Sample records for c-kit gene mutation

  1. No GIST-type c-kit gain of function mutations in neuroblastic tumours

    PubMed Central

    Korja, M; Finne, J; Salmi, T T; Haapasalo, H; Tanner, M; Isola, J

    2005-01-01

    Aims: Neuroblastic tumours (NTs) have been shown to respond to imatinib treatment in vivo and in vitro, possibly via inactivating the c-kit receptor. The purpose of this study was to identify gastrointestinal stromal tumour (GIST)-type c-kit gene associated mutations in exons 9, 11, 13, and 17 in NTs to recognise a subset of tumours that would probably respond to imatinib treatment. Methods: Expression of the c-kit protein was detected immunohistochemically in a total of 37 archival paraffin wax embedded NTs using polyclonal rabbit antihuman c-kit antibody. After immunohistochemistry, c-kit gene associated chromosomal mutations in all cases of NT were detected with denaturing high performance liquid chromatography (HPLC). Results: Denaturing HLPC analysis did not reveal GIST-type mutations in four immunohistochemically detected c-kit positive or in 33 c-kit negative NTs. Conclusions: c-kit receptor expression and GIST-type c-kit gene mutations are rare events in NTs. Oncogenic activation of c-kit in NTs presumably differs from that of GISTs, which may influence their responsiveness to imatinib treatment. Whether c-kit has an essential role in the pathogenesis of NTs remains to be investigated. PMID:15976348

  2. Evaluation of tyrosine-kinase receptor c-KIT (c-KIT) mutations, mRNA and protein expression in canine leukemia: might c-KIT represent a therapeutic target?

    PubMed

    Giantin, M; Aresu, L; Aricò, A; Gelain, M E; Riondato, F; Martini, V; Comazzi, S; Dacasto, M

    2013-04-15

    The tyrosine-kinase receptor c-KIT (c-KIT) plays an important role in proliferation, survival and differentiation of progenitor cells in normal hematopoietic cells. In human hematological malignancies, c-KIT is mostly expressed by progenitor cell neoplasia and seldom by those involving mature cells. Tyrosine kinase inhibitors (TKIs) are actually licensed for the first- and second-line treatment of human hematologic disorders. Aim of the present study was to evaluate c-KIT mRNA and protein expression and complementary DNA (cDNA) mutations in canine leukemia. Eleven acute lymphoblastic leukemia (ALL) and acute undifferentiated leukemia (AUL) and 12 chronic lymphocytic leukemia (CLL) were enrolled in this study. The amounts of c-KIT mRNA and protein were determined, in peripheral blood samples, by using quantitative real time RT-PCR, flow cytometry and immunocytochemistry, respectively. The presence of mutations on c-KIT exons 8-11 and 17 were investigated by cDNA sequencing. Higher amounts of c-KIT mRNA were found in ALL/AUL compared to CLL, and this latter showed a lower pattern of gene expression. Transcriptional data were confirmed at the protein level. No significant gain-of-function mutations were ever observed in both ALL/AUL and CLL. Among canine hematological malignancies, ALL/AUL typically show a very aggressive biological behavior, partly being attributable to the lack of efficacious therapeutic options. The high level of c-KIT expression found in canine ALL/AUL might represent the rationale for using TKIs in future clinical trials. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Comparison of lesional skin c-KIT mutations with clinical phenotype in patients with mastocytosis.

    PubMed

    Chan, I J; Tharp, M D

    2018-06-01

    Activating c-KIT mutations cause abnormal mast cell growth and appear to play a role in mastocytosis. However, the correlation of c-KIT mutations with disease phenotypes is poorly characterized. To evaluate the correlation of c-KIT mutations with clinical presentations and laboratory findings. Total cellular RNA was isolated from the skin lesions of 43 adults and 7 children with mastocytosis, and PCR amplicons of cDNA were sequenced for c-KIT mutations. The most common activating mutation, KIT-D816V, was identified in 72% of adults and 57% of children. Additional activating mutations, namely, V560G and the internal tandem duplications (ITDs) 502-503dupAY, were detected in 12% of adults and 8% of children. V560G occurred more commonly in our patients than previously reported, and it appeared to be associated with more advanced disease. Otherwise, the presence or absence of activating mutations did not correlate with skin lesion morphology, disease extent or total serum tryptase levels. Four adults had expression only of wild-type KIT, while two others had expression of a truncated KIT lacking tyrosine kinase activity; yet these patients were clinically indistinguishable from those patients with activating c-KIT mutations. Activating c-KIT mutations exist in a significant portion of patients with mastocytosis, but not all patients showed expression of these mutations. Except for V560G, the presence or absence of activating c-KIT mutations did not predict the extent of disease. These observations suggest that although activating c-KIT mutations are associated with mast cell growth, other genes probably play a role in the cause of mastocytosis. © 2018 British Association of Dermatologists.

  4. Pim1 kinase regulates c-Kit gene translation.

    PubMed

    An, Ningfei; Cen, Bo; Cai, Houjian; Song, Jin H; Kraft, Andrew; Kang, Yubin

    2016-01-01

    Receptor tyrosine kinase, c-Kit (CD117) plays a pivotal role in the maintenance and expansion of hematopoietic stem/progenitor cells (HSPCs). Additionally, over-expression and/or mutational activation of c-Kit have been implicated in numerous malignant diseases including acute myeloid leukemia. However, the translational regulation of c-Kit expression remains largely unknown. We demonstrated that loss of Pim1 led to specific down-regulation of c-Kit expression in HSPCs of Pim1 -/- mice and Pim1 -/- 2 -/- 3 -/- triple knockout (TKO) mice, and resulted in attenuated ERK and STAT3 signaling in response to stimulation with stem cell factor. Transduction of c-Kit restored the defects in colony forming capacity seen in HSPCs from Pim1 -/- and TKO mice. Pharmacologic inhibition and genetic modification studies using human megakaryoblastic leukemia cells confirmed the regulation of c-Kit expression by Pim1 kinase: i.e., Pim1-specific shRNA knockdown down-regulated the expression of c-Kit whereas overexpression of Pim1 up-regulated the expression of c-Kit. Mechanistically, inhibition or knockout of Pim1 kinase did not affect the transcription of c-Kit gene. Pim1 kinase enhanced c-Kit 35 S methionine labeling and increased the incorporation of c-Kit mRNAs into the polysomes and monosomes, demonstrating that Pim1 kinase regulates c-Kit expression at the translational level. Our study provides the first evidence that Pim1 regulates c-Kit gene translation and has important implications in hematopoietic stem cell transplantation and cancer treatment.

  5. KIT amplification and gene mutations in acral/mucosal melanoma in Korea.

    PubMed

    Yun, Jina; Lee, Jeeyun; Jang, Jiryeon; Lee, Eui Jin; Jang, Kee Taek; Kim, Jung Han; Kim, Kyoung-Mee

    2011-06-01

    Mucosal and acral melanomas have demonstrated different genetic alterations and biological behavior compared with more common cutaneous melanomas. It was recently reported that gain-of-function KIT mutations and/or copy number increases are more common in mucosal and acral melanomas. Thus, we studied the frequency and pattern of KIT aberrations in mucosal and acral melanomas in Korea. We analyzed 97 patients who were pathologically confirmed with mucosal or acral melanoma between 1997 and 2010 at Samsung Medical Center. Of the 97 melanoma patients, 92 were screened for mutations in KIT exons 11, 13, 17, and 18, BRAF and NRAS genes. KIT copy number was assessed by quantitative, real-time PCR. Of the 97 patients, 55 (56.7%) were mucosal, 40 (41.2%) were acral melanoma, and two were of unknown primary origin. Among seven cases with KIT mutation, five (60.0%) occurred in exon 11, one (20.0%) in exon 17, and one (20.0%) in exon 13. Point mutations were the most common, resulting in substitutions in exon 11 (K558R, T574A, L576P, and V559A), exon 13 (N655K), and exon 17 (N822K). A novel Thr574Ala (c.1720A>G) KIT mutation, which has not been reported in melanoma or other tumor types, was identified in one genital melanoma case. Of the 97 mucosal or acral melanoma specimens, 49 were tested for KIT gene copy number changes using quantitative PCR. Increased KIT copy number was identified in 15 patients: seven (40%) of 20 acral melanomas and eight (31%) of 26 mucosal melanomas. Our study implicates that a significant proportion of acral and mucosal melanomas have KIT mutations in Asian population. © 2011 The Authors. APMIS © 2011 APMIS.

  6. c-KIT positive schistosomal urinary bladder carcinoma are frequent but lack KIT gene mutations.

    PubMed

    Shams, Tahany M; Metawea, Mokhtar; Salim, Elsayed I

    2013-01-01

    Urinary bladder squamous cell carcinoma (SCC), one of the most common neoplasms in Egypt, is attributed to chronic urinary infection with Schistosoma haematobium (Schistosomiasis). The proto-oncogene c-KIT, encoding a tyrosine kinase receptor and implicated in the development of a number of human malignancies, has not been studied so far in schistosomal urinary bladder SCCs. We therefore determined immunohistochemical (IHC) expression of c-KIT in paraffin sections from 120 radical cystectomies of SCCs originally obtained from the Pathology Department of Suez Canal University (Ismailia, Egypt). Each slide was evaluated for staining intensity where the staining extent of >10% of cells was considered positive. c-KIT overexpression was detected in 78.3% (94/120) of the patients, the staining extents in the tumor cells were 11-50% and >50% in 40 (42.6%) and 54 (57.4%) respectively. The positive cases had 14.9%, 63.8%, 21.3% as weak, moderate and strong intensity respectively. Patients with positive bilharzial ova had significantly higher c-KIT expression than patients without (95.2% vs. 38.9%, P=0.000). Mutation analysis of exons 9-13 was negative in thirty KIT positive cases. The high rate of positivity in SBSCC was one of the striking findings; However, CD117 may be a potential target for site specific immunotherapy to improve the outcome of this tumor.

  7. Molecular spectrum of c-KIT and PDGFRA gene mutations in gastro intestinal stromal tumor: determination of frequency, distribution pattern and identification of novel mutations in Indian patients.

    PubMed

    Ahmad, Firoz; Lad, Purnima; Bhatia, Simi; Das, Bibhu Ranjan

    2015-01-01

    KIT and PDGFRA gene mutations are the major genetic alterations seen in gastrointestinal stromal tumors (GISTs) and are being used clinically for predicting response to imatinib therapy. In the current study, we set out to explore the frequency and distribution pattern of c-KIT (exons 9, 11 and 13) and PDGFRA (exons 12 and 18) by direct sequencing in a series of 70 Indian GIST cases. Overall, 27 (38.5 %) and 4 (5.7 %) of the cases had c-KIT and PDGFRA mutations, respectively. Majority of KIT mutations involved exon 11 (85.7 %), followed by exon 9 (14.3 %), while none showed exon 13 mutation. Most exon 9 mutations showed Ala503-Tyr504 duplication, while one had novel point mutation at codon 476 (S476G). In contrast to exon 9 mutations, most exon 11 mutations were in-frame deletions (79 %, 19/24), predominantly at codons 550-560, while remaining exon 11 mutant cases were point mutations at codons 559, 560, 568, 573 and 575. Interestingly, P573T, Q556_V560delinsH, Q575H and Q575_P577 were novel variations observed in exon 11. The PDGFRA mutations were seen mostly in exon 18, which showed point mutation at codon 842 (D842V), while exon 12 showed a novel indel variation (V561_H570delinsT). No significant correlation between c-KIT/PDGFRA mutations and clinicopathological data was observed. In conclusion, this study highlights the frequency and distribution pattern of c-KIT/PDGFRA mutation in Indian cohort. The current study identified novel variations that added new insights into the genetic heterogeneity of GIST patients. Furthermore, this is the first study to report the presence of PDGFRA mutation from Indian subcontinent.

  8. KIT gene mutations and patterns of protein expression in mucosal and acral melanoma.

    PubMed

    Abu-Abed, Suzan; Pennell, Nancy; Petrella, Teresa; Wright, Frances; Seth, Arun; Hanna, Wedad

    2012-01-01

    Recently characterized KIT (CD117) gene mutations have revealed new pathways involved in melanoma pathogenesis. In particular, certain subtypes harbor mutations similar to those observed in gastrointestinal stromal tumors, which are sensitive to treatment with tyrosine kinase inhibitors. The purpose of this study was to characterize KIT gene mutations and patterns of protein expression in mucosal and acral melanoma. Formalin-fixed, paraffin-embedded tissues were retrieved from our archives. Histologic assessment included routine hematoxylin-eosin stains and immunohistochemical staining for KIT. Genomic DNA was used for polymerase chain reaction-based amplification of exons 11 and 13. We identified 59 acral and mucosal melanoma cases, of which 78% showed variable levels of KIT expression. Sequencing of exons 11 and 13 was completed on all cases, and 4 (6.8%) mutant cases were isolated. We successfully optimized conditions for the detection of KIT mutations and showed that 8.6% of mucosal and 4.2% of acral melanoma cases at our institution harbor KIT mutations; all mutant cases showed strong, diffuse KIT protein expression. Our case series represents the first Canadian study to characterize KIT gene mutations and patterns of protein expression in acral and mucosal melanoma.

  9. D816 mutation of the KIT gene in core binding factor acute myeloid leukemia is associated with poorer prognosis than other KIT gene mutations.

    PubMed

    Yui, Shunsuke; Kurosawa, Saiko; Yamaguchi, Hiroki; Kanamori, Heiwa; Ueki, Toshimitsu; Uoshima, Nobuhiko; Mizuno, Ishikazu; Shono, Katsuhiro; Usuki, Kensuke; Chiba, Shigeru; Nakamura, Yukinori; Yanada, Masamitsu; Kanda, Junya; Tajika, Kenji; Gomi, Seiji; Fukunaga, Keiko; Wakita, Satoshi; Ryotokuji, Takeshi; Fukuda, Takahiro; Inokuchi, Koiti

    2017-10-01

    The clinical impact of KIT mutations in core binding factor acute myeloid leukemia (CBF-AML) is still unclear. In the present study, we analyzed the prognostic significance of each KIT mutation (D816, N822K, and other mutations) in Japanese patients with CBF-AML. We retrospectively analyzed 136 cases of CBF-AML that had gone into complete remission (CR). KIT mutations were found in 61 (45%) of the patients with CBF-AML. D816, N822K, D816 and N822K, and other mutations of the KIT gene were detected in 29 cases (21%), 20 cases (15%), 7 cases (5%), and 5 cases (4%), respectively. The rate of relapse-free survival (RFS) and overall survival (OS) in patients with D816 and with both D816 and N822K mutations was significantly lower than in patients with other or with no KIT mutations (RFS: p < 0.001, OS: p < 0.001). Moreover, stratified analysis of the chromosomal abnormalities t(8;21)(q22;q22) and inv(16)(p13.1q22), t(16;16)(p13.1;q22) showed that D816 mutation was associated with a significantly worse prognosis. In a further multivariate analysis of RFS and OS, D816 mutation was found to be an independent risk factor for significantly poorer prognosis. In the present study, we were able to establish that, of all KIT mutations, D816 mutation alone is an unfavorable prognostic factor.

  10. The clinical significance of c-Kit mutations in metastatic oral mucosal melanoma in China.

    PubMed

    Ma, Xuhui; Wu, Yunteng; Zhang, Tian; Song, Hao; Jv, Houyu; Guo, Wei; Ren, Guoxin

    2017-10-10

    c-Kit mutations are frequently detected in mucosal melanomas, but their clinical significance in metastatic oral mucosal melanomas (OMM) remains unclear. The main purpose of this study was to investigate the clinical and pathological features of metastatic OMMs with c-Kit mutations and the efficiency of the tyrosine kinase inhibitor imatinib in treating metastatic OMMs. We found thatresidual primary lesion and neck lymph nodes could act as independent prognostic factors in metastatic OMM patients. c-Kit mutations were detected in 22 out of 139 (15.8%) metastatic OMM patients. Under chemotherapy, the overall survival (OS) of c-Kit mutant patients was significantly shorter than that of wild-type patients. The Ki67 expression was significantly higher in c-Kit mutant patients than in wild-type patients. In distant metastatic OMM patients with c-Kit mutations, the treatment with c-Kit inhibitor resulted in a better OS. In conclusion, residual primary lesion, cervical lymph nodes and c-Kit mutations act as adverse prognostic factors of metastatic OMMs. The Kit inhibitor imatinib could benefit metastatic OMM patients with c-Kit mutations.

  11. Identification of mutations in the coding sequence of the proto-oncogene c-kit in a human mast cell leukemia cell line causing ligand-independent activation of c-kit product.

    PubMed Central

    Furitsu, T; Tsujimura, T; Tono, T; Ikeda, H; Kitayama, H; Koshimizu, U; Sugahara, H; Butterfield, J H; Ashman, L K; Kanayama, Y

    1993-01-01

    The c-kit proto-oncogene encodes a receptor tyrosine kinase. Binding of c-kit ligand, stem cell factor (SCF) to c-kit receptor (c-kitR) is known to activate c-kitR tyrosine kinase, thereby leading to autophosphorylation of c-kitR on tyrosine and to association of c-kitR with substrates such as phosphatidylinositol 3-kinase (PI3K). In a human mast cell leukemia cell line HMC-1, c-kitR was found to be constitutively phosphorylated on tyrosine, activated, and associated with PI3K without the addition of SCF. The expression of SCF mRNA transcript in HMC-1 cells was not detectable by means of PCR after reverse transcription (RT-PCR) analysis, suggesting that the constitutive activation of c-kitR was ligand independent. Sequencing of whole coding region of c-kit cDNA revealed that c-kit genes of HMC-1 cells were composed of a normal, wild-type allele and a mutant allele with two point mutations resulting in intracellular amino acid substitutions of Gly-560 for Val and Val-816 for Asp. Amino acid sequences in the regions of the two mutations are completely conserved in all of mouse, rat, and human c-kit. In order to determine the causal role of these mutations in the constitutive activation, murine c-kit mutants encoding Gly-559 and/or Val-814, corresponding to human Gly-560 and/or Val-816, were constructed by site-directed mutagenesis and expressed in a human embryonic kidney cell line, 293T cells. In the transfected cells, both c-kitR (Gly-559, Val-814) and c-kitR (Val-814) were abundantly phosphorylated on tyrosine and activated in immune complex kinase reaction in the absence of SCF, whereas tyrosine phosphorylation and activation of c-kitR (Gly-559) or wild-type c-kitR was modest or little, respectively. These results suggest that conversion of Asp-816 to Val in human c-kitR may be an activating mutation and responsible for the constitutive activation of c-kitR in HMC-1 cells. Images PMID:7691885

  12. C-kit mutations in gastrointestinal stromal tumours.

    PubMed

    Morey, Adrienne L; Wanigesekera, G David; Hawkins, Nicholas J; Ward, Robyn L

    2002-08-01

    Gastrointestinal stromal tumours (GISTs), once assumed to be of smooth muscle origin, generally express CD117 and CD34, similar to the interstitial cells of Cajal. Assessment of malignant potential in GISTs is problematic, especially on small biopsies. Some recent data indicate that mutations in the juxtamembrane domain (exon 11) of the c-kit (CD117) proto-oncogene may be associated with a worse prognosis. In this study, the frequency of c-kit exon 11 mutations has been determined in a series of 18 gut stromal tumours. Immunophenotype was assessed by immunoperoxidase stains for smooth muscle actin, desmin, S100, CD34 and CD117, and each tumour classified as being of low, uncertain (intermediate) or high malignant potential based on standard histological criteria. DNA from each tumour was extracted from fresh (n = 5) or formalin-fixed, paraffin-embedded (n= 13) tissues using the direct lysis method. Exon 11 was amplified by PCR and sequencing of both sense and antisense strands was performed on two occasions using an ABI 377 sequencer. Mutations in exon 11 were detected in three of 14 confirmed GISTs, two being point mutations at codon 560 and one a 3-bp deletion resulting in the in-frame deletion of glutamine at codon 561. All three tumours were of high or intermediate malignant potential histologically. Three other 'high risk' primary GISTs and a metastatic GIST deposit were negative for exon 11 mutations. Data on this relatively small cohort of Australian patients indicate that c-kit exon 11 mutation analysis does not correlate well with histological assessment of malignant potential, and cannot be regarded as a reliable objective marker for poor prognosis in GISTs.

  13. Unraveling the spectrum of KIT mutations in gastrointestinal stromal tumors: An Indian Tertiary Cancer Center Experience.

    PubMed

    Pai, Trupti; Bal, Munita; Shetty, Omshree; Gurav, Mamta; Ostwal, Vikas; Ramaswamy, Anant; Ramadwar, Mukta; Desai, Sangeeta

    2017-01-01

    Primary mutations in the KIT gene are the driving force for gastrointestinal stromal tumors (GIST) tumorigenesis. Predictive role of KIT mutation status aids oncologists in patient management. There is a paucity of comprehensive data on the frequency of mutations in the KIT gene in GIST affecting Indian patients. The aims of this study were to determine the frequency and spectrum of molecular alterations affecting the KIT gene and assess their association with clinicopathologic features in a cohort of patients of GIST. Morphological and immunohistochemically confirmed GIST cases ( n = 114) accessioned from August 2014-June 2015 were analyzed for mutations in KIT exons 9, 11, 13, and 17 and subjected to Sanger sequencing onto the ABI 3500 Genetic Analyzer. The sequences were analyzed using sequence analysis software: SeqScape ® and Chromas Lite. KIT mutations were seen in 70% of cases and the majority of KIT mutations involved exon 11 (57%), followed by exon 9 (10%), exon 13 (3%), and exon 17 (1%). Most common exon 11 mutations were in-frame deletions (61.4%) followed by substitution mutations (19.3%). Exon 9 mutations showed identical duplication of Ala-Tyr at codons 502-503. Simultaneous mutations affecting exon 11 and 13 were discovered. Novel variations, namely, p.Q556E (c.1666C>G), p.Q556dup (c.1666_1668dupCAG), p.K558_V559delinsS (c.1672_1677delAAGGTTinsAGT), p.Y503_F504insTY (c.1509_1510insACCTAT), and p.K642R (c.1925A>G) involving exons 11, 9, and 13, respectively, were observed. First study with complete analysis of all 4 exons of KIT (exons 9, 11, 13, and 17) in Indian GIST patients. Along with well-described KIT mutations, several rare double mutations as well as novel alterations were reported in this series.

  14. Characterization of various types of mast cells derived from model mice of familial gastrointestinal stromal tumors with KIT-Asp818Tyr mutation

    PubMed Central

    Kajimoto, Noriko; Nakai, Norihiro; Ohkouchi, Mizuka; Hashikura, Yuka; Liu-Kimura, Ning-Ning; Isozaki, Koji; Hirota, Seiichi

    2015-01-01

    Sporadic mast cell neoplasms and gastrointestinal stromal tumors (GISTs) often have various types of somatic gain-of-function mutations of the c-kit gene which encodes a receptor tyrosine kinase, KIT. Several types of germline gain-of-function mutations of the c-kit gene have been detected in families with multiple GISTs. All three types of model mice for the familial GISTs with germline c-kit gene mutations at exon 11, 13 or 17 show development of GIST, while they are different from each other in skin mast cell number. Skin mast cell number in the model mice with exon 17 mutation was unchanged compared to the corresponding wild-type mice. In the present study, we characterized various types of mast cells derived from the model mice with exon 17 mutation (KIT-Asp818Tyr) corresponding to human familial GIST case with human KIT-Asp820Tyr to clarify the role of the c-kit gene mutation in mast cells. Bone marrow-derived cultured mast cells (BMMCs) derived from wild-type mice, heterozygotes and homozygotes were used for the experiments. Immortalized BMMCs, designated as IMC-G4 cells, derived from BMMCs of a homozygote during long-term culture were also used. Ultrastructure, histamine contents, proliferation profiles and phosphorylation of various signaling molecules in those cells were examined. In IMC-G4 cells, presence of additional mutation(s) of the c-kit gene and effect of KIT inhibitors on both KIT autophosphorylation and cell proliferation were also analyzed. We demonstrated that KIT-Asp818Tyr did not affect ultrastructure and proliferation profiles but did histamine contents in BMMCs. IMC-G4 cells had an additional novel c-kit gene mutation of KIT-Tyr421Cys which is considered to induce neoplastic transformation of mouse mast cells and the mutation appeared to be resistant to a KIT inhibitor of imatinib but sensitive to another KIT inhibitor of nilotinib. IMC-G4 cells might be a useful mast cell line to investigate mast cell biology. PMID:26722383

  15. Expression and Mutational Analysis of c-kit in Ovarian Surface Epithelial Tumors

    PubMed Central

    Lee, Myung-Hoon; Park, Tae-In; Bae, Han-Ik

    2006-01-01

    Coexpression of Kit ligand and c-kit has been reported in some gynecologic tumors. To determine whether imatinib mesylate is useful in ovarian epithelial tumors, we performed immunohistochemical and mutational analysis. The cases consisted of 33 cases, which included 13 serous cystadenocarcinomas, 1 borderline serous tumor, 8 mucinous cystadenocarcinomas, 6 borderline mucinous tumors and 5 clear cell carcinomas. Five cases of serous cystadenoma and 5 cases of mucinous cystadenoma were also included. In the immunohistochemical study, 3 cases (3/6, 50%) of borderline mucinous cystic tumor and two cases (2/8, 25%) of mucinous cystadenocarcinoma show positive staining for KIT protein. Only one case (1/13, 7.7%) of serous cystadenocarcinoma had positive staining. On mutational analysis, no mutation was identified at exon 11. However, two cases of borderline mucinous tumors and one case of mucinous cystadenocarcinoma had mutations at exon 17. In these cases, the immunohistochemistry also shows focal positive staining at epithelial component. Although, KIT protein expression showed higher incidence in mucinous tumors than serous tumors, they lack KIT-activating mutations in exon 11. Thus, ovarian surface epithelial tumors are unlikely to respond to imatinib mesylate. PMID:16479070

  16. Kit W-sh Mutation Prevents Cancellous Bone Loss during Calcium Deprivation.

    PubMed

    Lotinun, Sutada; Suwanwela, Jaijam; Poolthong, Suchit; Baron, Roland

    2018-01-01

    Calcium is essential for normal bone growth and development. Inadequate calcium intake increases the risk of osteoporosis and fractures. Kit ligand/c-Kit signaling plays an important role in regulating bone homeostasis. Mice with c-Kit mutations are osteopenic. The present study aimed to investigate whether impairment of or reduction in c-Kit signaling affects bone turnover during calcium deprivation. Three-week-old male WBB6F1/J-Kit W /Kit W-v /J (W/W v ) mice with c-Kit point mutation, Kit W-sh /HNihrJaeBsmJ (W sh /W sh ) mice with an inversion mutation in the regulatory elements upstream of the c-Kit promoter region, and their wild-type controls (WT) were fed either a normal (0.6% calcium) or a low calcium diet (0.02% calcium) for 3 weeks. μCT analysis indicated that both mutants fed normal calcium diet had significantly decreased cortical thickness and cancellous bone volume compared to WT. The low calcium diet resulted in a comparable reduction in cortical bone volume and cortical thickness in the W/W v and W sh /W sh mice, and their corresponding controls. As expected, the low calcium diet induced cancellous bone loss in the W/W v mice. In contrast, W sh /W sh cancellous bone did not respond to this diet. This c-Kit mutation prevented cancellous bone loss by antagonizing the low calcium diet-induced increase in osteoblast and osteoclast numbers in the W sh /W sh mice. Gene expression profiling showed that calcium deficiency increased Osx, Ocn, Alp, type I collagen, c-Fms, M-CSF, and RANKL/OPG mRNA expression in controls; however, the W sh mutation suppressed these effects. Our findings indicate that although calcium restriction increased bone turnover, leading to osteopenia, the decreased c-Kit expression levels in the W sh /W sh mice prevented the low calcium diet-induced increase in cancellous bone turnover and bone loss but not the cortical bone loss.

  17. Analysis of the surface expression of c-kit and occurrence of the c-kit Asp816Val activating mutation in T cells, B cells, and myelomonocytic cells in patients with mastocytosis.

    PubMed

    Akin, C; Kirshenbaum, A S; Semere, T; Worobec, A S; Scott, L M; Metcalfe, D D

    2000-02-01

    The Asp816Val c-kit activating mutation is detectable in the peripheral blood cells of some patients with mastocytosis and in lesional skin biopsies obtained from adult patients with urticaria pigmentosa. These observations led to the conclusion that this mutation is present in mast cells and mast cell precursors that express c-kit. However, the distribution of the Asp816Val mutation among hematopoietic lineages is unknown. To determine the distribution of the Asp816Val mutation among hematopoietic lineages and to explore its relationship to clinical disease, we examined cells bearing differentiation markers for myelomonocytic cells as well as T and B lymphocytes, in both peripheral blood and bone marrow obtained from patients with mastocytosis. The presence of Asp816Val c-kit mutation in cells magnetically sorted from peripheral blood or bone marrow according to surface differentiation markers was studied by reverse transcriptase polymerase chain reaction (RT-PCR) restriction fragment length polymorphism (RFLP) analysis. The surface expression of c-kit was determined by flow cytometry. The mutation was detectable by RT-PCR in at least one cell lineage in the bone marrow in 7 of 7 patients examined and in the peripheral blood of 11 of 11 adult patients with urticaria pigmentosa and indolent disease. The mutation was identified most frequently in B cells and myeloid cells. Flow cytometric analysis demonstrated that the differentiated cells expressing mutated c-kit were negative for surface KIT. These results are consistent with the conclusion that the c-kit Asp816Val mutation occurs in an early progenitor cell and is carried by myelomonocytic cells, T cells, and B cells in addition to mast cells. However, unlike mast cells, these myelomonocytic cells, T cells, and B cells do not concomitantly express surface c-kit and thus may be less susceptible to the effects of this mutation.

  18. Disruption of c-Kit Signaling in Kit(W-sh/W-sh) Growing Mice Increases Bone Turnover.

    PubMed

    Lotinun, Sutada; Krishnamra, Nateetip

    2016-08-16

    c-Kit tyrosine kinase receptor has been identified as a regulator of bone homeostasis. The c-Kit loss-of-function mutations in WBB6F1/J-Kit(W/W-v) mice result in low bone mass. However, these mice are sterile and it is unclear whether the observed skeletal phenotype is secondary to a sex hormone deficiency. In contrast, C57BL/6J-Kit(W-sh)/(W-sh) (W(sh)/W(sh)) mice, which carry an inversion mutation affecting the transcriptional regulatory elements of the c-Kit gene, are fertile. Here, we showed that W(sh)/W(sh) mice exhibited osteopenia with elevated bone resorption and bone formation at 6- and 9-week-old. The c-Kit W(sh) mutation increased osteoclast differentiation, the number of committed osteoprogenitors, alkaline phosphatase activity and mineralization. c-Kit was expressed in both osteoclasts and osteoblasts, and c-Kit expression was decreased in W(sh)/W(sh)osteoclasts, but not osteoblasts, suggesting an indirect effect of c-Kit on bone formation. Furthermore, the osteoclast-derived coupling factor Wnt10b mRNA was increased in W(sh)/W(sh) osteoclasts. Conditioned medium from W(sh)/W(sh) osteoclasts had elevated Wnt10b protein levels and induced increased alkaline phosphatase activity and mineralization in osteoblast cultures. Antagonizing Wnt10b signaling with DKK1 or Wnt10b antibody inhibited these effects. Our data suggest that c-Kit negatively regulates bone turnover, and disrupted c-Kit signaling couples increased bone resorption with bone formation through osteoclast-derived Wnt 10 b.

  19. Familial gastrointestinal stromal tumors, lentigines, and café-au-lait macules associated with germline c-kit mutation treated with imatinib.

    PubMed

    Gupta, Divya; Chandrashekar, Laxmisha; Larizza, Lidia; Colombo, Elisa A; Fontana, Laura; Gervasini, Cristina; Thappa, Devinder M; Rajappa, Medha; Rajendiran, Kalai Selvi; Sreenath, Gubbi Shamanna; Kate, Vikram

    2017-02-01

    Familial lentiginosis syndromes are characterized by a wide array of manifestations resulting from activation of molecular pathways which control growth, proliferation, and differentiation of a broad range of tissues. Familial gastrointestinal stromal tumors (GISTs) are often accompanied by additional features like hyperpigmentation, mastocytosis, and dysphagia. They have been described with mutations in c-kit (most commonly), platelet-derived growth factor receptor A, neurofibromatosis-1, and succinate dehydrogenase genes. We report on molecular characterization and tumor histopathology of two siblings in whom lentigines and café-au-lait macules were present along with multifocal GIST. Immuhistochemical analysis of CD34 and CD117 was performed on GIST biopsy samples from both siblings, while c-kit mutational analysis was done by PCR and direct sequencing on DNA from peripheral blood leukocytes of all family members and from paraffin-embedded gastric biopsy specimens of affected siblings. Histopathology revealed positive expression of CD117 and CD34. Mutational analysis showed the germline c.1676T>C mutation in c-kit exon 11, (p.(Val559Ala)), in the peripheral blood of both siblings and a second exon 11 mutation, c.1669T>A (p.(Trp557Arg)) in the tumor biopsy of one of them. Initiation of imatinib treatment resulted in striking resolution of their hyperpigmentation and a stable gastrointestinal disease in one of them. A c-kit mutational test in familial GISTs is indicated before initiation of imatinib therapy, as it can help predict tumor response to treatment. © 2017 The International Society of Dermatology.

  20. A variant c-KIT mutation, D816H, fundamental to the sequential development of an ovarian mixed germ cell tumor and systemic mastocytosis with chronic myelomonocytic leukemia.

    PubMed

    Mitchell, Sarah G; Bunting, Silvia T; Saxe, Debra; Olson, Thomas; Keller, Frank G

    2017-04-01

    An activating point mutation of the c-KIT tyrosine kinase receptor gene, D816H, has been described in germ cell tumors (GCTs). We report an adolescent diagnosed with an ovarian mixed GCT and systemic mastocytosis with chronic myelomonocytic leukemia (SM-CMML). The teratoma and dysgerminoma differed by copy number aberrations via single nucleotide polymorphism (SNP) microarray, but were inclusive of the same c-KIT D816H point mutation (c.2446G>C) also identified in blood and bone marrow mast cells. These findings indicate not only a clonal origin of the GCT and hematologic malignancy, but also suggest a rare KIT mutation may be playing a fundamental role in malignancy development. © 2016 Wiley Periodicals, Inc.

  1. KIT Mutations Are Common in Testicular Seminomas

    PubMed Central

    Kemmer, Kathleen; Corless, Christopher L.; Fletcher, Jonathan A.; McGreevey, Laura; Haley, Andrea; Griffith, Diana; Cummings, Oscar W.; Wait, Cecily; Town, Ajia; Heinrich, Michael C.

    2004-01-01

    Expression of KIT tyrosine kinase is critical for normal germ cell development and is observed in the majority of seminomas. Activating mutations in KIT are common in gastrointestinal stromal tumors and mastocytosis. In this study we examined the frequency and spectrum of KIT mutations in 54 testicular seminomas, 1 ovarian dysgerminoma and 37 non-seminomatous germ cell tumors (NSGCT). Fourteen seminomas (25.9%) contained exon 17 point mutations including D816V (6 cases), D816H (3 cases), Y823D (2 cases), and single examples of Y823C, N822K, and T801I. No KIT mutations were found in the ovarian dysgerminoma or the NSGCTs. In transient transfection assays, mutant isoforms D816V, D816H, Y823D, and N822K were constitutively phosphorylated in the absence of the natural ligand for KIT, stem cell factor (SCF). In contrast, activation of T801I and wild-type KIT required SCF. Mutants N822K and Y823D were inhibited by imatinib mesylate (Gleevec, previously STI571) whereas D816V and D816H were both resistant to imatinib mesylate. Biochemical evidence of KIT activation, as assessed by KIT phosphorylation and KIT association with phosphatidylinositol (PI) 3-kinase in tumor cell lysates, was largely confined to seminomas with a genomic KIT mutation. These findings suggest that activating KIT mutations may contribute to tumorigenesis in a subset of seminomas, but are not involved in NSGCT. PMID:14695343

  2. c-kit mutation in a population of patients with mastocytosis.

    PubMed

    Nagata, H; Okada, T; Worobec, A S; Semere, T; Metcalfe, D D

    1997-01-01

    The c-kit Asp816Val activating mutation is found in all patients with mastocytosis with an associated hematologic disorder, and at least in a subset of patients with indolent mastocytosis. The case of an 11-month-old child is presented who was categorized as having indolent mastocytosis, and where the Asp816Val mutation was identified in lesional skin, but not in bone marrow or in peripheral blood mononuclear cell populations. The significance of these findings is discussed.

  3. A Frameshift Mutation in KIT is Associated with White Spotting in the Arabian Camel

    PubMed Central

    Holl, Heather; Isaza, Ramiro; Mohamoud, Yasmin; Ahmed, Ayeda; Almathen, Faisal; Youcef, Cherifi; Gaouar, Semir; Antczak, Douglas F.; Brooks, Samantha

    2017-01-01

    While the typical Arabian camel is characterized by a single colored coat, there are rare populations with white spotting patterns. White spotting coat patterns are found in virtually all domesticated species, but are rare in wild species. Theories suggest that white spotting is linked to the domestication process, and is occasionally associated with health disorders. Though mutations have been found in a diverse array of species, fewer than 30 genes have been associated with spotting patterns, thus providing a key set of candidate genes for the Arabian camel. We obtained 26 spotted camels and 24 solid controls for candidate gene analysis. One spotted and eight solid camels were whole genome sequenced as part of a separate project. The spotted camel was heterozygous for a frameshift deletion in KIT (c.1842delG, named KITW1 for White spotting 1), whereas all other camels were wild-type (KIT+/KIT+). No additional mutations unique to the spotted camel were detected in the EDNRB, EDN3, SOX10, KITLG, PDGFRA, MITF, and PAX3 candidate white spotting genes. Sanger sequencing of the study population identified an additional five KITW1/KIT+ spotted camels. The frameshift results in a premature stop codon five amino acids downstream, thus terminating KIT at the tyrosine kinase domain. An additional 13 spotted camels tested KIT+/KIT+, but due to phenotypic differences when compared to the KITW1/KIT+ camels, they likely represent an independent mutation. Our study suggests that there are at least two causes of white spotting in the Arabian camel, the newly described KITW1 allele and an uncharacterized mutation. PMID:28282952

  4. Prevalence of c-KIT Mutations in Gonadoblastoma and Dysgerminomas of Patients with Disorders of Sex Development (DSD) and Ovarian Dysgerminomas

    PubMed Central

    Hersmus, Remko; Stoop, Hans; van de Geijn, Gert Jan; Eini, Ronak; Biermann, Katharina; Oosterhuis, J. Wolter; DHooge, Catharina; Schneider, Dominik T.; Meijssen, Isabelle C.; Dinjens, Winand N. M.; Dubbink, Hendrikus Jan; Drop, Stenvert L. S.; Looijenga, Leendert H. J.

    2012-01-01

    Activating c-KIT mutations (exons 11 and 17) are found in 10–40% of testicular seminomas, the majority being missense point mutations (codon 816). Malignant ovarian dysgerminomas represent ∼3% of all ovarian cancers in Western countries, resembling testicular seminomas, regarding chromosomal aberrations and c-KIT mutations. DSD patients with specific Y-sequences have an increased risk for Type II Germ Cell Tumor/Cancer, with gonadoblastoma as precursor progressing to dysgerminoma. Here we present analysis of c-KIT exon 8, 9, 11, 13 and 17, and PDGFRA exon 12, 14 and 18 by conventional sequencing together with mutational analysis of c-KIT codon 816 by a sensitive and specific LightCycler melting curve analysis, confirmed by sequencing. The results are combined with data on TSPY and OCT3/4 expression in a series of 16 DSD patients presenting with gonadoblastoma and dysgerminoma and 15 patients presenting pure ovarian dysgerminomas without DSD. c-KIT codon 816 mutations were detected in five out of the total of 31 cases (all found in pure ovarian dysgerminomas). A synonymous SNP (rs 5578615) was detected in two patients, one DSD patient (with bilateral disease) and one patient with dysgerminoma. Next to these, three codon N822K mutations were detected in the group of 15 pure ovarian dysgerminomas. In total activating c-KIT mutations were found in 53% of ovarian dysgerminomas without DSD. In the group of 16 DSD cases a N505I and D820E mutation was found in a single tumor of a patient with gonadoblastoma and dysgerminoma. No PDGFRA mutations were found. Positive OCT3/4 staining was present in all gonadoblastomas and dysgerminomas investigated, TSPY expression was only seen in the gonadoblastoma/dysgerminoma lesions of the 16 DSD patients. This data supports the existence of two distinct but parallel pathways in the development of dysgerminoma, in which mutational status of c-KIT might parallel the presence of TSPY. PMID:22937135

  5. Receptor tyrosine kinase (c-Kit) inhibitors: a potential therapeutic target in cancer cells

    PubMed Central

    Abbaspour Babaei, Maryam; Kamalidehghan, Behnam; Saleem, Mohammad; Huri, Hasniza Zaman; Ahmadipour, Fatemeh

    2016-01-01

    c-Kit, a receptor tyrosine kinase, is involved in intracellular signaling, and the mutated form of c-Kit plays a crucial role in occurrence of some cancers. The function of c-Kit has led to the concept that inhibiting c-Kit kinase activity can be a target for cancer therapy. The promising results of inhibition of c-Kit for treatment of cancers have been observed in some cancers such as gastrointestinal stromal tumor, acute myeloid leukemia, melanoma, and other tumors, and these results have encouraged attempts toward improvement of using c-Kit as a capable target for cancer therapy. This paper presents the findings of previous studies regarding c-Kit as a receptor tyrosine kinase and an oncogene, as well as its gene targets and signaling pathways in normal and cancer cells. The c-Kit gene location, protein structure, and the role of c-Kit in normal cell have been discussed. Comprehending the molecular mechanism underlying c-Kit-mediated tumorogenesis is consequently essential and may lead to the identification of future novel drug targets. The potential mechanisms by which c-Kit induces cellular transformation have been described. This study aims to elucidate the function of c-Kit for future cancer therapy. In addition, it has c-Kit inhibitor drug properties and their functions have been listed in tables and demonstrated in schematic pictures. This review also has collected previous studies that targeted c-Kit as a novel strategy for cancer therapy. This paper further emphasizes the advantages of this approach, as well as the limitations that must be addressed in the future. Finally, although c-Kit is an attractive target for cancer therapy, based on the outcomes of treatment of patients with c-Kit inhibitors, it is unlikely that Kit inhibitors alone can lead to cure. It seems that c-Kit mutations alone are not sufficient for tumorogenesis, but do play a crucial role in cancer occurrence. PMID:27536065

  6. Molecular Characterization of PDGFR-α/PDGF-A and c-KIT/SCF in Gliosarcomas

    PubMed Central

    Reis, Rui M.; Martins, Albino; Ribeiro, Susana A.; Basto, Diana; Longatto-Filho, Adhemar; Schmitt, Fernando C.; Lopes, José M.

    2005-01-01

    Gliosarcomas are rare and poorly characterized malignant brain tumors that exhibit a biphasic tissue pattern with areas of gliomatous and sarcomatous differentiation. These tumors are histological variants of glioblastoma, displaying a similar genetic profile and dismal prognosis. Up-regulation of PDGFR subfamily of tyrosine kinase members, PDGFR-α and c-Kit, and their intracellular effectors RAS/RAF/MAPK has a crucial role in the cancer development. In addition, signal transduction mediated by activating mutations of c-Kit and PDGFR can be effectively blocked by specific tyrosine kinase inhibitors, such as Imatinib mesylate. The aim of this study was to characterize the molecular alterations of PDGFR signaling in gliosarcomas. Six cases were analyzed by immunohistochemistry for the expression of PDGFR-α, c-Kit and their ligands PDGF-A and SCF, respectively. The cases were further evaluated for the presence of activating mutations of PDGFR-α (exons 12 and 18) and c-kit (exons 9, 11, 13, and 17), as well as B-RAF (exons 11 and 15). Expression of PDGF-A was found in all cases and co-expression of PDGFR-α was observed in three cases. Four cases showed expression of SCF, and c-Kit was observed only in one case that also expressed SCF. Generally, immunoreaction predominates in the glial component. The mutational analysis of PDGFR-α showed the presence of an IVS17-50insT intronic insertion in two cases, one of them also with a 2472C > T silent mutation; this silent mutation was also found in another case. Glioma cell line analysis of IVS17-50insT insertion showed no influence on PDGFR-α gene splicing. No mutations were detected in c-kit and B-RAF oncogenes. Our Results indicate that activating mutations of PDGFR-α, c-kit and B-RAF are absent in gliosarcomas. Nevertheless, the presence of a PDGFR-a/PDGFA and c-Kit/SCF autocrine/paracrine stimulation loop in a proportion of cases, supports the potential role of specific tyrosine kinase inhibitors in the treatment of

  7. c-Kit Mutation and Localization Status as Response Predictors in Mast Cell Tumors in Dogs Treated with Prednisone and Toceranib or Vinblastine.

    PubMed

    Weishaar, K M; Ehrhart, E J; Avery, A C; Charles, J B; Elmslie, R E; Vail, D M; London, C A; Clifford, C A; Eickhoff, J C; Thamm, D H

    2018-01-01

    KIT inhibitors, such as toceranib (TOC), and vinblastine (VBL) have not been prospectively compared in the treatment of macroscopic mast cell tumors (MCTs). Also, it is unknown whether VBL or TOC is superior for treating MCT without c-kit mutations. To determine the value of KIT genotyping and localization in treatment decisions for dogs with macroscopic MCT. We hypothesized that c-kit mutated MCT would have a better response to TOC than VBL. Eighty-eight client-owned dogs with macroscopic MCT. Prospective, randomized trial. Dogs were randomized to TOC (2.75 mg/kg EOD) or VBL (2.5 mg/m 2 weekly × 4 then EOW) by KIT localization and c-kit mutation status using an adaptive randomization scheme. Sixty dogs were allocated to TOC and 28 to VBL. Of the dogs receiving TOC, 20% had c-kit mutations, compared to 30% receiving VBL (P = 0.74). Overall response rates were 46% (TOC) and 30% (VBL) (odds ratio = 1.56 [0.62-3.92]; P = 0.28). Median progression-free survival (PFS) for dogs receiving VBL was 78 days (7-1,521) and for TOC 95.5 (14-990); hazard ratio (HR) = 1.34 [0.72-2.50]; P = 0.36. Median overall survival (OS) was 241.5 days (10-1,521) for the VBL group and 159 (20-990) for the TOC group; HR = 0.80 ([0.45-1.41]; P = 0.44). Neither PFS nor OS was significantly different between treatment groups. As the proportion of dogs with c-kit mutations was not different between treatment groups in this population of dogs, c-kit mutation status did not predict treatment response. Copyright © 2017 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  8. Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

    PubMed Central

    Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma

    2006-01-01

    Background Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. Methods In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. Results No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. Conclusion In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs. PMID:16579858

  9. Prognostic Importance of C-KIT Mutations in Core Binding Factor Acute Myeloid Leukemia: A Systematic Review.

    PubMed

    Ayatollahi, Hossein; Shajiei, Arezoo; Sadeghian, Mohammad Hadi; Sheikhi, Maryam; Yazdandoust, Ehsan; Ghazanfarpour, Masumeh; Shams, Seyyede Fatemeh; Shakeri, Sepideh

    2017-03-01

    Acute myeloid leukemia (AML) is defined as leukemic blast reproduction in bone marrow. Chromosomal abnormalities form different subgroups with joint clinical specifications and results. t(8;21)(q22;q22) and inv(16)(p13;q22) form core binding factor-AML (CBF-AML). c-kit mutation activation occurs in 12.8-46.1% of adults with CBF leukemia. These mutations occur in 20-25% of t(8;21) and 30% of inv(16) cases. In this systematic review, we searched different databases, including PubMed, Scopus, and Embase. Selected articles were measured based on the inclusion criteria of this study and initially compared in terms of titles or abstracts. Finally, articles relevant to the subject of this review were retrieved in full text. Twenty-two articles matched the inclusion criteria and were selected for this review. In this study, c-kit mutations were associated with poor prognosis in AML patients with t(8;21) and inv(16). In addition, these mutations had better prognostic effects on AML patients with inv(16) compared with those with t(8;21). According to the results of this study, c-kit mutations have intense, harmful effects on the relapse and white blood cell increase in CBF-AML adults. However, these mutations have no significant prognostic effects on patients. Copyright © 2016 King Faisal Specialist Hospital & Research Centre. Published by Elsevier Ltd. All rights reserved.

  10. A de novo mutation in KIT causes white spotting in a subpopulation of German Shepherd dogs.

    PubMed

    Wong, A K; Ruhe, A L; Robertson, K R; Loew, E R; Williams, D C; Neff, M W

    2013-06-01

    Although variation in the KIT gene is a common cause of white spotting among domesticated animals, KIT has not been implicated in the diverse white spotting observed in the dog. Here, we show that a loss-of-function mutation in KIT recapitulates the coat color phenotypes observed in other species. A spontaneous white spotting observed in a pedigree of German Shepherd dogs was mapped by linkage analysis to a single locus on CFA13 containing KIT (pairwise LOD = 15). DNA sequence analysis identified a novel 1-bp insertion in the second exon that co-segregated with the phenotype. The expected frameshift and resulting premature stop codons predicted a severely truncated c-Kit receptor with presumably abolished activity. No dogs homozygous for the mutation were recovered from multiple intercrosses (P = 0.01), suggesting the mutation is recessively embryonic lethal. These observations are consistent with the effects of null alleles of KIT in other species. © 2012 The Authors, Animal Genetics © 2012 Stichting International Foundation for Animal Genetics.

  11. KIT mutations in Russian patients with mucosal melanoma.

    PubMed

    Abysheva, Svetlana N; Iyevleva, Aglaya G; Efimova, Nina V; Mokhina, Yulia B; Sabirova, Feruza A; Ivantsov, Alexandr O; Artemieva, Anna S; Togo, Alexandr V; Moiseyenko, Vladimir M; Matsko, Dmitry E; Imyanitov, Evgeny N

    2011-12-01

    A single institution series of 48 mucosal melanomas (MMs) has been analyzed for the presence of KIT mutations using high-resolution melting and sequencing of abnormally melted DNA fragments. The analysis of exons 9, 11, 13, and 17 has revealed eight of 48 (17%) nonsynonymous alterations, including zero of seven head and neck, six of 24 anorectal, one of 15 genitourinary, one of one gastric, and zero of one mediastinal MMs. Seven of these mutations were potentially associated with the tumor sensitivity to KIT tyrosine kinase inhibitors. One tumor harbored somatically acquired silent nucleotide substitution c.1383A>G (T461T). This study adds to the evidence that a substantial portion of MMs carry a therapeutically relevant mutation in the KIT oncogene.

  12. Comprehensive molecular screening by next generation sequencing reveals a distinctive mutational profile of KIT/PDGFRA genes and novel genomic alterations: results from a 20-year cohort of patients with GIST from north-western Greece.

    PubMed

    Mavroeidis, Leonidas; Metaxa-Mariatou, Vassiliki; Papoudou-Bai, Alexandra; Lampraki, Angeliki Maria; Kostadima, Lida; Tsinokou, Ilias; Zarkavelis, George; Papadaki, Alexandra; Petrakis, Dimitrios; Gκoura, Stefania; Kampletsas, Eleftherios; Nasioulas, George; Batistatou, Anna; Pentheroudakis, George

    2018-01-01

    Gastrointestinal stromal tumours (GIST) are mesenchymal neoplasms that usually carry an activating mutation in KIT or platelet-derived growth factor receptor alpha ( PDGFRA ) genes with predictive and prognostic significance. We investigated the extended mutational status of GIST in a patient population of north-western Greece in order to look at geopraphic/genotypic distinctive traits. Clinicopathological and molecular data of 38 patients diagnosed from 1996 to 2016 with GIST in the region of Epirus in Greece were retrospectively assessed. Formalin-fixed paraffin-embedded tumours were successfully analysed for mutations in 54 genes with oncogenic potential. Next generation sequencing was conducted by using the Ion AmpliSeqCancer Hotspot Panel V.2 for DNA analysis (Thermofisher Scientific). Among 38 tumours, 24 (63.16%) and seven (18.42%) of the tumours harboured mutations in the KIT and PDGFRA genes, respectively, while seven (18.42%) tumours were negative for either KIT or PDGFRA mutation. No mutations were detected in five (13.16%) cases. Concomitant mutations of BRAF and fibroblast growth factor receptor 3 ( FGFR3 ) genes were observed in two patients with KIT gene mutation. Two patients with KIT / PDGFRA wild-type GIST had mutations in either KRAS or phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha ( PIK3CA ) genes. There was no significant survival difference regarding the exonic site of mutation in either KIT or PDGFRA gene. The presence of a mutation in pathway effectors downstream of KIT or PDGFRA , such as BRAF , KRAS or PIK3CA , was associated with poor prognosis. Adverse prognosticators were also high mitotic index and the advanced disease status at diagnosis. We report comparable incidence of KIT and PDGFRA mutation in patients with GIST from north-western Greece as compared with cohorts from other regions. Interestingly, we identified rare mutations on RAS , BRAF and PIK3CA genes in patients with poor prognosis.

  13. Emergence of CTNNB1 mutation at acquired resistance to KIT inhibitor in metastatic melanoma.

    PubMed

    Cho, J; Kim, S Y; Kim, Y J; Sim, M H; Kim, S T; Kim, N K D; Kim, K; Park, W; Kim, J H; Jang, K-T; Lee, J

    2017-10-01

    The KIT inhibitor, imatinib, has shown promising efficacy in patients with KIT-mutated melanoma; however, acquisition of resistance to imatinib occurs rapidly in the majority of patients. The mechanisms of acquired resistance to imatinib in melanoma remain unclear. We analyzed biopsy samples from paired baseline and post-treatment tumor lesions in one patient with KIT-mutated melanoma who had had an initial objective tumor regression in response to imatinib treatment followed by disease progression 8 months later. Targeted deep sequencing from post-treatment biopsy samples detected an additional mutation in CTNNB1 (S33C) with original KIT L576P mutation. We examined the functional role of the additional CTNNB1 S33C mutation in resistance to imatinib indirectly using the Ba/F3 cell model. Ba/F3 cell lines transfected with both the L576P KIT mutation and the CTNNB1 S33C mutation demonstrated no growth inhibition despite imatinib treatment, whereas growth inhibition was observed in the Ba/F3 cell line transfected with the L576 KIT mutation alone. We report the first identification of the emergence of a CTNNB1 mutation that can confer acquired resistance to imatinib. Further investigation into the causes of acquired resistance to imatinib will be essential to improve the prognosis for patients with KIT-mutated melanoma.

  14. Activated c-Kit receptor in the heart promotes cardiac repair and regeneration after injury

    PubMed Central

    Di Siena, S; Gimmelli, R; Nori, S L; Barbagallo, F; Campolo, F; Dolci, S; Rossi, P; Venneri, M A; Giannetta, E; Gianfrilli, D; Feigenbaum, L; Lenzi, A; Naro, F; Cianflone, E; Mancuso, T; Torella, D; Isidori, A M; Pellegrini, M

    2016-01-01

    The role of endogenous c-Kit receptor activation on cardiac cell homeostasis and repair remains largely unexplored. Transgenic mice carrying an activating point mutation (TgD814Y) in the kinase domain of the c-Kit gene were generated. c-KitTgD814Y receptor was expressed in the heart during embryonic development and postnatal life, in a similar timing and expression pattern to that of the endogenous gene, but not in the hematopoietic compartment allowing the study of a cardiac-specific phenotype. c-KitTgD814Y mutation produced a constitutive active c-Kit receptor in cardiac tissue and cells from transgenic mice as demonstrated by the increased phosphorylation of ERK1/2 and AKT, which are the main downstream molecular effectors of c-Kit receptor signaling. In adult transgenic hearts, cardiac morphology, size and total c-Kit+ cardiac cell number was not different compared with wt mice. However, when c-KitTgD814Y mice were subjected to transmural necrotic heart damage by cryoinjury (CI), all transgenic survived, compared with half of wt mice. In the sub-acute phase after CI, transgenic and wt mice showed similar heart damage. However, 9 days after CI, transgenic mice exhibited an increased number of c-Kit+CD31+ endothelial progenitor cells surrounding the necrotic area. At later follow-up, a consistent reduction of fibrotic area, increased capillary density and increased cardiomyocyte replenishment rate (as established by BrdU incorporation) were observed in transgenic compared with wt mice. Consistently, CD45−c-Kit+ cardiac stem cells isolated from transgenic c-KitTgD814Y mice showed an enhanced endothelial and cardiomyocyte differentiation potential compared with cells isolated from the wt. Constitutive activation of c-Kit receptor in mice is associated with an increased cardiac myogenic and vasculogenic reparative potential after injury, with a significant improvement of survival. PMID:27468693

  15. A change in structural integrity of c-Kit mutant D816V causes constitutive signaling.

    PubMed

    Raghav, Pawan Kumar; Singh, Ajay Kumar; Gangenahalli, Gurudutta

    2018-03-01

    Several signaling pathways, ligands, and genes that regulate proliferative and self-renewal properties of the Hematopoietic Stem Cells (HSCs) have been studied meticulously. One of the signaling pathways that play a crucial role in the process of hematopoiesis is the Stem Cell Factor (SCF) mediated c-Kit pathway. The c-Kit is a Receptor Tyrosine Kinase (RTK), which is expressed in the cells including HSCs. It undergoes dimerization upon binding with its cognate ligand SCF. As a result, phosphorylation of the Juxtamembrane (JM) domain of c-Kit takes place at Tyr568 and Tyr570 residues. These phosphorylated residues become the docking sites for protein tyrosine phosphatases (PTPs) namely SHP-1 and SHP-2, which in turn cause dephosphorylation and negative regulation of the downstream signaling responsible for the cell proliferation. Interestingly, it has been reported that the mutation of c-Kit at D816V makes it independent of SCF stimulation and SHP-1/SHP-2 inhibition, thereby, causing its constitutive activation. The present study was commenced to elucidate the structural behavior of this mutation in the JM and A-loop region of c-Kit using Molecular Dynamics (MD) simulations of the wild-type and mutant c-Kit in unphosphorylated and phosphorylated states. The energy difference computed between the wild type and mutant (D816V) c-Kit, and protein-protein docking and complex analysis revealed the impact of this single residue mutation on the integrity dynamics of c-Kit that makes it independent of SHP-1/SHP-2 negative regulation. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Novel somatic KIT exon 8 mutation with dramatic response to imatinib in a patient with mucosal melanoma: a case report.

    PubMed

    Rapisuwon, Suthee; Parks, Kellie; Al-Refaie, Waddah; Atkins, Michael B

    2014-10-01

    Primary mucosal melanomas represent ∼1.3% of all cases of melanoma diagnosed in the USA. The sinonasal location is the most common primary site. Mutations in the KIT gene occur in 10-22% of mucosal melanomas. Tumor response to imatinib mesylate has been reported in about half of the patients with tumors harboring KIT mutations. Responses are almost exclusively restricted to tumors with mutations in KIT exon 9 or 11. We report a case of a patient with a sinonasal mucosal melanoma with a novel exon 8 mutation (C443S) who had marked initial response to imatinib. Somatic exon 8 KIT mutations have not been previously reported in mucosal melanoma or in other human solid tumors; however, such mutations have been reported in canine and feline mast cell tumors. Protein transcripts from exon 8 play an important role in the structural and functional integrity of the extracellular domain of KIT. In preclinical studies, a mutation in exon 8 led to autophosphorylation, independent of KIT ligand, and constitutive activation of the tyrosine kinase. This biology may explain the successful application of imatinib in animals with tumors harboring exon 8 KIT mutations and in our patient with mucosal melanoma. This report expands the population of patients with melanoma who might benefit from imatinib to those with somatic exon 8 KIT mutations. Such mutations should be looked for in patients with mucosal melanoma.

  17. [Molecular mechanisms of primary and secondary resistance, molecular-genetic features and characteristics of KIT/PDGFRA non-mutated GISTs].

    PubMed

    Kalfusová, Alena; Kodet, Roman

    2017-01-01

    Gastrointestinal stromal tumors (GISTs) are the most common mesenchymal tumors of the gastrointestinal tract. Most of them arise due to activating mutations in KIT (75 - 85 %) or PDGFRA (less than 10 %) genes. Identification of the activating mutations in KIT and PDGFRA genes, which code for receptor tyrosine kinases (RTKs), has improved the outcome of targeted therapy of metastatic, unresectable or recurrent GISTs. Primary and/or secondary resistance represents a significant problem in the targeted therapy by Imatinib mesylate (IM) in patients with GIST. An important mechanism of the secondary resistance is the evolvement of secondary mutations. Except for primary and secondary resistance, there is another problem of disease progression - a failure of tumor cells eradication even in the long term therapy of tyrosine kinase inhibitors. GISTs without mutations in KIT/PDGFRA genes constitute 10 - 15% GISTs in adults, and a majority (85 %) of pediatric GISTs. KIT/PDGFRA wild-type GISTs represent a heterogeneous group of tumors with several molecular-genetics and/or morphologic differences. KIT/PDGFRA wild-type GISTs are different in their molecular features, for example in mutations in the BRAF, KRAS, NF1 genes or defects of succinate dehydrogenase (SDH) subunits. KIT/PDGFRA wild-type GISTs are generally less sensitive to targeted therapy by tyrosine kinase inhibitors in comparison with KIT/PDGFRA mutated GISTs. Inhibitors of BRAF, PI3K (mTOR) or inhibitors of IGF1R and VEGFR receptors provide alternative therapeutic strategies.

  18. Identification of a point mutation in the catalytic domain of the protooncogene c-kit in peripheral blood mononuclear cells of patients who have mastocytosis with an associated hematologic disorder.

    PubMed Central

    Nagata, H; Worobec, A S; Oh, C K; Chowdhury, B A; Tannenbaum, S; Suzuki, Y; Metcalfe, D D

    1995-01-01

    Both stem cells and mast cells express c-kit and proliferate after exposure to c-kit ligand. Mutations in c-kit may enhance or interfere with the ability of c-kit receptor to initiate the intracellular pathways resulting in cell proliferation. These observations suggested to us that mastocytosis might in some patients result from mutations in c-kit. cDNA synthesized from peripheral blood mononuclear cells of patients with indolent mastocytosis, mastocytosis with an associated hematologic disorder, aggressive mastocytosis, solitary mastocytoma, and chronic myelomonocytic leukemia unassociated with mastocytosis was thus screened for a mutation of c-kit. This analysis revealed that four of four mastocytosis patients with an associated hematologic disorder with predominantly myelodysplastic features had an A-->T substitution at nt 2468 of c-kit mRNA that causes an Asp-816-->Val substitution. One of one patient examined who had mastocytosis with an associated hematologic disorder had the corresponding mutation in genomic DNA. Identical or similar amino acid substitutions in mast cell lines result in ligand-independent autophosphorylation of the c-kit receptor. This mutation was not identified in the patients within the other disease categories or in 67 of 67 controls. The identification of the point mutation Asp816Val in c-kit in patients with mastocytosis with an associated hematologic disorder provides insight not only into the pathogenesis of this form of mastocytosis but also into how hematopoiesis may become dysregulated and may serve to provide a means of confirming the diagnosis, assessing prognosis, and developing intervention strategies. Images Fig. 1 Fig. 2 Fig. 3 PMID:7479840

  19. Identification of a point mutation in the catalytic domain of the protooncogene c-kit in peripheral blood mononuclear cells of patients who have mastocytosis with an associated hematologic disorder.

    PubMed

    Nagata, H; Worobec, A S; Oh, C K; Chowdhury, B A; Tannenbaum, S; Suzuki, Y; Metcalfe, D D

    1995-11-07

    Both stem cells and mast cells express c-kit and proliferate after exposure to c-kit ligand. Mutations in c-kit may enhance or interfere with the ability of c-kit receptor to initiate the intracellular pathways resulting in cell proliferation. These observations suggested to us that mastocytosis might in some patients result from mutations in c-kit. cDNA synthesized from peripheral blood mononuclear cells of patients with indolent mastocytosis, mastocytosis with an associated hematologic disorder, aggressive mastocytosis, solitary mastocytoma, and chronic myelomonocytic leukemia unassociated with mastocytosis was thus screened for a mutation of c-kit. This analysis revealed that four of four mastocytosis patients with an associated hematologic disorder with predominantly myelodysplastic features had an A-->T substitution at nt 2468 of c-kit mRNA that causes an Asp-816-->Val substitution. One of one patient examined who had mastocytosis with an associated hematologic disorder had the corresponding mutation in genomic DNA. Identical or similar amino acid substitutions in mast cell lines result in ligand-independent autophosphorylation of the c-kit receptor. This mutation was not identified in the patients within the other disease categories or in 67 of 67 controls. The identification of the point mutation Asp816Val in c-kit in patients with mastocytosis with an associated hematologic disorder provides insight not only into the pathogenesis of this form of mastocytosis but also into how hematopoiesis may become dysregulated and may serve to provide a means of confirming the diagnosis, assessing prognosis, and developing intervention strategies.

  20. Allelic Heterogeneity at the Equine KIT Locus in Dominant White (W) Horses

    PubMed Central

    Haase, Bianca; Brooks, Samantha A; Schlumbaum, Angela; Azor, Pedro J; Bailey, Ernest; Alaeddine, Ferial; Mevissen, Meike; Burger, Dominik; Poncet, Pierre-André; Rieder, Stefan; Leeb, Tosso

    2007-01-01

    White coat color has been a highly valued trait in horses for at least 2,000 years. Dominant white (W) is one of several known depigmentation phenotypes in horses. It shows considerable phenotypic variation, ranging from ∼50% depigmented areas up to a completely white coat. In the horse, the four depigmentation phenotypes roan, sabino, tobiano, and dominant white were independently mapped to a chromosomal region on ECA 3 harboring the KIT gene. KIT plays an important role in melanoblast survival during embryonic development. We determined the sequence and genomic organization of the ∼82 kb equine KIT gene. A mutation analysis of all 21 KIT exons in white Franches-Montagnes Horses revealed a nonsense mutation in exon 15 (c.2151C>G, p.Y717X). We analyzed the KIT exons in horses characterized as dominant white from other populations and found three additional candidate causative mutations. Three almost completely white Arabians carried a different nonsense mutation in exon 4 (c.706A>T, p.K236X). Six Camarillo White Horses had a missense mutation in exon 12 (c.1805C>T, p.A602V), and five white Thoroughbreds had yet another missense mutation in exon 13 (c.1960G>A, p.G654R). Our results indicate that the dominant white color in Franches-Montagnes Horses is caused by a nonsense mutation in the KIT gene and that multiple independent mutations within this gene appear to be responsible for dominant white in several other modern horse populations. PMID:17997609

  1. Two variants in the KIT gene as candidate causative mutations for a dominant white and a white spotting phenotype in the donkey.

    PubMed

    Haase, B; Rieder, S; Leeb, T

    2015-06-01

    White spotting phenotypes have been intensively studied in horses, and although similar phenotypes occur in the donkey, little is known about the molecular genetics underlying these patterns in donkeys. White spotting in donkeys can range from only a few white areas to almost complete depigmentation and is characterised by a loss of pigmentation usually progressing from a white spot in the hip area. Completely white-born donkeys are rare, and the phenotype is characterised by the complete absence of pigment resulting in pink skin and a white coat. A dominant mode of inheritance has been demonstrated for spotting in donkeys. Although the mode of inheritance for the completely white phenotype in donkeys is not clear, the phenotype shows similarities to dominant white in horses. As variants in the KIT gene are known to cause a range of white phenotypes in the horse, we investigated the KIT gene as a potential candidate gene for two phenotypes in the donkey, white spotting and white. A mutation analysis of all 21 KIT exons identified a missense variant in exon 4 (c.662A>C; p.Tyr221Ser) present only in a white-born donkey. A second variant affecting a splice donor site (c.1978+2T>A) was found exclusively in donkeys with white spotting. Both variants were absent in 24 solid-coloured controls. To the authors' knowledge, this is the first study investigating genetic mechanisms underlying white phenotypes in donkeys. Our results suggest that two independent KIT alleles are probably responsible for white spotting and white in donkeys. © 2015 Stichting International Foundation for Animal Genetics.

  2. Germline mutations of KIT in gastrointestinal stromal tumor (GIST) and mastocytosis.

    PubMed

    Ke, Hengning; Kazi, Julhash U; Zhao, Hui; Sun, Jianmin

    2016-01-01

    Somatic mutations of KIT are frequently found in mastocytosis and gastrointestinal stromal tumor (GIST), while germline mutations of KIT are rare, and only found in few cases of familial GIST and mastocytosis. Although ligand-independent activation is the common feature of KIT mutations, the phenotypes mediated by various germline KIT mutations are different. Germline KIT mutations affect different tissues such as interstitial cells of Cajal (ICC), mast cells or melanocytes, and thereby lead to GIST, mastocytosis, or abnormal pigmentation. In this review, we summarize germline KIT mutations in familial mastocytosis and GIST and discuss the possible cellular context dependent transforming activity of KIT mutations.

  3. Association of KIT exon 9 mutations with nongastric primary site and aggressive behavior: KIT mutation analysis and clinical correlates of 120 gastrointestinal stromal tumors.

    PubMed

    Antonescu, Cristina R; Sommer, Gunhild; Sarran, Lisa; Tschernyavsky, Sylvia J; Riedel, Elyn; Woodruff, James M; Robson, Mark; Maki, Robert; Brennan, Murray F; Ladanyi, Marc; DeMatteo, Ronald P; Besmer, Peter

    2003-08-15

    Activating mutations of the KIT juxtamembrane region are the most common genetic events in gastrointestinal stromal tumors (GISTs) and have been noted as independent prognostic factors. The impact of KIT mutation in other regions, such as the extracellular or kinase domains, is not well-defined and fewer than 30 cases have been published to date. One hundred twenty GISTs, confirmed by KIT immunoreactivity, were evaluated for the presence of KIT exon 9, 11, 13, and 17 mutations. The relation between the presence/type of KIT mutation and clinicopathological factors was analyzed using Fisher's exact test and log-rank test. Forty-four % of the tumors were located in the stomach, 47% in the small bowel, 6% in the rectum, and 3% in the retroperitoneum. Overall, KIT mutations were detected in 78% of patients as follows: 67% in exon 11, 11% in exon 9, and none in exon 13 or 17. The types of KIT exon 11 mutations were heterogeneous and clustered in the classic "hot spot" at the 5' end of exon 11. Seven % of cases showed internal tandem duplications (ITD) at the 3' end of exon 11, in a region that we designate as a second hot spot for KIT mutations. Interestingly, these cases were associated with: female predominance, stomach location, occurrence in older patients, and favorable outcome. There were significant associations between exon 9 mutations and large tumor size (P < 0.001) and extragastric location (P = 0.02). Ten of these 13 patients with more than 1-year follow-up have developed recurrent disease. Most KIT-expressing GISTs show KIT mutations that are preferentially located within the classic hot spot of exon 11. In addition, we found an association between a second hot spot at the 3'end of exon 11, characterized by ITDs, and a subgroup of clinically indolent gastric GISTs in older females. KIT exon 9 mutations seem to define a distinct subset of GISTs, located predominantly in the small bowel and associated with an unfavorable clinical course.

  4. Essential requirement for PP2A inhibition by the oncogenic receptor c-KIT suggests PP2A reactivation as a strategy to treat c-KIT+ cancers

    PubMed Central

    Roberts, Kathryn G.; Smith, Amanda M.; McDougall, Fiona; Carpenter, Helen; Horan, Martin; Neviani, Paolo; Powell, Jason A.; Thomas, Daniel; Guthridge, Mark A.; Perrotti, Danilo; Sim, Alistair T.R.; Ashman, Leonie K.; Verrills, Nicole M.

    2010-01-01

    Oncogenic mutations of the receptor tyrosine kinase c-KIT play an important role in the pathogenesis of gastrointestinal stromal tumors (GIST), systemic mastocytosis, and some acute myeloid leukemias (AML). Whilst juxtamembrane mutations commonly detected in GIST are sensitive to tyrosine kinase inhibitors, the kinase domain mutations frequently encountered in systemic mastocytosis and AML confer resistance and are largely unresponsive to targeted inhibition by the existing agent imatinib. In this study we show that myeloid cells expressing activated c-KIT mutants that are imatinib-sensitive (V560G) or –resistant (D816V) can inhibit the tumor suppressor activity of protein phosphatase 2A (PP2A). This effect was associated with reduced expression of PP2A structural (A) and regulatory subunits (B55α; B56α; B56γ and B56δ). Overexpression of PP2A-Aα in D816V c-KIT cells induced apoptosis and inhibited proliferation. In addition, pharmacological activation of PP2A by FTY720 reduced proliferation, inhibited clonogenic potential and induced apoptosis of mutant c-KIT+ cells, whilst having no effect on WT c-KIT cells or empty vector controls. FTY720 treatment caused dephosphorylation of the D816V c-KIT receptor and its downstream signaling targets pAkt, pSTAT5 and pERK1/2. Additionally, in vivo administration of FTY720 delayed the growth of V560G and D816V c-KIT tumors, inhibited splenic and bone marrow infiltration, and prolonged survival. Our findings show that PP2A inhibition is essential for c-KIT-mediated tumorigenesis, and that reactivating PP2A may offer an attractive strategy to treat drug-resistant c-KIT+ cancers. PMID:20551067

  5. Mutational status of EGFR and KIT in thymoma and thymic carcinoma.

    PubMed

    Yoh, Kiyotaka; Nishiwaki, Yutaka; Ishii, Genichiro; Goto, Koichi; Kubota, Kaoru; Ohmatsu, Hironobu; Niho, Seiji; Nagai, Kanji; Saijo, Nagahiro

    2008-12-01

    This study was conducted to evaluate the prevalence of EGFR and KIT mutations in thymomas and thymic carcinomas as a means of exploring the potential for molecularly targeted therapy with tyrosine kinase inhibitors. Genomic DNA was isolated from 41 paraffin-embedded tumor samples obtained from 24 thymomas and 17 thymic carcinomas. EGFR exons 18, 19, and 21, and KIT exons 9, 11, 13, and 17, were analyzed for mutations by PCR and direct sequencing. Protein expression of EGFR and KIT was evaluated immunohistochemically. EGFR mutations were detected in 2 of 20 thymomas, but not in any of the thymic carcinomas. All of the EGFR mutations detected were missense mutations (L858R and G863D) in exon 21. EGFR protein was expressed in 71% of the thymomas and 53% of the thymic carcinomas. The mutational analysis of KIT revealed only a missense mutation (L576P) in exon 11 of one thymic carcinoma. KIT protein was expressed in 88% of the thymic carcinomas and 0% of the thymomas. The results of this study indicate that EGFR and KIT mutations in thymomas and thymic carcinomas are rare, but that many of the tumors express EGFR or KIT protein.

  6. Mastocytosis: a mutated KIT receptor induced myeloproliferative disorder

    PubMed Central

    Chatterjee, Anindya; Ghosh, Joydeep; Kapur, Reuben

    2015-01-01

    Although more than 90% systemic mastocytosis (SM) patients express gain of function mutations in the KIT receptor, recent next generation sequencing has revealed the presence of several additional genetic and epigenetic mutations in a subset of these patients, which confer poor prognosis and inferior overall survival. A clear understanding of how genetic and epigenetic mutations cooperate in regulating the tremendous heterogeneity observed in these patients will be essential for designing effective treatment strategies for this complex disease. In this review, we describe the clinical heterogeneity observed in patients with mastocytosis, the nature of relatively novel mutations identified in these patients, therapeutic strategies to target molecules downstream from activating KIT receptor and finally we speculate on potential novel strategies to interfere with the function of not only the oncogenic KIT receptor but also epigenetic mutations seen in these patients. PMID:26158763

  7. Internal associations and dynamic expression of c-kit and nanog genes in ventricular remodelling induced by adriamycin.

    PubMed

    Liu, Zhen; Li, Shuo; Liu, Lingling; Guo, Zhikun; Wang, Pengfei

    2016-09-01

    The present study aimed to investigate the dynamic expression of the c-kit and nanog genes in rats with left ventricular remodelling induced by adriamycin (ADR), and explore its internal association and mechanism of action. Sprague-Dawley male rats were randomly divided into a normal control group and a heart failure model group. Heart failure was induced by a single intraperitoneal injection of ADR (4 mg/kg) weekly for six weeks. The normal control group was given the same amount of saline. At the eighth week, rat cardiac function was examined to demonstrate the formation of heart failure. The rat hearts were harvested frozen and sectioned, and the expression levels of the nanog and c-kit genes in the myocardial tissue samples were detected using immunohistochemistry, immunofluorescence and reverse transcription-polymerase chain reaction (RT-PCR). Hematoxylin and eosin staining demonstrated various pathological changes in the myocardial cells in the heart failure model group, whereas myocardial infarction was not observed in the normal control group. Immunohistochemistry and immunofluorescence demonstrated that nanog-positive cells were predominantly expressed in the vascular endothelium, with a few myocardial cells and stem cells in normal myocardium. The expression levels of c-kit and nanog in the myocardium of the rats with heart failure decreased significantly. c-kit-positive cells clustered together in the epicardium and its vicinity, and c-kit expression significantly decreased in the myocardium of rats with heart failure, as compared with normal rats. In both groups, some cells co-expressed both the c-kit and nanog genes. The RT-PCR results demonstrated that the expression levels of the two genes in the heart failure model group were significantly lower compared with those in the normal control group (P<0.05). In conclusion, the c-kit- and nanog-positive stem cells decreased in the myocardium of the rats with left ventricular remodelling induced by ADR

  8. Identification of a secondary mutation in the KIT kinase domain correlated with imatinib-resistance in a canine mast cell tumor.

    PubMed

    Nakano, Yuko; Kobayashi, Masato; Bonkobara, Makoto; Takanosu, Masamine

    2017-06-01

    Imatinib-resistance is a major therapeutic problem in human chronic myeloid leukemia, human gastrointestinal stromal tumors, and canine mast cell tumors. In the present study, we identified the secondary mutation c.2006C>T in c-KIT exon 14 in a mast cell tumor obtained from a dog carrying c.1663-1671del in exon 11 and showing resistance to imatinib. The mutation in exon 14 resulted in substitution of threonine with isoleucine at position 669, which was located at the center of the ATP binding site as a gatekeeper and played an important role in binding to imatinib. Transfectants were constructed to survey the functions of these mutations in exons 11 and 14. The transfectant with mutant KIT encoded by c-KIT carrying c.1663-1671del showed constitutive ligand-independent phosphorylation that was suppressed by imatinib, indicating a gain-of-function mutation. Furthermore, the transfectant with mutant KIT encoded by c-KIT carrying both c.1663-1671del and c.2006C>T caused ligand-independent phosphorylation, which was not suppressed by imatinib. From these results, we concluded that the mutation c.2006C>T in c-KIT exon 14 was an imatinib-resistance mutation in a canine mast cell tumor. These findings revealed, for the first time, a mechanism of imatinib resistance in a clinical case of canine mast cell tumor. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Anal mucosal melanoma with KIT-activating mutation and response to imatinib therapy--case report and review of the literature.

    PubMed

    Satzger, Imke; Küttler, Uta; Völker, Bernward; Schenck, Florian; Kapp, Alexander; Gutzmer, Ralf

    2010-01-01

    Previously an increased frequency of KIT aberrations in mucosal melanomas was reported, whereas c-KIT in most types of cutaneous melanomas does not appear to be of pathogenetic importance. Imatinib has become the standard of care in other cancers with KIT mutations such as gastrointestinal stromal tumors. Recently 12 cases of metastatic melanoma and KIT-activating mutations have been published to be successfully treated with c-KIT blockers such as imatinib, sunitinib, dasatinib or sorafenib. We report here on one of our patients with KIT-activating mutation in metastatic anal mucosal melanoma, who showed a response to imatinib therapy and summarize the available literature regarding this new therapeutic option. Copyright 2009 S. Karger AG, Basel.

  10. c-Kit modifies the inflammatory status of smooth muscle cells.

    PubMed

    Song, Lei; Martinez, Laisel; Zigmond, Zachary M; Hernandez, Diana R; Lassance-Soares, Roberta M; Selman, Guillermo; Vazquez-Padron, Roberto I

    2017-01-01

    c-Kit is a receptor tyrosine kinase present in multiple cell types, including vascular smooth muscle cells (SMC). However, little is known about how c-Kit influences SMC biology and vascular pathogenesis. High-throughput microarray assays and in silico pathway analysis were used to identify differentially expressed genes between primary c-Kit deficient (Kit W/W-v ) and control (Kit +/+ ) SMC. Quantitative real-time RT-PCR and functional assays further confirmed the differences in gene expression and pro-inflammatory pathway regulation between both SMC populations. The microarray analysis revealed elevated NF-κB gene expression secondary to the loss of c-Kit that affects both the canonical and alternative NF-κB pathways. Upon stimulation with an oxidized phospholipid as pro-inflammatory agent, c-Kit deficient SMC displayed enhanced NF-κB transcriptional activity, higher phosphorylated/total p65 ratio, and increased protein expression of NF-κB regulated pro-inflammatory mediators with respect to cells from control mice. The pro-inflammatory phenotype of mutant cells was ameliorated after restoring c-Kit activity using lentiviral transduction. Functional assays further demonstrated that c-Kit suppresses NF-κB activity in SMC in a TGFβ-activated kinase 1 (TAK1) and Nemo-like kinase (NLK) dependent manner. Our study suggests a novel mechanism by which c-Kit suppresses NF-κB regulated pathways in SMC to prevent their pro-inflammatory transformation.

  11. c-Kit modifies the inflammatory status of smooth muscle cells

    PubMed Central

    Song, Lei; Martinez, Laisel; Zigmond, Zachary M.; Hernandez, Diana R.; Lassance-Soares, Roberta M.; Selman, Guillermo

    2017-01-01

    Background c-Kit is a receptor tyrosine kinase present in multiple cell types, including vascular smooth muscle cells (SMC). However, little is known about how c-Kit influences SMC biology and vascular pathogenesis. Methods High-throughput microarray assays and in silico pathway analysis were used to identify differentially expressed genes between primary c-Kit deficient (KitW/W–v) and control (Kit+/+) SMC. Quantitative real-time RT-PCR and functional assays further confirmed the differences in gene expression and pro-inflammatory pathway regulation between both SMC populations. Results The microarray analysis revealed elevated NF-κB gene expression secondary to the loss of c-Kit that affects both the canonical and alternative NF-κB pathways. Upon stimulation with an oxidized phospholipid as pro-inflammatory agent, c-Kit deficient SMC displayed enhanced NF-κB transcriptional activity, higher phosphorylated/total p65 ratio, and increased protein expression of NF-κB regulated pro-inflammatory mediators with respect to cells from control mice. The pro-inflammatory phenotype of mutant cells was ameliorated after restoring c-Kit activity using lentiviral transduction. Functional assays further demonstrated that c-Kit suppresses NF-κB activity in SMC in a TGFβ-activated kinase 1 (TAK1) and Nemo-like kinase (NLK) dependent manner. Discussion Our study suggests a novel mechanism by which c-Kit suppresses NF-κB regulated pathways in SMC to prevent their pro-inflammatory transformation. PMID:28626608

  12. Oncogenic activation of v-kit involves deletion of a putative tyrosine-substrate interaction site.

    PubMed

    Herbst, R; Munemitsu, S; Ullrich, A

    1995-01-19

    The transforming gene of the Hardy-Zuckerman-4 strain of feline sarcoma virus, v-kit, arose by transduction of the cellular c-kit gene, which encodes the receptor tyrosine kinase (RTK) p145c-kit. To gain insight into the molecular basis of the v-kit transforming potential, we characterized the feline c-kit by cDNA cloning. Comparison of the feline v-kit and c-kit sequences revealed, in addition to deletions of the extracellular and transmembrane domains, three additional mutations in the v-kit oncogene product: deletion of tyrosine-569 and valine-570, the exchange of aspartate at position 761 to glycine, and replacement of the C-terminal 50 amino acids by five unrelated residues. Examinations of individual v-kit mutations in the context of chimeric receptors yielded inhibitory effects for some mutants on both autophosphorylation and substrate phosphorylation functions. In contrast, deletion of tyrosine-569 and valine-570 significantly enhanced transforming and mitogenic activities of p145c-kit, while the other mutations had no significant effects. Conservation in subclass III RTKs and the identification of the corresponding residue in beta PDGF-R, Y579, as a binding site for src family tyrosine kinases suggests an important role for Y568 in kit signal regulation and the definition of its oncogenic potential. Repositioning of Y571 by an inframe two codon deletion may be the crucial alteration resulting in enhancement of v-kit oncogenic activity.

  13. Novel mutations in the USH1C gene in Usher syndrome patients.

    PubMed

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María

    2010-12-31

    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

  14. Novel mutations in the USH1C gene in Usher syndrome patients

    PubMed Central

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Millán, José María

    2010-01-01

    Purpose Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Methods Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Results Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. Conclusions In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population. PMID:21203349

  15. A meta-analysis of prognostic value of KIT mutation status in gastrointestinal stromal tumors

    PubMed Central

    Jiang, Zhiqiang; Zhang, Jian; Li, Zhi; Liu, Yingjun; Wang, Daohai; Han, Guangsen

    2016-01-01

    Numerous types of KIT mutations have been reported in gastrointestinal stromal tumors (GISTs); however, controversy still exists regarding their clinicopathological significance. In this study, we reviewed the publicly available literature to assess the data by a meta-analysis to characterize KIT mutations and different types of KIT mutations in prognostic prediction in patients with GISTs. Twenty-eight studies that included 4,449 patients were identified and analyzed. We found that KIT mutation status was closely correlated with size of tumors and different mitosis indexes, but not with tumor location. KIT mutation was also observed to be significantly correlated with tumor recurrence, metastasis, as well as the overall survival of patients. Interestingly, there was higher risk of progression in KIT exon 9-mutated patients than in exon 11-mutated patients. Five-year relapse-free survival (RFS) rate was significantly higher in KIT exon 11-deleted patients than in those with other types of KIT exon 11 mutations. In addition, RFS for 5 years was significantly worse in patients bearing KIT codon 557–558 deletions than in those bearing other KIT exon 11 deletions. Our results strongly support the hypothesis that KIT mutation status is another evaluable factor for prognosis prediction in GISTs. PMID:27350754

  16. qPCR in gastrointestinal stromal tumors: Evaluation of reference genes and expression analysis of KIT and the alternative receptor tyrosine kinases FLT3, CSF1-R, PDGFRB, MET and AXL

    PubMed Central

    2010-01-01

    Background Gastrointestinal stromal tumors (GIST) represent the most common mesenchymal tumors of the gastrointestinal tract. About 85% carry an activating mutation in the KIT or PDGFRA gene. Approximately 10% of GIST are so-called wild type GIST (wt-GIST) without mutations in the hot spots. In the present study we evaluated appropriate reference genes for the expression analysis of formalin-fixed, paraffin-embedded and fresh frozen samples from gastrointestinal stromal tumors. We evaluated the gene expression of KIT as well as of the alternative receptor tyrosine kinase genes FLT3, CSF1-R, PDGFRB, AXL and MET by qPCR. wt-GIST were compared to samples with mutations in KIT exon 9 and 11 and PDGFRA exon 18 in order to evaluate whether overexpression of these alternative RTK might contribute to the pathogenesis of wt-GIST. Results Gene expression variability of the pooled cDNA samples is much lower than the single reverse transcription cDNA synthesis. By combining the lowest variability values of fixed and fresh tissue, the genes POLR2A, PPIA, RPLPO and TFRC were chosen for further analysis of the GIST samples. Overexpression of KIT compared to the corresponding normal tissue was detected in each GIST subgroup except in GIST with PDGFRA exon 18 mutation. Comparing our sample groups, no significant differences in the gene expression levels of FLT3, CSF1R and AXL were determined. An exception was the sample group with KIT exon 9 mutation. A significantly reduced expression of CSF1R, FLT3 and PDGFRB compared to the normal tissue was detected. GIST with mutations in KIT exon 9 and 11 and in PDGFRA exon 18 showed a significant PDGFRB downregulation. Conclusions As the variability of expression levels for the reference genes is very high comparing fresh frozen and formalin-fixed tissue there is a strong need for validation in each tissue type. None of the alternative receptor tyrosine kinases analyzed is associated with the pathogenesis of wild-type or mutated GIST. It

  17. Platinum coat color in red fox (Vulpes vulpes) is caused by a mutation in an autosomal copy of KIT.

    PubMed

    Johnson, J L; Kozysa, A; Kharlamova, A V; Gulevich, R G; Perelman, P L; Fong, H W F; Vladimirova, A V; Oskina, I N; Trut, L N; Kukekova, A V

    2015-04-01

    The red fox (Vulpes vulpes) demonstrates a variety of coat colors including platinum, a common phenotype maintained in farm-bred fox populations. Foxes heterozygous for the platinum allele have a light silver coat and extensive white spotting, whereas homozygosity is embryonic lethal. Two KIT transcripts were identified in skin cDNA from platinum foxes. The long transcript was identical to the KIT transcript of silver foxes, whereas the short transcript, which lacks exon 17, was specific to platinum. The KIT gene has several copies in the fox genome: an autosomal copy on chromosome 2 and additional copies on the B chromosomes. To identify the platinum-specific KIT sequence, the genomes of one platinum and one silver fox were sequenced. A single nucleotide polymorphism (SNP) was identified at the first nucleotide of KIT intron 17 in the platinum fox. In platinum foxes, the A allele of the SNP disrupts the donor splice site and causes exon 17, which is part of a segment that encodes a conserved tyrosine kinase domain, to be skipped. Complete cosegregation of the A allele with the platinum phenotype was confirmed by linkage mapping (LOD 25.59). All genotyped farm-bred platinum foxes from Russia and the US were heterozygous for the SNP (A/G), whereas foxes with different coat colors were homozygous for the G allele. Identification of the platinum mutation suggests that other fox white-spotting phenotypes, which are allelic to platinum, would also be caused by mutations in the KIT gene. © 2015 Stichting International Foundation for Animal Genetics.

  18. BRAF, NRAS and C-KIT Advanced Melanoma: Clinico-pathological Features, Targeted-Therapy Strategies and Survival.

    PubMed

    Ponti, Giovanni; Manfredini, Marco; Greco, Stefano; Pellacani, Giovanni; Depenni, Roberta; Tomasi, Aldo; Maccaferri, Monia; Cascinu, Stefano

    2017-12-01

    The mutational status of stage III and IV melanomas should be recognized in order to allow for targeted therapies. The aim of our study was the characterization of BRAF, NRAS and C-KIT melanoma patients, in order to define their optimal management. Between 1991 and 2015, 63 mutated melanoma patients were treated and monitored during their diagnostic and therapeutic management at a single institution. BRAF-mutated melanoma patients were the most common, representing 70% of the study population, while NRAS- and C-KIT-mutated melanoma represented 19% and 11% respectively. BRAF-mutated melanomas were mostly located at sites of intermittent sun exposure, and were associated with higher Breslow thickness and an increased number of mitosis. NRAS mutated melanoma were mainly observed in chronic sun-damaged areas and had a negative prognostic value, with shorter time to progression and a high incidence of central nervous system involvement. C-KIT mutated melanoma were located at acral and mucosal sites. Overall survival observed in the three groups of patients revealed wide differences. BRAF, NRAS and C-KIT melanomas constitute distinct clinico-pathological entities. BRAF-mutated melanoma benefit from both anti-BRAF and anti-MEK targeted therapies while triple-negative melanomas could benefit from novel anti-CTLA-4 and anti-PD-L1 immunotherapeutic approaches. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  19. c-KIT receptor expression is strictly associated with the biological behaviour of thyroid nodules

    PubMed Central

    2012-01-01

    Background A large amount of information has been collected on the molecular tumorigenesis of thyroid cancer. A low expression of c-KIT gene has been reported during the transformation of normal thyroid epithelium to papillary carcinoma suggesting a possible role of the gene in the differentiation of thyroid tissue rather than in the proliferation. The initial presentation of thyroid carcinoma is through a nodule and the best way nowadays to evaluate it is by fine-needle aspiration (FNA). However many thyroid FNAs are not definitively benign or malignant, yielding an indeterminate or suspicious diagnosis which ranges from 10 to 25% of FNAs. BRAF mutational analysis is commonly used to assess the malignancy of thyroid nodules but unfortunately it still leaves indeterminate diagnoses. The development of molecular initial diagnostic tests for evaluating a thyroid nodule is needed in order to define optimal surgical approach for patients with uncertain diagnosis pre- and intra-operatively. Methods In this study we extracted RNA from 82 FNA smears, 46 malignant and 36 benign at the histology, in order to evaluate by quantitative Real Time PCR the expression levels of c-KIT gene. Results We have found a highly preferential decrease rather than increase in transcript of c-KIT in malignant thyroid lesions compared to the benign ones. To explore the diagnostic utility of c-KIT expression in thyroid nodules, its expression values were divided in four arbitrarily defined classes, with class I characterized by the complete silencing of the gene. Class I and IV represented the two most informative groups, with 100% of the samples found malignant or benign respectively. The molecular analysis was proven by ROC (receiver operating characteristic) analysis to be highly specific and sensitive improving the cytological diagnostic accuracy of 15%. Conclusion We propose the use of BRAF test (after uncertain cytological diagnosis) to assess the malignancy of thyroid nodules at first

  20. A decrease in ubiquitination and resulting prolonged life-span of KIT underlies the KIT overexpression-mediated imatinib resistance of KIT mutation-driven canine mast cell tumor cells.

    PubMed

    Kobayashi, Masato; Kuroki, Shiori; Kurita, Sena; Miyamoto, Ryo; Tani, Hiroyuki; Tamura, Kyoichi; Bonkobara, Makoto

    2017-10-01

    Overexpression of KIT is one of the mechanisms that contributes to imatinib resistance in KIT mutation-driven tumors. Here, the mechanism underlying this overexpression of KIT was investigated using an imatinib-sensitive canine mast cell tumor (MCT) line CoMS, which has an activating mutation in KIT exon 11. A KIT-overexpressing imatinib-resistant subline, rCoMS1, was generated from CoMS cells by their continuous exposure to increasing concentrations of imatinib. Neither a secondary mutation nor upregulated transcription of KIT was detected in rCoMS1 cells. A decrease in KIT ubiquitination, a prolonged KIT life-span, and KIT overexpression were found in rCoMS1 cells. These events were suppressed by withdrawal of imatinib and were re-induced by re‑treatment with imatinib. These findings suggest that imatinib elicited overexpression of KIT via suppression of its ubiquitination. These results also indicated that imatinib-induced overexpression of KIT in rCoMS1 cells was not a permanently acquired feature but was a reversible response of the cells. Moreover, the pan deubiquitinating enzyme inhibitor PR619 prevented imatinib induction of KIT overexpression, suggesting that the imatinib-induced decrease in KIT ubiquitination could be mediated by upregulation and/or activation of deubiquitinating enzyme(s). It may be possible that a similar mechanism of KIT overexpression underlies the acquisition of imatinib resistance in some human tumors that are driven by KIT mutation.

  1. CNS germinomas are characterized by global demethylation, chromosomal instability and mutational activation of the Kit-, Ras/Raf/Erk- and Akt-pathways

    PubMed Central

    Schulte, Simone Laura; Waha, Andreas; Steiger, Barbara; Denkhaus, Dorota; Dörner, Evelyn; Calaminus, Gabriele; Leuschner, Ivo; Pietsch, Torsten

    2016-01-01

    CNS germinomas represent a unique germ cell tumor entity characterized by undifferentiated tumor cells and a high response rate to current treatment protocols. Limited information is available on their underlying genomic, epigenetic and biological alterations. We performed a genome-wide analysis of genomic copy number alterations in 49 CNS germinomas by molecular inversion profiling. In addition, CpG dinucleotide methylation was studied by immunohistochemistry for methylated cytosine residues. Mutational analysis was performed by resequencing of candidate genes including KIT and RAS family members. Ras/Erk and Akt pathway activation was analyzed by immunostaining with antibodies against phospho-Erk, phosho-Akt, phospho-mTOR and phospho-S6. All germinomas coexpressed Oct4 and Kit but showed an extensive global DNA demethylation compared to other tumors and normal tissues. Molecular inversion profiling showed predominant genomic instability in all tumors with a high frequency of regional gains and losses including high level gene amplifications. Activating mutations of KIT exons 11, 13, and 17 as well as a case with genomic KIT amplification and activating mutations or amplifications of RAS gene family members including KRAS, NRAS and RRAS2 indicated mutational activation of crucial signaling pathways. Co-activation of Ras/Erk and Akt pathways was present in 83% of germinomas. These data suggest that CNS germinoma cells display a demethylated nuclear DNA similar to primordial germ cells in early development. This finding has a striking coincidence with extensive genomic instability. In addition, mutational activation of Kit-, Ras/Raf/Erk- and Akt- pathways indicate the biological importance of these pathways and their components as potential targets for therapy. PMID:27391150

  2. Insight on Mutation-Induced Resistance from Molecular Dynamics Simulations of the Native and Mutated CSF-1R and KIT.

    PubMed

    Da Silva Figueiredo Celestino Gomes, Priscila; Chauvot De Beauchêne, Isaure; Panel, Nicolas; Lopez, Sophie; De Sepulveda, Paulo; Geraldo Pascutti, Pedro; Solary, Eric; Tchertanov, Luba

    2016-01-01

    The receptors tyrosine kinases (RTKs) for the colony stimulating factor-1, CSF-1R, and for the stem cell factor, SCFR or KIT, are important mediators of signal transduction. The abnormal function of these receptors, promoted by gain-of-function mutations, leads to their constitutive activation, associated with cancer or other proliferative diseases. A secondary effect of the mutations is the alteration of receptors' sensitivity to tyrosine kinase inhibitors, compromising effectiveness of these molecules in clinical treatment. In particular, the mutation V560G in KIT increases its sensitivity to Imatinib, while the D816V in KIT, and D802V in CSF-1R, triggers resistance to the drug. We analyzed the Imatinib binding affinity to the native and mutated KIT (mutations V560G, S628N and D816V) and CSF-1R (mutation D802V) by using molecular dynamics simulations and energy calculations of Imatinib•target complexes. Further, we evaluated the sensitivity of the studied KIT receptors to Imatinib by measuring the inhibition of KIT phosphorylation. Our study showed that (i) the binding free energy of Imatinib to the targets is highly correlated with their experimentally measured sensitivity; (ii) the electrostatic interactions are a decisive factor affecting the binding energy; (iii) the most deleterious impact to the Imatinib sensitivity is promoted by D802V (CSF-1R) and D816V (KIT) mutations; (iv) the role of the juxtamembrane region, JMR, in the imatinib binding is accessory. These findings contribute to a better description of the mutation-induced effects alternating the targets sensitivity to Imatinib.

  3. Molecular Alterations of KIT Oncogene in Gliomas

    PubMed Central

    Gomes, Ana L.; Reis-Filho, Jorge S.; Lopes, José M.; Martinho, Olga; Lambros, Maryou B. K.; Martins, Albino; Schmitt, Fernando; Pardal, Fernando; Reis, Rui M.

    2007-01-01

    Gliomas are the most common and devastating primary brain tumours. Despite therapeutic advances, the majority of gliomas do not respond either to chemo or radiotherapy. KIT, a class III receptor tyrosine kinase (RTK), is frequently involved in tumourigenic processes. Currently, KIT constitutes an attractive therapeutic target. In the present study we assessed the frequency of KIT overexpression in gliomas and investigated the genetic mechanisms underlying KIT overexpression. KIT (CD117) immunohistochemistry was performed in a series of 179 gliomas of various grades. KIT activating gene mutations (exons 9, 11, 13 and 17) and gene amplification analysis, as defined by chromogenic in situ hybridization (CISH) and quantitative real-time PCR (qRT-PCR) were performed in CD117 positive cases. Tumour cell immunopositivity was detected in 15.6% (28/179) of cases, namely in 25% (1/4) of pilocytic astrocytomas, 25% (5/20) of diffuse astrocytomas, 20% (1/5) of anaplastic astrocytomas, 19.5% (15/77) of glioblastomas and one third (3/9) of anaplastic oligoastrocytomas. Only 5.7% (2/35) of anaplastic oligodendrogliomas showed CD117 immunoreactivity. No association was found between tumour CD117 overexpression and patient survival. In addition, we also observed CD117 overexpression in endothelial cells, which varied from 0–22.2% of cases, being more frequent in high-grade lesions. No KIT activating mutations were identified. Interestingly, CISH and/or qRT-PCR analysis revealed the presence of KIT gene amplification in 6 glioblastomas and 2 anaplastic oligoastrocytomas, corresponding to 33% (8/24) of CD117 positive cases. In conclusion, our results demonstrate that KIT gene amplification rather than gene mutation is a common genetic mechanism underlying KIT expression in subset of malignant gliomas. Further studies are warranted to determine whether glioma patients exhibiting KIT overexpression and KIT gene amplification may benefit from therapy with anti-KIT RTK inhibitors. PMID

  4. Gene expression in gastrointestinal stromal tumors is distinguished by KIT genotype and anatomic site.

    PubMed

    Antonescu, Cristina R; Viale, Agnes; Sarran, Lisa; Tschernyavsky, Sylvia J; Gonen, Mithat; Segal, Neil H; Maki, Robert G; Socci, Nicholas D; DeMatteo, Ronald P; Besmer, Peter

    2004-05-15

    Gastrointestinal stromal tumors (GISTs) are specific KIT expressing and KIT-signaling driven mesenchymal tumors of the human digestive tract, many of which have KIT-activating mutations. Previous studies have found a relatively homogeneous gene expression profile in GIST, as compared with other histological types of sarcomas. Transcriptional heterogeneity within clinically or molecularly defined subsets of GISTs has not been previously reported. We tested the hypothesis that the gene expression profile in GISTs might be related to KIT genotype and possibly to other clinicopathological factors. An HG-U133A Affymetrix chip (22,000 genes) platform was used to determine the variability of gene expression in 28 KIT-expressing GIST samples from 24 patients. A control group of six intra-abdominal leiomyosarcomas was also included for comparison. Statistical analyses (t tests) were performed to identify discriminatory gene lists among various GIST subgroups. The levels of expression of various GIST subsets were also linked to a modified version of the growth factor/KIT signaling pathway to analyze differences at various steps in signal transduction. Genes involved in KIT signaling were differentially expressed among wild-type and mutant GISTs. High gene expression of potential drug targets, such as VEGF, MCSF, and BCL2 in the wild-type group, and Mesothelin in exon 9 GISTs were found. There was a striking difference in gene expression between stomach and small bowel GISTs. This finding was validated in four separate tumors, two gastric and two intestinal, from a patient with familial GIST with a germ-line KIT W557R substitution. GISTs have heterogeneous gene expression depending on KIT genotype and tumor location, which is seen at both the genomic level and the KIT signaling pathway in particular. These findings may explain their variable clinical behavior and response to therapy.

  5. Immunohistochemical expression of c-KIT protein in feline soft tissue fibrosarcomas.

    PubMed

    Smith, A J; Njaa, B L; Lamm, C G

    2009-09-01

    C-KIT is the cellular homolog of the feline sarcoma viral oncogene v-KIT, which encodes the tyrosine kinase receptor protein KIT. Mutations and varied expression of this gene have been demonstrated within multiple neoplasms in people and domestic animals. The purpose of this study was to determine if KIT protein is expressed in feline soft tissue fibrosarcomas (ST FSA) using immunohistochemistry (IHC). The computer database at the Oklahoma Animal Disease Diagnostic Laboratory was searched from January 1, 2006, to December 31, 2007, for any domestic cat with an ST FSA. Routinely stained slides from 46 feline ST FSAs were reviewed and graded based on the scale outlined by Kuntz et al. Immunohistochemistry for KIT protein was performed on one representative section from each cat. There were a total of 12/46 (26%) cats that were immunoreactive for KIT. Immunoreactivity was detected in greater than 80% of the neoplastic cells in 4/46 (9%) cats. Immunoreactivity was detected in less than 10% of the neoplastic cells in 8/46 (17%) cats. Immunoreactivity was characterized by evenly distributed cytoplasmic stippling within the neoplastic spindle-shaped cells and/or multinucleated giant cells. Based on these results, KIT immunoreactivity can be detected within feline ST FSAs using IHC. The results of this study also indicate that KIT immunoreactivity in feline ST FSA does not correlate with the histologic grade (P = .141, X(2) = 2.166), survivability (P = .241, X(2) = 1.373), or whether the neoplasm was a spontaneous or an injection site FSA (P = .074, X(2) = 3.184).

  6. Loss of c-KIT expression in thyroid cancer cells.

    PubMed

    Franceschi, Sara; Lessi, Francesca; Panebianco, Federica; Tantillo, Elena; La Ferla, Marco; Menicagli, Michele; Aretini, Paolo; Apollo, Alessandro; Naccarato, Antonio Giuseppe; Marchetti, Ivo; Mazzanti, Chiara Maria

    2017-01-01

    Papillary thyroid carcinoma is the most frequent histologic type of thyroid tumor. Few studies investigated the role of c-KIT expression in thyroid tumors, suggesting a role for this receptor and its ligand in differentiation and growth control of thyroid epithelium and a receptor loss following malignant transformation. We investigated and correlated c-KIT expression levels and two known markers of thyrocytes differentiation, PAX8 and TTF-1, in malignant and benign cytological thyroid samples. Moreover, we performed functional studies on human papillary thyroid carcinoma cell line to associated c-KIT expression to thyrocytes differentiation and tumor proliferation. c-KIT and PAX8 expression resulted higher in benign samples compared to the malignant ones, and the expression levels of these two genes were significantly correlated to each other. We also observed that c-KIT overexpression led to an increase of PAX8 expression level together with a decrease of proliferation. Furthermore, c-KIT overexpressing cells showed a regression of typical morphological features of malignancy. Taken together these results suggest that c-KIT could be involved in the differentiation of thyroid cells and in tumor progression.

  7. Loss of c-KIT expression in thyroid cancer cells

    PubMed Central

    Panebianco, Federica; Tantillo, Elena; La Ferla, Marco; Menicagli, Michele; Aretini, Paolo; Apollo, Alessandro; Naccarato, Antonio Giuseppe; Marchetti, Ivo; Mazzanti, Chiara Maria

    2017-01-01

    Papillary thyroid carcinoma is the most frequent histologic type of thyroid tumor. Few studies investigated the role of c-KIT expression in thyroid tumors, suggesting a role for this receptor and its ligand in differentiation and growth control of thyroid epithelium and a receptor loss following malignant transformation. We investigated and correlated c-KIT expression levels and two known markers of thyrocytes differentiation, PAX8 and TTF-1, in malignant and benign cytological thyroid samples. Moreover, we performed functional studies on human papillary thyroid carcinoma cell line to associated c-KIT expression to thyrocytes differentiation and tumor proliferation. c-KIT and PAX8 expression resulted higher in benign samples compared to the malignant ones, and the expression levels of these two genes were significantly correlated to each other. We also observed that c-KIT overexpression led to an increase of PAX8 expression level together with a decrease of proliferation. Furthermore, c-KIT overexpressing cells showed a regression of typical morphological features of malignancy. Taken together these results suggest that c-KIT could be involved in the differentiation of thyroid cells and in tumor progression. PMID:28301608

  8. Growth control of genetically modified cells using an antibody/c-Kit chimera.

    PubMed

    Kaneko, Etsuji; Kawahara, Masahiro; Ueda, Hiroshi; Nagamune, Teruyuki

    2012-05-01

    Gene therapy has been regarded as an innovative potential treatment against serious congenital diseases. However, applications of gene therapy remain limited, partly because its clinical success depends on therapeutic gene-transduced cells acquiring a proliferative advantage. To address this problem, we have developed the antigen-mediated genetically modified cell amplification (AMEGA) system, which uses chimeric receptors to enable the selective proliferation of gene-transduced cells. In this report, we describe mimicry of c-Kit signaling and its application to the AMEGA system. We created an antibody/c-Kit chimera in which the extracellular domain of c-Kit is replaced with an anti-fluorescein single-chain Fv antibody fragment and the extracellular D2 domain of the erythropoietin receptor. A genetically modified mouse pro-B cell line carrying this chimera showed selective expansion in the presence of fluorescein-conjugated BSA (BSA-FL) as a growth inducer. By further engineering the transmembrane domain of the chimera to reduce interchain interaction we attained stricter ligand-dependency. Since c-Kit is an important molecule in the expansion of hematopoietic stem cells (HSCs), this antibody/c-Kit chimera could be a promising tool for gene therapy targeting HSCs. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  9. Insight on Mutation-Induced Resistance from Molecular Dynamics Simulations of the Native and Mutated CSF-1R and KIT

    PubMed Central

    Da Silva Figueiredo Celestino Gomes, Priscila; Chauvot De Beauchêne, Isaure; Panel, Nicolas; Lopez, Sophie; De Sepulveda, Paulo; Geraldo Pascutti, Pedro; Solary, Eric; Tchertanov, Luba

    2016-01-01

    The receptors tyrosine kinases (RTKs) for the colony stimulating factor-1, CSF-1R, and for the stem cell factor, SCFR or KIT, are important mediators of signal transduction. The abnormal function of these receptors, promoted by gain-of-function mutations, leads to their constitutive activation, associated with cancer or other proliferative diseases. A secondary effect of the mutations is the alteration of receptors’ sensitivity to tyrosine kinase inhibitors, compromising effectiveness of these molecules in clinical treatment. In particular, the mutation V560G in KIT increases its sensitivity to Imatinib, while the D816V in KIT, and D802V in CSF-1R, triggers resistance to the drug. We analyzed the Imatinib binding affinity to the native and mutated KIT (mutations V560G, S628N and D816V) and CSF-1R (mutation D802V) by using molecular dynamics simulations and energy calculations of Imatinib•target complexes. Further, we evaluated the sensitivity of the studied KIT receptors to Imatinib by measuring the inhibition of KIT phosphorylation. Our study showed that (i) the binding free energy of Imatinib to the targets is highly correlated with their experimentally measured sensitivity; (ii) the electrostatic interactions are a decisive factor affecting the binding energy; (iii) the most deleterious impact to the Imatinib sensitivity is promoted by D802V (CSF-1R) and D816V (KIT) mutations; (iv) the role of the juxtamembrane region, JMR, in the imatinib binding is accessory. These findings contribute to a better description of the mutation-induced effects alternating the targets sensitivity to Imatinib. PMID:27467080

  10. Whole-exome sequencing identifies recurrent SF3B1 R625 mutation and comutation of NF1 and KIT in mucosal melanoma.

    PubMed

    Hintzsche, Jennifer D; Gorden, Nicholas T; Amato, Carol M; Kim, Jihye; Wuensch, Kelsey E; Robinson, Steven E; Applegate, Allison J; Couts, Kasey L; Medina, Theresa M; Wells, Keith R; Wisell, Joshua A; McCarter, Martin D; Box, Neil F; Shellman, Yiqun G; Gonzalez, Rene C; Lewis, Karl D; Tentler, John J; Tan, Aik Choon; Robinson, William A

    2017-06-01

    Mucosal melanomas are a rare subtype of melanoma, arising in mucosal tissues, which have a very poor prognosis due to the lack of effective targeted therapies. This study aimed to better understand the molecular landscape of these cancers and find potential new therapeutic targets. Whole-exome sequencing was performed on mucosal melanomas from 19 patients and 135 sun-exposed cutaneous melanomas, with matched peripheral blood samples when available. Mutational profiles were compared between mucosal subgroups and sun-exposed cutaneous melanomas. Comparisons of molecular profiles identified 161 genes enriched in mucosal melanoma (P<0.05). KIT and NF1 were frequently comutated (32%) in the mucosal subgroup, with a significantly higher incidence than that in cutaneous melanoma (4%). Recurrent SF3B1 R625H/S/C mutations were identified and validated in 7 of 19 (37%) mucosal melanoma patients. Mutations in the spliceosome pathway were found to be enriched in mucosal melanomas when compared with cutaneous melanomas. Alternative splicing in four genes were observed in SF3B1-mutant samples compared with the wild-type samples. This study identified potential new therapeutic targets for mucosal melanoma, including comutation of NF1 and KIT, and recurrent R625 mutations in SF3B1. This is the first report of SF3B1 R625 mutations in vulvovaginal mucosal melanoma, with the largest whole-exome sequencing project of mucosal melanomas to date. The results here also indicated that the mutations in SF3B1 lead to alternative splicing in multiple genes. These findings expand our knowledge of this rare disease.

  11. Elevated expression of the proto-oncogene c-kit in patients with mastocytosis.

    PubMed

    Nagata, H; Worobec, A S; Semere, T; Metcalfe, D D

    1998-02-01

    The stem cell factor (SCF)c-kit receptor interaction plays a critical role in the development and survival of mast cells. Several studies have also associated c-kit receptor mutations with the human diseases, mastocytosis and piebaldism. Overexpression of c-kit has been reported to be associated with myeloproliferative disorders and myelodysplastic syndromes. Using peripheral blood mononuclear cells (PBMCs) from 11 patients with indolent mastocytosis (category I), mastocytosis with an associated hematologic disorder (category II), or aggressive mastocytosis (category III); a patient with CMML unassociated with mastocytosis, and PBMCs from 13 normal subjects, we examined the level of expression of c-kit mRNA along with other c-kit isoforms to determine if overexpression of the c-kit receptor was associated with mastocytosis. Using quantitative competitive PCR, c-kit mRNA levels on average were found to be statistically elevated in the five patients with mastocytosis with an associated hematologic disorder and in the patient with aggressive mastocytosis as compared with controls, but not elevated in patients with indolent mastocytosis. The relative mRNA expression for the two c-kit isoforms was not significantly different in the mastocytosis patients compared with controls. This demonstration of the overexpression of c-kit mRNA in mastocytosis, and particularly those patients with clinical evidence of myelodysplastic syndrome, adds evidence to support the conclusion that mastocytosis, at least in some patients, is a feature of myelodysplasia; and suggests that determination of c-kit mRNA expression in PBMCs may provide an additional approach to assessing prognosis.

  12. KIT mutations correlate with adverse survival in children with core-binding factor acute myeloid leukemia.

    PubMed

    Chen, Xi; Dou, Hu; Wang, Xingjuan; Huang, Yi; Lu, Ling; Bin, Junqing; Su, Yongchun; Zou, Lin; Yu, Jie; Bao, Liming

    2018-04-01

    The prevalence and clinical relevance of KIT mutations in childhood core-binding factor (CBF) acute myeloid leukemia (AML) have not been well characterized. In this study, a total of 212 children with de novo AML were enrolled from a Chinese population and 50 (23.5%) of the patients were deemed CBF-AML. KIT mutations were identified in 30% of the CBF-AML cohort. The KIT mutations were clustered in exon 17 and exon 8, and KIT mutations in exons 8 and 17 were correlated with a shorter overall survival (OS) (5-year OS: 30.0 ± 14.5% vs. 73.0 ± 8.5%, p = .007) and event-free survival (EFS) (5-year EFS: 30.0 ± 14.5% vs. 73.0 ± 8.5%, p = .003). Multivariate analysis revealed KIT mutations as an independent risk factor in CBF-AML. Our results suggest that KIT mutations are a molecular marker for an inferior prognosis in pediatric CBF-AML.

  13. Imatinib for melanomas harboring mutationally activated or amplified KIT arising on mucosal, acral, and chronically sun-damaged skin.

    PubMed

    Hodi, F Stephen; Corless, Christopher L; Giobbie-Hurder, Anita; Fletcher, Jonathan A; Zhu, Meijun; Marino-Enriquez, Adrian; Friedlander, Philip; Gonzalez, Rene; Weber, Jeffrey S; Gajewski, Thomas F; O'Day, Steven J; Kim, Kevin B; Lawrence, Donald; Flaherty, Keith T; Luke, Jason J; Collichio, Frances A; Ernstoff, Marc S; Heinrich, Michael C; Beadling, Carol; Zukotynski, Katherine A; Yap, Jeffrey T; Van den Abbeele, Annick D; Demetri, George D; Fisher, David E

    2013-09-10

    Amplifications and mutations in the KIT proto-oncogene in subsets of melanomas provide therapeutic opportunities. We conducted a multicenter phase II trial of imatinib in metastatic mucosal, acral, or chronically sun-damaged (CSD) melanoma with KIT amplifications and/or mutations. Patients received imatinib 400 mg once per day or 400 mg twice per day if there was no initial response. Dose reductions were permitted for treatment-related toxicities. Additional oncogene mutation screening was performed by mass spectroscopy. Twenty-five patients were enrolled (24 evaluable). Eight patients (33%) had tumors with KIT mutations, 11 (46%) with KIT amplifications, and five (21%) with both. Median follow-up was 10.6 months (range, 3.7 to 27.1 months). Best overall response rate (BORR) was 29% (21% excluding nonconfirmed responses) with a two-stage 95% CI of 13% to 51%. BORR was significantly greater than the hypothesized null of 5% and statistically significantly different by mutation status (7 of 13 or 54% KIT mutated v 0% KIT amplified only). There were no statistical differences in rates of progression or survival by mutation status or by melanoma site. The overall disease control rate was 50% but varied significantly by KIT mutation status (77% mutated v 18% amplified). Four patients harbored pretreatment NRAS mutations, and one patient acquired increased KIT amplification after treatment. Melanomas that arise on mucosal, acral, or CSD skin should be assessed for KIT mutations. Imatinib can be effective when tumors harbor KIT mutations, but not if KIT is amplified only. NRAS mutations and KIT copy number gain may be mechanisms of therapeutic resistance to imatinib.

  14. Single-cell analysis of the fate of c-kit-positive bone marrow cells

    NASA Astrophysics Data System (ADS)

    Czarna, Anna; Sanada, Fumihiro; Matsuda, Alex; Kim, Junghyun; Signore, Sergio; Pereira, João D.; Sorrentino, Andrea; Kannappan, Ramaswamy; Cannatà, Antonio; Hosoda, Toru; Rota, Marcello; Crea, Filippo; Anversa, Piero; Leri, Annarosa

    2017-10-01

    The plasticity of c-kit-positive bone marrow cells (c-kit-BMCs) in tissues different from their organ of origin remains unclear. We tested the hypothesis that c-kit-BMCs are functionally heterogeneous and only a subgroup of these cells possesses cardiomyogenic potential. Population-based assays fall short of identifying the properties of individual stem cells, imposing on us the introduction of single cell-based approaches to track the fate of c-kit-BMCs in the injured heart; they included viral gene-tagging, multicolor clonal-marking and transcriptional profiling. Based on these strategies, we report that single mouse c-kit-BMCs expand clonally within the infarcted myocardium and differentiate into specialized cardiac cells. Newly-formed cardiomyocytes, endothelial cells, fibroblasts and c-kit-BMCs showed in their genome common sites of viral integration, providing strong evidence in favor of the plasticity of a subset of BMCs expressing the c-kit receptor. Similarly, individual c-kit-BMCs, which were infected with multicolor reporters and injected in infarcted hearts, formed cardiomyocytes and vascular cells organized in clusters of similarly colored cells. The uniform distribution of fluorescent proteins in groups of specialized cells documented the polyclonal nature of myocardial regeneration. The transcriptional profile of myogenic c-kit-BMCs and whole c-kit-BMCs was defined by RNA sequencing. Genes relevant for engraftment, survival, migration, and differentiation were enriched in myogenic c-kit-BMCs, a cell subtype which could not be assigned to a specific hematopoietic lineage. Collectively, our findings demonstrate that the bone marrow comprises a category of cardiomyogenic, vasculogenic and/or fibrogenic c-kit-positive cells and a category of c-kit-positive cells that retains an undifferentiated state within the damaged heart.

  15. Single-cell analysis of the fate of c-kit-positive bone marrow cells.

    PubMed

    Czarna, Anna; Sanada, Fumihiro; Matsuda, Alex; Kim, Junghyun; Signore, Sergio; Pereira, João D; Sorrentino, Andrea; Kannappan, Ramaswamy; Cannatà, Antonio; Hosoda, Toru; Rota, Marcello; Crea, Filippo; Anversa, Piero; Leri, Annarosa

    2017-01-01

    The plasticity of c-kit-positive bone marrow cells (c-kit-BMCs) in tissues different from their organ of origin remains unclear. We tested the hypothesis that c-kit-BMCs are functionally heterogeneous and only a subgroup of these cells possesses cardiomyogenic potential. Population-based assays fall short of identifying the properties of individual stem cells, imposing on us the introduction of single cell-based approaches to track the fate of c-kit-BMCs in the injured heart; they included viral gene-tagging, multicolor clonal-marking and transcriptional profiling. Based on these strategies, we report that single mouse c-kit-BMCs expand clonally within the infarcted myocardium and differentiate into specialized cardiac cells. Newly-formed cardiomyocytes, endothelial cells, fibroblasts and c-kit-BMCs showed in their genome common sites of viral integration, providing strong evidence in favor of the plasticity of a subset of BMCs expressing the c-kit receptor. Similarly, individual c-kit-BMCs, which were infected with multicolor reporters and injected in infarcted hearts, formed cardiomyocytes and vascular cells organized in clusters of similarly colored cells. The uniform distribution of fluorescent proteins in groups of specialized cells documented the polyclonal nature of myocardial regeneration. The transcriptional profile of myogenic c-kit-BMCs and whole c-kit-BMCs was defined by RNA sequencing. Genes relevant for engraftment, survival, migration, and differentiation were enriched in myogenic c-kit-BMCs, a cell subtype which could not be assigned to a specific hematopoietic lineage. Collectively, our findings demonstrate that the bone marrow comprises a category of cardiomyogenic, vasculogenic and/or fibrogenic c-kit-positive cells and a category of c-kit-positive cells that retains an undifferentiated state within the damaged heart.

  16. The stem cell factor (SCF)/c-KIT signalling in testis and prostate cancer.

    PubMed

    Cardoso, Henrique J; Figueira, Marília I; Socorro, Sílvia

    2017-12-01

    The stem cell factor (SCF) is a cytokine that specifically binds the tyrosine kinase receptor c-KIT. The SCF/c-KIT interaction leads to receptor dimerization, activation of kinase activity and initiation of several signal transduction pathways that control cell proliferation, apoptosis, differentiation and migration in several tissues. The activity of SCF/c-KIT system is linked with the phosphatidylinositol 3-kinase (PI3-K), the Src, the Janus kinase/signal transducers and activators of transcription (JAK/STAT), the phospholipase-C (PLC-γ) and the mitogen-activated protein kinase (MAPK) pathways. Moreover, it has been reported that cancer cases display an overactivation of c-KIT due to the presence of gain-of-function mutations or receptor overexpression, which renders c-KIT a tempting target for cancer treatment. In the case of male cancers the most documented activated pathways are the PI3-K and Src, both enhancing abnormal cell proliferation. It is also known that the Src activity in prostate cancer cases depends on the presence of tr-KIT, the cytoplasmic truncated variant of c-KIT that is specifically expressed in tumour tissues and, thus, a very interesting target for drug development. The present review provides an overview of the signalling pathways activated by SCF/c-KIT and discusses the potential application of c-KIT inhibitors for treatment of testicular and prostatic cancers.

  17. Cabozantinib Is Active against Human Gastrointestinal Stromal Tumor Xenografts Carrying Different KIT Mutations.

    PubMed

    Gebreyohannes, Yemarshet K; Schöffski, Patrick; Van Looy, Thomas; Wellens, Jasmien; Vreys, Lise; Cornillie, Jasmien; Vanleeuw, Ulla; Aftab, Dana T; Debiec-Rychter, Maria; Sciot, Raf; Wozniak, Agnieszka

    2016-12-01

    In the majority of gastrointestinal stromal tumors (GIST), oncogenic signaling is driven by KIT mutations. Advanced GIST is treated with tyrosine kinase inhibitors (TKI) such as imatinib. Acquired resistance to TKI is mainly caused by secondary KIT mutations, but can also be attributed to a switch of KIT dependency to another receptor tyrosine kinase (RTK). We tested the efficacy of cabozantinib, a novel TKI targeting KIT, MET, AXL, and vascular endothelial growth factor receptors (VEGFR), in patient-derived xenograft (PDX) models of GIST, carrying different KIT mutations. NMRI nu/nu mice (n = 52) were bilaterally transplanted with human GIST: UZLX-GIST4 (KIT exon 11 mutation, imatinib sensitive), UZLX-GIST2 (KIT exon 9, imatinib dose-dependent resistance), or UZLX-GIST9 (KIT exon 11 and 17 mutations, imatinib resistant). Mice were grouped as control (untreated), imatinib (50 mg/kg/bid), and cabozantinib (30 mg/kg/qd) and treated orally for 15 days. Cabozantinib resulted in significant tumor regression in UZLX-GIST4 and -GIST2 and delayed tumor growth in -GIST9. In all three models, cabozantinib inhibited the proliferative activity, which was completely absent in UZLX-GIST4 and significantly reduced in -GIST2 and -GIST9. Increased apoptotic activity was observed only in UZLX-GIST4. Cabozantinib inhibited the KIT signaling pathway in UZLX-GIST4 and -GIST2. In addition, compared with both control and imatinib, cabozantinib significantly reduced microvessel density in all models. In conclusion, cabozantinib showed antitumor activity in GIST PDX models through inhibition of tumor growth, proliferation, and angiogenesis, in both imatinib-sensitive and imatinib-resistant models. Mol Cancer Ther; 15(12); 2845-52. ©2016 AACR. ©2016 American Association for Cancer Research.

  18. Stromal and epithelial cells react differentially to c-kit in fibroepithelial tumors of the breast.

    PubMed

    Logullo, Angela F; Nonogaki, Suely; Do Socorro Maciel, Maria; Mourão-Neto, Mário; Soares, Fernando Augusto

    2008-01-01

    The CD117 protein is a tyrosine-kinase receptor encoded by the c-kit gene that frequently bears activating mutations in gastrointestinal tumors. Conflicting findings regarding CD117 expression in other stromal tumors, including phyllodes tumors (PTs), have been reported in the literature. The purpose of this study was to evaluate c-kit expression in the stroma and epithelia of fibroepithelial breast tumors and its correlation with clinical pathological variables. Ninety-six fibroepithelial tumors of the breast, including 14 fibroadenomas (FAs), 12 juvenile FAs and 70 PTs, were classified according to stromal cellularity, atypia, epithelial hyperplasia, mitosis and borders into 45 benign (PTB), 17 borderline (PTBL) and 8 malignant (PTM) tumors. CD117 expression was identified in the stromal component in only two cases of PTBL. Overall, 38 cases (39.6%) showed positive CD117 in the epithelial component, including 20 FAs (10 regular, 10 juvenile) and 18 PTs (11 PTBs and 8 PTBLs). Other cases, including all PTMs, 6 FAs (4 regular, 2 juvenile), 34 PTBs and 10 PTBLs, showed no positivity in the epithelial component. Expression of c-kit did not correlate with diagnosis or malignancy (p>0.05). In conclusion, c-kit is expressed more often in the epithelial than in the stromal component in fibroepithelial tumors of the breast, and is associated with benign lesions.

  19. Whole-exome sequencing identifies recurrent SF3B1 R625 mutation and comutation of NF1 and KIT in mucosal melanoma

    PubMed Central

    Hintzsche, Jennifer D.; Gorden, Nicholas T.; Amato, Carol M.; Kim, Jihye; Wuensch, Kelsey E.; Robinson, Steven E.; Applegate, Allison J.; Couts, Kasey L.; Medina, Theresa M.; Wells, Keith R.; Wisell, Joshua A.; McCarter, Martin D.; Box, Neil F.; Shellman, Yiqun G.; Gonzalez, Rene C.; Lewis, Karl D.; Tentler, John J.

    2017-01-01

    Mucosal melanomas are a rare subtype of melanoma, arising in mucosal tissues, which have a very poor prognosis due to the lack of effective targeted therapies. This study aimed to better understand the molecular landscape of these cancers and find potential new therapeutic targets. Whole-exome sequencing was performed on mucosal melanomas from 19 patients and 135 sun-exposed cutaneous melanomas, with matched peripheral blood samples when available. Mutational profiles were compared between mucosal subgroups and sun-exposed cutaneous melanomas. Comparisons of molecular profiles identified 161 genes enriched in mucosal melanoma (P<0.05). KIT and NF1 were frequently comutated (32%) in the mucosal subgroup, with a significantly higher incidence than that in cutaneous melanoma (4%). Recurrent SF3B1 R625H/S/C mutations were identified and validated in 7 of 19 (37%) mucosal melanoma patients. Mutations in the spliceosome pathway were found to be enriched in mucosal melanomas when compared with cutaneous melanomas. Alternative splicing in four genes were observed in SF3B1-mutant samples compared with the wild-type samples. This study identified potential new therapeutic targets for mucosal melanoma, including comutation of NF1 and KIT, and recurrent R625 mutations in SF3B1. This is the first report of SF3B1 R625 mutations in vulvovaginal mucosal melanoma, with the largest whole-exome sequencing project of mucosal melanomas to date. The results here also indicated that the mutations in SF3B1 lead to alternative splicing in multiple genes. These findings expand our knowledge of this rare disease. PMID:28296713

  20. Bone-induced c-kit expression in prostate cancer: a driver of intraosseous tumor growth

    PubMed Central

    Mainetti, Leandro E.; Zhe, Xiaoning; Diedrich, Jonathan; Saliganan, Allen D.; Cho, Won Jin; Cher, Michael L.; Heath, Elisabeth; Fridman, Rafael; Kim, Hyeong-Reh Choi; Bonfil, R. Daniel

    2014-01-01

    Loss of BRCA2 function stimulates prostate cancer (PCa) cell invasion and is associated with more aggressive and metastatic tumors in PCa patients. Concurrently, the receptor tyrosine kinase c-kit is highly expressed in skeletal metastases of PCa patients and induced in PCa cells placed into the bone microenvironment in experimental models. However, the precise requirement of c-kit for intraosseous growth of PCa and its relation to BRCA2 expression remain unexplored. Here, we show that c-kit expression promotes migration and invasion of PCa cells. Alongside, we found that c-kit expression in PCa cells parallels BRCA2 downregulation. Gene rescue experiments with human BRCA2 transgene in c-kit-transfected PCa cells resulted in reduction of c-kit protein expression and migration and invasion, suggesting a functional significance of BRCA2 downregulation by c-kit. The inverse association between c-kit and BRCA2 gene expressions in PCa cells was confirmed using laser capture microdissection in experimental intraosseous tumors and bone metastases of PCa patients. Inhibition of bone-induced c-kit expression in PCa cells transduced with lentiviral short hairpin RNA reduced intraosseous tumor incidence and growth. Overall, our results provide evidence of a novel pathway that links bone-induced c-kit expression in PCa cells to BRCA2 downregulation and supports bone metastasis. PMID:24798488

  1. Antiproliferation effect of imatinib mesylate on MCF7, T-47D tumorigenic and MCF 10A nontumorigenic breast cell lines via PDGFR-β, PDGF-BB, c-Kit and SCF genes

    PubMed Central

    Kadivar, Ali; Kamalidehghan, Behnam; Akbari Javar, Hamid; Karimi, Benyamin; Sedghi, Reihaneh; Noordin, Mohamed Ibrahim

    2017-01-01

    Recent cancer molecular therapies are targeting main functional molecules to control applicable process of cancer cells. Attractive targets are established by receptor tyrosine kinases, such as platelet-derived growth factor receptors (PDGFRs) and c-Kit as mostly irregular signaling, which is due to either over expression or mutation that is associated with tumorigenesis and cell proliferation. Imatinib mesylate is a selective inhibitor of receptor tyrosine kinase, including PDGFR-β and c-Kit. In this research, we studied how imatinib mesylate would exert effect on MCF7 and T-47D breast cancer and MCF 10A epithelial cell lines, the gene and protein expression of PDGFR-β, c-Kit and their relevant ligands platelet-derived growth factor (PDGF)-BB and stem cell factor (SCF). The MTS assay was conducted in therapeutic relevant concentration of 2–10 µM for 96, 120 and 144 h treatment. In addition, apoptosis induction and cytostatic activity of imatinib mesylate were investigated with the terminal deoxynucleotidyl transferase dUTP nick end labeling TUNEL and cell cycle assays, respectively, in a time-dependent manner. Comparative real-time PCR and Western blot analysis were conducted to evaluate the expression and regulation of imatinib target genes and proteins. Our finding revealed that imatinib mesylate antiproliferation effect, apoptosis induction and cytostatic activity were significantly higher in breast cancer cell lines compared to MCF 10A. This effect might be due to the expression of PDGFR-β, PDGF-BB, c-Kit and SCF, which was expressed by all examined cell lines, except the T-47D cell line which was not expressed c-Kit. However, examined gene and proteins expressed more in cancer cell lines. Therefore, imatinib mesylate was more effective on them. It is concluded that imatinib has at least two potential targets in both examined breast cancer cell lines and can be a promising drug for targeted therapy to treat breast cancer. PMID:28260860

  2. HAEdb: a novel interactive, locus-specific mutation database for the C1 inhibitor gene.

    PubMed

    Kalmár, Lajos; Hegedüs, Tamás; Farkas, Henriette; Nagy, Melinda; Tordai, Attila

    2005-01-01

    Hereditary angioneurotic edema (HAE) is an autosomal dominant disorder characterized by episodic local subcutaneous and submucosal edema and is caused by the deficiency of the activated C1 esterase inhibitor protein (C1-INH or C1INH; approved gene symbol SERPING1). Published C1-INH mutations are represented in large universal databases (e.g., OMIM, HGMD), but these databases update their data rather infrequently, they are not interactive, and they do not allow searches according to different criteria. The HAEdb, a C1-INH gene mutation database (http://hae.biomembrane.hu) was created to contribute to the following expectations: 1) help the comprehensive collection of information on genetic alterations of the C1-INH gene; 2) create a database in which data can be searched and compared according to several flexible criteria; and 3) provide additional help in new mutation identification. The website uses MySQL, an open-source, multithreaded, relational database management system. The user-friendly graphical interface was written in the PHP web programming language. The website consists of two main parts, the freely browsable search function, and the password-protected data deposition function. Mutations of the C1-INH gene are divided in two parts: gross mutations involving DNA fragments >1 kb, and micro mutations encompassing all non-gross mutations. Several attributes (e.g., affected exon, molecular consequence, family history) are collected for each mutation in a standardized form. This database may facilitate future comprehensive analyses of C1-INH mutations and also provide regular help for molecular diagnostic testing of HAE patients in different centers.

  3. Prognostic significance of KIT exon 11 deletion mutation in intermediate-risk gastrointestinal stromal tumor.

    PubMed

    Quek, Richard; Farid, Mohamad; Kanjanapan, Yada; Lim, Cindy; Tan, Iain Beehuat; Kesavan, Sittampalam; Lim, Tony Kiat Hon; Oon, Lynette Lin-Ean; Goh, Brian Kp; Chan, Weng Hoong; Teo, Melissa; Chung, Alexander Yf; Ong, Hock Soo; Wong, Wai Keong; Tan, Patrick; Yip, Desmond

    2017-06-01

    Benefit of adjuvant imatinib therapy following curative resection in patients with intermediate-risk gastrointestinal stromal tumor (GIST) is unclear. GIST-specific exon mutations, in particular exon 11 deletions, have been shown to be prognostic. We hypothesize that specific KIT mutations may improve risk stratification in patients with intermediate-risk GIST, identifying a subgroup of patients who may benefit from adjuvant therapy. In total, 142 GIST patients with complete clinicopathologic and mutational data from two sites were included. Risk classification was based on the modified National Institute of Health (NIH) criteria. In this cohort, 74% (n = 105) of patients harbored a KIT mutation; 61% (n = 86) were found in exon 11 of which nearly 70% were KIT exon 11 deletions (n = 60). A total of 18% (n = 25) of cases were classified as having intermediate-risk disease. Univariate analysis confirmed tumor size, mitotic index, nongastric origin, presence of tumor rupture and modified NIH criteria were adversely prognostic for relapse-free survival (RFS). Among KIT/PDGFRA mutants, KIT exon 11 deletions had a significantly worse prognosis (hazard ratio 2.31; 95% confidence interval, 1.30-4.10; P = 0.003). Multivariate analysis confirmed KIT exon 11 deletion (P = 0.003) and clinical risk classification (P < 0.001) as independent adverse prognostic factors for RFS. Intermediate-risk patients harboring KIT exon 11 deletions had RFS outcomes similar to high-risk patients. The presence of KIT exon 11 deletion mutation in patients with intermediate-risk GIST is associated with an inferior clinical outcome with RFS similar to high-risk patients. © 2016 John Wiley & Sons Australia, Ltd.

  4. Performance evaluation of the HepB Typer-Entecavir kit for detection of entecavir resistance mutations in chronic hepatitis B.

    PubMed

    Ahn, Sang Hoon; Chun, Ji-Yong; Shin, Soo-Kyung; Park, Jun Yong; Yoo, Wangdon; Hong, Sun Pyo; Kim, Soo-Ok; Han, Kwang-Hyub

    2013-12-01

    Molecular diagnostic methods have enabled the rapid diagnosis of drug-resistant mutations in hepatitis B virus (HBV) and have reduced both unnecessary therapeutic interventions and medical costs. In this study we evaluated the analytical and clinical performances of the HepB Typer-Entecavir kit (GeneMatrix, Korea) in detecting entecavir-resistance-associated mutations. The HepB Typer-Entecavir kit was evaluated for its limit of detection, interference, cross-reactivity, and precision using HBV reference standards made by diluting high-titer viral stocks in HBV-negative human serum. The performance of the HepB Typer-Entecavir kit for detecting mutations related to entecavir resistance was compared with direct sequencing for 396 clinical samples from 108 patients. Using the reference standards, the detection limit of the HepB Typer-Entecavir kit was found to be as low as 500 copies/mL. No cross-reactivity was observed, and elevated levels of various interfering substances did not adversely affect its analytical performance. The precision test conducted by repetitive analysis of 2,400 replicates with reference standards at various concentrations showed 99.9% agreement (2398/2400). The overall concordance rate between the HepB Typer-Entecavir kit and direct sequencing assays in 396 clinical samples was 99.5%. The HepB Typer-Entecavir kit showed high reliability and precision, and comparable sensitivity and specificity for detecting mutant virus populations in reference and clinical samples in comparison with direct sequencing. Therefore, this assay would be clinically useful in the diagnosis of entecavir-resistance-associated mutations in chronic hepatitis B.

  5. Performance evaluation of the HepB Typer-Entecavir kit for detection of entecavir resistance mutations in chronic hepatitis B

    PubMed Central

    Ahn, Sang Hoon; Chun, Ji-Yong; Shin, Soo-Kyung; Park, Jun Yong; Yoo, Wangdon; Hong, Sun Pyo; Han, Kwang-Hyub

    2013-01-01

    Background/Aims Molecular diagnostic methods have enabled the rapid diagnosis of drug-resistant mutations in hepatitis B virus (HBV) and have reduced both unnecessary therapeutic interventions and medical costs. In this study we evaluated the analytical and clinical performances of the HepB Typer-Entecavir kit (GeneMatrix, Korea) in detecting entecavir-resistance-associated mutations. Methods The HepB Typer-Entecavir kit was evaluated for its limit of detection, interference, cross-reactivity, and precision using HBV reference standards made by diluting high-titer viral stocks in HBV-negative human serum. The performance of the HepB Typer-Entecavir kit for detecting mutations related to entecavir resistance was compared with direct sequencing for 396 clinical samples from 108 patients. Results Using the reference standards, the detection limit of the HepB Typer-Entecavir kit was found to be as low as 500 copies/mL. No cross-reactivity was observed, and elevated levels of various interfering substances did not adversely affect its analytical performance. The precision test conducted by repetitive analysis of 2,400 replicates with reference standards at various concentrations showed 99.9% agreement (2398/2400). The overall concordance rate between the HepB Typer-Entecavir kit and direct sequencing assays in 396 clinical samples was 99.5%. Conclusions The HepB Typer-Entecavir kit showed high reliability and precision, and comparable sensitivity and specificity for detecting mutant virus populations in reference and clinical samples in comparison with direct sequencing. Therefore, this assay would be clinically useful in the diagnosis of entecavir-resistance-associated mutations in chronic hepatitis B. PMID:24459645

  6. MNK1/2 inhibition limits oncogenicity and metastasis of KIT-mutant melanoma.

    PubMed

    Zhan, Yao; Guo, Jun; Yang, William; Goncalves, Christophe; Rzymski, Tomasz; Dreas, Agnieszka; Żyłkiewicz, Eliza; Mikulski, Maciej; Brzózka, Krzysztof; Golas, Aniela; Kong, Yan; Ma, Meng; Huang, Fan; Huor, Bonnie; Guo, Qianyu; da Silva, Sabrina Daniela; Torres, Jose; Cai, Yutian; Topisirovic, Ivan; Su, Jie; Bijian, Krikor; Alaoui-Jamali, Moulay A; Huang, Sidong; Journe, Fabrice; Ghanem, Ghanem E; Miller, Wilson H; Del Rincón, Sonia V

    2017-11-01

    Melanoma can be stratified into unique subtypes based on distinct pathologies. The acral/mucosal melanoma subtype is characterized by aberrant and constitutive activation of the proto-oncogene receptor tyrosine kinase C-KIT, which drives tumorigenesis. Treatment of these melanoma patients with C-KIT inhibitors has proven challenging, prompting us to investigate the downstream effectors of the C-KIT receptor. We determined that C-KIT stimulates MAP kinase-interacting serine/threonine kinases 1 and 2 (MNK1/2), which phosphorylate eukaryotic translation initiation factor 4E (eIF4E) and render it oncogenic. Depletion of MNK1/2 in melanoma cells with oncogenic C-KIT inhibited cell migration and mRNA translation of the transcriptional repressor SNAI1 and the cell cycle gene CCNE1. This suggested that blocking MNK1/2 activity may inhibit tumor progression, at least in part, by blocking translation initiation of mRNAs encoding cell migration proteins. Moreover, we developed an MNK1/2 inhibitor (SEL201), and found that SEL201-treated KIT-mutant melanoma cells had lower oncogenicity and reduced metastatic ability. Clinically, tumors from melanoma patients harboring KIT mutations displayed a marked increase in MNK1 and phospho-eIF4E. Thus, our studies indicate that blocking MNK1/2 exerts potent antimelanoma effects and support blocking MNK1/2 as a potential strategy to treat patients positive for KIT mutations.

  7. Investigating Associations Between Proliferation Indices, C-kit, and Lymph Node Stage in Canine Mast Cell Tumors.

    PubMed

    Krick, Erika Lauren; Kiupel, Matti; Durham, Amy C; Thaiwong, Tuddow; Brown, Dorothy C; Sorenmo, Karin U

    Previous studies have evaluated cellular proliferation indices, KIT expression, and c-kit mutations to predict the clinical behavior of canine mast cell tumors (MCTs). The study purpose was to retrospectively compare mitotic index, argyrophilic nucleolar organizer regions (AgNORs)/nucleus, Ki-67 index, KIT labeling pattern, and internal tandem duplication mutations in c-KIT between stage I and stage II grade II MCTs. Medical records and tumor biopsy samples from dogs with Grade II MCTs with cytological or histopathological regional lymph node evaluation were included. Signalment, tumor location and stage, and presence of a recurrent versus de novo tumor were recorded. Mitotic index, AgNORs/nucleus, Ki-67, KIT staining pattern, and internal tandem duplication mutations in exon 11 of c-KIT were evaluated. Sixty-six tumors (51 stage I; 15 stage II) were included. Only AgNORs/nucleus and recurrent tumors were significantly associated with stage (odds ratio 2.8, 95% confidence interval [CI] 1.0-8.0, P = .049; odds ratio 8.8, 95% CI 1.1-69.5; P = .039). Receiver-operator characteristic analysis showed that the sensitivity and specificity of AgNORs/cell ≥ 1.87 were 93.3% and 27.4%, respectively, (area under the curve: 0.65) for predicting stage. Recurrent tumors and higher AgNORs/nucleus are associated with stage II grade II MCTs; however, an AgNOR cutoff value that reliably predicts lymph node metastasis was not determined.

  8. Mutations in HAMP and HJV genes and their impact on expression of clinical hemochromatosis in a cohort of 100 Spanish patients homozygous for the C282Y mutation of HFE gene.

    PubMed

    Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat

    2009-10-01

    Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.

  9. Kit receptor tyrosine kinase dysregulations in feline splenic mast cell tumours.

    PubMed

    Sabattini, S; Barzon, G; Giantin, M; Lopparelli, R M; Dacasto, M; Prata, D; Bettini, G

    2017-09-01

    This study investigated Kit receptor dysregulations (cytoplasmic immunohistochemical expression and/or c-KIT mutations) in cats affected with splenic mast cell tumours. Twenty-two cats were included. Median survival time was 780 days (range: 1-1219). An exclusive splenic involvement was significantly (P = 0.042) associated with longer survival (807 versus 120 days). Eighteen tumours (85.7%) showed Kit cytoplasmic expression (Kit pattern 2, 3). Mutation analysis was successful in 20 cases. Fourteen missense mutations were detected in 13 out of 20 tumours (65%). Eleven (78.6%) were located in exon 8, and three (21.6%) in exon 9. No mutations were detected in exons 11 and 17. Seven mutations corresponded to the same internal tandem duplication in exon 8 (c.1245_1256dup). Although the association between Kit cytoplasmic expression and mutations was significant, immunohistochemistry cannot be considered a surrogate marker for mutation analysis. No correlation was observed between c-Kit mutations and tumour differentiation, mitotic activity or survival. © 2016 John Wiley & Sons Ltd.

  10. Novel and recurrent mutations in the C1NH gene of Arab patients affected with hereditary angioedema.

    PubMed

    Faiyaz-Ul-Haque, Muhammad; Al-Gazlan, Sulaiman; Abalkhail, Halah A; Al-Abdulatif, Ahmad; Toulimat, Mohamed; Peltekova, Iskra; Khaliq, Agha M R; Al-Dayel, Fouad; Zaidi, Syed H E

    2010-01-01

    Autosomal dominant hereditary angioedema (HAE) results in episodes of subcutaneous edema in any body part and/or submucosal edema of the upper respiratory or gastrointestinal tracts. This disorder is caused by mutations in the C1NH gene, many of which have been described primarily in European patients. However, the genetic cause of HAE in Middle Eastern Arab patients has not yet been determined. Four unrelated Arab families, in which 15 patients were diagnosed with HAE, were studied. DNA from 13 patients was analyzed for mutations in the C1NH gene by DNA sequencing. Three novel and 2 recurrent mutations were identified in the C1NH gene of HAE patients. In family 1, the patient was heterozygous for a novel c.856C>T and a recurrent c.1361T>A missense mutation encoding for p.Arg264Cys and p.Val432Glu, respectively. In patients from family 2, a novel c.509C>T missense mutation encoding for a p.Ser148Phe was identified. In patients from family 3, a novel c.1142delC nonsense mutation encoding for a p.Ala359AlafsX15 was discovered. In family 4, a recurrent c.1397G>A missense mutation encoding for a p.Arg444His was present. This is the first ever report of C1NH gene mutations in Middle Eastern Arab patients. Our study suggests that, despite the numerous existing mutations in the C1NH gene, there are novel and recurrent mutations in HAE patients of non-European origin. We conclude that the spectrum of C1NH gene mutations in HAE patients is wider due to the likely presence of novel and recurrent mutations in patients of other ethnicities. 2009 S. Karger AG, Basel.

  11. Molecular Analysis of Glucose-6-Phosphate Dehydrogenase Gene Mutations in Bangladeshi Individuals.

    PubMed

    Sarker, Suprovath Kumar; Islam, Md Tarikul; Eckhoff, Grace; Hossain, Mohammad Amir; Qadri, Syeda Kashfi; Muraduzzaman, A K M; Bhuyan, Golam Sarower; Shahidullah, Mohammod; Mannan, Mohammad Abdul; Tahura, Sarabon; Hussain, Manzoor; Akhter, Shahida; Nahar, Nazmun; Shirin, Tahmina; Qadri, Firdausi; Mannoor, Kaiissar

    2016-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common X-linked human enzyme defect of red blood cells (RBCs). Individuals with this gene defect appear normal until exposed to oxidative stress which induces hemolysis. Consumption of certain foods such as fava beans, legumes; infection with bacteria or virus; and use of certain drugs such as primaquine, sulfa drugs etc. may result in lysis of RBCs in G6PD deficient individuals. The genetic defect that causes G6PD deficiency has been identified mostly as single base missense mutations. One hundred and sixty G6PD gene mutations, which lead to amino acid substitutions, have been described worldwide. The purpose of this study was to detect G6PD gene mutations in hospital-based settings in the local population of Dhaka city, Bangladesh. Qualitative fluorescent spot test and quantitative enzyme activity measurement using RANDOX G6PDH kit were performed for analysis of blood specimens and detection of G6PD-deficient participants. For G6PD-deficient samples, PCR was done with six sets of primers specific for G6PD gene. Automated Sanger sequencing of the PCR products was performed to identify the mutations in the gene. Based on fluorescence spot test and quantitative enzyme assay followed by G6PD gene sequencing, 12 specimens (11 males and one female) among 121 clinically suspected patient-specimens were found to be deficient, suggesting a frequency of 9.9% G6PD deficiency. Sequencing of the G6PD-deficient samples revealed c.C131G substitution (exon-3: Ala44Gly) in six samples, c.G487A substitution (exon-6:Gly163Ser) in five samples and c.G949A substitution (exon-9: Glu317Lys) of coding sequence in one sample. These mutations either affect NADP binding or disrupt protein structure. From the study it appears that Ala44Gly and Gly163Ser are the most common G6PD mutations in Dhaka, Bangladesh. This is the first study of G6PD mutations in Bangladesh.

  12. Mutation profiling of 19 candidate genes in acute myeloid leukemia suggests significance of DNMT3A mutations.

    PubMed

    Shin, Sang-Yong; Lee, Seung-Tae; Kim, Hee-Jin; Cho, Eun Hae; Kim, Jong-Won; Park, Silvia; Jung, Chul Won; Kim, Sun-Hee

    2016-08-23

    We selected 19 significantly-mutated genes in AMLs, including FLT3, DNMT3A, NPM1, TET2, RUNX1, CEBPA, WT1, IDH1, IDH2, NRAS, ASXL1, SETD2, PTPN11, TP53, KIT, JAK2, KRAS, BRAF and CBL, and performed massively parallel sequencing for 114 patients with acute myeloid leukemias, mainly including those with normal karyotypes (CN-AML). More than 80% of patients had at least one mutation in the genes tested. DNMT3A mutation was significantly associated with adverse outcome in addition to conventional risk stratification such as the European LeukemiaNet (ELN) classification. We observed clinical usefulness of mutation testing on multiple target genes and the association with disease subgroups, clinical features and prognosis in AMLs.

  13. Frequency of the S65C mutation in the hemochromatosis gene in Brazil.

    PubMed

    Oliveira, V C; Caxito, F A; Gomes, K B; Castro, A M; Pardini, V C; Ferreira, A C S

    2009-07-14

    Development of hereditary hemochromatosis is associated with the C282Y, H63D or S65C mutations in the hemochromatosis gene. Though there is extensive knowledge about the former two, there is little information on the mechanism of action and the allelic frequency of the S65C mutation. We examined the prevalence of the S65C mutation of the hemochromatosis gene in Brazilians with clinical suspicion of hereditary hemochromatosis. Genotyping for this mutation was carried out in 633 individuals with clinical suspicion of hereditary hemochromatosis, using the polymerase chain reaction, followed by enzymatic digestion. The sample comprised 77.1% men and 22.9% women, giving a ratio of approximately 3:1; the mean age was 48.8 +/- 13.8 years. More than half (57.3%) of the individuals in the sample were 41 to 60 years old. The frequency of heterozygotes for this mutation was 0.016; no homozygous mutant patients were found. This is the first analysis of the S65C mutation in individuals suspected of having hereditary hemochromatosis in Brazil.

  14. Hotspot Mutations in KIT Receptor Differentially Modulate Its Allosterically Coupled Conformational Dynamics: Impact on Activation and Drug Sensitivity

    PubMed Central

    Chauvot de Beauchêne, Isaure; Allain, Ariane; Panel, Nicolas; Laine, Elodie; Trouvé, Alain; Dubreuil, Patrice; Tchertanov, Luba

    2014-01-01

    Receptor tyrosine kinase KIT controls many signal transduction pathways and represents a typical allosterically regulated protein. The mutation-induced deregulation of KIT activity impairs cellular physiological functions and causes serious human diseases. The impact of hotspots mutations (D816H/Y/N/V and V560G/D) localized in crucial regulatory segments, the juxtamembrane region (JMR) and the activation (A-) loop, on KIT internal dynamics was systematically studied by molecular dynamics simulations. The mutational outcomes predicted in silico were correlated with in vitro and in vivo activation rates and drug sensitivities of KIT mutants. The allosteric regulation of KIT in the native and mutated forms is described in terms of communication between the two remote segments, JMR and A-loop. A strong correlation between the communication profile and the structural and dynamical features of KIT in the native and mutated forms was established. Our results provide new insight on the determinants of receptor KIT constitutive activation by mutations and resistance of KIT mutants to inhibitors. Depiction of an intra-molecular component of the communication network constitutes a first step towards an integrated description of vast communication pathways established by KIT in physiopathological contexts. PMID:25079768

  15. Case report of a KIT-mutated melanoma patient with an excellent response to apatinib and temozolomide combination therapy.

    PubMed

    Luo, Cong; Shen, Jiayu; Ying, Jieer; Fang, Xianhua; Wang, Xiaohong; Fu, Zhixuan; Liu, Peng

    2017-01-01

    Malignant melanoma is one kind of malignant disease which has high rates of mortality, metastasis, and poor prognosis. The therapeutic landscape is rapidly changing with the development of novel agents in recent decades, such as anti-PD-1 agents, anti-CTLA-4 agents, and BRAF inhibitors. However, since most of these novel agents are very expensive, not all patients can afford them. Apatinib is a novel oral small-molecule tyrosine kinase inhibitor targeting the intracellular domain of vascular endothelial growth factor receptor 2 (VEGFR-2) and may also be effective on Ret, c-KIT, and c-src. Temozolomide (TMZ) is a second-generation alkylating agent and a cytotoxic drug for melanoma treatment. In this work, we reported a case of metastatic melanoma with an excellent response to apatinib/TMZ combination therapy with progression-free survival for more than one year. This patient showed high expression of CD117, VEGFR-3, and KIT mutation in exon 11, suggesting that apatinib may induce clinical response via inhibiting VEGFR and c-KIT. Apatinib/TMZ combination therapy could be a new option for the treatment of advanced melanoma with KIT mutation.

  16. Phosphorylation of the Activation Loop Tyrosine 823 in c-Kit Is Crucial for Cell Survival and Proliferation*

    PubMed Central

    Agarwal, Shruti; Kazi, Julhash U.; Rönnstrand, Lars

    2013-01-01

    The receptor tyrosine kinase c-Kit, also known as the stem cell factor receptor, plays a key role in several developmental processes. Activating mutations in c-Kit lead to alteration of these cellular processes and have been implicated in many human cancers such as gastrointestinal stromal tumors, acute myeloid leukemia, testicular seminomas and mastocytosis. Regulation of the catalytic activity of several kinases is known to be governed by phosphorylation of tyrosine residues in the activation loop of the kinase domain. However, in the case of c-Kit phosphorylation of Tyr-823 has been demonstrated to be a late event that is not required for kinase activation. However, because phosphorylation of Tyr-823 is a ligand-activated event, we sought to investigate the functional consequences of Tyr-823 phosphorylation. By using a tyrosine-to-phenylalanine mutant of tyrosine 823, we investigated the impact of Tyr-823 on c-Kit signaling. We demonstrate here that Tyr-823 is crucial for cell survival and proliferation and that mutation of Tyr-823 to phenylalanine leads to decreased sustained phosphorylation and ubiquitination of c-Kit as compared with the wild-type receptor. Furthermore, the mutated receptor was, upon ligand-stimulation, quickly internalized and degraded. Phosphorylation of the E3 ubiquitin ligase Cbl was transient, followed by a substantial reduction in phosphorylation of downstream signaling molecules such as Akt, Erk, p38, Shc, and Gab2. Thus, we propose that activation loop tyrosine 823 is crucial for activation of both the MAPK and PI3K pathways and that its disruption leads to a destabilization of the c-Kit receptor and decreased survival of cells. PMID:23803604

  17. HFE gene C282Y, H63D and S65C mutations frequency in the Transylvania region, Romania.

    PubMed

    Trifa, Adrian P; Popp, Radu A; Militaru, Mariela S; Farcaş, Marius F; Crişan, Tania O; Gana, Ionuţ; Cucuianu, Andrei; Pop, Ioan V

    2012-06-01

    HFE-associated haemochromatosis is one of the most frequent autosomal recessive disorders in the Caucasian population. Although most of the cases are homozygous individuals for the C282Y mutation, another two mutations, H63D and S65C, have been reported to be associated with milder forms of the disease. This study was a first attempt to evaluate the distribution of these HFE gene mutations in the Transylvania region. Two-hundred and twenty-five healthy, unrelated volunteers originating from the Transylvania region, Romania, were screened for the HFE gene C282Y, H63D and S65C mutations, using molecular genetics assays (Polymerase Chain Reaction-Restriction Fragments Length Polymorphism). For the C282Y mutation, 7 heterozygotes (3.1%) were found, but no homozygous individual. In the case of the H63D mutation, 40 heterozygotes (17.8%) and 4 homozygotes (1.75%) for the mutant allele were evidenced. We found a compound heterozygous genotype (C282Y/H63D) in one individual (0.45%). Thus, the allele frequencies of the C282Y and H63D were 1.75% and 10.9%, respectively. Three individuals (1.3%) were found to harbour the S65C mutation in a heterozygous state, but none in a homozygous state: the allele frequency of the mutant allele was 0.75%. The distribution of the HFE gene C282Y, H63D and S65C mutations found in our group matches the tendencies observed in other European countries: a decreasing gradient from Northern to Southern Europe for the C282Y mutation; high frequency for the H63D mutation, and low frequency for the S65C mutation in most of the countries.

  18. Association of MTHFR gene C677T mutation with diabetic peripheral neuropathy and diabetic retinopathy

    PubMed Central

    Yigit, Serbulent; Inanir, Ahmet

    2013-01-01

    Purpose Diabetic peripheral neuropathy (DPN) is one of the most common diabetic chronic complications. Methylenetetrahydrofolate reductase (MTHFR) gene variants have been associated with vasculopathy that has been linked to diabetic neuropathy. The aim of the present study was to investigate the possible association between MTHFR gene C677T mutation and DPN and evaluate if there is an association with clinical features in a relatively large cohort of Turkish patients. Methods The study included 230 patients affected by DPN and 282 healthy controls. Genomic DNA was isolated and genotyped using the polymerase chain reaction–based restriction fragment length polymorphism assay for the MTHFR gene C677T mutation. Results The genotype and allele frequencies of the C677T mutation showed statistically significant differences between the patients with DPN and the controls (p=0.003 and p=0.002, respectively). After the patients with DPN were stratified according to clinical and demographic characteristics, a significant association was observed between the C677T mutation and history of retinopathy (p=0.039). Conclusions A high association between the MTHFR gene C677T mutation and DPN was observed in the present study. In addition, history of retinopathy was associated with the MTHFR C677T mutation in patients with DPN. PMID:23901246

  19. MNK1/2 inhibition limits oncogenicity and metastasis of KIT-mutant melanoma

    PubMed Central

    Zhan, Yao; Guo, Jun; Yang, William; Goncalves, Christophe; Rzymski, Tomasz; Dreas, Agnieszka; Żyłkiewicz, Eliza; Mikulski, Maciej; Brzózka, Krzysztof; Golas, Aniela; Kong, Yan; Ma, Meng; Huang, Fan; Huor, Bonnie; Guo, Qianyu; da Silva, Sabrina Daniela; Torres, Jose; Cai, Yutian; Topisirovic, Ivan; Su, Jie; Bijian, Krikor; Alaoui-Jamali, Moulay A.; Huang, Sidong; Journe, Fabrice; Ghanem, Ghanem E.; Miller, Wilson H.

    2017-01-01

    Melanoma can be stratified into unique subtypes based on distinct pathologies. The acral/mucosal melanoma subtype is characterized by aberrant and constitutive activation of the proto-oncogene receptor tyrosine kinase C-KIT, which drives tumorigenesis. Treatment of these melanoma patients with C-KIT inhibitors has proven challenging, prompting us to investigate the downstream effectors of the C-KIT receptor. We determined that C-KIT stimulates MAP kinase–interacting serine/threonine kinases 1 and 2 (MNK1/2), which phosphorylate eukaryotic translation initiation factor 4E (eIF4E) and render it oncogenic. Depletion of MNK1/2 in melanoma cells with oncogenic C-KIT inhibited cell migration and mRNA translation of the transcriptional repressor SNAI1 and the cell cycle gene CCNE1. This suggested that blocking MNK1/2 activity may inhibit tumor progression, at least in part, by blocking translation initiation of mRNAs encoding cell migration proteins. Moreover, we developed an MNK1/2 inhibitor (SEL201), and found that SEL201-treated KIT-mutant melanoma cells had lower oncogenicity and reduced metastatic ability. Clinically, tumors from melanoma patients harboring KIT mutations displayed a marked increase in MNK1 and phospho-eIF4E. Thus, our studies indicate that blocking MNK1/2 exerts potent antimelanoma effects and support blocking MNK1/2 as a potential strategy to treat patients positive for KIT mutations. PMID:29035277

  20. Tyrosine Kinase Inhibitors Induce Down-Regulation of c-Kit by Targeting the ATP Pocket

    PubMed Central

    Descarpentries, Clotilde; Frisan, Emilie; Adam, Kevin; Verdier, Frederique; Floquet, Célia; Dubreuil, Patrice; Lacombe, Catherine; Fontenay, Michaela; Mayeux, Patrick; Kosmider, Olivier

    2013-01-01

    The stem cell factor receptor (SCF) c-Kit plays a pivotal role in regulating cell proliferation and survival in many cell types. In particular, c-Kit is required for early amplification of erythroid progenitors, while it must disappear from cell surface for the cell entering the final steps of maturation in an erythropoietin-dependent manner. We initially observed that imatinib (IM), an inhibitor targeting the tyrosine kinase activity of c-Kit concomitantly down-regulated the expression of c-Kit and accelerated the Epo-driven differentiation of erythroblasts in the absence of SCF. We investigated the mechanism by which IM or related masitinib (MA) induce c-Kit down-regulation in the human UT-7/Epo cell line. We found that the down-regulation of c-Kit in the presence of IM or MA was inhibited by a pre-incubation with methyl-β-cyclodextrin suggesting that c-Kit was internalized in the absence of ligand. By contrast to SCF, the internalization induced by TKI was independent of the E3 ubiquitin ligase c-Cbl. Furthermore, c-Kit was degraded through lysosomal, but not proteasomal pathway. In pulse-chase experiments, IM did not modulate c-Kit synthesis or maturation. Analysis of phosphotyrosine peptides in UT-7/Epo cells treated or not with IM show that IM did not modify overall tyrosine phosphorylation in these cells. Furthermore, we showed that a T670I mutation preventing the full access of IM to the ATP binding pocket, did not allow the internalization process in the presence of IM. Altogether these data show that TKI-induced internalization of c-Kit is linked to a modification of the integrity of ATP binding pocket. PMID:23637779

  1. Transforming and differentiation-inducing potential of constitutively activated c-kit mutant genes in the IC-2 murine interleukin-3-dependent mast cell line.

    PubMed Central

    Hashimoto, K.; Tsujimura, T.; Moriyama, Y.; Yamatodani, A.; Kimura, M.; Tohya, K.; Morimoto, M.; Kitayama, H.; Kanakura, Y.; Kitamura, Y.

    1996-01-01

    Two mutations of c-kit receptor tyrosine kinase (KIT), valine-559 to glycine (G559) and aspartic acid-814 to valine (V814), resulted in its constitutive activation. To examine the transforming and differentiation-inducing potential of the mutant KIT, we used the murine interleukin-3-dependent IC-2 mast cell line as a transfectant. The IC-2 cells contained few basophilic granules and did not express KIT on the surface. The KITG559 or KITV814 gene was introduced into IC-2 cells using a retroviral vector. KITG559 and KITV814 expressed in IC-2 cells were constitutively phosphorylated on tyrosine and demonstrated kinase activity in the absence of stem cell factor, which is a ligand for KIT. IC-2 cells expressing either KITG559 or KITV814 (IC-2G559 or IC-2V814 cells) showed factor-independent growth in suspension culture and produced tumors in nude athymic mice. In addition, IC-2G559 and IC-2V814 cells showed a more mature phenotype compared with the phenotype of the original IC-2 cells, especially after transplantation into nude mice. The number of basophilic granules and the content of histamine increased remarkably. KITG559 and KITV814 also influenced the transcriptional phenotype of mouse mast cell proteases (MMCP) in IC-2 cells. The expression of MMCP-2, MMCP-4, and MMCP-6 was much greater in IC-2G559 and IC-2V814 cells than in the original IC-2 cells. The results indicated that constitutively activated KIT had not only oncogenic activity but also differentiation-inducing activity in mast cells. Images Figure 1 Figure 4 Figure 5 Figure 6 PMID:8546206

  2. Evaluation of the cationic trypsinogen gene for potential mutations in miniature schnauzers with pancreatitis

    PubMed Central

    2004-01-01

    Abstract The purpose of this study was to evaluate the cationic trypsinogen gene in miniature schnauzers for possible mutations. Genetic mutations have been linked with hereditary pancreatitis in humans. Four miniature schnauzers were selected on the basis of a clinical history of pancreatitis. One healthy miniature schnauzer and 1 healthy mixed breed canine were enrolled as controls. DNA was extracted from these canines using a commercial kit. Primers were designed to amplify the entire canine cationic trypsinogen cDNA sequence. A polymerase chain reaction (PCR) was performed and products were purified and sequenced. All sequences were then compared. The healthy control canine, a healthy miniature schnauzer, and the 4 miniature schnauzers with pancreatitis showed identical sequences of the cationic trypsinogen gene to the published sequence. We conclude that, in contrast to humans with hereditary pancreatitis, mutations of the cationic trypsinogen gene do not play a major role in the genesis of pancreatitis in the miniature schnauzer. PMID:15581228

  3. Evaluation of the cationic trypsinogen gene for potential mutations in miniature schnauzers with pancreatitis.

    PubMed

    Bishop, Micah A; Steiner, Jörg M; Moore, Lisa E; Williams, David A

    2004-10-01

    The purpose of this study was to evaluate the cationic trypsinogen gene in miniature schnauzers for possible mutations. Genetic mutations have been linked with hereditary pancreatitis in humans. Four miniature schnauzers were selected on the basis of a clinical history of pancreatitis. One healthy miniature schnauzer and 1 healthy mixed breed canine were enrolled as controls. DNA was extracted from these canines using a commercial kit. Primers were designed to amplify the entire canine cationic trypsinogen cDNA sequence. A polymerase chain reaction (PCR) was performed and products were purified and sequenced. All sequences were then compared. The healthy control canine, a healthy miniature schnauzer, and the 4 miniature schnauzers with pancreatitis showed identical sequences of the cationic trypsinogen gene to the published sequence. We conclude that, in contrast to humans with hereditary pancreatitis, mutations of the cationic trypsinogen gene do not play a major role in the genesis of pancreatitis in the miniature schnauzer.

  4. Cancer genes mutation profiling in calcifying epithelial odontogenic tumour.

    PubMed

    de Sousa, Sílvia Ferreira; Diniz, Marina Gonçalves; França, Josiane Alves; Fontes Pereira, Thaís Dos Santos; Moreira, Rennan Garcias; Santos, Jean Nunes Dos; Gomez, Ricardo Santiago; Gomes, Carolina Cavalieri

    2018-03-01

    To identify calcifying epithelial odontogenic tumour (CEOT) mutations in oncogenes and tumour suppressor genes. A panel of 50 genes commonly mutated in cancer was sequenced in CEOT by next-generation sequencing. Sanger sequencing was used to cover the region of the frameshift deletion identified in one sample. Missense single nucleotide variants (SNVs) with minor allele frequency (MAF) <1% were detected in PTEN , MET and JAK3 . A frameshift deletion in CDKN2A occurred in association with a missense mutation in the same gene region, suggesting a second hit in the inactivation of this gene. APC, KDR, KIT, PIK3CA and TP53 missense SNVs were identified; however, these are common SNVs, showing MAF >1%. CEOT harbours mutations in the tumour suppressor PTEN and CDKN2A and in the oncogenes JAK3 and MET . As these mutations occurred in only one case each, they are probably not driver mutations for these tumours. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  5. Cardiac c-Kit Biology Revealed by Inducible Transgenesis.

    PubMed

    Gude, Natalie A; Firouzi, Fareheh; Broughton, Kathleen M; Ilves, Kelli; Nguyen, Kristine P; Payne, Christina R; Sacchi, Veronica; Monsanto, Megan M; Casillas, Alexandria R; Khalafalla, Farid G; Wang, Bingyan J; Ebeid, David E; Alvarez, Roberto; Dembitsky, Walter P; Bailey, Barbara A; van Berlo, Jop; Sussman, Mark A

    2018-06-22

    Biological significance of c-Kit as a cardiac stem cell marker and role(s) of c-Kit+ cells in myocardial development or response to pathological injury remain unresolved because of varied and discrepant findings. Alternative experimental models are required to contextualize and reconcile discordant published observations of cardiac c-Kit myocardial biology and provide meaningful insights regarding clinical relevance of c-Kit signaling for translational cell therapy. The main objectives of this study are as follows: demonstrating c-Kit myocardial biology through combined studies of both human and murine cardiac cells; advancing understanding of c-Kit myocardial biology through creation and characterization of a novel, inducible transgenic c-Kit reporter mouse model that overcomes limitations inherent to knock-in reporter models; and providing perspective to reconcile disparate viewpoints on c-Kit biology in the myocardium. In vitro studies confirm a critical role for c-Kit signaling in both cardiomyocytes and cardiac stem cells. Activation of c-Kit receptor promotes cell survival and proliferation in stem cells and cardiomyocytes of either human or murine origin. For creation of the mouse model, the cloned mouse c-Kit promoter drives Histone2B-EGFP (enhanced green fluorescent protein; H2BEGFP) expression in a doxycycline-inducible transgenic reporter line. The combination of c-Kit transgenesis coupled to H2BEGFP readout provides sensitive, specific, inducible, and persistent tracking of c-Kit promoter activation. Tagging efficiency for EGFP+/c-Kit+ cells is similar between our transgenic versus a c-Kit knock-in mouse line, but frequency of c-Kit+ cells in cardiac tissue from the knock-in model is 55% lower than that from our transgenic line. The c-Kit transgenic reporter model reveals intimate association of c-Kit expression with adult myocardial biology. Both cardiac stem cells and a subpopulation of cardiomyocytes express c-Kit in uninjured adult heart

  6. Immunohistochemical study of C-kit expression in subtypes of renal cell carcinoma.

    PubMed

    Norouzinia, Farahnaz; Abbasi, Fariba; Dindarian, Sina; Mohammadi, Sedra; Meisami, Farid; Bagheri, Mahdi; Mohammadi, Hozan

    2018-01-01

    Renal cell carcinomas (RCCs) include about 2% of adult neoplasms and 90-95% of all renal tumors. Mostly, it is possible to distinguish RCC subtypes using hematoxylin-eosin staining. However, overlapping morphologic features cause some difficulties in making a precise diagnosis. In order to render an accurate diagnosis, additional methods such as immunohistochemical staining for c-kit have been recommended. In this study, we aimed to investigate c-kit gene expression in various subtypes of RCC. We reviewed 65 diagnosed RCC cases. Formalin- fixed, paraffin- embedded specimens were available for the cases. The expression of c-kit was evaluated using immunohistochemistry. The correlation between c-kit expression and clinicopathological parameters including patients' age and gender in addition to grade, stage, and size of the tumor were investigated. Six cases of 39 clear cell types (15.4%), 8 of 13 papillary types (61.5%), 11 of 12 chromophobe types (91.7%), and no sarcomatoid type were positive for c-kit expression. Based on chi-square test results, there was a significant relationship between RCC subtypes and c-kit expression (p=0.001). There was no significant correlation between age, sex, grade, stage, and size of the tumor and c-kit expression. The expression of c-kit in RCC may have diagnostic significance in subtypes of RCC especially papillary and chromophobe subtypes of RCC.

  7. Molecular Analysis of Glucose-6-Phosphate Dehydrogenase Gene Mutations in Bangladeshi Individuals

    PubMed Central

    Sarker, Suprovath Kumar; Hossain, Mohammad Amir; Qadri, Syeda Kashfi; Muraduzzaman, A. K. M.; Bhuyan, Golam Sarower; Shahidullah, Mohammod; Mannan, Mohammad Abdul; Tahura, Sarabon; Hussain, Manzoor; Akhter, Shahida; Nahar, Nazmun; Shirin, Tahmina; Qadri, Firdausi; Mannoor, Kaiissar

    2016-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common X-linked human enzyme defect of red blood cells (RBCs). Individuals with this gene defect appear normal until exposed to oxidative stress which induces hemolysis. Consumption of certain foods such as fava beans, legumes; infection with bacteria or virus; and use of certain drugs such as primaquine, sulfa drugs etc. may result in lysis of RBCs in G6PD deficient individuals. The genetic defect that causes G6PD deficiency has been identified mostly as single base missense mutations. One hundred and sixty G6PD gene mutations, which lead to amino acid substitutions, have been described worldwide. The purpose of this study was to detect G6PD gene mutations in hospital-based settings in the local population of Dhaka city, Bangladesh. Qualitative fluorescent spot test and quantitative enzyme activity measurement using RANDOX G6PDH kit were performed for analysis of blood specimens and detection of G6PD-deficient participants. For G6PD-deficient samples, PCR was done with six sets of primers specific for G6PD gene. Automated Sanger sequencing of the PCR products was performed to identify the mutations in the gene. Based on fluorescence spot test and quantitative enzyme assay followed by G6PD gene sequencing, 12 specimens (11 males and one female) among 121 clinically suspected patient-specimens were found to be deficient, suggesting a frequency of 9.9% G6PD deficiency. Sequencing of the G6PD-deficient samples revealed c.C131G substitution (exon-3: Ala44Gly) in six samples, c.G487A substitution (exon-6:Gly163Ser) in five samples and c.G949A substitution (exon-9: Glu317Lys) of coding sequence in one sample. These mutations either affect NADP binding or disrupt protein structure. From the study it appears that Ala44Gly and Gly163Ser are the most common G6PD mutations in Dhaka, Bangladesh. This is the first study of G6PD mutations in Bangladesh. PMID:27880809

  8. Association of paediatric mastocytosis with a polymorphism resulting in an amino acid substitution (M541L) in the transmembrane domain of c-KIT.

    PubMed

    Foster, R; Byrnes, E; Meldrum, C; Griffith, R; Ross, G; Upjohn, E; Braue, A; Scott, R; Varigos, G; Ferrao, P; Ashman, L K

    2008-11-01

    The receptor tyrosine kinase c-KIT plays a key role in normal mast cell development. Point mutations in c-KIT have been associated with sporadic or familial mastocytosis. Two unrelated pairs of apparently identical twins affected by cutaneous mastocytosis attending the Mastocytosis Clinic at the Royal Children's Hospital, Melbourne, provided an opportunity to assess the possible contribution of c-KIT germline mutations or polymorphisms in this disease. Tissue biopsy, blood and/or buccal swab specimens were collected from 10 children with mastocytosis. To detect germline mutations/polymorphisms in c-KIT, we studied all coding exons by denaturing high pressure liquid chromatography. Exons showing mismatches were examined by direct sequencing. The influence of the substitution identified was further examined by expressing the variant form of c-KIT in factor-dependent FDC-P1 cells. In both pairs of twins, a heterozygous ATG to CTG transition in codon 541 was observed, resulting in the substitution of a methionine residue in the transmembrane domain by leucine (M541L). In each case, one parent was also heterozygous for this allele. Expression of M541L KIT in FDC-P1 cells enabled them to grow in human KIT ligand (stem cell factor, SCF) but did not confer factor independence. Compared with cells expressing wild-type KIT at a similar level, M541L KIT-expressing cells displayed enhanced growth at low levels of SCF, and heightened sensitivity to the KIT inhibitor, imatinib mesylate. The data suggest that the single nucleotide polymorphism resulting in the substitution M541L may predispose to paediatric mastocytosis.

  9. KIT D816V-mutated bone marrow mesenchymal stem cells in indolent systemic mastocytosis are associated with disease progression.

    PubMed

    Garcia-Montero, Andres C; Jara-Acevedo, Maria; Alvarez-Twose, Ivan; Teodosio, Cristina; Sanchez-Muñoz, Laura; Muñiz, Carmen; Muñoz-Gonzalez, Javier I; Mayado, Andrea; Matito, Almudena; Caldas, Carolina; Morgado, Jose M; Escribano, Luis; Orfao, Alberto

    2016-02-11

    Multilineage involvement of bone marrow (BM) hematopoiesis by the somatic KIT D816V mutation is present in a subset of adult indolent systemic mastocytosis (ISM) patients in association with a poorer prognosis. Here, we investigated the potential involvement of BM mesenchymal stem cells (MSCs) from ISM patients by the KIT D816V mutation and its potential impact on disease progression and outcome. This mutation was investigated in highly purified BM MSCs and other BM cell populations from 83 ISM patients followed for a median of 116 months. KIT D816V-mutated MSCs were detected in 22 of 83 cases. All MSC-mutated patients had multilineage KIT mutation (100% vs 30%, P = .0001) and they more frequently showed involvement of lymphoid plus myeloid BM cells (59% vs 22%; P = .03) and a polyclonal pattern of inactivation of the X-chromosome of KIT-mutated BM mast cells (64% vs 0%; P = .01) vs other multilineage ISM cases. Moreover, presence of KIT-mutated MSCs was associated with more advanced disease features, a greater rate of disease progression (50% vs 17%; P = .04), and a shorter progression-free survival (P ≤ .003). Overall, these results support the notion that ISM patients with mutated MSCs may have acquired the KIT mutation in a common pluripotent progenitor cell, prior to differentiation into MSCs and hematopoietic precursor cells, before the X-chromosome inactivation process occurs. From a clinical point of view, acquisition of the KIT mutation in an earlier BM precursor cell confers a significantly greater risk for disease progression and a poorer outcome. © 2016 by The American Society of Hematology.

  10. [Gene mutation analysis of X-linked hypophosphatemic rickets].

    PubMed

    Song, Ying; Ma, Hong-Wei; Li, Fang; Hu, Man; Ren, Shuang; Yu, Ya-Fen; Zhao, Gui-Jie

    2013-11-01

    To investigate the frequency and type of PHEX gene mutations in children with X-linked hypophosphatemic rickets (XLH), the possible presence of mutational hot spots, and the relationship between genotype and clinical phenotype. Clinical data of 10 children with XLH was retrospectively reviewed. The relationship between gene mutation type and severity of XLH was evaluated. PHEX gene mutations were detected in all 10 children with XLH, including 6 cases of missense mutation, 2 cases of splice site mutation, 1 case of frameshift mutation, and 1 case of nonsense mutation. Two new mutations, c.2048T>C and IVS14+1delAG, were found. The type of PHEX gene mutation was not associated with the degree of short stature and leg deformity (P=0.571 and 0.467), and the mutation site was also not associated with the degree of short stature and leg deformity (P=0.400 and 1.000). Missense mutation is the most common type of PHEX gene mutation in children with XLH, and c.2048T>C and IVS14+1delAG are two new PHEX gene mutations. The type and site of PHEX gene mutation are not associated with the severity of XLH.

  11. Prognostic and predictive values of oncogenic BRAF, NRAS, c-KIT and MITF in cutaneous and mucous melanoma.

    PubMed

    Pracht, M; Mogha, A; Lespagnol, A; Fautrel, A; Mouchet, N; Le Gall, F; Paumier, V; Lefeuvre-Plesse, C; Rioux-Leclerc, N; Mosser, J; Oger, E; Adamski, H; Galibert, M-D; Lesimple, T

    2015-08-01

    Mutations of BRAF, NRAS and c-KIT oncogenes are preferentially described in certain histological subtypes of melanoma and linked to specific histopathological features. BRAF-, MEK- and KIT-inhibitors led to improvement in overall survival of patients harbouring mutated metastatic melanoma. To assess the prevalence and types of BRAF, NRAS, c-KIT and MITF mutations in cutaneous and mucous melanoma and to correlate mutation status with clinicopathological features and outcome. Clinicopathological features and mutation status of 108 samples and of 98 consecutive patients were, respectively, assessed in one retrospective and one prospective study. Clinicopathological features were correlated with mutation status and the predictive value of these mutations was studied. This work identified significant correlations between BRAF mutations and melanoma occurring on non-chronic sun-damaged skin and superficial spreading melanoma (P < 0.05) on one hand, and between NRAS mutations and nodular melanoma (P < 0.05) on the other hand. Younger age (P < 0.05), microscopic (P < 0.05) and macroscopic (P < 0.05) lymphatic involvement at diagnosis of primary melanoma were significantly linked to BRAF mutations. A mutated status was a positive predictive factor of a response to BRAF inhibitors (OR = 3.44). Mutated melanoma showed a significantly (P = 0.038) higher objective response rate to cytotoxic chemotherapy (26.3%) than wild-type tumours (6.7%). Clinical and pathological characteristics of the primary melanoma differed between wild-type and BRAF- or NRAS-mutated tumours. Patients with BRAF-mutated tumours were younger at diagnosis of primary melanoma. Patients carrying mutations showed better responses better to specific kinase inhibitors and interestingly also to systemic cytotoxic chemotherapy. © 2015 European Academy of Dermatology and Venereology.

  12. Novel Compound Heterozygous CLCNKB Gene Mutations (c.1755A>G/ c.848_850delTCT) Cause Classic Bartter Syndrome.

    PubMed

    Wang, Chunli; Chen, Ying; Zheng, Bixia; Zhu, Mengshu; Fan, Jia; Wang, Juejin; Jia, Zhanjun; Huang, Songming; Zhang, Aihua

    2018-02-14

    Inactivated variants in CLCNKB gene encoding the basolateral chloride channel ClC-Kb cause classic Bartter syndrome characterized by hypokalemic metabolic alkalosis and hyperreninemic hyperaldosteronism. Here we identified two cBS siblings presenting hypokalemia in a Chinese family due to novel compound heterozygous CLCNKB mutations (c.848_850delTCT/c.1755A>G). Compound heterozygosity was confirmed by amplifying and sequencing the patient's genomic DNA. The synonymous mutation c.1755A>G (Thr585Thr) was located at +2bp from the 5' splice donor site in exon 15, further transcript analysis demonstrated that this single nucleotide mutation causes exclusion of exon 15 in the cDNA from the proband and his mother. Furthermore, we investigated the expression and protein trafficking change of c.848_850delTCT (TCT) and exon 15 deletion(E15)mutation in vitro. The E15 mutation markedly decreased the expression of ClC-Kb and resulted in a low-molecular-weight band (~55kD) trapping in the endoplasmic reticulum, while the TCT mutant only decreased the total and plasma membrane ClC-Kb protein expression but did not affect the subcellular localization. Finally, we studied the physiological functions of mutations by using whole-cell patch clamp and found that E15 or TCT mutation decreased the current of ClC-Kb/barttin channel. These results suggested that the compound defective mutations of CLCNKB gene are the molecular mechanism of the two cBS siblings.

  13. Detection of the KIT D816V mutation in peripheral blood of systemic mastocytosis: diagnostic implications.

    PubMed

    Jara-Acevedo, Maria; Teodosio, Cristina; Sanchez-Muñoz, Laura; Álvarez-Twose, Ivan; Mayado, Andrea; Caldas, Carolina; Matito, Almudena; Morgado, José M; Muñoz-González, Javier I; Escribano, Luis; Garcia-Montero, Andrés C; Orfao, Alberto

    2015-08-01

    Recent studies have found the KIT D816V mutation in peripheral blood of virtually all adult systemic mastocytosis patients once highly sensitive PCR techniques were used; thus, detection of the KIT D816V mutation in peripheral blood has been proposed to be included in the diagnostic work-up of systemic mastocytosis algorithms. However, the precise frequency of the mutation, the biological significance of peripheral blood-mutated cells and their potential association with involvement of bone marrow hematopoietic cells other than mast cells still remain to be investigated. Here, we determined the frequency of peripheral blood involvement by the KIT D816V mutation, as assessed by two highly sensitive PCR methods, and investigated its relationship with multilineage involvement of bone marrow hematopoiesis. Overall, our results confirmed the presence of the KIT D816V mutation in peripheral blood of most systemic mastocytosis cases (161/190; 85%)--with an increasing frequency from indolent systemic mastocytosis without skin lesions (29/44; 66%) to indolent systemic mastocytosis with skin involvement (124/135; 92%), and more aggressive disease subtypes (11/11; 100%)--as assessed by the allele-specific oligonucleotide-qPCR method, which was more sensitive (P<.0001) than the peptide nucleic acid-mediated PCR approach (84/190; 44%). Although the presence of the KIT mutation in peripheral blood, as assessed by the allele-specific oligonucleotide-qPCR technique, did not accurately predict for multilineage bone marrow involvement of hematopoiesis, the allele-specific oligonucleotide-qPCR allele burden and the peptide nucleic acid-mediated-PCR approach did. These results suggest that both methods provide clinically useful and complementary information through the identification and/or quantification of the KIT D816V mutation in peripheral blood of patients suspected of systemic mastocytosis.

  14. SHP-1 Binds and Negatively Modulates the c-Kit Receptor by Interaction with Tyrosine 569 in the c-Kit Juxtamembrane Domain

    PubMed Central

    Kozlowski, Maya; Larose, Louise; Lee, Fai; Le, Duc Mingh; Rottapel, Robert; Siminovitch, Katherine A.

    1998-01-01

    The SH2 domain-containing SHP-1 tyrosine phosphatase has been shown to negatively regulate a broad spectrum of growth factor- and cytokine-driven mitogenic signaling pathways. Included among these is the cascade of intracellular events evoked by stem cell factor binding to c-Kit, a tyrosine kinase receptor which associates with and is dephosphorylated by SHP-1. Using a series of glutathione S-transferase (GST) fusion proteins containing either tyrosine-phosphorylated segments of the c-Kit cytosolic region or the SH2 domains of SHP-1, we have shown that SHP-1 interacts with c-Kit by binding selectively to the phosphorylated c-Kit juxtamembrane region and that the association of c-Kit with the larger of the two SHP-1 isoforms may be mediated through either the N-terminal or C-terminal SHP-1 SH2 domain. The results of binding assays with mutagenized GST-Kit juxtamembrane fusion proteins and competitive inhibition assays with phosphopeptides encompassing each c-Kit juxtamembrane region identified the tyrosine residue at position 569 as the major site for binding of SHP-1 to c-Kit and suggested that tyrosine 567 contributes to, but is not required for, this interaction. By analysis of Ba/F3 cells retrovirally transduced to express c-Kit receptors, phenylalanine substitution of c-Kit tyrosine residue 569 was shown to be associated with disruption of c-Kit–SHP-1 binding and induction of hyperproliferative responses to stem cell factor. Although phenylalanine substitution of c-Kit tyrosine residue 567 in the Ba/F3–c-Kit cells did not alter SHP-1 binding to c-Kit, the capacity of a second c-Kit-binding tyrosine phosphatase, SHP-2, to associate with c-Kit was markedly reduced, and the cells again showed hyperproliferative responses to stem cell factor. These data therefore identify SHP-1 binding to tyrosine 569 on c-Kit as an interaction pivotal to SHP-1 inhibitory effects on c-Kit signaling, but they indicate as well that cytosolic protein tyrosine phosphatases other

  15. Cell type-specific deficiency of c-kit gene expression in mutant mice of mi/mi genotype.

    PubMed Central

    Isozaki, K.; Tsujimura, T.; Nomura, S.; Morii, E.; Koshimizu, U.; Nishimune, Y.; Kitamura, Y.

    1994-01-01

    The mi locus of mice encodes a novel member of the basic-helix-loop-helix-leucine zipper protein family of transcription factors (hereafter called mi factor). In addition to microphthalmus, osteopetrosis, and lack of melanocytes, mice of mi/mi genotype are deficient in mast cells. Since the c-kit receptor tyrosine kinase plays an important role in the development of mast cells, and since the c-kit expression by cultured mast cells from mi/mi mice is deficient in both mRNA and protein levels, the mast cell deficiency of mi/mi mice has been attributed at least in part to the deficient expression of c-kit. However, it remained to be examined whether the c-kit expression was also deficient in tissues of mi/mi mice. In the present study, we examined the c-kit expression by mi/mi skin mast cells using in situ hybridization and immunohistochemistry. Moreover, we examined the c-kit expression by various cells other than mast cells in tissues of mi/mi mice. We found that the c-kit expression was deficient in mast cells but not in erythroid precursors, testicular germ cells, and neurons of mi/mi mice. This suggested that the regulation of the c-kit transcription by the mi factor was dependent on cell types. Mice of mi/mi genotype appeared to be a useful model to analyze the function of transcription factors in the whole-animal level. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:7524330

  16. Gene expression analyses determine two different subpopulations in KIT-negative GIST-like (KNGL) patients.

    PubMed

    Moura, David S; Ramos, Rafael; Fernandez-Serra, Antonio; Serrano, Teresa; Cruz, Julia; Alvarez-Alegret, Ramiro; Ortiz-Duran, Rosa; Vicioso, Luis; Gomez-Dorronsoro, Maria Luisa; Garcia Del Muro, Xavier; Martinez-Trufero, Javier; Rubio-Casadevall, Jordi; Sevilla, Isabel; Lainez, Nuria; Gutierrez, Antonio; Serrano, Cesar; Lopez-Alvarez, Maria; Hindi, Nadia; Taron, Miguel; López-Guerrero, José Antonio; Martin-Broto, Javier

    2018-04-03

    There are limited findings available on KIT-negative GIST-like (KNGL) population. Also, KIT expression may be post-transcriptionally regulated by miRNA221 and miRNA222. Hence, the aim of this study is to characterize KNGL population, by differential gene expression, and to analyze miRNA221/222 expression and their prognostic value in KNGL patients. KIT , PDGFRA , DOG1 , IGF1R , MIR221 and MIR222 expression levels were determined by qRT-PCR. We also analyzed KIT and PDGFRA mutations, DOG1 expression, by immunohistochemistry, along with clinical and pathological data. Disease-free survival (DFS) and overall survival (OS) differences were calculated using Log-rank test. Hierarchical cluster analyses from gene expression data identified two groups: group I had KIT , DOG1 and PDGFRA overexpression and IGF1R underexpression and group II had overexpression of IGF1R and low expression of KIT , DOG1 and PDGFRA . Group II had a significant worse OS ( p = 0.013) in all the series, and showed a tendency for worse OS ( p = 0.11), when analyzed only the localized cases. MiRNA222 expression was significantly lower in a control subset of KIT-positive GIST ( p < 0.001). OS was significantly worse in KNGL cases with higher expression of MIR221 ( p = 0.028) or MIR222 ( p = 0.014). We identified two distinct KNGL subsets, with a different prognostic value. Increased levels of miRNA221/222, which are associated with worse OS, could explain the absence of KIT protein expression of most KNGL tumors.

  17. An intronic mutation c.6430-3C>G in the F8 gene causes splicing efficiency and premature termination in hemophilia A.

    PubMed

    Xia, Zunjing; Lin, Jie; Lu, Lingping; Kim, Chol; Yu, Ping; Qi, Ming

    2018-06-01

    : Hemophilia A is a bleeding disorder caused by coagulation factor VIII protein deficiency or dysfunction, which is classified into severe, moderate, and mild according to factor clotting activity. An overwhelming majority of missense and nonsense mutations occur in exons of F8 gene, whereas mutations in introns can also be pathogenic. This study aimed to investigate the effect of an intronic mutation, c.6430-3C>G (IVS22-3C>G), on pre-mRNA splicing of the F8 gene. We applied DNA and cDNA sequencing in a Chinese boy with hemophilia A to search if any pathogenic mutation in the F8 gene. Functional analysis was performed to investigate the effect of an intronic mutation at the transcriptional level. Human Splicing Finder and PyMol were also used to predict its effect. We found the mutation c.6430-3C>G (IVS22-3C>G) in the F8 gene in the affected boy, with his mother being a carrier. cDNA from the mother and pSPL3 splicing assay showed that the mutation IVS22-3C>G results in a two-nucleotide AG inclusion at the 3' end of intron 22 and leads to a truncated coagulation factor VIII protein, with partial loss of the C1 domain and complete loss of the C2 domain. The in-silico tool predicted that the mutation induces altered pre-mRNA splicing by using a cryptic acceptor site in intron 22. The IVS22-3C>G mutation was confirmed to affect pre-mRNA splicing and produce a truncated protein, which reduces the stability of binding between the F8 protein and von Willebrand factor carrier protein due to the loss of an interaction domain.

  18. c-Kit mutation reduce intestinal epithelial cell proliferation and migration, but not influence intestinal permeability stimulated by lipopolysaccharide.

    PubMed

    Xue, Hong; Wang, Feng Yun; Kang, Qian; Tang, Xu Dong

    2018-06-20

    The proto-oncogene c-kit, as a marker of interstitial cells of Cajal (ICCs) in the gastrointestinal tract, plays an important role in the ICCs. Although limited evidences showed c-kit is present in the colonic epithelium but its roles remain unclear. In the present study, we aimed to investigate the expression, location and function of c-kit in the intestinal epithelium. Immunofluorescence, western blotting, and RT-PCR were performed to detect the expression and location of c-kit in the intestinal mucosa of WT mice. We investigated intestinal epithelial proliferation and migration in vivo by performing 5-Bromodeoxyuridine (BrdU) incorporation and Ki-67 staining in WT and Wads m/m mice. An Ussing chamber with fluorescein-isothiocyanate dextran 4000 was used to detect the transepithelial electric resistance (TER), short circuit current (ISC) and permeability across ex vivo colon segments under control and endotoxaemia conditions. We demonstrated that c-kit was located and expressed in the gut crypt compartment in WT mice, which was demonstrated in the c-kit mutant mice (Wads m/m ). In addition, both the number of proliferating cells and the percentage of the distance migrated were lower in the Wads m/m mice than those in the WT mice. Moreover, the intestinal permeability, TER and tight junction were unaltered in the Wads m/m mice under endotoxic conditions compared with those in both the control condition and the WT mice. Altogether, these observations imply that the expression of c-kit in the colonic epithelium is involved in the proliferation and permeability of the colonic epithelium. Copyright © 2018. Published by Elsevier GmbH.

  19. Neoplasia Driven by Mutant c-KIT Is Mediated by Intracellular, Not Plasma Membrane, Receptor Signaling▿

    PubMed Central

    Xiang, Zhifu; Kreisel, Frederike; Cain, Jennifer; Colson, AnnaLynn; Tomasson, Michael H.

    2007-01-01

    Activating mutations in c-KIT are associated with gastrointestinal stromal tumors, mastocytosis, and acute myeloid leukemia. In attempting to establish a murine model of human KITD816V (hKITD816V)-mediated leukemia, we uncovered an unexpected relationship between cellular transformation and intracellular trafficking. We found that transport of hKITD816V protein was blocked at the endoplasmic reticulum in a species-specific fashion. We exploited these species-specific trafficking differences and a set of localization domain-tagged KIT mutants to explore the relationship between subcellular localization of mutant KIT and cellular transformation. The protein products of fully transforming KIT mutants localized to the Golgi apparatus and to a lesser extent the plasma membrane. Domain-tagged KITD816V targeted to the Golgi apparatus remained constitutively active and transforming. Chemical inhibition of intracellular transport demonstrated that Golgi localization is sufficient, but plasma membrane localization is dispensable, for downstream signaling mediated by KIT mutation. When expressed in murine bone marrow, endoplasmic reticulum-localized hKITD816V failed to induce disease in mice, while expression of either Golgi-localized HyKITD816V or cytosol-localized, ectodomain-deleted KITD816V uniformly caused fatal myeloproliferative diseases. Taken together, these data demonstrate that intracellular, non-plasma membrane receptor signaling is sufficient to drive neoplasia caused by mutant c-KIT and provide the first animal model of myelomonocytic neoplasia initiated by human KITD816V. PMID:17060458

  20. Detection of single nucleotide polymorphisms (SNP) in equine coat color genes using SNaPshotTM multiplex kit or pluronic F-108 tri-block copolymer and capillary electrophoresis.

    PubMed

    Martin, Lauren; Damaso, Natalie; Mills, DeEtta

    2016-10-01

    Molecular methods for the detection of mammalian coat color phenotypes have expanded greatly within the past decade. Many phenotypes are associated with a single nucleotide polymorphism mutation in the genetic sequence. Traditionally, these mutations are detected through sequencing, hybridization assays or mini-sequencing. However, these techniques can be expensive and tedious. Previously, CE-SSCP using the F-108 polymer was able to distinguish SNPs for the melanocortin-1 receptor (mc1r) coat color gene in horses (Equus caballus) that differed by one nucleotide substitution. The objective of this study was to expand the detection of coat color SNPs in horses. The genes for the solute carrier family member 2 (slc45a2/matp), type III receptor protein-tyrosine kinase (kit) and mc1r genes using CE-SSCP and F-108 polymer were compared to mini-sequencing with the SNaPshot TM kit. The F-108 polymer reproducibly resolved homozygous and heterozygous individuals for the mc1r and kit markers, but was unable to resolve heterozygous individuals for slc45a2 at 38ºC. The need for temperatures <15ºC, the SNP position being close to the 5'-end, and conformational structures/free energy with similar values resulted in the inability to resolve the secondary structures. Despite this limitation, the CE-SSCP method could be used to provide a rapid phenotypic description for equine forensic investigations. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Detection of KIT Genotype in Pigs by TaqMan MGB Real-Time Quantitative Polymerase Chain Reaction.

    PubMed

    Li, Xiuxiu; Li, Xiaoning; Luo, Rongrong; Wang, Wenwen; Wang, Tao; Tang, Hui

    2018-05-01

    The dominant white phenotype in domestic pigs is caused by two mutations in the KIT gene: a 450 kb duplication containing the entire KIT gene together with flanking sequences and one splice mutation with a G:A substitution in intron 17. The purpose of this study was to establish a simple, rapid method to determine KIT genotype in pigs. First, to detect KIT copy number variation (CNV), primers for exon 2 of the KIT gene, along with a TaqMan minor groove binder (MGB) probe, were designed. The single-copy gene, estrogen receptor (ESR), was used as an internal control. A real-time fluorescence-based quantitative PCR (FQ-PCR) protocol was developed to accurately detect KIT CNVs. Second, to detect the splice mutation ratio of the G:A substitution in intron 17, a 175 bp region, including the target mutation, was amplified from genomic DNA. Based on the sequence of the resulting amplified fragment, an MGB probe set was designed to detect the ratio of splice mutation to normal using FQ-PCR. A series of parallel amplification curves with the same internal distances were obtained using gradually diluted DNA as templates. The CT values among dilutions were significantly different (p < 0.001) and the coefficients of variation from each dilution were low (from 0.13% to 0.26%). The amplification efficiencies for KIT and ESR were approximately equal, indicating ESR was an appropriate control gene. Furthermore, use of the MGB probe set resulted in detection of the target mutation at a high resolution and stability; standard curves illustrated that the amplification efficiencies of KIT1 (G) and KIT2 (A) were approximately equal (98.8% and 97.2%). In conclusion, a simple, rapid method, with high specificity and stability, for the detection of the KIT genotype in pigs was established using TaqMan MGB probe real-time quantitative PCR.

  2. Mutation scanning of BRAF, NRAS, KIT, and GNAQ/GNA11 in oral mucosal melanoma: a study of 57 cases.

    PubMed

    Lyu, Jiong; Wu, Yunteng; Li, Chaojun; Wang, Runxiang; Song, Hao; Ren, Guoxin; Guo, Wei

    2016-04-01

    Recent advances in novel targeted therapies have created the need for molecular characterization of cancer to allow accurate personalized treatments. In this study, our aim was to investigate the incidence of activating mutations of oncogenes BRAF, NRAS, KIT, and GNAQ/GNA11 in oral mucosal melanoma. We analyzed a cohort of 57 oral mucosal melanoma samples, including 27 frozen samples and 30 formalin-fixed paraffin-embedded samples. The tumors were screened for hotspot mutations of BRAF (exon 15), NRAS (exons 2 and 3), KIT (exons 9, 11, 13, and 17), and GNAQ/GNA11 (exon 5) by high-resolution melting and direct sequencing. In oral mucosal melanoma, 7.0% of tumors harbored KIT mutations and 3.5% harbored BRAF mutations, while classic BRAF V600E mutation was not detected. We found no mutations of NRAS or GNAQ/GNA11 in oral mucosal melanoma. We demonstrated that driver mutations are rare in mutational hotspots of BRAF, NRAS, KIT, and GNAQ/GNA11 in oral mucosal melanoma. The majority of patients will not benefit from KIT and BRAF inhibitors. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Short communication: novel truncating mutations in the CFTR gene causing a severe form of cystic fibrosis in Italian patients.

    PubMed

    Lenarduzzi, S; Morgutti, M; Crovella, S; Coiana, A; Rosatelli, M C

    2014-11-14

    Cystic fibrosis (CF) is a common recessive genetic disease caused by mutations in the gene encoding for the cystic fibrosis transmembrane conductance regulator (CFTR) protein. More than 1800 different mutations have been described to date. Here, we report 3 novel mutations in CFTR in 3 Italian CF patients. To detect and identify 36 frequent mutations in Caucasians, we used the INNO-LiPA CFTR19 and INNO-LiPA CFTR17+Tn Update kits (Innogenetics; Ghent, Belgium). Our first analysis did not reveal both of the responsible mutations; thus, direct sequencing of the CFTR gene coding region was performed. The 3 patients were compound heterozygous. In one allele, the F508del (c.1521_1523delCTT, p.PHE508del) mutation in exon 11 was observed in each case. For the second allele, in patient No.1, direct sequencing revealed an 11-base pair deletion (GAGGCGATACT) in exon 14 (c.2236_2246del; pGlu746Alafs*29). In patient No. 2, direct sequencing revealed a nonsense mutation at nucleotide 3892 (c.3892G>T) in exon 24. In patient No. 3, direct sequencing revealed a deletion of cytosine in exon 27 (c.4296delC; p.Asn1432Lysfs*16). These 3 novel mutations indicate the production of a truncated protein, which consequently results in a non-functional polypeptide.

  4. Prevalence of C282Y, H63D, and S65C mutations in hereditary HFE-hemochromatosis gene in Lithuanian population.

    PubMed

    Kucinskas, Laimutis; Juzenas, Simonas; Sventoraityte, Jurgita; Cedaviciute, Ruta; Vitkauskiene, Astra; Kalibatas, Vytenis; Kondrackiene, Jurate; Kupcinskas, Limas

    2012-04-01

    HFE-hemochromatosis is a common autosomal recessive disease caused by HFE gene mutations and characterized as iron overload and failure of different organs. The aim of this study was to determine the prevalence of C282Y (c.845 G>A), H63D (c.187 C>G), and S65C (c.193A>T) alleles of HFE gene in the Lithuanian population. One thousand and eleven healthy blood donors of Lithuanian nationality were examined in four different ethnic Lithuanian regions to determine HFE gene alleles and genotype frequencies. The samples of DNA were analyzed for the presence of restriction fragment length polymorphism and validated by DNA sequencing. Among 1,011 blood donors tested, the frequency of C282Y, H63D, and S65C alleles were 2.6%, 15.9%, and 1.9%, respectively. One third of the tested subjects (n = 336) had at least one of the C282Y or H63D HFE gene mutations. The screening of Lithuanian blood donors has detected 13 (1.3%) subjects with a genotype C282Y/C282Y or C282Y/H63D responsible for the development of HFE-hemochromatosis. The prevalence of C282Y mutation was significantly higher among the inhabitants of Zemaitija (Somogitia) at the Baltic Sea area (5.9%) in comparison to the regions of continental part of Lithuania (2.4% in Dzukija, 2.3% in Aukstaitija, and 2% in Suvalkija, p < 0.05). These data support the hypothesis that the p.C282Y mutation originated from Scandinavia and spread with the Vikings along the Baltic Sea coast. The first epidemiological investigation of HFE gene mutations in ethnic Lithuanians showed that the frequencies of H63D, C282Y, and S65C of HFE gene alleles are similar to the other North-Eastern Europeans, especially in the Baltic region (Estonia, Latvia), Poland, and part of Russia (Moscow region).

  5. KIT pathway alterations in mucosal melanomas of the vulva and other sites.

    PubMed

    Omholt, Katarina; Grafström, Eva; Kanter-Lewensohn, Lena; Hansson, Johan; Ragnarsson-Olding, Boel K

    2011-06-15

    A significant proportion of mucosal melanomas contain alterations in KIT. The aim of this study was to characterize the pattern of KIT, NRAS, and BRAF mutations in mucosal melanomas at specific sites and to assess activation of the KIT downstream RAF/MEK/extracellular signal-regulated kinase (ERK) and phosphoinositide 3-kinase (PI3K)/AKT pathways in mucosal melanoma specimens. Seventy-one primary mucosal melanomas from various sites were studied. Mutation analysis was done by DNA sequencing. Expression of KIT, phosphorylated (p)-ERK, and p-AKT was evaluated by immunohistochemistry. KIT mutations were detected in 35% (8 of 23) of vulvar, 9% (2 of 22) of anorectal, 7% (1 of 14) of nasal cavity, and 20% (1 of 5) of penile melanomas. No KIT mutations were found in 7 vaginal melanomas. The difference in KIT mutation frequency between vulvar and nonvulvar cases was statistically significant (P = 0.014). The overall frequencies of NRAS and BRAF mutations were 10% and 6%, respectively. Notably, vaginal melanomas showed a NRAS mutation rate of 43%. KIT gene amplification (≥4 copies), as assessed by quantitative real-time PCR, was observed in 19% of cases. KIT expression was associated with KIT mutation status (P < 0.001) and was more common in vulvar than nonvulvar tumors (P = 0.016). Expression of p-ERK and p-AKT was observed in 42% and 59% of tumors, respectively, and occurred irrespective of KIT/NRAS/BRAF mutation status. NRAS mutation was associated with worse overall survival in univariate analysis. Results show that KIT mutations are more common in vulvar melanomas than other types of mucosal melanomas and that both the RAF/MEK/ERK and PI3K/AKT pathways are activated in mucosal melanoma specimens. ©2011 AACR.

  6. Signal transduction by normal isoforms and W mutant variants of the Kit receptor tyrosine kinase.

    PubMed

    Reith, A D; Ellis, C; Lyman, S D; Anderson, D M; Williams, D E; Bernstein, A; Pawson, T

    1991-09-01

    Germline mutations at the Dominant White Spotting (W) and Steel (Sl) loci have provided conclusive genetic evidence that c-kit mediated signal transduction pathways are essential for normal mouse development. We have analysed the interactions of normal and mutant W/c-kit gene products with cytoplasmic signalling proteins, using transient c-kit expression assays in COS cells. In addition to the previously identified c-kit gene product (Kit+), a second normal Kit isoform (KitA+) containing an in-frame insertion, Gly-Asn-Asn-Lys, within the extracellular domain, was detected in murine mast cell cultures and mid-gestation placenta. Both Kit+ and KitA+ isoforms showed increased autophosphorylation and enhanced association with phosphatidylinositol (PI) 3' kinase and PLC gamma 1, when stimulated with recombinant soluble Steel factor. No association or increase in phosphorylation of GAP and two GAP-associated proteins, p62 and p190, was observed. The two isoforms had distinct activities in the absence of exogenous soluble Steel factor; Kit+, but not KitA+, showed constitutive tyrosine phosphorylation that was accompanied by a low constitutive level of association with PI-3' kinase and PLC gamma 1. Introduction of the point substitutions associated with W37 (Glu582----Lys) or W41 (Val831----Met) mutant alleles into c-kit expression constructs abolished (W37) or reduced (W41) the Steel factor-induced association of the Kit receptor with signalling proteins in a manner proportional to the overall severity of the corresponding W mutant phenotype. These data suggest a diversity of normal Kit signalling pathways and indicate that W mutant phenotypes result from primary defects in the Kit receptor that affect its interaction with cytoplasmic signalling proteins.

  7. An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

    PubMed

    Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

    2017-07-01

    We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

  8. Remarkable effects of imatinib in a family with young onset gastrointestinal stromal tumors and cutaneous hyperpigmentation associated with a germline KIT-Trp557Arg mutation: case report and literature overview.

    PubMed

    Farag, S; van der Kolk, L E; van Boven, H H; van Akkooi, A C J; Beets, G L; Wilmink, J W; Steeghs, N

    2018-04-01

    Gastrointestinal stromal tumors (GISTs) occur mostly sporadically. GISTs associated with a familial syndrome are very rare and are mostly wild type for KIT and platelet-derived growth factor alpha (PDGFRA). To date 35 kindreds and 8 individuals have been described with GISTs associated with germline KIT mutations. This is the third family described with a germline p.Trp557Arg mutation in exon 11 of the KIT gene. The effect of imatinib in patients harboring a germline KIT mutation has been rarely described. Moreover, in some studies imatinib treatment was withheld considering the lack of evidence for efficacy of this treatment in GIST patients harboring a germline KIT mutation. This paper describes a 52-year old patient with a de novo germline p.Trp557Arg mutation with multiple GISTs throughout the gastrointestinal tract and cutaneous hyperpigmentation. Imatinib treatment showed long-term regression of the GISTs and evident pathological response was seen after resection. Remarkably, the hyperpigmentation of the skin also diminished during imatinib treatment. Genetic screening of the family revealed the same mutation in two daughters, both with similar cutaneous hyperpigmentation. One daughter, aged 23, was diagnosed with multiple small intestine GISTs, which were resected. She was treated with adjuvant imatinib which prompted rapid regression of the cutaneous hyperpigmentation. Imatinib treatment in GIST patients harboring a germline KIT mutation shows favorable and long-term responses in both the tumor and the phenotypical hyperpigmentation.

  9. Mastocytosis in mice expressing human Kit receptor with the activating Asp816Val mutation

    PubMed Central

    Zappulla, Jacques P.; Dubreuil, Patrice; Desbois, Sabine; Létard, Sébastien; Hamouda, Nadine Ben; Daëron, Marc; Delsol, Georges; Arock, Michel; Liblau, Roland S.

    2005-01-01

    Mastocytosis is a rare neoplastic disease characterized by a pathologic accumulation of tissue mast cells (MCs). Mastocytosis is often associated with a somatic point mutation in the Kit protooncogene leading to an Asp/Val substitution at position 816 in the kinase domain of this receptor. The contribution of this mutation to mastocytosis development remains unclear. In addition, the clinical heterogeneity presented by mastocytosis patients carrying the same mutation is unexplained. We report that a disease with striking similarities to human mastocytosis develops spontaneously in transgenic mice expressing the human Asp816Val mutant Kit protooncogene specifically in MCs. This disease is characterized by clinical signs ranging from a localized and indolent MC hyperplasia to an invasive MC tumor. In addition, bone marrow–derived MCs from transgenic animals can be maintained in culture for >24 mo and acquire growth factor independency for proliferation. These results demonstrate a causal link in vivo between the Asp816Val Kit mutation and MC neoplasia and suggest a basis for the clinical heterogeneity of human mastocytosis. PMID:16352739

  10. [Hereditary hypomelanocytoses: the role of PAX3, SOX10, MITF, SNAI2, KIT, EDN3 and EDNRB genes].

    PubMed

    Otręba, Michał; Miliński, Maciej; Buszman, Ewa; Wrześniok, Dorota; Beberok, Artur

    2013-11-26

    Hypo- and hyperpigmentation disorders are the most severe dermatological diseases observed in patients from all over the world. These disorders can be divided into melanoses connected with disorders of melanocyte function and melanocytoses connected with melanocyte development. The article presents some hereditary hypomelanocytoses, which are caused by abnormal melanoblast development, migration and proliferation as well as by abnormal melanocyte viability and proliferation. These disorders are represented by Waardenburg syndrome, piebaldism and Tietz syndrome, and are caused by different mutations of various or the same genes. The types of mutations comprise missense and nonsense mutations, frameshifts (in-frame insertions or deletions), truncating variations, splice alterations and non-stop mutations. It has been demonstrated that mutations of the same gene may cause different hypopigmentation syndromes that may have similar phenotypes. For example, mutations of the MITF gene cause Waardenburg syndrome type 2A as well as Tietz syndrome. It has also been demonstrated that mutations of different genes may cause an identical syndrome. For example, mutations of MITF, SNAI2 and SOX10 genes are observed in Waardenburg syndrome type II and mutations of EDNRB, EDN3 and SOX10 genes are responsible for Waardenburg syndrome type IV. In turn, mutation of the KIT gene and/or heterozygous deletion of the SNAI2 gene result in piebaldism disease. The knowledge of the exact mechanisms of pigmentary disorders may be useful in the development of new therapeutic approaches to their treatment.

  11. Investigation of c-KIT and Ki67 expression in normal, preneoplastic and neoplastic canine prostate.

    PubMed

    Fonseca-Alves, Carlos Eduardo; Kobayashi, Priscilla Emiko; Palmieri, Chiara; Laufer-Amorim, Renée

    2017-12-06

    c-KIT expression has been related to bone metastasis in human prostate cancer, but whether c-KIT expression can be similarly classified in canine prostatic tissue is unknown. This study assessed c-KIT and Ki67 expression in canine prostate cancer (PC). c-KIT gene and protein expression and Ki67 expression were evaluated in forty-four canine prostatic tissues by immunohistochemistry, RT-qPCR and western blot. Additionally, we have investigated c-KIT protein expression by immunoblotting in two primary canine prostate cancer cell lines. Eleven normal prostates, 12 proliferative inflammatory atrophy (PIA) prostates, 18 PC, 3 metastatic lesions and two prostate cancer cell cultures (PC1 and PC2) were analysed. The prostatic tissue exhibited varying degrees of membranous, cytoplasmic or membranous/cytoplasmic c-KIT staining. Four normal prostates, 4 PIA and 5 prostatic carcinomas showed positive c-KIT expression. No c-KIT immunoexpression was observed in metastases. Canine prostate cancer and PIA samples contained a higher number of Ki67-positive cells compared to normal samples. The median relative quantification (RQ) for c-KIT expression in normal, PIA and prostate cancer and metastatic samples were 0.6 (0.1-2.5), 0.7 (0.09-2.1), 0.7 (0.09-5.1) and 0.1 (0.07-0.6), respectively. A positive correlation between the number of Ki67-positive cells and c-KIT transcript levels was observed in prostate cancer samples. In the cell line, PC1 was negative for c-KIT protein expression, while PC2 was weakly positive. The present study identified a strong correlation between c-KIT expression and proliferative index, suggesting that c-KIT may influence cell proliferation. Therefore, c-KIT heterogeneous protein expression among the samples (five positive and thirteen negative prostate cancer samples) indicates a personalized approach for canine prostate cancer.

  12. Different mutations of the human c-mpl gene indicate distinct haematopoietic diseases.

    PubMed

    He, Xin; Chen, Zhigang; Jiang, Yangyan; Qiu, Xi; Zhao, Xiaoying

    2013-01-25

    The human c-mpl gene (MPL) plays an important role in the development of megakaryocytes and platelets as well as the self-renewal of haematopoietic stem cells. However, numerous MPL mutations have been identified in haematopoietic diseases. These mutations alter the normal regulatory mechanisms and lead to autonomous activation or signalling deficiencies. In this review, we summarise 59 different MPL mutations and classify these mutations into four different groups according to the associated diseases and mutation rates. Using this classification, we clearly distinguish four diverse types of MPL mutations and obtain a deep understand of their clinical significance. This will prove to be useful for both disease diagnosis and the design of individual therapy regimens based on the type of MPL mutations.

  13. Different mutations of the human c-mpl gene indicate distinct haematopoietic diseases

    PubMed Central

    2013-01-01

    The human c-mpl gene (MPL) plays an important role in the development of megakaryocytes and platelets as well as the self-renewal of haematopoietic stem cells. However, numerous MPL mutations have been identified in haematopoietic diseases. These mutations alter the normal regulatory mechanisms and lead to autonomous activation or signalling deficiencies. In this review, we summarise 59 different MPL mutations and classify these mutations into four different groups according to the associated diseases and mutation rates. Using this classification, we clearly distinguish four diverse types of MPL mutations and obtain a deep understand of their clinical significance. This will prove to be useful for both disease diagnosis and the design of individual therapy regimens based on the type of MPL mutations. PMID:23351976

  14. The Frequency of c.550delA Mutation of the CANP3 Gene in the Polish LGMD2A Population.

    PubMed

    Dorobek, Małgorzata; Ryniewicz, Barbara; Kabzińska, Dagmara; Fidziańska, Anna; Styczyńska, Maria; Hausmanowa-Petrusewicz, Irena

    2015-11-01

    Limb girdle muscular dystrophy 2A (LGMD2A) is the most frequent LGMD variant in the European population, representing about 40% of LGMD. The c.550delA mutation in the CANP3 (calcium activated neutral protease 3) gene is the most commonly reported mutation in LGMD2A. Prevalence of this mutation in the Polish population has not been previously investigated. The aim of this study was to identify and estimate the frequency of the c.550delA mutation in Polish LGMD2A patients. Polymerase chain reaction-sequencing analysis, restriction fragment length polymorphism polymerase chain reaction method. We analyzed 76 families affected with LGMD and identified 62 probands with mutations in the CANP3 gene. C.550delA was the most common mutation identified, being found in 78% of the LGMD2A families. The remaining mutations observed multiple times were as follows: c.598-612del15ntd; c.2242C>T; c.418dupC; c.1356insT, listed in terms of decreasing frequency. Two novel variants in the CANP3 gene, that is, c.700G>A Gly234Arg and c.661G>A Gly221Ser were also characterized. Overall, mutations in the LGMD2A gene were estimated to be present in 81% of patients with the LGMD phenotype who were without sarcoglycans and dysferlin deficiency on immunocytochemical analysis. The frequency of the heterozygous c.550delA mutation in the healthy Polish population was estimated at 1/124. The c.550delA is the most frequent CANP3 mutation in the Polish population, thus sequencing of exon 4 of this gene could identify the majority of LGMD2A patients in Poland.

  15. In-frame Val216-Ser217 deletion of KIT in mild piebaldism causes aberrant secretion and SCF response.

    PubMed

    Hattori, Mai; Ishikawa, Osamu; Oikawa, Daisuke; Amano, Hiroo; Yasuda, Masahito; Kaira, Kyoichi; Ishida-Yamamoto, Akemi; Nakano, Hajime; Sawamura, Daisuke; Terawaki, Shin-Ichi; Wakamatsu, Kaori; Tokunaga, Fuminori; Shimizu, Akira

    2018-03-21

    Piebaldism is a pigmentary disorder characterized by a white forelock and depigmented patches. Although the loss-of-function mutations in the KIT gene underlie the disease, the intracellular dynamics of the mutant KIT are largely unknown. We herein report a Japanese family with piebaldism in which the affected members showed a mild phenotype. The objective of this study is to investigate the functions and intracellular dynamics of the mutant KIT protein. We performed genetic analyses of the KIT gene using peripheral blood cells. We analyzed the intracellular localization of the mutant KIT protein in HEK293T cells transfected with wild-type (Wt) and/or mutant KIT genes. Immunoprecipitation analyses, immunoblotting and immunofluorescence studies were performed using antibodies against KIT and downstream signaling proteins. Glycosidase digestion analysis was performed to clarify the intracellular localization of KIT protein. A genetic analysis revealed a novel heterozygous mutation c.645_650delTGTGTC which results in the in-frame deletion of Val 216 and Ser 217 in the extracellular domain of KIT. Immunoprecipitation analyses confirmed that the wild and mutant KIT formed a heterodimer after treatment with stem cell factor (SCF); however, the phosphorylation of the downstream signaling factors was decreased. In an immunofluorescence study, the mutant KIT accumulated predominantly in the endoplasmic reticulum (ER) and was sparsely expressed on the cell surface. A glycosidase digestion study revealed that the mutant KIT is predominantly localized in the ER. These data reveal an aberrant function and intracellular localization of mutant KIT protein in piebaldism. Copyright © 2018 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

  16. The c.1364C>A (p.A455E) Mutation in the CFTR Pseudogene Results in an Incorrectly Assigned Carrier Status by a Commonly Used Screening Platform.

    PubMed

    Deeb, Kristin K; Metcalf, James D; Sesock, Kaitlin M; Shen, Junqing; Wensel, Christine A; Rippel, Larisa I; Smith, Michelle; Chapman, Mark S; Zhang, Shulin

    2015-07-01

    Cystic fibrosis (CF) is one of the most common recessive conditions among whites, with an estimated carrier frequency of 1 in 25 in the United States. Population-based CF carrier screening was implemented in the United States in 2001. The number of mutations screened by each laboratory may vary; however, the 23 most common CF mutations recommended for screening by the American College of Medical Genetics and American College of Obstetricians and Gynecologists are included in all platforms. The c.1364C>A (p.A455E) mutation located in exon 10 of the CFTR gene is one of the 23 mutations. Because CFTR exon 10 and its flanking intronic regions are duplicated and transposed onto several other chromosomes of the human genome during evolution and function as unprocessed pseudogenes, variations in the CFTR pseudogenes may confound CF screening results for mutations located in exon 10 of the CFTR gene. We report an incorrectly identified carrier status for the c.1364C>A (p.A455E) mutation in a healthy individual using the Hologic InPlex CF assay. Further analysis revealed that the mutation resides in one of the CFTR pseudogenes. Because most commercial kits and laboratory-developed tests for CF carrier screening involve a short amplicon encompassing this mutation, this finding suggests that individuals with the c.1364C>A (p.A455E) mutation may require further investigation to avoid a false assignment of CF carrier status. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  17. Pathologic Stimulus Determines Lineage Commitment of Cardiac C-kit+ Cells.

    PubMed

    Chen, Zhongming; Zhu, Wuqiang; Bender, Ingrid; Gong, Wuming; Kwak, Il-Youp; Yellamilli, Amritha; Hodges, Thomas J; Nemoto, Natsumi; Zhang, Jianyi; Garry, Daniel J; van Berlo, Jop H

    2017-12-12

    Although cardiac c-kit + cells are being tested in clinical trials, the circumstances that determine lineage differentiation of c-kit + cells in vivo are unknown. Recent findings suggest that endogenous cardiac c-kit + cells rarely contribute cardiomyocytes to the adult heart. We assessed whether various pathological stimuli differentially affect the eventual cell fates of c-kit + cells. We used single-cell sequencing and genetic lineage tracing of c-kit + cells to determine whether various pathological stimuli would result in different fates of c-kit + cells. Single-cell sequencing of cardiac CD45 - c-kit + cells showed innate heterogeneity, indicative of the existence of vascular and mesenchymal c-kit + cells in normal hearts. Cardiac pressure overload resulted in a modest increase in c-kit-derived cardiomyocytes, with significant increases in the numbers of endothelial cells and fibroblasts. Doxorubicin-induced acute cardiotoxicity did not increase c-kit-derived endothelial cell fates but instead induced cardiomyocyte differentiation. Mechanistically, doxorubicin-induced DNA damage in c-kit + cells resulted in expression of p53. Inhibition of p53 blocked cardiomyocyte differentiation in response to doxorubicin, whereas stabilization of p53 was sufficient to increase c-kit-derived cardiomyocyte differentiation. These results demonstrate that different pathological stimuli induce different cell fates of c-kit + cells in vivo. Although the overall rate of cardiomyocyte formation from c-kit + cells is still below clinically relevant levels, we show that p53 is central to the ability of c-kit + cells to adopt cardiomyocyte fates, which could lead to the development of strategies to preferentially generate cardiomyocytes from c-kit + cells. © 2017 American Heart Association, Inc.

  18. Exome-wide Sequencing Shows Low Mutation Rates and Identifies Novel Mutated Genes in Seminomas.

    PubMed

    Cutcutache, Ioana; Suzuki, Yuka; Tan, Iain Beehuat; Ramgopal, Subhashini; Zhang, Shenli; Ramnarayanan, Kalpana; Gan, Anna; Lee, Heng Hong; Tay, Su Ting; Ooi, Aikseng; Ong, Choon Kiat; Bolthouse, Jonathan T; Lane, Brian R; Anema, John G; Kahnoski, Richard J; Tan, Patrick; Teh, Bin Tean; Rozen, Steven G

    2015-07-01

    Testicular germ cell tumors are the most common cancer diagnosed in young men, and seminomas are the most common type of these cancers. There have been no exome-wide examinations of genes mutated in seminomas or of overall rates of nonsilent somatic mutations in these tumors. The objective was to analyze somatic mutations in seminomas to determine which genes are affected and to determine rates of nonsilent mutations. Eight seminomas and matched normal samples were surgically obtained from eight patients. DNA was extracted from tissue samples and exome sequenced on massively parallel Illumina DNA sequencers. Single-nucleotide polymorphism chip-based copy number analysis was also performed to assess copy number alterations. The DNA sequencing read data were analyzed to detect somatic mutations including single-nucleotide substitutions and short insertions and deletions. The detected mutations were validated by independent sequencing and further checked for subclonality. The rate of nonsynonymous somatic mutations averaged 0.31 mutations/Mb. We detected nonsilent somatic mutations in 96 genes that were not previously known to be mutated in seminomas, of which some may be driver mutations. Many of the mutations appear to have been present in subclonal populations. In addition, two genes, KIT and KRAS, were affected in two tumors each with mutations that were previously observed in other cancers and are presumably oncogenic. Our study, the first report on exome sequencing of seminomas, detected somatic mutations in 96 new genes, several of which may be targetable drivers. Furthermore, our results show that seminoma mutation rates are five times higher than previously thought, but are nevertheless low compared to other common cancers. Similar low rates are seen in other cancers that also have excellent rates of remission achieved with chemotherapy. We examined the DNA sequences of seminomas, the most common type of testicular germ cell cancer. Our study identified 96

  19. c-kit Positive Cardiac Outgrowth Cells Demonstrate Better Ability for Cardiac Recovery Against Ischemic Myopathy.

    PubMed

    Li, Chuan; Matsushita, Satoshi; Li, Zhengqing; Guan, Jianjun; Amano, Atsushi

    2017-10-01

    Resident cardiac stem cells are expected to be a therapeutic option for patients who suffer from severe heart failure. However, uncertainty remains over whether sorting cells for c-kit, a stem cell marker, improves therapeutic outcomes. Cardiac outgrowth cells cultured from explants of rat heart atrium were sorted according to their positivity (+) or negativity (-) for c-kit. These cells were exposed to hypoxia for 3 d, and subsequently harvested for mRNA expression measurement. The cell medium was also collected to assess cytokine secretion. To test for a functional benefit in animals, myocardial infarction (MI) was induced in rats, and c-kit+ or c-kit- cells were injected. The left ventricular ejection fraction (LVEF) was measured for up to 4 weeks, after which the heart was harvested for biological and histological analyses. Expression of the angiogenesis-related genes, VEGF and ANGPTL2, was significantly higher in c-kit+ cells after 3 d of hypoxic culture, although we found no such difference prior to hypoxia. Secretion of VEGF and ANGPTL2 was greater in the c-kit+ group than in the c-kit- group, while hypoxia tended to increase cytokine expression in both groups. In addition, IGF-1 was significantly increased in the c-kit+ group, consistent with the relatively low expression of cleaved-caspase 3 revealed by western blot assay, and the relatively low count of apoptotic cells revealed by histochemical analysis. Administration of c-kit+cells into the MI heart improved the LVEF and increased neovascularization. These results indicate that c-kit+cells may be useful in cardiac stem cell therapy.

  20. Exclusion of EDNRB and KIT as the basis for white spotting in Border Collies.

    PubMed

    Metallinos, D; Rine, J

    2000-01-01

    White spotting patterns in mammals can be caused by mutations in the genes for the endothelin B receptor and c-Kit, whose protein products are necessary for proper migration, differentiation or survival of the melanoblast population of cells. Although there are many different dog breeds that segregate white spotting patterns, no genes have been identified that are linked to these phenotypes. An intercross was generated from a female Newfoundland and a male Border Collie and the white spotting phenotypes of the intercross progeny were evaluated by measuring percentage surface area of white in the puppies. The Border Collie markings segregated as a simple autosomal recessive (7/25 intercross progeny had the phenotype). Two candidate genes, for the endothelin B receptor (EDNRB) and c-Kit (KIT), were evaluated for segregation with the white spotting pattern. Polymorphisms between the Border Collie and Newfoundland were identified for EDNRB using Southern analysis after a portion of the canine gene had been cloned. Polymorphisms for KIT were identified using a microsatellite developed from a bacterial artificial chromosome containing the canine gene. Both EDNRB and KIT were excluded as a cause of the white spotting pattern in at least two of the intercross progeny. Although these genes have been implicated in white spotting in other mammals, including horses, pigs, cows, mice and rats, they do not appear to be responsible for the white spotting pattern found in the Border Collie breed of dog.

  1. Exclusion of EDNRB and KIT as the basis for white spotting in Border Collies

    PubMed Central

    Metallinos, Danika; Rine, Jasper

    2000-01-01

    Background: White spotting patterns in mammals can be caused by mutations in the genes for the endothelin B receptor and c-Kit, whose protein products are necessary for proper migration, differentiation or survival of the melanoblast population of cells. Although there are many different dog breeds that segregate white spotting patterns, no genes have been identified that are linked to these phenotypes. Results: An intercross was generated from a female Newfoundland and a male Border Collie and the white spotting phenotypes of the intercross progeny were evaluated by measuring percentage surface area of white in the puppies. The Border Collie markings segregated as a simple autosomal recessive (7/25 intercross progeny had the phenotype). Two candidate genes, for the endothelin B receptor (EDNRB) and c-Kit (KIT), were evaluated for segregation with the white spotting pattern. Polymorphisms between the Border Collie and Newfoundland were identified for EDNRB using Southern analysis after a portion of the canine gene had been cloned. Polymorphisms for KIT were identified using a microsatellite developed from a bacterial artificial chromosome containing the canine gene. Conclusions: Both EDNRB and KIT were excluded as a cause of the white spotting pattern in at least two of the intercross progeny. Although these genes have been implicated in white spotting in other mammals, including horses, pigs, cows, mice and rats, they do not appear to be responsible for the white spotting pattern found in the Border Collie breed of dog. PMID:11178229

  2. Expression profiling of c-kit and its impact after esiRNA silencing during gonadal development in catfish.

    PubMed

    Laldinsangi, C; Senthilkumaran, B

    2018-04-03

    C-kit receptor is a member of a family of growth factor receptors that have tyrosine kinase activity, and are involved in the transduction of growth regulatory signals across plasma membrane by activation of its ligand, kitl/scf. The present study analysed mRNA and protein expression profiles of c-kit in the gonads of catfish, Clarias gariepinus, using real time PCR, in situ hybridization and immunohistochemistry. Tissue distribution analysis revealed higher expression mainly in the catfish gonads. Ontogeny studies showed minimal expression during early developmental stages and highest during 50-75 days post hatch, and the dimorphic expression in gonads decreased gradually till adulthood, which might suggest an important role for this gene around later stages of sex differentiation and gonadal development. Expression of C-kit was analysed at various phases of gonadal cycle in both male and female, which showed minimal expression during the resting phase, and higher expression in male compared to females during the pre-spawning phase. In vitro and in vivo induction using human chorionic gonadotropin elevated the expression of c-kit indicating the regulatory influence of hypothalamo-hypophyseal axis. In vivo transient gene silencing using c-kit-esiRNA in adult catfish during gonadal recrudescence showed a decrease in c-kit expression, which affected the expression level of germ cell meiotic marker sycp3, as well as several factors and steroidogenic enzyme genes involved in germ cell development. Decrease in the levels of serum 11-KT and T were also observed after esiRNA silencing. The findings of this study suggest that c-kit has an important role in the process of germ cell proliferation, development and maturation during gonadal development and recrudescence in catfish. Copyright © 2018. Published by Elsevier Inc.

  3. The stem cell factor (SCF)/c-KIT system in carcinogenesis of reproductive tissues: What does the hormonal regulation tell us?

    PubMed

    Figueira, Marília I; Cardoso, Henrique J; Correia, Sara; Maia, Cláudio J; Socorro, Sílvia

    2017-10-01

    The tyrosine kinase receptor c-KIT and its ligand, the stem cell factor (SCF) are expressed in several tissues of male and female reproductive tract, playing an important role in the regulation of basic biological processes. The activation of c-KIT by SCF controls, cell survival and death, cell differentiation and migration. Also, the SCF/c-KIT system has been implicated in carcinogenesis of reproductive tissues due to its altered expression pattern or overactivation in consequence of gain-of-functions mutations. Over the years, it has also been shown that hormones, the primary regulators of reproductive function and causative agents in the case of hormone-dependent cancers, are also able to control the SCF/c-KIT tissue levels. Therefore, it is liable to suppose that disturbed SCF/c-KIT expression driven by (de)regulated hormone actions can be a relevant step towards carcinogenesis. The present review describes the SCF and c-KIT expression in cancers of reproductive tissues, discussing the implications of the hormonal regulation of the SCF/c-KIT system in cancer development. Understanding the relationship between hormonal imbalance and the SCF/c-KIT expression and activity would be relevant in the context of novel therapeutic approaches in reproductive cancers. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Synthesis and evaluation of 7-substituted-5,6-dihydrobenzo[c]acridine derivatives as new c-KIT promoter G-quadruplex binding ligands.

    PubMed

    Guo, Qian-Liang; Su, Hua-Fei; Wang, Ning; Liao, Sheng-Rong; Lu, Yu-Ting; Ou, Tian-Miao; Tan, Jia-Heng; Li, Ding; Huang, Zhi-Shu

    2017-04-21

    It has been shown that treatment of cancer cells with c-KIT G-quadruplex binding ligands can reduce their c-KIT expression levels thus inhibiting cell proliferation and inducing cell apoptosis. Herein, a series of new 7-substituted-5,6-dihydrobenzo[c]acridine derivatives were designed and synthesized. Subsequent biophysical evaluation demonstrated that the derivatives could effectively bind to and stabilize c-KIT G-quadruplex with good selectivity against duplex DNA. It was found that 12-N-methylated derivatives with a positive charge introduced at 12-position of 5,6-dihydrobenzo[c]acridine ring had similar binding affinity but lower stabilizing ability to c-KIT G-quadruplex DNA, compared with those of nonmethylated derivatives. Further molecular modeling studies showed possible binding modes of G-quadruplex with the ligands. RT-PCR assay and Western blot showed that compound 2b suppressed transcription and translation of c-KIT gene in K562 cells, which was consistent with the property of an effective G-quadruplex binding ligand targeting c-KIT oncogene promoter. Further biological evaluation showed that compound 2b could induce apoptosis through activation of the caspase-3 cascade pathway. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  5. Discovery of amido-benzisoxazoles as potent c-Kit inhibitors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kunz, Roxanne K.; Rumfelt, Shannon; Chen, Ning

    2010-01-12

    Deregulation of the receptor tyrosine kinase c-Kit is associated with an increasing number of human diseases, including certain cancers and mast cell diseases. Interference of c-Kit signaling with multi-kinase inhibitors has been shown clinically to successfully treat gastrointestinal stromal tumors and mastocytosis. Targeted therapy of c-Kit activity may provide therapeutic advantages against off-target effects for non-oncology applications. A new structural class of c-Kit inhibitors is described, including in vitro c-Kit potency, kinase selectivity, and the observed binding mode.

  6. A novel mutation in the albumin gene (c.1A>C) resulting in analbuminemia.

    PubMed

    Caridi, Gianluca; Dagnino, Monica; Lugani, Francesca; Shalev, Stavit A; Campagnoli, Monica; Galliano, Monica; Spiegel, Ronen; Minchiotti, Lorenzo

    2013-01-01

    Analbuminemia (OMIM # 103600) is a rare autosomal recessive disorder manifested by the absence or severe reduction of circulating serum albumin in homozygous or compound heterozygous subjects. The trait is caused by a variety of mutations within the albumin gene. We report here the clinical and molecular characterisation of two new cases of congenital analbuminemia diagnosed in two members of the Druze population living in a Galilean village (Northern Israel) on the basis of their low level of circulating albumin. The albumin gene was screened by single-strand conformation polymorphism and heteroduplex analysis, and the mutated region was submitted to DNA sequencing. Both the analbuminemic subjects resulted homozygous for a previously unreported c.1 A>C transversion, for which we suggest the name Afula from the hospital where the two cases were investigated. This mutation causes the loss of the primary start codon ATG for Met1, which is replaced by a - then untranslated - triplet CTG for Leu. (p.Met1Leu). The use of an alternative downstream ATG codon would probably give rise to a completely aberrant polypeptide chain, leading to a misrouted intracellular transport and a premature degradation. The discovery of this new ALB mutation, probably inherited from a common ancestor, sheds light on the molecular mechanism underlying the analbuminemic trait and may serve in the development of a rapid genetic test for the identification of a-symptomatic heterozygous carriers in the Druze population in the Galilee. © 2012 The Authors. European Journal of Clinical Investigation © 2012 Stichting European Society for Clinical Investigation Journal Foundation.

  7. [Maple syrup urine disease and gene mutations in twin neonates].

    PubMed

    Li, Tao; Wang, Yu; Li, Cui; Xu, Wei-Wei; Niu, Feng-Hai; Zhang, Di

    2016-12-01

    To investigate the clinical features of one pair of twin neonates with maple syrup urine disease (MSUD) in the Chinese Han population and pathogenic mutations in related genes, and to provide guidance for the early diagnosis and treatment of MSUD. The clinical and imaging data of the twin neonates were collected. The peripheral blood samples were collected from the twin neonates and their parents to detect the genes related to MSUD (BCKDHA, BCKDHB, DBT, and DLD). The loci with gene mutations were identified, and a bioinformatic analysis was performed. Two mutations were detected in the BCKDHB gene, missense mutation c.304G>A (p.Gly102Arg) and nonsense mutation c.331C>T (p.Arg111*), and both of them were heterozygotes. The mutation c.304G>A (p.Gly102Arg) had not been reported in the world. Their father carried the missense mutation c.304G>A (p.Gly102Arg), and their mother carried the nonsense mutation c.331C>T (p.Arg111*). The c.331C>T (p.Arg111*) heterozygous mutation in BCKDHB gene is the pathogenic mutation in these twin neonates and provides a genetic and molecular basis for the clinical features of children with MSUD.

  8. Localisation of a gene for prepubertal periodontitis to chromosome 11q14 and identification of a cathepsin C gene mutation

    PubMed Central

    Hart, T; Hart, P; Michalec, M; Zhang, Y; Marazita, M; Cooper, M; Yassin, O; Nusier, M; Walker, S

    2000-01-01

    Prepubertal periodontitis (PPP) is a rare and rapidly progressive disease of young children that results in destruction of the periodontal support of the primary dentition. The condition may occur as part of a recognised syndrome or may occur as an isolated finding. Both autosomal dominant and recessive forms of Mendelian transmission have been reported for PPP. We report a consanguineous Jordanian family with four members affected by PPP in two nuclear sibships. The parents of the affected subjects are first cousins. We have localised a gene of major effect for PPP in this kindred (Zmax=3.55 for D11S901 at θ=0.00) to a 14 cM genetic interval on chromosome 11q14 flanked by D11S916 and D11S1367. This PPP candidate interval overlaps the region of chromosome 11q14 that contains the cathepsin C gene responsible for Papillon-Lefèvre and Haim-Munk syndromes. Sequence analysis of the cathepsin C gene from PPP affected subjects from this Jordanian family indicated that all were homozygous for a missense mutation (1040A→G) that changes a tyrosine to a cysteine. All four parents were heterozygous carriers of this Tyr347Cys cathepsin C mutation. None of the family members who were heterozygous carriers for this mutation showed any clinical findings of PPP. None of the 50 controls tested were found to have this Tyr347Cys mutation. This is the first reported gene mutation for non-syndromic periodontitis and shows that non-syndromic PPP is an allelic variant of the type IV palmoplantar ectodermal dysplasias.


Keywords: prepubertal periodontitis; periodontal disease; cathepsin C; linkage PMID:10662808

  9. CMT2C with vocal cord paresis associated with short stature and mutations in the TRPV4 gene

    PubMed Central

    Chen, D.-H.; Sul, Y.; Weiss, M.; Hillel, A.; Lipe, H.; Wolff, J.; Matsushita, M.; Raskind, W.; Bird, T.

    2010-01-01

    Background: Recently, mutations in the transient receptor potential cation channel, subfamily V, member 4 gene (TRPV4) have been reported in Charcot-Marie-Tooth Type 2C (CMT2C) with vocal cord paresis. Other mutations in this same gene have been described in separate families with various skeletal dysplasias. Further clarification is needed of the different phenotypes associated with this gene. Methods: We performed clinical evaluation, electrophysiology, and genetic analysis of the TRPV4 gene in 2 families with CMT2C. Results: Two multigenerational families had a motor greater than sensory axonal neuropathy associated with variable vocal cord paresis. The vocal cord paresis varied from absent to severe, requiring permanent tracheotomy in 2 subjects. One family with mild neuropathy also manifested pronounced short stature, more than 2 SD below the average height for white Americans. There was one instance of dolichocephaly. A novel S542Y mutation in the TRPV4 gene was identified in this family. The other family had a more severe, progressive, motor neuropathy with sensory loss, but less remarkable short stature and an R315W mutation in TRPV4. Third cranial nerve involvement and sleep apnea occurred in one subject in each family. Conclusion: CMT2C with axonal neuropathy, vocal cord paresis, and short stature is a unique syndrome associated with mutations in the TRPV4 gene. Mutations in TRPV4 can cause abnormalities in bone, peripheral nerve, or both and may result in highly variable orthopedic and neurologic phenotypes. GLOSSARY CMAP = compound muscle action potential; CMT = Charcot-Marie-Tooth; CMT2C = Charcot-Marie-Tooth Type 2C; HMSN = hereditary motor and sensory neuropathy; NCV = nerve conduction velocity; RFLP = restriction fragment length polymorphism; SMA = spinal muscular atrophy; SNAP = sensory nerve action potential; SPSMA = scapuloperoneal spinal muscular atrophy. PMID:21115951

  10. A somatic T15091C mutation in the Cytb gene of mouse mitochondrial DNA dominantly induces respiration defects.

    PubMed

    Hayashi, Chisato; Takibuchi, Gaku; Shimizu, Akinori; Mito, Takayuki; Ishikawa, Kaori; Nakada, Kazuto; Hayashi, Jun-Ichi

    2015-08-07

    Our previous studies provided evidence that mammalian mitochondrial DNA (mtDNA) mutations that cause mitochondrial respiration defects behave in a recessive manner, because the induction of respiration defects could be prevented with the help of a small proportion (10%-20%) of mtDNA without the mutations. However, subsequent studies found the induction of respiration defects by the accelerated accumulation of a small proportion of mtDNA with various somatic mutations, indicating the presence of mtDNA mutations that behave in a dominant manner. Here, to provide the evidence for the presence of dominant mutations in mtDNA, we used mouse lung carcinoma P29 cells and examined whether some mtDNA molecules possess somatic mutations that dominantly induce respiration defects. Cloning and sequence analysis of 40-48 mtDNA molecules from P29 cells was carried out to screen for somatic mutations in protein-coding genes, because mutations in these genes could dominantly regulate respiration defects by formation of abnormal polypeptides. We found 108 missense mutations existing in one or more of 40-48 mtDNA molecules. Of these missense mutations, a T15091C mutation in the Cytb gene was expected to be pathogenic due to the presence of its orthologous mutation in mtDNA from a patient with cardiomyopathy. After isolation of many subclones from parental P29 cells, we obtained subclones with various proportions of T15091C mtDNA, and showed that the respiration defects were induced in a subclone with only 49% T15091C mtDNA. Because the induction of respiration defects could not be prevented with the help of the remaining 51% mtDNA without the T15091C mutation, the results indicate that the T15091C mutation in mtDNA dominantly induced the respiration defects. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Detection of a large duplication mutation in the myosin-binding protein C3 gene in a case of hypertrophic cardiomyopathy.

    PubMed

    Meyer, Thomas; Pankuweit, Sabine; Richter, Anette; Maisch, Bernhard; Ruppert, Volker

    2013-09-15

    Hypertrophic cardiomyopathy (HCM) is a cardiovascular disease with autosomal dominant inheritance caused by mutations in genes coding for sarcomeric and/or regulatory proteins expressed in cardiomyocytes. In a small cohort of HCM patients (n=8), we searched for mutations in the two most common genes responsible for HCM and found four missense mutations in the MYH7 gene encoding cardiac β-myosin heavy chain (R204H, M493V, R719W, and R870H) and three mutations in the myosin-binding protein C3 gene (MYBPC3) including one missense (A848V) and two frameshift mutations (c.3713delTG and c.702ins26bp). The c.702ins26bp insertion resulted from the duplication of a 26-bp fragment in a 54-year-old female HCM patient presenting with clinical signs of heart failure due to diastolic dysfunction. Although such large duplications (>10 bp) in the MYBPC3 gene are very rare and have been identified only in 4 families reported so far, the identical duplication mutation was found earlier in a Dutch patient, demonstrating that it may constitute a hitherto unknown founder mutation in central European populations. This observation underscores the significance of insertions into the coding sequence of the MYBPC3 gene for the development and pathogenesis of HCM. © 2013 Elsevier B.V. All rights reserved.

  12. Allelic Mutations of KITLG, Encoding KIT Ligand, Cause Asymmetric and Unilateral Hearing Loss and Waardenburg Syndrome Type 2

    PubMed Central

    Zazo Seco, Celia; Serrão de Castro, Luciana; van Nierop, Josephine W.; Morín, Matías; Jhangiani, Shalini; Verver, Eva J.J.; Schraders, Margit; Maiwald, Nadine; Wesdorp, Mieke; Venselaar, Hanka; Spruijt, Liesbeth; Oostrik, Jaap; Schoots, Jeroen; van Reeuwijk, Jeroen; Lelieveld, Stefan H.; Huygen, Patrick L.M.; Insenser, María; Admiraal, Ronald J.C.; Pennings, Ronald J.E.; Hoefsloot, Lies H.; Arias-Vásquez, Alejandro; de Ligt, Joep; Yntema, Helger G.; Jansen, Joop H.; Muzny, Donna M.; Huls, Gerwin; van Rossum, Michelle M.; Lupski, James R.; Moreno-Pelayo, Miguel Angel; Kunst, Henricus P.M.; Kremer, Hannie

    2015-01-01

    Linkage analysis combined with whole-exome sequencing in a large family with congenital and stable non-syndromic unilateral and asymmetric hearing loss (NS-UHL/AHL) revealed a heterozygous truncating mutation, c.286_303delinsT (p.Ser96Ter), in KITLG. This mutation co-segregated with NS-UHL/AHL as a dominant trait with reduced penetrance. By screening a panel of probands with NS-UHL/AHL, we found an additional mutation, c.200_202del (p.His67_Cys68delinsArg). In vitro studies revealed that the p.His67_Cys68delinsArg transmembrane isoform of KITLG is not detectable at the cell membrane, supporting pathogenicity. KITLG encodes a ligand for the KIT receptor. Also, KITLG-KIT signaling and MITF are suggested to mutually interact in melanocyte development. Because mutations in MITF are causative of Waardenburg syndrome type 2 (WS2), we screened KITLG in suspected WS2-affected probands. A heterozygous missense mutation, c.310C>G (p.Leu104Val), that segregated with WS2 was identified in a small family. In vitro studies revealed that the p.Leu104Val transmembrane isoform of KITLG is located at the cell membrane, as is wild-type KITLG. However, in culture media of transfected cells, the p.Leu104Val soluble isoform of KITLG was reduced, and no soluble p.His67_Cys68delinsArg and p.Ser96Ter KITLG could be detected. These data suggest that mutations in KITLG associated with NS-UHL/AHL have a loss-of-function effect. We speculate that the mechanism of the mutation underlying WS2 and leading to membrane incorporation and reduced secretion of KITLG occurs via a dominant-negative or gain-of-function effect. Our study unveils different phenotypes associated with KITLG, previously associated with pigmentation abnormalities, and will thereby improve the genetic counseling given to individuals with KITLG variants. PMID:26522471

  13. Allelic Mutations of KITLG, Encoding KIT Ligand, Cause Asymmetric and Unilateral Hearing Loss and Waardenburg Syndrome Type 2.

    PubMed

    Zazo Seco, Celia; Serrão de Castro, Luciana; van Nierop, Josephine W; Morín, Matías; Jhangiani, Shalini; Verver, Eva J J; Schraders, Margit; Maiwald, Nadine; Wesdorp, Mieke; Venselaar, Hanka; Spruijt, Liesbeth; Oostrik, Jaap; Schoots, Jeroen; van Reeuwijk, Jeroen; Lelieveld, Stefan H; Huygen, Patrick L M; Insenser, María; Admiraal, Ronald J C; Pennings, Ronald J E; Hoefsloot, Lies H; Arias-Vásquez, Alejandro; de Ligt, Joep; Yntema, Helger G; Jansen, Joop H; Muzny, Donna M; Huls, Gerwin; van Rossum, Michelle M; Lupski, James R; Moreno-Pelayo, Miguel Angel; Kunst, Henricus P M; Kremer, Hannie

    2015-11-05

    Linkage analysis combined with whole-exome sequencing in a large family with congenital and stable non-syndromic unilateral and asymmetric hearing loss (NS-UHL/AHL) revealed a heterozygous truncating mutation, c.286_303delinsT (p.Ser96Ter), in KITLG. This mutation co-segregated with NS-UHL/AHL as a dominant trait with reduced penetrance. By screening a panel of probands with NS-UHL/AHL, we found an additional mutation, c.200_202del (p.His67_Cys68delinsArg). In vitro studies revealed that the p.His67_Cys68delinsArg transmembrane isoform of KITLG is not detectable at the cell membrane, supporting pathogenicity. KITLG encodes a ligand for the KIT receptor. Also, KITLG-KIT signaling and MITF are suggested to mutually interact in melanocyte development. Because mutations in MITF are causative of Waardenburg syndrome type 2 (WS2), we screened KITLG in suspected WS2-affected probands. A heterozygous missense mutation, c.310C>G (p.Leu104Val), that segregated with WS2 was identified in a small family. In vitro studies revealed that the p.Leu104Val transmembrane isoform of KITLG is located at the cell membrane, as is wild-type KITLG. However, in culture media of transfected cells, the p.Leu104Val soluble isoform of KITLG was reduced, and no soluble p.His67_Cys68delinsArg and p.Ser96Ter KITLG could be detected. These data suggest that mutations in KITLG associated with NS-UHL/AHL have a loss-of-function effect. We speculate that the mechanism of the mutation underlying WS2 and leading to membrane incorporation and reduced secretion of KITLG occurs via a dominant-negative or gain-of-function effect. Our study unveils different phenotypes associated with KITLG, previously associated with pigmentation abnormalities, and will thereby improve the genetic counseling given to individuals with KITLG variants. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  14. Existence of c-Kit negative cells with ultrastructural features of interstitial cells of Cajal in the subserosal layer of the W/Wv mutant mouse colon

    PubMed Central

    Tamada, Hiromi; Kiyama, Hiroshi

    2015-01-01

    Interstitial cells of Cajal (ICC) are mesenchymal cells that are distributed along the gastrointestinal tract and function as pacemaker cells or intermediary cells between nerves and smooth muscle cells. ICC express a receptor tyrosine kinase c-Kit, which is an established marker for ICC. The c-kit gene is allelic with the murine white-spotting locus (W), and some ICC subsets were reported to be missing in heterozygous mutant W/Wv mice carrying W and Wv mutated alleles. In this study, the characterization of interstitial cells in the subserosal layer of W/Wv mice was analyzed by immunohistochemistry and electron microscopy. In the proximal and distal colon of W/Wv mutant mice, no c-Kit-positive cells were detected in the subserosal layer by immunohistochemistry. By electron microscopy, the interstitial cells, which were characterized by the existence of caveolae, abundant mitochondria and gap junctions, were observed in the W/Wv mutant colon. The morphological characteristics were comparable to those of the multipolar c-Kit positive ICC seen in the subserosa of proximal and distal colon of wild-type mice. Fibroblasts were also located in the same layers, but the morphology of the fibroblasts was distinguishable from that of ICC in wild type mice or of ICC-like cells in W/Wv mutant mice. Collectively, it is concluded that c-Kit-negative interstitial cells showing a typical ICC ultrastructure exist in the proximal and distal colon of W/Wv mutant mice. PMID:26727725

  15. Existence of c-Kit negative cells with ultrastructural features of interstitial cells of Cajal in the subserosal layer of the W/Wv mutant mouse colon.

    PubMed

    Tamada, Hiromi; Kiyama, Hiroshi

    2015-01-01

    Interstitial cells of Cajal (ICC) are mesenchymal cells that are distributed along the gastrointestinal tract and function as pacemaker cells or intermediary cells between nerves and smooth muscle cells. ICC express a receptor tyrosine kinase c-Kit, which is an established marker for ICC. The c-kit gene is allelic with the murine white-spotting locus (W), and some ICC subsets were reported to be missing in heterozygous mutant W/Wv mice carrying W and Wv mutated alleles. In this study, the characterization of interstitial cells in the subserosal layer of W/Wv mice was analyzed by immunohistochemistry and electron microscopy. In the proximal and distal colon of W/Wv mutant mice, no c-Kit-positive cells were detected in the subserosal layer by immunohistochemistry. By electron microscopy, the interstitial cells, which were characterized by the existence of caveolae, abundant mitochondria and gap junctions, were observed in the W/Wv mutant colon.The morphological characteristics were comparable to those of the multipolar c-Kit positive ICC seen in the subserosa of proximal and distal colon of wild-type mice. Fibroblasts were also located in the same layers,but the morphology of the fibroblasts was distinguishable from that of ICC in wild type mice or of ICC-like cells in W/Wv mutant mice. Collectively, it is concluded that c-Kit-negative interstitial cells showing a typical ICC ultrastructure exist in the proximal and distal colon of W/Wv mutant mice.

  16. Mutation analysis of metastatic melanomas in the central nervous system: results of a panel of 5 genes in 48 cases.

    PubMed

    Gamsizkan, Mehmet; Yilmaz, Ismail; Simsek, Hasan Aktug; Onguru, Onder; Griffin, Ann; Tihan, Tarik

    2016-01-01

    Melanocytic lesions in the central nervous system (CNS) may be primary to the site but are more commonly metastases from cutaneous primaries. In fact, melanomas are one of the most common malignancies that can metastasize to the brain, and some patients may not have a diagnosis of melanoma prior to the discovery of the CNS lesion. In such cases, identifying the primary site may be challenging. We reviewed the archives of a large referral center for melanocytic tumors involving the CNS and selected 48 patients for this study based on our inclusion criteria. We used sequencing to identify mutation status of these tumors and compared these with clinicopathological features. Mutations in exon 9, 11, 13, 17, and 18 of KIT gene, exon 15 of BRAF gene, exon 2 and 3 of NRAS gene, exon 4 and 5 of GNAQ and GNA11 genes were analyzed. Mutations in BRAF-exon 15 were the most common among tumors (58.3%). NRAS-exon 2 and NRAS-exon 3 mutations were detected in 3 and 7 cases, respectively. GNAQ-exon 4, GNAQ-exon 5 and GNA11-exon 5 mutation were present in 1 tumor each. Eight tumors were wild type for all 5 genes, and 6 of these were not known primary despite a work-up and clinical follow-up. Only 1 of these tumors showed a mutation in exon 11 of KIT gene. When compared to primary melanocytic lesions of the CNS, metastatic melanomas were characterized by BRAF gene mutations and wild-type GNAQ and GNA11 genes.

  17. Relative high frequency of the c.255delA parkin gene mutation in Spanish patients with autosomal recessive parkinsonism

    PubMed Central

    Munoz, E; Tolosa, E; Pastor, P; Marti, M; Valldeoriola, F; Campdelacreu, J; Oliva, R

    2002-01-01

    Objectives: To search for the presence of parkin gene mutations in Spanish patients with Parkinson's disease (PD) and characterise the phenotype associated with these mutations. Methods: Thirty seven PD patients with either early onset or autosomal recessive pattern of inheritance were selected for genetic study. Results: Mutations were identified in seven index patients (19%). Homozygous mutations were detected in six patients and a heterozygous mutation in one. The age at onset was lower in patients with mutations than in patients without mutations. Dystonia at onset was present in two patients with parkin gene mutations. The disease began in two patients with postural tremor in the upper limbs mimicking essential tremor. Four patients exhibited a long term response to dopamine agonists. The c.255delA mutation was identified in four unrelated families. This is a frameshift mutation leading to protein truncation. Conclusions: Parkin gene mutations are present in Spanish patients with early onset and/or an autosomal recessive parkinsonism. The c.255delA is the most frequent mutation found, suggesting a relative high prevalence in the Spanish population. PMID:12397156

  18. Novel KRAS Gene Mutations in Sporadic Colorectal Cancer

    PubMed Central

    Naser, Walid M.; Shawarby, Mohamed A.; Al-Tamimi, Dalal M.; Seth, Arun; Al-Quorain, Abdulaziz; Nemer, Areej M. Al; Albagha, Omar M. E.

    2014-01-01

    Introduction In this article, we report 7 novel KRAS gene mutations discovered while retrospectively studying the prevalence and pattern of KRAS mutations in cancerous tissue obtained from 56 Saudi sporadic colorectal cancer patients from the Eastern Province. Methods Genomic DNA was extracted from formalin-fixed, paraffin-embedded cancerous and noncancerous colorectal tissues. Successful and specific PCR products were then bi-directionally sequenced to detect exon 4 mutations while Mutector II Detection Kits were used for identifying mutations in codons 12, 13 and 61. The functional impact of the novel mutations was assessed using bioinformatics tools and molecular modeling. Results KRAS gene mutations were detected in the cancer tissue of 24 cases (42.85%). Of these, 11 had exon 4 mutations (19.64%). They harbored 8 different mutations all of which except two altered the KRAS protein amino acid sequence and all except one were novel as revealed by COSMIC database. The detected novel mutations were found to be somatic. One mutation is predicted to be benign. The remaining mutations are predicted to cause substantial changes in the protein structure. Of these, the Q150X nonsense mutation is the second truncating mutation to be reported in colorectal cancer in the literature. Conclusions Our discovery of novel exon 4 KRAS mutations that are, so far, unique to Saudi colorectal cancer patients may be attributed to environmental factors and/or racial/ethnic variations due to genetic differences. Alternatively, it may be related to paucity of clinical studies on mutations other than those in codons 12, 13, 61 and 146. Further KRAS testing on a large number of patients of various ethnicities, particularly beyond the most common hotspot alleles in exons 2 and 3 is needed to assess the prevalence and explore the exact prognostic and predictive significance of the discovered novel mutations as well as their possible role in colorectal carcinogenesis. PMID:25412182

  19. A chromosome inversion near the KIT gene and the Tobiano spotting pattern in horses.

    PubMed

    Brooks, S A; Lear, T L; Adelson, D L; Bailey, E

    2007-01-01

    Tobiano is a white spotting pattern in horses caused by a dominant gene, Tobiano(TO). Here, we report TO associated with a large paracentric chromosome inversion on horse chromosome 3. DNA sequences flanking the inversion were identified and a PCR test was developed to detect the inversion. The inversion was only found in horses with the tobiano pattern, including horses with diverse genetic backgrounds, which indicated a common genetic origin thousands of years ago. The inversion does not interrupt any annotated genes, but begins approximately 100 kb downstream of the KIT gene. This inversion may disrupt regulatory sequences for the KIT gene and cause the white spotting pattern. Copyright (c) 2008 S. Karger AG, Basel.

  20. Mutation Frequency of the Major Frontotemporal Dementia Genes, MAPT, GRN and C9ORF72 in a Turkish Cohort of Dementia Patients.

    PubMed

    Guven, Gamze; Lohmann, Ebba; Bras, Jose; Gibbs, J Raphael; Gurvit, Hakan; Bilgic, Basar; Hanagasi, Hasmet; Rizzu, Patrizia; Heutink, Peter; Emre, Murat; Erginel-Unaltuna, Nihan; Just, Walter; Hardy, John; Singleton, Andrew; Guerreiro, Rita

    2016-01-01

    'Microtubule-associated protein tau' (MAPT), 'granulin' (GRN) and 'chromosome 9 open reading frame72' (C9ORF72) gene mutations are the major known genetic causes of frontotemporal dementia (FTD). Recent studies suggest that mutations in these genes may also be associated with other forms of dementia. Therefore we investigated whether MAPT, GRN and C9ORF72 gene mutations are major contributors to dementia in a random, unselected Turkish cohort of dementia patients. A combination of whole-exome sequencing, Sanger sequencing and fragment analysis/Southern blot was performed in order to identify pathogenic mutations and novel variants in these genes as well as other FTD-related genes such as the 'charged multivesicular body protein 2B' (CHMP2B), the 'FUS RNA binding protein' (FUS), the 'TAR DNA binding protein' (TARDBP), the 'sequestosome1' (SQSTM1), and the 'valosin containing protein' (VCP). We determined one pathogenic MAPT mutation (c.1906C>T, p.P636L) and one novel missense variant (c.38A>G, p.D13G). In GRN we identified a probably pathogenic TGAG deletion in the splice donor site of exon 6. Three patients were found to carry the GGGGCC expansions in the non-coding region of the C9ORF72 gene. In summary, a complete screening for mutations in MAPT, GRN and C9ORF72 genes revealed a frequency of 5.4% of pathogenic mutations in a random cohort of 93 Turkish index patients with dementia.

  1. Existence of c-Kit negative cells with ultrastructural features of interstitial cells of Cajal in the subserosal layer of the W/W(v) mutant mouse colon.

    PubMed

    Tamada, Hiromi; Kiyama, Hiroshi

    2015-01-01

    Interstitial cells of Cajal (ICC) are mesenchymal cells that are distributed along the gastrointestinal tract and function as pacemaker cells or intermediary cells between nerves and smooth muscle cells. ICC express a receptor tyrosine kinase c-Kit, which is an established marker for ICC. The c-kit gene is allelic with the murine white-spotting locus (W), and some ICC subsets were reported to be missing in heterozygous mutant W/W(v) mice carrying W and W(v) mutated alleles. In this study, the characterization of interstitial cells in the subserosal layer of W/W(v) mice was analyzed by immunohistochemistry and electron microscopy. In the proximal and distal colon of W/W(v) mutant mice, no c-Kit-positive cells were detected in the subserosal layer by immunohistochemistry. By electron microscopy, the interstitial cells, which were characterized by the existence of caveolae, abundant mitochondria and gap junctions, were observed in the W/W(v) mutant colon. The morphological characteristics were comparable to those of the multipolar c-Kit positive ICC seen in the subserosa of proximal and distal colon of wild-type mice. Fibroblasts were also located in the same layers, but the morphology of the fibroblasts was distinguishable from that of ICC in wild type mice or of ICC-like cells in W/W(v) mutant mice. Collectively, it is concluded that c-Kit-negative interstitial cells showing a typical ICC ultrastructure exist in the proximal and distal colon of W/W(v) mutant mice.

  2. Radotinib induces high cytotoxicity in c-KIT positive acute myeloid leukemia cells.

    PubMed

    Heo, Sook-Kyoung; Noh, Eui-Kyu; Kim, Jeong Yi; Jo, Jae-Cheol; Choi, Yunsuk; Koh, SuJin; Baek, Jin Ho; Min, Young Joo; Kim, Hawk

    2017-06-05

    Previously, we reported that radotinib, a BCR-ABL1 tyrosine kinase inhibitor, induced cytotoxicity in acute myeloid leukemia (AML) cells. However, the effects of radotinib in the subpopulation of c-KIT-positive AML cells were unclear. We observed that low-concentration radotinib had more potent cytotoxicity in c-KIT-positive cells than c-KIT-negative cells from AML patients. To address this issue, cell lines with high c-KIT expression, HEL92.1.7, and moderate c-KIT expression, H209, were selected. HEL92.1.7 cells were grouped into intermediate and high c-KIT expression populations. The cytotoxicity of radotinib against the HEL92.1.7 cell population with intermediate c-KIT expression was not different from that of the population with high c-KIT expression. When H209 cells were grouped into c-KIT expression-negative and c-KIT expression-positive populations, radotinib induced cytotoxicity in the c-KIT-positive population, but not the c-KIT-negative population. Thus, radotinib induces cytotoxicity in c-KIT-positive cells, regardless of the c-KIT expression intensity. Therefore, radotinib induces significant cytotoxicity in c-KIT-positive AML cells, suggesting that radotinib is a potential target agent for the treatment of c-KIT-positive malignancies including AML. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Prospective evaluation of gene mutations and minimal residual disease in patients with core binding factor acute myeloid leukemia.

    PubMed

    Jourdan, Eric; Boissel, Nicolas; Chevret, Sylvie; Delabesse, Eric; Renneville, Aline; Cornillet, Pascale; Blanchet, Odile; Cayuela, Jean-Michel; Recher, Christian; Raffoux, Emmanuel; Delaunay, Jacques; Pigneux, Arnaud; Bulabois, Claude-Eric; Berthon, Céline; Pautas, Cécile; Vey, Norbert; Lioure, Bruno; Thomas, Xavier; Luquet, Isabelle; Terré, Christine; Guardiola, Philippe; Béné, Marie C; Preudhomme, Claude; Ifrah, Norbert; Dombret, Hervé

    2013-03-21

    Not all patients with core binding factor acute myeloid leukemia (CBF-AML) display a good outcome. Modern risk factors include KIT and/or FLT3 gene mutations and minimal residual disease (MRD) levels, but their respective values have never been prospectively assessed. A total of 198 CBF-AML patients were randomized between a reinforced and a standard induction course, followed by 3 high-dose cytarabine consolidation courses. MRD levels were monitored prospectively. Gene mutations were screened at diagnosis. Despite a more rapid MRD decrease after reinforced induction, induction arm did not influence relapse-free survival (RFS) (64% in both arms; P = .91). Higher WBC, KIT, and/or FLT3-ITD/TKD gene mutations, and a less than 3-log MRD reduction after first consolidation, were associated with a higher specific hazard of relapse, but MRD remained the sole prognostic factor in multivariate analysis. At 36 months, cumulative incidence of relapse and RFS were 22% vs 54% (P < .001) and 73% vs 44% (P < .001) in patients who achieved 3-log MRD reduction vs the others. These results suggest that MRD, rather than gene mutations, should be used for future treatment stratifications in CBF-AML patients. This trial was registered at EudraCT as #2006-005163-26 and at www.clinicaltrials.gov as #NCT 00428558.

  4. c-kit+ Cells Minimally Contribute Cardiomyocytes to the Heart

    PubMed Central

    van Berlo, Jop H.; Kanisicak, Onur; Maillet, Marjorie; Vagnozzi, Ronald J.; Karch, Jason; Lin, Suh-Chin J.; Middleton, Ryan C.; Marbán, Eduardo; Molkentin, Jeffery D.

    2014-01-01

    If and how the heart regenerates after an injury event is highly debated. c-kit-expressing cardiac progenitor cells have been reported as the primary source for generation of new myocardium after injury. Here we generated two genetic approaches in mice to examine if endogenous c-kit+ cells contribute differentiated cardiomyocytes to the heart during development, with aging or after injury in adulthood. A cDNA encoding either Cre recombinase or a tamoxifen inducible MerCreMer chimeric protein was targeted to the Kit locus in mice and then bred with reporter lines to permanently mark cell lineage. Endogenous c-kit+ cells did produce new cardiomyocytes within the heart, although at a percentage of ≈0.03% or less, and if a preponderance towards cellular fusion is considered, the percentage falls below ≈0.008%. In contrast, c-kit+ cells amply generated cardiac endothelial cells. Thus, endogenous c-kit+ cells can generate cardiomyocytes within the heart, although likely at a functionally insignificant level. PMID:24805242

  5. The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.

    PubMed Central

    Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H

    1988-01-01

    We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795

  6. Low frequency of c-MPL gene mutations in Iranian patients with Philadelphia-negative myeloproliferative disorders.

    PubMed

    Ghotaslou, A; Nadali, F; Chahardouli, B; Alizad Ghandforosh, N; Rostami, S H; Alimoghaddam, K; Ghavamzadeh, A

    2015-01-01

    Myeloproliferative disorders are a group of diseases characterized by increased proliferation of myeloid lineage. In addition to JAK2V617F mutation, several mutations in the c-MPL gene have been reported in patients with philadelphia-negative chronic myeloproliferative disorders that could be important in the pathogenesis of diseases. The aim of the present study was to investigate the frequency of c-MPL and JAK2V617F mutations in Iranian patients with Philadelphia-negativemyeloproliferative disorders. Peripheral blood samples were collected from 60 patients with Philadelphia-negative MPD) Subgroups ET and PMF) and 25 healthy subjects as control group. The mutation status of c-MPL and Jak2V617F were investigated by using Amplification-refractory mutation system (ARMS) and Allele-Specific PCR (AS-PCR), respectively. The results were confirmed by sequencing. Among 60 patients, 34 (56.6%) and 1(1.7%) had Jak2V617F and c-MPL mutation, respectively. Patients with Jak2V617F mutation had higher WBC counts and hemoglobin concentration than those without the mutation (p= 0.005, p=0.003). In addition, for all healthy subjects in control group, mutations were negative. The present study revealed that the c-MPL mutations unlike the Jak2V617F mutations are rare in Iranian patients with Ph-negative MPNs and the low mutation rate should be considered in the design of screening strategies of MPD patients.

  7. Low frequency of c-MPL gene mutations in Iranian patients with Philadelphia-negative myeloproliferative disorders

    PubMed Central

    Ghotaslou, A; Nadali, F; Chahardouli, B; Alizad Ghandforosh, N; Rostami, SH; Alimoghaddam, K; Ghavamzadeh, A

    2015-01-01

    Background Myeloproliferative disorders are a group of diseases characterized by increased proliferation of myeloid lineage. In addition to JAK2V617F mutation, several mutations in the c-MPL gene have been reported in patients with philadelphia-negative chronic myeloproliferative disorders that could be important in the pathogenesis of diseases. The aim of the present study was to investigate the frequency of c-MPL and JAK2V617F mutations in Iranian patients with Philadelphia-negativemyeloproliferative disorders. Material and Methods Peripheral blood samples were collected from 60 patients with Philadelphia-negative MPD) Subgroups ET and PMF) and 25 healthy subjects as control group. The mutation status of c-MPL and Jak2V617F were investigated by using Amplification-refractory mutation system (ARMS) and Allele-Specific PCR (AS-PCR), respectively. The results were confirmed by sequencing. Results Among 60 patients, 34 (56.6%) and 1(1.7%) had Jak2V617F and c-MPL mutation, respectively. Patients with Jak2V617F mutation had higher WBC counts and hemoglobin concentration than those without the mutation (p= 0.005, p=0.003). In addition, for all healthy subjects in control group, mutations were negative. Conclusions The present study revealed that the c-MPL mutations unlike the Jak2V617F mutations are rare in Iranian patients with Ph-negative MPNs and the low mutation rate should be considered in the design of screening strategies of MPD patients. PMID:25914801

  8. DNA polymerase θ contributes to the generation of C/G mutations during somatic hypermutation of Ig genes

    PubMed Central

    Masuda, Keiji; Ouchida, Rika; Takeuchi, Arata; Saito, Takashi; Koseki, Haruhiko; Kawamura, Kiyoko; Tagawa, Masatoshi; Tokuhisa, Takeshi; Azuma, Takachika; O-Wang, Jiyang

    2005-01-01

    Somatic hypermutation of Ig variable region genes is initiated by activation-induced cytidine deaminase; however, the activity of multiple DNA polymerases is required to ultimately introduce mutations. DNA polymerase η (Polη) has been implicated in mutations at A/T, but polymerases involved in C/G mutations have not been identified. We have generated mutant mice expressing DNA polymerase (Polθ) specifically devoid of polymerase activity. Compared with WT mice, Polq-inactive (Polq, the gene encoding Polθ) mice exhibited a reduced level of serum IgM and IgG1. The mutant mice mounted relatively normal primary and secondary immune responses to a T-dependent antigen, but the production of high-affinity specific antibodies was partially impaired. Analysis of the JH4 intronic sequences revealed a slight reduction in the overall mutation frequency in Polq-inactive mice. Remarkably, although mutations at A/T were unaffected, mutations at C/G were significantly decreased, indicating an important, albeit not exclusive, role for Polθ activity. The reduction of C/G mutations was particularly focused on the intrinsic somatic hypermutation hotspots and both transitions and transversions were similarly reduced. These findings, together with the recent observation that Polθ efficiently catalyzes the bypass of abasic sites, lead us to propose that Polθ introduces mutations at C/G by replicating over abasic sites generated via uracil-DNA glycosylase. PMID:16172387

  9. Severe Clinical Course in a Patient with Congenital Amegakaryocytic Thrombocytopenia Due to a Missense Mutation of the c-MPL Gene.

    PubMed

    Ok Bozkaya, İkbal; Yaralı, Neşe; Işık, Pamir; Ünsal Saç, Rukiye; Tavil, Betül; Tunç, Bahattin

    2015-06-01

    Congenital amegakaryocytic thrombocytopenia (CAMT) generally begins at birth with severe thrombocytopenia and progresses to pancytopenia. It is caused by mutations in the thrombopoietin receptor gene, the myeloproliferative leukemia virus oncogene (c-MPL). The association between CAMT and c-MPL mutation type has been reported in the literature. Patients with CAMT have been categorized according to their clinical symptoms caused by different mutations. Missense mutations of c-MPL have been classified as type II and these patients have delayed onset of bone marrow failure compared to type I patients. Here we present a girl with severe clinical course of CAMT II having a missense mutation in exon 4 of the c-MPL gene who was admitted to our hospital with intracranial hemorrhage during the newborn period.

  10. [Identification of novel pathogenic gene mutations in pediatric acute myeloid leukemia by whole-exome resequencing].

    PubMed

    Shiba, Norio

    2015-12-01

    A new class of gene mutations, identified in the pathogenesis of adult acute myeloid leukemia (AML), includes DNMT3A, IDH1/2, TET2 and EZH2. However, these mutations are rare in pediatric AML cases, indicating that pathogeneses differ between adult and pediatric forms of AML. Meanwhile, the recent development of massively parallel sequencing technologies has provided a new opportunity to discover genetic changes across entire genomes or proteincoding sequences. In order to reveal a complete registry of gene mutations, we performed whole exome resequencing of paired tumor-normal specimens from 19 pediatric AML cases using Illumina HiSeq 2000. In total, 80 somatic mutations or 4.2 mutations per sample were identified. Many of the recurrent mutations identified in this study involved previously reported targets in AML, such as FLT3, CEBPA, KIT, CBL, NRAS, WT1 and EZH2. On the other hand, several genes were newly identified in the current study, including BCORL1 and major cohesin components such as SMC3 and RAD21. Whole exome resequencing revealed a complex array of gene mutations in pediatric AML genomes. Our results indicate that a subset of pediatric AML represents a discrete entity that could be discriminated from its adult counterpart, in terms of the spectrum of gene mutations.

  11. Sensitive and reliable detection of Kit point mutation Asp 816 to Val in pathological material

    PubMed Central

    Kähler, Christian; Didlaukat, Sabine; Feller, Alfred C; Merz, Hartmut

    2007-01-01

    Background Human mastocytosis is a heterogenous disorder which is linked to a gain-of-function mutation in the kinase domain of the receptor tyrosine kinase Kit. This D816V mutation leads to constitutive activation and phosphorylation of Kit with proliferative disorders of mast cells in the peripheral blood, skin, and spleen. Most PCR applications used so far are labour-intensive and are not adopted to daily routine in pathological laboratories. The method has to be robust and working on such different materials like archival formalin-fixed, paraffin-embedded tissue (FFPE) and blood samples. Such a method is introduced in this publication. Methods The Kit point mutation Asp 816 to Val is heterozygous which means a problem in detection by PCR because the wild-type allele is also amplified and the number of cells which bear the point mutation is in most of the cases low. Most PCR protocols use probes to block the wild-type allele during amplification with more or less satisfying result. This is why point-mutated forward primers were designed and tested for efficiency in amplification of the mutated allele. Results One primer combination (A) fits the most for the introduced PCR assay. It was able just to amplify the mutated allele with high specificity from different patient's materials (FFPE or blood) of varying quality and quantity. Moreover, the sensitivity for this assay was convincing because 10 ng of DNA which bears the point mutation could be detected in a total volume of 200 ng of DNA. Conclusion The PCR assay is able to deal with different materials (blood and FFPE) this means quality and quantity of DNA and can be used for high-througput screening because of its robustness. Moreover, the method is easy-to-use, not labour-intensive, and easy to realise in a standard laboratory. PMID:17900365

  12. The cyc1-11 mutation in yeast reverts by recombination with a nonallelic gene: composite genes determining the iso-cytochromes c.

    PubMed Central

    Ernst, J F; Stewart, J W; Sherman, F

    1981-01-01

    DNA sequence analysis of a cloned fragment directly established that the cyc1-11 mutation of iso-1-cytochrome c in the yeast Saccharomyces cerevisiae is a two-base-pair substitution that changes the CCA proline codon at amino acid position 76 to a UAA nonsense codon. Analysis of 11 revertant proteins and one cloned revertant gene showed that reversion of the cyc1-11 mutation can occur in three ways: a single base-pair substitution, which produces a serine replacement at position 76; recombination with the nonallelic CYC7 gene of iso-2-cytochrome c, which causes replacement of a segment in the cyc1-11 gene by the corresponding segment of the CYC7 gene; and either a two-base-pair substitution or recombination with the CYC7 gene, which causes the formation of the normal iso-1-cytochrome c sequence. These results demonstrate the occurrence of low frequencies of recombination between nonallelic genes having extensive but not complete homology. The formation of composite genes that share sequences from nonallelic genes may be an evolutionary mechanism for producing protein diversities and for maintaining identical sequences at different loci. Images PMID:6273865

  13. Analysis of gene mutations among South Indian patients with maple syrup urine disease: identification of four novel mutations.

    PubMed

    Narayanan, M P; Menon, Krishnakumar N; Vasudevan, D M

    2013-10-01

    Maple syrup urine disease (MSUD) is predominantly caused by mutations in the BCKDHA, BCKDHB and DBT genes, which encode for the E1alpha, E1beta and E2 subunits of the branched-chain alpha-keto acid dehydrogenase complex, respectively. Because disease causing mutations play a major role in the development of the disease, prenatal diagnosis at gestational level may have significance in making decisions by parents. Thus, this study was aimed to screen South Indian MSUD patients for mutations and assess the genotype-phenotype correlation. Thirteen patients diagnosed with MSUD by conventional biochemical screening such as urine analysis by DNPH test, thin layer chromatography for amino acids and blood amino acid quantification by HPLC were selected for mutation analysis. The entire coding regions of the BCKDHA, BCKDHB and DBT genes were analyzed for mutations by PCR-based direct DNA sequencing. BCKDHA and BCKDHB mutations were seen in 43% of the total ten patients, while disease-causing DBT gene mutation was observed only in 14%. Three patients displayed no mutations. Novel mutations were c.130C>T in BCKDHA gene, c. 599C>T and c.121_122delAC in BCKDHB gene and c.190G>A in DBT gene. Notably, patients harbouring these mutations were non-responsive to thiamine supplementation and other treatment regimens and might have a worse prognosis as compared to the patients not having such mutations. Thus, identification of these mutations may have a crucial role in the treatment as well as understanding the molecular mechanisms in MSUD.

  14. [Fluoroquinolone resistance mutations in topoisomerase genes of Salmonella typhimurium isolates].

    PubMed

    Guo, Yunchang; Pei, Xiaoyan; Liu, Xiumei

    2004-09-01

    Mutations in topoisomerase genes were main cause of the resistence of Salmonella typhimurium to fluoroquinolone. The MICs of three Salmonella typhimurium isolates X2, X7, X11 to ciprofloxacin were above 32 microg/ml, 0.38 microg/ml and 0.023 microg/ml, respectively. The genetic alterations in four topoisomerase genes, gyrA, gyrB, parC, and parE were detected by multiplex PCR amplimer conformation analysis in these three strains. X2 isolate showed both gyrA mutations (Ser83-->Phe, Asp87-->Asn) and parC mutation (Ser80-->Arg). X7 isolate showed a single gyrA mutation (Ser83-->Phe) and X11 isolate had no changes in all of the four quinolone resistance genes, gyrA, gyrB, parC, and parE. X7 isolate with a single gyrA mutation was less resistant to ciprofloxacin than X2 with double gyrA mutations and an additional parC mutation. GyrA and parC genes play important role of the resistance of Salmonella typhimurium to ciprofloxacin.

  15. Identification of Bangladeshi domestic cats with GM1 gangliosidosis caused by the c.1448G>C mutation of the feline GLB1 gene: case study.

    PubMed

    Uddin, Mohammad Mejbah; Hossain, Mohammad Alamgir; Rahman, Mohammad Mahbubur; Chowdhury, Morshedul Alam; Tanimoto, Takeshi; Yabuki, Akira; Mizukami, Keijiro; Chang, Hye-Sook; Yamato, Osamu

    2013-01-01

    GM1 gangliosidosis is a fatal, progressive neurodegenerative lysosomal storage disease caused by mutations in the β-galactosidase (GLB1) gene. In feline GM1 gangliosidosis, a pathogenic mutation (c.1448G>C) in the feline GLB1 gene was identified in Siamese cats in the United States and Japan and in Korat cats in Western countries. The present study found the homozygous c.1448G>C mutation in 2 apparent littermate native kittens in Bangladesh that were exhibiting neurological signs. This is the first identification of GM1 gangliosidosis in native domestic cats in Southeast Asia. This pathogenic mutation seems to have been present in the domestic cat population in the Siamese region and may have been transferred to pure breeds such as Siamese and Korat cats originating in this region.

  16. Nociceptive tuning by stem cell factor/c-Kit signaling.

    PubMed

    Milenkovic, Nevena; Frahm, Christina; Gassmann, Max; Griffel, Carola; Erdmann, Bettina; Birchmeier, Carmen; Lewin, Gary R; Garratt, Alistair N

    2007-12-06

    The molecular mechanisms regulating the sensitivity of sensory circuits to environmental stimuli are poorly understood. We demonstrate here a central role for stem cell factor (SCF) and its receptor, c-Kit, in tuning the responsiveness of sensory neurons to natural stimuli. Mice lacking SCF/c-Kit signaling displayed profound thermal hypoalgesia, attributable to a marked elevation in the thermal threshold and reduction in spiking rate of heat-sensitive nociceptors. Acute activation of c-Kit by its ligand, SCF, resulted in a reduced thermal threshold and potentiation of heat-activated currents in isolated small-diameter neurons and thermal hyperalgesia in mice. SCF-induced thermal hyperalgesia required the TRP family cation channel TRPV1. Lack of c-Kit signaling during development resulted in hypersensitivity of discrete mechanoreceptive neuronal subtypes. Thus, c-Kit can now be grouped with a small family of receptor tyrosine kinases, including c-Ret and TrkA, that control the transduction properties of sensory neurons.

  17. PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.

    PubMed

    Wimmer, Katharina; Wernstedt, Annekatrin

    2014-01-01

    The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.

  18. Mutations That Affect the Efficiency of Translation of mRNA for the cII Gene of Coliphage Lambda

    PubMed Central

    Dul, Ed; Mahoney, Michael E.; Wulff, Daniel L.

    1987-01-01

    Starting with the λ pRE- strain λctr1 cy3008, which forms clear plaques, we have isolated two mutant strains, λdya2 ctr1 cy3008 and λ dya3 ctr1 cy3008, that form plaques with very slightly turbid centers. The dya2 and dya3 mutations lie in the region of overlap between the PRE promoter and the ribosome recognition region of the cII gene, and have nucleotide alterations at positions -1 and +5 of pRE, and alterations of cII mRNA at -16 and -21 nucleotides before the initial AUG codon of the gene. Both mutations destabilize a stem structure that may be formed by cII mRNA, and dya2 also changes the sequence on cII mRNA that is complementary to the 3'-end of 16 S rRNA from 5'-UAAGGA-3' to 5'-UGAGGA-3'.—The dya2 and dya3 mutations, along with the ctr1 mutation, which destabilizes either of two alternate stem structures which may be formed by cII mRNA (these being more stable stem structures than the one affected by dya2 and dya3), were tested for their ability to reverse two cII- mutations that are characterized by inefficient translation of cII mRNA. These are cII3088, an A → G mutation four bases before the initial AUG codon, and cII3059 , a GUU → GAU (Val2 → Asp) second codon mutation. It was found that ctr1 completely reverses the translation defects of these two mutations, while dya2 partially reverses these translation defects. The dya3 mutation has no effect on translation efficiency under any condition tested. However neither the ctr1 mutation nor the dya2 mutation has much effect on translation efficiency in an otherwise cII+ background, indicating that other factors must limit the rate of translation of cII mRNA under these conditions. PMID:2953647

  19. [Cytochrome c oxydase-deficient Leigh syndrome with homozygous mutation in SURF1 gene].

    PubMed

    Monnot, S; Chabrol, B; Cano, A; Pellissier, J F; Collignon, P; Montfort, M F; Paquis-Flucklinger, V

    2005-05-01

    Leigh syndrome is a heterogeneous disorder, usually due to a defect in oxidative metabolism. Mutations in SURF1 gene have been identified in patients with cytochrome c oxidase deficiency. We report a homozygous splice site deletion [516-2_516-1delAG] in a young girl presenting with cytochrome c oxidase-deficient Leigh syndrome. Identification of molecular defect is indispensable for genetic counselling and prenatal diagnosis.

  20. miR-137 downregulates c-kit expression in acute myeloid leukemia.

    PubMed

    Hu, Yanping; Dong, Xiaolong; Chu, Guoming; Lai, Guangrui; Zhang, Bijun; Wang, Leitong; Zhao, Yanyan

    2017-06-01

    The oncogene c-kit plays a vital role in the pathogenesis of acute myeloid leukemia (AML). However, the mechanism of microRNAs targeting c-kit in AML has not been determined in detail. Moreover, the role miR-137 in tumor cell proliferation remains controversial. The aim of this work was to verify whether miR-137 targets c-kit and to research the biological effects of restoring miR-137 expression in leukemia cells. We found that miR-137 binds specifically to the 3'-UTR of c-kit and suppresses the expression and activities of c-kit. There is a negative correlation between miR-137 and c-kit expression in both patients and cell lines determined by screening large clinical samples. We found that miR-137 can inhibit proliferation, promote apoptosis, and induce differentiation of c-kit+ AML cells. We determined that miR-137 can participate in the leukemogenesis by regulating c-kit, which could be used as a therapeutic target for acute myeloid leukemia. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Glucokinase gene mutations (MODY 2) in Asian Indians.

    PubMed

    Kanthimathi, Sekar; Jahnavi, Suresh; Balamurugan, Kandasamy; Ranjani, Harish; Sonya, Jagadesan; Goswami, Soumik; Chowdhury, Subhankar; Mohan, Viswanathan; Radha, Venkatesan

    2014-03-01

    Heterozygous inactivating mutations in the glucokinase (GCK) gene cause a hyperglycemic condition termed maturity-onset diabetes of the young (MODY) 2 or GCK-MODY. This is characterized by mild, stable, usually asymptomatic, fasting hyperglycemia that rarely requires pharmacological intervention. The aim of the present study was to screen for GCK gene mutations in Asian Indian subjects with mild hyperglycemia. Of the 1,517 children and adolescents of the population-based ORANGE study in Chennai, India, 49 were found to have hyperglycemia. These children along with the six patients referred to our center with mild hyperglycemia were screened for MODY 2 mutations. The GCK gene was bidirectionally sequenced using BigDye(®) Terminator v3.1 (Applied Biosystems, Foster City, CA) chemistry. In silico predictions of the pathogenicity were carried out using the online tools SIFT, Polyphen-2, and I-Mutant 2.0 software programs. Direct sequencing of the GCK gene in the patients referred to our Centre revealed one novel mutation, Thr206Ala (c.616A>G), in exon 6 and one previously described mutation, Met251Thr (c.752T>C), in exon 7. In silico analysis predicted the novel mutation to be pathogenic. The highly conserved nature and critical location of the residue Thr206 along with the clinical course suggests that the Thr206Ala is a MODY 2 mutation. However, we did not find any MODY 2 mutations in the 49 children selected from the population-based study. Hence prevalence of GCK mutations in Chennai is <1:1,517. This is the first study of MODY 2 mutations from India and confirms the importance of considering GCK gene mutation screening in patients with mild early-onset hyperglycemia who are negative for β-cell antibodies.

  2. Imatinib in systemic mastocytosis: a phase IV clinical trial in patients lacking exon 17 KIT mutations and review of the literature

    PubMed Central

    Alvarez-Twose, Iván; Matito, Almudena; Morgado, José Mário; Sánchez-Muñoz, Laura; Jara-Acevedo, María; García-Montero, Andrés; Mayado, Andrea; Caldas, Carolina; Teodósio, Cristina; Muñoz-González, Javier Ignacio; Mollejo, Manuela; Escribano, Luis; Orfao, Alberto

    2017-01-01

    Resistance to imatinib has been recurrently reported in systemic mastocytosis (SM) carrying exon 17 KIT mutations. We evaluated the efficacy and safety of imatinib therapy in 10 adult SM patients lacking exon 17 KIT mutations, 9 of which fulfilled criteria for well-differentiated SM (WDSM). The World Health Organization 2008 disease categories among WDSM patients were mast cell (MC) leukemia (n = 3), indolent SM (n = 3) and cutaneous mastocytosis (n = 3); the remainder case had SM associated with a clonal haematological non-MC disease. Patients were given imatinib for 12 months −400 or 300 mg daily depending on the presence vs. absence of > 30% bone marrow (BM) MCs and/or signs of advanced disease–. Absence of exon 17 KIT mutations was confirmed in highly-purified BM MCs by peptide nucleic acid-mediated PCR, while mutations involving other exons were investigated by direct sequencing of purified BM MC DNA. Complete response (CR) was defined as resolution of BM MC infiltration, skin lesions, organomegalies and MC-mediator release-associated symptoms, plus normalization of serum tryptase. Criteria for partial response (PR) included ≥ 50% reduction in BM MC infiltration and improvement of skin lesions and/or organomegalies. Treatment was well-tolerated with an overall response rate of 50%, including early and sustained CR in four patients, three of whom had extracellular mutations of KIT, and PR in one case. This later patient and all non-responders (n = 5) showed wild-type KIT. These results together with previous data from the literature support the relevance of the KIT mutational status in selecting SM patients who are candidates for imatinib therapy. PMID:28978170

  3. Imatinib in systemic mastocytosis: a phase IV clinical trial in patients lacking exon 17 KIT mutations and review of the literature.

    PubMed

    Alvarez-Twose, Iván; Matito, Almudena; Morgado, José Mário; Sánchez-Muñoz, Laura; Jara-Acevedo, María; García-Montero, Andrés; Mayado, Andrea; Caldas, Carolina; Teodósio, Cristina; Muñoz-González, Javier Ignacio; Mollejo, Manuela; Escribano, Luis; Orfao, Alberto

    2017-09-15

    Resistance to imatinib has been recurrently reported in systemic mastocytosis (SM) carrying exon 17 KIT mutations. We evaluated the efficacy and safety of imatinib therapy in 10 adult SM patients lacking exon 17 KIT mutations, 9 of which fulfilled criteria for well-differentiated SM (WDSM). The World Health Organization 2008 disease categories among WDSM patients were mast cell (MC) leukemia ( n = 3), indolent SM ( n = 3) and cutaneous mastocytosis ( n = 3); the remainder case had SM associated with a clonal haematological non-MC disease. Patients were given imatinib for 12 months -400 or 300 mg daily depending on the presence vs. absence of > 30% bone marrow (BM) MCs and/or signs of advanced disease-. Absence of exon 17 KIT mutations was confirmed in highly-purified BM MCs by peptide nucleic acid-mediated PCR, while mutations involving other exons were investigated by direct sequencing of purified BM MC DNA. Complete response (CR) was defined as resolution of BM MC infiltration, skin lesions, organomegalies and MC-mediator release-associated symptoms, plus normalization of serum tryptase. Criteria for partial response (PR) included ≥ 50% reduction in BM MC infiltration and improvement of skin lesions and/or organomegalies. Treatment was well-tolerated with an overall response rate of 50%, including early and sustained CR in four patients, three of whom had extracellular mutations of KIT , and PR in one case. This later patient and all non-responders ( n = 5) showed wild-type KIT . These results together with previous data from the literature support the relevance of the KIT mutational status in selecting SM patients who are candidates for imatinib therapy.

  4. Optic atrophy and a Leigh-like syndrome due to mutations in the c12orf65 gene: report of a novel mutation and review of the literature.

    PubMed

    Heidary, Gena; Calderwood, Laurel; Cox, Gerald F; Robson, Caroline D; Teot, Lisa A; Mullon, Jennifer; Anselm, Irina

    2014-03-01

    Combined oxidative phosphorylation deficiency type 7 (COXPD7) is a rare disorder of mitochondrial metabolism that results in optic atrophy and Leigh syndrome-like disease. We describe 2 siblings with compound heterozygous mutations in the recently identified C12orf65 gene who presented with optic atrophy and mild developmental delays and subsequently developed bilateral, symmetric lesions in the brainstem reminiscent of Leigh syndrome. Repeat neuroimaging demonstrated reversibility of the findings in 1 sibling and persistent metabolic stroke in the other. This article highlights the phenotypic manifestations from a novel mutation in the C12orf65 gene and reviews the clinical presentation of the 5 other individuals reported to date who carry mutations in this gene.

  5. Clinical correlates of the presence of the Asp816Val c-kit mutation in the peripheral blood mononuclear cells of patients with mastocytosis.

    PubMed

    Worobec, A S; Semere, T; Nagata, H; Metcalfe, D D

    1998-11-15

    The Asp816Val mutation in the catalytic domain of the c-kit receptor has been identified in patients with systemic mastocytosis. To determine whether this mutation is associated with identifiable clinical patterns of disease and prognosis, a total of 65 patients with mastocytosis were screened for the presence of the Asp816Val mutation in peripheral blood mononuclear cells (PBMCs). By analysis of HinfI digestion products, the authors found that the overall prevalence of this mutation in the current patient series was 25%. The presence of the Asp816Val mutation in PBMCs was observed in 15 adults (of 16 Asp816Val mutation positive patients) and 1 infant, but not in any children with mastocytosis. Patients whose PBMCs were positive for this mutation (category II and a subset of category Ib mastocytosis patients) manifested a more severe disease pattern, with clinical features ranging in severity from early to advanced myelodysplastic or myeloproliferative syndromes. These patients more commonly had osteosclerotic bone involvement (a clinical feature primarily observed in mastocytosis patients with an associated hematologic disorder) as well as immunoglobulin dysregulation and peripheral blood abnormalities. Furthermore, pedigree analysis of three families provided evidence that the mutation was somatic. Twenty-five percent of all patients with mastocytosis had the Asp816Val mutation in PBMCs; 56% of these patients had evidence of a myelodysplastic or myeloproliferative syndrome, and 44% had been clinically placed in the indolent mastocytosis category, suggesting that the current classification scheme used to assign prognosis may be inadequate. Therefore, determination of the presence or absence of this mutation in PBMCs of mastocytosis patients offers a useful adjunct in determining the extent of workup and assigning prognosis in this complex and heterogeneous disease.

  6. Wilms tumor gene 1 (WT1), TP53, RAS/BRAF and KIT aberrations in testicular germ cell tumors.

    PubMed

    Boublikova, L; Bakardjieva-Mihaylova, V; Skvarova Kramarzova, K; Kuzilkova, D; Dobiasova, A; Fiser, K; Stuchly, J; Kotrova, M; Buchler, T; Dusek, P; Grega, M; Rosova, B; Vernerova, Z; Klezl, P; Pesl, M; Zachoval, R; Krolupper, M; Kubecova, M; Stahalova, V; Abrahamova, J; Babjuk, M; Kodet, R; Trka, J

    2016-07-01

    Wilms tumor gene 1 (WT1), a zinc-finger transcription factor essential for testis development and function, along with other genes, was investigated for their role in the pathogenesis of testicular germ cell tumors (TGCT). In total, 284 TGCT and 100 control samples were investigated, including qPCR for WT1 expression and BRAF mutation, p53 immunohistochemistry detection, and massively parallel amplicon sequencing. WT1 was significantly (p < 0.0001) under-expressed in TGCT, with an increased ratio of exon 5-lacking isoforms, reaching low levels in chemo-naïve relapsed TGCT patients vs. high levels in chemotherapy-pretreated relapsed patients. BRAF V600E mutation was identified in 1% of patients only. p53 protein was lowly expressed in TGCT metastases compared to the matched primary tumors. Of 9 selected TGCT-linked genes, RAS/BRAF and WT1 mutations were frequent while significant TP53 and KIT variants were not detected (p = 0.0003). WT1 has been identified as a novel factor involved in TGCT pathogenesis, with a potential prognostic impact. Distinct biologic nature of the two types of relapses occurring in TGCT has been demonstrated. Differential mutation rate of the key TGCT-related genes has been documented. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. FUNCTIONAL DEREGULATION OF KIT: LINK TO MAST CELL PROLIFERATIVE DISEASES AND OTHER NEOPLASMS

    PubMed Central

    Cruse, Glenn; Metcalfe, Dean D.; Olivera, Ana

    2014-01-01

    SYNOPSIS Signaling through the receptor tyrosine kinase KIT mediates differentiation, proliferation and survival of hematopoietic precursor cells and mast cells. Constitutive KIT signaling due to somatic point mutations in c-Kit is an important occurrence in the development of mast cell proliferation disorders and other hematological malignancies. In this review, we discuss the common gain-of-function mutations found in these malignancies, particularly in mast cell proliferation disorders, and summarize the current understanding of the molecular mechanisms by which transforming point mutations in KIT may affect KIT structure and function and lead to altered downstream signaling and cellular transformation. Drugs targeting KIT have shown mixed success in the treatment of these diseases. A brief overview of the most common KIT inhibitors currently used, the reasons for the varied clinical results of such inhibitors and a discussion of potential new strategies are provided. PMID:24745671

  8. Increased c-kit and stem cell factor expression in the pulmonary vasculature of nitrofen-induced congenital diaphragmatic hernia.

    PubMed

    Takahashi, Toshiaki; Friedmacher, Florian; Zimmer, Julia; Puri, Prem

    2016-05-01

    Persistent pulmonary hypertension(PPH) in congenital diaphragmatic hernia (CDH) is caused by increased vascular cell proliferation and endothelial cell (EC) dysfunction, thus leading to obstructive changes in the pulmonary vasculature. C-Kit and its ligand, stem cell factor(SCF), are expressed by ECs in the developing lung mesenchyme, suggesting an important role during lung vascular formation. Conversely, absence of c-Kit expression has been demonstrated in ECs of dysplastic alveolar capillaries. We hypothesized that c-Kit and SCF expression is increased in the pulmonary vasculature of nitrofen-induced CDH. Timed-pregnant rats received nitrofen or vehicle on gestational day 9(D9). Fetuses were sacrificed on D15, D18, and D21, and divided into control and CDH group. Pulmonary gene expression levels of c-Kit and SCF were analyzed by qRT-PCR. Immunofluorescence double staining for c-Kit and SCF was combined with CD34 to evaluate protein expression in ECs of the pulmonary vasculature. Relative mRNA levels of c-Kit and SCF were significantly increased in lungs of CDH fetuses on D15, D18, and D21 compared to controls. Confocal laser scanning microscopy confirmed markedly increased vascular c-Kit and SCF expression in mesenchymal ECs of CDH lungs on D15, D18, and D21 compared to controls. Increased expression of c-Kit and SCF in the pulmonary vasculature of nitrofen-induced CDH lungs suggest that increased c-Kit signaling during lung vascular formation may contribute to vascular remodeling and thus to PPH. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Ancestral association between HLA and HFE H63D and C282Y gene mutations from northwest Colombia

    PubMed Central

    Rodriguez, Libia M; Giraldo, Mabel C; Velasquez, Laura I; Alvarez, Cristiam M; Garcia, Luis F; Jimenez-Del-Rio, Marlene; Velez-Pardo, Carlos

    2015-01-01

    A significant association between HFE gene mutations and the HLA-A*03-B*07 and HLA-A*29-B*44 haplotypes has been reported in the Spanish population. It has been proposed that these mutations are probably connected with Celtic and North African ancestry, respectively. We aimed to find the possible ancestral association between HLA alleles and haplotypes associated with the HFE gene (C282Y and H63D) mutations in 214 subjects from Antioquia, Colombia. These were 18 individuals with presumed hereditary hemochromatosis (“HH”) and 196 controls. The HLA-B*07 allele was in linkage disequilibrium (LD) with C282Y, while HLA-A*23, A*29, HLA-B*44, and B*49 were in LD with H63D. Altogether, our results show that, although the H63D mutation is more common in the Antioquia population, it is not associated with any particular HLA haplotype, whereas the C282Y mutation is associated with HLA-A*03-B*07, this supporting a northern Spaniard ancestry. PMID:25983618

  10. Ancestral association between HLA and HFE H63D and C282Y gene mutations from northwest Colombia.

    PubMed

    Rodriguez, Libia M; Giraldo, Mabel C; Velasquez, Laura I; Alvarez, Cristiam M; Garcia, Luis F; Jimenez-Del-Rio, Marlene; Velez-Pardo, Carlos

    2015-03-01

    A significant association between HFE gene mutations and the HLA-A*03-B*07 and HLA-A*29-B*44 haplotypes has been reported in the Spanish population. It has been proposed that these mutations are probably connected with Celtic and North African ancestry, respectively. We aimed to find the possible ancestral association between HLA alleles and haplotypes associated with the HFE gene (C282Y and H63D) mutations in 214 subjects from Antioquia, Colombia. These were 18 individuals with presumed hereditary hemochromatosis ("HH") and 196 controls. The HLA-B*07 allele was in linkage disequilibrium (LD) with C282Y, while HLA-A*23, A*29, HLA-B*44, and B*49 were in LD with H63D. Altogether, our results show that, although the H63D mutation is more common in the Antioquia population, it is not associated with any particular HLA haplotype, whereas the C282Y mutation is associated with HLA-A*03-B*07, this supporting a northern Spaniard ancestry.

  11. Mutant KIT as imatinib-sensitive target in metastatic sinonasal carcinoma.

    PubMed

    Dieter, S M; Heining, C; Agaimy, A; Huebschmann, D; Bonekamp, D; Hutter, B; Ehrenberg, K R; Fröhlich, M; Schlesner, M; Scholl, C; Schlemmer, H-P; Wolf, S; Mavratzas, A; Jung, C S; Gröschel, S; von Kalle, C; Eils, R; Brors, B; Penzel, R; Kriegsmann, M; Reuss, D E; Schirmacher, P; Stenzinger, A; Federspil, P A; Weichert, W; Glimm, H; Fröhling, S

    2017-01-01

    Sinonasal carcinomas (SNCs) comprise various rare tumor types that are characterized by marked histologic diversity and largely unknown molecular profiles, yet share an overall poor prognosis owing to an aggressive clinical course and frequent late-stage diagnosis. The lack of effective systemic therapies for locally advanced or metastatic SNC poses a major challenge to therapeutic decision making for individual patients. We here aimed to identify actionable genetic alterations in a patient with metastatic SNC whose tumor, despite all diagnostic efforts, could not be assigned to any known SNC category and was refractory to multimodal therapy. We used whole-exome and transcriptome sequencing to identify a KIT exon 11 mutation (c.1733_1735del, p.D579del) as potentially druggable target in this patient and carried out cancer hotspot panel sequencing to detect secondary resistance-conferring mutations in KIT. Furthermore, as a step towards clinical exploitation of the recently described signatures of mutational processes in cancer genomes, we established and applied a novel bioinformatics algorithm that enables supervised analysis of the mutational catalogs of individual tumors. Molecularly guided treatment with imatinib in analogy to the management of gastrointestinal stromal tumor (GIST) resulted in a dramatic and durable response with remission of nearly all tumor manifestations, indicating a dominant driver function of mutant KIT in this tumor. KIT dependency was further validated by a secondary KIT exon 17 mutation (c.2459_2462delATTCinsG, p.D820_S821delinsG) that was detected upon tumor progression after 10 months of imatinib treatment and provided a rationale for salvage therapy with regorafenib, which has activity against KIT exon 11/17 mutant GIST. These observations highlight the potential of unbiased genomic profiling for uncovering the vulnerabilities of individual malignancies, particularly in rare and unclassifiable tumors, and underscore that KIT exon 11

  12. Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    PubMed

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

  13. Complex I deficiency related to T10158C mutation ND3 gene: A further definition of the clinical spectrum.

    PubMed

    Grosso, Salvatore; Carluccio, Maria Alessandra; Cardaioli, Elena; Cerase, Alfonso; Malandrini, Alessandro; Romano, Chiara; Federico, Antonio; Dotti, Maria Teresa

    2017-03-01

    Complex I deficiency is the most common energy generation disorder which may clinically present at any age with a wide spectrum of symptoms and signs. The T10158C mutation ND3 gene is rare and occurs in patients showing an early rapid neurological deterioration invariably leading to death after a few months. We report a 9year-old boy with a mtDNA T10158C mutation showing a mild MELAS-like phenotype and brain MRI features congruent with both MELAS and Leigh syndrome. Epilepsia partialis continua also occurred in the clinical course and related to a mild cortical atrophy of the left perisylvian area. The present case confirms that the clinical spectrum of Complex I deficiency related to T10158C mutation ND3 gene is wider than previously described. Our observation further suggests that testing mutation in the MT-ND3 gene should be included in the diagnostic work-up of patients presenting with epilepsia partialis continua accompanied by suspicion of mitochondrial disorder. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  14. A Frameshift Mutation in KIT is Associated with  White Spotting in the Arabian Camel.

    PubMed

    Holl, Heather; Isaza, Ramiro; Mohamoud, Yasmin; Ahmed, Ayeda; Almathen, Faisal; Youcef, Cherifi; Gaouar, Semir; Antczak, Douglas F; Brooks, Samantha

    2017-03-09

    While the typical Arabian camel is characterized by a single colored coat, there are rare populations with white spotting patterns. White spotting coat patterns are found in virtually all domesticated species, but are rare in wild species. Theories suggest that white spotting is linked to the domestication process, and is occasionally associated with health disorders. Though mutations have been found in a diverse array of species, fewer than 30 genes have been associated with spotting patterns, thus providing a key set of candidate genes for the Arabian camel. We obtained 26 spotted camels and 24 solid controls for candidate gene analysis. One spotted and eight solid camels were whole genome sequenced as part of a separate project. The spotted camel was heterozygous for a frameshift deletion in KIT (c.1842delG, named KITW1 for White spotting 1), whereas all other camels were wild-type (KIT+/KIT+). No additional mutations unique to the spotted camel were detected in the EDNRB, EDN3, SOX10, KITLG, PDGFRA, MITF, and PAX3 candidate white spotting genes. Sanger sequencing of the study population identified an additional five kITW1/KIT+ spotted camels. The frameshift results in a premature stop codon five amino acids downstream, thus terminating KIT at the tyrosine kinase domain. An additional 13 spotted camels tested KIT+/KIT+, but due to phenotypic differences when compared to the KITW1/KIT+ camels, they likely represent an independent mutation. Our study suggests that there are at least two causes of white spotting in the Arabian camel, the newly described KITW1 allele and an uncharacterized mutation.

  15. [Mutation analysis of FAH gene in patients with tyrosinemia type 1].

    PubMed

    Dou, Li-Min; Fang, Ling-Juan; Wang, Xiao-Hong; Lu, Wei; Chen, Rui; Li, Li-Ting; Zhao, Jing; Wang, Jian-She

    2013-04-01

    To investigate the clinical features and mutations of the FAH gene. Clinical records of two cases were collected, and diagnosis was made according to the diagnostic criteria of the International Organization for Rare Disorders (NORD). Genomic DNA was extracted from peripheral blood leukocytes with QIAamp DNA Mini Kit. The DNA extracts were subjected to direct sequencing for 14 exons together with adjacent fragments of FAH gene using ABI Prism 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA) after PCR based on genomic DNA. The mutation source was verified by analyzing parents' exons corresponding to patients' mutation exons. The homology between human FAH enzyme and that of other species was surveyed using software Clustal X(European Bioinformatics Institute, Hinxton, Saffron Walde, UK). Polyphen (Polymorphism Phenotyping), available online, were used to predict possible impact of an amino acid substitution on structure and function of FAH enzyme. Polyphen calculates position-specific independent counts (PISC) scores for two amino acid variants in polymorphic position. A PISC scores that differ by > 2 were regarded as indicating the probability of damaging variants. Patient 1 was a 5 months and 21 days-old boy who suffered from persistent diarrhea, hepatomegaly, ascites; Alpha-fetoprotein > 1210 µg/L, levels of tyrosine in blood and succinylacetone in urine were 110.8 µmol/L and 83.7 µmol/L. His sister suffered from tyrosinemia type 1. Direct sequencing showed a G to A transition in CDS position 455 and 1027. He was compound heterozygous for the mutation c.455G > A/c.1027G > A, which predicts a change from tryptophan to a stop codon (TGG > TAG) at position 152 (W152X) and a change from glycine to arginine (GGG > AGG) at position 343 respectively. Patient 2 was a 6 year and 1 month-old girl with late-onset rickets who had signs of hepatosplenomegaly, rachitic rosary, windswept knees. Hypophosphatemia and alkaline phosphatase 1620 IU/L were detected

  16. Differential effects of c-fms and c-kit ligands on the lineage development of the lymphohematopoietic cell line EML C1.

    PubMed

    Tsai, S

    1996-01-01

    The lymphohematopoietic progenitors represent < 0.01% of nucleated marrow cells. We have shown that murine lymphohematopoietic progenitors can be immortalized by a recombinant retroviral vector harboring a dominant-negative retinoic acid (RA) receptor. The immortalized progenitors proliferate as a stem-cell factor-dependent clonal line designated EML C1. The EML C1 cell line spontaneously generates prepro-B-lymphocytes and erythroid and myeloid progenitors. Upon stimulation with interleukin 7 and marrow stromal cells, the prepro-B-lymphocytes express recombination-activating gene 1 (RAG-1) and undergo D-J rearrangements of the immunoglobulin heavy-chain genes. With erythropoietin, the erythroid progenitors proliferate and differentiate into red cells. Generation of the common progenitors for neutrophils and macrophages [colony-forming units-granulocyte-macrophage (CFU-GM)] is suppressed in EML C1 cells but is inducible by high concentrations of RA. An additional block in neutrophil differentiation occurs at the promyelocyte stage, but this can also be overcome by high concentrations of RA. Although c-fms is homologous to c-kit, which encodes the receptor for stem-cell factor (SCF), EML C1 cells neither express c-fms nor respond to macrophage colony-stimulating factor (M-CSF), the ligand for c-fms. Transduction and expression of c-fms cDNA in EML C1 cells confers responsiveness to M-CSF. This finding indicates that c-kit and c-fms share substantially overlapping signal-transduction pathways. However, c-fms-transduced EML C1 cells (EML C1/c-fms cells) exhibit different development patterns when stimulated by SCF alone or by M-CSF alone. When stimulated by SCF alone, EML C1/c-fms cells show mostly erythroid and B-lymphoid development. When stimulated by M-CSF alone, development switches to mostly myeloid (neutrophil and macrophage) development. This observation suggests that c-kit and c-fms must have unique signal-transduction pathways in addition to the common ones.

  17. Differential Effects of CSF-1R D802V and KIT D816V Homologous Mutations on Receptor Tertiary Structure and Allosteric Communication

    PubMed Central

    Da Silva Figueiredo Celestino Gomes, Priscila; Panel, Nicolas; Laine, Elodie; Pascutti, Pedro Geraldo; Solary, Eric; Tchertanov, Luba

    2014-01-01

    The colony stimulating factor-1 receptor (CSF-1R) and the stem cell factor receptor KIT, type III receptor tyrosine kinases (RTKs), are important mediators of signal transduction. The normal functions of these receptors can be compromised by gain-of-function mutations associated with different physiopatological impacts. Whereas KIT D816V/H mutation is a well-characterized oncogenic event and principal cause of systemic mastocytosis, the homologous CSF-1R D802V has not been identified in human cancers. The KIT D816V oncogenic mutation triggers resistance to the RTK inhibitor Imatinib used as first line treatment against chronic myeloid leukemia and gastrointestinal tumors. CSF-1R is also sensitive to Imatinib and this sensitivity is altered by mutation D802V. Previous in silico characterization of the D816V mutation in KIT evidenced that the mutation caused a structure reorganization of the juxtamembrane region (JMR) and facilitated its departure from the kinase domain (KD). In this study, we showed that the equivalent CSF-1R D802V mutation does not promote such structural effects on the JMR despite of a reduction on some key H-bonds interactions controlling the JMR binding to the KD. In addition, this mutation disrupts the allosteric communication between two essential regulatory fragments of the receptors, the JMR and the A-loop. Nevertheless, the mutation-induced shift towards an active conformation observed in KIT D816V is not observed in CSF-1R D802V. The distinct impact of equivalent mutation in two homologous RTKs could be associated with the sequence difference between both receptors in the native form, particularly in the JMR region. A local mutation-induced perturbation on the A-loop structure observed in both receptors indicates the stabilization of an inactive non-inhibited form, which Imatinib cannot bind. PMID:24828813

  18. Clinical Impact of Additional Cytogenetic Aberrations, cKIT and RAS Mutations, and Treatment Elements in Pediatric t(8;21)-AML: Results From an International Retrospective Study by the International Berlin-Frankfurt-Münster Study Group

    PubMed Central

    Klein, Kim; Kaspers, Gertjan; Harrison, Christine J.; Beverloo, H. Berna; Reedijk, Ardine; Bongers, Mathilda; Cloos, Jacqueline; Pession, Andrea; Reinhardt, Dirk; Zimmerman, Martin; Creutzig, Ursula; Dworzak, Michael; Alonzo, Todd; Johnston, Donna; Hirsch, Betsy; Zapotocky, Michal; De Moerloose, Barbara; Fynn, Alcira; Lee, Vincent; Taga, Takashi; Tawa, Akio; Auvrignon, Anne; Zeller, Bernward; Forestier, Erik; Salgado, Carmen; Balwierz, Walentyna; Popa, Alexander; Rubnitz, Jeffrey; Raimondi, Susana; Gibson, Brenda

    2015-01-01

    Purpose This retrospective cohort study aimed to determine the predictive relevance of clinical characteristics, additional cytogenetic aberrations, and cKIT and RAS mutations, as well as to evaluate whether specific treatment elements were associated with outcomes in pediatric t(8;21)-positive patients with acute myeloid leukemia (AML). Patients and Methods Karyotypes of 916 pediatric patients with t(8;21)-AML were reviewed for the presence of additional cytogenetic aberrations, and 228 samples were screened for presence of cKIT and RAS mutations. Multivariable regression models were used to assess the relevance of anthracyclines, cytarabine, and etoposide during induction and overall treatment. End points were the probability of achieving complete remission, cumulative incidence of relapse (CIR), probability of event-free survival, and probability of overall survival. Results Of 838 patients included in final analyses, 92% achieved complete remission. The 5-year overall survival, event-free survival, and CIR were 74%, 58%, and 26%, respectively. cKIT mutations and RAS mutations were not significantly associated with outcome. Patients with deletions of chromosome arm 9q [del(9q); n = 104] had a lower probability of complete remission (P = .01). Gain of chromosome 4 (+4; n = 21) was associated with inferior CIR and survival (P < .01). Anthracycline doses greater than 150 mg/m2 and etoposide doses greater than 500 mg/m2 in the first induction course and high-dose cytarabine 3 g/m2 during induction were associated with better outcomes on various end points. Cumulative doses of cytarabine greater than 30 g/m2 and etoposide greater than 1,500 mg/m2 were associated with lower CIR rates and better probability of event-free survival. Conclusion Pediatric patients with t(8;21)-AML and additional del(9q) or additional +4 might not be considered at good risk. Patients with t(8;21)-AML likely benefit from protocols that have high doses of anthracyclines, etoposide, and

  19. Fanconi anemia founder mutation in Macedonian patients.

    PubMed

    Madjunkova, Svetlana; Kocheva, Svetlana A; Plaseska-Karanfilska, Dijana

    2014-01-01

    Fanconi anemia (FA) is a rare autosomal recessive disorder clinically characterized by developmental abnormalities, progressive bone marrow failure (BMF) and profound cancer predisposition. Approximately 65% of all affected individuals have mutation in the FANCA (Fanconi anemia complementation group A) gene. The mutation spectrum of the FANCA gene is highly heterogeneous. FA-A is usually associated with private FANCA mutations in individual families. We describe 3 unrelated patients with FA with a similar clinical presentation: BMF, renal anomalies and café-au-lait pigmentation without major skeletal abnormality. The molecular analysis of the FANCA gene using the FA MLPA kit P031-A2/P032 FANCA, showed homozygous deletion of exon 3 in all 3 patients. Molecular analysis of the flanking regions of exon 3 precisely defined unique deletion of 2,040 bp and duplication of C (1788_3828dupC). These are the first 3 patients homozygous for deletion of FANCA exon 3 described to date. Although not related, the patients originated from the same Gypsy-like ethnic population. We conclude that c.190-256_283 + 1680del2040 dupC mutation in the FANCA gene is a founder mutation in Macedonian FA patients of Gypsy-like ethnic origin. Our finding has very strong implications for these patients in formulating diagnostic and carrier-screening strategy for BMF and FA and to enable comprehensive genetic counseling. © 2013 S. Karger AG, Basel.

  20. The high frequency of GJB2 gene mutation c.313_326del14 suggests its possible origin in ancestors of Lithuanian population.

    PubMed

    Mikstiene, Violeta; Jakaitiene, Audrone; Byckova, Jekaterina; Gradauskiene, Egle; Preiksaitiene, Egle; Burnyte, Birute; Tumiene, Birute; Matuleviciene, Ausra; Ambrozaityte, Laima; Uktveryte, Ingrida; Domarkiene, Ingrida; Rancelis, Tautvydas; Cimbalistiene, Loreta; Lesinskas, Eugenijus; Kucinskas, Vaidutis; Utkus, Algirdas

    2016-02-19

    Congenital hearing loss (CHL) is diagnosed in 1 - 2 newborns in 1000, genetic factors contribute to two thirds of CHL cases in industrialised countries. Mutations of the GJB2 gene located in the DFNB1 locus (13q11-12) are a major cause of CHL worldwide. The aim of this cross-sectional study was to assess the contribution of the DFNB1 locus containing the GJB2 and GJB6 genes in the development of early onset hearing loss in the affected group of participants, to determine the population-specific mutational profile and DFNB1-related HL burden in Lithuanian population. Clinical data were obtained from a collection of 158 affected participants (146 unrelated probands) with early onset non-syndromic HL. GJB2 and GJB6 gene sequencing and GJB6 gene deletion testing were performed. The data of GJB2 and GJB6 gene sequencing in 98 participants in group of self-reported healthy Lithuanian inhabitants were analysed. Statistic summary, homogeneity tests, and logistic regression analysis were used for the assessment of genotype-phenotype correlation. Our findings show 57.5% of affected participants with two pathogenic GJB2 gene mutations identified. The most prevalent GJB2 mutations were c.35delG, p. (Gly12Valfs*2) (rs80338939) and c.313_326del14, p. (Lys105Glyfs*5) (rs111033253) with allele frequencies 64.7% and 28.3% respectively. GJB6 gene mutations were not identified in the affected group of participants. The statistical analysis revealed significant differences between GJB2(-) and GJB2(+) groups in disease severity (p = 0.001), and family history (p = 0.01). The probability of identification of GJB2 mutations in patients with various HL characteristics was estimated. The carrier rate of GJB2 gene mutations - 7.1% (~1 in 14) was identified in the group of healthy participants and a high frequency of GJB2-related hearing loss was estimated in our population. The results show a very high proportion of GJB2-positive individuals in the research group affected with sensorineural

  1. Multiscale mutation clustering algorithm identifies pan-cancer mutational clusters associated with pathway-level changes in gene expression

    PubMed Central

    Poole, William; Leinonen, Kalle; Shmulevich, Ilya

    2017-01-01

    Cancer researchers have long recognized that somatic mutations are not uniformly distributed within genes. However, most approaches for identifying cancer mutations focus on either the entire-gene or single amino-acid level. We have bridged these two methodologies with a multiscale mutation clustering algorithm that identifies variable length mutation clusters in cancer genes. We ran our algorithm on 539 genes using the combined mutation data in 23 cancer types from The Cancer Genome Atlas (TCGA) and identified 1295 mutation clusters. The resulting mutation clusters cover a wide range of scales and often overlap with many kinds of protein features including structured domains, phosphorylation sites, and known single nucleotide variants. We statistically associated these multiscale clusters with gene expression and drug response data to illuminate the functional and clinical consequences of mutations in our clusters. Interestingly, we find multiple clusters within individual genes that have differential functional associations: these include PTEN, FUBP1, and CDH1. This methodology has potential implications in identifying protein regions for drug targets, understanding the biological underpinnings of cancer, and personalizing cancer treatments. Toward this end, we have made the mutation clusters and the clustering algorithm available to the public. Clusters and pathway associations can be interactively browsed at m2c.systemsbiology.net. The multiscale mutation clustering algorithm is available at https://github.com/IlyaLab/M2C. PMID:28170390

  2. Multiscale mutation clustering algorithm identifies pan-cancer mutational clusters associated with pathway-level changes in gene expression.

    PubMed

    Poole, William; Leinonen, Kalle; Shmulevich, Ilya; Knijnenburg, Theo A; Bernard, Brady

    2017-02-01

    Cancer researchers have long recognized that somatic mutations are not uniformly distributed within genes. However, most approaches for identifying cancer mutations focus on either the entire-gene or single amino-acid level. We have bridged these two methodologies with a multiscale mutation clustering algorithm that identifies variable length mutation clusters in cancer genes. We ran our algorithm on 539 genes using the combined mutation data in 23 cancer types from The Cancer Genome Atlas (TCGA) and identified 1295 mutation clusters. The resulting mutation clusters cover a wide range of scales and often overlap with many kinds of protein features including structured domains, phosphorylation sites, and known single nucleotide variants. We statistically associated these multiscale clusters with gene expression and drug response data to illuminate the functional and clinical consequences of mutations in our clusters. Interestingly, we find multiple clusters within individual genes that have differential functional associations: these include PTEN, FUBP1, and CDH1. This methodology has potential implications in identifying protein regions for drug targets, understanding the biological underpinnings of cancer, and personalizing cancer treatments. Toward this end, we have made the mutation clusters and the clustering algorithm available to the public. Clusters and pathway associations can be interactively browsed at m2c.systemsbiology.net. The multiscale mutation clustering algorithm is available at https://github.com/IlyaLab/M2C.

  3. Identification of XLRS1 gene mutation (608C > T) in a Portuguese family with juvenile retinoschisis.

    PubMed

    Teixeira, C; Rocha-Sousa, A; Trump, D; Brandão, E; Falcão-Reis, F

    2005-01-01

    To characterize electroretinogram (ERG) and molecular genetic findings in a family with XLRS1 mutation. The authors present two cases of a Portuguese family with juvenile retinoschisis with a mutation in exon 6. Two brothers and their parents, grandmother, and uncle underwent a full ophthalmic examination. The two brothers with ophthalmic disease were evaluated with color fundus photography, fluorescein angiography, optical coherence tomography (OCT), molecular genetic study (Group VI of Retinoschisis Consortium), pattern visual evoked potential (PVEP), and full field ERG. Both patients presented funduscopic manifestations of vitre o retinal degeneration. They presented peripheral schisis and retinal detachment. However, foveal schisis had never been observed at funduscopy. A negative ERG was recorded in both. Six months after that, the younger brother showed a typical foveal schisis at fundus examination. A retinoschisis gene (XLRS1) mutation with transition of cytosine by thymine at position 608 (608C > T) had been identified in both. Negative ERG is the most secure clinical marker to establish the diagnosis of juvenile retinoschisis. XLRS1 gene 608C > T mutation was described for the first time in a Portuguese family.

  4. [Application of gene capture technology on mutation screening of RB1 gene in retinoblastoma patients].

    PubMed

    Meng, Q Y; Huang, L Z; Wang, B; Li, X X; Liang, J H

    2017-06-11

    Objectives: To analyze RB1 gene mutation in retinoblastoma (RB) patients using gene capture technology. Methods: Experimental research. The clinical data of 17 RB patients were collected at Department of Ophthalmology, Peking University People's Hospital from June 2010 to Jun 2014. Peripheral blood samples of seventeen RB patients and their parents were collected and genomic DNA were extracted. DNA library from RB patients was mixed with designed gene capture probe of RB1 exons and its flanking sequences. The data were analyzed using bioinformatics software. To avoid the false positive, the abnormal sites were verified using the Sanger sequencing method. Results: Totally, there were 17 RB patients, including 12 males and 5 females, from 0.5 to 23 years old, average ages were (3.2±5.2) years old. Both eyes were involved in 6 patients. The other 11 cases were only one eye was attacked. Four RB patients were found to have germline mutations, among whom 2 had bilateral tumors and 2 had unilateral tumors. 2 novel missense mutations were identified, including 15(th) exon c.1408A>T (p. Ile470Phe) and c.1960G>C (p. Val654Leu) at 19(th) exon. No RB1 mutation was identified in any of their parents. We also identified 2 mutations reported previously. One is c.1030C>T termination mutation at 10(th) exon in a bilateral RB patients and his father, who was diagnosed with unilateral RB. The other is c.371-372delTA frame shift mutation at 3(rd) exon. No mutation was found in their parents. Conclusions: Two novel germline RB1 mutations were found using gene capture technology, which enriched RB1 mutations library. (Chin J Ophthalmol, 2017, 53: 455-459) .

  5. AML1/ETO trans-activates c-KIT expression through the long range interaction between promoter and intronic enhancer.

    PubMed

    Tian, Ying; Wang, Genjie; Hu, Qingzhu; Xiao, Xichun; Chen, Shuxia

    2018-04-01

    The AML1/ETO onco-fusion protein is crucial for the genesis of t(8;21) acute myeloid leukemia (AML) and is well documented as a transcriptional repressor through dominant-negative effect. However, little is known about the transactivation mechanism of AML1/ETO. Through large cohort of patient's expression level data analysis and a series of experimental validation, we report here that AML1/ETO transactivates c-KIT expression through directly binding to and mediating the long-range interaction between the promoter and intronic enhancer regions of c-KIT. Gene expression analyses verify that c-KIT expression is significantly high in t(8;21) AML. Further ChIP-seq analysis and motif scanning identify two regulatory regions located in the promoter and intronic enhancer region of c-KIT, respectively. Both regions are enriched by co-factors of AML1/ETO, such as AML1, CEBPe, c-Jun, and c-Fos. Further luciferase reporter assays show that AML1/ETO trans-activates c-KIT promoter activity through directly recognizing the AML1 motif and the co-existence of co-factors. The induction of c-KIT promoter activity is reinforced with the existence of intronic enhancer region. Furthermore, ChIP-3C-qPCR assays verify that AML1/ETO mediates the formation of DNA-looping between the c-KIT promoter and intronic enhancer region through the long-range interaction. Collectively, our data uncover a novel transcriptional activity mechanism of AML1/ETO and enrich our knowledge of the onco-fusion protein mediated transcription regulation. © 2017 Wiley Periodicals, Inc.

  6. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

    PubMed

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

    2016-08-01

    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  7. Simultaneous detection of human CYP2C19 polymorphisms and antibiotic resistance of Helicobacter pylori using a personalised diagnosis kit.

    PubMed

    Zhang, Jun; Zhong, Jing; Ding, Jian; Shi, Jiemin; Tang, Tao; Liu, Qiqi; Huang, Huilian; Dai, Licheng; Yang, Ningmin

    2018-06-01

    A personalised diagnosis kit for Helicobacter pylori that employs visual gene chip technology for the simultaneous detection of CYP2C19 polymorphisms and clarithromycin/levofloxacin antibiotic resistance was evaluated. Gastric antrum mucosa biopsy specimens of 394 patients were tested using the kit. DNA sequencing and antibiotic susceptibility testing of the H. pylori were also performed. In total, 267 (67.8%) of the 394 specimens were positive for H. pylori using the kit and DNA sequencing, and 136 (34.5%) were positive by culturing. For human CYP2C19 and the bacterial 23S rRNA and gyrA genes, the concordance rates were 92.4% (364/394), 96.6% (258/267) and 97.0% (259/267) between the kit and DNA sequencing results, respectively. For clarithromycin and levofloxacin resistance, the concordance rates were 90.4% (123/136) and 81.6% (111/136) between the kit and antibiotic susceptibility testing results. The personalised diagnosis kit for H. pylori provides useful information for the choice of proton pump inhibitor and antibiotic in combination therapy. Copyright © 2018 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

  8. Novel Founder Mutation in FANCA Gene (c.3446_3449dupCCCT) Among Romani Patients from the Balkan Region.

    PubMed

    Dimishkovska, Marija; Kotori, Vjosa Mulliqi; Gucev, Zoran; Kocheva, Svetlana; Polenakovic, Momir; Plaseska-Karanfilska, Dijana

    2018-01-20

    Fanconi anemia is a rare autosomal recessive or X-linked disorder characterised by clinical and genetic heterogeneity. Most fanconi anemia patients harbour homozygous or double heterozygous mutations in the FANCA (60-65%), FANCC (10-15%), FANCG (~10%) or FANCD2 (3-6%) genes. We have already reported the FANCA variant c.190-256_283+1680del2040dupC as a founder mutation among Macedonian fanconi anemia patients of Gypsy-like ethnic origin. Here, we present a novel FANCA mutation in two patients from Macedonia and Kosovo. The novel FANCA mutation c.3446_3449dupCCCT was identified in two fanconi anemia patients with Romany ethnicity; a 2-year-old girl from Macedonia who is a compound heterozygote for a previously reported FANCA c.190-256_283+1680del2040dupC and the novel mutation and a 10-year-old girl from Kosovo who is a homozygote for the novel FANCA c.3446_3449dupCCCT mutation. The novel mutation is located in exon 35 in the FAAP20-binding domain which plays a crucial role in the FANCA -FAAP20 interaction and is required for integrity of the fanconi anemia pathway. The finding of the FANCA c.3446_3449dupCCCT mutation in two unrelated FA patients with Romani ethnicity from Macedonia and Kosovo suggests it is a founder mutation in the Romani population living in the Balkan region.

  9. Transplantation of Epigenetically Modified Adult Cardiac c-Kit+ Cells Retards Remodeling and Improves Cardiac Function in Ischemic Heart Failure Model

    PubMed Central

    Zakharova, Liudmila; Nural-Guvener, Hikmet; Feehery, Lorraine; Popovic-Sljukic, Snjezana

    2015-01-01

    Cardiac c-Kit+ cells have a modest cardiogenic potential that could limit their efficacy in heart disease treatment. The present study was designed to augment the cardiogenic potential of cardiac c-Kit+ cells through class I histone deacetylase (HDAC) inhibition and evaluate their therapeutic potency in the chronic heart failure (CHF) animal model. Myocardial infarction (MI) was created by coronary artery occlusion in rats. c-Kit+ cells were treated with mocetinostat (MOCE), a specific class I HDAC inhibitor. At 3 weeks after MI, CHF animals were retrogradely infused with untreated (control) or MOCE-treated c-Kit+ cells (MOCE/c-Kit+ cells) and evaluated at 3 weeks after cell infusion. We found that class I HDAC inhibition in c-Kit+ cells elevated the level of acetylated histone H3 (AcH3) and increased AcH3 levels in the promoter regions of pluripotent and cardiac-specific genes. Epigenetic changes were accompanied by increased expression of cardiac-specific markers. Transplantation of CHF rats with either control or MOCE/c-Kit+ cells resulted in an improvement in cardiac function, retardation of CHF remodeling made evident by increased vascularization and scar size, and cardiomyocyte hypertrophy reduction. Compared with CHF infused with control cells, infusion of MOCE/c-Kit+ cells resulted in a further reduction in left ventricle end-diastolic pressure and total collagen and an increase in interleukin-6 expression. The low engraftment of infused cells suggests that paracrine effects might account for the beneficial effects of c-Kit+ cells in CHF. In conclusion, selective inhibition of class I HDACs induced expression of cardiac markers in c-Kit+ cells and partially augmented the efficacy of these cells for CHF repair. Significance The study has shown that selective class 1 histone deacetylase inhibition is sufficient to redirect c-Kit+ cells toward a cardiac fate. Epigenetically modified c-Kit+ cells improved contractile function and retarded remodeling of the

  10. The usefulness of c-Kit in the immunohistochemical assessment of melanocytic lesions

    PubMed Central

    Pilloni, L.; Bianco, P.; Difelice, E.; Cabras, S.; Castellanos, M.E.; Atzori, L.; Ferreli, C.; Mulas, P.; Nemolato, S.; Faa, G.

    2011-01-01

    C-Kit (CD117), the receptor for the stem cell factor, a growth factor for melanocyte migration and proliferation, has shown differential immunostaining in various benign and malignant melanocytic lesions. The purpose of this study is to compare c-Kit immunostaining in benign nevi and in primary and metastatic malignant melanomas, to determine whether c-Kit can aid in the differential diagnosis of these lesions. c-Kit immunostaining was performed in 60 cases of pigmented lesions, including 39 benign nevi (5 blue nevi, 5 intra-dermal nevi, 3 junctional nevi, 15 cases of primary compound nevus, 11 cases of Spitz nevus), 18 cases of primary malignant melanoma and 3 cases of metastatic melanoma. The vast majority of nevi and melanomas examined in this study were positive for c-Kit, with minimal differences between benign and malignant lesions. C-Kit cytoplasmatic immunoreactivity in the intraepidermal proliferating nevus cells, was detected in benign pigmented lesions as well as in malignant melanoma, increasing with the age of patients (P=0.007) in both groups. The patient’s age at presentation appeared to be the variable able to cluster benign and malignant pigmented lesions. The percentage of c-Kit positive intraepidermal nevus cells was better associated with age despite other variables (P=0.014). The intensity and percentage of c-Kit positivity in the proliferating nevus cells in the dermis was significantly increased in malignant melanocytic lesions (P=0.015 and P=0.008) compared to benign lesions (compound melanocytic nevi, Spitz nevi, intradermal nevi, blue nevi). Immunostaning for c-Kit in metastatic melanomas was negative. Interestingly in two cases of melanoma occurring on a pre-existent nevus, the melanoma tumor cells showed strong cytoplasmatic and membranous positivity for c-kit, in contrast with the absence of any immunoreactivity in pre-existent intradermal nevus cells. C-Kit does not appear to be a strong immunohistochemical marker for distinguishing

  11. c-kit expression profile and regulatory factors during spermatogonial stem cell differentiation

    PubMed Central

    2013-01-01

    Background It has been proven that c-kit is crucial for proliferation, migration, survival and maturation of spermatogenic cells. A periodic expression of c-kit is observed from primordial germ cells (PGCs) to spermatogenetic stem cells (SSCs), However, the expression profile of c-kit during the entire spermatogenesis process is still unclear. This study aims to reveal and compare c-kit expression profiles in the SSCs before and after the anticipated differentiation, as well as to examine its relationship with retinoic acid (RA) stimulation. Results We have found that there are more than 4 transcripts of c-kit expressed in the cell lines and in the testes. The transcripts can be divided into short and long categories. The long transcripts include the full-length canonical c-kit transcript and the 3′ end short transcript. Short transcripts include the 3.4 kb short transcript and several truncated transcripts (1.9-3.2 kb). In addition, the 3.4 kb transcript (starting from intron 9 and covering exons 10 ~ 21) is discovered to be specifically expressed in the spermatogonia. The extracellular domain of Kit is obtained in the spermatogonia stage, but the intracellular domain (50 kDa) is constantly expressed in both SSCs and spermatogonia. The c-kit expression profiles in the testis and the spermatogonial stem cell lines vary after RA stimulation. The wave-like changes of the quantitative expression pattern of c-kit (increase initially and decrease afterwards) during the induction process are similar to that of the in vivo male germ cell development process. Conclusions There are dynamic transcription and translation changes of c-kit before and after SSCs’ anticipated differentiation and most importantly, RA is a significant upstream regulatory factor for c-kit expression. PMID:24161026

  12. C-MORE Science Kits as a Classroom Learning Tool

    ERIC Educational Resources Information Center

    Foley, J. M.; Bruno, B. C.; Tolman, R. T.; Kagami, R. S.; Hsia, M. H.; Mayer, B.; Inazu, J. K.

    2013-01-01

    To support teachers in enhancing ocean literacy, the Center for Microbial Oceanography: Research and Education (C-MORE) has developed a series of portable, hands-on science kits on selected topics in oceanography. This paper provides an overview of kit content, describes how the kits were developed, and evaluates their efficacy as a curriculum…

  13. Estrogen-induced transcription factor EGR1 regulates c-Kit transcription in the mouse uterus to maintain uterine receptivity for embryo implantation.

    PubMed

    Park, Mira; Kim, Hye-Ryun; Kim, Yeon Sun; Yang, Seung Chel; Yoon, Jung Ah; Lyu, Sang Woo; Lim, Hyunjung Jade; Hong, Seok-Ho; Song, Haengseok

    2018-07-15

    Early growth response 1 (Egr1) is a key transcription factor that mediates the action of estrogen (E 2 ) to establish uterine receptivity for embryo implantation. However, few direct target genes of EGR1 have been identified in the uterus. Here, we demonstrated that E 2 induced EGR1-regulated transcription of c-Kit, which plays a crucial role in cell fate decisions. Spatiotemporal expression of c-Kit followed that of EGR1 in uteri of ovariectomized mice at various time points after E 2 treatment. E 2 activated ERK1/2 and p38 to induce EGR1, which then activated c-Kit expression in the uterus. EGR1 transfection produced rapid and transient induction of c-KIT in a time- and dose-dependent manner. Furthermore, luciferase assays to measure c-Kit promoter activity confirmed that a functional EGR1 binding site(s) (EBS) was located within -1 kb of the c-Kit promoter. Site-directed mutagenesis and chromatin immunoprecipitation-PCR for three putative EBS within -1 kb demonstrated that the EBS at -818/-805 was critical for EGR1-dependent c-Kit transcription. c-Kit expression was significantly increased in the uterus on day 4 and administration of Masitinib, a c-Kit inhibitor, effectively interfered with embryo implantation. Collectively, our results showed that estrogen induces transcription factor EGR1 to regulate c-Kit transcription for uterine receptivity for embryo implantation in the mouse uterus. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Novel compound heterozygous mutations in the GPR98 (USH2C) gene identified by whole exome sequencing in a Moroccan deaf family.

    PubMed

    Bousfiha, Amale; Bakhchane, Amina; Charoute, Hicham; Detsouli, Mustapha; Rouba, Hassan; Charif, Majida; Lenaers, Guy; Barakat, Abdelhamid

    2017-10-01

    In the present work, we identified two novel compound heterozygote mutations in the GPR98 (G protein-coupled receptor 98) gene causing Usher syndrome. Whole-exome sequencing was performed to study the genetic causes of Usher syndrome in a Moroccan family with three affected siblings. We identify two novel compound heterozygote mutations (c.1054C > A, c.16544delT) in the GPR98 gene in the three affected siblings carrying post-linguale bilateral moderate hearing loss with normal vestibular functions and before installing visual disturbances. This is the first time that mutations in the GPR98 gene are described in the Moroccan deaf patients.

  15. Missense variations in the cystic fibrosis gene: Heteroduplex formation in the F508C mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Macek, M. Jr.; Ladanyi, L.; Buerger, J.

    1992-11-01

    Kobayashi et al. (1990) have described missense variations in the conserved region of exon 10 of the cystic fibrosis (CF) transmembrane conductance regulator gene. In their paper, two [Delta]F508/F508C compound heterozygous individuals were reported. Clinical and epithelial physiological studies in both cases were normal, suggesting that the substitution of cysteine for phenylalanine at position 508, the F508C mutation, is benign. However, Kerem et al. reported a patient with this substitution who had typical symptoms of CF. In routine [Delta]F508 mutation screening by visualization of the 3-bp deletion on a 12% polyacrylamide gel the authors detected an abnormal heteroduplex in themore » father of a CF patient of German origin. Subsequent direct sequencing of the PCR product confirmed that this clinically normal father is a compound heterozygote for the [Delta]F508/F508C mutations. This heteroduplex is slightly different from the usual heteroduplex in [Delta]F508/F508C heteroduplex was not published, it is likely that similar cases can be overseen during the widely performed [Delta]F508 mutation screening by PAGE. Detection of more cases, such as the one presented here, together with careful, standardized clinical examination of the proband, would be valuable to verify the nature of this mutation. 4 refs., 1 fig.« less

  16. Factors for C-Kit Expression in Cardiac Outgrowth Cells and Human Heart Tissue.

    PubMed

    Matsushita, Satoshi; Minematsu, Kazuo; Yamamoto, Taira; Inaba, Hirotaka; Kuwaki, Kenji; Shimada, Akie; Yokoyama, Yasutaka; Amano, Atsushi

    2017-12-12

    We determined the factors associated with the expression of c-kit in the heart and the proliferation of c-kit-positive (c-kit pos ) cardiac stem cells among the outgrowth cells cultured from human cardiac explants.Samples of the right atrium (RA), left atrium (LA), and left ventricle obtained from patients during open-heart surgery were processed for cell culture of outgrowth cells and tissue analysis. The total number of growing cells and the population of c-kit pos cells were measured and compared with c-kit expression in native tissues and characteristics of the patients according to the region of the heart.We analyzed 452 samples from 334 patients. Atrial fibrillation (AF) in the patients reduced the number of outgrowth cells from the RA and LA, and aging was a co-factor for the LA. The c-kit pos population from the RA was associated with serum brain natriuretic peptide (BNP). C-kit expression in native tissue was also associated with BNP expression. However, we observed no relationship in expression between outgrowth cells and native tissue. In addition, the RA tissue provided the highest number of c-kit pos cells, and the left ventricle provided the lowest.C-kit was weakly expressed in response to damage. In addition, no correlation between outgrowth cells and native tissue was found for c-kit expression.

  17. Efficacy and safety of nilotinib in patients with KIT-mutated metastatic or inoperable melanoma: final results from the global, single-arm, phase II TEAM trial.

    PubMed

    Guo, J; Carvajal, R D; Dummer, R; Hauschild, A; Daud, A; Bastian, B C; Markovic, S N; Queirolo, P; Arance, A; Berking, C; Camargo, V; Herchenhorn, D; Petrella, T M; Schadendorf, D; Sharfman, W; Testori, A; Novick, S; Hertle, S; Nourry, C; Chen, Q; Hodi, F S

    2017-06-01

    The single-arm, phase II Tasigna Efficacy in Advanced Melanoma (TEAM) trial evaluated the KIT-selective tyrosine kinase inhibitor nilotinib in patients with KIT-mutated advanced melanoma without prior KIT inhibitor treatment. Forty-two patients with KIT-mutated advanced melanoma were enrolled and treated with nilotinib 400 mg twice daily. TEAM originally included a comparator arm of dacarbazine (DTIC)-treated patients; the design was amended to a single-arm trial due to an observed low number of KIT-mutated melanomas. Thirteen patients were randomized to DTIC before the protocol amendment removing this study arm. The primary endpoint was objective response rate (ORR), determined according to Response Evaluation Criteria In Solid Tumors. ORR was 26.2% (n = 11/42; 95% CI, 13.9%-42.0%), sufficient to reject the null hypothesis (ORR ≤10%). All observed responses were partial responses (PRs; median response duration, 7.1 months). Twenty patients (47.6%) had stable disease and 10 (23.8%) had progressive disease; 1 (2.4%) response was unknown. Ten of the 11 responding patients had exon 11 mutations, four with an L576P mutation. The median progression-free survival and overall survival were 4.2 and 18.0 months, respectively. Three of the 13 patients on DTIC achieved a PR, and another patient had a PR following switch to nilotinib. Nilotinib activity in patients with advanced KIT-mutated melanoma was similar to historical data from imatinib-treated patients. DTIC treatment showed potential activity, although the low patient number limits interpretation. Similar to previously reported results with imatinib, nilotinib showed greater activity among patients with an exon 11 mutation, including L576P, suggesting that nilotinib may be an effective treatment option for patients with specific KIT mutations. ClinicalTrials.gov, NCT01028222. © The Author 2017. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved

  18. Mutations in the SURF1 gene associated with Leigh syndrome and cytochrome C oxidase deficiency.

    PubMed

    Péquignot, M O; Dey, R; Zeviani, M; Tiranti, V; Godinot, C; Poyau, A; Sue, C; Di Mauro, S; Abitbol, M; Marsac, C

    2001-05-01

    Cytochrome c oxidase (COX) deficiency is one of the major causes of Leigh Syndrome (LS), a fatal encephalopathy of infancy or childhood, characterized by symmetrical lesions in the basal ganglia and brainstem. Mutations in the nuclear genes encoding COX subunits have not been found in patients with LS and COX deficiency, but mutations have been identified in SURF1. SURF1 encodes a factor involved in COX biogenesis. To date, 30 different mutations have been reported in 40 unrelated patients. We aim to provide an overview of all known mutations in SURF1, and to propose a common nomenclature. Twelve of the mutations were insertion/deletion mutations in exons 1, 4, 6, 8, and 9; 10 were missense/nonsense mutations in exons 2, 4, 5, 7, and 8; and eight were detected at splicing sites in introns 3 to 7. The most frequent mutation was 312_321del 311_312insAT which was found in 12 patients out of 40. Twenty mutations have been described only once. We also list all polymorphisms discovered to date. Copyright 2001 Wiley-Liss, Inc.

  19. Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

    PubMed

    Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

    2008-01-01

    The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

  20. A novel Norrie disease pseudoglioma gene mutation, c.-1_2delAAT, responsible for Norrie disease in a Chinese family.

    PubMed

    Zhang, Xin-Yu; Jiang, Wei-Ying; Chen, Lu-Ming; Chen, Su-Qin

    2013-01-01

    To investigate the genetic findings and phenotypic characteristics of a Chinese family with Norrie disease (ND). Molecular genetic analysis and clinical examinations were performed on a Chinese family with ND. Mutations in the Norrie disease pseudoglioma (NDP) gene were detected by direct sequencing. Haplotypes were constructed and compared with the phenotypes in the family. Evolutionary comparisons and mutant open reading frame (ORF) prediction were also undertaken. Two family members with ocular manifestations were diagnosed with ND. No signs of sensorineural hearing loss were observed in either patient, while one of them showed signs of mild mental retardation. A novel heterozygous mutation in the NDP gene, c.-1_2delAAT, was detected in both patients. The mutation and the mutation bearing haplotype co-segregated with the ND phenotype in males and was transmitted from their mothers and/or grandmothers (II:2). The male without ND did not harbor the mutation. The mutation occurred at the highly conserved nucleotides. ORF finder predicted that the mutation would lead to the production of a truncated protein that lacks the first 11 N-terminal amino acids. A novel mutation, c.-1_2delAAT in the NDP gene, was identified in a Chinese family with ND. This mutation caused ND without obvious sensorineural hearing loss. Mental disorder was found in one but not the other patients. The clinical heterogeneity in the family indicated that other genetic variants and epigenetic factors may also play a role in the disease presentation.

  1. CFTR gene mutations in isolated chronic obstructive pulmonary disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pignatti, P.F.; Bombien, C.; Marigo, C.

    1994-09-01

    In order to identify a possible hereditary predisposition to the development of chronic obstructive pulmonary disease (COPD), we have looked for the presence of cystic fibrosis transmembrane regulator (CFTR) gene DNA sequence modifications in 28 unrelated patients with no signs of cystic fibrosis. The known mutations in Italian CF patients, as well as the most frequent worldwide CF mutations, were investigated. In addition, a denaturing gradient gel electrophoresis analysis of about half of the coding sequence of the gene in 56 chromosomes from the patients and in 102 chromosomes from control individuals affected by other pulmonary diseases and from normalmore » controls was performed. Nine different CFTR gene mutations and polymorphisms were found in seven patients, a highly significant increase over controls. Two of the patients were compound heterozygotes. Two frequent CF mutations were detected: deletion F508 and R117H; two rare CF mutations: R1066C and 3667ins4; and five CF sequence variants: R75Q (which was also described as a disease-causing mutation in male sterility cases due to the absence of the vasa deferentia), G576A, 2736 A{r_arrow}G, L997F, and 3271+18C{r_arrow}T. Seven (78%) of the mutations are localized in transmembrane domains. Six (86%) of the patients with defined mutations and polymorphisms had bronchiectasis. These results indicate that CFTR gene mutations and sequence alterations may be involved in the etiopathogenesis of some cases of COPD.« less

  2. Detection of EGFR Gene Mutation by Mutation-oriented LAMP Method.

    PubMed

    Matsumoto, Naoyuki; Kumasaka, Akira; Ando, Tomohiro; Komiyama, Kazuo

    2018-04-01

    Epidermal growth factor receptor (EGFR) is a target of molecular therapeutics for non-small cell lung cancer. EGFR gene mutations at codons 746-753 promote constitutive EGFR activation and result in worst prognosis. However, these mutations augment the therapeutic effect of EGFR-tyrosine kinase inhibitor. Therefore, the detection of EGFR gene mutations is important for determining treatment planning. The aim of the study was to establish a method to detect EGFR gene mutations at codons 746-753. EGFR gene mutation at codons 746-753 in six cancer cell lines were investigated. A loop-mediated isothermal amplification (LAMP)-based procedure was developed, that employed peptide nucleic acid to suppress amplification of the wild-type allele. This mutation-oriented LAMP can amplify the DNA fragment of the EGFR gene with codons 746-753 mutations within 30 min. Moreover, boiled cells can work as template resources. Mutation oriented-LAMP assay for EGFR gene mutation is sensitive on extracted DNA. This procedure would be capable of detecting EGFR gene mutation in sputum, pleural effusion, broncho-alveolar lavage fluid or trans-bronchial lung biopsy by chair side. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  3. A Founder Effect of c.257 + 2T > C Mutation in NCF2 Gene Underlies Severe Chronic Granulomatous Disease in Eleven Patients.

    PubMed

    Ben-Farhat, Khaoula; Ben-Mustapha, Imen; Ben-Ali, Meriem; Rouault, Karen; Hamami, Saber; Mekki, Najla; Ben-Chehida, Amel; Larguèche, Beya; Fitouri, Zohra; Abdelmoula, Selim; Khemiri, Monia; Guediche, Mohamed-Neji; Boukthir, Samir; Barsaoui, Sihem; Chemli, Jalel; Barbouche, Mohamed-Ridha

    2016-08-01

    Chronic granulomatous disease (CGD) is the prototypic functional neutrophil disorder caused by genetic defects in one of the five genes encoding the superoxide-generating nicotinamide adenine dinucleotide phosphate (NADPH)-oxidase subunits of phagocytes. Mutations causing the most prevalent form of CGD in western populations are located in the X-linked-CYBB gene. The four remaining autosomal recessive (AR) forms collectively account for one-third of CGD cases. We investigated the clinical and molecular features of eleven patients with CGD from 6 consanguineous families, originating from contiguous regions in the west of Tunisia. The patients' clinical phenotype is characterized by a high incidence of mycobacterial infections. Five out of the eleven patients died despite treatment arguing in favor of a severe clinical form of CGD. These findings correlated with the absence of functional p67phox protein as well as the absence of residual reactive oxygen intermediates (ROI) production. Genetic analysis showed the presence, in all patients, of a unique mutation (c.257 + 2T > C) in NCF2 gene predicted to affect RNA splicing. Segregating analysis using nine polymorphic markers overlapping the NCF2 gene revealed a common haplotype spanning 4.1 Mb. The founder event responsible for this mutation was estimated to have arisen approximately 175 years ago. These findings will facilitate the implementation of preventive approaches through genetic counseling in affected consanguineous families.

  4. Frameshift mutations of TAF1C gene, a core component for transcription by RNA polymerase I, and its regional heterogeneity in gastric and colorectal cancers.

    PubMed

    Oh, Hye Rim; An, Chang Hyeok; Yoo, Nam Jin; Lee, Sug Hyung

    2015-02-01

    Initiation of transcription for ribosomal RNA (rRNA) by RNA polymerase I requires TATA-binding protein (TBP) and TBP-associated factors (TAF1A, TAF1B and TAF1C). p53 tumour suppressor inhibits rRNA transcription by blocking TAF1C-UBF interaction, but alterations of TAF1C itself in tumorigenesis remain unknown. The aim of this study was to explore whether TAF1C gene was mutated in gastric (GC) and colorectal cancers (CRC).In a public database, we found that TAF1C gene had a mononucleotide repeat (C8) in the coding sequences that might be a mutation target in the cancers with microsatellite instability (MSI). We analysed 79 GC and 124 CRC by single-strand conformation polymorphism and DNA sequencing analyses. In this study, we found TAF1C frameshift mutations (8.8% of GC and 10.1% of CRC with MSI-H), which were not found in stable MSI/low MSI (MSS/MSI-L) (0/90). In addition, we analysed intratumoural heterogeneity (ITH) of TAF1C frameshift mutations in 16 CRC and found that three CRC (18.8%) harboured regional ITH of the TAF1C frameshift mutations. Our results indicate that TAF1C gene harboured not only somatic frameshift mutations but also the mutational ITH, which together might play a role in tumourigenesis of GC and CRC. Our data also suggest that multi-regional mutation analysis is needed for a better evaluation of the mutation status in CRC.

  5. A novel Norrie disease pseudoglioma gene mutation, c.-1_2delAAT, responsible for Norrie disease in a Chinese family

    PubMed Central

    Zhang, Xin-Yu; Jiang, Wei-Ying; Chen, Lu-Ming; Chen, Su-Qin

    2013-01-01

    AIM To investigate the genetic findings and phenotypic characteristics of a Chinese family with Norrie disease (ND). METHODS Molecular genetic analysis and clinical examinations were performed on a Chinese family with ND. Mutations in the Norrie disease pseudoglioma (NDP) gene were detected by direct sequencing. Haplotypes were constructed and compared with the phenotypes in the family. Evolutionary comparisons and mutant open reading frame (ORF) prediction were also undertaken. RESULTS Two family members with ocular manifestations were diagnosed with ND. No signs of sensorineural hearing loss were observed in either patient, while one of them showed signs of mild mental retardation. A novel heterozygous mutation in the NDP gene, c.-1_2delAAT, was detected in both patients. The mutation and the mutation bearing haplotype co-segregated with the ND phenotype in males and was transmitted from their mothers and/or grandmothers (II:2). The male without ND did not harbor the mutation. The mutation occurred at the highly conserved nucleotides. ORF finder predicted that the mutation would lead to the production of a truncated protein that lacks the first 11 N-terminal amino acids. CONCLUSION A novel mutation, c.-1_2delAAT in the NDP gene, was identified in a Chinese family with ND. This mutation caused ND without obvious sensorineural hearing loss. Mental disorder was found in one but not the other patients. The clinical heterogeneity in the family indicated that other genetic variants and epigenetic factors may also play a role in the disease presentation. PMID:24392318

  6. Correlation of KIT and PDGFRA mutational status with clinical benefit in patients with gastrointestinal stromal tumor treated with sunitinib in a worldwide treatment-use trial.

    PubMed

    Reichardt, Peter; Demetri, George D; Gelderblom, Hans; Rutkowski, Piotr; Im, Seock-Ah; Gupta, Sudeep; Kang, Yoon-Koo; Schöffski, Patrick; Schuette, Jochen; Soulières, Denis; Blay, Jean-Yves; Goldstein, David; Fly, Kolette; Huang, Xin; Corsaro, Massimo; Lechuga, Maria Jose; Martini, Jean-Francois; Heinrich, Michael C

    2016-01-15

    Several small studies indicated that the genotype of KIT or platelet-derived growth factor receptor-α (PDGFRA) contributes in part to the level of clinical effectiveness of sunitinib in gastrointestinal stromal tumor (GIST) patients. This study aimed to correlate KIT and PDGFRA mutational status with clinical outcome metrics (progression-free survival [PFS], overall survival [OS], objective response rate [ORR]) in a larger international patient population. This is a non-interventional, retrospective analysis in patients with imatinib-resistant or intolerant GIST who were treated in a worldwide, open-label treatment-use study (Study 1036; NCT00094029) in which sunitinib was administered at a starting dose of 50 mg/day on a 4-week-on, 2-week-off schedule. Molecular status was obtained in local laboratories with tumor samples obtained either pre-imatinib, post-imatinib/pre-sunitinib, or post-sunitinib treatment, and all available data were used in the analyses regardless of collection time. The primary analysis compared PFS in patients with primary KIT exon 11 versus exon 9 mutations (using a 2-sided log-rank test) and secondary analyses compared OS (using the same test) and ORR (using a 2-sided Pearson χ(2) test) in the same molecular subgroups. Of the 1124 sunitinib-treated patients in the treatment-use study, 230 (20%) were included in this analysis, and baseline characteristics were similar between the two study populations. Median PFS was 7.1 months. A significantly better PFS was observed in patients with a primary mutation in KIT exon 9 (n = 42) compared to those with a primary mutation in exon 11 (n = 143; hazard ratio = 0.59; 95 % confidence interval, 0.39-0.89; P = 0.011), with median PFS times of 12.3 and 7.0 months, respectively. Similarly, longer OS and higher ORR were observed in patients with a primary KIT mutation in exon 9 versus exon 11. The data available were limited to investigate the effects of additional KIT or PDGFRA mutations on the efficacy

  7. Complex phenotype linked to a mutation in exon 11 of the lamin A/C gene: Hypertrophic cardiomyopathy, atrioventricular block, severe dyslipidemia and diabetes.

    PubMed

    Francisco, Ana Rita G; Santos Gonçalves, Inês; Veiga, Fátima; Mendes Pedro, Mónica; Pinto, Fausto J; Brito, Dulce

    2017-09-01

    The lamin A/C (LMNA) gene encodes lamins A and C, which have an important role in nuclear cohesion and chromatin organization. Mutations in this gene usually lead to the so-called laminopathies, the primary cardiac manifestations of which are dilated cardiomyopathy and intracardiac conduction defects. Some mutations, associated with lipodystrophy but not cardiomyopathy, have been linked to metabolic abnormalities such as diabetes and severe dyslipidemia. Herein we describe a new phenotype associated with a mutation in exon 11 of the LMNA gene: hypertrophic cardiomyopathy, atrioventricular block, severe dyslipidemia and diabetes. A 64-year-old woman with hypertrophic cardiomyopathy and a point mutation in exon 11 of the LMNA gene (c.1718C>T, Ser573Leu) presented with severe symptomatic ventricular hypertrophy and left ventricular outflow tract obstruction. She underwent septal alcohol ablation, followed by Morrow myectomy. The patient was also diagnosed with severe dyslipidemia, diabetes and obesity, and fulfilled diagnostic criteria for metabolic syndrome. No other characteristics of LMNA mutation-related phenotypes were identified. The development of type III atrioventricular block with no apparent cause, and mildly depressed systolic function, prompted referral for cardiac resynchronization therapy. In conclusion, the association between LMNA mutations and different phenotypes is complex and not fully understood, and can present with a broad spectrum of severity. Copyright © 2017 Sociedade Portuguesa de Cardiologia. Publicado por Elsevier España, S.L.U. All rights reserved.

  8. The PCBP1 gene encoding poly(rC) binding protein I is recurrently mutated in Burkitt lymphoma.

    PubMed

    Wagener, Rabea; Aukema, Sietse M; Schlesner, Matthias; Haake, Andrea; Burkhardt, Birgit; Claviez, Alexander; Drexler, Hans G; Hummel, Michael; Kreuz, Markus; Loeffler, Markus; Rosolowski, Maciej; López, Cristina; Möller, Peter; Richter, Julia; Rohde, Marius; Betts, Matthew J; Russell, Robert B; Bernhart, Stephan H; Hoffmann, Steve; Rosenstiel, Philip; Schilhabel, Markus; Szczepanowski, Monika; Trümper, Lorenz; Klapper, Wolfram; Siebert, Reiner

    2015-09-01

    The genetic hallmark of Burkitt lymphoma is the translocation t(8;14)(q24;q32), or one of its light chain variants, resulting in IG-MYC juxtaposition. However, these translocations alone are insufficient to drive lymphomagenesis, which requires additional genetic changes for malignant transformation. Recent studies of Burkitt lymphoma using next generation sequencing approaches have identified various recurrently mutated genes including ID3, TCF3, CCND3, and TP53. Here, by using similar approaches, we show that PCBP1 is a recurrently mutated gene in Burkitt lymphoma. By whole-genome sequencing, we identified somatic mutations in PCBP1 in 3/17 (18%) Burkitt lymphomas. We confirmed the recurrence of PCBP1 mutations by Sanger sequencing in an independent validation cohort, finding mutations in 3/28 (11%) Burkitt lymphomas and in 6/16 (38%) Burkitt lymphoma cell lines. PCBP1 is an intron-less gene encoding the 356 amino acid poly(rC) binding protein 1, which contains three K-Homology (KH) domains and two nuclear localization signals. The mutations predominantly (10/12, 83%) affect the KH III domain, either by complete domain loss or amino acid changes. Thus, these changes are predicted to alter the various functions of PCBP1, including nuclear trafficking and pre-mRNA splicing. Remarkably, all six primary Burkitt lymphomas with a PCBP1 mutation expressed MUM1/IRF4, which is otherwise detected in around 20-40% of Burkitt lymphomas. We conclude that PCBP1 mutations are recurrent in Burkitt lymphomas and might contribute, in cooperation with other mutations, to its pathogenesis. © 2015 Wiley Periodicals, Inc.

  9. [Analysis of MAT1A gene mutations in a child affected with simple hypermethioninemia].

    PubMed

    Sun, Yun; Ma, Dingyuan; Wang, Yanyun; Yang, Bin; Jiang, Tao

    2017-02-10

    To detect potential mutations of MAT1A gene in a child suspected with simple hypermethioninemia by MS/MS neonatal screening. Clinical data of the child was collected. Genomic DNA was extracted by a standard method and subjected to targeted sequencing using an Ion Ampliseq TM Inherited Disease Panel. Detected mutations were verified by Sanger sequencing. The child showed no clinical features except evaluated methionine. A novel compound mutation of the MAT1A gene, i.e., c.345delA and c.529C>T, was identified in the child. His father and mother were found to be heterozygous for the c.345delA mutation and c.529C>T mutation, respectively. The compound mutation c.345delA and c.529C>T of the MAT1A gene probably underlie the disease in the child. The semi-conductor sequencing has provided an important means for the diagnosis of hereditary diseases.

  10. Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency in Greek newborns: the Mediterranean C563T mutation screening.

    PubMed

    Molou, Elina; Schulpis, Kleopatra H; Thodi, Georgia; Georgiou, Vassiliki; Dotsikas, Yannis; Papadopoulos, Konstantinos; Biti, Sofia; Loukas, Yannis L

    2014-04-01

    Glucose-6-Phosphate Dehydrogenase (G6PD) gene is located at the X-chromosome at Xq28 and the disease is recessively inherited predominantly in males. More than 400 variants have been proposed based on clinical and enzymatic studies. The aim of the current study was to identify C563T mutation in G6PD-deficient newborns and to correlate the enzyme residual activity with the presence of the mutation. Some 1189 full-term neonates aged 3-5 days old were tested for G6PD activity in dried blood spots from Guthrie cards using a commercial kit. DNA extraction from Guthrie cards and mutation identification among the deficient samples were performed with current techniques. A total of 92 (7.7%) newborns were G6PD-deficient. In 46 (50%), the mutation C563T was identified. The residual activity in C563T hemizygote males (n = 28) was statistically significantly lower (1.23 ± 0.93 U/g Hb) than that in non-C563T G6PD-deficient males (n = 25) (4.01 ± 1.20 U/g Hb, p < 0.0001) and in controls (13.6 ± 2.9 U/g Hb, p < 0.0001). In C563T heterozygote females, the estimated enzyme activity was lower than that determined in non-C563T females. Male C563T hemizygotes suffer from G6PD deficiency and severe neonatal jaundice. G6PD activity showed statistically significant correlation with total bilirubin blood levels.

  11. Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis.

    PubMed

    Bittencourt, Paulo Lisboa; Marin, Maria Lúcia Carnevale; Couto, Cláudia Alves; Cançado, Eduardo Luiz Rachid; Carrilho, Flair José; Goldberg, Anna Carla

    2009-01-01

    Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH) are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2) and ferroportin 1 (SCL40A1). To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. Nineteen male subjects (median age 42 [range: 20-72] years) with HH were evaluated using the Haemochromatosis StripAssay A. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. In our cohort, nine (47%) patients were homozygous for the C282Y mutation, two (11%) were heterozygous for the H63D mutation, and one each (5%) was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

  12. Targeting c-KIT (CD117) by dasatinib and radotinib promotes acute myeloid leukemia cell death.

    PubMed

    Heo, Sook-Kyoung; Noh, Eui-Kyu; Kim, Jeong Yi; Jeong, Yoo Kyung; Jo, Jae-Cheol; Choi, Yunsuk; Koh, SuJin; Baek, Jin Ho; Min, Young Joo; Kim, Hawk

    2017-11-10

    Dasatinib and radotinib are oral BCR-ABL tyrosine kinase inhibitors that were developed as drugs for the treatment of chronic myeloid leukemia. We report here that the c-KIT (CD117) targeting with dasatinib and radotinib promotes acute myeloid leukemia (AML) cell death, and c-KIT endocytosis is essential for triggering c-KIT-positive AML cell death by dasatinib and radotinib during the early stages. In addition, dasatinib and radotinib reduce heat shock protein 90β (HSP90β) expression and release Apaf-1 in c-KIT-positive AML cells. Finally, this activates a caspase-dependent apoptotic pathway in c-KIT-positive AML cells. Moreover, the inhibition of c-KIT endocytosis by dynamin inhibitor (DY) reversed cell viability and c-KIT expression by dasatinib and radotinib. HSP90β expression was recovered by DY in c-KIT-positive AML cells as well. Furthermore, the effect of radotinib on c-KIT and HSP90β showed the same pattern in a xenograft animal model using HEL92.1.7 cells. Therefore, dasatinib and radotinib promote AML cell death by targeting c-KIT. Taken together, these results indicate that dasatinib and radotinib treatment have a potential role in anti-leukemic therapy on c-KIT-positive AML cells.

  13. Changes in c-Kit expression levels during the course of radiation therapy for nasopharyngeal carcinoma.

    PubMed

    Jiang, Feng; Hu, Wei; Zhang, Bicheng; Xu, Jing; Shui, Yongjie; Zhou, Xiaofeng; Ren, Xiaoqiu; Chen, Xiaozhong; Shen, Li; Wei, Qichun

    2016-10-01

    In the era of intensity-modulated radiotherapy, distant metastasis is currently the main cause of treatment failure for nasopharyngeal carcinoma (NPC). Additional therapeutic strategies are required to control the metastasis and improve survival. One strategy is targeted therapy, for example against c-Kit. In the current study, the frequency of c-Kit expression was determined immunohistochemically in 106 NPC patients. c-Kit expression changes during the course of radiation therapy were detected in 41 cases via weekly biopsy. Twelve cases (11.3%) had c-Kit expression scores of 3 + and 16 (15.1%) had scores of 2 + . Thus, c-Kit overexpression (2 + or 3 + ) was observed in 28 (26.4%) patients. There were 35 (33.0%) and 43 (40.6%) patients with c-Kit expression scores of 1 + and 0, respectively. Furthermore, a trend of decreased c-Kit expression was observed after commencing radiotherapy according to the 41 NPC patients who were biopsied weekly. Therefore, c-Kit overexpression was identified to be common in NPC, and evaluating c-Kit as a therapeutic target for metastatic NPC via c-Kit overexpression subsequent to first line treatment may be of interest. To the best of our knowledge, the present study is the first to demonstrate a trend of decreased c-Kit expression during the course of radiotherapy.

  14. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

    PubMed

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

    2017-08-10

    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  15. Prevalence of exon 11 internal tandem duplications in the C-KIT proto-oncogene in Australian canine mast cell tumours.

    PubMed

    Tamlin, V S; Kessell, A E; Mccoy, R J; Dobson, E C; Smith, T S; Hebart, M; Brown, L; Mitrovic, D; Peaston, A E

    2017-10-01

    To measure the prevalence of internal tandem duplications (ITDs) in exon 11 of the proto-oncogene C-KIT in a sample of Australian cutaneous canine mast cell tumours (MCTs) drawn from general practice and to evaluate relationships between tumour mutation status and prognostic factors including signalment, tumour histological grade, tumour anatomical location and tumour size. C-KIT exon 11 ITDs were detected by PCR in DNA extracted from formalin-fixed, paraffin-embedded canine MCTs sourced from three veterinary diagnostic laboratories in Adelaide and Melbourne. Tumours were graded according to two different systems (Patnaik and Kiupel systems) by board-certified anatomical pathologists blinded to the PCR results. Relationships between tumour mutation status and prognostic factors were evaluated using a generalised binary logistic regression analysis. ITDs were identified in 13 of 74 cutaneous canine MCT samples, giving an overall prevalence of 17.6% (95% confidence interval: 8.9-26.2%). ITDs were detected in 10 of 18 Patnaik grade III MCTs (55.6%) and 11 of 22 Kiupel high-grade MCTs (50%). Wald chi-square analysis revealed that detection of tumour ITDs was significantly associated with both Patnaik's and Kiupel's histologic grading systems (each: P < 0.001). The presence of the ITDs in MCTs was not associated with signalment, tumour anatomical location or tumour size. The prevalence of C-KIT exon 11 ITDs in Australian canine MCTs is similar to the prevalence in overseas canine populations (overall prevalence in Australia approximately 18%). ITDs were more frequently identified in higher grade MCTs. © 2017 Australian Veterinary Association.

  16. A novel c.240_241insGG mutation in NDP gene in a family with Norrie disease.

    PubMed

    Andarva, Monavvar; Jamshidi, Javad; Ghaedi, Hamid; Daftarian, Narsis; Emamalizadeh, Babak; Alehabib, Elham; Taghavi, Shaghyegh; Pouriran, Ramin; Darvish, Hossein

    2018-03-01

    Norrie disease (ND) is a rare, X-linked recessive disorder with the main characteristic of early childhood blindness. The aim of the present study was to identify the genetic cause of the disease and the phenotypic characteristics of the patients in an Iranian family with four affected males with ND. Norrie disease pseudoglioma (NDP) gene was sequenced and clinical examination was performed on patients. A GG dinucleotide insertion in exon 3 (c.240_241insGG) of NDP was detected in all patients. The mutation caused a frameshift and an early stop codon (p.Phe81Glyfs*23). A novel mutation was found in the NDP gene in the affected males of the family. As the mutation was absent in the normal male members of the family, it should be the genetic cause of the disease. © 2017 Optometry Australia.

  17. Multiple malignant extragastrointestinal stromal tumors of the greater omentum and results of immunohistochemistry and mutation analysis: A case report

    PubMed Central

    Kim, Jong-Han; Boo, Yoon-Jung; Jung, Cheol-Woong; Park, Sung-Soo; Kim, Seung-Joo; Mok, Young-Jae; Kim, Sang-Dae; Chae, Yang-Suk; Kim, Chong-Suk

    2007-01-01

    To report an extragastrointestinal stromal tumor (EGIST) that occurs outside the gastrointestinal tract and shows unique clinicopathologic and immunohistochemical features. In our case, we experienced multiple soft tissue tumors that originate primarily in the greater omentum, and in immunohistochemical analysis, the tumors showed features that correspond to malignant EGIST. Two large omental masses measured 15 cm x 10 cm and 5 cm × 4 cm sized and several small ovoid fragments were attached to small intestine, mesentery and peritoneum. On histologic findings, the masses were separated from small bowel serosa and had high mitotic count (115/50 HPFs). In the results of immunohistochemical stains, the tumor showed CD117 (c-kit) positive reactivity and high Ki-67 labeling index. On mutation analysis, the c-kit gene mutation was found in the juxtamembrane domain (exon 11) and it was heterozygote. Platelet-derived growth factor receptor (PDGFR) gene mutation was also found in the juxtamemembrane (exon 12) and it was polymorphism. From above findings, we proposed that there may be several mutational pathways to malignant EGIST, so further investigations could be needed to approach this unfavorable disease entity. PMID:17659683

  18. NDP gene mutations in 14 French families with Norrie disease.

    PubMed

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

  19. DHPLC-based mutation analysis of ENG and ALK-1 genes in HHT Italian population.

    PubMed

    Lenato, Gennaro M; Lastella, Patrizia; Di Giacomo, Marilena C; Resta, Nicoletta; Suppressa, Patrizia; Pasculli, Giovanna; Sabbà, Carlo; Guanti, Ginevra

    2006-02-01

    Hereditary haemorrhagic telangiectasia (HHT or Rendu-Osler-Weber syndrome) is an autosomal dominant disorder characterized by localized angiodysplasia due to mutations in endoglin, ALK-1 gene, and a still unidentified locus. The lack of highly recurrent mutations, locus heterogeneity, and the presence of mutations in almost all coding exons of the two genes makes the screening for mutations time-consuming and costly. In the present study, we developed a DHPLC-based protocol for mutation detection in ALK1 and ENG genes through retrospective analysis of known sequence variants, 20 causative mutations and 11 polymorphisms, and a prospective analysis on 47 probands with unknown mutation. Overall DHPLC analysis identified the causative mutation in 61 out 66 DNA samples (92.4%). We found 31 different mutations in the ALK1 gene, of which 15 are novel, and 20, of which 12 are novel, in the ENG gene, thus providing for the first time the mutational spectrum in a cohort of Italian HHT patients. In addition, we characterized the splicing pattern of ALK1 gene in lymphoblastoid cells, both in normal controls and in two individuals carrying a mutation in the non-invariant -3 position of the acceptor splice site upstream exon 6 (c.626-3C>G). Functional essay demonstrated the existence, also in normal individuals, of a small proportion of ALK1 alternative splicing, due to exon 5 skipping, and the presence of further aberrant splicing isoforms in the individuals carrying the c.626-3C>G mutation. 2006 Wiley-Liss, Inc.

  20. Mutations in the ADAR1 gene in Chinese families with dyschromatosis symmetrica hereditaria.

    PubMed

    Zhang, G L; Shi, H J; Shao, M H; Li, M; Mu, H J; Gu, Y; Du, X F; Xie, P

    2013-01-04

    We investigated 2 Chinese families with dyschromatosis symmetrica hereditaria (DSH) and search for mutations in the adenosine deaminase acting on RNA1 (ADAR1) gene in these 2 pedigrees. We performed a mutation analysis of the ADAR1 gene in 2 Chinese families with DSH and reviewed all articles published regarding ADAR1 mutations reported since 2003 by using PubMed. By direct sequencing, a 2-nucleotide AG deletion, 2099-2100delAG, was found in family 1, and a C→T mutation was identified at nucleotide 1420 that changed codon 474 from arginine to a translational termination codon in family 2. Two different pathogenic mutations were identified, c.2099-2100delAG and c.1420C>T, the former being a novel mutation, and the latter previously reported in 3 other families with DSH. To date, a total of 110 mutations in the ADAR1 gene have been reported, and 10 of them were recurrent; the mutations R474X, R1083C, R1096X, and R1155W might be the DSH-related hotspots.

  1. Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

    PubMed

    Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

    2012-01-01

    Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

  2. GM-CSF Inhibits c-Kit and SCF Expression by Bone Marrow-Derived Dendritic Cells

    PubMed Central

    Barroeta Seijas, Amairelys Belen; Simonetti, Sonia; Vitale, Sara; Runci, Daniele; Quinci, Angela Caterina; Soriani, Alessandra; Criscuoli, Mattia; Filippi, Irene; Naldini, Antonella; Sacchetti, Federico Maria; Tarantino, Umberto; Oliva, Francesco; Piccirilli, Eleonora; Santoni, Angela; Di Rosa, Francesca

    2017-01-01

    Stem cell factor (SCF), the ligand of c-kit, is a key cytokine for hematopoiesis. Hematopoietic precursors express c-kit, whereas differentiated cells of hematopoietic lineage are negative for this receptor, with the exception of NK cells, mast cells, and a few others. While it has long been recognized that dendritic cells (DCs) can express c-kit, several questions remain concerning the SCF/c-kit axis in DCs. This is particularly relevant for DCs found in those organs wherein SCF is highly expressed, including the bone marrow (BM). We characterized c-kit expression by conventional DCs (cDCs) from BM and demonstrated a higher proportion of c-kit+ cells among type 1 cDC subsets (cDC1s) than type 2 cDC subsets (cDC2s) in both humans and mice, whereas similar levels of c-kit expression were observed in cDC1s and cDC2s from mouse spleen. To further study c-kit regulation, DCs were generated with granulocyte-macrophage colony-stimulating factor (GM-CSF) from mouse BM, a widely used protocol. CD11c+ cells were purified from pooled non-adherent and slightly adherent cells collected after 7 days of culture, thus obtaining highly purified BM-derived DCs (BMdDCs). BMdDCs contained a small fraction of c-kit+ cells, and by replating them for 2 days with GM-CSF, we obtained a homogeneous population of c-kit+ CD40hi MHCIIhi cells. Not only did BMdDCs express c-kit but they also produced SCF, and both were striking upregulated if GM-CSF was omitted after replating. Furthermore, a small but significant reduction in BMdDC survival was observed upon SCF silencing. Incubation of BMdDCs with SCF did not modulate antigen presentation ability of these cells, nor it did regulate their membrane expression of the chemokine receptor CXCR4. We conclude that the SCF/c-kit-mediated prosurvival circuit may have been overlooked because of the prominent use of GM-CSF in DC cultures in vitro, including those human DC cultures destined for the clinics. We speculate that DCs more prominently rely

  3. New splicing-site mutations in the SURF1 gene in Leigh syndrome patients.

    PubMed

    Pequignot, M O; Desguerre, I; Dey, R; Tartari, M; Zeviani, M; Agostino, A; Benelli, C; Fouque, F; Prip-Buus, C; Marchant, D; Abitbol, M; Marsac, C

    2001-05-04

    The gene SURF1 encodes a factor involved in the biogenesis of cytochrome c oxidase, the last complex in the respiratory chain. Mutations of the SURF1 gene result in Leigh syndrome and severe cytochrome c oxidase deficiency. Analysis of seven unrelated patients with cytochrome c oxidase deficiency and typical Leigh syndrome revealed different SURF1 mutations in four of them. Only these four cases had associated demyelinating neuropathy. Three mutations were novel splicing-site mutations that lead to the excision of exon 6. Two different novel heterozygous mutations were found at the same guanine residue at the donor splice site of intron 6; one was a deletion, whereas the other was a transition [588+1G>A]. The third novel splicing-site mutation was a homozygous [516-2_516-1delAG] in intron 5. One patient only had a homozygous polymorphism in the middle of the intron 8 [835+25C>T]. Western blot analysis showed that Surf1 protein was absent in all four patients harboring mutations. Our studies confirm that the SURF1 gene is an important nuclear gene involved in the cytochrome c oxidase deficiency. We also show that Surf1 protein is not implicated in the assembly of other respiratory chain complexes or the pyruvate dehydrogenase complex.

  4. Confirmation of the pathogenicity of a mutation p.G337C in the COL1A2 gene associated with osteogenesis imperfecta

    PubMed Central

    Jia, Mingrui; Shi, Ranran; Zhao, Xuli; Fu, Zhijian; Bai, Zhijing; Sun, Tao; Zhao, Xuejun; Wang, Wenbo; Xu, Chao; Yan, Fang

    2017-01-01

    Abstract Mutation analysis as the gold standard is particularly important in diagnosis of osteogenesis imperfecta (OI) and it may be preventable upon early diagnosis. In this study, we aimed to analyze the clinical and genetic materials of an OI pedigree as well as to confirm the deleterious property of the mutation. A pedigree with OI was identified. All family members received careful clinical examinations and blood was drawn for genetic analyses. Genes implicated in OI were screened for mutation. The function and structure of the mutant protein were predicted using bioinformatics analysis. The proband, a 9-month fetus, showed abnormal sonographic images. Disproportionately short and triangular face with blue sclera was noticed at birth. She can barely walk and suffered multiple fractures till 2-year old. Her mother appeared small stature, frequent fractures, blue sclera, and deformity of extremities. A heterozygous missense mutation c.1009G>T (p.G337C) in the COL1A2 gene was identified in her mother and her. Bioinformatics analysis showed p.G337 was well-conserved among multiple species and the mutation probably changed the structure and damaged the function of collagen. We suggest that the mutation p.G337C in the COL1A2 gene is pathogenic for OI by affecting the protein structure and the function of collagen. PMID:28953610

  5. Mutation analysis of 12 genes in Chinese families with congenital cataracts

    PubMed Central

    Sun, Wenmin; Xiao, Xueshan; Li, Shiqiang; Guo, Xiangming

    2011-01-01

    Purpose To identify mutations in 12 genes in Chinese families with congenital cataracts. Methods Twenty five families with congenital cataracts involved in this study. The coding exons and adjacent intronic regions of 12 genes were analyzed by cycle sequencing, including the alpha A crystallin (CRYAA), alpha B crystallin (CRYAB), beta A1 crystallin (CRYBA1), beta A4 crystallin (CRYBA4), beta B1 crystallin (CRYBB1), beta B2 crystallin (CRYBB2), beta B3 crystallin (CRYBB3), gamma C crystallin (CRYGC), gamma D crystallin (CRYGD), gamma S crystallin (CRYGS), alpha 3 gap junction protein (GJA3), and alpha 8 gap junction protein (GJA8) genes. Novel variants were further evaluated in 96 normal controls. Results Nine mutations were identified in 10 of the 25 families (40%), including 5 novel (c.350_352delGCT in CRYAA, c.205C>T in CRYAB, c.106G>C in CRYGD, c.77A>G in CRYGS, c.1143_1165del23 in GJA3) and 4 known (c.292G>A in CRYAA; c.215+1G>A and c.272_274delGAG in CRYBA1, and c.176C>T in GJA3). All novel mutations were predicted to be pathogenic and were not present in 96 controls. Conclusions Mutations in the 12 genes encoding crystallins and connexins were responsible for 40% Chinese families with congenital cataracts. Our results enriched our knowledge on the molecular basis of congenital cataracts in Chinese population. PMID:21866213

  6. Stage-specific expression of DDX4 and c-kit at different developmental stages of the porcine testis.

    PubMed

    Lee, Ran; Lee, Won-Young; Park, Hyun-Jung; Ha, Woo-Tae; Woo, Jae-Seok; Chung, Hak-Jae; Lee, Ji-Heon; Hong, Kwonho; Song, Hyuk

    2018-03-01

    Spermatogenesis begins with spermatogonial stem cells (SSCs), which are located in the basement membrane of the adult testes. Previous studies have described specific biomarkers for undifferentiated porcine spermatogonia or SSCs; however, these markers are not sufficient to understand spermatogenesis at different developmental stages. The objective of this study was characterize the expression of DEAD-Box polypeptide 4 (DDX4, also known as VASA) and tyrosine-protein kinase kit (c-kit), as potential markers of male germ cells in the porcine testis. In porcine testis tissue at prepubertal stages (5, 30, and 60 days), DDX4 and c-kit protein expression was detected in the most undifferentiated spermatogonia, which also express protein gene product 9.5 (PGP9.5). However, in porcine testis tissues from pubertal and postpubertal stages (90, 120, and 150 days), DDX4 and c-kit were not detected in PGP9.5-positive undifferentiated spermatogonia. The DDX4 expression pattern was similar to that of c-kit in the porcine testis. In adult porcine testes, DDX4-expressing cells were located on the lumenal side, compared to synaptonemal complex protein 3-positive primary spermatocytes, but DDX-4 was not co-expressed with acrosin, a known acrosome marker. In addition, DDX4 was detected in PGP9.5-expressing porcine SSCs in culture. Based on our results, we suggest that DDX4 and c-kit are putative markers of undifferentiated spermatogonia in the prepubertal porcine testis. While in the postpubertal porcine testis, they are markers of differentiated spermatocytes. These findings may facilitate future studies of porcine spermatogenesis. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Prenatal diagnosis for a Chinese family with a de novo DMD gene mutation

    PubMed Central

    Li, Tao; Zhang, Zhao-jing; Ma, Xin; Lv, Xue; Xiao, Hai; Guo, Qian-nan; Liu, Hong-yan; Wang, Hong-dan; Wu, Dong; Lou, Gui-yu; Wang, Xin; Zhang, Chao-yang; Liao, Shi-xiu

    2017-01-01

    Abstract Background: Patients with Duchenne muscular dystrophy (DMD) usually have severe and fatal symptoms. At present, there is no effective treatment for DMD, thus it is very important to avoid the birth of children with DMD by effective prenatal diagnosis. We identified a de novo DMD gene mutation in a Chinese family, and make a prenatal diagnosis. Methods: First, multiplex ligation-dependent probe amplification (MLPA) was applied to analyze DMD gene exon deletion/duplication in all family members. The coding sequences of 79 exons in DMD gene were analyzed by Sanger sequencing in the patient; and then according to DMD gene exon mutation in the patient, DMD gene sequencing was performed in the family members. On the basis of results above, the pathogenic mutation in DMD gene was identified. Results: MLPA showed no DMD gene exon deletion/duplication in all family members. Sanger sequencing revealed c.2767_2767delT [p.Ser923LeufsX26] mutation in DMD gene of the patient. Heterozygous deletion mutation (T/-) at this locus was observed in the pregnant woman and her mother and younger sister. The analyses of amniotic fluid samples indicated negative Y chromosome sex-determining gene, no DMD gene exon deletion/duplication, no mutations at c.2767 locus, and the inherited maternal X chromosome different from that of the patient. Conclusion: The pathogenic mutation in DMD gene, c.2767_2767delT [p.Ser923LeufsX26], identified in this family is a de novo mutation. On the basis of specific conditions, it is necessary to select suitable methods to make prenatal diagnosis more effective, accurate, and economic. PMID:29390271

  8. HFE Gene Mutations and Iron Status in 100 Healthy Polish Children.

    PubMed

    Kaczorowska-Hac, Barbara; Luszczyk, Marcin; Antosiewicz, Jedrzej; Ziolkowski, Wieslaw; Adamkiewicz-Drozynska, Elzbieta; Mysliwiec, Malgorzata; Milosz, Ewa; Kaczor, Jan J

    2017-07-01

    Iron participates in oxygen transport, energetic, metabolic, and immunologic processes. There are 2 main causes of iron overload: hereditary hemochromatosis which is a primary cause, is a metabolic disorder caused by mutations of genes that control iron metabolism and secondary hemochromatosis caused by multitransfusions, chronic hemolysis, and intake of iron rich food. The most common type of hereditary hemochromatosis is caused by HFE gene mutation. In this study, we analyzed iron metabolism in 100 healthy Polish children in relation to their HFE gene status. The wild-type HFE gene was predominant being observed in 60 children (60%). Twenty-five children (25%), presented with heterozygotic H63D mutation, and 15 children (15%), presented with other mutations (heterozygotic C282Y and S65C mutation, compound heterozygotes C282Y/S65C, C282Y/H63D, H63D homozygote). The mean concentration of iron, the level of ferritin, and transferrin saturation were statistically higher in the group of HFE variants compared with the wild-type group. H63D carriers presented with higher mean concentration of iron, ferritin levels, and transferrin saturation compared with the wild-type group. Male HFE carriers presented with higher iron concentration, transferrin saturation, and ferritin levels than females. This preliminary investigation demonstrates allelic impact on potential disease progression from childhood.

  9. Screening for mutations in two exons of FANCG gene in Pakistani population.

    PubMed

    Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

    2017-06-01

    Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

  10. Mutation and virulence assessment of chromosomal genes of Rhodococcus equi 103

    PubMed Central

    Pei, Yanlong; Parreira, Valeria; Nicholson, Vivian M.; Prescott, John F.

    2007-01-01

    Rhodococcus equi can cause severe or fatal pneumonia in foals as well as in immunocompromised animals and humans. Its ability to persist in macrophages is fundamental to how it causes disease, but the basis of this is poorly understood. To examine further the general application of a recently developed system of targeted gene mutation and to assess the importance of different genes in resistance to innate immune defenses, we disrupted the genes encoding high-temperature requirement A (htrA), nitrate reductase (narG), peptidase D (pepD), phosphoribosylaminoimidazole-succinocarboxamide synthase (purC), and superoxide dismutase (sodC) in strain 103 of R. equi using a double-crossover homologous recombination approach. Virulence testing by clearance after intravenous injection in mice showed that the htrA and narG mutants were fully attenuated, the purC and sodC mutants were unchanged, and the pepD mutant was slightly attenuated. Complementation with the pREM shuttle plasmid restored the virulence of the htrA and pepD mutants but not that of the narG mutant. A single-crossover mutation approach was simpler and faster than the double-crossover homologous recombination technique and was used to obtain mutations in 6 other genes potentially involved in virulence (clpB, fadD8, fbpB, glnA1, regX3, and sigF). These mutants were not attenuated in the mouse clearance assay. We were not able to obtain mutants for genes furA, galE, and sigE using the single-crossover mutation approach. In summary, the targeted-mutation system had general applicability but was not always completely successful, perhaps because some genes are essential under the growth conditions used or because the success of mutation depends on the target genes. PMID:17193875

  11. Synthesis and biological evaluation of di-aryl urea derivatives as c-Kit inhibitors.

    PubMed

    Ravez, Séverine; Arsenlis, Stéphane; Barczyk, Amélie; Dupont, Anthony; Frédérick, Raphaël; Hesse, Stéphanie; Kirsch, Gilbert; Depreux, Patrick; Goossens, Laurence

    2015-11-15

    Inhibition of receptor tyrosine kinases (RTKs) continued to be a successful approach for the treatment of many types of human cancers and many potent small molecules kinase inhibitors have been discovered the last decade. In the present study, we describe the synthesis of thienopyrimidine derivatives and their pharmacological evaluation against nine kinases (EGFR, PDGFR-ß, c-Kit, c-Met, Src, Raf, VEGFR-1, -2 and -3). Most of the synthesized compounds showed from moderate to potent activities against c-Kit with IC50 values in the nanomolar range. Among them, 4-anilino(urea)thienopyrimidine analogs showed selectivity and potent c-Kit inhibition with IC50 values less than 6 nM. Docking simulation was performed for the most promising compound 9 into the c-Kit active site to determine the potential binding mode. This study reveal that the 4-anilino(urea)thienopyrimidine is an interesting scaffold to design novel potent and selective c-Kit inhibitors which may make promising candidates for cancers where c-Kit receptors are overexpressed. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Mutational analysis in patients with Autosomal Dominant Polycystic Kidney Disease (ADPKD): Identification of five mutations in the PKD1 gene.

    PubMed

    Abdelwahed, Mayssa; Hilbert, Pascale; Ahmed, Asma; Mahfoudh, Hichem; Bouomrani, Salem; Dey, Mouna; Hachicha, Jamil; Kamoun, Hassen; Keskes-Ammar, Leila; Belguith, Neïla

    2018-05-31

    Autosomal Dominant Polycystic Kidney Disease (ADPKD), the most frequent genetic disorder of the kidneys, is characterized by a typical presenting symptoms include cysts development in different organs and a non-cysts manifestations. ADPKD is caused by mutations in PKD1 or PKD2 genes. In this study, we aimed to search for molecular causative defects among PKD1 and PKD2 genes. Eighteen patients were diagnosed based on renal ultrasonography and renal/extra-renal manifestations. Then, Sanger sequencing was performed for PKD1 and PKD2 genes. Multiplex Ligation dependent Probe Amplification method (MLPA) methods was performed for both PKD genes. Mutational analysis of the PKD2 gene revealed the absence of variants and no deletions or duplications of both PKD genes were detected. But three novels mutations i.e. p.S463C exon 7; c. c.11156+2T>C IVS38 and c.8161-1G>A IVS22 and two previously reported c.1522T>C exon 7 and c.412C>T exon 4 mutations in the PKD1 gene were detected. Bioinformatics tools predicted that the novel variants have a pathogenic effects on splicing machinery, pre-mRNA secondary structure and stability and protein stability. Our results highlighted molecular features of Tunisian patients with ADPKD and revealed novel variations that can be utilized in clinical diagnosis and in the evaluation of living kidney donor. To the best of our knowledge, this is the first report of Autosomal Polycystic Kidney Disease in Tunisia. Copyright © 2017. Published by Elsevier B.V.

  13. [Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

    PubMed

    Fukuda, H; Hiramatsu, K

    1997-05-01

    Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

  14. Ocular phenotypes associated with two mutations (R121W, C126X) in the Norrie disease gene.

    PubMed

    Kellner, U; Fuchs, S; Bornfeld, N; Foerster, M H; Gal, A

    1996-06-01

    To describe the ocular phenotypes associated with 2 mutations in the Norrie disease gene including a manifesting carrier. Ophthalmological examinations were performed in 2 affected males and one manifesting carrier. Genomic DNA was analyzed by direct sequencing of the Norrie disease gene. Family I: A 29-year-old male had the right eye enucleated at the age of 3 years. His left eye showed severe temporal dragging of the retina and central scars. Visual acuity was 20/300. DNA analysis revealed a C-to-T transition of the first nucleotide in codon 121 predicting the replacement of arginine-121 by tryptophan (R121W). Both the mother and maternal grandmother carry the same mutation in heterozygous form. Family 2: A 3-month-old boy presented with severe temporal dragging of the retina on both eyes and subsequently developed retinal detachment. Visual acuity was limited to light perception. His mother's left eye was amaurotic and phthitic. Her right eye showed severe retinal dragging, visual acuity was reduced to 20/60. DNA analysis revealed a T-to-A transversion of the third nucleotide in codon 126 creating a stop codon (C126X). The mother and maternal grandmother were carriers. Mutations in the Norrie disease gene can lead to retinal malformations of variable severity both in hemizygous males and manifesting carriers.

  15. Mutation spectrum and differential gene expression in cystic and solid vestibular schwannoma.

    PubMed

    Zhang, Zhihua; Wang, Zhaoyan; Sun, Lianhua; Li, Xiaohua; Huang, Qi; Yang, Tao; Wu, Hao

    2014-03-01

    We sought to characterize the mutation spectrum of NF2 and the differential gene expression in cystic and solid vestibular schwannomas. We collected tumor tissue and blood samples of 31 cystic vestibular schwannomas and 114 solid vestibular schwannomas. Mutation screening of NF2 was performed in both tumor and blood DNA samples of all patients. cDNA microarray was used to analyze the differential gene expression between 11 cystic vestibular schwannomas and 6 solid vestibular schwannomas. Expression levels of top candidate genes were verified by quantitative reverse transcription PCR. NF2 mutations were identified in 34.5% of sporadic vestibular schwannomas, with all mutations being exclusively somatic. No significant difference was found between the mutation detection rates of cystic vestibular schwannoma (35.5%) and solid vestibular schwannoma (34.2%). cDNA microarray analysis detected a total of 46 differentially expressed genes between the cystic vestibular schwannoma and solid vestibular schwannoma samples. The significantly decreased expression of four top candidate genes, C1orf130, CNTF, COL4A3, and COL4A4, was verified by quantitative reverse transcription PCR. NF2 mutations are not directly involved in the cystic formation of vestibular schwannoma. In addition, the differential gene expression of cystic vestibular schwannoma reported in our study may provide useful insights into the molecular mechanism underlying this process.

  16. Is the c.3G>C mutation in the succinate dehydrogenase subunit D (SDHD) gene due to a founder effect in Chinese head and neck paraganglioma patients?

    PubMed

    Zha, Yang; Chen, Xing-ming; Lam, Ching-wan; Lee, Soo-chin; Tong, Sui-fan; Gao, Zhi-qiang

    2011-08-01

    Three Chinese patients with head and neck paragangliomas have been reported to carry the c.3G>C mutation in the succinate dehydrogenase subunit D (SDHD) gene. In addition, in our hospital, two further patients were identified who have the same mutation. It is unclear whether the c.3G>C mutation in Chinese patients is a recurrent mutation or if it is due to a founder effect. We conducted haplotype analysis on these patients to answer this question. Individual case-control study. Germ-line mutations were confirmed in the patients and their families examined in this study using direct sequencing. We also constructed and analyzed haplotypes in four Chinese families. Genotype frequencies were compared to the control group. Three of four families shared the same haplotype, which rarely occurred in the control group. The last family shared a very short area on the physical map with the other three families. There is a founder effect in Chinese head and neck paraganglioma patients carrying the SDHD c.3G>C mutation. Copyright © 2011 The American Laryngological, Rhinological, and Otological Society, Inc.

  17. Utilization of gene mapping and candidate gene mutation screening for diagnosing clinically equivocal conditions: a Norrie disease case study.

    PubMed

    Chini, Vasiliki; Stambouli, Danai; Nedelea, Florina Mihaela; Filipescu, George Alexandru; Mina, Diana; Kambouris, Marios; El-Shantil, Hatem

    2014-06-01

    Prenatal diagnosis was requested for an undiagnosed eye disease showing X-linked inheritance in a family. No medical records existed for the affected family members. Mapping of the X chromosome and candidate gene mutation screening identified a c.C267A[p.F89L] mutation in NPD previously described as possibly causing Norrie disease. The detection of the c.C267A[p.F89L] variant in another unrelated family confirms the pathogenic nature of the mutation for the Norrie disease phenotype. Gene mapping, haplotype analysis, and candidate gene screening have been previously utilized in research applications but were applied here in a diagnostic setting due to the scarcity of available clinical information. The clinical diagnosis and mutation identification were critical for providing proper genetic counseling and prenatal diagnosis for this family.

  18. Loss of c-Kit function impairs arteriogenesis in a mouse model of hindlimb ischemia.

    PubMed

    Hernandez, Diana R; Artiles, Adriana; Duque, Juan C; Martinez, Laisel; Pinto, Mariana T; Webster, Keith A; Velazquez, Omaida C; Vazquez-Padron, Roberto I; Lassance-Soares, Roberta M

    2018-04-01

    Arteriogenesis is a process whereby collateral vessels remodel usually in response to increased blood flow and/or wall stress. Remodeling of collaterals can function as a natural bypass to alleviate ischemia during arterial occlusion. Here we used a genetic approach to investigate possible roles of tyrosine receptor c-Kit in arteriogenesis. Mutant mice with loss of c-Kit function (Kit W/W-v ), and controls were subjected to hindlimb ischemia. Blood flow recovery was evaluated pre-, post-, and weekly after ischemia. Foot ischemic damage and function were assessed between days 1 to 14 post-ischemia while collaterals remodeling were measured 28 days post-ischemia. Both groups of mice also were subjected to wild type bone marrow cells transplantation 3 weeks before hindlimb ischemia to evaluate possible contributions of defective bone marrow c-Kit expression on vascular recovery. Kit W/W-v mice displayed impaired blood flow recovery, greater ischemic damage and foot dysfunction after ischemia compared to controls. Kit W/W-v mice also demonstrated impaired collateral remodeling consistent with flow recovery findings. Because arteriogenesis is a biological process that involves bone marrow-derived cells, we investigated which source of c-Kit signaling (bone marrow or vascular) plays a major role in arteriogenesis. Kit W/W-v mice transplanted with bone marrow wild type cells exhibited similar phenotype of impaired blood flow recovery, greater tissue ischemic damage and foot dysfunction as nontransplanted Kit W/W-v mice. This study provides evidence that c-Kit signaling is required during arteriogenesis. Also, it strongly suggests a vascular role for c-Kit signaling because rescue of systemic c-Kit activity by bone marrow transplantation did not augment the functional recovery of Kit W/W-v mouse hindlimbs. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. FANCA Gene Mutations with 8 Novel Molecular Changes in Indian Fanconi Anemia Patients.

    PubMed

    Solanki, Avani; Mohanty, Purvi; Shukla, Pallavi; Rao, Anita; Ghosh, Kanjaksha; Vundinti, Babu Rao

    2016-01-01

    Fanconi anemia (FA), a rare heterogeneous genetic disorder, is known to be associated with 19 genes and a spectrum of clinical features. We studied FANCA molecular changes in 34 unrelated and 2 siblings of Indian patients with FA and have identified 26 different molecular changes of FANCA gene, of which 8 were novel mutations (a small deletion c.2500delC, 4 non-sense mutations c.2182C>T, c.2630C>G, c.3677C>G, c.3189G>A; and 3 missense mutations; c.1273G>C, c.3679 G>C, and c.3992 T>C). Among these only 16 patients could be assigned FA-A complementation group, because we could not confirm single exon deletions detected by MLPA or cDNA amplification by secondary confirmation method and due to presence of heterozygous non-pathogenic variations or heterozygous pathogenic mutations. An effective molecular screening strategy should be developed for confirmation of these mutations and determining the breakpoints for single exon deletions.

  20. FANCA Gene Mutations with 8 Novel Molecular Changes in Indian Fanconi Anemia Patients

    PubMed Central

    Solanki, Avani; Mohanty, Purvi; Shukla, Pallavi; Rao, Anita; Ghosh, Kanjaksha; Vundinti, Babu Rao

    2016-01-01

    Fanconi anemia (FA), a rare heterogeneous genetic disorder, is known to be associated with 19 genes and a spectrum of clinical features. We studied FANCA molecular changes in 34 unrelated and 2 siblings of Indian patients with FA and have identified 26 different molecular changes of FANCA gene, of which 8 were novel mutations (a small deletion c.2500delC, 4 non-sense mutations c.2182C>T, c.2630C>G, c.3677C>G, c.3189G>A; and 3 missense mutations; c.1273G>C, c.3679 G>C, and c.3992 T>C). Among these only 16 patients could be assigned FA-A complementation group, because we could not confirm single exon deletions detected by MLPA or cDNA amplification by secondary confirmation method and due to presence of heterozygous non-pathogenic variations or heterozygous pathogenic mutations. An effective molecular screening strategy should be developed for confirmation of these mutations and determining the breakpoints for single exon deletions. PMID:26799702

  1. iMARS--mutation analysis reporting software: an analysis of spontaneous cII mutation spectra.

    PubMed

    Morgan, Claire; Lewis, Paul D

    2006-01-31

    The sensitivity of any mutational assay is determined by the level at which spontaneous mutations occur in the corresponding untreated controls. Establishing the type and frequency at which mutations occur naturally within a test system is essential if one is to draw scientifically sound conclusions regarding chemically induced mutations. Currently, mutation-spectra analysis is laborious and time-consuming. Thus, we have developed iMARS, a comprehensive mutation-spectrum analysis package that utilises routinely used methodologies and visualisation tools. To demonstrate the use and capabilities of iMARS, we have analysed the distribution, types and sequence context of spontaneous base substitutions derived from the cII gene mutation assay in transgenic animals. Analysis of spontaneous mutation spectra revealed variation both within and between the transgenic rodent test systems Big Blue Mouse, MutaMouse and Big Blue Rat. The most common spontaneous base substitutions were G:C-->A:T transitions and G:C-->T:A transversions. All Big Blue Mouse spectra were significantly different from each other by distribution and nearly all by mutation type, whereas the converse was true for the other test systems. Twenty-eight mutation hotspots were observed across all spectra generally occurring in CG, GA/TC, GG and GC dinucleotides. A mutation hotspot at nucleotide 212 occurred at a higher frequency in MutaMouse and Big Blue Rat. In addition, CG dinucleotides were the most mutable in all spectra except two Big Blue Mouse spectra. Thus, spontaneous base-substitution spectra showed more variation in distribution, type and sequence context in Big Blue Mouse relative to spectra derived from MutaMouse and Big Blue Rat. The results of our analysis provide a baseline reference for mutation studies utilising the cII gene in transgenic rodent models. The potential differences in spontaneous base-substitution spectra should be considered when making comparisons between these test systems

  2. A new C-terminal located mutation (V272ter) in the PIT-1 gene manifesting with severe congenital hypothyroidism. Possible functionality of the PIT-1 C-terminus.

    PubMed

    Blankenstein, O; Mühlenberg, R; Kim, C; Wüller, S; Pfäffle, R; Heimann, G

    2001-01-01

    We describe a newborn with clinical signs of severe hypothyroidism and combined pituitary hormone deficiency due to a new mutation in the PIT-1 gene. Endocrine stimulation test revealed a deficiency for PRL, TSH and GH, suggesting a defect in the pituitary transcription factor PIT-1. Genetic analysis of the PIT-1 gene was performed by exon-specific PCR, followed by SSCP mutation screening and DNA sequencing of the abnormal migrating fragments. DNA sequencing revealed a new mutation (V272ter) in direct neighborhood to a known mutational hot spot (R271W) in the C-terminal part of the PIT-1 molecule. Whereas the R271W mutation has a dominant negative effect on the mutant protein, the newly described mutation is inherited in an autosomal-recessive way. The biological consequences of these two different mutations are discussed. Copyright 2002 S. Karger AG, Basel

  3. Functional TRPV2 and TRPV4 channels in human cardiac c-kit(+) progenitor cells.

    PubMed

    Che, Hui; Xiao, Guo-Sheng; Sun, Hai-Ying; Wang, Yan; Li, Gui-Rong

    2016-06-01

    The cellular physiology and biology of human cardiac c-kit(+) progenitor cells has not been extensively characterized and remains an area of active research. This study investigates the functional expression of transient receptor potential vanilloid (TRPV) and possible roles for this ion channel in regulating proliferation and migration of human cardiac c-kit(+) progenitor cells. We found that genes coding for TRPV2 and TRPV4 channels and their proteins are significantly expressed in human c-kit(+) cardiac stem cells. Probenecid, an activator of TRPV2, induced an increase in intracellular Ca(2+) (Ca(2+) i ), an effect that may be attenuated or abolished by the TRPV2 blocker ruthenium red. The TRPV4 channel activator 4α-phorbol 12-13-dicaprinate induced Ca(2+) i oscillations, which can be inhibited by the TRPV4 blocker RN-1734. The alteration of Ca(2+) i by probenecid or 4α-phorbol 12-13-dicprinate was dramatically inhibited in cells infected with TRPV2 short hairpin RNA (shRNA) or TRPV4 shRNA. Silencing TRPV2, but not TRPV4, significantly reduced cell proliferation by arresting cells at the G0/G1 boundary of the cell cycle. Cell migration was reduced by silencing TRPV2 or TRPV4. Western blot revealed that silencing TRPV2 decreased expression of cyclin D1, cyclin E, pERK1/2 and pAkt, whereas silencing TRPV4 only reduced pAkt expression. Our results demonstrate for the first time that functional TRPV2 and TRPV4 channels are abundantly expressed in human cardiac c-kit(+) progenitor cells. TRPV2 channels, but not TRPV4 channels, participate in regulating cell cycle progression; moreover, both TRPV2 and TRPV4 are involved in migration of human cardiac c-kit(+) progenitor cells. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  4. Recurrently Mutated Genes Differ between Leptomeningeal and Solid Lung Cancer Brain Metastases.

    PubMed

    Li, Yingmei; Liu, Boxiang; Connolly, Ian David; Kakusa, Bina Wasunga; Pan, Wenying; Nagpal, Seema; Montgomery, Stephen B; Hayden Gephart, Melanie

    2018-03-29

    When compared with solid brain metastases from NSCLC, leptomeningeal disease (LMD) has unique growth patterns and is rapidly fatal. Patients with LMD do not undergo surgical resection, limiting the tissue available for scientific research. In this study we performed whole exome sequencing on eight samples of LMD to identify somatic mutations and compared the results with those for 26 solid brain metastases. We found that taste 2 receptor member 31 gene (TAS2R31) and phosphodiesterase 4D interacting protein gene (PDE4DIP) were recurrently mutated among LMD samples, suggesting involvement in LMD progression. Together with a retrospective review of the charts of an additional 44 patients with NSCLC LMD, we discovered a surprisingly low number of KRAS mutations (n = 4 [7.7%]) but a high number of EGFR mutations (n = 33 [63.5%]). The median interval for development of LMD from NSCLC was shorter in patients with mutant EGFR (16.3 months) than in patients with wild-type EGFR (23.9 months) (p = 0.017). Targeted analysis of recurrent mutations thus presents a useful complement to the existing diagnostic tool kit, and correlations of EGFR in LMD and KRAS in solid metastases suggest that molecular distinctions or systemic treatment pressure underpin the differences in growth patterns within the brain. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  5. Growth factor independence-1 (Gfi-1) plays a role in mediating specific granule deficiency (SGD) in a patient lacking a gene-inactivating mutation in the C/EBPϵ gene

    PubMed Central

    Khanna-Gupta, Arati; Sun, Hong; Zibello, Theresa; Lee, Han Myung; Dahl, Richard; Boxer, Laurence A.

    2007-01-01

    Neutrophil-specific granule deficiency (SGD) is a rare congenital disorder marked by recurrent bacterial infections. Neutrophils from SGD patients lack secondary and tertiary granules and their content proteins and lack normal neutrophil functions. Gene-inactivating mutations in the C/EBPϵ gene have been identified in 2 SGD patients. Our studies on a third SGD patient revealed a heterozygous mutation in the C/EBPϵ gene. However, we demonstrate elevated levels of C/EBPϵ and PU.1 proteins in the patient's peripheral blood neutrophils. The expression of the transcription factor growth factor independence-1 (Gfi-1), however, was found to be markedly reduced in our SGD patient despite the absence of an obvious mutation in this gene. This may explain the elevated levels of both C/EBPϵ and PU.1, which are targets of Gfi-1 transcriptional repression. We have generated a growth factor–dependent EML cell line from the bone marrow of Gfi-1+/− and Gfi-1+/+ mice as a model for Gfi-1–deficient SGD, and demonstrate that lower levels of Gfi-1 expression in the Gfi-1+/− EML cells is associated with reduced levels of secondary granule protein (SGP) gene expression. Furthermore, we demonstrate a positive role for Gfi-1 in SGP expression, in that Gfi-1 binds to and up-regulates the promoter of neutrophil collagenase (an SGP gene), in cooperation with wild-type but not with mutant C/EBPϵ. We hypothesize that decreased Gfi-1 levels in our SGD patient, together with the mutant C/EBPϵ, block SGP expression, thereby contributing to the underlying etiology of the disease in our patient. PMID:17244686

  6. Mutation and virulence assessment of chromosomal genes of Rhodococcus equi 103.

    PubMed

    Pei, Yanlong; Parreira, Valeria; Nicholson, Vivian M; Prescott, John F

    2007-01-01

    Rhodococcus equi can cause severe or fatal pneumonia in foals as well as in immunocompromised animals and humans. Its ability to persist in macrophages is fundamental to how it causes disease, but the basis of this is poorly understood. To examine further the general application of a recently developed system of targeted gene mutation and to assess the importance of different genes in resistance to innate immune defenses, we disrupted the genes encoding high-temperature requirement A (htrA), nitrate reductase (narG), peptidase D (pepD), phosphoribosylaminoimidazole-succinocarboxamide synthase (purC), and superoxide dismutase (sodC) in strain 103 of R. equi using a double-crossover homologous recombination approach. Virulence testing by clearance after intravenous injection in mice showed that the htrA and narG mutants were fully attenuated, the purC and sodC mutants were unchanged, and the pepD mutant was slightly attenuated. Complementation with the pREM shuttle plasmid restored the virulence of the htrA and pepD mutants but not that of the narG mutant. A single-crossover mutation approach was simpler and faster than the double-crossover homologous recombination technique and was used to obtain mutations in 6 other genes potentially involved in virulence (clpB, fadD8, fbpB, glnA1, regX3, and sigF). These mutants were not attenuated in the mouse clearance assay. We were not able to obtain mutants for genesfurA, galE, and sigE using the single-crossover mutation approach. In summary, the targeted-mutation system had general applicability but was not always completely successful, perhaps because some genes are essential under the growth conditions used or because the success of mutation depends on the target genes.

  7. Compound Heterozygosity for Hb Alperton (HBB: c.407C>T) and IVS-I-5 (G>C) (HBB: c.92+5G>C) Mutations Presenting as a Moderate Anemia in an Indian Family.

    PubMed

    Godbole, Koumudi G; Ramachandran, Angelina; Karkamkar, Ashwini S; Dalal, Ashwin B

    2018-04-13

    While knowledge of HBB gene mutations is necessary for offering prenatal diagnosis (PND) of β-thalassemia (β-thal), a genotype-phenotype correlation may not always be available for rare variants. We present for the first time, genotype-phenotype correlation for a compound heterozygous status with IVS-I-5 (G>C) (HBB: c.92+5G>C) and HBB: c.407C>T (Hb Alperton) mutations on the HBB gene in an Indian family. Hb Alperton is a very rare hemoglobin (Hb) variant with scant published information about its clinical presentation, especially when accompanied with another HBB gene mutation. Here we provide biochemical as well as clinical details of this variant.

  8. Targeted next generation sequencing of mucosal melanomas identifies frequent NF1 and RAS mutations.

    PubMed

    Cosgarea, Ioana; Ugurel, Selma; Sucker, Antje; Livingstone, Elisabeth; Zimmer, Lisa; Ziemer, Mirjana; Utikal, Jochen; Mohr, Peter; Pfeiffer, Christiane; Pföhler, Claudia; Hillen, Uwe; Horn, Susanne; Schadendorf, Dirk; Griewank, Klaus G; Roesch, Alexander

    2017-06-20

    Mucosal melanoma represents ~1% of all melanomas, frequently having a poor prognosis due to diagnosis at a late stage of disease. Mucosal melanoma differs from cutaneous melanoma not only in terms of poorer clinical outcome but also on the molecular level having e.g. less BRAF and more frequent KIT mutations than cutaneous melanomas. For the majority of mucosal melanomas oncogenic driver mutations remain unknown. In our study, 75 tumor tissues from patients diagnosed with mucosal melanoma were analyzed, applying a targeted next generation sequencing panel covering 29 known recurrently mutated genes in melanoma. NF1 and RAS mutations were identified as the most frequently mutated genes occurring in 18.3% and 16.9% of samples, respectively. Mutations in BRAF were identified in 8.4% and KIT in 7.0% of tumor samples. Our study identifies NF1 as the most frequently occurring driver mutation in mucosal melanoma. RAS alterations, consisting of NRAS and KRAS mutations, were the second most frequent mutation type. BRAF and KIT mutations were rare with frequencies below 10% each. Our data indicate that in mucosal melanomas RAS/NF1 alterations are frequent, implying a significant pathogenetic role for MAPK and potentially PI3K pathway activation in these tumors.

  9. Targeted next generation sequencing of mucosal melanomas identifies frequent NF1 and RAS mutations

    PubMed Central

    Cosgarea, Ioana; Ugurel, Selma; Sucker, Antje; Livingstone, Elisabeth; Zimmer, Lisa; Ziemer, Mirjana; Utikal, Jochen; Mohr, Peter; Pfeiffer, Christiane; Pföhler, Claudia; Hillen, Uwe; Horn, Susanne; Schadendorf, Dirk

    2017-01-01

    Purpose Mucosal melanoma represents ~1% of all melanomas, frequently having a poor prognosis due to diagnosis at a late stage of disease. Mucosal melanoma differs from cutaneous melanoma not only in terms of poorer clinical outcome but also on the molecular level having e.g. less BRAF and more frequent KIT mutations than cutaneous melanomas. For the majority of mucosal melanomas oncogenic driver mutations remain unknown. Experimental Design and Results In our study, 75 tumor tissues from patients diagnosed with mucosal melanoma were analyzed, applying a targeted next generation sequencing panel covering 29 known recurrently mutated genes in melanoma. NF1 and RAS mutations were identified as the most frequently mutated genes occurring in 18.3% and 16.9% of samples, respectively. Mutations in BRAF were identified in 8.4% and KIT in 7.0% of tumor samples. Conclusions Our study identifies NF1 as the most frequently occurring driver mutation in mucosal melanoma. RAS alterations, consisting of NRAS and KRAS mutations, were the second most frequent mutation type. BRAF and KIT mutations were rare with frequencies below 10% each. Our data indicate that in mucosal melanomas RAS/NF1 alterations are frequent, implying a significant pathogenetic role for MAPK and potentially PI3K pathway activation in these tumors. PMID:28380455

  10. Cadmium exposure in newborn rats ovary induces developmental disorders of primordial follicles and the differential expression of SCF/c-kit gene.

    PubMed

    Zhang, Wenchang; Wu, Tingting; Zhang, Chenyun; Luo, Lingfeng; Xie, Meimei; Huang, Huiling

    2017-10-05

    Since the 1990s, the rising problem that gonad reproductive toxicity on adult female after exposing to cadmium (Cd), an environmental endocrine disruptor, has attracted high attention at home and abroad,and was systematically studied. Our research focuses on a further problem is that early cadmium exposure (during birth to before puberty) impact on development and function of ovarian cells and its possible mechanism. Our research focuses on the changes of ovarian cells growth and development after the newborn rat ovaries with cadmium exposure in vitro, and different expression of ovarian cells development-related factors, SCF/c-kit and changes of their DNA methylation status. We obtained ovaries from 4-day-old SD rats and cultured them in DMEM/F12 mixed with α-MEM media in vitro. Different doses of cadmium were designed as control, 0.5, 5, 10 and 50μM, and then the constituent ratio of ovarian follicle and follicular oocytes diameter were observed with microscope after 4-h exposure. We found that the increased constituent ratio of original follicle and decreased diameter of all levels of follicular oocytes(compared with control, with statistically significant differences, P<0.01).After the measurement of expression of SCF/c-kit by qRT-PCR and Western Blotting, the mRNA and protein expression of SCF/c-kit in ovarian were both decreased. We further found that the increased constituent ratio of growth follicle and increased diameter of oocytes under the treatment of adding SCF in cell culture media. Finally, MALDI-TOF-MS method showed DNA-low methylation status of SCF/c-kit promoter region after Cd exposure. Overall, we concluded that the exposure of cadimium (5-50μM) on newborn rats ovaries could inhibit follicle development.SCF/c-kit system might mediate follicle development damage caused by cadmium, which is associated with DNA hypomethylation of SCF/c-kit promoter region may be worthy of further study. Copyright © 2017. Published by Elsevier B.V.

  11. Novel mutations of the AGXT gene causing primary hyperoxaluria type 1.

    PubMed

    Yuen, Yuet-Ping; Lai, Chi-Kong; Tong, Gensy Mei-Wah; Wong, Ping-Nam; Wong, Francis Kim-Ming; Mak, Siu-Ka; Lo, Kin-Yee; Wong, Andrew Kui-Man; Tong, Sui-Fan; Chan, Yan-Wo; Lam, Ching-Wan

    2004-01-01

    Primary hyperoxaluria type 1 (PH1), an inherited cause of nephrolithiasis, is due to a functional defect of the liver-specific peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT). A definitive PH1 diagnosis can be established by analyzing AGT activity in liver tissue or mutation analysis of the AGXT gene. The molecular basis of PH1 in three Chinese patients, two with adult-onset and one with childhood-onset recurrent nephrolithiasis, was established by analyzing the entire AGXT gene. Three novel mutations (c2T>C, c817insAG and c844C>T) and two previously reported mutations (c33insC and 679-IVS6+2delAAgt) were identified. c2T>C converts the initiation codon from ATG to ACG, which predicts significant reduction, if not complete abolition, of protein translation. c817insAG leads to a frameshift and changes the amino acid sequence after codon 274. c844C>T changes glutamine at codon 282 to a termination codon, resulting in protein truncation. This is the first report describing AGXT gene mutations in Chinese patients with PH1. AGXT genotypes cannot fully explain the clinical heterogeneity of PH1, and other factors involved in disease pathogenesis remain to be identified. Our experience emphasizes the importance of excluding PH1 in patients with recurrent nephrolithiasis to avoid delay or inappropriate management.

  12. Hotspot mutations in cancer genes may be missed in routine diagnostics due to neighbouring sequence variants.

    PubMed

    Bartels, Stephan; Schipper, Elisa; Hasemeier, Britta; Kreipe, Hans; Lehmann, Ulrich

    2018-05-27

    The detection of hotspot mutations in key cancer genes is now an essential part of the diagnostic work-up in molecular pathology. Nearly all assays for mutation detection involve an amplification step. A second single nucleotide variant (SNV) on the same allele adjacent to a mutational hotspot can interfere with primer binding, leading to unnoticed allele-specific amplification of the wild type allele and thereby false-negative mutation testing. We present two diagnostic cases with false negative sequence results for JAK2 and SRSF2. In both cases mutations would have escaped detection if only one strand of DNA had been analysed. Because many commercially available diagnostic kits rely on the analysis of only one DNA strand they are prone to fail in cases like these. Detailed protocols and quality control measures to prevent corresponding pitfalls are presented. Copyright © 2017. Published by Elsevier Inc.

  13. Iron overload and HFE gene mutations in Czech patients with chronic liver diseases.

    PubMed

    Dostalikova-Cimburova, Marketa; Kratka, Karolina; Stransky, Jaroslav; Putova, Ivana; Cieslarova, Blanka; Horak, Jiri

    2012-01-01

    The aim of the study was to identify the prevalence of HFE gene mutations in Czech patients with chronic liver diseases and the influence of the mutations on iron status. The presence of HFE gene mutations (C282Y, H63D, and S65C) analyzed by the PCR-RFLP method, presence of cirrhosis, and serum iron indices were compared among 454 patients with different chronic liver diseases (51 with chronic hepatitis B, 122 with chronic hepatitis C, 218 with alcoholic liver disease, and 63 patients with hemochromatosis). Chronic liver diseases patients other than hemochromatics did not have an increased frequency of HFE gene mutations compared to controls. Although 33.3% of patients with hepatitis B, 43% of patients with hepatitis C, and 73.2% of patients with alcoholic liver disease had elevated transferrin saturation or serum ferritin levels, the presence of HFE gene mutations was not significantly associated with iron overload in these patients. Additionally, patients with cirrhosis did not have frequencies of HFE mutations different from those without cirrhosis. This study emphasizes the importance, not only of C282Y, but also of the H63D homozygous genetic constellation in Czech hemochromatosis patients. Our findings show that increased iron indices are common in chronic liver diseases but {\\it HFE} mutations do not play an important role in the pathogenesis of chronic hepatitis B, chronic hepatitis C, and alcoholic liver disease.

  14. The landscape of cancer genes and mutational processes in breast cancer

    PubMed Central

    Stephens, Philip J.; Tarpey, Patrick S.; Davies, Helen; Loo, Peter Van; Greenman, Chris; Wedge, David C.; Nik-Zainal, Serena; Martin, Sancha; Varela, Ignacio; Bignell, Graham R.; Yates, Lucy R.; Papaemmanuil, Elli; Beare, David; Butler, Adam; Cheverton, Angela; Gamble, John; Hinton, Jonathan; Jia, Mingming; Jayakumar, Alagu; Jones, David; Latimer, Calli; Lau, King Wai; McLaren, Stuart; McBride, David J.; Menzies, Andrew; Mudie, Laura; Raine, Keiran; Rad, Roland; Chapman, Michael Spencer; Teague, Jon; Easton, Douglas; Langerød, Anita; OSBREAC; Lee, Ming Ta Michael; Shen, Chen-Yang; Tee, Benita Tan Kiat; Huimin, Bernice Wong; Broeks, Annegien; Vargas, Ana Cristina; Turashvili, Gulisa; Martens, John; Fatima, Aquila; Miron, Penelope; Chin, Suet-Feung; Thomas, Gilles; Boyault, Sandrine; Mariani, Odette; Lakhani, Sunil R.; van de Vijver, Marc; van ’t Veer, Laura; Foekens, John; Desmedt, Christine; Sotiriou, Christos; Tutt, Andrew; Caldas, Carlos; Reis-Filho, Jorge S.; Aparicio, Samuel A. J. R.; Salomon, Anne Vincent; Børresen-Dale, Anne-Lise; Richardson, Andrea L.; Campbell, Peter J.; Futreal, P. Andrew; Stratton, Michael R.

    2012-01-01

    All cancers carry somatic mutations in their genomes. A subset, known as driver mutations, confer clonal selective advantage on cancer cells and are causally implicated in oncogenesis1, and the remainder are passenger mutations. The driver mutations and mutational processes operative in breast cancer have not yet been comprehensively explored. Here we examine the genomes of 100 tumours for somatic copy number changes and mutations in the coding exons of protein-coding genes. The number of somatic mutations varied markedly between individual tumours. We found strong correlations between mutation number, age at which cancer was diagnosed and cancer histological grade, and observed multiple mutational signatures, including one present in about ten per cent of tumours characterized by numerous mutations of cytosine at TpC dinucleotides. Driver mutations were identified in several new cancer genes including AKT2, ARID1B, CASP8, CDKN1B, MAP3K1, MAP3K13, NCOR1, SMARCD1 and TBX3. Among the 100 tumours, we found driver mutations in at least 40 cancer genes and 73 different combinations of mutated cancer genes. The results highlight the substantial genetic diversity underlying this common disease. PMID:22722201

  15. Expression of c-Kit isoforms in multiple myeloma: differences in signaling and drug sensitivity.

    PubMed

    Montero, Juan Carlos; López-Pérez, Ricardo; San Miguel, Jesús F; Pandiella, Atanasio

    2008-06-01

    c-Kit is expressed in the plasma cells from 30% of patients with multiple myeloma. Two different isoforms of c-Kit, characterized by the presence or absence of the tetrapeptide sequence GNNK in the extracellular domain, have been described. However, their expression and function in myeloma cells are unknown. We explored the function and expression of these c-Kit isoforms in myeloma cells. Expression of c-Kit isoforms was investigated by reverse transcriptase polymerase chain reaction in fresh plasma cells from patients and cell lines. The function of these c-Kit isoforms was analyzed upon expression in myeloma cells. Signaling was investigated by western blotting using antibodies specific for activated forms of several signaling proteins. The impact of c-Kit on the action of drugs commonly used in the treatment of multiple myeloma was investigated by MTT proliferation assays. Fresh plasma cells from patients as well as myeloma cell lines expressed the two isoforms of c-Kit. Retroviral infection of myeloma cells with vectors that code for c-Kit-GNNK+ or c-Kit-GNNK- forms demonstrated differences in the kinetics of phosphorylation between these isoforms. Stem cell factor-induced activation of the GNNK- form was faster and more pronounced than that of the GNNK+ form, whose activation, however, lasted for longer. The c-Kit receptors weakly activated the Erk1/2 and Erk5 pathways. Both receptors, however, efficiently coupled to the PI3K/Akt pathway, and stimulated p70S6K activation. The latter was sensitive to the mTOR inhibitor, rapamycin. Studies of drug sensitivity indicated that cells expressing the GNNK- form were more resistant to the anti-myeloma action of bortezomib and melphalan. Our data indicate that c-Kit expression in multiple myeloma cells is functional, and coupled to survival pathways that may modulate cell death in response to therapeutic compounds used in the treatment of this disease.

  16. The Lambda Select cII Mutation Detection System.

    PubMed

    Besaratinia, Ahmad; Tommasi, Stella

    2018-04-26

    A number of transgenic animal models and mutation detection systems have been developed for mutagenicity testing of carcinogens in mammalian cells. Of these, transgenic mice and the Lambda (λ) Select cII Mutation Detection System have been employed for mutagenicity experiments by many research groups worldwide. Here, we describe a detailed protocol for the Lambda Select cII mutation assay, which can be applied to cultured cells of transgenic mice/rats or the corresponding animals treated with a chemical/physical agent of interest. The protocol consists of the following steps: (1) isolation of genomic DNA from the cells or organs/tissues of transgenic animals treated in vitro or in vivo, respectively, with a test compound; (2) recovery of the lambda shuttle vector carrying a mutational reporter gene (i.e., cII transgene) from the genomic DNA; (3) packaging of the rescued vectors into infectious bacteriophages; (4) infecting a host bacteria and culturing under selective conditions to allow propagation of the induced cII mutations; and (5) scoring the cII-mutants and DNA sequence analysis to determine the cII mutant frequency and mutation spectrum, respectively.

  17. A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

    PubMed

    Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

    2014-07-01

    In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

  18. A novel mutation of the ACADM gene (c.145C>G) associated with the common c.985A>G mutation on the other ACADM allele causes mild MCAD deficiency: a case report

    PubMed Central

    2010-01-01

    A female patient, with normal familial history, developed at the age of 30 months an episode of diarrhoea, vomiting and lethargy which resolved spontaneously. At the age of 3 years, the patient re-iterated vomiting, was sub-febrile and hypoglycemic, fell into coma, developed seizures and sequels involving right hemi-body. Urinary excretion of hexanoylglycine and suberylglycine was low during this metabolic decompensation. A study of pre- and post-prandial blood glucose and ketones over a period of 24 hours showed a normal glycaemic cycle but a failure to form ketones after 12 hours fasting, suggesting a mitochondrial β-oxidation defect. Total blood carnitine was lowered with unesterified carnitine being half of the lowest control value. A diagnosis of mild MCAD deficiency (MCADD) was based on rates of 1-14C-octanoate and 9, 10-3H-myristate oxidation and of octanoyl-CoA dehydrogenase being reduced to 25% of control values. Other mitochondrial fatty acid oxidation proteins were functionally normal. De novo acylcarnitine synthesis in whole blood samples incubated with deuterated palmitate was also typical of MCADD. Genetic studies showed that the patient was compound heterozygous with a sequence variation in both of the two ACADM alleles; one had the common c.985A>G mutation and the other had a novel c.145C>G mutation. This is the first report for the ACADM gene c.145C>G mutation: it is located in exon 3 and causes a replacement of glutamine to glutamate at position 24 of the mature protein (Q24E). Associated with heterozygosity for c.985A>G mutation, this mutation is responsible for a mild MCADD phenotype along with a clinical story corroborating the emerging literature view that patients with genotypes representing mild MCADD (high residual enzyme activity and low urinary levels of glycine conjugates), similar to some of the mild MCADDs detected by MS/MS newborn screening, may be at risk for disease presentation. PMID:20923556

  19. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome

    PubMed Central

    Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

    2017-01-01

    Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene (ERCC6), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family. PMID:28848724

  20. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome.

    PubMed

    Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

    2017-01-01

    Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene ( ERCC6 ), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  1. Incomplete Timothy syndrome secondary to a mosaic mutation of the CACNA1C gene diagnosed using next-generation sequencing.

    PubMed

    Baurand, Amandine; Falcon-Eicher, Sylvie; Laurent, Gabriel; Villain, Elisabeth; Bonnet, Caroline; Thauvin-Robinet, Christel; Jacquot, Caroline; Eicher, Jean-Christophe; Gourraud, Jean-Baptiste; Schmitt, Sébastien; Bézieau, Stéphane; Giraud, Mathilde; Dumont, Solenne; Kuentz, Paul; Probst, Vincent; Burguet, Antoine; Kyndt, Florence; Faivre, Laurence

    2017-02-01

    Autosomal dominant genetic diseases can occur de novo and in the form of somatic mosaicism, which can give rise to a less severe phenotype, and make diagnosis more difficult given the sensitivity limits of the methods used. We report the case of female child with a history of surgery for syndactyly of the hands and feet, who was admitted at 6 years of age to a pediatric intensive care unit following cardiac arrest. The electrocardiogram (ECG) showed a long QT interval that on occasions reached 500 ms. Despite the absence of facial dysmorphism and the presence of normal psychomotor development, a diagnosis of Timothy syndrome was made given the association of syndactyly and the ECG features. Sanger sequencing of the CACNA1C gene, followed by sequencing of the genes KCNQ1, KCNH2, KCNE1, KCNE2, were negative. The subsequent analysis of a panel of genes responsible for hereditary cardiac rhythm disorders using Haloplex technology revealed a recurrent mosaic p.Gly406Arg missense mutation of the CACNA1C gene in 18% of the cells. This mosaicism can explain the negative Sanger analysis and the less complete phenotype in this patient. Given the other cases in the literature, mosaic mutations in Timothy syndrome appear more common than previously thought. This case demonstrates the importance of using next-generation sequencing to identify mosaic mutations when the clinical picture supports a specific mutation that is not identified using conventional testing. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  2. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

    PubMed

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

    2018-02-10

    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  3. Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population.

    PubMed

    Juzėnas, Simonas; Kupčinskas, Juozas; Valantienė, Irena; Šumskienė, Jolanta; Petrenkienė, Vitalija; Kondrackienė, Jūrate; Kučinskas, Laimutis; Kiudelis, Gediminas; Skiecevičienė, Jurgita; Kupčinskas, Limas

    2016-01-01

    Liver cirrhosis is the end-stage disease of chronic liver injury. Due to differences in the natural course of chronic liver diseases, identification of genetic factors that influence individual outcomes is warranted. HFE-linked hereditary hemochromatosis (HH) predisposes disease progression to cirrhosis; however, the role of heterozygous C282Y or H63D mutations in the development of cirrhosis in the presence of other etiological factors is still debated. The aim of this study was to determine the association between heterozygous C282Y and H63D mutations and non-HH liver cirrhosis in Lithuanian population. The patient cohort consisted of 209 individuals. Diagnosis of cirrhosis was confirmed by clinical, laboratory parameters, liver biopsy, and radiological imaging. Control samples were obtained from 1005 randomly selected unrelated healthy individuals. HFE gene mutations were determined using the PCR-RFLP method. The most common causes of cirrhosis were hepatitis C (33.9%), hepatitis B (13.6%), and alcohol (25.8%). C282Y allele was associated with the presence of cirrhosis (OR=2.07; P=0.005); this was also observed under recessive model for C282Y (OR=2.06, P=0.008). The prevalence of C282Y allele was higher in cirrhotic men than in controls (7.0% vs. 2.8%, P=0.002). The carriage of H63D risk allele (OR=1.54; P=0.02), heterozygous C282Y/wt and homozygous H63D/H63D genotypes were associated with liver cirrhosis in males (OR=2.48, P=0.008, and OR=4.13, P=0.005, respectively). Heterozygous C282Y mutation of the HFE gene was associated with liver cirrhosis in the Lithuanian population. In gender-related analysis, heterozygous C282Y and homozygous H63D mutations were linked to liver cirrhosis in men, not in women. Copyright © 2016 The Lithuanian University of Health Sciences. Production and hosting by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  4. SAMHD1 Gene Mutations Are Associated with Cerebral Large-Artery Atherosclerosis

    PubMed Central

    Xin, Baozhong; Yan, Junpeng; Wu, Ying; Hu, Bo; Liu, Liping; Wang, Yilong; Ahn, Jinwoo; Skowronski, Jacek; Zhang, Zaiqiang; Wang, Yongjun; Wang, Heng

    2015-01-01

    Background. To investigate whether one or more SAMHD1 gene mutations are associated with cerebrovascular disease in the general population using a Chinese stroke cohort. Methods. Patients with a Chinese Han background (N = 300) diagnosed with either cerebral large-artery atherosclerosis (LAA, n = 100), cerebral small vessel disease (SVD, n = 100), or other stroke-free neurological disorders (control, n = 100) were recruited. Genomic DNA from the whole blood of each patient was isolated, and direct sequencing of the SAMHD1 gene was performed. Both wild type and mutant SAMHD1 proteins identified from the patients were expressed in E. coli and purified; then their dNTPase activities and ability to form stable tetramers were analysed in vitro. Results. Three heterozygous mutations, including two missense mutations c.64C>T (P22S) and c.841G>A (p.E281K) and one splice site mutation c.696+2T>A, were identified in the LAA group with a prevalence of 3%. No mutations were found in the patients with SVD or the controls (p = 0.05). The mutant SAMHD1 proteins were functionally impaired in terms of their catalytic activity as a dNTPase and ability to assemble stable tetramers. Conclusions. Heterozygous SAMHD1 gene mutations might cause genetic predispositions that interact with other risk factors, resulting in increased vulnerability to stroke. PMID:26504826

  5. Novel Mutations Causing C5 Deficiency in Three North-African Families.

    PubMed

    Colobran, Roger; Franco-Jarava, Clara; Martín-Nalda, Andrea; Baena, Neus; Gabau, Elisabeth; Padilla, Natàlia; de la Cruz, Xavier; Pujol-Borrell, Ricardo; Comas, David; Soler-Palacín, Pere; Hernández-González, Manuel

    2016-05-01

    The complement system plays a central role in defense to encapsulated bacteria through opsonization and membrane attack complex (MAC) dependent lysis. The three activation pathways (classical, lectin, and alternative) converge in the cleavage of C5, which initiates MAC formation and target lysis. C5 deficiency is associated to recurrent infections by Neisseria spp. In the present study, complement deficiency was suspected in three families of North-African origin after one episode of invasive meningitis due to a non-groupable and two uncommon Meningococcal serotypes (E29, Y). Activity of alternative and classical pathways of complement were markedly reduced and the measurement of terminal complement components revealed total C5 absence. C5 gene analysis revealed two novel mutations as causative of the deficiency: Family A propositus carried a homozygous deletion of two adenines in the exon 21 of C5 gene, resulting in a frameshift and a truncated protein (c.2607_2608del/p.Ser870ProfsX3 mutation). Families B and C probands carried the same homozygous deletion of three consecutive nucleotides (CAA) in exon 9 of the C5 gene, leading to the deletion of asparagine 320 (c.960_962del/p.Asn320del mutation). Family studies confirmed an autosomal recessive inheritance pattern. Although sharing the same geographical origin, families B and C were unrelated. This prompted us to investigate this mutation prevalence in a cohort of 768 North-African healthy individuals. We identified one heterozygous carrier of the p.Asn320del mutation (allelic frequency = 0.065 %), indicating that this mutation is present at low frequency in North-African population.

  6. Nonsense mutations in the PAX3 gene cause Waardenburg syndrome type I in two Chinese patients.

    PubMed

    Yang, Shu-Zhi; Cao, Ju-Yang; Zhang, Rui-Ning; Liu, Li-Xian; Liu, Xin; Zhang, Xin; Kang, Dong-Yang; Li, Mei; Han, Dong-Yi; Yuan, Hui-Jun; Yang, Wei-Yan

    2007-01-05

    Waardenburg syndrome type I (WS1) is an autosomal dominant disorder characterized by sensorineural hearing loss, pigmental abnormalities of the eye, hair and skin, and dystopia canthorum. The gene mainly responsible for WS1 is PAX3 which is involved in melanocytic development and survival. Mutations of PAX3 have been reported in familiar or sporadic patients with WS1 in several populations of the world except Chinese. In order to explore the genetic background of Chinese WS1 patients, a mutation screening of PAX3 gene was carried out in four WS1 pedigrees. A questionnaire survey and comprehensive clinical examination were conducted in four Chinese pedigrees of WS1. Genomic DNA from each patient and their family members was extracted and exons of PAX3 were amplified by PCR. PCR fragments were ethanol-purified and sequenced in both directions on an ABI_Prism 3100 DNA sequencer with the BigDye Terminator Cycle Sequencing Ready Reaction Kit. The sequences were obtained and aligned to the wild type sequence of PAX3 with the GeneTool program. Two nonsense PAX3 mutations have been found in the study population. One is heterozygous for a novel nonsense mutation S209X. The other is heterozygous for a previously reported mutation in European population R223X. Both mutations create stop codons leading to truncation of the PAX3 protein. This is the first demonstration of PAX3 mutations in Chinese WS1 patients and one of the few examples of an identical mutation of PAX3 occurred in different populations.

  7. Mutation screening of the HGD gene identifies a novel alkaptonuria mutation with significant founder effect and high prevalence.

    PubMed

    Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P

    2014-05-01

    Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.

  8. The hepcidin gene promoter nc.-1010C > T; -582A > G haplotype modulates serum ferritin in individuals carrying the common H63D mutation in HFE gene.

    PubMed

    Silva, Bruno; Pita, Lina; Gomes, Susana; Gonçalves, João; Faustino, Paula

    2014-12-01

    Hereditary hemochromatosis is an autosomal recessive disorder characterized by severe iron overload. It is usually associated with homozygosity for the HFE gene mutation c.845G > A; p.C282Y. However, in some cases, another HFE mutation (c.187C > G; p.H63D) seems to be associated with the disease. Its penetrance is very low, suggesting the possibility of other iron genetic modulators being involved. In this work, we have screened for HAMP promoter polymorphisms in 409 individuals presenting normal or increased serum ferritin levels together with normal or H63D-mutated HFE genotypes. Our results show that the hepcidin gene promoter TG haplotype, originated by linkage of the nc.-1010C > T and nc.-582A > G polymorphisms, is more frequent in the HFE_H63D individuals presenting serum ferritin levels higher than 300 μg/L than in those presenting the HFE_H63D mutation but with normal serum ferritin levels or in the normal control group.Moreover, it was observed that the TG haplotype was associated to increased serum ferritin levels in the overall pool of HFE_H63D individuals. Thus, our data suggest that screening for these polymorphisms could be of interest in order to explain the phenotype. However, this genetic condition seems to have no clinical significance.

  9. Clinical phenotype of hereditary spastic paraplegia due to KIF1C gene mutations across life span.

    PubMed

    Yücel-Yılmaz, Didem; Yücesan, Emrah; Yalnızoğlu, Dilek; Oğuz, Kader Karlı; Sağıroğlu, Mahmut Şamil; Özbek, Uğur; Serdaroğlu, Esra; Bilgiç, Başar; Erdem, Sevim; İşeri, Sibel Aylin Uğur; Hanağası, Haşmet; Gürvit, Hakan; Özgül, Rıza Köksal; Dursun, Ali

    2018-06-01

    Hereditary spastic paraplegias (HSPs) are a group of genetic disorders resulting in pyramidal tract impairment, predominantly in lower limbs. KIF1C gene has recently been identified as one of the genetic causes of HSP and associated with pure or complicated HSP. We present three patients with complicated HSP from two unrelated families, who had early onset progressive cerebellar signs and developed pyramidal tract signs during follow-up. Whole exome sequencing in these patients followed by segregation analysis identified novel truncating KIF1C mutations (c.463C> T; p.R155 ∗ and c.2478delA; p.Ala828Argfs ∗ 13). Neuroimaging findings showed cerebral and upper cervical spinal atrophy, bilateral symmetrical pyramidal tract involvement, and focal cerebral white matter lesions. Patients with KIF1C mutations may present with cerebellar signs and pyramidal findings may emerge later, therefore complicated HSP should be considered in the differential diagnosis of unidentified cases with cerebellar dysfunction. Copyright © 2018 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  10. DNMT3A mutations in Chinese childhood acute myeloid leukemia.

    PubMed

    Li, Weijing; Cui, Lei; Gao, Chao; Liu, Shuguang; Zhao, Xiaoxi; Zhang, Ruidong; Zheng, Huyong; Wu, Minyuan; Li, Zhigang

    2017-08-01

    DNA methyltransferase 3A (DNMT3A) mutations have been found in approximately 20% of adult acute myeloid leukemia (AML) patients and in 0% to 1.4% of children with AML, and the hotspots of mutations are mainly located in the catalytic methyltransferase domain, hereinto, mutation R882 accounts for 60%. Although the negative effect of DNMT3A on treatment outcome is well known, the prognostic significance of other DNMT3A mutations in AML is still unclear. Here, we tried to determine the incidence and prognostic significance of DNMT3A mutations in a large cohort in Chinese childhood AML. We detected the mutations in DNMT3A exon 23 by polymerase chain reaction and direct sequencing in 342 children with AML (0-16 years old) from January 2005 to June 2013, treated on BCH-2003 AML protocol. The correlation of DNMT3A mutations with clinical characteristics, fusion genes, other molecular anomalies (FLT3 internal tandem duplication [FLT3-ITD], Nucleophosmin 1, C-KIT (KIT proto-oncogene receptor tyrosine kinase), and Wilms tumor 1 mutations), and treatment outcome were analyzed. DNMT3A mutations were detected in 4 out of 342 (1.2%) patients. Two patients were PML-RARA positive and 1 patient was FLT3-ITD positive. The mutations in coding sequences included S892S, V912A, R885G, and Q886R. Furthermore, there was 1 intronic mutation (c.2739+55A>C) found in 1 patient. No association of DNMT3A mutations with common clinical features was found. Two patients with DNMT3A mutations died of relapse or complications during treatment. One patient gave up treatment due to remission induction failure in day 33. Only 1 patient achieved continuous complete remission. DNMT3A mutations were rare in Chinese children with AML including PML-RARA positive APL. The mutation positions were different from the hotspots reported in adult AML. DNMT3A mutations may have adverse impact on prognosis of children with AML.

  11. Screening for duplications, deletions and a common intronic mutation detects 35% of second mutations in patients with USH2A monoallelic mutations on Sanger sequencing.

    PubMed

    Steele-Stallard, Heather B; Le Quesne Stabej, Polona; Lenassi, Eva; Luxon, Linda M; Claustres, Mireille; Roux, Anne-Francoise; Webster, Andrew R; Bitner-Glindzicz, Maria

    2013-08-08

    Usher Syndrome is the leading cause of inherited deaf-blindness. It is divided into three subtypes, of which the most common is Usher type 2, and the USH2A gene accounts for 75-80% of cases. Despite recent sequencing strategies, in our cohort a significant proportion of individuals with Usher type 2 have just one heterozygous disease-causing mutation in USH2A, or no convincing disease-causing mutations across nine Usher genes. The purpose of this study was to improve the molecular diagnosis in these families by screening USH2A for duplications, heterozygous deletions and a common pathogenic deep intronic variant USH2A: c.7595-2144A>G. Forty-nine Usher type 2 or atypical Usher families who had missing mutations (mono-allelic USH2A or no mutations following Sanger sequencing of nine Usher genes) were screened for duplications/deletions using the USH2A SALSA MLPA reagent kit (MRC-Holland). Identification of USH2A: c.7595-2144A>G was achieved by Sanger sequencing. Mutations were confirmed by a combination of reverse transcription PCR using RNA extracted from nasal epithelial cells or fibroblasts, and by array comparative genomic hybridisation with sequencing across the genomic breakpoints. Eight mutations were identified in 23 Usher type 2 families (35%) with one previously identified heterozygous disease-causing mutation in USH2A. These consisted of five heterozygous deletions, one duplication, and two heterozygous instances of the pathogenic variant USH2A: c.7595-2144A>G. No variants were found in the 15 Usher type 2 families with no previously identified disease-causing mutations. In 11 atypical families, none of whom had any previously identified convincing disease-causing mutations, the mutation USH2A: c.7595-2144A>G was identified in a heterozygous state in one family. All five deletions and the heterozygous duplication we report here are novel. This is the first time that a duplication in USH2A has been reported as a cause of Usher syndrome. We found that 8 of

  12. An exonic missense mutation c.28G>A is associated with weak B blood group by affecting RNA splicing of the ABO gene.

    PubMed

    Cai, Xiaohong; Qian, Chengrui; Wu, Wenman; Lei, Hang; Ding, Qiulan; Zou, Wei; Xiang, Dong; Wang, Xuefeng

    2017-09-01

    The amino acid substitutions caused by ABO gene mutations are usually predicted to impact glycosyltransferase's function or its biosynthesis. Here we report an ABO exonic missense mutation that affects B-antigen expression by decreasing the mRNA level of the ABO gene rather than the amino acid change. Serologic studies including plasma total GTB transfer capacity were performed. The exon sequences of the ABO gene were analyzed by Sanger sequencing. B 310 cDNA with c.28G>A (p.G10R) mutation was expressed in HeLa cells and total GTB transfer capacity in cell supernatant was measured. Flow cytometry was performed on these HeLa cells after transfection, and agglutination of Hela-B weak cells was also examined. The mRNA of the ABO gene was analyzed by direct sequencing and real-time reverse transcriptase-polymerase chain reaction. A minigene construct was prepared to evaluate the potential of splicing. While plasma total GTB transfer capacity was undetectable in this B 3 -like individual, the relative percentage of antigen-expressing cells and mean fluorescence index of the B weak red blood cells (RBCs) were 19 and 14% of normal B RBCs, respectively. There was no significant difference of total GTB transfer capacity in cell supernatant and B-antigen expression on cell surfaces between HeLa cells transfected with B 310 cDNA and B cDNA. The mRNA expression level of B 310 in peripheral whole blood was significantly reduced. The amount of splicing is significantly lower in c.28G>A construct compared to that in wild-type construct after transfection in K562 cells. ABO c.28G>A mutation may cause B 3 -like subgroup by affecting RNA splicing of the ABO gene. © 2017 AABB.

  13. EGFR, KRAS, and BRAF mutational profiles of female patients with micropapillary predominant invasive lung adenocarcinoma

    PubMed

    Demirağ, Funda; Yılmaz, Aydın; Yılmaz Demirci, Nilgün; Yılmaz, Ülkü; Erdoğan, Yurdanur

    2017-11-13

    Background/aim: This study aimed to analyze EGFR, KRAS, and BRAF mutations in females with micropapillary predominant invasive lung adenocarcinoma and their relationships with immunohistochemical and clinicopathological patterns.Materials and methods: A total of 15 females with micropapillary lung adenocarcinoma were selected. Mutational analysis of the EGFR, KRAS, and BRAF genes was carried out. Information regarding the demographic data, tumor size, treatment, and survival time for each patient was collated, and the predominant cell type, secondary architectural growth patterns, psammoma bodies, necrosis, and visceral pleural and angiolymphatic invasions were evaluated.Results: We identified EGFR mutation in six cases, KRAS mutation in three cases, and BRAF mutation in one case. EGFR, c-kit, VEGFR, and bcl-2 positivity was observed in ten, seven, four, and six cases, respectively. All cases were positive for VEGF (strong positivity in 11 cases and weak positivity in four cases) and bcl-2 (strong positivity in nine cases and weak positivity in six cases). Seven (46.6%) cases were positive for c-kit and 10 (66.6%) cases were positive for EGFR. Conclusion: EGFR mutation occurred at a higher incidence rate in micropapillary predominant invasive adenocarcinoma than has previously been found in conventional lung adenocarcinomas. KRAS mutation was observed as having a similar frequency to what was previously observed, but the frequency of BRAF mutation was lower than previously reported.

  14. Characterization of a point mutation in the parC gene of Mycoplasma bovirhinis associated with fluoroquinolone resistance.

    PubMed

    Hirose, K; Kawasaki, Y; Kotani, K; Abiko, K; Sato, H

    2004-05-01

    Quinolone-resistant (QR) mutants of Mycoplasma bovirhinis strain PG43 (type strain) were generated by stepwise selection in increasing concentrations of enrofloxacin (ENR). An alteration was found in the quinolone resistance-determining region (QRDR) of the parC gene coding for the ParC subunit of topoisomerase IV from these mutants, but not in the gyrA, gyrB, and parE gene coding for the GyrA and GyrB subunits of DNA gyrase and the ParE subunit of topoisomerase IV. Similarly, such an alteration in QRDR of parC was found in the field isolates of M. bovirhinis, which possessed various levels of QR. The substitution of leucine (Leu) by serine (Ser) at position 80 of QRDR of ParC was observed in both QR-mutants and QR-isolates. This is the first report of QR based on a point mutation of the parC gene in M. bovirhinis.

  15. Severe hypertriglyceridemia due to two novel loss-of-function lipoprotein lipase gene mutations (C310R/E396V) in a Chinese family associated with recurrent acute pancreatitis.

    PubMed

    Lun, Yu; Sun, Xiaofang; Wang, Ping; Chi, Jingwei; Hou, Xu; Wang, Yangang

    2017-07-18

    Lipoprotein lipase (LPL) is widely expressed in skeletal muscles, cardiac muscles as well as adipose tissue and involved in the catabolism of triglyceride. Herein we have systematically characterized two novel loss-of-function mutations in LPL from a Chinese family in which afflicted members were manifested by severe hypertriglyceridemia and recurrent pancreatitis. DNA sequencing revealed that the proband was a heterozygote carrying a novel c.T928C (p.C310R) mutation in exon 6 of the LPL gene. Another member of the family was detected to be a compound heterozygote who along with the c.T928C mutation also carried a novel missense mutation c.A1187T (p.E396V) in exon 8 of the LPL gene. Furthermore, COS-1 cells were transfected with lentiviruses containing the mutant LPL genes. While C310R markedly reduced the overall LPL protein level, COS-1 cells carrying E396V or double mutations contained similar overall LPL protein levels to the wild-type. The specific activity of the LPL mutants remained at comparable magnitude to the wild-type. However, few LPL were detected in the culture medium for the mutants, suggesting that both mutations caused aberrant triglyceride catabolism. More specifically, E396V and double mutations dampened the transport of LPL to the cell surface, while for the C310R mutation, reducing LPL protein level might be involved. By characterizing these two novel LPL mutations, this study has expanded our understanding on the pathogenesis of familial hypertriglyceridemia (FHTG).

  16. Clinical characteristics and STK11 gene mutations in Chinese children with Peutz-Jeghers syndrome.

    PubMed

    Huang, Zhiheng; Miao, Shijian; Wang, Lin; Zhang, Ping; Wu, Bingbing; Wu, Jie; Huang, Ying

    2015-11-25

    Peutz-Jeghers syndrome (PJS) is a rare autosomal dominant inherited disease characterized by gastrointestinal hamartomatous polyps and mucocutaneous melanin spots. Germline mutation of the serine/threonine kinase 11 (STK11) gene are responsible for PJS. In this study, we investigated the clinical characteristics and molecular basis of the disease in Chinese children with PJS. Thirteen children diagnosed with PJS in our hospital were enrolled in this study from 2011 to 2015, and their clinical data on polyp characteristics, intussusceptions events, family histories, etc. were described. Genomic DNA was extracted from whole-blood samples from each subject, and the entire coding sequence of the STK11 gene was amplified by polymerase chain reaction and analyzed by direct sequencing. The median age at the onset of symptoms was 2 years and 4 months. To date, these children have undergone 40 endoscopy screenings, 17 laparotomies and 9 intussusceptions. Polyps were found in the stomach, duodenum, small bowel, colon and rectum, with large polyps found in 7 children. Mutations were found in eleven children, including seven novel mutations (c.481het_dupA, c.943_944het_delCCinsG, c.397het_delG, c.862 + 1G > G/A, c.348_349het_delGT, and c.803_804het_delGGinsC and c.121_139de l19insTT) and four previously reported mutations (c.658C > C/T, c.890G > G/A, c.1062 C > C/G, and c.290 + 1G > G/A). One PJS patient did not have any STK11 mutations. The polyps caused significant clinical consequences in children with PJS, and mutations of the STK11 gene are generally the cause of PJS in Chinese children. This study expands the spectrum of known STK11 gene mutations.

  17. An EDMD mutation in C. elegans lamin blocks muscle-specific gene relocation and compromises muscle integrity.

    PubMed

    Mattout, Anna; Pike, Brietta L; Towbin, Benjamin D; Bank, Erin M; Gonzalez-Sandoval, Adriana; Stadler, Michael B; Meister, Peter; Gruenbaum, Yosef; Gasser, Susan M

    2011-10-11

    In worms, as in other organisms, many tissue-specific promoters are sequestered at the nuclear periphery when repressed and shift inward when activated. It has remained unresolved, however, whether the association of facultative heterochromatin with the nuclear periphery, or its release, has functional relevance for cell or tissue integrity. Using ablation of the unique lamin gene in C. elegans, we show that lamin is necessary for the perinuclear positioning of heterochromatin. We then express at low levels in otherwise wild-type worms a lamin carrying a point mutation, Y59C, which in humans is linked to an autosomal-dominant form of Emery-Dreifuss muscular dystrophy. Using embryos and differentiated tissues, we track the subnuclear position of integrated heterochromatic arrays and their expression. In LMN-1 Y59C-expressing worms, we see abnormal retention at the nuclear envelope of a gene array bearing a muscle-specific promoter. This correlates with impaired activation of the array-borne myo-3 promoter and altered expression of a number of muscle-specific genes. However, an equivalent array carrying the intestine-specific pha-4 promoter is expressed normally and shifts inward when activated in gut cells of LMN-1 Y59C worms. Remarkably, adult LMN-1 Y59C animals have selectively perturbed body muscle ultrastructure and reduced muscle function. Lamin helps sequester heterochromatin at the nuclear envelope, and wild-type lamin permits promoter release following tissue-specific activation. A disease-linked point mutation in lamin impairs muscle-specific reorganization of a heterochromatic array during tissue-specific promoter activation in a dominant manner. This dominance and the correlated muscle dysfunction in LMN-1 Y59C worms phenocopies Emery-Dreifuss muscular dystrophy. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. [Expression of c-kit in North African nasopharyngeal carcinomas: correlation with age and LMP1].

    PubMed

    Charfi, S; Khabir, A; Ayadi, L; Mseddi, M; Makni, H; Gorbel, A; Daoud, J; Frikha, M; Jlidi, R; Busson, P; Boudawara, T S

    2007-09-01

    To determine the level and prognostic significance of c-kit expression in the two age groups of North African nasopharyngeal carcinomas. A retrospective study of 99 NPC specimens from Tunisian patients was investigated by immunohistochemistry. Immunohistochemical data were correlated with Epstein-Barr virus LMP1 expression and pathological, clinical and survival parameters. c-kit was detected in 79% of the cases for patients under 30 years of age (juvenile form) but in only 56% of specimens in patients over 30 years (P=0.039) and was significantly over-expressed for patients with lymph node involvement (P=0.015). LMP1 score was 5.78 (+/-1.84) for c-kit negative tumors compared to 8,23 (+/-2.39) for c-kit positive tumors (P=0.002). Multivariate analysis including age, lymph nodes involvement and LMP1 expression as co-variables, showed that only age (P=0.027) and LMP1 expression (P=0.005) were significantly correlated to the c-kit expression. c-kit is highly expressed in the juvenile form of North African nasopharyngeal carcinomas. There is a significant association between LMP1 and c-kit expression. The contrasted levels of C-kit expression in the two age groups strengthen the hypothesis that these clinical forms result from distinct oncogenic mechanisms.

  19. SDF1 gradient associates with the distribution of c-Kit+ cardiac cells in the heart.

    PubMed

    Renko, Outi; Tolonen, Anna-Maria; Rysä, Jaana; Magga, Johanna; Mustonen, Erja; Ruskoaho, Heikki; Serpi, Raisa

    2018-01-18

    Identification of the adult cardiac stem cells (CSCs) has offered new therapeutic possibilities for treating ischemic myocardium. CSCs positive for the cell surface antigen c-Kit are known as the primary source for cardiac regeneration. Accumulating evidence shows that chemokines play important roles in stem cell homing. Here we investigated molecular targets to be utilized in modulating the mobility of endogenous CSCs. In a four week follow-up after experimental acute myocardial infarction (AMI) with ligation of the left anterior descending (LAD) coronary artery of Sprague-Dawley rats c-Kit+ CSCs redistributed in the heart. The number of c-Kit+ CSCs in the atrial c-Kit niche was diminished, whereas increased amount was observed in the left ventricle and apex. This was associated with increased expression of stromal cell-derived factor 1 alpha (SDF1α), and a significant positive correlation was found between c-Kit+ CSCs and SDF1α expression in the heart. Moreover, the migratory capacity of isolated c-Kit+ CSCs was induced by SDF1 treatment in vitro. We conclude that upregulation of SDF1α after AMI associates with increased expression of endogenous c-Kit+ CSCs in the injury area, and show induced migration of c-Kit+ cells by SDF1.

  20. Surfactant protein B deficiency and gene mutations for neonatal respiratory distress syndrome in China Han ethnic population

    PubMed Central

    Yin, Xiaojuan; Meng, Fanping; wang, Yan; Xie, Lu; Kong, Xiangyong; Feng, Zhichun

    2013-01-01

    Objective: To determine whether the SP-B deficiency and gene mutations in exon 4 is associated with neonatal RDS in China Han ethnic population. Methods: The study population consisted of 40 neonates with RDS and 40 neonates with other diseases as control in China Han ethnic population. We Compared SP-B expression in lung tissue and bronchoalveolar lavage fluid with immunoblotting, and analyzed mutations in the SP-B gene with polymerase chain reaction (PCR) and gene sequencing. Results: In RDS group, low mature Surfactant protein B was found in both lung tissue and bronchoalveolar lavage fluid in 8 neonates. In control group, only 4 neonates with low mature Surfactant protein B in both lung tissue and bronchoalveolar lavage fluid. In RDS group, 20 neonates were found to have mutations in exon 4, 12 homozygous mutations with C/C genotype and 8 heterozygous mutations with C/T genotype in surfactant protein B gene+1580 polymorphism. There were 8 cases mutations in control group, 1 in C/C and 7 in C/T genotype. The frequency of homozygotes with C/C genotype was 0.3 and frequency of heterozygotes with C/T genotype was 0.02 in RDS group. In control group, frequency of homozygotes with C/C genotype was 0.025 and frequency of heterozygote with C/T genotype was 0.175. Conclusion: Low mature Surfactant protein B is associated with the pathogenesis of neonatal respiratory distress syndrome (RDS) in China Han ethnic population. Mutations in exon 4 of the surfactant protein B gene demonstrate an association between homozygous mutations with C/C genotype in SP-B gene and neonatal RDS. PMID:23330012

  1. [Observation and analysis on mutation of routine STR locus].

    PubMed

    Li, Qiu-yang; Feng, Wei-jun; Yang, Qin-gen

    2005-05-01

    To observe and analyze the characteristic of mutation at STR locus. 27 mutant genes observed in 1211 paternity testing cases were checked by PAGE-silver stained and PowerPlex 16 System Kit and validated by sequencing. Mutant genes locate on 15 loci. The pattern of mutation was accord with stepwise mutation model. The mutation ratio of male-to-female was 8:1 and correlated to the age of father. Mutation rate is correlated to the geometric mean of the number of homogeneous repeats of locus. The higher the mean, the higher the mutation rate. These loci are not so appropriate for use in paternity testing.

  2. Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) associated with a novel C82R mutation in the NOTCH3 gene.

    PubMed

    Zea-Sevilla, M Ascensión; Bermejo-Velasco, Pedro; Serrano-Heranz, Regino; Calero, Miguel

    2015-01-01

    Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is a rare inherited cerebrovascular disease associated with mutations in the NOTCH3 gene on chromosome 19, and represents the most common hereditary stroke disorder. We describe a pedigree, which suffered the classical clinical CADASIL pattern of migraine headaches, recurrent subcortical infarcts, and subcortical dementia, associated with a previously undescribed missense mutation (c.[244T>C], p.[C82R]) in NOTCH3. This new mutation extends the list of known pathogenic mutations responsible for CADASIL, which are associated with an odd number of cysteine residues within any of the epidermal growth factor-like repeats of Notch3 receptor protein.

  3. Two new mutations in the MTATP6 gene associated with Leigh syndrome.

    PubMed

    Moslemi, A-R; Darin, N; Tulinius, M; Oldfors, A; Holme, E

    2005-10-01

    In this study we have analyzed the mtDNA encoded ATPase 6 and 8 genes ( MTATP6 and MTATP8) in two children with Leigh syndrome (LS) and reduced Mg (2+) ATPase activity in muscle mitochondria. In patient 1, with a mild and reversible phenotype, mutational analysis revealed a heteroplasmic T --> C mutation at nt position 9185 (T9185C) in the MTATP6. The mutation resulted in substitution of a highly conserved leucine to proline at codon 220. The proportion of the mutation was > 97 % in the patient's blood and muscle and 85 % in blood of his asymptomatic mother. Patient 2, with severe clinical phenotype and death at 2 years of age, exhibited a novel heteroplasmic T9191C missense mutation in the MTATP6, which converted a highly conserved leucine to a proline at position 222 of the polypeptide. The proportion of the mutation was 90 % in fibroblasts and 94 % muscle tissue. This mutation was absent in the patient's parents and sister suggesting that the mutation was de novo. Our findings expand the spectrum of mutations causing LS and emphasize the role of MTATP6 gene mutations in pathogenesis of LS.

  4. Identification of a polymorphism in the transmembrane domain of the protooncogene c-kit in healthy subjects.

    PubMed

    Nagata, H; Worobec, A S; Metcalfe, D D

    1996-01-01

    c-Kit is the receptor for stem cell factor (SCF) and is found on hematopoietic stem cells, mast cells, melanocytes, and germ cells. Aggregation of c-Kit by SCF regulates cell proliferation, differentiation, and survival. In the process of examining c-Kit, a polymorphism in the transmembrane domain of the protooncogene c-Kit was identified. This polymorphism consisted of an A-to-C transversion at nucleotide (nt) 1642, and was deduced to substitute leucine for methionine at codon 541. The frequency of the allele with 'C' at nt 1642 was 0.09 in 64 unrelated subjects. Analysis of a two-generation family with the polymorphism suggested that this polymorphism did not result in disease. This is the first report of a polymorphism in the transmembrane domain of c-Kit, and may be of value in understanding and following the function of c-Kit in normal subjects and in those with other abnormalities of c-Kit.

  5. Preappointment testing for BRAF/KIT mutation in advanced melanoma: a model in molecular data delivery for individualized medicine.

    PubMed

    Mounajjed, Taofic; Brown, Char L; Stern, Therese K; Bjorheim, Annette M; Bridgeman, Andrew J; Rumilla, Kandelaria M; McWilliams, Robert R; Flotte, Thomas J

    2014-11-01

    The emergence of individualized medicine is driven by developments in precision diagnostics, epitomized by molecular testing. Because treatment decisions are being made based on such molecular data, data management is gaining major importance. Among data management challenges, creating workflow solutions for timely delivery of molecular data has become pivotal. This study aims to design and implement a scalable process that permits preappointment BRAF/KIT mutation analysis in melanoma patients, allowing molecular results necessary for treatment plans to be available before the patient's appointment. Process implementation aims to provide a model for efficient molecular data delivery for individualized medicine. We examined the existing process of BRAF/KIT testing in melanoma patients visiting our institution for oncology consultation. We created 5 working groups, each designing a specific segment of an alternative process that would allow preappointment BRAF/KIT testing and delivery of results. Data were captured and analyzed to evaluate the success of the alternative process. For 1 year, 35 (59%) of 55 patients had prior BRAF/KIT testing. The remaining 20 patients went through the new process of preappointment testing; results were available at the time of appointment for 12 patients (overall preappointment results availability, 85.5%). The overall process averaged 13.4 ± 4.7 days. In conclusion, we describe the successful implementation of a scalable workflow solution that permits preappointment BRAF/KIT mutation analysis and result delivery in melanoma patients. This sets the stage for further applications of this model to other conditions, answering an increasing demand for robust delivery of molecular data for individualized medicine. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Analysis of EGFR, EML4-ALK, KRAS, and c-MET mutations in Chinese lung adenocarcinoma patients.

    PubMed

    Xia, Ning; An, Jian; Jiang, Qing-qing; Li, Min; Tan, Jun; Hu, Cheng-ping

    2013-10-01

    Mutation analysis of cancer driver genes is helpful for determining an optimal treatment strategy. We evaluated mutations in four driver genes, namely epidermal growth factor receptor (EGFR), Kirsten ras oncogene (KRAS), c-MET, and echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase (EML4-ALK), in Chinese lung adenocarcinoma patients from Hunan Province. We enrolled 110 lung adenocarcinoma patients in a single institution. EGFR and KRAS mutations were examined by direct sequencing, the EML4-ALK fusion gene was analyzed by fluorescence in situ hybridization, and c-MET amplification and c-Met protein expression were detected by quantitative PCR and immunohistochemistry, respectively. EGFR and KRAS mutations were observed in 52.7% (58/110) and 3.6% (4/106) of patients, respectively. c-MET amplification was detected in 5.5% (6/110) of patients. In addition, 30% (33/110) of the cases expressed c-Met protein, including all of the patients harboring c-MET amplification. Ten percent (11/110) of patients harbored the EML4-ALK fusion gene, and the frequency of ALK rearrangement was higher than that of other cohort analyses involving patients from other regions in China. Almost all of these gene mutations were exclusive except that in two female non-smoking patients, who harbored an EGFR mutation and EML4-ALK rearrangement simultaneously. In total, 70% of patients in the study harbored one of the four gene mutations. Most Chinese lung adenocarcinoma patients harbor driver gene mutations, among which ALK rearrangements were more common in Hunan patients than in previously reported populations. Future clinical trials should be conducted to determine the safety and efficacy of drug combination targeting different driver mutations.

  7. AGXT Gene Mutations and Prevalence of Primary Hyperoxaluria Type 1 in Moroccan Population.

    PubMed

    Boualla, Lamiae; Tajir, Mariam; Oulahiane, Najat; Lyahyai, Jaber; Laarabi, Fatima Zahra; Chafai Elalaoui, Siham; Soulami, Kenza; Ait Ouamar, Hassan; Sefiani, Abdelaziz

    2015-11-01

    Primary hyperoxaluria type 1 (PH1) is an autosomal recessive disorder caused by deficiency of alanine glyoxylate aminotransferase, due to a defect in the AGXT gene. Several mutations in this gene have been reported and some of them have been observed in multiple populations. The aim of our study was to analyze the mutations causing PH1 in the Moroccan population and to estimate its prevalence in Morocco. Molecular studies of 29 unrelated Moroccan patients with PH were performed by direct sequencing of all exons of the AGXT gene. In addition, to estimate the prevalence of PH1, we screened for the recurrent p.Ile244Thr mutation in 250 unrelated Moroccan newborns using real-time polymerase chain reaction. Four pathogenic mutations were detected in 25 unrelated patients. The c.731T>C (p.Ile244Thr) was the most frequent mutation with a frequency of 84%. The other three mutations were c.33delC, c.976delG, and c.331C>T. The prevalence of the PH1 mutation among Moroccans was then estimated to range from 1/7267 to 1/6264. PH1 is one of the most prevalent genetic diseases in the Moroccan population and is probably underdiagnosed. Front line genetic testing for PH1 in Morocco should be initiated using an assay for the recurrent p.Ile244Thr mutation. This strategy would provide a useful tool for precocious diagnosis of presymptomatic individuals and to prevent their rapid progression to renal failure.

  8. Histone deacetylase inhibitor SAHA mediates mast cell death and epigenetic silencing of constitutively active D816V KIT in systemic mastocytosis.

    PubMed

    Lyberg, Katarina; Ali, Hani Abdulkadir; Grootens, Jennine; Kjellander, Matilda; Tirfing, Malin; Arock, Michel; Hägglund, Hans; Nilsson, Gunnar; Ungerstedt, Johanna

    2017-02-07

    Systemic mastocytosis (SM) is a clonal bone marrow disorder, where therapeutical options are limited. Over 90% of the patients carry the D816V point mutation in the KIT receptor that renders this receptor constitutively active. We assessed the sensitivity of primary mast cells (MC) and mast cell lines HMC1.2 (D816V mutated), ROSA (KIT WT) and ROSA (KIT D816V) cells to histone deacetylase inhibitor (HDACi) treatment. We found that of four HDACi, suberoyl anilide hydroxamic acid (SAHA) was the most effective in killing mutated MC. SAHA downregulated KIT, followed by major MC apoptosis. Primary SM patient MC cultured ex vivo were even more sensitive to SAHA than HMC1.2 cells, whereas primary MC from healthy subjects were less affected. There was a correlation between cell death and SM disease severity, where cell death was more pronounced in the case of aggressive SM, with almost 100% cell death among MC from the mast cell leukemia patient. Additionally, ROSA (KIT D816V) was more affected by HDACi than ROSA (KIT WT) cells. Using ChIP qPCR, we found that the level of active chromatin mark H3K18ac/H3 decreased significantly in the KIT region. This epigenetic silencing was seen only in the KIT region and not in control genes upstream and downstream of KIT, indicating that the downregulation of KIT is exerted by specific epigenetic silencing. In conclusion, KIT D816V mutation sensitized MC to HDACi mediated killing, and SAHA may be of value as specific treatment for SM, although the specific mechanism of action requires further investigation.

  9. Histone deacetylase inhibitor SAHA mediates mast cell death and epigenetic silencing of constitutively active D816V KIT in systemic mastocytosis

    PubMed Central

    Lyberg, Katarina; Ali, Hani Abdulkadir; Grootens, Jennine; Kjellander, Matilda; Tirfing, Malin; Arock, Michel; Hägglund, Hans

    2017-01-01

    Systemic mastocytosis (SM) is a clonal bone marrow disorder, where therapeutical options are limited. Over 90% of the patients carry the D816V point mutation in the KIT receptor that renders this receptor constitutively active. We assessed the sensitivity of primary mast cells (MC) and mast cell lines HMC1.2 (D816V mutated), ROSA (KIT WT) and ROSA (KIT D816V) cells to histone deacetylase inhibitor (HDACi) treatment. We found that of four HDACi, suberoyl anilide hydroxamic acid (SAHA) was the most effective in killing mutated MC. SAHA downregulated KIT, followed by major MC apoptosis. Primary SM patient MC cultured ex vivo were even more sensitive to SAHA than HMC1.2 cells, whereas primary MC from healthy subjects were less affected. There was a correlation between cell death and SM disease severity, where cell death was more pronounced in the case of aggressive SM, with almost 100% cell death among MC from the mast cell leukemia patient. Additionally, ROSA (KIT D816V) was more affected by HDACi than ROSA (KIT WT) cells. Using ChIP qPCR, we found that the level of active chromatin mark H3K18ac/H3 decreased significantly in the KIT region. This epigenetic silencing was seen only in the KIT region and not in control genes upstream and downstream of KIT, indicating that the downregulation of KIT is exerted by specific epigenetic silencing. In conclusion, KIT D816V mutation sensitized MC to HDACi mediated killing, and SAHA may be of value as specific treatment for SM, although the specific mechanism of action requires further investigation. PMID:28038453

  10. [Analysis of gene mutation in a Chinese family with Norrie disease].

    PubMed

    Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

    2012-09-01

    To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

  11. [Frequency of CHEK2 gene mutations in patients with breast cancer from the Republic of Bashkortostan].

    PubMed

    2014-01-01

    Several studies have shown, that mutation in CHEK2 gene can increase the risk of different cancers, including breast cancer (BC). Clearly, that character of mutations distribution in the defined regions is depended on genetic structure of the population. We conducted the screening of mutations c.1100delC, c.444 + 1G>A, de15395, p.I157T andIp.R145Win CHEK2 gene in patients with breast cancer (n = 977) and in control group (n = 1069) originating from the Republic of Bashkortostan. The mutation de15395 in CHEK2 gene was detected with frequency of 1,23% (12/977)in woman with BC and 0.09% (1/1069) in controls (OR:13.28, CI 95%: 1.72-102.33, p = 0.003). Mutations c.1100delC and c.444 + 1G>A were found in BC patients and controls with frequencies of 0.4%, 0.4% (4/977) and 0.09% (1/1069), 0.2% (2/1069), respectively. The missense mutation p.I157T in CHEK2 was found as the most common variant in two studied cohorts (approximately 5%), but differences did not achieved statistical significance. We found the ethnic specificity in distribution of truncating mutations, which occurs mainly among the women of Slavic origin. All three mutations were identified in women of Russian and Ukrainian ethnic origin. Mutations c.1100delC and c.444 + 1G>A in CHEK2 gene were not detected in Bashkirs and Tatars, but CHEK2 de15395 mutation was observed in Tatars.

  12. A new nonsense mutation in the NF1 gene with neurofibromatosis-Noonan syndrome phenotype.

    PubMed

    Yimenicioğlu, Sevgi; Yakut, Ayten; Karaer, Kadri; Zenker, Martin; Ekici, Arzu; Carman, Kürşat Bora

    2012-12-01

    Neurofibromatosis-Noonan syndrome is a rare autosomal dominant disorder which combines neurofibromatosis type 1 (NF1) features with Noonan syndrome. NF1 gene mutations are reported in the majority of these patients. Sequence analysis of the established genes for Noonan syndrome revealed no mutation; a heterozygous NF1 point mutation c.7549C>T in exon 51, creating a premature stop codon (p.R2517X), had been demonstrated. Neurofibromatosis-Noonan syndrome recently has been considered a subtype of NF1 and caused by different NF1 mutations. We report the case of a 14-year-old boy with neurofibromatosis type 1 with Noonan-like features, who complained of headache with triventricular hydrocephaly and a heterozygous NF1 point mutation c.7549C>T in exon 51.

  13. The search for mutations in the gene for the beta subunit of the cGMP phosphodiesterase (PDEB) in patients with autosomal recessive retinitis pigmentosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Riess, O.; Weber, B.; Hayden, M.R.

    1992-10-01

    The finding of a mutation in the beta subunit of the cyclic GMP (cGMP) phosphodiesterase gene causing retinal degeneration in mice (the Pdeb gene) prompted a search for disease-causing mutations in the human phosphodiesterase gene (PDEB gene) in patients with retinitis pigmentosa. All 22 exons including 196 bp of the 5[prime] region of the PDEB gene have been assessed for mutations by using single-strand conformational polymorphism analysis in 14 patients from 13 unrelated families with autosomal recessive retinitis pigmentosa (ARRP). No disease-causing mutations were found in this group of affected individuals of seven different ancestries. However, a frequent intronic andmore » two exonic polymorphisms (Leu[sup 489][yields]Gln and Gly[sup 842][yields]Gly) were identified. Segregation analysis using these polymorphic sites excludes linkage of ARRP to the PDEB gene in a family with two affected children. 43 refs., 3 figs., 2 tabs.« less

  14. A homozygous nonsense CEP250 mutation combined with a heterozygous nonsense C2orf71 mutation is associated with atypical Usher syndrome.

    PubMed

    Khateb, Samer; Zelinger, Lina; Mizrahi-Meissonnier, Liliana; Ayuso, Carmen; Koenekoop, Robert K; Laxer, Uri; Gross, Menachem; Banin, Eyal; Sharon, Dror

    2014-07-01

    Usher syndrome (USH) is a heterogeneous group of inherited retinitis pigmentosa (RP) and sensorineural hearing loss (SNHL) caused by mutations in at least 12 genes. Our aim is to identify additional USH-related genes. Clinical examination included visual acuity test, funduscopy and electroretinography. Genetic analysis included homozygosity mapping and whole exome sequencing (WES). A combination of homozygosity mapping and WES in a large consanguineous family of Iranian Jewish origin revealed nonsense mutations in two ciliary genes: c.3289C>T (p.Q1097*) in C2orf71 and c.3463C>T (p.R1155*) in centrosome-associated protein CEP250 (C-Nap1). The latter has not been associated with any inherited disease and the c.3463C>T mutation was absent in control chromosomes. Patients who were double homozygotes had SNHL accompanied by early-onset and severe RP, while patients who were homozygous for the CEP250 mutation and carried a single mutant C2orf71 allele had SNHL with mild retinal degeneration. No ciliary structural abnormalities in the respiratory system were evident by electron microscopy analysis. CEP250 expression analysis of the mutant allele revealed the generation of a truncated protein lacking the NEK2-phosphorylation region. A homozygous nonsense CEP250 mutation, in combination with a heterozygous C2orf71 nonsense mutation, causes an atypical form of USH, characterised by early-onset SNHL and a relatively mild RP. The severe retinal involvement in the double homozygotes indicates an additive effect caused by nonsense mutations in genes encoding ciliary proteins. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  15. KRAS, EGFR, PDGFR-α, KIT and COX-2 status in carcinoma showing thymus-like elements (CASTLE)

    PubMed Central

    2014-01-01

    Background CASTLE (Carcinoma showing thymus-like elements) is a rare malignant neoplasm of the thyroid resembling lymphoepithelioma-like and squamous cell carcinoma of the thymus with different biological behaviour and a better prognosis than anaplastic carcinoma of the thyroid. Methods We retrospectively investigated 6 cases of this very rare neoplasm in order to investigate the mutational status of KRAS, EGFR, PDGFR-α and KIT, as well as the immunohistochemical expression pattern of CD117, EGFR and COX-2, and possibly find new therapeutic targets. Results Diagnosis was confirmed by a moderate to strong expression of CD5, CD117 and CK5/6, whereas thyroglobulin, calcitonin and TTF-1 were negative in all cases. Tumors were also positive for COX-2 and in nearly all cases for EGFR. In four cases single nucleotide polymorphisms (SNPs) could be detected in exon 12 of the PDGFR-α gene (rs1873778), in three cases SNPs were found in exon 20 of the EGFR gene (rs1050171). No mutations were found in the KIT and KRAS gene. Conclusions All tumors showed a COX-2 expression as well as an EGFR expression except for one case and a wild-type KRAS status. No activating mutations in the EGFR, KIT and PDGFR-α gene could be detected. Our data may indicate a potential for targeted therapies, but if these therapeutic strategies are of benefit in CASTLE remains to be determined. Virtual Slides The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1658499296115016 PMID:24934485

  16. Proteomics screen to reveal molecular changes mediated by C722G missense mutation in CHRM2 gene.

    PubMed

    Hou, Dongyan; Chen, Ying; Liu, Jiamei; Xu, Lin; Zhang, Zhiyong; Zhang, Juan; Wang, Hua; Wang, Xin; Chen, Jin; Zhao, Rongrui; Hu, Aihua; Hakonarson, Hakon; Zhang, Lin; Shen, Yan

    2013-08-26

    Previously, we reported a missense mutation (C722G) in the M2-muscarinic acetylcholine receptor (CHRM2) gene associated with familial dilated cardiomyopathy. However, the exact molecular mechanisms by the related protein changes of CHRM2-C722G mutation induced are still unclear. CHRM2 and CHRM2-C722G lentiviral vector was infected to CHO cells. Proteomic analysis by label-free shotgun strategy and the STRING 9.0 software were performed. A total of 102 proteins with at least 2-fold change in the CHRM2-C722G group were identified, 42 proteins were up-regulated, whereas 57 were down-regulated. These altered proteins belong to three broad functional categories: (i) metabolic (e.g. Cytosolic acyl coenzyme A thioester hydrolase, Malate dehydrogenase); (ii) cytoskeletal (e.g. Actin-related protein, Myosin light polypeptide 6 and Alpha-actinin-1) and (iii) stress response (e.g. heat shock protein 70, Ras-related protein Rab-10). Interestingly, the marked differences in the expression of selected eight proteins (change >4.0-fold), were connected with many proteins related to apoptosis and immune/inflammatory response such as: FOS, BAX, MYC, TP53 and IL6. This novel study demonstrated for the first time a full-scale screening of the proteomics research by CHRM2-C722G mutation and profiled 102 changed proteins, of which, eight might be critical in cardiac dysfunction for future mapping. It was a full-scale screening of the proteomics research by CHRM2-C722G mutation. These proteins might serve as valuable biomarkers that could predict the presence of a precursor field. These proteins might serve to further explore the pathophysiological mechanisms in familial DCM patients with C176W mutation. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Comprehensive mutational profiling of core binding factor acute myeloid leukemia

    PubMed Central

    Duployez, Nicolas; Marceau-Renaut, Alice; Boissel, Nicolas; Petit, Arnaud; Bucci, Maxime; Geffroy, Sandrine; Lapillonne, Hélène; Renneville, Aline; Ragu, Christine; Figeac, Martin; Celli-Lebras, Karine; Lacombe, Catherine; Micol, Jean-Baptiste; Abdel-Wahab, Omar; Cornillet, Pascale; Ifrah, Norbert; Dombret, Hervé; Leverger, Guy; Jourdan, Eric

    2016-01-01

    Acute myeloid leukemia (AML) with t(8;21) or inv(16) have been recognized as unique entities within AML and are usually reported together as core binding factor AML (CBF-AML). However, there is considerable clinical and biological heterogeneity within this group of diseases, and relapse incidence reaches up to 40%. Moreover, translocations involving CBFs are not sufficient to induce AML on its own and the full spectrum of mutations coexisting with CBF translocations has not been elucidated. To address these issues, we performed extensive mutational analysis by high-throughput sequencing in 215 patients with CBF-AML enrolled in the Phase 3 Trial of Systematic Versus Response-adapted Timed-Sequential Induction in Patients With Core Binding Factor Acute Myeloid Leukemia and Treating Patients with Childhood Acute Myeloid Leukemia with Interleukin-2 trials (age, 1-60 years). Mutations in genes activating tyrosine kinase signaling (including KIT, N/KRAS, and FLT3) were frequent in both subtypes of CBF-AML. In contrast, mutations in genes that regulate chromatin conformation or encode members of the cohesin complex were observed with high frequencies in t(8;21) AML (42% and 18%, respectively), whereas they were nearly absent in inv(16) AML. High KIT mutant allele ratios defined a group of t(8;21) AML patients with poor prognosis, whereas high N/KRAS mutant allele ratios were associated with the lack of KIT or FLT3 mutations and a favorable outcome. In addition, mutations in epigenetic modifying or cohesin genes were associated with a poor prognosis in patients with tyrosine kinase pathway mutations, suggesting synergic cooperation between these events. These data suggest that diverse cooperating mutations may influence CBF-AML pathophysiology as well as clinical behavior and point to potential unique pathogenesis of t(8;21) vs inv(16) AML. PMID:26980726

  18. Comprehensive mutational profiling of core binding factor acute myeloid leukemia.

    PubMed

    Duployez, Nicolas; Marceau-Renaut, Alice; Boissel, Nicolas; Petit, Arnaud; Bucci, Maxime; Geffroy, Sandrine; Lapillonne, Hélène; Renneville, Aline; Ragu, Christine; Figeac, Martin; Celli-Lebras, Karine; Lacombe, Catherine; Micol, Jean-Baptiste; Abdel-Wahab, Omar; Cornillet, Pascale; Ifrah, Norbert; Dombret, Hervé; Leverger, Guy; Jourdan, Eric; Preudhomme, Claude

    2016-05-19

    Acute myeloid leukemia (AML) with t(8;21) or inv(16) have been recognized as unique entities within AML and are usually reported together as core binding factor AML (CBF-AML). However, there is considerable clinical and biological heterogeneity within this group of diseases, and relapse incidence reaches up to 40%. Moreover, translocations involving CBFs are not sufficient to induce AML on its own and the full spectrum of mutations coexisting with CBF translocations has not been elucidated. To address these issues, we performed extensive mutational analysis by high-throughput sequencing in 215 patients with CBF-AML enrolled in the Phase 3 Trial of Systematic Versus Response-adapted Timed-Sequential Induction in Patients With Core Binding Factor Acute Myeloid Leukemia and Treating Patients with Childhood Acute Myeloid Leukemia with Interleukin-2 trials (age, 1-60 years). Mutations in genes activating tyrosine kinase signaling (including KIT, N/KRAS, and FLT3) were frequent in both subtypes of CBF-AML. In contrast, mutations in genes that regulate chromatin conformation or encode members of the cohesin complex were observed with high frequencies in t(8;21) AML (42% and 18%, respectively), whereas they were nearly absent in inv(16) AML. High KIT mutant allele ratios defined a group of t(8;21) AML patients with poor prognosis, whereas high N/KRAS mutant allele ratios were associated with the lack of KIT or FLT3 mutations and a favorable outcome. In addition, mutations in epigenetic modifying or cohesin genes were associated with a poor prognosis in patients with tyrosine kinase pathway mutations, suggesting synergic cooperation between these events. These data suggest that diverse cooperating mutations may influence CBF-AML pathophysiology as well as clinical behavior and point to potential unique pathogenesis of t(8;21) vs inv(16) AML. © 2016 by The American Society of Hematology.

  19. Oncogenic mutations in melanomas and benign melanocytic nevi of the female genital tract

    PubMed Central

    Tseng, Diane; Kim, Julie; Warrick, Andrea; Nelson, Dylan; Pukay, Marina; Beadling, Carol; Heinrich, Michael; Selim, Maria Angelica; Corless, Christopher L.; Nelson, Kelly

    2015-01-01

    Background The genetic heterogeneity of melanomas and melanocytic nevi of the female genital tract is poorly understood. Objective We aim to characterize the frequency of mutations of the following genes: BRAF, NRAS, KIT, GNA11, and GNAQ in female genital tract melanomas. We also characterize the frequency of BRAF mutations in female genital tract melanomas compared with melanocytic nevi. Methods Mutational screening was performed on the following female genital tract melanocytic neoplasms: 25 melanomas, 7 benign melanocytic nevi, and 4 atypical melanocytic nevi. Results Of the 25 female genital tract melanoma specimens queried, KIT mutations were detected in 4 (16.0%), NRAS mutations in 4 (16.0%), and BRAF mutations in 2 (8.0%) samples. Two of the tumors with KIT mutations harbored double mutations in the same exon. No GNAQ or GNA11 mutations were identified among 11 melanomas screened. BRAF V600E mutations were detected in 7 of 7 benign melanocytic genital nevi (100%) and 3 of 4 atypical genital nevi (75%). Limitations Our study is limited by the small sample size of this rare subset of melanomas. Conclusion KIT, NRAS, and BRAF mutations are found in a subset of female genital tract melanomas. Screening for oncogenic mutations is important for developing and applying clinical therapies for melanomas of the female genital tract. PMID:24842760

  20. Oncogenic mutations in melanomas and benign melanocytic nevi of the female genital tract.

    PubMed

    Tseng, Diane; Kim, Julie; Warrick, Andrea; Nelson, Dylan; Pukay, Marina; Beadling, Carol; Heinrich, Michael; Selim, Maria Angelica; Corless, Christopher L; Nelson, Kelly

    2014-08-01

    The genetic heterogeneity of melanomas and melanocytic nevi of the female genital tract is poorly understood. We aim to characterize the frequency of mutations of the following genes: BRAF, NRAS, KIT, GNA11, and GNAQ in female genital tract melanomas. We also characterize the frequency of BRAF mutations in female genital tract melanomas compared with melanocytic nevi. Mutational screening was performed on the following female genital tract melanocytic neoplasms: 25 melanomas, 7 benign melanocytic nevi, and 4 atypical melanocytic nevi. Of the 25 female genital tract melanoma specimens queried, KIT mutations were detected in 4 (16.0%), NRAS mutations in 4 (16.0%), and BRAF mutations in 2 (8.0%) samples. Two of the tumors with KIT mutations harbored double mutations in the same exon. No GNAQ or GNA11 mutations were identified among 11 melanomas screened. BRAF V600E mutations were detected in 7 of 7 benign melanocytic genital nevi (100%) and 3 of 4 atypical genital nevi (75%). Our study is limited by the small sample size of this rare subset of melanomas. KIT, NRAS, and BRAF mutations are found in a subset of female genital tract melanomas. Screening for oncogenic mutations is important for developing and applying clinical therapies for melanomas of the female genital tract. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  1. [NOTCH3 gene mutations in two Chinese families featuring cerebral autosomal dominant arteriopathy with subcortical infarct and leucoencephalopathy].

    PubMed

    Sun, Qiying; Li, Wenwen; Zhou, Yafang; Yi, Fang; Wang, Jianfeng; Hu, Yacen; Yao, Lingyan; Zhou, Lin; Xu, Hongwei

    2017-12-10

    To analyze potential mutations of the NOTCH3 gene in two Chinese families featuring cerebral autosomal dominant arteriopathy with subcortical infarct and leucoencephalopathy (CADASIL). The two probands and related family members and 100 healthy controls were recruited. Potential mutations of the NOTCH3 gene were screened by PCR and direct sequencing. PolyPhen-2 and SIFT software were used to predict the protein function. The conditions of both probands were adult-onset, with main clinical features including recurrent transient ischemic attacks and/or strokes, cognitive impairment. MRI findings suggested multiple cerebral infarcts and severe leukoencephalopathy. A heterozygous mutation c.328C>T (p.Arg110Cys), which was located in exon 3 of the NOTCH3 gene and known as a causative mutation, was identified in proband 1. A novel heterozygous mutation c.1013 G>C (p.Cys338Ser) located in exon 6 of the NOTCH3 gene was identified in the proband 2, which was not reported previously. The same mutations were not detected among the 100 unrelated healthy controls. Function analysis suggested that heterozygous mutation c.1013G>C can severely affect the functions of NOTCH3 protein. Two heterozygous missense mutations in the NOTCH3 gene have been identified in two families affected with CADASIL. The novel heterozygous Cys338Ser mutation in exon 6 of the NOTCH3 gene probably underlies the CADASIL.

  2. Clinical features and gene mutational spectrum of CDKL5-related diseases in a cohort of Chinese patients

    PubMed Central

    2014-01-01

    Background Mutations in the cyclin-dependent kinase-like 5 (CDKL5) (NM_003159.2) gene have been associated with early-onset epileptic encephalopathies or Hanefeld variants of RTT(Rett syndrome). In order to clarify the CDKL5 genotype-phenotype correlations in Chinese patients, CDKL5 mutational screening in cases with early-onset epileptic encephalopathies and RTT without MECP2 mutation were performed. Methods The detailed clinical information including clinical manifestation, electroencephalogram (EEG), magnetic resonance imaging (MRI), blood, urine amino acid and organic acid screening of 102 Chinese patients with early-onset epileptic encephalopathies and RTT were collected. CDKL5 gene mutations were analyzed by PCR, direct sequencing and multiplex ligation-dependent probe amplification (MLPA). The patterns of X-chromosome inactivation (XCI) were studied in the female patients with CDKL5 gene mutation. Results De novo CDKL5 gene mutations were found in ten patients including one missense mutation (c.533G > A, p.R178Q) which had been reported, two splicing mutations (ISV6 + 1A > G, ISV13 + 1A > G), three micro-deletions (c.1111delC, c.2360delA, c.234delA), two insertions (c.1791 ins G, c.891_892 ins TT in a pair of twins) and one nonsense mutation (c.1375C > T, p.Q459X). Out of ten patients, 7 of 9 females with Hanefeld variants of RTT and the remaining 2 females with early onset epileptic encephalopathy, were detected while only one male with infantile spasms was detected. The common features of all female patients with CDKL5 gene mutations included refractory seizures starting before 4 months of age, severe psychomotor retardation, Rett-like features such as hand stereotypies, deceleration of head growth after birth and poor prognosis. In contrast, the only one male patient with CDKL5 mutation showed no obvious Rett-like features as females in our cohort. The X-chromosome inactivation patterns of all the female patients were random. Conclusions Mutations in CDKL

  3. Clinical features and gene mutational spectrum of CDKL5-related diseases in a cohort of Chinese patients.

    PubMed

    Zhao, Ying; Zhang, Xiaoying; Bao, Xinhua; Zhang, Qingping; Zhang, Jingjing; Cao, Guangna; Zhang, Jie; Li, Jiarui; Wei, Liping; Pan, Hong; Wu, Xiru

    2014-02-25

    Mutations in the cyclin-dependent kinase-like 5 (CDKL5) (NM_003159.2) gene have been associated with early-onset epileptic encephalopathies or Hanefeld variants of RTT(Rett syndrome). In order to clarify the CDKL5 genotype-phenotype correlations in Chinese patients, CDKL5 mutational screening in cases with early-onset epileptic encephalopathies and RTT without MECP2 mutation were performed. The detailed clinical information including clinical manifestation, electroencephalogram (EEG), magnetic resonance imaging (MRI), blood, urine amino acid and organic acid screening of 102 Chinese patients with early-onset epileptic encephalopathies and RTT were collected. CDKL5 gene mutations were analyzed by PCR, direct sequencing and multiplex ligation-dependent probe amplification (MLPA). The patterns of X-chromosome inactivation (XCI) were studied in the female patients with CDKL5 gene mutation. De novo CDKL5 gene mutations were found in ten patients including one missense mutation (c.533G > A, p.R178Q) which had been reported, two splicing mutations (ISV6 + 1A > G, ISV13 + 1A > G), three micro-deletions (c.1111delC, c.2360delA, c.234delA), two insertions (c.1791 ins G, c.891_892 ins TT in a pair of twins) and one nonsense mutation (c.1375C > T, p.Q459X). Out of ten patients, 7 of 9 females with Hanefeld variants of RTT and the remaining 2 females with early onset epileptic encephalopathy, were detected while only one male with infantile spasms was detected. The common features of all female patients with CDKL5 gene mutations included refractory seizures starting before 4 months of age, severe psychomotor retardation, Rett-like features such as hand stereotypies, deceleration of head growth after birth and poor prognosis. In contrast, the only one male patient with CDKL5 mutation showed no obvious Rett-like features as females in our cohort. The X-chromosome inactivation patterns of all the female patients were random. Mutations in CDKL5 gene are responsible for 7 with

  4. Activating mutations in the NT5C2 nucleotidase gene drive chemotherapy resistance in relapsed ALL

    PubMed Central

    Tzoneva, Gannie; Garcia, Arianne Perez; Carpenter, Zachary; Khiabanian, Hossein; Tosello, Valeria; Allegretta, Maddalena; Paietta, Elisabeth; Racevskis, Janis; Rowe, Jacob M.; Tallman, Martin S.; Paganin, Maddalena; Basso, Giuseppe; Hof, Jana; Kirschner-Schwabe, Renate; Palomero, Teresa; Rabadan, Raul; Ferrando, Adolfo

    2013-01-01

    Acute lymphoblastic leukemia (ALL) is an aggressive hematological tumor resulting from the malignant transformation of lymphoid progenitors. Despite intensive chemotherapy, 20% of pediatric and over 50% of adult ALL patients fail to achieve a complete remission or relapse after intensified chemotherapy, making disease relapse and resistance to therapy the most significant challenge in the treatment of this disease1,2. Using whole exome sequencing, here we identify mutations in the cytosolic 5'-nucleotidase II gene (NT5C2), which encodes a 5'-nucleotidase enzyme responsible for inactivation of nucleoside analog chemotherapy drugs, in 20/103 (19%) relapse T-ALLs and in 1/35 (3%) relapse B-precursor ALLs analyzed. NT5C2 mutant proteins show increased nucleotidase activity in vitro and conferred resistance to chemotherapy with 6-mercaptopurine and 6-thioguanine when expressed in ALL lymphoblasts. These results support a prominent role for activating mutations in NT5C2 and increased nucleoside analog metabolism in disease progression and chemotherapy resistance in ALL. PMID:23377281

  5. [Gene mutation and clinical phenotype analysis of patients with Noonan syndrome and hypertrophic cardiomyopathy].

    PubMed

    Liu, X H; Ding, W W; Han, L; Liu, X R; Xiao, Y Y; Yang, J; Mo, Y

    2017-10-02

    Objective: To analyze the gene mutations and clinical features of patients with Noonan syndrome and hypertrophic cardiomyopathy. Method: Determined the mutation domain in five cases diagnosed with Noonan syndrome and hypertrophic cardiomyopathy and identified the relationship between the mutant domain and hypertrophic cardiomyopathy by searching relevant articles in pubmed database. Result: Three mutant genes (PTPN11 gene in chromosome 12, RIT1 gene in chromosome 1 and RAF1 gene in chromosome 3) in five cases all had been reported to be related to hypertrophic cardiomyopathy. The reported hypertrophic cardiomyopathy relevant genes MYPN, MYH6 and MYBP3 had also been found in case 1 and 2. Patients with same gene mutation had different clinical manifestations. Both case 4 and 5 had RAF1 mutation (c.770C>T). However, case 4 had special face, low IQ, mild pulmonary artery stenosis, and only mild ventricular hypertrophy. Conclusion: Noonan syndrome is a genetic heterogeneity disease. Our study identified specific gene mutations that could result in Noonan syndrome with hypertrophic cardiomyopathy through molecular biology methods. The results emphasize the importance of gene detection in the management of Noonan syndrome.

  6. VHL c.505 T>C mutation confers a high age related penetrance but no increased overall mortality

    PubMed Central

    Bender, B.; Eng, C.; Olschewski, M.; Berger, D.; Laubenberger, J.; Altehofer, C.; Kirste, G.; Orszagh, M.; van Velthoven, V.; Miosczka, H.; Schmidt, D.; Neumann, H.

    2001-01-01

    BACKGROUND—Germline mutations of the VHL gene cause von Hippel-Lindau syndrome (VHL). In southern Germany, a specific mutation in this gene, c.505 T>C, is one of the most frequent alterations owing to a founder effect.
METHODS—This study was conducted to evaluate morbidity, specific clinical risk profile, and mortality among a series of VHL c.505 T/C mutation carriers. A total of 125 eligible subjects carrying VHL c.505 T/C underwent ophthalmoscopy and gadolinium enhanced magnetic resonance imaging of the brain, the spinal cord, and the abdomen. Age related penetrance, morbidity, and mortality were assessed.
RESULTS—Frequently observed lesions were phaeochromocytoma (47%), retinal angiomas (36%), haemangioblastoma of the spine (36%), and haemangioblastoma of the brain (16%). Four patients developed renal cell carcinoma. VHL was symptomatic in 47% of subjects; 30% were asymptomatic despite the presence of at least one VHL related tumour and 23% of the carriers had no detectable VHL lesion. Of the 19 patients who had died (15%), 10 died of symptomatic VHL lesions. Overall penetrance by cumulative incidence functions is estimated at 48% by 35 years and 88% by 70 years. In contrast to the only existing published report based on patients with presumably unselected VHL germline mutations, the mortality rate for c.505 T/C mutation carriers is comparable to that of the general population of Germany.
CONCLUSIONS—Our results are an important example that a specific genotype, at least in the case of VHL c.505 T/C, can favourably impact on mortality despite a high age related penetrance. Our study also indirectly provides objective data which might be useful to the life and health insurance industry; it would appear that c.505 T>C mutation positive subjects have similar disease specific mortality to that of the general population owing to a combination of phenotype and timely detection of mutation carrier status followed by aggressive clinical screening and

  7. Methylenetetrahydrofolate reductase C677T mutation and risk of retinal vein thrombosis.

    PubMed

    Soltanpour, Mohammad Soleiman; Soheili, Zahra; Shakerizadeh, Ali; Pourfathollah, Ali Akbar; Samiei, Shahram; Meshkani, Reza; Shahjahani, Mohammad; Karimi, Abbas

    2013-06-01

    Elevated plasma homocysteine (Hcy) level has been established as a significant risk factor for venous thrombosis and cardiovascular disease. Homozygosity for the methylenetetrahydrofolate reductase (MTHFR) C677T mutation has been associated with elevated plasma Hcy concentration and may contribute to retinal vein thrombosis (RVT) development. The aim of the present study was to investigate whether the hyperhomocysteinemia and/or homozygosity for the MTHFR C677T mutation are associated with an increased risk for RVT. Our study population consisted of 73 consecutive patients (50-78 years old) with RVT and 73 control subjects (51-80 years old), matched for age and sex. Genotyping for the MTHFR C677T mutation was performed by polymerase chain reaction-restriction fragment length polymorphism technique and Hcy level was determined by an enzyme immunoassay kit. The prevalence of 677TT genotype was higher in patients than control subjects, but the difference in frequency didn't reach a significant value (P = 0.07). The frequency of the 677T allele was 26% and 21.2% in patients and controls, respectively and did not differ significantly between the two groups (odds ratio = 1.3, 95% confidence interval (0.75-2.24), P = 0.33). Fasting plasma total Hcy level was significantly higher in patients than controls (P = 0.001). Our study demonstrated that hyperhomocysteinemia, but not the MTHFR C677T mutation, is associated with RVT.

  8. Immunohistochemical loss of 5-hydroxymethylcytosine expression in acute myeloid leukaemia: relationship to somatic gene mutations affecting epigenetic pathways.

    PubMed

    Magotra, Minoti; Sakhdari, Ali; Lee, Paul J; Tomaszewicz, Keith; Dresser, Karen; Hutchinson, Lloyd M; Woda, Bruce A; Chen, Benjamin J

    2016-12-01

    Genes affecting epigenetic pathways are frequently mutated in myeloid malignancies, including acute myeloid leukaemia (AML). The genes encoding TET2, IDH1 and IDH2 are among the most commonly mutated genes, and cause defective conversion of 5-methylcytosine into 5-hydroxymethylcytosine (5hmC), impairing demethylation of DNA, and presumably serving as driver mutations in leukaemogenesis. The aim of this study was to correlate 5hmC immunohistochemical loss with the mutation status of genes involved in epigenetic pathways in AML. Immunohistochemical staining with an anti-5hmC antibody was performed on 41 decalcified, formalin-fixed paraffin-embedded (FFPE) bone marrow biopsies from patients with AML. Archived DNA was subjected to next-generation sequencing for analysis of a panel of genes, including TET2, IDH1, IDH2, WT1 and DNMT3A. TET2, IDH1, IDH2, WT1 and DNMT3A mutations were found in 46% (19/41) of the cases. Ten of 15 cases (67%) with TET2, IDH1, IDH2 or WT1 mutations showed deficient 5hmC staining, whereas nine of 26 cases (35%) without a mutation in these genes showed loss of 5hmC. It is of note that all four cases with TET2 mutations showed deficient 5hmC staining. Overall, somatic mutations in TET2, IDH1, IDH2, WT1 and DNMT3A were common in our cohort of AML cases. Immunohistochemical staining for 5hmC was lost in the majority of cases harbouring mutations in these genes, reflecting the proposed relationship between dysfunctional epigenetic pathways and leukaemogenesis. © 2016 John Wiley & Sons Ltd.

  9. CHEK2 c.1100delC mutation is associated with an increased risk for male breast cancer in Finnish patient population.

    PubMed

    Hallamies, Sanna; Pelttari, Liisa M; Poikonen-Saksela, Paula; Jekunen, Antti; Jukkola-Vuorinen, Arja; Auvinen, Päivi; Blomqvist, Carl; Aittomäki, Kristiina; Mattson, Johanna; Nevanlinna, Heli

    2017-09-05

    Several susceptibility genes have been established for female breast cancer, of which mutations in BRCA1 and especially in BRCA2 are also known risk factors for male breast cancer (MBC). The role of other breast cancer genes in MBC is less well understood. In this study, we have genotyped 68 MBC patients for the known breast or ovarian cancer associated mutations in the Finnish population in CHEK2, PALB2, RAD51C, RAD51D, and FANCM genes. CHEK2 c.1100delC mutation was found in 4 patients (5.9%), which is significantly more frequent than in the control population (OR: 4.47, 95% CI 1.51-13.18, p = 0.019). Four CHEK2 I157T variants were also detected, but the frequency did not significantly differ from population controls (p = 0.781). No RAD51C, RAD51D, PALB2, or FANCM mutations were found. These data suggest that the CHEK2 c.1100delC mutation is associated with an increased risk for MBC in the Finnish population.

  10. Novel recurrently mutated genes and a prognostic mutation signature in colorectal cancer.

    PubMed

    Yu, Jun; Wu, William K K; Li, Xiangchun; He, Jun; Li, Xiao-Xing; Ng, Simon S M; Yu, Chang; Gao, Zhibo; Yang, Jie; Li, Miao; Wang, Qiaoxiu; Liang, Qiaoyi; Pan, Yi; Tong, Joanna H; To, Ka F; Wong, Nathalie; Zhang, Ning; Chen, Jie; Lu, Youyong; Lai, Paul B S; Chan, Francis K L; Li, Yingrui; Kung, Hsiang-Fu; Yang, Huanming; Wang, Jun; Sung, Joseph J Y

    2015-04-01

    Characterisation of colorectal cancer (CRC) genomes by next-generation sequencing has led to the discovery of novel recurrently mutated genes. Nevertheless, genomic data has not yet been used for CRC prognostication. To identify recurrent somatic mutations with prognostic significance in patients with CRC. Exome sequencing was performed to identify somatic mutations in tumour tissues of 22 patients with CRC, followed by validation of 187 recurrent and pathway-related genes using targeted capture sequencing in additional 160 cases. Seven significantly mutated genes, including four reported (APC, TP53, KRAS and SMAD4) and three novel recurrently mutated genes (CDH10, FAT4 and DOCK2), exhibited high mutation prevalence (6-14% for novel cancer genes) and higher-than-expected number of non-silent mutations in our CRC cohort. For prognostication, a five-gene-signature (CDH10, COL6A3, SMAD4, TMEM132D, VCAN) was devised, in which mutation(s) in one or more of these genes was significantly associated with better overall survival independent of tumor-node-metastasis (TNM) staging. The median survival time was 80.4 months in the mutant group versus 42.4 months in the wild type group (p=0.0051). The prognostic significance of this signature was successfully verified using the data set from the Cancer Genome Atlas study. The application of next-generation sequencing has led to the identification of three novel significantly mutated genes in CRC and a mutation signature that predicts survival outcomes for stratifying patients with CRC independent of TNM staging. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  11. Contribution of Germline Mutations in the RAD51B, RAD51C, and RAD51D Genes to Ovarian Cancer in the Population

    PubMed Central

    Song, Honglin; Dicks, Ed; Ramus, Susan J.; Tyrer, Jonathan P.; Intermaggio, Maria P.; Hayward, Jane; Edlund, Christopher K.; Conti, David; Harrington, Patricia; Fraser, Lindsay; Philpott, Susan; Anderson, Christopher; Rosenthal, Adam; Gentry-Maharaj, Aleksandra; Bowtell, David D.; Alsop, Kathryn; Cicek, Mine S.; Cunningham, Julie M.; Fridley, Brooke L.; Alsop, Jennifer; Jimenez-Linan, Mercedes; Høgdall, Estrid; Høgdall, Claus K.; Jensen, Allan; Kjaer, Susanne Krüger; Lubiński, Jan; Huzarski, Tomasz; Jakubowska, Anna; Gronwald, Jacek; Poblete, Samantha; Lele, Shashi; Sucheston-Campbell, Lara; Moysich, Kirsten B.; Odunsi, Kunle; Goode, Ellen L.; Menon, Usha; Jacobs, Ian J.; Gayther, Simon A.; Pharoah, Paul D.P.

    2015-01-01

    Purpose The aim of this study was to estimate the contribution of deleterious mutations in the RAD51B, RAD51C, and RAD51D genes to invasive epithelial ovarian cancer (EOC) in the population and in a screening trial of individuals at high risk of ovarian cancer. Patients and Methods The coding sequence and splice site boundaries of the three RAD51 genes were sequenced and analyzed in germline DNA from a case-control study of 3,429 patients with invasive EOC and 2,772 controls as well as in 2,000 unaffected women who were BRCA1/BRCA2 negative from the United Kingdom Familial Ovarian Cancer Screening Study (UK_FOCSS) after quality-control analysis. Results In the case-control study, we identified predicted deleterious mutations in 28 EOC cases (0.82%) compared with three controls (0.11%; P < .001). Mutations in EOC cases were more frequent in RAD51C (14 occurrences, 0.41%) and RAD51D (12 occurrences, 0.35%) than in RAD51B (two occurrences, 0.06%). RAD51C mutations were associated with an odds ratio of 5.2 (95% CI, 1.1 to 24; P = .035), and RAD51D mutations conferred an odds ratio of 12 (95% CI, 1.5 to 90; P = .019). We identified 13 RAD51 mutations (0.65%) in unaffected UK_FOCSS participants (RAD51C, n = 7; RAD51D, n = 5; and RAD51B, n = 1), which was a significantly greater rate than in controls (P < .001); furthermore, RAD51 mutation carriers were more likely than noncarriers to have a family history of ovarian cancer (P < .001). Conclusion These results confirm that RAD51C and RAD51D are moderate ovarian cancer susceptibility genes and suggest that they confer levels of risk of EOC that may warrant their use alongside BRCA1 and BRCA2 in routine clinical genetic testing. PMID:26261251

  12. AID-initiated purposeful mutations in immunoglobulin genes.

    PubMed

    Goodman, Myron F; Scharff, Matthew D; Romesberg, Floyd E

    2007-01-01

    Exposure brings risk to all living organisms. Using a remarkably effective strategy, higher vertebrates mitigate risk by mounting a complex and sophisticated immune response to counter the potentially toxic invasion by a virtually limitless army of chemical and biological antagonists. Mutations are almost always deleterious, but in the case of antibody diversification there are mutations occurring at hugely elevated rates within the variable (V) and switch regions (SR) of the immunoglobulin (Ig) genes that are responsible for binding to and neutralizing foreign antigens throughout the body. These mutations are truly purposeful. This chapter is centered on activation-induced cytidine deaminase (AID). AID is required for initiating somatic hypermutation (SHM) in the V regions and class switch recombination (CSR) in the SR portions of Ig genes. By converting C --> U, while transcription takes place, AID instigates a cascade of mutational events involving error-prone DNA polymerases, base excision and mismatch repair enzymes, and recombination pathways. Together, these processes culminate in highly mutated antibody genes and the B cells expressing antibodies that have achieved optimal antigenic binding undergo positive selection in germinal centers. We will discuss the biological role of AID in this complex process, primarily in terms of its biochemical properties in relation to SHM in vivo. The chapter also discusses recent advances in experimental methods to characterize antibody dynamics as a function of SHM to help elucidate the role that the AID-induced mutations play in tailoring molecular recognition. The emerging experimental techniques help to address long-standing conundrums concerning evolution-imposed constraints on antibody structure and function.

  13. Characterization of a mast cell line that lacks the extracellular domain of membrane c-kit.

    PubMed

    Mekori, Y A; Oh, C K; Dastych, J; Goff, J P; Adachi, S; Bianchine, P J; Worobec, A; Semere, T; Pierce, J H; Metcalfe, D D

    1997-04-01

    Expression of the c-kit proto-oncogene receptor on mast cells is essential for their normal proliferation and maturation as well as for several biological responses such as chemotaxis and attachment. In the present study we report that the interleukin-3 (IL-3)-dependent mast cell line CFTL-15 lacks the extracellular domain of the c-kit receptor. This observation was made after noting that the c-kit ligand stem cell factor (SCF) could not prevent IL-3 deprivation-induced mast cell apoptosis and that CFTL-15 cells did not proliferate in response to SCF. Flow cytometric analysis employing monoclonal anti-c-kit antibodies, and immunogold labelling with analysis by electron microscopy, subsequently showed a diminished expression of c-kit on CFTL-15 cells. There was no identifiable message for the extracellular domain of c-kit in these cells, as determined by reverse transcriptase-polymerase chain reaction (RT-PCR). These previously unrecognized properties of the CFTL-15 mast cell line allowed the examination of other biological consequences of the lack of c-kit on mast cells. Analysing the ability of these cells to adhere to surface-bound fibronectin, it was found that addition of SCF did not increase their adhesion to this substrate, in opposition to what is reported with other mast cells. Similarly, CFTL-15 mast cells did not adhere to fibroblasts, which is known to require c-kit expression. Also, there was no protein tyrosine phosphorylation in these cells in response to SCF. CFTL-15 cells underwent apoptosis on removal of IL-3 coincident with a decrease in endogenous Bcl-2 mRNA. Overexpression of Bcl-2 cDNA prolonged survival of Bcl-2-transfected CFTL-15 cells upon withdrawal of IL-3. Thus, the CFTL-15 cell line that lacks surface c-kit is not able to proliferate in response to SCF, undergoes apoptosis in the presence of SCF, and does not adhere to fibroblasts. These results confirm earlier studies on the functional consequences of c-kit and provide a novel

  14. Novel autosomal recessive gene mutations in aquaporin-2 in two Chinese congenital nephrogenic diabetes insipidus pedigrees

    PubMed Central

    Cen, Jing; Nie, Min; Duan, Lian; Gu, Feng

    2015-01-01

    Recent evidence has linked novel mutations in the arginine vasopressin receptor 2 gene (AVPR2) and aquaporin-2 gene (AQP2) present in Southeast Asian populations to congenital nephrogenic diabetes insipidus (NDI). To investigate mutations in 2 distinct Chinese pedigrees with NDI patients, clinical data, laboratory findings, and genomic DNA sequences from peripheral blood leukocytes were analyzed in two 5.5- and 8-year-old boys (proband 1 and 2, respectively) and their first-degree relatives. Water intake, urinary volume, body weight and medication use were recorded. Mutations in coding regions and intron-exon borders of both AQP2 and AVPR2 gene were sequenced. Three mutations in AQP2 were detected, including previously reported heterozygous frameshift mutation (c.127_128delCA, p.Gln43Aspfs ×63) inherited from the mother, a novel frameshift mutation (c.501_502insC, p.Val168Argfs ×30, inherited from the father) in proband 1 and a novel missense mutation (c. 643G>A, p. G215S), inherited from both parents in proband 2. In family 2 both parents and one sister were heterozygous carriers of the novel missense mutation. Neither pedigree exhibited mutation in the AVPR2 gene. The patient with truncated AQP2 may present with much more severe NDI manifestations. Identification of these novel AQP2 gene mutations expands the AQP2 genotypic spectrum and may contribute to etiological diagnosis and genetic counseling. PMID:26064258

  15. Association of HFE gene mutations with nonalcoholic fatty liver disease in the Iranian population.

    PubMed

    Saremi, L; Lotfipanah, S; Mohammadi, M; Hosseinzadeh, H; Sayad, A; Saltanatpour, Z

    2016-10-31

    To determine whether the HFE gene variants H63D and C282Y are associated with NAFLD in persons with type 2 diabetes, we conducted a case-control study including 145 case of NAFLD patients with a history of type 2 diabetes and 145 matching control. The genomic DNA was extracted from the peripheral venous blood and the genotyping of HFE gene mutations was analyzed using the PCR-RFLP technique. Statistical analysis was performed using SPSS 12.0 software by χ2 test, t test and ANOVA (P<0.05). Data showed no increased frequency of HFE mutations in persons with type 2 diabetes and no association between H63D mutation and NAFLD in the study population. Also, we analyzed index of physiological variables including FBS, lipid profile (TC, TG, LDL-C, and HDL-C), BMI, HbA1c, and micro albuminuria and Cr levels). Data showed there are no relationship between these indexes and HFE gene mutations and either NAFLD as a complication of diabetes. But our results showed a relationship between C282Y mutation and NAFLD in persons with type 2 diabetes. C282Y mutation might be a genetic marker of NAFLD in Iranian population.

  16. Phenotype of Usher syndrome type II assosiated with compound missense mutations of c.721 C>T and c.1969 C>T in MYO7A in a Chinese Usher syndrome family.

    PubMed

    Zhai, Wei; Jin, Xin; Gong, Yan; Qu, Ling-Hui; Zhao, Chen; Li, Zhao-Hui

    2015-01-01

    To identify the pathogenic mutations in a Chinese pedigree affected with Usher syndrome type II (USH2). The ophthalmic examinations and audiometric tests were performed to ascertain the phenotype of the family. To detect the genetic defect, exons of 103 known RDs -associated genes including 12 Usher syndrome (USH) genes of the proband were captured and sequencing analysis was performed to exclude known genetic defects and find potential pathogenic mutations. Subsequently, candidate mutations were validated in his pedigree and 100 normal controls using polymerase chain reaction (PCR) and Sanger sequencing. The patient in the family occurred hearing loss (HL) and retinitis pigmentosa (RP) without vestibular dysfunction, which were consistent with standards of classification for USH2. He carried the compound heterozygous mutations, c.721 C>T and c.1969 C>T, in the MYO7A gene and the unaffected members carried only one of the two mutations. The mutations were not present in the 100 normal controls. We suggested that the compound heterozygous mutations of the MYO7A could lead to USH2, which had revealed distinguished clinical phenotypes associated with MYO7A and expanded the spectrum of clinical phenotypes of the MYO7A mutations.

  17. [Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].

    PubMed

    Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong

    2014-10-18

    To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in

  18. Next-Generation Sequencing-based genomic profiling of brain metastases of primary ovarian cancer identifies high number of BRCA-mutations.

    PubMed

    Balendran, S; Liebmann-Reindl, S; Berghoff, A S; Reischer, T; Popitsch, N; Geier, C B; Kenner, L; Birner, P; Streubel, B; Preusser, M

    2017-07-01

    Ovarian cancer represents the most common gynaecological malignancy and has the highest mortality of all female reproductive cancers. It has a rare predilection to develop brain metastases (BM). In this study, we evaluated the mutational profile of ovarian cancer metastases through Next-Generation Sequencing (NGS) with the aim of identifying potential clinically actionable genetic alterations with options for small molecule targeted therapy. Library preparation was conducted using Illumina TruSight Rapid Capture Kit in combination with a cancer specific enrichment kit covering 94 genes. BRCA-mutations were confirmed by using TruSeq Custom Amplicon Low Input Kit in combination with a custom-designed BRCA gene panel. In our cohort all eight sequenced BM samples exhibited a multitude of variant alterations, each with unique molecular profiles. The 37 identified variants were distributed over 22 cancer-related genes (23.4%). The number of mutated genes per sample ranged from 3 to 7 with a median of 4.5. The most commonly altered genes were BRCA1/2, TP53, and ATM. In total, 7 out of 8 samples revealed either a BRCA1 or a BRCA2 pathogenic mutation. Furthermore, all eight BM samples showed mutations in at least one DNA repair gene. Our NGS study of BM of ovarian carcinoma revealed a significant number of BRCA-mutations beside TP53, ATM and CHEK2 mutations. These findings strongly suggest the implication of BRCA and DNA repair malfunction in ovarian cancer metastasizing to the brain. Based on these findings, pharmacological PARP inhibition could be one potential targeted therapeutic for brain metastatic ovarian cancer patients.

  19. Whole-exome sequencing for mutation detection in pediatric disorders of insulin secretion: Maturity onset diabetes of the young and congenital hyperinsulinism.

    PubMed

    Johnson, S R; Leo, P J; McInerney-Leo, A M; Anderson, L K; Marshall, M; McGown, I; Newell, F; Brown, M A; Conwell, L S; Harris, M; Duncan, E L

    2018-06-01

    To assess the utility of whole-exome sequencing (WES) for mutation detection in maturity-onset diabetes of the young (MODY) and congenital hyperinsulinism (CHI). MODY and CHI are the two commonest monogenic disorders of glucose-regulated insulin secretion in childhood, with 13 causative genes known for MODY and 10 causative genes identified for CHI. The large number of potential genes makes comprehensive screening using traditional methods expensive and time-consuming. Ten subjects with MODY and five with CHI with known mutations underwent WES using two different exome capture kits (Nimblegen SeqCap EZ Human v3.0 Exome Enrichment Kit, Nextera Rapid Capture Exome Kit). Analysis was blinded to previously identified mutations, and included assessment for large deletions. The target capture of five exome capture technologies was also analyzed using sequencing data from >2800 unrelated samples. Four of five MODY mutations were identified using Nimblegen (including a large deletion in HNF1B). Although targeted, one mutation (in INS) had insufficient coverage for detection. Eleven of eleven mutations (six MODY, five CHI) were identified using Nextera Rapid (including the previously missed mutation). On reconciliation, all mutations concorded with previous data and no additional variants in MODY genes were detected. There were marked differences in the performance of the capture technologies. WES can be useful for screening for MODY/CHI mutations, detecting both point mutations and large deletions. However, capture technologies require careful selection. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. [Mutation analysis of the PAH gene in children with phenylketonuria from the Qinghai area of China].

    PubMed

    He, Jiang; Wang, Hui-Zhen; Xu, Fa-Liang; Yang, Xi; Wang, Rui; Zou, Hong-Yun; Yu, Wu-Zhong

    2015-11-01

    To study the mutation characteristics of the phenylalanine hydroxylase (PAH) gene in children with phenylketonuria (PKU) from the Qinghai area of China, in order to provide basic information for genetic counseling and prenatal diagnosis. Mutations of the PAH gene were detected in the promoter and exons 1-13 and their flanking intronic sequences of PAH gene by PCR and DNA sequencing in 49 children with PKU and their parents from the Qinghai area of China. A total of 30 different mutations were detected in 80 out of 98 mutant alleles (82%), including 19 missense (63%), 5 nonsense (17%), 3 splice-site (10%) and 3 deletions (10%). Most mutations were detected in exons 3, 6, 7, 11 and intron 4 of PAH gene. The most frequent mutations were p.R243Q (19%), IVS4-1G>A (9%), p.Y356X (7%) and p.EX6-96A>G(5%). Two novel mutations p.N93fsX5 (c.279-282delCATC) and p.G171E (c.512G>A) were found. p.H64fsX9(c.190delC) was documented for the second time in Chinese PAH gene. The mutation spectrum of the gene PAH in the Qinghai population was similar to that in other populations in North China while significantly different from that in the populations from some provinces in southern China, Japan and Europe. The mutations of PAH gene in the Qinghai area of China demonstrate a unique diversity, complexity and specificity.

  1. A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with severe nephropathy.

    PubMed

    Tabebi, Mouna; Mkaouar-Rebai, Emna; Mnif, Mouna; Kallabi, Fakhri; Ben Mahmoud, Afif; Ben Saad, Wafa; Charfi, Nadia; Keskes-Ammar, Leila; Kamoun, Hassen; Abid, Mohamed; Fakhfakh, Faiza

    2015-04-10

    Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating that this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. Copyright © 2015. Published by Elsevier Inc.

  2. Identification of 5 novel mutations in the AGXT gene.

    PubMed

    Basmaison, O; Rolland, M O; Cochat, P; Bozon, D

    2000-06-01

    In order to identify additional genotypes in primary hyperoxaluria type 1, we sequenced the AGXT genes of 9 patients. We report 5 new mutations. Three are splice-site mutations situated at the end of intron 4 and 8 (647-1G>A, 969-1G>C, 969-3C>G), one is a missense mutation in exon 5 (D183N), and one is a short duplication in exon 2 (349ins7). Their consequence is always a lack of enzymatic activity of the Alanine-Glyoxylate Aminotransferase (AGT); for 4 of them, we were able to deduce that they were associated to the absence of AGT protein. These mutations are rare, as they have been found on one allele in our study (except 969-3C>G present in 2 unrelated families), and have not been previously reported.

  3. Stem cell factor (SCF) protects osteoblasts from oxidative stress through activating c-Kit-Akt signaling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Lei; Wu, Zhong; Yin, Gang

    2014-12-12

    Highlights: • SCF receptor c-Kit is functionally expressed in primary and transformed osteoblasts. • SCF protects primary and transformed osteoblasts from H{sub 2}O{sub 2}. • SCF activation of c-Kit in osteoblasts, required for its cyto-protective effects. • c-Kit mediates SCF-induced Akt activation in cultured osteoblasts. • Akt activation is required for SCF-regulated cyto-protective effects in osteoblasts. - Abstract: Osteoblasts regulate bone formation and remodeling, and are main target cells of oxidative stress in the progression of osteonecrosis. The stem cell factor (SCF)-c-Kit pathway plays important roles in the proliferation, differentiation and survival in a range of cell types, but littlemore » is known about its functions in osteoblasts. In this study, we found that c-Kit is functionally expressed in both osteoblastic-like MC3T3-E1 cells and primary murine osteoblasts. Its ligand SCF exerted significant cyto-protective effects against hydrogen peroxide (H{sub 2}O{sub 2}). SCF activated its receptor c-Kit in osteoblasts, which was required for its cyto-protective effects against H{sub 2}O{sub 2}. Pharmacological inhibition (by Imatinib and Dasatinib) or shRNA-mediated knockdown of c-Kit thus inhibited SCF-mediated osteoblast protection. Further investigations showed that protection by SCF against H{sub 2}O{sub 2} was mediated via activation of c-Kit-dependent Akt pathway. Inhibition of Akt activation, through pharmacological or genetic means, suppressed SCF-mediated anti-H{sub 2}O{sub 2} activity in osteoblasts. In summary, we have identified a new SCF-c-Kit-Akt physiologic pathway that protects osteoblasts from H{sub 2}O{sub 2}-induced damages, and might minimize the risk of osteonecrosis caused by oxidative stress.« less

  4. The KIT gene is associated with the english spotting coat color locus and congenital megacolon in Checkered Giant rabbits (Oryctolagus cuniculus).

    PubMed

    Fontanesi, Luca; Vargiolu, Manuela; Scotti, Emilio; Latorre, Rocco; Faussone Pellegrini, Maria Simonetta; Mazzoni, Maurizio; Asti, Martina; Chiocchetti, Roberto; Romeo, Giovanni; Clavenzani, Paolo; De Giorgio, Roberto

    2014-01-01

    The English spotting coat color locus in rabbits, also known as Dominant white spotting locus, is determined by an incompletely dominant allele (En). Rabbits homozygous for the recessive wild-type allele (en/en) are self-colored, heterozygous En/en rabbits are normally spotted, and homozygous En/En animals are almost completely white. Compared to vital en/en and En/en rabbits, En/En animals are subvital because of a dilated ("mega") cecum and ascending colon. In this study, we investigated the role of the KIT gene as a candidate for the English spotting locus in Checkered Giant rabbits and characterized the abnormalities affecting enteric neurons and c-kit positive interstitial cells of Cajal (ICC) in the megacolon of En/En rabbits. Twenty-one litters were obtained by crossing three Checkered Giant bucks (En/en) with nine Checkered Giant (En/en) and two en/en does, producing a total of 138 F1 and backcrossed rabbits. Resequencing all coding exons and portions of non-coding regions of the KIT gene in 28 rabbits of different breeds identified 98 polymorphisms. A single nucleotide polymorphism genotyped in all F1 families showed complete cosegregation with the English spotting coat color phenotype (θ=0.00 LOD  =75.56). KIT gene expression in cecum and colon specimens of En/En (pathological) rabbits was 5-10% of that of en/en (control) rabbits. En/En rabbits showed reduced and altered c-kit immunolabelled ICC compared to en/en controls. Morphometric data on whole mounts of the ascending colon showed a significant decrease of HuC/D (P<0.05) and substance P (P<0.01) immunoreactive neurons in En/En vs. en/en. Electron microscopy analysis showed neuronal and ICC abnormalities in En/En tissues. The En/En rabbit model shows neuro-ICC changes reminiscent of the human non-aganglionic megacolon. This rabbit model may provide a better understanding of the molecular abnormalities underlying conditions associated with non-aganglionic megacolon.

  5. The KIT Gene Is Associated with the English Spotting Coat Color Locus and Congenital Megacolon in Checkered Giant Rabbits (Oryctolagus cuniculus)

    PubMed Central

    Fontanesi, Luca; Vargiolu, Manuela; Scotti, Emilio; Latorre, Rocco; Faussone Pellegrini, Maria Simonetta; Mazzoni, Maurizio; Asti, Martina; Chiocchetti, Roberto; Romeo, Giovanni; Clavenzani, Paolo; De Giorgio, Roberto

    2014-01-01

    The English spotting coat color locus in rabbits, also known as Dominant white spotting locus, is determined by an incompletely dominant allele (En). Rabbits homozygous for the recessive wild-type allele (en/en) are self-colored, heterozygous En/en rabbits are normally spotted, and homozygous En/En animals are almost completely white. Compared to vital en/en and En/en rabbits, En/En animals are subvital because of a dilated (“mega”) cecum and ascending colon. In this study, we investigated the role of the KIT gene as a candidate for the English spotting locus in Checkered Giant rabbits and characterized the abnormalities affecting enteric neurons and c-kit positive interstitial cells of Cajal (ICC) in the megacolon of En/En rabbits. Twenty-one litters were obtained by crossing three Checkered Giant bucks (En/en) with nine Checkered Giant (En/en) and two en/en does, producing a total of 138 F1 and backcrossed rabbits. Resequencing all coding exons and portions of non-coding regions of the KIT gene in 28 rabbits of different breeds identified 98 polymorphisms. A single nucleotide polymorphism genotyped in all F1 families showed complete cosegregation with the English spotting coat color phenotype (θ = 0.00 LOD  = 75.56). KIT gene expression in cecum and colon specimens of En/En (pathological) rabbits was 5–10% of that of en/en (control) rabbits. En/En rabbits showed reduced and altered c-kit immunolabelled ICC compared to en/en controls. Morphometric data on whole mounts of the ascending colon showed a significant decrease of HuC/D (P<0.05) and substance P (P<0.01) immunoreactive neurons in En/En vs. en/en. Electron microscopy analysis showed neuronal and ICC abnormalities in En/En tissues. The En/En rabbit model shows neuro-ICC changes reminiscent of the human non-aganglionic megacolon. This rabbit model may provide a better understanding of the molecular abnormalities underlying conditions associated with non-aganglionic megacolon. PMID:24736498

  6. [Rapid detection of hot spot mutations of FGFR3 gene with PCR-high resolution melting assay].

    PubMed

    Li, Shan; Wang, Han; Su, Hua; Gao, Jinsong; Zhao, Xiuli

    2017-08-10

    To identify the causative mutations in five individuals affected with dyschondroplasia and develop an efficient procedure for detecting hot spot mutations of the FGFR3 gene. Genomic DNA was extracted from peripheral blood samples with a standard phenol/chloroform method. PCR-Sanger sequencing was used to analyze the causative mutations in the five probands. PCR-high resolution melting (HRM) was developed to detect the identified mutations. A c.1138G>A mutation in exon 8 was found in 4 probands, while a c.1620C>G mutation was found in exon 11 of proband 5 whom had a mild phenotype. All patients were successfully distinguished from healthy controls with the PCR-HRM method. The results of HRM analysis were highly consistent with that of Sanger sequencing. The Gly380Arg and Asn540Lys are hot spot mutations of the FGFR3 gene among patients with ACH/HCH. PCR-HRM analysis is more efficient for detecting hot spot mutations of the FGFR3 gene.

  7. Naturally Occurring Mutations in Large Surface Genes Related to Occult Infection of Hepatitis B Virus Genotype C

    PubMed Central

    Kim, Hong; Lee, Seoung-Ae; Kim, Dong-Won; Lee, Sueng-Hyun; Kim, Bum-Joon

    2013-01-01

    Molecular mechanisms related to occult hepatitis B virus (HBV) infection, particularly those based on genotype C infection, have rarely been determined thus far in the ongoing efforts to determine infection mechanisms. Therefore, we aim to elucidate the mutation patterns in the surface open reading frame (S ORF) underlying occult infections of HBV genotype C in the present study. Nested PCRs were applied to 624 HBV surface antigen (HBsAg) negative Korean subjects. Cloning and sequencing of the S ORF gene was applied to 41 occult cases and 40 control chronic carriers. Forty-one (6.6%) of the 624 Korean adults with HBsAg-negative serostatus were found to be positive for DNA according to nested PCR tests. Mutation frequencies in the three regions labeled here as preS1, preS2, and S were significantly higher in the occult subjects compared to the carriers in all cases. A total of two types of deletions, preS1 deletions in the start codon and preS2 deletions as well as nine types of point mutations were significantly implicated in the occult infection cases. Mutations within the “a” determinant region in HBsAg were found more frequently in the occult subjects than in the carriers. Mutations leading to premature termination of S ORF were found in 16 occult subjects (39.0%) but only in one subject from among the carriers (2.5%). In conclusion, our data suggest that preS deletions, the premature termination of S ORF, and “a” determinant mutations are associated with occult infections of HBV genotype C among a HBsAg-negative population. The novel mutation patterns related to occult infection introduced in the present study can help to broaden our understanding of HBV occult infections. PMID:23349904

  8. β-Thalassemia gene mutations in Antalya, Turkey: results from a single centre study.

    PubMed

    Kurtoğlu, Ayşegül; Karakuş, Volkan; Erkal, Özgür; Kurtoğlu, Erdal

    2016-11-01

    β-Thalassemia (β-thal) is a common autosomal recessive disorder resulting from over 300 different mutations of the β-globin genes. Our aim was to create a mutation map of β-thal in the province of Antalya, Turkey. In this study, mutation analysis of a total 146 of β-thal patients followed at the Thalassemia Center of the Antalya Education and Research Hospital, Antalya, Turkey, were included. Direct DNA sequence analysis was performed for mutation scanning of the β-globin gene. One hundred and forty-six patients with β-thal including all types were analyzed, and 14 different β-thal mutations were detected. The most frequently seen mutation was HBB: c.93 - 21G > A [IVS-I-110 (G > A)] (52.7%), followed by HBB: .c.92 + 6T > C [IVS-I-6 (T > C)] (14.4%), HBB: c.-80T > A [-30 (T > A)] (8.2%), HBB: c.315 + 1G > A [IVS-II-1 (G > A)] (8.2%), which made up 83.1% of the observed mutations. Our results indicate the importance of micromapping and epidemiology studies of thalassemia, which will assist in establishing the national prevention and control program in Turkey.

  9. The clinical presentation and genotype of protein C deficiency with double mutations of the protein C gene.

    PubMed

    Inoue, Hirofumi; Terachi, Shin-Ichi; Uchiumi, Takeshi; Sato, Tetsuji; Urata, Michiyo; Ishimura, Masataka; Koga, Yui; Hotta, Taeko; Hara, Toshiro; Kang, Dongchon; Ohga, Shouichi

    2017-07-01

    Severe protein C (PC) deficiency is a rare heritable thrombophilia leading to thromboembolic events during the neonatal period. It remains unclear how individuals with complete PC gene (PROC) defects develop or escape neonatal stroke or purpura fulminans (PF). We studied the onset of disease and the genotype of 22 PC-deficient patients with double mutations in PROC based on our cohort (n = 12) and the previous reports (n = 10) in Japan. Twenty-two patients in 20 unrelated families had 4 homozygous and 18 compound heterozygous mutations. Sixteen newborns presented with PF (n = 11, 69%), intracranial thromboembolism and hemorrhage (n = 13, 81%), or both (n = 8, 50%), with most showing a plasma PC activity of <10%. Six others first developed overt thromboembolism when they were over 15 years of age, showing a median PC activity of 31% (range: 19-52%). Fifteen of the 22 patients (68%) had the five major mutations (G423VfsX82, V339M, R211W, M406I, and F181V) or two others (E68K and K193del) that have been reported in Japan. Three of the six late-onset cases, but none of the 16 neonatal cases, had the K193del mutation, which has been reported to be the most common variant of Chinese thrombophilia. A novel mutation of A309V was determined in a family of two patients with late onset. The genotype of double-PROC mutants might show less diversity than heterozygous mutants in terms of the timing of the onset of thrombophilia (newborn onset or late onset). © 2017 Wiley Periodicals, Inc.

  10. A novel splicing mutation in GALT gene causing Galactosemia in Ecuadorian family.

    PubMed

    De Lucca, M; Barba, C; Casique, L

    2017-07-01

    Classic Galactosemia (OMIM 230400) is an autosomal recessive disorder of galactose metabolism caused by mutations in the galactose-1-phosphate uridyl transferase (GALT) gene. This disease caused by the inability to metabolize galactose is potentially life-threatening but its pathophysiology has not been clearly defined. GALT gene presents high allelic heterogeneity and around 336 variations have been identified. Here, we report the case of a patient with Classic Galactosemia who was detected during a neonatal screening in Ecuador. Molecular study revealed a mutation in GALT gene intron 1, c.82+3A>G in homozygous condition, this mutation has not been previously reported. This gene variation was not found in any of the 119 healthy Ecuadorian individuals used as control. Furthermore, the mutation was the only alteration detected in the propositus's GALT after sequencing all exons and introns of this gene. In silico modeling predicted that the mutation was pathogenic. Copyright © 2017. Published by Elsevier B.V.

  11. A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with sever nephropathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tabebi, Mouna, E-mail: mouna.biologiste@yahoo.com; Mkaouar-Rebai, Emna; Mnif, Mouna

    Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating thatmore » this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. - Highlights: • MT-COX3 m.9267G>C (p.A21P), heteroplasmic substitution, is not reported in any database. • m.9267G>C can be responsible of the MIDD associated with nephropaty. • This substitution can modify the function and the stability of the MT-CO3 protein. • This substitution can modify MT-CO3 structure (2D and 3D). • MT-COX3 m.9267G>C is

  12. Mutation analysis of the carbohydrate sulfotransferase gene in Vietnamese with macular corneal dystrophy.

    PubMed

    Ha, Nguyen Thanh; Chau, Hoang Minh; Cung, Le Xuan; Thanh, Ton Kim; Fujiki, Keiko; Murakami, Akira; Hiratsuka, Yoshimune; Kanai, Atsushi

    2003-08-01

    Mutations in a new carbohydrate sulfotransferase gene (CHST6) encoding corneal N-acetylglucosamine-6-sulfotransferase (C-GlcNac-6-ST) have been identified as the cause of macular corneal dystrophy (MCD) in various ethnicities. This study was conducted to examine the CHST6 gene in Vietnamese with MCD. Nineteen unrelated families, including 35 patients and 38 unaffected relatives were examined clinically. Blood samples were collected. Fifty normal Vietnamese individuals served as control subjects. Genomic DNA was extracted from leukocytes. Analysis of the CHST6 gene was performed with polymerase chain reaction and direct sequencing. Corneal buttons were studied histopathologically. A slit lamp examination revealed clinical features of MCD with gray-white opacities and stromal haze between. On histopathology, corneal sections showed positive staining with colloidal iron. Sequencing of the CHST6 gene revealed six homozygous and three compound heterozygous mutations. The homozygous mutations, including L59P, V66L, R211Q, W232X, Y268C, and 1067-1068ins(GGCCGTG) were detected, respectively, in two, one, eight, one, one, and two families. Compound heterozygous mutations R211Q/Q82X, S51L/Y268C, and Y268C/1067-1068ins(GGCCGTG) were identified, each in one family. A single heterozygous change at codon 76 (GTG-->ATG) was detected in family L, resulting in a valine-to-methionine substitution (V76M). None of these mutations was detected in the control group. Mutations identified in the CHST6 gene cosegregated with the disease phenotype in all but one family studied and thus caused MCD. Among these, the R211Q detected in 9 of 19 families may be the most common mutation in Vietnamese. These data also indicate that significant allelic heterogeneity exists for MCD.

  13. Myeloid Conditioning with c-kit-Targeted CAR-T Cells Enables Donor Stem Cell Engraftment.

    PubMed

    Arai, Yasuyuki; Choi, Uimook; Corsino, Cristina I; Koontz, Sherry M; Tajima, Masaki; Sweeney, Colin L; Black, Mary A; Feldman, Steven A; Dinauer, Mary C; Malech, Harry L

    2018-05-02

    We report a novel approach to bone marrow (BM) conditioning using c-kit-targeted chimeric antigen receptor T (c-kit CAR-T) cells in mice. Previous reports using anti-c-kit or anti-CD45 antibody linked to a toxin such as saporin have been promising. We developed a distinctly different approach using c-kit CAR-T cells. Initial studies demonstrated in vitro killing of hematopoietic stem cells by c-kit CAR-T cells but poor expansion in vivo and poor migration of CAR-T cells into BM. Pre-treatment of recipient mice with low-dose cyclophosphamide (125 mg/kg) together with CXCR4 transduction in the CAR-T cells enhanced trafficking to and expansion in BM (<1%-13.1%). This resulted in significant depletion of the BM c-kit + population (9.0%-0.1%). Because congenic Thy1.1 CAR-T cells were used in the Thy1.2-recipient mice, anti-Thy1.1 antibody could be used to deplete CAR-T cells in vivo before donor BM transplant. This achieved 20%-40% multilineage engraftment. We applied this conditioning to achieve an average of 28% correction of chronic granulomatous disease mice by wild-type BM transplant. Our findings provide a proof of concept that c-kit CAR-T cells can achieve effective BM conditioning without chemo-/radiotherapy. Our work also demonstrates that co-expression of a trafficking receptor can enhance targeting of CAR-T cells to a designated tissue. Published by Elsevier Inc.

  14. Crenolanib is a type I tyrosine kinase inhibitor that inhibits mutant KIT D816 isoforms prevalent in systemic mastocytosis and core binding factor leukemia.

    PubMed

    Kampa-Schittenhelm, Kerstin Maria; Frey, Julia; Haeusser, Lara A; Illing, Barbara; Pavlovsky, Ashly A; Blumenstock, Gunnar; Schittenhelm, Marcus Matthias

    2017-10-10

    Activating D816 mutations of the class III receptor tyrosine kinase KIT are associated with the majority of patients with systemic mastocytosis (SM), but also core binding factor (CBF) AML, making KIT mutations attractive therapeutic targets for the treatment of these cancers. Crenolanib is a potent and selective inhibitor of wild-type as well as mutant isoforms of the class III receptor tyrosine kinases FLT3 and PDGFRα/β. Notably, crenolanib inhibits constitutively active mutant-FLT3 isoforms resulting from amino acid substitutions of aspartic acid at codon 835, which is homologous to codon 816 in the KIT gene - suggesting sensitivity against mutant-KIT D816 isoforms as well. Here we demonstrate that crenolanib targets KIT D816 in SM and CBF AML models: crenolanib inhibits cellular proliferation and initiates apoptosis of mastocytosis cell lines expressing these mutations. Target-specificity was confirmed using an isogenic cell model. In addition, we demonstrate that KIT D816 mutations are targetable with clinically achievable doses of crenolanib. Further, a rationale to combine cladribine (2-CDA), the therapeutic standard in SM, with crenolanib is provided. In conclusion, we demonstrate that crenolanib is an inhibitor of mutant-KIT D816 isoforms at clinically achievable concentrations, and thus may be a potential treatment for SM and CBF AML as a monotherapy or in combination approaches.

  15. The transcriptome of the human mast cell leukemia cells HMC-1.2: an approach to identify specific changes in the gene expression profile in KitD816V systemic mastocytosis.

    PubMed

    Haenisch, B; Herms, S; Molderings, G J

    2013-05-01

    To circumvent the costly isolation procedure associated with tissue mast cells, human mast cell lines such as HMC-1 are employed in mastocytosis research, but their relation to mutated mast cells in systemic mastocytosis has not been investigated systematically. In the present study, we determined the transcriptome of HMC-1.2 cells and compared the expression data with those reported in the literature for normal human resting lung and tonsillar mast cells as well as leukocytes from peripheral blood and mononuclear cells from bone marrow aspirates of patients with D816 V-positive systemic mastocytosis. Our results suggest that HMC-1.2 cells are an appropriate model for the investigation of this variant of systemic mast cell activation disease. The data confirm previous suggestions that the pathologically increased activity of mast cells in patients with D816 V-positive systemic mastocytosis can be deduced from the detection of mutation-related changes in the gene expression profile in leukocytes from peripheral blood and in mononuclear cells from bone marrow aspirates. Thus, mutation-related changes of the expression profile can serve as surrogates (besides clustering of mast cells, expression of CD25, and increased release of tryptase) for the presence of the mutation D816 V in tyrosine kinase Kit in patients with systemic mastocytosis according to the WHO criteria. Whether this also holds true for systemic mast cell activation disease caused by other mutations in Kit or other mast cell activity-related genes is a subject for future studies.

  16. [Mutations of gyrA gene and parC gene in fluoroquinolone-resistant Escherichia coli isolates from sporadic diarrheal cases].

    PubMed

    Ishiguro, Fubito; Toho, Miho; Yamazaki, Mitsugu; Matsuyuki, Seiko; Moriya, Kazuo; Tanaka, Daisuke; Isobe, Junko; Kyota, Yoshito; Muraoka, Michio

    2006-09-01

    We studied 107 isolates of Escherichia coli O153 from sporadic diarrhea cases in Fukui, Toyama, Aichi, and Saga prefectures from 1991 to 2005 for antimicrobial susceptibility and mechanisms of fluoroquinolone resistance, based on standard disk diffusion. Of 12 drugs tested, ampicillin displayed resistance to 72.9% of isolates, streptomycin to 48.6%, tetracycline to 46.7%, sulfisoxazole to 46.7%, trimethoprim/sulfamethoxazole to 29.9%, nalidixic acid (NA) to 29.9%, and ciprofloxacin (CPFX) to 24.3%. Ten of 32 isolates resistant to 3-6 drugs and 16 of 18 isolates resistant to 7-10 drugs were resistant both to NA and CPFX. Mutations of amino acid in quinolone resistance-determining regions of gyrA and parC genes were detected in 24 isolates resistant both to NA and CPFX, and in 1 isolate resistant to NA. The former possessed a combination of double substitution (S83L and D87L) in GyrA and a single substitution (S80I) in ParC. Some 12 of 24 isolates possessed another single substitution (E84V or E84G or A108T) in ParC. The 25 isolates were classified into 4 types as follows. 1 isolate as type 1: GyrA (S83L) and ParC (S80I); 12 isolates as type 2: GyrA (S83L and D87N) and ParC (S80I); 8 isolates as type 3: GyrA (S83L and D87N) and ParC (S80I and E84G/S80R and E84V); and 4 isolate as type 4: GyrA (S83L and D87N) and ParC (S80I and A108T). In the relationship between amino acid mutations and minimal inhibitory concentrations (MIC) of fluoroquinolone, MICs of CPFX, ofloxacin, and norfloxacin showed 1microg/mL, 2microg/mL and 8microg/mL in type 1; 8 approximately 32microg/mL, 8 approximately 32microg/mL and 16 approximately 256microg/mL in type 2; and 32 approximately 256microg/mL' 32 approximately 128microg/mL and 128-->512microg/ mL in types 3 and 4. These results suggest that most of multiple-antimicrobial-resitant E. coli O153 isolates from sporadic diarrhea cases were resistant to fluoroquinolones and possessed mutations at gyrA and parC genes associated with

  17. Mutator gene and hereditary non-polyposis colorectal cancer

    DOEpatents

    de la Chapelle, Albert [Helsingfors, FI; Vogelstein, Bert [Baltimore, MD; Kinzler, Kenneth W [Baltimore, MD

    2008-02-05

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  18. Study on the Evolution of Genes Mutation Related With Gastrointestinal Stromal Tumors

    ClinicalTrials.gov

    2012-01-05

    Full Gene Sequences of c-KIT、PDGFRA and DOG1 Are Analyzed With the Screening-sequencing Approach; Investigate the Characteristics and Variations Associated With the Different Gene Mutations of c-KIT、PDGFRA and DOG1 in GIST Patients

  19. A mitochondrial tRNA(His) gene mutation causing pigmentary retinopathy and neurosensorial deafness.

    PubMed

    Crimi, M; Galbiati, S; Perini, M P; Bordoni, A; Malferrari, G; Sciacco, M; Biunno, I; Strazzer, S; Moggio, M; Bresolin, N; Comi, G P

    2003-04-08

    We have identified a heteroplasmic G to A mutation at position 12,183 of the mitochondrial transfer RNA Histidine (tRNA(His)) gene in three related patients. These phenotypes varied according to mutation heteroplasmy: one had severe pigmentary retinopathy, neurosensorial deafness, testicular dysfunction, muscle hypotrophy, and ataxia; the other two had only retinal and inner ear involvement. The mutation is in a highly conserved region of the T(psi)C stem of the tRNA(His) gene and may alter secondary structure formation. This is the first described pathogenic, maternally inherited mutation of the mitochondrial tRNA(His) gene.

  20. Novel compound heterozygous mutations in the OTOF Gene identified by whole-exome sequencing in auditory neuropathy spectrum disorder.

    PubMed

    Tang, Fengzhu; Ma, Dengke; Wang, Yulan; Qiu, Yuecai; Liu, Fei; Wang, Qingqing; Lu, Qiutian; Shi, Min; Xu, Liang; Liu, Min; Liang, Jianping

    2017-03-23

    Many hearing-loss diseases are demonstrated to have Mendelian inheritance caused by mutations in single gene. However, many deaf individuals have diseases that remain genetically unexplained. Auditory neuropathy is a sensorineural deafness in which sounds are able to be transferred into the inner ear normally but the transmission of the signals from inner ear to auditory nerve and brain is injured, also known as auditory neuropathy spectrum disorder (ANSD). The pathogenic mutations of the genes responsible for the Chinese ANSD population remain poorly understood. A total of 127 patients with non-syndromic hearing loss (NSHL) were enrolled in Guangxi Zhuang Autonomous Region. A hereditary deafness gene mutation screening was performed to identify the mutation sites in four deafness-related genes (GJB2, GJB3, 12S rRNA, and SLC26A4). In addition, whole-exome sequencing (WES) was applied to explore unappreciated mutation sites in the cases with the singularity of its phenotype. Well-characterized mutations were found in only 8.7% (11/127) of the patients. Interestingly, two mutations in the OTOF gene were identified in two affected siblings with ANSD from a Chinese family, including one nonsense mutation c.1273C > T (p.R425X) and one missense mutation c.4994 T > C (p.L1665P). Furthermore, we employed Sanger sequencing to confirm the mutations in each subject. Two compound heterozygous mutations in the OTOF gene were observed in the two affected siblings, whereas the two parents and unaffected sister were heterozygous carriers of c.1273C > T (father and sister) and c.4994 T > C (mother). The nonsense mutation p.R425X, contributes to a premature stop codon, may result in a truncated polypeptide, which strongly suggests its pathogenicity for ANSD. The missense mutation p.L1665P results in a single amino acid substitution in a highly conserved region. Two mutations in the OTOF gene in the Chinese deaf population were recognized for the first time. These

  1. Mutational Analysis of the Rhodopsin Gene in Sector Retinitis Pigmentosa.

    PubMed

    Napier, Maria L; Durga, Dash; Wolsley, Clive J; Chamney, Sarah; Alexander, Sharon; Brennan, Rosie; Simpson, David A; Silvestri, Giuliana; Willoughby, Colin E

    2015-01-01

    To determine the role of rhodopsin (RHO) gene mutations in patients with sector retinitis pigmentosa (RP) from Northern Ireland. A case series of sector RP in a tertiary ocular genetics clinic. Four patients with sector RP were recruited from the Royal Victoria Hospital (Belfast, Northern Ireland) and Altnagelvin Hospital (Londonderry, Northern Ireland) following informed consent. The diagnosis of sector RP was based on clinical examination, International Society for Clinical Electrophysiology of Vision (ISCEV) standard electrophysiology, and visual field analysis. DNA was extracted from peripheral blood leucocytes and the coding regions and adjacent flanking intronic sequences of the RHO gene were polymerase chain reaction (PCR) amplified and cycle sequenced. Rhodopsin mutational status. A heterozygous missense mutation in RHO (c.173C > T) resulting in a non-conservative substitution of threonine to methionine (p. Thr58Met) was identified in one patient and was absent from 360 control individuals. This non-conservative substitution (p.Thr58Met) replaces a highly evolutionary conserved polar hydrophilic threonine residue with a non-polar hydrophobic methionine residue at position 58 near the cytoplasmic border of helix A of RHO. The study identified a RHO gene mutation (p.Thr58Met) not previously reported in RP in a patient with sector RP. These findings outline the phenotypic variability associated with RHO mutations. It has been proposed that the regional effects of RHO mutations are likely to result from interplay between mutant alleles and other genetic, epigenetic and environmental factors.

  2. Characterization of a mast cell line that lacks the extracellular domain of membrane c-kit.

    PubMed Central

    Mekori, Y A; Oh, C K; Dastych, J; Goff, J P; Adachi, S; Bianchine, P J; Worobec, A; Semere, T; Pierce, J H; Metcalfe, D D

    1997-01-01

    Expression of the c-kit proto-oncogene receptor on mast cells is essential for their normal proliferation and maturation as well as for several biological responses such as chemotaxis and attachment. In the present study we report that the interleukin-3 (IL-3)-dependent mast cell line CFTL-15 lacks the extracellular domain of the c-kit receptor. This observation was made after noting that the c-kit ligand stem cell factor (SCF) could not prevent IL-3 deprivation-induced mast cell apoptosis and that CFTL-15 cells did not proliferate in response to SCF. Flow cytometric analysis employing monoclonal anti-c-kit antibodies, and immunogold labelling with analysis by electron microscopy, subsequently showed a diminished expression of c-kit on CFTL-15 cells. There was no identifiable message for the extracellular domain of c-kit in these cells, as determined by reverse transcriptase-polymerase chain reaction (RT-PCR). These previously unrecognized properties of the CFTL-15 mast cell line allowed the examination of other biological consequences of the lack of c-kit on mast cells. Analysing the ability of these cells to adhere to surface-bound fibronectin, it was found that addition of SCF did not increase their adhesion to this substrate, in opposition to what is reported with other mast cells. Similarly, CFTL-15 mast cells did not adhere to fibroblasts, which is known to require c-kit expression. Also, there was no protein tyrosine phosphorylation in these cells in response to SCF. CFTL-15 cells underwent apoptosis on removal of IL-3 coincident with a decrease in endogenous Bcl-2 mRNA. Overexpression of Bcl-2 cDNA prolonged survival of Bcl-2-transfected CFTL-15 cells upon withdrawal of IL-3. Thus, the CFTL-15 cell line that lacks surface c-kit is not able to proliferate in response to SCF, undergoes apoptosis in the presence of SCF, and does not adhere to fibroblasts. These results confirm earlier studies on the functional consequences of c-kit and provide a novel

  3. Isolation, identification, and culture of goat spermatogonial stem cells using c-kit and PGP9.5 markers.

    PubMed

    Heidari, Banafsheh; Rahmati-Ahmadabadi, Maryam; Akhondi, Mohammad Mehdi; Zarnani, Amir Hassan; Jeddi-Tehrani, Mahmood; Shirazi, Abolfazl; Naderi, Mohammad Mehdi; Behzadi, Bahareh

    2012-10-01

    Presently the techniques for making transgenic animals are cumbersome, required costly instruments and trained man-power. The ability of spermatogonial stem cells (SSCs) to integrate foreign genes has provided the opportunity for developing alternate methods for generation of transgenic animals. One of the big challenges in this field is development of the methods to identify and purify donor SSCs by antibody mediated cell sorting. The present study was aimed to identify goat subpopulations of SSCs using polyclonal antibodies against PGP9.5 and c-kit molecular markers as well as the growth characteristics of SSCs during short term culture. One month old goats' testicular samples were subjected for immunohistochemical and immunocytochemical evaluations. The enzymatically isolated SSCs were cultured in DMEM plus FCS supplemented with (treatment) or without (control) growth factors (GDNF, LIF, FGF, and EGF) for 2 weeks. At the end of culture the morphological characteristics of SSCs colonies and immunocytochemical staining were evaluated. The number and size of colonies in treatment groups were significantly (P < 0.01) higher than corresponding values in controls. The presence of PGP 9.5 and c-kit antigens was confirmed in immunocytochemical evaluation. In immunocytochemical evaluation, the proportion of c-kit and PGP9.5 positive cells were significantly (P < 0.001) higher in control and treatment groups, respectively. The presence of PGP9.5 and c-kit antigens was confirmed in goat SSCs. Moreover, culture medium supplementation with growth factors could effectively retain the undifferentiation status of SSCs, reflected as a higher population of PGP9.5 positive cells, after short term culture.

  4. [Analysis of H63D mutation in hemochromatosis (HFE) gene in populations of central Eurasia].

    PubMed

    Khusainova, R I; Khusnutdinova, N N; Litvinov, S S; Khusnutdinova, E K

    2013-02-01

    An analysis of the frequency of H63D (c. 187C>G) mutations in the HFEgene in 19 populations from Central Eurasia demonstrated that the distribution of the mutation in the region of interest was not uniform and that there were the areas of H63D accumulation. The investigation of three polymorphic variants, c.340+4T>C (rs2071303, IVS2(+4)T>C), c.893-44T>C (rs1800708, IVS4(-44)T>C), and c.1007-47G>A (rs1572982, IVS5(-47)A>G), in the HFE gene in individuals homozygous for H63D mutations in the HFE gene revealed the linkage of H63D with three haplotypes, *CTA, *TG, and *TTA. These findings indicated the partial spread of the mutation in Central Eurasia from Western Europe, as well as the possible repeated appearance of the mutation on the territory on interest.

  5. Whole-exome sequencing reveals the spectrum of gene mutations and the clonal evolution patterns in paediatric acute myeloid leukaemia.

    PubMed

    Shiba, Norio; Yoshida, Kenichi; Shiraishi, Yuichi; Okuno, Yusuke; Yamato, Genki; Hara, Yusuke; Nagata, Yasunobu; Chiba, Kenichi; Tanaka, Hiroko; Terui, Kiminori; Kato, Motohiro; Park, Myoung-Ja; Ohki, Kentaro; Shimada, Akira; Takita, Junko; Tomizawa, Daisuke; Kudo, Kazuko; Arakawa, Hirokazu; Adachi, Souichi; Taga, Takashi; Tawa, Akio; Ito, Etsuro; Horibe, Keizo; Sanada, Masashi; Miyano, Satoru; Ogawa, Seishi; Hayashi, Yasuhide

    2016-11-01

    Acute myeloid leukaemia (AML) is a molecularly and clinically heterogeneous disease. Targeted sequencing efforts have identified several mutations with diagnostic and prognostic values in KIT, NPM1, CEBPA and FLT3 in both adult and paediatric AML. In addition, massively parallel sequencing enabled the discovery of recurrent mutations (i.e. IDH1/2 and DNMT3A) in adult AML. In this study, whole-exome sequencing (WES) of 22 paediatric AML patients revealed mutations in components of the cohesin complex (RAD21 and SMC3), BCORL1 and ASXL2 in addition to previously known gene mutations. We also revealed intratumoural heterogeneities in many patients, implicating multiple clonal evolution events in the development of AML. Furthermore, targeted deep sequencing in 182 paediatric AML patients identified three major categories of recurrently mutated genes: cohesion complex genes [STAG2, RAD21 and SMC3 in 17 patients (8·3%)], epigenetic regulators [ASXL1/ASXL2 in 17 patients (8·3%), BCOR/BCORL1 in 7 patients (3·4%)] and signalling molecules. We also performed WES in four patients with relapsed AML. Relapsed AML evolved from one of the subclones at the initial phase and was accompanied by many additional mutations, including common driver mutations that were absent or existed only with lower allele frequency in the diagnostic samples, indicating a multistep process causing leukaemia recurrence. © 2016 John Wiley & Sons Ltd.

  6. Prenatal diagnosis of fetal glutaric aciduria type 1 with rare compound heterozygous mutations in GCDH gene.

    PubMed

    Peng, Hsiu-Huei; Shaw, Sheng-Wen; Huang, Kuan-Gen

    2018-02-01

    Glutaric aciduria type 1 is a rare disease, with the estimated prevalence about 1 in 100,000 newborns. GCDH gene mutation can lead to glutaric acid and 3- OH glutaric acid accumulation, with clinical manifestation of neuronal damage, brain atrophy, microencephalic macrocephaly, decreased coordination of swallowing, poor muscle coordination, spasticity, and severe dystonic movement disorder. A 22-year-old female, Gravida 4 Para 2, is pregnancy at 13 weeks of gestational age. Her first child is normal, however, the second child was diagnosed as glutaric aciduria type I after birth. She came to our hospital for prenatal genetic counselling of her fetus at 13 weeks of gestational age. We performed GCDH gene mutation analysis of maternal blood showed IVS 3 + 1 G > A heterozygous mutation, GCDH gene mutation analysis of paternal blood showed c. 1240 G > A heterozygous mutation, and the second child has compound heterozygous IVS 3 + 1 G > A and c. 1240 G > A mutations. Later, we performed amniocentesis at 16 weeks of gestational age for chromosome study and GCDH gene mutation analysis for the fetus. The fetal chromosome study showed normal karyotype, however, GCDH gene mutation analysis showed compound heterozygous IVS 3 + 1 G > A and c. 1240 G > A mutations. The couple decided to termination of pregnancy thereafter. Glutaric acidemia type 1 is an autosomal recessive disorder because of pathogenic mutations in the GCDH gene. Early diagnosis and therapy of glutaric acidemia type 1 can reduce the risk of neuronal damage and acute dystonia. We report a case of prenatal diagnosis of fetal glutaric aciduria type 1 with rare compound heterozygous GCDH gene mutation at IVS 3 + 1 G > A and c. 1240 G > A mutations, which provide better genetic counselling for the couples. Copyright © 2018. Published by Elsevier B.V.

  7. A novel mutation (C1425Y) in the FBN2 gene in a father and son with congenital contractural arachnodactyly.

    PubMed

    Chen, Ying; Lei, Yun-Ping; Zheng, Hong-Xiang; Wang, Wei; Cheng, Hong-Bo; Zhang, Jing; Wang, Hong-Yan; Jin, Li; Li, Hong

    2009-06-01

    Congenital contractural arachnodactyly (Beals syndrome) is a rare autosomal dominantly inherited connective tissue disorder characterized by flexion contractures, arachnodactyly, crumpled ears, and mild muscular hypoplasia. Here, a father and son with congenital contractural arachnodactyly features were identified. After sequencing 15 exons (22 to 36) of the FBN2 gene, a novel mutation (C1425Y) was found in exon 33. This de novo mutation presented first in the father and was transmitted to his son, but not in the other 14 unaffected family members and 365 normal people. The C1425Y mutation occurs at the 19th cbEGF domain. Cysteines in this cbEGF domain are rather conserved in species, from human down to ascidian. The cbEGF12-13 in human FBN1 was employed as the template to perform homology modeling of cbEGF18-19 of human FBN2 protein. The mutation has also been evaluated by further prediction tools, for example, SIFT, Blosum62, biochemical Yu's matrice, and UMD-Predictor tool. In all analysis, the mutation is predicted to be pathogenic. Thus, the structure destabilization by C1425Y might be the cause of the disorder.

  8. Ultrastructural study of relationships between c-kit immunoreactive interstitial cells and other cellular elements in the human colon.

    PubMed

    Mazzia, C; Porcher, C; Julé, Y; Christen, M O; Henry, M

    2000-05-01

    C-kit immunocytochemistry was performed on ultrathin sections of human distal colon. Our attention was focused on relationships between c-kit immunoreactive interstitial cells (c-kit ICs) and muscular cells and nervous elements located in the external muscular layers of the colonic wall. C-kit ICs established membrane apposition with both nerve fibers and smooth muscle cells of, respectively, the longitudinal and circular muscle layers, the myenteric area, and the extremus submucosus plexus. C-kit ICs also surrounded the external submucosus plexus and established membrane appositions with nerve elements located inside the myenteric ganglia. These membrane appositions were observed either at the level of the c-kit IC bodies or at that of their cytoplasmic processes. In some cases, membrane appositions were observed concomitantly between the c-kit ICs, nerve fibers, and smooth muscle cells. In all the regions studied, the c-kit ICs were also found to be located in the close vicinity of blood vessels and to have established close contacts with non-immunoreactive fibroblast-like cells. The results of the present study shed essential light on the relationships of c-kit ICs with the neighboring muscle cells and nerve elements, and confirm that the intercalated c-kit ICs well fit with the so-called "interstitial cells of Cajal".

  9. A case of a Tunisian Rett patient with a novel double-mutation of the MECP2 gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fendri-Kriaa, Nourhene, E-mail: nourhene.fendri@gmail.com; Hsairi, Ines; Kifagi, Chamseddine

    2011-06-03

    Highlights: {yields} Sequencing of the MECP2 gene, modeling and comparison of the two variants were performed in a Tunisian classical Rett patient. {yields} A double-mutation: a new and de novo mutation c.535C > T and the common one c.763C > T of the MECP2 gene was identified. {yields} The P179S transition may change local electrostatic properties which may affect the function and stability of the protein MeCP2. -- Abstract: Rett syndrome is an X-linked dominant disorder caused frequently by mutations in the methyl-CpG-binding protein 2 gene (MECP2). Rett patients present an apparently normal psychomotor development during the first 6-18 monthsmore » of life. Thereafter, they show a short period of developmental stagnation followed by a rapid regression in language and motor development. The aim of this study was to perform a mutational analysis of the MECP2 gene in a classical Rett patient by sequencing the corresponding gene and modeling the found variants. The results showed the presence of a double-mutation: a new and de novo mutation c.535C > T (p.P179S) and the common c.763C > T (p.R255X) transition of the MECP2 gene. The p.P179S mutation was located in a conserved amino acid in CRIR domain (corepressor interacting region). Modeling results showed that the P179S transition could change local electrostatic properties by adding a negative charge due to serine hydroxyl group of this region of MeCP2 which may affect the function and stability of the protein. The p.R255X mutation is located in TRD-NLS domain (transcription repression domain-nuclear localization signal) of MeCP2 protein.« less

  10. Mutational analysis of genes coding for cell surface proteins in colorectal cancer cell lines reveal novel altered pathways, druggable mutations and mutated epitopes for targeted therapy

    PubMed Central

    Correa, Bruna R.; Bettoni, Fabiana; Koyama, Fernanda C.; Navarro, Fabio C.P.; Perez, Rodrigo O.; Mariadason, John; Sieber, Oliver M.; Strausberg, Robert L.; Simpson, Andrew J.G.; Jardim, Denis L.F.; Reis, Luiz Fernando L.; Parmigiani, Raphael B.; Galante, Pedro A.F.; Camargo, Anamaria A.

    2014-01-01

    We carried out a mutational analysis of 3,594 genes coding for cell surface proteins (Surfaceome) in 23 colorectal cancer cell lines, searching for new altered pathways, druggable mutations and mutated epitopes for targeted therapy in colorectal cancer. A total of 3,944 somatic non-synonymous substitutions and 595 InDels, occurring in 2,061 (57%) Surfaceome genes were catalogued. We identified 48 genes not previously described as mutated in colorectal tumors in the TCGA database, including genes that are mutated and expressed in >10% of the cell lines (SEMA4C, FGFRL1, PKD1, FAM38A, WDR81, TMEM136, SLC36A1, SLC26A6, IGFLR1). Analysis of these genes uncovered important roles for FGF and SEMA4 signaling in colorectal cancer with possible therapeutic implications. We also found that cell lines express on average 11 druggable mutations, including frequent mutations (>20%) in the receptor tyrosine kinases AXL and EPHA2, which have not been previously considered as potential targets for colorectal cancer. Finally, we identified 82 cell surface mutated epitopes, however expression of only 30% of these epitopes was detected in our cell lines. Notwithstanding, 92% of these epitopes were expressed in cell lines with the mutator phenotype, opening new venues for the use of “general” immune checkpoint drugs in this subset of patients. PMID:25193853

  11. Clinical and pathological features of amyotrophic lateral sclerosis caused by mutation in the C9ORF72 gene on chromosome 9p.

    PubMed

    Stewart, Heather; Rutherford, Nicola J; Briemberg, Hannah; Krieger, Charles; Cashman, Neil; Fabros, Marife; Baker, Matt; Fok, Alice; DeJesus-Hernandez, Mariely; Eisen, Andrew; Rademakers, Rosa; Mackenzie, Ian R A

    2012-03-01

    Two studies recently identified a GGGGCC hexanucleotide repeat expansion in a non-coding region of the chromosome 9 open-reading frame 72 gene (C9ORF72) as the cause of chromosome 9p-linked amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). In a cohort of 231 probands with ALS, we identified the C9ORF72 mutation in 17 familial (27.4%) and six sporadic (3.6%) cases. Patients with the mutation presented with typical motor features of ALS, although subjects with the C9ORF72 mutation had more frequent bulbar onset, compared to those without this mutation. Dementia was significantly more common in ALS patients and families with the C9ORF72 mutation and was usually early-onset FTD. There was striking clinical heterogeneity among the members of individual families with the mutation. The associated neuropathology was a combination of ALS with TDP-ir inclusions and FTLD-TDP. In addition to TDP-43-immunoreactive pathology, a consistent and specific feature of cases with the C9ORF72 mutation was the presence of ubiquitin-positive, TDP-43-negative inclusions in a variety of neuroanatomical regions, such as the cerebellar cortex. These findings support the C9ORF72 mutation as an important newly recognized cause of ALS, provide a more detailed characterization of the associated clinical and pathological features and further demonstrate the clinical and molecular overlap between ALS and FTD.

  12. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  13. Methylenetetrahydrofolate reductase C677T mutation and risk of retinal vein thrombosis

    PubMed Central

    Soltanpour, Mohammad Soleiman; Soheili, Zahra; Shakerizadeh, Ali; Pourfathollah, Ali Akbar; Samiei, Shahram; Meshkani, Reza; Shahjahani, Mohammad; Karimi, Abbas

    2013-01-01

    Background: Elevated plasma homocysteine (Hcy) level has been established as a significant risk factor for venous thrombosis and cardiovascular disease. Homozygosity for the methylenetetrahydrofolate reductase (MTHFR) C677T mutation has been associated with elevated plasma Hcy concentration and may contribute to retinal vein thrombosis (RVT) development. The aim of the present study was to investigate whether the hyperhomocysteinemia and/or homozygosity for the MTHFR C677T mutation are associated with an increased risk for RVT. Materials and Methods: Our study population consisted of 73 consecutive patients (50-78 years old) with RVT and 73 control subjects (51-80 years old), matched for age and sex. Genotyping for the MTHFR C677T mutation was performed by polymerase chain reaction-restriction fragment length polymorphism technique and Hcy level was determined by an enzyme immunoassay kit. Results: The prevalence of 677TT genotype was higher in patients than control subjects, but the difference in frequency didn't reach a significant value (P = 0.07). The frequency of the 677T allele was 26% and 21.2% in patients and controls, respectively and did not differ significantly between the two groups (odds ratio = 1.3, 95% confidence interval (0.75-2.24), P = 0.33). Fasting plasma total Hcy level was significantly higher in patients than controls (P = 0.001). Conclusion: Our study demonstrated that hyperhomocysteinemia, but not the MTHFR C677T mutation, is associated with RVT. PMID:24250697

  14. [Study of a family with epidermolysis bullosa simplex resulting from a novel mutation of KRT14 gene].

    PubMed

    Meng, Lanlan; Du, Juan; Li, Wen; Lu, Guangxiu; Tan, Yueqiu

    2017-08-10

    To determine the molecular etiology for a Chinese pedigree affected with epidermolysis bullosa simplex (EBS). Target region sequencing using a hereditary epidermolysis bullosa capture array combined with Sanger sequencing and bioinformatics analysis were used. Mutation taster, PolyPhen-2, Provean, and SIFT software and NCBI online were employed to assess the pathogenicity and conservation of detected mutations. One hundred healthy unrelated individuals were used as controls. Target region sequencing showed that the proband has carried a unreported heterozygous c.1234A>G (p.Ile412Val) mutation of the KRT14 gene, which was confirmed by Sanger sequencing in other 8 affected individuals but not among healthy members of the pedigree. Bioinformatics analysis indicated that the mutation is highly pathogenic. Remarkably, 3 members of the family (2 affected and 1 unaffected) have carried a heterozygous c.1237G>A (p.Ala413Thr) mutation of the KRT14 gene, which was collected in Human Gene Mutation Database (HGMD). Bioinformatics analysis indicated that the mutation may not be pathogenic. Both mutations were not detected among the 100 healthy controls. The novel c.1234A>G(p.Ile412Val) mutation of the KRT14 gene is probably responsible for the disease, while c.1237G>A (p.Ala413Thr) mutation of KRT14 gene may be a polymorphism. Compared with Sanger sequencing, target region capture sequencing is more efficient and can significantly reduce the cost of genetic testing for EBS.

  15. Cell proliferation and inhibition of apoptosis are related to c-Kit activation in leukaemic lymphoblasts.

    PubMed

    Reyes-Sebastian, Josefina; Montiel-Cervantes, Laura Arcelia; Reyes-Maldonado, Elba; Dominguez-Lopez, Maria Lilia; Ortiz-Butron, Rocio; Castillo-Alvarez, Aida; Lezama, Ruth Angélica

    2018-03-01

    Receptor tyrosine kinase (RTK) activity may contribute to carcinogenesis. The c-Kit receptor, a member of the RTK family, is expressed in immature haematopoietic system cells. Acute lymphoblastic leukaemia (ALL) presents incompletely differentiated lymphoblasts, and consequently, c-Kit expression can be detected in these cells. The BCR-ABL kinase, which is usually present in both ALL and chronic myeloid leukaemia, can trigger signalling pathways with neoplastic effects. However, a certain number of ALL patients and chronic myeloid leukaemia patients do not express this kinase, raising the question of which other proteins that intervene in signalling pathways may be involved in the development of these diseases. To test whether c-Kit has proliferative effects and affects the inhibition of apoptosis of leukaemic lymphoblasts that do not express BCR-ABL. We cultured RS4:11 lymphoblasts and analysed the expression and activation of c-Kit by immunofluorescence, and flow cytometry, evaluation of cell proliferation, apoptosis, cyclin D1 and Bak expression were carried out by flow cytometry; activation of AKT and survivin expression were tested by immunoblot. The c-Kit receptor was found to induce proliferation and to increase the expression of cyclin D1 via the PI3K/AKT/NF-kB signalling pathway. Additionally, the c-Kit/PI3K/AKT pathway increased the inhibition of apoptosis and survivin expression. Similarly, c-Kit was observed to reduce the expression of the pro-apoptotic Bak protein. These results suggest that, in leukaemic lymphoblasts, c-Kit triggers a signalling pathway with proliferative and anti-apoptotic effects; information to this effect has not yet been reported in the literature.

  16. Targeted next generation sequencing identifies novel NOTCH3 gene mutations in CADASIL diagnostics patients.

    PubMed

    Maksemous, Neven; Smith, Robert A; Haupt, Larisa M; Griffiths, Lyn R

    2016-11-24

    Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is a monogenic, hereditary, small vessel disease of the brain causing stroke and vascular dementia in adults. CADASIL has previously been shown to be caused by varying mutations in the NOTCH3 gene. The disorder is often misdiagnosed due to its significant clinical heterogeneic manifestation with familial hemiplegic migraine and several ataxia disorders as well as the location of the currently identified causative mutations. The aim of this study was to develop a new, comprehensive and efficient single assay strategy for complete molecular diagnosis of NOTCH3 mutations through the use of a custom next-generation sequencing (NGS) panel for improved routine clinical molecular diagnostic testing. Our custom NGS panel identified nine genetic variants in NOTCH3 (p.D139V, p.C183R, p.R332C, p.Y465C, p.C597W, p.R607H, p.E813E, p.C977G and p.Y1106C). Six mutations were stereotypical CADASIL mutations leading to an odd number of cysteine residues in one of the 34 NOTCH3 gene epidermal growth factor (EGF)-like repeats, including three new typical cysteine mutations identified in exon 11 (p.C597W; c.1791C>G); exon 18 (p.C977G; c.2929T>G) and exon 20 (p.Y1106C; c.3317A>G). Interestingly, a novel missense mutation in the CACNA1A gene was also identified in one CADASIL patient. All variants identified (novel and known) were further investigated using in silico bioinformatic analyses and confirmed through Sanger sequencing. NGS provides an improved and effective methodology for the diagnosis of CADASIL. The NGS approach reduced time and cost for comprehensive genetic diagnosis, placing genetic diagnostic testing within reach of more patients.

  17. Characterization of a Spontaneous Novel Mutation in the NPC2 Gene in a Cat Affected by Niemann Pick Type C Disease

    PubMed Central

    Zampieri, Stefania; Bianchi, Ezio; Cantile, Carlo; Saleri, Roberta; Bembi, Bruno; Dardis, Andrea

    2014-01-01

    Niemann-Pick C disease (NPC) is an autosomal recessive lysosomal storage disorder characterized by accumulation of unesterified cholesterol and other lipids within the lysosomes due to mutation in NPC1 or NPC2 genes. A feline model of NPC carrying a mutation in NPC1 gene has been previously described. We have identified two kittens affected by NPC disease due to a mutation in NPC2 gene. They manifested with tremors at the age of 3 months, which progressed to dystonia and severe ataxia. At 6 months of age cat 2 was unable to stand without assistance and had bilaterally reduced menace response. It died at the age of 10 months. Post-mortem histological analysis of the brain showed the presence of neurons with cytoplasmic swelling and vacuoles, gliosis of the substantia nigra and degeneration of the white matter. Spheroids with accumulation of ubiquitinated aggregates were prominent in the cerebellar cortex. Purkinje cells were markedly reduced in number and they showed prominent intracytoplasmic storage. Scattered perivascular aggregates of lymphocytes and microglial cells proliferation were present in the thalamus and midbrain. Proliferation of Bergmann glia was also observed. In the liver, hepatocytes were swollen because of accumulation of small vacuoles and foamy Kupffer cells were also detected. Foamy macrophages were observed within the pulmonary interstitium and alveoli as well. At 9 months cat 1 was unable to walk, developed seizures and it was euthanized at 21 months. Filipin staining of cultured fibroblasts showed massive storage of unesterified cholesterol. Molecular analysis of NPC1 and NPC2 genes showed the presence of a homozygous intronic mutation (c.82+5G>A) in the NPC2 gene. The subsequent analysis of the mRNA showed that the mutation causes the retention of 105 bp in the mature mRNA, which leads to the in frame insertion of 35 amino acids between residues 28 and 29 of NPC2 protein (p.G28_S29ins35). PMID:25396745

  18. Transcriptome and proteome analysis of tyrosine kinase inhibitor treated canine mast cell tumour cells identifies potentially kit signaling-dependent genes

    PubMed Central

    2012-01-01

    Background Canine mast cell tumour proliferation depends to a large extent on the activity of KIT, a tyrosine kinase receptor. Inhibitors of the KIT tyrosine kinase have recently been introduced and successfully applied as a therapeutic agent for this tumour type. However, little is known on the downstream target genes of this signaling pathway and molecular changes after inhibition. Results Transcriptome analysis of the canine mast cell tumour cell line C2 treated for up to 72 hours with the tyrosine kinase inhibitor masitinib identified significant changes in the expression levels of approximately 3500 genes or 16% of the canine genome. Approximately 40% of these genes had increased mRNA expression levels including genes associated with the pro-proliferative pathways of B- and T-cell receptors, chemokine receptors, steroid hormone receptors and EPO-, RAS and MAP kinase signaling. Proteome analysis of C2 cells treated for 72 hours identified 24 proteins with changed expression levels, most of which being involved in gene transcription, e.g. EIA3, EIA4, TARDBP, protein folding, e.g. HSP90, UCHL3, PDIA3 and protection from oxidative stress, GSTT3, SELENBP1. Conclusions Transcriptome and proteome analysis of neoplastic canine mast cells treated with masitinib confirmed the strong important and complex role of KIT in these cells. Approximately 16% of the total canine genome and thus the majority of the active genes were significantly transcriptionally regulated. Most of these changes were associated with reduced proliferation and metabolism of treated cells. Interestingly, several pro-proliferative pathways were up-regulated, which may represent attempts of masitinib treated cells to activate alternative pro-proliferative pathways. These pathways may contain hypothetical targets for a combination therapy with masitinib to further improve its therapeutic effect. PMID:22747577

  19. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease.

    PubMed

    Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

    2017-11-01

    Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

  20. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease

    PubMed Central

    Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

    2017-01-01

    Purpose: Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND. PMID:29133643

  1. Mutational analysis of GALT gene in Greek patients with galactosaemia: identification of two novel mutations and clinical evaluation.

    PubMed

    Schulpis, Kleopatra H; Thodi, Georgia; Iakovou, Konstantinos; Chatzidaki, Maria; Dotsikas, Yannis; Molou, Elina; Triantafylli, Olga; Loukas, Yannis L

    2017-10-01

    Classical galactosaemia is an inborn error of metabolism due to the deficiency of the enzyme galactose-1-phosphate uridylyltransferase (GALT). The aim of the study was to identify the underlying mutations in Greek patients with GALT deficiency and evaluate their psychomotor and speech development. Patients with GALT deficiency (n = 17) were picked up through neonatal screening. Mutational analysis was conducted via Sanger sequencing, while in silico analysis was used in the cases of novel missense mutations. Psychomotor speech development tests were utilized for the clinical evaluation of the patients. Eleven different mutations in the GALT gene were detected in the patient cohort, including two novel ones. The most frequent mutation was p.Q188R (c.563 A > G). As for the novel mutations, p.M298I (c.894 G > A) was identified in four out of 32 independent alleles, while p.P115S (c.343 C > T) was identified once. Psychomotor evaluation revealed that most of the patients were found in the borderline area (Peabody test), while only two had speech delay problems. The WISK test revealed three patients at borderline limits and two were at lower than normal limits. The mutational spectrum of the GALT gene in Greek patients is presented for the first time. The mutation p.Q188R is the most frequent among Greek patients. Two novel mutations were identified and their potential pathogenicity was estimated. Regarding the phenotypic characteristics, psychomotor disturbances and speech delay were mainly observed among GALT-deficient patients.

  2. Adult cardiac stem cells are multipotent and robustly myogenic: c-kit expression is necessary but not sufficient for their identification.

    PubMed

    Vicinanza, Carla; Aquila, Iolanda; Scalise, Mariangela; Cristiano, Francesca; Marino, Fabiola; Cianflone, Eleonora; Mancuso, Teresa; Marotta, Pina; Sacco, Walter; Lewis, Fiona C; Couch, Liam; Shone, Victoria; Gritti, Giulia; Torella, Annalaura; Smith, Andrew J; Terracciano, Cesare Mn; Britti, Domenico; Veltri, Pierangelo; Indolfi, Ciro; Nadal-Ginard, Bernardo; Ellison-Hughes, Georgina M; Torella, Daniele

    2017-12-01

    Multipotent adult resident cardiac stem cells (CSCs) were first identified by the expression of c-kit, the stem cell factor receptor. However, in the adult myocardium c-kit alone cannot distinguish CSCs from other c-kit-expressing (c-kit pos ) cells. The adult heart indeed contains a heterogeneous mixture of c-kit pos cells, mainly composed of mast and endothelial/progenitor cells. This heterogeneity of cardiac c-kit pos cells has generated confusion and controversy about the existence and role of CSCs in the adult heart. Here, to unravel CSC identity within the heterogeneous c-kit-expressing cardiac cell population, c-kit pos cardiac cells were separated through CD45-positive or -negative sorting followed by c-kit pos sorting. The blood/endothelial lineage-committed (Lineage pos ) CD45 pos c-kit pos cardiac cells were compared to CD45 neg (Lineage neg /Lin neg ) c-kit pos cardiac cells for stemness and myogenic properties in vitro and in vivo. The majority (~90%) of the resident c-kit pos cardiac cells are blood/endothelial lineage-committed CD45 pos CD31 pos c-kit pos cells. In contrast, the Lin neg CD45 neg c-kit pos cardiac cell cohort, which represents ⩽10% of the total c-kit pos cells, contain all the cardiac cells with the properties of adult multipotent CSCs. These characteristics are absent from the c-kit neg and the blood/endothelial lineage-committed c-kit pos cardiac cells. Single Lin neg c-kit pos cell-derived clones, which represent only 1-2% of total c-kit pos myocardial cells, when stimulated with TGF-β/Wnt molecules, acquire full transcriptome and protein expression, sarcomere organisation, spontaneous contraction and electrophysiological properties of differentiated cardiomyocytes (CMs). Genetically tagged cloned progeny of one Lin neg c-kit pos cell when injected into the infarcted myocardium, results in significant regeneration of new CMs, arterioles and capillaries, derived from the injected cells. The CSC's myogenic regenerative capacity is

  3. [Analysis of a family affected with familial male-limited precocious puberty due to a Ala568Val mutation in LHCGR gene].

    PubMed

    Chen, Rui-min; Zhang, Ying; Yang, Xiao-hong; Lin, Xiang-quan

    2012-12-01

    Familial male-limited precocious puberty (FMPP) is due to constitutive activation of a mutant luteinizing hormone/choriogonadotropin receptor (LH/CGR) leading to elevated testosterone synthesis in testicular Leydig cells. In the present study, we have analyzed the LHCGR gene for members of a Chinese FMPP family. Physical examinations have included assessment of penile length, testicular volume and pubic hair. Bone age assessment, levels of testosterone and gonadotropin-releasing hormone (GnRH) stimulations tests were measured. DNA was extracted from blood samples of the proband and his parents using an QIAGEN Blood DNA Mini Kit. The 11 exons of LHCGR gene were amplified using an AmpliTaq PCR system, and the PCR products were sequenced using an ABI3130xl Genetic Analyzer. The affected boy was 3 year and 1 month old and showed typical clinical manifestation of peripheral precocious puberty. His height was 116.8cm (+5.1s) and Tanner stages were PH 2. Testicular volume was 8 mL bilaterally, penile was 8.5 cm × 2.5 cm. Basal testosterone was 2310 ng/L and bone age was 9 years. GnRH stimulation test revealed a prepubertal response to gonadotropin. The peak of LH was 2.66 IU/L, and the peak of FSH was 1.03 IU/L. Upon sequencing exon 11 of the LHCGR, a heterozygous point mutation of nucleotide 1703 from C to T was detected, which resulted in an amino acid transition from Ala (GCC) to Val (GTC) at position 568. Thus the mutation of LHCGR gene was confirmed to be constitutively active. After treating with aromatase inhibitors for half a year, the patient showed an increase in bone age and height by half a year and 4 cm, respectively. The same point mutation was detected in the patient's father, but did not have any influence on his puberty development. A novel point mutation of the LHCGR gene has been identified in a family affected with FMPP. The c.1703C>T mutant LHCGR was confirmed to be constitutively active, which has led to maturation and proliferation of Leydig cells

  4. Leigh syndrome associated with a novel mutation in the COX15 gene.

    PubMed

    Miryounesi, Mohammad; Fardaei, Majid; Tabei, Seyed Mohammadbagher; Ghafouri-Fard, Soudeh

    2016-06-01

    Leigh syndrome (LS) is a subacute necrotizing encephalomyelopathy with a diverse range of symptoms, such as psychomotor delay or regression, weakness, hypotonia, truncal ataxia, intention tremor as well as lactic acidosis in the blood, cerebrospinal fluid or urine. Both nuclear gene defects and mutations of the mitochondrial genome have been detected in these patients. Here we report a 7-year-old girl with hypotonia, tremor, developmental delay and psychomotor regression. However, serum lactate level as well as brain magnetic resonance imaging were normal. Mutational analysis has revealed a novel mutation in exon 4 of COX15 gene (c.415C>G) which results in p.Leu139Val. Previous studies have demonstrated that COX15 mutations are associated with typical LS as well as fatal infantile hypertrophic cardiomyopathy. Consequently, clinical manifestations of COX15 mutations may be significantly different in patients. Such information is of practical importance in genetic counseling.

  5. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene.

    PubMed

    Win, Aung Ko; Reece, Jeanette C; Buchanan, Daniel D; Clendenning, Mark; Young, Joanne P; Cleary, Sean P; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G; MacInnis, Robert J; Tucker, Katherine M; Winship, Ingrid M; Macrae, Finlay A; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W; Newcomb, Polly A; Thibodeau, Stephen N; Lindor, Noralane M; Hopper, John L; Gallinger, Steven; Jenkins, Mark A

    2015-12-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understandin g the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95% confidence interval (CI) 9.19-50.1; p < 0.001], but not different from that for carriers of a MMR gene mutation alone (HR 1.94, 95% CI 0.63-5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative.

  6. Four novel RS1 gene mutations in Polish patients with X-linked juvenile retinoschisis.

    PubMed

    Skorczyk, Anna; Krawczyński, Maciej R

    2012-01-01

    To determine the clinical features and to identify mutations in the retinoschisis gene (RS1) in ten patients with X-linked retinoschisis (XLRS). Ten male patients from nine Polish families were included in this study. Ophthalmologic examinations, including optical coherence tomography (OCT) and full-field electroretinography (ERG), were performed in all affected boys. The entire coding region encompassing six exons of the RS1 gene was amplified with PCR and directly sequenced in all the patients. All affected individuals showed typical retinoschisis signs and symptoms, and all appeared to have a mutation in the RS1 gene. Seven different mutations were identified, including two novel missense substitutions: c.176G>C (p.Cys59Ser), c.451T>A (p.Tyr151Asp); one novel nonsense substitution: c.218C>A (p.Ser73*); and one novel frameshift mutation: c.354_355delCA (p.Asp118Glufs*2). We also found two missense substitutions that had been previously described: c.214G>A (p.Glu72Lys) and c.626G>T (p.Arg209Leu) and one known splice site mutation in intron 5: c.522+1G>T (IVS5+1G>T). This study provides the first molecular genetic characteristics of patients with juvenile retinoschisis from the previously unexplored Polish population. We investigated the molecular background of XLRS in ten boys. The present study reports for the first time four novel mutations, including two missense substitutions, one nonsense substitution, and one frameshift deletion. One of these substitutions and 2-bp deletion created stop codons. Moreover, we described three substitutions that had been previously reported (one is a splicing mutation). Further genetic characterization of Polish patients with XLRS will be helpful in understanding the worldwide spectrum of RS1 mutations. Despite the mutation heterogeneity found in a small group of our patients, they presented a relatively uniform clinical picture. Identifying the causative mutation is helpful in confirming diagnosis and counseling, but cannot

  7. Four novel RS1 gene mutations in Polish patients with X-linked juvenile retinoschisis

    PubMed Central

    Skorczyk, Anna

    2012-01-01

    Purpose To determine the clinical features and to identify mutations in the retinoschisis gene (RS1) in ten patients with X-linked retinoschisis (XLRS). Methods Ten male patients from nine Polish families were included in this study. Ophthalmologic examinations, including optical coherence tomography (OCT) and full-field electroretinography (ERG), were performed in all affected boys. The entire coding region encompassing six exons of the RS1 gene was amplified with PCR and directly sequenced in all the patients. Results All affected individuals showed typical retinoschisis signs and symptoms, and all appeared to have a mutation in the RS1 gene. Seven different mutations were identified, including two novel missense substitutions: c.176G>C (p.Cys59Ser), c.451T>A (p.Tyr151Asp); one novel nonsense substitution: c.218C>A (p.Ser73*); and one novel frameshift mutation: c.354_355delCA (p.Asp118Glufs*2). We also found two missense substitutions that had been previously described: c.214G>A (p.Glu72Lys) and c.626G>T (p.Arg209Leu) and one known splice site mutation in intron 5: c.522+1G>T (IVS5+1G>T). Conclusions This study provides the first molecular genetic characteristics of patients with juvenile retinoschisis from the previously unexplored Polish population. We investigated the molecular background of XLRS in ten boys. The present study reports for the first time four novel mutations, including two missense substitutions, one nonsense substitution, and one frameshift deletion. One of these substitutions and 2-bp deletion created stop codons. Moreover, we described three substitutions that had been previously reported (one is a splicing mutation). Further genetic characterization of Polish patients with XLRS will be helpful in understanding the worldwide spectrum of RS1 mutations. Despite the mutation heterogeneity found in a small group of our patients, they presented a relatively uniform clinical picture. Identifying the causative mutation is helpful in confirming

  8. Protein kinase C-δ-mediated recycling of active KIT in colon cancer.

    PubMed

    Park, Misun; Kim, Won Kyu; Song, Meiying; Park, Minhee; Kim, Hyunki; Nam, Hye Jin; Baek, Sung Hee; Kim, Hoguen

    2013-09-15

    Abnormal signaling through receptor tyrosine kinase (RTK) moieties is important in tumorigenesis and drug targeting of colorectal cancers. Wild-type KIT (WT-KIT), a RTK that is activated upon binding with stem cell factor (SCF), is highly expressed in some colon cancers; however, little is known about the functional role of SCF-dependent KIT activation in colon cancer pathogenesis. We aimed to elucidate the conditions and roles of WT-KIT activation in colon cancer tumorigenesis. Colorectal cancers with KIT expression were characterized by immunoblotting and immunohistochemistry. The biologic alterations after KIT-SCF binding were analyzed with or without protein kinase C (PKC) activation. We found that WT-KIT was expressed in a subset of colon cancer cell lines and was activated by SCF, leading to activation of downstream AKT and extracellular signal-regulated kinase (ERK) signaling pathways. We also showed that KIT expression gradually decreased, after prolonged SCF stimulation, due to lysosomal degradation. Degradation of WT-KIT after SCF binding was significantly rescued when PKC was activated. We also showed the involvement of activated PKC-δ in the recycling of WT-KIT. We further showed that a subset of colorectal cancers exhibit expressions of both WT-KIT and activated PKC-δ and that expression of KIT is correlated with poor patient survival (P = 0.004). Continuous downstream signal activation after KIT-SCF binding is accomplished through PKC-δ-mediated recycling of KIT. This sustained KIT activation may contribute to tumor progression in a subset of colon cancers with KIT expression and might provide the rationale for a therapeutic approach targeting KIT. ©2013 AACR.

  9. Study on the association between drug‑resistance and gene mutations of the active efflux pump acrAB‑tolC gene and its regulatory genes.

    PubMed

    Ma, Quan-Ping; Su, Liang; Liu, Jing-Wen; Yao, Ming-Xiao; Yuan, Guang-Ying

    2018-06-01

    The aim of the present study was to investigate the correlation between the multi‑drug resistance of Shigella flexneri and the drug‑resistant gene cassette carried by integrons; in the meanwhile, to detect the associations between drug‑resistance and gene mutations of the active efflux pump acrAB‑tolC gene and its regulatory genes, including marOR, acrR and soxS. A total of 158 isolates were isolated from the stool samples of 1,026 children with diarrhoea aged 14 years old between May 2012 and October 2015 in Henan. The K‑B method was applied for the determination of drug resistance of Shigella flexneri, and polymerase chain reaction amplification was used for class 1, 2 and 3 integrase genes. Enzyme digestion and sequence analysis were performed for the variable regions of positive strains. Based on the drug sensitivity assessment, multi‑drug resistant strains that were resistant to five or more antibiotics, and sensitive strains were selected for amplification. Their active efflux pump genes, acrA and acrB, and regulatory genes, marOR, acrR and soxS, were selected for sequencing. The results revealed that 91.1% of the 158 strains were multi‑resistant to ampicillin, chloramphenicol, tetracycline and streptomycin, and 69.6% of the strains were multi‑resistant to sulfamethoxazole/trimethoprim. The resistance to ceftazidime, ciprofloxacin and levofloxacin was <32.9%. All strains (100%) were sensitive to cefoxitin, cefoperazone/sulbactam and imipenem. The rate of the class 1 integron positivity was 91.9% (144/158). Among these class 1 integron‑positive strains, 18 strains exhibited the resistance gene cassette dfrV in the variable region of the strain, four strains exhibited dfrA17‑aadA5 in the variable region and 140 strains exhibited blaOXA‑30‑aadA1 in the variable region. Four strains showed no resistance gene in the variable regions. The rate of class 2 integron positivity was 86.1% (136/158), and all positive strains harboured the

  10. An Indian child with Kindler syndrome resulting from a new homozygous nonsense mutation (C468X) in the KIND1 gene.

    PubMed

    Sethuraman, G; Fassihi, H; Ashton, G H S; Bansal, A; Kabra, M; Sharma, V K; McGrath, J A

    2005-05-01

    Kindler syndrome is an inherited skin condition that presents with blistering followed by photosensitivity and a progressive poikiloderma. The disorder results from mutations in the KIND1 gene, encoding the protein kindlin-1, a recently characterized 677-amino acid protein involved in anchorage of the actin cytoskeleton to the extracellular matrix. We report the clinical features of an 11-year-old boy with Kindler syndrome from a consanguineous Indian family and the identification of a homozygous nonsense mutation (C468X) in exon 12 of the KIND1 gene in his genomic DNA. This mutation has not been described previously but is similar to the 17 previously published KIND1 mutations that are all predicted to lead to loss of kindlin-1 protein expression and function. The clinical features in this boy highlight the relevance of kindlin-1 in skin biology, specifically to epidermal adhesion and response to acute and chronic sun exposure. Delineation of this new pathogenic mutation in KIND1 is also useful for genetic counselling in this family and in assessing carrier status in unaffected family members.

  11. Novel compound heterozygous mutations in MYO7A gene associated with autosomal recessive sensorineural hearing loss in a Chinese family.

    PubMed

    Ma, Yalin; Xiao, Yun; Zhang, Fengguo; Han, Yuechen; Li, Jianfeng; Xu, Lei; Bai, Xiaohui; Wang, Haibo

    2016-04-01

    Mutations in MYO7A gene have been reported to be associated with Usher Syndrome type 1B (USH1B) and nonsyndromic hearing loss (DFNB2, DFNA11). Most mutations in MYO7A gene caused USH1B, whereas only a few reported mutations led to DFNB2 and DFNA11. The current study was designed to investigate the mutations among a Chinese family with autosomal recessive hearing loss. In this study, we present the clinical, genetic and molecular characteristics of a Chinese family. Targeted capture of 127 known deafness genes and next-generation sequencing were employed to study the genetic causes of two siblings in the Chinese family. Sanger sequencing was employed to examine those variant mutations in the members of this family and other ethnicity-matched controls. We identified the novel compound heterozygous mutant alleles of MYO7A gene: a novel missense mutation c.3671C>A (p.A1224D) and a reported insert mutation c.390_391insC (p.P131PfsX9). Variants were further confirmed by Sanger sequencing. These two compound heterozygous variants were co-segregated with autosomal recessive hearing loss phenotype. The gene mutation analysis and protein sequence alignment further supported that the novel compound heterozygous mutations were pathogenic. The novel compound heterozygous mutations (c.3671C>A and c.390_391insC) in MYO7A gene identified in this study were responsible for the autosomal recessive sensorineural hearing loss of this Chinese family. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  12. A double mutation in AGXT gene in families with primary hyperoxaluria type 1.

    PubMed

    Kanoun, Houda; Jarraya, Faiçal; Hadj Salem, Ikhlass; Mahfoudh, Hichem; Chaabouni, Yosr; Makni, Fatma; Hachicha, Jamil; Fakhfakh, Faiza

    2013-12-01

    Primary hyperoxaluria type 1 (PH1) is a severe autosomal recessive inherited disorder of glyoxylate metabolism caused by mutations in the AGXT gene on chromosome 2q37.3 that encodes the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase. These mutations are found throughout the entire gene and cause a wide spectrum of clinical severity. Rare in Europe, PH1 is responsible for 13% of the end stage renal failure in the Tunisian child. In the present work, we identified the double mutation c.32C>T (Pro11Leu) and c.731T>C (p.Ile244Thr) in AGXT gene in five unrelated Tunisian families with PH1 disease. Our results provide evidence regarding the potential involvement of c.32C>T, originally described as common polymorphism, on the resulting phenotype. We also reported an extreme intrafamilial heterogeneity in clinical presentation of PH1. Despite the same genetic background, the outcome of the affected members differs widely. The significant phenotypic heterogeneity observed within a same family, with a same genotype, suggests the existence of relevant modifier factors. © 2013.

  13. Mutational screening in patients with profound sensorineural hearing loss and neurodevelopmental delay: Description of a novel m.3861A > C mitochondrial mutation in the MT-ND1 gene.

    PubMed

    Ammar, Marwa; Tabebi, Mouna; Sfaihi, Lamia; Alila-Fersi, Olfa; Maalej, Marwa; Felhi, Rahma; Chabchoub, Imen; Keskes, Leila; Hachicha, Mongia; Fakhfakh, Faiza; Mkaouar-Rebai, Emna

    2016-06-10

    Mitochondrial diseases caused by mitochondrial dysfunction are a clinically and genetically, heterogeneous group of disorders involving multiple organs, particularly tissues with high-energy demand. Hearing loss is a recognized symptom of a number of mitochondrial diseases and can result from neuronal or cochlear dysfunction. The tissue affected in this pathology is most probably the cochlear hair cells, which are essential for hearing function since they are responsible for maintaining the ionic gradients necessary for sound signal transduction. Several mitochondrial DNA mutations have been associated with hearing loss and since mitochondria are crucial for the cellular energy supply in many tissues, most of these mtDNA mutations affect several tissues and will cause syndromic hearing loss. In the present study, we described 2 patients with sensorineural hearing loss and neurodevelopmental delay in whom we tested mitochondrial genes described to be associated with syndromic hearing loss. One of these patients showed a novel heteroplasmic mitochondrial mutation m.3861A > C (W185C) which lead to a loss of stability of the ND1 protein since it created a new hydrogen bund between the unique created cystein C185 and the A182 residue. In the second patient, we detected two novel heteroplasmic variations m.12350C > A (T5N) and m.14351T > C (E108G) respectively in the MT-ND5 and the MT-ND6 genes. The TopPred II prediction for the E108G variation revealed a decrease of the hydrophobicity in the mutated MT-ND6. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations.

    PubMed

    Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

    2018-04-14

    To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .

  15. Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations

    PubMed Central

    Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

    2018-01-01

    AIM To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori (H. pylori) and determine their association with therapeutic failure. METHODS PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar’s test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. RESULTS 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori (κ = 0.71). CONCLUSION The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori. PMID:29662291

  16. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene.

    PubMed

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B P

    2016-01-12

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients.

  17. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kang, Qing-lin; Xu, Jia; Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People's Hospital, Shanghai 200233

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related genemore » with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.« less

  18. Mitochondrial G8292A and C8794T mutations in patients with Niemann-Pick disease type C.

    PubMed

    Masserrat, Abbas; Sharifpanah, Fatemeh; Akbari, Leila; Tonekaboni, Seyed Hasan; Karimzadeh, Parvaneh; Asharafi, Mahmood Reza; Mazouei, Safoura; Sauer, Heinrich; Houshmand, Massoud

    2018-07-01

    Niemann-Pick disease type C (NP-C) is a neurovisceral lipid storage disorder. At the cellular level, the disorder is characterized by accumulation of unesterified cholesterol and glycolipids in the lysosomal/late endosomal system. NP-C is transmitted in an autosomal recessive manner and is caused by mutations in either the NPC1 (95% of families) or NPC2 gene. The estimated disease incidence is 1 in 120,000 live births, but this likely represents an underestimate, as the disease may be under-diagnosed due to its highly heterogeneous presentation. Variants of adenosine triphosphatase (ATPase) subunit 6 and ATPase subunit 8 ( ATPase6/8 ) in mitochondrial DNA (mtDNA) have been reported in different types of genetic diseases including NP-C. In the present study, the blood samples of 22 Iranian patients with NP-C and 150 healthy subjects as a control group were analyzed. The DNA of the blood samples was extracted by the salting out method and analyzed for ATPase6/8 mutations using polymerase chain reaction sequencing. Sequence variations in mitochondrial genome samples were determined via the Mitomap database. Analysis of sequencing data confirmed the existence of 11 different single nucleotide polymorphisms (SNPs) in patients with NP-C1. One of the most prevalent polymorphisms was the A8860G variant, which was observed in both affected and non-affected groups and determined to have no significant association with NP-C incidence. Amongst the 11 polymorphisms, only one was identified in the ATPase8 gene, while 9 including A8860G were observed in the ATPase6 gene. Furthermore, two SNPs, G8292A and C8792A, located in the non-coding region of mtDNA and the ATPase6 gene, respectively, exhibited significantly higher prevalence rates in NP-C1 patients compared with the control group (P<0.01). The present study suggests that there may be an association between mitochondrial ATPase6/8 mutations and the incidence of NP-C disease. In addition, the mitochondrial SNPs identified

  19. Characterization of an FTLD-PDB family with the coexistence of SQSTM1 mutation and hexanucleotide (G₄C₂) repeat expansion in C9orf72 gene.

    PubMed

    Almeida, Maria Rosário; Letra, Liliana; Pires, Paula; Santos, Ana; Rebelo, Olinda; Guerreiro, Rita; van der Zee, Julie; Van Broeckhoven, Christine; Santana, Isabel

    2016-04-01

    The C9orf72 expansion is considered a major genetic cause of familial frontotemporal dementia (FTD) in several patients' cohorts. Interestingly, C9orf72 expansion carriers, present also abundant neuronal p62-positive inclusions. Although p62/SQSTM1 mutations were initially associated with Paget disease of bone (PDB), they have been also identified in FTD. We describe an FTD-PDB family in which the proband presented with behavioral FTD phenotype and concomitant Paget disease. The molecular genetic analysis revealed the co-occurrence of 2 mutations; the pathogenic C9orf72 expansion and p.P392L heterozygous missense mutation in SQSTM1 gene. Amongst the 6 family members analyzed, the p.P392L SQSTM1 mutation segregated as expected with PDB, whereas the C9orf72 expansion segregated with frontal cognitive impairment or dementia in all but one carrier. The coexistence of these conditions could be underestimated since neither patients with FTD nor patients with PDB undergo bone scintigraphy or cognitive assessment, respectively. The number of cases with double mutations could also be over looked as the molecular strategy adopted in most laboratories ends with the identification of one pathogenic mutation in one of the known causative genes. Therefore, we advocate for further clinical and molecular evaluation in suspect cases. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Novel mutations in the homogentisate 1,2 dioxygenase gene identified in Jordanian patients with alkaptonuria.

    PubMed

    Al-sbou, Mohammed

    2012-06-01

    This study was conducted to identify mutations in the homogentisate 1,2 dioxygenase gene (HGD) in alkaptonuria patients among Jordanian population. Blood samples were collected from four alkaptonuria patients, four carriers, and two healthy volunteers. DNA was isolated from peripheral blood. All 14 exons of the HGD gene were amplified using the polymerase chain reaction (PCR) technique. The PCR products were then purified and analyzed by sequencing. Five mutations were identified in our samples. Four of them were novel C1273A, T1046G, 551-552insG, T533G and had not been previously reported, and one mutation T847C has been described before. The types of mutations identified were two missense mutations, one splice site mutation, one frameshift mutation, and one polymorphism. We present the first molecular study of the HGD gene in Jordanian alkaptonuria patients. This study provides valuable information about the molecular basis of alkaptonuria in Jordanian population.

  1. Incidence of nonamyloidogenic mutations in the transthyretin gene in patients with autonomic and small fiber neuropathy.

    PubMed

    Levine, Todd D; Bland, Ruth J

    2018-01-01

    Mutations of the transthyretin (TTR) gene have been associated with polyneuropathy; the protein product has a tendency to form amyloid deposits in the peripheral nervous system. Patients with small fiber neuropathy (SFN) with or without autonomic symptoms were given skin biopsies to assess nerve fiber density. Any patient with autonomic symptoms was assessed for autonomic neuropathy (AN). If testing revealed no clear cause of neuropathy, the TTR gene was sequenced. Thirty-six percent of patients were found to harbor at least 1 mutation in the TTR gene sequence (variants of unknown significance [VUS]). Of 24 patients diagnosed with SFN, 8% of patients had a point mutation (c76G>A). Of those patients who were diagnosed with both SFN and AN, 68% of patients had a VUS within the TTR gene (c76G>A, c337-18G>C). The results suggest an association between presumed nonamyloidogenic mutations in the TTR gene and the development of AN and SFN. Muscle Nerve 57: 140-142, 2017. © 2017 Wiley Periodicals, Inc.

  2. Diagnosis of Xeroderma Pigmentosum Groups A and C by Detection of Two Prevalent Mutations in West Algerian Population: A Rapid Genotyping Tool for the Frequent XPC Mutation c.1643_1644delTG.

    PubMed

    Bensenouci, Salima; Louhibi, Lotfi; De Verneuil, Hubert; Mahmoudi, Khadidja; Saidi-Mehtar, Nadhira

    2016-01-01

    Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder. Considering that XP patients have a defect of the nucleotide excision repair (NER) pathway which enables them to repair DNA damage caused by UV light, they have an increased risk of developing skin and eyes cancers. In the present study, we investigated the involvement of the prevalent XPA and XPC genes mutations-nonsense mutation (c.682C>T, p.Arg228X) and a two-base-pair (2 bp) deletion (c.1643_1644delTG or p.Val548Ala fsX25), respectively-in 19 index cases from 19 unrelated families in the West of Algeria. For the genetic diagnosis of XPA gene, we proceeded to PCR-RFLP. For the XPC gene, we validated a routine analysis which includes a specific amplification of a short region surrounding the 2 bp deletion using a fluorescent primer and fragment sizing (GeneScan size) on a sequencing gel. Among the 19 index cases, there were 17 homozygous patients for the 2 bp deletion in the XPC gene and 2 homozygous patients carrying the nonsense XPA mutation. Finally, XPC appears to be the major disease-causing gene concerning xeroderma pigmentosum in North Africa. The use of fragment sizing is the simplest method to analyze this 2 bp deletion for the DNA samples coming from countries where the mutation c.1643_1644delTG of XPC gene is prevalent.

  3. Frameshift mutational target gene analysis identifies similarities and differences in constitutional mismatch repair-deficiency and Lynch syndrome.

    PubMed

    Maletzki, Claudia; Huehns, Maja; Bauer, Ingrid; Ripperger, Tim; Mork, Maureen M; Vilar, Eduardo; Klöcking, Sabine; Zettl, Heike; Prall, Friedrich; Linnebacher, Michael

    2017-07-01

    Mismatch-repair deficient (MMR-D) malignancies include Lynch Syndrome (LS), which is secondary to germline mutations in one of the MMR genes, and the rare childhood-form of constitutional mismatch repair-deficiency (CMMR-D); caused by bi-allelic MMR gene mutations. A hallmark of LS-associated cancers is microsatellite instability (MSI), characterized by coding frameshift mutations (cFSM) in target genes. By contrast, tumors arising in CMMR-D patients are thought to display a somatic mutation pattern differing from LS. This study has the main goal to identify cFSM in MSI target genes relevant in CMMR-D and to compare the spectrum of common somatic mutations, including alterations in DNA polymerases POLE and D1 between LS and CMMR-D. CMMR-D-associated tumors harbored more somatic mutations compared to LS cases, especially in the TP53 gene and in POLE and POLD1, where novel mutations were additionally identified. Strikingly, MSI in classical mononucleotide markers BAT40 and CAT25 was frequent in CMMR-D cases. MSI-target gene analysis revealed mutations in CMMR-D-associated tumors, some of them known to be frequently hit in LS, such as RNaseT2, HT001, and TGFβR2. Our results imply a general role for these cFSM as potential new drivers of MMR-D tumorigenesis. © 2017 Wiley Periodicals, Inc.

  4. Chronic Granulomatous Disease Due to Neutrophil Cytosolic Factor (NCF2) Gene Mutations in Three Unrelated Families.

    PubMed

    Vignesh, Pandiarajan; Rawat, Amit; Kumar, Ankur; Suri, Deepti; Gupta, Anju; Lau, Yu L; Chan, Koon W; Singh, Surjit

    2017-02-01

    Chronic granulomatous disease (CGD) is an inheritable and genetically heterogeneous disease resulting from mutations in different subcomponents of the NADPH oxidase system. Mutations in the NCF2 gene account for <5% of all cases of CGD. We analyzed the clinical and laboratory findings of CGD with mutations in the NCF2 gene from amongst our cohort of CGD patients. A homozygous mutation (c.835_836delAC, p.T279fsX294), a deletion in NCF2 gene was found in two cases. In the third case, two heterozygous mutations were detected, IVS13-2A>T on one allele and c.1099C>T (p.) on the other allele. The mother of this child was a carrier for the IVS13-2A>T mutation. All three cases had colitis, and it was the initial symptom in two patients. One of the patients also developed a lung abscess due to Nocardia cyriacigeorgica.

  5. Detection of novel polymorphisms in the ckit gene of canine patients with lymphoma, melanoma, haemangiosarcoma, and osteosarcoma.

    PubMed

    Gramer, Irina; Kessler, Martin; Geyer, Joachim

    2016-06-01

    Tyrosine kinase inhibitors (TKIs) that specifically target cKIT represent a therapeutic approach for non-resectable canine mast cell tumours (MCTs) grade II/III. The therapeutic benefit of TKIs has been investigated in other tumours based on clinical response rates and identification of gain-of-function mutations. In the present study, cKIT expression in 14 dogs with osteosarcoma, melanoma, haemangiosarcoma, lymphoma, and fibrosarcoma was analysed. Tissue samples were used for cKIT sequencing to (I) detect the cKIT transcript and to (II) identify gain-of-function mutations. The cKIT transcript was detected in ten patients. Four novel amino acid substitutions and five silent polymorphisms were identified. Furthermore, an insertion mutation (GNSK) was discovered in the tissue, but not in the blood sample of one dog. CKIT expression was identified in a variety of canine tumours and, therefore, TKIs might have a broader therapeutic indication apart from treatment of MCTs. Further investigations will be necessary to localize the cKIT protein in the respective tumours and to evaluate the functional consequence of the cKIT variants identified in the present study.

  6. The c.301_302delAG PROP1 gene mutation in Romanian patients with multiple pituitary hormone deficiency.

    PubMed

    Lazea, Cecilia; Grigorescu-Sido, Paula; Popp, Radu; Legendre, Marie; Amselem, Serge; Al-Khzouz, Camelia; Bucerzan, Simona; Creţ, Victoria; Crişan, Mirela; Brad, Cristian

    2015-09-01

    To establish the frequency of the c.301_302 delAG mutation of the PROP1 gene in Romanian patients with multiple pituitary hormone deficiency (MPHD). Somatic assessment, hormonal test, bone age, magnetic resonance imaging of the pituitary gland, and molecular diagnosis were performed in 26 patients with MPHD (7 patients with familial form of MPHD and 19 patients with sporadic form of MPHD). The c.301_302delAG mutation was detected in the homozygous state in 10 patients belonging to 5 unrelated families (7 patients with familial history of MPHD and 3 patients with sporadic form of MPHD). Those 10 patients presented variable pituitary hormone deficiency and pituitary morphology. The c.301_302delAG homozygous genotype had a high frequency of 38% (10/26), reaching 100% (7/7) in group with familial cases of MPHD and 16% (3/19) in group with sporadic forms of MPHD.

  7. Novel XLRS1 gene mutations cause X-linked juvenile retinoschisis in Chinese families.

    PubMed

    Ma, Xiang; Li, Xiaoxin; Wang, Lihua

    2008-01-01

    To investigate various XLRS1 (RS1) gene mutations in Chinese families with X-linked juvenile retinoschisis (XLRS or RS). Genomic DNA was isolated from leukocytes of 29 male patients with X-linked juvenile retinoschisis, 38 female carriers, and 100 normal controls. All 6 exons of the RS1 gene were amplified by polymerase chain reaction, and the RS1 gene mutations were determined by direct sequencing. Eleven different RS1 mutations in 12 families were identified in the 29 male patients. The mutations comprised eight missense, two frameshift, and one splice donor site mutation. Four of these mutations, one frameshift mutation (26 del T) in exon 1, one frameshift mutation (488 del G) in exon 5, Asp145His and Arg156Gly in exon 5, have not been previously described. One novel non-disease-related polymorphism, 576C to T (Pro192Pro) in exon 6, was also found. Six recurrent mutations, Ser73Pro and Arg102Gln mutations in exon 4 and Arg200Cys, Arg209His, Arg213Gln, and Cys223Arg mutations in exon 6, were also identified in this study. RS1 gene mutations caused X-linked juvenile retinoschisis in these Chinese families.

  8. Hierarchical mutational events compensate for glutamate auxotrophy of a Bacillus subtilis gltC mutant.

    PubMed

    Dormeyer, Miriam; Lübke, Anastasia L; Müller, Peter; Lentes, Sabine; Reuß, Daniel R; Thürmer, Andrea; Stülke, Jörg; Daniel, Rolf; Brantl, Sabine; Commichau, Fabian M

    2017-06-01

    Glutamate is the major donor of nitrogen for anabolic reactions. The Gram-positive soil bacterium Bacillus subtilis either utilizes exogenously provided glutamate or synthesizes it using the gltAB-encoded glutamate synthase (GOGAT). In the absence of glutamate, the transcription factor GltC activates expression of the GOGAT genes for glutamate production. Consequently, a gltC mutant strain is auxotrophic for glutamate. Using a genetic selection and screening system, we could isolate and differentiate between gltC suppressor mutants in one step. All mutants had acquired the ability to synthesize glutamate, independent of GltC. We identified (i) gain-of-function mutations in the gltR gene, encoding the transcription factor GltR, (ii) mutations in the promoter of the gltAB operon and (iii) massive amplification of the genomic locus containing the gltAB operon. The mutants belonging to the first two classes constitutively expressed the gltAB genes and produced sufficient glutamate for growth. By contrast, mutants that belong to the third class appeared most frequently and solved glutamate limitation by increasing the copy number of the poorly expressed gltAB genes. Thus, glutamate auxotrophy of a B. subtilis gltC mutant can be relieved in multiple ways. Moreover, recombination-dependent amplification of the gltAB genes is the predominant mutational event indicating a hierarchy of mutations. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  9. Digenic mutations involving both the BSND and GJB2 genes detected in Bartter syndrome type IV.

    PubMed

    Wang, Hong-Han; Feng, Yong; Li, Hai-Bo; Wu, Hong; Mei, Ling-Yun; Wang, Xing-Wei; Jiang, Lu; He, Chu-Feng

    2017-01-01

    Bartter syndrome type IV, characterized by salt-losing nephropathies and sensorineural deafness, is caused by mutations of BSND or simultaneous mutations of both CLCNKA and CLCNKB. GJB2 is the primary causative gene for non-syndromic sensorineural deafness and associated with several syndromic sensorineural deafness. Owing to the rarity of Bartter syndrome, only a few mutations have been reported in the abovementioned causative genes. To investigate the underlying mutations in a Chinese patient with Bartter syndrome type IV, genetic analysis of BSND, CLCNKA, CLCNKB and GJB2 were performed by polymerase chain reaction and direct sequencing. Finally, double homozygous mutations c.22C > T (p.Arg8Trp) and c.127G > A (Val43Ile) were detected in exon 1 of BSND. Intriguingly, compound heterozygous mutations c.235delC (p.Leu79CysfsX3) and c.109G > A (p.Val37Ile) were also revealed in exon 2 of GJB2 in the same patient. No pathogenic mutations were found in CLCNKA and CLCNKB. Our results indicated that the homozygous mutation c.22C > T was the key genetic reason for the proband, and a digenic effect of BSND and GJB2 might contributed to sensorineural deafness. To our knowledge, it was the first report showing that the GJB2 gene mutations were detected in Bartter syndrome. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  10. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene

    PubMed Central

    Win, Aung Ko; Reece, Jeanette C.; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Cleary, Sean P.; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G.; MacInnis, Robert J.; Tucker, Katherine M.; Winship, Ingrid M.; Macrae, Finlay A.; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W.; Newcomb, Polly A.; Thibodeau, Stephen N.; Lindor, Noralane M.; Hopper, John L.; Gallinger, Steven; Jenkins, Mark A.

    2015-01-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understanding the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95 % confidence interval (CI) 9.19–50.1; p < 0.001], but not different from that for carriers of a MMR gene mutation alone (HR 1.94, 95 % CI 0.63–5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative. PMID:26202870

  11. Hereditary Angioedema Due to C1 Inhibitor Deficiency in Serbia: Two Novel Mutations and Evidence of Genotype-Phenotype Association

    PubMed Central

    Andrejević, Slađana; Korošec, Peter; Šilar, Mira; Košnik, Mitja; Mijanović, Radovan; Bonači-Nikolić, Branka; Rijavec, Matija

    2015-01-01

    Hereditary angioedema due to C1 inhibitor deficiency (C1-INH-HAE) is a rare autosomal dominant disease characterized by recurrent life-threatening oedemas and/or abdominal pain and caused by mutations affecting the C1 inhibitor gene, SERPING1. We sought to investigate the spectrum of SERPING1 mutations in Serbia and the possible genotype-phenotype association. C1-INH-HAE was diagnosed on the basis of clinical and laboratory criteria in 40 patients from 27 families; four were asymptomatic. Mutational analysis of the SERPING1 gene was performed by sequencing and multiplex ligation-dependent probe amplification. Disease-causing mutations in SERPING1 were identified in all patients. In C1-INH-HAE type I, we identified 19 different mutations, including 6 missense mutations, 6 nonsense mutations, 2 small deletions, 1 small insertion, 2 splicing defects and 2 large deletions. Two of the mutations (c.300C>T and c.1184_1185insTA) are reported here for the first time. All C1-INH-HAE type II patients from three families harboured the same substitution (c.1396C>T). Based on the type of mutation identified in the SERPING1 gene, patients were divided into two groups: group 1 (nonsense, frameshift, large deletions/insertions, splicing defect, and mutations at Arg444) or group 2 (missense, excluding mutations at Arg444). Significant differences were found in the clinical severity score (P = 0.005), prevalence of laryngeal (P = 0.040) and facial (P = 0.013) oedema, and long-term prophylaxis (P = 0.023) between the groups with different types of mutations. Because our population consisted of related subjects, differences in the severity score between mutation groups were further confirmed using the generalized estimating equation (P = 0.038). Our study identified 20 different disease-causing mutations, including two novel mutations, in all C1-INH-HAE patients, highlighting the heterogeneity of mutations in the SERPING1 gene. Furthermore, it appears that mutations with a clear effect

  12. Hereditary Angioedema Due to C1 Inhibitor Deficiency in Serbia: Two Novel Mutations and Evidence of Genotype-Phenotype Association.

    PubMed

    Andrejević, Slađana; Korošec, Peter; Šilar, Mira; Košnik, Mitja; Mijanović, Radovan; Bonači-Nikolić, Branka; Rijavec, Matija

    2015-01-01

    Hereditary angioedema due to C1 inhibitor deficiency (C1-INH-HAE) is a rare autosomal dominant disease characterized by recurrent life-threatening oedemas and/or abdominal pain and caused by mutations affecting the C1 inhibitor gene, SERPING1. We sought to investigate the spectrum of SERPING1 mutations in Serbia and the possible genotype-phenotype association. C1-INH-HAE was diagnosed on the basis of clinical and laboratory criteria in 40 patients from 27 families; four were asymptomatic. Mutational analysis of the SERPING1 gene was performed by sequencing and multiplex ligation-dependent probe amplification. Disease-causing mutations in SERPING1 were identified in all patients. In C1-INH-HAE type I, we identified 19 different mutations, including 6 missense mutations, 6 nonsense mutations, 2 small deletions, 1 small insertion, 2 splicing defects and 2 large deletions. Two of the mutations (c.300C>T and c.1184_1185insTA) are reported here for the first time. All C1-INH-HAE type II patients from three families harboured the same substitution (c.1396C>T). Based on the type of mutation identified in the SERPING1 gene, patients were divided into two groups: group 1 (nonsense, frameshift, large deletions/insertions, splicing defect, and mutations at Arg444) or group 2 (missense, excluding mutations at Arg444). Significant differences were found in the clinical severity score (P = 0.005), prevalence of laryngeal (P = 0.040) and facial (P = 0.013) oedema, and long-term prophylaxis (P = 0.023) between the groups with different types of mutations. Because our population consisted of related subjects, differences in the severity score between mutation groups were further confirmed using the generalized estimating equation (P = 0.038). Our study identified 20 different disease-causing mutations, including two novel mutations, in all C1-INH-HAE patients, highlighting the heterogeneity of mutations in the SERPING1 gene. Furthermore, it appears that mutations with a clear effect

  13. Hereditary Angioedema Nationwide Study in Slovenia Reveals Four Novel Mutations in SERPING1 Gene

    PubMed Central

    Rijavec, Matija; Korošec, Peter; Šilar, Mira; Zidarn, Mihaela; Miljković, Jovan; Košnik, Mitja

    2013-01-01

    Hereditary angioedema (HAE) is a rare autosomal dominant disease characterized by swelling of the face, lips, tongue, larynx, genitalia, or extremities, with abdominal pain caused by intra-abdominal edema. HAE is caused by mutations affecting the C1 inhibitor gene, SERPING1, resulting in low levels of C1 inhibitor (Type I HAE) or normal levels of ineffective C1 inhibitor (Type II HAE). A nationwide survey identified nine unrelated families with HAE in Slovenia, among whom 17 individuals from eight families were recruited for genetic analyses. A diagnosis of HAE was established in the presence of clinical and laboratory criteria (low C1 inhibitor antigenic levels and/or function), followed up by a positive family history. Genetic studies were carried out using PCR and sequencing to detect SERPING1 mutations in promoter, noncoding exon 1, the 7 coding exons, and exon-intron boundaries. Multiplex ligation-dependent probe amplification was performed in order to search for large deletions/duplications in SERPING1 gene. A mutation responsible for HAE was identified in patients from seven families with the disease. In HAE type I families, one previously reported substitution (Gln67Stop, c.265C>T) and four novel mutations were identified. The new mutations included two missense substitutions, Ser128Phe (c.449C>T), and Glu429Lys (c.1351G>A), together with two frameshift mutations, indel (c.49delGinsTT) and deletion (c.593_594delCT). Both families with HAE type II harbored the two well-known substitutions affecting the arginyl residue at the reactive center in exon 8, Arg444Cys (c.1396C>T) and Arg444His (c.1397G>A), respectively. In one patient only the homozygous variant g.566T>C (c.-21T>C) was identified. Our study identified four novel mutations in the Slovenian HAE population, highlighting the heterogeneity of mutations in the SERPING1 gene causing C1 inhibitor deficiency and HAE. In a single patient with HAE a homozygous variant g.566T>C (c.-21T>C) might be responsible

  14. Hereditary angioedema nationwide study in Slovenia reveals four novel mutations in SERPING1 gene.

    PubMed

    Rijavec, Matija; Korošec, Peter; Šilar, Mira; Zidarn, Mihaela; Miljković, Jovan; Košnik, Mitja

    2013-01-01

    Hereditary angioedema (HAE) is a rare autosomal dominant disease characterized by swelling of the face, lips, tongue, larynx, genitalia, or extremities, with abdominal pain caused by intra-abdominal edema. HAE is caused by mutations affecting the C1 inhibitor gene, SERPING1, resulting in low levels of C1 inhibitor (Type I HAE) or normal levels of ineffective C1 inhibitor (Type II HAE). A nationwide survey identified nine unrelated families with HAE in Slovenia, among whom 17 individuals from eight families were recruited for genetic analyses. A diagnosis of HAE was established in the presence of clinical and laboratory criteria (low C1 inhibitor antigenic levels and/or function), followed up by a positive family history. Genetic studies were carried out using PCR and sequencing to detect SERPING1 mutations in promoter, noncoding exon 1, the 7 coding exons, and exon-intron boundaries. Multiplex ligation-dependent probe amplification was performed in order to search for large deletions/duplications in SERPING1 gene. A mutation responsible for HAE was identified in patients from seven families with the disease. In HAE type I families, one previously reported substitution (Gln67Stop, c.265C>T) and four novel mutations were identified. The new mutations included two missense substitutions, Ser128Phe (c.449C>T), and Glu429Lys (c.1351G>A), together with two frameshift mutations, indel (c.49delGinsTT) and deletion (c.593_594delCT). Both families with HAE type II harbored the two well-known substitutions affecting the arginyl residue at the reactive center in exon 8, Arg444Cys (c.1396C>T) and Arg444His (c.1397G>A), respectively. In one patient only the homozygous variant g.566T>C (c.-21T>C) was identified. Our study identified four novel mutations in the Slovenian HAE population, highlighting the heterogeneity of mutations in the SERPING1 gene causing C1 inhibitor deficiency and HAE. In a single patient with HAE a homozygous variant g.566T>C (c.-21T>C) might be responsible

  15. MC1R, KIT, IGF2, and NR6A1 as markers for genetic differentiation in Thai native, wild boars, and Duroc and Chinese Meishan pigs.

    PubMed

    Klomtong, P; Chaweewan, K; Phasuk, Y; Duangjinda, M

    2015-10-19

    Mutations in melanocortin 1 receptor (MC1R) gene and v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (KIT) gene have been shown to affect coat color patterns in pigs. Additional functional marker genes, such as insulin like growth factor-2 (IGF2) and orphan nuclear receptor, germ cell nuclear factor (NR6A1), have been described for variations in factors such as fat deposition, litter size, and vertebra number in pigs. In this study, we investigated 129 pigs representing 4 breeds: Thai indigenous, classified into black (similar to Raad or Ka done pig) and black and white (similar to the Hailum and Kwai pig) coat color types; wild boar; Duroc; and Chinese Meishan. Mutations of MC1R, KIT, IGF2, and NR6A1 were detected using polymerase chain reaction-restriction fragment length polymorphism. The genotypes variation in MC1R and KIT genes could be used to differentiate four groups of coat color: solid black, black and white, red, and wild type. For IGF2, the GG genotype was present in wild boar only; for NR6A1 the TT genotype was found only in Duroc pigs. We identified novel 14-bp deletions in KIT that were associated with black and white coat color in Thai indigenous pigs. Insights into variations in genes presented in this study will be useful in future developmental breeding programs for the Thai native pig.

  16. Breast tumors from CHEK2 1100delC-mutation carriers: genomic landscape and clinical implications.

    PubMed

    Muranen, Taru A; Greco, Dario; Fagerholm, Rainer; Kilpivaara, Outi; Kämpjärvi, Kati; Aittomäki, Kristiina; Blomqvist, Carl; Heikkilä, Päivi; Borg, Ake; Nevanlinna, Heli

    2011-09-20

    Checkpoint kinase 2 (CHEK2) is a moderate penetrance breast cancer risk gene, whose truncating mutation 1100delC increases the risk about twofold. We investigated gene copy-number aberrations and gene-expression profiles that are typical for breast tumors of CHEK2 1100delC-mutation carriers. In total, 126 breast tumor tissue specimens including 32 samples from patients carrying CHEK2 1100delC were studied in array-comparative genomic hybridization (aCGH) and gene-expression (GEX) experiments. After dimensionality reduction with CGHregions R package, CHEK2 1100delC-associated regions in the aCGH data were detected by the Wilcoxon rank-sum test. The linear model was fitted to GEX data with R package limma. Genes whose expression levels were associated with CHEK2 1100delC mutation were detected by the bayesian method. We discovered four lost and three gained CHEK2 1100delC-related loci. These include losses of 1p13.3-31.3, 8p21.1-2, 8p23.1-2, and 17p12-13.1 as well as gains of 12q13.11-3, 16p13.3, and 19p13.3. Twenty-eight genes located on these regions showed differential expression between CHEK2 1100delC and other tumors, nominating them as candidates for CHEK2 1100delC-associated tumor-progression drivers. These included CLCA1 on 1p22 as well as CALCOCO1, SBEM, and LRP1 on 12q13. Altogether, 188 genes were differentially expressed between CHEK2 1100delC and other tumors. Of these, 144 had elevated and 44, reduced expression levels.Our results suggest the WNT pathway as a driver of tumorigenesis in breast tumors of CHEK2 1100delC-mutation carriers and a role for the olfactory receptor protein family in cancer progression. Differences in the expression of the 188 CHEK2 1100delC-associated genes divided breast tumor samples from three independent datasets into two groups that differed in their relapse-free survival time. We have shown that copy-number aberrations of certain genomic regions are associated with CHEK2 mutation 1100delC. On these regions, we identified

  17. Breast tumors from CHEK2 1100delC-mutation carriers: genomic landscape and clinical implications

    PubMed Central

    2011-01-01

    Introduction Checkpoint kinase 2 (CHEK2) is a moderate penetrance breast cancer risk gene, whose truncating mutation 1100delC increases the risk about twofold. We investigated gene copy-number aberrations and gene-expression profiles that are typical for breast tumors of CHEK2 1100delC-mutation carriers. Methods In total, 126 breast tumor tissue specimens including 32 samples from patients carrying CHEK2 1100delC were studied in array-comparative genomic hybridization (aCGH) and gene-expression (GEX) experiments. After dimensionality reduction with CGHregions R package, CHEK2 1100delC-associated regions in the aCGH data were detected by the Wilcoxon rank-sum test. The linear model was fitted to GEX data with R package limma. Genes whose expression levels were associated with CHEK2 1100delC mutation were detected by the bayesian method. Results We discovered four lost and three gained CHEK2 1100delC-related loci. These include losses of 1p13.3-31.3, 8p21.1-2, 8p23.1-2, and 17p12-13.1 as well as gains of 12q13.11-3, 16p13.3, and 19p13.3. Twenty-eight genes located on these regions showed differential expression between CHEK2 1100delC and other tumors, nominating them as candidates for CHEK2 1100delC-associated tumor-progression drivers. These included CLCA1 on 1p22 as well as CALCOCO1, SBEM, and LRP1 on 12q13. Altogether, 188 genes were differentially expressed between CHEK2 1100delC and other tumors. Of these, 144 had elevated and 44, reduced expression levels. Our results suggest the WNT pathway as a driver of tumorigenesis in breast tumors of CHEK2 1100delC-mutation carriers and a role for the olfactory receptor protein family in cancer progression. Differences in the expression of the 188 CHEK2 1100delC-associated genes divided breast tumor samples from three independent datasets into two groups that differed in their relapse-free survival time. Conclusions We have shown that copy-number aberrations of certain genomic regions are associated with CHEK2 mutation

  18. CD45{sup low}c-Kit{sup high} cells have hematopoietic properties in the mouse aorta-gonad-mesonephros region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nobuhisa, Ikuo, E-mail: nobuhisa.scr@mri.tmd.ac.jp; Department of Cell Fate Modulation, Institute of Molecular Embryology and Genetics/Graduate School of Pharmaceutical Sciences, Kumamoto University, Kumamoto, 860-0811; Yamasaki, Shoutarou

    Long-term reconstituting hematopoietic stem cells first arise from the aorta of the aorta-gonad-mesonephros (AGM) region in a mouse embryo. We have previously reported that in cultures of the dispersed AGM region, CD45{sup low}c-Kit{sup +} cells possess the ability to reconstitute multilineage hematopoietic cells, but investigations are needed to show that this is not a cultured artifact and to clarify when and how this population is present. Based on the expression profile of CD45 and c-Kit in freshly dissociated AGM cells from embryonic day 9.5 (E9.5) to E12.5 and aorta cells in the AGM from E13.5 to E15.5, we defined sixmore » cell populations (CD45{sup -}c-Kit{sup -}, CD45{sup -}c-Kit{sup low}, CD45{sup -}c-Kit{sup high}, CD45{sup low}c-Kit{sup high}, CD45{sup high}c-Kit{sup high}, and CD45{sup high}c-Kit{sup very} {sup low}). Among these six populations, CD45{sup low}c-Kit{sup high} cells were most able to form hematopoietic cell colonies, but their ability decreased after E11.5 and was undetectable at E13.5 and later. The CD45{sup low}c-Kit{sup high} cells showed multipotency in vitro. We demonstrated further enrichment of hematopoietic activity in the Hoechst dye-effluxing side population among the CD45{sup low}c-Kit{sup high} cells. Here, we determined that CD45{sup low}c-Kit{sup high} cells arise from the lateral plate mesoderm using embryonic stem cell-derived differentiation system. In conclusion, CD45{sup low}c-Kit{sup high} cells are the major hematopoietic cells of mouse AGM.« less

  19. Identification of FVIII gene mutations in patients with hemophilia A using new combinatorial sequencing by hybridization

    PubMed Central

    Chetta, M.; Drmanac, A.; Santacroce, R.; Grandone, E.; Surrey, S.; Fortina, P.; Margaglione, M.

    2008-01-01

    BACKGROUND: Standard methods of mutation detection are time consuming in Hemophilia A (HA) rendering their application unavailable in some analysis such as prenatal diagnosis. OBJECTIVES: To evaluate the feasibility of combinatorial sequencing-by-hybridization (cSBH) as an alternative and reliable tool for mutation detection in FVIII gene. PATIENTS/METHODS: We have applied a new method of cSBH that uses two different colors for detection of multiple point mutations in the FVIII gene. The 26 exons encompassing the HA gene were analyzed in 7 newly diagnosed Italian patients and in 19 previously characterized individuals with FVIII deficiency. RESULTS: Data show that, when solution-phase TAMRA and QUASAR labeled 5-mer oligonucleotide sets mixed with unlabeled target PCR templates are co-hybridized in the presence of DNA ligase to universal 6-mer oligonucleotide probe-based arrays, a number of mutations can be successfully detected. The technique was reliable also in identifying a mutant FVIII allele in an obligate heterozygote. A novel missense mutation (Leu1843Thr) in exon 16 and three novel neutral polymorphisms are presented with an updated protocol for 2-color cSBH. CONCLUSIONS: cSBH is a reliable tool for mutation detection in FVIII gene and may represent a complementary method for the genetic screening of HA patients. PMID:20300295

  20. [From gene to disease; primary hyperoxaluria type I caused by mutations in the AGXT gene].

    PubMed

    van Woerden, C S; Groothof, J W; Wanders, R J A; Waterham, H R; Wijburg, F R

    2006-07-29

    Primary hyperoxaluria type I (PH1) is a congenital defect in glyoxylate metabolism caused by a deficiency in the liver-specific peroxisomal enzyme known as alanine glyoxylate aminotransferase (AGT). The deficiency is due to mutations in the AGXT gene, located on chromosome 2q37.3, and results in the conversion of glyoxylate to oxalate. The crystallisation of oxalate with calcium results in symptoms varying from a solitary kidney stone to end-stage renal disease with systemic oxalosis. The diagnosis is based on increased oxalate and glycolate excretion in the urine, reduced AGT activity in liver tissue, and confirmed mutations in the AGXT gene. Over 50 disease-causing mutations have been identified in PH1, which are associated with a wide range of effects on the AGT enzyme. Homozygous Gly170Arg or Phei52Ile mutations are associated with a reduction in urinary oxalate excretion upon pyridoxine administration and long-term preservation of renal function when treatment is initiated in a timely manner. Homozygous 33insC and Gly82Arg mutations result in a much poorer prognosis. Mutational analysis of the AGXT gene in PH1 patients can be a useful tool for establishing the diagnosis and choosing an appropriate therapeutic strategy.

  1. Two novel mutations in the BCKDHB gene that cause maple syrup urine disease.

    PubMed

    Han, Bingjuan; Han, Bingchao; Guo, Bin; Liu, Yingxia; Cao, Zhiyang

    2018-01-06

    Maple syrup urine disease (MSUD) is a rare metabolic disorder of autosomal recessive inheritance caused by decreased activity of branched-chain α-ketoacid dehydrogenase complex (BCKD). Mutations in the three genes (BCKDHA, BCKDHB and DBT) are associated with MSUD. Here, we describe the presenting symptoms, clinical course and gene mutation analysis of a Chinese boy with MSUD. Plasma amino acid analysis was performed by tandem mass spectrometry and the levels of organic acids in urine were measured with gas chromatography-mass spectrometry. The BCKDHB gene was sequenced by Sanger method. Furthermore, the significance of the novel mutations was predicted by Polyphen and Mutationtaster. After diagnosis, the patient was fed with protein-restricted diet to reduce intake of BCAA and was treated with l -carnitine. Metabolic parameters, clinical presentation and mental development were followed up. The patient was diagnosed as MSUD. Two novel BCKDHB mutations (c.523 T > C and c.478-25_552del100) were identified. In silico analysis predicted that the two mutations were "disease causing". The boy tolerated the treatment well and had symptomatic improvement. He presented with mild hypotonia and had nearly normal DQ scores at the age of 10 months. The two novel mutations resulted in the clinical manifestations of MSUD. Our results may reflect the heterogeneity of the pathogenic variants found in patients with MSUD. Copyright © 2018. Published by Elsevier B.V.

  2. Leber's hereditary optic neuropathy is associated with mitochondrial ND1 T3394C mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liang, Min; Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003; Guan, Minqiang

    2009-06-05

    We report here the clinical, genetic and molecular characterization of four Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age-of-onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T3394C (Y30H) mutation, which localized at a highly conserved tyrosine at position 30 of ND1, and distinct sets of mtDNA polymorphisms belonging to haplogroups D4b and M9a. The occurrence of T3394C mutation in these several genetically unrelated subjects affected by visual impairment strongly indicatesmore » that this mutation is involved in the pathogenesis of visual impairment. However, there was the absence of functionally significant mtDNA mutations in these four Chinese pedigrees carrying the T3394C mutation. Therefore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic expression of the LHON-associated T3394C mutation.« less

  3. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

    PubMed Central

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B. P.

    2016-01-01

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients. PMID:26771602

  4. Normosmic idiopathic hypogonadotropic hypogonadism due to a novel homozygous nonsense c.C969A (p.Y323X) mutation in the KISS1R gene in three unrelated families.

    PubMed

    Demirbilek, Huseyin; Ozbek, M Nuri; Demir, Korcan; Kotan, L Damla; Cesur, Yasar; Dogan, Murat; Temiz, Fatih; Mengen, Eda; Gurbuz, Fatih; Yuksel, Bilgin; Topaloglu, A Kemal

    2015-03-01

    The spectrum of genetic alterations in cases of hypogonadotropic hypogonadism continue to expand. However, KISS1R mutations remain rare. The aim of this study was to understand the molecular basis of normosmic idiopathic hypogonadotropic hypogonadism. Clinical characteristics, hormonal studies and genetic analyses of seven cases with idiopathic normosmic hypogonadotropic hypogonadism (nIHH) from three unrelated consanguineous families are presented. One male presented with absence of pubertal onset and required surgery for severe penoscrotal hypospadias and cryptorchidism, while other two males had absence of pubertal onset. Two of four female cases required replacement therapy for pubertal onset and maintenance, whereas the other two had spontaneous pubertal onset but incomplete maturation. In sequence analysis, we identified a novel homozygous nonsense (p.Y323X) mutation (c.C969A) in the last exon of the KISS1R gene in all clinically affected cases. We identified a homozygous nonsense mutation in the KISS1R gene in three unrelated families with nIHH, which enabled us to observe the phenotypic consequences of this rare condition. Escape from nonsense-mediated decay, and thus production of abnormal proteins, may account for the variable severity of the phenotype. Although KISS1R mutations are extremely rare and can cause a heterogeneous phenotype, analysis of the KISS1R gene should be a part of genetic analysis of patients with nIHH, to allow better understanding of phenotype-genotype relationship of KISS1R mutations and the underlying genetic basis of patients with nIHH. © 2014 John Wiley & Sons Ltd.

  5. Mutation analysis of the MECP2 gene in patients of Slavic origin with Rett syndrome: novel mutations and polymorphisms.

    PubMed

    Zahorakova, Daniela; Rosipal, Robert; Hadac, Jan; Zumrova, Alena; Bzduch, Vladimir; Misovicova, Nadezda; Baxova, Alice; Zeman, Jiri; Martasek, Pavel

    2007-01-01

    Rett syndrome (RTT), an X-linked dominant neurodevelopmental disorder in females, is caused mainly by de novo mutations in the methyl-CpG-binding protein 2 gene (MECP2). Here we report mutation analysis of the MECP2 gene in 87 patients with RTT from the Czech and Slovak Republics, and Ukraine. The patients, all girls, with classical RTT were investigated for mutations using bi-directional DNA sequencing and conformation sensitive gel electrophoresis analysis of the coding sequence and exon/intron boundaries of the MECP2 gene. Restriction fragment length polymorphism analysis was performed to confirm the mutations that cause the creation or abolition of the restriction site. Mutation-negative cases were subsequently examined by multiple ligation-dependent probe amplification (MLPA) to identify large deletions. Mutation screening revealed 31 different mutations in 68 patients and 12 non-pathogenic polymorphisms. Six mutations have not been previously published: two point mutations (323T>A, 904C>T), three deletions (189_190delGA, 816_832del17, 1069delAGC) and one deletion/inversion (1063_1236del174;1189_1231inv43). MLPA analysis revealed large deletions in two patients. The detection rate was 78.16%. Our results confirm the high frequency of MECP2 mutations in females with RTT and provide data concerning the mutation heterogeneity in the Slavic population.

  6. New insights into thyroglobulin gene: molecular analysis of seven novel mutations associated with goiter and hypothyroidism.

    PubMed

    Citterio, Cintia E; Machiavelli, Gloria A; Miras, Mirta B; Gruñeiro-Papendieck, Laura; Lachlan, Katherine; Sobrero, Gabriela; Chiesa, Ana; Walker, Joanna; Muñoz, Liliana; Testa, Graciela; Belforte, Fiorella S; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

    2013-01-30

    The thyroglobulin (TG) gene is organized in 48 exons, spanning over 270 kb on human chromosome 8q24. Up to now, 62 inactivating mutations in the TG gene have been identified in patients with congenital goiter and endemic or non-endemic simple goiter. The purpose of the present study was to identify and characterize new mutations in the TG gene. We report 13 patients from seven unrelated families with goiter, hypothyroidism and low levels of serum TG. All patients underwent clinical, biochemical and imaging evaluation. Single-strand conformation polymorphism (SSCP) analysis, endonuclease restriction analysis, sequencing of DNA, genotyping, population screening, and bioinformatics studies were performed. Molecular analyses revealed seven novel inactivating TG mutations: c.378C>A [p.Y107X], c.2359C>T [p.R768X], c.2736delG [p.R893fsX946], c.3842G>A [p.C1262Y], c.5466delA [p.K1803fsX1833], c.6000C>G [p.C1981W] and c.6605C>G [p.P2183R] and three previously reported mutations: c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.7006C>T [p.R2317X]. Six patients from two families were homozygous for p.R277X mutation, four were compound heterozygous mutations (p.Y107X/p.C1262Y, p.R893fsX946/p.A2215D, p.K1803fsX1832/p.R2317X), one carried three identified mutations (p.R277X/p.C1981W-p.P2183R) together with a hypothetical micro deletion and the remaining two siblings from another family with typical phenotype had a single p.R768X mutated allele. In conclusion, our results confirm the genetic heterogeneity of TG defects and the pathophysiological importance of altered TG folding as a consequency of truncated TG proteins and missense mutations located in ACHE-like domain or that replace cysteine. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  7. Adaptive Mutations in RNA Polymerase and the Transcriptional Terminator Rho Have Similar Effects on Escherichia coli Gene Expression.

    PubMed

    González-González, Andrea; Hug, Shaun M; Rodríguez-Verdugo, Alejandra; Patel, Jagdish Suresh; Gaut, Brandon S

    2017-11-01

    Modifications to transcriptional regulators play a major role in adaptation. Here, we compared the effects of multiple beneficial mutations within and between Escherichia coli rpoB, the gene encoding the RNA polymerase β subunit, and rho, which encodes a transcriptional terminator. These two genes have harbored adaptive mutations in numerous E. coli evolution experiments but particularly in our previous large-scale thermal stress experiment, where the two genes characterized alternative adaptive pathways. To compare the effects of beneficial mutations, we engineered four advantageous mutations into each of the two genes and measured their effects on fitness, growth, gene expression and transcriptional termination at 42.2 °C. Among the eight mutations, two rho mutations had no detectable effect on relative fitness, suggesting they were beneficial only in the context of epistatic interactions. The remaining six mutations had an average relative fitness benefit of ∼20%. The rpoB mutations affected the expression of ∼1,700 genes; rho mutations affected the expression of fewer genes but most (83%) were a subset of those altered by rpoB mutants. Across the eight mutants, relative fitness correlated with the degree to which a mutation restored gene expression back to the unstressed, 37.0 °C state. The beneficial mutations in the two genes did not have identical effects on fitness, growth or gene expression, but they caused parallel phenotypic effects on gene expression and genome-wide transcriptional termination. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. [Study of gene mutation in 62 hemophilia A children].

    PubMed

    Hu, Q; Liu, A G; Zhang, L Q; Zhang, A; Wang, Y Q; Wang, S M; Lu, Y J; Wang, X

    2017-11-02

    Objective: To analyze the mutation type of FⅧ gene in children with hemophilia A and to explore the relationship among hemophilia gene mutation spectrum, gene mutation and clinical phenotype. Method: Sixty-two children with hemophilia A from Department of Pediatric Hematology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology between January 2015 and March 2017 were enrolled. All patients were male, aged from 4 months to 7 years and F Ⅷ activity ranged 0.2%-11.0%. Fifty cases had severe, 10 cases had moderate and 2 cases had mild hemophilia A. DNA was isolated from peripheral blood in hemophilia A children and the target gene fragment was amplified by PCR, in combination with the second generation sequencing, 22 and 1 introns were detected. Negative cases were detected by the second generation sequencing and results were compared with those of the international FⅧ gene mutation database. Result: There were 20 cases (32%) of intron 22 inversion, 2 cases (3%) of intron 1 inversion, 18 cases (29%) of missense mutation, 5 cases (8%) of nonsense mutation, 7 cases (11%) of deletion mutation, 1 case(2%)of splice site mutation, 2 cases (3%) of large fragment deletion and 1 case of insertion mutation (2%). No mutation was detected in 2 cases (3%), and 4 cases (7%) failed to amplify. The correlation between phenotype and genotype showed that the most common gene mutation in severe hemophilia A was intron 22 inversion (20 cases), accounting for 40% of severe patients, followed by 11 cases of missense mutation (22%). The most common mutation in moderate hemophilia A was missense mutation (6 cases), accounting for 60% of moderate patients. Conclusion: The most frequent mutation type in hemophilia A was intron 22 inversion, followed by missense mutation, again for missing mutation. The relationship between phenotype and genotype: the most frequent gene mutation in severe hemophilia A is intron 22 inversion, followed by missense

  9. Mutation analysis in 129 genes associated with other forms of retinal dystrophy in 157 families with retinitis pigmentosa based on exome sequencing.

    PubMed

    Xu, Yan; Guan, Liping; Xiao, Xueshan; Zhang, Jianguo; Li, Shiqiang; Jiang, Hui; Jia, Xiaoyun; Yang, Jianhua; Guo, Xiangming; Yin, Ye; Wang, Jun; Zhang, Qingjiong

    2015-01-01

    Mutations in 60 known genes were previously identified by exome sequencing in 79 of 157 families with retinitis pigmentosa (RP). This study analyzed variants in 129 genes associated with other forms of hereditary retinal dystrophy in the same cohort. Apart from the 73 genes previously analyzed, a further 129 genes responsible for other forms of hereditary retinal dystrophy were selected based on RetNet. Variants in the 129 genes determined by whole exome sequencing were selected and filtered by bioinformatics analysis. Candidate variants were confirmed by Sanger sequencing and validated by analysis of available family members and controls. A total of 90 candidate variants were present in the 129 genes. Sanger sequencing confirmed 83 of the 90 variants. Analysis of family members and controls excluded 76 of these 83 variants. The remaining seven variants were considered to be potential pathogenic mutations; these were c.899A>G, c.1814C>G, and c.2107C>T in BBS2; c.1073C>T and c.1669C>T in INPP5E; and c.3582C>G and c.5704-5C>G in CACNA1F. Six of these seven mutations were novel. The mutations were detected in five unrelated patients without a family history, including three patients with homozygous or compound heterozygous mutations in BBS2 and INPP5E, and two patients with hemizygous mutations in CACNA1F. None of the patients had mutations in the genes associated with autosome dominant retinal dystrophy. Only a small portion of patients with RP, about 3% (5/157), had causative mutations in the 129 genes associated with other forms of hereditary retinal dystrophy.

  10. Novel mutations in the TULP1 gene causing autosomal recessive retinitis pigmentosa.

    PubMed

    Paloma, E; Hjelmqvist, L; Bayés, M; García-Sandoval, B; Ayuso, C; Balcells, S; Gonzàlez-Duarte, R

    2000-03-01

    To assess the contribution of TULP1 to autosomal recessive retinitis pigmentosa (arRP). Fifteen exons of the gene were screened by single-strand conformation polymorphism analysis of 7 (of 49) arRP pedigrees showing cosegregation with TULP1 locus markers. In one of the seven families two allelic mutations, IVS4-2delAGA and c.937delC, were found in exons 5 and 10, respectively. Two novel mutations in TULP1 were found to be associated with arRP. That they both compromise the gene product supports their pathogenicity. This gene was present in no more than 2% of a panel of 49 Spanish families affected by arRP.

  11. Role of genetic mutations in folate-related enzyme genes on Male Infertility

    PubMed Central

    Liu, Kang; Zhao, Ruizhe; Shen, Min; Ye, Jiaxin; Li, Xiao; Huang, Yuan; Hua, Lixin; Wang, Zengjun; Li, Jie

    2015-01-01

    Several studies showed that the genetic mutations in the folate-related enzyme genes might be associated with male infertility; however, the results were still inconsistent. We performed a meta-analysis with trial sequential analysis to investigate the associations between the MTHFR C677T, MTHFR A1298C, MTR A2756G, MTRR A66G mutations and the MTHFR haplotype with the risk of male infertility. Overall, a total of 37 studies were selected. Our meta-analysis showed that the MTHFR C677T mutation was a risk factor for male infertility in both azoospermia and oligoasthenoteratozoospermia patients, especially in Asian population. Men carrying the MTHFR TC haplotype were most liable to suffer infertility while those with CC haplotype had lowest risk. On the other hand, the MTHFR A1298C mutation was not related to male infertility. MTR A2756G and MTRR A66G were potential candidates in the pathogenesis of male infertility, but more case-control studies were required to avoid false-positive outcomes. All of these results were confirmed by the trial sequential analysis. Finally, our meta-analysis with trial sequential analysis proved that the genetic mutations in the folate-related enzyme genes played a significant role in male infertility. PMID:26549413

  12. Mutation analysis of COL4A3 and COL4A4 genes in a Chinese autosomal-dominant Alport syndrome family.

    PubMed

    Guo, Liwei; Li, Duan; Dong, Shuangshuang; Wan, Donghao; Yang, Baosheng; Huang, Yanmei

    2017-06-01

    Autosomal dominant Alport syndrome (ADAS) accounts for 5% of all cases of Alport syndrome (AS), a primary basement membrane disorder arising from mutations in genes encoding the type IV collagen protein family.Mutations in COL4A3 and COL4A4 genes were reported to be associated with ADAS. In this study, clinical data in a large consanguineous family with seven affected members were reviewed, and genomic DNA was extracted. For mutation screening, all exons of COL4A3 and COL4A4 genes were polymerase chain reaction-amplified and direct sequenced from genomic DNA, and the mutations were analyzed by comparing with members in this family, 100 ethnicitymatched controls and the sequence of COL4A3 and COL4A4 genes from GenBank. A novel mutation determining a nucleotide change was found, i.e. c.4195 A>T (p.Met1399Leu) at 44th exon of COL4A4 gene, and this mutation showed heterozygous in all patients of this family. Also a novel intron mutation (c.4127+11 C>T) was observed at COL4A4 gene. Thus the novel missense mutation c.4195 A>T (p.Met1399Leu) and the intron mutation (c.4127+11 C>T) at COL4A4 gene might be responsible for ADAS of this family. Our results broadened the spectrum of mutations in COL4A4 and had important implications in the diagnosis, prognosis, and genetic counselling of ADAS.

  13. Prognostic significance of c-KIT in vulvar cancer: bringing this molecular marker from bench to bedside

    PubMed Central

    2012-01-01

    Background Vulvar carcinomas are rare tumors, and there is limited data regarding molecular alterations. To our knowledge there are no published studies on c-KIT and squamous cell carcinomas of the vulva (VSCC). Although there are a significant number of other tumor types which express c-KIT, there remains controversy as to its relationship to patient outcome. Thus, we wished to investigate such controversial findings to determine the prognostic importance of c-KIT by evaluating its protein and mRNA expression in VSCCs, correlating these findings with clinicopathological features and Human Papillomavirus (HPV) infection. Methods c-KIT expression was scored by immunohistochemistry (IHC) as positive or negative in 139 formalin-fixed paraffin-embedded (FFPE) cases of vulvar carcinomas arrayed in a tissue microarray (TMA) using the DAKO® A4502 rabbit polyclonal c-KIT antibody (diluted 1:100). c-KIT mRNA was evaluated by qRT-PCR in 34 frozen samples from AC Camargo Hospital Biobank (17 tumoral and 17 non-tumoral samples) using TaqMan probes–Applied Biosystems [Hs00174029_m1]. HPV genotyping was assessed in 103 samples using Linear Array® HPV Genotyping Test kit (Roche Molecular Diagnostics, Basel, Switzerland). All results obtained were correlated with clinical and pathological data of the patients. Results c-KIT protein was positive by immunohistochemistry in 70.5% of the cases and this was associated with a higher global survival (p = 0.007), a higher recurrence-free survival (p < 0.0001), an absence of associated lesions (p = 0.001), lymph node metastasis (p = 0.0053), and HPV infection (p = 0.034). Furthermore, c-KIT mRNA quantitation revealed higher levels of transcripts in normal samples compared to tumor samples (p = 0,0009). Conclusions Our findings indicate that those vulvar tumors staining positively for c-KIT present better prognosis. Thus, positivity of c-KIT as evaluated by IHC may be a good predictor for use of more conservative

  14. Resveratrol Improves Cell Cycle Arrest in Chronic Prostatitis Rats, by C-kit/SCF Suppression.

    PubMed

    He, Yi; Zeng, Huizhi; Yu, Yang; Zhang, Jiashu; Zeng, Xiaona; Gong, Fengtao; Liu, Qi; Yang, Bo

    2017-08-01

    Chronic prostatitis (CP) with complex pathogenesis is difficult for treatment. c-kit has been associated with the control of cell proliferation of prostate cells. This study aims to evaluate the role of resveratrol, an activator of Sirt1, in regulating the expression of c-kit in CP and investigate the consequent effects on cell cycle. Rat model of CP was established through subcutaneous injections of diphtheria-pertussis-tetanus vaccine and subsequently treated with resveratrol. Hematoxylin and eosin staining was performed to identify the histopathological changes in prostates. Western blotting and immunohistochemical staining examined the expression level of c-kit, stem cell factor (SCF), Sirt1, and cell cycle-associated proteins. The model group exhibited severe diffuse chronic inflammation, characterized by leukocyte infiltration and papillary frond protrusion into the gland cavities, and a notable increase in prostatic epithelial height. Gland lumen diameter was also significantly smaller; the activity of c-kit/SCF in the CP rats was increased significantly compared to the control group. Meanwhile, the cell cycle proteins are dysregulated significantly in CP rats. Resveratrol treatment significantly improved these factors by Sirt1 activation. Dysregulation of cell cycle was involved in the pathological processes of CP, which was improved after resveratrol treatment by the downregulation of c-kit/SCF by activating Sirt1.

  15. R124C mutation of the betaIGH3 gene leads to remarkable phenotypic variability in a Greek four-generation family with lattice corneal dystrophy type 1.

    PubMed

    Hellenbroich, Y; Tzivras, G; Neppert, B; Schwinger, E; Zühlke, C

    2001-01-01

    Five autosomal dominantly inherited corneal dystrophies are caused by missense mutations in the betaIGH3 gene on chromosome 5q31. Here we describe the clinical features and the analysis of the betaIGH3 gene in a Greek four-generation family with lattice corneal dystrophy type 1 (CDL1). Sequencing of the betaIGH3 cDNA from an affected family member revealed the R124C mutation. More recent data indicate that this is probably a mutation hot spot in CDL1. We could not find a common haplotype with another CDL1 family with the R124C mutation demonstrating that this mutation occurs independently in different families. The clinical course of the disease showed a remarkable variability between the affected family members. To investigate a possible role between the phenotypic variability and apolipoprotein E (ApoE), which co-localises with amyloid deposits in CDL1, we determined the ApoE genotype of all family members. The resulting data revealed no association with the variable clinical course. Copyright 2001 S. Karger AG, Basel

  16. Rapid and cost-effective method for the detection of the c.533G>A mutation in the HEXA gene.

    PubMed

    Ribeiro, Diogo; Duarte, Ana Joana; Amaral, Olga

    2011-03-01

    Tay-Sachs disease is a rare autosomal recessive neurodegenerative disorder that results from mutations in the HEXA gene, leading to β-hexosaminidase A (HexA) α subunit deficiency. An unusual variant of Tay-Sachs disease is known as the B1 variant. Previous studies indicated that, in northern Portugal, this is not only the most common variant but also one of the most prevalent lysosomal storage diseases. Additionally, this variant might also show a higher prevalence in populations of Portuguese and Spanish ancestry. A single mutation is invariably present in at least one of the alleles of B1 variant patients, HEXA mutation c.533G >A. To implement a method for c.533G >A testing in individuals and populations, we have optimized two distinct mutation analysis techniques, one based on restriction fragment length polymorphism analysis and the other based on allelic discrimination. We present the comparison of both methods and their advantages. Mutation screening by allelic discrimination proved to be particularly useful for the studying of large samples of individuals. It is time saving and highly reproducible, and under the conditions used, its cost is lower than the cost of polymerase chain reaction-based restriction fragment length polymorphism analysis.

  17. A novel start codon mutation of the MERTK gene in a patient with retinitis pigmentosa

    PubMed Central

    Jinda, Worapoj; Poungvarin, Naravat; Taylor, Todd D.; Suzuki, Yutaka; Thongnoppakhun, Wanna; Limwongse, Chanin; Lertrit, Patcharee; Suriyaphol, Prapat

    2016-01-01

    Purpose Retinitis pigmentosa (RP) is a clinically and genetically heterogeneous group of inherited retinal degenerations characterized by progressive loss of photoreceptor cells and RPE functions. More than 70 causative genes are known to be responsible for RP. This study aimed to identify the causative gene in a patient from a consanguineous family with childhood-onset severe retinal dystrophy. Methods To identify the defective gene, whole exome sequencing was performed. Candidate causative variants were selected and validated using Sanger sequencing. Segregation analysis of the causative gene was performed in additional family members. To verify that the mutation has an effect on protein synthesis, an expression vector containing the first ten amino acids of the mutant protein fused with the DsRed2 fluorescent protein was constructed and transfected into HEK293T cells. Expression of the fusion protein in the transfected cells was measured using fluorescence microscopy. Results By filtering against public variant databases, a novel homozygous missense mutation (c.3G>A) localized in the start codon of the MERTK gene was detected as a potentially pathogenic mutation for autosomal recessive RP. The c.3G>A mutation cosegregated with the disease phenotype in the family. No expression of the first ten amino acids of the MerTK mutant fused with the DsRed2 fluorescent protein was detected in HEK293T cells, indicating that the mutation affects the translation initiation site of the gene that may lead to loss of function of the MerTK signaling pathway. Conclusions We report a novel missense mutation (c.3G>A, p.0?) in the MERTK gene that causes severe vision impairment in a patient. Taken together with previous reports, our results expand the spectrum of MERTK mutations and extend our understanding of the role of the MerTK protein in the pathogenesis of retinitis pigmentosa. PMID:27122965

  18. The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

    PubMed

    Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

    2000-03-01

    Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

  19. Zinc finger point mutations within the WT1 gene in Wilms tumor patients.

    PubMed Central

    Little, M H; Prosser, J; Condie, A; Smith, P J; Van Heyningen, V; Hastie, N D

    1992-01-01

    A proposed Wilms tumor gene, WT1, which encodes a zinc finger protein, has previously been isolated from human chromosome 11p13. Chemical mismatch cleavage analysis was used to identify point mutations in the zinc finger region of this gene in a series of 32 Wilms tumors. Two exonic single base changes were detected. In zinc finger 3 of a bilateral Wilms tumor patient, a constitutional de novo C----T base change was found changing an arginine to a stop codon. One tumor from this patient showed allele loss leading to 11p hemizygosity of the abnormal allele. In zinc finger 2 of a sporadic Wilms tumor patient, a C----T base change resulted in an arginine to cysteine amino acid change. To our knowledge, a WT1 gene missense mutation has not been detected previously in a Wilms tumor. By comparison with a recent NMR and x-ray crystallographic analysis of an analogous zinc finger gene, early growth response gene 1 (EGR1), this amino acid change in WT1 occurs at a residue predicted to be critical for DNA binding capacity and site specificity. The detection of one nonsense point mutation and one missense WT1 gene point mutation adds to the accumulating evidence implicating this gene in a proportion of Wilms tumor patients. Images PMID:1317572

  20. Mutation screening of melatonin-related genes in patients with autism spectrum disorders

    PubMed Central

    2010-01-01

    Background One consistent finding in autism spectrum disorders (ASD) is a decreased level of the pineal gland hormone melatonin and it has recently been demonstrated that this decrease to a large extent is due to low activity of the acetylserotonin O-methyltransferase (ASMT), the last enzyme in the melatonin synthesis pathway. Moreover, mutations in the ASMT gene have been identified, including a splice site mutation, that were associated with low ASMT activity and melatonin secretion, suggesting that the low ASMT activity observed in autism is, at least partly, due to variation within the ASMT gene. Methods In the present study, we have investigated all the genes involved in the melatonin pathway by mutation screening of AA-NAT (arylalkylamine N-acetyltransferase), ASMT, MTNR1A, MTNR1B (melatonin receptor 1A and 1B) and GPR50 (G protein-coupled receptor 50), encoding both synthesis enzymes and the three main receptors of melatonin, in 109 patients with autism spectrum disorders (ASD). A cohort of 188 subjects from the general population was used as a comparison group and was genotyped for the variants identified in the patient sample. Results Several rare variants were identified in patients with ASD, including the previously reported splice site mutation in ASMT (IVS5+2T>C). Of the variants affecting protein sequence, only the V124I in the MTNR1B gene was absent in our comparison group. However, mutations were found in upstream regulatory regions in three of the genes investigated, ASMT, MTNR1A, and MTNR1B. Conclusions Our report of another ASD patient carrying the splice site mutation IVS5+2T>C, in ASMT further supports an involvement of this gene in autism. Moreover, our results also suggest that other melatonin related genes might be interesting candidates for further investigation in the search for genes involved in autism spectrum disorders and related neurobehavioral phenotypes. However, further studies of the novel variants identified in this study are

  1. Mutation screening of melatonin-related genes in patients with autism spectrum disorders.

    PubMed

    Jonsson, Lina; Ljunggren, Elin; Bremer, Anna; Pedersen, Christin; Landén, Mikael; Thuresson, Kent; Giacobini, Maibritt; Melke, Jonas

    2010-04-08

    One consistent finding in autism spectrum disorders (ASD) is a decreased level of the pineal gland hormone melatonin and it has recently been demonstrated that this decrease to a large extent is due to low activity of the acetylserotonin O-methyltransferase (ASMT), the last enzyme in the melatonin synthesis pathway. Moreover, mutations in the ASMT gene have been identified, including a splice site mutation, that were associated with low ASMT activity and melatonin secretion, suggesting that the low ASMT activity observed in autism is, at least partly, due to variation within the ASMT gene. In the present study, we have investigated all the genes involved in the melatonin pathway by mutation screening of AA-NAT (arylalkylamine N-acetyltransferase), ASMT, MTNR1A, MTNR1B (melatonin receptor 1A and 1B) and GPR50 (G protein-coupled receptor 50), encoding both synthesis enzymes and the three main receptors of melatonin, in 109 patients with autism spectrum disorders (ASD). A cohort of 188 subjects from the general population was used as a comparison group and was genotyped for the variants identified in the patient sample. Several rare variants were identified in patients with ASD, including the previously reported splice site mutation in ASMT (IVS5+2T>C). Of the variants affecting protein sequence, only the V124I in the MTNR1B gene was absent in our comparison group. However, mutations were found in upstream regulatory regions in three of the genes investigated, ASMT, MTNR1A, and MTNR1B. Our report of another ASD patient carrying the splice site mutation IVS5+2T>C, in ASMT further supports an involvement of this gene in autism. Moreover, our results also suggest that other melatonin related genes might be interesting candidates for further investigation in the search for genes involved in autism spectrum disorders and related neurobehavioral phenotypes. However, further studies of the novel variants identified in this study are warranted to shed light on their potential

  2. Iranian hereditary hemochromatosis patients: baseline characteristics, laboratory data and gene mutations.

    PubMed

    Zamani, Farhad; Bagheri, Zohreh; Bayat, Maryam; Fereshtehnejad, Seyed-Mohammad; Basi, Ali; Najmabadi, Hossein; Ajdarkosh, Hossein

    2012-10-01

    Hereditary hemochromatosis (HH) is the most common autosomal recessive disorder in white people, characterized by highly abnormal uptake of iron from the gastrointestinal tracts. Recently, mutation studies have focused to detect the genes responsible for HH. In this cross-sectional study, 12 HH patients were recruited, who were referred to Firoozgar Hospital, Tehran, Iran. In addition to the clinical assessments, a complete laboratory evaluation, imaging modalities, histopathologic assessment, atomic absorption spectrophotometry and gene mutation study were performed. The genetic study for HFE gene mutation was examined for all of the patients since 2006, while non-HFE mutation was conducted since December 2010 (only for 1 of them). Twelve patients were evaluated consisting of 11 men and 1 woman, with the mean age of 39.58±12.68 yr. The average of atomic iron loads was 13.25±4.83-fold higher than normal standards. Four patients had heterozygotic mutation of H63D (33.3%). There was no significant difference in either the iron load of liver (P=0.927) and heart (P=0.164) or serum concentration of ferritin (P=0.907) and TIBC (P=0.937) between the HFE-mutant and without HFE mutation HH cases. In contrast to other studies, C282Y mutation was not detected in any of our Iranian HH patients. Heterozygotic mutations of H63D (HFE) and TFR2 (non-HFE) genes were found to be more common in these patients. Similar to previous reports, these mutations were not found to be significantly associated with severity of presentation in HH patients.

  3. A novel mutation of the beta-globin gene promoter (-102 C>A) and pitfalls in family screening.

    PubMed

    Aguilar-Martinez, Patricia; Jourdan, Eric; Brun, Sophie; Cunat, Séverine; Giansily-Blaizot, Muriel; Pissard, Serge; Schved, Jean-François

    2007-12-01

    We describe a family with beta-thalassemia in which several pitfalls of genetic diagnoses were present. These include coherent family phenotypes with discrepancies in molecular findings because of nonpaternity, and a false beta-globin gene homozygous genotype due to a large deletion in the second locus. These findings underline the difficulties of family genetic studies and the need for tight relationship between professionals involved in laboratory studies and those in-charge of the clinical follow-up and genetic counselling. In this family, we also report a new silent beta-thalassemia mutation, -102 (C>A), in the distal CACCC box of the beta-globin gene promoter.

  4. Four novel mutations of the BCKDHA, BCKDHB and DBT genes in Iranian patients with maple syrup urine disease.

    PubMed

    Zeynalzadeh, Monica; Tafazoli, Alireza; Aarabi, Azadeh; Moghaddassian, Morteza; Ashrafzadeh, Farah; Houshmand, Massoud; Taghehchian, Negin; Abbaszadegan, Mohammad Reza

    2018-01-26

    Maple syrup urine disease (MSUD) is a rare metabolic autosomal recessive disorder caused by dysfunction of the branched-chain α-ketoacid dehydrogenase (BCKDH) complex. Mutations in the BCKDHA, BCKDHB and DBT genes are responsible for MSUD. The current study analyzed seven Iranian MSUD patients genetically and explored probable correlations between their genotype and phenotype. The panel of genes, including BCKDHA, BCKDHB and DBT, was evaluated, using routine the polymerase chain reaction (PCR)-sequencing method. In addition, protein modeling (homology and threading modeling) of the deduced novel mutations was performed. The resulting structures were then analyzed, using state-of-the-art bioinformatics tools to better understand the structural and functional effects caused by mutations. Seven mutations were detected in seven patients, including four novel pathogenic mutations in BCKDHA (c.1198delA, c.629C>T), BCKDHB (c.652C>T) and DBT (c.1150A>G) genes. Molecular modeling of the novel mutations revealed clear changes in the molecular energy levels and stereochemical traits of the modeled proteins, which may be indicative of strong correlations with the functional modifications of the genes. Structural deficiencies were compatible with the observed phenotypes. Any type of MSUD can show heterogeneous clinical manifestations in different ethnic groups. Comprehensive molecular investigations would be necessary for differential diagnosis.

  5. A de novo mutation in the AGXT gene causing primary hyperoxaluria type 1.

    PubMed

    Williams, Emma L; Kemper, Markus J; Rumsby, Gill

    2006-09-01

    Primary hyperoxaluria type 1 is caused by mutations in the alanine-glyoxylate aminotransferase (AGXT) gene. In cases in which no mutation was identified, linkage analysis can be used to confirm or exclude the diagnosis in other siblings. We present a family in which a sibling of the index case predicted to have primary hyperoxaluria type 1 by means of linkage analysis failed to show hyperoxaluria during the following 7 years, putting the diagnosis into question. Whole-gene sequence analysis identified 2 causative mutations in the index case, of which only 1, c.646A (Gly216Arg), was inherited. The other sequence change, c.33_34insC, was a de novo mutation occurring on the paternal allele. This particular mutation is a relatively common cause of primary hyperoxaluria type 1. It occurs in a run of 8 cytosines and therefore potentially is susceptible to polymerase slippage. This case illustrates 2 important points. First, biochemical confirmation of a genetic diagnosis should always be made in siblings diagnosed by using genetic tests. Second, de novo mutations should be considered as a potential, albeit rare, cause of primary hyperoxaluria type 1.

  6. Isolation of temperature-sensitive mutations in murC of Staphylococcus aureus.

    PubMed

    Ishibashi, Mihoko; Kurokawa, Kenji; Nishida, Satoshi; Ueno, Kohji; Matsuo, Miki; Sekimizu, Kazuhisa

    2007-09-01

    Enzymes in the bacterial peptidoglycan biosynthesis pathway are important targets for novel antibiotics. Of 750 temperature-sensitive (TS) mutants of Gram-positive Staphylococcus aureus, six were complemented by the murC gene, which encodes the UDP-N-acetylmuramic acid:l-alanine ligase. Each mutation resulted in a single amino acid substitution and, in all cases, the TS phenotype was suppressed by high osmotic stress. In mutant strains with the G222E substitution, a decrease in the viable cell number immediately after shift to the restrictive temperature was observed. These results suggest that S. aureus MurC protein is essential for cell growth. The MurC H343Y mutation is located in the putative alanine recognition pocket. Consistent with this, allele-specific suppression was observed of the H343Y mutation by multiple copies of the aapA gene, which encodes an alanine transporter. The results suggest an in vivo role for the H343 residue of S. aureus MurC protein in high-affinity binding to L-alanine.

  7. Intratumoral CD3+ T-Lymphocytes Immunoexpression and Its Association with c-Kit, Angiogenesis, and Overall Survival in Malignant Canine Mammary Tumors

    PubMed Central

    Carvalho, Maria Isabel; Pires, Isabel; Dias, Marlene; Prada, Justina; Gregório, Hugo; Lobo, Luis; Queiroga, Felisbina

    2015-01-01

    In this study 80 malignant CMT were submitted to immunohistochemical detection of CD3, c-kit, VEGF, and CD31, together with clinicopathological parameters of tumor aggressiveness. CD3+ T-cells and c-kit overexpression revealed a positive correlation with VEGF (r = 0.503, P < 0.0001; r = 0.284, P = 0.023 for CD3 and c-kit, resp.) and CD31 (r = 0.654, P < 0.0001; r = 0.365, P = 0.003 for CD3 and c-kit, resp.). A significant association (P = 0.039) and a positive correlation (r = 0.263, P = 0.039) between CD3 and c-kit were also observed. High CD3/VEGF, c-kit/VEGF, and CD3/c-kit tumors were associated with elevated grade of malignancy (P < 0.0001 for all groups), presence of intravascular emboli (P < 0.0001 for CD3/VEGF and CD3/c-kit; P = 0.002 for c-kit/VEGF), and presence of lymph node metastasis (P < 0.0001 for all groups). Tumors with high CD3/VEGF (P = 0.006), c-kit/VEGF (P < 0.0001), and CD3/c-kit (P = 0.002) were associated with poor prognosis. Interestingly high c-kit/VEGF tumors retained their significance by multivariate analysis arising as independent prognostic factor. PMID:26346272

  8. Membrane estrogen receptor alpha is an important modulator of bone marrow C-Kit+ cells mediated cardiac repair after myocardial infarction

    PubMed Central

    Su, Feng; Zhang, Wentian; Liu, Jianfang

    2015-01-01

    It has been validated that c-kit positive (c-kit+) cells in infarcted myocardium are from bone marrow (BM). Given the recent study that in the heart, estrogen receptor alpha (ERα) is involved in adaptive mechanisms by supporting cardiomyocytes survival via post-infarct cardiac c-kit+ cells, we tested a novel hypothesis that membrane ERα (mERа) supports survival of BM c-kit+ cells and enhance protective paracrine function for cardiac repair. Our data showed that myocardial infarction (MI) leads to an increase in c-kit+ first in bone marrow and then specifically within the infarcted myocardium. Also up-regulated mERа in post-infarct BM c-kit+ cells was found in day 3 post MI. In vitro co-culture system, mERа+ enhances the beneficial effects of BM c-kit+ cells by increasing their viability and reducing apoptosis. Post-infarct c-kit+ mERа+ cells population expresses predominant ERα and holds self-renewal as well as cardiac differentiation potentials after MI. In vivo, BM c-kit+ cells reduced infarct size, fibrosis and improved cardiac function. In conclusion, BM c-kit+ mERа+ exerted significantly cardiac protection after MI. A potential important implication of this study is that the manipulation of BM c-kit+ stem cells with ERа-dependent fashion may be helpful in recovering functional performance after cardiac tissue injury. PMID:26191121

  9. Characterization of the mutations in the glucose-6-phosphatase gene in Israeli patients with glycogen storage disease type 1a: R83C in six Jews and a novel V166G mutation in a Muslim Arab.

    PubMed

    Parvari, R; Moses, S; Hershkovitz, E; Carmi, R; Bashan, N

    1995-01-01

    Glycogen storage disease type 1a (GSD 1a), an autosomal recessive disease, is caused by the inactivity of glucose-6-phosphatase, the gene of which has been recently cloned. We report on the missense mutation C-->T at nucleotide 326 of the G6Pase gene, causing the change of the Arg codon at position 83 into a Cys codon, as the single mutation detected in six Jewish patients. This finding suggests that this mutation might be prevalent among the Jewish population. A new missense mutation T-->G at nucleotide 576 resulting in V166G was found in an Arab Muslim patient. These families may benefit now from pre- and postnatal diagnosis by analysis of DNA from blood and amniotic fluid or chorionic villus cells rather than liver biopsy. No mutations in the G6Pase gene were detected in two GSD 1b patients.

  10. Passenger mutations and aberrant gene expression in congenic tissue plasminogen activator-deficient mouse strains.

    PubMed

    Szabo, R; Samson, A L; Lawrence, D A; Medcalf, R L; Bugge, T H

    2016-08-01

    Essentials C57BL/6J-tissue plasminogen activator (tPA)-deficient mice are widely used to study tPA function. Congenic C57BL/6J-tPA-deficient mice harbor large 129-derived chromosomal segments. The 129-derived chromosomal segments contain gene mutations that may confound data interpretation. Passenger mutation-free isogenic tPA-deficient mice were generated for study of tPA function. Background The ability to generate defined null mutations in mice revolutionized the analysis of gene function in mammals. However, gene-deficient mice generated by using 129-derived embryonic stem cells may carry large segments of 129 DNA, even when extensively backcrossed to reference strains, such as C57BL/6J, and this may confound interpretation of experiments performed in these mice. Tissue plasminogen activator (tPA), encoded by the PLAT gene, is a fibrinolytic serine protease that is widely expressed in the brain. A number of neurological abnormalities have been reported in tPA-deficient mice. Objectives To study genetic contamination of tPA-deficient mice. Materials and methods Whole genome expression array analysis, RNAseq expression profiling, low- and high-density single nucleotide polymorphism (SNP) analysis, bioinformatics and genome editing were used to analyze gene expression in tPA-deficient mouse brains. Results and conclusions Genes differentially expressed in the brain of Plat(-/-) mice from two independent colonies highly backcrossed onto the C57BL/6J strain clustered near Plat on chromosome 8. SNP analysis attributed this anomaly to about 20 Mbp of DNA flanking Plat being of 129 origin in both strains. Bioinformatic analysis of these 129-derived chromosomal segments identified a significant number of mutations in genes co-segregating with the targeted Plat allele, including several potential null mutations. Using zinc finger nuclease technology, we generated novel 'passenger mutation'-free isogenic C57BL/6J-Plat(-/-) and FVB/NJ-Plat(-/-) mouse strains by introducing

  11. [Analysis on mutation of S gene and P gene of hepatitis B virus in two counties of Sichuan Province].

    PubMed

    Tong, Wen-Bin; He, Ji-Lan; Sun, Li

    2009-02-01

    To analyze HBV S gene/P gene mutation in 2 counties (districts) of Sichuan province. HBV DNA were extracted from sera positive both for HBsAg and HBeAg. After PCR and nucleotide sequencing, nucleotide/amino acid mutation in S and P gene were compared and analyzed. Of 47 serum samples from patients with chronic HBV infection, amino acid mutation in 'a' determinant occurred in 12 samples (25.53%,12/47), correlating with T126A, I126T/S, P127T, T131N, M133L, M133T and T140I; high proportion of mutation clustered in first loop of 'a' determinant (92.86%,13/14), rtV207I mutation in C domain of reverse transcription occured in one sample. Naturally occurring mutation in 'a' determinant clustered predominantly in the first loop and usually associated with altered antigenicity, posing a potential threat to successfully vaccinated individuals; Lamivudine-resistant mutant might occur in patient even without nucleotide analogue treatment.

  12. High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh.

    PubMed

    Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar

    2018-01-02

    Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and

  13. Molecular Diagnosis of Invasive Aspergillosis and Detection of Azole Resistance by a Newly Commercialized PCR Kit

    PubMed Central

    Gabriel, Frédéric; Gaboyard, Manuel; Lagardere, Gaëlle; Audebert, Lucile; Quesne, Gilles; Godichaud, Sandrine; Verweij, Paul E.; Accoceberry, Isabelle

    2017-01-01

    ABSTRACT Aspergillus fumigatus is the main species responsible for aspergillosis in humans. The diagnosis of aspergillosis remains difficult, and the rapid emergence of azole resistance in A. fumigatus is worrisome. The aim of this study was to validate the new MycoGENIE A. fumigatus real-time PCR kit and to evaluate its performance on clinical samples for the detection of A. fumigatus and its azole resistance. This multiplex assay detects DNA from the A. fumigatus species complex by targeting the multicopy 28S rRNA gene and specific TR34 and L98H mutations in the single-copy-number cyp51A gene of A. fumigatus. The specificity of cyp51A mutation detection was assessed by testing DNA samples from 25 wild-type or mutated clinical A. fumigatus isolates. Clinical validation was performed on 88 respiratory samples obtained from 62 patients and on 69 serum samples obtained from 16 patients with proven or probable aspergillosis and 13 patients without aspergillosis. The limit of detection was <1 copy for the Aspergillus 28S rRNA gene and 6 copies for the cyp51A gene harboring the TR34 and L98H alterations. No cross-reactivity was detected with various fungi and bacteria. All isolates harboring the TR34 and L98H mutations were accurately detected by quantitative PCR (qPCR) analysis. With respiratory samples, qPCR results showed a sensitivity and specificity of 92.9% and 90.1%, respectively, while with serum samples, the sensitivity and specificity were 100% and 84.6%, respectively. Our study demonstrated that this new real-time PCR kit enables sensitive and rapid detection of A. fumigatus DNA and azole resistance due to TR34 and L98H mutations in clinical samples. PMID:28814586

  14. Molecular Diagnosis of Invasive Aspergillosis and Detection of Azole Resistance by a Newly Commercialized PCR Kit.

    PubMed

    Dannaoui, Eric; Gabriel, Frédéric; Gaboyard, Manuel; Lagardere, Gaëlle; Audebert, Lucile; Quesne, Gilles; Godichaud, Sandrine; Verweij, Paul E; Accoceberry, Isabelle; Bougnoux, Marie-Elisabeth

    2017-11-01

    Aspergillus fumigatus is the main species responsible for aspergillosis in humans. The diagnosis of aspergillosis remains difficult, and the rapid emergence of azole resistance in A. fumigatus is worrisome. The aim of this study was to validate the new MycoGENIE A. fumigatus real-time PCR kit and to evaluate its performance on clinical samples for the detection of A. fumigatus and its azole resistance. This multiplex assay detects DNA from the A. fumigatus species complex by targeting the multicopy 28S rRNA gene and specific TR 34 and L98H mutations in the single-copy-number cyp51A gene of A. fumigatus The specificity of cyp51A mutation detection was assessed by testing DNA samples from 25 wild-type or mutated clinical A. fumigatus isolates. Clinical validation was performed on 88 respiratory samples obtained from 62 patients and on 69 serum samples obtained from 16 patients with proven or probable aspergillosis and 13 patients without aspergillosis. The limit of detection was <1 copy for the Aspergillus 28S rRNA gene and 6 copies for the cyp51A gene harboring the TR 34 and L98H alterations. No cross-reactivity was detected with various fungi and bacteria. All isolates harboring the TR 34 and L98H mutations were accurately detected by quantitative PCR (qPCR) analysis. With respiratory samples, qPCR results showed a sensitivity and specificity of 92.9% and 90.1%, respectively, while with serum samples, the sensitivity and specificity were 100% and 84.6%, respectively. Our study demonstrated that this new real-time PCR kit enables sensitive and rapid detection of A. fumigatus DNA and azole resistance due to TR 34 and L98H mutations in clinical samples. Copyright © 2017 American Society for Microbiology.

  15. Clinical and epidemiological study of EGFR mutations and EML4-ALK fusion genes among Indian patients with adenocarcinoma of the lung.

    PubMed

    Doval, Dc; Prabhash, K; Patil, S; Chaturvedi, H; Goswami, C; Vaid, Ak; Desai, S; Dutt, S; Veldore, Vh; Jambhekar, N; Mehta, A; Hazarika, D; Azam, S; Gawande, S; Gupta, S

    2015-01-01

    Mutation in the tyrosine kinase domain of epidermal growth factor receptor (EGFR) is a common feature observed in lung adenocarcinoma. A fusion gene between echinoderm microtubule-associated protein-like 4 (EML4) and the intracellular domain of anaplastic lymphoma kinase (ALK), named EML4-ALK, has been identified in a subset of non-small-cell lung cancer (NSCLC) tumors. The objective of this study was to determine the prevalence of EGFR mutations and EML4-ALK fusions in Indian patients with NSCLC (adenocarcinoma) as well as evaluate their clinical characteristics. Patients with NSCLC, adenocarcinoma histology, whose tumors had been tested for EGFR mutational status, were considered for this study. ALK gene rearrangement was detected by fluorescence in situ hybridization using the Vysis ALK Break Apart Rearrangement Probe Kit. ALK mutation was tested in samples that were negative for EGFR mutation. A total of 500 NSCLC adenocarcinoma patients were enrolled across six centers. There were 337 (67.4%) men and 163 (32.6%) women with a median age of 58 years. One hundred and sixty-four (32.8%) blocks were positive for EGFR mutations, whereas 336 (67.2%) were EGFR wild-type. Of the 336 EGFR-negative blocks, EML4-ALK fusion gene was present in 15 (4.5%) patients, whereas 321 (95.5%) tumors were EML4-ALK negative. The overall incidence of EML4-ALK fusion gene was 3% (15/500). The incidence of EGFR mutations (33%) in this Indian population is close to the reported incidence in Asian patients. EML4-ALK gene fusions are present in lung adenocarcinomas from Indian patients, and the 3% incidence of EML4-ALK gene fusion in EGFR mutation-negative cases is similar to what has been observed in other Western and Asian populations. The mutual exclusivity of EML4-ALK and EGFR mutations suggests implementation of biomarker testing for tumors harboring ALK rearrangements in order to identify patients that can benefit from newer targeted therapies.

  16. Identification of two novel mutations in the PHEX gene in Chinese patients with hypophosphatemic rickets/osteomalacia.

    PubMed

    Yue, Hua; Yu, Jin-bo; He, Jin-wei; Zhang, Zeng; Fu, Wen-zhen; Zhang, Hao; Wang, Chun; Hu, Wei-wei; Gu, Jie-mei; Hu, Yun-qiu; Li, Miao; Liu, Yu-juan; Zhang, Zhen-Lin

    2014-01-01

    X-linked dominant hypophosphatemia (XLH) is the most prevalent form of inherited rickets/osteomalacia in humans. The aim of this study was to identify PHEX gene mutations and describe the clinical features observed in 6 unrelated Chinese families and 3 sporadic patients with hypophosphatemic rickets/osteomalacia. For this study, 45 individuals from 9 unrelated families of Chinese Han ethnicity (including 16 patients and 29 normal phenotype subjects), and 250 healthy donors were recruited. All 22 exons and exon-intron boundaries of the PHEX gene were amplified by polymerase chain reaction (PCR) and directly sequenced. The PHEX mutations were detected in 6 familial and 3 sporadic hypophosphatemic rickets/osteomalacia. Altogether, 2 novel mutations were detected: 1 missense mutation c.1183G>C in exon 11, resulting in p.Gly395Arg and 1 missense mutation c.1751A>C in exon 17, resulting in p.His584Pro. No mutations were found in the 250 healthy controls. Our study increases knowledge of the PHEX gene mutation types and clinical phenotypes found in Chinese patients with XLH, which is important for understanding the genetic basis of XLH. The molecular diagnosis of a PHEX genetic mutation is of great importance for confirming the clinical diagnosis of XLH, conducting genetic counseling, and facilitating prenatal intervention, especially in the case of sporadic patients.

  17. Chromatin remodelling and DNA repair genes are frequently mutated in endometrioid endometrial carcinoma.

    PubMed

    García-Sanz, Pablo; Triviño, Juan Carlos; Mota, Alba; Pérez López, María; Colás, Eva; Rojo-Sebastián, Alejandro; García, Ángel; Gatius, Sonia; Ruiz, María; Prat, Jaime; López-López, Rafael; Abal, Miguel; Gil-Moreno, Antonio; Reventós, Jaume; Matias-Guiu, Xavier; Moreno-Bueno, Gema

    2017-04-01

    In developed countries, endometrial carcinoma is the most common cancer that affects the female genital tract. Endometrial carcinoma is divided into two main histological types, type I or endometrioid and type II or non-endometrioid, each of which have characteristic, although not exclusive, molecular alterations and mutational profiles. Nevertheless, information about the implication and relevance of some of these genes in this disease is lacking. We sought here to identify new recurrently mutated genes in endometrioid cancers that play a role in tumourigenesis and that influence the clinical outcome. We focused on low-grade, non-ultramutated tumours as these tumours have a worse prognosis than the ultramutated POLE-positive endometrioid endometrial carcinomas (EECs). We performed exome-sequencing of 11 EECs with matched normal tissue and subsequently validated 15 candidate genes in 76 samples. For the first time, we show that mutations in chromatin remodelling-related genes (KMT2D, KMT2C, SETD1B and BCOR) and in DNA-repair-related genes (BRCA1, BRCA2, RAD50 and CHD4) are frequent in this subtype of endometrial cancer. The alterations to these genes occurred with frequencies ranging from 35.5% for KMT2D to 10.5% for BRCA1 and BCOR, with some showing a tendency toward co-occurrence (RAD50-KMT2D and RAD50-SETD1B). All these genes harboured specific mutational hotspots. In addition, the mutational status of KMT2C, KMT2D and SETD1B helps to predict the degree of myometrial invasion, a critical prognostic feature. These results highlight the possible implication of these genes in this disease, creating opportunities for new therapeutic approaches. © 2016 UICC.

  18. Concurrent Oncogene Mutation Profile in Chinese Patients With Stage Ib Lung Adenocarcinoma

    PubMed Central

    Wen, Ying-Sheng; Cai, Ling; Zhang, Xue-wen; Zhu, Jian-fei; Zhang, Zi-chen; Shao, Jian-yong; Zhang, Lan-Jun

    2014-01-01

    Abstract Molecular characteristics in lung cancer are associated with carcinogenesis, response to targeted therapies, and prognosis. With concurrent oncogene mutations being reported more often, the adjustment of treatment based on the driver gene mutations would improve therapy. We proposed to investigate the distribution of concurrent oncogene mutations in stage Ib lung adenocarcinoma in a Chinese population and find out the correlation between survival outcome and the most frequently mutated genes in EGFR and KRAS in Chinese population. Simultaneously, we tried to validate the Sequenom method by real time fluoresce qualification reverse transcription polymerase chain reaction (RT-PCR) in oncogene detection. One hundred fifty-six patients who underwent complete surgical resection in our hospital between 1999 and 2007 were retrospectively investigated. Using time-of-flight mass spectrometry, 238 mutation hotspots in 19 oncogenes were examined. Genetic mutations occurred in 86 of 156 patients (55.13%). EGFR was most frequently gene contained driver mutations, with a rate of 44.23%, followed by KRAS (8.33%), PIK3CA (3.84%), KIT (3.20%), BRAF (2.56%), AKT (1.28%), MET (0.64%), NRAS (0.64%), HRAS (0.64%), and ERBB2 (0.64%). No mutations were found in the RET, PDGFRA, FGFR1, FGFR3, FLT3, ABL, CDK, or JAK2 oncogenes. Thirteen patients (8.3%) were detected in multiple gene mutations. Six patients had PIK3CA mutations in addition to mutations in EGFR and KRAS. EGFR mutations can coexist with mutations in NRAS, KIT, ERBB2, and BRAF. Only one case was found to have a KRAS mutation coexisting with the EGFR T790M mutation. Otherwise, mutations in EGFR and KRAS seem to be mutually exclusive. There is no survival benefit in favor of EGFR/KRAS mutation. Several concomitant driver gene mutations were observed in our study. None of EFGR/KRAS mutation was demonstrated as a prognostic factor. Polygenic mutation testing by time-of-flight mass spectrometry was validated by RT

  19. Identification of novel mutations in the XLRS1 gene in Chinese patients with X-linked juvenile retinoschisis.

    PubMed

    Zeng, Meizhen; Yi, Changxian; Guo, Xiangming; Jia, Xiaoyun; Deng, Yan; Wang, Juan; Shen, Huangxuan

    2007-01-01

    X-linked juvenile retinoschisis (XLRS) is a major cause of macular degeneration in young men. In this study we analyzed all six exons of the XLRS1 gene in four sporadic XLRS patients and in an affected family in China who were recently diagnosed. We found there are five different mutations with four containing missense point mutations and one having a frame-shift deletion. Among these mutations both c.644A>T and c.520delC are novel and have not been previously reported. Moreover all the second-generation offsprings and most of the third-generation ones in the affected family were found to carry the mutations bearing X chromosome. The discovery of novel mutations in the XLRS1 gene would increase the available information about the spectrum of genetic abnormalities causing XLRS. Although the limited data failed to reveal a correlation between mutations and disease phenotypes our identification of novel mutations in the XLRS1 gene will facilitate early and correct diagnosis and genetic counseling regarding the prognosis of XLRS disease.

  20. KRAS-G12C mutation is associated with poor outcome in surgically resected lung adenocarcinoma.

    PubMed

    Nadal, Ernest; Chen, Guoan; Prensner, John R; Shiratsuchi, Hiroe; Sam, Christine; Zhao, Lili; Kalemkerian, Gregory P; Brenner, Dean; Lin, Jules; Reddy, Rishindra M; Chang, Andrew C; Capellà, Gabriel; Cardenal, Felipe; Beer, David G; Ramnath, Nithya

    2014-10-01

    The aim of this study was to examine the effects of KRAS mutant subtypes on the outcome of patients with resected lung adenocarcinoma (AC). Using clinical and sequencing data, we identified 179 patients with resected lung AC for whom KRAS mutational status was determined. A multivariate Cox model was used to identify factors associated with disease-free survival (DFS) and overall survival (OS). Publicly available mutation and gene-expression data from lung cancer cell lines and lung AC were used to assess whether distinct KRAS mutant variants have a different profile. Patients with KRAS mutation had a significantly shorter DFS compared with those with KRAS wild-type (p = 0.009). Patients with KRAS-G12C mutant tumors had significantly shorter DFS compared with other KRAS mutants and KRAS wild-type tumors (p < 0.001). In the multivariate Cox model, KRAS-G12C remained as an independent prognostic marker for DFS (Hazard ratio = 2.46, 95% confidence interval 1.51-4.00, p < 0.001) and for OS (Hazard ratio = 2.35, 95% confidence interval 1.35-4.10, p = 0.003). No genes were statistically significant when comparing the mutational or transcriptional profile of lung cancer cell lines and lung AC harboring KRAS-G12C with other KRAS mutant subtypes. Gene set enrichment analysis revealed that KRAS-G12C mutants overexpressed epithelial to mesenchymal transition genes and expressed lower levels of genes predicting KRAS dependency. KRAS-G12C mutation is associated with worse DFS and OS in resected lung AC. Gene-expression profiles in lung cancer cell lines and surgically resected lung AC revealed that KRAS-G12C mutants had an epithelial to mesenchymal transition and a KRAS-independent phenotype.

  1. Structural analysis of chromosomal rearrangements associated with the developmental mutations Ph, W19H, and Rw on mouse chromosome 5.

    PubMed Central

    Nagle, D L; Martin-DeLeon, P; Hough, R B; Bućan, M

    1994-01-01

    We are studying the chromosomal structure of three developmental mutations, dominant spotting (W), patch (Ph), and rump white (Rw) on mouse chromosome 5. These mutations are clustered in a region containing three genes encoding tyrosine kinase receptors (Kit, Pdgfra, and Flk1). Using probes for these genes and for a closely linked locus, D5Mn125, we established a high-resolution physical map covering approximately 2.8 Mb. The entire chromosomal segment mapped in this study is deleted in the W19H mutation. The map indicates the position of the Ph deletion, which encompasses not more than 400 kb around and including the Pdgfra gene. The map also places the distal breakpoint of the Rw inversion to a limited chromosomal segment between Kit and Pdgfra. In light of the structure of the Ph-W-Rw region, we interpret the previously published complementation analyses as indicating that the pigmentation defect in Rw/+ heterozygotes could be due to the disruption of Kit and/or Pdgfra regulatory sequences, whereas the gene(s) responsible for the recessive lethality of Rw/Rw embryos is not closely linked to the Ph and W loci and maps proximally to the W19H deletion. The structural analysis of chromosomal rearrangements associated with W19H, Ph, and Rw combined with the high-resolution physical mapping points the way toward the definition of these mutations in molecular terms and isolation of homologous genes on human chromosome 4. Images PMID:8041773

  2. Allele-Specific Polymerase Chain Reaction for the Imatinib-Resistant KIT D816V and D816F Mutations in Mastocytosis and Acute Myelogenous Leukemia

    PubMed Central

    Corless, Christopher L.; Harrell, Patina; Lacouture, Mario; Bainbridge, Troy; Le, Claudia; Gatter, Ken; White, Clifton; Granter, Scott; Heinrich, Michael C.

    2006-01-01

    Oncogenic mutations of the receptor tyrosine kinase KIT contribute to the pathogenesis of gastrointestinal stromal tumors, systemic mastocytosis (SM), and some cases of acute myelogenous leukemia (AML). The D816V substitution in the activation loop of KIT results in relative resistance to the kinase inhibitor imatinib (Gleevec). Because this mutation occurs in 80 to 95% of adult SM, its detection has diagnostic and predictive significance. Unfortunately, the fraction of mutation-positive cells in clinical SM samples is often below the 20 to 30% threshold needed for detection by direct DNA sequencing. We have developed an allele-specific polymerase chain reaction assay using a mutation-specific primer combined with a wild-type blocking oligonucleotide that amplifies D816V at the level of 1% mutant allele in DNA extracted from formalin-fixed, paraffin-embedded tissue. There were no amplifications among 64 KIT wild-type tumors and cell lines, whereas all D816V-mutant samples (eight AML and 11 mast cell disease) were positive. Other D816 substitutions associated with resistance to imatinib in vitro are rare in SM. Among these D816F was detectable with the assay whereas D816H, D816Y, and D816G did not amplify. Nine biopsies (bone marrow, skin, or colon) with suspected SM were negative by denaturing high performance liquid chromatography and/or DNA sequencing but positive by allele-specific polymerase chain reaction. Thus, the assay may be useful in confirming the diagnosis of SM. PMID:17065430

  3. A single digital droplet PCR assay to detect multiple KIT exon 11 mutations in tumor and plasma from patients with gastrointestinal stromal tumors.

    PubMed

    Boonstra, Pieter A; Ter Elst, Arja; Tibbesma, Marco; Bosman, Lisette J; Mathijssen, Ron; Atrafi, Florence; van Coevorden, Frits; Steeghs, Neeltje; Farag, Sheima; Gelderblom, Hans; van der Graaf, Winette T A; Desar, Ingrid M E; Maier, Jacqueline; Overbosch, Jelle; Suurmeijer, Albert J H; Gietema, Jourik; Schuuring, Ed; Reyners, Anna K L

    2018-03-02

    Gastrointestinal stromal tumors (GISTs) are characterized by oncogenic KIT mutations that cluster in two exon 11 hotspots. The aim of this study was to develop a single, sensitive, quantitative digital droplet PCR (ddPCR) assay for the detection of common exon 11 mutations in both GIST tumor tissue and in circulating tumor DNA (ctDNA) isolated from GIST patients' plasma. A ddPCR assay was designed using two probes that cover both hotspots. Available archival FFPE tumor tissue from 27 consecutive patients with known KIT exon 11 mutations and 9 randomly selected patients without exon 11 mutations were tested. Plasma samples were prospectively collected in a multicenter bio-databank from December 2014. ctDNA was analyzed of 22 patients with an exon 11 mutation and a baseline plasma sample. The ddPCR assay detected the exon 11 mutation in 21 of 22 tumors with exon 11 mutations covered by the assay. Mutations in ctDNA were detected at baseline in 13 of 14 metastasized patients, but in only 1 of 8 patients with localized disease. In serial plasma samples from 11 patients with metastasized GIST, a decrease in mutant droplets was detected during treatment. According to RECIST 1.1, 10 patients had radiological treatment response and one patient stable disease. A single ddPCR assay for the detection of multiple exon 11 mutations in ctDNA is a feasible, promising tool for monitoring treatment response in patients with metastasized GIST and should be further evaluated in a larger cohort.

  4. Iron overload and HFE gene mutations in Polish patients with liver cirrhosis.

    PubMed

    Sikorska, Katarzyna; Romanowski, Tomasz; Stalke, Piotr; Iżycka-Świeszewska, Ewa; Bielawski, Krzysztof Piotr

    2011-06-01

    Increased liver iron stores may contribute to the progression of liver injury and fibrosis, and are associated with a higher risk of hepatocellular carcinoma development. Pre-transplant symptoms of iron overload in patients with liver cirrhosis are associated with higher risk of infectious and malignant complications in liver transplant recipients. HFE gene mutations may be involved in the pathogenesis of liver iron overload and influence the progression of chronic liver diseases of different origins. This study was designed to determine the prevalence of iron overload in relation to HFE gene mutations among Polish patients with liver cirrhosis. Sixty-one patients with liver cirrhosis included in the study were compared with a control group of 42 consecutive patients subjected to liver biopsy because of chronic liver diseases. Liver function tests and serum iron markers were assessed in both groups. All patients were screened for HFE mutations (C282Y, H63D, S65C). Thirty-six of 61 patients from the study group and all controls had liver biopsy performed with semiquantitative assessment of iron deposits in hepatocytes. The biochemical markers of iron overload and iron deposits in the liver were detected with a higher frequency (70% and 47% respectively) in patients with liver cirrhosis. There were no differences in the prevalence of all HFE mutations in both groups. In patients with a diagnosis of hepatocellular carcinoma, no significant associations with iron disorders and HFE gene mutations were found. Iron disorders were detected in patients with liver cirrhosis frequently but without significant association with HFE gene mutations. Only the homozygous C282Y mutation seems to occur more frequently in the selected population of patients with liver cirrhosis. As elevated biochemical iron indices accompanied liver iron deposits more frequently in liver cirrhosis compared to controls with chronic liver disease, there is a need for more extensive studies searching for

  5. Aarskog-Scott syndrome: clinical update and report of nine novel mutations of the FGD1 gene.

    PubMed

    Orrico, A; Galli, L; Faivre, L; Clayton-Smith, J; Azzarello-Burri, S M; Hertz, J M; Jacquemont, S; Taurisano, R; Arroyo Carrera, I; Tarantino, E; Devriendt, K; Melis, D; Thelle, T; Meinhardt, U; Sorrentino, V

    2010-02-01

    Mutations in the FGD1 gene have been shown to cause Aarskog-Scott syndrome (AAS), or facio-digito-genital dysplasia (OMIM#305400), an X-linked disorder characterized by distinctive genital and skeletal developmental abnormalities with a broad spectrum of clinical phenotypes. To date, 20 distinct mutations have been reported, but little phenotypic data are available on patients with molecularly confirmed AAS. In the present study, we report on our experience of screening for mutations in the FGD1 gene in a cohort of 60 European patients with a clinically suspected diagnosis of AAS. We identified nine novel mutations in 11 patients (detection rate of 18.33%), including three missense mutations (p.R402Q; p.S558W; p.K748E), four truncating mutations (p.Y530X; p.R656X; c.806delC; c.1620delC), one in-frame deletion (c.2020_2022delGAG) and the first reported splice site mutation (c.1935+3A>C). A recurrent mutation (p.R656X) was detected in three independent families. We did not find any evidence for phenotype-genotype correlations between type and position of mutations and clinical features. In addition to the well-established phenotypic features of AAS, other clinical features are also reported and discussed. Copyright 2010 Wiley-Liss, Inc.

  6. Hereditary cancer genes are highly susceptible to splicing mutations

    PubMed Central

    Soemedi, Rachel; Maguire, Samantha; Murray, Michael F.; Monaghan, Sean F.

    2018-01-01

    Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5′ and 3′ splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77%) of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36%) of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing. PMID:29505604

  7. Mutations in C8ORF37 cause Bardet Biedl syndrome (BBS21)

    PubMed Central

    Heon, Elise; Kim, Gunhee; Qin, Sophie; Garrison, Janelle E.; Tavares, Erika; Vincent, Ajoy; Nuangchamnong, Nina; Scott, C. Anthony; Slusarski, Diane C.; Sheffield, Val C.

    2016-01-01

    Bardet Biedl syndrome (BBS) is a multisystem genetically heterogeneous ciliopathy that most commonly leads to obesity, photoreceptor degeneration, digit anomalies, genito-urinary abnormalities, as well as cognitive impairment with autism, among other features. Sequencing of a DNA sample from a 17-year-old female affected with BBS did not identify any mutation in the known BBS genes. Whole-genome sequencing identified a novel loss-of-function disease-causing homozygous mutation (K102*) in C8ORF37, a gene coding for a cilia protein. The proband was overweight (body mass index 29.1) with a slowly progressive rod-cone dystrophy, a mild learning difficulty, high myopia, three limb post-axial polydactyly, horseshoe kidney, abnormally positioned uterus and elevated liver enzymes. Mutations in C8ORF37 were previously associated with severe autosomal recessive retinal dystrophies (retinitis pigmentosa RP64 and cone-rod dystrophy CORD16) but not BBS. To elucidate the functional role of C8ORF37 in a vertebrate system, we performed gene knockdown in Danio rerio and assessed the cardinal features of BBS and visual function. Knockdown of c8orf37 resulted in impaired visual behavior and BBS-related phenotypes, specifically, defects in the formation of Kupffer’s vesicle and delays in retrograde transport. Specificity of these phenotypes to BBS knockdown was shown with rescue experiments. Over-expression of human missense mutations in zebrafish also resulted in impaired visual behavior and BBS-related phenotypes. This is the first functional validation and association of C8ORF37 mutations with the BBS phenotype, which identifies BBS21. The zebrafish studies hereby show that C8ORF37 variants underlie clinically diagnosed BBS-related phenotypes as well as isolated retinal degeneration. PMID:27008867

  8. Mutations of E3 Ubiquitin Ligase Cbl Family Members Constitute a Novel Common Pathogenic Lesion in Myeloid Malignancies

    PubMed Central

    Makishima, Hideki; Cazzolli, Heather; Szpurka, Hadrian; Dunbar, Andrew; Tiu, Ramon; Huh, Jungwon; Muramatsu, Hideki; O'Keefe, Christine; Hsi, Eric; Paquette, Ronald L.; Kojima, Seiji; List, Alan F.; Sekeres, Mikkael A.; McDevitt, Michael A.; Maciejewski, Jaroslaw P.

    2009-01-01

    Purpose Acquired somatic uniparental disomy (UPD) is commonly observed in myelodysplastic syndromes (MDS), myelodysplastic/myeloproliferative neoplasms (MDS/MPN), or secondary acute myelogenous leukemia (sAML) and may point toward genes harboring mutations. Recurrent UPD11q led to identification of homozygous mutations in c-Cbl, an E3 ubiquitin ligase involved in attenuation of proliferative signals transduced by activated receptor tyrosine kinases. We examined the role and frequency of Cbl gene family mutations in MPN and related conditions. Methods We applied high-density SNP-A karyotyping to identify loss of heterozygosity of 11q in 442 patients with MDS, MDS/MPN, MPN, sAML evolved from these conditions, and primary AML. We sequenced c-Cbl, Cbl-b, and Cbl-c in patients with or without corresponding UPD or deletions and correlated mutational status with clinical features and outcomes. Results We identified c-Cbl mutations in 5% and 9% of patients with chronic myelomonocytic leukemia (CMML) and sAML, and also in CML blast crisis and juvenile myelomonocytic leukemia (JMML). Most mutations were homozygous and affected c-Cbl; mutations in Cbl-b were also found in patients with similar clinical features. Patients with Cbl family mutations showed poor prognosis, with a median survival of 5 months. Pathomorphologic features included monocytosis, monocytoid blasts, aberrant expression of phosphoSTAT5, and c-kit overexpression. Serial studies showed acquisition of c-Cbl mutations during malignant evolution. Conclusion Mutations in the Cbl family RING finger domain or linker sequence constitute important pathogenic lesions associated with not only preleukemic CMML, JMML, and other MPN, but also progression to AML, suggesting that impairment of degradation of activated tyrosine kinases constitutes an important cancer mechanism. PMID:19901108

  9. Novel de novo nonsense mutation of the PHEX gene (p.Lys50Ter) in a Chinese patient with hypophosphatemic rickets.

    PubMed

    Huang, Yanru; Mei, Libin; Pan, Qian; Tan, Hu; Quan, Yi; Gui, Baoheng; Chang, Jiazhen; Ma, Ruiyu; Peng, Ying; Yang, Pu; Liang, Desheng; Wu, Lingqian

    2015-07-01

    X-linked hypophosphatemic rickets (XLHR), the most common form of inherited rickets, is a dominant disorder characterized by hypophosphatemia, abnormal bone mineralization, and short stature. Mutations in the PHEX gene are major causes of XLHR. Herein, we clinically characterized four unrelated families with hypophosphatemia, bone abnormalities, short stature, and dentin malformation. Mutational analysis of the PHEX gene using Sanger sequencing revealed three recurrent mutations (c.2197T>C, c.1646G>C, and c.2198G>A) and a de novo nonsense mutation (c.148A>T). The novel mutation was not found in any of the unaffected family members or in the 100 healthy controls and was predicted to produce a truncated protein (p.K50X), a truncated form of the PHEX protein caused by nonsense mutations has been frequently detected in XLHR individuals. Thus, our work indicated that the c.148A>T (p.K50X) mutation was the likely pathogenic mutation in individual III-2 in family 2, and that PHEX gene mutations were responsible for XLHR in these Chinese families. These findings expand the mutation spectrum of PHEX and may help us to understand the molecular basis of XLHR in order to facilitate genetic counseling. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Three cases with L1 syndrome and two novel mutations in the L1CAM gene.

    PubMed

    Marín, Rosario; Ley-Martos, Miriam; Gutiérrez, Gema; Rodríguez-Sánchez, Felicidad; Arroyo, Diego; Mora-López, Francisco

    2015-11-01

    Mutations in the L1CAM gene have been identified in the following various X-linked neurological disorders: congenital hydrocephalus; mental retardation, aphasia, shuffling gait, and adducted thumbs (MASA) syndrome; spastic paraplegia; and agenesis of the corpus callosum. These conditions are currently considered different phenotypes of a single entity known as L1 syndrome. We present three families with L1 syndrome. Sequencing of the L1CAM gene allowed the identification of the following mutations involved: a known splicing mutation (c.3531-12G>A) and two novel ones: a missense mutation (c.1754A>C; p.Asp585Ala) and a nonsense mutation (c.3478C>T; p.Gln1160Stop). The number of affected males and carrier females identified in a relatively small population suggests that L1 syndrome may be under-diagnosed. L1 syndrome should be considered in the differential diagnosis of intellectual disability or mental retardation in children, especially when other signs such as hydrocephalus or adducted thumbs are present.

  11. Mutation screening of X-chromosomal neuroligin genes: no mutations in 196 autism probands.

    PubMed

    Vincent, John B; Kolozsvari, Debbie; Roberts, Wendy S; Bolton, Patrick F; Gurling, Hugh M D; Scherer, Stephen W

    2004-08-15

    Autism, a childhood neuropsychiatric disorder with a strong genetic component, is currently the focus of considerable attention within the field of human genetics as well many other medical-related disciplines. A recent study has implicated two X-chromosomal neuroligin genes, NLGN3 and NLGN4, as having an etiological role in autism, having identified a frameshift mutation in one gene and a substitution mutation in the other, segregating in multiplex autism spectrum families (Jamain et al. [2003: Nat Genet 34:27-29]). The function of neuroligin as a trigger for synapse formation would suggest that such mutations would likely result in some form of pathological manifestation. Our own study, screening a larger sample of 196 autism probands, failed to identify any mutations that would affect the coding regions of these genes. Our findings suggest that mutations in these two genes are infrequent in autism. Copyright 2004 Wiley-Liss, Inc.

  12. Seventeen Novel Mutations in PCCA and PCCB Genes in Indian Propionic Acidemia Patients, and Their Outcomes.

    PubMed

    Gupta, Deepti; Bijarnia-Mahay, Sunita; Kohli, Sudha; Saxena, Renu; Puri, Ratna Dua; Shigematsu, Yosuke; Yamaguchi, Seiji; Sakamoto, Osamu; Gupta, Neerja; Kabra, Madhulika; Thakur, Seema; Deb, Roumi; Verma, Ishwar Chander

    2016-07-01

    The goal of this study was to identify mutations in the propionyl-CoA carboxylase alpha subunit (PCCA) and propionyl-CoA carboxylase beta subunit (PCCB) genes, and to assess their effects on propionic academia (PA) patients. Twenty-five Indian children with PA were enrolled in this study. Bidirectional Sanger sequencing was performed on both the coding and flanking regions of the PCCA and PCCB genes and the chromatograms were analyzed. Bioinformatic tools were used to classify novel variations into pathogenic or benign. The majority of the cases (19/25, 76%) were of the early-onset (<90 days of age) type and 5 were of the late-onset type. The majority of patients had mutations in the PCCA gene (18/25). A total of 26 mutations were noted: 20 in the PCCA gene and 6 in PCCB gene. Seventeen mutations were novel (14 in PCCA and 3 in PCCB). The SNP c.937C>T (p.Arg313Ter), was noted in 9/36 (25%) alleles in the PCCA gene. All of the children were symptomatic and only three survived who are doing well with no major disabilities. The spectrum of mutations in the PCCA and PCCB genes among Indians is distinct from other populations. The absence of a common mutation signifies the heterogeneity and admixture of various subpopulations. These findings also suggest that individuals of Indian origin may not benefit from the mutation-based "carrier screening panels" offered by many genetic laboratories.

  13. A novel silent deletion, an insertion mutation and a nonsense mutation in the TCOF1 gene found in two Chinese cases of Treacher Collins syndrome.

    PubMed

    Wang, Yan; Yin, Xiao-Juan; Han, Tao; Peng, Wei; Wu, Hong-Lin; Liu, Xin; Feng, Zhi-Chun

    2014-12-01

    Treacher Collins syndrome (TCS) is the most common and well-known craniofacial disorder caused by mutations in the genes involved in pre-rRNA transcription, which include the TCOF1 gene. This study explored the role of TCOF1 mutations in Chinese patients with TCS. Mutational analysis of the TCOF1 gene was performed in three patients using polymerase chain reaction and direct sequencing. Among these three patients, two additional TCOF1 variations, a novel 18 bp deletion and a novel 1 bp insertion mutation, were found in patient 1, together with a novel nonsense mutation (p.Ser476X) and a previously reported 4 bp deletion (c.1872_1875delTGAG) in other patients. Pedigree analysis allowed for prediction of the character of the mutation, which was either pathological or not. The 18 bp deletion of six amino acids, Ser-Asp-Ser-Glu-Glu-Glu (798*803), which was located in the CKII phosphorylation site of treacle, seemed relatively benign for TCS. By contrast, another novel mutation of c.1072_1073insC (p.Gln358ProfsX23) was a frameshift mutation and expected to result in a premature stop codon. This study provides insights into the functional domain of treacle and illustrates the importance of clinical and family TCS screening for the interpretation of novel sequence alterations.

  14. Efficient gene-driven germ-line point mutagenesis of C57BL/6J mice

    PubMed Central

    Michaud, Edward J; Culiat, Cymbeline T; Klebig, Mitchell L; Barker, Paul E; Cain, KT; Carpenter, Debra J; Easter, Lori L; Foster, Carmen M; Gardner, Alysyn W; Guo, ZY; Houser, Kay J; Hughes, Lori A; Kerley, Marilyn K; Liu, Zhaowei; Olszewski, Robert E; Pinn, Irina; Shaw, Ginger D; Shinpock, Sarah G; Wymore, Ann M; Rinchik, Eugene M; Johnson, Dabney K

    2005-01-01

    Background Analysis of an allelic series of point mutations in a gene, generated by N-ethyl-N-nitrosourea (ENU) mutagenesis, is a valuable method for discovering the full scope of its biological function. Here we present an efficient gene-driven approach for identifying ENU-induced point mutations in any gene in C57BL/6J mice. The advantage of such an approach is that it allows one to select any gene of interest in the mouse genome and to go directly from DNA sequence to mutant mice. Results We produced the Cryopreserved Mutant Mouse Bank (CMMB), which is an archive of DNA, cDNA, tissues, and sperm from 4,000 G1 male offspring of ENU-treated C57BL/6J males mated to untreated C57BL/6J females. Each mouse in the CMMB carries a large number of random heterozygous point mutations throughout the genome. High-throughput Temperature Gradient Capillary Electrophoresis (TGCE) was employed to perform a 32-Mbp sequence-driven screen for mutations in 38 PCR amplicons from 11 genes in DNA and/or cDNA from the CMMB mice. DNA sequence analysis of heteroduplex-forming amplicons identified by TGCE revealed 22 mutations in 10 genes for an overall mutation frequency of 1 in 1.45 Mbp. All 22 mutations are single base pair substitutions, and nine of them (41%) result in nonconservative amino acid substitutions. Intracytoplasmic sperm injection (ICSI) of cryopreserved spermatozoa into B6D2F1 or C57BL/6J ova was used to recover mutant mice for nine of the mutations to date. Conclusions The inbred C57BL/6J CMMB, together with TGCE mutation screening and ICSI for the recovery of mutant mice, represents a valuable gene-driven approach for the functional annotation of the mammalian genome and for the generation of mouse models of human genetic diseases. The ability of ENU to induce mutations that cause various types of changes in proteins will provide additional insights into the functions of mammalian proteins that may not be detectable by knockout mutations. PMID:16300676

  15. In vivo levels of S-adenosylmethionine modulate C:G to T:A mutations associated with repeat-induced point mutation in Neurospora crassa.

    PubMed

    Rosa, Alberto Luis; Folco, Hernán Diego; Mautino, Mario Ricardo

    2004-04-14

    In Neurospora crassa, the mutagenic process termed repeat-induced point mutation (RIP) inactivates duplicated DNA sequences during the sexual cycle by the introduction of C:G to T:A transition mutations. In this work, we have used a collection of N. crassa strains exhibiting a wide range of cellular levels of S-adenosylmethionine (AdoMet), the universal donor of methyl groups, to explore whether frequencies of RIP are dependent on the cellular levels of this metabolite. Mutant strains met-7 and eth-1 carry mutations in genes of the AdoMet pathway and have low levels of AdoMet. Wild type strains with high levels of AdoMet were constructed by introducing a chimeric transgene of the AdoMet synthetase (AdoMet-S) gene fused to the constitutive promoter trpC from Aspergillus nidulans. Crosses of these strains against tester duplications of the pan-2 and am genes showed that frequencies of RIP, as well as the total number of C:G to T:A transition mutations found in randomly selected am(RIP) alleles, are inversely correlated to the cellular level of AdoMet. These results indicate that AdoMet modulates the biochemical pathway leading to RIP.

  16. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

    PubMed Central

    Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

    2017-01-01

    Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

  17. Gata4-Dependent Differentiation of c-Kit+ Derived Endothelial Cells Underlies Artefactual Cardiomyocyte Regeneration in the Heart.

    PubMed

    Maliken, Bryan D; Kanisicak, Onur; Karch, Jason; Khalil, Hadi; Fu, Xing; Boyer, Justin G; Prasad, Vikram; Zheng, Yi; Molkentin, Jeffery D

    2018-04-17

    Background -While c-Kit + adult progenitor cells were initially reported to produce new cardiomyocytes in the heart, recent genetic evidence suggests that such events are exceedingly rare. However, to determine if these rare events represent true de novo cardiomyocyte formation we deleted the necessary cardiogenic transcription factors Gata4 and Gata6 from c-Kit-expressing cardiac progenitor cells (CPCs). Methods - Kit allele-dependent lineage tracing and fusion analysis was performed in mice following simultaneous Gata4 and Gata6 cell-type specific deletion to examine rates of putative de novo cardiomyocyte formation from c-Kit + cells. Bone marrow transplantation experiments were used to define the contribution of Kit allele-derived hematopoietic cells versus Kit lineage-dependent cells endogenous to the heart in contributing to apparent de novo lineage-traced cardiomyocytes. A Tie2 CreERT2 transgene was also used to examine the global impact of Gata4 deletion on the mature cardiac endothelial cell network, which was further evaluated with select angiogenesis assays. Results -Deletion of Gata4 in Kit lineage-derived endothelial cells or in total endothelial cells using the Tie2 CreERT2 transgene, but not from bone morrow cells, resulted in profound endothelial cell expansion, defective endothelial cell differentiation, leukocyte infiltration into the heart and a dramatic increase in Kit allele-dependent lineage-traced cardiomyocytes. However, this increase in labeled cardiomyocytes was an artefact of greater leukocyte-cardiomyocyte cellular fusion due to defective endothelial cell differentiation in the absence of Gata4 Conclusions -Past identification of presumed de novo cardiomyocyte formation in the heart from c-Kit + cells using Kit allele lineage tracing appears to be an artefact of labeled leukocyte fusion with cardiomyocytes. Deletion of Gata4 from c-Kit + endothelial progenitor cells or adult endothelial cells negatively impacted angiogenesis and

  18. AB071. Mutations of AR gene in Vietnamese patients: genotype and phenotype

    PubMed Central

    Dung, Vu Chi; Fukami, Maki; Ngoc, Can Thi Bich; Thao, Bui Phuong; Khanh, Nguyen Ngoc; Nga, Pham Thu; Dat, Nguyen Phu; Ogata, Tsutomu

    2015-01-01

    Androgen insensitivity syndrome (AIS) is the most common specific cause of 46,XY disorder in sex development. The androgen signaling pathway is complex but so far, the only gene linked with AIS is the androgen receptor (AR). Mutations in the AR are found in most subjects with complete AIS but in partial AIS, the rate has varied 28-73%, depending on the case selection. More than over 800 entries of mutations causing AIS, representing over 500 different AR mutations from more than 850 patients with AIS have been reported. We aim to describe clinical manifestations and to identify mutation of AR in Vietnamese patients with AIS. This case series study included 12 patients from 9 unrelated families with AIS. The gonadal position and external genitalia were evaluated clinically and using ultrasound. The mutation analysis of AR was performed using PCR and direct sequencing. The age of diagnosis was 1 to 83 years old. 8/12 cases were complete androgen insensitivity syndrome (CAIS) (female external genitalia) and 4 cases were predominantly female partial AIS phenotype. Four cases had two labial testes, six cases had inguinal testes and two cases had abdominal testes. Five different mutations of AR were identified from seven cases of three unrelated families including three novel ones. The novel missense mutation p.L701F (c.2103G > T) was identified in a patient of 83 years of age. The novel missense mutation p.L705F (c.2113C > T) was identified in two sibs. The novel mutation p. W752S (c.2256G > T) was identified in a child with CAIS phenotype and had family history. The reported missense mutation p.V747M was identified in two sibs. The reported mutation p.V867M (c.2599G > A) was identified in a child with female phenotype. Our study identified three novel and two reported mutation in the AR gene that may provide us new insights into the molecular mechanisms of AIS. The expanded database of these mutations should benefit patients in the diagnosis and treatment of this

  19. Simulation of gene evolution under directional mutational pressure

    NASA Astrophysics Data System (ADS)

    Dudkiewicz, Małgorzata; Mackiewicz, Paweł; Kowalczuk, Maria; Mackiewicz, Dorota; Nowicka, Aleksandra; Polak, Natalia; Smolarczyk, Kamila; Banaszak, Joanna; R. Dudek, Mirosław; Cebrat, Stanisław

    2004-05-01

    The two main mechanisms generating the genetic diversity, mutation and recombination, have random character but they are biased which has an effect on the generation of asymmetry in the bacterial chromosome structure and in the protein coding sequences. Thus, like in a case of two chiral molecules-the two possible orientations of a gene in relation to the topology of a chromosome are not equivalent. Assuming that the sequence of a gene may oscillate only between certain limits of its structural composition means that the gene could be forced out of these limits by the directional mutation pressure, in the course of evolution. The probability of the event depends on the time the gene stays under the same mutation pressure. Inversion of the gene changes the directional mutational pressure to the reciprocal one and hence it changes the distance of the gene to its lower and upper bound of the structural tolerance. Using Monte Carlo methods we were able to simulate the evolution of genes under experimentally found mutational pressure, assuming simple mechanisms of selection. We found that the mutation and recombination should work in accordance to lower their negative effects on the function of the products of coding sequences.

  20. [Detection of gene mutation in glucose-6-phosphate dehydrogenase deficiency by RT-PCR sequencing].

    PubMed

    Lyu, Rong-Yu; Chen, Xiao-Wen; Zhang, Min; Chen, Yun-Sheng; Yu, Jie; Wen, Fei-Qiu

    2016-07-01

    Since glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common hereditary hemolytic erythrocyte enzyme deficiency, most cases have single nucleotide mutations in the coding region, and current test methods for gene mutation have some missed detections, this study aimed to investigate the feasibility of RT-PCR sequencing in the detection of gene mutation in G6PD deficiency. According to the G6PD/6GPD ratio, 195 children with anemia of unknown cause or who underwent physical examination between August 2013 and July 2014 were classified into G6PD-deficiency group with 130 children (G6PD/6GPD ratio <1.00) and control group with 65 children (G6PD/6GPD ratio≥1.00). The primer design and PCR amplification conditions were optimized, and RT-PCR sequencing was used to analyze the complete coding sequence and verify the genomic DNA sequence in the two groups. In the G6PD-deficiency group, the detection rate of gene mutation was 100% and 13 missense mutations were detected, including one new mutation. In the control group, no missense mutation was detected in 28 boys; 13 heterozygous missense mutations, 1 homozygous same-sense mutation (C1191T) which had not been reported in China and abroad, and 14 single nucleotide polymorphisms of C1311T were detected in 37 girls. The control group showed a high rate of missed detection of G6PD deficiency (carriers) in the specimens from girls (35%, 13/37). RT-PCR sequencing has a high detection rate of G6PD gene mutation and a certain value in clinical diagnosis of G6PD deficiency.

  1. NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.

    PubMed

    Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran

    2017-09-01

    To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.

  2. Recurrent mutations in the CDKL5 gene: genotype-phenotype relationships.

    PubMed

    Bahi-Buisson, Nadia; Villeneuve, Nathalie; Caietta, Emilie; Jacquette, Aurélia; Maurey, Helene; Matthijs, Gert; Van Esch, Hilde; Delahaye, Andrée; Moncla, Anne; Milh, Mathieu; Zufferey, Flore; Diebold, Bertrand; Bienvenu, Thierry

    2012-07-01

    Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been described in epileptic encephalopathies in females with infantile spasms with features that overlap with Rett syndrome. With more than 80 reported patients, the phenotype of CDKL5-related encephalopathy is well-defined. The main features consist of seizures starting before 6 months of age, severe intellectual disability with absent speech and hand stereotypies and deceleration of head growth, which resembles Rett syndrome. However, some clinical discrepancies suggested the influence of genetics and/or environmental factors. No genotype-phenotype correlation has been defined and thus there is a need to examine individual mutations. In this study, we analyzed eight recurrent CDKL5 mutations to test whether the clinical phenotype of patients with the same mutation is similar and whether patients with specific CDKL5 mutations have a milder phenotype than those with other CDKL5 mutations. Patients bearing missense mutations in the ATP binding site such as the p.Ala40Val mutation typically walked unaided, had normocephaly, better hand use ability, and less frequent refractory epilepsy when compared to girls with other CDKL5 mutations. In contrast, patients with mutations in the kinase domain (such as p.Arg59X, p.Arg134X, p.Arg178Trp/Pro/Gln, or c.145 + 2T > C) and frameshift mutations in the C-terminal region (such as c.2635_2636delCT) had a more severe phenotype with infantile spasms, refractory epileptic encephalopathy, absolute microcephaly, and inability to walk. It is important for clinicians to have this information when such patients are diagnosed. Copyright © 2012 Wiley Periodicals, Inc.

  3. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    PubMed

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  4. Novel C12orf65 mutations in patients with axonal neuropathy and optic atrophy.

    PubMed

    Tucci, Arianna; Liu, Yo-Tsen; Preza, Elisabeth; Pitceathly, Robert D S; Chalasani, Annapurna; Plagnol, Vincent; Land, John M; Trabzuni, Daniah; Ryten, Mina; Jaunmuktane, Zane; Reilly, Mary M; Brandner, Sebastian; Hargreaves, Iain; Hardy, John; Singleton, Andrew B; Abramov, Andrey Y; Houlden, Henry

    2014-05-01

    Charcot-Marie Tooth disease (CMT) forms a clinically and genetically heterogeneous group of disorders. Although a number of disease genes have been identified for CMT, the gene discovery for some complex form of CMT has lagged behind. The association of neuropathy and optic atrophy (also known as CMT type 6) has been described with autosomaldominant, recessive and X-linked modes of inheritance. Mutations in Mitofusin 2 have been found to cause dominant forms of CMT6. Phosphoribosylpyrophosphate synthetase-I mutations cause X-linked CMT6, but until now, mutations in the recessive forms of disease have never been identified. We here describe a family with three affected individuals who inherited in an autosomal recessive fashion a childhood onset neuropathy and optic atrophy. Using homozygosity mapping in the family and exome sequencing in two affected individuals we identified a novel protein-truncating mutation in the C12orf65 gene, which encodes for a protein involved in mitochondrial translation. Using a variety of methods we investigated the possibility of mitochondrial impairment in the patients cell lines. We described a large consanguineous family with neuropathy and optic atrophy carrying a loss of function mutation in the C12orf65 gene. We report mitochondrial impairment in the patients cell lines, followed by multiple lines of evidence which include decrease of complex V activity and stability (blue native gel assay), decrease in mitochondrial respiration rate and reduction of mitochondrial membrane potential. This work describes a mutation in the C12orf65 gene that causes recessive form of CMT6 and confirms the role of mitochondrial dysfunction in this complex axonal neuropathy.

  5. Activating cysteinyl leukotriene receptor 2 (CYSLTR2) mutations in blue nevi

    PubMed Central

    Möller, Inga; Murali, Rajmohan; Müller, Hansgeorg; Wiesner, Thomas; Jackett, Louise A; Scholz, Simone L; Cosgarea, Ioana; van de Nes, Johannes AP; Sucker, Antje; Hillen, Uwe; Schilling, Bastian; Paschen, Annette; Kutzner, Heinz; Rütten, Arno; Böckers, Martin; Scolyer, Richard A; Schadendorf, Dirk; Griewank, Klaus G

    2017-01-01

    Blue nevi are common melanocytic tumors arising in the dermal layer of the skin. Similar to uveal melanomas, blue nevi frequently harbor GNAQ and GNA11 mutations. Recently, recurrent CYSLTR2 and PLCB4 mutations were identified in uveal melanomas not harboring GNAQ or GNA11 mutations. All four genes (GNAQ, GNA11, CYSLTR2, and PLCB4) code for proteins involved in the same signaling pathway, which is activated by mutations in these genes. Given the related functional consequences of these mutations and the known genetic similarities between uveal melanoma and blue nevi, we analyzed a cohort of blue nevi to investigate whether CYSLTR2 and PLCB4 mutations occur in tumors lacking GNAQ or GNA11 mutations (as in uveal melanoma). A targeted next-generation sequencing assay covering known activating mutations in GNAQ, GNA11, CYSLTR2, PLCB4, KIT, NRAS, and BRAF was applied to 103 blue nevi. As previously reported, most blue nevi were found to harbor activating mutations in GNAQ (59%, n = 61), followed by less frequent mutations in GNA11 (16%, n = 17). Additionally, one BRAF (1%) and three NRAS (3%) mutations were detected. In three tumors (3%) harboring none of the aforementioned gene alterations, CYSLTR2 mutations were identified. All three CYSLTR2 mutations were the same c.386T > A, L129Q mutation previously identified in uveal melanoma that has been shown to lead to increased receptor activation and signaling. In summary, our study identifies CYSLTR2 L129Q alterations as a previously unrecognized activating mutation in blue nevi, occuring in a mutually exclusive fashion with known GNAQ and GNA11 mutations. Similar to GNAQ and GNA11 mutations, CYSLTR2 mutations, when present, are likely defining pathogenetic events in blue nevi. PMID:27934878

  6. Activating cysteinyl leukotriene receptor 2 (CYSLTR2) mutations in blue nevi.

    PubMed

    Möller, Inga; Murali, Rajmohan; Müller, Hansgeorg; Wiesner, Thomas; Jackett, Louise A; Scholz, Simone L; Cosgarea, Ioana; van de Nes, Johannes Ap; Sucker, Antje; Hillen, Uwe; Schilling, Bastian; Paschen, Annette; Kutzner, Heinz; Rütten, Arno; Böckers, Martin; Scolyer, Richard A; Schadendorf, Dirk; Griewank, Klaus G

    2017-03-01

    Blue nevi are common melanocytic tumors arising in the dermal layer of the skin. Similar to uveal melanomas, blue nevi frequently harbor GNAQ and GNA11 mutations. Recently, recurrent CYSLTR2 and PLCB4 mutations were identified in uveal melanomas not harboring GNAQ or GNA11 mutations. All four genes (GNAQ, GNA11, CYSLTR2, and PLCB4) code for proteins involved in the same signaling pathway, which is activated by mutations in these genes. Given the related functional consequences of these mutations and the known genetic similarities between uveal melanoma and blue nevi, we analyzed a cohort of blue nevi to investigate whether CYSLTR2 and PLCB4 mutations occur in tumors lacking GNAQ or GNA11 mutations (as in uveal melanoma). A targeted next-generation sequencing assay covering known activating mutations in GNAQ, GNA11, CYSLTR2, PLCB4, KIT, NRAS, and BRAF was applied to 103 blue nevi. As previously reported, most blue nevi were found to harbor activating mutations in GNAQ (59%, n=61), followed by less frequent mutations in GNA11 (16%, n=17). Additionally, one BRAF (1%) and three NRAS (3%) mutations were detected. In three tumors (3%) harboring none of the aforementioned gene alterations, CYSLTR2 mutations were identified. All three CYSLTR2 mutations were the same c.386T>A, L129Q mutation previously identified in uveal melanoma that has been shown to lead to increased receptor activation and signaling. In summary, our study identifies CYSLTR2 L129Q alterations as a previously unrecognized activating mutation in blue nevi, occuring in a mutually exclusive fashion with known GNAQ and GNA11 mutations. Similar to GNAQ and GNA11 mutations, CYSLTR2 mutations, when present, are likely defining pathogenetic events in blue nevi.

  7. A novel intronic mutation in the DDP1 gene in a family with X-linked dystonia-deafness syndrome.

    PubMed

    Ezquerra, Mario; Campdelacreu, Jaume; Muñoz, Esteban; Tolosa, Eduardo; Martí, María J

    2005-02-01

    X-linked dystonia-deafness syndrome (Mohr-Tranebjaerg syndrome) is a rare neurodegenerative disease characterized by hearing loss and dystonia. So far, 7 mutations in the coding region of the DDP1 gene have been described. They consist of frameshift, nonsense, missense mutations or deletions. To investigate the presence of mutations in the DDP1 gene in a family with dystonia-deafness syndrome. Seven members belonging to 2 generations of a family with 2 affected subjects underwent genetic analysis. Mutational screening in the DDP1 gene was made through DNA direct sequencing. We found an intronic mutation in the DDP1 gene. It consists of an A-to-C substitution in the position -23 in reference to the first nucleotide of exon 2 (IVS1-23A>C). The mutation was present in 2 affected men and their respective unaffected mothers, whereas it was absent in the healthy men from this family and in 90 healthy controls. Intronic mutations in the DDP1 gene can also cause X-linked dystonia-deafness syndrome. In our case, the effect of the mutation could be due to a splicing alteration.

  8. Progressive external ophthalmoplegia (PEO) due to a mutation in the C10orf2 (PEO1) gene mimicking a myasthenic crisis.

    PubMed

    Gonzalez-Moron, Dolores; Bueri, Jose; Kauffman, Marcelo Andres

    2013-09-07

    We described a case of a patient with autosomal dominant progressive external ophthalmoplegia (PEO) who presented with the acute onset dysphagia, quadriparesis, ptosis and respiratory insufficiency following a cardiac procedure and mimicking a myasthenic crisis. A pathogenic mutation in the C10orf2 (PEO1) gene was confirmed. The unusual presentation of our patient contributes to expand the clinical phenotype of PEO1 mutations and reinforces the need to consider mitochondrial myopathy as differential diagnosis of myasthenia gravis even in the case of acute onset symptoms.

  9. ADAMTS13 Gene Mutations in Children with Hemolytic Uremic Syndrome

    PubMed Central

    Choi, Hyoung Soo; Cheong, Hae Il; Kim, Nam Keun

    2011-01-01

    We investigated ADAMTS13 activity as well as the ADAMTS13 gene mutation in children with hemolytic uremic syndrome (HUS). Eighteen patients, including 6 diarrhea-negative (D-HUS) and 12 diarrhea-associated HUS (D+HUS) patients, were evaluated. The extent of von Willebrand factor (VWF) degradation was assayed by multimer analysis, and all exons of the ADAMTS13 gene were PCR-amplified using Taq DNA polymerase. The median and range for plasma activity of ADAMTS13 in 6 D-HUS and 12 D+HUS patients were 71.8% (22.8-94.1%) and 84.9% (37.9-119.9%), respectively, which were not statistically significantly different from the control group (86.4%, 34.2-112.3%) (p>0.05). Five ADAMTS13 gene mutations, including 2 novel mutations [1584+2T>A, 3941C>T (S1314L)] and 3 polymorphisms (Q448E, P475S, S903L), were found in 2 D-HUS and one D+HUS patients, which were not associated with deficiency of ADAMTS13 activity. Whether these mutations without reduced ADAMTS13 activity are innocent bystanders or predisposing factors in HUS remains unanswered. PMID:21488199

  10. Myostatin gene mutated mice induced with tale nucleases.

    PubMed

    Zhou, Fangfang; Sun, Ruilin; Chen, Hongyan; Fei, Jian; Lu, Daru

    2015-01-01

    Myostain gene (MSTN) is expressed primarily in skeletal muscle, and negatively regulates skeletal muscle mass; it has been suggested that mice with MSTN inhibition have reduced adiposity and improved insulin sensitivity. Therefore, it is important to establish a fast and effective gene editing method. In this report, we established the myostatin mutated-mouse model by microinjection of Transcription Activator-Like Effector Nucleases (TALENs) mRNA within the mouse fertilized oocytes and achieved high rates of mutagenesis of the mouse MSTN in C57BL/6J. Six of 45 born mice carried target mutations and we appointed one as the parental mating with wild mouse to produce the F1 and backcross to produce the F2 generation. All the mutations of the mice were examined quickly and efficiently by high-resolution melting curve analysis (HRMA) and then verified by direct sequencing. We obtained the homozygous of the F2 generation which transmitted the mutant alleles to the progeny with 100% efficiency. Mutant mice exhibited increases in muscle mass comparable to those observed in wild-type mice. Therefore, combining TALEN-mediated gene targeting with HRMA technology is a superior method of constructing genetically modified mice through microinjection in the mouse fertilized oocytes with high efficiency and short time of selection.

  11. Prevalence and Spectrum of Germline Cancer Susceptibility Gene Mutations Among Patients With Early-Onset Colorectal Cancer

    PubMed Central

    Pearlman, Rachel; Frankel, Wendy L.; Swanson, Benjamin; Zhao, Weiqiang; Yilmaz, Ahmet; Miller, Kristin; Bacher, Jason; Bigley, Christopher; Nelsen, Lori; Goodfellow, Paul J.; Goldberg, Richard M.; Paskett, Electra; Shields, Peter G.; Freudenheim, Jo L.; Stanich, Peter P; Lattimer, Ilene; Arnold, Mark; Liyanarachchi, Sandya; Kalady, Matthew; Heald, Brandie; Greenwood, Carla; Paquette, Ian; Prues, Marla; Draper, David J.; Lindeman, Carolyn; Kuebler, J. Philip; Reynolds, Kelly; Brell, Joanna M.; Shaper, Amy A.; Mahesh, Sameer; Buie, Nicole; Weeman, Kisa; Shine, Kristin; Haut, Mitchell; Edwards, Joan; Bastola, Shyamal; Wickham, Karen; Khanduja, Karamjit S.; Zacks, Rosemary; Pritchard, Colin C.; Shirts, Brian H.; Jacobson, Angela; Allen, Brian; de la Chapelle, Albert; Hampel, Heather

    2017-01-01

    IMPORTANCE Hereditary cancer syndromes infer high cancer risks and require intensive cancer surveillance, yet the prevalence and spectrum of these conditions among unselected patients with early-onset colorectal cancer (CRC) is largely undetermined. OBJECTIVE To determine the frequency and spectrum of cancer susceptibility gene mutations among patients with early-onset CRC. DESIGN, SETTING, AND PARTICIPANTS Overall, 450 patients diagnosed with colorectal cancer younger than 50 years were prospectively accrued from 51 hospitals into the Ohio Colorectal Cancer Prevention Initiative from January 1, 2013, to June 20, 2016. Mismatch repair (MMR) deficiency was determined by microsatellite instability and/or immunohistochemistry. Germline DNA was tested for mutations in 25 cancer susceptibility genes using next-generation sequencing. MAIN OUTCOMES AND MEASURES Mutation prevalence and spectrum in patients with early-onset CRC was determined. Clinical characteristics were assessed by mutation status. RESULTS In total 450 patients younger than 50 years were included in the study, and 75 gene mutations were found in 72 patients (16%). Forty-eight patients (10.7%) had MMR-deficient tumors, and 40 patients (83.3%) had at least 1 gene mutation: 37 had Lynch syndrome (13, MLH1 [including one with constitutional MLH1 methylation]; 16, MSH2; 1, MSH2/monoallelic MUTYH; 2, MSH6; 5, PMS2); 1 patient had the APC c.3920T>A, p.I1307K mutation and a PMS2 variant; 9 patients (18.8%) had double somatic MMR mutations (including 2 with germline biallelic MUTYH mutations); and 1 patient had somatic MLH1 methylation. Four hundred two patients (89.3%) had MMR-proficient tumors, and 32 patients (8%) had at least 1 gene mutation: 9 had mutations in high-penetrance CRC genes (5, APC; 1, APC/PMS2; 2, biallelic MUTYH; 1, SMAD4); 13 patients had mutations in high- or moderate-penetrance genes not traditionally associated with CRC (3, ATM; 1, ATM/CHEK2; 2, BRCA1; 4, BRCA2; 1, CDKN2A; 2, PALB2); 10

  12. Mutations in the hereditary haemochromatosis gene HFE in professional endurance athletes

    PubMed Central

    Chicharro, J; Hoyos, J; Gomez-Gallego, F; Villa, J; Bandres, F; Celaya, P; Jimenez, F; Alonso, J; Cordova, A; Lucia, A

    2004-01-01

    Background: Hereditary haemochromatosis, a disease that affects iron metabolism, progresses with a greater or lesser tendency to induce iron overload, possibly leading to severe organ dysfunction. Most elite endurance athletes take iron supplements during their active sporting life, which could aggravate this condition. Objective: To determine the prevalence and discuss potential clinical implications of mutations of HFE (the gene responsible for hereditary haemochromatosis) in endurance athletes. Methods: Basal concentrations of iron, ferritin, and transferrin and transferrin saturation were determined in the period before competition in 65 highly trained athletes. Possible mutations in the HFE gene were evaluated in each subject by extracting genomic DNA from peripheral blood. The restriction enzymes SnaBI and BclI were used to detect the mutations 845G→A (C282Y) and 187C→G (H63D). Results: Our findings indicate a high prevalence of HFE gene mutations in this population (49.2%) compared with sedentary controls (33.5%). No association was detected in the athletes between mutations and blood iron markers. Conclusions: The findings support the need to assess regularly iron stores in elite endurance athletes. PMID:15273174

  13. Genetic mutations in human rectal cancers detected by targeted sequencing.

    PubMed

    Bai, Jun; Gao, Jinglong; Mao, Zhijun; Wang, Jianhua; Li, Jianhui; Li, Wensheng; Lei, Yu; Li, Shuaishuai; Wu, Zhuo; Tang, Chuanning; Jones, Lindsey; Ye, Hua; Lou, Feng; Liu, Zhiyuan; Dong, Zhishou; Guo, Baishuai; Huang, Xue F; Chen, Si-Yi; Zhang, Enke

    2015-10-01

    Colorectal cancer (CRC) is widespread with significant mortality. Both inherited and sporadic mutations in various signaling pathways influence the development and progression of the cancer. Identifying genetic mutations in CRC is important for optimal patient treatment and many approaches currently exist to uncover these mutations, including next-generation sequencing (NGS) and commercially available kits. In the present study, we used a semiconductor-based targeted DNA-sequencing approach to sequence and identify genetic mutations in 91 human rectal cancer samples. Analysis revealed frequent mutations in KRAS (58.2%), TP53 (28.6%), APC (16.5%), FBXW7 (9.9%) and PIK3CA (9.9%), and additional mutations in BRAF, CTNNB1, ERBB2 and SMAD4 were also detected at lesser frequencies. Thirty-eight samples (41.8%) also contained two or more mutations, with common combination mutations occurring between KRAS and TP53 (42.1%), and KRAS and APC (31.6%). DNA sequencing for individual cancers is of clinical importance for targeted drug therapy and the advantages of such targeted gene sequencing over other NGS platforms or commercially available kits in sensitivity, cost and time effectiveness may aid clinicians in treating CRC patients in the near future.

  14. Discovery of mutations in homologous recombination genes in African-American women with breast cancer.

    PubMed

    Ding, Yuan Chun; Adamson, Aaron W; Steele, Linda; Bailis, Adam M; John, Esther M; Tomlinson, Gail; Neuhausen, Susan L

    2018-04-01

    African-American women are more likely to develop aggressive breast cancer at younger ages and experience poorer cancer prognoses than non-Hispanic Caucasians. Deficiency in repair of DNA by homologous recombination (HR) is associated with cancer development, suggesting that mutations in genes that affect this process may cause breast cancer. Inherited pathogenic mutations have been identified in genes involved in repairing DNA damage, but few studies have focused on African-Americans. We screened for germline mutations in seven HR repair pathway genes in DNA of 181 African-American women with breast cancer, evaluated the potential effects of identified missense variants using in silico prediction software, and functionally characterized a set of missense variants by yeast two-hybrid assays. We identified five likely-damaging variants, including two PALB2 truncating variants (Q151X and W1038X) and three novel missense variants (RAD51C C135R, and XRCC3 L297P and V337E) that abolish protein-protein interactions in yeast two-hybrid assays. Our results add to evidence that HR gene mutations account for a proportion of the genetic risk for developing breast cancer in African-Americans. Identifying additional mutations that diminish HR may provide a tool for better assessing breast cancer risk and improving approaches for targeted treatment.

  15. Cytochrome C oxydase deficiency: SURF1 gene investigation in patients with Leigh syndrome.

    PubMed

    Maalej, Marwa; Kammoun, Thouraya; Alila-Fersi, Olfa; Kharrat, Marwa; Ammar, Marwa; Felhi, Rahma; Mkaouar-Rebai, Emna; Keskes, Leila; Hachicha, Mongia; Fakhfakh, Faiza

    2018-03-18

    Leigh syndrome (LS) is a rare progressive neurodegenerative disorder occurring in infancy. The most common clinical signs reported in LS are growth retardation, optic atrophy, ataxia, psychomotor retardation, dystonia, hypotonia, seizures and respiratory disorders. The paper reported a manifestation of 3 Tunisian patients presented with LS syndrome. The aim of this study is the MT[HYPHEN]ATP6 and SURF1 gene screening in Tunisian patients affected with classical Leigh syndrome and the computational investigation of the effect of detected mutations on its structure and functions by clinical and bioinformatics analyses. After clinical investigations, three Tunisian patients were tested for mutations in both MT-ATP6 and SURF1 genes by direct sequencing followed by in silico analyses to predict the effects of sequence variation. The result of mutational analysis revealed the absence of mitochondrial mutations in MT-ATP6 gene and the presence of a known homozygous splice site mutation c.516-517delAG in sibling patients added to the presence of a novel double het mutations in LS patient (c.752-18 A > C/c. c.751 + 16G > A). In silico analyses of theses intronic variations showed that it could alters splicing processes as well as SURF1 protein translation. Leigh syndrome (LS) is a rare progressive neurodegenerative disorder occurring in infancy. The most common clinical signs reported in LS are growth retardation, optic atrophy, ataxia, psychomotor retardation, dystonia, hypotonia, seizures and respiratory disorders. The paper reported a manifestation of 3 Tunisian patients presented with LS syndrome. The aim of this study is MT-ATP6 and SURF1 genes screening in Tunisian patients affected with classical Leigh syndrome and the computational investigation of the effect of detected mutations on its structure and functions. After clinical investigations, three Tunisian patients were tested for mutations in both MT-ATP6 and SURF1 genes by direct sequencing followed by in

  16. Two novel mutations in NOTCH3 gene causes cerebral autosomal dominant arteriopathy with subcritical infarct and leucoencephalopathy in two Chinese families.

    PubMed

    Zhu, Yuyou; Wang, Juan; Wu, Yuanbo; Wang, Guoping; Hu, Bai

    2015-01-01

    To investigate the genetic pathogenic causes of cerebral autosomal dominant arteriopathy with subcritical infarct and leucoencephalopathy (CADASIL) in two Chinese families, to provide the molecular basis for genetic counseling and antenatal diagnosis. The genetic mutation of gene NOTCH3 of propositus and family members was analyzed in these two CADASIL families by polymerase chain reaction and DNA sequencing technology directly. At the same time, the NOTCH3 gene mutation point of 100 healthy collators was detected, to explicit the pathogenic mutation by function prediction with Polyphen-2 and SIFT. Both propositus of the two families and patients with symptom were all accorded with the clinical features of CADASIL. It was shown by DNA sequencing that the 19(th) exon [c. 3043 T > A (p.Cys1015Ser)] in gene NOTCH3 of propositus, 2 patients (II3, III7), and a presymptomatic patient (IV1) in Family I all had heterozygosity missense mutation; and the 3(rd) exon [c.316T > G, p. (Cys106Gly)] in gene NOTCH3 of the propositus, a patient (IV3) and two presymptomatic patients (IV5, 6) in Family II all had heterozygosity missense mutation; and no mutations were detected in the 100 healthy collators. It was indicated by analyzing the function prediction that the mutation of [c. 3043 T > A (p.Cys1015Ser)] and [c.316T > G, p. (Cys106Gly)] may both influence encoding protein in NOTCH3. By analysis of the conservatism of mutation point in each species, these two basic groups were highly conserved. The heterozygosity missense mutation of 19(th) exon [c. 3043 T > A (p.Cys1015Ser)] and the 3(rd) exon [c.316T > G, p. (Cys106Gly)] in NOTCH3 gene are the new pathogenic mutations of CADASIL, and enriches the mutation spectrum of NOTCH3 gene.

  17. An association study between CHEK2 gene mutations and susceptibility to breast cancer.

    PubMed

    Jalilvand, Manizheh; Oloomi, Mana; Najafipour, Reza; Alizadeh, Safar Ali; Saki, Najmaldin; Rad, Fatemeh Samiee; Shekari, Mohammad

    2017-01-01

    CHEK2 gene is known as a tumor suppressor gene in breast cancer (BC), which plays a role in DNA repair. The germ line mutations in CEHK2 have been associated with different types of cancer. The present study was aimed at studying the association between CHEK2 mutations and BC. Peripheral blood was collected from patients into a test tube containing EDTA, and DNA was extracted from blood samples. Then, we analyzed mutations including 1100delc, IVS2+1>A, del5395bp, and I157T within CHEK2 gene in patients with BC and 100 normal healthy controls according to PCR-RFLP, allelic specific PCR, and multiplex-PCR. Although IVS2+1G>A mutation within CHEK2 gene was found in two BC patients, other defined mutants were not detected. For the first time, we identified CHEK2 IVS2+1G>A mutation, one out of four different CHEK2 alterations in two Iranian BC patients (2%). Also, our results showed that CHEK2 1100elC, del5395bp, and I157T mutations are not associated with genetic susceptibility for BC among Iranian population.

  18. A base substitution in the donor site of intron 12 of KIT gene is responsible for the dominant white coat colour of blue fox (Alopex lagopus).

    PubMed

    Yan, S Q; Hou, J N; Bai, C Y; Jiang, Y; Zhang, X J; Ren, H L; Sun, B X; Zhao, Z H; Sun, J H

    2014-04-01

    The dominant white coat colour of farmed blue fox is inherited as a monogenic autosomal dominant trait and is suggested to be embryonic lethal in the homozygous state. In this study, the transcripts of KIT were identified by RT-PCR for a dominant white fox and a normal blue fox. Sequence analysis showed that the KIT transcript in normal blue fox contained the full-length coding sequence of 2919 bp (GenBank Acc. No KF530833), but in the dominant white individual, a truncated isoform lacking the entire exon 12 specifically co-expressed with the normal transcript. Genomic DNA sequencing revealed that a single nucleotide polymorphism (c.1867+1G>T) in intron 12 appeared only in the dominant white individuals and a 1-bp ins/del polymorphism in the same intron showed in individuals representing two different coat colours. Genotyping results of the SNP with PCR-RFLP in 185 individuals showed all 90 normal blue foxes were homozygous for the G allele, and all dominant white individuals were heterozygous. Due to the truncated protein with a deletion of 35 amino acids and an amino acid replacement (p.Pro623Ala) located in the conserved ATP binding domain, we propose that the mutant receptor had absent tyrosine kinase activity. These findings reveal that the base substitution at the first nucleotide of intron 12 of KIT gene, resulting in skipping of exon 12, is a causative mutation responsible for the dominant white phenotype of blue fox. © 2013 Stichting International Foundation for Animal Genetics.

  19. Cancer Susceptibility Gene Mutations in Individuals With Colorectal Cancer

    PubMed Central

    Yurgelun, Matthew B.; Kulke, Matthew H.; Fuchs, Charles S.; Allen, Brian A.; Uno, Hajime; Hornick, Jason L.; Ukaegbu, Chinedu I.; Brais, Lauren K.; McNamara, Philip G.; Mayer, Robert J.; Schrag, Deborah; Meyerhardt, Jeffrey A.; Ng, Kimmie; Kidd, John; Singh, Nanda; Hartman, Anne-Renee; Wenstrup, Richard J.

    2017-01-01

    Purpose Hereditary factors play an important role in colorectal cancer (CRC) risk, yet the prevalence of germline cancer susceptibility gene mutations in patients with CRC unselected for high-risk features (eg, early age at diagnosis, personal/family history of cancer or polyps, tumor microsatellite instability [MSI], mismatch repair [MMR] deficiency) is unknown. Patients and Methods We recruited 1,058 participants who received CRC care in a clinic-based setting without preselection for age at diagnosis, personal/family history, or MSI/MMR results. All participants underwent germline testing for mutations in 25 genes associated with inherited cancer risk. Each gene was categorized as high penetrance or moderate penetrance on the basis of published estimates of the lifetime cancer risks conferred by pathogenic germline mutations in that gene. Results One hundred five (9.9%; 95% CI, 8.2% to 11.9%) of 1,058 participants carried one or more pathogenic mutations, including 33 (3.1%) with Lynch syndrome (LS). Twenty-eight (96.6%) of 29 available LS CRCs demonstrated abnormal MSI/MMR results. Seventy-four (7.0%) of 1,058 participants carried non-LS gene mutations, including 23 (2.2%) with mutations in high-penetrance genes (five APC, three biallelic MUTYH, 11 BRCA1/2, two PALB2, one CDKN2A, and one TP53), 15 of whom lacked clinical histories suggestive of their underlying mutation. Thirty-eight (3.6%) participants had moderate-penetrance CRC risk gene mutations (19 monoallelic MUTYH, 17 APC*I1307K, two CHEK2). Neither proband age at CRC diagnosis, family history of CRC, nor personal history of other cancers significantly predicted the presence of pathogenic mutations in non-LS genes. Conclusion Germline cancer susceptibility gene mutations are carried by 9.9% of patients with CRC. MSI/MMR testing reliably identifies LS probands, although 7.0% of patients with CRC carry non-LS mutations, including 1.0% with BRCA1/2 mutations. PMID:28135145

  20. [Analysis of clinical phenotype and CGH1 gene mutations in a family affected with dopa-responsive dystonia].

    PubMed

    Yan, Yaping; Chen, Xiaohong; Luo, Wei

    2017-04-10

    To explore genetic mutations and clinical features of a pedigree affected with dopa-responsive dystonia. PCR and Sanger sequencing were applied to detect mutations of the GCH1 gene among 7 members from the pedigree. The family was detected to have a known heterozygous mutation of the GCH1 gene (c.550C>T). For the 7 members from the pedigree, the age of onset has ranged from 13 to 60 years. The mother of the proband has carried the same mutation but was still healthy at 80. The symptoms of the other three patients were in slow progression, with diurnal fluctuation which can be improved with sleeping, dystonias of lower limbs, and tremor of both hands. Treatment with small dose of levodopa has resulted in significant improvement of clinical symptoms. By database analysis, the c.550C>T mutation was predicted as probably pathological. The c.550C>T mutation probably underlies the disease in this pedigree. The clinical phenotypes of family members may be variable for their ages of onset. Some may even be symptom free.