presence of both addictive behaviors and psychiatric disorders. The present study further explore this link by analyzing the potential association of psychiatry comorbidity with alterations in the concentrations of circulating plasma chemokine in patients of both sexes diagnosed with alcohol use disorders (AUD). To this end, 85 abstinent subjects with AUD from an outpatient setting and 55 healthy subjects were evaluated for substance and mental disorders. Plasma samples were obtained to quantify chemokine concentrations [C-C motif (CC), C-X-C motif (CXC), and C-X 3 -C motif (CX 3 C) chemokines]. Abstinent AUD patients displayed a high prevalence of comorbid mental disorders (72%) and other substance use disorders (45%). Plasma concentrations of chemokines CXCL12/stromal cell-derived factor-1 ( p  < 0.001) and CX 3 CL1/fractalkine ( p  < 0.05) were lower in AUD patients compared to controls, whereas CCL11/eotaxin-1 concentrations were strongly decreased in female AUD patients ( p  < 0.001). In the alcohol group, CXCL8 concentrations were increased in patients with liver and pancreas diseases and there was a significant correlation to aspartate transaminase ( r  = +0.456, p  < 0.001) and gamma-glutamyltransferase ( r  = +0.647, p  < 0.001). Focusing on comorbid psychiatric disorders, we distinguish between patients with additional mental disorders ( N  = 61) and other substance use disorders ( N  = 38). Only CCL11 concentrations were found to be altered in AUD patients diagnosed with mental disorders ( p  < 0.01) with a strong main effect of sex. Thus, patients with mood disorders ( N  = 42) and/or anxiety ( N  = 16) had lower CCL11 concentrations than non-comorbid patients being more evident in women. The alcohol-induced alterations in circulating chemokines were also explored in preclinical models of alcohol use with male Wistar rats. Rats exposed to repeated ethanol (3 g/kg, gavage) had lower CXCL12 ( p  < 0.01) concentrations and higher CCL11 concentrations ( p  < 0.001) relative to vehicle-treated rats. Additionally, the increased CCL11 concentrations in rats exposed to ethanol were enhanced by the prior exposure to restraint stress ( p  < 0.01). Concordantly, acute ethanol exposure induced changes in CXCL12, CX 3 CL1, and CCL11 in the same direction to repeated exposure. These results clearly indicate a contribution of specific chemokines to the phenotype of AUD and a strong effect of sex, revealing a link of CCL11 to alcohol and anxiety/stress.

  5. CXCR6/CXCL16 functions as a regulator in metastasis and progression of cancer.

    PubMed

    Deng, Ling; Chen, Nianyong; Li, Yan; Zheng, Hong; Lei, Qianqian

    2010-08-01

    Metastasis is considered the obvious mark for most aggressive cancers. However, little is known about the molecular mechanism of the regulation of cancer metastasis. Recent evidence increasingly suggests that the interaction between chemokines and chemokine receptors is pivotal in the process of metastasis. The chemokine receptor CXCR4 and its ligand CXCL12, for example, have been reported to play a vital role in cancer metastasis. Another chemokine and chemokine receptor pair, the CXCL16/CXCR6 axis, has been studied by several independent research groups. Here, we summarize recent advances in our knowledge of the function of CXC chemokine receptor CXCR6 and its ligand CXCL16 in regulating metastasis and invasion of cancer. CXCR6 and CXCL16 are up-regulated in multiple cancer tissue types and cancer cell lines relative to normal tissues and cell lines. In addition, both CXCR6 and CXCL16 levels increase as tumor malignancy increases. Trans-membranous CXCL16 chemokine reduces proliferation while soluble CXCL16 chemokine enhances proliferation and migration. TM-CXCL16 functions as an inducer for lymphocyte build-up around tumor sites. High trans-membranous CXCL16 expression correlates with a good prognosis. Moreover, the Akt/mTOR signal pathway is involved in activating the CXCR6/CXCL16 axis. These findings suggest multiple opportunities for blocking the CXCR6/CXCL16 axis and the Akt/mTOR signal pathway in novel cancer therapies. Copyright 2010 Elsevier B.V. All rights reserved.

  6. The CC chemokine receptor 5 regulates olfactory and social recognition in mice.

    PubMed

    Kalkonde, Y V; Shelton, R; Villarreal, M; Sigala, J; Mishra, P K; Ahuja, S S; Barea-Rodriguez, E; Moretti, P; Ahuja, S K

    2011-12-01

    Chemokines are chemotactic cytokines that regulate cell migration and are thought to play an important role in a broad range of inflammatory diseases. The availability of chemokine receptor blockers makes them an important therapeutic target. In vitro, chemokines are shown to modulate neurotransmission. However, it is not very clear if chemokines play a role in behavior and cognition. Here we evaluated the role of CC chemokine receptor 5 (CCR5) in various behavioral tasks in mice using Wt (Ccr5⁺/⁺) and Ccr5-null (Ccr5⁻/⁻)mice. Ccr5⁻/⁻ mice showed enhanced social recognition. Administration of CC chemokine ligand 3 (CCL3), one of the CCR5-ligands, impaired social recognition. Since the social recognition task is dependent on the sense of olfaction, we tested olfactory recognition for social and non-social scents in these mice. Ccr5⁻/⁻ mice had enhanced olfactory recognition for both these scents indicating that enhanced performance in social recognition task could be due to enhanced olfactory recognition in these mice. Spatial memory and aversive memory were comparable in Wt and Ccr5⁻/⁻ mice. Collectively, these results suggest that chemokines/chemokine receptors might play an important role in olfactory recognition tasks in mice and to our knowledge represents the first direct demonstration of an in vivo role of CCR5 in modulating social behavior in mice. These studies are important as CCR5 blockers are undergoing clinical trials and can potentially modulate behavior. Copyright © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.

  7. Synergistic effect of interleukin-17 and tumour necrosis factor-α on inflammatory response in hepatocytes through interleukin-6-dependent and independent pathways.

    PubMed

    Beringer, A; Thiam, N; Molle, J; Bartosch, B; Miossec, P

    2018-04-20

    The proinflammatory cytokines interleukin (IL)-17 and tumour necrosis factor (TNF)-α are targets for treatment in many chronic inflammatory diseases. Here, we examined their role in liver inflammatory response compared to that of IL-6. Human hepatoma cells (HepaRG, Huh7.5 and HepG2 cells) and primary human hepatocytes (PHH) were cultured with IL-6, IL-17 and/or TNF-α. To determine the contribution of the IL-6 pathway in the IL-17/TNF-α-mediated effect, an anti-IL-6 receptor antibody was used. IL-17 and TNF-α increased in synergy IL-6 secretion by HepaRG cells and PHH but not by Huh7.5 and HepG2 cells. This IL-17/TNF-α synergistic cooperation enhanced the levels of C-reactive protein (CRP) and aspartate aminotransferase (ASAT) in HepaRG cell and PHH cultures through the induction of IL-6. IL-17/TNF-α also up-regulated IL-8, monocyte chemoattractant protein (MCP)-1 and chemokine (C-C motif) ligand 20 (CCL20) chemokines in synergy through an IL-6-independent pathway. Interestingly, first exposure to IL-17, but not to TNF-α, was crucial for the initiation of the IL-17/TNF-α synergistic effect on IL-6 and IL-8 production. In HepaRG cells, IL-17 enhanced IL-6 mRNA stability resulting in increased IL-6 protein levels. The IL-17A/TNF-α synergistic effect on IL-6 and IL-8 induction was mediated through the activation of extracellular signal-regulated kinase (ERK)-mitogen-activated protein kinase, nuclear factor-κB and/or protein kinase B (Akt)-phosphatidylinositol 3-kinase signalling pathways. Therefore, the IL-17/TNF-α synergistic interaction mediates systemic inflammation and cell damage in hepatocytes mainly through IL-6 for CRP and ASAT induction. Independently of IL-6, the IL-17A/TNF-α combination may also induce immune cell recruitment by chemokine up-regulation. IL-17 and/or TNF-α neutralization can be a promising therapeutic strategy to control both systemic inflammation and liver cell attraction. © 2018 British Society for Immunology.

  8. Iron oxide nanoparticles attenuate T helper 17 cell responses in vitro and in vivo.

    PubMed

    Hsiao, Yai-Ping; Shen, Chien-Chang; Huang, Chung-Hsiung; Lin, Yu-Chin; Jan, Tong-Rong

    2018-05-01

    Iron oxide nanoparticles (IONPs) have been shown to attenuate T helper (Th)1 and Th2 cell-mediated immunity in ovalbumin (OVA)-sensitized mice. The objective of this study is to investigate the effects of IONPs on the immune responses of Th17 cells, a subset of T cells involved in various inflammatory pathologies. For in vivo study, a murine model of delayed-type hypersensitivity (DTH) was employed. BALB/c mice received a single dose of IONPs (0.2-10 mg iron/kg) via the tail vein 1 h prior to ovalbumin (OVA) sensitization. Their footpads were subcutaneously challenged with OVA to induce DTH reactions. The expression of Th17 cell-related molecules in inflamed footpads were examined by immunohistochemistry. For in vitro study, OVA-primed splenocytes were directly exposed to IONPs (1-100 μg iron/mL), and then re-stimulated with OVA in culture. The expression of Th17 cell-related molecules were measured by reverse transcription-polymerase chain reaction and enzyme-linked immunosorbent assay. IONP administration attenuated the number of interleukin (IL)-6, IL-17, the transcription factor ROR-γ, and chemokine receptor 6 positive cells in OVA-challenged footpads, whereas the number of transforming growth factor-β, IL-23 and chemokine (C-C motif) ligand 20 positive cells was not altered. Direct exposure of OVA-primed splenocytes to IONPs suppressed the production of IL-6 and IL-17, and the mRNA expression of IL-17 and ROR-γt. These data indicate that exposure to IONPs attenuates Th17 cell responses in vivo and in vitro. Copyright © 2018. Published by Elsevier B.V.

  9. Interleukin-6, Produced by Resident Cells of the Central Nervous System and Infiltrating Cells, Contributes to the Development of Seizures following Viral Infection▿

    PubMed Central

    Libbey, Jane E.; Kennett, Nikki J.; Wilcox, Karen S.; White, H. Steve; Fujinami, Robert S.

    2011-01-01

    Cells that can participate in an innate immune response within the central nervous system (CNS) include infiltrating cells (polymorphonuclear leukocytes [PMNs], macrophages, and natural killer [NK] cells) and resident cells (microglia and sometimes astrocytes). The proinflammatory cytokine interleukin-6 (IL-6) is produced by all of these cells and has been implicated in the development of behavioral seizures in the Theiler's murine encephalomyelitis virus (TMEV)-induced seizure model. The assessment, via PCR arrays, of the mRNA expression levels of a large number of chemokines (ligands and receptors) in TMEV-infected and mock-infected C57BL/6 mice both with and without seizures did not clearly demonstrate the involvement of PMNs, monocytes/macrophages, or NK cells in the development of seizures, possibly due to overlapping function of the chemokines. Additionally, C57BL/6 mice unable to recruit or depleted of infiltrating PMNs and NK cells had seizure rates comparable to those of controls following TMEV infection, and therefore PMNs and NK cells do not significantly contribute to seizure development. In contrast, C57BL/6 mice treated with minocycline, which affects monocytes/macrophages, microglial cells, and PMNs, had significantly fewer seizures than controls following TMEV infection, indicating monocytes/macrophages and resident microglial cells are important in seizure development. Irradiated bone marrow chimeric mice that were either IL-6-deficient mice reconstituted with wild-type bone marrow cells or wild-type mice reconstituted with IL-6-deficient bone marrow cells developed significantly fewer behavioral seizures following TMEV infection. Therefore, both resident CNS cells and infiltrating cells are necessary for seizure development. PMID:21543484

  10. Complement inhibition decreases early fibrogenic events in the lung of septic baboons.

    PubMed

    Silasi-Mansat, Robert; Zhu, Hua; Georgescu, Constantin; Popescu, Narcis; Keshari, Ravi S; Peer, Glenn; Lupu, Cristina; Taylor, Fletcher B; Pereira, Heloise Anne; Kinasewitz, Gary; Lambris, John D; Lupu, Florea

    2015-11-01

    Acute respiratory distress syndrome (ARDS) induced by severe sepsis can trigger persistent inflammation and fibrosis. We have shown that experimental sepsis in baboons recapitulates ARDS progression in humans, including chronic inflammation and long-lasting fibrosis in the lung. Complement activation products may contribute to the fibroproliferative response, suggesting that complement inhibitors are potential therapeutic agents. We have been suggested that treatment of septic baboons with compstatin, a C3 convertase inhibitor protects against ARDS-induced fibroproliferation. Baboons challenged with 10(9) cfu/kg (LD50) live E. coli by intravenous infusion were treated or not with compstatin at the time of challenge or 5 hrs thereafter. Changes in the fibroproliferative response at 24 hrs post-challenge were analysed at both transcript and protein levels. Gene expression analysis showed that sepsis induced fibrotic responses in the lung as early as 24 hrs post-bacterial challenge. Immunochemical and biochemical analysis revealed enhanced collagen synthesis, induction of profibrotic factors and increased cell recruitment and proliferation. Specific inhibition of complement with compstatin down-regulated sepsis-induced fibrosis genes, including transforming growth factor-beta (TGF-β), connective tissue growth factor (CTGF), tissue inhibitor of metalloproteinase 1 (TIMP1), various collagens and chemokines responsible for fibrocyte recruitment (e.g. chemokine (C-C motif) ligand 2 (CCL2) and 12 (CCL12)). Compstatin decreased the accumulation of myofibroblasts and proliferating cells, reduced the production of fibrosis mediators (TGF-β, phospho-Smad-2 and CTGF) and inhibited collagen deposition. Our data demonstrate that complement inhibition effectively attenuates collagen deposition and fibrotic responses in the lung after severe sepsis. Inhibiting complement could prove an attractive strategy for preventing sepsis-induced fibrosis of the lung. © 2015 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  11. Peroxisome-proliferator-activated receptor-{gamma} agonists inhibit the release of proinflammatory cytokines from RSV-infected epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arnold, Ralf; Koenig, Wolfgang

    2006-03-15

    The epithelial cells of the airways are the target cells for respiratory syncytial virus (RSV) infection and the site of the majority of the inflammation associated with the disease. Recently, peroxisome-proliferator-activated receptor {gamma} (PPAR{gamma}), a member of the nuclear hormone receptor superfamily, has been shown to possess anti-inflammatory properties. Therefore, we investigated the role of PPAR{gamma} agonists (15d-PGJ{sub 2}, ciglitazone and troglitazone) on the synthesis of RSV-induced cytokine release from RSV-infected human lung epithelial cells (A549). We observed that all PPAR{gamma} ligands inhibited dose-dependently the release of TNF-{alpha}, GM-CSF, IL-1{alpha}, IL-6 and the chemokines CXCL8 (IL-8) and CCL5 (RANTES) frommore » RSV-infected A549 cells. Concomitantly, the PPAR{gamma} ligands diminished the cellular amount of mRNA encoding for IL-6, CXCL8 and CCL5 and the RSV-induced binding activity of the transcription factors NF-{kappa}B (p65/p50) and AP-1 (c-fos), respectively. Our data presented herein suggest a potential application of PPAR{gamma} ligands in the anti-inflammatory treatment of RSV infection.« less

  12. Increase in chemokine CXCL1 by ERβ ligand treatment is a key mediator in promoting axon myelination.

    PubMed

    Karim, Hawra; Kim, Sung Hoon; Lapato, Andrew S; Yasui, Norio; Katzenellenbogen, John A; Tiwari-Woodruff, Seema K

    2018-06-12

    Estrogen receptor β (ERβ) ligands promote remyelination in mouse models of multiple sclerosis. Recent work using experimental autoimmune encephalomyelitis (EAE) has shown that ERβ ligands induce axon remyelination, but impact peripheral inflammation to varying degrees. To identify if ERβ ligands initiate a common immune mechanism in remyelination, central and peripheral immunity and pathology in mice given ERβ ligands at peak EAE were assessed. All ERβ ligands induced differential expression of cytokines and chemokines, but increased levels of CXCL1 in the periphery and in astrocytes. Oligodendrocyte CXCR2 binds CXCL1 and has been implicated in normal myelination. In addition, despite extensive immune cell accumulation in the CNS, all ERβ ligands promoted extensive remyelination in mice at peak EAE. This finding highlights a component of the mechanism by which ERβ ligands mediate remyelination. Hence, interplay between the immune system and central nervous system may be responsible for the remyelinating effects of ERβ ligands. Our findings of potential neuroprotective benefits arising from the presence of CXCL1 could have implications for improved therapies for multiple sclerosis. Copyright © 2018 the Author(s). Published by PNAS.

  13. Human innate responses and adjuvant activity of TLR ligands in vivo in mice reconstituted with a human immune system.

    PubMed

    Cheng, Liang; Zhang, Zheng; Li, Guangming; Li, Feng; Wang, Li; Zhang, Liguo; Zurawski, Sandra M; Zurawski, Gerard; Levy, Yves; Su, Lishan

    2017-10-27

    TLR ligands (TLR-Ls) represent a class of novel vaccine adjuvants. However, their immunologic effects in humans remain poorly defined in vivo. Using a humanized mouse model with a functional human immune system, we investigated how different TLR-Ls stimulated human innate immune response in vivo and their applications as vaccine adjuvants for enhancing human cellular immune response. We found that splenocytes from humanized mice showed identical responses to various TLR-Ls as human PBMCs in vitro. To our surprise, various TLR-Ls stimulated human cytokines and chemokines differently in vivo compared to that in vitro. For example, CpG-A was most efficient to induce IFN-α production in vitro. In contrast, CpG-B, R848 and Poly I:C stimulated much more IFN-α than CpG-A in vivo. Importantly, the human innate immune response to specific TLR-Ls in humanized mice was different from that reported in C57BL/6 mice, but similar to that reported in nonhuman primates. Furthermore, we found that different TLR-Ls distinctively activated and mobilized human plasmacytoid dendritic cells (pDCs), myeloid DCs (mDCs) and monocytes in different organs. Finally, we showed that, as adjuvants, CpG-B, R848 and Poly I:C can all enhance antigen specific CD4 + T cell response, while only R848 and Poly I:C induced CD8 + cytotoxic T cells response to a CD40-targeting HIV vaccine in humanized mice, correlated with their ability to activate human mDCs but not pDCs. We conclude that humanized mice serve as a highly relevant model to evaluate and rank the human immunologic effects of novel adjuvants in vivo prior to testing in humans. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Profibrogenic chemokines and viral evolution predict rapid progression of hepatitis C to cirrhosis

    PubMed Central

    Farci, Patrizia; Wollenberg, Kurt; Diaz, Giacomo; Engle, Ronald E.; Lai, Maria Eliana; Klenerman, Paul; Purcell, Robert H.; Pybus, Oliver G.; Alter, Harvey J.

    2012-01-01

    Chronic hepatitis C may follow a mild and stable disease course or progress rapidly to cirrhosis and liver-related death. The mechanisms underlying the different rates of disease progression are unknown. Using serial, prospectively collected samples from cases of transfusion-associated hepatitis C, we identified outcome-specific features that predict long-term disease severity. Slowly progressing disease correlated with an early alanine aminotransferase peak and antibody seroconversion, transient control of viremia, and significant induction of IFN-γ and MIP-1β, all indicative of an effective, albeit insufficient, adaptive immune response. By contrast, rapidly progressive disease correlated with persistent and significant elevations of alanine aminotransferase and the profibrogenic chemokine MCP-1 (CCL-2), greater viral diversity and divergence, and a higher rate of synonymous substitution. This study suggests that the long-term course of chronic hepatitis C is determined early in infection and that disease severity is predicted by the evolutionary dynamics of hepatitis C virus and the level of MCP-1, a chemokine that appears critical to the induction of progressive fibrogenesis and, ultimately, the ominous complications of cirrhosis. PMID:22829669

  15. Profibrogenic chemokines and viral evolution predict rapid progression of hepatitis C to cirrhosis.

    PubMed

    Farci, Patrizia; Wollenberg, Kurt; Diaz, Giacomo; Engle, Ronald E; Lai, Maria Eliana; Klenerman, Paul; Purcell, Robert H; Pybus, Oliver G; Alter, Harvey J

    2012-09-04

    Chronic hepatitis C may follow a mild and stable disease course or progress rapidly to cirrhosis and liver-related death. The mechanisms underlying the different rates of disease progression are unknown. Using serial, prospectively collected samples from cases of transfusion-associated hepatitis C, we identified outcome-specific features that predict long-term disease severity. Slowly progressing disease correlated with an early alanine aminotransferase peak and antibody seroconversion, transient control of viremia, and significant induction of IFN-γ and MIP-1β, all indicative of an effective, albeit insufficient, adaptive immune response. By contrast, rapidly progressive disease correlated with persistent and significant elevations of alanine aminotransferase and the profibrogenic chemokine MCP-1 (CCL-2), greater viral diversity and divergence, and a higher rate of synonymous substitution. This study suggests that the long-term course of chronic hepatitis C is determined early in infection and that disease severity is predicted by the evolutionary dynamics of hepatitis C virus and the level of MCP-1, a chemokine that appears critical to the induction of progressive fibrogenesis and, ultimately, the ominous complications of cirrhosis.

  16. IL1R2, CCR2, and CXCR4 May Form Heteroreceptor Complexes with NMDAR and D2R: Relevance for Schizophrenia

    PubMed Central

    Borroto-Escuela, Dasiel O.; Tarakanov, Alexander O.; Bechter, Karl; Fuxe, Kjell

    2017-01-01

    The mild neuroinflammation hypothesis of schizophrenia was introduced by Bechter in 2001. It has been hypothesized that a hypofunction of glutamatergic signaling via N-methyl-D-aspartate receptors (NMDARs) and hyperactivation of dopamine D2 receptors play a role in schizophrenia. The triplet puzzle theory states that sets of triplet amino acid homologies guide two different receptors toward each other and contributes to the formation of a receptor heteromer. It is, therefore, proposed that putative NMDAR-C-C chemokine receptor type 2 (CCR2), NMDAR-C-X-C chemokine receptor type 4 (CXCR4), and NMDAR- interleukin 1 receptor type II (IL1R2) heteromers can be formed in the neuronal networks in mild neuroinflammation due to demonstration of Gly-Leu-Leu (GLL), Val-Ser-Thr (VST), and/or Ser-Val-Ser (SVS) amino acid homologies between these receptor protomers. This molecular process may underlie the ability to produce symptoms of schizophrenia in mild neuroinflammation. In this state, volume transmission (VT) is increased involving increased extracellular vesicle-mediated VT from microglia and astroglia. These vesicles may contain CCR2, CXCR4, and/or IL1R2 as well as their ligands and upon internalization by endocytic pathways into neurons can form heteroreceptor complexes with NMDAR in the plasma membrane with pathological allosteric receptor–receptor interactions involving increased internalization and reduced NMDAR signaling. The triplet puzzle theory also suggests the formation of putative D2R-CCR2, D2R-CXCR4, and D2R-IL1R2 heteromers in mild neuroinflammation in view of their demonstrated sets of Leu-Tyr-Ser (LYS), Leu-Pro-Phe (LPF), and/or Ser-Leu-Ala (SLA) triplet homologies. These D2R heteroreceptor complexes may also contribute to schizophrenia-like symptoms in mild neuroinflammation by enhancing D2R protomer function. PMID:28261115

  17. Effect of oxygen levels on the physiology of dendritic cells: implications for adoptive cell therapy.

    PubMed

    Futalan, Diahnn; Huang, Chien-Tze; Schmidt-Wolf, Ingo G H; Larsson, Marie; Messmer, Davorka

    2011-01-01

    Dendritic cell (DC)-based adoptive tumor immunotherapy approaches have shown promising results, but the incidence of tumor regression is low and there is an evident call for identifying culture conditions that produce DCs with a more potent Th1 potential. Routinely, DCs are differentiated in CO(2) incubators under atmospheric oxygen conditions (21% O(2)), which differ from physiological oxygen levels of only 3-5% in tissue, where most DCs reside. We investigated whether differentiation and maturation of DCs under physiological oxygen levels could produce more potent T-cell stimulatory DCs for use in adoptive immunotherapy. We found that immature DCs differentiated under physiological oxygen levels showed a small but significant reduction in their endocytic capacity. The different oxygen levels did not influence their stimuli-induced upregulation of cluster of differentiation 54 (CD54), CD40, CD83, CD86, C-C chemokine receptor type 7 (CCR7), C-X-C chemokine receptor type 4 (CXCR4) and human leukocyte antigen (HLA)-DR or the secretion of interleukin (IL)-6, tumor necrosis factor (TNF)-α and IL-10 in response to lipopolysaccharide (LPS) or a cytokine cocktail. However, DCs differentiated under physiological oxygen level secreted higher levels of IL-12(p70) after exposure to LPS or CD40 ligand. Immature DCs differentiated at physiological oxygen levels caused increased T-cell proliferation, but no differences were observed for mature DCs with regard to T-cell activation. In conclusion, we show that although DCs generated under atmospheric or physiological oxygen conditions are mostly similar in function and phenotype, DCs differentiated under physiological oxygen secrete larger amounts of IL-12(p70). This result could have implications for the use of ex vivo-generated DCs for clinical studies, since DCs differentiated at physiological oxygen could induce increased Th1 responses in vivo.

  18. Gene Polymorphisms in the CCL5/CCR5 Pathway as a Genetic Biomarker for Outcome and Hand-Foot Skin Reaction in Metastatic Colorectal Cancer Patients Treated With Regorafenib.

    PubMed

    Suenaga, Mitsukuni; Schirripa, Marta; Cao, Shu; Zhang, Wu; Yang, Dongyun; Ning, Yan; Cremolini, Chiara; Antoniotti, Carlotta; Borelli, Beatrice; Mashima, Tetsuo; Okazaki, Satoshi; Berger, Martin D; Miyamoto, Yuji; Gopez, Roel; Barzi, Afsaneh; Lonardi, Sara; Yamaguchi, Toshiharu; Falcone, Alfredo; Loupakis, Fotios; Lenz, Heinz-Josef

    2018-06-01

    The C-C motif chemokine ligand 5/C-C motif chemokine receptor 5 (CCL5/CCR5) pathway has been shown to induce endothelial progenitor cell migration, resulting in increased vascular endothelial growth factor A expression. We hypothesized that genetic polymorphisms in the CCL5/CCR5 pathway predict efficacy and toxicity in patients with metastatic colorectal cancer (mCRC) treated with regorafenib. We analyzed genomic DNA extracted from 229 tumor samples from 2 different cohorts of patients who received regorafenib: an evaluation cohort of 79 Japanese patients and a validation cohort of 150 Italian patients. Single nucleotide polymorphisms of CCL5/CCR5 pathway-related genes were analyzed by PCR-based direct sequencing. CCL4 rs1634517 and CCL3 rs1130371 were associated with progression-free survival in the evaluation cohort (hazard ratio [HR] 1.54, P = .043; HR 1.48, P = .064), and progression-free survival (HR 1.74, P < .001; HR 1.66, P = .002) and overall survival (HR 1.65, P = .004; HR 1.65, P = .004) in the validation cohort. The allelic frequencies of CCL5 single nucleotide polymorphisms varied between the evaluation and validation cohorts (G/G variant in rs2280789, 21.5% vs. 1.3%, P < .001; T/T variant in rs3817655, 22.8% vs. 2.7%, P < .001). In the evaluation cohort, patients with the G/G variant in rs2280789 had a higher incidence of grade 3+ hand-foot skin reaction compared to any A allele (53% vs. 27%, P = .078), and similarly to the T/T variant in rs3817655 compared to any A allele (56% vs. 26%, P = .026). Genetic variants in the CCL5/CCR5 pathway may serve as prognostic markers and may predict severe hand-foot skin reaction in mCRC patients receiving regorafenib therapy. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. From the Cover: Lifelong Exposure of C57bl/6n Male Mice to Bisphenol A or Bisphenol S Reduces Recovery From a Myocardial Infarction.

    PubMed

    Kasneci, Amanda; Lee, Jun Seong; Yun, Tae Jin; Shang, Jijun; Lampen, Shaun; Gomolin, Tamar; Cheong, Cheolho C; Chalifour, Lorraine E

    2017-09-01

    Bisphenol A (BPA) leaches from plastics to contaminate foodstuffs. Analogs, such as bisphenol S (BPS), are now used increasingly in manufacturing. Greater BPA exposure has been correlated with exacerbation of cardiovascular disease, including myocardial infarction (MI). To test the hypothesis that bisphenol exposure impairs cardiac healing, we exposed C57bl/6n mice to water containing 25ng/ml BPA or BPS from conception and surgically induced an MI in adult male progeny. Increased early death and cardiac dilation, and reduced cardiac function were found post-MI in BPA- and BPS-exposed mice. Flow cytometry revealed increased monocyte and macrophage infiltration that correlated with increased chemokine C-C motif ligand-2 expression in the infarct. In vitro BPA and BPS addition increased matrix metalloproteinase-9 (MMP) protein and secreted activity in RAW264.7 macrophage cells suggesting that invivo increases in MMP2 and MMP9 in exposed infarcts were myeloid-derived. Bone marrow-derived monocytes isolated from exposed mice had greater expression of pro-inflammatory polarization markers when chemokine stimulated indicating an enhanced susceptibility to develop a pro-inflammatory monocyte population. Chronic BPA exposure of estrogen receptor beta (ERβ) deficient mice did not worsen early death, cardiac structure/function, or expression of myeloid markers after an MI. In contrast, BPS exposure of ERβ-deficient mice resulted in greater death and expression of myeloid markers. We conclude that lifelong exposure to BPA or BPS augmented the monocyte/macrophage inflammatory response and adverse remodeling from an MI thereby reducing the ability to survive and successfully recover, and that the adverse effect of BPA, but not BPS, is downstream of ERβ signaling. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. In a murine tuberculosis model, the absence of homeostatic chemokines delay granuloma formation and protective immunity

    PubMed Central

    Khader, Shabaana A.; Rangel-Moreno, Javier; Fountain, Jeffrey J.; Martino, Cynthia A; Reiley, William W; Pearl, John E.; Winslow, Gary M; Woodland, David L; Randall, Troy D; Cooper, Andrea M.

    2009-01-01

    Mycobacterium tuberculosis infection results in the generation of protective cellular immunity and formation of granulomatous structures in the lung. CXC chemokine ligand (CXCL)-13, CC chemokine ligand (CCL)-21 and CCL19 are constitutively expressed in the secondary lymphoid organs and play a dominant role in the homing of lymphocytes and dendritic cells. Although it is known that dendritic cell transport of M. tuberculosis from the lung to the draining lymph node is dependent on CCL19/CCL21, we show here that CCL19/CCL21 is also important for the accumulation of antigen-specific IFNγ-producing T cells in the lung, development of the granuloma, and control of mycobacteria. Importantly, we also show that CXCL13 is not required for generation of IFNγ responses, but is essential for the spatial arrangement of lymphocytes within granulomas, optimal activation of phagocytes and subsequent control of mycobacterial growth. Further, we show that these chemokines are also induced in the lung during the early immune responses following pulmonary M. tuberculosis infection. These results demonstrate that homeostatic chemokines perform distinct functions that cooperate to mediate effective expression of immunity against M. tuberculosis infection. PMID:19933855

  1. Deficiency of endothelial CXCR4 reduces reendothelialization and enhances neointimal hyperplasia after vascular injury in atherosclerosis-prone mice.

    PubMed

    Noels, Heidi; Zhou, Baixue; Tilstam, Pathricia V; Theelen, Wendy; Li, Xiaofeng; Pawig, Lukas; Schmitz, Corinna; Akhtar, Shamima; Simsekyilmaz, Sakine; Shagdarsuren, Erdenechimeg; Schober, Andreas; Adams, Ralf H; Bernhagen, Jürgen; Liehn, Elisa A; Döring, Yvonne; Weber, Christian

    2014-06-01

    The Cxcl12/Cxcr4 chemokine ligand/receptor axis mediates the mobilization of smooth muscle cell progenitors, driving injury-induced neointimal hyperplasia. This study aimed to investigate the role of endothelial Cxcr4 in neointima formation. β-Galactosidase staining using bone marrow x kinase (Bmx)-CreER(T2) reporter mice and double immunofluorescence revealed an efficient and endothelial-specific deletion of Cxcr4 in Bmx-CreER(T2+) compared with Bmx-CreER(T2-) Cxcr4-floxed apolipoprotein E-deficient (Apoe(-/-)) mice (referred to as Cxcr4(EC-KO)ApoE(-/-) and Cxcr4(EC-WT) ApoE(-/-), respectively). Endothelial Cxcr4 deficiency significantly increased wire injury-induced neointima formation in carotid arteries from Cxcr4(EC-KO)ApoE(-/-) mice. The lesions displayed a higher number of macrophages, whereas the smooth muscle cell and collagen content were reduced. This was associated with a significant reduction in reendothelialization and endothelial cell proliferation in injured Cxcr4(EC-KO)ApoE(-/-) carotids compared with Cxcr4(EC-WT)ApoE(-/-) controls. Furthermore, stimulation of human aortic endothelial cells with chemokine (C-X-C motif) ligand 12 (CXCL12) significantly enhanced their wound-healing capacity in an in vitro scratch assay, an effect that could be reversed with the CXCR4 antagonist AMD3100. Also, flow cytometric analysis showed a reduced mobilization of Sca1(+)Flk1(+)Cd31(+) and of Lin(-)Sca1(+) progenitors in Cxcr4(EC-KO) ApoE(-/-) mice after vascular injury, although Cxcr4 surface expression was unaltered. No differences could be detected in plasma concentrations of Cxcl12, vascular endothelial growth factor, sphingosine 1-phosphate, or Flt3 (fms-related tyrosine kinase 3) ligand, all cytokines with an established role in progenitor cell mobilization. Nonetheless, double immunofluorescence revealed a significant reduction in local endothelial Cxcl12 staining in injured carotids from Cxcr4(EC-KO)ApoE(-/-) mice. Endothelial Cxcr4 is crucial for efficient reendothelialization after vascular injury through endothelial wound healing and proliferation, and through the mobilization of Sca1(+)Flk1(+)Cd31(+) cells, often referred to as circulating endothelial progenitor cells. © 2014 American Heart Association, Inc.

  2. Transforming growth factor-β stimulates the expression of eotaxin/CC chemokine ligand 11 and its promoter activity through binding site for nuclear factor-κB in airway smooth muscle cells

    PubMed Central

    Matsukura, S.; Odaka, M.; Kurokawa, M.; Kuga, H.; Homma, T.; Takeuchi, H.; Notomi, K.; Kokubu, F.; Kawaguchi, M.; Schleimer, R. P.; Johnson, M. W.; Adachi, M.

    2013-01-01

    Summary Background Chemokines ligands of CCR3 including eotaxin/CC chemokine ligand 11 (CCL11) may contribute to the pathogenesis of asthma. These chemokines and a growth factor (TGF-β) may be involved in the process of airway remodelling. Objective We analysed the effects of TGF-β on the expression of CCR3 ligands in human airway smooth muscle (HASM) cells and investigated the mechanisms. Methods HASM cells were cultured and treated with TGF-β and Th2 cytokines IL-4 or IL-13. Expression of mRNA was analysed by real-time PCR. Secretion of CCL11 into the culture medium was analysed by ELISA. Transcriptional regulation of CCL11 was analysed by luciferase assay using CCL11 promoter-luciferase reporter plasmids. Results IL-4 or IL-13 significantly up-regulated the expression of mRNAs for CCL11 and CCL26. TGF-β alone did not increase the expression of chemokine mRNAs, but enhanced the induction of only CCL11 by IL-4 or IL-13 among CCR3 ligands. Activity of the CCL11 promoter was stimulated by IL-4, and this activity was enhanced by TGF-β. Activation by IL-4 or IL-4 plus TGF-β was lost by mutation of the binding site for signal transducers and activators of transcription-6 (STAT6) in the promoter. Cooperative activation by IL-4 and TGF-β was inhibited by mutation of the binding site for nuclear factor-κB (NF-κB) in the promoter. Pretreatment with an inhibitor of NF-κB and glucocorticoid fluticasone propionate significantly inhibited the expression of CCL11 mRNA induced by IL-4 plus TGF-β, indicating the importance of NF-κB in the cooperative activation of CCL11 transcription by TGF-β and IL-4. Conclusion These results indicate that Th2 cytokines and TGF-β may contribute to the pathogenesis of asthma by stimulating expression of CCL11. The transcription factors STAT6 and NF-κB may play pivotal roles in this process. PMID:20214667

  3. Transforming growth factor-β stimulates the expression of eotaxin/CC chemokine ligand 11 and its promoter activity through binding site for nuclear factor-κβ in airway smooth muscle cells.

    PubMed

    Matsukura, S; Odaka, M; Kurokawa, M; Kuga, H; Homma, T; Takeuchi, H; Notomi, K; Kokubu, F; Kawaguchi, M; Schleimer, R P; Johnson, M W; Adachi, M

    2010-05-01

    Chemokines ligands of CCR3 including eotaxin/CC chemokine ligand 11 (CCL11) may contribute to the pathogenesis of asthma. These chemokines and a growth factor (TGF-beta) may be involved in the process of airway remodelling. We analysed the effects of TGF-beta on the expression of CCR3 ligands in human airway smooth muscle (HASM) cells and investigated the mechanisms. HASM cells were cultured and treated with TGF-beta and Th2 cytokines IL-4 or IL-13. Expression of mRNA was analysed by real-time PCR. Secretion of CCL11 into the culture medium was analysed by ELISA. Transcriptional regulation of CCL11 was analysed by luciferase assay using CCL11 promoter-luciferase reporter plasmids. IL-4 or IL-13 significantly up-regulated the expression of mRNAs for CCL11 and CCL26. TGF-beta alone did not increase the expression of chemokine mRNAs, but enhanced the induction of only CCL11 by IL-4 or IL-13 among CCR3 ligands. Activity of the CCL11 promoter was stimulated by IL-4, and this activity was enhanced by TGF-beta. Activation by IL-4 or IL-4 plus TGF-beta was lost by mutation of the binding site for signal transducers and activators of transcription-6 (STAT6) in the promoter. Cooperative activation by IL-4 and TGF-beta was inhibited by mutation of the binding site for nuclear factor-kappaB (NF-kappaB) in the promoter. Pretreatment with an inhibitor of NF-kappaB and glucocorticoid fluticasone propionate significantly inhibited the expression of CCL11 mRNA induced by IL-4 plus TGF-beta, indicating the importance of NF-kappaB in the cooperative activation of CCL11 transcription by TGF-beta and IL-4. These results indicate that Th2 cytokines and TGF-beta may contribute to the pathogenesis of asthma by stimulating expression of CCL11. The transcription factors STAT6 and NF-kappaB may play pivotal roles in this process.

  4. Consequences of ChemR23 Heteromerization with the Chemokine Receptors CXCR4 and CCR7

    PubMed Central

    de Poorter, Cédric; Baertsoen, Kevin; Lannoy, Vincent; Parmentier, Marc; Springael, Jean-Yves

    2013-01-01

    Recent studies have shown that heteromerization of the chemokine receptors CCR2, CCR5 and CXCR4 is associated to negative binding cooperativity. In the present study, we build on these previous results, and investigate the consequences of chemokine receptor heteromerization with ChemR23, the receptor of chemerin, a leukocyte chemoattractant protein structurally unrelated to chemokines. We show, using BRET and HTRF assays, that ChemR23 forms homomers, and provide data suggesting that ChemR23 also forms heteromers with the chemokine receptors CCR7 and CXCR4. As previously described for other chemokine receptor heteromers, negative binding cooperativity was detected between ChemR23 and chemokine receptors, i.e. the ligands of one receptor competed for the binding of a specific tracer of the other. We also showed, using mouse bone marrow-derived dendritic cells prepared from wild-type and ChemR23 knockout mice, that ChemR23-specific ligands cross-inhibited CXCL12 binding on CXCR4 in a ChemR23-dependent manner, supporting the relevance of the ChemR23/CXCR4 interaction in native leukocytes. Finally, and in contrast to the situation encountered for other previously characterized CXCR4 heteromers, we showed that the CXCR4-specific antagonist AMD3100 did not cross-inhibit chemerin binding in cells co-expressing ChemR23 and CXCR4, demonstrating that cross-regulation by AMD3100 depends on the nature of receptor partners with which CXCR4 is co-expressed. PMID:23469143

  5. Consequences of ChemR23 heteromerization with the chemokine receptors CXCR4 and CCR7.

    PubMed

    de Poorter, Cédric; Baertsoen, Kevin; Lannoy, Vincent; Parmentier, Marc; Springael, Jean-Yves

    2013-01-01

    Recent studies have shown that heteromerization of the chemokine receptors CCR2, CCR5 and CXCR4 is associated to negative binding cooperativity. In the present study, we build on these previous results, and investigate the consequences of chemokine receptor heteromerization with ChemR23, the receptor of chemerin, a leukocyte chemoattractant protein structurally unrelated to chemokines. We show, using BRET and HTRF assays, that ChemR23 forms homomers, and provide data suggesting that ChemR23 also forms heteromers with the chemokine receptors CCR7 and CXCR4. As previously described for other chemokine receptor heteromers, negative binding cooperativity was detected between ChemR23 and chemokine receptors, i.e. the ligands of one receptor competed for the binding of a specific tracer of the other. We also showed, using mouse bone marrow-derived dendritic cells prepared from wild-type and ChemR23 knockout mice, that ChemR23-specific ligands cross-inhibited CXCL12 binding on CXCR4 in a ChemR23-dependent manner, supporting the relevance of the ChemR23/CXCR4 interaction in native leukocytes. Finally, and in contrast to the situation encountered for other previously characterized CXCR4 heteromers, we showed that the CXCR4-specific antagonist AMD3100 did not cross-inhibit chemerin binding in cells co-expressing ChemR23 and CXCR4, demonstrating that cross-regulation by AMD3100 depends on the nature of receptor partners with which CXCR4 is co-expressed.

  6. Collagen-derived N-acetylated proline-glycine-proline upregulates the expression of pro-inflammatory cytokines and extracellular matrix proteases in nucleus pulposus cells via the NF-κB and MAPK signaling pathways.

    PubMed

    Feng, Chencheng; He, Jinyue; Zhang, Yang; Lan, Minghong; Yang, Minghui; Liu, Huan; Huang, Bo; Pan, Yong; Zhou, Yue

    2017-07-01

    N-acetylated proline-glycine-proline (N-Ac-PGP) is a chemokine involved in inflammatory diseases and is found to accumulate in degenerative discs. N-Ac-PGP has been demonstrated to have a pro-inflammatory effect on human cartilage endplate stem cells. However, the effect of N-Ac-PGP on human intervertebral disc cells, especially nucleus pulposus (NP) cells, remains unknown. The purpose of this study was to investigate the effect of N-Ac-PGP on the expression of pro-inflammatory factors and extracellular matrix (ECM) proteases in NP cells and the molecular mechanism underlying this effect. Therefore, Milliplex assays were used to detect the levels of various inflammatory cytokines in conditioned culture medium of NP cells treated with N-Ac-PGP, including interleukin-1β (IL-1β), IL-6, IL-17, tumor necrosis factor-α (TNF-α) and C-C motif ligand 2 (CCL2). RT-qPCR was also used to determine the expression of pro-inflammatory cytokines and ECM proteases in the NP cells treated with N-Ac-PGP. Moreover, the role of nuclear factor-κB (NF-κB) and mitogen-activated protein kinase (MAPK) signaling pathways in mediating the effect of N-Ac-PGP on the phenotype of NP cells was investigated using specific signaling inhibitors. Milliplex assays showed that NP cells treated with N-Ac-PGP (10 and 100 µg/ml) secreted higher levels of IL-1β, IL-6, IL-17, TNF-α and CCL2 compared with the control. RT-qPCR assays showed that NP cells treated with N-Ac-PGP (100 µg/ml) had markedly upregulated expression of matrix metalloproteinase 3 (MMP3), MMP13, a disintegrin and metalloproteinase with thrombospondin motif 4 (ADAMTS4), ADAMTS5, IL-6, CCL-2, CCL-5 and C-X-C motif chemokine ligand 10 (CXCL10). Moreover, N-Ac-PGP was shown to activate the MAPK and NF-κB signaling pathways in NP cells. MAPK and NF-κB signaling inhibitors suppressed the upregulation of proteases and pro-inflammatory cytokines in NP cells treated with N-Ac-PGP. In conclusion, N-Ac-PGP induces the expression of pro-inflammatory cytokines and matrix catabolic enzymes in NP cells via the NF-κB and MAPK signaling pathways. N-Ac-PGP is a novel therapeutic target for intervertebral disc degeneration.

  7. Small Molecular Weight Soybean Protein-Derived Peptides Nutriment Attenuates Rat Burn Injury-Induced Muscle Atrophy by Modulation of Ubiquitin-Proteasome System and Autophagy Signaling Pathway.

    PubMed

    Zhao, Fen; Yu, Yonghui; Liu, Wei; Zhang, Jian; Liu, Xinqi; Liu, Lingying; Yin, Huinan

    2018-03-21

    This article describes results of the effect of dietary supplementation with small molecular weight soybean protein-derived peptides on major rat burn injury-induced muscle atrophy. As protein nutrients have been previously implicated to play an important role in improving burn injury outcomes, optimized more readily absorbed small molecular weight soybean protein-derived peptides were evaluated. Thus, the quantity, sodium dodecyl sulfate polyacrylamide-gel electrophoresis patterns, molecular weight distribution, and composition of amino acids of the prepared peptides were analyzed, and a major full-thickness 30% total body surface area burn-injury rat model was utilized to assess the impact of supplementation with soybean protein-derived peptides on initial systemic inflammatory responses as measured by interferon-gamma (IFN-γ), chemokine (C-C motif) ligand 2 (CCL2, also known as MCP-1), chemokine (C-C motif) ligand 7 (CCL7, also known as MCP-3), and generation of muscle atrophy as measured by tibialis anterior muscle (TAM) weight relative to total body weight. Induction of burn injury-induced muscle atrophy ubiquitin-proteasome system (UPS) signaling pathways in effected muscle tissues was determined by Western blot protein expression measurements of E3 ubiquitin-protein ligase TRIM-63 (TRIM63, also known as MuRF1) and F-box only protein 32 (FBXO32, also known as atrogin-1 or MAFbx). In addition, induction of burn injury-induced autophagy signaling pathways associated with muscle atrophy in effected muscle tissues was assessed by immunohistochemical analysis as measured by microtubule-associated proteins 1 light chain 3 (MAP1LC3, or commonly abbreviated as LC3) and beclin-1 (BECN1) expression, as well as relative induction of cytoplasmic-liberated form of MAP1LC3 (LC3-I) and phagophore and autophagosome membrane-bound form of MAP1LC3 (LC3-II), and BECN1 protein expression by Western blot analysis. Nutrient supplementation with small molecular weight soybean protein-derived peptides resulted a significant reduction in burn injury-induced inflammatory markers, muscle atrophy, induction of TRIM63 and FBXO32 muscle atrophy signaling pathways, and induction of autophagy signaling pathways LC3 and BECN1 associated with muscle atrophy. These results implicated that small molecular weight soybean-derived peptides dietary supplementation could be used as an adjunct therapy in burn injury management to reduce the development or severity of muscle atrophy for improved burn patient outcomes.

  8. Dynamic conformational switching in the chemokine ligand is essential for G-protein-coupled receptor activation

    PubMed Central

    Joseph, Prem Raj B.; Sawant, Kirti V.; Isley, Angela; Pedroza, Mesias; Garofalo, Roberto P.; Richardson, Ricardo M.; Rajarathnam, Krishna

    2014-01-01

    Chemokines mediate diverse functions from organogenesis to mobilizing leucocytes, and are unusual agonists for class-A GPCRs (G-protein-coupled receptors) because of their large size and multi-domain structure. The current model for receptor activation, which involves interactions between chemokine N-loop and receptor N-terminal residues (Site-I) and between chemokine N-terminal and receptor extracellular loop/transmembrane residues (Site-II), fails to describe differences in ligand/receptor selectivity and the activation of multiple signalling pathways. In the present study, we show in neutrophil-activating chemokine CXCL8 that the highly conserved GP (glycine-proline) motif located distal to both N-terminal and N-loop residues couples Site-I and Site-II interactions. Mutations in the GP motif caused various differences from native-like function to complete loss of activity that could not be correlated with the specific mutation, receptor affinity or subtype, or a specific signalling pathway. NMR studies indicated that the GP motif does not influence Site-I interactions, but molecular dynamics simulations suggested that this motif dictates substates of the CXCL8 conformational ensemble. We conclude that the GP motif enables diverse receptor functions by controlling cross-talk between Site-I and Site-II, and further propose that the repertoire of chemokine functions is best described by a conformational ensemble model in which a network of long-range coupled indirect interactions mediate receptor activity. PMID:24032673

  9. Trichuris suis-induced modulation of human dendritic cell function is glycan-mediated.

    PubMed

    Klaver, Elsenoor J; Kuijk, Loes M; Laan, Lisa C; Kringel, Helene; van Vliet, Sandra J; Bouma, Gerd; Cummings, Richard D; Kraal, Georg; van Die, Irma

    2013-03-01

    Human monocyte-derived dendritic cells (DCs) show remarkable phenotypic changes upon direct contact with soluble products (SPs) of Trichuris suis, a pig whipworm that is experimentally used in therapies to ameliorate inflammation in patients with Crohn's disease and multiple sclerosis. These changes may contribute to the observed induction of a T helper 2 (Th2) response and the suppression of Toll-like receptor (TLR)-induced Th1 and Th17 responses by human DCs primed with T. suis SPs. Here it is demonstrated that glycans of T. suis SPs contribute significantly to the suppression of the lipopolysaccharide (LPS)-induced expression in DCs of a broad variety of cytokines and chemokines, including important pro-inflammatory mediators such as TNF-α, IL-6, IL-12, lymphotoxin α (LTA), C-C Motif Ligand (CCL)2, C-X-C Motif Ligands (CXCL)9 and CXCL10. In addition, the data show that human DCs strongly bind T. suis SP-glycans via the C-type lectin receptors (CLRs) mannose receptor (MR) and DC-specific ICAM-3-grabbing non-integrin (DC-SIGN). The interaction of DCs with T. suis glycans likely involves mannose-type glycans, rather than fucosylated glycans, which differs from DC binding to soluble egg antigens of the human worm parasite, Schistosoma mansoni. In addition, macrophage galactose-type lectin (MGL) recognises T. suis SPs, which may contribute to the interaction with immature DCs or other MGL-expressing immune cells such as macrophages. The interaction of T. suis glycans with CLRs of human DCs may be essential for the ability of T. suis to suppress a pro-inflammatory phenotype of human DCs. The finding that the T. suis-induced modulation of human DC function is glycan-mediated is novel and indicates that helminth glycans contribute to the dampening of inflammation in a wide range of human inflammatory diseases. Copyright © 2012 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  10. Interleukin-29 induces epithelial production of CXCR3A ligands and T-cell infiltration.

    PubMed

    Witte, Ellen; Kokolakis, Georgios; Witte, Katrin; Warszawska, Katarzyna; Friedrich, Markus; Christou, Demetrios; Kirsch, Stefan; Sterry, Wolfram; Volk, Hans-Dieter; Sabat, Robert; Wolk, Kerstin

    2016-04-01

    Psoriasis is considered as a model for chronic immune-mediated disorders. Th17-cells are pivotal players in those diseases. Recently, we demonstrated that Th17-cells produce interleukin (IL)-29 and that IL-29 is highly present in psoriatic lesions. Whether IL-29, with its action on epithelial cells and melanocytes, contributes to psoriasis pathogenesis, was unknown so far. Analysis of IL-29-treated human keratinocytes revealed induction of the chemokines CXCL10, CXCL11, and, to a much lesser extent, CXCL9. Unlike these CXCR3A ligands, known to attract Th1-, CD8(+), NK-, and Th1/Th17 transient cells, no influence was found on chemokines attracting other immune cell populations or on molecules modulating the CXCR3A/CXCR3A ligand interaction. CXCR3A ligand expression was also induced by IL-29 in melanocytes and in epidermis models and explanted skin. Regarding other psoriasis-relevant cytokines, interferon-γ and, less potently, tumor necrosis factor-α and IL-1β shared and strengthened IL-29's capacity. Murine IL-29 counterpart injected into mouse skin provoked local CXCL10 and CXCL11 expression, T-cell infiltration, and, in consequence, skin swelling. The elevated IL-29 expression in psoriatic lesions was associated with upregulation of CXCR3A ligands compared to non-lesional skin of these patients and to the skin of healthy donors and atopic dermatitis patients, which lack IL-29 production. Importantly, neutralization of IL-29 reduced CXCR3A ligand levels in explant cultures of psoriatic lesions. Finally, elevated blood CXCL11 levels were found in psoriasis that might be useful for monitoring lesional activity of the IL-29 axis. In summary, the Th17-cytokine IL-29 induces specific chemokines and, in consequence, provokes skin infiltration of potentially pathogenic T-cells. IL-29 selectively induces CXCR3A-binding chemokines (CXCL9, CXCL10, CXCL11) in skin cells. Murine IL-29 counterpart induces skin T-cell infiltration and inflammation in mice. CXCR3A ligands are IL-29-dependently increased in lesional skin of psoriasis patients. CXCR3A ligand levels in psoriatic skin correlate with epidermal T-cell numbers. Increased blood CXCL11 levels in psoriasis may be a biomarker for local IL-29 action.

  11. Atypical chemokine receptors in cancer: friends or foes?

    PubMed

    Massara, Matteo; Bonavita, Ornella; Mantovani, Alberto; Locati, Massimo; Bonecchi, Raffaella

    2016-06-01

    The chemokine system is a fundamental component of cancer-related inflammation involved in all stages of cancer development. It controls not only leukocyte infiltration in primary tumors but also angiogenesis, cancer cell proliferation, and migration to metastatic sites. Atypical chemokine receptors are a new, emerging class of regulators of the chemokine system. They control chemokine bioavailability by scavenging, transporting, or storing chemokines. They can also regulate the activity of canonical chemokine receptors with which they share the ligands by forming heterodimers or by modulating their expression levels or signaling activity. Here, we summarize recent results about the role of these receptors (atypical chemokine receptor 1/Duffy antigen receptor for chemokine, atypical chemokine receptor 2/D6, atypical chemokine receptor 3/CXC-chemokine receptor 7, and atypical chemokine receptor 4/CC-chemokine receptor-like 1) on the tumorigenesis process, indicating that their effects are strictly dependent on the cell type on which they are expressed and on their coexpression with other chemokine receptors. Indeed, atypical chemokine receptors inhibit tumor growth and progression through their activity as negative regulators of chemokine bioavailability, whereas, on the contrary, they can promote tumorigenesis when they regulate the signaling of other chemokine receptors, such as CXC-chemokine receptor 4. Thus, atypical chemokine receptors are key components of the regulatory network of inflammation and immunity in cancer and may have a major effect on anti-inflammatory and immunotherapeutic strategies. © Society for Leukocyte Biology.

  12. Expression of CXCR7 chemokine receptor in human meningioma cells and in intratumoral microvasculature.

    PubMed

    Würth, Roberto; Barbieri, Federica; Bajetto, Adriana; Pattarozzi, Alessandra; Gatti, Monica; Porcile, Carola; Zona, Gianluigi; Ravetti, Jean-Louis; Spaziante, Renato; Florio, Tullio

    2011-05-01

    CXCR4 and CXCR7 chemokine receptors, and their ligands CXCL11 and CXCL12, have been often involved in tumor cell proliferation and survival. We report the expression pattern of these ligand/receptor pairs in 22 human meningiomas. High CXCR7 and CXCL12 expression was associated with high-proliferative tumors. CXCR7 levels were correlated to the content of both ligands, suggesting a possible autocrine regulation. CXCR4 and CXCL12 were homogeneously expressed within tumor cells, while CXCR7 was mainly detected in tumor endothelial cells and CXCL11 in pericytes. Our results highlight the preferential CXCR7 and CXCL12 expression within more aggressive tumors and the possible role of CXCR7 in meningioma vascularization. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Chemokine CCR3 ligands-binding peptides derived from a random phage-epitope library.

    PubMed

    Houimel, Mehdi; Mazzucchelli, Luca

    2013-01-01

    Eosinophils are major effectors cells implicated in a number of chronic inflammatory diseases in humans, particularly bronchial asthma and allergic rhinitis. The human chemokine receptor C-C receptor 3 (hCCR3) provides a mechanism for the recruitment of eosinophils into tissue and thus has recently become an attractive biological target for therapeutic intervention. In order to develop peptides antagonists of hCCR3-hCCL11 (human eotaxin) interactions, a random bacteriophage hexapeptide library was used to map structural features of hCCR3 by determining the epitopes of neutralizing anti-hCCR3 mAb 7B11. This mAb t is selective for hCCR3 and exhibit potent antagonist activity in receptor binding and functional assays. After three rounds of biopanning, four mAb7B11-binding peptides were identified from a 6-mer linear peptide library. The phage bearing the peptides showed specific binding to immobilized mAb 7B11 with over 94% of phages bound being competitively inhibited by free synthetic peptides. In FACScan analysis all selected phage peptides were able to strongly inhibit the binding of mAb 7B11 to hCCR3-transfected preB-300-19 murine cells. Furthermore, synthetic peptides of the corresponding phage epitopes were effective in blocking the antibody-hCCR3 interactions and to inhibit the binding of hCCL11 to hCCR3 transfectants. Chemically synthesized peptides CKGERF, FERKGK, SSMKVK and RHVSSQ, effectively competed for (125)I-hCCL11 binding to hCCR3 with IC(50) ranging from 3.5 to 9.7μM. Calcium release and chemotaxis of hCCR3 transfectants or human eosinophils were inhibited by all peptides in a dose-dependent manner. Furthermore, they showed inhibitory effects on chemotaxis of human eosinophils induced by hCCL11, hCCL5, hCCL7, hCCL8, and hCCL24. Specificities of all selected peptides were assessed with hCXCR1, hCXCR2, hCXCR3, and hCCR5 receptors. Peptides CKGERF and FERKGK showed inhibitory effects on eosinophil chemotaxis in a murine model of mCCL11-induced peritoneal eosinophilia. The development of peptides inhibiting the interactions between hCCR3 and its chemokine ligands will facilitate the development of small peptides antagonists with the hope of ameliorating chronic inflammatory diseases in humans. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Chemokine axes CXCL12/CXCR4 and CXCL16/CXCR6 correlate with lymph node metastasis in epithelial ovarian carcinoma

    PubMed Central

    Guo, Li; Cui, Zhu-Mei; Zhang, Jia; Huang, Yu

    2011-01-01

    Recent evidence suggests that the chemokine axis of CXC chemokine ligand-12 and its receptor CXC chemokine receptor-4 (CXCL12/CXCR4) is highly expressed in gynecological tumors and the axis of CXC chemokine ligand-16 and CXC chemokine receptor-6 (CXCL16/CXCR6) is overexpressed in inflammation-associated tumors. This study aimed to determine the relationship between CXCL12/CXCR4, CXCL16/CXCR6 and ovarian carcinoma's clinicopathologic features and prognosis. Accordingly, the expression of these proteins in ovarian tissues was detected by tissue microarray and immunohistochemistry. The expressions of CXCL12/CXCR4 and CXCL16/CXCR6 were significantly higher in epithelial ovarian carcinomas than in normal epithelial ovarian tissues or benign epithelial ovarian tumors. The expression of chemokines CXCL12 and CXCL16 were positively correlated with their receptors CXCR4 and CXCR6 in ovarian carcinoma, respectively (r = 0.300, P < 0.05; r = 0.395, P < 0.05). Moreover, the expression of CXCL12 was related to the occurrence of ascites (χ2 = 4.76, P < 0.05), the expression of CXCR4 was significantly related to lymph node metastasis (χ2 = 4.37, P < 0.05), the expression of CXCR6 was significantly related to lymph node metastasis (χ2 = 7.43, P < 0.05) and histological type (χ2 = 33.48, P < 0.05). In univariate analysis, the expression of CXCR4 and CXCL16 significantly correlated with reduced median survival (χ2 = 4.67, P < 0.05; χ2 = 4.48, P < 0.05). Therefore, we conclude that the chemokine axes CXCL12/CXCR4 and CXCL16/CXCR6 may play important roles in the growth, proliferation, invasion, and metastasis of epithelial ovarian carcinoma. PMID:21527066

  15. Chemokine axes CXCL12/CXCR4 and CXCL16/CXCR6 correlate with lymph node metastasis in epithelial ovarian carcinoma.

    PubMed

    Guo, Li; Cui, Zhu-Mei; Zhang, Jia; Huang, Yu

    2011-05-01

    Recent evidence suggests that the chemokine axis of CXC chemokine ligand-12 and its receptor CXC chemokine receptor-4 (CXCL12/CXCR4) is highly expressed in gynecological tumors and the axis of CXC chemokine ligand-16 and CXC chemokine receptor-6 (CXCL16/CXCR6) is overexpressed in inflammation-associated tumors. This study aimed to determine the relationship between CXCL12/CXCR4, CXCL16/CXCR6 and ovarian carcinoma's clinicopathologic features and prognosis. Accordingly, the expression of these proteins in ovarian tissues was detected by tissue microarray and immunohistochemistry. The expressions of CXCL12/CXCR4 and CXCL16/CXCR6 were significantly higher in epithelial ovarian carcinomas than in normal epithelial ovarian tissues or benign epithelial ovarian tumors. The expression of chemokines CXCL12 and CXCL16 were positively correlated with their receptors CXCR4 and CXCR6 in ovarian carcinoma, respectively (r = 0.300, P < 0.05; r = 0.395, P < 0.05). Moreover, the expression of CXCL12 was related to the occurrence of ascites (Χ² = 4.76, P < 0.05), the expression of CXCR4 was significantly related to lymph node metastasis (Χ(2) = 4.37, P < 0.05), the expression of CXCR6 was significantly related to lymph node metastasis (Χ² = 7.43, P < 0.05) and histological type (Χ² = 33.48, P < 0.05). In univariate analysis, the expression of CXCR4 and CXCL16 significantly correlated with reduced median survival (Χ² = 4.67, P < 0.05; Χ² = 4.48, P < 0.05). Therefore, we conclude that the chemokine axes CXCL12/CXCR4 and CXCL16/CXCR6 may play important roles in the growth, proliferation, invasion, and metastasis of epithelial ovarian carcinoma.

  16. Regulation of MMP-3 expression and secretion by the chemokine eotaxin-1 in human chondrocytes.

    PubMed

    Chao, Pin-Zhir; Hsieh, Ming-Shium; Cheng, Chao-Wen; Lin, Yung-Feng; Chen, Chien-Ho

    2011-11-25

    Osteoarthritis (OA) is characterized by the degradation of articular cartilage, marked by the breakdown of matrix proteins. Studies demonstrated the involvement of chemokines in this process, and some may potentially serve as diagnostic markers and therapeutic targets; however, the underlying signal transductions are not well understood. We investigated the effects of the CC chemokine eotaxin-1 (CCL11) on the matrix metalloproteinase (MMP) expression and secretion in the human chondrocyte cell line SW1353 and primary chondrocytes. Eotaxin-1 significantly induced MMP-3 mRNA expression in a dose-dependent manner. Inhibitors of extracellular signal-regulated kinase (ERK) and p38 kinase were able to repress eotaxin-1-induced MMP-3 expression. On the contrary, Rp-adenosine-3',5'-cyclic monophosphorothioate (Rp-cAMPs), a competitive cAMP antagonist for cAMP receptors, and H-89, a protein kinase A (PKA) inhibitor, markedly enhanced eotaxin-1-induced MMP-3 expression. These results suggest that MMP-3 expression is specifically mediated by the G protein-coupled eotaxin-1 receptor activities. Interestingly, little amount of MMP-3 protein was detected in the cell lysates of eotaxin-1-treated SW1353 cells, and most of MMP-3 protein was in the culture media. Furthermore we found that the eotaxin-1-dependent MMP-3 protein secretion was regulated by phospholipase C (PLC)-protein kinase C (PKC) cascade and c-Jun N-terminal kinase (JNK)/mitogen-activated protein (MAP) kinase pathways. These data indicate a specific regulation of MMP-3 secretion also by eotaxin-1 receptor activities. Eotaxin-1 not only induces MMP-3 gene expression but also promotes MMP-3 protein secretion through G protein-coupled eotaxin-1 receptor activities. Chemokines, such as eotaxin-1, could be a potential candidate in the diagnosis and treatment of arthritis.

  17. Cytokine and chemokine expression in the central nervous system associated with protective cell-mediated immunity against Cryptococcus neoformans.

    PubMed

    Uicker, William C; Doyle, Hester A; McCracken, James P; Langlois, Mary; Buchanan, Kent L

    2005-02-01

    Cryptococcus neoformans is a yeast that causes cryptococcosis, a life-threatening disease that develops following inhalation and dissemination of the organisms. C. neoformans has a predilection for the central nervous system (CNS) and mortality is most frequently associated with meningoencephalitis. Susceptibility to cryptococcosis is increased in patients with deficiencies in cell-mediated immunity (CMI). Because cryptococcal CNS infections are associated with mortality and diagnosis of cryptococcosis is often not made until after dissemination to the CNS, a better understanding of host defense mechanisms against C. neoformans in the CNS is needed to design improved therapies for immunocompromised individuals suffering from cryptococcosis. Using a mouse model, we previously described a protective cell-mediated immune response induced in the periphery that limited the growth of C. neoformans in the CNS. In the current investigation, we examined cytokine and chemokine expression in the CNS to identify factors important in achieving protective immunity. We observed increased expression of IL-1beta, TNF-alpha, IFN-gamma, MCP-1, RANTES, and IP-10 in C. neoformans-infected brains of immune mice compared to control mice suggesting that these cytokines and chemokines are associated with the protective immune response. Furthermore, the Th1-type cytokines TNF-alpha and IFN-gamma, but not the Th2 cytokines IL-4 and IL-5, were secreted at significantly higher levels in C. neoformans-infected brains of immune mice compared to control mice. Our results demonstrate that cytokines and chemokines associated with CMI are produced following infection in the CNS of immunized mice, and the expression of these factors correlates with protection against C. neoformans in the CNS.

  18. Chronic administration of DSP-7238, a novel, potent, specific and substrate-selective DPP IV inhibitor, improves glycaemic control and beta-cell damage in diabetic mice.

    PubMed

    Furuta, Y; Horiguchi, M; Sugaru, E; Ono-Kishino, M; Otani, M; Sakai, M; Masui, Y; Tsuchida, A; Sato, Y; Takubo, K; Hochigai, H; Kimura, H; Nakahira, H; Nakagawa, T; Taiji, M

    2010-05-01

    The purpose of this study is to assess the in vitro enzyme inhibition profile of DSP-7238, a novel non-cyanopyrrolidine dipeptidyl peptidase (DPP) IV inhibitor and to evaluate the acute and chronic effects of this compound on glucose metabolism in two different mouse models of type 2 diabetes. The in vitro enzyme inhibition profile of DSP-7238 was assessed using plasma and recombinant enzymes including DPP IV, DPP II, DPP8, DPP9 and fibroblast activation protein alpha (FAPalpha) with fluorogenic substrates. The inhibition type was evaluated based on the Lineweaver-Burk plot. Substrate selectivity of DSP-7238 and comparator DPP IV inhibitors (vildagliptin, sitagliptin, saxagliptin and linagliptin) was evaluated by mass spectrometry based on the changes in molecular weight of peptide substrates caused by release of N-terminal dipeptides. In the in vivo experiments, high-fat diet-induced obese (DIO) mice were subjected to oral glucose tolerance test (OGTT) following a single oral administration of DSP-7238. To assess the chronic effects of DSP-7238 on glycaemic control and pancreatic beta-cell damage, DSP-7238 was administered for 11 weeks to mice made diabetic by a combination of high-fat diet (HFD) and a low-dose of streptozotocin (STZ). After the dosing period, HbA1c was measured and pancreatic damage was evaluated by biological and histological analyses. DSP-7238 and sitagliptin both competitively inhibited recombinant human DPP IV (rhDPP IV) with K(i) values of 0.60 and 2.1 nM respectively. Neither vildagliptin nor saxagliptin exhibited competitive inhibition of rhDPP IV. DSP-7238 did not inhibit DPP IV-related enzymes including DPP8, DPP9, DPP II and FAPalpha, whereas vildagliptin and saxagliptin showed inhibition of DPP8 and DPP9. Inhibition of glucagon-like peptide-1 (GLP-1) degradation by DSP-7238 was apparently more potent than its inhibition of chemokine (C-X-C motif) ligand 10 (IP-10) or chemokine (C-X-C motif) ligand 12 (SDF-1alpha) degradation. In contrast, vildagliptin and saxagliptin showed similar degree of inhibition of degradation for all the substrates tested. Compared to treatment with the vehicle, single oral administration of DSP-7238 dose-dependently decreased plasma DPP IV activity and improved glucose tolerance in DIO mice. In addition, DSP-7238 significantly decreased HbA1c and ameliorated pancreatic damage following 11 weeks of chronic treatment in HFD/STZ mice. We have shown in this study that DSP-7238 is a potent DPP IV inhibitor that has high specificity for DPP IV and substrate selectivity against GLP-1. We have also found that chronic treatment with DSP-7238 improves glycaemic control and ameliorates beta-cell damage in a mouse model with impaired insulin sensitivity and secretion. These findings indicate that DSP-7238 may be a new therapeutic agent for the treatment of type 2 diabetes.

  19. Dendritic cell immunotherapy followed by cART interruption during HIV-1 infection induces plasma protein markers of cellular immunity and neutrophil recruitment

    PubMed Central

    Cooper, Jason D.; Tomasik, Jakub; Bahn, Sabine; Aerts, Joeri L.; Osterhaus, Albert D. M. E.; Gruters, Rob A.; Andeweg, Arno C.

    2018-01-01

    Objectives To characterize the host response to dendritic cell-based immunotherapy and subsequent combined antiretroviral therapy (cART) interruption in HIV-1-infected individuals at the plasma protein level. Design An autologous dendritic cell (DC) therapeutic vaccine was administered to HIV-infected individuals, stable on cART. The effect of vaccination was evaluated at the plasma protein level during the period preceding cART interruption, during analytical therapy interruption and at viral reactivation. Healthy controls and post-exposure prophylactically treated healthy individuals were included as controls. Methods Plasma marker (‘analyte’) levels including cytokines, chemokines, growth factors, and hormones were measured in trial participants and control plasma samples using a multiplex immunoassay. Analyte levels were analysed using principle component analysis, cluster analysis and limma. Blood neutrophil counts were analysed using linear regression. Results Plasma analyte levels of HIV-infected individuals are markedly different from those of healthy controls and HIV-negative individuals receiving post-exposure prophylaxis. Viral reactivation following cART interruption also affects multiple analytes, but cART interruption itself only has only a minor effect. We find that Thyroxine-Binding Globulin (TBG) levels and late-stage neutrophil numbers correlate with the time off cART after DC vaccination. Furthermore, analysis shows that cART alters several regulators of blood glucose levels, including C-peptide, chromogranin-A and leptin. HIV reactivation is associated with the upregulation of CXCR3 ligands. Conclusions Chronic HIV infection leads to a change in multiple plasma analyte levels, as does virus reactivation after cART interruption. Furthermore, we find evidence for the involvement of TBG and neutrophils in the response to DC-vaccination in the setting of HIV-infection. PMID:29389978

  20. Dendritic cell immunotherapy followed by cART interruption during HIV-1 infection induces plasma protein markers of cellular immunity and neutrophil recruitment.

    PubMed

    van den Ham, Henk-Jan; Cooper, Jason D; Tomasik, Jakub; Bahn, Sabine; Aerts, Joeri L; Osterhaus, Albert D M E; Gruters, Rob A; Andeweg, Arno C

    2018-01-01

    To characterize the host response to dendritic cell-based immunotherapy and subsequent combined antiretroviral therapy (cART) interruption in HIV-1-infected individuals at the plasma protein level. An autologous dendritic cell (DC) therapeutic vaccine was administered to HIV-infected individuals, stable on cART. The effect of vaccination was evaluated at the plasma protein level during the period preceding cART interruption, during analytical therapy interruption and at viral reactivation. Healthy controls and post-exposure prophylactically treated healthy individuals were included as controls. Plasma marker ('analyte') levels including cytokines, chemokines, growth factors, and hormones were measured in trial participants and control plasma samples using a multiplex immunoassay. Analyte levels were analysed using principle component analysis, cluster analysis and limma. Blood neutrophil counts were analysed using linear regression. Plasma analyte levels of HIV-infected individuals are markedly different from those of healthy controls and HIV-negative individuals receiving post-exposure prophylaxis. Viral reactivation following cART interruption also affects multiple analytes, but cART interruption itself only has only a minor effect. We find that Thyroxine-Binding Globulin (TBG) levels and late-stage neutrophil numbers correlate with the time off cART after DC vaccination. Furthermore, analysis shows that cART alters several regulators of blood glucose levels, including C-peptide, chromogranin-A and leptin. HIV reactivation is associated with the upregulation of CXCR3 ligands. Chronic HIV infection leads to a change in multiple plasma analyte levels, as does virus reactivation after cART interruption. Furthermore, we find evidence for the involvement of TBG and neutrophils in the response to DC-vaccination in the setting of HIV-infection.

  1. The chemokine receptor CXCR3 and its splice variant are expressed in human airway epithelial cells.

    PubMed

    Kelsen, Steven G; Aksoy, Mark O; Yang, Yi; Shahabuddin, Syed; Litvin, Judith; Safadi, Fayez; Rogers, Thomas J

    2004-09-01

    Activation of the chemokine receptor CXCR3 by its cognate ligands induces several differentiated cellular responses important to the growth and migration of a variety of hematopoietic and structural cells. In the human respiratory tract, human airway epithelial cells (HAEC) release the CXCR3 ligands Mig/CXCL9, IP-10/CXCL10, and I-TAC/CXCL11. Simultaneous expression of CXCR3 by HAEC would have important implications for the processes of airway inflammation and repair. Accordingly, in the present study we sought to determine whether HAEC also express the classic CXCR3 chemokine receptor CXCR3-A and its splice variant CXCR3-B and hence may respond in autocrine fashion to its ligands. We found that cultured HAEC (16-HBE and tracheocytes) constitutively expressed CXCR3 mRNA and protein. CXCR3 mRNA levels assessed by expression array were approximately 35% of beta-actin expression. In contrast, CCR3, CCR4, CCR5, CCR8, and CX3CR1 were <5% beta-actin. Both CXCR3-A and -B were expressed. Furthermore, tracheocytes freshly harvested by bronchoscopy stained positively for CXCR3 by immunofluorescence microscopy, and 68% of cytokeratin-positive tracheocytes (i.e., the epithelial cell population) were positive for CXCR3 by flow cytometry. In 16-HBE cells, CXCR3 receptor density was approximately 78,000 receptors/cell when assessed by competitive displacement of 125I-labeled IP-10/CXCL10. Finally, CXCR3 ligands induced chemotactic responses and actin reorganization in 16-HBE cells. These findings indicate constitutive expression by HAEC of a functional CXC chemokine receptor, CXCR3. Our data suggest the possibility that autocrine activation of CXCR3 expressed by HAEC may contribute to airway inflammation and remodeling in obstructive lung disease by regulating HAEC migration.

  2. Interaction of chemokine receptor CXCR4 in monomeric and dimeric state with its endogenous ligand CXCL12: coarse-grained simulations identify differences.

    PubMed

    Cutolo, Pasquale; Basdevant, Nathalie; Bernadat, Guillaume; Bachelerie, Françoise; Ha-Duong, Tâp

    2017-02-01

    Despite the recent resolutions of the crystal structure of the chemokine receptor CXCR4 in complex with small antagonists or viral chemokine, a description at the molecular level of the interactions between the full-length CXCR4 and its endogenous ligand, the chemokine CXCL12, in relationship with the receptor recognition and activation, is not yet completely elucidated. Moreover, since CXCR4 is able to form dimers, the question of whether the CXCR4-CXCL12 complex has a 1:1 or 2:1 preferential stoichiometry is still an open question. We present here results of coarse-grained protein-protein docking and molecular dynamics simulations of CXCL12 in association with CXCR4 in monomeric and dimeric states. Our proposed models for the 1:1 and 2:1 CXCR4-CXCL12 quaternary structures are consistent with recognition and activation motifs of both partners provided by the available site-directed mutagenesis data. Notably, we observed that in the 2:1 complex, the chemokine N-terminus makes more steady contacts with the receptor residues critical for binding and activation than in the 1:1 structure, suggesting that the 2:1 stoichiometry would favor the receptor signaling activity with respect to the 1:1 association.

  3. Antigen-driven C–C Chemokine-mediated HIV-1 Suppression by CD4+ T Cells from Exposed Uninfected Individuals Expressing the Wild-type CCR-5 Allele

    PubMed Central

    Furci, Lucinda; Scarlatti, Gabriella; Burastero, Samuele; Tambussi, Giuseppe; Colognesi, Claudia; Quillent, Caroline; Longhi, Renato; Loverro, Patrizia; Borgonovo, Barbara; Gaffi, Davide; Carrow, Emily; Malnati, Mauro; Lusso, Paolo; Siccardi, Antonio G.; Lazzarin, Adriano; Beretta, Alberto

    1997-01-01

    Despite repeated exposure to HIV-1, certain individuals remain persistently uninfected. Such exposed uninfected (EU) people show evidence of HIV-1–specific T cell immunity and, in rare cases, selective resistance to infection by macrophage-tropic strains of HIV-1. The latter has been associated with a 32–base pair deletion in the C–C chemokine receptor gene CCR-5, the major coreceptor of macrophage-tropic strains of HIV-1. We have undertaken an analysis of the HIV-specific T cell responses in 12 EU individuals who were either homozygous for the wild-type CCR-5 allele or heterozygous for the deletion allele (CCR-5Δ32). We have found evidence of an oligoclonal T cell response mediated by helper T cells specific for a conserved region of the HIV-1 envelope. These cells produce very high levels of C–C chemokines when stimulated by the specific antigen and suppress selectively the replication of macrophage-tropic, but not T cell–tropic, strains of HIV-1. These chemokine-producing helper cells may be part of a protective immune response that could be potentially exploited for vaccine development. PMID:9236198

  4. Platelet-derived chemokines CXC chemokine ligand (CXCL)7, connective tissue-activating peptide III, and CXCL4 differentially affect and cross-regulate neutrophil adhesion and transendothelial migration.

    PubMed

    Schenk, Birgit I; Petersen, Frank; Flad, Hans-Dieter; Brandt, Ernst

    2002-09-01

    In this study, we have examined the major platelet-derived CXC chemokines connective tissue-activating peptide III (CTAP-III), its truncation product neutrophil-activating peptide 2 (CXC chemokine ligand 7 (CXCL7)), as well as the structurally related platelet factor 4 (CXCL4) for their impact on neutrophil adhesion to and transmigration through unstimulated vascular endothelium. Using monolayers of cultured HUVEC, we found all three chemokines to promote neutrophil adhesion, while only CXCL7 induced transmigration. Induction of cell adhesion following exposure to CTAP-III, a molecule to date described to lack neutrophil-stimulating capacity, depended on proteolytical conversion of the inactive chemokine into CXCL7 by neutrophils. This was evident from experiments in which inhibition of the CTAP-III-processing protease and simultaneous blockade of the CXCL7 high affinity receptor CXCR-2 led to complete abrogation of CTAP-III-mediated neutrophil adhesion. CXCL4 at substimulatory dosages modulated CTAP-III- as well as CXCL7-induced adhesion. Although cell adhesion following exposure to CTAP-III was drastically reduced, CXCL7-mediated adhesion underwent significant enhancement. Transendothelial migration of neutrophils in response to CXCL7 or IL-8 (CXCL8) was subject to modulation by CTAP-III, but not CXCL4, as seen by drastic desensitization of the migratory response of neutrophils pre-exposed to CTAP-III, which was paralleled by selective down-modulation of CXCR-2. Altogether our results demonstrate that there exist multiple interactions between platelet-derived chemokines in the regulation of neutrophil adhesion and transendothelial migration.

  5. Chemotactic Cues for NOTCH1-Dependent Leukemia

    PubMed Central

    Piovan, Erich; Tosello, Valeria; Amadori, Alberto; Zanovello, Paola

    2018-01-01

    The NOTCH signaling pathway is a conserved signaling cascade that regulates many aspects of development and homeostasis in multiple organ systems. Aberrant activity of this signaling pathway is linked to the initiation and progression of several hematological malignancies, exemplified by T-cell acute lymphoblastic leukemia (T-ALL). Interestingly, frequent non-mutational activation of NOTCH1 signaling has recently been demonstrated in B-cell chronic lymphocytic leukemia (B-CLL), significantly extending the pathogenic significance of this pathway in B-CLL. Leukemia patients often present with high-blood cell counts, diffuse disease with infiltration of the bone marrow, secondary lymphoid organs, and diffusion to the central nervous system (CNS). Chemokines are chemotactic cytokines that regulate migration of cells between tissues and the positioning and interactions of cells within tissue. Homeostatic chemokines and their receptors have been implicated in regulating organ-specific infiltration, but may also directly and indirectly modulate tumor growth. Recently, oncogenic NOTCH1 has been shown to regulate infiltration of leukemic cells into the CNS hijacking the CC-chemokine ligand 19/CC-chemokine receptor 7 chemokine axis. In addition, a crucial role for the homing receptor axis CXC-chemokine ligand 12/CXC-chemokine receptor 4 has been demonstrated in leukemia maintenance and progression. Moreover, the CCL25/CCR9 axis has been implicated in the homing of leukemic cells into the gut, particularly in the presence of phosphatase and tensin homolog tumor suppressor loss. In this review, we summarize the latest developments regarding the role of NOTCH signaling in regulating the chemotactic microenvironmental cues involved in the generation and progression of T-ALL and compare these findings to B-CLL. PMID:29666622

  6. Genetic engineering of human NK cells to express CXCR2 improves migration to renal cell carcinoma.

    PubMed

    Kremer, Veronika; Ligtenberg, Maarten A; Zendehdel, Rosa; Seitz, Christina; Duivenvoorden, Annet; Wennerberg, Erik; Colón, Eugenia; Scherman-Plogell, Ann-Helén; Lundqvist, Andreas

    2017-09-19

    Adoptive natural killer (NK) cell transfer is being increasingly used as cancer treatment. However, clinical responses have so far been limited to patients with hematological malignancies. A potential limiting factor in patients with solid tumors is defective homing of the infused NK cells to the tumor site. Chemokines regulate the migration of leukocytes expressing corresponding chemokine receptors. Various solid tumors, including renal cell carcinoma (RCC), readily secrete ligands for the chemokine receptor CXCR2. We hypothesize that infusion of NK cells expressing high levels of the CXCR2 chemokine receptor will result in increased influx of the transferred NK cells into tumors, and improved clinical outcome in patients with cancer. Blood and tumor biopsies from 14 primary RCC patients were assessed by flow cytometry and chemokine analysis. Primary NK cells were transduced with human CXCR2 using a retroviral system. CXCR2 receptor functionality was determined by Calcium flux and NK cell migration was evaluated in transwell assays. We detected higher concentrations of CXCR2 ligands in tumors compared with plasma of RCC patients. In addition, CXCL5 levels correlated with the intratumoral infiltration of CXCR2-positive NK cells. However, tumor-infiltrating NK cells from RCC patients expressed lower CXCR2 compared with peripheral blood NK cells. Moreover, healthy donor NK cells rapidly lost their CXCR2 expression upon in vitro culture and expansion. Genetic modification of human primary NK cells to re-express CXCR2 improved their ability to specifically migrate along a chemokine gradient of recombinant CXCR2 ligands or RCC tumor supernatants compared with controls. The enhanced trafficking resulted in increased killing of target cells. In addition, while their functionality remained unchanged compared with control NK cells, CXCR2-transduced NK cells obtained increased adhesion properties and formed more conjugates with target cells. To increase the success of NK cell-based therapies of solid tumors, it is of great importance to promote their homing to the tumor site. In this study, we show that stable engineering of human primary NK cells to express a chemokine receptor thereby enhancing their migration is a promising strategy to improve anti-tumor responses following adoptive transfer of NK cells.

  7. Reduced locomotor activity and exploratory behavior in CC chemokine receptor 4 deficient mice.

    PubMed

    Ambrée, Oliver; Klassen, Irene; Förster, Irmgard; Arolt, Volker; Scheu, Stefanie; Alferink, Judith

    2016-11-01

    Chemokines and their receptors are key regulators of immune cell trafficking and activation. Recent findings suggest that they may also play pathophysiological roles in psychiatric diseases like depression and anxiety disorders. The CC chemokine receptor 4 (CCR4) and its two ligands, CCL17 and CCL22, are functionally involved in neuroinflammation as well as anti-infectious and autoimmune responses. However, their influence on behavior remains unknown. Here we characterized the functional role of the CCR4-CCL17 chemokine-receptor axis in the modulation of anxiety-related behavior, locomotor activity, and object exploration and recognition. Additionally, we investigated social exploration of CCR4 and CCL17 knockout mice and wild type (WT) controls. CCR4 knockout (CCR4(-/-)) mice exhibited fewer anxiety-related behaviors in the elevated plus-maze, diminished locomotor activity, exploratory behavior, and social exploration, while their recognition memory was not affected. In contrast, CCL17 deficient mice did not show an altered behavior compared to WT mice regarding locomotor activity, anxiety-related behavior, social exploration, and object recognition memory. In the dark-light and object recognition tests, CCL17(-/-) mice even covered longer distances than WT mice. These data demonstrate a mechanistic or developmental role of CCR4 in the regulation of locomotor and exploratory behaviors, whereas the ligand CCL17 appears not to be involved in the behaviors measured here. Thus, either CCL17 and the alternative ligand CCL22 may be redundant, or CCL22 is the main activator of CCR4 in these processes. Taken together, these findings contribute to the growing evidence regarding the involvement of chemokines and their receptors in the regulation of behavior. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Rhenium complexes of bidentate, bis-bidentate and tridentate N-heterocyclic carbene ligands.

    PubMed

    Chan, Chung Ying; Barnard, Peter J

    2015-11-28

    A series of eight Rhenium(I)-N-heterocyclic carbene (NHC) complexes of the general form [ReCl(CO)3(C^C)] (where C^C is a bis(NHC) bidentate ligand), [ReCl(CO)3(C^C)]2 (where C^C is a bis-bidentate tetra-NHC ligand) and [Re(CO)3(C^N^C)](+)[X](-) (where C^N^C is a bis(NHC)-amine ligand and the counter ion X is either the ReO4(-) or PF6(-)) have been synthesised using a Ag2O transmetallation protocol. The novel precursor imidazolium salts and Re(I) complexes were characterized by elemental analysis, (1)H and (13)C NMR spectroscopy and the molecular structures for two imidazolium salt and six Re(I) complexes were determined by single crystal X-ray diffraction. These NHC ligand systems are of interest for possible applications in the development of Tc-99m or Re-186/188 radiopharmaceuticals and as such the stability of two complexes of the form [ReCl(CO)3(C^C)] and [Re(CO)3(C^N^C)][ReO4] were evaluated in ligand challenge experiments using the metal binding amino acids L-histidine or L-cysteine. These studies showed that the former was unstable, with the chloride ligand being replaced by either cysteine or histidine, while no evidence for transchelation was observed for the latter suggesting that bis(NHC)-amine ligands of this type may be suitable for biological applications.

  9. Identification of a cobia (Rachycentron canadum) CC chemokine gene and its involvement in the inflammatory response.

    PubMed

    Su, Youlu; Guo, Zhixun; Xu, Liwen; Jiang, Jingzhe; Wang, Jiangyong; Feng, Juan

    2012-01-01

    The chemokines regulate immune cell migration under inflammatory and physiological conditions. We investigated a CC chemokine gene (RcCC1) from cobia (Rachycentron canadum). The full-length RcCC1 cDNA is comprised 673 nucleotides and encodes a four-cysteine arrangement 99-amino-acid protein typical of known CC chemokines. The genomic DNA of RcCC1 consists of three exons and two introns. Phylogenetic analysis showed that RcCC1 was closest to the MIP group of CC chemokines. Quantitative real-time RT-PCR (qRT-PCR) analysis revealed RcCC1 was constitutively expressed in all tissues examined, with relative strong expression in gill, blood, kidney, spleen, and head kidney. The RcCC1 transcripts in the head kidney, spleen, and liver were quickly up-regulated after stimulation with formalin-inactivated Vibrio carchariae (bacterial vaccine) or polyriboinosinic polyribocytidylic acid (poly I:C). These results indicate RcCC1 not only plays a role in homeostasis, but also may be involved in inflammatory responses to bacterial and viral infection. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. Citrullinated Chemokines in Rheumatoid Arthritis

    DTIC Science & Technology

    2015-10-01

    1 AWARD NUMBER: W81XWH-13-1-0210 TITLE: Citrullinated Chemokines in Rheumatoid Arthritis PRINCIPAL INVESTIGATOR: David A. Fox CONTRACTING...CONTRACT NUMBER Citrullinated Chemokines in Rheumatoid Arthritis 5b. GRANT NUMBER W81XWH-13-1-0210 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) David A. Fox...citrulline, which contributes to the pathogenesis of rheumatoid arthritis (RA). We show that citrullinated epithelial- derived neutrophil-activating peptide 78

  11. [Characterization and transcriptional analysis of a new CC chemokine associated with innate imimune response in cobia (Rachycentron canadum)].

    PubMed

    Su, Y; Feng, J; Sun, X; Guo, Z; Xu, L; Jiang, J

    2013-01-01

    Chemokines are small, secreted cytokine peptides, known principally for their ability to induce migration and activation of leukocyte populations under both pathological and physiological conditions. On the basis of previously constructed express sequence tags (ESTs) of the head kidney and spleen cDNA library of the perciform marine fish Rachycentron canadum (common name cobia). We used bi-directional rapid amplification of cDNA ends (RACE) and obtained a full-length cDNA of a new CC chemokine gene (designated RcCC3). The RcCC3 putative peptide exhibits sequence similarity to the group of CCL19/21/25 CC chemokines. The reverse transcription quantitative polymerase chain reaction (RT-qPCR) was used in transcript expression studies of RcCC3. We examined the constitutive expression of the transcripts in 12 tissues of non-stressed cobia; RcCC3 transcripts were detected in all tissues examined, with the highest expression in gill and liver, following by head kidney, kidney, spleen, skin, intestine, muscle, stomach, heart, blood and brain. Transcript expression of RcCC3 was examined in immune-related organs, including head kidney, spleen and liver, following intraperitoneal injection of phosphate-buffered saline control, polyriboinosinic polyribocytidylic acid (poly(I:C)) and formalin-killed Vibrio carchariae (bacterial vaccine). The transcripts in these tissues were quickly up-regulated by the injection of poly(I:C) and bacterial vaccine at early time points, although with different expression profiles. These results indicate RcCC3 represents an important component of innate immunity in cobia.

  12. Perfluorinated Ligands in Organometallic Chemistry

    DTIC Science & Technology

    1989-12-12

    C49t00ooVER ,or C M’ AD"OV’~mDecember 12) 199IFinal 1/1/86 to 8/31/89C smuS. FUNOING NUMgIERS cJ Perfluorinated Ligands in Organometallic Chemistry 612...compounds, stabilized by tridentate perfluorinated ligands. Dinuclear rhodium complexes of OFCOT undergo a selective C-F bond activation reaction...hexafluorocyclooctatrieneyne ligand. Stereospecific cleavage of a fluorinated C-C bond,#-bond in perfluorocyclopropene by platinum and iridium complexes has been achieved

  13. Chemokines in teleost fish species.

    PubMed

    Alejo, Alí; Tafalla, Carolina

    2011-12-01

    Chemokines are chemoattractant cytokines defined by the presence of four conserved cysteine residues which in mammals can be divided into four subfamilies depending on the arrangement of the first two conserved cysteines in their sequence: CXC (α), CC (β), C and CX(3)C classes. Evolutionarily, fish can be considered as an intermediate step between species which possess only innate immunity (invertebrates) and species with a fully developed acquired immune network such as mammals. Therefore, the functionality of their different immune cell types and molecules is sometimes also intermediate between innate and acquired responses. The first chemokine gene identified in a teleost was a rainbow trout (Oncorhynchus mykiss) chemokine designated as CK1 in 1998. Since then, many different chemokine genes have been identified in several fish species, but their role in homeostasis and immune response remains largely unknown. Extensive genomic duplication events and the fact that chemokines evolve more quickly than other immune genes, make it very difficult to establish true orthologues between fish and mammalian chemokines that would help us with the ascription of immune roles. In this review, we describe the current state of knowledge of chemokine biology in teleost fish, focusing mainly on which genes have been identified so far and highlighting the most important aspects of their expression regulation, due to the great lack of functional information available for them. As the number of chemokine genes begins to close down for some teleost species, there is an important need for functional assays that may elucidate the role of each of these molecules within the fish immune response. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. Extramedullary Myelopoiesis in Malaria Depends on Mobilization of Myeloid-Restricted Progenitors by IFN-γ Induced Chemokines

    PubMed Central

    Belyaev, Nikolai N.; Biró, Judit; Langhorne, Jean; Potocnik, Alexandre J.

    2013-01-01

    Resolution of a variety of acute bacterial and parasitic infections critically relies on the stimulation of myelopoiesis leading in cases to extramedullary hematopoiesis. Here, we report the isolation of the earliest myeloid-restricted progenitors in acute infection with the rodent malaria parasite, Plasmodium chabaudi. The rapid disappearance of these infection-induced myeloid progenitors from the bone marrow (BM) equated with contraction of the functional myeloid potential in that organ. The loss of BM myelopoiesis was not affected by the complete genetic inactivation of toll-like receptor signaling. De-activation of IFN-γ signaling completely abrogated the contraction of BM myeloid progenitors. Radiation chimeras of Ifngr1-null and control BM revealed that IFN-γ signaling in an irradiation-resistant stromal compartment was crucial for the loss of early myeloid progenitors. Systemic IFN-γ triggered the secretion of C-C motif ligand chemokines CCL2 and CCL7 leading to the egress of early, myeloid-committed progenitors from the bone marrow mediated by their common receptor CCR2. The mobilization of myeloid progenitors initiated extramedullary myelopoiesis in the spleen in a CCR2-dependent manner resulting in augmented myelopoiesis during acute malaria. Consistent with the lack of splenic myelopoiesis in the absence of CCR2 we observed a significant persistence of parasitemia in malaria infected CCR2-deficient hosts. Our findings reveal how the activated immune system mobilizes early myeloid progenitors out of the BM thereby transiently establishing myelopoiesis in the spleen in order to contain and resolve the infection locally. PMID:23762028

  15. Parallel Effects of Methamphetamine on Anxiety and CCL3 in Humans and a Genetic Mouse Model of High Methamphetamine Intake

    PubMed Central

    Huckans, Marilyn; Wilhelm, Clare J.; Phillips, Tamara J.; Huang, Elaine T.; Hudson, Rebekah; Loftis, Jennifer M.

    2018-01-01

    Background Methamphetamine (MA) abuse causes immune dysfunction and neuropsychiatric impairment. The mechanisms underlying these deficits remain unidentified. Methods The effects of MA on anxiety-like behavior and immune function were investigated in mice selectively bred to voluntarily consume high amounts of MA [i.e., MA high drinking (MAHDR) mice]. MA (or saline) was administered to mice using a chronic (14-day), binge-like model. Performance in the elevated zero maze (EZM) was determined 5 days after the last MA dose to examine anxiety-like behavior. Cytokine and chemokine expressions were measured in the hippocampus using quantitative polymerase chain reaction (qPCR). Human studies were also conducted to evaluate symptoms of anxiety using the General Anxiety Disorder-7 Scale in adults with and without a history of MA dependence. Plasma samples collected from human research participants were used for confirmatory analysis of murine qPCR results using an enzyme-linked immunosorbent assay. Results During early remission from MA, MAHDR mice exhibited increased anxiety-like behavior on the EZM and reduced expression of chemokine (C-C motif) ligand 3 (ccl3) in the hippocampus relative to saline-treated mice. Human adults actively dependent on MA and those in early remission had elevated symptoms of anxiety as well as reductions in plasma levels of CCL3, relative to adults with no history of MA abuse. Conclusions The results highlight the complex effects of MA on immune and behavioral function and suggest that alterations in CCL3 signaling may contribute to the mood impairments observed during remission from MA addiction. PMID:29402784

  16. Necroptosis in microglia contributes to neuroinflammation and retinal degeneration through TLR4 activation.

    PubMed

    Huang, Zijing; Zhou, Tian; Sun, Xiaowei; Zheng, Yingfeng; Cheng, Bing; Li, Mei; Liu, Xialin; He, Chang

    2018-01-01

    Inflammation has emerged to be a critical mechanism responsible for neural damage and neurodegenerative diseases. Microglia, the resident innate immune cells in retina, are implicated as principal components of the immunological insult to retinal neural cells. The involvement of microglia in retinal inflammation is complex and here we propose for the first time that necroptosis in microglia triggers neuroinflammation and exacerbates retinal neural damage and degeneration. We found microglia experienced receptor-interacting protein kinase 1 (RIP1)- and RIP3-dependent necroptosis not only in the retinal degenerative rd1 mice, but also in the acute retinal neural injury mice. The necroptotic microglia released various pro-inflammatory cytokines and chemokines, such as tumor necrosis factor-α and chemokine (C-C motif) ligand 2, which orchestrated the retinal inflammation. Importantly, necroptosis blockade using necrostatin-1 could suppress microglia-mediated inflammation, rescue retinal degeneration or prevent neural injury in vivo. Meanwhile, cultured microglia underwent RIP1/3-mediated necroptosis and the necroptotic microglia produced large amounts of pro-inflammatory cytokines in response to lipopolysaccharide or oxidative stress in vitro. Mechanically, TLR4 deficiency ameliorated microglia necroptosis with decreased expression levels of machinery molecules RIP1 and RIP3, and suppressed retinal inflammation, suggesting that TLR4 signaling was required in microglia necroptosis-mediated inflammation. Thus, we proposed that microglia experienced necroptosis through TLR4 activation, promoting an inflammatory response that serves to exacerbate considerable neural damage and degeneration. Necroptosis blockade therefore emerged as a novel therapeutic strategy for tempering microglia-mediated neuroinflammation and ameliorating neural injury and neurodegenerative diseases.

  17. Necroptosis in microglia contributes to neuroinflammation and retinal degeneration through TLR4 activation

    PubMed Central

    Huang, Zijing; Zhou, Tian; Sun, Xiaowei; Zheng, Yingfeng; Cheng, Bing; Li, Mei; Liu, Xialin; He, Chang

    2018-01-01

    Inflammation has emerged to be a critical mechanism responsible for neural damage and neurodegenerative diseases. Microglia, the resident innate immune cells in retina, are implicated as principal components of the immunological insult to retinal neural cells. The involvement of microglia in retinal inflammation is complex and here we propose for the first time that necroptosis in microglia triggers neuroinflammation and exacerbates retinal neural damage and degeneration. We found microglia experienced receptor-interacting protein kinase 1 (RIP1)- and RIP3-dependent necroptosis not only in the retinal degenerative rd1 mice, but also in the acute retinal neural injury mice. The necroptotic microglia released various pro-inflammatory cytokines and chemokines, such as tumor necrosis factor-α and chemokine (C-C motif) ligand 2, which orchestrated the retinal inflammation. Importantly, necroptosis blockade using necrostatin-1 could suppress microglia-mediated inflammation, rescue retinal degeneration or prevent neural injury in vivo. Meanwhile, cultured microglia underwent RIP1/3-mediated necroptosis and the necroptotic microglia produced large amounts of pro-inflammatory cytokines in response to lipopolysaccharide or oxidative stress in vitro. Mechanically, TLR4 deficiency ameliorated microglia necroptosis with decreased expression levels of machinery molecules RIP1 and RIP3, and suppressed retinal inflammation, suggesting that TLR4 signaling was required in microglia necroptosis-mediated inflammation. Thus, we proposed that microglia experienced necroptosis through TLR4 activation, promoting an inflammatory response that serves to exacerbate considerable neural damage and degeneration. Necroptosis blockade therefore emerged as a novel therapeutic strategy for tempering microglia-mediated neuroinflammation and ameliorating neural injury and neurodegenerative diseases. PMID:28885615

  18. Lack of Toll-like receptor 2 results in higher mortality of bacterial meningitis by impaired host resistance.

    PubMed

    Böhland, Martin; Kress, Eugenia; Stope, Matthias B; Pufe, Thomas; Tauber, Simone C; Brandenburg, Lars-Ove

    2016-10-15

    Bacterial meningitis is - despite therapeutical progress during the last decades - still characterized by high mortality and severe permanent neurogical sequelae. The brain is protected from penetrating pathogens by both the blood-brain barrier and the innate immune system. Invading pathogens are recognized by so-called pattern recognition receptors including the Toll-like receptors (TLR) which are expressed by glial immune cells in the central nervous system. Among these, TLR2 is responsible for the detection of Gram-positive bacteria such as the meningitis-causing pathogen Streptococcus pneumoniae. Here, we used TLR2-deficient mice to investigate the effects on mortality, bacterial growth and inflammation in a mouse model of pneumococcal meningitis. Our results revealed a significantly increased mortality rate and higher bacterial burden in TLR2-deficient mice with pneumococcal meningitis. Furthermore, infected TLR2-deficient mice suffered from a significantly increased pro-inflammatory cytokine tumor necrosis factor-α (TNF-α) and Chemokine (C-C motif) ligand 2 (CCL2) or CCL3 chemokine expression and decreased expression of anti-inflammatory cytokines and antimicrobial peptides. In contrast, glial cell activation assessed by glial cell marker expression was comparable to wildtype mice. Taken together, the results suggest that TLR2 is essential for an efficient immune response against Streptococcus pneumoniae meningitis since lack of the receptor led to a worse outcome by higher mortality due to increased bacterial burden, weakened innate immune response and reduced expression of antimicrobial peptides. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Manufacturing porcine islets: culture at 22°C has no advantage above culture at 37°C

    PubMed Central

    Mueller, Kate R; Martins, Kyra V; Murtaugh, Michael P; Schuurman, Henk-Jan; Papas, Klearchos K

    2013-01-01

    Background The manufacturing process of islets includes a culture step which was originally introduced to ease the logistics of procedures in preparing the graft and transplant recipient. It has been suggested that culture at room temperature has an advantage over culture at 37°C, in part by reducing immunogenicity via preferential elimination of contaminating cells (such as passenger leukocytes) within islets. We investigated this using islets isolated from pancreata of adult pigs. Methods Porcine islets were isolated from three donors and cultured at 37°C for 1 day, and then under three different conditions: 37°C for 6 days (condition A); 22°C for 6 days (condition B); or 22°C for 5 days followed by 37°C for 1 day (condition C). Recovery was assessed by DNA measurement, viability by oxygen consumption rate normalized for DNA (OCR/DNA), and gene expression by RT-PCR for a series of 9 lymphocyte markers, 11 lymphokines and chemokines, and 14 apoptotic and stress markers. Results Post-culture islet recoveries were similar for the three culture conditions. Average OCR/DNA values were 129–159 nmol/min.mgDNA before culture, and 259–291, 204–212, and 207–228 nmol/min•mgDNA, respectively, for culture under conditions A, B, and C, respectively. Irrespective of culture condition, examined gene expression in all three series of lymphocyte markers, lymphokines and chemokines, and apoptotic and stress markers manifested a statistically significant decrease upon culture for 7 days. This decrease was most dramatic for condition A: in particular most of lymphocyte markers showed a >10-fold reduction and also 6 markers in the lymphokine and chemokine series: these reductions are consistent with the elimination of immune cells present within islets during culture. The reduction was less for apoptotic and stress markers. For culture under condition B the reduction in gene expression was less, and culture under condition C resulted in gene expression levels similar to those under condition A: this indicates that 24 hours at 37°C is sufficient to re-equilibrate gene expression levels from those in islets cultured at 22°C to those in islets cultured at 37°C. Results were consistent among the preparations from the three donors. Conclusions Culture of porcine islets at 37°C provides benefits over culture at 22°C with respect to OCR/DNA outcomes and reduced expression of genes encoding lymphocyte markers, lymphokines and chemokines, and markers for apoptosis and stress. PMID:23941232

  20. Plectin regulates the signaling and trafficking of the HIV-1 co-receptor CXCR4 and plays a role in HIV-1 infection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ding Yun; Department of Neurobiology and Neurotoxicology, Meharry Medical College, Nashville, TN 37208; Zhang Li

    2008-02-01

    The CXC chemokine CXCL12 and its cognate receptor CXCR4 play an important role in inflammation, human immunodeficiency virus (HIV) infection and cancer metastasis. The signal transduction and intracellular trafficking of CXCR4 are involved in these functions, but the underlying mechanisms remain incompletely understood. In the present study, we demonstrated that the CXCR4 formed a complex with the cytolinker protein plectin in a ligand-dependent manner in HEK293 cells stably expressing CXCR4. The glutathione-S-transferase (GST)-CXCR4 C-terminal fusion proteins co-precipitated with the full-length and the N-terminal fragments of plectin isoform 1 but not with the N-terminal deletion mutants of plectin isoform 1, therebymore » suggesting an interaction between the N-terminus of plectin and the C-terminus of CXCR4. This interaction was confirmed by confocal microscopic reconstructions showing co-distribution of these two proteins in the internal vesicles after ligand-induced internalization of CXCR4 in HEK293 cells stably expressing CXCR4. Knockdown of plectin with RNA interference (RNAi) significantly inhibited ligand-dependent CXCR4 internalization and attenuated CXCR4-mediated intracellular calcium mobilization and activation of extracellular signal regulated kinase 1/2 (ERK1/2). CXCL12-induced chemotaxis of HEK293 cells stably expressing CXCR4 and of Jurkat T cells was inhibited by the plectin RNAi. Moreover, CXCR4 tropic HIV-1 infection in MAGI (HeLa-CD4-LTR-Gal) cells was inhibited by the RNAi of plectin. Thus, plectin appears to interact with CXCR4 and plays an important role in CXCR4 signaling and trafficking and HIV-1 infection.« less

  1. Minoxidil Promotes Hair Growth through Stimulation of Growth Factor Release from Adipose-Derived Stem Cells

    PubMed Central

    Choi, Nahyun; Shin, Soyoung; Song, Sun U.; Sung, Jong-Hyuk

    2018-01-01

    Minoxidil directly promotes hair growth via the stimulation of dermal papilla (DP) and epithelial cells. Alternatively, there is little evidence for indirect promotion of hair growth via stimulation of adipose-derived stem cells (ASCs). We investigated whether minoxidil stimulates ASCs and if increased growth factor secretion by ASCs facilitates minoxidil-induced hair growth. Telogen-to-anagen induction was examined in mice. Cultured DP cells and vibrissae hair follicle organ cultures were used to further examine the underlying mechanisms. Subcutaneous injection of minoxidil-treated ASCs accelerated telogen-to-anagen transition in mice, and increased hair weight at day 14 post-injection. Minoxidil did not alter ASC proliferation, but increased migration and tube formation. Minoxidil also increased the secretion of growth factors from ASCs, including chemokine (C-X-C motif) ligand 1 (CXCL1), platelet-derived endothelial cell growth factor (PD-ECGF), and platelet-derived growth factor-C (PDGF-C). Minoxidil increased extracellular signal–regulated kinases 1/2 (ERK1/2) phosphorylation, and concomitant upregulation of PD-ECGF and PDGF-C mRNA levels were attenuated by an ERK inhibitor. Subcutaneous injection of CXCL1, PD-ECGF, or PDGF-C enhanced anagen induction in mice, and both CXCL1 and PDGF-C increased hair length in ex vivo organ culture. Treatment with CXCL1, PD-ECGF, or PDGF-C also increased the proliferation index in DP cells. Finally, topical application of CXCL1, PD-ECGF, or PDGF-C with 2% minoxidil enhanced anagen induction when compared to minoxidil alone. Minoxidil stimulates ASC motility and increases paracrine growth factor signaling. Minoxidil-stimulated secretion of growth factors by ASCs may enhance hair growth by promoting DP proliferation. Therefore, minoxidil can be used as an ASC preconditioning agent for hair regeneration. PMID:29495622

  2. Minoxidil Promotes Hair Growth through Stimulation of Growth Factor Release from Adipose-Derived Stem Cells.

    PubMed

    Choi, Nahyun; Shin, Soyoung; Song, Sun U; Sung, Jong-Hyuk

    2018-02-28

    Minoxidil directly promotes hair growth via the stimulation of dermal papilla (DP) and epithelial cells. Alternatively, there is little evidence for indirect promotion of hair growth via stimulation of adipose-derived stem cells (ASCs). We investigated whether minoxidil stimulates ASCs and if increased growth factor secretion by ASCs facilitates minoxidil-induced hair growth. Telogen-to-anagen induction was examined in mice. Cultured DP cells and vibrissae hair follicle organ cultures were used to further examine the underlying mechanisms. Subcutaneous injection of minoxidil-treated ASCs accelerated telogen-to-anagen transition in mice, and increased hair weight at day 14 post-injection. Minoxidil did not alter ASC proliferation, but increased migration and tube formation. Minoxidil also increased the secretion of growth factors from ASCs, including chemokine (C-X-C motif) ligand 1 (CXCL1), platelet-derived endothelial cell growth factor (PD-ECGF), and platelet-derived growth factor-C (PDGF-C). Minoxidil increased extracellular signal-regulated kinases 1/2 (ERK1/2) phosphorylation, and concomitant upregulation of PD-ECGF and PDGF-C mRNA levels were attenuated by an ERK inhibitor. Subcutaneous injection of CXCL1, PD-ECGF, or PDGF-C enhanced anagen induction in mice, and both CXCL1 and PDGF-C increased hair length in ex vivo organ culture. Treatment with CXCL1, PD-ECGF, or PDGF-C also increased the proliferation index in DP cells. Finally, topical application of CXCL1, PD-ECGF, or PDGF-C with 2% minoxidil enhanced anagen induction when compared to minoxidil alone. Minoxidil stimulates ASC motility and increases paracrine growth factor signaling. Minoxidil-stimulated secretion of growth factors by ASCs may enhance hair growth by promoting DP proliferation. Therefore, minoxidil can be used as an ASC preconditioning agent for hair regeneration.

  3. Altered expression of glial markers, chemokines, and opioid receptors in the spinal cord of type 2 diabetic monkeys.

    PubMed

    Kiguchi, Norikazu; Ding, Huiping; Peters, Christopher M; Kock, Nancy D; Kishioka, Shiroh; Cline, J Mark; Wagner, Janice D; Ko, Mei-Chuan

    2017-01-01

    Neuroinflammation is a pathological condition that underlies diabetes and affects sensory processing. Given the high prevalence of pain in diabetic patients and crosstalk between chemokines and opioids, it is pivotal to know whether neuroinflammation-associated mediators are dysregulated in the central nervous system of diabetic primates. Therefore, the aim of this study was to investigate whether mRNA expression levels of glial markers, chemokines, and opioid receptors are altered in the spinal cord and thalamus of naturally occurring type 2 diabetic monkeys (n=7) compared with age-matched non-diabetic monkeys (n=6). By using RT-qPCR, we found that mRNA expression levels of both GFAP and IBA1 were up-regulated in the spinal dorsal horn (SDH) of diabetic monkeys compared with non-diabetic monkeys. Among all chemokines, expression levels of three chemokine ligand-receptor systems, i.e., CCL2-CCR2, CCL3-CCR1/5, and CCL4-CCR5, were up-regulated in the SDH of diabetic monkeys. Moreover, in the SDH, seven additional chemokine receptors, i.e., CCR4, CCR6, CCR8, CCR10, CXCR3, CXCR5, and CXCR6, were also up-regulated in diabetic monkeys. In contrast, expression levels of MOP, KOP, and DOP, but not NOP receptors, were down-regulated in the SDH of diabetic monkeys, and the thalamus had fewer changes in the glial markers, chemokines and opioids. These findings indicate that neuroinflammation, manifested as glial activation and simultaneous up-regulation of multiple chemokine ligands and receptors, seems to be permanent in type 2 diabetic monkeys. As chemokines and opioids are important pain modulators, this first-in-primate study provides a translational bridge for determining the functional efficacy of spinal drugs targeting their signaling cascades. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. CXCR4/CXCL12/CXCR7 axis is functional in neuroendocrine tumors and signals on mTOR.

    PubMed

    Circelli, Luisa; Sciammarella, Concetta; Guadagno, Elia; Tafuto, Salvatore; del Basso de Caro, Marialaura; Botti, Giovanni; Pezzullo, Luciano; Aria, Massimo; Ramundo, Valeria; Tatangelo, Fabiana; Losito, Nunzia Simona; Ieranò, Caterina; D'Alterio, Crescenzo; Izzo, Francesco; Ciliberto, Gennaro; Colao, Annamaria; Faggiano, Antongiulio; Scala, Stefania

    2016-04-05

    To evaluate the possible crosstalk between C-X-C chemokine receptor 4 (CXCR4)/C-X-C motif chemokine 12 (CXCL12)/C-X-C chemokine receptor 7 (CXCR7) axis with the mammalian target of rapamycin (mTOR) pathway in neuroendocrine tumors (NETs). Sixty-one human NETs were included into the study. CXCR4/CXCL12/CXCR7 axis and mTOR pathway were assessed by qRT-PCR and immunohistochemistry (IHC). The effect of mTOR inhibitor, RAD001, was evaluated on CXCR4 pathway through proliferation and p-Erk and p-AKT induction. CXCR4/CXCL12/CXCR7 axis and p-mTOR were found to be active and correlated with grading, Ki67 index and tumor stage. mTOR pathway activation significantly correlated with poor prognosis. In human NET cells, CXCL12 induced mTOR signalling while AMD3100 (CXCR4-antagonist) impaired it. The mTOR-antagonist, RAD001, impaired the CXCL12-dependent induction of CXCR4 downstream effectors. Combination of AMD3100 and RAD001 potentiate cell growth inhibition. CXCR4/CXCL12/CXCR7 axis is active in NETs and signals on mTOR. CXCR4 might be considered a prognostic factor in NETs. Combined treatment with AMD3100 and RAD001 may provide clinical benefits in NET patients with drug-resistant.

  5. CXCR4/CXCL12/CXCR7 axis is functional in neuroendocrine tumors and signals on mTOR

    PubMed Central

    Guadagno, Elia; Tafuto, Salvatore; del Basso de Caro, Marialaura; Botti, Giovanni; Pezzullo, Luciano; Aria, Massimo; Ramundo, Valeria; Tatangelo, Fabiana; Losito, Nunzia Simona; Ieranò, Caterina; D'Alterio, Crescenzo; Izzo, Francesco; Ciliberto, Gennaro; Colao, Annamaria; Faggiano, Antongiulio; Scala, Stefania

    2016-01-01

    Objective To evaluate the possible crosstalk between C-X-C chemokine receptor 4 (CXCR4)/C-X-C motif chemokine 12 (CXCL12)/C-X-C chemokine receptor 7 (CXCR7) axis with the mammalian target of rapamycin (mTOR) pathway in neuroendocrine tumors (NETs). Methods Sixty-one human NETs were included into the study. CXCR4/CXCL12/CXCR7 axis and mTOR pathway were assessed by qRT-PCR and immunohistochemistry (IHC). The effect of mTOR inhibitor, RAD001, was evaluated on CXCR4 pathway through proliferation and p-Erk and p-AKT induction. Results: CXCR4/CXCL12/CXCR7 axis and p-mTOR were found to be active and correlated with grading, Ki67 index and tumor stage. mTOR pathway activation significantly correlated with poor prognosis. In human NET cells, CXCL12 induced mTOR signalling while AMD3100 (CXCR4-antagonist) impaired it. The mTOR-antagonist, RAD001, impaired the CXCL12-dependent induction of CXCR4 downstream effectors. Combination of AMD3100 and RAD001 potentiate cell growth inhibition. Conclusions CXCR4/CXCL12/CXCR7 axis is active in NETs and signals on mTOR. CXCR4 might be considered a prognostic factor in NETs. Combined treatment with AMD3100 and RAD001 may provide clinical benefits in NET patients with drug-resistant. PMID:26934559

  6. [Expression profiles and clinical implication of plasma chemokines in patients with Stanford type A aortic dissection].

    PubMed

    Fan, F D; Xu, Z J; Zhou, Q; Wang, D J

    2017-04-24

    Objective: To explore the plasma chemokines expressions and related clinical implication in patients with Stanford type A aortic dissection (AD). Methods: We retrospectively analyzed the data of 65 patients with Stanford type A aortic dissection, hypertensive patients and 11 healthy subjects admitted in our department from October 2013 to December 2014, they were divided into four groups: NH-CON group (11 healthy subjects), H-AD group (29 AD patients with hypertension), NH-AD group (21 AD patients without hypertension), and H-CON group (14 hypertension patients). Four plasma samples from AD patients and 4 plasma samples from healthy subjects were collected randomly with random numbers table, and the levels of different chemokines were examined by protein array analysis. Then, plasma levels of chemokines including macrophage inflammatory protein 1β(MIP-1β), epithelial neutrophil activating peptide 78(ENA-78), interleukin 16(IL-16), interferon inducible protein 10(IP-10) and FMS-like tyrosine kinase 3(Flt-3) ligand were analyzed by luminex. Pearson analysis was used to determine the correlations between the chemokines and serum C reactive protein (CRP) levels. Results: Plasma levels of MIP-1β(34.0(29.3, 47.2) ng/L vs. 51.0(28.2, 80.7) ng/L, P <0.05) and ENA-78(110.5(59.1, 161.4) ng/L vs. 475.7(299.3, 837.3) ng/L, P <0.05) were significantly lower in H-AD group, while plasma IL-16 level was significantly higher in H-AD group(54.7(16.3, 187.8) ng/L vs. 17.5(11.9, 20.8) ng/L, P <0.05) than in H-CON group. Plasma levels of MIP-1β(48.3(26.4, 62.1) ng/L, P <0.05) were significantly lower in H-AD patients than in NH-AD patients. Plasma level of ENA-78 was significantly lower in NH-AD group than in NH-CON group (95.0(58.0, 155.0) ng/L vs. 257.7(85.2, 397.8) ng/L, P <0.05). The levels of IP-10 and Flt-3 ligand were similar among the 4 groups (all P >0.05). Pearson analysis showed that there were no correlation between MIP-1β( r (2)=0.01, P >0.05), ENA-78( r (2)=0.02, P >0.05), IL-16( r (2)=0.02, P >0.05), IP-10( r (2)=0.00, P >0.05), Flt-3 ligand( r (2)=0.02, P >0.05) and CRP levels in patients with Stanford type A aortic dissection. Conclusions: Lower plasma levels of MIP-1β and ENA-78 and higher plasma levels of IL-16 may associate with the occurrence and development of type A aortic dissection, but their concentrations are not correlated with serum CRP levels. There is no significant change on plasma levels of IP-10 and Flt-3 in the Stanford type A aortic dissection patients.

  7. Generation of a Tet-On Expression System to Study Transactivation Ability of Tax-2.

    PubMed

    Bignami, Fabio; Sozzi, Riccardo Alessio; Pilotti, Elisabetta

    2017-01-01

    HTLV Tax proteins (Tax-1 and Tax-2) are known to be able to transactivate several host cellular genes involved in complex molecular pathways. Here, we describe a stable and regulated high-level expression model based on Tet-On system, to study the capacity of Tax-2 to transactivate host genes. In particular, the Jurkat Tet-On cell line suitable for evaluating the ability of Tax-2 to stimulate transactivation of a specific host gene, CCL3L1 (C-C motif chemokine ligand 3 like 1 gene), was selected. Then, a plasmid expressing tax-2 gene under control of a tetracycline-response element was constructed. To avoid the production of a fusion protein between the report gene and the inserted gene, a bidirectional plasmid was designed. Maximum expression and fast response time were achieved by using nucleofection technology as transfection method. After developing an optimized protocol for efficiently transferring tax-2 gene in Jurkat Tet-On cellular model and exposing transfected cells to Dox (doxycycline, a tetracycline derivate), a kinetics of tax-2 expression through TaqMan Real-time PCR assay was determined.

  8. Evidence that Meningeal Mast Cells Can Worsen Stroke Pathology in Mice

    PubMed Central

    Arac, Ahmet; Grimbaldeston, Michele A.; Nepomuceno, Andrew R.B.; Olayiwola, Oluwatobi; Pereira, Marta P.; Nishiyama, Yasuhiro; Tsykin, Anna; Goodall, Gregory J.; Schlecht, Ulrich; Vogel, Hannes; Tsai, Mindy; Galli, Stephen J.; Bliss, Tonya M.; Steinberg, Gary K.

    2015-01-01

    Stroke is the leading cause of adult disability and the fourth most common cause of death in the United States. Inflammation is thought to play an important role in stroke pathology, but the factors that promote inflammation in this setting remain to be fully defined. An understudied but important factor is the role of meningeal-located immune cells in modulating brain pathology. Although different immune cells traffic through meningeal vessels en route to the brain, mature mast cells do not circulate but are resident in the meninges. With the use of genetic and cell transfer approaches in mice, we identified evidence that meningeal mast cells can importantly contribute to the key features of stroke pathology, including infiltration of granulocytes and activated macrophages, brain swelling, and infarct size. We also obtained evidence that two mast cell-derived products, interleukin-6 and, to a lesser extent, chemokine (C-C motif) ligand 7, can contribute to stroke pathology. These findings indicate a novel role for mast cells in the meninges, the membranes that envelop the brain, as potential gatekeepers for modulating brain inflammation and pathology after stroke. PMID:25134760

  9. Cranberry extract attenuates hepatic inflammation in high fat-fed obese mice

    PubMed Central

    Glisan, Shannon L.; Ryan, Caroline; Neilson, Andrew P.; Lambert, Joshua D.

    2016-01-01

    Cranberry (Vaccinium macrocarpon) consumption has been associated with health beneficial effects. Non-alcoholic fatty liver disease (NAFLD) is a co-morbidity of obesity. In the present study, we investigated the effect of a polyphenol-rich cranberry extract (CBE) on hepatic inflammation in high fat-fed obese C57BL/6J mice. Following dietary treatment with 0.8% CBE for 10 weeks, we observed no change in body weight or visceral fat mass in CBE supplemented mice compared to high fat-fed control mice. We did observe a significant decrease in plasma alanine aminotransferase (31%) and histological severity of NAFLD (33% decrease in area of involvement, 29% decrease in lipid droplet size) compared to high fat-fed controls. Hepatic protein levels of tumor necrosis factor alpha and C-C chemokine ligand 2 were reduced by 28% and 19%, respectively, following CBE supplementation. CBE significantly decreased hepatic mRNA levels of toll-like receptor 4 (TLR4, 63%) and nuclear factorκ B (NFκB, 24%), as well as a number of genes related to the nucleotide-binding domain, leucine-rich-containing family, pyrin domain-containing-3 inflammasome. In conclusion, CBE reduced NAFLD and hepatic inflammation in high fat-fed obese C57BL/6J mice. These effects appear to be related to mitigation of TLR4-NFκB related signaling, however further studies into the underlying mechanisms of these hepatoprotective effects are needed. PMID:27619543

  10. CaM Kinase II mediates maladaptive post-infarct remodeling and pro-inflammatory chemoattractant signaling but not acute myocardial ischemia/reperfusion injury

    PubMed Central

    Weinreuter, Martin; Kreusser, Michael M; Beckendorf, Jan; Schreiter, Friederike C; Leuschner, Florian; Lehmann, Lorenz H; Hofmann, Kai P; Rostosky, Julia S; Diemert, Nathalie; Xu, Chang; Volz, Hans Christian; Jungmann, Andreas; Nickel, Alexander; Sticht, Carsten; Gretz, Norbert; Maack, Christoph; Schneider, Michael D; Gröne, Hermann-Josef; Müller, Oliver J; Katus, Hugo A; Backs, Johannes

    2014-01-01

    CaMKII was suggested to mediate ischemic myocardial injury and adverse cardiac remodeling. Here, we investigated the roles of different CaMKII isoforms and splice variants in ischemia/reperfusion (I/R) injury by the use of new genetic CaMKII mouse models. Although CaMKIIδC was upregulated 1 day after I/R injury, cardiac damage 1 day after I/R was neither affected in CaMKIIδ-deficient mice, CaMKIIδ-deficient mice in which the splice variants CaMKIIδB and C were re-expressed, nor in cardiomyocyte-specific CaMKIIδ/γ double knockout mice (DKO). In contrast, 5 weeks after I/R, DKO mice were protected against extensive scar formation and cardiac dysfunction, which was associated with reduced leukocyte infiltration and attenuated expression of members of the chemokine (C-C motif) ligand family, in particular CCL3 (macrophage inflammatory protein-1α, MIP-1α). Intriguingly, CaMKII was sufficient and required to induce CCL3 expression in isolated cardiomyocytes, indicating a cardiomyocyte autonomous effect. We propose that CaMKII-dependent chemoattractant signaling explains the effects on post-I/R remodeling. Taken together, we demonstrate that CaMKII is not critically involved in acute I/R-induced damage but in the process of post-infarct remodeling and inflammatory processes. PMID:25193973

  11. Human Mas-Related G Protein-Coupled Receptors-X1 Induce Chemokine Receptor 2 Expression in Rat Dorsal Root Ganglia Neurons and Release of Chemokine Ligand 2 from the Human LAD-2 Mast Cell Line

    PubMed Central

    Solinski, Hans Jürgen; Petermann, Franziska; Rothe, Kathrin; Boekhoff, Ingrid; Gudermann, Thomas; Breit, Andreas

    2013-01-01

    Primate-specific Mas-related G protein-coupled receptors-X1 (MRGPR-X1) are highly enriched in dorsal root ganglia (DRG) neurons and induce acute pain. Herein, we analyzed effects of MRGPR-X1 on serum response factors (SRF) or nuclear factors of activated T cells (NFAT), which control expression of various markers of chronic pain. Using HEK293, DRG neuron-derived F11 cells and cultured rat DRG neurons recombinantly expressing human MRGPR-X1, we found activation of a SRF reporter gene construct and induction of the early growth response protein-1 via extracellular signal-regulated kinases-1/2 known to play a significant role in the development of inflammatory pain. Furthermore, we observed MRGPR-X1-induced up-regulation of the chemokine receptor 2 (CCR2) via NFAT, which is considered as a key event in the onset of neuropathic pain and, so far, has not yet been described for any endogenous neuropeptide. Up-regulation of CCR2 is often associated with increased release of its endogenous agonist chemokine ligand 2 (CCL2). We also found MRGPR-X1-promoted release of CCL2 in a human connective tissue mast cell line endogenously expressing MRGPR-X1. Thus, we provide first evidence to suggest that MRGPR-X1 induce expression of chronic pain markers in DRG neurons and propose a so far unidentified signaling circuit that enhances chemokine signaling by acting on two distinct yet functionally co-operating cell types. Given the important role of chemokine signaling in pain chronification, we propose that interruption of this signaling circuit might be a promising new strategy to alleviate chemokine-promoted pain. PMID:23505557

  12. Structure of CC chemokine receptor 2 with orthosteric and allosteric antagonists

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zheng, Yi; Qin, Ling; Zacarías, Natalia V. Ortiz

    CC chemokine receptor 2 (CCR2) is one of 19 members of the chemokine receptor subfamily of human class A G-protein-coupled receptors. CCR2 is expressed on monocytes, immature dendritic cells, and T-cell subpopulations, and mediates their migration towards endogenous CC chemokine ligands such as CCL2 (ref. 1). CCR2 and its ligands are implicated in numerous inflammatory and neurodegenerative diseases2 including atherosclerosis, multiple sclerosis, asthma, neuropathic pain, and diabetic nephropathy, as well as cancer3. These disease associations have motivated numerous preclinical studies and clinical trials4 (see http://www.clinicaltrials.gov) in search of therapies that target the CCR2–chemokine axis. To aid drug discovery efforts5, heremore » we solve a structure of CCR2 in a ternary complex with an orthosteric (BMS-681 (ref. 6)) and allosteric (CCR2-RA-[R]7) antagonist. BMS-681 inhibits chemokine binding by occupying the orthosteric pocket of the receptor in a previously unseen binding mode. CCR2-RA-[R] binds in a novel, highly druggable pocket that is the most intracellular allosteric site observed in class A G-protein-coupled receptors so far; this site spatially overlaps the G-protein-binding site in homologous receptors. CCR2-RA-[R] inhibits CCR2 non-competitively by blocking activation-associated conformational changes and formation of the G-protein-binding interface. The conformational signature of the conserved microswitch residues observed in double-antagonist-bound CCR2 resembles the most inactive G-protein-coupled receptor structures solved so far. Like other protein–protein interactions, receptor–chemokine complexes are considered challenging therapeutic targets for small molecules, and the present structure suggests diverse pocket epitopes that can be exploited to overcome obstacles in drug design.« less

  13. Structure of CC Chemokine Receptor 2 with Orthosteric and Allosteric Antagonists

    PubMed Central

    Zheng, Yi; Qin, Ling; Ortiz Zacarías, Natalia V.; de Vries, Henk; Han, Gye Won; Gustavsson, Martin; Dabros, Marta; Zhao, Chunxia; Cherney, Robert J.; Carter, Percy; Stamos, Dean; Abagyan, Ruben; Cherezov, Vadim; Stevens, Raymond C.; IJzerman, Adriaan P.; Heitman, Laura H.; Tebben, Andrew; Kufareva, Irina; Handel, Tracy M.

    2016-01-01

    Summary CC chemokine receptor 2 (CCR2) is one of 19 members of the chemokine receptor subfamily of human Class A G protein-coupled receptors (GPCRs). CCR2 is expressed on monocytes, immature dendritic cells and T cell subpopulations, and mediates their migration towards endogenous CC chemokine ligands such as CCL21. CCR2 and its ligands are implicated in numerous inflammatory and neurodegenerative diseases2 including atherosclerosis, multiple sclerosis, asthma, neuropathic pain, and diabetic nephropathy, as well as cancer3. These disease associations have motivated numerous preclinical studies and clinical trials4 (see ClinicalTrials.gov) in search of therapies that target the CCR2:chemokine axis. To aid drug discovery efforts5, we solved a structure of CCR2 in a ternary complex with an orthosteric (BMS-6816) and allosteric (CCR2-RA-[R]7) antagonist. BMS-681 inhibits chemokine binding by occupying the orthosteric pocket of the receptor in a previously unseen binding mode. CCR2-RA-[R] binds in a novel, highly druggable pocket that is the most intracellular allosteric site observed in Class A GPCRs to date; this site spatially overlaps the G protein-binding site in homologous receptors. CCR2-RA-[R] inhibits CCR2 non-competitively by blocking activation-associated conformational changes and formation of the G protein-binding interface. The conformational signature of the conserved microswitch residues observed in double-antagonist-bound CCR2 resembles the most inactive GPCR structures solved to date. Like other protein:protein interactions, receptor:chemokine complexes are considered challenging therapeutic targets for small molecules, and the present structure suggests diverse pocket epitopes that can be exploited to overcome drug design obstacles. PMID:27926736

  14. Further Insight into the Lability of MeCN Ligands of Cytotoxic Cycloruthenated Compounds: Evidence for the Antisymbiotic Effect Trans to the Carbon Atom at the Ru Center.

    PubMed

    Barbosa, Ana Soraya Lima; Werlé, Christophe; Colunga, Claudia Olivia Oliva; Rodríguez, Cecilia Franco; Toscano, Ruben Alfredo; Le Lagadec, Ronan; Pfeffer, Michel

    2015-08-03

    The two MeCN ligands in [Ru(2-C6H4-2'-Py-κC,N)(Phen, trans-C)(MeCN)2]PF6 (1), both trans to a sp(2) hybridized N atom, cannot be substituted by any other ligand. In contrast, the isomerized derivative [Ru(2-C6H4-2'-Py-κC,N)(Phen, cis-C)(MeCN)2]PF6 (2), in which one MeCN ligand is now trans to the C atom of the phenyl ring orthometalated to Ru, leads to fast and quantitative substitution reactions with several monodentate ligands. With PPh3, 2 affords [Ru(2-C6H4-2'-Py-κC,N)(Phen, cis-C)(PPh3)(MeCN)]PF6 (3), in which PPh3 is trans to the C σ bound to Ru. Compound 3 is not kinetically stable, because, under thermodynamic control, it leads to 4, in which the PPh3 is trans to a N atom of the Phen ligand. Dimethylsulfoxide (DMSO) can also substitute a MeCN ligand in 2, leading to 5, in which DMSO is coordinated to Ru via its S atom trans to the N atom of the Phen ligand, the isomer under thermodynamic control being the only compound observed. We also found evidence for the fast to very fast substitution of MeCN in 2 by water or a chloride anion by studying the electronic spectra of 2 in the presence of water or NBu4Cl, respectively. An isomerization related to that observed between 3 and 4 is also found for the known monophosphine derivative [Ru(2-C6H4-2'-Py-κC,N)(PPh3, trans-C)(MeCN)3]PF6 (10), in which the PPh3 is located trans to the C of the cyclometalated 2-phenylpyridine, since, upon treatment by refluxing MeCN, it leads to its isomer 11, [Ru(2-C6H4-2'-Py-κC,N)(PPh3, cis-C)(MeCN)3]PF6. Further substitutions are also observed on 11, whereby N^N chelates (N^N = 2,2'-bipyridine and phenanthroline) substitute two MeCN ligands, affording [Ru(2-C6H4-2'-Py-κC,N)(PPh3, cis-C)(N^N)(MeCN)]PF6 (12a and 12b). Altogether, the behavior of the obtained complexes by ligand substitution reactions can be rationalized by an antisymbiotic effect on the Ru center, trans to the C atom of the cyclometalated unit, leading to compounds having the least nucleophilic ligand trans to C whenever an isomerization, involving either a monodentate or a bidentate ligand, is possible.

  15. Effective virtual screening protocol for CYP2C9 ligands using a screening site constructed from flurbiprofen and S-warfarin pockets

    NASA Astrophysics Data System (ADS)

    Polgár, Tímea; Menyhárd, Dóra K.; Keserű, György M.

    2007-09-01

    An effective virtual screening protocol was developed against an extended active site of CYP2C9, which was derived from X-ray structures complexed with flubiprofen and S-warfarin. Virtual screening has been effectively supported by our structure-based pharmacophore model. Importance of hot residues identified by mutation data and structural analysis was first estimated in an enrichment study. Key role of Arg108 and Phe114 in ligand binding was also underlined. Our screening protocol successfully identified 76% of known CYP2C9 ligands in the top 1% of the ranked database resulting 76-fold enrichment relative to random situation. Relevance of the protocol was further confirmed in selectivity studies, when 89% of CYP2C9 ligands were retrieved from a mixture of CYP2C9 and CYP2C8 ligands, while only 22% of CYP2C8 ligands were found applying the structure-based pharmacophore constraints. Moderate discrimination of CYP2C9 ligands from CYP2C18 and CYP2C19 ligands could also be achieved extending the application domain of our virtual screening protocol for the entire CYP2C family. Our findings further demonstrate the existence of an active site comprising of at least two binding pockets and strengthens the need of involvement of protein flexibility in virtual screening.

  16. Role of fractalkine/CX3CR1 signaling pathway in the recovery of neurological function after early ischemic stroke in a rat model.

    PubMed

    Liu, Yan-Zhi; Wang, Chun; Wang, Qian; Lin, Yong-Zhong; Ge, Yu-Song; Li, Dong-Mei; Mao, Geng-Sheng

    2017-09-01

    This study aims to explore the role of fractalkine/CX3C chemokine receptor 1 (CX3CR1) signaling pathway in the recovery of neurological functioning after an early ischemic stroke in rats. After establishment of permanent middle cerebral artery occlusion (pMCAO) models, 50 rats were divided into blank, sham, model, positive control and CX3CR1 inhibitor groups. Neurological impairment, walking and grip abilities, and cortical and hippocampal infarctions were evaluated by Zea Longa scoring criterion, beam-walking assay and grip strength test, and diffusion-weighted magnetic resonance imaging. qRT-PCR and Western blotting were performed to detect mRNA and protein expressions. ELISA was conducted to measure concentration of sFractalkine (sFkn), interleukin-1β (IL-1β) and TNF-α. The recovery rate of neurological functioning impairment and reduced walking and grip abilities was faster in the positive control and CX3CR1 inhibitor groups than the model group. The model, positive control and CX3CR1 inhibitor groups showed increased mRNA and protein expression of chemokine C-X3-C motif ligand 1 (CX3CL1) and CX3CR1, concentration of sFkn, IL-1β and TNF-α, and size of cortical and cerebral infarctions while decreased expression of NGF and BDNF compared with the blank and sham groups. Compared with the model group, the mRNA and protein expression of CX3CL1 and CX3CR1, concentration of sFkn, IL-1β and TNF-α, and size of cortical and cerebral infarctions decreased while expression of NGF and BDNF increased in the positive control and CX3CR1 inhibitor groups. Thus, the study suggests that inhibition of fractalkine/CX3CR1 signaling pathway promotes the recovery of neurological functioning after the occurrence of an early ischemic stroke. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Gas6 Promotes Inflammatory (CCR2hiCX3CR1lo) Monocyte Recruitment in Venous Thrombosis.

    PubMed

    Laurance, Sandrine; Bertin, François-René; Ebrahimian, Talin; Kassim, Yusra; Rys, Ryan N; Lehoux, Stéphanie; Lemarié, Catherine A; Blostein, Mark D

    2017-07-01

    Coagulation and inflammation are inter-related. Gas6 (growth arrest-specific 6) promotes venous thrombosis and participates to inflammation through endothelial-innate immune cell interactions. Innate immune cells can provide the initiating stimulus for venous thrombus development. We hypothesize that Gas6 promotes monocyte recruitment during venous thrombosis. Deep venous thrombosis was induced in wild-type and Gas6-deficient (-/-) mice using 5% FeCl 3 and flow reduction in the inferior vena cava. Total monocyte depletion was achieved by injection of clodronate before deep venous thrombosis. Inflammatory monocytes were depleted using an anti-C-C chemokine receptor type 2 (CCR2) antibody. Similarly, injection of an anti-chemokine ligand 2 (CCL2) antibody induced CCL2 depletion. Flow cytometry and immunofluorescence were used to characterize the monocytes recruited to the thrombus. In vivo, absence of Gas6 was associated with a reduction of monocyte recruitment in both deep venous thrombosis models. Global monocyte depletion by clodronate leads to smaller thrombi in wild-type mice. Compared with wild type, the thrombi from Gas6 -/- mice contain less inflammatory (CCR2 hi CX 3 CR1 lo ) monocytes, consistent with a Gas6-dependent recruitment of this monocyte subset. Correspondingly, selective depletion of CCR2 hi CX 3 CR1 lo monocytes reduced the formation of venous thrombi in wild-type mice demonstrating a predominant role of the inflammatory monocytes in thrombosis. In vitro, the expression of both CCR2 and CCL2 were Gas6 dependent in monocytes and endothelial cells, respectively, impacting monocyte migration. Moreover, Gas6-dependent CCL2 expression and monocyte migration were mediated via JNK (c-Jun N-terminal kinase). This study demonstrates that Gas6 specifically promotes the recruitment of inflammatory CCR2 hi CX 3 CR1 lo monocytes through the regulation of both CCR2 and CCL2 during deep venous thrombosis. © 2017 American Heart Association, Inc.

  18. Age-related differences in biomarkers of acute inflammation during hospitalization for sepsis.

    PubMed

    Ginde, Adit A; Blatchford, Patrick J; Trzeciak, Stephen; Hollander, Judd E; Birkhahn, Robert; Otero, Ronny; Osborn, Tiffany M; Moretti, Eugene; Nguyen, H Bryant; Gunnerson, Kyle J; Milzman, David; Gaieski, David F; Goyal, Munish; Cairns, Charles B; Rivers, Emanuel P; Shapiro, Nathan I

    2014-08-01

    The authors aimed to evaluate age-related differences in inflammation biomarkers during the first 72 h of hospitalization for sepsis. This was a secondary analysis of a prospective observational cohort of adult patients (n = 855) from 10 urban academic emergency departments with confirmed infection and two or more systemic inflammatory response syndrome criteria. Six inflammation-related biomarkers were analyzed-chemokine (CC-motif) ligand-23, C-reactive protein, interleukin-1 receptor antagonist, neutrophil gelatinase-associated lipocalin (NGAL), peptidoglycan recognition protein, and tumor necrosis factor receptor-1a (TNFR-1a)-measured at presentation and 3, 6, 12, 24, 48, or 72 h later. The median age was 56 (interquartile range, 43 - 72) years, and sepsis severity was 38% sepsis, 16% severe sepsis without shock, and 46% septic shock; the overall 30-day mortality was 12%. Older age was associated with higher sepsis severity: 41% of subjects aged 18 to 34 years had severe sepsis or septic shock compared with 71% for those aged 65 years or older (P < 0.001). In longitudinal models adjusting for demographics, comorbidities, and infection source, older age was associated with higher baseline values for chemokine (CC-motif) ligand-23, interleukin-1 receptor antagonist, NGAL, and TNFR-1a (all P < 0.05). However, older adults had higher mean values during the entire 72-h period only for NGAL and TNFR-1a and higher final 72-h values only for TNFR-1a. Adjustment or stratification by sepsis severity did not change the age-inflammation associations. Although older adults had higher levels of inflammation at presentation and an increased incidence of severe sepsis and septic shock, these age-related differences in inflammation largely resolved during the first 72 h of hospitalization.

  19. Wnt5a-Ror2 signaling in mesenchymal stem cells promotes proliferation of gastric cancer cells by activating CXCL16-CXCR6 axis.

    PubMed

    Takiguchi, Gosuke; Nishita, Michiru; Kurita, Kana; Kakeji, Yoshihiro; Minami, Yasuhiro

    2016-03-01

    Wnt5a-Ror2 signaling has been shown to play important roles in promoting aggressiveness of various cancer cells in a cell-autonomous manner. However, little is known about its function in cancer-associated stromal cells, including mesenchymal stem cells (MSCs). Thus, we examined the role of Wnt5a-Ror2 signaling in bone marrow-derived MSCs in regulating proliferation of undifferentiated gastric cancer cells. Coculture of a gastric cancer cell line, MKN45, with MSCs either directly or indirectly promotes proliferation of MKN45 cells, and suppressed expression of Ror2 in MSCs prior to coculture inhibits enhanced proliferation of MKN45 cells. In addition, conditioned media from MSCs, treated with control siRNA, but not siRNAs against Ror2, can enhance proliferation of MKN45 cells. Interestingly, it was found that expression of CXCL16 in MSCs is augmented by Wnt5a-Ror2 signaling, and that recombinant chemokine (C-X-C motif) ligand (CXCL)16 protein can enhance proliferation of MKN45 cells in the absence of MSCs. In fact, suppressed expression of CXCL16 in MSCs or an addition of a neutralizing antibody against CXCL16 fails to promote proliferation of MKN45 cells in either direct or indirect coculture with MSCs. Importantly, we show that MKN45 cells express chemokine (C-X-C motif) receptor (CXCR)6, a receptor for CXCL16, and that suppressed expression of CXCR6 in MKN45 cells results in a failure of its enhanced proliferation in either direct or indirect coculture with MSCs. These findings indicate that Wnt5a-Ror2 signaling enhances expression of CXCL16 in MSCs and, as a result, enhanced secretion of CXCL16 from MSCs might act on CXCR6 expressed on MKN45, leading to the promotion of its proliferation. © 2015 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  20. Altered circulating leukocytes and their chemokines in a clinical trial of therapeutic hypothermia for neonatal hypoxic ischemic encephalopathy*.

    PubMed

    Jenkins, Dorothea D; Lee, Timothy; Chiuzan, Cody; Perkel, Jessica K; Rollins, Laura Grace; Wagner, Carol L; Katikaneni, Lakshmi P; Bass, W Thomas; Kaufman, David A; Horgan, Michael J; Laungani, Sheela; Givelichian, Laurence M; Sankaran, Koravangatta; Yager, Jerome Y; Martin, Renee

    2013-10-01

    To determine systemic hypothermia's effect on circulating immune cells and their corresponding chemokines after hypoxic ischemic encephalopathy in neonates. In our randomized, controlled, multicenter trial of systemic hypothermia in neonatal hypoxic ischemic encephalopathy, we measured total and leukocyte subset and serum chemokine levels over time in both hypothermia and normothermia groups, as primary outcomes for safety. Neonatal ICUs participating in a Neurological Disorders and Stroke sponsored clinical trial of therapeutic hypothermia. Sixty-five neonates with moderate to severe hypoxic ischemic encephalopathy within 6 hours after birth. Patients were randomized to normothermia of 37°C or systemic hypothermia of 33°C for 48 hours. Complete and differential leukocyte counts and serum chemokines were measured every 12 hours for 72 hours. The hypothermia group had significantly lower median circulating total WBC and leukocyte subclasses than the normothermia group before rewarming, with a nadir at 36 hours. Only the absolute neutrophil count rebounded after rewarming in the hypothermia group. Chemokines, monocyte chemotactic protein-1 and interleukin-8, which mediate leukocyte chemotaxis as well as bone marrow suppression, were negatively correlated with their target leukocytes in the hypothermia group, suggesting active chemokine and leukocyte modulation by hypothermia. Relative leukopenia at 60-72 hours correlated with an adverse outcome in the hypothermia group. Our data are consistent with chemokine-associated systemic immunosuppression with hypothermia treatment. In hypothermic neonates, persistence of lower leukocyte counts after rewarming is observed in infants with more severe CNS injury.

  1. Shear Stress Enhances Chemokine Secretion from Chlamydia pneumoniae-infected Monocytes.

    PubMed

    Evani, Shankar J; Dallo, Shatha F; Murthy, Ashlesh K; Ramasubramanian, Anand K

    2013-09-01

    Chlamydia pneumoniae is a common respiratory pathogen that is considered a highly likely risk factor for atherosclerosis. C. pneumoniae is disseminated from the lung into systemic circulation via infected monocytes and lodges at the atherosclerotic sites. During transit, C. pneumoniae -infected monocytes in circulation are subjected to shear stress due to blood flow. The effect of mechanical stimuli on infected monocytes is largely understudied in the context of C. pneumoniae infection and inflammation. We hypothesized that fluid shear stress alters the inflammatory response of C. pneumoniae -infected monocytes and contributes to immune cell recruitment to the site of tissue damage. Using an in vitro model of blood flow, we determined that a physiological shear stress of 7.5 dyn/cm 2 for 1 h on C. pneumoniae -infected monocytes enhances the production of several chemokines, which in turn is correlated with the recruitment of significantly large number of monocytes. Taken together, these results suggest synergistic interaction between mechanical and chemical factors in C. pneumoniae infection and associated inflammation.

  2. Cytokine markers of B lymphocytes in minor salivary gland infiltrates in Sjögren's syndrome.

    PubMed

    Navarro-Mendoza, Erika P; Aguirre-Valencia, David; Posso-Osorio, Iván; Correa-Forero, Shirley Vanessa; Torres-Cutiva, Daniel-Felipe; Loaiza, Diana; Tobón, Gabriel J

    2018-05-03

    Sjögren's syndrome (SS) is a chronic autoimmune disorder characterised by the clinical presence of sicca syndrome. SS compromises the dysfunction of exocrine glands due to the presence of focal, mononuclear cell infiltrates that surround the ducts and replace the secretory units. Abnormal expression of different cytokines and chemokines such as B-cell activating factor, CXC Motif Chemokine Ligand 13, interleukin 6 (IL-6), IL-22, and FMS-like tyrosine kinase 3 ligand as well as that of their corresponding receptors has been implicated in the inflammatory process. The severity of glandular infiltration has been suggested to be associated with the presence of extra-glandular systemic manifestations, contributing to a clinical spectrum of the most severe disease. This review describes several cytokines and chemokines associated with B lymphocytes expressed in the minor salivary gland, their chemical structures, and their roles in SS as possible early predictors of lymphoma development and disease progression. Copyright © 2018. Published by Elsevier B.V.

  3. Chemokine guided angiogenesis directs coronary vasculature formation in zebrafish

    PubMed Central

    Harrison, Michael R.M.; Bussmann, Jeroen; Huang, Ying; Zhao, Long; Osorio, Arthela; Burns, C. Geoffrey; Burns, Caroline E.; Sucov, Henry M.; Siekmann, Arndt F.; Lien, Ching-Ling

    2015-01-01

    SUMMARY Interruption of coronary blood supply severely impairs heart function with often-fatal consequences for heart disease patients. However the formation and maturation of these coronary vessels is not fully understood. Here we provide a detailed analysis of coronary vessel development in zebrafish. We observe that coronary vessels form in zebrafish by angiogenic sprouting of arterial cells derived from the endocardium at the atrioventricular canal. Endothelial cells express the CXC-motif chemokine receptor Cxcr4a and migrate to vascularize the ventricle under the guidance of the myocardium-expressed ligand Cxcl12b. cxcr4a mutant zebrafish fail to form a vascular network, whereas ectopic expression of Cxcl12b ligand induces coronary vessel formation. Importantly, cxcr4a mutant zebrafish fail to undergo heart regeneration following injury. Our results suggest that chemokine-signaling has an essential role in coronary vessel formation by directing migration of endocardium-derived endothelial cells. Poorly developed vasculature in cxcr4a mutants likely underlies decreased regenerative potential in adults. PMID:26017769

  4. Regulation of MMP-3 expression and secretion by the chemokine eotaxin-1 in human chondrocytes

    PubMed Central

    2011-01-01

    Background Osteoarthritis (OA) is characterized by the degradation of articular cartilage, marked by the breakdown of matrix proteins. Studies demonstrated the involvement of chemokines in this process, and some may potentially serve as diagnostic markers and therapeutic targets; however, the underlying signal transductions are not well understood. Methods We investigated the effects of the CC chemokine eotaxin-1 (CCL11) on the matrix metalloproteinase (MMP) expression and secretion in the human chondrocyte cell line SW1353 and primary chondrocytes. Results Eotaxin-1 significantly induced MMP-3 mRNA expression in a dose-dependent manner. Inhibitors of extracellular signal-regulated kinase (ERK) and p38 kinase were able to repress eotaxin-1-induced MMP-3 expression. On the contrary, Rp-adenosine-3',5'-cyclic monophosphorothioate (Rp-cAMPs), a competitive cAMP antagonist for cAMP receptors, and H-89, a protein kinase A (PKA) inhibitor, markedly enhanced eotaxin-1-induced MMP-3 expression. These results suggest that MMP-3 expression is specifically mediated by the G protein-coupled eotaxin-1 receptor activities. Interestingly, little amount of MMP-3 protein was detected in the cell lysates of eotaxin-1-treated SW1353 cells, and most of MMP-3 protein was in the culture media. Furthermore we found that the eotaxin-1-dependent MMP-3 protein secretion was regulated by phospholipase C (PLC)-protein kinase C (PKC) cascade and c-Jun N-terminal kinase (JNK)/mitogen-activated protein (MAP) kinase pathways. These data indicate a specific regulation of MMP-3 secretion also by eotaxin-1 receptor activities. Conclusions Eotaxin-1 not only induces MMP-3 gene expression but also promotes MMP-3 protein secretion through G protein-coupled eotaxin-1 receptor activities. Chemokines, such as eotaxin-1, could be a potential candidate in the diagnosis and treatment of arthritis. PMID:22114952

  5. Manufacturing porcine islets: culture at 22 °C has no advantage above culture at 37 °C: a gene expression evaluation.

    PubMed

    Mueller, Kate R; Martins, Kyra V; Murtaugh, Michael P; Schuurman, Henk-Jan; Papas, Klearchos K

    2013-01-01

    The manufacturing process of islets includes a culture step which was originally introduced to ease the logistics of procedures in preparing the graft and transplant recipient. It has been suggested that culture at room temperature has an advantage over culture at 37 °C, in part by reducing immunogenicity via preferential elimination of contaminating cells (such as passenger leukocytes) within islets. We investigated this using islets isolated from pancreata of adult pigs. Porcine islets were isolated from three donors and cultured at 37 °C for 1 day, and then under three different conditions: 37 °C for 6 days (condition A); 22 °C for 6 days (condition B); or 22 °C for 5 days followed by 37 °C for 1 day (condition C). Recovery was assessed by DNA measurement, viability by oxygen consumption rate normalized for DNA (OCR/DNA), and gene expression by RT-PCR for a series of 9 lymphocyte markers, 11 lymphokines and chemokines, and 14 apoptotic and stress markers. Post-culture islet recoveries were similar for the three culture conditions. Average OCR/DNA values were 129-159 nmol/min·mgDNA before culture, and 259-291, 204-212, and 207-228 nmol/min·mgDNA, respectively, for culture under conditions A, B, and C, respectively. Irrespective of culture condition, examined gene expression in all three series of lymphocyte markers, lymphokines and chemokines, and apoptotic and stress markers manifested a statistically significant decrease upon culture for 7 days. This decrease was most dramatic for condition A: in particular, most of lymphocyte markers showed a >10-fold reduction and also six markers in the lymphokine and chemokine series; these reductions are consistent with the elimination of immune cells present within islets during culture. The reduction was less for apoptotic and stress markers. For culture under condition B, the reduction in gene expression was less, and culture under condition C resulted in gene expression levels similar to those under condition A: this indicates that 24 h at 37 °C is sufficient to re-equilibrate gene expression levels from those in islets cultured at 22 °C to those in islets cultured at 37 °C. Results were consistent among the preparations from the three donors. Culture of porcine islets at 37 °C provides benefits over culture at 22 °C with respect to OCR/DNA outcomes and reduced expression of genes encoding lymphocyte markers, lymphokines and chemokines, and markers for apoptosis and stress. © 2013 John Wiley & Sons A/S.

  6. Suppressive effects of a novel CC chemokine receptor 4 antagonist on Th2 cell trafficking in ligand- and antigen-induced mouse models.

    PubMed

    Komiya, Takaki; Sugiyama, Tetsuya; Takeda, Kazuhiko; Watanabe, Noriki; Imai, Masamichi; Kokubo, Masaya; Tokuda, Natsuko; Ochiai, Hiroshi; Habashita, Hiromu; Shibayama, Shiro

    2013-11-15

    CC chemokine receptor 4 (CCR4) has been implicated as a preferential marker for T helper type 2 (Th2) cells, and is believed to be involved in the pathology of allergic diseases by controlling Th2 cell trafficking into inflamed tissues. The objective of the study was to characterize the pharmacological properties of E0001-163, a novel CCR4 antagonist. E0001-163 was tested in both in vitro chemotaxis assays as well as in vivo mouse models of CCR4 ligand-induced air pouch and antigen-induced airway inflammation by utilizing in vitro-polarized Th2 cells. In vitro, E0001-163 inhibited migratory response of human Th2-polarized cells to CCL22, a CCR4 ligand, with an IC50 value of 11.9 nM. E0001-163 significantly suppressed CCL22-induced Th2 cell trafficking into mouse air pouch in a dose-dependent manner at doses of 3 and 10mg/kg, suggesting that E0001-163 has an inhibitory effect on CCR4-mediated T cell trafficking in vivo. In addition, E0001-163 partially decreased Th2 cell trafficking and the level of IL-4 in the lungs in Th2-tansferred and ovalbumin (OVA)-challenged mice. T cell trafficking involves multiple chemokine receptors both in acute and chronic phases, and our findings suggest that CCR4, together with other chemokine receptors, may be involved in Th2 cell trafficking under disease conditions. © 2013 Elsevier B.V. All rights reserved.

  7. The prognostic importance of CXCR3 chemokine during organizing pneumonia on the risk of chronic lung allograft dysfunction after lung transplantation

    PubMed Central

    Weigt, S. Samuel; Li, Ning; Palchevskiy, Vyacheslav; Derhovanessian, Ariss; Saggar, Rajan; Sayah, David M.; Huynh, Richard H.; Gregson, Aric L.; Fishbein, Michael C.; Ardehali, Abbas; Ross, David J.; Lynch, Joseph P.; Elashoff, Robert M.; Belperio, John A.

    2017-01-01

    Rationale Since the pathogenesis of chronic lung allograft dysfunction (CLAD) remains poorly defined with no known effective therapies, the identification and study of key events which increase CLAD risk is a critical step towards improving outcomes. We hypothesized that bronchoalveolar lavage fluid (BALF) CXCR3 ligand concentrations would be augmented during organizing pneumonia (OP) and that episodes of OP with marked chemokine elevations would be associated with significantly higher CLAD risk. Methods All transbronchial biopsies (TBBX) from patients who received lung transplantation between 2000 to 2010 were reviewed. BALF concentrations of the CXCR3 ligands (CXCL9, CXCL10 and CXCL11) were compared between episodes of OP and “healthy” biopsies using linear mixed-effects models. The association between CXCR3 ligand concentrations during OP and CLAD risk was evaluated using proportional hazards models with time-dependent covariates. Results There were 1894 bronchoscopies with TBBX evaluated from 441 lung transplant recipients with 169 (9%) episodes of OP and 907 (49%) non-OP histopathologic injuries. 62 (37%) episodes of OP were observed during routine surveillance bronchoscopy. Eight hundred thirty-eight (44%) TBBXs had no histopathology and were classified as “healthy” biopsies. There were marked elevations in BALF CXCR3 ligand concentrations during OP compared with “healthy” biopsies. In multivariable models adjusted for other injury patterns, OP did not significantly increase the risk of CLAD when BAL CXCR3 chemokine concentrations were not taken into account. However, OP with elevated CXCR3 ligands markedly increased CLAD risk in a dose-response manner. An episode of OP with CXCR3 concentrations greater than the 25th, 50th and 75th percentiles had HRs for CLAD of 1.5 (95% CI 1.0–2.3), 1.9 (95% CI 1.2–2.8) and 2.2 (95% CI 1.4–3.4), respectively. Conclusions This study identifies OP, a relatively uncommon histopathologic finding after lung transplantation, as a major risk factor for CLAD development when considered in the context of increased allograft expression of interferon-γ inducible ELR- CXC chemokines. We further demonstrate for the first time, the prognostic importance of BALF CXCR3 ligand concentrations during OP on subsequent CLAD risk. PMID:28686641

  8. Mutating the CX3C Motif in the G Protein Should Make a Live Respiratory Syncytial Virus Vaccine Safer and More Effective.

    PubMed

    Boyoglu-Barnum, S; Todd, S O; Meng, J; Barnum, T R; Chirkova, T; Haynes, L M; Jadhao, S J; Tripp, R A; Oomens, A G; Moore, M L; Anderson, L J

    2017-05-15

    Respiratory syncytial virus (RSV) belongs to the family Paramyxoviridae and is the single most important cause of serious lower respiratory tract infections in young children, yet no highly effective treatment or vaccine is available. Through a CX3C chemokine motif ( 182 CWAIC 186 ) in the G protein, RSV binds to the corresponding chemokine receptor, CX3CR1. Since RSV binding to CX3CR1 contributes to disease pathogenesis, we investigated whether a mutation in the CX3C motif by insertion of an alanine, A 186 , within the CX3C motif, mutating it to CX4C ( 182 CWAIAC 187 ), which is known to block binding to CX3CR1, might decrease disease. We studied the effect of the CX4C mutation in two strains of RSV (A2 and r19F) in a mouse challenge model. We included RSV r19F because it induces mucus production and airway resistance, two manifestations of RSV infection in humans, in mice. Compared to wild-type (wt) virus, mice infected with CX4C had a 0.7 to 1.2 log 10 -fold lower virus titer in the lung at 5 days postinfection (p.i.) and had markedly reduced weight loss, pulmonary inflammatory cell infiltration, mucus production, and airway resistance after challenge. This decrease in disease was not dependent on decrease in virus replication but did correspond to a decrease in pulmonary Th2 and inflammatory cytokines. Mice infected with CX4C viruses also had higher antibody titers and a Th1-biased T cell memory response at 75 days p.i. These results suggest that the CX4C mutation in the G protein could improve the safety and efficacy of a live attenuated RSV vaccine. IMPORTANCE RSV binds to the corresponding chemokine receptor, CX3CR1, through a CX3C chemokine motif ( 182 CWAIC 186 ) in the G protein. RSV binding to CX3CR1 contributes to disease pathogenesis; therefore, we investigated whether a mutation in the CX3C motif by insertion of an alanine, A 186 , within the CX3C motif, mutating it to CX4C ( 182 CWAIAC 187 ), known to block binding to CX3CR1, might decrease disease. The effect of this mutation and treatment with the F(ab') 2 form of the anti-RSV G 131-2G monoclonal antibody (MAb) show that mutating the CX3C motif to CX4C blocks much of the disease and immune modulation associated with the G protein and should improve the safety and efficacy of a live attenuated RSV vaccine. Copyright © 2017 American Society for Microbiology.

  9. AMP-activated protein kinase activation mediates CCL3-induced cell migration and matrix metalloproteinase-2 expression in human chondrosarcoma

    PubMed Central

    2013-01-01

    Chemokine (C-C motif) ligand 3 (CCL3), also known as macrophage inflammatory protein-1α, is a cytokine involved in inflammation and activation of polymorphonuclear leukocytes. CCL3 has been detected in infiltrating cells and tumor cells. Chondrosarcoma is a highly malignant tumor that causes distant metastasis. However, the effect of CCL3 on human chondrosarcoma metastasis is still unknown. Here, we found that CCL3 increased cellular migration and expression of matrix metalloproteinase (MMP)-2 in human chondrosarcoma cells. Pre-treatment of cells with the MMP-2 inhibitor or transfection with MMP-2 specific siRNA abolished CCL3-induced cell migration. CCL3 has been reported to exert its effects through activation of its specific receptor, CC chemokine receptor 5 (CCR5). The CCR5 and AMP-activated protein kinase (AMPK) inhibitor or siRNA also attenuated CCL3-upregulated cell motility and MMP-2 expression. CCL3-induced expression of MMP-2 and migration were also inhibited by specific inhibitors, and inactive mutants of AMPK, p38 mitogen activated protein kinase (p38 or p38-MAPK), and nuclear factor κB (NF-κB) cascades. On the other hand, CCL3 treatment demonstrably activated AMPK, p38, and NF-κB signaling pathways. Furthermore, the expression levels of CCL3, CCR5, and MMP-2 were correlated in human chondrosarcoma specimens. Taken together, our results indicate that CCL3 enhances the migratory ability of human chondrosarcoma cells by increasing MMP-2 expression via the CCR5, AMPK, p38, and NF-κB pathways. PMID:24047437

  10. CXCR3+CD4+ T cells mediate innate immune function in the pathophysiology of liver ischemia/reperfusion injury.

    PubMed

    Zhai, Yuan; Shen, Xiu-da; Hancock, Wayne W; Gao, Feng; Qiao, Bo; Lassman, Charles; Belperio, John A; Strieter, Robert M; Busuttil, Ronald W; Kupiec-Weglinski, Jerzy W

    2006-05-15

    Ischemia-reperfusion injury (IRI), an innate immune-dominated inflammatory response, develops in the absence of exogenous Ags. The recently highlighted role of T cells in IRI raises a question as to how T lymphocytes interact with the innate immune system and function with no Ag stimulation. This study dissected the mechanism of innate immune-induced T cell recruitment and activation in rat syngeneic orthotopic liver transplantation (OLT) model. Liver IRI was induced after cold storage (24-36 h) at 4 degrees C in University of Wisconsin solution. Gene products contributing to IRI were identified by cDNA microarray at 4-h posttransplant. IRI triggered increased intrahepatic expression of CXCL10, along with CXCL9 and 11. The significance of CXCR3 ligand induction was documented by the ability of neutralizing anti-CXCR3 Ab treatment to ameliorate hepatocellular damage and improve 14-day survival of 30-h cold-stored OLTs (95 vs 40% in controls; p < 0.01). Immunohistology analysis confirmed reduced CXCR3+ and CD4+ T cell infiltration in OLTs after treatment. Interestingly, anti-CXCR3 Ab did not suppress innate immune activation in the liver, as evidenced by increased levels of IL-1beta, IL-6, inducible NO synthase, and multiple neutrophil/monokine-targeted chemokine programs. In conclusion, this study demonstrates a novel mechanism of T cell recruitment and function in the absence of exogenous Ag stimulation. By documenting that the execution of innate immune function requires CXCR3+CD4+ T cells, it highlights the critical role of CXCR3 chemokine biology for the continuum of innate to adaptive immunity in the pathophysiology of liver IRI.

  11. Enhanced tumor metastasis in response to blockade of the chemokine receptor CXCR6 is overcome by NKT cell activation.

    PubMed

    Cullen, Robyn; Germanov, Elitza; Shimaoka, Takeshi; Johnston, Brent

    2009-11-01

    Invariant NKT (iNKT) cells can induce potent antitumor responses in vivo. However, the mechanisms that regulate the effects of iNKT cells are unclear. The chemokine receptor CXCR6, and its ligand CXCL16, have been shown to play critical roles in iNKT cell homeostasis and activation. Thus we investigated the role of CXCR6 in protection against experimental metastasis of B16-F10 melanoma (B16) and Lewis lung carcinoma (LLC) cells to the liver and lungs. Wild-type and CXCR6(-/-) mice exhibited no differences in tumor cell metastasis to the lungs. However, metastasis of LLC and B16 tumor cells to the liver was enhanced in CXCR6(-/-) mice. Liver metastasis was also increased in wild-type mice treated with a CXCL16 neutralizing Ab. As Ab treatments did not alter iNKT cell numbers, this implicates a direct role for CXCR6/CXCL16 in regulating antitumor immunity. Cytokine induction was significantly attenuated in CXCR6(-/-) mice upon systemic iNKT cell activation with the glycolipid Ags alpha-galactosylceramide (alpha-GalCer), alpha-C-GalCer (a Th1 polarizing derivative), or OCH (a Th2 polarizing derivative). Despite differences in the levels of cytokine production, liver and lung metastasis were inhibited significantly in both wild-type and CXCR6(-/-) mice treated with glycolipids. Single doses of alpha-GalCer, alpha-C-GalCer, or OCH were sufficient to prevent liver metastasis and subsequent doses failed to elicit optimal cytokine responses. Our findings implicate a role for CXCR6 in natural immunosurveillance against liver metastasis. However, CXCR6 deficiency could be overcome by systemic iNKT cell activation, demonstrating that even suboptimal iNKT cell activation can protect against metastasis.

  12. CXCL4L1 and CXCL4 signaling in human lymphatic and microvascular endothelial cells and activated lymphocytes: involvement of mitogen-activated protein (MAP) kinases, Src and p70S6 kinase.

    PubMed

    Van Raemdonck, Katrien; Gouwy, Mieke; Lepers, Stefanie Antoinette; Van Damme, Jo; Struyf, Sofie

    2014-07-01

    CXC chemokines influence a variety of biological processes, such as angiogenesis, both in a physiological and pathological context. Platelet factor-4 (PF-4)/CXCL4 and its variant PF-4var/CXCL4L1 are known to favor angiostasis by inhibiting endothelial cell proliferation and chemotaxis. CXCL4L1 in particular is a potent inhibitor of angiogenesis with anti-tumoral characteristics, both through regulation of neovascularization and through attraction of activated lymphocytes. However, its underlying signaling pathways remain to be elucidated. Here, we have identified various intracellular pathways activated by CXCL4L1 in comparison with other CXCR3 ligands, including CXCL4 and interferon-γ-induced protein 10/CXCL10. Signaling experiments show involvement of the mitogen-activated protein kinase (MAPK) family in CXCR3A-transfected cells, activated lymphocytes and human microvascular endothelial cells (HMVEC). In CXCR3A transfectants, CXCL4 and CXCL4L1 activated p38 MAPK, as well as Src kinase within 30 and 5 min, respectively. Extracellular signal-regulated kinase (ERK) phosphorylation occurred in activated lymphocytes, yet was inhibited in microvascular and lymphatic endothelial cells. CXCL4L1 and CXCL4 counterbalanced the angiogenic chemokine stromal cell-derived factor-1/CXCL12 in both endothelial cell types. Notably, inhibition of ERK signaling by CXCL4L1 and CXCL4 in lymphatic endothelial cells implies that these chemokines might also regulate lymphangiogenesis. Furthermore, CXCL4, CXCL4L1 and CXCL10 slightly enhanced forskolin-stimulated cAMP production in HMVEC. Finally, CXCL4, but not CXCL4L1, induced activation of p70S6 kinase within 5 min in HMVEC. Our findings confirm that the angiostatic chemokines CXCL4L1 and CXCL4 activate both CXCR3A and CXCR3B and bring new insights into the complexity of their signaling cascades.

  13. Deregulation of the endogenous C/EBPβ LIP isoform predisposes to tumorigenesis.

    PubMed

    Bégay, Valérie; Smink, Jeske J; Loddenkemper, Christoph; Zimmermann, Karin; Rudolph, Cornelia; Scheller, Marina; Steinemann, Doris; Leser, Ulf; Schlegelberger, Brigitte; Stein, Harald; Leutz, Achim

    2015-01-01

    Two long and one truncated isoforms (termed LAP*, LAP, and LIP, respectively) of the transcription factor CCAAT enhancer binding protein beta (C/EBPβ) are expressed from a single intronless Cebpb gene by alternative translation initiation. Isoform expression is sensitive to mammalian target of rapamycin (mTOR)-mediated activation of the translation initiation machinery and relayed through an upstream open reading frame (uORF) on the C/EBPβ mRNA. The truncated C/EBPβ LIP, initiated by high mTOR activity, has been implied in neoplasia, but it was never shown whether endogenous C/EBPβ LIP may function as an oncogene. In this study, we examined spontaneous tumor formation in C/EBPβ knockin mice that constitutively express only the C/EBPβ LIP isoform from its own locus. Our data show that deregulated C/EBPβ LIP predisposes to oncogenesis in many tissues. Gene expression profiling suggests that C/EBPβ LIP supports a pro-tumorigenic microenvironment, resistance to apoptosis, and alteration of cytokine/chemokine expression. The results imply that enhanced translation reinitiation of C/EBPβ LIP promotes tumorigenesis. Accordingly, pharmacological restriction of mTOR function might be a therapeutic option in tumorigenesis that involves enhanced expression of the truncated C/EBPβ LIP isoform. Elevated C/EBPβ LIP promotes cancer in mice. C/EBPβ LIP is upregulated in B-NHL. Deregulated C/EBPβ LIP alters apoptosis and cytokine/chemokine networks. Deregulated C/EBPβ LIP may support a pro-tumorigenic microenvironment.

  14. Patients Lacking a KIR-Ligand of HLA Group C1 or C2 Have a Better Outcome after Umbilical Cord Blood Transplantation.

    PubMed

    Martínez-Losada, Carmen; Martín, Carmen; Gonzalez, Rafael; Manzanares, Bárbara; García-Torres, Estefania; Herrera, Concha

    2017-01-01

    Donor natural killer (NK) cells can destroy residual leukemic cells after allogeneic hematopoietic stem cell transplantation. This effect is based on the interaction of killer-cell immunoglobulin-like receptors (KIR) of donor NK cells with ligands of the major histocompatibility complex found on the surface of the target cells. HLA-C1 subtypes provide the ligand for KIR2DL2 and KIR2DL3 and the HLA-C2 subtypes for KIR2DL1. We have studied the probability of relapse (PR) after single-unit unrelated cord blood transplantation (UCBT) in relation to the potential graft-vs.-leukemia effect mediated by NK cells present in the umbilical cord blood (UCB) by analyzing KIR-ligand and HLA-C typing of the receptor. Data from 33 consecutive patients given a single unit UCBT were included. We have considered two groups of patients based on the absence or the presence of one of the C-ligands for inhibitory KIR and the incompatibility HLA-C1/2 between UCB and patients. Group 1 ( n  = 21): the patient lacks a C-ligand for inhibitory KIR present in UCB NK cells, i.e., patients homozygous C1/C1 or C2/C2. Group 2 ( n  = 12): patients heterozygous C1/C2 in which KIR-mediated graft-vs.-leukemia effect is not expected (presence of both C ligands for inhibitory KIR in the receptor). With a median follow-up post-UCBT of 93 months, patients with absence of a C-ligand for inhibitory KIRs (Group 1) showed a lower actuarial PR than patients with both C-ligands (group 2): 21 ± 10 vs. 68 ± 18% at 2 year and 36 ± 13 vs. 84 ± 14% at 5 years ( p  = 0.025), respectively. In patients with acute lymphoblastic leukemia, the 2-year PR was 36 ± 21% for group 1 and 66 ± 26% for 2 ( p  = 0.038). Furthermore, group 1 had a lower incidence of grades II-IV acute graft-vs.-host disease ( p  = 0.04). In the setting of UCBT, the absence of a C-ligand (C1 or C2) of inhibitory KIR in the patient is associated with lower PR, which is probably due to the graft-vs.-host leukemia effect caused by UCB NK cells that lack a ligand for the inhibitory KIR 2DL1/2DL2/2DL3.

  15. Acute and chronic rejection: compartmentalization and kinetics of counterbalancing signals in cardiac transplants.

    PubMed

    Kaul, A M K; Goparaju, S; Dvorina, N; Iida, S; Keslar, K S; de la Motte, C A; Valujskikh, A; Fairchild, R L; Baldwin, W M

    2015-02-01

    Acute and chronic rejection impact distinct compartments of cardiac allografts. Intramyocardial mononuclear cell infiltrates define acute rejection, whereas chronic rejection affects large arteries. Hearts transplanted from male to female C57BL/6 mice undergo acute rejection with interstitial infiltrates at 2 weeks that resolve by 6 weeks when large arteries develop arteriopathy. These processes are dependent on T cells because no infiltrates developed in T cell-deficient mice and transfer of CD4 T cells restored T cell as well as macrophage infiltrates and ultimately neointima formation. Markers of inflammatory macrophages were up-regulated in the interstitium acutely and decreased as markers of wound healing macrophages increased chronically. Programmed cell death protein, a negative costimulator, and its ligand PDL1 were up-regulated in the interstitium during resolution of acute rejection. Blocking PDL1:PD1 interactions in the acute phase increased interstitial T cell infiltrates. Toll-like receptor (TLR) 4 and its endogenous ligand hyaluronan were increased in arteries with neointimal expansion. Injection of hyaluronan fragments increased intragraft production of chemokines. Our data indicate that negative costimulatory pathways are critical for the resolution of acute interstitial infiltrates. In the arterial compartment recognition of endogenous ligands including hyaluronan by the innate TLRs may support the progression of arteriopathy. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

  16. Structural biology. Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor.

    PubMed

    Burg, John S; Ingram, Jessica R; Venkatakrishnan, A J; Jude, Kevin M; Dukkipati, Abhiram; Feinberg, Evan N; Angelini, Alessandro; Waghray, Deepa; Dror, Ron O; Ploegh, Hidde L; Garcia, K Christopher

    2015-03-06

    Chemokines are small proteins that function as immune modulators through activation of chemokine G protein-coupled receptors (GPCRs). Several viruses also encode chemokines and chemokine receptors to subvert the host immune response. How protein ligands activate GPCRs remains unknown. We report the crystal structure at 2.9 angstrom resolution of the human cytomegalovirus GPCR US28 in complex with the chemokine domain of human CX3CL1 (fractalkine). The globular body of CX3CL1 is perched on top of the US28 extracellular vestibule, whereas its amino terminus projects into the central core of US28. The transmembrane helices of US28 adopt an active-state-like conformation. Atomic-level simulations suggest that the agonist-independent activity of US28 may be due to an amino acid network evolved in the viral GPCR to destabilize the receptor's inactive state. Copyright © 2015, American Association for the Advancement of Science.

  17. High dilutions of antimony modulate cytokines production and macrophage - Leishmania (L.) amazonensis interaction in vitro.

    PubMed

    de Santana, Fabiana Rodrigues; Dalboni, Luciane C; Nascimento, Kátia F; Konno, Fabiana Toshie; Alvares-Saraiva, Anuska M; Correia, Michelle S F; Bomfim, Maristela Dutra Correa; Casarin, Renato C V; Perez, Elizabeth C; Lallo, Maria Anete; Peres, Giovani B; Laurenti, Márcia Dalastra; Benites, Nilson R; Buchi, Dorly F; Bonamin, Leoni Villano

    2017-04-01

    In previous results mice treated with high dilutions of antimony presented reduction of monocyte migration to the site of infection with increase in B lymphocytes population in the local lymph node. To know the mechanisms involved, a series of in vitro studies was done, using co-cultures of macrophages (RAW 264.7) and Leishmania (L.) amazonensis treated with different dilutions of antimony (Antimonium crudum or AC), in different times. Spreading, phagocytosis, the oxidative activity of macrophages, the viability of free promastigotes and the cytokines/chemokines concentration in the supernatant were evaluated. The assays were performed in quadruplicate. Cells treated with AC 30cH (10 -58 M) and AC 200cH (10 -398 M) presented a temporary reduction of the spreading after 02h of incubation, followed by increase after 48h, being the most significant increase observed after the AC 200cH treatment. However, the percentage of internalized parasites at 48, 96 and 120h of incubation was also higher in cells treated with AC 200cH. It is suggested that the AC 200cH improves the ability of phagocytes to internalize the parasites, but not to digest them. The cytokines-chemokines panel corroborated these results. Both dilutions potentiated the parasite-induced reduction of cytokines production, especially IL-6, IL 12 p40 and γ-IFN, after 48h of incubation. In addition, the production of MIP-1 beta (CCL4), a chemokine involved in chronic inflammation, was also reduced after 120h. A specific effect of AC 30cH was seen by the inhibition of two peaks of CCL2 (MCP-1) observed in infected macrophages, at 24 and 120h. Since this cytokine is an important chemokine for monocytes, it explains the results obtained formerly in vivo. The morphology of macrophages after acridine orange staining revealed that the treatment with AC 30cH reduced substantially the acid vacuoles in the cytoplasm, indicating a certain inability of these cells to digest the parasites. On the other hand, a large peak of VEGF-A, associated with increase of internalized parasites was observed after 120h of treatment with AC 200cH, which could be associated to the regulation of the chronic inflammation events by M1-M2 polarization. There was no statistical difference among groups regarding the production of TNF, NO and H 2 O 2 , showing that the drugs do not alter macrophage cytotoxic activity. A clear quantitative and qualitative variation of the modulatory effects of AC 30cH and 200cH was seen, in function of time. Both dilutions were able to potentiate the decrease of most of cytokines and chemokines induced by the parasite infection in vitro, which explains the clinical improvement seen previously in vivo, however, the mechanisms involved and the epidemiological significance of these findings are still under discussion. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Non-genomic oestrogen receptor signal in B lymphocytes: An approach towards therapeutic interventions for infection, autoimmunity and cancer.

    PubMed

    Seto, Karsen; Hoang, Minh; Santos, Thaddeus; Bandyopadhyay, Mausumi; Kindy, Mark S; Dasgupta, Subhajit

    2016-07-01

    The non-genomic membrane bound oestrogen receptor (mER) regulates intracellular signals through receptor-ligand interactions. The mER, along with G-protein coupled oestrogen receptor GPR 30 (GPER), induces diverse cell signalling pathways in murine lymphocytes. The mER isoform ER-alpha46 has recently been demonstrated in human B and T lymphocytes as an analogue receptor for chemokine CCL18, the signalling events of which are not clearly understood. Ligand-induced mER and GPER signalling events are shared with BCR, CD19 mediated intracellular signalling through phospholipase C, PIP2/IP3/PI3 mediated activation of Akt, MAP kinase, and mTOR. Oestrogen has the ability to induce CD40-mediated activation of B cells. The complete signalling pathways of mER, GPR30 and their interaction with other signals are targeted areas for novel drug development in B cells during infection, autoimmunity and cancer. Therefore, an in depth investigation is critical for determining shared signal outputs during B cell activation. Here, we focus on the mode of action of membrane bound ER in B cells as therapeutic checkpoints. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Fluorescent-responsive synthetic C1b domains of protein kinase Cδ as reporters of specific high-affinity ligand binding.

    PubMed

    Ohashi, Nami; Nomura, Wataru; Narumi, Tetsuo; Lewin, Nancy E; Itotani, Kyoko; Blumberg, Peter M; Tamamura, Hirokazu

    2011-01-19

    Protein kinase C (PKC) is a critical cell signaling pathway involved in many disorders such as cancer and Alzheimer-type dementia. To date, evaluation of PKC ligand binding affinity has been performed by competitive studies against radiolabeled probes that are problematic for high-throughput screening. In the present study, we have developed a fluorescent-based binding assay system for identifying ligands that target the PKC ligand binding domain (C1 domain). An environmentally sensitive fluorescent dye (solvatochromic fluorophore), which has been used in multiple applications to assess protein-binding interactions, was inserted in proximity to the binding pocket of a novel PKCδ C1b domain. These resultant fluorescent-labeled δC1b domain analogues underwent a significant change in fluorescent intensity upon ligand binding, and we further demonstrate that the fluorescent δC1b domain analogues can be used to evaluate ligand binding affinity.

  20. Topically applied recombinant chemokine analogues fully protect macaques from vaginal simian-human immunodeficiency virus challenge.

    PubMed

    Veazey, Ronald S; Ling, Binhua; Green, Linda C; Ribka, Erin P; Lifson, Jeffrey D; Piatak, Michael; Lederman, Michael M; Mosier, Donald; Offord, Robin; Hartley, Oliver

    2009-05-15

    Effective strategies for preventing human immunodeficiency virus infection are urgently needed, but recent failures in key clinical trials of vaccines and microbicides highlight the need for new approaches validated in relevant animal models. Here, we show that 2 new chemokine (C-C motif) receptor 5 inhibitors, 5P12-RANTES (regulated on activation, normal T cell expressed and secreted) and 6P4-RANTES, fully protect against infection in the rhesus vaginal challenge model. These highly potent molecules, which are amenable to low-cost production, represent promising new additions to the microbicides pipeline.

  1. Immunological Cells and Functions in Gaucher Disease

    PubMed Central

    Pandey, Manoj Kumar; Grabowski, Gregory A.

    2013-01-01

    The macrophage (MΦ) has been the focus of causality, research, and therapy of Gaucher disease, but recent evidence casts doubt its solitary role in the disease pathogenesis. The excess of glucosylceramide (GC) in such cells accounts for some of the disease manifestations. Evidence of increased expression of C-C and C-X-C chemokines (i.e., CCL2,CXCL1, CXCL8) in Gaucher disease could be critical for monocytes (MOs) transformation to inflammatory subsets of (MΦs) and dendritic cells (DCs) as well as neutrophil (PMNs) recruitment to visceral organs. These immune responses could be essential for activation of T- and B-cell subsets, and the induction of numerous cytokines and chemokines that participate in the initiation and propagation of the molecular pathogenesis of Gaucher disease. The association of Gaucher disease with a variety of cellular and humoral immune responses is reviewed here to provide a potential foundation for expanding the complex pathophysiology of Gaucher disease. PMID:23510064

  2. Circulating Cytokine/Chemokine Concentrations Respond to Ionizing Radiation Doses but not Radiation Dose Rates: Granulocyte-Colony Stimulating Factor and Interleukin-18.

    PubMed

    Kiang, Juliann G; Smith, Joan T; Hegge, Sara R; Ossetrova, Natalia I

    2018-06-01

    Exposure to ionizing radiation is a crucial life-threatening factor in nuclear and radiological incidents. It is known that ionizing radiation affects cytokine/chemokine concentrations in the blood of B6D2F1 mice. It is not clear whether radiation dose rates would vary the physiological response. Therefore, in this study we utilized data from two experiments using B6D2F1 female mice exposed to six different dose rates ranging from low to high rates. In one experiment, mice received a total dose of 8 Gy (LD 0/30 ) of 60 Co gamma radiation at four dose rates: 0.04, 0.15, 0.30 and 0.47 Gy/min. Blood samples from mice were collected at 24 and 48 h postirradiation for cytokine/chemokine measurements, including interleukin (IL)-1β, IL-6, IL-10, keratinocyte cytokine (KC), IL-12p70, IL-15, IL-17A, IL-18, granulocyte-colony stimulating factor (G-CSF), granulocyte macrophage (GM)-CSF, macrophage (M)-CSF, monokine induced by gamma interferon (MIG), tumor necrosis factor (TNF)-α, fibroblast growth factor (FGF)-basic, vascular endothelial growth factor (VEGF) and platelet-derived growth factor basic (PDGF-bb). At 24 h after ionizing irradiation at dose rate of 0.04 Gy/min, significant increases were observed only in G-CSF and M-CSF ( P < 0.05). At 0.15 Gy/min, IL-10, IL-17A, G-CSF and GM-CSF concentrations were increased. At 0.3 Gy/min, IL-15, IL-18, G-CSF, GM-CSF, M-CSF, MCP-1, MIP-2, MIG, FGF-basic, VEGF and PDGF-bb were significantly elevated ( P < 0.05). At 0.47 Gy/min, IL-6, KC, IL-10, MCP-1, G-CSF, GM-CSF and M-CSF were significantly increased. At 48 h postirradiation, all cytokines/chemokines except MCP-1 returned to or were below their baselines, suggesting these increases are transient at LD 0/30 irradiation. Of note, there is a limitation on day 2 because cytokines/chemokines are either at or below their baselines. Other parameters such as fms-like tyrosine kinase receptor-3 ligand (Flt-3 ligand) concentrations and lymphocyte counts, which have proven to be unaffected by radiation dose rates, can be used instead for assessing the radiation dose. However, in a separate radiation dose and time-course experiment, increases in IL-18 and G-CSF depended on the radiation doses but showed no significant differences between 0.58 and 1.94 Gy/min ( P > 0.05) at 3 and 6 Gy but not 12 Gy. G-CSF continued to increase up to day 7, whereas IL-18 increased on day 4 and remained above baseline level on day 7. Therefore, time after irradiation at different doses should be taken into consideration. To our knowledge, these results are the first to suggest that ionizing radiation, even at a very low-dose-rate (0.04 Gy/min), induces circulating G-CSF increases but not others for selected time points; radiation-induced increases in IL-18 at radiation dose rates between 0.15 and 1.94 Gy/min are also not in a radiation dose-rate-dependent manner. C-CSF, lymphocyte counts and circulating Flt-3 ligand should be explored further as possible biomarkers of radiation exposure at early time points. IL-18 is also worthy of further study as a potential biomarker at later time points.

  3. Cranberry extract attenuates hepatic inflammation in high-fat-fed obese mice.

    PubMed

    Glisan, Shannon L; Ryan, Caroline; Neilson, Andrew P; Lambert, Joshua D

    2016-11-01

    Cranberry (Vaccinium macrocarpon) consumption has been associated with health beneficial effects. Nonalcoholic fatty liver disease (NAFLD) is a comorbidity of obesity. In the present study, we investigated the effect of a polyphenol-rich cranberry extract (CBE) on hepatic inflammation in high fat (HF)-fed obese C57BL/6J mice. Following dietary treatment with 0.8% CBE for 10 weeks, we observed no change in body weight or visceral fat mass in CBE-supplemented mice compared to HF-fed control mice. We did observe a significant decrease in plasma alanine aminotransferase (31%) and histological severity of NAFLD (33% decrease in area of involvement, 29% decrease in lipid droplet size) compared to HF-fed controls. Hepatic protein levels of tumor necrosis factor α and C-C chemokine ligand 2 were reduced by 28% and 19%, respectively, following CBE supplementation. CBE significantly decreased hepatic mRNA levels of toll-like receptor 4 (TLR4, 63%) and nuclear factor κB (NFκB, 24%), as well as a number of genes related to the nucleotide-binding domain, leucine-rich-containing family, pyrin domain-containing 3 inflammasome. In conclusion, CBE reduced NAFLD and hepatic inflammation in HF-fed obese C57BL/6J mice. These effects appear to be related to mitigation of TLR4-NFκB related signaling; however, further studies into the underlying mechanisms of these hepatoprotective effects are needed. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Plasma Chemokines in Patients with Alcohol Use Disorders: Association of CCL11 (Eotaxin-1) with Psychiatric Comorbidity

    PubMed Central

    García-Marchena, Nuria; Araos, Pedro Fernando; Barrios, Vicente; Sánchez-Marín, Laura; Chowen, Julie A.; Pedraz, María; Castilla-Ortega, Estela; Romero-Sanchiz, Pablo; Ponce, Guillermo; Gavito, Ana L.; Decara, Juan; Silva, Daniel; Torrens, Marta; Argente, Jesús; Rubio, Gabriel; Serrano, Antonia; de Fonseca, Fernando Rodríguez; Pavón, Francisco Javier

    2017-01-01

    Recent studies have linked changes in peripheral chemokine concentrations to the presence of both addictive behaviors and psychiatric disorders. The present study further explore this link by analyzing the potential association of psychiatry comorbidity with alterations in the concentrations of circulating plasma chemokine in patients of both sexes diagnosed with alcohol use disorders (AUD). To this end, 85 abstinent subjects with AUD from an outpatient setting and 55 healthy subjects were evaluated for substance and mental disorders. Plasma samples were obtained to quantify chemokine concentrations [C–C motif (CC), C–X–C motif (CXC), and C–X3–C motif (CX3C) chemokines]. Abstinent AUD patients displayed a high prevalence of comorbid mental disorders (72%) and other substance use disorders (45%). Plasma concentrations of chemokines CXCL12/stromal cell-derived factor-1 (p < 0.001) and CX3CL1/fractalkine (p < 0.05) were lower in AUD patients compared to controls, whereas CCL11/eotaxin-1 concentrations were strongly decreased in female AUD patients (p < 0.001). In the alcohol group, CXCL8 concentrations were increased in patients with liver and pancreas diseases and there was a significant correlation to aspartate transaminase (r = +0.456, p < 0.001) and gamma-glutamyltransferase (r = +0.647, p < 0.001). Focusing on comorbid psychiatric disorders, we distinguish between patients with additional mental disorders (N = 61) and other substance use disorders (N = 38). Only CCL11 concentrations were found to be altered in AUD patients diagnosed with mental disorders (p < 0.01) with a strong main effect of sex. Thus, patients with mood disorders (N = 42) and/or anxiety (N = 16) had lower CCL11 concentrations than non-comorbid patients being more evident in women. The alcohol-induced alterations in circulating chemokines were also explored in preclinical models of alcohol use with male Wistar rats. Rats exposed to repeated ethanol (3 g/kg, gavage) had lower CXCL12 (p < 0.01) concentrations and higher CCL11 concentrations (p < 0.001) relative to vehicle-treated rats. Additionally, the increased CCL11 concentrations in rats exposed to ethanol were enhanced by the prior exposure to restraint stress (p < 0.01). Concordantly, acute ethanol exposure induced changes in CXCL12, CX3CL1, and CCL11 in the same direction to repeated exposure. These results clearly indicate a contribution of specific chemokines to the phenotype of AUD and a strong effect of sex, revealing a link of CCL11 to alcohol and anxiety/stress. PMID:28149283

  5. Effects of peritoneal fluid from endometriosis patients on the release of monocyte-specific chemokines by leukocytes.

    PubMed

    Na, Yong-Jin; Lee, Dong-Hyung; Kim, Seung-Chul; Joo, Jong-Kil; Wang, Ji-Won; Jin, Jun-O; Kwak, Jong-Young; Lee, Kyu-Sup

    2011-06-01

    Chemokines have been implicated in the pathological process of endometriosis. We compared the effects of peritoneal fluid obtained from patients with endometriosis (ePF) and controls without endometriosis (cPF) on the release of monocyte-specific CC chemokines such as monocyte chemotactic protein-1 (MCP-1), regulated upon activation normal T cell expressed and secreted (RANTES), and macrophage inflammatory protein-1α (MIP-1α) by neutrophils, monocytes, and T cells. Moreover, we evaluated the correlation between the levels of chemokines in ePF and their release by these cells. Cells were obtained from healthy young volunteers and cultured with ePF (n = 12) or cPF (n = 8). The chemokine levels in the ePF and the supernatants of cultured cells with ePF were then measured by ELISA. There was a positive correlation between the levels of MCP-1 and MIP-1α in ePF. The addition of ePF to the cell cultures failed to increase the release of MCP-1, RANTES, and MIP-1α when compared to cPF, but the levels of RANTES in ePF were positively correlated with the release of RANTES by ePF-treated monocytes and T cells. Moreover, there was a positive correlation between the levels of RANTES and MIP-1α released by neutrophils and between the levels of MCP-1 and MIP-1α released by T cells. Finally, the levels of RANTES released by monocyte-derived macrophages and monocytes cultured with ePF were positively correlated. These findings suggest that monocytes, neutrophils, and T cells release differential levels of MCP-1, RANTES, and MIP-1α in response to stimulation with ePF.

  6. CCR2 and CCR5 receptor-binding properties of herpesvirus-8 vMIP-II based on sequence analysis and its solution structure.

    PubMed

    Shao, W; Fernandez, E; Sachpatzidis, A; Wilken, J; Thompson, D A; Schweitzer, B I; Lolis, E

    2001-05-01

    Human herpesvirus-8 (HHV-8) is the infectious agent responsible for Kaposi's sarcoma and encodes a protein, macrophage inflammatory protein-II (vMIP-II), which shows sequence similarity to the human CC chemokines. vMIP-II has broad receptor specificity that crosses chemokine receptor subfamilies, and inhibits HIV-1 viral entry mediated by numerous chemokine receptors. In this study, the solution structure of chemically synthesized vMIP-II was determined by nuclear magnetic resonance. The protein is a monomer and possesses the chemokine fold consisting of a flexible N-terminus, three antiparallel beta strands, and a C-terminal alpha helix. Except for the N-terminal residues (residues 1-13) and the last two C-terminal residues (residues 73-74), the structure of vMIP-II is well-defined, exhibiting average rmsd of 0.35 and 0.90 A for the backbone heavy atoms and all heavy atoms of residues 14-72, respectively. Taking into account the sequence differences between the various CC chemokines and comparing their three-dimensional structures allows us to implicate residues that influence the quaternary structure and receptor binding and activation of these proteins in solution. The analysis of the sequence and three-dimensional structure of vMIP-II indicates the presence of epitopes involved in binding two receptors CCR2 and CCR5. We propose that vMIP-II was initially specific for CCR5 and acquired receptor-binding properties to CCR2 and other chemokine receptors.

  7. SDF-1 signaling via the CXCR4-TCR heterodimer requires PLC-β3 and PLC-γ1 for distinct cellular responses 1

    PubMed Central

    Kremer, Kimberly N.; Clift, Ian C.; Miamen, Alexander G.; Bamidele, Adebowale O.; Qian, Nan-Xin; Humphreys, Troy D.; Hedin, Karen E.

    2011-01-01

    The CXCR4 chemokine receptor is a G protein-coupled receptor (GPCR) that signals in T lymphocytes by forming a heterodimer with the T cell antigen receptor (TCR). CXCR4 and TCR functions are consequently highly cross-regulated, affecting T cell immune activation, cytokine secretion, and T cell migration. The CXCR4-TCR heterodimer stimulates T cell migration and activation of the ERK MAP kinase and downstream AP-1-dependent cytokine transcription in response to SDF-1, the sole chemokine ligand of CXCR4. These responses require Gi-type G proteins as well as TCR ITAM domains and the ZAP-70 tyrosine kinase, thus indicating that the CXCR4-TCR heterodimer signals to integrate GPCR-associated and TCR-associated signaling molecules in response to SDF-1. Yet, the phospholipase C (PLC) isozymes responsible for coupling the CXCR4-TCR heterodimer to distinct downstream cellular responses are incompletely characterized. Here, we demonstrate that PLC activity is required for SDF-1 to induce ERK activation, migration, and CXCR4 endocytosis in human T cells. SDF-1 signaling via the CXCR4-TCR heterodimer uses PLC-β3 to activate the Ras-ERK pathway and increase intracellular Ca2+ concentrations, while PLC-γ1 is dispensable for these outcomes. In contrast, PLC-γ1, but not PLC-β3, is required for SDF-1-mediated migration, via a mechanism independent of LAT. These results increase understanding of the signaling mechanisms employed by the CXCR4-TCR heterodimer, characterize new roles for PLC-β3 and PLC-γ1 in T cells, and suggest that multiple PLCs may also be activated downstream of other chemokine receptors in order to distinctly regulate migration versus other signaling functions. PMID:21705626

  8. The effect of storage on ammonia, cytokine, and chemokine concentrations in feline whole blood.

    PubMed

    Cummings, Katherine A; Abelson, Amanda L; Rozanski, Elizabeth A; Sharp, Claire R

    2016-09-01

    To determine if the concentrations of ammonia and inflammatory mediators in feline stored whole blood (SWB) increase with duration of storage. Prospective ex vivo study. University Teaching Hospital. Thirteen cats, recruited from the hospital feline donor pool, deemed healthy based on the predonation donor screening process. One unit (30 mL) of whole blood was collected from 13 unique blood donor cats, anticoagulated with citrate-phosphate-dextrose, and stored at 4°C. Concentrations of ammonia, interleukin (IL) 6, and IL-10 were measured in 5 units weekly for 4 weeks. Presence of chemokine ligand (CXCL) 8 was measured weekly in 8 other units in the same manner. The ammonia concentration increased nonlinearly with duration of storage, from a median of 48 μmol/L (range 25-74 μmol/L) on day 0 and 417 μmol/L (324-457 μmol/L) on day 28. IL-6 and IL-10 concentrations were below the lower limits of detection of the assay used (IL-6 < 31.2 pg/mL and IL-10 < 125 pg/mL). CXCL-8 was detected in 4 of 8 SWB units at all time points. Ammonia concentration increases with storage time in feline SWB. The clinical significance of this finding is yet to be determined. The presence of the proinflammatory chemokine CXCL-8 in feline SWB warrants further research to determine whether it can incite an inflammatory response in the recipient. Further research evaluating the epidemiology of transfusion reactions in cats should evaluate the effect of unit age, and should include the possible impact of the presence of CXCL-8. © Veterinary Emergency and Critical Care Society 2016.

  9. Interleukin (IL)-18, cooperatively with IL-23, induces prominent inflammation and enhances psoriasis-like epidermal hyperplasia.

    PubMed

    Shimoura, Noriko; Nagai, Hiroshi; Fujiwara, Susumu; Jimbo, Haruki; Yoshimoto, Takayuki; Nishigori, Chikako

    2017-05-01

    The interleukin (IL)-23/IL-17 axis is strongly implicated in the pathogenesis of psoriasis. Previous studies showed that IL-18 was elevated in early active and progressive plaque-type psoriatic lesions and that serum or plasma levels of IL-18 correlated with the Psoriasis Area and Severity Index. However, the mechanism whereby IL-18 affects disease severity remains unknown. In this study, we investigated the effects of IL-18 on a psoriasis-like skin inflammation model induced by recombinant mouse IL-23. We found that IL-18, cooperatively with IL-23, induced prominent inflammation and enhanced psoriasis-like epidermal hyperplasia. In the skin of mice treated with IL-23 plus IL-18, the expression of interferon-γ was significantly upregulated and that of chemokine (C-X-C motif) ligand 9 (CXCL9) was synergistically increased. Histologically, strong positive signals of CXCL9 were observed around the infiltrating inflammatory cells. The current results suggest that IL-18 might synergize with IL-23 to induce a T helper 1 immune reaction, without inhibiting the IL-23/IL-17 axis, and thus may aggravate psoriatic inflammation.

  10. The Interaction of Human Pathogenic Fungi With C-Type Lectin Receptors.

    PubMed

    Goyal, Surabhi; Castrillón-Betancur, Juan Camilo; Klaile, Esther; Slevogt, Hortense

    2018-01-01

    Fungi, usually present as commensals, are a major cause of opportunistic infections in immunocompromised patients. Such infections, if not diagnosed or treated properly, can prove fatal. However, in most cases healthy individuals are able to avert the fungal attacks by mounting proper antifungal immune responses. Among the pattern recognition receptors (PRRs), C-type lectin receptors (CLRs) are the major players in antifungal immunity. CLRs can recognize carbohydrate ligands, such as β-glucans and mannans, which are mainly found on fungal cell surfaces. They induce proinflammatory immune reactions, including phagocytosis, oxidative burst, cytokine, and chemokine production from innate effector cells, as well as activation of adaptive immunity via Th17 responses. CLRs such as Dectin-1, Dectin-2, Mincle, mannose receptor (MR), and DC-SIGN can recognize many disease-causing fungi and also collaborate with each other as well as other PRRs in mounting a fungi-specific immune response. Mutations in these receptors affect the host response and have been linked to a higher risk in contracting fungal infections. This review focuses on how CLRs on various immune cells orchestrate the antifungal response and on the contribution of single nucleotide polymorphisms in these receptors toward the risk of developing such infections.

  11. TRIM56 Is an Essential Component of the TLR3 Antiviral Signaling Pathway*

    PubMed Central

    Shen, Yang; Li, Nan L.; Wang, Jie; Liu, Baoming; Lester, Sandra; Li, Kui

    2012-01-01

    Members of the tripartite motif (TRIM) proteins are being recognized as important regulators of host innate immunity. However, specific TRIMs that contribute to TLR3-mediated antiviral defense have not been identified. We show here that TRIM56 is a positive regulator of TLR3 signaling. Overexpression of TRIM56 substantially potentiated extracellular dsRNA-induced expression of interferon (IFN)-β and interferon-stimulated genes (ISGs), while knockdown of TRIM56 greatly impaired activation of IRF3, induction of IFN-β and ISGs, and establishment of an antiviral state by TLR3 ligand and severely compromised TLR3-mediated chemokine induction following infection by hepatitis C virus. The ability to promote TLR3 signaling was independent of the E3 ubiquitin ligase activity of TRIM56. Rather, it correlated with a physical interaction between TRIM56 and TRIF. Deletion of the C-terminal portion of TRIM56 abrogated the TRIM56-TRIF interaction as well as the augmentation of TLR3-mediated IFN response. Together, our data demonstrate TRIM56 is an essential component of the TLR3 antiviral signaling pathway and reveal a novel role for TRIM56 in innate antiviral immunity. PMID:22948160

  12. Synthesis and structure-activity relationship of the first nonpeptidergic inverse agonists for the human cytomegalovirus encoded chemokine receptor US28.

    PubMed

    Hulshof, Janneke W; Casarosa, Paola; Menge, Wiro M P B; Kuusisto, Leena M S; van der Goot, Henk; Smit, Martine J; de Esch, Iwan J P; Leurs, Rob

    2005-10-06

    US28 is a human cytomegalovirus (HCMV) encoded G-protein-coupled receptor that signals in a constitutively active manner. Recently, we identified 1 [5-(4-(4-chlorophenyl)-4-hydroxypiperidin-1-yl)-2,2-diphenylpentanenitrile] as the first reported nonpeptidergic inverse agonist for a viral-encoded chemokine receptor. Interestingly, this compound is able to partially inhibit the viral entry of HIV-1. In this study we describe the synthesis of 1 and several of its analogues and unique structure-activity relationships for this first class of small-molecule ligands for the chemokine receptor US28. Moreover, the compounds have been pharmacologically characterized as inverse agonists on US28. By modification of lead structure 1, it is shown that a 4-phenylpiperidine moiety is essential for affinity and activity. Other structural features of 1 are shown to be of less importance. These compounds define the first SAR of ligands on a viral GPCR (US28) and may therefore serve as important tools to investigate the significance of US28-mediated constitutive activity during viral infection.

  13. Type I interferon dependence of plasmacytoid dendritic cell activation and migration

    PubMed Central

    Asselin-Paturel, Carine; Brizard, Géraldine; Chemin, Karine; Boonstra, Andre; O'Garra, Anne; Vicari, Alain; Trinchieri, Giorgio

    2005-01-01

    Differential expression of Toll-like receptor (TLR) by conventional dendritic cells (cDCs) and plasmacytoid DC (pDCs) has been suggested to influence the type of immune response induced by microbial pathogens. In this study we show that, in vivo, cDCs and pDCs are equally activated by TLR4, -7, and -9 ligands. Type I interferon (IFN) was important for pDC activation in vivo in response to all three TLR ligands, whereas cDCs required type I IFN signaling only for TLR9- and partially for TLR7-mediated activation. Although TLR ligands induced in situ migration of spleen cDC into the T cell area, spleen pDCs formed clusters in the marginal zone and in the outer T cell area 6 h after injection of TLR9 and TLR7 ligands, respectively. In vivo treatment with TLR9 ligands decreased pDC ability to migrate ex vivo in response to IFN-induced CXCR3 ligands and increased their response to CCR7 ligands. Unlike cDCs, the migration pattern of pDCs required type I IFN for induction of CXCR3 ligands and responsiveness to CCR7 ligands. These data demonstrate that mouse pDCs differ from cDCs in the in vivo response to TLR ligands, in terms of pattern and type I IFN requirement for activation and migration. PMID:15795237

  14. Ligand-accelerated enantioselective methylene C(sp3)-H bond activation.

    PubMed

    Chen, Gang; Gong, Wei; Zhuang, Zhe; Andrä, Michal S; Chen, Yan-Qiao; Hong, Xin; Yang, Yun-Fang; Liu, Tao; Houk, K N; Yu, Jin-Quan

    2016-09-02

    Effective differentiation of prochiral carbon-hydrogen (C-H) bonds on a single methylene carbon via asymmetric metal insertion remains a challenge. Here, we report the discovery of chiral acetyl-protected aminoethyl quinoline ligands that enable asymmetric palladium insertion into prochiral C-H bonds on a single methylene carbon center. We apply these palladium complexes to catalytic enantioselective functionalization of β-methylene C-H bonds in aliphatic amides. Using bidentate ligands to accelerate C-H activation of otherwise unreactive monodentate substrates is crucial for outcompeting the background reaction driven by substrate-directed cyclopalladation, thereby avoiding erosion of enantioselectivity. The potential of ligand acceleration in C-H activation is also demonstrated by enantioselective β-C-H arylation of simple carboxylic acids without installing directing groups. Copyright © 2016, American Association for the Advancement of Science.

  15. Comparison of Long Noncoding RNA and mRNA Expression Profiles in Mesenchymal Stem Cells Derived from Human Periodontal Ligament and Bone Marrow

    PubMed Central

    Dong, Rui; Du, Juan; Wang, Liping; Wang, Jinsong; Ding, Gang; Wang, Songlin; Fan, Zhipeng

    2014-01-01

    Mesenchymal stem cells (MSCs) in different anatomic locations possess diverse biological activities. Maintaining the pluripotent state and differentiation depend on the expression and regulation of thousands of genes, but it remains unclear which molecular mechanisms underlie MSC diversity. Thus, potential MSC applications are restricted. Long noncoding RNAs (lncRNAs) are implicated in the complex molecular circuitry of cellular processes. We investigated differences in lncRNA and mRNA expression profiles between bone marrow stem cells (BMSCs) and periodontal ligament stem cells (PDLSCs) with lncRNA microarray assays and bioinformatics analysis. In PDLSCs, numerous lncRNAs were significantly upregulated (n = 457) or downregulated (n = 513) compared to BMSCs. Furthermore, 1,578 mRNAs were differentially expressed. These genes implicated cellular pathways that may be associated with MSC characteristics, including apoptosis, MAPK, cell cycle, and Wnt signaling pathway. Signal-net analysis indicated that phospholipase C beta 4, filamin B beta, calcium/calmodulin-dependent protein kinase II gamma, and the ionotropic glutamate receptor, AMPA 1, had the highest betweenness centrality among significant genes in the differential gene profile network. A comparison between the coding-noncoding gene coexpression networks of PDLSCs and BMSCs identified chemokine (C-X-C motif) ligand 12 as a core regulatory factor in MSC biology. These results provided insight into the mechanisms underlying MSC biology. PMID:24790996

  16. CCR2 antagonist CCX140-B provides renal and glycemic benefits in diabetic transgenic human CCR2 knockin mice

    PubMed Central

    Sullivan, Timothy; Miao, Zhenhua; Dairaghi, Daniel J.; Krasinski, Antoni; Wang, Yu; Zhao, Bin N.; Baumgart, Trageen; Ertl, Linda S.; Pennell, Andrew; Seitz, Lisa; Powers, Jay; Zhao, Ruiping; Ungashe, Solomon; Wei, Zheng; Boring, Landin; Tsou, Chia-Lin; Charo, Israel; Schall, Thomas J.; Jaen, Juan C.

    2013-01-01

    Chemokine (C-C motif) receptor 2 (CCR2) is central for the migration of monocytes into inflamed tissues. The novel CCR2 antagonist CCX140-B, which is currently in two separate phase 2 clinical trials in diabetic nephropathy, has recently been shown to reduce hemoglobin A1c and fasting blood glucose levels in type 2 diabetics. In this report, we describe the effects of this compound on glycemic and renal function parameters in diabetic mice. Since CCX140-B has a low affinity for mouse CCR2, transgenic human CCR2 knockin mice were generated and rendered diabetic with either a high-fat diet (diet-induced obesity) or by deletion of the leptin receptor gene (db/db). CCX140-B treatment in both models resulted in decreased albuminuria, which was associated with decreased glomerular hypertrophy and increased podocyte density. Moreover, treatment of diet-induced obese mice with CCX140-B resulted in decreased levels of fasting blood glucose and insulin, normalization of homeostatic model assessment of insulin resistance values, and decreased numbers of adipose tissue inflammatory macrophages. Unlike other CCR2 antagonists, CCX140-B had no effect on plasma levels of the CCR2 ligand CCL2 or on the numbers of blood monocytes. These results support the ongoing evaluation of this molecule in diabetic subjects with impaired renal function. PMID:23986513

  17. CXC chemokine ligand 4 (CXCL4) is predictor of tumour angiogenic activity and prognostic biomarker in non-small cell lung cancer (NSCLC) patients undergoing surgical treatment.

    PubMed

    Spaks, Artjoms; Svirina, Darja; Spaka, Irina; Jaunalksne, Inta; Breiva, Donats; Tracums, Ilmars; Krievins, Dainis

    2016-07-01

    To evaluate the association of CXC chemokine ligand 4 (CXCL4) plasma levels with tumour angiogenesis in non-small cell lung cancer (NSCLC) and to assess association of CXCL4 with clinical outcomes. Fifty patients with early stage NSCLC who underwent pulmonary resection. CXCL4 levels were analysed by ELISA. Angiogenesis was assessed by immunohistochemistry, and microvessel density (MVD) count. There was positive correlation between MVD and CXCL4 levels. Patients with higher CXCL4 levels had worse overall and disease-free survival. Plasma levels of CXCL4 are associated with tumour vascularity. Increased CXCL4 levels in NSCLC patients undergoing treatment may indicate active cancer-induced angiogenesis associated with relapse and worse outcome.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Li; DeRider, Michele; McCornack, Milissa A.

    Chemokines (chemotactic cytokines) comprise a large family of proteins that recruit and activate leukocytes, giving chemokines a major role in both the immune response and inflammation-related diseases. The poxvirus-encoded viral CC chemokine inhibitor (vCCI) binds to many CC chemokines with high affinity, acting as a potent inhibitor of chemokine action. We have used heteronuclear multidimensional NMR to determine the first structure of an orthopoxvirus vCCI in complex with a human CC chemokine MIP-1β. vCCI binds to the chemokine with 1:1 stoichiometry, using residues from its β-sheet II to interact with the a surface of MIP-1β that includes the N-terminus, themore » following residues in the so-called N-loop20’s region, and the 40’s loop. This structure reveals a general strategy of vCCI for selective chemokine binding, as vCCI appears to interact most stronglyinteracts most directly with residues that are conserved among a subset of CC chemokines, but are not conservednot among the other chemokine subfamilies. This structure reveals a general strategy of vCCI for selective chemokine binding. Chemokines play critical roles in the immune system, causing chemotaxis of a variety of cells to sites of infection and inflammation, as well as mediating cell homing and immune system development 1(Baggiolini 2001). To date, about 50 chemokines have been identified, and these small proteins (7-14 kDa) are believed to function by binding with endothelial or matrix glycosaminoglycans to form a concentration gradient that is then sensed by high affinity, 7-transmembrane domain G-protein coupled chemokine receptors on the surface of immune cells surface. The chemokine system is critical for host defense in healthy individuals, butand can also lead to diseases including asthma, arthritis, and atherosclerosis in the case of malfunction, often due to inappropriate inflammation and subsequent tissue damage 2(Gerard and Rollins 2001). There are four subfamilies of chemokines, CC, CXC, C, and CX3C, named for the position of conserved N-terminal cysteine residues. Members of the same subfamily often have overlapping receptor binding and cell activation ability while different subfamilies tend to functionwork on different cell subsets1{Baggiolini, 2001 #472} (REF). For example, CC chemokines mostly interact with monocytes, macrophages, T cells and eosinophils, while CXC chemokines mainly interact with neutrophils. Structures of chemokines from different subfamilies have been solved by NMR and X-ray crystallography (XXX Include Fernandez and Lolis review) 3-9{Clore, 1990 #91;Skelton, 1995 #97;Handel, 1996 #93;Crump, 1997 #92;Crump, 1998 #248;Meunier, 1997 #96;Fernandez, 2002 #496}(Clore 1990; Skelton 1995; Handel and Domaille 1996; Crump, Gong et al. 1997; Meunier 1997; Crump, Rajarathnam et al. 1998)(Clore 1990; Skelton 1995; Handel and Domaille 1996; Crump et al. 1997; Meunier 1997; Crump et al. 1998).« less

  19. Interstitial Fluid Flow Increases Hepatocellular Carcinoma Cell Invasion through CXCR4/CXCL12 and MEK/ERK Signaling

    PubMed Central

    2015-01-01

    Hepatocellular carcinoma (HCC) is the most common form of liver cancer (~80%), and it is one of the few cancer types with rising incidence in the United States. This highly invasive cancer is very difficult to detect until its later stages, resulting in limited treatment options and low survival rates. There is a dearth of knowledge regarding the mechanisms associated with the effects of biomechanical forces such as interstitial fluid flow (IFF) on hepatocellular carcinoma invasion. We hypothesized that interstitial fluid flow enhanced hepatocellular carcinoma cell invasion through chemokine-mediated autologous chemotaxis. Utilizing a 3D in vitro invasion assay, we demonstrated that interstitial fluid flow promoted invasion of hepatocellular carcinoma derived cell lines. Furthermore, we showed that autologous chemotaxis influences this interstitial fluid flow-induced invasion of hepatocellular carcinoma derived cell lines via the C-X-C chemokine receptor type 4 (CXCR4)/C-X-C motif chemokine 12 (CXCL12) signaling axis. We also demonstrated that mitogen-activated protein kinase (MEK)/extracellular signal-regulated kinase (ERK) signaling affects interstitial fluid flow-induced invasion; however, this pathway was separate from CXCR4/CXCL12 signaling. This study demonstrates, for the first time, the potential role of interstitial fluid flow in hepatocellular carcinoma invasion. Uncovering the mechanisms that control hepatocellular carcinoma invasion will aid in enhancing current liver cancer therapies and provide better treatment options for patients. PMID:26560447

  20. Bite angle effects of diphosphines in C-C and C-X bond forming cross coupling reactions.

    PubMed

    Birkholz, Mandy-Nicole; Freixa, Zoraida; van Leeuwen, Piet W N M

    2009-04-01

    Catalytic reactions of C-C and C-X bond formation are discussed in this critical review with particular emphasis on cross coupling reactions catalyzed by palladium and wide bite angle bidentate diphosphine ligands. Especially those studies have been collected that allow comparison of the ligand bite angles for the selected ligands: dppp, BINAP, dppf, DPEphos and Xantphos. Similarities with hydrocyanation and CO/ethene/MeOH reactions have been highlighted, while rhodium hydroformylation has been mentioned as a contrasting example, in which predictability is high and steric and electronic effects follow smooth trends. In palladium catalysis wide bite angles and bulkiness of the ligands facilitate generally the reductive elimination thus giving more efficient cross coupling catalysis (174 references).

  1. Preparation and Analysis of N-Terminal Chemokine Receptor Sulfopeptides Using Tyrosylprotein Sulfotransferase Enzymes.

    PubMed

    Seibert, Christoph; Sanfiz, Anthony; Sakmar, Thomas P; Veldkamp, Christopher T

    2016-01-01

    In most chemokine receptors, one or multiple tyrosine residues have been identified within the receptor N-terminal domain that are, at least partially, modified by posttranslational tyrosine sulfation. For example, tyrosine sulfation has been demonstrated for Tyr-3, -10, -14, and -15 of CCR5, for Tyr-3, -14, and -15 of CCR8, and for Tyr-7, -12, and -21 of CXCR4. While there is evidence for several chemokine receptors that tyrosine sulfation is required for optimal interaction with the chemokine ligands, the precise role of tyrosine sulfation for chemokine receptor function remains unclear. Furthermore, the function of the chemokine receptor N-terminal domain in chemokine binding and receptor activation is also not well understood. Sulfotyrosine peptides corresponding to the chemokine receptor N-termini are valuable tools to address these important questions both in structural and functional studies. However, due to the lability of the sulfotyrosine modification, these peptides are difficult to obtain using standard peptide chemistry methods. In this chapter, we provide methods to prepare sulfotyrosine peptides by enzymatic in vitro sulfation of peptides using purified recombinant tyrosylprotein sulfotransferase (TPST) enzymes. In addition, we also discuss alternative approaches for the generation of sulfotyrosine peptides and methods for sulfopeptide analysis. © 2016 Elsevier Inc. All rights reserved.

  2. Preparation and analysis of N-terminal chemokine receptor sulfopeptides using tyrosylprotein sulfotransferase enzymes

    PubMed Central

    Seibert, Christoph; Sanfiz, Anthony; Sakmar, Thomas P.; Veldkamp, Christopher T.

    2016-01-01

    In most chemokine receptors, one or multiple tyrosine residues have been identified within the receptor N-terminal domain that are, at least partially, modified by post-translational tyrosine sulfation. For example, tyrosine sulfation has been demonstrated for Tyr-3, -10, -14, and -15 of CCR5, for Tyr-3, -14, and -15 of CCR8 and for Tyr-7, -12, and -21 of CXCR4. While there is evidence for several chemokine receptors that tyrosine sulfation is required for optimal interaction with the chemokine ligands, the precise role of tyrosine sulfation for chemokine receptor function remains unclear. Furthermore, the function of the chemokine receptor N-terminal domain in chemokine binding and receptor activation is also not well understood. Sulfotyrosine peptides corresponding to the chemokine receptor N-termini are valuable tools to address these important questions both in structural and functional studies. However, due to the liability of the sulfotyrosine modification, these peptides are difficult to obtain using standard peptide chemistry methods. In this chapter, we provide methods to prepare sulfotyrosine peptides by enzymatic in vitro sulfation of peptides using purified recombinant tyrosylprotein sulfotransferase (TPST) enzymes. In addition, we also discuss alternative approaches for the generation of sulfotyrosine peptides and methods from sulfopeptide analysis. PMID:26921955

  3. CXCR4 in breast cancer: oncogenic role and therapeutic targeting

    PubMed Central

    Xu, Chao; Zhao, Hong; Chen, Haitao; Yao, Qinghua

    2015-01-01

    Chemokines are 8–12 kDa peptides that function as chemoattractant cytokines and are involved in cell activation, differentiation, and trafficking. Chemokines bind to specific G-protein-coupled seven-span transmembrane receptors. Chemokines play a fundamental role in the regulation of a variety of cellular, physiological, and developmental processes. Their aberrant expression can lead to a variety of human diseases including cancer. C-X-C chemokine receptor type 4 (CXCR4), also known as fusin or CD184, is an alpha-chemokine receptor specific for stromal-derived-factor-1 (SDF-1 also called CXCL12). CXCR4 belongs to the superfamily of the seven transmembrane domain heterotrimeric G protein-coupled receptors and is functionally expressed on the cell surface of various types of cancer cells. CXCR4 also plays a role in the cell proliferation and migration of these cells. Recently, CXCR4 has been reported to play an important role in cell survival, proliferation, migration, as well as metastasis of several cancers including breast cancer. This review is mainly focused on the current knowledge of the oncogenic role and potential drugs that target CXCR4 in breast cancer. Additionally, CXCR4 proangiogenic molecular mechanisms will be reviewed. Strict biunivocal binding affinity and activation of CXCR4/CXCL12 complex make CXCR4 a unique molecular target for prevention and treatment of breast cancer. PMID:26356032

  4. The interaction between ketamine and some crown ethers in common organic solvents studied by NMR: The effect of donating atoms and ligand structure

    NASA Astrophysics Data System (ADS)

    Chekin, Fereshteh; Bordbar, Maryam; Fathollahi, Yaghoub; Alizadeh, Naader

    2006-02-01

    1H NMR spectroscopy was used to investigate the stoichiometry and stability of the drug ketamine cation complexes with some crown ethers, such as 15-crown-5 (15C5), aza-15-crown-5 (A15C5), 18-crown-6 (18C6), aza-18-crown-6 (A18C6), diaza-18-crown-6 (DA18C6), dibenzyl-diaza-18-crown-6 (DBzDA18C6) and cryptant [2,2,2] (C222) in acetonitrile (AN), dimethylsulfoxide (DMSO) and methanol (MeOH) at 27 °C. In order to evaluate the formation constants of the ketamine cation complexes, the CH 3 protons chemical shift (on the nitrogen atom of ketamine) was measured as function of ligand/ketamine mole ratio. The formation constant of resulting complexes were calculated by the computer fitting of chemical shift versus mole ratio data to appropriate equations. A significant chemical shift variation was not observed for 15C5 and 18C6. The stoichiometry of the mono aza and diaza ligands are 1:1 and 1:2 (ligand/ketamine), respectively. In all of the solvents studied, DA18C6 formed more stable complexes than other ligands. The solvent effect on the stability of these complexes is discussed.

  5. Telomere Length, Oxidative Stress, Inflammation and BDNF Levels in Siblings of Patients with Bipolar Disorder: Implications for Accelerated Cellular Aging

    PubMed Central

    Vasconcelos-Moreno, Mirela Paiva; Fries, Gabriel Rodrigo; Gubert, Carolina; dos Santos, Bárbara Tietböhl Martins Quadros; Fijtman, Adam; Sartori, Juliana; Ferrari, Pamela; Grun, Lucas Kich; Parisi, Mariana Migliorini; Guma, Fátima Theresinha Costa Rodrigues; Barbé-Tuana, Florencia Maria; Kapczinski, Flávio; Rosa, Adriane Ribeiro; Yatham, Lakshmi N.

    2017-01-01

    Abstract Background: Growing evidence supports the existence of neurobiological trait abnormalities in individuals at genetic risk for bipolar disorder. The aim of this study was to examine potential differences in brain-derived neurotrophic factor, cytokines, oxidative stress, and telomere length markers between patients with bipolar disorder, their siblings, and healthy controls. Methods: Thirty-six patients with bipolar disorder type I, 39 siblings, and 44 healthy controls were assessed. Serum levels of brain-derived neurotrophic factor, interleukin-6, interleukin-10, tumor necrosis factor-α, C-C motif chemokine 11, C-C motif chemokine 24, and 3-nitrotyrosine were measured, as were the activities of glutathione peroxidase, glutathione reductase, and glutathione S-transferase. Telomere length (T/S ratio) was measured using quantitative polymerase chain reaction. Results: Telomere length was different between the 3 groups (P = .041) with both patients and siblings showing a shorter T/S ratio compared with healthy controls. Patients showed increased levels of interleukin-6 (P = .005) and interleukin-10 (P = .002) compared with controls as well as increased levels of interleukin-6 (p = 0.014) and CCL24 (P = .016) compared with their siblings. C-C motif chemokine 11 levels were increased in siblings compared with controls (P = .015), and a similar tendency was found in patients compared with controls (P = .045). Glutathione peroxidase activity was decreased in patients compared with controls (P = .006) and siblings (P = .025). No differences were found for the other markers. Conclusions: The present results suggest that unaffected siblings may present accelerated aging features. These neurobiological findings may be considered as endophenotypic traits. Further prospective studies are warranted. PMID:28339618

  6. Exaggerated Hepatic Injury Due to Acetaminophen Challenge in Mice Lacking C-C Chemokine Receptor 2

    PubMed Central

    Hogaboam, Cory M.; Bone-Larson, Cynthia L.; Steinhauser, Matthew L.; Matsukawa, Akihiro; Gosling, Jennifa; Boring, Landin; Charo, Israel F.; Simpson, Kenneth J.; Lukacs, Nicholas W.; Kunkel, Steven L.

    2000-01-01

    Monocyte chemoattractant protein-1 is one of the major C-C chemokines that has been implicated in liver injury. The C-C chemokine receptor, CCR2, has been identified as the primary receptor that mediates monocyte chemoattractant protein-1 (MCP-1) responses in the mouse. Accordingly, the present study addressed the role of CCR2 in mice acutely challenged with acetaminophen (APAP). Mice genetically deficient in CCR2 (CCR2−/−) and their wild-type counterparts (CCR2+/+) were fasted for 10 hours before receiving an intraperitoneal injection of APAP (300 mg/kg). Liver and serum samples were removed from both groups of mice before and at 24 and 48 hours post APAP. Significantly elevated levels of MCP-1 were detected in liver samples from CCR2+/+ and CCR2−/− mice at 24 hours post-APAP. Although CCR2+/+ mice exhibited no liver injury at any time after receiving APAP, CCR2−/− mice exhibited marked evidence of necrotic and TUNEL-positive cells in the liver, particularly at 24 hours post-APAP. Enzyme-linked immunosorbent assay analysis of liver homogenates from both groups of mice at the 24 hours time point revealed that liver tissue from CCR2−/− mice contained significantly greater amounts of immunoreactive IFN-γ and TNF-α. The in vivo immunoneutralization of IFN-γ or TNF-α significantly attenuated APAP-induced liver injury in CCR2−/− mice and increased hepatic IL-13 levels. Taken together, these findings demonstrate that CCR2 expression in the liver provides a hepatoprotective effect through its regulation of cytokine generation during APAP challenge. PMID:10751350

  7. Regulation of inflammatory chemokine receptors on blood T cells associated to the circulating versus liver chemokines in dengue fever.

    PubMed

    de-Oliveira-Pinto, Luzia Maria; Marinho, Cíntia Ferreira; Povoa, Tiago Fajardo; de Azeredo, Elzinandes Leal; de Souza, Luiza Assed; Barbosa, Luiza Damian Ribeiro; Motta-Castro, Ana Rita C; Alves, Ada M B; Ávila, Carlos André Lins; de Souza, Luiz José; da Cunha, Rivaldo Venâncio; Damasco, Paulo Vieira; Paes, Marciano Viana; Kubelka, Claire Fernandes

    2012-01-01

    Little is known about the role of chemokines/chemokines receptors on T cells in natural DENV infection. Patients from DENV-2 and -3- outbreaks were studied prospectively during the acute or convalescent phases. Expression of chemokine receptor and activation markers on lymphocyte subpopulations were determined by flow cytometry analysis, plasma chemokine ligands concentrations were measured by ELISA and quantification of CCL5/RANTES(+) cells in liver tissues from fatal dengue cases was performed by immunochemistry. In the acute DENV-infection, T-helper/T-cytotoxic type-1 cell (Th1/Tc1)-related CCR5 is significantly higher expressed on both CD4 and CD8 T cells. The Th1-related CXCR3 is up-regulated among CD4 T cells and Tc2-related CCR4 is up-regulated among CD8 T cells. In the convalescent phase, all chemokine receptor or chemokine ligand expression tends to reestablish control healthy levels. Increased CCL2/MCP-1 and CCL4/MIP-1β but decreased CCL5/RANTES levels were observed in DENV-patients during acute infection. Moreover, we showed an increased CD107a expression on CCR5 or CXCR3-expressing T cells and higher expression of CD29, CD44(HIGH) and CD127(LOW) markers on CCR4-expressing CD8 T cells in DENV-patients when compared to controls. Finally, liver from dengue fatal patients showed increased number of cells expressing CCL5/RANTES in three out of four cases compared to three death from a non-dengue patient. In conclusion, both Th1-related CCR5 and CXCR3 among CD4 T cells have a potential ability to exert cytotoxicity function. Moreover, Tc1-related CCR5 and Tc2-related CCR4 among CD8 T cells have a potential ability to exert effector function and migration based on cell markers evaluated. The CCR5 expression would be promoting an enhanced T cell recruitment into liver, a hypothesis that is corroborated by the CCL5/RANTES increase detected in hepatic tissue from dengue fatal cases. The balance between protective and pathogenic immune response mediated by chemokines during dengue fever will be discussed.

  8. Regulation of Inflammatory Chemokine Receptors on Blood T Cells Associated to the Circulating Versus Liver Chemokines in Dengue Fever

    PubMed Central

    Povoa, Tiago Fajardo; de Azeredo, Elzinandes Leal; de Souza, Luiza Assed; Barbosa, Luiza Damian Ribeiro; Motta-Castro, Ana Rita C.; Alves, Ada M. B.; Ávila, Carlos André Lins; de Souza, Luiz José; da Cunha, Rivaldo Venâncio; Damasco, Paulo Vieira; Paes, Marciano Viana; Kubelka, Claire Fernandes

    2012-01-01

    Little is known about the role of chemokines/chemokines receptors on T cells in natural DENV infection. Patients from DENV-2 and -3- outbreaks were studied prospectively during the acute or convalescent phases. Expression of chemokine receptor and activation markers on lymphocyte subpopulations were determined by flow cytometry analysis, plasma chemokine ligands concentrations were measured by ELISA and quantification of CCL5/RANTES+ cells in liver tissues from fatal dengue cases was performed by immunochemistry. In the acute DENV-infection, T-helper/T-cytotoxic type-1 cell (Th1/Tc1)-related CCR5 is significantly higher expressed on both CD4 and CD8 T cells. The Th1-related CXCR3 is up-regulated among CD4 T cells and Tc2-related CCR4 is up-regulated among CD8 T cells. In the convalescent phase, all chemokine receptor or chemokine ligand expression tends to reestablish control healthy levels. Increased CCL2/MCP-1 and CCL4/MIP-1β but decreased CCL5/RANTES levels were observed in DENV-patients during acute infection. Moreover, we showed an increased CD107a expression on CCR5 or CXCR3-expressing T cells and higher expression of CD29, CD44HIGH and CD127LOW markers on CCR4-expressing CD8 T cells in DENV-patients when compared to controls. Finally, liver from dengue fatal patients showed increased number of cells expressing CCL5/RANTES in three out of four cases compared to three death from a non-dengue patient. In conclusion, both Th1-related CCR5 and CXCR3 among CD4 T cells have a potential ability to exert cytotoxicity function. Moreover, Tc1-related CCR5 and Tc2-related CCR4 among CD8 T cells have a potential ability to exert effector function and migration based on cell markers evaluated. The CCR5 expression would be promoting an enhanced T cell recruitment into liver, a hypothesis that is corroborated by the CCL5/RANTES increase detected in hepatic tissue from dengue fatal cases. The balance between protective and pathogenic immune response mediated by chemokines during dengue fever will be discussed. PMID:22815692

  9. Ligand-Sensitive But Not Ligand-Diagnostic: Evaluating Cr Valence-to-Core X-ray Emission Spectroscopy as a Probe of Inner-Sphere Coordination

    PubMed Central

    2015-01-01

    This paper explores the strengths and limitations of valence-to-core X-ray emission spectroscopy (V2C XES) as a probe of coordination environments. A library was assembled from spectra obtained for 12 diverse Cr complexes and used to calibrate density functional theory (DFT) calculations of V2C XES band energies. A functional dependence study was undertaken to benchmark predictive accuracy. All 7 functionals tested reproduce experimental V2C XES energies with an accuracy of 0.5 eV. Experimentally calibrated, DFT calculated V2C XES spectra of 90 Cr compounds were used to produce a quantitative spectrochemical series showing the V2C XES band energy ranges for ligands comprising 18 distinct classes. Substantial overlaps are detected in these ranges, which complicates the use of V2C XES to identify ligands in the coordination spheres of unknown Cr compounds. The ligand-dependent origins of V2C intensity are explored for a homologous series of [CrIII(NH3)5X]2+ (X = F, Cl, Br, and I) to rationalize the variable intensity contributions of these ligand classes. PMID:25496512

  10. GM-CSF Inhibits c-Kit and SCF Expression by Bone Marrow-Derived Dendritic Cells

    PubMed Central

    Barroeta Seijas, Amairelys Belen; Simonetti, Sonia; Vitale, Sara; Runci, Daniele; Quinci, Angela Caterina; Soriani, Alessandra; Criscuoli, Mattia; Filippi, Irene; Naldini, Antonella; Sacchetti, Federico Maria; Tarantino, Umberto; Oliva, Francesco; Piccirilli, Eleonora; Santoni, Angela; Di Rosa, Francesca

    2017-01-01

    Stem cell factor (SCF), the ligand of c-kit, is a key cytokine for hematopoiesis. Hematopoietic precursors express c-kit, whereas differentiated cells of hematopoietic lineage are negative for this receptor, with the exception of NK cells, mast cells, and a few others. While it has long been recognized that dendritic cells (DCs) can express c-kit, several questions remain concerning the SCF/c-kit axis in DCs. This is particularly relevant for DCs found in those organs wherein SCF is highly expressed, including the bone marrow (BM). We characterized c-kit expression by conventional DCs (cDCs) from BM and demonstrated a higher proportion of c-kit+ cells among type 1 cDC subsets (cDC1s) than type 2 cDC subsets (cDC2s) in both humans and mice, whereas similar levels of c-kit expression were observed in cDC1s and cDC2s from mouse spleen. To further study c-kit regulation, DCs were generated with granulocyte-macrophage colony-stimulating factor (GM-CSF) from mouse BM, a widely used protocol. CD11c+ cells were purified from pooled non-adherent and slightly adherent cells collected after 7 days of culture, thus obtaining highly purified BM-derived DCs (BMdDCs). BMdDCs contained a small fraction of c-kit+ cells, and by replating them for 2 days with GM-CSF, we obtained a homogeneous population of c-kit+ CD40hi MHCIIhi cells. Not only did BMdDCs express c-kit but they also produced SCF, and both were striking upregulated if GM-CSF was omitted after replating. Furthermore, a small but significant reduction in BMdDC survival was observed upon SCF silencing. Incubation of BMdDCs with SCF did not modulate antigen presentation ability of these cells, nor it did regulate their membrane expression of the chemokine receptor CXCR4. We conclude that the SCF/c-kit-mediated prosurvival circuit may have been overlooked because of the prominent use of GM-CSF in DC cultures in vitro, including those human DC cultures destined for the clinics. We speculate that DCs more prominently rely on SCF in vivo in some microenvironments, with potential implications for graft-versus-host disease and antitumor immunity. PMID:28261209

  11. LipC (Rv0220) Is an Immunogenic Cell Surface Esterase of Mycobacterium tuberculosis

    PubMed Central

    Shen, Guomiao; Singh, Krishna; Chandra, Dinesh; Serveau-Avesque, Carole; Maurin, Damien; Canaan, Stéphane; Singla, Rupak; Behera, Digambar

    2012-01-01

    We have reported previously the identification of novel proteins of Mycobacterium tuberculosis by the immunoscreening of an expression library of M. tuberculosis genomic DNA with sera obtained from M. tuberculosis-infected rabbits at 5 weeks postinfection. In this study, we report the further characterization of one of these antigens, LipC (Rv0220). LipC is annotated as a member of the Lip family based on the presence of the consensus motif “GXSXG” characteristic of esterases. Although predicted to be a cytoplasmic enzyme, we provide evidence that LipC is a cell surface protein that is present in both the cell wall and the capsule of M. tuberculosis. Consistent with this localization, LipC elicits strong humoral immune responses in both HIV-negative (HIV−) and HIV-positive (HIV+) tuberculosis (TB) patients. The absence of anti-LipC antibodies in sera from purified protein derivative-positive (PPD+) healthy subjects confirms its expression only during active M. tuberculosis infection. Epitope mapping of LipC identified 6 immunodominant epitopes, 5 of which map to the exposed surface of the modeled LipC protein. The recombinant LipC (rLipC) protein also elicits proinflammatory cytokine and chemokine responses from macrophages and pulmonary epithelial cells. rLipC can hydrolyze short-chain esters with the carbon chain containing 2 to 10 carbon atoms. Together, these studies demonstrate that LipC is a novel cell surface-associated esterase of M. tuberculosis that is highly immunogenic and elicits both antibodies and cytokines/chemokines. PMID:22038913

  12. Evaluation of IL-12RB1, IL-12B, CXCR-3 and IL-17a expression in cases affected by a non-healing form of cutaneous leishmaniasis: an observational study design

    PubMed Central

    Moafi, Mohammad; Rezvan, Hossein; Sherkat, Roya; Taleban, Roya; Asilian, Ali; Zarkesh Esfahani, Seyed Hamid; Nilforoushzadeh, Mohammad Ali; Jaffary, Fariba; Feizi, Awat

    2017-01-01

    Introduction Seldom cutaneous leishmaniasis (CL) may present as a lasting and active lesion(s), known as a non-healing form of CL (NHCL). Non-functional type 1 T helper (Th1) cells are assumed the most important factor in the outcome of the disease. The present study aims to assess some molecular defects that potentially contribute to Th1 impairment in NHCL. Methods and analysis This prospective observational study will be implemented among five groups. The first and second groups comprise patients afflicted with non-healing and healing forms of CL, respectively. The third group consists of those recovered participants who have scars as a result of CL. Those participants who have never lived or travelled to endemic areas of leishmaniasis will comprise the fourth group. The fifth group comprises participants living in hyperendemic areas for leishmaniasis, although none of them have been afflicted by CL. The aim is to recruit 10 NHCL cases and 30 participants in each of the other groups. A leishmanin skin test (LST) will be performed to assess in vivo immunity against the Leishmania infection. The cytokine profile (interleukin (IL)-12p70, interferon (IFN)-γ, C-X-C motif chemokine ligand (CXCL)-11 and IL-17a) of the isolated peripheral blood mononuclear cells (PBMCs) will be evaluated through ELISA. Real-time PCR will determine the C-X-C motif chemokine receptor (CXCR)-3 and IL-17a gene expression and expression of IL-12Rβ1 will be assessed by flow cytometry. Furthermore, IL-12B and IL-12RB1 mutation analysis will be performed. Discussion It is anticipated that the outcome of the current study will identify IL-12B and IL-12RB1 mutations, which lead to persistent lesions of CL. Furthermore, our expected results will reveal an association between NHCL and pro-inflammatory cytokines (IL-12p70, IFN-γ IL-17a and CXCL-11), as well as CXCR-3 expression. Ethics and dissemination This study has been approved by a local ethical committee. The final results will be disseminated through peer-reviewed journals and scientific conferences. PMID:28132002

  13. Evaluation of IL-12RB1, IL-12B, CXCR-3 and IL-17a expression in cases affected by a non-healing form of cutaneous leishmaniasis: an observational study design.

    PubMed

    Moafi, Mohammad; Rezvan, Hossein; Sherkat, Roya; Taleban, Roya; Asilian, Ali; Zarkesh Esfahani, Seyed Hamid; Nilforoushzadeh, Mohammad Ali; Jaffary, Fariba; Feizi, Awat

    2017-01-27

    Seldom cutaneous leishmaniasis (CL) may present as a lasting and active lesion(s), known as a non-healing form of CL (NHCL). Non-functional type 1 T helper (Th1) cells are assumed the most important factor in the outcome of the disease. The present study aims to assess some molecular defects that potentially contribute to Th1 impairment in NHCL. This prospective observational study will be implemented among five groups. The first and second groups comprise patients afflicted with non-healing and healing forms of CL, respectively. The third group consists of those recovered participants who have scars as a result of CL. Those participants who have never lived or travelled to endemic areas of leishmaniasis will comprise the fourth group. The fifth group comprises participants living in hyperendemic areas for leishmaniasis, although none of them have been afflicted by CL. The aim is to recruit 10 NHCL cases and 30 participants in each of the other groups. A leishmanin skin test (LST) will be performed to assess in vivo immunity against the Leishmania infection. The cytokine profile (interleukin (IL)-12p70, interferon (IFN)-γ, C-X-C motif chemokine ligand (CXCL)-11 and IL-17a) of the isolated peripheral blood mononuclear cells (PBMCs) will be evaluated through ELISA. Real-time PCR will determine the C-X-C motif chemokine receptor (CXCR)-3 and IL-17a gene expression and expression of IL-12Rβ1 will be assessed by flow cytometry. Furthermore, IL-12B and IL-12RB1 mutation analysis will be performed. It is anticipated that the outcome of the current study will identify IL-12B and IL-12RB1 mutations, which lead to persistent lesions of CL. Furthermore, our expected results will reveal an association between NHCL and pro-inflammatory cytokines (IL-12p70, IFN-γ IL-17a and CXCL-11), as well as CXCR-3 expression. This study has been approved by a local ethical committee. The final results will be disseminated through peer-reviewed journals and scientific conferences. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  14. The Baculovirus-Expressed Binding Region of Plasmodium falciparum EBA-140 Ligand and Its Glycophorin C Binding Specificity

    PubMed Central

    Rydzak, Joanna; Kaczmarek, Radoslaw; Czerwinski, Marcin; Lukasiewicz, Jolanta; Tyborowska, Jolanta; Szewczyk, Boguslaw; Jaskiewicz, Ewa

    2015-01-01

    The erythrocyte binding ligand 140 (EBA-140) is a member of the Plasmodium falciparum DBL family of erythrocyte binding proteins, which are considered as prospective candidates for malaria vaccine development. The EBA-140 ligand is a paralogue of the well-characterized P. falciparum EBA-175 protein. They share homology of domain structure, including Region II, which consists of two homologous F1 and F2 domains and is responsible for ligand-erythrocyte receptor interaction during invasion. In this report we describe, for the first time, the glycophorin C specificity of the recombinant, baculovirus-expressed binding region (Region II) of P. falciparum EBA-140 ligand. It was found that the recombinant EBA-140 Region II binds to the endogenous and recombinant glycophorin C, but does not bind to Gerbich-type glycophorin C, neither normal nor recombinant, which lacks amino acid residues 36–63 of its polypeptide chain. Our results emphasize the crucial role of this glycophorin C region in EBA-140 ligand binding. Moreover, the EBA-140 Region II did not bind either to glycophorin D, the truncated form of glycophorin C lacking the N-glycan or to desialylated GPC. These results draw attention to the role of glycophorin C glycans in EBA-140 binding. The full identification of the EBA-140 binding site on glycophorin C molecule, consisting most likely of its glycans and peptide backbone, may help to design therapeutics or vaccines that target the erythrocyte binding merozoite ligands. PMID:25588042

  15. Double stranded viral RNA induces inflammation and insulin resistance in skeletal muscle from pregnant women in vitro.

    PubMed

    Lappas, Martha

    2015-05-01

    Maternal peripheral insulin resistance and increased inflammation are two features of pregnancies complicated by pre-existing maternal obesity and gestational diabetes mellitus (GDM). There is now increasing evidence that activation of Toll-like receptor (TLR) signalling pathways by viral products may play a role in the pathophysiology of diabetes. Thus, the aim of this study was to assess the effect of the TLR3 ligand and viral dsRNA analogue polyinosinic polycytidilic acid (poly(I:C)) on inflammation and the insulin signalling pathway in skeletal muscle from pregnant women. Human skeletal muscle tissue explants were performed to determine the effect of poly(I:C) on the expression and secretion of markers of inflammation, and the insulin signalling pathway and glucose uptake. Poly(I:C) significantly increased the expression of a number of inflammatory markers in skeletal muscle from pregnant women. Specifically, there was an increase in the expression and/or secretion of the pro-inflammatory cytokines TNF-α, and IL-6 and the pro-inflammatory chemokines IL-8 and MCP-1. These effect of poly(I:C) appear to mediated via a number of signalling molecules including the pro-inflammatory transcription factor NF-κB, and the serine threonine kinases GSK3 and AMPKα. Additionally, poly(I:C) decreased insulin stimulated GLUT-4 expression and glucose uptake in skeletal muscle from pregnant women. The in vitro data presented in this study suggests that viral infection may contribute to the pathophysiology of pregnancies complicated by pre-existing maternal obesity and/or GDM. It should be noted that the in vitro studies cannot be directly used to infer the same outcomes in the intact subject. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Ligand activation of peroxisome proliferator-activated receptor-β/δ (PPAR β/δ) inhibits cell growth in a mouse mammary gland cancer cell line

    PubMed Central

    Foreman, Jennifer E.; Sharma, Arun K.; Amin, Shantu; Gonzalez, Frank J.; Peters, Jeffrey M.

    2009-01-01

    The effects of ligand activation of PPARβ/δ were examined in the mouse mammary tumor cell line (C20). Expression of PPARβ/δ was markedly lower in C20 cells as compared to the human non-tumorigenic mammary gland derived cell line (MCF10A) and mouse keratinocytes. Ligand activation of PPARβ/δ in C20 cells caused upregulation of the PPARβ/δ target gene angiopoietin-like 4 (Angptl4). Inhibition of C20 cell proliferation and clonogenicity was observed following treatment with GW0742 or GW501516, two highly specific PPARβ/δ ligands. In addition, an increase in apoptosis was observed in C20 cells cultured with 10 µM GW501516 that preceded the observed inhibition of cell proliferation. Results from this study show that proliferation of the C20 mouse mammary gland cancer cell line is inhibited by ligand activation of PPARβ/δ due in part to increased apoptosis. PMID:19660859

  17. A one-dimensional nickel(II) coordination polymer containing 2,6-dipicolinate and dipyrido[3,2-a:2',3'-c]phenazine.

    PubMed

    Ma, Yi; Zhang, Li-Tian; Wang, Xiao-Fang; He, Yong-Ke; Han, Zheng-Bo

    2007-12-01

    A new coordination polymer, catena-poly[[(dipyrido[3,2-a:2',3'-c]phenazine-kappa(2)N,N')nickel(II)]-mu-2,6-dipicolinato-kappa(4)O(2),N,O(6):O(2')], [Ni(C7H3NO4)(C18H10N4)]n, exhibits a one-dimensional structure in which 2,6-dipicolinate acts as a bridging ligand interconnecting adjacent nickel(II) centers to form a chain structure. The asymmetric unit contains one Ni(II) center, one dipyrido[3,2-a:2',3'-c]phenazine ligand and one 2,6-dipicolinate ligand. Each Ni(II) center is six-coordinated and surrounded by three N atoms and three O atoms from one dipyrido[3,2-a:2',3'-c]phenazine ligand and two different 2,6-dipicolinate ligands, leading to a distorted octahedral geometry. Adjacent chains are linked by pi-pi stacking interactions and weak interactions to form a three-dimensional supramolecular network.

  18. C^C* cyclometalated platinum(II) N-heterocyclic carbene complexes with a sterically demanding β-diketonato ligand – synthesis, characterization and photophysical properties.

    PubMed

    Tenne, M; Metz, S; Wagenblast, G; Münster, Ingo; Strassner, T

    2015-05-14

    Neutral cyclometalated platinum(ii) N-heterocyclic carbene complexes [Pt(C^C*)(O^O)] with C^C* ligands based on 1-phenyl-1,2,4-triazol-5-ylidene and 4-phenyl-1,2,4-triazol-5-ylidene, as well as acetylacetonato (O^O = acac) and 1,3-bis(2,4,6-trimethylphenyl)propan-1,3-dionato (O^O = mesacac) ancillary ligands were synthesized and characterized. All complexes are emissive at room temperature in a poly(methyl methacrylate) (PMMA) matrix with emission maxima in the blue region of the spectrum. High quantum efficiencies and short decay times were observed for all complexes with mesacac ancillary ligands. The sterically demanding mesityl groups of the mesacac ligand effectively prevent molecular stacking. The emission behavior of these emitters is in general independent of the position of the nitrogen in the backbone of the N-heterocyclic carbene (NHC) unit and a variety of substituents in 4-position of the phenyl unit, meta to the cyclometalating bond.

  19. CCL5 promotes VEGF-C production and induces lymphangiogenesis by suppressing miR-507 in human chondrosarcoma cells

    PubMed Central

    Lin, Chih-Yang; Liu, Shih-Chia; Chen, Yen-Ling; Chen, Jih-Jung; Chan, Chia-Han; Lin, Ting-Yi; Chen, Chi-Kuan; Xu, Guo-Hong; Chen, Shiou-Sheng; Tang, Chih-Hsin; Wang, Shih-Wei

    2016-01-01

    Chondrosarcoma is the second most frequently occurring type of bone malignancy that is characterized by the distant metastasis propensity. Vascular endothelial growth factor-C (VEGF-C) is the major lymphangiogenic factor, and makes crucial contributions to tumor lymphangiogenesis and lymphatic metastasis. Chemokine CCL5 has been reported to facilitate angiogenesis and metastasis in chondrosarcoma. However, the effect of chemokine CCL5 on VEGF-C regulation and lymphangiogenesis in chondrosarcoma has largely remained a mystery. In this study, we showed a clinical correlation between CCL5 and VEGF-C as well as tumor stage in human chondrosarcoma tissues. We further demonstrated that CCL5 promoted VEGF-C expression and secretion in human chondrosarcoma cells. The conditioned medium (CM) from CCL5-overexpressed cells significantly induced tube formation of human lymphatic endothelial cells (LECs). Mechanistic investigations showed that CCL5 activated VEGF-C-dependent lymphangiogenesis by down-regulating miR-507. Moreover, inhibiting CCL5 dramatically reduced VEGF-C and lymphangiogenesis in the chondrosarcoma xenograft animal model. Collectively, we document for the first time that CCL5 induces tumor lymphangiogenesis by the induction of VEGF-C in human cancer cells. Our present study reveals miR-507/VEGF-C signaling as a novel mechanism in CCL5-mediated tumor lymphangiogenesis. Targeting both CCL5 and VEGF-C pathways might serve as the potential therapeutic strategy to block cancer progression and metastasis in chondrosarcoma. PMID:27166194

  20. CCL5 promotes VEGF-C production and induces lymphangiogenesis by suppressing miR-507 in human chondrosarcoma cells.

    PubMed

    Wang, Li-Hong; Lin, Chih-Yang; Liu, Shih-Chia; Liu, Guan-Ting; Chen, Yen-Ling; Chen, Jih-Jung; Chan, Chia-Han; Lin, Ting-Yi; Chen, Chi-Kuan; Xu, Guo-Hong; Chen, Shiou-Sheng; Tang, Chih-Hsin; Wang, Shih-Wei

    2016-06-14

    Chondrosarcoma is the second most frequently occurring type of bone malignancy that is characterized by the distant metastasis propensity. Vascular endothelial growth factor-C (VEGF-C) is the major lymphangiogenic factor, and makes crucial contributions to tumor lymphangiogenesis and lymphatic metastasis. Chemokine CCL5 has been reported to facilitate angiogenesis and metastasis in chondrosarcoma. However, the effect of chemokine CCL5 on VEGF-C regulation and lymphangiogenesis in chondrosarcoma has largely remained a mystery. In this study, we showed a clinical correlation between CCL5 and VEGF-C as well as tumor stage in human chondrosarcoma tissues. We further demonstrated that CCL5 promoted VEGF-C expression and secretion in human chondrosarcoma cells. The conditioned medium (CM) from CCL5-overexpressed cells significantly induced tube formation of human lymphatic endothelial cells (LECs). Mechanistic investigations showed that CCL5 activated VEGF-C-dependent lymphangiogenesis by down-regulating miR-507. Moreover, inhibiting CCL5 dramatically reduced VEGF-C and lymphangiogenesis in the chondrosarcoma xenograft animal model. Collectively, we document for the first time that CCL5 induces tumor lymphangiogenesis by the induction of VEGF-C in human cancer cells. Our present study reveals miR-507/VEGF-C signaling as a novel mechanism in CCL5-mediated tumor lymphangiogenesis. Targeting both CCL5 and VEGF-C pathways might serve as the potential therapeutic strategy to block cancer progression and metastasis in chondrosarcoma.

  1. Pirfenidone inhibits fibrocyte accumulation in the lungs in bleomycin-induced murine pulmonary fibrosis.

    PubMed

    Inomata, Minoru; Kamio, Koichiro; Azuma, Arata; Matsuda, Kuniko; Kokuho, Nariaki; Miura, Yukiko; Hayashi, Hiroki; Nei, Takahito; Fujita, Kazue; Saito, Yoshinobu; Gemma, Akihiko

    2014-02-08

    Bone marrow-derived fibrocytes reportedly play important roles in the pathogenesis of idiopathic pulmonary fibrosis. Pirfenidone is an anti-fibrotic agent; however, its effects on fibrocytes have not been investigated. The aim of this study was to investigate whether pirfenidone inhibits fibrocyte pool size in the lungs of bleomycin-treated mice. Bleomycin (100 mg/kg) was infused with osmotic pumps into C57BL/6 mice, and pirfenidone (300 mg/kg/day) was orally administered daily for 2 wk. The lungs were removed, and single-cell suspensions were subjected to fluorescence-activated cell sorter (FACS) analysis to detect fibrocytes, which were defined as CD45 and collagen-I double-positive cells. Immunohistochemistry was performed on the lung specimens to quantify fibrocytes. Chemokines in the lung digests were measured with enzyme-linked immunosorbent assay. The effect of pirfenidone on alveolar macrophages was evaluated with bronchoalveolar lavage (BAL). In a therapeutic setting, pirfenidone administration was initiated 10 days after bleomycin treatment. For chemotaxis assay, lung fibrocytes were isolated with immunomagnetic selection (CD45-positive mesenchymal cells) after culture and allowed to migrate toward chemokines in the presence or absence of pirfenidone. Moreover, the effect of pirfenidone on the expression of chemokine receptors on fibrocytes was evaluated. Pirfenidone significantly ameliorated bleomycin-induced pulmonary fibrosis as assessed with quantitative histology and collagen measurement. Fibrocyte pool size in bleomycin-treated mice lungs was attenuated from 26.5% to 13.7% by pirfenidone on FACS analysis. This outcome was also observed in a therapeutic setting. Immunohistochemistry revealed that fibrocytes were significantly decreased by pirfenidone administration compared with those in bleomycin-treated mice (P = 0.0097). Increased chemokine (CC motif) ligand-2 (CCL2) and CCL12 production in bleomycin-treated mouse lungs was significantly attenuated by pirfenidone (P = 0.0003 and P < 0.0001, respectively). Pirfenidone also attenuated macrophage counts stimulated by bleomycin in BAL fluid. Fibrocyte migration toward CCL2 and chemokine (CC motif) receptor-2 expression on fibrocytes was significantly inhibited by pirfenidone in vitro. Pirfenidone attenuated the fibrocyte pool size in bleomycin-treated mouse lungs via attenuation of CCL2 and CCL12 production in vivo, and fibrocyte migration was inhibited by pirfenidone in vitro. Fibrocyte inhibition is considered a mechanism of anti-fibrotic action of pirfenidone.

  2. Pirfenidone inhibits fibrocyte accumulation in the lungs in bleomycin-induced murine pulmonary fibrosis

    PubMed Central

    2014-01-01

    Background Bone marrow-derived fibrocytes reportedly play important roles in the pathogenesis of idiopathic pulmonary fibrosis. Pirfenidone is an anti-fibrotic agent; however, its effects on fibrocytes have not been investigated. The aim of this study was to investigate whether pirfenidone inhibits fibrocyte pool size in the lungs of bleomycin-treated mice. Methods Bleomycin (100 mg/kg) was infused with osmotic pumps into C57BL/6 mice, and pirfenidone (300 mg/kg/day) was orally administered daily for 2 wk. The lungs were removed, and single-cell suspensions were subjected to fluorescence-activated cell sorter (FACS) analysis to detect fibrocytes, which were defined as CD45 and collagen-I double-positive cells. Immunohistochemistry was performed on the lung specimens to quantify fibrocytes. Chemokines in the lung digests were measured with enzyme-linked immunosorbent assay. The effect of pirfenidone on alveolar macrophages was evaluated with bronchoalveolar lavage (BAL). In a therapeutic setting, pirfenidone administration was initiated 10 days after bleomycin treatment. For chemotaxis assay, lung fibrocytes were isolated with immunomagnetic selection (CD45-positive mesenchymal cells) after culture and allowed to migrate toward chemokines in the presence or absence of pirfenidone. Moreover, the effect of pirfenidone on the expression of chemokine receptors on fibrocytes was evaluated. Results Pirfenidone significantly ameliorated bleomycin-induced pulmonary fibrosis as assessed with quantitative histology and collagen measurement. Fibrocyte pool size in bleomycin-treated mice lungs was attenuated from 26.5% to 13.7% by pirfenidone on FACS analysis. This outcome was also observed in a therapeutic setting. Immunohistochemistry revealed that fibrocytes were significantly decreased by pirfenidone administration compared with those in bleomycin-treated mice (P = 0.0097). Increased chemokine (CC motif) ligand-2 (CCL2) and CCL12 production in bleomycin-treated mouse lungs was significantly attenuated by pirfenidone (P = 0.0003 and P < 0.0001, respectively). Pirfenidone also attenuated macrophage counts stimulated by bleomycin in BAL fluid. Fibrocyte migration toward CCL2 and chemokine (CC motif) receptor-2 expression on fibrocytes was significantly inhibited by pirfenidone in vitro. Conclusions Pirfenidone attenuated the fibrocyte pool size in bleomycin-treated mouse lungs via attenuation of CCL2 and CCL12 production in vivo, and fibrocyte migration was inhibited by pirfenidone in vitro. Fibrocyte inhibition is considered a mechanism of anti-fibrotic action of pirfenidone. PMID:24507087

  3. Human papillomavirus-exposed Langerhans cells are activated by stabilized Poly-I:C.

    PubMed

    Da Silva, Diane M; Woodham, Andrew W; Rijkee, Laurie K; Skeate, Joseph G; Taylor, Julia R; Koopman, Maaike E; Brand, Heike E; Wong, Michael K; McKee, Greg M; Salazar, Andres M; Kast, W Martin

    2015-12-01

    Human papillomaviruses (HPV) establish persistent infections because of evolved immune evasion mechanisms, particularly HPV-mediated suppression of the immune functions of Langerhans cells (LC), the antigen presenting cells of the epithelium. Polyinosinic-polycytidilic acid (Poly-I:C) is broadly immunostimulatory with the ability to enhance APC expression of costimulatory molecules and inflammatory cytokines resulting in T cell activation. Here we investigated the activation of primary human LC derived from peripheral blood monocytes after exposure to HPV16 virus like particles followed by treatment with stabilized Poly-I:C compounds (s-Poly-I:C), and their subsequent induction of HPV16-specific T cells. Our results indicate that HPV16 particles alone were incapable of inducing LC activation as demonstrated by the lack of costimulatory molecules, inflammatory cytokines, chemokine-directed migration, and HPV16-specific CD8 + T cells in vitro . Conversely, s-Poly-I:C caused significant upregulation of costimulatory molecules and induction of chemokine-directed migration of LC that were pre-exposed to HPV16. In HLA-A*0201-positive donors, s-Poly-I:C treatment was able to induce CD8 + T cell immune responses against HPV16-derived peptides. Thus, s-Poly-I:C compounds are attractive for translation into therapeutics in which they could potentially mediate clearance of persistent HPV infection.

  4. A molecular dynamics investigation of CDK8/CycC and ligand binding: conformational flexibility and implication in drug discovery

    NASA Astrophysics Data System (ADS)

    Cholko, Timothy; Chen, Wei; Tang, Zhiye; Chang, Chia-en A.

    2018-05-01

    Abnormal activity of cyclin-dependent kinase 8 (CDK8) along with its partner protein cyclin C (CycC) is a common feature of many diseases including colorectal cancer. Using molecular dynamics (MD) simulations, this study determined the dynamics of the CDK8-CycC system and we obtained detailed breakdowns of binding energy contributions for four type-I and five type-II CDK8 inhibitors. We revealed system motions and conformational changes that will affect ligand binding, confirmed the essentialness of CycC for inclusion in future computational studies, and provide guidance in development of CDK8 binders. We employed unbiased all-atom MD simulations for 500 ns on twelve CDK8-CycC systems, including apoproteins and protein-ligand complexes, then performed principal component analysis (PCA) and measured the RMSF of key regions to identify protein dynamics. Binding pocket volume analysis identified conformational changes that accompany ligand binding. Next, H-bond analysis, residue-wise interaction calculations, and MM/PBSA were performed to characterize protein-ligand interactions and find the binding energy. We discovered that CycC is vital for maintaining a proper conformation of CDK8 to facilitate ligand binding and that the system exhibits motion that should be carefully considered in future computational work. Surprisingly, we found that motion of the activation loop did not affect ligand binding. Type-I and type-II ligand binding is driven by van der Waals interactions, but electrostatic energy and entropic penalties affect type-II binding as well. Binding of both ligand types affects protein flexibility. Based on this we provide suggestions for development of tighter-binding CDK8 inhibitors and offer insight that can aid future computational studies.

  5. The CXCR4/SDF-1 chemokine receptor axis: a new target therapeutic for non-small cell lung cancer.

    PubMed

    Otsuka, Shannon; Bebb, Gwyn

    2008-12-01

    Chemokines are proinflammatory chemoattractant cytokines that regulate cell trafficking and adhesion. The CXCR4 chemokine receptor and its ligand, stromal cell derived factor (SDF-1), constitute a chemokine/receptor axis that has attracted great interest because of an increasing understanding of its role in cancer, including lung cancer. The CXCR4/SDF-1 complex activates several pathways that mediate chemotaxis, migration and secretion of angiopoietic factors. Neutralization of SDF-1 by anti-SDF-1 or anti-CXCR4 monoclonal antibody in preclinical in vivo studies results in a significant decrease of non-small cell lung cancer metastases. Since anti-SDF-1/CXCR4 strategies have already been developed for use in combating human immunodeficiency virus infections, it is likely that these approaches will be used in clinical trials in non-small cell lung cancer in the very near future.

  6. Structure of the CCR5 Chemokine Receptor-HIV Entry Inhibitor Maraviroc Complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tan, Qiuxiang; Zhu, Ya; Li, Jian

    2013-10-21

    The CCR5 chemokine receptor acts as a co-receptor for HIV-1 viral entry. Here we report the 2.7 angstrom–resolution crystal structure of human CCR5 bound to the marketed HIV drug maraviroc. The structure reveals a ligand-binding site that is distinct from the proposed major recognition sites for chemokines and the viral glycoprotein gp120, providing insights into the mechanism of allosteric inhibition of chemokine signaling and viral entry. A comparison between CCR5 and CXCR4 crystal structures, along with models of co-receptor–gp120-V3 complexes, suggests that different charge distributions and steric hindrances caused by residue substitutions may be major determinants of HIV-1 co-receptor selectivity.more » These high-resolution insights into CCR5 can enable structure-based drug discovery for the treatment of HIV-1 infection.« less

  7. The DRF motif of CXCR6 as chemokine receptor adaptation to adhesion.

    PubMed

    Koenen, Andrea; Babendreyer, Aaron; Schumacher, Julian; Pasqualon, Tobias; Schwarz, Nicole; Seifert, Anke; Deupi, Xavier; Ludwig, Andreas; Dreymueller, Daniela

    2017-01-01

    The CXC-chemokine receptor 6 (CXCR6) is a class A GTP-binding protein-coupled receptor (GPCRs) that mediates adhesion of leukocytes by interacting with the transmembrane cell surface-expressed chemokine ligand 16 (CXCL16), and also regulates leukocyte migration by interacting with the soluble shed variant of CXCL16. In contrast to virtually all other chemokine receptors with chemotactic activity, CXCR6 carries a DRF motif instead of the typical DRY motif as a key element in receptor activation and G protein coupling. In this work, modeling analyses revealed that the phenylalanine F3.51 in CXCR6 might have impact on intramolecular interactions including hydrogen bonds by this possibly changing receptor function. Initial investigations with embryonic kidney HEK293 cells and further studies with monocytic THP-1 cells showed that mutation of DRF into DRY does not influence ligand binding, receptor internalization, receptor recycling, and protein kinase B (AKT) signaling. Adhesion was slightly decreased in a time-dependent manner. However, CXCL16-induced calcium signaling and migration were increased. Vice versa, when the DRY motif of the related receptor CX3CR1 was mutated into DRF the migratory response towards CX3CL1 was diminished, indicating that the presence of a DRF motif generally impairs chemotaxis in chemokine receptors. Transmembrane and soluble CXCL16 play divergent roles in homeostasis, inflammation, and cancer, which can be beneficial or detrimental. Therefore, the DRF motif of CXCR6 may display a receptor adaptation allowing adhesion and cell retention by transmembrane CXCL16 but reducing the chemotactic response to soluble CXCL16. This adaptation may avoid permanent or uncontrolled recruitment of inflammatory cells as well as cancer metastasis.

  8. The chemokine receptor CXCR6 and its ligand CXCL16 are expressed in carcinomas and inhibit proliferation.

    PubMed

    Meijer, Joost; Ogink, Janneke; Kreike, Bas; Nuyten, Dimitry; de Visser, Karin E; Roos, Ed

    2008-06-15

    The chemokine receptor CXCR6 and its ligand CXCL16 are involved in inflammation. Thus far, they were known to be expressed mainly by T cells and macrophages, respectively. However, we detected both in all of 170 human primary mammary carcinomas and at similar levels in all 8 human mammary carcinoma cell lines tested by microarray analysis. Expression was confirmed by reverse transcription-PCR and for the cell lines also by fluorescence-activated cell sorting analysis. CXCR6 and CXCL16 were also detected in several mouse and human mammary, colon, and pancreatic carcinoma cell lines. CXCL16 is a transmembrane protein from which the soluble chemokine can be cleaved off. The transmembrane form is present on the surface of the carcinoma cells. Surprisingly, suppression of either CXCR6 or CXCL16 led to greatly enhanced proliferation in vitro as well as in vivo, indicating that their interaction inhibits proliferation. This notion was verified using inhibitory antibodies and by introduction of CXCL16 into a rare CXCL16-negative cell line. The effect was mediated by the G protein-coupled receptor CXCR6 because it was blocked by the G(i) protein inhibitor pertussis toxin. In contrast, the soluble CXCL16 chemokine enhanced proliferation, and this was also mediated by CXCR6 but not via G(i) protein. It is remarkable that both CXCR6 and CXCL16 are expressed by all mammary carcinomas because cells that lose either acquire a growth advantage and should be selected during tumor progression. This suggests an unknown important role in tumor formation. Proteases, possibly macrophage derived, might convert inhibitory transmembrane CXCL16 into the stimulatory chemokine.

  9. The DRF motif of CXCR6 as chemokine receptor adaptation to adhesion

    PubMed Central

    Koenen, Andrea; Babendreyer, Aaron; Schumacher, Julian; Pasqualon, Tobias; Schwarz, Nicole; Seifert, Anke; Deupi, Xavier

    2017-01-01

    The CXC-chemokine receptor 6 (CXCR6) is a class A GTP-binding protein-coupled receptor (GPCRs) that mediates adhesion of leukocytes by interacting with the transmembrane cell surface-expressed chemokine ligand 16 (CXCL16), and also regulates leukocyte migration by interacting with the soluble shed variant of CXCL16. In contrast to virtually all other chemokine receptors with chemotactic activity, CXCR6 carries a DRF motif instead of the typical DRY motif as a key element in receptor activation and G protein coupling. In this work, modeling analyses revealed that the phenylalanine F3.51 in CXCR6 might have impact on intramolecular interactions including hydrogen bonds by this possibly changing receptor function. Initial investigations with embryonic kidney HEK293 cells and further studies with monocytic THP-1 cells showed that mutation of DRF into DRY does not influence ligand binding, receptor internalization, receptor recycling, and protein kinase B (AKT) signaling. Adhesion was slightly decreased in a time-dependent manner. However, CXCL16-induced calcium signaling and migration were increased. Vice versa, when the DRY motif of the related receptor CX3CR1 was mutated into DRF the migratory response towards CX3CL1 was diminished, indicating that the presence of a DRF motif generally impairs chemotaxis in chemokine receptors. Transmembrane and soluble CXCL16 play divergent roles in homeostasis, inflammation, and cancer, which can be beneficial or detrimental. Therefore, the DRF motif of CXCR6 may display a receptor adaptation allowing adhesion and cell retention by transmembrane CXCL16 but reducing the chemotactic response to soluble CXCL16. This adaptation may avoid permanent or uncontrolled recruitment of inflammatory cells as well as cancer metastasis. PMID:28267793

  10. Activation of the CXCL16/CXCR6 Pathway by Inflammation Contributes to Atherosclerosis in Patients with End-stage Renal Disease.

    PubMed

    Hu, Ze Bo; Chen, Yan; Gong, Yu Xiang; Gao, Min; Zhang, Yang; Wang, Gui Hua; Tang, Ri Ning; Liu, Hong; Liu, Bi Cheng; Ma, Kun Ling

    2016-01-01

    Background: Chronic inflammation plays a critical role in the progression of atherosclerosis (AS). This study aimed to determine the effects of the CXC chemokine ligand 16 (CXCL16)/CXC chemokine receptor 6 (CXCR6) pathway on cholesterol accumulation in the radial arteries of end-stage renal disease (ESRD) patients with concomitant microinflammation and to further investigate the potential effects of the purinergic receptor P2X ligand-gated ion channel 7 (P2X7R). Methods: Forty-three ESRD patients were divided into the control group (n=17) and the inflamed group (n=26) based on plasma C-reactive protein (CRP) levels. Biochemical indexes and lipid profiles of the patients were determined. Surgically removed tissues from the radial arteries of patients receiving arteriovenostomy were used for preliminary evaluation of AS. Haematoxylin-eosin (HE) and Filipin staining were performed to assess foam cell formation. CXCL16/CXCR6 pathway-related protein expression, P2X7R protein expression and the expression of monocyte chemotactic protein-1 (MCP-1), tumour necrosis factor-α (TNF-α), and CD68 were detected by immunohistochemical and immunofluorescence staining. Results: Inflammation increased both MCP-1 and TNF-α expression and macrophage infiltration in radial arteries. Additionally, foam cell formation significantly increased in the radial arteries of the inflamed group compared to that of the controls. Further analysis showed that protein expression of CXCL16, CXCR6, disintegrin and metalloproteinase-10 (ADAM10) in the radial arteries of the inflamed group was significantly increased. Furthermore, CXCL16 expression was positively correlated with P2X7R expression in the radial arteries of ESRD patients. Conclusions: Inflammation contributed to foam cell formation in the radial arteries of ESRD patients via activation of the CXCL16/CXCR6 pathway, which may be regulated by P2X7R.

  11. Peripheral blood stem cell mobilization: the CXCR2 ligand GRObeta rapidly mobilizes hematopoietic stem cells with enhanced engraftment properties.

    PubMed

    Pelus, Louis M; Fukuda, Seiji

    2006-08-01

    Chemokines direct the movement of leukocytes, including hematopoietic stem and progenitor cells, and can mobilize hematopoietic cells from marrow to peripheral blood where they can be used for transplantation. In this review, we will discuss the stem cell mobilizing activities and mechanisms of action of GRObeta, a CXC chemokine ligand for the CXCR2 receptor. GRObeta rapidly mobilizes short- and long-term repopulating cells in mice and/or monkeys and synergistically enhances mobilization responses when combined with the widely used clinical mobilizer, granulocyte colony-stimulating factor (G-CSF). The hematopoietic graft mobilized by GRObeta contains significantly more CD34(neg), Sca-1+, c-kit+, lineage(neg) (SKL) cells than the graft mobilized by G-CSF. In mice, stem cells mobilized by GRObeta demonstrate a competitive advantage upon long-term repopulation analysis and restore neutrophil and platelet counts significantly faster than cells mobilized by G-CSF. Even greater advantage in repopulation and restoration of hematopoiesis are observed with stem cells mobilized by the combination of GRObeta and G-CSF. GRObeta-mobilized SKL cells demonstrate enhanced adherence to vascular cell adhesion molecule-1 and VCAM(pos) endothelial cells and home more efficiently to bone marrow in vivo. The marrow homing ability of GRObeta-mobilized cells is less dependent on the CXCR4/SDF-1 axis than cells mobilized by G-CSF. The mechanism of mobilization by GRObeta requires active matrix metalloproteinase-9 (MMP-9), which results from release of pro-MMP-9 from peripheral blood, and marrow neutrophils, which alters the stoichiometry between pro-MMP-9 and its inhibitor tissue inhibitor of metalloproteinase-1, resulting in MMP-9 activation. The efficacy and rapid action of GRObeta and lack of proinflammatory activity make it an attractive agent to supplement mobilization by G-CSF. In addition, GRObeta may also have clinical mobilizing efficacy on its own, reducing the overall time and costs associated with peripheral blood stem cell transplantation.

  12. Development of a Unique Small Molecule Modulator of CXCR4

    PubMed Central

    Yoon, Younghyoun; Lin, Songbai; Sasaki, Maiko; Klapproth, Jan-Michael A.; Yang, Hua; Grossniklaus, Hans E.; Xu, Jianguo; Rojas, Mauricio; Voll, Ronald J.; Goodman, Mark M.; Arrendale, Richard F.; Liu, Jin; Yun, C. Chris; Snyder, James P.; Liotta, Dennis C.; Shim, Hyunsuk

    2012-01-01

    Background Metastasis, the spread and growth of tumor cells to distant organ sites, represents the most devastating attribute and plays a major role in the morbidity and mortality of cancer. Inflammation is crucial for malignant tumor transformation and survival. Thus, blocking inflammation is expected to serve as an effective cancer treatment. Among anti-inflammation therapies, chemokine modulation is now beginning to emerge from the pipeline. CXC chemokine receptor-4 (CXCR4) and its ligand stromal cell-derived factor-1 (CXCL12) interaction and the resulting cell signaling cascade have emerged as highly relevant targets since they play pleiotropic roles in metastatic progression. The unique function of CXCR4 is to promote the homing of tumor cells to their microenvironment at the distant organ sites. Methodology/Principal Findings We describe the actions of N,N′-(1,4-phenylenebis(methylene))dipyrimidin-2-amine (designated MSX-122), a novel small molecule and partial CXCR4 antagonist with properties quite unlike that of any other reported CXCR4 antagonists, which was prepared in a single chemical step using a reductive amination reaction. Its specificity toward CXCR4 was tested in a binding affinity assay and a ligand competition assay using 18F-labeled MSX-122. The potency of the compound was determined in two functional assays, Matrigel invasion assay and cAMP modulation. The therapeutic potential of MSX-122 was evaluated in three different murine models for inflammation including an experimental colitis, carrageenan induced paw edema, and bleomycin induced lung fibrosis and three different animal models for metastasis including breast cancer micrometastasis in lung, head and neck cancer metastasis in lung, and uveal melanoma micrometastasis in liver in which CXCR4 was reported to play crucial roles. Conclusions/Significance We developed a novel small molecule, MSX-122, that is a partial CXCR4 antagonist without mobilizing stem cells, which can be safer for long-term blockade of metastasis than other reported CXCR4 antagonists. PMID:22485156

  13. Cysteine Cathepsins Activate ELR Chemokines and Inactivate Non-ELR Chemokines*

    PubMed Central

    Repnik, Urska; Starr, Amanda E.; Overall, Christopher M.; Turk, Boris

    2015-01-01

    Cysteine cathepsins are primarily lysosomal proteases involved in general protein turnover, but they also have specific proteolytic functions in antigen presentation and bone remodeling. Cathepsins are most stable at acidic pH, although growing evidence indicates that they have physiologically relevant activity also at neutral pH. Post-translational proteolytic processing of mature chemokines is a key, yet underappreciated, level of chemokine regulation. Although the role of selected serine proteases and matrix metalloproteases in chemokine processing has long been known, little has been reported about the role of cysteine cathepsins. Here we evaluated cleavage of CXC ELR (CXCL1, -2, -3, -5, and -8) and non-ELR (CXCL9–12) chemokines by cysteine cathepsins B, K, L, and S at neutral pH by high resolution Tris-Tricine SDS-PAGE and matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Whereas cathepsin B cleaved chemokines especially in the C-terminal region, cathepsins K, L, and S cleaved chemokines at the N terminus with glycosaminoglycans modulating cathepsin processing of chemokines. The functional consequences of the cleavages were determined by Ca2+ mobilization and chemotaxis assays. We show that cysteine cathepsins inactivate and in some cases degrade non-ELR CXC chemokines CXCL9–12. In contrast, cathepsins specifically process ELR CXC chemokines CXCL1, -2, -3, -5, and -8 N-terminally to the ELR motif, thereby generating agonist forms. This study suggests that cysteine cathepsins regulate chemokine activity and thereby leukocyte recruitment during protective or pathological inflammation. PMID:25833952

  14. Chemokine and Chemokine Receptor Profiles in Metastatic Salivary Adenoid Cystic Carcinoma.

    PubMed

    Mays, Ashley C; Feng, Xin; Browne, James D; Sullivan, Christopher A

    2016-08-01

    To characterize the chemokine pattern in metastatic salivary adenoid cystic carcinoma (SACC). Real-time polymerase chain reaction (RT-PCR) was used to compare chemokine and chemokine receptor gene expression in two SACC cell lines: SACC-83 and SACC-LM (lung metastasis). Chemokines and receptor genes were then screened and their expression pattern characterized in human tissue samples of non-recurrent SACC and recurrent SACC with perineural invasion. Expression of chemokine receptors C5AR1, CCR1, CCR3, CCR6, CCR7, CCR9, CCR10, CXCR4, CXCR6, CXCR7, CCRL1 and CCRL2 were higher in SACC-83 compared to SACC-LM. CCRL1, CCBP2, CMKLR1, XCR1 and CXCR2 and 6 chemokine genes (CCL13, CCL27, CXCL14, CMTM1, CMTM2, CKLF) were more highly expressed in tissues of patients without tumor recurrence/perineural invasion compared to those with tumor recurrence. CCRL1 (receptor), CCL27, CMTM1, CMTM2, and CKLF (chemokine) genes were more highly expressed in SACC-83 and human tissues of patients without tumor recurrence/perineural invasion. CCRL1, CCL27, CMTM1, CMTM2 and CKLF may play important roles in the development of tumor metastases in SACC. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  15. Non-metallocene organometallic complexes and related methods and systems

    DOEpatents

    Agapie, Theodor; Golisz, Suzanne Rose; Tofan, Daniel; Bercaw, John E.

    2010-12-07

    A non-metallocene organometallic complex comprising a tridentate ligand and a metal bonded to a tridentate ligand, wherein two substituted aryl groups in the tridentate ligand are connected to a cyclic group at the ortho position via semi-rigid ring-ring linkages, and selected so to provide the resulting non-metallocene organometallic complex with a C.sub.S geometry, a C.sub.1 geometry, a C.sub.2 geometry or a C.sub.2v geometry. Method for performing olefin polymerization with a non-metallocene organometallic complex as a catalyst, related catalytic systems, tridentate ligand and method for providing a non-metallocene organometallic complex.

  16. Aromatic interactions impact ligand binding and function at serotonin 5-HT2C G protein-coupled receptors: receptor homology modelling, ligand docking, and molecular dynamics results validated by experimental studies

    NASA Astrophysics Data System (ADS)

    Córdova-Sintjago, Tania; Villa, Nancy; Fang, Lijuan; Booth, Raymond G.

    2014-02-01

    The serotonin (5-hydroxytryptamine, 5-HT) 5-HT2 G protein-coupled receptor (GPCR) family consists of types 2A, 2B, and 2C that share ∼75% transmembrane (TM) sequence identity. Agonists for 5-HT2C receptors are under development for psychoses; whereas, at 5-HT2A receptors, antipsychotic effects are associated with antagonists - in fact, 5-HT2A agonists can cause hallucinations and 5-HT2B agonists cause cardiotoxicity. It is known that 5-HT2A TM6 residues W6.48, F6.51, and F6.52 impact ligand binding and function; however, ligand interactions with these residues at the 5-HT2C receptor have not been reported. To predict and validate molecular determinants for 5-HT2C-specific activation, results from receptor homology modelling, ligand docking, and molecular dynamics simulation studies were compared with experimental results for ligand binding and function at wild type and W6.48A, F6.51A, and F6.52A point-mutated 5-HT2C receptors.

  17. Evaluation of Protease Inhibitors and an Antioxidant for Treatment of Sulfur Mustard-Induced Toxic Lung Injury

    DTIC Science & Technology

    2009-01-01

    chemokines as ell as MMP-9, which together produce inflammation and con- ribute to the pathogenesis of SM toxicity ( Sabourin et al., 2002). uignabert et al...hakarjian, M.P., Bhatt, P., Gordon, M.K., Chang, Y.C., Casbohm, S.L., Rudge, T.L., Kiser, R.C., Sabourin , C.l., Casillas, R.P., Ohman-Strickland, P., Riley

  18. The chemokine receptor CX3CR1 coordinates monocyte recruitment and endothelial regeneration after arterial injury.

    PubMed

    Getzin, Tobias; Krishnasamy, Kashyap; Gamrekelashvili, Jaba; Kapanadze, Tamar; Limbourg, Anne; Häger, Christine; Napp, L Christian; Bauersachs, Johann; Haller, Hermann; Limbourg, Florian P

    2018-02-01

    Regeneration of arterial endothelium after injury is critical for the maintenance of normal blood flow, cell trafficking, and vascular function. Using mouse models of carotid injury, we show that the transition from a static to a dynamic phase of endothelial regeneration is marked by a strong increase in endothelial proliferation, which is accompanied by induction of the chemokine CX 3 CL1 in endothelial cells near the wound edge, leading to progressive recruitment of Ly6C lo monocytes expressing high levels of the cognate CX 3 CR1 chemokine receptor. In Cx3cr1 -deficient mice recruitment of Ly6C lo monocytes, endothelial proliferation and regeneration of the endothelial monolayer after carotid injury are impaired, which is rescued by acute transfer of normal Ly6C lo monocytes. Furthermore, human non-classical monocytes induce proliferation of endothelial cells in co-culture experiments in a VEGFA-dependent manner, and monocyte transfer following carotid injury promotes endothelial wound closure in a hybrid mouse model in vivo Thus, CX 3 CR1 coordinates recruitment of specific monocyte subsets to sites of endothelial regeneration, which promote endothelial proliferation and arterial regeneration. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  19. Role of chemokine network in the development and progression of ovarian cancer: a potential novel pharmacological target.

    PubMed

    Barbieri, Federica; Bajetto, Adriana; Florio, Tullio

    2010-01-01

    Ovarian cancer is the most common type of gynecologic malignancy. Despite advances in surgery and chemotherapy, the survival rate is still low since most ovarian cancers relapse and become drug-resistant. Chemokines are small chemoattractant peptides mainly involved in the immune responses. More recently, chemokines were also demonstrated to regulate extra-immunological functions. It was shown that the chemokine network plays crucial functions in the tumorigenesis in several tissues. In particular the imbalanced or aberrant expression of CXCL12 and its receptor CXCR4 strongly affects cancer cell proliferation, recruitment of immunosuppressive cells, neovascularization, and metastasization. In the last years, several molecules able to target CXCR4 or CXCL12 have been developed to interfere with tumor growth, including pharmacological inhibitors, antagonists, and specific antibodies. This chemokine ligand/receptor pair was also proposed to represent an innovative therapeutic target for the treatment of ovarian cancer. Thus, a thorough understanding of ovarian cancer biology, and how chemokines may control these different biological activities might lead to the development of more effective therapies. This paper will focus on the current biology of CXCL12/CXCR4 axis in the context of understanding their potential role in ovarian cancer development.

  20. Transient Ligand Docking Sites in Cerebratulus lacteus Mini-Hemoglobin

    PubMed Central

    Deng, Pengchi; Nienhaus, Karin; Palladino, Pasquale; Olson, John S.; Blouin, George; Moens, Luc; Dewilde, Sylvia; Geuens, Eva; Nienhaus, G. Ulrich

    2007-01-01

    The monomeric hemoglobin of the nemertean worm Cerebratulus lacteus functions as an oxygen storage protein to maintain neural activity under hypoxic conditions. It shares a large, apolar matrix tunnel with other small hemoglobins, which has been implicated as a potential ligand migration pathway. Here we explore ligand migration and binding within the distal heme pocket, to which the tunnel provides access to ligands from the outside. FTIR/TDS experiments performed at cryogenic temperatures reveal the presence of three transient ligand docking sites within the distal pocket, the primary docking site B on top of pyrrole C and secondary sites C and D. Site C is assigned to a cavity adjacent to the distal portion of the heme pocket, surrounded by the B and E helices. It has an opening to the apolar tunnel and is expected to be on the pathway for ligand entry and exit, whereas site D, circumscribed by TyrB10, GlnE7, and the CD corner, most likely is located on a side pathway of ligand migration. Flash photolysis experiments at ambient temperatures indicate that the rate-limiting step for ligand binding to CerHb is migration through the apolar channel to site C. Movement from C to B and iron-ligand bond formation involve low energy barriers and thus are very rapid processes in the wt protein. PMID:17531406

  1. IL-27 Modulates Chemokine Production in TNF-α -Stimulated Human Oral Epithelial Cells.

    PubMed

    Hosokawa, Yoshitaka; Hosokawa, Ikuko; Ozaki, Kazumi; Matsuo, Takashi

    2017-01-01

    Interleukin-27 (IL-27) is a cytokine which belongs to the IL-12 family. However, the role of IL-27 in the pathogenesis of periodontal disease is uncertain. The aim of this study was to examine the effect of IL-27 on chemokine production in TNF-α-stimulated human oral epithelial cells (TR146). We measured chemokine production in TR146 by ELISA. We used western blot analysis to detect the phosphorylation levels of signal transduction molecules, including STAT1 and STAT3 in TR146. We used inhibitors to examine the role of STAT1 and STAT3 activation. IL-27 increased CXCR3 ligands production in TNF-α-stimulated TR146. Meanwhile, IL-27 suppressed IL-8 and CCL20 production induced by TNF-α. STAT1 phosphorylation level in IL-27 and TNF-α-stimulated TR146 was enhanced in comparison to TNF-α-stimulated TR146. STAT3 phosphorylation level in IL-27-treated TR146 did not change by TNF-α. Both STAT1 inhibitor and STAT3 inhibitor decreased CXCR3 ligands production. STAT1 inhibitor overrode the inhibitory effect of IL-27 on IL-8 and CCL20 production in TNF-α-stimulated TR146. Meanwhile, STAT3 inhibitor did not modulate IL-8 and CCL20 production. IL-27 might control leukocyte migration in periodontal lesion by modulating chemokine production from epithelial cells. © 2017 The Author(s). Published by S. Karger AG, Basel.

  2. Antigen-Specific Immune Modulation Targets mTORC1 Function To Drive Chemokine Receptor-Mediated T Cell Tolerance.

    PubMed

    Chen, Weirong; Wan, Xiaoxiao; Ukah, Tobechukwu K; Miller, Mindy M; Barik, Subhasis; Cattin-Roy, Alexis N; Zaghouani, Habib

    2016-11-01

    To contain autoimmunity, pathogenic T cells must be eliminated or diverted from reaching the target organ. Recently, we defined a novel form of T cell tolerance whereby treatment with Ag downregulates expression of the chemokine receptor CXCR3 and prevents diabetogenic Th1 cells from reaching the pancreas, leading to suppression of type 1 diabetes (T1D). This report defines the signaling events underlying Ag-induced chemokine receptor-mediated tolerance. Specifically, we show that the mammalian target of rapamycin complex 1 (mTORC1) is a major target for induction of CXCR3 downregulation and crippling of Th1 cells. Indeed, Ag administration induces upregulation of programmed death-ligand 1 on dendritic cells in a T cell-dependent manner. In return, programmed death-ligand 1 interacts with the constitutively expressed programmed death-1 on the target T cells and stimulates docking of Src homology 2 domain-containing tyrosine phosphatase 2 phosphatase to the cytoplasmic tail of programmed death-1. Active Src homology 2 domain-containing tyrosine phosphatase 2 impairs the signaling function of the PI3K/protein kinase B (AKT) pathway, leading to functional defect of mTORC1, downregulation of CXCR3 expression, and suppression of T1D. Thus, mTORC1 component of the metabolic pathway serves as a target for chemokine receptor-mediated T cell tolerance and suppression of T1D. Copyright © 2016 by The American Association of Immunologists, Inc.

  3. The chemokines CCR1 and CCRL2 have a role in colorectal cancer liver metastasis.

    PubMed

    Akram, Israa G; Georges, Rania; Hielscher, Thomas; Adwan, Hassan; Berger, Martin R

    2016-02-01

    C-C chemokine receptor type 1 (CCR1) and chemokine C-C motif receptor-like 2 (CCRL2) have not yet been sufficiently investigated for their role in colorectal cancer (CRC). Here, we investigated their expression in rat and human CRC samples, their modulation of expression in a rat liver metastasis model, as well as the effects on cellular properties resulting from their knockdown. One rat and five human colorectal cancer cell lines were used. CC531 rat colorectal cells were injected via the portal vein into rats and re-isolated from rat livers after defined periods. Following mRNA isolation, the gene expression was investigated by microarray. In addition, all cell lines were screened for mRNA expression of CCR1 and CCRL2 by reverse transcription polymerase chain reaction (RT-PCR). Cell lines with detectable expression were used for knockdown experiments; and the respective influence was determined on the cells' proliferation, scratch closure, and colony formation. Finally, specimens from the primaries of 50 patients with CRC were monitored by quantitative RT-PCR for CCR1 and CCRL2 expression levels. The microarray studies showed peak increases of CCR1 and CCRL2 in the early phase of liver colonization. Knockdown was sufficient at mRNA but only moderate at protein levels and resulted in modest but significant inhibition of proliferation (p < 0.05), scratch closure, and colony formation (p < 0.05). All human CRC samples were positive for CCR1 and CCRL2 and showed a significant pairwise correlation (p < 0.0004), but there was no correlation with tumor stage or age of patients. In summary, the data point to an important role of CCR1 and CCRL2 under conditions of organ colonization and both chemokine receptors qualify as targets of treatment during early colorectal cancer liver metastasis.

  4. In silico identification of novel ligands for G-quadruplex in the c- MYC promoter

    NASA Astrophysics Data System (ADS)

    Kang, Hyun-Jin; Park, Hyun-Ju

    2015-04-01

    G-quadruplex DNA formed in NHEIII1 region of oncogene promoter inhibits transcription of the genes. In this study, virtual screening combining pharmacophore-based search and structure-based docking screening was conducted to discover ligands binding to G-quadruplex in promoter region of c- MYC. Several hit ligands showed the selective PCR-arresting effects for oligonucleotide containing c- MYC G-quadruplex forming sequence. Among them, three hits selectively inhibited cell proliferation and decreased c- MYC mRNA level in Ramos cells, where NHEIII1 is included in translocated c- MYC gene for overexpression. Promoter assay using two kinds of constructs with wild-type and mutant sequences showed that interaction of these ligands with the G-quadruplex resulted in turning-off of the reporter gene. In conclusion, combined virtual screening methods were successfully used for discovery of selective c- MYC promoter G-quadruplex binders with anticancer activity.

  5. Oligomerization State of CXCL4 Chemokines Regulates G Protein-Coupled Receptor Activation.

    PubMed

    Chen, Ya-Ping; Wu, Hsin-Li; Boyé, Kevin; Pan, Chen-Ya; Chen, Yi-Chen; Pujol, Nadège; Lin, Chun-Wei; Chiu, Liang-Yuan; Billottet, Clotilde; Alves, Isabel D; Bikfalvi, Andreas; Sue, Shih-Che

    2017-11-17

    CXCL4 chemokines have antiangiogenic properties, mediated by different mechanisms, including CXCR3 receptor activation. Chemokines have distinct oligomerization states that are correlated with their biological functions. CXCL4 exists as a stable tetramer under physiological conditions. It is unclear whether the oligomerization state impacts CXCL4-receptor interaction. We found that the CXCL4 tetramer is sensitive to pH and salt concentration. Residues Glu28 and Lys50 were important for tetramer formation, and the first β-strand and the C-terminal helix are critical for dimerization. By mutating the critical residues responsible for oligomerization, we generated CXCL4 mutants that behave as dimers or monomers under neutral/physiological conditions. The CXCL4 monomer acts as the minimal active unit for interacting CXCR3A, and sulfation of N-terminal tyrosine residues on the receptor is important for binding. Noticeably, CXCL4L1, a CXCL4 variant that differs by three residues in the C-terminal helix, could activate CXCR3A. CXCL4L1 showed a higher tendency to dissociate into monomers, but native CXCL4 did not. This result indicates that monomeric CXCL4 behaves like CXCL4L1. Thus, in this chemokine family, being in the monomeric state seems critical for interaction with CXCR3A.

  6. Drawing Mononuclear Octahedral Coordination Compounds Containing Tridentate Chelating Ligands

    ERIC Educational Resources Information Center

    Mohamadou, Aminou; Ple, Karen; Haudrechy, Arnaud

    2011-01-01

    Complexes with tridentate ligands of the type [M(A-B-C)2], where A [not equal to] B [not equal to] C and with an imposed bonding sequence A-B-C, require special attention to draw all possible stereoisomers. Depending on the nature of the central donor atom B of the tridentate ligand, an easy drawing method is presented that shows seven chiral…

  7. C-Terminal Clipping of Chemokine CCL1/I-309 Enhances CCR8-Mediated Intracellular Calcium Release and Anti-Apoptotic Activity

    PubMed Central

    Denis, Catherine; Deiteren, Kathleen; Mortier, Anneleen; Tounsi, Amel; Fransen, Erik; Proost, Paul; Renauld, Jean-Christophe; Lambeir, Anne-Marie

    2012-01-01

    Carboxypeptidase M (CPM) targets the basic amino acids arginine and lysine present at the C-terminus of peptides or proteins. CPM is thought to be involved in inflammatory processes. This is corroborated by CPM-mediated trimming and modulation of inflammatory factors, and expression of the protease in inflammatory environments. Since the function of CPM in and beyond inflammation remains mainly undefined, the identification of natural substrates can aid in discovering the (patho)physiological role of CPM. CCL1/I-309, with its three C-terminal basic amino acids, forms a potential natural substrate for CPM. CCL1 plays a role not only in inflammation but also in apoptosis, angiogenesis and tumor biology. Enzymatic processing differently impacts the biological activity of chemokines thereby contributing to the complex regulation of the chemokine system. The aim of the present study was to investigate whether (i) CCL1/I-309 is prone to trimming by CPM, and (ii) the biological activity of CCL1 is altered after C-terminal proteolytic processing. CCL1 was identified as a novel substrate for CPM in vitro using mass spectrometry. C-terminal clipping of CCL1 augmented intracellular calcium release mediated by CCR8 but reduced the binding of CCL1 to CCR8. In line with the higher intracellular calcium release, a pronounced increase of the anti-apoptotic activity of CCL1 was observed in the BW5147 cellular model. CCR8 signaling, CCR8 binding and anti-apoptotic activity were unaffected when CPM was exposed to the carboxypeptidase inhibitor DL-2-mercaptomethyl-3-guanidino-ethylthiopropanoic acid. The results of this study suggest that CPM is a likely candidate for the regulation of biological processes relying on the CCL1-CCR8 system. PMID:22479563

  8. Human β-Defensin 3 [corrected] Exacerbates MDA5 but Suppresses TLR3 Responses to the Viral Molecular Pattern Mimic Polyinosinic:Polycytidylic Acid.

    PubMed

    Semple, Fiona; MacPherson, Heather; Webb, Sheila; Kilanowski, Fiona; Lettice, Laura; McGlasson, Sarah L; Wheeler, Ann P; Chen, Valerie; Millhauser, Glenn L; Melrose, Lauren; Davidson, Donald J; Dorin, Julia R

    2015-12-01

    Human β-defensin 3 (hBD3) is a cationic host defence peptide and is part of the innate immune response. HBD3 is present on a highly copy number variable block of six β-defensin genes, and increased copy number is associated with the autoimmune disease psoriasis. It is not known how this increase influences disease development, but psoriasis is a T cell-mediated disease and activation of the innate immune system is required for the initial trigger that leads to the amplification stage. We investigated the effect of hBD3 on the response of primary macrophages to various TLR agonists. HBD3 exacerbated the production of type I Interferon-β in response to the viral ligand mimic polyinosinic:polycytidylic acid (polyI:C) in both human and mouse primary cells, although production of the chemokine CXCL10 was suppressed. Compared to polyI:C alone, mice injected with both hBD3 peptide and polyI:C also showed an enhanced increase in Interferon-β. Mice expressing a transgene encoding hBD3 had elevated basal levels of Interferon-β, and challenge with polyI:C further increased this response. HBD3 peptide increased uptake of polyI:C by macrophages, however the cellular response and localisation of polyI:C in cells treated contemporaneously with hBD3 or cationic liposome differed. Immunohistochemistry showed that hBD3 and polyI:C do not co-localise, but in the presence of hBD3 less polyI:C localises to the early endosome. Using bone marrow derived macrophages from knockout mice we demonstrate that hBD3 suppresses the polyI:C-induced TLR3 response mediated by TICAM1 (TRIF), while exacerbating the cytoplasmic response through MDA5 (IFIH1) and MAVS (IPS1/CARDIF). Thus, hBD3, a highly copy number variable gene in human, influences cellular responses to the viral mimic polyI:C implying that copy number may have a significant phenotypic effect on the response to viral infection and development of autoimmunity in humans.

  9. Human β-D-3 Exacerbates MDA5 but Suppresses TLR3 Responses to the Viral Molecular Pattern Mimic Polyinosinic:Polycytidylic Acid

    PubMed Central

    Semple, Fiona; MacPherson, Heather; Webb, Sheila; Kilanowski, Fiona; Lettice, Laura; McGlasson, Sarah L.; Wheeler, Ann P.; Chen, Valerie; Millhauser, Glenn L.; Melrose, Lauren; Davidson, Donald J.; Dorin, Julia R.

    2015-01-01

    Human β-defensin 3 (hBD3) is a cationic host defence peptide and is part of the innate immune response. HBD3 is present on a highly copy number variable block of six β-defensin genes, and increased copy number is associated with the autoimmune disease psoriasis. It is not known how this increase influences disease development, but psoriasis is a T cell-mediated disease and activation of the innate immune system is required for the initial trigger that leads to the amplification stage. We investigated the effect of hBD3 on the response of primary macrophages to various TLR agonists. HBD3 exacerbated the production of type I Interferon-β in response to the viral ligand mimic polyinosinic:polycytidylic acid (polyI:C) in both human and mouse primary cells, although production of the chemokine CXCL10 was suppressed. Compared to polyI:C alone, mice injected with both hBD3 peptide and polyI:C also showed an enhanced increase in Interferon-β. Mice expressing a transgene encoding hBD3 had elevated basal levels of Interferon-β, and challenge with polyI:C further increased this response. HBD3 peptide increased uptake of polyI:C by macrophages, however the cellular response and localisation of polyI:C in cells treated contemporaneously with hBD3 or cationic liposome differed. Immunohistochemistry showed that hBD3 and polyI:C do not co-localise, but in the presence of hBD3 less polyI:C localises to the early endosome. Using bone marrow derived macrophages from knockout mice we demonstrate that hBD3 suppresses the polyI:C-induced TLR3 response mediated by TICAM1 (TRIF), while exacerbating the cytoplasmic response through MDA5 (IFIH1) and MAVS (IPS1/CARDIF). Thus, hBD3, a highly copy number variable gene in human, influences cellular responses to the viral mimic polyI:C implying that copy number may have a significant phenotypic effect on the response to viral infection and development of autoimmunity in humans. PMID:26646717

  10. Chemokine scavenger D6 is expressed by trophoblasts and aids the survival of mouse embryos transferred into allogeneic recipients.

    PubMed

    Madigan, Judith; Freeman, Dilys J; Menzies, Fiona; Forrow, Steve; Nelson, Scott M; Young, Anne; Sharkey, Andrew; Moffett, Ashley; Graham, Gerard J; Greer, Ian A; Rot, Antal; Nibbs, Robert J B

    2010-03-15

    Proinflammatory CC chemokines are thought to drive recruitment of maternal leukocytes into gestational tissues and regulate extravillous trophoblast migration. The atypical chemokine receptor D6 binds many of these chemokines and is highly expressed by the human placenta. D6 is thought to act as a chemokine scavenger because, when ectopically expressed in cell lines in vitro, it efficiently internalizes proinflammatory CC chemokines and targets them for destruction in the absence of detectable chemokine-induced signaling. Moreover, D6 suppresses inflammation in many mouse tissues, and notably, D6-deficient fetuses in D6-deficient female mice show increased susceptibility to inflammation-driven resorption. In this paper, we report strong anti-D6 immunoreactivity, with specific intracellular distribution patterns, in trophoblast-derived cells in human placenta, decidua, and gestational membranes throughout pregnancy and in trophoblast disease states of hydatidiform mole and choriocarcinoma. We show, for the first time, that endogenous D6 in a human choriocarcinoma-derived cell line can mediate progressive chemokine scavenging and that the D6 ligand CCL2 can specifically associate with human syncytiotrophoblasts in term placenta in situ. Moreover, despite strong chemokine production by gestational tissues, levels of D6-binding chemokines in maternal plasma decrease during pregnancy, even in women with pre-eclampsia, a disease associated with increased maternal inflammation. In mice, D6 is not required for syngeneic or semiallogeneic fetal survival in unchallenged mice, but interestingly, it does suppress fetal resorption after embryo transfer into fully allogeneic recipients. These data support the view that trophoblast D6 scavenges maternal chemokines at the fetomaternal interface and that, in some circumstances, this can help to ensure fetal survival.

  11. Bis(azido) compounds of Pd and Pt with bulky phosphine ligands (dppn=1,8-bis(diphenylphosphino)naphthalene, dppf=1,1‧-bis(diphenylphosphino)ferrocene, 1-dpn=1-diphenylphosphino-naphthalene): Preparation, structures, and reactivity toward isocyanides

    NASA Astrophysics Data System (ADS)

    Huh, Hyun Sue; Lee, Yeon Kyoung; Lee, Soon W.

    2006-05-01

    Pd-bis(azido) compounds [Pd(dppn)(N 3) 2] and [Pd(dppf)(N 3) 2], which contain bulky chelating bis(phosphine) ligands (dppn=1,8-bis(diphenylphosphino)naphthalene, dppf=1,1'-bis(diphenylphosphino)ferrocene), were prepared from the corresponding chlorides and NaN 3. We also prepared the Pt-bis(azido) compound [Pt(1-dpn)(SMe 2)(N 3) 2] containing a bulky monodentate phosphine (1-dpn=1-diphenylphosphino-naphthalene). All these compounds underwent [2+3] cycloaddition with isocyanides (R-NC, R=cyclohexyl, tert-butyl, 2,6-dimethylphenyl) to convert azido ligands to five-membered, C-coordinated tetrazolate rings. In addition, we observed the [Pd(dppn)Cl 2]-mediated C-C coupling of PhC tbnd6 CH to generate the η 2-PhC tbnd6 C-C tbnd6 CPh ligand. All compounds have been structurally characterized by X-ray diffraction.

  12. A radiogallium-DOTA-based bivalent peptidic ligand targeting a chemokine receptor, CXCR4, for tumor imaging.

    PubMed

    Sano, Kohei; Masuda, Ryo; Hisada, Hayato; Oishi, Shinya; Shimokawa, Kenta; Ono, Masahiro; Fujii, Nobutaka; Saji, Hideo; Mukai, Takahiro

    2014-03-01

    We have developed a novel radiogallium (Ga)-DOTA-based bivalent peptidic ligand targeting a chemokine receptor, CXCR4, for tumor imaging. A CXCR4 imaging probe with two CXCR4 antagonists (Ac-TZ14011) on Ga-DOTA core, Ga-DOTA-TZ2, was synthesized, and the affinity and binding to CXCR4 was evaluated in CXCR4 expressing cells in vitro. The affinity of Ga-DOTA-TZ2 for CXCR4 was 20-fold greater than the corresponding monovalent probe, Ga-DOTA-TZ1. (67)Ga-DOTA-TZ2 showed the significantly higher accumulation in CXCR4-expressing tumor cells compared with (67)Ga-DOTA-TZ1, suggesting the bivalent effect enhances its binding to CXCR4. The incorporation of two CXCR4 antagonists to Ga-DOTA could be effective in detecting CXCR4-expressing tumors. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. LKB1 loss promotes endometrial cancer progression via CCL2-dependent macrophage recruitment.

    PubMed

    Peña, Christopher G; Nakada, Yuji; Saatcioglu, Hatice D; Aloisio, Gina M; Cuevas, Ileana; Zhang, Song; Miller, David S; Lea, Jayanthi S; Wong, Kwok-Kin; DeBerardinis, Ralph J; Amelio, Antonio L; Brekken, Rolf A; Castrillon, Diego H

    2015-11-02

    Endometrial cancer is the most common gynecologic malignancy and the fourth most common malignancy in women. For most patients in whom the disease is confined to the uterus, treatment results in successful remission; however, there are no curative treatments for tumors that have progressed beyond the uterus. The serine/threonine kinase LKB1 has been identified as a potent suppressor of uterine cancer, but the biological modes of action of LKB1 in this context remain incompletely understood. Here, we have shown that LKB1 suppresses tumor progression by altering gene expression in the tumor microenvironment. We determined that LKB1 inactivation results in abnormal, cell-autonomous production of the inflammatory cytokine chemokine (C-C motif) ligand 2 (CCL2) within tumors, which leads to increased recruitment of macrophages with prominent tumor-promoting activities. Inactivation of Ccl2 in an Lkb1-driven mouse model of endometrial cancer slowed tumor progression and increased survival. In human primary endometrial cancers, loss of LKB1 protein was strongly associated with increased CCL2 expression by tumor cells as well as increased macrophage density in the tumor microenvironment. These data demonstrate that CCL2 is a potent effector of LKB1 loss in endometrial cancer, creating potential avenues for therapeutic opportunities.

  14. Prevalence and Risk Factors for Mycobacterium bovis Infection in African Lions ( Panthera leo ) in the Kruger National Park.

    PubMed

    Sylvester, Tashnica Taime; Martin, Laura Elizabeth Rosen; Buss, Peter; Loxton, Andre Gareth; Hausler, Guy Anton; Rossouw, Leana; van Helden, Paul; Parsons, Sven David Charles; Olea-Popelka, Francisco; Miller, Michele Ann

    2017-04-01

    Mycobacterium bovis, the causative agent of bovine tuberculosis (BTB), is endemic in the Kruger National Park (KNP), South Africa. African lions ( Panthera leo ) are susceptible to BTB, but the impact of the disease on lion populations is unknown. In this study, we used a novel gene expression assay for chemokine (C-X-C motif) ligand 9 (CXCL9) to measure the prevalence of M. bovis infection in 70 free-ranging lions that were opportunistically sampled in the southern and central regions of the KNP. In the southern region of the KNP, the apparent prevalence of M. bovis infection was 54% (95% confidence interval [CI]=36.9-70.5%), compared with 33% (95% CI=18.0-51.8%) in the central region, an important difference (P=0.08). Prevalence of M. bovis infection in lions showed similar patterns to estimated BTB prevalence in African buffaloes ( Syncerus caffer ) in the same areas. Investigation of other risk factors showed a trend for older lions, males, or lions with concurrent feline immunodeficiency virus infection to have a higher M. bovis prevalence. Our findings demonstrate that the CXCL9 gene expression assay is a useful tool for the determination of M. bovis status in free-ranging lions and identifies important epidemiologic trends for future studies.

  15. Cerebrospinal fluid monocyte chemoattractant protein-1 in alcoholics: support for a neuroinflammatory model of chronic alcoholism.

    PubMed

    Umhau, John C; Schwandt, Melanie; Solomon, Matthew G; Yuan, Peixiong; Nugent, Allison; Zarate, Carlos A; Drevets, Wayne C; Hall, Samuel D; George, David T; Heilig, Markus

    2014-05-01

    Liver inflammation in alcoholism has been hypothesized to influence the development of a neuroinflammatory process in the brain characterized by neurodegeneration and altered cognitive function. Monocyte chemoattractant protein-1/chemokine (C-C motif) ligand 2 (MCP-1/CCL2) elevations have been noted in the alcoholic brain at autopsy and may have a role in this process. We studied cerebrospinal fluid (CSF) levels of MCP-1 as well as interleukin-1β and tumor necrosis factor-α in 13 healthy volunteers and 28 alcoholics during weeks 1 and 4 following detoxification. Serum liver enzymes were obtained as markers of alcohol-related liver inflammation. Compared to healthy volunteers, MCP-1 levels were significantly higher in alcoholics both on day 4 and day 25 (p < 0.0001). Using multiple regression analysis, we found that MCP-1 concentrations were positively associated with the liver enzymes gamma glutamyltransferase (GGT; p = 0.03) and aspartate aminotransferase/glutamic oxaloacetic transaminase (AST/GOT; p = 0.004). These preliminary findings are consistent with the hypothesis that neuroinflammation as indexed by CSF MCP-1 is associated with alcohol-induced liver inflammation, as defined by peripheral concentrations of GGT and AST/GOT. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  16. Inhibition of G0/G1 Switch 2 Ameliorates Renal Inflammation in Chronic Kidney Disease.

    PubMed

    Matsunaga, Naoya; Ikeda, Eriko; Kakimoto, Keisuke; Watanabe, Miyako; Shindo, Naoya; Tsuruta, Akito; Ikeyama, Hisako; Hamamura, Kengo; Higashi, Kazuhiro; Yamashita, Tomohiro; Kondo, Hideaki; Yoshida, Yuya; Matsuda, Masaki; Ogino, Takashi; Tokushige, Kazutaka; Itcho, Kazufumi; Furuichi, Yoko; Nakao, Takaharu; Yasuda, Kaori; Doi, Atsushi; Amamoto, Toshiaki; Aramaki, Hironori; Tsuda, Makoto; Inoue, Kazuhide; Ojida, Akio; Koyanagi, Satoru; Ohdo, Shigehiro

    2016-11-01

    Chronic kidney disease (CKD) is a global health problem, and novel therapies to treat CKD are urgently needed. Here, we show that inhibition of G 0 /G 1 switch 2 (G0s2) ameliorates renal inflammation in a mouse model of CKD. Renal expression of chemokine (C-C motif) ligand 2 (Ccl2) was increased in response to p65 activation in the kidneys of wild-type 5/6 nephrectomy (5/6Nx) mice. Moreover, 5/6Nx Clk/Clk mice, which carry homozygous mutations in the gene encoding circadian locomotor output cycles kaput (CLOCK), did not exhibit aggravation of apoptosis or induction of F4/80-positive cells. The renal expression of G0s2 in wild-type 5/6Nx mice was important for the transactivation of Ccl2 by p65. These pathologies were ameliorated by G0s2 knockdown. Furthermore, a novel small-molecule inhibitor of G0s2 expression was identified by high-throughput chemical screening, and the inhibitor suppressed renal inflammation in 5/6Nx mice. These findings indicated that G0s2 inhibitors may have applications in the treatment of CKD. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  17. AGEs and HMGB1 Increase Inflammatory Cytokine Production from Human Placental Cells, Resulting in an Enhancement of Monocyte Migration.

    PubMed

    Shirasuna, Koumei; Seno, Kotomi; Ohtsu, Ayaka; Shiratsuki, Shogo; Ohkuchi, Akihide; Suzuki, Hirotada; Matsubara, Shigeki; Nagayama, Shiho; Iwata, Hisataka; Kuwayama, Takehito

    2016-05-01

    Advanced glycation end products (AGEs) and high-mobility group box-1 (HMGB1) are considered contributing to placental inflammation. We examined the effect of AGEs and HMGB1 on cytokines from Sw.71 human trophoblast cell lines and the interactions between Sw.71 cells and THP-1-monocytes. Sw.71 cells were cultured with/without AGEs or HMGB1. We examined the role of AGEs or HMGB1 on THP1 migration and effect of AGEs on IL-6 from Sw.71 cells using co-cultures or conditioned medium from THP-1 cells. AGEs and HMGB1 increased interleukin (IL)-6, IL-8, and chemokine C-C motif ligand 2 (CCL2) secretion from Sw.71 cells. The secretion of IL-6 was dependent on reactive oxygen species (ROS) and NF-κB. AGEs stimulated IL-6 secretion through receptor RAGE and TLR4, whereas HMGB1 stimulated it through TLR4. AGEs, but not HMGB1, increased monocyte migration via IL-8 and CCL2 from Sw.71 cells. THP-1 monocytes induced IL-6 secretion from Sw.71 cells, and AGEs further stimulated it. AGEs and HMGB1 may promote sterile placental inflammation cooperating with monocytes/macrophages. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. SLM produced porous titanium implant improvements for enhanced vascularization and osteoblast seeding.

    PubMed

    Matena, Julia; Petersen, Svea; Gieseke, Matthias; Kampmann, Andreas; Teske, Michael; Beyerbach, Martin; Murua Escobar, Hugo; Haferkamp, Heinz; Gellrich, Nils-Claudius; Nolte, Ingo

    2015-04-02

    To improve well-known titanium implants, pores can be used for increasing bone formation and close bone-implant interface. Selective Laser Melting (SLM) enables the production of any geometry and was used for implant production with 250-µm pore size. The used pore size supports vessel ingrowth, as bone formation is strongly dependent on fast vascularization. Additionally, proangiogenic factors promote implant vascularization. To functionalize the titanium with proangiogenic factors, polycaprolactone (PCL) coating can be used. The following proangiogenic factors were examined: vascular endothelial growth factor (VEGF), high mobility group box 1 (HMGB1) and chemokine (C-X-C motif) ligand 12 (CXCL12). As different surfaces lead to different cell reactions, titanium and PCL coating were compared. The growing into the porous titanium structure of primary osteoblasts was examined by cross sections. Primary osteoblasts seeded on the different surfaces were compared using Live Cell Imaging (LCI). Cross sections showed cells had proliferated, but not migrated after seven days. Although the cell count was lower on titanium PCL implants in LCI, the cell count and cell spreading area development showed promising results for titanium PCL implants. HMGB1 showed the highest migration capacity for stimulating the endothelial cell line. Future perspective would be the incorporation of HMGB1 into PCL polymer for the realization of a slow factor release.

  19. Megakaryocytes regulate hematopoietic stem cell quiescence via Cxcl4 secretion

    PubMed Central

    Bruns, Ingmar; Lucas, Daniel; Pinho, Sandra; Ahmed, Jalal; Lambert, Michele P.; Kunisaki, Yuya; Scheiermann, Christoph; Schiff, Lauren; Poncz, Mortimer; Bergman, Aviv; Frenette, Paul S.

    2014-01-01

    In the bone marrow (BM), hematopoietic stem cells (HSCs) lodge in specialized microenvironments that tightly control their proliferative state to adapt to the varying needs for replenishment of blood cells while also preventing exhaustion1. All putative niche cells suggested thus far have a non-hematopoietic origin2-8. Thus, it remains unclear how feedback from mature cells is conveyed to HSCs to adjust proliferation. Here we show that megakaryocytes (Mk) can directly regulate HSC pool size. Three-dimensional whole-mount imaging revealed that endogenous HSCs are frequently located adjacent to Mk in a non-random fashion. Selective in vivo depletion of Mk resulted in specific loss of HSC quiescence and led to a marked expansion of functional HSCs. Gene expression analyses revealed that Mk were the source of chemokine C-X-C motif ligand 4 (Cxcl4, also named platelet factor 4, Pf4) in the BM and Cxcl4 injection reduced HSC numbers via increased quiescence. By contrast, Cxcl4−/− mice exhibited increased HSC numbers and proliferation. Combined use of whole-mount imaging and computational modelling was highly suggestive of a megakaryocytic niche capable of influencing independently HSC maintenance by regulating quiescence. Thus, these results indicate that a terminally differentiated HSC progeny contributes to niche activity by directly regulating HSC behavior. PMID:25326802

  20. Prevention of inflammation-mediated bone loss in murine and canine periodontal disease via recruitment of regulatory lymphocytes.

    PubMed

    Glowacki, Andrew J; Yoshizawa, Sayuri; Jhunjhunwala, Siddharth; Vieira, Andreia E; Garlet, Gustavo P; Sfeir, Charles; Little, Steven R

    2013-11-12

    The hallmark of periodontal disease is the progressive destruction of gingival soft tissue and alveolar bone, which is initiated by inflammation in response to an invasive and persistent bacterial insult. In recent years, it has become apparent that this tissue destruction is associated with a decrease in local regulatory processes, including a decrease of forkhead box P3-expressing regulatory lymphocytes. Accordingly, we developed a controlled release system capable of generating a steady release of a known chemoattractant for regulatory lymphocytes, C-C motif chemokine ligand 22 (CCL22), composed of a degradable polymer with a proven track record of clinical translation, poly(lactic-co-glycolic) acid. We have previously shown that this sustained presentation of CCL22 from a point source effectively recruits regulatory T cells (Tregs) to the site of injection. Following administration of the Treg-recruiting formulation to the gingivae in murine experimental periodontitis, we observed increases in hallmark Treg-associated anti-inflammatory molecules, a decrease of proinflammatory cytokines, and a marked reduction in alveolar bone resorption. Furthermore, application of the Treg-recruiting formulation (fabricated with human CCL22) in ligature-induced periodontitis in beagle dogs leads to reduced clinical measures of inflammation and less alveolar bone loss under severe inflammatory conditions in the presence of a diverse periodontopathogen milieu.

  1. Vx-809/Vx-770 treatment reduces inflammatory response to Pseudomonas aeruginosa in primary differentiated cystic fibrosis bronchial epithelial cells.

    PubMed

    Ruffin, Manon; Roussel, Lucie; Maillé, Émilie; Rousseau, Simon; Brochiero, Emmanuelle

    2018-04-01

    Cystic fibrosis patients exhibit chronic Pseudomonas aeruginosa respiratory infections and sustained proinflammatory state favoring lung tissue damage and remodeling, ultimately leading to respiratory failure. Loss of cystic fibrosis transmembrane conductance regulator (CFTR) function is associated with MAPK hyperactivation and increased cytokines expression, such as interleukin-8 [chemoattractant chemokine (C-X-C motif) ligand 8 (CXCL8)]. Recently, new therapeutic strategies directly targeting the basic CFTR defect have been developed, and ORKAMBI (Vx-809/Vx-770 combination) is the only Food and Drug Administration-approved treatment for CF patients homozygous for the F508del mutation. Here we aimed to determine the effect of the Vx-809/Vx-770 combination on the induction of the inflammatory response by fully differentiated primary bronchial epithelial cell cultures from CF patients carrying F508del mutations, following exposure to P. aeruginosa exoproducts. Our data unveiled that CFTR functional rescue with Vx-809/Vx-770 drastically reduces CXCL8 (as well as CXCL1 and CXCL2) transcripts and p38 MAPK phosphorylation in response to P. aeruginosa exposure through a CFTR-dependent mechanism. These results suggest that ORKAMBI has anti-inflammatory properties that could decrease lung inflammation and contribute to the observed beneficial impact of this treatment in CF patients.

  2. Reovirus-Mediated Cytotoxicity and Enhancement of Innate Immune Responses Against Acute Myeloid Leukemia

    PubMed Central

    Hall, Kathryn; Scott, Karen J.; Rose, Ailsa; Desborough, Michael; Harrington, Kevin; Pandha, Hardev; Parrish, Christopher; Vile, Richard; Coffey, Matt; Bowen, David; Errington-Mais, Fiona

    2012-01-01

    Abstract Reovirus is a naturally occurring oncolytic virus that has shown preclinical efficacy in the treatment of a wide range of tumor types and has now reached phase III testing in clinical trials. The anti-cancer activity of reovirus has been attributed to both its direct oncolytic activity and the enhancement of anti-tumor immune responses. In this study, we have investigated the direct effect of reovirus on acute myeloid leukemia (AML) cells and its potential to enhance innate immune responses against AML, including the testing of primary samples from patients. Reovirus was found to replicate in and kill AML cell lines, and to reduce cell viability in primary AML samples. The pro-inflammatory cytokine interferon alpha (IFNα) and the chemokine (C-C motif) ligand 5 (known as RANTES [regulated upon activation, normal T-cell expressed, and secreted]) were also secreted from AML cells in response to virus treatment. In addition, reovirus-mediated activation of natural killer (NK) cells, within the context of peripheral blood mononuclear cells, stimulated their anti-leukemia response, with increased NK degranulation and IFNγ production and enhanced killing of AML targets. These data suggest that reovirus has the potential as both a direct cytotoxic and an immunotherapeutic agent for the treatment of AML. PMID:23515241

  3. Genome-wide Association Study of Dermatomyositis Reveals Genetic Overlap with other Autoimmune Disorders

    PubMed Central

    Miller, Frederick W.; Cooper, Robert G.; Vencovsky, Jiri; Rider, Lisa G.; Danko, Katalin; Wedderburn, Lucy R.; Lundberg, Ingrid E.; Pachman, Lauren M.; Reed, Ann M.; Ytterberg, Steven R.; Padyukov, Leonid; Selva-O’Callaghan, Albert; Radstake, Timothy; Isenberg, David A.; Chinoy, Hector; Ollier, William E. R.; O’Hanlon, Terrance P.; Peng, Bo; Lee, Annette; Lamb, Janine A.; Chen, Wei; Amos, Christopher I.; Gregersen, Peter K.

    2014-01-01

    Objective To identify new genetic associations with juvenile and adult dermatomyositis (DM). Methods We performed a genome-wide association study (GWAS) of adult and juvenile DM patients of European ancestry (n = 1178) and controls (n = 4724). To assess genetic overlap with other autoimmune disorders, we examined whether 141 single nucleotide polymorphisms (SNPs) outside the major histocompatibility complex (MHC) locus, and previously associated with autoimmune diseases, predispose to DM. Results Compared to controls, patients with DM had a strong signal in the MHC region consisting of GWAS-level significance (P < 5x10−8) at 80 genotyped SNPs. An analysis of 141 non-MHC SNPs previously associated with autoimmune diseases showed that three SNPs linked with three genes were associated with DM, with a false discovery rate (FDR) < 0.05. These genes were phospholipase C like 1 (PLCL1, rs6738825, FDR=0.00089), B lymphoid tyrosine kinase (BLK, rs2736340, FDR=0.00031), and chemokine (C-C motif) ligand 21 (CCL21, rs951005, FDR=0.0076). None of these genes was previously reported to be associated with DM. Conclusion Our findings confirm the MHC as the major genetic region associated with DM and indicate that DM shares non-MHC genetic features with other autoimmune diseases, suggesting the presence of additional novel risk loci. This first identification of autoimmune disease genetic predispositions shared with DM may lead to enhanced understanding of pathogenesis and novel diagnostic and therapeutic approaches. PMID:23983088

  4. Europium-Labeled Synthetic C3a Protein as a Novel Fluorescent Probe for Human Complement C3a Receptor.

    PubMed

    Dantas de Araujo, Aline; Wu, Chongyang; Wu, Kai-Chen; Reid, Robert C; Durek, Thomas; Lim, Junxian; Fairlie, David P

    2017-06-21

    Measuring ligand affinity for a G protein-coupled receptor is often a crucial step in drug discovery. It has been traditionally determined by binding putative new ligands in competition with native ligand labeled with a radioisotope of finite lifetime. Competing instead with a lanthanide-based fluorescent ligand is more attractive due to greater longevity, stability, and safety. Here, we have chemically synthesized the 77 residue human C3a protein and conjugated its N-terminus to europium diethylenetriaminepentaacetate to produce a novel fluorescent protein (Eu-DTPA-hC3a). Time-resolved fluorescence analysis has demonstrated that Eu-DTPA-hC3a binds selectively to its cognate G protein-coupled receptor C3aR with full agonist activity and similar potency and selectivity as native C3a in inducing calcium mobilization and phosphorylation of extracellular signal-regulated kinases in HEK293 cells that stably expressed C3aR. Time-resolved fluorescence analysis for saturation and competitive binding gave a dissociation constant (K d ) of 8.7 ± 1.4 nM for Eu-DTPA-hC3a and binding affinities for hC3a (pK i of 8.6 ± 0.2 and K i of 2.5 nM) and C3aR ligands TR16 (pK i of 6.8 ± 0.1 and K i of 138 nM), BR103 (pK i of 6.7 ± 0.1 and K i of 185 nM), BR111 (pK i of 6.3 ± 0.2 and K i of 544 nM) and SB290157 (pK i of 6.3 ± 0.1 and K i of 517 nM) via displacement of Eu-DTPA-hC3a from hC3aR. The macromolecular conjugate Eu-DTPA-hC3a is a novel nonradioactive probe suitable for studying ligand-C3aR interactions with potential value in accelerating drug development for human C3aR in physiology and disease.

  5. Coadministration of Hedera helix L. Extract Enabled Mice to Overcome Insufficient Protection against Influenza A/PR/8 Virus Infection under Suboptimal Treatment with Oseltamivir

    PubMed Central

    Shim, Aeri; Lee, Bo-Ra; Kwon, Bo-Eun; Song, Hyuk-Hwan; Kim, Yeon-Jeong; Chang, Sun-Young; Jeong, Hyeon Gun; Kim, Jong Geal; Seo, Sang-Uk; Kim, HyunPyo; Kwon, YongSoo; Ko, Hyun-Jeong

    2015-01-01

    Several anti-influenza drugs that reduce disease manifestation exist, and although these drugs provide clinical benefits in infected patients, their efficacy is limited by the emergence of drug-resistant influenza viruses. In the current study, we assessed the therapeutic strategy of enhancing the antiviral efficacy of an existing neuraminidase inhibitor, oseltamivir, by coadministering with the leaf extract from Hedera helix L, commonly known as ivy. Ivy extract has anti-inflammatory, antibacterial, antifungal, and antihelminthic properties. In the present study, we investigated its potential antiviral properties against influenza A/PR/8 (PR8) virus in a mouse model with suboptimal oseltamivir that mimics a poor clinical response to antiviral drug treatment. Suboptimal oseltamivir resulted in insufficient protection against PR8 infection. Oral administration of ivy extract with suboptimal oseltamivir increased the antiviral activity of oseltamivir. Ivy extract and its compounds, particularly hedrasaponin F, significantly reduced the cytopathic effect in PR8-infected A549 cells in the presence of oseltamivir. Compared with oseltamivir treatment alone, coadministration of the fraction of ivy extract that contained the highest proportion of hedrasaponin F with oseltamivir decreased pulmonary inflammation in PR8-infected mice. Inflammatory cytokines and chemokines, including tumor necrosis factor-alpha and chemokine (C-C motif) ligand 2, were reduced by treatment with oseltamivir and the fraction of ivy extract. Analysis of inflammatory cell infiltration in the bronchial alveolar of PR8-infected mice revealed that CD11b+Ly6G+ and CD11b+Ly6Cint cells were recruited after virus infection; coadministration of the ivy extract fraction with oseltamivir reduced infiltration of these inflammatory cells. In a model of suboptimal oseltamivir treatment, coadministration of ivy extract fraction that includes hedrasaponin F increased protection against PR8 infection that could be explained by its antiviral and anti-inflammatory activities. PMID:26098681

  6. Coadministration of Hedera helix L. Extract Enabled Mice to Overcome Insufficient Protection against Influenza A/PR/8 Virus Infection under Suboptimal Treatment with Oseltamivir.

    PubMed

    Hong, Eun-Hye; Song, Jae-Hyoung; Shim, Aeri; Lee, Bo-Ra; Kwon, Bo-Eun; Song, Hyuk-Hwan; Kim, Yeon-Jeong; Chang, Sun-Young; Jeong, Hyeon Gun; Kim, Jong Geal; Seo, Sang-Uk; Kim, HyunPyo; Kwon, YongSoo; Ko, Hyun-Jeong

    2015-01-01

    Several anti-influenza drugs that reduce disease manifestation exist, and although these drugs provide clinical benefits in infected patients, their efficacy is limited by the emergence of drug-resistant influenza viruses. In the current study, we assessed the therapeutic strategy of enhancing the antiviral efficacy of an existing neuraminidase inhibitor, oseltamivir, by coadministering with the leaf extract from Hedera helix L, commonly known as ivy. Ivy extract has anti-inflammatory, antibacterial, antifungal, and antihelminthic properties. In the present study, we investigated its potential antiviral properties against influenza A/PR/8 (PR8) virus in a mouse model with suboptimal oseltamivir that mimics a poor clinical response to antiviral drug treatment. Suboptimal oseltamivir resulted in insufficient protection against PR8 infection. Oral administration of ivy extract with suboptimal oseltamivir increased the antiviral activity of oseltamivir. Ivy extract and its compounds, particularly hedrasaponin F, significantly reduced the cytopathic effect in PR8-infected A549 cells in the presence of oseltamivir. Compared with oseltamivir treatment alone, coadministration of the fraction of ivy extract that contained the highest proportion of hedrasaponin F with oseltamivir decreased pulmonary inflammation in PR8-infected mice. Inflammatory cytokines and chemokines, including tumor necrosis factor-alpha and chemokine (C-C motif) ligand 2, were reduced by treatment with oseltamivir and the fraction of ivy extract. Analysis of inflammatory cell infiltration in the bronchial alveolar of PR8-infected mice revealed that CD11b+Ly6G+ and CD11b+Ly6Cint cells were recruited after virus infection; coadministration of the ivy extract fraction with oseltamivir reduced infiltration of these inflammatory cells. In a model of suboptimal oseltamivir treatment, coadministration of ivy extract fraction that includes hedrasaponin F increased protection against PR8 infection that could be explained by its antiviral and anti-inflammatory activities.

  7. Implication of Interleukin-12/15/18 and Ruxolitinib in the Phenotype, Proliferation, and Polyfunctionality of Human Cytokine-Preactivated Natural Killer Cells.

    PubMed

    Terrén, Iñigo; Mikelez, Idoia; Odriozola, Irati; Gredilla, Andrea; González, Javier; Orrantia, Ane; Vitallé, Joana; Zenarruzabeitia, Olatz; Borrego, Francisco

    2018-01-01

    A brief in vitro stimulation of natural killer (NK) cells with interleukin (IL)-12, IL-15, and IL-18 endow them a memory-like behavior, characterized by higher effector responses when they are restimulated after a resting period of time. These preactivated NK cells, also known as cytokine-induced memory-like (CIML) NK cells, have several properties that make them a promising tool in cancer immunotherapy. In the present study, we have described the effect that different combinations of IL-12, IL-15, and IL-18 have on the generation of human CIML NK cells. Our data points to a major contribution of IL-15 to CIML NK cell-mediated cytotoxicity against target cells. However, the synergistic effect of the three cytokines grant them the best polyfunctional profile, that is, cells that simultaneously degranulate (CD107a) and produce multiple cytokines and chemokines such as interferon γ, tumor necrosis factor α, and C-C motif chemokine ligand 3. We have also analyzed the involvement of each cytokine and their combinations in the expression of homing receptors CXCR4 and CD62L, as well as the expression of CD25 and IL-2-induced proliferation. Furthermore, we have tested the effects of the Jak1/2 inhibitor ruxolitinib in the generation of CIML NK cells. We found that ruxolitinib-treated CIML NK cells expressed lower levels of CD25 than non-treated CIML NK cells, but exhibited similar proliferation in response to IL-2. In addition, we have also found that ruxolitinib-treated NK cells displayed reduced effector functions after the preactivation, which can be recovered after a 4 days expansion phase in the presence of low doses of IL-2. Altogether, our results describe the impact that each cytokine and the Jak1/2 pathway have in the phenotype, IL-2-induced proliferation, and effector functions of human CIML NK cells.

  8. CSF CXCL10, CXCL9, and Neopterin as Candidate Prognostic Biomarkers for HTLV-1-Associated Myelopathy/Tropical Spastic Paraparesis

    PubMed Central

    Sato, Tomoo; Coler-Reilly, Ariella; Utsunomiya, Atae; Araya, Natsumi; Yagishita, Naoko; Ando, Hitoshi; Yamauchi, Junji; Inoue, Eisuke; Ueno, Takahiko; Hasegawa, Yasuhiro; Nishioka, Kusuki; Nakajima, Toshihiro; Jacobson, Steven; Izumo, Shuji; Yamano, Yoshihisa

    2013-01-01

    Background Human T-lymphotropic virus type 1 (HTLV-1) -associated myelopathy/tropical spastic paraparesis (HAM/TSP) is a rare chronic neuroinflammatory disease. Since the disease course of HAM/TSP varies among patients, there is a dire need for biomarkers capable of predicting the rate of disease progression. However, there have been no studies to date that have compared the prognostic values of multiple potential biomarkers for HAM/TSP. Methodology/Principal Findings Peripheral blood and cerebrospinal fluid (CSF) samples from HAM/TSP patients and HTLV-1-infected control subjects were obtained and tested retrospectively for several potential biomarkers, including chemokines and other cytokines, and nine optimal candidates were selected based on receiver operating characteristic (ROC) analysis. Next, we evaluated the relationship between these candidates and the rate of disease progression in HAM/TSP patients, beginning with a first cohort of 30 patients (Training Set) and proceeding to a second cohort of 23 patients (Test Set). We defined “deteriorating HAM/TSP” as distinctly worsening function (≥3 grades on Osame's Motor Disability Score (OMDS)) over four years and “stable HAM/TSP” as unchanged or only slightly worsened function (1 grade on OMDS) over four years, and we compared the levels of the candidate biomarkers in patients divided into these two groups. The CSF levels of chemokine (C-X-C motif) ligand 10 (CXCL10), CXCL9, and neopterin were well-correlated with disease progression, better even than HTLV-1 proviral load in PBMCs. Importantly, these results were validated using the Test Set. Conclusions/Significance As the CSF levels of CXCL10, CXCL9, and neopterin were the most strongly correlated with rate of disease progression, they represent the most viable candidates for HAM/TSP prognostic biomarkers. The identification of effective prognostic biomarkers could lead to earlier detection of high-risk patients, more patient-specific treatment options, and more productive clinical trials. PMID:24130912

  9. Primed Mycobacterial Uveitis (PMU): Histologic and Cytokine Characterization of a Model of Uveitis in Rats

    PubMed Central

    Pepple, Kathryn L.; Rotkis, Lauren; Van Grol, Jennifer; Wilson, Leslie; Sandt, Angela; Lam, Deborah L.; Carlson, Eric; Van Gelder, Russell N.

    2015-01-01

    Purpose The purpose of this study was to compare the histologic features and cytokine profiles of experimental autoimmune uveitis (EAU) and a primed mycobacterial uveitis (PMU) model in rats. Methods In Lewis rats, EAU was induced by immunization with interphotoreceptor binding protein peptide, and PMU was induced by immunization with a killed mycobacterial extract followed by intravitreal injection of the same extract. Clinical course, histology, and the cytokine profiles of the aqueous and vitreous were compared using multiplex bead fluorescence immunoassays. Results Primed mycobacterial uveitis generates inflammation 2 days after intravitreal injection and resolves spontaneously 14 days later. CD68+ lymphocytes are the predominant infiltrating cells and are found in the anterior chamber, surrounding the ciliary body and in the vitreous. In contrast to EAU, no choroidal infiltration or retinal destruction is noted. At the day of peak inflammation, C-X-C motif ligand 10 (CXCL10), IL-1β, IL-18, and leptin were induced in the aqueous of both models. Interleukin-6 was induced 2-fold in the aqueous of PMU but not EAU. Cytokines elevated in the aqueous of EAU exclusively include regulated on activation, normal T cell expressed and secreted (RANTES), lipopolysaccharide-induced CXC chemokine (LIX), growth-related oncogene/keratinocyte chemokine (GRO/KC), VEGF, monocyte chemoattractant protein-1 (MCP-1), macrophage inflammatory protein-1α (MIP-1α), and IL-17A. In the vitreous, CXCL10, GRO/KC, RANTES, and MIP-1α were elevated in both models. Interleukin-17A and IL-18 were elevated exclusively in EAU. Conclusions Primed mycobacterial uveitis generates an acute anterior and intermediate uveitis without retinal involvement. Primed mycobacterial uveitis has a distinct proinflammatory cytokine profile compared with EAU, suggesting PMU is a good complementary model for study of immune-mediated uveitis. CXCL10, a proinflammatory cytokine, was increased in the aqueous and vitreous of both models and may be a viable therapeutic target. PMID:26747775

  10. Primed Mycobacterial Uveitis (PMU): Histologic and Cytokine Characterization of a Model of Uveitis in Rats.

    PubMed

    Pepple, Kathryn L; Rotkis, Lauren; Van Grol, Jennifer; Wilson, Leslie; Sandt, Angela; Lam, Deborah L; Carlson, Eric; Van Gelder, Russell N

    2015-12-01

    The purpose of this study was to compare the histologic features and cytokine profiles of experimental autoimmune uveitis (EAU) and a primed mycobacterial uveitis (PMU) model in rats. In Lewis rats, EAU was induced by immunization with interphotoreceptor binding protein peptide, and PMU was induced by immunization with a killed mycobacterial extract followed by intravitreal injection of the same extract. Clinical course, histology, and the cytokine profiles of the aqueous and vitreous were compared using multiplex bead fluorescence immunoassays. Primed mycobacterial uveitis generates inflammation 2 days after intravitreal injection and resolves spontaneously 14 days later. CD68+ lymphocytes are the predominant infiltrating cells and are found in the anterior chamber, surrounding the ciliary body and in the vitreous. In contrast to EAU, no choroidal infiltration or retinal destruction is noted. At the day of peak inflammation, C-X-C motif ligand 10 (CXCL10), IL-1β, IL-18, and leptin were induced in the aqueous of both models. Interleukin-6 was induced 2-fold in the aqueous of PMU but not EAU. Cytokines elevated in the aqueous of EAU exclusively include regulated on activation, normal T cell expressed and secreted (RANTES), lipopolysaccharide-induced CXC chemokine (LIX), growth-related oncogene/keratinocyte chemokine (GRO/KC), VEGF, monocyte chemoattractant protein-1 (MCP-1), macrophage inflammatory protein-1α (MIP-1α), and IL-17A. In the vitreous, CXCL10, GRO/KC, RANTES, and MIP-1α were elevated in both models. Interleukin-17A and IL-18 were elevated exclusively in EAU. Primed mycobacterial uveitis generates an acute anterior and intermediate uveitis without retinal involvement. Primed mycobacterial uveitis has a distinct proinflammatory cytokine profile compared with EAU, suggesting PMU is a good complementary model for study of immune-mediated uveitis. CXCL10, a proinflammatory cytokine, was increased in the aqueous and vitreous of both models and may be a viable therapeutic target.

  11. Adeno Associated Viral-mediated intraosseus labeling of bone marrow derived cells for CNS tracking

    PubMed Central

    Selenica, Maj-Linda B.; Reid, Patrick; Pena, Gabriela; Alvarez, Jennifer; Hunt, Jerry B.; Nash, Kevin R.; Morgan, Dave; Gordon, Marcia N.; Lee, Daniel C.

    2016-01-01

    Inflammation, including microglial activation in the CNS, is an important hallmark in many neurodegenerative diseases. Microglial stimuli not only impact the brain microenvironment by production and release of cytokines and chemokines, but also influence the activity of bone marrow derived cells and blood born macrophage populations. In many diseases including brain disorders and spinal cord injury, researchers have tried to harbor the neuroprotective and repair properties of these subpopulations. Hematopoietic bone marrow derived cells (BMDCs) are of great interest, especially during gene therapy because certain hematopoietic cell subpopulations traffic to the sites of injury and inflammation. The aim of this study was to develop a method of labeling endogenous bone marrow derived cells through intraosseus impregnation of recombinant adeno-associated virus (rAAV) or lentivirus. We utilized rAAV serotype 9 (rAAV-9) or lentivirus for gene delivery of green florescence protein (GFP) to the mouse bone marrow cells. Flow cytometry showed that both viruses were able to efficiently transduce mouse bone marrow cells in vivo. However, the rAAV9–GFP viral construct transduced BMDCs more efficiently than the lentivirus (11.2% vs. 6.8%), as indicated by cellular GFP expression. We also demonstrate that GFP labeled cells correspond to bone marrow cells of myeloid origin using CD11b as a marker. Additionally, we characterized the ability of bone marrow derived, GFP labeled cells to extravasate into the brain parenchyma upon acute and subchronic neuroinflammatory stimuli in the mouse CNS. Viral mediated over expression of chemokine (C-C motif) ligand 2 (CCL2) or intracranial injection of lipopolysaccharide (LPS) recruited GFP labeled BMDCs from the periphery into the brain parenchyma compared to vehicle treated mice. Altogether our findings demonstrate a useful method of labeling endogenous BMDCs via viral transduction and the ability to track subpopulations throughout the body following insult or injury. Alternatively, this method might find utility in delivering therapeutic genes for neuroinflammatory conditions. PMID:26784524

  12. Analysis of nucleoside-binding proteins by ligand-specific elution from dye resin: application to Mycobacterium tuberculosis aldehyde dehydrogenases.

    PubMed

    Kim, Chang-Yub; Webster, Cecelia; Roberts, Justin K M; Moon, Jin Ho; Alipio Lyon, Emily Z; Kim, Heungbok; Yu, Minmin; Hung, Li-Wei; Terwilliger, Thomas C

    2009-12-01

    We show that Cibacron Blue F3GA dye resin chromatography can be used to identify ligands that specifically interact with proteins from Mycobacterium tuberculosis, and that the identification of these ligands can facilitate structure determination by enhancing the quality of crystals. Four native Mtb proteins of the aldehyde dehydrogenase (ALDH) family were previously shown to be specifically eluted from a Cibacron Blue F3GA dye resin with nucleosides. In this study we characterized the nucleoside-binding specificity of one of these ALDH isozymes (recombinant Mtb Rv0223c) and compared these biochemical results with co-crystallization experiments with different Rv0223c-nucleoside pairings. We found that the strongly interacting ligands (NAD and NADH) aided formation of high-quality crystals, permitting solution of the first Mtb ALDH (Rv0223c) structure. Other nucleoside ligands (AMP, FAD, adenosine, GTP and NADP) exhibited weaker binding to Rv0223c, and produced co-crystals diffracting to lower resolution. Difference electron density maps based on crystals of Rv0223c with various nucleoside ligands show most share the binding site where the natural ligand NAD binds. From the high degree of similarity of sequence and structure compared to human mitochondrial ALDH-2 (BLAST Z-score = 53.5 and RMSD = 1.5 A), Rv0223c appears to belong to the ALDH-2 class. An altered oligomerization domain in the Rv0223c structure seems to keep this protein as monomer whereas native human ALDH-2 is a multimer.

  13. Critical role in CXCR4 signaling and internalization of the polypeptide main chain in the amino terminus of SDF-1α probed by novel N-methylated synthetically and modularly modified chemokine analogues.

    PubMed

    Dong, Chang-Zhi; Tian, Shaomin; Choi, Won-Tak; Kumar, Santhosh; Liu, Dongxiang; Xu, Yan; Han, Xiaofeng; Huang, Ziwei; An, Jing

    2012-07-31

    The replication of human immunodeficiency virus type 1 (HIV-1) can be profoundly inhibited by the natural ligands of two major HIV-1 coreceptors, CXCR4 and CCR5. Stromal cell-derived factor-1α (SDF-1α) is a natural ligand of CXCR4. We have recently developed a synthetic biology approach of using synthetically and modularly modified (SMM)-chemokines to dissect various aspects of the structure-function relationship of chemokines and their receptors. Here, we used this approach to design novel SMM-SDF-1α analogues containing unnatural N-methylated residues in the amino terminus to investigate whether the polypeptide main chain amide bonds in the N-terminus of SDF-1α play a role in SDF-1α signaling via CXCR4 and/or receptor internalization. The results show that SDF-1α analogues with a modified N-methylated main chain at position 2, 3, or 5 retain significant CXCR4 binding and yet completely lose signaling activities. Furthermore, a representative N-methylated analogue has been shown to be incapable of causing CXCR4 internalization. These results suggest that the ability of SDF-1α to activate CXCR4 signaling and internalization is dependent upon the main chain amide bonds in the N-terminus of SDF-1α. This study demonstrates the feasibility and value of applying a synthetic biology approach to chemically engineer natural proteins and peptide ligands as probes of important biological functions that are not addressed by other biological techniques.

  14. Overexpression of chemokine receptor CXCR2 and ligand CXCL7 in liver metastases from colon cancer is correlated to shorter disease-free and overall survival

    PubMed Central

    Desurmont, Thibault; Skrypek, Nicolas; Duhamel, Alain; Jonckheere, Nicolas; Millet, Guillaume; Leteurtre, Emmanuelle; Gosset, Pierre; Duchene, Belinda; Ramdane, Nassima; Hebbar, Mohamed; Van Seuningen, Isabelle; Pruvot, François-René; Huet, Guillemette; Truant, Stéphanie

    2015-01-01

    Our aim was to analyze the potential role of chemokine receptors CXCR2 and CXCR4 signalling pathways in liver metastatic colorectal cancer (CRC) relapse. CXCR2, CXCR4, and their chemokine ligands were evaluated in liver metastases of colorectal cancer in order to study their correlation with overall and disease-free survival of patients having received, or not received, a neoadjuvant chemotherapy regimen. Quantitative RT-PCR and CXCR2 immunohistochemical staining were carried out using CRC liver metastasis samples. Expression levels of CXCR2, CXCR4, and their ligands were statistically analyzed according to treatment with neoadjuvant chemotherapy and patients’ outcome. CXCR2 and CXCL7 overexpression are correlated to shorter overall and disease-free survival. By multivariate analysis, CXCR2 and CXCL7 expressions are independent factors of overall and disease-free survival. Neoadjuvant chemotherapy increases significantly the expression of CXCR2: treated group 1.89 (0.02–50.92) vs 0.55 (0.07–3.22), P = 0.016. CXCL7 was overexpressed close to significance, 0.40 (0.00–7.85) vs 0.15 (0.01–7.88), P = 0.12. We show the involvement of CXCL7/CXCR2 signalling pathways as a predictive factor of poor outcome in metastatic CRC. 5-Fluorouracil-based chemotherapy regimens increase the expression of these genes in liver metastasis, providing one explanation for aggressiveness of relapsed drug-resistant tumors. Selective blockage of CXCR2/CXCL7 signalling pathways could provide new potential therapeutic opportunities. PMID:25580640

  15. Genetics of Host Response to Leishmania tropica in Mice – Different Control of Skin Pathology, Chemokine Reaction, and Invasion into Spleen and Liver

    PubMed Central

    Grekov, Igor; Volkova, Valeriya; Vojtíšková, Jarmila; Slapničková, Martina; Kurey, Iryna; Sohrabi, Yahya; Svobodová, Milena; Demant, Peter; Lipoldová, Marie

    2012-01-01

    Background Leishmaniasis is a disease caused by protozoan parasites of genus Leishmania. The frequent involvement of Leishmania tropica in human leishmaniasis has been recognized only recently. Similarly as L. major, L. tropica causes cutaneous leishmaniasis in humans, but can also visceralize and cause systemic illness. The relationship between the host genotype and disease manifestations is poorly understood because there were no suitable animal models. Methods We studied susceptibility to L. tropica, using BALB/c-c-STS/A (CcS/Dem) recombinant congenic (RC) strains, which differ greatly in susceptibility to L. major. Mice were infected with L. tropica and skin lesions, cytokine and chemokine levels in serum, and parasite numbers in organs were measured. Principal Findings Females of BALB/c and several RC strains developed skin lesions. In some strains parasites visceralized and were detected in spleen and liver. Importantly, the strain distribution pattern of symptoms caused by L. tropica was different from that observed after L. major infection. Moreover, sex differently influenced infection with L. tropica and L. major. L. major-infected males exhibited either higher or similar skin pathology as females, whereas L. tropica-infected females were more susceptible than males. The majority of L. tropica-infected strains exhibited increased levels of chemokines CCL2, CCL3 and CCL5. CcS-16 females, which developed the largest lesions, exhibited a unique systemic chemokine reaction, characterized by additional transient early peaks of CCL3 and CCL5, which were not present in CcS-16 males nor in any other strain. Conclusion Comparison of L. tropica and L. major infections indicates that the strain patterns of response are species-specific, with different sex effects and largely different host susceptibility genes. PMID:22679519

  16. Mast cells mediate neutrophil recruitment during atherosclerotic plaque progression.

    PubMed

    Wezel, Anouk; Lagraauw, H Maxime; van der Velden, Daniël; de Jager, Saskia C A; Quax, Paul H A; Kuiper, Johan; Bot, Ilze

    2015-08-01

    Activated mast cells have been identified in the intima and perivascular tissue of human atherosclerotic plaques. As mast cells have been described to release a number of chemokines that mediate leukocyte fluxes, we propose that activated mast cells may play a pivotal role in leukocyte recruitment during atherosclerotic plaque progression. Systemic IgE-mediated mast cell activation in apoE(-/-)μMT mice resulted in an increase in atherosclerotic lesion size as compared to control mice, and interestingly, the number of neutrophils was highly increased in these lesions. In addition, peritoneal mast cell activation led to a massive neutrophil influx into the peritoneal cavity in C57Bl6 mice, whereas neutrophil numbers in mast cell deficient Kit(W(-sh)/W(-sh)) mice were not affected. Within the newly recruited neutrophil population, increased levels of CXCR2(+) and CXCR4(+) neutrophils were observed after mast cell activation. Indeed, mast cells were seen to contain and release CXCL1 and CXCL12, the ligands for CXCR2 and CXCR4. Intriguingly, peritoneal mast cell activation in combination with anti-CXCR2 receptor antagonist resulted in decreased neutrophil recruitment, thus establishing a prominent role for the CXCL1/CXCR2 axis in mast cell-mediated neutrophil recruitment. Our data suggest that chemokines, and in particular CXCL1, released from activated mast cells induce neutrophil recruitment to the site of inflammation, thereby aggravating the ongoing inflammatory response and thus affecting plaque progression and destabilization. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  17. Insights into the binding modes of CC chemokine receptor 4 (CCR4) inhibitors: a combined approach involving homology modelling, docking, and molecular dynamics simulation studies.

    PubMed

    Gadhe, Changdev G; Kim, Mi-hyun

    2015-02-01

    CC chemokine receptor 4 (CCR4), a G protein-coupled receptor (GPCR), plays a vital role in the progression of asthma, T-cell lymphoma, inflammation, and Alzheimer's disease. To date, the structure of CCR4 has not been determined. Therefore, the nature of the interactions between inhibitors and CCR4 is not well known. In this study, we used CCR5 as a template to model the structure of CCR4. Docking studies were performed for four naphthalene-sulphonamide derivatives and crucial ligand-protein interactions were analysed. Molecular dynamics (MD) simulations of these complexes (100 ns each) were carried out to gain insights into the interactions between ligands and CCR4. MD simulations revealed that the residues identified by the docking were displaced and new residues were inserted near the ligands. Results of a principal component analysis (PCA) suggested that CCR4 unfolds at the extracellular site surrounding the ligands. Our simulations identified crucial residues involved in CCR4 antagonism, which were supported by previous mutational studies. Additionally, we identified Ser3.29, Leu3.33, Ser5.39, Phe6.47, Ile7.35, Thr7.38, Thr7.40, and Ala7.42 as residues that play crucial roles in CCR4 antagonism. Mutational studies will help elucidate the significance of these residues in CCR4 antagonism. An understanding of ligand-CCR4 interactions might aid in the design of novel CCR4 inhibitors.

  18. Molecular Basis for Failure of “Atypical” C1 Domain of Vav1 to Bind Diacylglycerol/Phorbol Ester*

    PubMed Central

    Geczy, Tamas; Peach, Megan L.; El Kazzouli, Saïd; Sigano, Dina M.; Kang, Ji-Hye; Valle, Christopher J.; Selezneva, Julia; Woo, Wonhee; Kedei, Noemi; Lewin, Nancy E.; Garfield, Susan H.; Lim, Langston; Mannan, Poonam; Marquez, Victor E.; Blumberg, Peter M.

    2012-01-01

    C1 domains, the recognition motif of the second messenger diacylglycerol and of the phorbol esters, are classified as typical (ligand-responsive) or atypical (not ligand-responsive). The C1 domain of Vav1, a guanine nucleotide exchange factor, plays a critical role in regulation of Vav activity through stabilization of the Dbl homology domain, which is responsible for exchange activity of Vav. Although the C1 domain of Vav1 is classified as atypical, it retains a binding pocket geometry homologous to that of the typical C1 domains of PKCs. This study clarifies the basis for its failure to bind ligands. Substituting Vav1-specific residues into the C1b domain of PKCδ, we identified five crucial residues (Glu9, Glu10, Thr11, Thr24, and Tyr26) along the rim of the binding cleft that weaken binding potency in a cumulative fashion. Reciprocally, replacing these incompatible residues in the Vav1 C1 domain with the corresponding residues from PKCδ C1b (δC1b) conferred high potency for phorbol ester binding. Computer modeling predicts that these unique residues in Vav1 increase the hydrophilicity of the rim of the binding pocket, impairing membrane association and thereby preventing formation of the ternary C1-ligand-membrane binding complex. The initial design of diacylglycerol-lactones to exploit these Vav1 unique residues showed enhanced selectivity for C1 domains incorporating these residues, suggesting a strategy for the development of ligands targeting Vav1. PMID:22351766

  19. Chemokine (C-C motif) receptor 5-using envelopes predominate in dual/mixed-tropic HIV from the plasma of drug-naive individuals.

    PubMed

    Irlbeck, David M; Amrine-Madsen, Heather; Kitrinos, Kathryn M; Labranche, Celia C; Demarest, James F

    2008-07-31

    HIV-1 utilizes CD4 and either chemokine (C-C motif) receptor 5 (CCR5) or chemokine (C-X-C motif) receptor 4 (CXCR4) to gain entry into host cells. Small molecule CCR5 antagonists are currently being developed for the treatment of HIV-1 infection. Because HIV-1 may also use CXCR4 for entry, the use of CCR5 entry inhibitors is controversial for patients harboring CCR5-using and CXCR4-using (dual/mixed-tropic) viruses. The goal of the present study was to determine the proportion of CCR5-tropic and CXCR4-tropic viruses in dual/mixed-tropic virus isolates from drug-naïve patients and the phenotypic and genotypic relationships of viruses that use CCR5 or CXCR4 or both. Fourteen antiretroviral-naive HIV-1-infected patients were identified as having population coreceptor tropism readout of dual/mixed-tropic viruses. Intrapatient comparisons of coreceptor tropism and genotype of env clones were conducted on plasma virus from each patient. Population HIV-1 envelope tropism and susceptibility to the CCR5 entry inhibitor, aplaviroc, were performed using the Monogram Biosciences Trofile Assay. Twelve env clones from each patient were analyzed for coreceptor tropism, aplaviroc sensitivity, genotype, and intrapatient phylogenetic relationships. Viral populations from antiretroviral-naive patients with dual/mixed-tropic virus are composed primarily of CCR5-tropic env clones mixed with those that use both coreceptors (R5X4-tropic) and, occasionally, CXCR4-tropic env clones. Interestingly, the efficiency of CXCR4 use by R5X4-tropic env clones varied with their genetic relationships to CCR5-tropic env clones from the same patient. These data show that the majority of viruses in these dual/mixed-tropic populations use CCR5 and suggest that antiretroviral-naive patients may benefit from combination therapy that includes CCR5 entry inhibitors.

  20. Chelation of /sup 238/Pu(IV) in vivo by 3,4,3-LICAM(C): Effects of ligand methylation and pH

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Durbin, P.W.; White, D.L.; Jeung, N.L.

    1989-06-01

    The linear tetracarboxycatecholate ligand, 3,4,3-LICAM(C) N1,N5,N10,N14-tetrakis(2,3-dihydroxy-4-carboxybenzoyl-tetraaza tet radecane, tetra sodium salt) injected within 1 h after injection of Pu(IV) citrate, removes about the same fraction of Pu from animals as CaNa3-DTPA but removes less inhaled Pu than CaNa3-DTPA and leaves a Pu residue in the renal cortex. However, the formation constant of the expected Pu-3,4,3-LICAM(C) complexes are orders of magnitude greater than that of Pu-DTPA, and 3,4,3-LICAM(C) is 100 times more efficient than CaNa3-DTPA for removing Pu from transferrin in vitro. Because the formation constants of their actinide complexes are central to in vivo actinide chelation, ligand design strategies aremore » dominated by the search for ligands with large Pu complex stabilities, and it was necessary to explain the failure of 3,4,3-LICAM(C) to achieve its thermodynamic potential in vivo. All the batches of 3,4,3-LICAM(C) prepared at Berkeley or in France (Euro-LICAM(C)) were found by high-pressure liquid chromatography to be mixtures of the pure ligand (55% in Berkeley preparations, 8.5% in Euro-LICAM(C)) and its four methylesters. A revised synthesis for 3,4,3-LICAM(C) is appended to this report. All of the incompletely hydrolyzed 3,4,3-LICAM(C) preparations and the pure ligand were tested for removal of Pu from mice (238Pu(IV) citrate intravenous, 30 mumol kg-1 of ligand at 1 h, kill at 24 h, radioanalyze tissues and separated excretal). The presence of methylesters did not significantly impair the ability of the ligands to remove Pu from mice, and it did not alter the fraction of injected Pu deposited in kidneys. Temporary elevation (reduction) of plasma and urine pH of mice by 0.5 mL of 0.1 M NaHCO3 (NH4Cl) injected before or simultaneously with pure 3,4,3-LICAM(C) somewhat improved (significantly reduced) Pu excretion but had little influence on Pu deposition in kidneys.« less

  1. A theoretical and experimental approach toward the development of affinity adsorbents for GFP and GFP-fusion proteins purification.

    PubMed

    Fernandes, Cláudia S M; Pina, Ana Sofia; Dias, Ana M G C; Branco, Ricardo J F; Roque, Ana Cecília Afonso

    2014-09-30

    The green fluorescent protein (GFP) is widely employed to report on a variety of molecular phenomena, but its selective recovery is hampered by the lack of a low-cost and robust purification alternative. This work reports an integrated approach combining rational design and experimental validation toward the optimization of a small fully-synthetic ligand for GFP purification. A total of 56 affinity ligands based on a first-generation lead structure were rationally designed through molecular modeling protocols. The library of ligands was further synthesized by solid-phase combinatorial methods based on the Ugi reaction and screened against Escherichia coli extracts containing GFP. Ligands A4C2, A5C5 and A5C6 emerged as the new lead structures based on the high estimated theoretical affinity constants and the high GFP binding percentages and enrichment factors. The elution of GFP from these adsorbents was further characterized, where the best compromise between mild elution conditions, yield and purity was found for ligands A5C5 and A5C6. These were tested for purifying a model GFP-fusion protein, where ligand A5C5 yielded higher protein recovery and purity. The molecular interactions between the lead ligands and GFP were further assessed by molecular dynamics simulations, showing a wide range of potential hydrophobic and hydrogen-bond interactions. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Steric and electronic ligand perturbations in catalysis: asymmetric allylic substitution reactions using C2-symmetrical phosphorus-chiral (bi)ferrocenyl donors.

    PubMed

    Nettekoven, U; Widhalm, M; Kalchhauser, H; Kamer, P C; van Leeuwen, P W; Lutz, M; Spek, A L

    2001-02-09

    Three series of P-chiral diphosphines based on ferrocene (1a-f, 2a-c) and biferrocenyl skeletons (3a-c), including novel ligands 1f and 3c, were employed in palladium-catalyzed allylic substitution reactions. Steric effects imposed by the phosphine residues were studied using C2-symmetrical donors 1 (1 = 1,1'-bis(arylphenylphosphino)ferrocene with aryl groups a = 1-naphthyl, b = 2-naphthyl, c = 2-anisyl, d = 2-biphenylyl, e = 9-phenanthryl, and f = ferrocenyl), whereas para-methoxy- and/or para-trifluoromethyl substitution of the phenyl moieties in 1a enabled investigation of ligand electronic effects applying ferrocenyl diphosphines 2a-c. Ligands 3 (3 = 2,2'-bis- (arylphenylphosphino)-1,1'-biferrocenyls with aryl substituents a,c = 1-naphthyl (diastereomers) and b = 2-biphenylyl) allowed for comparison of backbone structure effects (bite angle variation) in catalysis. Linear and cyclic allylic acetates served as substrates in typical test reactions; upon attack of soft carbon and nitrogen nucleophiles on (E)-1,3-diphenylprop-2-ene-1-yl acetate the respective malonate, amine, or imide products were obtained in enantioselectivities of up to 99% ee. A crystal structure analysis of a palladium 1,3-diphenyl-eta 3-allyl complex incorporating ligand (S,S)-1a revealed a marked distortion of the allyl fragment, herewith defining the regioselectivity of nucleophile addition.

  3. Interferon-γ-induced protein 10 in Lyme disease.

    PubMed

    Fallahi, P; Elia, G; Bonatti, A

    2017-01-01

    Lyme disease is an infectious disease caused by bacteria of the Borrelia type, that affects about 300,000 people a year in the USA and 65,000 people a year in Europe. Borrelia infection, and Lyme disease, following occupational exposure has been frequently reported in USA, Europe and Asia. The manifestations of Lyme disease include erythema migrans (EM), arthritis, neuroborrelliosis (NB), and others. Cytokines and chemokines primarily orchestrate leukocyte recruitment to the areas of Borrelia infection, and they are critical mediators of immune and inflammatory responses, in particular of the induction of interferon (IFN)-γ and IFN-γ dependent chemokines. In EM high levels of T helper (Th) 1 cells chemoattranctants [monokine induced by IFN-γ (MIG), IFN-γ-induced protein 10 (IP- 10), and IFN-inducible T cell alpha chemoattractant (I-TAC)] have been shown. Synovial tissues and fluids of patients with Lyme Arthritis (LA) (overall with antibiotic-refractory LA) contained exceptionally high levels of Th1 chemoattractants and cytokines, particularly MIG and IFN-γ. In NB concentrations of IP-10 and I-TAC in the cerebrospinal fluid (CSF) were significantly higher, suggesting that IP-10 and I-TAC create a chemokine gradient between the CSF and serum and recruite C-X-C chemokine receptor 3-expressing memory CD4+ T-cells into the CSF of these patients. A positive association between the disseminating capacity of B. burgdorferi and early type I IFN induction has also been shown. These results suggest that IFN-γ dependent chemokines are important biomarkers to monitor the progression and diffusion of the disease in patients with Borrelia infection; further larger studies are needed.

  4. Synthesis and evaluation of 7-substituted-5,6-dihydrobenzo[c]acridine derivatives as new c-KIT promoter G-quadruplex binding ligands.

    PubMed

    Guo, Qian-Liang; Su, Hua-Fei; Wang, Ning; Liao, Sheng-Rong; Lu, Yu-Ting; Ou, Tian-Miao; Tan, Jia-Heng; Li, Ding; Huang, Zhi-Shu

    2017-04-21

    It has been shown that treatment of cancer cells with c-KIT G-quadruplex binding ligands can reduce their c-KIT expression levels thus inhibiting cell proliferation and inducing cell apoptosis. Herein, a series of new 7-substituted-5,6-dihydrobenzo[c]acridine derivatives were designed and synthesized. Subsequent biophysical evaluation demonstrated that the derivatives could effectively bind to and stabilize c-KIT G-quadruplex with good selectivity against duplex DNA. It was found that 12-N-methylated derivatives with a positive charge introduced at 12-position of 5,6-dihydrobenzo[c]acridine ring had similar binding affinity but lower stabilizing ability to c-KIT G-quadruplex DNA, compared with those of nonmethylated derivatives. Further molecular modeling studies showed possible binding modes of G-quadruplex with the ligands. RT-PCR assay and Western blot showed that compound 2b suppressed transcription and translation of c-KIT gene in K562 cells, which was consistent with the property of an effective G-quadruplex binding ligand targeting c-KIT oncogene promoter. Further biological evaluation showed that compound 2b could induce apoptosis through activation of the caspase-3 cascade pathway. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  5. Increased expression of chemokine receptor CCR3 and its ligands in ulcerative colitis: the role of colonic epithelial cells in in vitro studies.

    PubMed

    Manousou, P; Kolios, G; Valatas, V; Drygiannakis, I; Bourikas, L; Pyrovolaki, K; Koutroubakis, I; Papadaki, H A; Kouroumalis, E

    2010-11-01

    Human colonic epithelial cells express T helper type 1 (Th1)-associated chemoattractants, yet little is known about the production of Th2-associated chemoattractants. CCL11/eotaxin-1, CCL24/eotaxin-2 and CCL26/eotaxin-3 are known to attract CCR3-expressing, Th2-polarized lymphocytes. We studied constitutive and inflammation-induced expression and production of CCR3 together with its ligands in the colon and peripheral blood of patients with inflammatory bowel disease (IBD) by flow cytometry, reverse transcription–polymerase chain reaction (RT–PCR) and enzyme-linked immunosorbent assay (ELISA). We further defined the regulated expression of these chemokines by RT–PCR and ELISA using cultured human epithelial cell lines. A higher fraction of peripheral T lymphocytes were found to be positive for CCR3 in patients with ulcerative colitis (UC) compared to Crohn’s disease (CD), while almost no CCR3(+) T cells were found in normal controls (NC). Similarly, higher and more frequent expression of CCR3 was observed in colonic biopsies from patients with UC, regardless of the disease activity, when compared to CD or NCs. Serum CCL11/eotaxin-1 was increased significantly in UC (306 ± 87 pg/ml) and less so in CD (257 ± 43 pg/ml), whereas CCL24/eotaxin-2, and CCL26/eotaxin-3 were increased only in UC. Colonic expression of the three chemokines was minimal in NCs but high in inflammatory bowel diseases (especially UC) and was independent of disease activity. Th2, and to a lesser extent Th1, cytokines were able to induce expression and production of all three eotaxins from colonic epithelial cells in culture. CCR3 and ligands over-expression would appear to be a characteristic of UC. The production of CCR3 ligands by human colonic epithelial cells suggests further that epithelium can play a role in modulating pathological T cell-mediated mucosal inflammation.

  6. Structure-kinetic relationships--an overlooked parameter in hit-to-lead optimization: a case of cyclopentylamines as chemokine receptor 2 antagonists.

    PubMed

    Vilums, Maris; Zweemer, Annelien J M; Yu, Zhiyi; de Vries, Henk; Hillger, Julia M; Wapenaar, Hannah; Bollen, Ilse A E; Barmare, Farhana; Gross, Raymond; Clemens, Jeremy; Krenitsky, Paul; Brussee, Johannes; Stamos, Dean; Saunders, John; Heitman, Laura H; Ijzerman, Adriaan P

    2013-10-10

    Preclinical models of inflammatory diseases (e.g., neuropathic pain, rheumatoid arthritis, and multiple sclerosis) have pointed to a critical role of the chemokine receptor 2 (CCR2) and chemokine ligand 2 (CCL2). However, one of the biggest problems of high-affinity inhibitors of CCR2 is their lack of efficacy in clinical trials. We report a new approach for the design of high-affinity and long-residence-time CCR2 antagonists. We developed a new competition association assay for CCR2, which allows us to investigate the relation of the structure of the ligand and its receptor residence time [i.e., structure-kinetic relationship (SKR)] next to a traditional structure-affinity relationship (SAR). By applying combined knowledge of SAR and SKR, we were able to re-evaluate the hit-to-lead process of cyclopentylamines as CCR2 antagonists. Affinity-based optimization yielded compound 1 with good binding (Ki = 6.8 nM) but very short residence time (2.4 min). However, when the optimization was also based on residence time, the hit-to-lead process yielded compound 22a, a new high-affinity CCR2 antagonist (3.6 nM), with a residence time of 135 min.

  7. Structural Insights into the Ligand Binding and Releasing Mechanism of Antheraea polyphemus PBP1: Role of the C-terminal Tail

    PubMed Central

    Katre, Uma V.; Mazumder, Suman; Mohanty, Smita

    2013-01-01

    Pheromone-binding proteins (PBPs) in lepidopteran moths selectively transport the hydrophobic pheromone molecules across the sensillar lymph to trigger the neuronal response. Moth PBPs are known to bind ligand at physiological pH and release it at acidic pH while undergoing a conformational change. Two molecular switches are considered to play a role in this mechanism: (i) Protonation of His70 and His95 situated at one end of binding pocket, and (ii) Switch of the unstructured C-terminus at the other end of the binding pocket to a helix that enters the pocket. We have reported previously the role of the histidine-driven switch in ligand release for Antheraea polyphemus PBP1 (ApolPBP1). Here we show that the C-terminus plays a role in ligand release and binding mechanism of ApolPBP1. The C-terminus truncated mutants of ApolPBP1 (ApolPBP1ΔP129-V142 and ApolPBP1H70A/H95AΔP129-V142) exist only in the bound conformation at all pH levels, and they fail to undergo pH- or ligand- dependent conformational switch. Although these proteins could bind ligands even at acidic pH unlike the wild-type ApolPBP1, they had ~4 fold reduced affinity towards the ligand at both acidic and physiological pH than that of ApolPBP1wt and ApolPBP1H70A/H95A. Thus, apart from helping in the ligand-release at acidic pH, the C-terminus in ApolPBP1 also plays an important role in ligand binding and/or locking the ligand in the binding pocket. Our results are in stark contrast to those reported for BmorPBP and AtraPBP, where C-terminus truncated proteins had similar or increased pheromone-binding affinity at any pH. PMID:23327454

  8. Role of Chemokine Network in the Development and Progression of Ovarian Cancer: A Potential Novel Pharmacological Target

    PubMed Central

    Barbieri, Federica; Bajetto, Adriana; Florio, Tullio

    2010-01-01

    Ovarian cancer is the most common type of gynecologic malignancy. Despite advances in surgery and chemotherapy, the survival rate is still low since most ovarian cancers relapse and become drug-resistant. Chemokines are small chemoattractant peptides mainly involved in the immune responses. More recently, chemokines were also demonstrated to regulate extra-immunological functions. It was shown that the chemokine network plays crucial functions in the tumorigenesis in several tissues. In particular the imbalanced or aberrant expression of CXCL12 and its receptor CXCR4 strongly affects cancer cell proliferation, recruitment of immunosuppressive cells, neovascularization, and metastasization. In the last years, several molecules able to target CXCR4 or CXCL12 have been developed to interfere with tumor growth, including pharmacological inhibitors, antagonists, and specific antibodies. This chemokine ligand/receptor pair was also proposed to represent an innovative therapeutic target for the treatment of ovarian cancer. Thus, a thorough understanding of ovarian cancer biology, and how chemokines may control these different biological activities might lead to the development of more effective therapies. This paper will focus on the current biology of CXCL12/CXCR4 axis in the context of understanding their potential role in ovarian cancer development. PMID:20049170

  9. Differential activity of pro-angiogenic CXC chemokines

    PubMed Central

    Moldobaeva, Aigul; Baek, Amy; Eldridge, Lindsey; Wagner, Elizabeth M.

    2010-01-01

    We showed previously in a mouse model of lung ischemia-induced angiogenesis, enhanced expression of the three ELR+ CXC chemokines (KC, LIX, and MIP-2 ) and that blockade of the ligand receptor CXCR2 limited neovascularization. The present study was undertaken to determine the relative abundance and angiogenic potential of the three CXC chemokines and whether RhoA activation explained the measured differences in potencies. We found that LIX showed the greatest absolute amount in the in vivo model 4 hrs after left pulmonary artery obstruction (LIX>KC>MIP-2; p<0.05). In vitro, LIX induced the greatest degree of arterial endothelial cell chemotaxis and KC was without effect. A significant increase (~40%) in active RhoA was observed with both LIX and MIP-2 compared with vehicle control (p<0.05). On average, LIX induced the greatest amount of tube formation within pleural tissue in culture. Thus, the results of the present study suggest that among the three ELR+ CXC chemokines, LIX predominates in eliciting a pro-angiogenic phenotype. PMID:20144627

  10. Membrane interaction of the N-terminal domain of chemokine receptor CXCR1.

    PubMed

    Haldar, Sourav; Raghuraman, H; Namani, Trishool; Rajarathnam, Krishna; Chattopadhyay, Amitabha

    2010-06-01

    The N-terminal domain of chemokine receptors constitutes one of the two critical ligand binding sites, and plays important roles by mediating binding affinity, receptor selectivity, and regulating function. In this work, we monitored the organization and dynamics of a 34-mer peptide of the CXC chemokine receptor 1 (CXCR1) N-terminal domain and its interaction with membranes by utilizing a combination of fluorescence-based approaches and surface pressure measurements. Our results show that the CXCR1 N-domain 34-mer peptide binds vesicles of 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) and upon binding, the tryptophan residues of the peptide experience motional restriction and exhibit red edge excitation shift (REES) of 19nm. These results are further supported by increase in fluorescence anisotropy and mean fluorescence lifetime upon membrane binding. These results constitute one of the first reports demonstrating membrane interaction of the N-terminal domain of CXCR1 and gain relevance in the context of the emerging role of cellular membranes in chemokine signaling.

  11. Multiple C-H Bond Activations and Ring-Opening C-S Bond Cleavage of Thiophene by Dirhenium Carbonyl Complexes.

    PubMed

    Adams, Richard D; Dhull, Poonam; Tedder, Jonathan D

    2018-06-14

    The reaction of Re 2 (CO) 8 (μ-C 6 H 5 )(μ-H) (1) with thiophene in CH 2 Cl 2 at 40 °C yielded the new compound Re 2 (CO) 8 (μ-η 2 -SC 4 H 3 )(μ-H) (2), which contains a bridging σ-π-coordinated thienyl ligand formed by the activation of the C-H bond at the 2 position of the thiophene. Compound 2 exhibits dynamical activity on the NMR time scale involving rearrangements of the bridging thienyl ligand. The reaction of compound 2 with a second 1 equiv of 1 at 45 °C yielded the doubly metalated product [Re 2 (CO) 8 (μ-H)] 2 (μ-η 2 -2,3-μ-η 2 -4,5-C 4 H 2 S) (3), formed by the activation of the C-H bond at the 5 position of the thienyl ligand in 2. Heating 3 in a hexane solvent to reflux transformed it into the ring-opened compound Re(CO) 4 [μ-η 5 -η 2 -SCC(H)C(H)C(H)][Re(CO) 3 ][Re 2 (CO) 8 (μ-H)] (4) by the loss of one CO ligand. Compound 4 contains a doubly metalated 1-thiapentadienyl ligand formed by the cleavage of one of the C-S bonds. When heated to reflux (125 °C) in an octane solvent in the presence of H 2 O, the new compound Re(CO) 4 [η 5 -μ-η 2 -SC(H)C(H)C(H)C(H)]Re(CO) 3 (5) was obtained by cleavage of the Re 2 (CO) 8 (μ-H) group from 4 with formation of the known coproduct [Re(CO) 3 (μ 3 -OH)] 4 . All new products were characterized by single-crystal X-ray diffraction analyses.

  12. CD47 Promotes Protective Innate and Adaptive Immunity in a Mouse Model of Disseminated Candidiasis

    PubMed Central

    Navarathna, Dhammika H. M. L. P.; Stein, Erica V.; Lessey-Morillon, Elizabeth C.; Nayak, Debasis; Martin-Manso, Gema; Roberts, David D.

    2015-01-01

    CD47 is a widely expressed receptor that regulates immunity by engaging its counter-receptor SIRPα on phagocytes and its secreted ligand thrombospondin-1. Mice lacking CD47 can exhibit enhanced or impaired host responses to bacterial pathogens, but its role in fungal immunity has not been examined. cd47 -/- mice on a C57BL/6 background showed significantly increased morbidity and mortality following Candida albicans infection when compared with wild-type mice. Despite normal fungal colonization at earlier times, cd47 -/- mice at four days post-infection had increased colonization of brain and kidneys accompanied by stronger inflammatory reactions. Neutrophil and macrophage numbers were significantly elevated in kidneys and neutrophils in the brains of infected cd47 -/- mice. However, no defect in phagocytic activity towards C. albicans was observed in cd47 -/- bone-marrow-derived macrophages, and neutrophil and macrophage killing of C. albicans was not impaired. CD47-deficiency did not alter the early humoral immune response to C. albicans. Th1, Th2, and Th17 population of CD4+ T cells were expanded in the spleen, and gene expression profiles of spleen and kidney showed stronger pro-inflammatory signaling in infected cd47 -/- mice. The chemoattractant chemokines MIP-2α and MIP-2β were highly expressed in infected spleens of cd47 -/- mice. G-CSF, GM-CSF, and the inflammasome component NLRP3 were more highly expressed in infected cd47 -/- kidneys than in infected wild-type controls. Circulating pro- (TNF-α, IL-6) and anti-inflammatory cytokines (IL-10) were significantly elevated, but IL-17 was decreased. These data indicate that CD47 plays protective roles against disseminated candidiasis and alters pro-inflammatory and immunosuppressive pathways known to regulate innate and T cell immunity. PMID:26010544

  13. Immediate initiation of cART is associated with lower levels of cerebrospinal fluid YKL-40, a marker of microglial activation, in HIV-1 infection

    PubMed Central

    Peluso, Michael J.; Valcour, Victor; Phanuphak, Nittaya; Ananworanich, Jintanat; Fletcsher, James LK; Chalermchai, Thep; Krebs, Shelly J.; Robb, Merlin L.; Hellmuth, Joanna; Gisslén, Magnus; Zetterberg, Henrik; Spudich, Serena

    2018-01-01

    Objective To characterize cerebrospinal fluid (CSF) YKL-40, a unique biomarker that reflects activation of microglial cells, in acute (AHI) and chronic HIV-1 infection (CHI) and to determine the effect of treatment initiation on levels of this marker. Design Cross-sectional study of two groups of HIV-infected participants at baseline and follow-up timepoints. Methods AHI (n=33) and CHI (n=34) participants underwent CSF and blood sampling before treatment initiation with combination antiretroviral therapy (cART) and at follow up on cART in a subset of these individuals (6 months in AHI participants [n=24], 1 year in CHI participants [n=10]). Measured parameters were analyzed at each timepoint. Analyses employed Mann-Whitney tests and Spearman correlations. Results Baseline median YKL-40 was higher in CHI than AHI (96844 versus 80754 ng/L; p=0.011). Elevations in the CHI group relative to the AHI group persisted at follow-up despite treatment (87414 versus 66130 ng/L; p=0.003). In untreated CHI, YKL-40 correlated with neopterin (r=0.51, p=0.0025), chemokine (CXC-motif) ligand-10 (r=0.44, p=0.011), and neurofilament light chain (r=0.56, p=0.0008) in CSF. Conclusions This study is the first to describe the dynamics of CSF YKL-40 in two groups of HIV-infected individuals before and after cART and demonstrates the value of this marker in understanding HIV neuropathogenesis. The results suggest the utility of further exploring the prognostic value of YKL-40, particularly in individuals with early HIV infection or those initiating treatment during CHI. PMID:27819802

  14. Immediate initiation of cART is associated with lower levels of cerebrospinal fluid YKL-40, a marker of microglial activation, in HIV-1 infection.

    PubMed

    Peluso, Michael J; Valcour, Victor; Phanuphak, Nittaya; Ananworanich, Jintanat; Fletcher, James L K; Chalermchai, Thep; Krebs, Shelly J; Robb, Merlin L; Hellmuth, Joanna; Gisslén, Magnus; Zetterberg, Henrik; Spudich, Serena

    2017-01-14

    To characterize cerebrospinal fluid (CSF) YKL-40, a unique biomarker that reflects activation of microglial cells, in acute (AHI) and chronic HIV-1 infection (CHI) and to determine the effect of treatment initiation on levels of this marker. A cross-sectional study of two groups of HIV-infected participants at baseline and follow-up timepoints. AHI (n = 33) and CHI (n = 34) participants underwent CSF and blood sampling before treatment initiation with combination antiretroviral therapy (cART) and at follow-up on cART in a subset of these individuals [6 months in AHI participants (n = 24), 1 year in CHI participants (n = 10)]. Measured parameters were analyzed at each timepoint. Analyses employed Mann-Whitney tests and Spearman correlations. Baseline median YKL-40 was higher in CHI than AHI (96844 versus 80754 ng/l; P = 0.011). Elevations in the CHI group relative to the AHI group persisted at follow-up despite treatment (87414 versus 66130 ng/l; P = 0.003). In untreated CHI, YKL-40 correlated with neopterin (r = 0.51, P = 0.0025), chemokine (CXC-motif) ligand-10 (r = 0.44, P = 0.011), and neurofilament light chain (r = 0.56, P = 0.0008) in CSF. This study is the first to describe the dynamics of CSF YKL-40 in two groups of HIV-infected individuals before and after cART and demonstrates the value of this marker in understanding HIV neuropathogenesis. The results suggest the utility of further exploring the prognostic value of YKL-40, particularly in individuals with early HIV infection or those initiating treatment during CHI.

  15. Hepatocyte nuclear receptor SHP suppresses inflammation and fibrosis in a mouse model of nonalcoholic steatohepatitis.

    PubMed

    Zou, An; Magee, Nancy; Deng, Fengyan; Lehn, Sarah; Zhong, Cuncong; Zhang, Yuxia

    2018-06-01

    Nonalcoholic fatty liver disease (NAFLD) is a burgeoning health problem worldwide, ranging from nonalcoholic fatty liver (NAFL, steatosis without hepatocellular injury) to the more aggressive nonalcoholic steatohepatitis (NASH, steatosis with ballooning, inflammation, or fibrosis). Although many studies have greatly contributed to the elucidation of NAFLD pathogenesis, the disease progression from NAFL to NASH remains incompletely understood. Nuclear receptor small heterodimer partner (Nr0b2, SHP ) is a transcriptional regulator critical for the regulation of bile acid, glucose, and lipid metabolism. Here, we show that SHP levels are decreased in the livers of patients with NASH and in diet-induced mouse NASH. Exposing primary mouse hepatocytes to palmitic acid and lipopolysaccharide in vitro , we demonstrated that the suppression of Shp expression in hepatocytes is due to c-Jun N-terminal kinase (JNK) activation, which stimulates c-Jun-mediated transcriptional repression of Shp Interestingly, in vivo induction of hepatocyte-specific SHP in steatotic mouse liver ameliorated NASH progression by attenuating liver inflammation and fibrosis, but not steatosis. Moreover, a key mechanism linking the anti-inflammatory role of hepatocyte-specific SHP expression to inflammation involved SHP-induced suppression of NF-κB p65-mediated induction of chemokine (C-C motif) ligand 2 (CCL2), which activates macrophage proinflammatory polarization and migration. In summary, our results indicate that a JNK/SHP/NF-κB/CCL2 regulatory network controls communications between hepatocytes and macrophages and contributes to the disease progression from NAFL to NASH. Our findings may benefit the development of new management or prevention strategies for NASH. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Genomic Analysis of the Appearance of Ovarian Mast Cells in Neonatal MRL/MpJ Mice

    PubMed Central

    Nakamura, Teppei; Sakata, Yuko; Otsuka-Kanazawa, Saori; Ichii, Osamu; Chihara, Masataka; Nagasaki, Ken-ichi; Namiki, Yuka; Kon, Yasuhiro

    2014-01-01

    In MRL/MpJ mice, ovarian mast cells (OMCs) are more abundant than in other mouse strains, and tend to distribute beneath the ovarian surface epithelium at birth. This study investigated the factors regulating the appearance of neonatal OMCs in progeny of the cross between MRL/MpJ and C57BL/6N strains. F1 neonates had less than half the number of OMCs than MRL/MpJ. Interestingly, MRLB6F1 had more neonatal OMCs than B6MRLF1, although they were distributed over comparable areas. Furthermore, in MRL/MpJ fetuses for which parturition was delayed until embryonic day 21.5, the number of OMCs was significantly higher than in age-matched controls at postnatal day 2. These results suggest that the number of OMCs was influenced by the environmental factors during pregnancy. Quantitative trait locus analysis using N2 backcross progeny revealed two significant loci on chromosome 8: D8Mit343–D8Mit312 for the number of OMCs and D8Mit86–D8Mit89 for their distribution, designated as mast cell in the ovary of MRL/MpJ 1 (mcom1) and mcom2, respectively. Among MC migration-associated genes, ovarian expression of chemokine (C-C motif) ligand 17 at mcom1 locus was significantly higher in MRL/MpJ than in C57BL/6N, and positively correlated with the expression of OMC marker genes. These results indicate that the appearance of neonatal OMCs in MRL/MpJ is controlled by environmental factors and filial genetic factors, and that the abundance and distribution of OMCs are regulated by independent filial genetic elements. PMID:24956472

  17. Tumor cell apoptosis induces tumor-specific immunity in a CC chemokine receptor 1- and 5-dependent manner in mice.

    PubMed

    Iida, Noriho; Nakamoto, Yasunari; Baba, Tomohisa; Kakinoki, Kaheita; Li, Ying-Yi; Wu, Yu; Matsushima, Kouji; Kaneko, Shuichi; Mukaida, Naofumi

    2008-10-01

    The first step in the generation of tumor immunity is the migration of dendritic cells (DCs) to the apoptotic tumor, which is presumed to be mediated by various chemokines. To clarify the roles of chemokines, we induced apoptosis using suicide gene therapy and investigated the immune responses following tumor apoptosis. We injected mice with a murine hepatoma cell line, BNL 1ME A.7R.1 (BNL), transfected with HSV-thymidine kinase (tk) gene and then treated the animals with ganciclovir (GCV). GCV treatment induced massive tumor cell apoptosis accompanied with intratumoral DC infiltration. Tumor-infiltrating DCs expressed chemokine receptors CCR1 and CCR5, and T cells and macrophages expressed CCL3, a ligand for CCR1 and CCR5. Moreover, tumor apoptosis increased the numbers of DCs migrating into the draining lymph nodes and eventually generated a specific cytotoxic cell population against BNL cells. Although GCV completely eradicated HSV-tk-transfected BNL cells in CCR1-, CCR5-, or CCL3-deficient mice, intratumoral and intranodal DC infiltration and the subsequent cytotoxicity generation were attenuated in these mice. When parental cells were injected again after complete eradication of primary tumors by GCV treatment, the wild-type mice completely rejected the rechallenged cells, but the deficient mice exhibited impairment in rejection. Thus, we provide definitive evidence indicating that CCR1 and CCR5 and their ligand CCL3 play a crucial role in the regulation of intratumoral DC accumulation and the subsequent establishment of tumor immunity following induction of tumor apoptosis by suicide genes.

  18. Molecular interactions of agonist and inverse agonist ligands at serotonin 5-HT2C G protein-coupled receptors: computational ligand docking and molecular dynamics studies validated by experimental mutagenesis results

    NASA Astrophysics Data System (ADS)

    Córdova-Sintjago, Tania C.; Liu, Yue; Booth, Raymond G.

    2015-02-01

    To understand molecular determinants for ligand activation of the serotonin 5-HT2C G protein-coupled receptor (GPCR), a drug target for obesity and neuropsychiatric disorders, a 5-HT2C homology model was built according to an adrenergic β2 GPCR (β2AR) structure and validated using a 5-HT2B GPCR crystal structure. The models were equilibrated in a simulated phosphatidyl choline membrane for ligand docking and molecular dynamics studies. Ligands included (2S, 4R)-(-)-trans-4-(3'-bromo- and trifluoro-phenyl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalene-2-amine (3'-Br-PAT and 3'-CF3-PAT), a 5-HT2C agonist and inverse agonist, respectively. Distinct interactions of 3'-Br-PAT and 3'-CF3-PAT at the wild-type (WT) 5-HT2C receptor model were observed and experimental 5-HT2C receptor mutagenesis studies were undertaken to validate the modelling results. For example, the inverse agonist 3'-CF3-PAT docked deeper in the WT 5-HT2C binding pocket and altered the orientation of transmembrane helices (TM) 6 in comparison to the agonist 3'-Br-PAT, suggesting that changes in TM orientation that result from ligand binding impact function. For both PATs, mutation of 5-HT2C residues S3.36, T3.37, and F5.47 to alanine resulted in significantly decreased affinity, as predicted from modelling results. It was concluded that upon PAT binding, 5-HT2C residues T3.37 and F5.47 in TMs 3 and 5, respectively, engage in inter-helical interactions with TMs 4 and 6, respectively. The movement of TMs 5 and 6 upon agonist and inverse agonist ligand binding observed in the 5-HT2C receptor modelling studies was similar to movements reported for the activation and deactivation of the β2AR, suggesting common mechanisms among aminergic neurotransmitter GPCRs.

  19. Crystal structure of fac-[2-(4-methyl-5-phenyl-pyridin-2-yl)phenyl-κ2C1,N]bis-[2-(pyridin-2-yl)phenyl-κ2C1,N]iridium(III).

    PubMed

    Lee, Chi-Heon; Moon, Suk-Hee; Park, Ki-Min; Kang, Youngjin

    2016-12-01

    In the title compound, [Ir(C 11 H 8 N) 2 (C 18 H 14 N)], the Ir III ion adopts a distorted octa-hedral coordination environment defined by three C , N -chelating ligands, one stemming from a 2-(4-phenyl-5-methyl-pyridin-2-yl)phenyl ligand and two from 2-(pyridin-2-yl)phenyl ligands, arranged in a facial manner. The Ir III ion lies almost in the equatorial plane [deviation = 0.0069 (15) Å]. In the crystal, inter-molecular π-π stacking inter-actions, as well as inter-molecular C-H⋯π inter-actions, are present, leading to a three-dimensional network.

  20. Myocardial Chemokine Expression and Intensity of Myocarditis in Chagas Cardiomyopathy Are Controlled by Polymorphisms in CXCL9 and CXCL10

    PubMed Central

    Nogueira, Luciana Gabriel; Santos, Ronaldo Honorato Barros; Ianni, Barbara Maria; Fiorelli, Alfredo Inácio; Mairena, Eliane Conti; Benvenuti, Luiz Alberto; Frade, Amanda; Donadi, Eduardo; Dias, Fabrício; Saba, Bruno; Wang, Hui-Tzu Lin; Fragata, Abilio; Sampaio, Marcelo; Hirata, Mario Hiroyuki; Buck, Paula; Mady, Charles; Bocchi, Edimar Alcides; Stolf, Noedir Antonio; Kalil, Jorge; Cunha-Neto, Edecio

    2012-01-01

    Background Chronic Chagas cardiomyopathy (CCC), a life-threatening inflammatory dilated cardiomyopathy, affects 30% of the approximately 8 million patients infected by Trypanosoma cruzi. Even though the Th1 T cell-rich myocarditis plays a pivotal role in CCC pathogenesis, little is known about the factors controlling inflammatory cell migration to CCC myocardium. Methods and Results Using confocal immunofluorescence and quantitative PCR, we studied cell surface staining and gene expression of the CXCR3, CCR4, CCR5, CCR7, CCR8 receptors and their chemokine ligands in myocardial samples from end-stage CCC patients. CCR5+, CXCR3+, CCR4+, CCL5+ and CXCL9+ mononuclear cells were observed in CCC myocardium. mRNA expression of the chemokines CCL5, CXCL9, CXCL10, CCL17, CCL19 and their receptors was upregulated in CCC myocardium. CXCL9 mRNA expression directly correlated with the intensity of myocarditis, as well as with mRNA expression of CXCR3, CCR4, CCR5, CCR7, CCR8 and their ligands. We also analyzed single-nucleotide polymorphisms for genes encoding the most highly expressed chemokines and receptors in a cohort of Chagas disease patients. CCC patients with ventricular dysfunction displayed reduced genotypic frequencies of CXCL9 rs10336 CC, CXCL10 rs3921 GG, and increased CCR5 rs1799988CC as compared to those without dysfunction. Significantly, myocardial samples from CCC patients carrying the CXCL9/CXCL10 genotypes associated to a lower risk displayed a 2–6 fold reduction in mRNA expression of CXCL9, CXCL10, and other chemokines and receptors, along with reduced intensity of myocarditis, as compared to those with other CXCL9/CXCL10 genotypes. Conclusions Results may indicate that genotypes associated to reduced risk in closely linked CXCL9 and CXCL10 genes may modulate local expression of the chemokines themselves, and simultaneously affect myocardial expression of other key chemokines as well as intensity of myocarditis. Taken together our results may suggest that CXCL9 and CXCL10 are master regulators of myocardial inflammatory cell migration, perhaps affecting clinical progression to the life-threatening form of CCC. PMID:23150742

  1. Up-regulation of CC chemokine receptor 6 on tonsillar T cells and its induction by in vitro stimulation with α-streptococci in patients with pustulosis palmaris et plantaris

    PubMed Central

    Yoshizaki, T; Bandoh, N; Ueda, S; Nozawa, H; Goto, T; Kishibe, K; Takahara, M; Harabuchi, Y

    2009-01-01

    Pustulosis palmaris et plantaris (PPP) is a tonsil-related disease; tonsillectomy is somewhat effective in treating the condition. However, the aetiological association between the tonsils and PPP has not yet been elucidated fully. Recently, some chemokines and chemokine receptors, including CC chemokine receptor (CCR) 4, CCR6 and CX chemokine receptor (CXCR) 3, have been reported to play important roles in the development of psoriasis, a disease related closely to PPP. In this study, we found that CCR6 expression on both tonsillar and peripheral blood T cells was up-regulated more intensively in PPP patients than in non-PPP patients (P < 0·001 for both), but CCR4 and CXCR3 expressions were not. In vitro stimulation with α-streptococcal antigen enhanced CCR6 expression significantly on tonsillar T cells in PPP patients (P < 0·05), but this was not observed in non-PPP patients. The chemotactic response of tonsillar T cells to the CCR6 ligand CC chemokine ligand (CCL) 20 was significantly higher in PPP patients than in non-PPP patients (P < 0·05). The percentage of CCR6-positive peripheral blood T cells decreased after tonsillectomy in PPP patients (P < 0·01); this decrease correlated with an improvement of skin lesions (P < 0·05, r = −0·63). The numbers of CCR6-positive cells and the expression of CCL20 were increased significantly in pathological lesions compared with non-pathological lesions in PPP skin (P < 0·01, P < 0·05 respectively). These results suggest that a novel immune response to α-streptococci may enhance CCR6 expression on T cells in tonsils and that CCR6-positive T cells may move to peripheral blood circulation, resulting in recruitment to target skin lesions expressing CCL20 in PPP patients. This may be one of the key roles in pathogenesis of the tonsil-related disease PPP. PMID:19659772

  2. α2A- and α2C-Adrenoceptors as Potential Targets for Dopamine and Dopamine Receptor Ligands.

    PubMed

    Sánchez-Soto, Marta; Casadó-Anguera, Verònica; Yano, Hideaki; Bender, Brian Joseph; Cai, Ning-Sheng; Moreno, Estefanía; Canela, Enric I; Cortés, Antoni; Meiler, Jens; Casadó, Vicent; Ferré, Sergi

    2018-03-18

    The poor norepinephrine innervation and high density of Gi/o-coupled α 2A - and α 2C -adrenoceptors in the striatum and the dense striatal dopamine innervation have prompted the possibility that dopamine could be an effective adrenoceptor ligand. Nevertheless, the reported adrenoceptor agonistic properties of dopamine are still inconclusive. In this study, we analyzed the binding of norepinephrine, dopamine, and several compounds reported as selective dopamine D 2 -like receptor ligands, such as the D 3 receptor agonist 7-OH-PIPAT and the D 4 receptor agonist RO-105824, to α 2 -adrenoceptors in cortical and striatal tissue, which express α 2A -adrenoceptors and both α 2A - and α 2C -adrenoceptors, respectively. The affinity of dopamine for α 2 -adrenoceptors was found to be similar to that for D 1 -like and D 2 -like receptors. Moreover, the exogenous dopamine receptor ligands also showed high affinity for α 2A - and α 2C -adrenoceptors. Their ability to activate Gi/o proteins through α 2A - and α 2C -adrenoceptors was also analyzed in transfected cells with bioluminescent resonance energy transfer techniques. The relative ligand potencies and efficacies were dependent on the Gi/o protein subtype. Furthermore, dopamine binding to α 2 -adrenoceptors was functional, inducing changes in dynamic mass redistribution, adenylyl cyclase activity, and ERK1/2 phosphorylation. Binding events were further studied with computer modeling of ligand docking. Docking of dopamine at α 2A - and α 2C -adrenoceptors was nearly identical to its binding to the crystallized D 3 receptor. Therefore, we provide conclusive evidence that α 2A - and α 2C -adrenoceptors are functional receptors for norepinephrine, dopamine, and other previously assumed selective D 2 -like receptor ligands, which calls for revisiting previous studies with those ligands.

  3. Demonstration of a specific C3a receptor on guinea pig platelets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fukuoka, Y.; Hugli, T.E.

    1988-05-15

    Guinea pig platelets reportedly contain receptors specific for the anaphylatoxin C3a based on both ligand-binding studies and functional responses. A portion of the human 125I-C3a that binds to guinea pig platelets is competitively displaced by excess unlabeled C3a; however, the majority of ligand uptake was nonspecific. Uptake of 125I-C3a by guinea pig platelets is maximal in 1 min, and stimulation of guinea pig platelets by thrombin, ADP, or the Ca2+ ionophore A23187 showed little influence on binding of the ligand. Scatchard analysis indicated that approximately 1200 binding sites for C3a exist per cell with an estimated Kd of 8 xmore » 10(-10) M. Human C3a des Arg also binds to guinea pig platelets, but Scatchard analysis indicated that no specific binding occurred. Because the ligand-binding studies were complicated by high levels of nonspecific uptake, we attempted to chemically cross-link the C3a molecule to a specific component on the platelet surface. Cross-linkage of 125I-C3a to guinea pig platelets with bis(sulfosuccinimidyl)suberate revealed radioactive complexes at 105,000 and 115,000 m.w. on SDS-PAGE gels by autoradiographic analysis. In the presence of excess unlabeled C3a, complex formation was inhibited. No cross-linkage could be demonstrated between the inactive 125I-C3a des Arg and the putative C3a-R on guinea pig platelets. Human C3a, but not C3a des Arg induces serotonin release and aggregation of the guinea pig platelets. Human C3a was unable to induce either serotonin release or promote aggregation of human platelets. Uptake of human 125I-C3a by human platelets was not saturable, and Scatchard analysis was inconclusive. Attempts to cross-link 125I-C3a to components on the surface of human platelets also failed to reveal a ligand-receptor complex. Therefore, we conclude that guinea pig platelets have specific surface receptors to C3a and that human platelets appear devoid of receptors to the anaphylatoxin.« less

  4. Ligand-to-ligand charge-transfer transitions of platinum(II) complexes with arylacetylide ligands with different chain lengths: spectroscopic characterization, effect of molecular conformations, and density functional theory calculations.

    PubMed

    Tong, Glenna So Ming; Law, Yuen-Chi; Kui, Steven C F; Zhu, Nianyong; Leung, King Hong; Phillips, David Lee; Che, Chi-Ming

    2010-06-11

    The complexes [Pt(tBu(3)tpy){C[triple bond]C(C(6)H(4)C[triple bond]C)(n-1)R}](+) (n = 1: R = alkyl and aryl (Ar); n = 1-3: R = phenyl (Ph) or Ph-N(CH(3))(2)-4; n = 1 and 2, R = Ph-NH(2)-4; tBu(3)tpy = 4,4',4''-tri-tert-butyl-2,2':6',2''-terpyridine) and [Pt(Cl(3)tpy)(C[triple bond]CR)](+) (R = tert-butyl (tBu), Ph, 9,9'-dibutylfluorene, 9,9'-dibutyl-7-dimethyl-amine-fluorene; Cl(3)tpy = 4,4',4''-trichloro-2,2':6',2''-terpyridine) were prepared. The effects of substituent(s) on the terpyridine (tpy) and acetylide ligands and chain length of arylacetylide ligands on the absorption and emission spectra were examined. Resonance Raman (RR) spectra of [Pt(tBu(3)tpy)(C[triple bond]CR)](+) (R = n-butyl, Ph, and C(6)H(4)-OCH(3)-4) obtained in acetonitrile at 298 K reveal that the structural distortion of the C[triple bond]C bond in the electronic excited state obtained by 502.9 nm excitation is substantially larger than that obtained by 416 nm excitation. Density functional theory (DFT) and time-dependent DFT (TDDFT) calculations on [Pt(H(3)tpy)(C[triple bond]CR)](+) (R = n-propyl (nPr), 2-pyridyl (Py)), [Pt(H(3)tpy){C[triple bond]C(C(6)H(4)C[triple bond]C)(n-1)Ph}](+) (n = 1-3), and [Pt(H(3)tpy){C[triple bond]C(C(6)H(4)C[triple bond]C)(n-1)C(6)H(4)-N(CH(3))(2)-4}](+)/+H(+) (n = 1-3; H(3)tpy = nonsubstituted terpyridine) at two different conformations were performed, namely, with the phenyl rings of the arylacetylide ligands coplanar ("cop") with and perpendicular ("per") to the H(3)tpy ligand. Combining the experimental data and calculated results, the two lowest energy absorption peak maxima, lambda(1) and lambda(2), of [Pt(Y(3)tpy)(C[triple bond]CR)](+) (Y = tBu or Cl, R = aryl) are attributed to (1)[pi(C[triple bond]CR)-->pi*(Y(3)tpy)] in the "cop" conformation and mixed (1)[d(pi)(Pt)-->pi*(Y(3)tpy)]/(1)[pi(C[triple bond]CR)-->pi*(Y(3)tpy)] transitions in the "per" conformation. The lowest energy absorption peak lambda(1) for [Pt(tBu(3)tpy){C[triple bond]C(C(6)H(4)C[triple bond]C)(n-1)C(6)H(4)-H-4}](+) (n = 1-3) shows a redshift with increasing chain length. However, for [Pt(tBu(3)tpy){C[triple bond]C(C6H4C[triple bond]C)(n-1)C(6)H(4)-N(CH(3))(2)-4}](+) (n = 1-3), lambda(1) shows a blueshift with increasing chain length n, but shows a redshift after the addition of acid. The emissions of [Pt(Y(3)tpy)(C[triple bond]CR)](+) (Y = tBu or Cl) at 524-642 nm measured in dichloromethane at 298 K are assigned to the (3)[pi(C[triple bond]CAr)-->pi*(Y(3)tpy)] excited states and mixed (3)[d(pi)(Pt)-->pi*(Y(3)tpy)]/(3)[pi(C[triple bond]C)-->pi*(Y(3)tpy)] excited states for R = aryl and alkyl groups, respectively. [Pt(tBu(3)tpy){C[triple bond]C(C(6)H(4)C[triple bond]C)(n-1)C(6)H(4)-N(CH(3))(2)-4}](+) (n = 1 and 2) are nonemissive, and this is attributed to the small energy gap between the singlet ground state (S(0)) and the lowest triplet excited state (T(1)).

  5. Molecular models of site-isolated cobalt, rhodium, and iridium catalysts supported on zeolites: Ligand bond dissociation energies

    DOE PAGES

    Chen, Mingyang; Serna, Pedro; Lu, Jing; ...

    2015-09-28

    The chemistry of zeolite-supported site-isolated cobalt, rhodium, and iridium complexes that are essentially molecular was investigated with density functional theory (DFT) and the results compared with experimentally determined spectra characterizing rhodium and iridium species formed by the reactions of Rh(C 2H 4) 2(acac) and Ir(C 2H 4) 2(acac) (acac = acetylacetonate) with acidic zeolites such as dealuminated HY zeolite. The experimental results characterize ligand exchange reactions and catalytic reactions of adsorbed ligands, including olefin hydrogenation and dimerization. Two molecular models were used to characterize various binding sites of the metal complexes in the zeolites, and the agreement between experimental andmore » calculated infrared frequencies and metal-ligand distances determined by extended X-ray absorption fine structure spectroscopy was generally very good. The calculated structures and energies indicate a metal-support-oxygen (M(I)-O) coordination number of two for most of the supported complexes and a value of three when the ligands include the radicals C 2H 5 or H. The results characterizing various isomers of the supported metal complexes incorporating hydrocarbon ligands indicate that some carbene and carbyne ligands could form. Ligand bond dissociation energies (LDEs) are reported to explain the observed reactivity trends. The experimental observations of a stronger M-CO bond than M-(C 2H 4) bond for both Ir and Rh match the calculated LDEs, which show that the single-ligand LDEs of the mono and dual-ligand complexes for CO are similar to 12 and similar to 15 kcal/mol higher in energy (when the metal is Rh) and similar to 17 and similar to 20 kcal/mol higher (when the metal is Ir) than the single-ligand LDEs of the mono and dual ligand complexes for C 2H 4, respectively. The results provide a foundation for the prediction of the catalytic properties of numerous supported metal complexes, as summarized in detail here.« less

  6. Pivotal Advance: Interconversion between pure chemotactic ligands and chemoattractant/secretagogue ligands of neutrophil C5a receptor by a single amino acid substitution.

    PubMed

    Jia, Nan; Semba, Umeko; Nishiura, Hiroshi; Kuniyasu, Akihiko; Nsiama, Tienabe K; Nishino, Norikazu; Yamamoto, Tetsuro

    2010-06-01

    Skp derived from Escherichia coli attracts leukocytes as a pure chemotactic ligand of the C5a receptor. We identified the submolecular region of Skp that binds and activates the C5a receptor to be -Gln103-Asp104-Arg105- using synthetic peptide fragments and site-directed mutants of Skp. As the C5a amino acid residue equivalent to Gln103 of Skp is Leu72, we prepared a Gln103Leu-Skp mutant as a recombinant protein. With this mutation, Skp gained secretagogue functions including induction of the respiratory burst and granule release reactions and leukotriene generation, in addition to the chemoattraction displayed by C5a. However, when we substituted Leu72 with Gln in C5a, the L72Q-C5a mutant largely lost its secretagogue function. These functional conversions were reproduced using synthetic peptides mimicking the receptor-binding/-activating regions of the recombinant proteins. Receptor-binding assays using the mimicking peptides demonstrated only a small difference between the Leu72-C5a and Gln72-C5a peptides. Consistently, L72Q-C5a apparently antagonized C5a secretagogue function. These results indicate that the difference between a chemotactic response and a combined chemotactic/secretory response can be attributed not to the nature of the receptor but to guidance by the ligand, at least in the case of C5a receptor-mediated leukocyte responses.

  7. Effects of Mutations and Ligands on the Thermostability of the l-Arginine/Agmatine Antiporter AdiC and Deduced Insights into Ligand-Binding of Human l-Type Amino Acid Transporters

    PubMed Central

    Ilgü, Hüseyin; Jeckelmann, Jean-Marc; Colas, Claire; Ucurum, Zöhre; Schlessinger, Avner; Fotiadis, Dimitrios

    2018-01-01

    The l-arginine/agmatine transporter AdiC is a prokaryotic member of the SLC7 family, which enables pathogenic enterobacteria to survive the extremely acidic gastric environment. Wild-type AdiC from Escherichia coli, as well as its previously reported point mutants N22A and S26A, were overexpressed homologously and purified to homogeneity. A size-exclusion chromatography-based thermostability assay was used to determine the melting temperatures (Tms) of the purified AdiC variants in the absence and presence of the selected ligands l-arginine (Arg), agmatine, l-arginine methyl ester, and l-arginine amide. The resulting Tms indicated stabilization of AdiC variants upon ligand binding, in which Tms and ligand binding affinities correlated positively. Considering results from this and previous studies, we revisited the role of AdiC residue S26 in Arg binding and proposed interactions of the α-carboxylate group of Arg exclusively with amide groups of the AdiC backbone. In the context of substrate binding in the human SLC7 family member l-type amino acid transporter-1 (LAT1; SLC7A5), an analogous role of S66 in LAT1 to S26 in AdiC is discussed based on homology modeling and amino acid sequence analysis. Finally, we propose a binding mechanism for l-amino acid substrates to LATs from the SLC7 family. PMID:29558430

  8. Effects of Mutations and Ligands on the Thermostability of the l-Arginine/Agmatine Antiporter AdiC and Deduced Insights into Ligand-Binding of Human l-Type Amino Acid Transporters.

    PubMed

    Ilgü, Hüseyin; Jeckelmann, Jean-Marc; Colas, Claire; Ucurum, Zöhre; Schlessinger, Avner; Fotiadis, Dimitrios

    2018-03-20

    The l-arginine/agmatine transporter AdiC is a prokaryotic member of the SLC7 family, which enables pathogenic enterobacteria to survive the extremely acidic gastric environment. Wild-type AdiC from Escherichia coli, as well as its previously reported point mutants N22A and S26A, were overexpressed homologously and purified to homogeneity. A size-exclusion chromatography-based thermostability assay was used to determine the melting temperatures ( T m s) of the purified AdiC variants in the absence and presence of the selected ligands l-arginine (Arg), agmatine, l-arginine methyl ester, and l-arginine amide. The resulting T m s indicated stabilization of AdiC variants upon ligand binding, in which T m s and ligand binding affinities correlated positively. Considering results from this and previous studies, we revisited the role of AdiC residue S26 in Arg binding and proposed interactions of the α-carboxylate group of Arg exclusively with amide groups of the AdiC backbone. In the context of substrate binding in the human SLC7 family member l-type amino acid transporter-1 (LAT1; SLC7A5), an analogous role of S66 in LAT1 to S26 in AdiC is discussed based on homology modeling and amino acid sequence analysis. Finally, we propose a binding mechanism for l-amino acid substrates to LATs from the SLC7 family.

  9. A chemokine-binding domain in the tumor necrosis factor receptor from variola (smallpox) virus

    PubMed Central

    Alejo, Alí; Ruiz-Argüello, M. Begoña; Ho, Yin; Smith, Vincent P.; Saraiva, Margarida; Alcami, Antonio

    2006-01-01

    Variola virus (VaV) is the causative agent of smallpox, one of the most devastating diseases encountered by man, that was eradicated in 1980. The deliberate release of VaV would have catastrophic consequences on global public health. However, the mechanisms that contribute to smallpox pathogenesis are poorly understood at the molecular level. The ability of viruses to evade the host defense mechanisms is an important determinant of viral pathogenesis. Here we show that the tumor necrosis factor receptor (TNFR) homologue CrmB encoded by VaV functions not only as a soluble decoy TNFR but also as a highly specific binding protein for several chemokines that mediate recruitment of immune cells to mucosal surfaces and the skin, sites of virus entry and viral replication at late stages of smallpox. CrmB binds chemokines through its C-terminal domain, which is unrelated to TNFRs, was named smallpox virus-encoded chemokine receptor (SECRET) domain and uncovers a family of poxvirus chemokine inhibitors. An active SECRET domain was found in another viral TNFR (CrmD) and three secreted proteins encoded by orthopoxviruses. These findings identify a previously undescribed chemokine-binding and inhibitory domain unrelated to host chemokine receptors and a mechanism of immune modulation in VaV that may influence smallpox pathogenesis. PMID:16581912

  10. A chemokine-binding domain in the tumor necrosis factor receptor from variola (smallpox) virus.

    PubMed

    Alejo, Alí; Ruiz-Argüello, M Begoña; Ho, Yin; Smith, Vincent P; Saraiva, Margarida; Alcami, Antonio

    2006-04-11

    Variola virus (VaV) is the causative agent of smallpox, one of the most devastating diseases encountered by man, that was eradicated in 1980. The deliberate release of VaV would have catastrophic consequences on global public health. However, the mechanisms that contribute to smallpox pathogenesis are poorly understood at the molecular level. The ability of viruses to evade the host defense mechanisms is an important determinant of viral pathogenesis. Here we show that the tumor necrosis factor receptor (TNFR) homologue CrmB encoded by VaV functions not only as a soluble decoy TNFR but also as a highly specific binding protein for several chemokines that mediate recruitment of immune cells to mucosal surfaces and the skin, sites of virus entry and viral replication at late stages of smallpox. CrmB binds chemokines through its C-terminal domain, which is unrelated to TNFRs, was named smallpox virus-encoded chemokine receptor (SECRET) domain and uncovers a family of poxvirus chemokine inhibitors. An active SECRET domain was found in another viral TNFR (CrmD) and three secreted proteins encoded by orthopoxviruses. These findings identify a previously undescribed chemokine-binding and inhibitory domain unrelated to host chemokine receptors and a mechanism of immune modulation in VaV that may influence smallpox pathogenesis.

  11. Desert dust induces TLR signaling to trigger Th2-dominant lung allergic inflammation via a MyD88-dependent signaling pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Miao, E-mail: hemiao@mail.cmu.edu.cn; Ichinose, Takamichi, E-mail: ichinose@oita-nhs.ac.jp; Song, Yuan

    Asian sand dust (ASD) is known to exacerbate asthma, although its mechanism is not yet well understood. In this study, when the effects on inflammatory response by LPS present in ASD was investigated by measuring the gene expression of cytokines and chemokines in RAW264.7 cells treated with ASD and/or polymyxin B (PMB), the ASD effects were attenuated by PMB, but not completely. When an in vitro study was performed using bone marrow-derived macrophages (BMDMs) from WT, TLR2{sup −/−}, TLR4{sup −/−}, and MyD88{sup −/−} BALB/c mice and BMDMs from WT, TLR2{sup −/−}, TLR4{sup −/−}, TLR2/4{sup −/−}, TLR7/9{sup −/−}, and MyD88{sup −/−}more » C57BL/6J mice, cytokine (IL-6, IL-12) production in BMDMs was higher in ASD-stimulated TLR2{sup −/−} cells than in TLR4{sup −/−} cells, whereas it was lower or undetectable in TLR2/4{sup −/−} and MyD88{sup −/−} cells. These results suggest that ASD causes cytokine production predominantly in a TLR4/MyD88-dependent pathway. When WT and TLRs 2{sup −/−}, 4{sup −/−}, and MyD88{sup −/−} BALB/c mice were intratracheally challenged with OVA and/or ASD, ASD caused exacerbation of lung eosinophilia along with Th2 cytokine and eosinophil-relevant chemokine production. Serum OVA-specific IgE and IgG1 similar to WT was observed in TLRs 2{sup −/−}, 4{sup −/−} mice, but not in MyD88{sup −/−} mice. The Th2 responses in TLR2{sup −/−} mice were attenuated remarkably by PMB. These results indicate that ASD exacerbates lung eosinophilia in a MyD88-dependent pathway. TLRs 2 and 4 signaling may be important in the increase in lung eosinophilia. Also, the TLR4 ligand LPS and TLR2 ligand like β-glucan may be strong candidates for exacerbation of lung eosinophilia. - Highlights: • ASD enhanced Th2 response in TLR2{sup −/−}, TLR4{sup −/−} and WT mice, but not in MyD88{sup −/−}. • Th2 responses in TLR2{sup −/−} mice were attenuated by LPS inhibitor polymyxin B. • TLR2 and TLR4 signaling is important in allergic lung disease aggravation by ASD. • MyD88 is the key adapter molecule in the signaling pathway for Th2 activation. • ASD-bound LPS and β-glucan may be strong candidates for the aggravating substances.« less

  12. Highly sensitive SERS analysis of the cyclic Arg-Gly-Asp peptide ligands of cells using nanogap antennas.

    PubMed

    Portela, Alejandro; Yano, Taka-Aki; Santschi, Christian; Martin, Olivier J F; Tabata, Hitoshi; Hara, Masahiko

    2017-02-01

    The cyclic RGD (cRGD) peptide ligands of cells have become widely used for treating several cancers. We report a highly sensitive analysis of c(RGDfC) using surface enhanced Raman spectroscopy (SERS) using single dimer nanogap antennas in aqueous environment. Good agreement between characteristic peaks of the SERS and the Raman spectra of bulk c(RGDfC) with its peptide's constituents were observed. The exhibited blinking of the SERS spectra and synchronization of intensity fluctuations, suggest that the SERS spectra acquired from single dimer nanogap antennas was dominated by the spectrum of single to a few molecules. SERS spectra of c(RGDfC) could be used to detect at the nanoscale, the cells' transmembrane proteins binding to its ligand. SERS of cyclic RGD on nanogap antenna. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Synthesis, crystal structure and biological activity of the Schiff base organotin(IV) complexes based on salicylaldehyde-o-aminophenol

    NASA Astrophysics Data System (ADS)

    Tan, Yu-Xing; Zhang, Zhi-Jian; Liu, Yang; Yu, Jiang-Xi; Zhu, Xiao-Ming; Kuang, Dai-Zhi; Jiang, Wu-Jiu

    2017-12-01

    Schiff base organotin(IV) complexes C1 ∼ C5b have been synthesized via the reaction of the substituted salicylaldehyde-o-aminophenol Schiff base ligands (L1 ∼ L3) with the dibenzyltin dichloride, n-butyltin trichloride or dibutyltin oxide, respectively. The complexes have been characterized by IR, UV-Vis, 1H NMR, 13C NMR spectra, elemental analysis and the crystal structures have been determined by X-ray diffraction. The anticancer activity of the Schiff base ligand and complexes C1 ∼ C5b against five species of cancer cell which are Hela, MCF7, HepG2, Colo205, NCIsbnd H460 were tested respectively, the tests showed that C1 ∼ C5b exhibited significant anticancer activity for the cancer cells in comparison with the ligand, and the activity was greater than carboplatin.

  14. C. elegans Notch signaling regulates adult chemosensory response and larval molting quiescence

    PubMed Central

    Singh, Komudi; Chao, Michael Y.; Somers, Gerard A.; Komatsu, Hidetoshi; Corkins, Mark E.; Larkins-Ford, Jonah; Tucey, Tim; Dionne, Heather M.; Walsh, Melissa B.; Beaumont, Emma K.; Hart, Douglas P.; Lockery, Shawn; Hart, Anne C.

    2011-01-01

    Summary Background The conserved DOS motif proteins OSM-7 and OSM-11 function as co-ligands with canonical DSL ligands to activate C. elegans Notch receptors during development. We report herein that Notch ligands, co-ligands and the receptors LIN-12 and GLP-1 regulate two C. elegans behaviors: chemosensory avoidance of octanol and quiescence during molting lethargus. Results C. elegans lacking osm-7 or osm-11 are defective in their response to octanol. We find that OSM-11 is secreted from hypodermal seam cells into the pseudocoelomic body cavity and acts non-cell autonomously as a diffusible factor. OSM-11 acts with the DSL ligand LAG-2 to activate LIN-12 and GLP-1 Notch receptors in the neurons of adult animals,- thereby regulating octanol avoidance response. In adult animals, over-expression of osm-11 and consequent Notch receptor activation induces anachronistic sleep-like quiescence. Perturbation of Notch signaling altered basal activity in adults as well as arousal thresholds and quiescence during molting lethargus. Genetic epistasis studies revealed that Notch signaling regulates quiescence via previously identified circuits and genetic pathways including the egl-4 cGMP-dependent kinase. Conclusions Our findings indicate that the conserved Notch pathway modulates behavior in adult C. elegans in response to environmental stress. Additionally, Notch signaling regulates sleep-like quiescence in C. elegans suggesting Notch may regulate sleep in other species. PMID:21549604

  15. Constructing a Catalytic Cycle for C-F to C-X (X = O, S, N) Bond Transformation Based on Gold-Mediated Ligand Nucleophilic Attack.

    PubMed

    Hu, Ji-Yun; Zhang, Jing; Wang, Gao-Xiang; Sun, Hao-Ling; Zhang, Jun-Long

    2016-03-07

    A tricoordinated gold(I) chloride complex, tBuXantphosAuCl, supported by a sterically bulky 9,9-dimethyl-4,5-bis(di-tert-butylphosphino)xanthene ligand (tBuXantphos) was synthesized. This complex features a remarkably longer Au-Cl bond length [2.632(1) Å] than bicoordinated linear gold complexes (2.27-2.30 Å) and tricoordinated XantphosAuCl [2.462(1) Å]. Single-crystal X-ray diffraction analysis of a cocrystal of tBuXantphosAuCl and pentafluoronitrobenzene (PFNB) and UV-vis spectroscopic titration experiments revealed the existence of an anion-π interaction between the Cl anion ligand and PFNB. Stoichiometric reaction between PFNB and tBuXantphosAuOtBu, after replacement of Cl by a more nucleophilic tBuO anion ligand, showed higher reactivity and para selectivity in the transformation of C-F to C-OtBu bond, distinctively different from that when only KOtBu was used (ortho selectivity) under the identical condition. Mechanistic studies including density functional theory calculations suggested a gold-mediated nucleophilic ligand attack of the C-F bond pathway via an SNAr process. On the basis of these results, using trimethylsilyl derivatives TMS-X (X = OMe, SEt, NEt2) as the nucleophilic ligand source and the fluorine acceptor, catalytic transformation of the C-F bond of aromatic substrates to the C-X (X = O, S, N) bond was achieved with tBuXantphosAuCl as the catalyst (up to 20 turnover numbers).

  16. Phosphorescent heterobimetallic complexes involving platinum(iv) and rhenium(vii) centers connected by an unsupported μ-oxido bridge.

    PubMed

    Molaee, Hajar; Nabavizadeh, S Masoud; Jamshidi, Mahboubeh; Vilsmeier, Max; Pfitzner, Arno; Samandar Sangari, Mozhgan

    2017-11-28

    Heterobimetallic compounds [(C^N)LMe 2 Pt(μ-O)ReO 3 ] (C^N = ppy, L = PPh 3 , 2a; C^N = ppy, L = PMePh 2 , 2b; C^N = bhq, L = PPh 3 , 2c; C^N = bhq, L = PMePh 2 , 2d) containing a discrete unsupported Pt(iv)-O-Re(vii) bridge have been synthesized through a targeted synthesis route. The compounds have been prepared by a single-pot synthesis in which the Pt(iv) precursor [PtMe 2 I(C^N)L] complexes are allowed to react easily with AgReO 4 in which the iodide ligand of the starting Pt(iv) complex is replaced by an ReO 4 - anion. In these Pt-O-Re complexes, the Pt(iv) centers have an octahedral geometry, completed by a cyclometalated bidentate ligand (C^N), two methyl groups and a phosphine ligand, while the Re(vii) centers have a tetrahedral geometry. Elemental analysis, single crystal X-ray diffraction analysis and multinuclear NMR spectroscopy are used to establish their identities. The new complexes exhibit phosphorescence emission in the solid and solution states at 298 and 77 K, which is an uncommon property of platinum complexes with an oxidation state of +4. According to DFT calculations, we found that this emission behavior in the new complexes originates from ligand centered 3 LC (C^N) character with a slight amount of metal to ligand charge transfer ( 3 MLCT). The solid-state emission data of the corresponding cycloplatinated(iv) precursor complexes [PtMe 2 I(C^N)L], 1a-1d, pointed out that the replacement of I - by an ReO 4 - anion helps enhancing the emission efficiency besides shifting the emission wavelengths.

  17. Lymphoid follicle cells in chronic obstructive pulmonary disease overexpress the chemokine receptor CXCR3.

    PubMed

    Kelsen, Steven G; Aksoy, Mark O; Georgy, Mary; Hershman, Richard; Ji, Rong; Li, Xiuxia; Hurford, Matthew; Solomides, Charalambos; Chatila, Wissam; Kim, Victor

    2009-05-01

    The mechanisms underlying formation of lung lymphoid follicles (LF) in chronic obstructive pulmonary disease (COPD) are unknown. The chemokine receptor CXCR3 regulates immune responses in secondary lymphoid structures elsewhere in the body and is highly expressed by Th1 lymphocytes in the airway in COPD. Because chemokine receptors control inflammatory cell homing to inflamed tissue, we reasoned that CXCR3 may contribute to LF formation in COPD. We assessed the expression of CXCR3 and its ligands (IP-10/CXCL10, Mig/CXCL9, and ITAC/CXCL11) by LF cells in never-smokers, smokers without COPD, and subjects with COPD. CXCR3, IP-10, Mig, and ITAC expression were assessed in lung sections from 46 subjects (never-smokers, smokers without COPD [S], and subjects with COPD in GOLD stages 1-4) by immunohistochemistry. CXCR3-expressing T cells (CD8+ or CD4+) and B cells (CD20+) were topographically distributed at the follicle periphery and center, respectively. The percentage of immunohistochemically identified CXCR3+ cells increased progressively while proceeding from S through GOLD 3-4 (P < 0.01 for GOLD 3-4 vs. S). Moreover, the number of CXCR3+ follicular cells correlated inversely with FEV(1) (r = 0.60). The CXCR3 ligands IP-10 and Mig were expressed by several cell types in and around the follicle, including CD68+ dendritic cells/ macrophages, airway epithelial cells, endothelial cells, and T and B cells. These results suggest that LF form in the COPD lung by recruitment and/or retention of CXCR3-expressing T and B lymphocytes, which are attracted to the region through production of CXCR3 ligands IP-10 and Mig by lung structural and follicular cells.

  18. Lymphoid Follicle Cells in Chronic Obstructive Pulmonary Disease Overexpress the Chemokine Receptor CXCR3

    PubMed Central

    Kelsen, Steven G.; Aksoy, Mark O.; Georgy, Mary; Hershman, Richard; Ji, Rong; Li, XiuXia; Hurford, Matthew; Solomides, Charalambos; Chatila, Wissam; Kim, Victor

    2009-01-01

    Rationale: The mechanisms underlying formation of lung lymphoid follicles (LF) in chronic obstructive pulmonary disease (COPD) are unknown. The chemokine receptor CXCR3 regulates immune responses in secondary lymphoid structures elsewhere in the body and is highly expressed by Th1 lymphocytes in the airway in COPD. Because chemokine receptors control inflammatory cell homing to inflamed tissue, we reasoned that CXCR3 may contribute to LF formation in COPD. Objectives: We assessed the expression of CXCR3 and its ligands (IP-10/CXCL10, Mig/CXCL9, and ITAC/CXCL11) by LF cells in never-smokers, smokers without COPD, and subjects with COPD. Methods: CXCR3, IP-10, Mig, and ITAC expression were assessed in lung sections from 46 subjects (never-smokers, smokers without COPD [S], and subjects with COPD in GOLD stages 1–4) by immunohistochemistry. Measurements and Main Results: CXCR3-expressing T cells (CD8+ or CD4+) and B cells (CD20+) were topographically distributed at the follicle periphery and center, respectively. The percentage of immunohistochemically identified CXCR3+ cells increased progressively while proceeding from S through GOLD 3–4 (P < 0.01 for GOLD 3–4 vs. S). Moreover, the number of CXCR3+ follicular cells correlated inversely with FEV1 (r = 0.60). The CXCR3 ligands IP-10 and Mig were expressed by several cell types in and around the follicle, including CD68+ dendritic cells/ macrophages, airway epithelial cells, endothelial cells, and T and B cells. Conclusions: These results suggest that LF form in the COPD lung by recruitment and/or retention of CXCR3-expressing T and B lymphocytes, which are attracted to the region through production of CXCR3 ligands IP-10 and Mig by lung structural and follicular cells. PMID:19218194

  19. Overexpression of chemokine receptor CXCR2 and ligand CXCL7 in liver metastases from colon cancer is correlated to shorter disease-free and overall survival.

    PubMed

    Desurmont, Thibault; Skrypek, Nicolas; Duhamel, Alain; Jonckheere, Nicolas; Millet, Guillaume; Leteurtre, Emmanuelle; Gosset, Pierre; Duchene, Belinda; Ramdane, Nassima; Hebbar, Mohamed; Van Seuningen, Isabelle; Pruvot, François-René; Huet, Guillemette; Truant, Stéphanie

    2015-03-01

    Our aim was to analyze the potential role of chemokine receptors CXCR2 and CXCR4 signalling pathways in liver metastatic colorectal cancer (CRC) relapse. CXCR2, CXCR4, and their chemokine ligands were evaluated in liver metastases of colorectal cancer in order to study their correlation with overall and disease-free survival of patients having received, or not received, a neoadjuvant chemotherapy regimen. Quantitative RT-PCR and CXCR2 immunohistochemical staining were carried out using CRC liver metastasis samples. Expression levels of CXCR2, CXCR4, and their ligands were statistically analyzed according to treatment with neoadjuvant chemotherapy and patients' outcome. CXCR2 and CXCL7 overexpression are correlated to shorter overall and disease-free survival. By multivariate analysis, CXCR2 and CXCL7 expressions are independent factors of overall and disease-free survival. Neoadjuvant chemotherapy increases significantly the expression of CXCR2: treated group 1.89 (0.02-50.92) vs 0.55 (0.07-3.22), P = 0.016. CXCL7 was overexpressed close to significance, 0.40 (0.00-7.85) vs 0.15 (0.01-7.88), P = 0.12. We show the involvement of CXCL7/CXCR2 signalling pathways as a predictive factor of poor outcome in metastatic CRC. 5-Fluorouracil-based chemotherapy regimens increase the expression of these genes in liver metastasis, providing one explanation for aggressiveness of relapsed drug-resistant tumors. Selective blockage of CXCR2/CXCL7 signalling pathways could provide new potential therapeutic opportunities. © 2015 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association.

  20. Human Eosinophils Express Functional CCR7

    PubMed Central

    Ueki, Shigeharu; Estanislau, Jessica; Weller, Peter F.

    2013-01-01

    Human eosinophils display directed chemotactic activity toward an array of soluble chemokines. Eosinophils have been observed to migrate to draining lymph nodes in experimental models of allergic inflammation, yet it is unknown whether eosinophils express CCR7, a key chemokine receptor in coordinating leukocyte trafficking to lymph nodes. The purpose of this study is to demonstrate expression of CCR7 by human eosinophils and functional responses to CCL19 and CCL21, the known ligands of CCR7. Human eosinophils were purified by negative selection from healthy donors. CCR7 expression of freshly purified, unstimulated eosinophils and of IL-5–primed eosinophils was determined by flow cytometry and Western blot. Chemotaxis to CCL19 and CCL21 was measured in transwell assays. Shape changes to CCL19 and CCL21 were analyzed by flow cytometry and microscopy. Calcium fluxes of fluo-4 AM–loaded eosinophils were recorded by flow cytometry after chemokine stimulation. ERK phosphorylation of CCL19- and CCL21-stimulated eosinophils was measured by Western blot and Luminex assay. Human eosinophils expressed CCR7 as demonstrated by flow cytometry and Western blots. Eosinophils exhibited detectable cell surface expression of CCR7. IL-5–primed eosinophils exhibited chemotaxis toward CCL19 and CCL21 in a dose-dependent fashion. Upon stimulation with CCL19 or CCL21, IL-5–primed eosinophils demonstrated dose-dependent shape changes with polarization of F-actin and exhibited calcium influxes. Finally, primed eosinophils stimulated with CCL19 or CCL21 exhibited increased phosphorylation of ERK in response to both CCR7 ligands. We demonstrate that human eosinophils express CCR7 and have multipotent responses to the known ligands of CCR7. PMID:23449735

  1. Mouse macrophages primed with alendronate down-regulate monocyte chemoattractant protein-1 (MCP-1) and macrophage inflammatory protein-1alpha (MIP-1alpha) production in response to Toll-like receptor (TLR) 2 and TLR4 agonist via Smad3 activation.

    PubMed

    Masuda, Takahiro; Deng, Xue; Tamai, Riyoko

    2009-08-01

    Alendronate is one of the nitrogen-containing bisphosphonates (NBPs) used as anti-bone resorptive drugs. However, NBPs have inflammatory side effects including osteomyelitis and osteonecrosis of the jaw. In the present study, we examined the effects of alendronate on chemokine production by the macrophage-like cell line, J774.1, when incubated with Pam(3)CSK(4) (a Toll-like receptor (TLR) 2 agonist) and Lipid A (a TLR4 agonist). Pretreatment of J774.1 cells with alendronate decreased the production of TLR ligand-induced monocyte chemoattractant protein-1 (MCP-1) and macrophage inflammatory protein-1alpha (MIP-1alpha) but did not influence nuclear factor-kappaB (NF-kappaB) activation. While this agent induced caspase-8 activation, a caspase-8 inhibitor did not affect the decrease in MCP-1 production by alendronate and TLR ligands. Thus, the alendronate-mediated decrease in chemokine production was independent of NF-kappaB and caspase-8 activation. Although transforming growth factor-beta1 (TGF-beta1) is known to inhibit chemokine production by various cell types via Smad3 activation, pretreatment with alendronate did not increase TGF-beta1 production by J774.1 cells incubated in the presence or absence of TLR ligands. However, alendronate directly activated Smad3. These results suggest that by down-regulating MCP-1 and MIP-1alpha production via Smad3, long-term use of alendronate might inhibit normal activation and migration of osteoclasts and cause osteonecrosis.

  2. Heterologous Quaternary Structure of CXCL12 and its Relationship to the CC Chemokine Family

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murphy, J.; Yuan, H; Kong, Y

    2010-01-01

    X-ray crystallographic studies reveal that CXCL12 is able to form multiple dimer types, a traditional CXC dimer and a 'CC-like' form. Phylogenetic analysis of all known human chemokines demonstrates CXCL12 is more closely related to the CC chemokine class than other CXC chemokines. These observations indicate that CXCL12 contains genomic and structural elements characteristic of both CXC and CC chemokines.Chemokines are members of a superfamily of proteins involved in the migration of cells to the proper anatomical position during embryonic development or in response to infection or stress during an immune response. There are two major (CC and CXC) andmore » two minor (CX3C and XC) families based on the sequence around the first conserved cysteine. The topology of all structures is essentially identical with a flexible N-terminal region of 3-8 amino acids, a 10-20 residue N-terminal loop, a short 3{sub 10}-helix, three {beta}-strands, and a {alpha}-helix. The major consequence of the subtle difference between the families occurs at the oligomeric level. Monomers of the CC, CXC, and CX3C families form dimers in a family-specific manner. The XCL1 chemokine is a monomer that can interconvert between two folded states. All chemokines activate GPCRs according to family-specificity, however there are a few examples of chemokines crossing the family boundary to function as antagonists. A two-stage mechanism for chemokine activation of GPCRs has been proposed. The N-terminal region of the receptor interacts with the chemokine, followed by receptor activation by the chemokine N-terminal region. Monomeric chemokines have been demonstrated to be the active form for receptor function. There are numerous examples of both chemokines and their receptors forming dimers. While family-specific dimerization may be an attractive explanation for why specific chemokines only activate GPCRs within their own family, the role of dimers in the function of chemokines has not been resolved. Given that CXCL12 is in the CXC family, the CXC dimer is considered the physiologic dimer in all previous studies based on crystallographic evidence. NMR and mutational studies agree with the CXC dimer form in solution. The CXC form of the dimer is seen in recent structures of CXCL12 bound to a heparin disaccharide and several CXCR4 peptides. In one case, crystals of the CXC-type dimer were soaked in a heparin disaccharide solution to determine the interactions between this dimer and bound disaccharide. In another case, in order to overcome NMR chemical shift line broadening when CXCR4 peptides are added, a 'locked' dimer was constructed by introducing a cysteine mutant that linked subunits as a CXC dimer through an inter-subunit disulfide bond. The solution structures of the locked CXC dimer with CXCR4 peptides were determined. The locked CXC dimer retained Ca{sup 2+} mobilization yet lost chemotaxis activity, presumably because the monomer is the active form. In addition to existing as a monomer and CXC dimer, CXCL12 is now demonstrated to have the capacity to form CC type dimers in the presence of a CXCR4 peptide.« less

  3. The heterodimerization of platelet-derived chemokines.

    PubMed

    Carlson, James; Baxter, Sarah A; Dréau, Didier; Nesmelova, Irina V

    2013-01-01

    Chemokines encompass a large family of proteins that act as chemoattractants and are involved in many biological processes. In particular, chemokines guide the migration of leukocytes during normal and inflammatory conditions. Recent studies reveal that the heterophilic interactions between chemokines significantly affect their biological activity, possibly representing a novel regulatory mechanism of the chemokine activities. The co-localization of platelet-derived chemokines in vivo allows them to interact. Here, we used nano-spray ionization mass spectrometry to screen eleven different CXC and CC platelet-derived chemokines for possible interactions with the two most abundant chemokines present in platelets, CXCL4 and CXCL7. Results indicate that many screened chemokines, although not all of them, form heterodimers with CXCL4 and/or CXCL7. In particular, a strong heterodimerization was observed between CXCL12 and CXCL4 or CXCL7. Compared to other chemokines, the main structural difference of CXCL12 is in the orientation and packing of the C-terminal alpha-helix in relation to the beta-sheet. The analysis of one possible structure of the CXCL4/CXCL12 heterodimer, CXC-type structure, using molecular dynamics (MD) trajectory reveals that CXCL4 may undergo a conformational transition to alter the alpha helix orientation. In this new orientation, the alpha-helix of CXCL4 aligns in parallel with the CXCL12 alpha-helix, an energetically more favorable conformation. Further, we determined that CXCL4 and CXCL12 physically interact to form heterodimers by co-immunoprecipitations from human platelets. Overall, our results highlight that many platelet-derived chemokines are capable of heterophilic interactions and strongly support future studies of the biological impact of these interactions. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Treatment with the CC chemokine-binding protein Evasin-4 improves post-infarction myocardial injury and survival in mice.

    PubMed

    Braunersreuther, Vincent; Montecucco, Fabrizio; Pelli, Graziano; Galan, Katia; Proudfoot, Amanda E; Belin, Alexandre; Vuilleumier, Nicolas; Burger, Fabienne; Lenglet, Sébastien; Caffa, Irene; Soncini, Debora; Nencioni, Alessio; Vallée, Jean-Paul; Mach, François

    2013-10-01

    Chemokines trigger leukocyte trafficking and are implicated in cardiovascular disease pathophysiology. Chemokine-binding proteins, called "Evasins" have been shown to inhibit both CC and CXC chemokine-mediated bioactivities. Here, we investigated whether treatment with Evasin-3 (CXC chemokine inhibitor) and Evasin-4 (CC chemokine inhibitor) could influence post-infarction myocardial injury and remodelling. C57Bl/6 mice were submitted in vivo to left coronary artery permanent ligature and followed up for different times (up to 21 days). After coronary occlusion, three intraperitoneal injections of 10 μg Evasin-3, 1 μg Evasin-4 or equal volume of vehicle (PBS) were performed at 5 minutes, 24 hours (h) and 48 h after ischaemia onset. Both anti-chemokine treatments were associated with the beneficial reduction in infarct size as compared to controls. This effect was accompanied by a decrease in post-infarction myocardial leukocyte infiltration, reactive oxygen species release, and circulating levels of CXCL1 and CCL2. Treatment with Evasin-4 induced a more potent effect, abrogating the inflammation already at one day after ischaemia onset. At days 1 and 21 after ischaemia onset, both anti-chemokine treatments failed to significantly improve cardiac function, remodelling and scar formation. At 21-day follow-up, mouse survival was exclusively improved by Evasin-4 treatment when compared to control vehicle. In conclusion, we showed that the selective inhibition of CC chemokines (i.e. CCL5) with Evasin-4 reduced cardiac injury/inflammation and improved survival. Despite the inhibition of CXC chemokine bioactivities, Evasin-3 did not affect mouse survival. Therefore, early inhibition of CC chemokines might represent a promising therapeutic approach to reduce the development of post-infarction heart failure in mice.

  5. Role of Complement C5 in Experimental Blunt Chest Trauma-Induced Septic Acute Lung Injury (ALI)

    PubMed Central

    Karbach, Michael; Braumueller, Sonja; Kellermann, Philipp; Gebhard, Florian; Huber-Lang, Markus; Perl, Mario

    2016-01-01

    Background Severe blunt chest trauma is associated with high mortality. Sepsis represents a serious risk factor for mortality in acute respiratory distress syndrome (ARDS). In septic patients with ARDS complement activation products were found to be elevated in the plasma. In single models like LPS or trauma complement has been studied to some degree, however in clinically highly relevant double hit models such as the one used here little data is available. Here, we hypothesized that absence of C5 is correlated with a decreased inflammatory response in trauma induced septic acute lung injury. Methods 12 hrs after DH in mice the local and systemic cytokines and chemokines were quantified by multiplex bead array or ELISA, activated caspase-3 by western blot. Data were analyzed using one-way ANOVA followed by post-hoc Sidak’s multiple comparison test (significance, p≤ 0.05). Results In lung tissue interleukin (IL)-6, monocyte chemo attractant protein-1 (MCP-1) and granulocyte-colony stimulating factor (G-CSF) was elevated in both C5-/- mice and wildtype littermates (wt), whereas caspase-3 was reduced in lungs after DH in C5-/- mice. Systemically, reduced keratinocyte-derived chemokine (KC) levels were observed after DH in C5-/- compared to wt mice. Locally, lung myeloperoxidase (MPO), protein, IL-6, MCP-1 and G-CSF in brochoalveolar lavage fluid (BALF) were elevated after DH in C5-/- compared to wt. Conclusions In the complex but clinically relevant DH model the local and systemic inflammatory immune response features both, C5-dependent and C5-independent characteristics. Activation of caspase-3 in lung tissue after DH was C5-dependent whereas local inflammation in lung tissue was C5-independent. PMID:27437704

  6. Role of Complement C5 in Experimental Blunt Chest Trauma-Induced Septic Acute Lung Injury (ALI).

    PubMed

    Kalbitz, Miriam; Karbach, Michael; Braumueller, Sonja; Kellermann, Philipp; Gebhard, Florian; Huber-Lang, Markus; Perl, Mario

    2016-01-01

    Severe blunt chest trauma is associated with high mortality. Sepsis represents a serious risk factor for mortality in acute respiratory distress syndrome (ARDS). In septic patients with ARDS complement activation products were found to be elevated in the plasma. In single models like LPS or trauma complement has been studied to some degree, however in clinically highly relevant double hit models such as the one used here little data is available. Here, we hypothesized that absence of C5 is correlated with a decreased inflammatory response in trauma induced septic acute lung injury. 12 hrs after DH in mice the local and systemic cytokines and chemokines were quantified by multiplex bead array or ELISA, activated caspase-3 by western blot. Data were analyzed using one-way ANOVA followed by post-hoc Sidak's multiple comparison test (significance, p≤ 0.05). In lung tissue interleukin (IL)-6, monocyte chemo attractant protein-1 (MCP-1) and granulocyte-colony stimulating factor (G-CSF) was elevated in both C5-/- mice and wildtype littermates (wt), whereas caspase-3 was reduced in lungs after DH in C5-/- mice. Systemically, reduced keratinocyte-derived chemokine (KC) levels were observed after DH in C5-/- compared to wt mice. Locally, lung myeloperoxidase (MPO), protein, IL-6, MCP-1 and G-CSF in brochoalveolar lavage fluid (BALF) were elevated after DH in C5-/- compared to wt. In the complex but clinically relevant DH model the local and systemic inflammatory immune response features both, C5-dependent and C5-independent characteristics. Activation of caspase-3 in lung tissue after DH was C5-dependent whereas local inflammation in lung tissue was C5-independent.

  7. A mini review on immune role of chemokines and its receptors in snakehead murrel Channa striatus.

    PubMed

    Bhatt, Prasanth; Kumaresan, Venkatesh; Palanisamy, Rajesh; Ravichandran, Gayathri; Mala, Kanchana; Amin, S M Nurul; Arshad, Aziz; Yusoff, Fatimah Md; Arockiaraj, Jesu

    2018-01-01

    Chemokines are ubiquitous cytokine molecules involved in migration of cells during inflammation and normal physiological processes. Though the study on chemokines in mammalian species like humans have been extensively studied, characterization of chemokines in teleost fishes is still in the early stage. The present review provides an overview of chemokines and its receptors in a teleost fish, Channa striatus. C. striatus is an air breathing freshwater carnivore, which has enormous economic importance. This species is affected by an oomycete fungus, Aphanomyces invadans and a Gram negative bacteria Aeromonas hydrophila is known to cause secondary infection. These pathogens impose immune changes in the host organism, which in turn mounts several immune responses. Of these, the role of cytokines in the immune response is immense, due to their involvement in several activities of inflammation such as cell trafficking to the site of inflammation and antigen presentation. Given that importance, chemokines in fishes do have significant role in the immunological and other physiological functions of the organism, hence there is a need to understand the characteristics, activities and performace of these small molecules in details. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. CXCR3, CXCR5, CXCR6, and CXCR7 in Diabetes.

    PubMed

    Fallahi, Poupak; Corrado, Alda; Di Domenicantonio, Andrea; Frenzilli, Giada; Antonelli, Alessandro; Ferrari, Silvia Martina

    2016-01-01

    Many studies have suggested that CXCR3, CXCR5, CXCR6 and CXCR7 chemokine receptors are determinant in type 1 diabetes (T1D), expecially in autoimmunity and β-cell destruction. In particular circulating CXCL10 level (the ligand of CXCR3) is high in T1D patients, and this suggests that CXCL10 may be a candidate for a predictive marker of T1D. Blocking the CXCL10/CXCR3 axis in newly onset of diabetes seems to be a potential strategy for the therapy of T1D. Attempts have been done in modulating or blocking CXCR5, CXCR6 and CXCR7 chemokine receptors in experimental settings of T1D. More researches are necessary to evaluate the interplay among cytokines, chemokines and the pathogenesis and therapy of T1D.

  9. Xenon triggers pro-inflammatory effects and suppresses the anti-inflammatory response compared to sevoflurane in patients undergoing cardiac surgery.

    PubMed

    Breuer, Thomas; Emontzpohl, Christoph; Coburn, Mark; Benstoem, Carina; Rossaint, Rolf; Marx, Gernot; Schälte, Gereon; Bernhagen, Juergen; Bruells, Christian S; Goetzenich, Andreas; Stoppe, Christian

    2015-10-15

    Cardiac surgery encompasses various stimuli that trigger pro-inflammatory mediators, reactive oxygen species and mobilization of leucocytes. The aim of this study was to evaluate the effect of xenon on the inflammatory response during cardiac surgery. This randomized trial enrolled 30 patients who underwent elective on-pump coronary-artery bypass grafting in balanced anaesthesia of either xenon or sevoflurane. For this secondary analysis, blood samples were drawn prior to the operation, intra-operatively and on the first post-operative day to measure the pro- and anti-inflammatory cytokines interleukin-6 (IL-6), interleukin-8/C-X-C motif ligand 8 (IL-8/CXCL8), and interleukin-10 (IL-10). Chemokines such as C-X-C motif ligand 12/ stromal cell-derived factor-1α (CXCL12/SDF-1α) and macrophage migration inhibitory factor (MIF) were measured to characterize xenon's perioperative inflammatory profile and its impact on migration of peripheral blood mononuclear cells (PBMC). Xenon enhanced the postoperative increase of IL-6 compared to sevoflurane (Xenon: 90.7 versus sevoflurane: 33.7 pg/ml; p = 0.035) and attenuated the increase of IL-10 (Xenon: 127.9 versus sevoflurane: 548.3 pg/ml; p = 0.028). Both groups demonstrated a comparable intraoperative increase of oxidative stress (intra-OP: p = 0.29; post-OP: p = 0.65). While both groups showed an intraoperative increase of the cardioprotective mediators MIF and CXCL12/SDF-1α, only MIF levels decreased in the xenon group on the first postoperative day (50.0 ng/ml compared to 23.3 ng/ml; p = 0.012), whereas it remained elevated after sevoflurane anaesthesia (58.3 ng/ml to 53.6 ng/ml). Effects of patients' serum on chemotactic migration of peripheral mononuclear blood cells taken from healthy volunteers indicated a tendency towards enhanced migration after sevoflurane anaesthesia (p = 0.07). Compared to sevoflurane, balanced xenon anaesthesia triggers pro-inflammatory effects and suppresses the anti-inflammatory response in cardiac surgery patients even though the clinical significance remains unknown. This clinical trial was approved by the European Medicines Agency (EudraCT-number: 2010-023942-63) and at ClinicalTrials.gov ( NCT01285271 ; first received: January 24, 2011).

  10. Dynamic Behaviour of Tetramethylethylene Diamine (TMEDA) Ligands in Solid Organolithium Compounds: A Variable Temperature 13C and I5N CP/MAS NMR Study

    NASA Astrophysics Data System (ADS)

    Baumann, Wolfgang; Oprunenko, Yuri; Günther, Harald

    1995-05-01

    The dynamic behaviour of tetramethylethylene diamine (TMEDA) ligands in three organometallic complexes, dimeric phenyllithium, [Li(tmeda)μ-Ph]2 (1), lithium cyclopentadienide, [Li(tmeda)]C5H5 (2), and dilithium naphthalendiide, trans-[Li(tmeda)]2C10H8 (3), has been studied by CP/MAS 13C and 15N as well as 7Li MAS NMR spectroscopy of powdered samples. Two dynamic processes with free activation enthalpies of 40 and 68 kJ mol-1, respectively, were detected for 1. The first one can be assigned to ring inversion of the five-membered Li-TMEDA rings, while the second is caused by a complete rotation of the TMEDA ligands or a ring inversion of the central four-membered C-Li-C-Li metallacycle. Fast rotation of the ligands on the NMR time scale was found for 2, while 3 shows 180° ring flips of the Li-TMEDA groups, which are characterized by an energy barrier ΔG" (317) of 64 kJ mol-1

  11. Rod shaped oxovanadium(IV) Schiff base complexes: Synthesis, mesomorphism and influence of flexible alkoxy chain lengths

    NASA Astrophysics Data System (ADS)

    Gupta, Bishop Dev; Datta, Chitraniva; Das, Gobinda; Bhattacharjee, Chira R.

    2014-06-01

    A series of oxovanadium(IV) complexes of bidentate [N,O] donor Schiff-base ligands of the type [VO(L)2], [L = N-(4-n-alkoxysalicylaldimine)-4‧-octadecyloxyaniline, n = 8, 10, 12, 14, 16 and 18] have been synthesized. The compounds were characterized by elemental analyses, Fourier transform infrared spectroscopy (FTIR), 1H, 13C nuclear magnetic resonance (NMR), ultraviolet-visible spectroscopy (UV-Vis), and fast atom bombardment (FAB) mass spectrometry. The mesomorphic behavior of the compounds was studied by polarized optical microscopy (POM) and differential scanning calorimetry (DSC). The ligands and complexes are all thermally stable exhibiting smectic mesomorphism. The ligands 8-OR to16-OR show SmC phase at ∼113-118 °C and an unidentified SmX phase reminiscent of soft crystal at ∼77-91 °C whereas the complexes all showed SmA phases. Interestingly the complexes with C10 and C12 alkoxy chain length exhibited additionally SmC phases also. The melting points of the ligands linearly increases whereas mesophase to isotropic transition temperature decreases as a function of increasing carbon chain length of alkoxy arm while no trend was apparently noticeable for the complexes.

  12. A Nonbactericidal Zinc-Complexing Ligand as a Biofilm Inhibitor: Structure-Guided Contrasting Effects on Staphylococcus aureus Biofilm.

    PubMed

    Kapoor, Vidushi; Rai, Rajanikant; Thiyagarajan, Durairaj; Mukherjee, Sandipan; Das, Gopal; Ramesh, Aiyagari

    2017-08-04

    Zinc-complexing ligands are prospective anti-biofilm agents because of the pivotal role of zinc in the formation of Staphylococcus aureus biofilm. Accordingly, the potential of a thiosemicarbazone (compound C1) and a benzothiazole-based ligand (compound C4) in the prevention of S. aureus biofilm formation was assessed. Compound C1 displayed a bimodal activity, hindering biofilm formation only at low concentrations and promoting biofilm growth at higher concentrations. In the case of C4, a dose-dependent inhibition of S. aureus biofilm growth was observed. Atomic force microscopy analysis suggested that at higher concentrations C1 formed globular aggregates, which perhaps formed a substratum that favored adhesion of cells and biofilm formation. In the case of C4, zinc supplementation experiments validated zinc complexation as a plausible mechanism of inhibition of S. aureus biofilm. Interestingly, C4 was nontoxic to cultured HeLa cells and thus has promise as a therapeutic anti-biofilm agent. The essential understanding of the structure-driven implications of zinc-complexing ligands acquired in this study might assist future screening regimes for identification of potent anti-biofilm agents. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Irradiation of breast cancer cells enhances CXCL16 ligand expression and induces the migration of natural killer cells expressing the CXCR6 receptor.

    PubMed

    Yoon, Mee Sun; Pham, Chanh Tin; Phan, Minh-Trang Thi; Shin, Dong-Jun; Jang, Youn-Young; Park, Min-Ho; Kim, Sang-Ki; Kim, Seokho; Cho, Duck

    2016-12-01

    Few studies have examined the migration pattern of natural killer (NK) cells, especially after radiation treatment for cancer. We investigated whether irradiation can modulate the expression of chemokines in cancer cells and the migration of NK cells to irradiated tumor cells. The expression of chemokine receptors (CXCR3, CXCR4 and CXCR6) on interleukin-2 (IL-2)/IL-15-activated NK cells was assessed using flow cytometry. Related chemokine ligands (CXCL11, CXCL12 and CXCL16) in human breast cancer cell lines (MCF7, SKBR3 and MDA-MB231) irradiated at various doses were assessed using reverse transcription-polymerase chain reaction (RT-PCR), fluorescence-activated cell sorting (FACS) and enzyme-linked immunosorbent assay (ELISA). The cell-free culture supernatant was collected 96 h after irradiation of breast cancer cell lines for migration and blocking assays. The activated NK cells expressed CXCR6. Expression of the CXCR6 ligand CXCL16 increased in a time- and dose-dependent manner in all analyzed cancer cell lines. CXCL16 expression was statistically significantly enhanced in all breast cancer cell lines on day 3 after 20 Gy irradiation. Activated NK cells migration correlated with CXCL16 concentration (R 2  = 0.91; P <0.0001). Significantly enhanced migration of NK cells to irradiated cancer cells was observed for a dose of 20 Gy in MCF7 (P = 0.043) and SKBR3 (P = 0.043) cells, but not in MDA-MB231 (P = 0.225) cells. A blocking assay using a CXCR6 antibody showed a significant decrease in the migration of activated NK cells in all cancer cell lines. Our data indicate that irradiation induces CXCL16 chemokine expression in cancer cells and enhances the migration of activated NK cells expressing CXCR6 to irradiated breast cancer cells. These results suggest that radiation would improve the anti-tumor effect of NK cells through enhanced migration of NK cells to tumor site for the treatment of patients with breast cancer. Copyright © 2016 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  14. Fragment-Based Optimization of Small Molecule CXCL12 Inhibitors for Antagonizing the CXCL12/CXCR4 Interaction

    PubMed Central

    Ziarek, Joshua J.; Liu, Yan; Smith, Emmanuel; Zhang, Guolin; Peterson, Francis C.; Chen, Jun; Yu, Yongping; Chen, Yu; Volkman, Brian F.; Li, Rongshi

    2013-01-01

    The chemokine CXCL12 and its G protein-coupled receptor (GPCR) CXCR4 are high-priority clinical targets because of their involvement in metastatic cancers (also implicated in autoimmune disease and cardiovascular disease). Because chemokines interact with two distinct sites to bind and activate their receptors, both the GPCRs and chemokines are potential targets for small molecule inhibition. A number of chemokines have been validated as targets for drug development, but virtually all drug discovery efforts focus on the GPCRs. However, all CXCR4 receptor antagonists with the exception of MSX-122 have failed in clinical trials due to unmanageable toxicities, emphasizing the need for alternative strategies to interfere with CXCL12/CXCR4-guided metastatic homing. Although targeting the relatively featureless surface of CXCL12 was presumed to be challenging, focusing efforts at the sulfotyrosine (sY) binding pockets proved successful for procuring initial hits. Using a hybrid structure-based in silico/NMR screening strategy, we recently identified a ligand that occludes the receptor recognition site. From this initial hit, we designed a small fragment library containing only nine tetrazole derivatives using a fragment-based and bioisostere approach to target the sY binding sites of CXCL12. Compound binding modes and affinities were studied by 2D NMR spectroscopy, X-ray crystallography, molecular docking and cell-based functional assays. Our results demonstrate that the sY binding sites are conducive to the development of high affinity inhibitors with better ligand efficiency (LE) than typical protein-protein interaction inhibitors (LE ≤ 0.24). Our novel tetrazole-based fragment 18 was identified to bind the sY21 site with a Kd of 24 μM (LE = 0.30). Optimization of 18 yielded compound 25 which specifically inhibits CXCL12-induced migration with an improvement in potency over the initial hit 9. The fragment from this library that exhibited the highest affinity and ligand efficiency (11: Kd = 13 μM, LE = 0.33) may serve as a starting point for development of inhibitors targeting the sY12 site. PMID:23368099

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Mingyang; Serna, Pedro; Lu, Jing

    The chemistry of zeolite-supported site-isolated cobalt, rhodium, and iridium complexes that are essentially molecular was investigated with density functional theory (DFT) and the results compared with experimentally determined spectra characterizing rhodium and iridium species formed by the reactions of Rh(C 2H 4) 2(acac) and Ir(C 2H 4) 2(acac) (acac = acetylacetonate) with acidic zeolites such as dealuminated HY zeolite. The experimental results characterize ligand exchange reactions and catalytic reactions of adsorbed ligands, including olefin hydrogenation and dimerization. Two molecular models were used to characterize various binding sites of the metal complexes in the zeolites, and the agreement between experimental andmore » calculated infrared frequencies and metal-ligand distances determined by extended X-ray absorption fine structure spectroscopy was generally very good. The calculated structures and energies indicate a metal-support-oxygen (M(I)-O) coordination number of two for most of the supported complexes and a value of three when the ligands include the radicals C 2H 5 or H. The results characterizing various isomers of the supported metal complexes incorporating hydrocarbon ligands indicate that some carbene and carbyne ligands could form. Ligand bond dissociation energies (LDEs) are reported to explain the observed reactivity trends. The experimental observations of a stronger M-CO bond than M-(C 2H 4) bond for both Ir and Rh match the calculated LDEs, which show that the single-ligand LDEs of the mono and dual-ligand complexes for CO are similar to 12 and similar to 15 kcal/mol higher in energy (when the metal is Rh) and similar to 17 and similar to 20 kcal/mol higher (when the metal is Ir) than the single-ligand LDEs of the mono and dual ligand complexes for C 2H 4, respectively. The results provide a foundation for the prediction of the catalytic properties of numerous supported metal complexes, as summarized in detail here.« less

  16. CTC-Endothelial Cell Interactions during Metastasis

    DTIC Science & Technology

    2013-04-01

    endothelial cells via a variety of E-selectin ligands ( ESL ). These ESLs express a unique carbohydrate motif, sLex, which appears to be required for... ESL binding. The chemokine receptor CXCR4 has also been reported to supporting transendothelial migration of prostate cells through bone marrow

  17. Expression of CXCL4 in microglia in vitro and in vivo and its possible signaling through CXCR3.

    PubMed

    de Jong, Eiko K; de Haas, Alexander H; Brouwer, Nieske; van Weering, Hilmar R J; Hensens, Marjolein; Bechmann, Ingo; Pratley, Pierre; Wesseling, Evelyn; Boddeke, Hendrikus W G M; Biber, Knut

    2008-06-01

    Signaling through chemokine receptor CXCR3 in the brain has been implicated in various brain diseases, as CXCR3 and its ligands are found under these conditions. Recently, a new chemokine ligand for CXCR3 was reported. In humans, an alternatively spliced variant of CXCR3 expressed on microvascular endothelial cells, named CXCR3b, was shown to bind CXCL4. In the periphery, the cellular expression and functions of CXCL4 are well described but in the brain its expression and function are unknown. Here, we show that brain microglia are a cellular source of CXCL4 in vitro and in vivo under neurodegenerating conditions. Microglial migration induced by CXCL4 is absent in CXCR3-deficient microglia, indicating a role of CXCR3. CXCL4 furthermore attenuates lipopolysaccharide-induced microglial phagocytosis and nitric oxide production in microglia and BV-2 cells. Based on these findings, it is proposed that locally released CXCL4 may control microglia responses.

  18. Genome-wide association study of dermatomyositis reveals genetic overlap with other autoimmune disorders.

    PubMed

    Miller, Frederick W; Cooper, Robert G; Vencovský, Jiří; Rider, Lisa G; Danko, Katalin; Wedderburn, Lucy R; Lundberg, Ingrid E; Pachman, Lauren M; Reed, Ann M; Ytterberg, Steven R; Padyukov, Leonid; Selva-O'Callaghan, Albert; Radstake, Timothy R D J; Isenberg, David A; Chinoy, Hector; Ollier, William E R; O'Hanlon, Terrance P; Peng, Bo; Lee, Annette; Lamb, Janine A; Chen, Wei; Amos, Christopher I; Gregersen, Peter K

    2013-12-01

    To identify new genetic associations with juvenile and adult dermatomyositis (DM). We performed a genome-wide association study (GWAS) of adult and juvenile DM patients of European ancestry (n = 1,178) and controls (n = 4,724). To assess genetic overlap with other autoimmune disorders, we examined whether 141 single-nucleotide polymorphisms (SNPs) outside the major histocompatibility complex (MHC) locus, and previously associated with autoimmune diseases, predispose to DM. Compared to controls, patients with DM had a strong signal in the MHC region consisting of GWAS-level significance (P < 5 × 10(-8)) at 80 genotyped SNPs. An analysis of 141 non-MHC SNPs previously associated with autoimmune diseases showed that 3 SNPs linked with 3 genes were associated with DM, with a false discovery rate (FDR) of <0.05. These genes were phospholipase C-like 1 (PLCL1; rs6738825, FDR = 0.00089), B lymphoid tyrosine kinase (BLK; rs2736340, FDR = 0.0031), and chemokine (C-C motif) ligand 21 (CCL21; rs951005, FDR = 0.0076). None of these genes was previously reported to be associated with DM. Our findings confirm the MHC as the major genetic region associated with DM and indicate that DM shares non-MHC genetic features with other autoimmune diseases, suggesting the presence of additional novel risk loci. This first identification of autoimmune disease genetic predispositions shared with DM may lead to enhanced understanding of pathogenesis and novel diagnostic and therapeutic approaches. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  19. Renal cytokines improve early after bariatric surgery.

    PubMed

    Bueter, M; Dubb, S S; Gill, A; Joannou, L; Ahmed, A; Frankel, A H; Tam, F W K; le Roux, C W

    2010-12-01

    Bariatric surgery has been suggested to improve arterial hypertension and renal function. This prospective controlled observational study aimed to investigate changes in renal inflammation, renal function and arterial blood pressure before and after bariatric surgery. Blood pressure was measured, and urine and blood samples were collected from 34 morbidly obese patients before and 4 weeks after bariatric surgery. Serum levels of cystatin C, creatinine, albumin, cholesterol and C-reactive protein (CRP) were measured, along with urinary cytokine/creatinine ratios for macrophage migration inhibitory factor (MIF), monocyte chemotactic protein (MCP) 1, chemokine ligand (CCL) 18 and CCL-15. Mean(s.e.m.) bodyweight dropped from 124·1(2·6) to 114·8(2·4) kg (P < 0·001) and mean arterial blood pressure decreased from 105·7(1·8) to 95·5(1·2) mmHg (P < 0·001) in 4 weeks. Systemic and urinary inflammatory markers improved, with a reduction in serum CRP level (P < 0·001), and decreased urinary MIF/creatinine (P < 0·001), MCP-1/creatinine (P < 0·001) and CCL-18/creatinine (P = 0·003) ratios. In contrast, urinary CCL-15/creatinine ratios did not change and the glomerular filtration rate, measured by serum cystatin C, was unchanged (P = 0·615). Surgically induced weight loss contributed to a decrease in blood pressure and markers of renal inflammation. The reduced levels of CRP and urinary cytokines suggest that bariatric surgery attenuates systemic and renal inflammatory status. Copyright © 2010 British Journal of Surgery Society Ltd. Published by John Wiley & Sons, Ltd.

  20. Serum Paraoxonase-1 Concentration as a Potential Predictor of Urinary Bladder Cancer Recurrence. A Five Year Follow-Up Study.

    PubMed

    Iftimie, Simona; García-Heredia, Anabel; Pujol-Bosch, Francesc; Pont-Salvadó, Antoni; López-Azcona, Ana Felisa; Hernández-Aguilera, Anna; Cabré, Noemí; Luciano-Mateo, Fedra; Fort-Gallifa, Isabel; Castro, Antoni; Camps, Jordi; Joven, Jorge

    2018-04-23

    This study provides preliminary information on the usefulness of measuring serum paraoxonase-1 (PON1) concentration and activity (and other inflammatory markers) to predict tumor recurrence in patients with urinary bladder cancer. We studied a total of 39 hospitalized patients in whom the diagnosis of urinary bladder cancer was confirmed by transurethral resection. After five years of follow-up, 29 patients presented with tumor recurrence. As control subjects, we also studied 61 healthy subjects and a further 132 hospitalized patients who had a urinary catheter-related infection due to causes other than cancer. Results showed that urinary bladder patients had lower serum PON1 concentration and activity, and higher chemokine (C-C motif) ligand 2, C-reactive protein, and procalcitonin concentrations than the control individuals. Patients with tumor recurrence had significantly lower serum PON1 concentration than patients without tumor recurrence. The mean area under the curve of the receiver operating characteristics plot for serum PON1 concentration in discriminating patients with and those without tumor recurrence was 0.755 and the best combination of sensitivity and specificity was obtained at PON1 = 100 mg/L (0.72 and 0.80, respectively). Establishing this value as a cut-off, positive predictive value was = 0.91, and negative predictive value was = 0.50. These results suggest that the measurement of serum PON1 concentration may be a high-sensitivity marker of tumor recurrence in urinary bladder cancer patients. Copyright © 2018 IMSS. Published by Elsevier Inc. All rights reserved.

  1. Optimized hydrophobic interactions and hydrogen bonding at the target-ligand interface leads the pathways of drug-designing.

    PubMed

    Patil, Rohan; Das, Suranjana; Stanley, Ashley; Yadav, Lumbani; Sudhakar, Akulapalli; Varma, Ashok K

    2010-08-16

    Weak intermolecular interactions such as hydrogen bonding and hydrophobic interactions are key players in stabilizing energetically-favored ligands, in an open conformational environment of protein structures. However, it is still poorly understood how the binding parameters associated with these interactions facilitate a drug-lead to recognize a specific target and improve drugs efficacy. To understand this, comprehensive analysis of hydrophobic interactions, hydrogen bonding and binding affinity have been analyzed at the interface of c-Src and c-Abl kinases and 4-amino substituted 1H-pyrazolo [3, 4-d] pyrimidine compounds. In-silico docking studies were performed, using Discovery Studio software modules LigandFit, CDOCKER and ZDOCK, to investigate the role of ligand binding affinity at the hydrophobic pocket of c-Src and c-Abl kinase. Hydrophobic and hydrogen bonding interactions of docked molecules were compared using LigPlot program. Furthermore, 3D-QSAR and MFA calculations were scrutinized to quantify the role of weak interactions in binding affinity and drug efficacy. The in-silico method has enabled us to reveal that a multi-targeted small molecule binds with low affinity to its respective targets. But its binding affinity can be altered by integrating the conformationally favored functional groups at the active site of the ligand-target interface. Docking studies of 4-amino-substituted molecules at the bioactive cascade of the c-Src and c-Abl have concluded that 3D structural folding at the protein-ligand groove is also a hallmark for molecular recognition of multi-targeted compounds and for predicting their biological activity. The results presented here demonstrate that hydrogen bonding and optimized hydrophobic interactions both stabilize the ligands at the target site, and help alter binding affinity and drug efficacy.

  2. Optimized Hydrophobic Interactions and Hydrogen Bonding at the Target-Ligand Interface Leads the Pathways of Drug-Designing

    PubMed Central

    Stanley, Ashley; Yadav, Lumbani; Sudhakar, Akulapalli; Varma, Ashok K.

    2010-01-01

    Background Weak intermolecular interactions such as hydrogen bonding and hydrophobic interactions are key players in stabilizing energetically-favored ligands, in an open conformational environment of protein structures. However, it is still poorly understood how the binding parameters associated with these interactions facilitate a drug-lead to recognize a specific target and improve drugs efficacy. To understand this, comprehensive analysis of hydrophobic interactions, hydrogen bonding and binding affinity have been analyzed at the interface of c-Src and c-Abl kinases and 4-amino substituted 1H-pyrazolo [3, 4-d] pyrimidine compounds. Methodology In-silico docking studies were performed, using Discovery Studio software modules LigandFit, CDOCKER and ZDOCK, to investigate the role of ligand binding affinity at the hydrophobic pocket of c-Src and c-Abl kinase. Hydrophobic and hydrogen bonding interactions of docked molecules were compared using LigPlot program. Furthermore, 3D-QSAR and MFA calculations were scrutinized to quantify the role of weak interactions in binding affinity and drug efficacy. Conclusions The in-silico method has enabled us to reveal that a multi-targeted small molecule binds with low affinity to its respective targets. But its binding affinity can be altered by integrating the conformationally favored functional groups at the active site of the ligand-target interface. Docking studies of 4-amino-substituted molecules at the bioactive cascade of the c-Src and c-Abl have concluded that 3D structural folding at the protein-ligand groove is also a hallmark for molecular recognition of multi-targeted compounds and for predicting their biological activity. The results presented here demonstrate that hydrogen bonding and optimized hydrophobic interactions both stabilize the ligands at the target site, and help alter binding affinity and drug efficacy. PMID:20808434

  3. Ruthenium(II) bipyridine complexes bearing new keto-enol azoimine ligands: synthesis, structure, electrochemistry and DFT calculations.

    PubMed

    Al-Noaimi, Mousa; Awwadi, Firas F; Mansi, Ahmad; Abdel-Rahman, Obadah S; Hammoudeh, Ayman; Warad, Ismail

    2015-01-25

    The novel azoimine ligand, Ph-NH-N=C(COCH3)-NHPh(C≡CH) (H2L), was synthesized and its molecular structure was determined by X-ray crystallography. Catalytic hydration of the terminal acetylene of H2L in the presence of RuCl3·3H2O in ethanol at reflux temperature yielded a ketone (L1=Ph-N=N-C(COCH3)=N-Ph(COCH3) and an enol (L2=Ph-N=N-C(COCH3)=N-PhC(OH)=CH2) by Markovnikov addition of water. Two mixed-ligand ruthenium complexes having general formula, trans-[Ru(bpy)(Y)Cl2] (1-2) (where Y=L1 (1) and Y=L2 (2), bpy is 2.2'-bipyrdine) were achieved by the stepwise addition of equimolar amounts of (H2L) and bpy ligands to RuCl3·3H2O in absolute ethanol. Theses complexes were characterized by elemental analyses and spectroscopic (IR, UV-Vis, and NMR (1D (1)H NMR, (13)C NMR, (DEPT-135), (DEPT-90), 2D (1)H-(1)H and (13)C-(1)H correlation (HMQC) spectroscopy)). The two complexes exhibit a quasi-reversible one electron Ru(II)/Ru(III) oxidation couple at 604 mV vs. ferrocene/ferrocenium (Cp2Fe(0/+)) couple along with one electron ligand reduction at -1010 mV. The crystal structure of complex 1 showed that the bidentate ligand L1 coordinates to Ru(II) by the azo- and imine-nitrogen donor atoms. The complex adopts a distorted trans octahedral coordination geometry of chloride ligands. The electronic spectra of 1 and 1+ in dichloromethane have been modeled by time-dependent density functional theory (TD-DFT). Copyright © 2014 Elsevier B.V. All rights reserved.

  4. The Activating Human NK Cell Receptor KIR2DS2 Recognizes a β2-Microglobulin-Independent Ligand on Cancer Cells.

    PubMed

    Thiruchelvam-Kyle, Lavanya; Hoelsbrekken, Sigurd E; Saether, Per C; Bjørnsen, Elisabeth Gyllensten; Pende, Daniela; Fossum, Sigbjørn; Daws, Michael R; Dissen, Erik

    2017-04-01

    The functions of activating members of the killer cell Ig-like receptor (KIR) family are not fully understood, as the ligands for these receptors are largely unidentified. In this study, we report that KIR2DS2 reporter cells recognize a ligand expressed by cancer cell lines. All cancer targets recognized by KIR2DS2 were also recognized by KIR2DL2 and KIR2DL3 reporters. Trogocytosis of membrane proteins from the cancer targets was observed with responding reporter cells, indicating the formation of KIR2DS2 ligand-specific immunological synapses. HLA-C typing of target cells showed that KIR2DS2 recognition was independent of the HLA C1 or C2 group, whereas targets cells that were only recognized by KIR2DL3 expressed C1 group alleles. Anti-HLA class I Abs blocked KIR2DL3 responses toward C1-expressing targets, but they did not block KIR2DS2 recognition of cancer cells. Small interfering RNA knockdown of β 2 -microglobulin reduced the expression of class I H chain on the cancer targets by >97%, but it did not reduce the KIR2DS2 reporter responses, indicating a β 2 -microglobulin-independent ligand for KIR2DS2. Importantly, KIR2DL3 responses toward some KIR2DS2 ligand-expressing cells were also undiminished after β 2 -microglobulin knockdown, and they were not blocked by anti-HLA class I Abs, suggesting that KIR2DL3, in addition to the traditional HLA-C ligands, can bind to the same β 2 -microglobulin-independent ligand as KIR2DS2. These observations indicate the existence of a novel, presently uncharacterized ligand for the activating NK cell receptor KIR2DS2. Molecular identification of this ligand may lead to improved KIR-HLA mismatching in hematopoietic stem cell transplantation therapy for leukemia and new, more specific NK cell-based cancer therapies. Copyright © 2017 by The American Association of Immunologists, Inc.

  5. CXCR4/CXCL12 Axis in Non Small Cell Lung Cancer (NSCLC) Pathologic Roles and Therapeutic Potential

    PubMed Central

    Wald, Ori; Shapira, Oz M.; Izhar, Uzi

    2013-01-01

    Lung cancer is the second most common malignancy and the leading cause of cancer-related death in the western world. Moreover, despite advances in surgery, chemotherapy and radiotherapy, the death rate from lung cancer remains high and the reported overall five-year survival rate is only 15%. Thus, novel treatments for this devastating disease are urgently needed. Chemokines, a family of 48 chemotactic cytokines interacts with their 7 transmembrane G-protein-coupled receptors, to guide immune cell trafficking in the body under both physiologic and pathologic conditions. Tumor cells, which express a relatively restricted repertoire of chemokine and chemokine receptors, utilize and manipulate the chemokine system in a manner that benefits both local tumor growth and distant dissemination. Among the 19 chemokine receptors, CXCR4 is the receptor most widely expressed by malignant tumors and whose role in tumor biology is most thoroughly studied. The chemokine CXCL12, which is the sole ligand of CXCR4, is highly expressed in primary lung cancer as well as in the bone marrow, liver, adrenal glands and brain, which are all sites for lung cancer metastasis. This review focuses on the pathologic role of the CXCR4/CXCL12 axis in NSCLC and on the potential therapeutic implication of targeting this axis for the treatment of NSCLC. PMID:23382783

  6. Crystal structure of human complement protein C8{gamma} at 1.2 {Angstrom} resolution reveals a lipocalin fold and a distinct ligand binding site.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ortlund, E.; Parker, C. L.; Schreck, A. F.

    2002-01-01

    C8gamma is a 22-kDa subunit of human C8, which is one of five components of the cytolytic membrane attack complex of complement (MAC). C8gamma is disulfide-linked to a C8alpha subunit that is noncovalently associated with a C8beta chain. In the present study, the three-dimensional structure of recombinant C8gamma was determined by X-ray diffraction to 1.2 A resolution. The structure displays a typical lipocalin fold forming a calyx with a distinct binding pocket that is indicative of a ligand-binding function for C8gamma. When compared to other lipocalins, the overall structure is most similar to neutrophil gelatinase associated lipocalin (NGAL), a proteinmore » released from granules of activated neutrophils. Notable differences include a much deeper binding pocket in C8gamma as well as variation in the identity and position of residues lining the pocket. In C8gamma, these residues allow ligand access to a large hydrophobic cavity at the base of the calyx, whereas corresponding residues in NGAL restrict access. This suggests the natural ligands for C8gamma and NGAL are significantly different in size. Cys40 in C8gamma, which forms the disulfide bond to C8alpha, is located in a partially disordered loop (loop 1, residues 38-52) near the opening of the calyx. Access to the calyx may be regulated by movement of this loop in response to conformational changes in C8alpha during MAC formation.« less

  7. FT-Raman and FT-IR spectra of some heterobimetallic complexes with phenylcyclopentadienyl ligands

    NASA Astrophysics Data System (ADS)

    Nie, Chong-Shi; Guo, Jianhua; Qian, Changtao; Tan, Ying

    1996-11-01

    The FT-Raman and selected IR spectra of 14 heterobimetallic complexes of (CO) 3CrC 6H 5-C 5H 4M(CO) n(NO) mX (M = transition metal, X = other ligands) are reported. FT-Raman exhibits distinct strong characteristic bands of coordinated C 6H 5-C 5H 4 ligand ring deformation near 1540, 1490 and 1280 cm -1 and the coordinated phenyl ring deformation mode near 1000 cm -1, which are negligible in IR spectra. It is also easy to find the M-CO stretching and M-C-O bending as well as phenyl-M stretching bands in the FT-Raman spectra. The v(CO) IR absorptions in THF solution were reasonably assigned according to the local symmetry of the complexes.

  8. 1,1,1-tris(hydroxymethyl)ethane as a new, efficient, and versatile tripod ligand for copper-catalyzed cross-coupling reactions of aryl iodides with amides, thiols, and phenols.

    PubMed

    Chen, Yao-Jung; Chen, Hsin-Hung

    2006-11-23

    1,1,1-tris(hydroxymethyl)ethane was presented as a new, efficient, and versatile tridentate O-donor ligand suitable for the copper-catalyzed formation of C-N, C-S, and C-O bonds. This inexpensive and commercially available tripod ligand has been demonstrated to facilitate the copper-catalyzed cross-coupling reactions of aryl iodides with amides, thiols, and phenols to afford the corresponding desired products in good to excellent yields. [reaction: see text].

  9. The Correlation of Serums CCL11, CCL17, CCL26, and CCL27 and Disease Severity in Patients with Urticaria.

    PubMed

    Lu, Tao; Jiao, Xiaoyang; Si, Mengya; He, Ping; Zou, Jinbo; Zhang, Shuping; Zeng, Kang

    2016-01-01

    Chemokines may be involved in the pathogenesis of urticaria, but their correlation with disease severity as well as eruption type is unclear. The aim of this study was to explore the expression of chemokines in patients with urticaria. The association between disease severity and levels of chemokines was analysed. Serums CCL11, CCL17, CCL26, and CCL27, D-dimer, C-reactive protein, and total IgE were measured in 51 patients with urticaria and in 25 healthy control subjects. Serums CCL11, CCL17, CCL26, and CCL27 were significantly higher in patients with urticaria than in the healthy controls (P < 0.05). Serum CCL27 strongly correlated with urticarial disease severity. Serums CCL17, CCL26, and CCL27 significantly correlated with D-dimer, while innercorrelations were noted among the chemokines. Our findings reveal that chemokines participate in the pathogenesis of urticaria. Further study in larger cohort is needed to testify whether they could be the biomarkers for predicting the severity of urticaria.

  10. The chemokine receptor CXCR6 controls the functional topography of interleukin-22 producing intestinal innate lymphoid cells.

    PubMed

    Satoh-Takayama, Naoko; Serafini, Nicolas; Verrier, Thomas; Rekiki, Abdessalem; Renauld, Jean-Christophe; Frankel, Gad; Di Santo, James P

    2014-11-20

    Interleukin-22 (IL-22) plays a critical role in mucosal defense, although the molecular mechanisms that ensure IL-22 tissue distribution remain poorly understood. We show that the CXCL16-CXCR6 chemokine-chemokine receptor axis regulated group 3 innate lymphoid cell (ILC3) diversity and function. CXCL16 was constitutively expressed by CX3CR1(+) intestinal dendritic cells (DCs) and coexpressed with IL-23 after Citrobacter rodentium infection. Intestinal ILC3s expressed CXCR6 and its ablation generated a selective loss of the NKp46(+) ILC3 subset, a depletion of intestinal IL-22, and the inability to control C. rodentium infection. CD4(+) ILC3s were unaffected by CXCR6 deficiency and remained clustered within lymphoid follicles. In contrast, the lamina propria of Cxcr6(-/-) mice was devoid of ILC3s. The loss of ILC3-dependent IL-22 epithelial stimulation reduced antimicrobial peptide expression that explained the sensitivity of Cxcr6(-/-) mice to C. rodentium. Our results delineate a critical CXCL16-CXCR6 crosstalk that coordinates the intestinal topography of IL-22 secretion required for mucosal defense. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Ligand-Promoted Rh(III)-Catalyzed Coupling of Aryl C-H Bonds with Arylboron Reagents.

    PubMed

    Wang, Huai-Wei; Cui, Pei-Pei; Lu, Yi; Sun, Wei-Yin; Yu, Jin-Quan

    2016-04-15

    Rhodium(III)-catalyzed C-H arylation of arenes with phenylboronic acid pinacol esters has been achieved using a readily removable N-pentafluorophenylbenzamide directing group for the first time. The use of a bidentate phosphine ligand (Binap) significantly increased the yield of the cross-coupling of C-H bonds with organoboron reagents.

  12. Changes in expression of T-helper (Th) 1- and Th2-associated chemokine receptors on peripheral blood lymphocytes and plasma concentrations of their ligands, interferon-inducible protein-10 and thymus and activation-regulated chemokine, after antithyroid drug administration in hyperthyroid patients with Graves' disease.

    PubMed

    Inukai, Yoshihisa; Momobayashi, Atsushi; Sugawara, Naoto; Aso, Yoshimasa

    2007-06-01

    Although Graves' disease is considered an autoantibody-mediated, T-helper 2 (Th2)-dominant disease, Th1-dominance may prevail in its initial phase. We longitudinally investigated Th1/Th2 balance in untreated hyperthyroid patients with Graves' disease after treatment of methimazole (MMI), an antithyroid drug. University clinic outpatients were studied prospectively. Subjects included 23 untreated hyperthyroid patients with Graves' disease and 17 age-matched control subjects. Before and after treatment, we measured Th1- and Th2-associated chemokine receptors (CXCR)3 and CCR4, on peripheral blood lymphocytes using flow cytometry, as well as plasma concentrations of their ligands, interferon-inducible protein (IP)-10 and thymus and activation-regulated chemokine (TARC). The percentage of CXCR3-expressing cells among CD4+T lymphocytes and plasma IP-10 was significantly higher in hyperthyroid Graves' disease patients than in controls. At 12 and 24 weeks after initiation of MMI, percentage of CXCR3-expressing CD4+T lymphocytes had decreased significantly, while the percentage of CCR4-expressing CD4+T lymphocytes had increased significantly at 24 weeks. The CXCR3/CCR4 ratio had decreased significantly at 24 weeks. Plasma concentrations of IP-10 had decreased significantly at 12 and 24 weeks. Plasma concentrations of TARC also had decreased significantly at 24 weeks. In hyperthyroid patients with Graves' disease in the active phase, Th1 cells rather than Th2 cells predominated among peripheral blood lymphocytes. After initiation of MMI, an ongoing transition from Th1 to Th2 dominance occurred.

  13. Antimycotics suppress the Malassezia extract-induced production of CXC chemokine ligand 10 in human keratinocytes.

    PubMed

    Hau, Carren S; Kanda, Naoko; Makimura, Koichi; Watanabe, Shinichi

    2014-02-01

    Malassezia, a lipophilic yeast, exacerbates atopic dermatitis. Malassezia products can penetrate the disintegrated stratum corneum and encounter subcorneal keratinocytes in the skin of atopic dermatitis patients. Type 1 helper T (Th1) cells infiltrate chronic lesions with atopic dermatitis, and antimycotic agents improve its symptoms. We aimed to identify Malassezia-induced chemokines in keratinocytes and examine whether antimycotics suppressed this induction. Normal human keratinocytes were incubated with a Malassezia restricta extract and antimycotics. Chemokine expression was analyzed by enzyme-linked immunosorbent assays and real-time polymerase chain reaction. Signal transducer and activator of transcription (STAT)1 activity was examined by luciferase assays. The tyrosine-phosphorylation of STAT1 was analyzed by western blotting. The M. restricta extract increased the mRNA and protein expression of Th1-attracting CXC chemokine ligand (CXCL)10 and STAT1 activity and phosphorylation in keratinocytes, which was suppressed by a Janus kinase inhibitor. The antimycotics itraconazole, ketoconazole, luliconazole, terbinafine, butenafine and amorolfine suppressed M. restricta extract-induced CXCL10 mRNA and protein expression and STAT1 activity and phosphorylation. These effects were similarly induced by 15-deoxy-Δ-(12,14) -prostaglandin J2 (15d-PGJ2 ), a prostaglandin D2 metabolite. Antimycotics increased the release of 15d-PGJ2 from keratinocytes. The antimycotic-induced suppression of CXCL10 production and STAT1 activity was counteracted by a lipocalin-type prostaglandin D synthase inhibitor. The antimycotics itraconazole, ketoconazole, luliconazole, terbinafine, butenafine and amorolfine may suppress the M. restricta-induced production of CXCL10 by inhibiting STAT1 through an increase in 15d-PGJ2 production in keratinocytes. These antimycotics may block the Th1-mediated inflammation triggered by Malassezia in the chronic phase of atopic dermatitis. © 2014 Japanese Dermatological Association.

  14. Peroxisome proliferator-activated receptor gamma activators affect the maturation of human monocyte-derived dendritic cells.

    PubMed

    Gosset, P; Charbonnier, A S; Delerive, P; Fontaine, J; Staels, B; Pestel, J; Tonnel, A B; Trottein, F

    2001-10-01

    Peroxisome proliferator-activated receptor gamma (PPARgamma ), a member of the nuclear receptor superfamily, has recently been described as a modulator of macrophage functions and as an inhibitor of T cell proliferation. Here, we investigated the role of PPARgamma in dendritic cells (DC), the most potent antigen-presenting cells. We showed that PPARgamma is highly expressed in immature human monocyte-derived DC (MDDC) and that it may affect the immunostimulatory function of MDDC stimulated with lipopolysaccharide (LPS) or via CD40 ligand (CD40L). We found that the synthetic PPARgamma agonist rosiglitazone (as well as pioglitazone and troglitazone) significantly increases on LPS- and CD40L-activated MDDC, the surface expression of CD36 (by 184% and 104%, respectively) and CD86 (by 54% and 48%), whereas it reduces the synthesis of CD80 (by 42% and 42%). Moreover, activation of PPARgamma resulted in a dramatic decreased secretion of the Th1-promoting factor IL-12 in LPS- and CD40L-stimulated cells (by 47% and 62%), while the production of IL-1beta, TNF-alpha, IL-6 and IL-10 was unaffected. Finally, PPARgamma ligands down-modulate the synthesis of IFN-gamma -inducible protein-10 (recently termed as CXCL10) and RANTES (CCL5), both chemokines involved in the recruitment of Th1 lymphocytes (by 49% and 30%), but not the levels of the Th2 cell-attracting chemokines,macrophage-derived chemokine (CCL22) and thymus and activation regulated chemokine (CCL17), in mature MDDC. Taken together, our data suggest that activation of PPARgamma in human DC may have an impact in the orientation of primary and secondary immune responses by favoring type 2 responses.

  15. Recombinant guinea pig CCL5 (RANTES) differentially modulates cytokine production in alveolar and peritoneal macrophages.

    PubMed

    Skwor, Troy A; Cho, Hyosun; Cassidy, Craig; Yoshimura, Teizo; McMurray, David N

    2004-12-01

    The CC chemokine ligand 5 (CCL5; regulated on activation, normal T expressed and secreted) is known to recruit and activate leukocytes; however, its role in altering the responses of host cells to a subsequent encounter with a microbial pathogen has rarely been studied. Recombinant guinea pig (rgp)CCL5 was prepared, and its influence on peritoneal and alveolar macrophage activation was examined by measuring cytokine and chemokine mRNA expression in cells stimulated with rgpCCL5 alone or exposed to rgpCCL5 prior to lipopolysaccharide (LPS) stimulation. Levels of mRNA for guinea pig tumor necrosis factor alpha (TNF-alpha), interleukin (IL)-1beta, CCL2 (monocyte chemoattractant protein-1), and CXC chemokine ligand 8 (IL-8) were analyzed by reverse transcription followed by real-time polymerase chain reaction analysis using SYBR Green. Bioactive TNF-alpha protein concentration was measured using the L929 bioassay. Both macrophage populations displayed significant enhancement of all the genes and TNF-alpha protein levels when stimulated with rgpCCL5, except for CCL2 in alveolar macrophages. When peritoneal or alveolar macrophages were pretreated with rgpCCL5 for 2 h and then exposed to low concentrations of LPS, diminished cytokine and chemokine mRNA levels were apparent at 6 h compared with LPS alone. At the protein level, there was a reduction in TNF-alpha protein at 6 h in the CCL5-pretreated cells compared with LPS alone. These results further support a role for CCL5 in macrophage activation in addition to chemotactic properties and suggest a role in regulating the inflammatory response to LPS in the guinea pig by modulating the production of proinflammatory cytokines by macrophages.

  16. Temporal Patterns of Novel Circulating Biomarkers in IL-2-mediated Vascular Injury in the Rat.

    PubMed

    Keirstead, Natalie D; Bertinetti-Lapatki, Cristina; Knapp, Denise; Albassam, Mudher; Hughes, Valerie; Hong, Feng; Roth, Adrian B; Mikaelian, Igor

    2015-10-01

    Recombinant interleukin-2 (rIL-2) administration in oncology indications is hampered by vascular toxicity, which presents as a vascular leak syndrome. We used this aspect of the toxicity of rIL-2 to evaluate candidate biomarkers of drug-induced vascular injury (DIVI) in rats given 0.36 mg/kg rIL-2 daily. Groups of rats were given either 2 or 5 doses of rIL-2 or 5 doses of rIL-2 followed by a 7-day recovery. The histomorphologic lexicon and grading scheme developed by the Vascular Injury Working Group of the Predictive Safety Testing Consortium of the Critical Path Institute were utilized to enable semiquantitative integration with circulating biomarker levels. The administration of rIL-2 was associated with time-dependent endothelial cell hyperplasia and hypertrophy and perivascular inflammation that correlated with increases in circulating angiopoietin-2, lipocalin-2, monocyte chemotactic protein-1, tissue inhibitor of metalloproteinase-1, vascular endothelial growth factor A, E-selectin, and chemokine (C-X-C motif) ligand-1, and the microRNAs miR-21, miR-132, and miR-155. The dose groups were differentially identified by panels comprising novel candidate biomarkers and traditional hematologic parameters. These results identify biomarkers of the early stages of DIVI prior to the onset of vascular smooth muscle necrosis. © 2015 by The Author(s).

  17. Idiopathic systemic capillary leak syndrome in children.

    PubMed

    Hsu, Peter; Xie, Zhihui; Frith, Katie; Wong, Melanie; Kakakios, Alyson; Stone, Kelly D; Druey, Kirk M

    2015-03-01

    Adult subjects with systemic capillary leak syndrome (SCLS) present with acute and recurrent episodes of vascular leak manifesting as severe hypotension, hypoalbuminemia, hemoconcentration, and generalized edema. We studied clinical disease characteristics, serum cytokine profiles, and treatment modalities in a cohort of children with documented SCLS. Six children with SCLS were recruited from the United States, Australia, Canada, and Italy. Serum cytokines from SCLS subjects and a group of 10 healthy children were analyzed. Children with SCLS (aged 5-11 years old) presented with at least 1 acute, severe episode of hypotension, hypoalbuminemia, and hemoconcentration in the absence of underlying causes for these abnormalities. In contrast to what is observed in adult SCLS, identifiable infectious triggers precipitated most episodes in these children, and none of them had a monoclonal gammopathy. We found elevated levels of chemokine (C-C motif) ligand 2 (CCL2), interleukin-8, and tumor necrosis factor α in baseline SCLS sera compared with the control group. All patients are alive and well on prophylactic therapy, with 4 patients receiving intravenous or subcutaneous immunoglobulins at regular intervals. The clinical manifestations of pediatric and adult SCLS are similar, with the notable exceptions of frequent association with infections and the lack of monoclonal gammopathy. Prophylactic medication, including high dose immunoglobulins or theophylline plus verapamil, appears to be safe and efficacious therapy for SCLS in children. Copyright © 2015 by the American Academy of Pediatrics.

  18. IL-29 Enhances CXCL10 Production in TNF-α-stimulated Human Oral Epithelial Cells.

    PubMed

    Hosokawa, Yoshitaka; Hosokawa, Ikuko; Shindo, Satoru; Ozaki, Kazumi; Matsuo, Takashi

    2017-08-01

    Interleukin-29 (IL-29) is a cytokine belonging to the Type III interferon family. It was recently detected in the gingival crevicular fluid of periodontitis patients. However, the role of IL-29 in the pathogenesis of periodontal disease remains unknown. The aim of this study was to examine the effects of IL-29 on C-X-C motif chemokine ligand 10 (CXCL10) production in human oral epithelial cells. We measured CXCL10 production in TR146 cells, which is a human oral epithelial cell line, using an enzyme-linked immunosorbent assay. We used a Western blot analysis to detect IL-29 receptor expression and the phosphorylation levels of signal transduction molecules, including p38 mitogen-activated protein kinases (MAPK), signal transducer and activator of transcription 3 (STAT3), and nuclear factor (NF)- κB p65, in the TR146 cells. The TR146 cells expressed the IL-29 receptor. IL-29 induced CXCL10 production in the TR146 cells. IL-29 significantly enhanced CXCL10 production in tumor necrosis factor (TNF)-α-stimulated TR146 cells. The p38 MAPK, STAT3, and NF-κB pathways were found to be related to the IL-29-induced enhancement of CXCL10 production in TNF-α-stimulated TR146 cells. IL-29 promotes T helper 1-cell accumulation in periodontal lesions by inducing CXCL10 production in oral epithelial cells.

  19. Atf3 mutant mice show reduced axon regeneration and impaired regeneration-associated gene induction after peripheral nerve injury

    PubMed Central

    Gey, Manuel; Wanner, Renate; Schilling, Corinna; Pedro, Maria T.; Sinske, Daniela

    2016-01-01

    Axon injury in the peripheral nervous system (PNS) induces a regeneration-associated gene (RAG) response. Atf3 (activating transcription factor 3) is such a RAG and ATF3's transcriptional activity might induce ‘effector’ RAGs (e.g. small proline rich protein 1a (Sprr1a), Galanin (Gal), growth-associated protein 43 (Gap43)) facilitating peripheral axon regeneration. We provide a first analysis of Atf3 mouse mutants in peripheral nerve regeneration. In Atf3 mutant mice, facial nerve regeneration and neurite outgrowth of adult ATF3-deficient primary dorsal root ganglia neurons was decreased. Using genome-wide transcriptomics, we identified a neuropeptide-encoding RAG cluster (vasoactive intestinal peptide (Vip), Ngf, Grp, Gal, Pacap) regulated by ATF3. Exogenous administration of neuropeptides enhanced neurite growth of Atf3 mutant mice suggesting that these molecules might be effector RAGs of ATF3's pro-regenerative function. In addition to the induction of growth-promoting molecules, we present data that ATF3 suppresses growth-inhibiting molecules such as chemokine (C-C motif) ligand 2. In summary, we show a pro-regenerative ATF3 function during PNS nerve regeneration involving transcriptional activation of a neuropeptide-encoding RAG cluster. ATF3 is a general injury-inducible factor, therefore ATF3-mediated mechanisms identified herein might apply to other cell and injury types. PMID:27581653

  20. SLM Produced Porous Titanium Implant Improvements for Enhanced Vascularization and Osteoblast Seeding

    PubMed Central

    Matena, Julia; Petersen, Svea; Gieseke, Matthias; Kampmann, Andreas; Teske, Michael; Beyerbach, Martin; Murua Escobar, Hugo; Haferkamp, Heinz; Gellrich, Nils-Claudius; Nolte, Ingo

    2015-01-01

    To improve well-known titanium implants, pores can be used for increasing bone formation and close bone-implant interface. Selective Laser Melting (SLM) enables the production of any geometry and was used for implant production with 250-µm pore size. The used pore size supports vessel ingrowth, as bone formation is strongly dependent on fast vascularization. Additionally, proangiogenic factors promote implant vascularization. To functionalize the titanium with proangiogenic factors, polycaprolactone (PCL) coating can be used. The following proangiogenic factors were examined: vascular endothelial growth factor (VEGF), high mobility group box 1 (HMGB1) and chemokine (C-X-C motif) ligand 12 (CXCL12). As different surfaces lead to different cell reactions, titanium and PCL coating were compared. The growing into the porous titanium structure of primary osteoblasts was examined by cross sections. Primary osteoblasts seeded on the different surfaces were compared using Live Cell Imaging (LCI). Cross sections showed cells had proliferated, but not migrated after seven days. Although the cell count was lower on titanium PCL implants in LCI, the cell count and cell spreading area development showed promising results for titanium PCL implants. HMGB1 showed the highest migration capacity for stimulating the endothelial cell line. Future perspective would be the incorporation of HMGB1 into PCL polymer for the realization of a slow factor release. PMID:25849656

  1. Regulatory T cells are recruited in the infarcted mouse myocardium and may modulate fibroblast phenotype and function

    PubMed Central

    Saxena, Amit; Dobaczewski, Marcin; Rai, Vikrant; Haque, Zaffar; Chen, Wei; Li, Na

    2014-01-01

    Regulatory T cells (Tregs) play a pivotal role in suppressing immune responses regulating behavior and gene expression in effector T cells, macrophages, and dendritic cells. Tregs infiltrate the infarcted myocardium; however, their role the inflammatory and reparative response after myocardial infarction remains poorly understood. We used FoxP3EGFP reporter mice to study Treg trafficking in the infarcted heart and examined the effects of Treg depletion on postinfarction remodeling using an anti-CD25 antibody. Moreover, we investigated the in vitro effects of Tregs on cardiac fibroblast phenotype and function. Low numbers of Tregs infiltrated the infarcted myocardium after 24–72 h of reperfusion. Treg depletion had no significant effects on cardiac dysfunction and scar size after reperfused myocardial infarction but accelerated ventricular dilation and accentuated apical remodeling. Enhanced myocardial dilation in Treg-depleted animals was associated with increased expression of chemokine (C-C motif) ligand 2 and accentuated macrophage infiltration. In vitro, Tregs modulated the cardiac fibroblast phenotype, reducing expression of α-smooth muscle actin, decreasing expression of matrix metalloproteinase-3, and attenuating contraction of fibroblast-populated collagen pads. Our findings suggest that endogenous Tregs have modest effects on the inflammatory and reparative response after myocardial infarction. However, the anti-inflammatory and matrix-preserving properties of Tregs may suggest a role for Treg-based cell therapy in the attenuation of adverse postinfarction remodeling. PMID:25128167

  2. Prevention of inflammation-mediated bone loss in murine and canine periodontal disease via recruitment of regulatory lymphocytes

    PubMed Central

    Glowacki, Andrew J.; Yoshizawa, Sayuri; Jhunjhunwala, Siddharth; Vieira, Andreia E.; Garlet, Gustavo P.; Sfeir, Charles; Little, Steven R.

    2013-01-01

    The hallmark of periodontal disease is the progressive destruction of gingival soft tissue and alveolar bone, which is initiated by inflammation in response to an invasive and persistent bacterial insult. In recent years, it has become apparent that this tissue destruction is associated with a decrease in local regulatory processes, including a decrease of forkhead box P3-expressing regulatory lymphocytes. Accordingly, we developed a controlled release system capable of generating a steady release of a known chemoattractant for regulatory lymphocytes, C-C motif chemokine ligand 22 (CCL22), composed of a degradable polymer with a proven track record of clinical translation, poly(lactic-co-glycolic) acid. We have previously shown that this sustained presentation of CCL22 from a point source effectively recruits regulatory T cells (Tregs) to the site of injection. Following administration of the Treg-recruiting formulation to the gingivae in murine experimental periodontitis, we observed increases in hallmark Treg-associated anti-inflammatory molecules, a decrease of proinflammatory cytokines, and a marked reduction in alveolar bone resorption. Furthermore, application of the Treg-recruiting formulation (fabricated with human CCL22) in ligature-induced periodontitis in beagle dogs leads to reduced clinical measures of inflammation and less alveolar bone loss under severe inflammatory conditions in the presence of a diverse periodontopathogen milieu. PMID:24167272

  3. CXCL13 as a Cerebrospinal Fluid Marker for Neurosyphilis in HIV-infected Patients with Syphilis

    PubMed Central

    Marra, Christina M.; Tantalo, Lauren C.; Sahi, Sharon K.; Maxwell, Clare L.; Lukehart, Sheila A.

    2010-01-01

    Background Asymptomatic neurosyphilis is more difficult to diagnose in HIV-infected patients because HIV itself can cause cerebrospinal fluid (CSF) pleocytosis. The proportion of CSF lymphocytes that are B cells is elevated in neurosyphilis, suggesting that the CSF concentration of the B cell chemoattractant, chemokine (C-X-C motif) ligand 13 (CXCL13) concentration may also be elevated. Methods CSF and blood were collected from 199 HIV-infected patients with syphilis and neurosyphilis. Serum and CSF CXCL13 concentrations were determined. Results Patients with neurosyphilis had higher CSF and serum CXCL13 concentrations compared to patients with syphilis but not neurosyphilis. The odds of having symptomatic neurosyphilis were increased by 2.23 fold for every log increase in CSF CXCL13 concentration and were independent of CSF WBC and plasma HIV RNA concentrations, peripheral blood CD4+ T cell count and use of antiretroviral medications. A cut-off of 10 pg/mL CSF CXCL13 had high sensitivity and a cut-off of 250 pg/mL or evidence of intrathecal synthesis of CXCL13 had high specificity for diagnosis of both symptomatic and asymptomatic neurosyphilis. CSF concentrations of CXCL13 declined after treatment for neurosyphilis. Conclusions CSF CXCL13 concentration may be particularly useful for diagnosis of neurosyphilis in HIV-infected patients because it is independent of CSF pleocytosis and markers of HIV disease. PMID:20393380

  4. Vitamin C Modulates the Immunotoxic Effect of 17α-Methyltestosterone in Nile Tilapia.

    PubMed

    Abo-Al-Ela, Haitham G; El-Nahas, Abeer F; Mahmoud, Shawky; Ibrahim, Essam M

    2017-04-11

    The synthetic androgen 17α-methyltestosterone (MT) is profusely used and practically needed in the production of all-male Nile tilapia fry; however, such androgenic hormones badly disrupt the immune system. This study aimed to alleviate or counteract the immunotoxic effect of MT using vitamin C (ascorbic acid or vit C). Our results show that the highest phagocytic activity (PA), phagocytic index (PI), and lysozyme activity were detected in the vit C group and the MT plus vit C group. Furthermore, PA and PI were significantly suppressed, but lysozyme activity was stronger in the MT group than in the control. No differences were detected in the differential leukocyte count among the studied groups. Moreover, vit C obviously reduced the upregulated expression level of the innate immune-related genes, interleukin 1β (il1β), interleukin 8 (il8), tumor necrosis factor α (tnfα), CC-chemokine, Toll-like receptor 7 (tlr7), immunoglobulin M (IgM) heavy chain, and cellular apoptosis susceptibility (cas) induced by MT, excluding tnfα in the liver and CC-chemokine and tlr7 in the kidney. The micronucleus frequency was found to significantly improve in the vit C plus MT group in comparison to that in the MT group. Normal histoarchitecture of the liver, kidney, and spleen was observed in all the groups, except for the frequently observed melanomacrophage centers in the spleen and kidney of the fish that were treated with vit C and vit C plus MT. More importantly, our findings demonstrate that the upregulation of immune-related genes is not necessarily a sign of a stimulated or enhanced immune system.

  5. Titanium, aluminum and zinc complexes containing diamine-bis(benzotriazole phenolate) ligands: Synthesis, structural characterization and catalytic studies for ring-opening polymerization of ε-caprolactone

    NASA Astrophysics Data System (ADS)

    Liu, Zheng-Tang; Li, Chen-Yu; Chen, Jhy-Der; Liu, Wan-Ling; Tsai, Chen-Yen; Ko, Bao-Tsan

    2017-04-01

    Structurally diverse metal complexes bearing diamine-bis(benzotriazole phenolate) (DiBTP) ligands have been synthesized and fully characterized by single crystal X-ray crystallography. The reaction of Ti(OiPr)4 with C8MEADiBTP-H2 or C8BEADiBTP-H2 (1.0 mol equiv.) generated the monomeric titanium alkoxy complexes [(C8MEADiBTP)Ti(OiPr)2] (1) and [(C8BEADiBTP)Ti(OiPr)2] (2), respectively. Moreover, C8BEADiBTP-H2 reacted with 2.0 molar equiv. of AlMe3 to give the tetra-coordinated di-aluminum complex [(C8BEADiBTP)Al2Me4] (3). Zinc complex [(C8BEADiBTP)Zn2Et2] (4) could be obtained by the alkane elimination of ZnEt2 (2.0 equiv.) with C8BEADiBTP-H2 as the pro-ligand under similar synthetic methods in good yield. Single-crystal X-ray diffraction indicates that 3 is a bimetallic aluminum dimethyl complex with a tetradentate C8BEADiBTP moiety chelating two metal atoms, whereas complex 4 displays the dinuclear feature containing both tetra- and penta-coordinated zinc atoms bonded by one ONNON-pentadentate C8BEADiBTP ligand. Catalytic studies for ring-opening polymerization of ε-caprolactone of complex 1-4 were systematic explored; the comparative studies of such polymerization were also discussed.

  6. Lidocaine reduces neutrophil recruitment by abolishing chemokine-induced arrest and transendothelial migration in septic patients.

    PubMed

    Berger, Christian; Rossaint, Jan; Van Aken, Hugo; Westphal, Martin; Hahnenkamp, Klaus; Zarbock, Alexander

    2014-01-01

    The inappropriate activation, positioning, and recruitment of leukocytes are implicated in the pathogenesis of multiple organ failure in sepsis. Although the local anesthetic lidocaine modulates inflammatory processes, the effects of lidocaine in sepsis are still unknown. This double-blinded, prospective, randomized clinical trial was conducted to investigate the effect of lidocaine on leukocyte recruitment in septic patients. Fourteen septic patients were randomized to receive either a placebo (n = 7) or a lidocaine (n = 7) bolus (1.5 mg/kg), followed by continuous infusion (100 mg/h for patients >70 kg or 70 mg/h for patients <70 kg) over a period of 48 h. Selectin-mediated slow rolling, chemokine-induced arrest, and transmigration were investigated by using flow chamber and transmigration assays. Lidocaine treatment abrogated chemokine-induced neutrophil arrest and significantly impaired neutrophil transmigration through endothelial cells by inhibition of the protein kinase C-θ while not affecting the selectin-mediated slow leukocyte rolling. The observed results were not attributable to changes in surface expression of adhesion molecules or selectin-mediated capturing capacity, indicating a direct effect of lidocaine on signal transduction in neutrophils. These data suggest that lidocaine selectively inhibits chemokine-induced arrest and transmigration of neutrophils by inhibition of protein kinase C-θ while not affecting selectin-mediated slow rolling. These findings may implicate a possible therapeutic role for lidocaine in decreasing the inappropriate activation, positioning, and recruitment of leukocytes during sepsis.

  7. A Chemokine Receptor CXCR2 Macromolecular Complex Regulates Neutrophil Functions in Inflammatory Diseases*

    PubMed Central

    Wu, Yanning; Wang, Shuo; Farooq, Shukkur M.; Castelvetere, Marcello P.; Hou, Yuning; Gao, Ji-Liang; Navarro, Javier V.; Oupicky, David; Sun, Fei; Li, Chunying

    2012-01-01

    Inflammation plays an important role in a wide range of human diseases such as ischemia-reperfusion injury, arteriosclerosis, cystic fibrosis, inflammatory bowel disease, etc. Neutrophilic accumulation in the inflamed tissues is an essential component of normal host defense against infection, but uncontrolled neutrophilic infiltration can cause progressive damage to the tissue epithelium. The CXC chemokine receptor CXCR2 and its specific ligands have been reported to play critical roles in the pathophysiology of various inflammatory diseases. However, it is unclear how CXCR2 is coupled specifically to its downstream signaling molecules and modulates cellular functions of neutrophils. Here we show that the PDZ scaffold protein NHERF1 couples CXCR2 to its downstream effector phospholipase C (PLC)-β2, forming a macromolecular complex, through a PDZ-based interaction. We assembled a macromolecular complex of CXCR2·NHERF1·PLC-β2 in vitro, and we also detected such a complex in neutrophils by co-immunoprecipitation. We further observed that the CXCR2-containing macromolecular complex is critical for the CXCR2-mediated intracellular calcium mobilization and the resultant migration and infiltration of neutrophils, as disrupting the complex with a cell permeant CXCR2-specific peptide (containing the PDZ motif) inhibited intracellular calcium mobilization, chemotaxis, and transepithelial migration of neutrophils. Taken together, our data demonstrate a critical role of the PDZ-dependent CXCR2 macromolecular signaling complex in regulating neutrophil functions and suggest that targeting the CXCR2 multiprotein complex may represent a novel therapeutic strategy for certain inflammatory diseases. PMID:22203670

  8. Photophysical properties of the series fac- and mer-(1-phenylisoquinolinato-N∧C2')(x)(2-phenylpyridinato-N∧C2')(3-x)iridium(III) (x = 1-3).

    PubMed

    Deaton, Joseph C; Young, Ralph H; Lenhard, Jerome R; Rajeswaran, Manju; Huo, Shouquan

    2010-10-18

    The photophysical properties of tris-cyclometalated iridium(III) complexes have been probed by chemical and geometric variation through the series fac- and mer-Ir(piq)(x)(ppy)(3-x) (x = 1-3; piq = 1-phenylisoquinolinato-N(∧)C(2'), ppy = 2-phenylpyridinato-N(∧)C(2')). The phosphorescent decays were recorded in solution at 295 K and in polymer films from 2 to 295 K. In the heteroleptic complexes, emission occurs based solely on the piq ligand(s), at least by the nanosecond time scale, as its excited states are the lowest energy. Because fac-Ir(piq)(3) and fac-Ir(ppy)(3) possess practically the same oxidation potential, comparison of photophysical properties through the series fac-Ir(piq)(x)(ppy)(3-x) (x = 1-3) revealed the effects of having one, two, or three emissive piq ligands with no confounding effects from differences in electron withdrawing or donating properties between the spectator ppy ligands and the piq ligands. Effects of placement of piq ligands in different coordination geometries were elucidated by comparisons to the mer series.

  9. Composition, Characterization and Antibacterial activity of Mn(II), Co(II),Ni(II), Cu(II) Zn(II) and Cd(II) mixed ligand complexes Schiff base derived from Trimethoprim with 8-Hydroxy quinoline

    NASA Astrophysics Data System (ADS)

    Numan, Ahmed T.; Atiyah, Eman M.; Al-Shemary, Rehab K.; Ulrazzaq, Sahira S. Abd

    2018-05-01

    New Schiff base ligand 2-((4-amino-5-(3, 4, 5-trimethoxybenzyl) pyrimidin-2-ylimino) (phenyl)methyl)benzoic acid] = [HL] was synthesized using microwave irradiation trimethoprim and 2-benzoyl benzoic acid. Mixed ligand complexes of Mn((II), Co(II), Ni(II), Cu(II), Zn(II) and Cd(II) are reacted in ethanol with Schiff base ligand [HL] and 8-hydroxyquinoline [HQ] then reacted with metal salts in ethanol as a solvent in (1:1:1) ratio. The ligand [HL] is characterized by FTIR, UV-Vis, melting point, elemental microanalysis (C.H.N), 1H-NMR, 13C-NMR, and mass spectra. The mixed ligand complexes are characterized by infrared spectra, electronic spectra, (C.H.N), melting point, atomic absorption, molar conductance and magnetic moment measurements. These measurements indicate that the ligand [HL] coordinates with metal (II) ion in a tridentate manner through the oxygen and nitrogen atoms of the ligand, octahedral structures are suggested for these complexes. Antibacterial activity of the ligands [HL], [HQ] and their complexes are studied against (gram positive) and (gram negative) bacteria.

  10. MCP-1 and CCR2 Contribute to Non-Lymphocyte-Mediated Brain Disease Induced by Fr98 Polytropic Retrovirus Infection in Mice: Role for Astrocytes in Retroviral Neuropathogenesis

    PubMed Central

    Peterson, Karin E.; Errett, John S.; Wei, Tao; Dimcheff, Derek E.; Ransohoff, Richard; Kuziel, William A.; Evans, Leonard; Chesebro, Bruce

    2004-01-01

    Virus infection of the central nervous system (CNS) often results in chemokine upregulation. Although often associated with lymphocyte recruitment, increased chemokine expression is also associated with non-lymphocyte-mediated CNS disease. In these instances, the effect of chemokine upregulation on neurological disease is unclear. In vitro, several chemokines including monocyte chemotactic protein 1 (MCP-1) protect neurons from apoptosis. Therefore, in vivo, chemokine upregulation may be a protective host response to CNS damage. Alternatively, chemokines may contribute to pathogenesis by stimulating intrinsic brain cells or recruiting macrophages to the brain. To investigate these possibilities, we studied a neurovirulent retrovirus, Fr98, that induces severe non-lymphocyte-mediated neurological disease and causes the upregulation of several chemokines that bind to chemokine receptors CCR2 and CCR5. Knockout mice deficient in CCR2 had reduced susceptibility to Fr98 pathogenesis, with significantly fewer mice developing clinical disease than did wild-type controls. In contrast, no reduction in Fr98-induced disease was observed in CCR5 knockout mice. Thus, signaling through CCR2, but not CCR5, plays an important role in Fr98-mediated pathogenesis. Three ligands for CCR2 (MCP-1, MCP-3, and MCP-5) were upregulated during Fr98 infection of the brain. Antibody-blocking experiments demonstrated that MCP-1 was important for retrovirus-induced neurological disease. In situ hybridization analysis revealed that MCP-1 was expressed by glial fibrillary acidic protein-positive astrocytes. Thus, astrocytes, previously not thought to play an effector role in the disease process were found to contribute to pathogenesis through the production of MCP-1. This study also demonstrates that chemokines can mediate pathogenesis in the CNS in the absence of lymphocytic infiltrate and gives credence to the hypothesis that chemokine upregulation is a mechanism by which retroviruses such as human immunodeficiency virus induce neurological damage. PMID:15163738

  11. C-H activations at iridium(I) square-planar complexes promoted by a fifth ligand.

    PubMed

    Martín, Marta; Torres, Olga; Oñate, Enrique; Sola, Eduardo; Oro, Luis A

    2005-12-28

    In the presence of ligands such as acetonitrile, ethylene, or propylene, the Ir(I) complex [Ir(1,2,5,6-eta-C8H12)(NCMe)(PMe3)]BF4 (1) transforms into the Ir(III) derivatives [Ir(1-kappa-4,5,6-eta-C8H12)(NCMe)(L)(PMe3)]BF4 (L = NCMe, 2; eta2-C2H4, 3; eta2-C3H6, 4), respectively, through a sequence of C-H oxidative addition and insertion elementary steps. The rate of this transformation depends on the nature of L and, in the case of NCMe, the pseudo-first-order rate constants display a dependence upon ligand concentration suggesting the formation of five-coordinate reaction intermediates. A similar reaction between 1 and vinyl acetate affords the Ir(III) complex [Ir(1-kappa-4,5,6-eta-C8H12){kappa-O-eta2-OC(Me)OC2H3}(PMe3)]BF4 (7) via the isolable five-coordinate Ir(I) compound [Ir(1,2,5,6-eta-C8H12){kappa-O-eta2-OC(Me)OC2H3}(PMe3)]BF4 (6). DFT (B3LYP) calculations in model complexes show that reactions initiated by acetonitrile or ethylene five-coordinate adducts involve C-H oxidative addition transition states of lower energy than that found in the absence of these ligands. Key species in these ligand-assisted transformations are the distorted (nonsquare-planar) intermediates preceding the intramolecular C-H oxidative addition step, which are generated after release of one cyclooctadiene double bond from the five-coordinate species. The feasibility of this mechanism is also investigated for complexes [IrCl(L)(PiPr3)2] (L = eta2-C2H4, 27; eta2-C3H6, 28). In the presence of NCMe, these complexes afford the C-H activation products [IrClH(CH=CHR)(NCMe)(PiPr3)2] (R = H, 29; Me, 30) via the common cyclometalated intermediate [IrClH{kappa-P,C-P(iPr)2CH(CH3)CH2}(NCMe)(PiPr3)] (31). The most effective C-H oxidative addition mechanism seems to involve three-coordinate intermediates generated by photochemical release of the alkene ligand. However, in the absence of light, the reaction rates display dependences upon NCMe concentration again indicating the intermediacy of five-coordinate acetonitrile adducts.

  12. Human umbilical vein endothelial cells protect against hypoxic-ischemic damage in neonatal brain via stromal cell-derived factor 1/C-X-C chemokine receptor type 4.

    PubMed

    Wu, Chia-Ching; Chen, Yi-Chi; Chang, Ying-Chao; Wang, Lan-Wan; Lin, Yung-Chieh; Chiang, Yi-Lun; Ho, Chien-Jung; Huang, Chao-Ching

    2013-05-01

    Agents that protect against neurovascular damage provide a powerful neuroprotective strategy. Human umbilical vein endothelial cells (HUVECs) may be used to treat neonates with hypoxic-ischemia (HI) because of its autologous capability. We hypothesized that peripherally injected HUVECs entered the brain after HI, protected against neurovascular damage, and provided protection via stromal cell-derived factor 1/C-X-C chemokine receptor type 4 pathway in neonatal brain. Postpartum day 7 rat pups received intraperitoneal injections of low-passage HUVEC-P4, high-passage HUVEC-P8, or conditioned medium before and immediately after HI. HUVECs were transfected with adenovirus-green fluorescent protein for cell tracing. Oxygen-glucose deprivation was established by coculturing HUVEC-P4 with mouse neuroblastoma neuronal cells (Neuro-2a) and with mouse immortalized cerebral vascular endothelial cells (b.End3). HUVEC-P4-treated group had more blood levels of green fluorescent protein-positive cells than HUVEC-P8-treated group 3 hours postinjection. Intraperitoneally injected HUVEC-P4, but not HUVEC-P8, entered the cortex after HI and positioned closed to the neurons and microvessels. Compared with the condition medium-treated group, the HUVEC-P4-treated but not the HUVEC-P8-treated group showed significantly less neuronal apoptosis and blood-brain barrier damage and more preservation of microvessels in the cortex 24 hours after HI. On postpartum day 14, the HUVEC-P4-treated group showed significant neuroprotection compared with the condition medium-treated group. Stromal cell-derived factor 1 was upregulated in the ipsilateral cortex 3 hours after HI, and inhibiting the stromal cell-derived factor 1/C-X-C chemokine receptor type 4 reduced the protective effect of HUVEC-P4. In vitro transwell coculturing of HUVEC-P4 also significantly protected against oxygen-glucose deprivation cell death in neurons and endothelial cells. Cell therapy using HUVECs may provide a powerful therapeutic strategy in treating neonates with HI.

  13. A conserved tripeptide in CNG and HCN channels regulates ligand gating by controlling C-terminal oligomerization.

    PubMed

    Zhou, Lei; Olivier, Nelson B; Yao, Huan; Young, Edgar C; Siegelbaum, Steven A

    2004-12-02

    Cyclic nucleotides directly enhance the opening of the tetrameric CNG and HCN channels, although the mechanism remains unclear. We examined why HCN and certain CNG subunits form functional homomeric channels, whereas other CNG subunits only function in heteromeric channels. The "defect" in the CNGA4 subunit that prevents its homomeric expression was localized to its C-linker, which connects the transmembrane domain to the binding domain and contains a tripeptide that decreases the efficacy of ligand gating. Remarkably, replacement of the homologous HCN tripeptide with the CNGA4 sequence transformed cAMP into an inverse agonist that inhibits HCN channel opening. Using analytical ultracentrifugation, we identified the structural basis for this gating switch: whereas cAMP normally enhances the assembly of HCN C-terminal domains into a tetrameric gating ring, inclusion of the CNGA4 tripeptide reversed this action so that cAMP now causes gating ring disassembly. Thus, ligand gating depends on the dynamic oligomerization of C-terminal binding domains.

  14. Disulfide Trapping for Modeling and Structure Determination of Receptor: Chemokine Complexes.

    PubMed

    Kufareva, Irina; Gustavsson, Martin; Holden, Lauren G; Qin, Ling; Zheng, Yi; Handel, Tracy M

    2016-01-01

    Despite the recent breakthrough advances in GPCR crystallography, structure determination of protein-protein complexes involving chemokine receptors and their endogenous chemokine ligands remains challenging. Here, we describe disulfide trapping, a methodology for generating irreversible covalent binary protein complexes from unbound protein partners by introducing two cysteine residues, one per interaction partner, at selected positions within their interaction interface. Disulfide trapping can serve at least two distinct purposes: (i) stabilization of the complex to assist structural studies and/or (ii) determination of pairwise residue proximities to guide molecular modeling. Methods for characterization of disulfide-trapped complexes are described and evaluated in terms of throughput, sensitivity, and specificity toward the most energetically favorable crosslinks. Due to abundance of native disulfide bonds at receptor:chemokine interfaces, disulfide trapping of their complexes can be associated with intramolecular disulfide shuffling and result in misfolding of the component proteins; because of this, evidence from several experiments is typically needed to firmly establish a positive disulfide crosslink. An optimal pipeline that maximizes throughput and minimizes time and costs by early triage of unsuccessful candidate constructs is proposed. © 2016 Elsevier Inc. All rights reserved.

  15. Mixed-ligand Pt(II) dithione-dithiolato complexes: influence of the dicyanobenzodithiolato ligand on the second-order NLO properties.

    PubMed

    Espa, Davide; Pilia, Luca; Marchiò, Luciano; Artizzu, Flavia; Serpe, Angela; Mercuri, Maria Laura; Simão, Dulce; Almeida, Manuel; Pizzotti, Maddalena; Tessore, Francesca; Deplano, Paola

    2012-03-28

    The mixed-ligand dithiolene complex [Pt(Bz(2)pipdt)(dcbdt)] (1) bearing the two ligands Bz(2)pipdt = 1,4-dibenzyl-piperazine-3,2-dithione and dcbdt = dicyanobenzodithiolato, has been synthesized, characterized and studied to evaluate its second-order optical nonlinearity. The dithione/dithiolato character of the two ligands gives rise to an asymmetric distribution of the charge in the molecule. This is reflected by structural data showing that in the C(2)S(2)PtS(2)C(2) dithiolene core the four sulfur atoms define a square-planar coordination environment of the metal where the Pt-S bond distances involving the two ligands are similar, while the C-S bond distances in the C(2)S(2) units exhibit a significant difference in Bz(2)pipdt (dithione) and dcbdt (dithiolato). 1 shows a moderately strong absorption peak in the visible region, which can be related to a HOMO-LUMO transition, where the dcbdt ligand (dithiolato) contributes mostly to the HOMO, and the Bz(2)pipdt one (dithione) mostly to the LUMO. Thus this transition has ligand-to-ligand charge transfer (CT) character with some contribution of the metal and undergoes negative solvatochromism and molecular quadratic optical nonlinearity (μβ(0) = -1296 × 10(-48) esu), which was determined by the EFISH (electric-field-induced second-harmonic generation) technique and compared with the values of similar complexes on varying the dithiolato ligand (mnt = maleonitriledithiolato, dmit = 2-thioxo-1,3-dithiole-4,5-dithiolato). Theoretical calculations help to elucidate the role of the dithiolato ligands in affecting the molecular quadratic optical nonlinearity of these complexes.

  16. Cytokine and chemokine expression in the skin from patients with maculopapular exanthema to drugs.

    PubMed

    Fernandez, T D; Mayorga, C; Torres, M J; Cornejo-Garcia, J A; López, S; Chaves, P; Rondon, C; Blanca, M

    2008-06-01

    Maculopapular exanthema (MPE) is the most frequent clinical manifestation of nonimmediate allergic reactions to drugs and T helper 1 (Th1) cytokines and CD4(+) T cells have been shown to play an important role in its pathogenesis. We assessed the role of cytokines and chemokines and their receptors in the pathogenesis of MPE. We evaluated skin biopsies and peripheral CD4(+) and CD8(+) T cells from 27 patients during the acute phase of the reaction and 26 exposed controls. Semiquantitative real-time PCR was performed to determine the expression of cytokines and chemokines and their receptors and immunohistochemistry was used to determine the same chemokines and their receptor proteins in skin. There was a high expression of the Th1 cytokines interferon-gamma (P = 0.006) and tumor necrosis factor-alpha (P = 0.022) in skin and CD4(+) T cells (P = 0.007 and P = 0.005, respectively); and of the Th1 chemokines CXCL9 (P = 0.005) and CXCL10 (P = 0.028) in the skin, while their receptor CXCR3 was increased in skin (P = 0.006) and CD4(+) T cells (P = 0.03). Homing chemokine receptors were also increased: CCR6 in skin (P = 0.026) and CD4(+) T cells (P = 0.016), and CCR10 only in CD4(+) T cells (P = 0.016), as well as their ligands, CCL20 and CCL27, in skin alone. Immunohistochemistry confirmed these results. These data show significant differences in the expression of chemokines and chemokine receptors, related with a Th1 profile, in both skin biopsies and peripheral CD4(+) T cells in patients with drug-induced MPE.

  17. Extraordinary cluster formation and intramolecular ligand-ligand interactions in cyanoacetylene [corrected] mediated by Mg+*: implications for the atmospheric chemistry of titan and for circumstellar chemistry.

    PubMed

    Milburn, Rebecca K; Hopkinson, Alan C; Bohme, Diethard K

    2005-09-21

    Experimental results are reported that track the kinetics of gas-phase reactions initiated by Mg+*, (c-C5H5)Mg+ and (c-C5H5)2Mg+* in hydrogen cyanide and cyanoacetylene. The experiments were performed with a selected-ion flow tube (SIFT) tandem mass spectrometer at a helium buffer-gas pressure of 0.35 +/- 0.01 Torr and at 294 +/- 3 K. The observed chemistries of Mg+* and (c-C5H5)Mg+ are dominated by sequential ligation, while that of (c-C5H5)2Mg+* is by ligand switching. The rate-coefficient measurements for sequential addition of cyanoacetylene to Mg+* indicate an extraordinary pattern in alternating chemical reactivity while multiple-collision induced dissociation experiments revealed an extraordinary stability for the Mg(HC3N)4+* cluster ion. Molecular orbital calculations with density functional theory (DFT) at the B3LYP level, Hartree-Fock (HF) and second-order Mphiller-Plesset (MP2) levels, all performed with a 6-31+G(d) basis set, have been used to calculate structures and energies for the observed Mg(HC3N)1-4(+)* cations. These calculations indicate that the path of formation of Mg(HC3N)4+* involves ligand-ligand interactions leading to two cyclic (HC3N)2 ligands which then interact to form 2,4,6,8-tetracyanosemibullvalene-Mg+ or 1,2,5,6-tetracyano-1,3,5,7-cyclooctatetraene-Mg+ cations. A case is made for the formation of similar complex organomagnesium ions in the upper atmosphere of Titan where subsequent electron-ion recombination may produce cyano derivatives of large unsaturated hydrocarbons. In contrast, circumstellar environments with their much higher relative content of free electrons are less likely to give rise to such chemistry.

  18. Mutagenesis Analysis Reveals Distinct Amino Acids of the Human Serotonin 5-HT2C Receptor Underlying the Pharmacology of Distinct Ligands.

    PubMed

    Liu, Yue; Canal, Clinton E; Cordova-Sintjago, Tania C; Zhu, Wanying; Booth, Raymond G

    2017-01-18

    While exploring the structure-activity relationship of 4-phenyl-2-dimethylaminotetralins (PATs) at serotonin 5-HT 2C receptors, we discovered that relatively minor modification of PAT chemistry impacts function at 5-HT 2C receptors. In HEK293 cells expressing human 5-HT 2C-INI receptors, for example, (-)-trans-3'-Br-PAT and (-)-trans-3'-Cl-PAT are agonists regarding Gα q -inositol phosphate signaling, whereas (-)-trans-3'-CF 3 -PAT is an inverse agonist. To investigate the ligand-receptor interactions that govern this change in function, we performed site-directed mutagenesis of 14 amino acids of the 5-HT 2C receptor based on molecular modeling and reported G protein-coupled receptor crystal structures, followed by molecular pharmacology studies. We found that S3.36, T3.37, and F5.47 in the orthosteric binding pocket are critical for affinity (K i ) of all PATs tested, we also found that F6.44, M6.47, C7.45, and S7.46 are primarily involved in regulating EC/IC 50 functional potencies of PATs. We discovered that when residue S5.43, N6.55, or both are mutated to alanine, (-)-trans-3'-CF 3 -PAT switches from inverse agonist to agonist function, and when N6.55 is mutated to leucine, (-)-trans-3'-Br-PAT switches from agonist to inverse agonist function. Notably, most point-mutations that affected PAT pharmacology did not significantly alter affinity (K D ) of the antagonist radioligand [ 3 H]mesulergine, but every mutation tested negatively impacted serotonin binding. Also, amino acid mutations differentially affected the pharmacology of other commercially available 5-HT 2C ligands tested. Collectively, the data show that functional outcomes shared by different ligands are mediated by different amino acids and that some 5-HT 2C receptor residues important for pharmacology of one ligand are not necessarily important for another ligand.

  19. Mixed-Ligand Uranyl Polyrotaxanes Incorporating a Sulfate/Oxalate Coligand: Achieving Structural Diversity via pH-Dependent Competitive Effect.

    PubMed

    Xie, Zhen-Ni; Mei, Lei; Hu, Kong-Qiu; Xia, Liang-Shu; Chai, Zhi-Fang; Shi, Wei-Qun

    2017-03-20

    A mixed-ligand system provides an alternative route to tune the structures and properties of metal-organic compounds by introducing functional organic or inorganic coligands. In this work, five new uranyl-based polyrotaxane compounds incorporating a sulfate or oxalate coligand have been hydrothermally synthesized via a mixed-ligand method. Based on C6BPCA@CB6 (C6BPCA = 1,1'-(hexane-1,6-diyl)bis(4-(carbonyl)pyridin-1-ium), CB6 = cucurbit[6]uril) ligand, UPS1 (UO 2 (L) 0.5 (SO 4 )(H 2 O)·2H 2 O, L = C6BPCA@CB6) is formed by the alteration of initial aqueous solution pH to a higher acidity. The resulting 2D uranyl polyrotaxane sheet structure of UPS1 is based on uranyl-sulfate ribbons connected by the C6BPCA@CB6 pseudorotaxane linkers. By using oxalate ligand instead of sulfate, four oxalate-containing uranyl polyrotaxane compounds, UPO1-UPO4, have been acquired by tuning reaction pH and ligand concentration: UPO1 (UO 2 (L) 0.5 (C 2 O 4 ) 0.5 (NO 3 )·3H 2 O) in one-dimensional chain was obtained at a low pH value range (1.47-1.89) and UPO2 (UO 2 (L)(C 2 O 4 )(H 2 O)·7H 2 O)obtained at a higher pH value range (4.31-7.21). By lowering the amount of oxalate, another two uranyl polyrotaxane network UPO3 ((UO 2 ) 2 (L) 0.5 (C 2 O 4 ) 2 (H 2 O)) and UPO4 ((UO 2 ) 2 O(OH)(L) 0.5 (C 2 O 4 ) 0.5 (H 2 O)) could be acquired at a low pH value of 1.98 and a higher pH value over 6, respectively. The UPO1-UPO4 compounds, which display structural diversity via pH-dependent competitive effect of oxalate, represent the first series of mixed-ligand uranyl polyrotaxanes with organic ligand as the coligand. Moreover, the self-assembly process and its internal mechanism concerning pH-dependent competitive effect and other related factors such as concentration of the reagents and coordination behaviors of the coligands were discussed in detail.

  20. Nanoparticle Vaccines Encompassing the Respiratory Syncytial Virus (RSV) G Protein CX3C Chemokine Motif Induce Robust Immunity Protecting from Challenge and Disease

    PubMed Central

    Jorquera, Patricia A.; Choi, Youngjoo; Oakley, Katie E.; Powell, Thomas J.; Boyd, James G.; Palath, Naveen; Haynes, Lia M.; Anderson, Larry J.; Tripp, Ralph A.

    2013-01-01

    Nanoparticle vaccines were produced using layer-by-layer fabrication and incorporating respiratory syncytial virus (RSV) G protein polypeptides comprising the CX3C chemokine motif. BALB/c mice immunized with G protein nanoparticle vaccines produced a neutralizing antibody response that inhibited RSV replication in the lungs following RSV challenge. ELISPOT analysis showed that G nanoparticle vaccinated mice had increased levels of RSV G protein-specific IL-4 and IFN-γ secreting cells compared to controls following RSV challenge. Remarkably, RSV challenge of G protein nanoparticle vaccinated mice resulted in increased RSV M2-specific IL-4 and IFN-γ secreting T cells, and increased M2-specific H-2Kd-tetramer positive CD8+ T cells in the lungs compared to controls. Cell type analysis showed vaccination was not associated with increased pulmonary eosinophilia following RSV challenge. These results demonstrate that vaccination of mice with the RSV G protein nanoparticle vaccines induces a potent neutralizing antibody response, increased G protein- and M2- specific T cell responses, and a reduction in RSV disease pathogenesis. PMID:24040360

Top